Note: Descriptions are shown in the official language in which they were submitted.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 130
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 130
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME:
NOTE POUR LE TOME / VOLUME NOTE:
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
ANTIVIRAL OLIGONUCLEOTIDES
FIELD OF THE INVENTION
The present invention relates to bligonucleotides having antiviral activities
and their use
as therapeutic agents in viral infections caused by human and animal viruses
and in
cancers 'caused by oncogene viruses and in other diseases whose etiology is
viral-
based.
BACKGROUND OF THE INVENTION
The following discussion is provided solely to assist the understanding of the
reader,
and does not constitute an admission that any of the information discussed or
references cited constitute prior art to the present invention.
Many important infectious diseases afflicting mankind are caused by viruses.
Many of
these diseases, including rabies, smallpox, poliomyelitis, viral hemaoragghic
fevers,
hepatitis, yellow fever, immune deficiencies and various encephalitic
diseases, are
frequently fatal. Others are significant in that they are highly contagious
and create
acute discomfort such as influenza, measles, mumps and chickenpox, as well as.
respiratory or gastrointestinal disorders. Others such as rubella and
cytomegalovirus
can cause congenital abnormalities. Finally there are viruses, known as
oncoviruses,
which can cause cancer in humans and animals.
Among viruses, the family of Herpesviridae is of great interest. The
Herpesviridae are a
ubiquitous class of icoshedral, double stranded DNA viruses. Of over 100
characterized
members of Herpesviridae (HHV), only eight infect humans. The best known among
these are Herpes simplex type 1(HSV-1), Herpes simplex type 2 (HSV-2),
Varicella
zoster (chicken pox or shingles), cytomegalovirus (CMV) and Epstein-Barr vitus
(EBV).
The prevalence of Herpes viruses in humans is high, affecting at least one
third of the
worldwide population; and in the United States, 70-80% of the population have
some
kind of Herpes infection. While the pathology of Herpes infections are usually
not
dangerous, as in the case of HSV-1 which usually only causes short lived
lesions
around the mouth and face, these viruses are also known to be the cause of
more
dangerous symptoms, which vary from genital ulcers and discharge to fetal
infections
which can lead to encephalitis (15% mortality) or disseminated infection (40%
mortality).
Herpes viruses are highly disseminated in nature and highly pathogenic for
man. For
example, Epstein-Barr virus (EBV) is known to cause infectious mononucieosis
in late
1
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
childhood or adolescence or in young adults. The hallmarks of acute infectious
mononucleosis are sore throat, fever, headache, lymphadenopathy, enlarged
tonsils
and atypical, dividing lymphocytes in the peripheral blood. Other
manifestations
frequently include mild hepatitis, splenomegaly and encephalitis. EBV is also
associated with two forms of cancer: Burkitt's lymphoma (BL). and the
nasopharyngeal
carcinoma (NPC). In endemic areas of equatorial Africa, BL is the most common
childhood malignancy, accounting for approximately 80% of cancers in children.
While
moderately observed in North American Caucasians, NPC is one of the most
common
cancers in Southern China with age incidence of 25 to 55 years. EBV, like the
cytomegalovirus, is also associated with post-transplant lymphoproliferative
disease,
which is a potentially fatal complication of chronic immunosuppression
following solid
organ or bone marrow transplantation.
Other diseases are also associated with HSV, including skin and eye
infections, for
example, chorioretinitis or keratoconjunctivitis. Approximately 300,000 cases
of HSV
infections of the eye are diagnosed yearly in the United States.
AIDS (acquired immunodeficiency syndrome) is caused by the human
immunodeficiency virus (HIV). By killing or damaging cells of the body's
immune
system, HIV progressively destroys the body's ability to fight infections and
certain -
cancers: There are currently approximately 42 million people living with
HIV/AIDS
worldwide. A total of 3.1 million people died of HIV/AIDS related causes in
2002. The
ultimate goal of anti-HIV drug therapy is to prevent the virus from
reproducing and
damaging the immune system. Although substantial progress has been made over
the
past fifteen years in the fight against HIV, a cure still eludes medical
science. Today,
physicians have more than a dozen antiretroviral agents in three different
drug classes
to manage the disease. Typically, drugs from two or three classes are
prescribed in a
variety of combinations known as HAART '(Highly Active AntiRetroviral
Treatment).
HAART therapies typically comprise two nucleoside reverse transcriptase
inhibitors
drugs with a third drug, either a protease inhibitor or a non-nucleoside
reverse
transcriptase inhibitor. Clinical studies have shown that HAART is the most
effective
means of reducing viral loads and minimizing the likelihood of drug
resistance.
While HAART has been shown to reduce the amount of HIV in the body, commonly
known as viral load, tens of thousands of patients encounter significant
problems with
this therapy. Some side effects are serious and include abnormal fat
metabolism, kidney
stones, and heart disease. Other side effects such as nausea, vomiting, and
insomnia
2
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
are less serious, but still problematic for HIV patients that need chronic
drug therapy for
a lifetime.
Currently approved anti-HIV drugs Work by entering an HIV infected CD4+ T cell
and
blocking the function of a viral enzyme, either the reverse transcriptase or a
protease.
HIV needs both of these enzymes in order to reproduce. However, HIV frequently
mutates, rendering reverse transcriptase or protease inhibitor drugs
ineffective against
these resistant strains. Once resistance occurs, viral loads increase and
dictate the
need to switch the ineffective agent for another antiretroviral agent.
Unfortunately, when
a virus becomes resistant to one drug in a class, other drugs in that class
may also
become less effective. This phenomenon, known as cross-resistance, occurs
because
many anti-HIV drugs work in a similar fashion. The occurrence of drug cross-
resistance
is highly undesirable because it reduces the available number of treatment
options for
patients.
There is therefore a great need for the development of other antiviral agents
effective
against HIV that work through other mechanisms of action against which the
virus has
not developed resistance. This is becoming especially important in view of
recent data
showing that I out of 10 patients newly diagnosed with HIV in Europe, is
infected with a
strain of HIV already resistant to at least one of the approved drugs on the
market.
Respiratory syncytial virus (RSV) causes upper and lower respiratory tract
infections. It
is a negative-sense, enveloped RNA virus and is highly infectious. It commonly
affects
young children and is the most common cause of lower respiratory tract illness
in
infants. RSV infections. are usually associated with moderate-to-severe cold-
like
symptoms. However, severe lower respiratory tract disease may occur at any
age,
especially in elderly or immunocompromised patients. Children with severe
infections
may require oxygen therapy and, in certain cases; mechanical ventilation.
According to
the American Medical Association, an increasing number of children are being
hospitalized for bronchiolitis, often caused by RSV infection. RSV infections
also
account for approximately one-third of community-associated respiratory virus
infections
in patients in bone marrow transplant centers. In the elderly population, RSV
infection
has been recently recognized to be very similar in severity to influenza virus
infection.
Influenza (INF), also known as the flu, is a contagious disease that is caused
by the
influenza virus. It attacks the respiratory tract in humans (nose, throat, and
lungs). An
average of about 36,000 people per year in the United States die from
influenza, and
114,000 per year require hospitalization as a result of influenza. Influenza
has recently
3
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
become a more serious concern with the emergence of highly pathogenic strains
previously only found in animals (e.g. avian flu).
In all infectious diseases, the efficacy of a given therapy often depends on
the host
immune response. This is particularly true for herpes viruses, where the
ability of all
herpes viruses to establish latent infections results in an extremely high
incidence of
reactivated infections in immunocompromised patients. In renal transplant
recipients,
40% to 70% reactivate latent HSV infections, and 80% to 100% reactivate CMV
infections. Such viral reactivations have also been observed with AIDS
patients.
The hepatitis B virus (HBV) is a DNA virus that belongs to the Hepadnaviridae
family of
viruses. HBV causes hepatitis B in humans. It is estimated that 2 billion
people have
been infected (1 out of 3 people) in the world. About 350 million people
remain
chronically infected and an estimated 1 million people die each year from
hepatitis B
and its complications. HBV can cause lifelong infection, cirrhosis of the
liver, liver
cancer, liver failure, and death. The virus is transmitted through blood and
bodily fluids.
This can occur through direct blood-to-blood contact, unprotected sex, use of
unsterile
needles, and from an infected woman to her newborn during the delivery
process. Most
healthy adults (90%) who are infected will recover and develop protective
antibodies
against future hepatitis B infections. A small number (5-10%) will be
unable.to get rid of
the virus and will develop chronic infections while 90% of infants and up to
50% of
young children develop chronic infections when infected with the, virus. Alpha-
interferon
is the most frequent type of treatment used. Significant side effects are
related to this
treatment including flu-like symptoms, depression, rashes, other reactions and
abnormal
blood counts. Another treatment option includes 3TC which also has many side
effects
associated with its use. In the last few years, there have been an increasing
number of
reports showing that patients treated with 3TC are developing resistant
strains of HBV.
This is especially problematic in the population of patients who are co-
infected with HBV
and HIV. There is clearly an urgent need to develop new antiviral therapies
against this
virus.
Hepatitis C virus (HCV) infection is the most common chronic bloodborne
infection in the
United States where the number of infected patients likely exceeds 4 million.
This
common viral infection is a leading cause of cirrhosis and liver cancer, and
is now the
leading reason for liver transplantation in the United States. Recovery from
infection is
uncommon, and about 85 percent of infected patients become chronic carriers of
the
virus and 10 to 20 percerit develop cirrhosis.. It is estimated that there are
currently 170
million people worldwide who are chronic carriers. According to the Centers
for Disease
4
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Control and Prevention, chronic hepatitis C causes between 8,000 and 10,000
deaths
and leads to about 1,000 liver transplants in the United States alone each
year. There is
no vaccine available for hepatitis C. Prolonged therapy with interferon alpha,
or the
combination of interferon with Ribavirin, is effective in only about 40
percent of patients
and causes significant side effects.
Today, the therapeutic outlook for viral infections in general is not
favourable. In
general, therapies for viruses have mediocre efficacies and are associated
with strong
side effects which either prevent the administration of an effective dosage or
prevent
long term treatment. Three clinical situations which exemplify these problems
are
herpesviridae, HIV and RSV infections.
In the case of herpesviridae, there are five major treatments currently
approved for use
in the clinic: idoxuridine, vidarabine, acyclovir, foscarnet and ganciclovir.
While having
limited efficacy, these treatments are also fraught with side effects.
Allergic reactions
have been reported in 35% of patients treated with idoxuridine, vidarabine can
result in
gastrointestional disturbances in 15% of patients and acyclovir, foscarnet and
ganciclovir, being nucleoside analogs, affect DNA replication in host cells.
In the case
of ganciclovir, neutropenia and thrombocytopenia are reported in 40% of AIDS
patients
treated with this drug.
While there are many different drugs currently available for the treatment of
HIV
infections, all of these are associated with side effects potent enough to
require
extensive supplemental medication to give patients a reasonable quality of
life. The
additional problem of drug resistant strains of HIV (a problem also found in
herpesviridae infections) usually requires periodic changing of the treatment
cocktail and
in some cases, makes the infection extremely difficult to treat.
The treatment of RSV infections in young infants is another example of the
urgent need
for new drug development. In this case, the usual line of treatment is to
deliver Ribavirin
by inhalation using a small-particule aerosol in an isolation tent. Not only
is Ribavirin
only m,ildly effective, but its use is associated with significant side
effects. In addition,
the potential release of the drug has caused great concern in hospital
personnel
because of the known teratogenicity of Ribavirin. -
It is clear that for any new emerging antiviral drug being developed, it would
be highly
desirable to incorporate the three following features: 1- improved efficacy; 2-
reduced
5
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
risks of side effects and 3- a mechanism of action which is difficult for the
virus to
overcome by mutation.
Several attempts to inhibit particular viruses by various antisense approaches
have
been made.
Zamecnik et al. have used ONs specifically targeted to the reverse
transcriptase primer
site and to splice donor/acceptor sites (Zamecnik, et al (1986) Proc. Natl.
Acad. Sci.
USA 83:4143-) (Goodchild & Zamecnik (1989) US Pat 4,806,463).
Crooke and coworkers. (Crooke et al. (1992) Antimicrob. Agents Chemother.
36:527-
532) described an antisense against HSV-1.
Draper et al. (1993) (US Pat 5,248,670) reported antisense oligonucleotides
having anti-
HSV activity containing the Cat sequence and hybridizing to the HSV-1 genes
UL13,
UL39 and UL40.
Kean et al. (Biochemistry (1995) 34:14617-14620) reported testing of antisense
methylphosphonate oligomers as anti-HSV agents.
Peyman et al. (Biol Chem Hoppe Seyler (1995) Mar; 376:195-198) have reported
testing
specific antisense oligonucleotides directed against the IE110 and the UL30
mRNA of
HSV-1 for their antiviral properties.
Oligonucleotides or oligonucleotide analogs targeting CMV mRNAs coding for
IE1, IE2
or DNA polymerase were reported by Anderson et al (1997) (US Pat 5,591,720)
Hanecak et al (1999) (US Pat 5,952,490) have described modified
oligonucleotides
having a conserved G quartet sequence and a sufficient number of flanking
nucleotides
to significantly inhibit the activity of a virus such as HSV-1.
Jairath et al (Antiviral Res. (1997) 33:201-213) have reported antisense
oligonucleotides
against RSV.
Torrence et al (1999) (US Pat 5,998,602) have reported compounds comprising an
antisense component complementary to a single stranded portion of the RSV
antigenomic strand (the mRNA strahd), a linkerand a oligonucleotide activator
of RNase
L.
Qi et al. (Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi.(2000) 14:253-
256)
have reported testing antisense PS-oligonucleotides (PS-ONs) in Coxsackie
virus B3.
6
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
International publication W09203051 (Roizman arid Maxwell) describes
methylphosphonate antisense oligomers which are complementary to vital regions
of
HSV viral genome or mRNA transcripts thereof which exhibit antiviral activity.
Guanosine/thymidine or guanosine-rich phosphorothioate oligodeoxynucleotides
(GT-
PS-ONs) have been reported to have antiviral activity. The article stated that
"several
different PS-containing GT-rich ONs (B106-140, 1100-12, and G106-57) all 26 or
27 nt in
length, were just as effective at reducing HIV-2 titers as GT-rich ONs
consisting of 36
(B106-96, B106-97) or 45 nt (Table 4)." (Fennewaid et al., Antiviral Res.
(1995) 26:37-
54).
In US Pat 6,184,369, anti-HIV, anti-HSV, and anti-CMV oligonucleotides
containing a
high percentage of guanosine bases are described. In preferred embodiments,
the
oligonucleotide has a three dimensional structure and this structure is
stabilized by
guanosine tetrads. In a further embodiment, the oligonucleotide compositions
of the
invention have two or more runs of two contiguous deoxyguanosines. The patent
claims a G-rich oligodeoxynucleotide (ODN) that includes at least two G
residues in at
least two positions.
Cohen et al. (US Pats. 5,264,423 and 5,276,019) described the inhibition of
replication
of HIV, and more particularly to PS-ODN analogs that can be used to prevent
replication
of foreign nucleic acids in the presence of normal living cells. Cohen et al
describe
antiviral activity of antisense PS-ODNs specific to a viral sequence. They
also describe
testing polyA, polyT and polyC PS-ODN sequences of 14, 18, 21 and 28-mers and
indicate an antiviral effect of those PS-ODNs.
Matsukura et al. (Matsukura et al (1987) Proc Natl Acad Sci USA 84:7706-7710)
later
published the result described in Cohen et al, US patents above.
Gao et al (Gao et al (1989) J Biol Chem 264 :11521-11526), describe the
inhibition of
replication of HSV-2, by PS-ODNs by testing of polyA, polyT and polyC PS-ODN
sequences in sizes of 7, 15, 21 and 28 nucleotides.
Archambault, Stein and Cohen (Archambault et al (1994) Arch Virol 139:97109)
report
that a PS-ODN polyC of 28 nucleotides is not effective against HSV-1.
Stein et al (Stein et al. (1989) AIDS Res Hum Retrovir 5:639-646), published
results
concerning additional data on anti-HIV ODNs, generally of 21-28 nucleotides in
length.
7
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Marshal et al. (Marshall et al. (1992) Proc. Natl. Acad. Sci. USA 89:6265-
6269) describe
anti-HIV-1 effect of phosphorothioate and phosphorothioate poly-C oligos of 4-
28
nucleotides iri length.
Stein & Cheng (Stein et al. (1993) Science 261 :1004-1012), in a review
article, mention
the antiviral activity of non.specific ODNs of 28 nucleotides, stating that
"the anti-HIV
properties of PS oligos are significantly influenced by non-sequence-specific
effects,
that is, the inhibitory effect is independent of the base sequence."
In a review article Lebedeva & Stein (Lebedeva et al (2001) Annul Rev
Pharmacol
41:403-419) report a variety of non-specific protein binding activity of PS-
ODNs,
including viral proteins. They state that "these molecules are highly
biologically active,
and it is often relatively easy to mistake artifact for antisense".
Rein et al. (US Pat. 6,316,190) reported a GT rich ON decoy linked to a fusion
partner
and binding to the HIV nucleocapsid, which can be used as an antiviral
compound.
Similarly, Campbell et al. (Campbell et al (1999) J. ViroL 73 :2270-2279)
reported PO-
ODN with a TGTGT motif binding specifically to the nucleocapsid of HIV but
with no
references to an antiviral activity.
Feng at al. (Feng et al. (2002) J. Virol. 76 :11757-11762) described A(n) and
TG(n) PO-
ODNs binding to the recombinant HIV nucleocapsid but with no data nor
references to
an anti-HIV activity.
Antisense ODNs developed as anticancer agents, antiviral agents, or to treat
others
diseases are typically approximately 20 nucleotides in length. In a review
article (Stein,
CA, (2001) J. Clin. Invest. 108:641-644), it is affirmed that "the length of
an antisense
oligonucleotide must be optimized: If the antisense oligonucleotide is either
too long or
too short, an element of specificity is lost. At the present time, the optimal
length for an
antisense oligonucleotide seems to be roughly 16-20 nucleotides". Similarly,
in another
review article (Crooke, ST (2000) Methods Enzymol. 313:3-45) it is stated that
"Compared to RNA and RNA duplex formation, a phosphorothioate
oligodeoxynucleotide has a Tn, approximately -2.2 lower per unit. This means
that to be
effective in vitro, phosphorothioate oligodeoxynucleotides rriust typically be
17- to -20-
mer in length...".
Caruthers and co-workers (Marshall et al. (1992) Proc. Natl. Acad. Sci. USA
89:6265-
6269) reported anti-HIV activity of phosphorodithioate ODNs (PS2-ODNs) for a
12mer
polycytidine-PS2-ODN and for a 14mer PS2-ODN. No other sizes were tested for
anti-
8
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
HIV activity. They also reported the inhibition of HIV reverse transcriptase
(RT) for 12,
14, 20 and 28mer polycytidine-PS2-ODNs. Later,' this group (Marshal et al
(1993)
Science 259:1564-1570) reported results showing sequence specific inhibition
of the
HIV RT. The same group published data for PS2-ODNs in several patents. In US
Pat
Nos. 5,218,103 and 5,684.148, PS2-ODN structure and synthesis is described. In
U.S.
Pat. Nos: 5,452,496, 5,278,302, and 5,695,979 inhibition of HIV RT is
described for
PS2-ODNs not longer than 15 bases. In U.S. Pat. Nos. 5,750,666 and 5,602,244,
antisense activity of PS2-ODNs is described.
Oligonucleotides modified at the 2' position of the ribose and their uses in
antisense
strategies have been evaluated, e.g., as described in the references cited
below.
Inoue and coworkers (Inoue et al. (1985) Nucleic Acids Res. 16:165168)
describe the
synthesis and properties of oligos (2'-O-methylribonucleotides). The same
group (Inoue
et al. (1987) FEBS Letter 215:327-330) reported that no RNAse H mediated mRNA
cleavage occurs when the oligonucleotide contains all 2'-O-
methylribonucleotides. With
mixed oligonucleotides i.e. oligonucleotides having unmodified and 2'-O-
methylribonucleotides, they report sequence specific RNAse H hydrolysis of the
nucleic
acid complex formed by RNA and 2'-O-methylribonucleotides.
Fully 2'-O-methylated and phosphorothioated oligonucleotides which do not
support
RNase H-mediated cleavage of target mRNA, were used to determine if active
antisense oligonucleotides inhibited ICAM-1 expression by an RNase H-dependent
mechanism (Chiang et al., (1991) J. Biol. Chem. 266:18162-18171). They stated
that
these antisense oligonucleotides may be useful as therapeutic agents.
Oligonucleotides with 2'-sugar modifications including 2'-O-methyl, 2'-O-
propyl, 2'-O-
pentyl, and 2'-fluoro were analyzed for antisense activity. Evaluation of
antisense
activities of uniformly 2'-modified oligonucleotides revealed that these
compounds were
completely ineffective in inhibiting gene expression. Activity was restored if
the
compound contained a stretch of at least five 2'-deoxyribonucleotide residues.
This
minimum deoxyribonucleotide length correlated perfectly with the minimum
length
required for efficient RNase H activation in vitro. (Monia et al., 1993, J.
Biol. Chem.
268:14514.)
Yu et al. ((1996) Bioorganic. Med. Chem. 4:1685-1692) reported that hybrid
antisense
oligonucleotides having phosphorothioate, phosphodiester, or mixed backbones
with a
9
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
portion of 2'-O-methyl modified sugars have a specific anti-HIV activity
measured by p24
ELISA quantification.
It is reported that correct splicing was efficiently restored when
phosphorothioated 2'-O-
methyl-oligoribonucleotides were targeted to the aberrant splice sites of IVS2-
654 pre-
mRNA expressed in mammalian cells stably transformed with this mutated human
beta-
globin gene. (Sierakowska, et al (1996) Proc. Natl. Acad. Sci. USA 93:12840-
12844.)
A review article, Agrawal ((1999) Biochim. Biophys. Acta 1489:53-68) suggests
that for
optimum activity, antisense oligonucleotides should have a combination of
various
properties, instead of only increased stability toward nucleases or high
affnity to target
RNA. Such properties include RNAse H activation. In a later review, Agrawal
and
Kandimalla ((2000) Mol. Med. Today =6:72-81) say that mixed backbone
oligonucleotides, including 2'-O-methyl modifications, have become the choice
for
second-generation antisense oligonucleotides for their improved
characteristics
including RNAse H activation. An antisense oligo should posses certain
important
characteristics such as the ability to activate RNAse H upon binding to the
target RNA.
(Agrawal and Kandimalla, 2001, Current Cancer Drug Target 1:197-209.) For most
antisense approaches target RNA cleavage by RNAse H is desired in order to
increase
antisense potency. (Kurreck, 2003, Eur. J. Biochem. 270:1628-1644.)
Many studies describe the use of the 2'-O-methoxyethyl modification in
antisense
oligonucleotides. An example is a study using a gapped 2' modified
oligonucleotide
antisense described in Zellweger et al. ((2001) J. Pharmacol. Experimental
Therapeutics
298:934-940). Another example shows inhibition of the formation of the
translation
initiation complex using RNase H independent 2'-O-methoxyethyl antisense.
(Baker et
al. 1997) J. Biol. Chem. 272 :1994-12000.) .
Kuwasaki et al. (2003) J. Antimicrob. Chemother. 51:813-819, describes the
design of a
highly nuclease-resistant, dimeric hairpin guanosine-quadruplex containing 2'-
O-methyl
groups on the nucleosides and sulphur groups on the internucleotidic bonds,
and its
anti-HIV-1 activity in cultured cells.
Mou and Gray (2002) (Nucleic Acids Res. 30:749-758), indicates that, compared
with
typical phosphorothioate-DNA oligomers, the addition of the 2'-O-methyl
modification
lowers the non-specific protein binding property. The protein binding
affinities of g5p for
a 36mers oligonucleotide increased in the order of dA36 < rA36 < 2'-O-MeA36 <
S-rA36
S-2'-O-MeA38 < S-dA36 (where d = deoxy, r= ribo, 2'-O-Me = 2'-O-methyl, S
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
phosphorothioate). This order was in agreement with the order of S-RNA << S-2'-
O-
MeRNA <S-DNA reported in Kandimalla et al. ((1998) Bioorganic Med Chem Left.
8:2103-2108) for the non-specific, binding of plasma proteins, such as human
serum
albumin, y-globulin and fibrinogen for these oligomer modifications.
US Patents 5,591,623 and 5,514,788 describe compositions and methods for the
treatment and diagnosis of diseases amenable to treatment through modulation
of the
synthesis or metabolism of intercellular adhesion molecules. In accordance
with
preferred embodiments, oligonucleotides are described which are specifically
hybridizable with nucleic acids encoding intercellular adhesion genes. The
invention
describes the synthesis of 2'-O-methyl phosphorothioate oligonucleotides and
their use
as antisense.
US Patents 5,652,355, 6,143,881 and 6,346,614 describe hybrid oligonucleotides
(containing segments of deoxy- and ribo nucleotides) that resist nucleolytic
degradation,
form stable duplexes with RNA or DNA, and activate RNase H when hybridized
with
RNA. It is indicated that one property of phosphorothioate 2'-O-methyl-
oligonucleotide
is the non-activation of RNAse H. In one aspect, the invention provides hybrid
oligonucleotides that are effective in inhibiting viruses, pathogenic
organisms, or the
expression of cellular genes. A feature of oligonucleotides according to this
aspect of
the invention is the presence of deoxyribonucleotides. Oligonucleotides
according to
the invention contain at least one deoxyribonucleotide. The nucleotide
sequence of
oligonucleotides according to this aspect of the invention is complementary to
a nucleic
acid sequence that is from a virus, a pathogenic organism or a cellular gene.
U.S. Patents 5,591,721 and 6,608,035 describe a method of down-regulating the
expression of a gene in an animal by the oral administration of an
oligonucleotide whose
nucleotide sequence is complementary to the targeted gene. Thus, because of
the
properties described in the patent, such oligonucleotides are said to be
useful
therapeutically by their ability to control or down-regulate the expression of
a particular
gene in an animal. The hybrid DNA/RNA oligonucleotides useful in the method of
the
invention resist nucleolytic degradation, form stable duplexes with RNA or
DNA, and
preferably activate RNase H when hybridized with RNA. The oligonucleotides
according
to the invention are reported to be effective in inhibiting the expression of
various genes
in viruses, pathogenic organisms, or in inhibiting the expression of cellular
genes. Thus,
oligonucleotides according to the method of the invention have a nucleotide
sequence
which is complementary to a nucleic acid sequence that is from a virus, a
pathogenic
organism or a cellular gene.
11
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
US Patent 6,608,035 presents data indicating that a phosphorothioate
oligonucleotide is
not stable in the stomach after 6 hours but a hybrid phosphorothioate
oligonucleotide
containing 2'-O-methyl ribonucleotide at the 3' and 5'ends and a
deoxyribonucleotide
interior is more stable in the stomach but partially degraded.
SUMMARY OF THE INVENTION
The present invention involves the discovery that oligonucleotides (ONs),
e.g.,
oligodeoxynucleotides (ODNs), including highly modified oligonucleotides, can
have a
broadly applicable, sequence independent antiviral activity. Advantageous
modifications include modified internucleotidic linkages and 2'-modifications.
It is not
necessary for the oligonucleotide to be complementary to any viral sequence or
to have
a particular distribution of nucleotides in order to have antiviral activity.
Such an
oligonucleotide can even be prepared as a randomer, such that there will be at
most a
few copies of any particular sequence in a preparation, e.g., in a 15 micromol
randomer
preparation 32 or more nucleotides in length.
In addition, the inventors have discovered that different length
oligonucleotides have
varying antiviral effect. For example, present results indicate that the
length of antiviral
oligonucleotide that produces maximal antiviral effect when modified with
phosphorothioate internucleotidic linkages is typically in the range of 40-120
nucleotides. In view of the present discoveries concerning antiviral
properties of
oligonucleotides, this invention provides oligonucleotide antiviral agents
that can have
activity against numerous different viruses, and can even be selected as broad-
spectrum antiviral agents. Such antiviral agents are particularly advantageous
in view of
the limited antiviral therapeutic options currently available.
Therefore, the ONs, e.g., ODNs, of the present invention are useful in therapy
for
treating or preventing viral infections or for treating or preventing tumors
or cancers
induced by viruses, such as oncoviruses (e.g., retroviruses, papillomaviruses,
and
herpesviruses), and in treating or preventing other diseases whose etiology is
viral-
based. Such treatments are applicable to many types of patients and
treatments,
including, for example, the prophylaxis or treatment of viral infections in
immunosuppressed human and animal patients.
A first aspect of the invention concerns antiviral oligonucleotides, e.g.,
purified
oligonucleotides, where the antiviral occurs principally by a sequence
independent, e.g.,
12
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
non-sequence complementary, mode of action, and formulations containing such
oligonucleotides.
Oligonucleotides useful in the present invention can be of various lengths,
e.g., at least
6, 10, 14, 15, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 38, 40, 45, 50,
60, 70, 80,
90, 100, 110, 120, 140, 160, or more nucleotides in length. Likewise, the
oligonucleotide can be in a range, e.g., a range defined by taking any two of
the
preceding listed values as inclusive end points of the range, for example 10-
20, 20-30,
20-40, 30-40, 30-50, 40-50, 40-60, 40-80, 50-60, 50-70, 60-70, 70-80, 60-120,
and 80-
120 nucleotides. In particular embodiments, a minimum length or length range
is
combined with any other of the oligonucleotide specifications listed herein
for the
present antiviral oligonucieotides.
The antiviral nucleotide can include various modifications, e.g., stabilizing
modifications,
and thus can include at least one modification in the phosphodiester linkage
and/or on
the sugar, and/or on the base. For example, the oligonucleotide can include
one or
more phosphorothioate linkages, phosphorodithioate linkages, and/or
methylphosphonate linkages. Different chemically compatible modified linkages
can be
combined, e.g., modifications where the synthesis conditions are chemically
compatible.
While modified linkages are useful, the oligonucleotides can include
phosphodiester
linkages, e.g., include at least.one phosphodiester linkage, or at least 5,
10, 20, 30% or
more phosphodiester linkages. Additional useful modifications include, without
restriction, modifications at the 2'-position of the sugar, such as 2'-O-alkyl
modifications
such as 2'-O-methyl modifications, 2'-amino modifications, 2'-halo
modifications such as
2'-fluoro; acyclic nucleotide analogs. Other modifications are also known in
the art and
can be used. In particular embodiments, the oligonucleotide has modified
linkages
throughout, e.g., phosphorothioate; has a 3'- and/or 5'-cap; includes a
terminal 3'-5'
linkage; the oligohucleotide is or includes a concatemer consisting of two or
more
oligonucleotide sequences joined by a linker(s).
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
is linked or conjugated at one or more nucleotide residues, to a molecule
modifying the
characteristics of the oligonucleotide to obtain one or more characteristics
selected from
the group consisting of higher stability, lower serum interaction, higher
cellular uptake,
higher viral protein interaction, an improved ability to be formulated for
delivery, a
detectable signal, higher antiviral activity, better pharmacokinetic
properties, specific
tissue distribution, lower toxicity.
13
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
In certain embodiments, the oligonucleotide includes at least 10, 20, 30, 40,
50, 60, 70,
80, 90, 95, or 100% modified linkages, e.g., phosphorothioate,
phosphorodithioate,
and/or methylphosphonate.
In certain embodiments, at Ieast 10, 20, 30, 40, 50, 60, 70, 80, 90, or 95%,
or all of the
nucleotides are modified at the 2'-position of the ribose, e.g., 2'-OMe, 2'-F,
2'-amino.
In certain embodiments modified linkages are combined with 2'-modifications in
oligonucleotides, for example, at least 30% modified linkages and at least 30%
2'-
modifications; or respectively at least 40% and 40%, at least 50% and 50%, at
least
60% and 60%, at least 70% and 70%, at least 80% and 80%, at least 90% and 90%,
100% and 100%. In certain embodiments, the oligonucleotide includes at least
30, 40,
50, 60, 70, 80, 90, or 100% modified linkages and at least 30, 40, 50, 60, 70,
80,90, or
100% 2'-modifications where embodiments include each combination of listed
modified
linkage percentage and 2'-modification percentage (e.g., at least 50% modified
linkage
and at least 80% 2'-modifications, and at least 80% modified linkages and 100%
2'-
modifications). In particular embodiments of each of the combinations
percentages
described, the modified linkages are phosphorothioate linkages; the modified
linkages
are phosphorodithioate linkages; the 2'-modifications are 2'-OMe; the 2'-
modifications
are 2'-fluoro; the 2'-modifications are a combination of 2'-OMe and 2'-fluoro;
the
modified linkages are phosphorothioate linkages and the 2'-modifications are
2'-OMe;
the modified linkages are phosphorothioate linkages and the 2'-modifications
are 2'-
fluoro; the modified linkages are phosphorodithioate linkages and the 2'-
modifications
are 2'-OMe; the modified linkages are phosphorodithioate linkages and the 2'-
modifications are 2'-fluoro; the modified linkages are phosphorodithioate
linkages and
the 2'-modifications are a combination of 2'-OMe and 2'-fluoro. In certain
embodiments
of oligonucleotides as described herein that combine a particular percentage
of modified
linkages and a particular percentage of 2'-modifications, the oligonucleotide
is at least
15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 110, or 120 nucleotides in
length, or is in
a length range defined by taking any two of the specified lengths as inclusive
endpoints
of the range.
In certain embodiments, all but 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the
internucleotidic
linkages and/or 2'-positions of the ribose moiety are modified, e.g., with
linkages
modified with phosphorothioate, phosphorodithioate, or methylphosphonate
linkages
and/or 2'-OMe, 2'-F, and/or 2'-amino modifications of the ribose moiety.
14
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
In some embodiments, the oligonucleotide includes at least 1, 2, 3, or 4
ribonucleotides,
or at least 10, 20, 30, 40, 50, 60, 70, 80, 90%, or even 100% ribonucleotides.
In particular embodiments, the oligonucleotide includes non-nucleotide groups
in the
chain (i.e., form part of the chain backbone) and/or as side chain moieties,
e.g., 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, or even more, or up to 5, 10, 20% or more of the chain
moieties
and/or side chain moieties.
In certain embodiments, the oligonucleotide is free of self-complementary
sequences
longer than 5, 8, 10, 15, 20, 25, 30 nucleotides; the oligonucleotide is free
of catalytic
activity, e.g., cleavage activity against RNA; the oligonucleotide does not
induce an
RNAi mechanism.
In particular embodiments, the oligonucleotide binds to one or more viral
proteins; the
sequence of the oligonucleotide (or a portion thereof, e.g., at least 20, 30,
40, 50, 60,
70% or more) is derived from a viral genome; the activity of an
oligonucleotide with a
sequence derived from a viral genome is not superior to a randomer
oligonucleotide or a
random oligonucleotide of the same length; the oligonucleotide includes a
portion
complementary to a. viral sequence and a portion. not complementary to a viral
sequence; the sequence of the oligonucleotide is derived from a viral
packaging
sequence or other viral sequence involved in an aptameric interaction; unless
otherwise
indicated, the sequence of the oligonucleotide includes A(x); C(x), G(x),
T(x), U(x), I(x),
AC(x), AG(x), AT(x), AU(x), CG(x), CT(x), CU(x), GT(x), GU(x), TU(x), AI(x),
IC(x),
IG(x), IT(x) IU(x) where x is 2, 3, 4, 5, 6, ... 60 ... 120 (in particular
embodiments the
oligonucleotide is at least 15, 20, 25, 29, 30, 32, 34, 35, 36, 38, 40, 45,
46, 50, 60, 70,
80, 90, 100, 110, 120, 140, or 160 nucleotides in length or is in a range
defined by
taking any two of the listed values as inclusive endpoints, or the length of
the specified
repeat sequence is at least a length or in a length range just specified); the
oligonucleotide includes a combination of repeat sequences (e.g., repeat
sequences as
specified above), including, for example, each combination of the above
monomer
and/or dimer repeats taken 2, 3, or 4 at a time; the oligonucleotide is single
stranded
(RNA or DNA); the oligonucleotide is double stranded (RNA or DNA); the
oligonucleotide includes at least one Gquartet or CpG portion; the
oligonucleotide
includes a portion complementary to a viral mRNA and is at least 29, 37, or 38
nucleotides in length (or other length as specified above); the
oligonucleotide includes at
least one non-Watson-Crick oligonucleotide and/or at least one nucleotide that
participates in non-Watson-Crick binding with another nucleotide and/or at
least one
nucleotide that cannot form base pairs with other nucleotides; the
oligonucleotide is a
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
random oligonucleotide, the oligonucleotide is a randomer or includes a
randomer
portion, e.g., a randomer portion that has a length of at least 5, 10, 15, 20,
25, 30, 35,
40 . or more contiguous oligonucleotides or a length as specified above for
oligonucleotide length or at least 10, 20, 30, 40, 50, 60, 70, 80, 90% or all
the.
nucleotides are randomer; the oligonucleotide is linked or conjugated at one
or more
nucleotide residues to a molecule that modifies the characteristics of the
oligonucleotide, e.g. to provide higher stability (such as stability in serum
or stability in a
particular solution), lower serum interaction, higher cellular uptake, higher
viral protein
interaction, improved ability to be formulated for delivery, a detectable
signal, improved
pharmacokinetic properties, specific tissue distribution, and/or lower
toxicity.
It was also discovered that phosphorothioated ONs containing only (or at least
primariiy)
pyrimidine nucleotides, including cytosine and/or thymidine and/or other
pyrimidines are
resistant to low pH and polycytosine oligonucleotides showed increased
resistance to a
number of nucleases, thereby providing two important characteristics for oral
administration of an antiviral ON. Thus, in certain embodiments, the
oligonucleotide has
at least 80, 90, or 95, or 100% modified internucleotidic linkages (e.g.,
phosphorothioate
or phosphorodithoiate) and the pyrimidine content is more than 50%, more than
60%,
more than 70%, more than 80%, more than 90%, or 100%, 'i.e.; is a pyrimidine
oligonucleotide or the cytosine content is more than 50%, more than 60%, more
than
70%, more than 80%, morethan 90% or 100% i.e. is a polycytosine
oligonucleotide. In
certain embodiments, the length is at least 29, 30, 32, 34, 36, 38, 40, 45,
50, 60, 70, or
80 nucleotides, or is in a range of 20-28, 25-35, 29-40, 30-40, 35-45, 40-50,
45-55, 50-
60, 55-65, 60-70, 65-75, or 70-80, or is in a range defined by taking any two
of the listed
values as inclusive endpoints of the range. In particular embodiment, the
oligonucleotide is at least 50, 60, 70, 80, or 90% cytosine; at least 50, 60,
70, 80, or
90% thymidine (and may have a total pyrimidine content as listed above). In
particular
embodiments, the oligonucleotide contains a listed percentage of either
cytosine or
thymidine, and the remainder of the pyrimidine nucleotides are the other of
cytosine and
thymidine. Also in certain embodiments, the oligonucleotide includes at least
10, 12, 14,
16, 18, 20, 25, 30, 35, 40, or more contiguous pyrimidine nucleotides, e.g.,
as C
nucleotides, T nucleotides, or CT dinucleotide pairs. In certain embodiments,
the
pyrimidine oligonucleotide consists only of pyrimidine nucleotides; includes
at least 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10 non-pyrimidine moieities; includes 1-5, 6-10, 11-
15, or at least 16
non-pyrimidine backbone moieties; includes at least one, 1-20, 1-5, 6-10, 11-
15, or 16-
20 non-nucleotide moieties; includes at least one, 1-20, 1-5, 6-10, 11-15, or
16-20
purine nucleotides. Preferably, in embodiments in which non-nucleotide
moieities are
16
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
present, the linkages between such moieties or between such moieties and
nucleotides
are at least 25, 35, 50, 70, 90, or 100 % as resistant to acidic conditions as
PS linkages
in a 40-mer polyC oligonucleotide as evaluated by gel electrophoresis under
conditions
appropriate for the size and chemistry of the oligonucleotide.
Oligonucleotides can also be used in combinations, e.g., as a mixture. Such
combinations or mixtures can include, for example, at least 2, 3, 4, 5, 10,
20, 50, 100,
1000, 10000, 100,000, 1,000,000, or more different oligonucleotides, e.g., any
combination of oligonucleotides are described herein. Such combinations or
mixtures
can, for example, be different sequences and/or different lengths and/or
different
modifications and/or different linked or conjugated molecules. In particular
embodiments of such combinations or mixtures, a plurality of oligonucleotides
have a
minimum length or are in a length range as specified above for
oligonucleotides. In
particular embodiments of such combinations or mixtures, at least one, a
plurality, or
each of the oligonucleotides, can have any of the other properties specified
herein for .
individual antiviral oligonucleoties (which can also be in any consistent
combination).
In certain embodiments, the sequence of the oligonucleotide is not perfectly
complementary to any equal length portion of the genome sequence of the target
virus,
or has less than 95, 90, 80, 70, 60, or 50% complementarity to any equal
length portion
of the genomic sequence of the target virus, the oligonucleotide sequence does
not
consist essentially of polyA, polyC, polyG, polyT, Gquartet, or a TG-rich
sequence.
As used in connection with the present oligos, the term "TG=rich" indicates
that the
sequence of the antiviral oligonucleotide consists of at least 50 percent T
and G
nucleotides, or if so specified, at.least 60, 70, 80, 90, or 95% T and G, or
even 100%.
In a related aspect, the invention provides a mixture of antiviral
oligonucleotides that
includes at least two different antiviral oligonucleotides as described
herein, e.g., at
least 2, 3, 4, 5, 7, 10, 50, 100, 1000, 10,000, 100,000, 1,000,000, or even
more.
As used herein in connection with oligonucleotides or other materials, the
term "antiviral"
refers to an effect of the presence of the oligonucleotides or other material
in inhibiting
production of viral particles, i.e., reducing the number of infectious viral
particles formed,
in a system otherwise suitable for formation of infectious viral particles for
at least one
virus. In certain embodiments of the present invention, the antiviral
oligonucleotides will
have antiviral activity against multiple different viruses.
17
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
The term "antiviral oligonucleotide formulation" refers to a preparation that
includes at
least one antiviral oligonucleotide that is adapted for use as an antiviral
agent. The
formulation includes the oligonucleotide or oligonucleotides, and can contain
other
materials that do not interfere with use of the formulation as an antiviral
agent in vivo.
Such other materials can include without restriction diluents, excipients,
carrier
materials, and/or other antiviral materials.
As used herein, the term "pharmaceutical composition" refers to an antiviral
oligonucleotide formulation that includes a physiologically or
pharmaceutically
acceptable carrier or excipient. Such compositions can also include other
components
that do not make the composition unsuitable for administration to a desired
subject, e.g.,
a human.
In the context of the present invention, unless specifically limited the term
"oligonucleotide (ON)" means oligodeoxynucleotide (ODN) or
oligodeoxyribonucleotide
or oligoribonucleotide. Thus, "oligonucleotide" refers to an oligomer or
polymer of
ribonucleic acid (RNA) and/or deoxyribonucleic acid (DNA) and/or analogs
thereof. This
term includes oligonucleotides composed of naturally-occurring nucleobases,
sugars
and covalent internucleoside (backbone) linkages as' well as oligonucleotides
having
non-naturally-occurring portions which function similarly. Such modified or
substituted
oligonucleotides are often preferred over native forms because of desirable
properties
such as, for example, enhanced cellular uptake, enhanced affinity for nucleic
acid target
and increased stability in the presence of nucleases. Examples of
modifications that
can be used are described herein. Oligonucleotides that include backbone
and/or other
modifications can also be referred to as oligonucleosides.
In the present context, the phrase "modified internucleotidic linkage" refers
to a linkage
between nucleotides or nucleotide analogs in an oligonucleotide that differs
from the
phosphodiester linkage generally found in naturally-occurring polynucleotides.
Examples include phosphorothioate linkages, phosphorodithioate linkages, and
methylphosphonate linkages.
Specification of particular lengths for oligonucleotides, e.g., at least 20
nucleotides in
length, means that the oligonucleotide includes at least 20 linked
nucleotides. Unless
clearly indicated to the contrary, the oligonucleotide may also include
additional, non-
nucleotide moieties, which may form part of the backbone of the
oligonucleotide chain.
Unless otherwise indicated, when non-nucleotide moieities are present in the
backbone,
at least 10 of the linked nucleotides are contiguous.
18
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
As used in connection with an antiviral formulation, pharmaceutical
composition, or
other material, the phrase "adapted for use as an antiviral agent" indicates
that the
material exhibits an antiviral effect and does not include any component or
material that
makes it unsuitable for use in inhibiting viral production in an in vivo
system, e.g., for
administering to a subject such as a human subject. As used herein in
connection with antiviral action of an antiviral oligonucleotide,
"sequence independent mode of action" indicates that-the particular biological
activity
(e.g., antiviral activity) is not dependent on a particular oligonucleotide
sequence in the
oligonucleotide. For example, the activity does not depend on sequence
dependent
hybridization such as with antisense activity, or a particular sequence
resulting in a
sequence dependent aptameric interaction. Similarly, the phrase "non-sequence
complementary mode of action" indicates that the mechanism by which the
material
exhibits an antiviral effect is not due to hybridization of complementary
nucleic acid
sequences, e.g., an antisense effect. Conversely, a "sequence complementary
mode of
action" means that the antiviral effect of a material involves hybridization
of
complementary nucleic acid sequences or sequence specific aptameric
interaction.
Thus, indicating that the antiviral activity of a material is due to a
sequence indeperident
mode of action" or that the activity is "not primarily due to a sequence
complementary
mode of action" means that the the activity of the oligonucleotide satisfies
at Ieast one of
the 4 tests provided herein (see Example, 10). In particular embodiments, the
oligonucleotide satisfies test 1, test 2, test 3, test 4, or test 5; the
oligonucleotide
satisfies a combination of two of the tests, i.e., tests 1& 2; tests 1 & 3;
tests 1& 4, tests
1& 5, tests 2 & 3, tests 2 & 4, test 2 & 5, tests 3 & 4, tests 3 & 5, or tests
4 & 5; the
oligonucleotide satisfies a combination of 3 of the tests, i.e., tests 1, 2,
and 3, tests 1, 2,
and 4, test 1, 2, & 5, tests 1, 3, and 4, tests 1, 3, & 5, tests 2, 3, and 4,
tests 2, 3, & 5,
tests 3, 4, & 5; the oligonucleotide satisifies all of tests 1, 2, 3, and 4.
As used herein in connection with administration of an antiviral material, the
term
"subject" refers to a living higher organism, including, for example, animals
such as
mammals, e.g., humans, non-human primates, bovines, porcines, ovines, equines,
dogs, and cats; birds (Aves),; and plants, e.g., fruit trees.
A related aspect concerns an antiviral oligonucleotide randomer or randomer
formulation that contains at least one randomer, where the antiviral activity
of the
randomer occurs principally by a sequence independent, e.g., non-sequence
complementary mode of action. Such a randomer formulation can, for example,
include
19
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
a mixture of randomers of different lengths, e.g., at least 2, 3, 5, 10, or
more different
lengths, or other mixtures as described herein.
As used herein in connection with oligonucleotide sequences, the term "random"
characterizes a sequence or an ON that is not complementary to a viral mRNA,
and
which is selected to not form hairpins and not to have palindromic sequences
contained
therein. When the term "random" is used in the context of antiviral activity
of an
oligonucleotide toward a particular virus, it implies the.absence of
complementarity to a
viral mRNA of that particular virus. The absence of complementarity may be
broader,
e.g., for a plurality of viruses, for viruses from a particular viral family,
or for infectious
human viruses.
In the present application, the term "randomer" is intended to mean a single
stranded
DNA having a wobble (N) at every position, such as NNNNNNNNNN. Each base is
synthesized as a wobble such that this ON actually exists as a population of
different
randomly generated sequences of substantially the same size. It is recognized
that
preparation of such a randomer will normally generate a distribution of sizes
around a
particular length (primarily shorter lengths); unless clearly indicated to the
contrary, in
the present context such a preparation is regarded as a randomer of the
particular
length.
The phrase "derived from a viral genome" indicates that a particular sequence
has a
nucleotide base sequence that. has at least 70% identity to a viral genomic
nucleotide
sequence or its complement (e.g., is the same as or complementary to such
viral
genomic sequence), or is a corresponding RNA sequence. In particular
embodiments of
the present invention, the term indicates that the sequence is at least 70%
identical to a
viral genomic sequence of the particular virus against which the
oligonucleotide is
directed, or to its complementary sequence. In particular embodiments, the
identity is at
least 80, 90, 95, 98, 99, or 100%.
The invention also provides an antiviral pharmaceutical composition that
includes a
therapeutically effective amount of a pharmacologically acceptable, antiviral
oligonucleotide. or mixture of oligonucleotides as described herein, e.g., at
least 6
nucleotides in length or other length as listed herein, where the antiviral
activity of the
oligonucleotide occurs principally by a sequence independent, e.g., non-
sequence
complementary, mode of action, and a pharmaceutically acceptable carrier., In
particular
embodiments, the oligonucleotide or a combination or mixture of
oligonucleotides is as
specified above for individual oligonucleotides 'or combinations or mixtures
of
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
oligonucleotides. In particular embodiments, the pharmaceutical compositions
are
approved for administration to a human, or a non-human ariimal such as a non-
human
primate.
In particular embodiments, the pharmaceutical composition is adapted for the
treatment,
control, or prevention of a disease with a viral etiology; adapted for
treatment, control, or
prevention of a prion disease; is adapted for delivery by intraocular
administration, oral
ingestion, enteric administration, inhalation, cutaneous, subcutaneous,
intramuscular,
intraperitoneal, intrathecal, intratracheal, or intravenous injection, or
topical
administration.
In particular embodiments, the pharmaceutical composition can be formulated
for delivery by a mode selected from.the group consisting of but not
restricted to
oral ingestion, oral mucosal delivery, intranasal drops or spray, intraocular
injection, subconjonctival injection, eye drops, ear drops, by inhalation,
intratracheal injection or spray, intrabronchial injection or spray,
intrapleural
injection, intraperitoneal injection perfusion or irrigation, intrathecal
injection or
perfusion, intracranial injection or perfusion, intramuscular injection,
intravenous
injection or perfusion, intraarterial injection or perfusion, intralymphatic
injection
or perfusion, subcutaneous injection or perfusion, intradermal injection,
topical
skin application, by organ perfusion, by topical application during surgery,
intratumoral injection, topical application, gastric injection perfusion or
irrigation,
enteral injection or perfusion, colonic injection perfusion or irrigation,
rectal
injection perfusion or irrigation, by rectal suppository or enema, by urethral
suppository or injection, intravesical injection perfusion or irrigation, or
intraarticular injection.
In particular embodiments, the composition includes a delivery system, e.g.,
targeted to
specific cells or tissues; a liposomal formulation, another. antiviral drug,
e.g., a non-
nucleotide antiviral polymer, an antisense molecule, an siRNA, or a small
molecule
drug.
In particular embodiments, the antiviral oligonucleotide, oligonucleotide
preparation,
oligonucleotide formulation, or antiviral pharmaceutical composition has an in
vitro IC5o
for a target virus (e.g., any of particular viruses or viruses in a group of
viruses as
indicated herein) of 10, 5, 2, 1, 0.50, 0.20, 0.10, 0.09. 0.08, 0.07, 0.75,
0.06, 0.05,
0.045, 0.04, 0.035, 0.03, 0.025, 0.02, 0.015, or 0.01 pM or less.
21
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
In particular embodiments of formulations, pharmaceutical compositions, uses
for
prophylaxis or treatment and methods for prophylaxis or treatment, the
composition or
formulation is adapted for treatment, control, or prevention of a disease with
viral
etiology; is adapted for the treatment, control or prevention of a prion
disease; is
adapted for delivery by a mode selected from the group consisting of
intraocular, oral
ingestion, enterally, inhalation, or cutaneous, subcutaneous, intramuscular,
or
intravenous injection delivery; further comprises a delivery system, which can
include or
be associated with a molecule increasing affinity with specific cells; further
comprises at
least one other antiviral drug in combination; and/or further comprises an
antiviral
polymer in combination.
In particular embodiments, the pharmaceutical composition contains at least
one
polypyrimidine oligonucleotide as described herein. In view of the resistance
to low pH
discovered for polypyrimidine oligonucleoides; in certain embodiments such a
composition is adapted for delivery to an acidic in vivo site, e.g., oral
delivery or vaginal
delivery.
In particular embodiments of compositions and formulations for oral
administration
containing such polypyrimidine oligonucleotides, the composition or
formulation is
prepared in the form of a powder, granules, microparticulates,
nanoparticulates,
suspensions or solutions in water or non-aqueous media, emulsion (e.g.,
microemulsion), capsule, gel capsule, sachet, tablet, or minitablet. In
certain
embodiments, thickeners, flavoring agents, diluents, emulsifiers, dispersing
aids or
binders may be included. In some embodiments, the oral formulations are those
in
which oligonucleotides of the invention are administered in.conjunction with
one or more
penetration enhancers surfactants and/or chelators, e.g. and without
restriction, fatty
acids and/or esters or salts thereof (for example, arachidonic acid,
undecanoic acid,
oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic
acid, stearic acid,
linoleic acid, linolenic acid, dicaprate, tricaprate, monooiein, dilaurin,
glyceryl 1-
monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine,
or a
monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof
(e.g.
sodium), bile acids and/or salts thereof (for example, chenodeoxycholic acid
(CDCA)
and ursodeoxychenedeoxycholic acid (UDCA), cholic acid, dehydrocholic acid,
deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid,
taurocholic acid,
taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate, sodium
glycodihydrofusidate). Some embodiments include a combination of penetration
enhancers, for example, fatty acids/salts in combination with bile acids/salts
such as the
22
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
sodium salt of lauric acid, capric acid and UDCA. Further exemplary
penetration
enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl
ether.
In particular embodiments in which the oligonucleotides of the invention are
prepared in
granular form (including sprayed dried particles) or complexed to form micro
or
nanoparticles, a complexing agent(s) is used that is selected, without
restriction, from
poly-amino acids; polyimines; polyacrytates; polyalkylacrylates,
polyoxethanes,
polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates,
polyethyleneglycols (PEG), and starches; polyalkylcyanoacrylates; DEAE-
derivatized
polyimines, pollulans, celluloses, and starches, or more specifically selected
from
chitosan, N-trimethytchitosan, poiy-L-Iysine, polyhistidine, polyorithine,
polyspermines,
protamine, polyvinylpyridine, polythiodiethylamino-methylethylene P(TDAE),
polyaminostyrene (e.g. p-amino), poly(methylcyanoacrylate),
poly(ethylcyanoacrylate),
poly(butylcyanoacrylatc), poly(isobutylcyanoacrylate),
poly(isohexylcynaoacrylate),
DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-
dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-Iactic .acid),
poly(DL-lactic-co-
glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG).
In particular embodiments, the composition is adapted for vaginal
administration. In
such embodiments, the composition may be prepared, without limitation, in the
form of
tablets, a solution, a cream, a gel, a suppository.
In particular embodiments, the composition is adapted for topical
administration.
As used herein, the terms "polypyrimidine oligonucleotide" or "pyrimidine
oligonucleotide" means an oligonucleotide that contains greater than 50%
pyrimidine
nucleotides.
As used in relation to in vivo administration of the present oligonucleotides
and
compositions, the term "acidic site" means a site that has a pH of less than
7. Examples
include the stomach (pH generally 1-2), the vagina (pH generally 4-5 but may
be lower),
and to a lesser degree, the skin (pH generally 4-6).
As used herein, the phrase "adapted for oral delivery" and like terms indicate
that the
composition is sufficiently resistant to acidic pH to allow oral
administration without a
clinically excessive loss of activity,.e.g., an excessive first pass loss due
to stomach
acidity of less than 50% (or is indicated, less than 40%, 30%, 20%, 10%, or
5%).
23
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
As used herein, the phrase "adapted for vaginal administration" and like terms
indicate
that the composition is prepared such that when appropriately administered, -
the
composition will not degrade to a clinically. unacceptable extent (e.g., less
than 50%,
40%, 30%, 20%, 10%, or 5% over a specified time for retention) and will remain
substantially in the vagina (excluding material that is absorbed) for at least
1 hour (or if
indicated, for at least 2 hr, 4 hr, 8 hr, 12 hr, 1 day, or 2 days). Such
retention may be
due to any of a number of different factors or combinations of factors, for
example, due
to physical form or adhesive properties, and the like.
As used herein in connection with antiviral oligonucleotides and formulations,
and the
like, in reference to a particular virus or group of viruses the term
"targeted" indicates
that the oligonucleotide is selected to inhibit that virus or group of
viruses. As used in.
connection with a particular tissue or cell type, the term indicates that the
oligonucleotide, formulation, or delivery system is selected such that the
oligonucleotide
is preferentially present and/or preferentially exhibits an antiviral effect
in or proximal to
the particular tissue or cell type.
As used herein, the term "delivery system" refers to a component or components
that,
when combined with an oligonucleotide (e.g., an antisense oligo, siRNA, or
oligonucleotide as described herein), increases the amount of the
oligonucleotide_ that
contacts the intended location in vivo, and/or extends the duration of its
presence at the
target, e.g., by at least 20, 50, or 100%, or even more as compared to the
amount
and/or duration in the absence of the delivery system, and/or prevents or
reduces
interactions that cause side effects.
As used herein in connection with antiviral agents and other drugs or test
compounds,
the term "small molecule" means that the molecular weight of the molecule is
1500
daltons or less. In some cases, the molecular weight is 1000, 800, 600; 500,
or 400
daltons or less. .
In another aspect, the invention provides a kit that includes at least one
antiviral
oligonucleotide, antiviral oligonucleotide mixture, antiviral oligonucleotide
formulation, or
antiviral pharmaceutical composition that includes such oligonucleotide,
oligonucleotide
mixture, or oligonucleotide formulation in a labeled package, where the
antiviral activity
of the oligonucleotide occurs principally by a sequence independent e.g., non-
sequence
complementary, mode of action and the label on the package indicates that the
antiviral
oligonucleotide can be used against at least one virus.
24
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
In particular embodiments the kit includes a pharmaceutical composition that
includes at
least one antiviral oligonucletide as described herein. In one embodiment, the
kit
contains a mixture of at least two different antiviral oligonucleotides. In
one embodiment,
the antiviral oligonucleotide is adapted for in vivo use in an animal and/or
the label
indicates that the oligonucleotide or composition is acceptable and/or
approved for use
in an animal; the animal is a mammal, such as human, or a non-human mammal
such
as bovine, porcine, a ruminant, ovine, or equine; the animal is a non-human
animal; the
animal is a bird, the kit is approved by a regulatory agency such as the U.S.
Food and
Drug Administration or equivalent agency for use in an animal, e.g., a human.
In another aspect, the invention provides a method for selecting an antiviral
oligonucleotide, e.g, a non-sequence complementary antiviral oligonucleotide,
for use
as an antiviral agent. The method involves synthesizing a plurality of
different random
oligonucleotides, testing,the oligonucleotides for activity in inhibiting the
ability of a virus
to produce infectious virions, and selecting an oligonucleotide having a
pharmaceutically
acceptable level of activity for use as an antiviral agent.
In particular embodiments, the different random oligonucleotides comprises
randomers
of different lengths; the random oligonucleotides can have different sequences
or can
have sequence in common, such as the sequence of the shortest oligos of the
plurality;
and/or the different random oligonucleotides comprise a plurality of
oligonucleotides
comprising a randomer segment at least 5 nucleotides in length or the
different random
oligonucleotides include a plurality of randomers of different lengths. Other
oligonucleotides, e.g., as described herein for antiviral oligonucleotides,
can be tested in
a particular system.
In yet another aspect, the invention provides a method for the prophylaxis or
treatment
of a viral infection in a subject by administering to a subject in need of
such treatment a
therapeutically effective amount of at least one pharmacologically acceptable
oligonucleotide as described herein, e.g., a non-sequence complementary
oligonucleotide at least 6 nucleotides in length, or an antiviral
pharmaceutical
composition or formulation or mixture containing such oligonucleotide(s). In a
further
embodiment, the inverition provides a use for the prophylaxis or treatment of
a viral
infection in a subject by administering to a subject in need of such treatment
a
therapeutically effective amount of at least one pharmacologically acceptable
oligonucleotide as described herein, e.g., a non-sequence complementary
oligonucleotide at least 6 nucleotides in length,. or an antiviral
pharmaceutical
composition or formulation or mixture containing such oligonucleotide(s). In
particular
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
embodiments, the virus can be any of those listed herein as suitable for
inhibition using
the present invention; the infection is related to a disease or condition
indicated herein
as related to a viral infection; the subject is a type of subject as indicated
herein, e.g.,
human, non-human animal, non-human mammal, bird, plant, and the like; the
treatment
is for a viral disease or disease with a viral etiology, e.g., a disease as
indicated in the
Background section herein.
In yet another aspect, the invention provides a method for the prophylaxis or
treatment
of a viral infection in an acidic environnement in a subject, comprising
administering to a
subject in need of such a treatment a therapeutically effective amount of at
least one
pharmacologically acceptable antiviral pharmaceutical composition of the
invention, said
composition being adapted for administration to an acidic in vivo site.
In yet another aspect, the invention provides a use for the prophylaxis or
treatment of a
viral infection in an acidic environnement in a subject, comprising
administering to a
subject in need of such a treatment a therapeutically effective amount of at
least one
pharmacologically acceptable antiviral pharmaceutical composition of the
invention, said
composition being adapted for administration to an acidic in vivo site.
In particular embodiments, an antiviral oligonucleotide (or oligonucleotide
formulation or
pharmaceutical composition) as described herein is administered;
administration is a
method as described herein; a delivery system or method as described herein is
used;
the viral infection is of a DNA virus or an RNA virus; the virus is a
parvoviridae,
papovaviridae, adenoviridae, herpesviridae, poxviridae, hepadnaviridae, or
papillomaviridae; the virus is a arenaviridae, bunyaviridae, calciviridae,
coronaviridae,
filoviridae, flaviridae, orthomyxoviridae, paramyxoviridae, picornaviridae,
reoviridae,
rhabdoviridae, retroviridae, or togaviridae; the herpesviridae virus is EBV,
HSV-1, HSV-
2, CMV, VZV, HHV-6, HHV-7, or HHV-8; the virus is HIV-1 or HIV-2; the virus is
respiratory syncytical virus (RSV); the virus is parainfluenza-3 virus; the
virus is an
influenza virus, e.g., influenza A; the virus is HBV; the virus is smallpox
virus or vaccinia
virus; the virus is a coronavirus; the virus is SARS virus; the virus is West
Nile Virus; the
virus is. a hantavirus; the virus is a parainfluenza virus; the virus is
coxsackievirus; the
virus is rhinovirus;.the virus is yellow fever virus; the virus is dengue
virus; the virus is
hepatitis C virus; the virus is Ebola virus; the virus is Marburg virus; the
virus is Lassa
fever virus; the virus is Varicella Zoster Virus; the virus is Epstein Barr
Virus; the virus is
Human Herpesvirus 6A or 6B; the virus is HBV; the virus is parainfluenza
virus; the
virus is human metapneumovirus; the virus is Rift Valley fever virus; the
virus is Crimean
Congo Hemorrhagic Fever virus; the'virus is Western Equine Encephalitis virus.
26
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
In a particular embodiment, the oligonucleotide of the invention targets
influenza virus.
In particular embodiments, the oligonucleotide is a polypyrimidine
oligonucleotide (or a
formulation or pharmaceutical . composition containing such polypyrimidine
oligonucleotide), which may be adapted for oral or vaginal administration,
e.g., as
described herein.
Similarly, in a related aspect, the invention provides a method for the
prophylactic
treatment of cancer caused by oncoviruses in a human or animal by
administering to a
human or animal in need of such treatment, a pharmacologically acceptable,
therapeutically effective amount of at.least one random oligonucleotide of at
least 6
nucleotides in length (or another length as described herein), or a
formulation or
pharmaceutical composition containing such oligonucleotide. In one embodiment,
a
mixture of oligonucleotides of the invention.
Similarly, in a related aspect, the invention provides a use for the
prophylactic treatment
of cancer caused by oncoviruses in a human or animal by administering to a
human or
animal in need of such treatriient, a pharrnacologically acceptable,
therapeutica!!y
effective amount of at least one random oligonucleotide of at least 6
nucleotides in
length (or another length as described herein), or a formulation or
pharmaceutical
composition containing such oligonucleotide. In one embodiment, a mixture of
oligonucleotides of the invention.
In particular embodiments, the oligonucleotide(s) is as described herein for
the present
invention, e.g., having a length as described herein; a method of
administration as
described herein is used; a use as described herein is used; a delivery system
as
described herein is used.
The term "therapeutically effective amount" refers to an amount that is
sufficient to effect
a therapeutically or prophylactically significant reduction in production of
infectious virus
particles when administered to a typical subject of the intended type. In
aspects
involving administration of an antiviral oligonucleotide to a subject,
typically the
oligonucleotide, formulation, or composition should be administered in a
therapeutically
effective amount. .
In certain embodiments involving oligonucleotide formulations, pharmaceutical
compositions, treatment and prophylactic methods and/or treatment and
prophylactic
uses described herein, the oligonucleotide(s) having a sequence independent
mode of
action is not associated with a transfection agent; the oligonucleotide(s)
having a
27
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
sequence independent mode of action is not encapsulated in liposomes and/or
non-
liposomal lipid particles. In certain embodiments, the oligonucleotide(s)
having a
sequence independent mode of. action is in a pharmaceutical composition or is
administered in conjunction with (concurrently or sequentially) an antiviral
oligonucleotide that acts principally by a sequence dependent mode of action,
e.g.,
antisense oligonucleotide or siRNA, where the oligonucleotide(s) having a
sequence
dependent mode of action can be associated with a transfection agent and/or
encapsulated in liposomes and/or non-liposomal lipid particles.
In another aspect, the discovery that sequence independent, e.g., non-sequence
complementary, interactions produce effective antiviral activity provides a
method of
screening to identify a compound that alters binding of an oligonucleotide to
a viral
component, such as one or more viral proteins (e.g., extracted or purified
from a viral
culture of infected"host organisms, or produced by recombinant methods). For
exampie,
the method can involve determining whether a test compound reduces the binding
of
oligonucleotide to one or more viral components.
As used herein, the term "screening" refers to assaying a plurality of
compounds to
determine if they possess a desired property. The plurality of compounds can,
for
example, be at least 10, 100, 1000, 10,000 or more test compounds.
In particular embodiments, any of a variety of assay formats and detection
methods can
be used to identify such alteration in binding, e.g., by contacting the
oligonucleotide with
the viral component(s) in the presence and, absence of a compound(s) to be
screened
(e.g., in separate reactions) and determining whether a difference occurs in
binding of
the oligo the viral component(s) in the presence of the compound compared to
the-
absence of the compound. The presence of such a difference is indicative that
the
compound alters the binding of the random oligonucleotide to the viral
component.
Alternatively, a competitive displacement can be used, such that
oligonucleotide is
bound to the viral component and displacement by added test compound is
determined,
or conversely test compound is bound and displacement by added oligonucleotide
is
determined.
In particular embodiments, the oligonucleotide is as described herein for
antiviral
oligonucleotides; the oligonucleotide is at least 6, 8, 10, 15, 20, 25, 29,
30, 32, 34, 36,
38, 40, 46, 50, 60, 70, 80, 90, 100, 110, or 120 nucleotides in length or at
least another
length specified herein for the antiviral oligonucleotides, or is in a range
defined by
taking any two of the preceding values as inclusive endpoints of the range;
the test
28
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
compound(s) is a small molecule; the test compound has a molecular weight of
less
than 400, 500, 600, 800, 1000, 1500, 2000, 2500, or 3000 daltons, or is in a
range
defined by taking any two of the preceding values as inclusive endpoints of
the range;
the viral extract or component is from a virus as listed herein; at least 100,
1000, 10,000,
20,000, 50,000, or 100,000 compounds are screened; the oligonucleotide has an
in vitro
ICso of equal to or less than 10, 5, 2, 1, 0.500, 0.200, 0.100, 0.075, 0.05,
0.045, 0.04,
0.035, 0.03, 0.025, 0.02, 0.015, or 0.01 pM.
The present invention further provides oligonucleotides described in Table 21.
The present invention further provides an antiviral oligonucleotide as set
forth in any one
of REP 1001, REP 2001, REP 3007, REP 2004, REP 2005, REP 2006, REP 2007, REP
2008, REP 2017, REP 2018, REP 2020, REP 2021, REP 2024, REP 2036, A20, G20,
C20, REP 2029, REP 2031, REP 2030, REP 2033, REP 2055, REP 2056, REP 2057,
REP 2060 and REP 2107.
As used herein, the term "viral component" refers to a product encoded by a
virus or
produced by infected host cells as a consequence of the viral infection. Such
components can include , proteins as well as other biomolecules. Such viral
components, can, for example, be obtained from viral cultures, infected host
organisms,
e.g., animals and plants, ot can be produced from viral sequences in
recombinant
systems (prokaryotes and eukaryotes), as.welt synthetic proteins having amino
acid
sequences correspondirig to viral encoded proteins. The term "viral culture
extract"
refers to an extract from cells infected by a virus that will include virus-
specific products.
Similarly, a "viral protein" refers to a virus-specific protein, usually
encoded by a virus,
but can also be encoded at least in part by hosf sequences as a consequence of
the
viral infection.
In a related aspect, the invention provides an antiviral compound identified
by the
preceding method, e.g., a novel antiviral compound.
In a further aspect, the invention provides a method for purifying
oligonucleotides
binding to at least one viral component from a pool of oligonucleotides by
contacting the
pool with at least one viral component, e.g., bound to a stationary phase
medium, and
collecting oligonucleotides that bind to the viral component(s). Generally,
the collecting
involves displacing the oligonucleotides from the viral component(s). The
method can
also involve sequencing and/or testing antiviral activity of collected
oligonucleotides (i.e.,
oligonucleotides that bound to viral protein).
29
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
In particular embodiments, the bound oligonucleotides of the pool are
displaced from
the stationary phase medium by any appropriate method, e.g., using an ionic
displacer,
and displaced oligonucleotides are collected. Typically for the various
methods of
displacement, the displacement can be performed in increasing stringent manner
(e.g.,
with an increasing concentration of displacing agent, such as a salt
concentration, so
that there is a stepped or continuous gradient), such that oligonucleotides
are displaced
generally in order of increased binding affinity. In many cases, a low
stringency wash
will be performed to remove weakly bound oligonucleotides, and one or more
fractions
will be collected containing displaced, tighter binding oligonucleotides. In
some cases, it
will be desired to select fractions that contain very tightly binding
oligonucleotides (e.g.,
oligonucleotides in fractions resulting from displacement by the more
stringent
displacement conditions) for further use.
Similarly, the invention provides a method for enriching oligonucleotides from
a pool of
oligonucleotides binding to at least one viral component, by contacting the
pool with one
15' or more viral proteins, and amplifying oligonucleotides bound to the viral
proteins to
provide an enriched oligonucleotide paol_ The contacting and amplifying can be
performed in multiple rounds, e.g., at least 1, 2, 3, 4, 5, 10, or more
additional times
using the enriched oligonucleotide pool from the preceding round as the pool
of
oligonucleotides for the next round. The method can also involve sequencing
and
testing antiviral activity of oligonucleotides in the enriched oligonucleotide
pool following
one or more rounds of contacting and amplifying.
The method can involve displacing oligonucleotides from the viral component
(e.g., viral
protein bound to a solid phase medium) with any of a variety of techniques,
such as
those described above, e.g., using a displacement agent. As indicated above,
it can be
advantageous to select the tighter binding oligonucleotides for further use,
e.g., in
further rounds of binding and amplifying. The method can further involve
selecting one
or more enriched oligonucleotides, e.g., high affinity oligonucleotides, for
further use. In
particular embodiments, the selection can include eliminating oligonucleotides
that have
sequences complementary to host genomic sequences (e.g., human) for a
particular
virus of interest. Such elimination can involve comparing the oligonucleotide
sequence(s) with.sequences from the particular host in a sequence database(s),
e.g.,
using a sequence alignment program (e.g., a BLAST search), and eliminating
those
oligonucleotides that have sequences identical or with a particular level of
identity to a
host sequence. Eliminating such host complementary sequences and/or selecting
one
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
or more oligonucleotides that are not complementary to host sequences can also
be
done for the other aspects of the present invention.
In the preceding methods. for identifying, purifying, or enriching
oligonucleotides, the
oligonucleotides can be of types as described herein. The above methods are
advantageous for identifying, purifying or enriching high affinity
oligonucleotides, e.g.,
from an oligonucleotide randomer preparation.
In a related aspect, the invention concerns an antiviral oligonucleotide
preparation that
includes one or more oligonucleotides identified using a method of any of the
preceding
methods for identifying, obtaining, or purifying antiviral oligonucleotides
from an initial
oligonucleotide pool, where the oligonucleotides in the oligonucleotide
preparation
exhibit higher mean binding affinity with one or more viral proteins than the
mean
binding affinity of oligonucletides in the initial oligonucleotide pool.
In particular embodiments, the mean binding affinity of the oligonucleotides
is at least
two-fold, 3-fold, 5-fold, 10-fold, 20-fold, 50-fold, or 100-fold greater than
the mean
binding affinity of oiigonucieotides in the initial oligonucleotide pool, or
even more; the
median of binding affinity is at least two-fold, 3-fold, 5-fold, 10-fold, 20-
fold, 50-fold, or
100-fold greater relative to the median of the binding affinity of the initial
oligo pool,
where median refers to the middle value.
In yet another aspect, the invention provides an antiviral polymer mix that
includes at
least one antiviral oligonucleotide and at least one non-nucleotide antiviral
polymer. In
particular embodiments, the oligonucleotide is as described herein for
antiviral
oligonucleotides and/or the antiviral polymer is as described herein or
otherwise known
in the art or subsequently identified.
In yet another aspect, the invention provides an oligonucleotide randomer,
where the
randomer is at least 6 nucleotides in length. In particular embodiments the
randomer
has a length as specified above for.antiviral oligonucleotides; the randomer
includes at
least one phosphorothioate linkage, the randomer includes at least one
phosphorodithioate linkage or other modification as listed herein; the
randomer
oligonucleotides include at least one non-randomer segment (such as a segment
complementary to a selected virus nucleic acid sequence), which can have a
length as
specified above. for oligonucleotides; the randomer is in a preparation or
pool of
preparations containing at least 5, 10, 15, 20, 50, 100, 200, 500, or 700
micromol, 1, 5,
7, 10, 20, 50, 100, 200, 500, or 700 mmol, or I mole of randomer, or a range
defined by
31
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
taking any two different values from the preceding as inclusive end points, or
is
synthesized at one of the listed scales or scale ranges.
Likewise, the invention provides a method for preparing antiviral randomers,
by
synthesizing at least one randomer, e.g., a randomer as described above.
As indicated above, for, any aspect involving a viral infection or risk of
viral infection or
targeting to a particular virus, in particular embodiments the virus is as
listed above.
The expression "human and animal viruses" is intended to include, without
limitation,
DNA and RNA viruses in general. DNA viruses include, for example,
parvoviridae,
papovaviridae, adenoviridae, herpesviridae, poxviridae, hepadnaviridae, and
papillomaviridae. RNA viruses include, for example, arenaviridae,
bunyaviridae,
calciviridae, coronaviridae, filoviridae, flaviridae, orthomyxoviridae,
paramyxoviridae,
picornaviridae, reoviridae, rhabdoviridae, retroviridae, or togaviridae.
In connection with modifying characteristics of an oligonucleotide by linking
or
conjugating with another molecule or moiety, the modifications in the
characteristics are
evaluated relative to the same oligonucleotide without the linked or
conjugated molecule
or moiety.
Additional embodiments will be apparent from the Detailed Description and from
the
claims.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
The present invention is concerned with the identificatio.n and use of
antiviral
oligonucleotides that act by a sequence independent mechanism, and includes
the
discovery that for many viruses, the antiviral activity is greater for larger
oligonucleotides, and is typically optimal for oligonucleotides that are 40
nucleotides or
more in length. 25 In accordance with the present inventionthere is provided
an oligonucleotide comprising
at least one modified' internucleotidic linkage, wherein said oligonucleotide
has an
antiviral activity against a target virus wherein said activity operates
predominantly by a
sequence independent mode of action.
In accordance with the present invention, there is provided an
oligonucleotide, having at
least 50% of its nucleotides in said oligonucleotide modified at the 2'-
position of the
ribose moiety and having at least 50% of its internucleotidic linkages
modified, wherein
32
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
said oligonucleotide has an antiviral activity against a target virus, said
activity operating
predominantly by a sequence independent mode of action. In one embodiment,
50%,
80% respectively. In one embodiment, 80%, 80% respectively. In one embodiment,
90%, 90% respectively. In one embodiment, 100%, 100% respectively.
Lengths & not self-complementary
The present invention further provides an oligonucieotide having at least 15
nucleotides
in length. In one embodiment, at least 20 nucleotides in length. In one
embodiment, at
least 25 nucleotides in length. In one embodiment, at least 30 nucleotides in
length. In
one embodiment, at least 35 nucleotides in length. In one embodiment, at least
40
nucleotides in length. In one embodiment, at least 45 nucleotides in length.
In one
embodiment, at least 50 nucleotides in length. In one embodiment, at Ieast.60
nucleotides in iength. In one embodiment, at least 80 nucleotides in length.
The present invention further provides an oligonucleotide having 20-30
nucleotides in
length. In one embodiment, 30-40 nucleotides in length.in one embodiment, 40-
50
nucleotides in length. In one embodiment, 50-60 nucleotides in length. In one
embodiment, 60-70 nuclebtides in length. In one embodiment, 70-80 nucleotides
in
length.
The present invention further provides an oligonucleotide which is free from.
self-
complementary sequences of greater than 5 contiguous nucleotides. In one
embodiment, greater than 10 contiguous nucleotides. In one embodiment, greater
than
20 contiguous nucleotides.
The present invention further provides an oligonucleotide which is free of
catalytic
activity.
Random
The present invention further provides an oligonucleotide having an antiviral
activity
against a target virus, and the sequence of said oligonucleotide not being
complementary to any equal length portion of the genomic sequence of said
target
virus.
33
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
is not complementary to any equal length portion of the genomic sequence of a
human
pathogenic virus .
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
is not complementary to any equal length portion of the genomic sequence of a
human
pathogenic virus sequenced as of January 1st, 2005.
The present invention further provides an oligonucleotide which is not
complementary to
any equal length portion of the genomic sequence of a human.
The present invention further provides an oligonucleotide which is not
complementary to
any equal length portion of the genomic sequence of one or more animals
selected from
the group consisting of cattle, horse, swine, sheep, bird, dog, cat and fish.
RNA and other chain moiety limitations
The present invention further provides an oligonucleotide wherein at least 30%
of the
nucleotides are ribonucleotides. In one embodiment, at least 50% of the
nucleotides are
ribonucleotides. In one embodiment, at least 70% of the nucleotides are
ribonucleotides.
In one embodiment, at least 80% of the nucleotides are ribonucleotides. In one
embodiment, at least 90% of the nucleotides are ribonucleotides. In one
embodiment,
all of the nucleotides are ribonucleotides.
The present invention further provides an oligonucleotide comprising 1-4 non-
nucleotide
chain moieties.
Randomer
The present invention further provides an oligonucleotide comprising at least
10
contiguous nucleotides of randomer sequence. In one embodiment, at least 20
nucleotides of randomer sequence. In one embodiment, at least 30 nucleotides.
of
randomer sequence: In one embodiment, at least 40 nucleotides of randomer
sequence.
The present invention further provides an oligonucleotide wherein said
oligonucleotide is
randomer oligonucleotide.
34
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Homopolymer
The present invention further provides an oligonucleotide comprising a
homopolymer
sequence of at least 10 contiguous. A nucleotides. In one embodiment, at least
10
contiguous T nucleotides In one embodiment,at least 10 contiguous U
nucleotides. In
one embodiment, at least 10 contiguous C nucleotides. In one embodiment,at
least 10
contiguous G nucleotides. In one embodiment, at lea'st 10 contiguous I
nucleotide
analogs.
Heterodimers
The present invention further provides an oligonucleotide comprising a polyAT
sequence at least 10 nucleotides in length. In one embodiment,a polyAC
sequence at
least 10 nucleotides in length. In one embodiment,a polyAG sequence at least
10
nucleotides in length. In one embodiment, a polyAU sequence at least 10
nucleotides in
length. In one embodiment, a polyAl sequence at least 10 nucleotides in
length. In one
embodiment,a polyGC sequence at least 10 nucleotides in length. In one
embodiment,
a polyGT sequence at least 10 nucleotides in length. In one embodiment, a
polyGU
sequence at least 10 nucleotides in length. In one embodiment, a polyGi
sequence at
least 10 nucleotides in length. In one embodiment,a polyCT sequence at least
10
nucleotides in length. In one embodiment, a polyCU sequence at least 10
nucleotides in
length. In one embodiment,a polyCl sequence at least 10 nucleotides in length.
In one
embodiment,a polyTl sequence at least 10 nucleotides in length.
Modified linkages, including ps and ps2
The present invention further provides an oligonucleotide, wherein the
modified linkages
are selected from the group consisting of phosphorothioate linkages,
phosphorodithioate linkages, and boranophosphate linkages.
The present invention further provides an oligonucleotide wherein at least 50%
of the
internucleotidic linkages are modified linkages. In one embodiment, wherein at
least
80% of the internucleotidic linkages are modified linkages. In one embodiment,
wherein
at least 90% of the internucleotidic linkages are modified linkages. In one
embodiment,
wherein all of the internucleotidic linkages are modified linkages.
The present invention further provides an oligonucleotide, wherein at least
50% of the
internucleotidic linkages are phosphorothioate linkages. In one embodiment,
wherein at
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
least 80% of the internucleotidic linkages are phosphorothioate linkages. In
one
embodiment, wherein at least 90% of the internucleotidic linkages are
phosphorothioate
linkages. In one embodiment, wherein all of the internucleotidic linkages are
phosphorothioate linkages.
The present invention further provides an oligonucleotide, wherein at least
50% of the
internucleotidic linkages are phosphorodithioate linkages. In one embodiment,
wherein
at least 80% of the internucleotidic linkages are phosphorodithioate linkages.
In one
embodiment, wherein all of the internucleotidic linkages are
phosphorodithioate
linkages.
2'-modifications; combinations with modified linkages
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
comprises at least one phosphodiester linkage. In one embodiment, wherein said
oligonucleotide comprises at least 10% phosphodiester linkages. In one
embodiment ,
wherein said oligonucleotide comprises at least 20% phosphodiester linkages.
In one embodiment, wherein at least 50% of the nucleotides in said
oligonucleotide are
modified at the 2'-position of the ribose moiety. In one embodiment, wherein
at least
60% of the nucleotides in said oligonucleotide are modified at the 2'-position
of the
ribose moiety. In one embodiment, wherein at least 70% of the nucleotides in
said
oligonucleotide are modified at the 2'-position of the ribose moiety. In one
embodiment,
wherein at least 80% of the nucleotides in said oligonucleotide are modified
at the 2'-
position of the ribose moiety. In one embodiment, wherein at least 90% of the
nucleotides in said oligonucleotide are modified at the 2'-position of the
ribose moiety. In
one embodiment, wherein 100% of the nucleotides in said oligonucleotide are
modified
at the 2'-position of the ribose moiety.
The present invention further provides an oligonucleotide, wherein at least
50% of the
internucleotidic linkages are modified and at least 50% of the nucleotides in
said
oligonucleotide are modified at the 2'-position of the ribose moiety. In one
embodiment,
wherein at least 60% of the internucleotidic linkages are modified and at
least 60% of
the nucleotides in said oligonucleotide are modified at the 2'-position of the
ribose
moiety. In one embodiment, wherein at least 70%'of the internucleotidic
linkages are
modified and at least 70% of the nucleotides in said oligonucleotide are
modified at the
2'-position of the ribose moiety. In one embodiment, wherein at least 80% of
the
internucleotidic linkages are modified and at least 80% of the nucleotides in
said
36
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
oligonucleotide are modified at the 2'-position of the ribose moiety. In one
embodiment,
wherein all of the internucleotidic linkages are modified and all of the
nucleotides in said
oligonucleotide are modified at the 2'-position of the ribose moiety.
The present invention further provides an oligonucleotide, wherein at least
15% of the
nucleotides in said oligonucleotide comprise 2'-OMe moieties at the 2'-
position of the
ribose moiety. In one erimbodiment, wherein at least 20% of the nucleotides in
said
oligonucleotide comprise 2'-OMe moieties at the 2'-position of the ribose
moiety. In one
embodiment, wherein at least 30% of the nucleotides in said oligonucleotide
comprise
2'-OMe moieties at the 2'-position of the ribose moiety. In one embodiment,
wherein at
least 50%,of the nucleotides in said oligonucleotide comprise 2'-OMe moieties
at the 2'-
position of the ribose moiety. In one embodiment, wherein at least 60% of the
nucleotides in said oligonucleotide comprise 2'-OMe moieties at the 2'-
position of the
ribose moiety. In one embodiment, wherein at least 70% of the nucleotides in
said
oligonucleotide comprise 2'-OMe moieties at the 2'-position of the ribose
moiety. In one
embodiment, wherein at least 80% of the nucleotides in said oligonucleotide
comprise
2'-OMe moieties at the 2'-position of the ribose moiety. In one embodiment,
wherein at
least 90% of the nucleotides in said oligonucleotide comprise 2'-OMe moieties
at the 2'-
position of the ribose moiety. In one embodiment, wherein all of the
nucleotides in said
oligonucleotide comprise 2'-OMe moieties at the 2'-position of the ribose
moiety.
2 0 Misc. Characteristics
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
is a concatemer consisting of two or more oligonucleotide sequences joined by
a linker.
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
is linked or conjugated at one or more nucleotide residues, to a molecule
modifying the
characteristics of the oligonucleotide to obtain one or more characteristics
selected from
the group consisting of higher stability, lower serum interaction, higher
cellular uptake,
higher viral protein interaction, an improved ability to be formulated for
delivery, a
detectable signal, higher antiviral activity, better pharmacokinetic
properties, specific
tissue distribution, lower toxicity.
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
is double stranded.
37
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
is double or single stranded and comprises at least one base which is capable
of
hybridizing via non-watson-crick interactions.
The present invention further provides an oligonucieotide, wherein said
oligonucleotide
comprises a portion complementary to a viral mRNA.
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
binds to one or more viral components.
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
interacts with one or more host components, wherein said interaction results
in inhibition
of viral activity or production.
The present invention further provides an oligonucleotide, wherein at least a
portion of
the sequence of said oligonucleotide is derived from a viral genome.
The present invention further provides an oligonucleotide, wherein at least a
portion of
the sequence of said oligonucleotide is derived from a viral genome and has an
antiviral
activity that is predominantly a non-sequence complementary mode of action.
The present invention further provides an oligonucleotide, wherein at least a
portion of
the sequence of said oligonucleotide is derived from a viral packaging
sequence or
other viral sequence involved in an aptameric interaction.
The present invention further provides an oligonucleotide, wherein at least a
portion of
the sequence of said oligonucleotide is involved in an aptameric interaction
with a viral
component or a host compon.ent or both.
Activity levels
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
has an IC50 for a target virus of 0.10 Nm or less. In one embodiment, wherein
said
oligonucleotide has an IC50 for a target virus of 0.05 pm or less. In one
embodiment,
wherein said oligonucleotide has an IC5o for a target virus of 0.025 pm or
less. In one
embodiment, wherein said oligonucleotide has an IC50 for a target virus of
0.015 pm or
less.
38
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Target viruses
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
targets a DNA virus. In one embodiment, an RNA virus. In one embodiment, a
member
of the herpesviridae. In one embodiment, HSV-1. In one embodiment, HSV-2. In
one
embodiment, CMV. In one embodiment, a member of the hepadnaviridae In one
embodiment, HBV. In one embodiment, a member of the parvoviridae. In one
embodiment, a member of the poxviridae. In one embodiment, a member of the
papillomaviridae. In one embodiment, a member of the adenoviridae In one
embodiment, a member of the retroviridae In one embodiment, HIV-1. In one
embodiment, HIV-2 In one embodiment, a member of the paramyxoviridae. In one
. embodiment, RSV. In one embodiment, parainfluenza virus. In one embodiment,
a
member of the bunyaviridae. In one embodiment, hantavirus In one embodiment, a
member of the picornaviridae In one embodiment, coxsackievirus. In one
embodiment,
rhinovirus. In one embodiment, a member of the flaviviridae In one embodiment,
yellow
fever virus In one embodiment, dengue virus. In one embodiment, West Nile
virus In
one embodiment, hepatitis C virus. In one embodiment, a member of the
filoviridae. In
one embodiment, Ebola virus In one embodiment, Marburg virus In one
embodiment, a
member of the orthomyxoviridae. In one embodiment, influenza virus. In one
embodiment, a member of the togaviridae. In one embodiment, a member of the
coronaviridae. In one embodiment, a member of the reoviridae. In one
embodiment, a
member of the rhabdoviridae. In one embodiment, a member of the arenaviridae.
In one
embodiment, a member of the calciviridae. In one embodiment, Varicella Zoster
Virus.
In one embodimerit, Epstein Barr Virus. In one embodiment, Herpesvirus 6A or
6B. In
one embodiment, a member of hepadnaviridae. In one embodiment, human
metapneumovirus. In one embodiment, Rift Valley fever virus. In one
embodiment,
Crimean Congo Hemorrhagic Fever virus. In one embodiment, Western Equine
Encephalitis virus. In one embodiment, lassa fever virus.
Oligonucleotide
The present invention further provides an oligonucleotide comprising at least
20 linked
nucleotides, wherein at least 80% of the linkages are modified; and at least
80% of the
nucleotides comprise 2'-modifications of the ribose sugar moiety. In one
embodiment,
this oligonucleotide has an antiviral activity.
39
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
In one embodiment, wherein at least 90% of the internucleotidic linkages are
modified In
one embodiment, , wherein all of the internucleotidic linkages are modified.
In one
embodiment, wherein at least 90% of the nucleotides comprise 2'-modifications
of the
ribose sugar. In one embodiment, wherein all of the nucleotides comprise 2'-
modifications of the ribose sugar.
The present invention further provides an oligonucleotide, wherein said 2'-
modifications
are 2'-OMe substitutions. In one embodiment, wherein at least 90% of the
nucleotides
comprise 2'-OMe substitutions. In one embodiment, wherein all of the
nucleotides
comprise 2'-OMe substitutions.
The present invention further provides an oligonucleotide, wherein said 2'-
modifications
are 2'-methoxyethoxy substitutions. In one embodiment, at least 15% of the
nucleotides
comprise 2'- methoxyethoxy substitutions. In one embodiment, at least 50% of
the
nucleotides comprise 2'- methoxyethoxy substitutions. In one embodiment, at
least 90%
of the nucleotides comprise 2'- methoxyethoxy substitutions. In one
embodiment, all of
the nucleotides comprise 2'- methoxyethoxy substitutions.
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
is at least 40 nucleotides in length. In one embodiment, at Ieast 50
nucleotides in length.
In one embodiment, at least 60 nucleotides in length. In one embodiment, at
least 80
nucleotides in length
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
is 30-40 nucleotides in length. In one embodiment, 40-50 nucleotides in
length. In one
embodiment, 50-60 nucleotides in length. In one embodiment, 60-70 nucleotides
in
length. In one embodiment, 70-80 nucleotides in length.
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
is free from self-complementary sequences of greater than 5 contiguous
nucleotides. In
one embodiment, greater than 10 contiguous nucleotides. In one embodiment,
greater
than 20 contiguous nucleotides.
The present invention further provides an oligonucleotide, wherein said
oligonucleotide
is free of catalytic activity.
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Chain moiety limitations
The present invention further provides an oligonucleotide, further comprising
1-4 non-
nucleotide chain moieties.
Mixtures
The present invention further provides an oligonucleotide mixture, comprising
a mixture
of at least two different antiviral oligonucleotides of the invention. In one
embodiment, at
least ten different antiviral oligonucleotides. In one embodiment, at least
100 different
antiviral oligonucieotides. In one embodiment, at least 1000 different
antiviral
oligonucleotides. In one embodiment, at,least 106 different antiviral
oligonucleotides.
The present invention further provides a mixture, wherein a plurality of said
different
oligonucleotides are at least 10 nucleotides in length. In one embodiment, at
least 20
nucleotides in length. In one embodiment, at least 30 nucleotides in length.
In one
embodiment, at least 40 nucleotides in length. In one embodiment, at least 50
nucleotides in length. In one embodiment, at least 60 nucleotides in length.
In one
embodiment, at least 70 nucleotides in length. In one embodiment, at least 80
nucleotides in length. In one embodiment, at least 120 nucleotides in length.
Pharmaceutical compositions
The present invention further provides an antiviral pharmaceutical composition
.
comprising a therapeutically effective amount of at least one
pharmacologically
acceptable, antiviral oligonucleotide, polypyrimidine or oligonucleotide
mixture, wherein
the antiviral activity of said oligonucleotide or the oligonucleotides in said
mixture occurs
principally by a sequence independent mode of action; and a pharmaceutically
acceptable carrier.
The present invention further provides an antiviral pharmaceutical
composition, adapted
for the treatment, control, or prevention of a disease with a viral etiology.
The present invention further provides an antiviral pharmaceutical
composition, adapted
for the treatment, control or prevention of a prion disease.
The present invention further provides an antiviral pharmaceutical
composition, adapted
for delivery by a mode selected from .the group consisting of intraocular,
oral ingestion,
enterally, inhalation, cutaneous injection, subcutaneous injection,
intramuscular
41
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
injection, intraperitoneal injection, intrathecal injection, intratrachael
injection, and
intravenous injection.
The present invention further provides an antiviral pharmaceutical
composition, wherein
said composition further comprises a delivery system. In one embodiment, said
delivery
system targets specific cells or specific tissues. In one embodiment, said
composition
further comprises at least one other antiviral drug in combination. In one
embodiment,
said composition further comprises a non-nucleotide antiviral polymer in
combination. In
one embodiment, said composition further comprises an antiviral antisense
oligonucleotide in combination. In one embodiment, said comoposition further
comprises
an antiviral RNAi-inducing oligonucleotide. In one embodiment, said antiviral
RNAi-
inducing oligonucleotide is an siRNA.
The present invention further provides an antiviral pharmaceutical
composition, wherein
said composition has an IC5o for a target virus of 0.10 pM or less. In one
embodiment,
an IC50 for a target virus of 0.05 pM or less. In one embodiment, an IC50 for
a target
virus of 0.025 pM or less. In one embodiment, an IC5o for a target virus of
0.015 pM or
less.
Kits
The present invention further provides a kit comprising at least one antiviral
oligonucleotide, mixture, or antiviral pharmaceutical composition in a labeled
package,
2 0' wherein the antiviral activity of said oligonucleotide occurs principally
by a non-
sequence complementary mode of action and the label on said package indicates
that
said antiviral oligonucleotide can be used against at least one virus.
The present invention further provides a kit, wherein said kit contains a
mixture of at
least two different antiviral oligonucleotides.
The present invention further provides a kit approved by a regulatory agency
for use in
humans.
The present invention further provides a kit approved by a regulatory agency
for use in
at least one non-human animal. In one embodiment, said non-human animal is a
primate In, one embodiment, said non-human animal is a feline In one
embodiment, said
non-human animal is a bovine. In one embodiment, said non-human animal is an
ovine.
In one embodiment, said non-human animal is a canine In one embodiment, said
non-
human animal is a porcine. In one embodiment, said non-human animal is an
equine.
42
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Method of treatment
The present invention further provides use of at least one oligonucleotide
according to
the invention, or pharmaceutical composition according to the invention in the
manufacture of a medicament for the prophylaxis or treatment of a viral
infection in a
subject.
In one embodiment, said subject is a human. In one embodiment, said subject is
a
non-human animal. In one embodiment, said non-human animal is a primate. In
one
embodiment, said non-human animal is a feline. In one embodiment, said non-
human
animal is a bovine. In one embodiment, said non-human animal is an ovine. In
one
embodiment, said non-human animal is a canine. In one embodiment, said non-
human
animal is a porcine. In one embodiment, said non-human animal is an equine. In
one
embodiment, said subject is a plant.
The present invention further provides use of at least one oligonucleotide
according to.
the invention, or pharmaceutical composition according to the invention in the
manufacture of a medicament for the prophylactic treatment of cancer caused by
oncoviruses in a human or a non-human animal.
In one embodiment, said oligonucleotide is administered to a human. In one
embodiment, said oligonucleotide is administered to a non-human animal. In one
embodiment, said non-human animal is a primate. In one embodiment, said non-
human animal is a feline. In one embodiment, said non-human animal is a
bovine. In
one embodiment, said non-human animal is an ovine. In one embodiment, said non-
human animal is a canine. In one embodiment, said non-human animal is a
porcine. In
one embodiment, said non-human animal is an equine.
Polypyrimidine oligo-related
The present invention further provides an oligonucleotide comprising at least
50% of
pyrimidine residues. In one embodiment, at least 80%. In one embodiment, at
least
90%. In one embodiment, only pyrimidine residues.
The present invention further provides an oligonucleotide wherein the
pyrimidine
residues are cytosine residues. In one embodiment, thymine residues. In one
embodiment, cytosine or thymine residues.
The present invention further provides an antiviral pharmaceutical composition
comprising a therapeutically effective amount of at least one
pharmacologically
43
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
acceptable, polypyrimidine oligonucleotide or polypyrimidine oligonucleotide
mixture,
wherein the antiviral activity of said oligonucleotide or the oligonucleotides
in said
mixture - occurs principally by a sequence independent mode of action; and a
pharmaceutically acceptable carrier. In one embodiment, . said oligonucleotide
comprises at least one modified internucleotidic linkage.
In one embodiment, said composition is adapted for administration to an acidic
in vivo
site.
In one embodiment, said composition further comprises a penetration enhancer.
In one embodiment, said composition further comprises a-surfactant.
In one embodiment, said composition is in the form of a powder.
In one embodiment, said composition is in the form of granules.
In one embodiment, said composition is in the form of microparticulates.
In one embodiment, said composition is in the form of nanoparticulates.
In one embodirrient, said composition is in the form of a suspension or
solution.
In one embodiment, said composition is in the form of an emulsion.
In one embodiment, said composition is adapted for oral administration.
In one embodiment, wherein said composition is adapted for vaginal
administration.
In one embodiment, said composition comprises at least one polyC
oligonucleotide.
In one embodiment, said composition comprises at least one polyT
oligonucleotide.
In one embodiment, said composition comprises at least one polyCT
oligonucleotide.
In one embodiment, said composition is approved for administration to a human.
In one embodiment, said composition is approved for administration to a
mammal.
In one embodiment, said composition is approved for administration to a non-
mammal
animal.
44
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
The present invention further provides use of a pharmaceutical coniposition
adapted for
administration to an acidic in vivo site, wherein said composition contains at
least one
pharmacologically acceptable polypyrimidine oligonucleotide in the manufacture
of a
medicarrient for the prophylaxis or treatment of a viral infection in a
subject.
In one embodiment, said subject is a human. In one embodiment, said subject is
a
mammal. In one embodiment, said subject is a non-mammal animal.
As described in the Background, a number of antisense oligonucleotides (ONs)
have
been tested for antiviral activity. However, such antisense ONs are sequence-
specific,
and typically are about 16-20 nucleotides in length.
As demonstrated by the results in Examples 1 and 2, the antiviral effect of
random PS-
ONs is not sequence specific. Considering the volumes and concentrations of PS-
ONs
used in those tests, it is almost theoretically impossible that a particular
random
sequence is present at more than 1 copy in the mixture. This means than there
can be
no antisense effect in these PS-ON randomers. In the latter example, should
the
antiviral effect be caused by the sequence-specificity of the PS-ONs, such
effect would
thus have to be caused by only one molecule, a result that does not appear
possible.
For example, for an ON randomer 40 bases in length, any particular sequence in
the
population would theoretically represent only 1/440 or 4.1 X 10-4' of the
total fraction.
Given that 1 mole = 6.022X1023 molecules, and the fact that our largest
synthesis is
currently done at the 15 micromole scale, all possible sequences will not be
present and
also, each sequence is present most probably as only one copy. Of course, one
skilled
in the art applying the teaching of the present invention could also use ONs
that have
sequences of such sequence specific ONs, but utilize the sequence independent
activity
discovered in the present invention. Accordingly, the present invention is not
to be
restricted to non-sequence complementary ONs, but disclaims what has been
disclosed
in the prior art regarding sequence-specific aritisense and RNAi (e.g., siRNA)
ONs for
treating viral infections.
For applicable viruses (including, for example, those for which data is
described herein),
as the size of the randomer increases, so does its antiviral potency for
lengths up to and
even exceeding 40 nucleotides. It should be pointed out that due to
limitations in
current phosphoramidite-based oligonucieotide synthesis, the larger PS-ONs
(e.g., 80-
and 120-mers) have a significant contamination of fragments smaller than the
desired
size. The weaker effects (on a per base basis) seen with larger oligos (80 and
120 bp)
may reflect the lower concentration of full-length randomers in these
populations and
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
may also reflect a decreased availability at the appropriate site. It may be
possible to
achieve much larger increases in antiviral activity if larger randomers (>40
bases) of
reasonable purity (e.g., at least 75% full length) are synthesized or
purified, and/or if the
delivery of any of these ONs is facilitated by a delivery system, e.g., a
delivery system
providing targeting or sustained release.*
In the present invention, randomers (or other antiviral oligonucleotides as
described
herein) may block~viral replication by several mechanisms, including but not
limited to
the following: 1. preventing the adsorption or receptor interaction' of
virions, thus
preventing infection, 2. doping the virus assembly or the packaging of viral
genomes
into capsids (competing with viral DNA or RNA for packaging), resulting in
defective
virions, 3. disrupting and or preventing the formation of capsids during
packaging or the
interaction of capsid proteins with other structural proteins, resulting in
inhibition of viral
release or causing the release of defective virions, 4. binding to key viral
components
and preventing or reducing their activity, 5. binding to key host components
required for
'viral proliferation.
Without being limited on the mechanism by which the present viral inhibition
is achieved,
as indicated above there are several possible mechanisms that could explain
and/or
predict the inhibitory properties of ONs against viral replication. The first
of these is that
the general aptameric effect of ONs is allowing for their attachment, either
to proteins on
the cell surface or to viral proteins, -preventing viral adsorption and
fusion. The size
threshold for effect may be a result of a certain cumulative charge required
for
interaction.
A second possible mechanism is that ONs may function within the cell by
preventing
packaging and/or assembly of the virus. ONs above a certain size threshold may
compete or interfere with the normal capsid/nucleic acid interaction,
preventing the
packaging of a functional viral genome inside new viruses. Alternatively, ONs
may
prevent the formation of a normal capsid, which could prevent normal viral
budding, alter
viral stability, or prevent proper virion disassembly upon internalization.
While the mechanism of action is not yet entirely clear, assay results
demonstrate that
the present ONs can exhibit greater efficacy in viral inhibition compared to
the clinical
correlates, acyclovir, gancyclovir, Ribavirin, and protease inhibitors. ONs in
accordance
with the present invention could thus be used for treating or preventing viral
infection.
The viral infections treated could be those caused by human, animal, and plant
viruses
46
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Chemical modification of oligonucleotides can advantageously be used to
enhance the
stability and/or activity of the present antiviral oligonucleotides.
Methoxylation and other
modifications at the 2'-position of the ribose on RNA have been shown to
render RNA
stable to nucleases, to minimize the protein binding observed with
phosphorothioated
nucleic acids and to increase the melting temperature of these oligos with
their target
sequences. While 2'-0 methylation and other 2'-modifications are currently
used to
improve the characteristics of antisense oligonucleotides, oligonucleotides
with such
modfications do not elicit RNase H activity when present on every ribose,
making
completely 2'-modified oligonucleotides poorer candidates for antisense
activity. This
has resulted in the use of 2'-0 methyl and other 2' modification "gapmers"
which contain
2' modifications only at the extremities of the oligoriucleotide, thus
retaining the ability of
the oligo to activate RNase H. To our knowledge, there is no report of a non-
sequence
specific antiviral oligonucleotide with phosphorothioate linkages and
ribonucleotides
such as 2'-O-methyl or other 2' modification on each ribose sugar in the
oligonucleotide.
As described herein, we had found that the 40 base PS-ON randomer' is a potent
inhibitor of several different viruses. We suggest the non-limiting hypothesis
that the
thioated backbone imparts an increased hydrophobic character to the ON
randomer,
which may allow it to interact with hydrophobic domains in viral fusion
proteins. These
hydrophobic domains are believed to be essential for the membrane fusion
activity of
many different viruses including HSV, HIV, influenza, RSV, and Ebola. In the
case of
HIV, such hydrophobic domain has been used as a target for the development of
fusion
inhibitors.
Thus, the incorporation of phosphorothioate linkages and ribonucleotide
modifications,
including 2'-O-methyl and other 2' sugar modifications, into oligonucleotides
of this
invention, is useful for improving characteristics ~ of non-sequence specific
antiviral
oligonucleotides. Results demonstrate that modification at the 2-position of
each ribose
of PS-ONs does not significantly alter their antiviral activity, but that such
modification
reduces the general interaction of the PS-ONs with serum proteins and renders
them
significantly more resistant to low pH. These properties promise to increase
the
pharmacokinetic performance and reduce the toxic side effects normally seen
with PS-
ONs. For example, their pH resistance make them more suitable for oral
delivery. Also
their lowered interaction with serum proteins promises to improve their
pharmacokinetic
behaviour without affecting their antiviral activity. Thus, oligonucleotides
having each
linkage phosphorothioated and each ribonucleotide modified at the 2'-position
of the
ribose, e.g., 2'-O-methyl modifications, have antiviral activity but do not
trigger RNase H
47
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
activity , a property desirable for traditional antisense oligonucleotide but
completely
dispensable for the activity described in this present invention. Results also
demonstrate that modifications at the '2-position of each ribose of PS-ONs
renders the
ON more resistant to nucleases in comparison with a PS-ON comprising the same
modifications but only at both ends (gapmer). Gapmers are preferentially used
in the
antisense technology. Nuclease resistance of PS-ONs including modifications at
the '2-
position of each ribose should display beneficial properties, such as improved
pharmakokinetics and/or oral availability.
In addition, while PS-ONs that include modifications at the 2'-position of
each ribose
show desirable characteristics, PS-ONs with substantial numbers of
modifications at the
2'-position of riboses would also display desirable characteristic, e.g.,
modification at at
least 50 % of the riboses and more preferably 80% or even more.
As described above, the activity of the present oligonucleotides does not
target any
nucleic acid by hybridization since randomers, for example, have no antisense
activity.
Thus, we believe that the oligonucleotides target proteins. Since the addition
of 2'-O-
methyl ribose modifications to phosphorothioate oligonucleotides lowers the
protein
binding activity (Kandimalla et al., 1998, Bioorganic Med Chem Lett. 8:2103-
2108; Mou
et al., 2002, Nucleic Acids Res. 30:749-758), it would be expected that these
modifications would lower antiviral activity. Unexpectedly, we found that
addition of 2'-O-
2 0 methyl ribose modifications to phosphorothioate oligonucleotides does not
affect the
antiviral activity.
Assay results for a number of different oligonucieotides are described herein.
Unless
otherwise indicated, the tested oligonucleotides have 2'-H moieties (2'-deoxy)
and are
thus ODNs. However, the sequence independent activities of the present
invention are
not limited to oligonucleotides with such 2'-H moieties, but is also present
for oligos
containing, nucleotides having 2'-OH moieties as well as other 2'-
modifications, for
example, 2'-O-methyl and 2'-fluoro.
The description herein utilizes a number of abbreviations, including the
following:
Selected abbreviations
ON: Oligonucleotide
ODN: Oligodeoxynucleotide
PS: Phosphorothioate
48
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
PS2: Phosphorodithioate
PRA: Plaque reduction assay
PFU: Plaque forming unit
INF A: Influenza A virus
5' HIV: Human immunodeficiency virus (includes both HIV-1 and HIV-2 if
not specified)
HSV: Herpes simplex virus (includes both HSV-2 and HSV-3 if not
specified)
RSV:. Respiratory syncytial virus
COX: Coxsackievirus
DHBV: Duck hepatitis B virus
Broad spectrum antiviral activity
According to the conclusions discussed above and the data reported herein, it
appeared
.15 that random ONs and ON randomers could have broad-spectrum antiviral
activity with
viruses where assembly and/or packaging and/or encapsidation of the viral
genome is a
required step in replication. Therefore to test this hypothesis, several PS-ON
randomers
of different sizes were selected to be tested in cellular models of various
viral Infections.
A.number of such tests are described herein in the Examples, including tests
with CMV,
HIV-1, RSV, Coxsackie virus B2, DHBV, Hantavirus, Parainfluenza virus, and
Vaccinia
virus, as well as the tests on HSV-1 and HSV-2 described in Examples I and 2.
Conclusions on broad spectrum antiviral activity
The efficacy studies with different viruses demonstrate that random ONs and
randomers
display inhibitory properties against a variety of different viruses.
Moreover, these
studies support the conclusion that larger randomers display greater efficacy
for viral
inhibition than smaller randomers. This suggests a common size and/or charge
dependent mechanism for the random ONs or ON randomers activity in all
encapsidating viruses.
49
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
While HSV and CMV are both double-stranded DNA viruses of the herpesviridae
family,
HIV is "a RNA virus from the retroviridae, and RSV a RNA virus from the
paramyxoviridae. Given the fact that ON randomers can inhibit viral function
in a variety
of different viruses, without being limited to the mechanisms listed, as
discussed above
the following mechanisms are reasonable: A) ONs/ON randomers are inhibiting
viral
infection via an aptameric effect, preventing viral fusion with the plasma
membrane;
and/or. B) ONs/ON randomers are preventing or doping the assembly of virions
or the
packaging of viral DNA within capsids resulting in defective virions; and/or
C) ONs/ON
randomers are interfering with host proteins or components required in the
assembly
and/or packaging and/or gene expression of the virus.
Requirement for antiviral activity
Since a randomized DNA sequence seems to be sufficient for viral inhibition,
it was
interesting to see if antiviral activity could be maintained in the absence of
the
phosphorothioate modification and also if the efficacy was augmented by either
choosing a random sequence or a specific sequence found in the viral genome.
Accordingly, DNA and RNA modifications were investigated with respect to their
effect
on the antiviral efficacy of the randomers. Since randomers work via a
sequence
independent, e.g., non-sequence complementary, mechanism, these experiments
were
designed to test the slight changes in nucleic acid conformation and charge
distribution
20. on antiviral efficacy.
To test if ONs with different nucleotide/nucleoside modifications could
inhibit HSV-1,
REP 2024, 2026, 2059, and 2060 were tested in the HSV-1 PRA as described in
the
Examples. REP 2024 (a PS-ON with a 2-0-Methyl modification to the ribose on 4
bases
at both termini of the ON), REP 2026 (a PO-ON with methylphosphonate
modifications
to the linkages between the 4 bases at both termini of the ON), REP 2059 (RNA
PS-ON
randomer 20 bases in length), and REP 2060 (RNA PS-ON randomer 30 bases in
length) showed anti-HSV-1 activity. The assay was conducted as a plaque
reduction
assay in VERO cells using HSV-1 (strain KOS). The PS-ONs were tested in
increasing
concentrations. IC50 values calculated from linear regressions were 0.14,
3.41, 1.36,
and 0.80 respectively.
In the latter example, should the antiviral effect be caused only by the ONs
consisting of
DNA phosphorothioate backbone, such effect would thus be caused by only one
molecule. But other backbones and modifications gave positive antiviral
activity. Of
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
course, one skilled in the art applying the teaching of the present invention
could also
use different chemistry ONs. A modification of the ON, such as, but not
limited to, a
phosphorothioate modification, appears to be beneficial for antiviral
activity. This is
most likely due to the needed charge of ONs and/or the requirement for
stabilization of
DNA both in the media and intracellularly, and it may also be due to the
chirality of the
PS-ONs.
Compound REP 2026 showed an antiviral activity while having a central portion
comprising unmodified PO-nucleotides and 4 methylphosphonate linkages at both
termini protecting from degradation. This indicates that PO-ONs can be used as
antivirals while protected from degradation. This protection can be achieved
by
modifying nucleotides at termini and/or by using a suitable delivery system as
described
later.
In general, the sequence. composition of the DNA used has little effect on the
overall
efficacy, whether randomer, random sequence or a specific HSV-1 sequence.
However, at intermediate lengths, HSV-1 sequence was almost 3X more potent
than a
random sequence. This data suggests that while specific antisense
functionality exists
for specific HSV sequences, sequence independent mechanism (the non-antisense
mechanism) elucidated herein may represent the predominant part of this
activity.
Indeed, as the ON grows to 40 bases, essentially all of the antiviral activity
can be
attributed to a sequence independent (e.g., non-antisense) effect.
Lower toxicity of randomer
One goal of using an ON randomer is to lower the toxicity..It is known that
different
sequences may trigger different responses in the animal, such as general
toxicity,
interaction with serum proteins, and interaction with immune system (Monteith
et al
(1998) Toxicol Sci 46:365-375). The mixture of ONs may thus decrease toxic
effects
because the level of any particular sequence will be very low, so that no
significant
interaction due to sequence or nucleotide composition is likely.
Pharmaceutical compositions
The ONs of the 'invention may be in the form of a therapeutic composition or
formulation
useful for treating (or prophylaxis of) viral diseases, which can be approved
by a
regulatory agency for use in humans or in non-human animals, and/or against a
particular virus or group of viruses. These ONs may be used as part of a
pharmaceutical composition when combined with a physiologically and/or
51
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
pharmaceutically acceptable carrier. The characteristics of the carrier may
depend on
the route of administration. The pharmaceutical composition of the invention
may also
contain other active factors and/or agents which enhance activity.
Administration of the ONs of the invention used in the pharmaceutical
composition or
formulation or to practice the method of treating an animal can be carried out
in a variety
of conventional ways, such as intraocular, oral ingestion, enterally,
inhalation, or
cutaneous, subcutaneous, intramuscular, intraperitoneal, intrathecal,
intratracheal, or
intravenous injection.
The pharmaceutical composition or oligonucleotide formulation of the invention
may
further contain other chemotherapeutic drugs for the treatment of viral
diseases, such
as, without limitation, Rifampin, Ribavirin, Pleconaryl, Cidofovir, Acyclovir,
Pencyclovir,
Gancyclovir, Valacyclovir, Famciclovir, Foscarnet, Vidarabine, Amantadine,
Zanamivir,
Oseltamivir, Resquimod, antiproteases, pegylated interferon (PegasysTM) anti
HIV
proteases (e.g. lopinivir, saquinivir, amprenavir, HIV fusion inhibitors,
nucleotide HIV RT
inhibitors (e.g., AZT, Lamivudine, Abacavir), non-nucleotide HIV RT
inhibitors,
Doconosol, Interferons, Butylated Hydroxytoluene (BHT) and Hypericin. Such
additional
factors and/or agents may be included in the pharmaceutical composition, for
example,
to produce a synergistic effect with the ONs of the invention.
The pharmaceutical composition or oligonucleotide formulation of the invention
may
further contain a polymer, such as, without restriction, polyanionic agents,
sulfated
polysaccharides, heparin, dextran sulfate, pentosan polysulfate,
polyvinylalcool sulfate,
acemannan, polyhydroxycarboxylates, cellulose sulfate, polymers containing
sulfonated
benzene or naphthalene rings and naphthalene sulfonate polymers, acetyl
phthaloyl
cellulose, poly-L-lysine, sodium caprate, cationic amphiphiles, cholic acid.
Polymers are
known to affect the entry of virions in cells by, in some cases, binding or
adsorbing to
the virion itself. This characteristic of antiviral polymers can be useful in
competing with
ONs for the binding, or adsorption to the virion, the result being an
increased
intracellular activity of the ONs compared to its extracellular activity.
Exemplary lipid encapsulation and delivery
Although PS-ONs (as well as oligonucleotides with other modified linkages) are
more
resistant to endogenous nucleases than natural phosphodiesters, they are not
completely stable and are slowly degraded in blood and tissues. A limitation
in the
clinical application of PS oligonucleotide drugs is their propensity to
activate
52
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
complement on i.v. administration. In general, liposomes and other delivery
systems
enhance the therapeutic index of drugs, including ONs, by reducing drug
toxicity,
increasing residency time in. the plasma, and delivering more active drug to
disease
tissue by extravasation of the carriers through hyperpermeable vasculature.
Moreover in
the case of PS-ON, lipid encapsulation prevents the interaction with potential
protein-
binding sites while in circulation (Klimuk et al. (2000) J Pharmacol Exp Ther
292:480-
488).
According to our results described herein, an approach is to use a delivery
system such
as, but without restriction, lipophilic molecules, polar lipids, liposomes,
monolayers,
bilayers, vesicles, programmable fusogenic vesicles, micelles, cyclodextrins,
PEG,
iontophoresis, powder injection, and nanoparticies (such, as PIBCA, PIHCA,
PHCA,
gelatine, PEG-PLA) for the delivery of ONs described herein and/or
antisenseand
siRNA oligonucleotides. . Use of such delivery systems can, without
limitation, provide
one or more of the following benefits: lower the toxicity of the active
compound in
animals and humans, lower the IC5o, increase the duration of action from the
standpoint
of drug delivery, and protect the oligonucleotides from non-specific binding
with serum
proteins. -
Thus, we have shown that the antiviral activity of PS-ON randomers increases
with
increasing size. Moreover this activity is correlated with increased affinity
for viral
proteins (in a viral lysate). Since it is well known in the art that the
phosphorothioate
modification increases the affinity of protein-DNA interaction, we tested the
ability of
increasingly larger PS-ON randomers to bind to fetal bovine serum (FBS) using
the
same FP-based assay used for measuring interaction with viral lysates. In this
assay,
250ug of non-heat inactivated FBS was complexed with a fluorescently labeled
20 base
PS-ON randomer, under conditions where the binding (mP value) was saturated.
Unlabelled PS-ON randomers of increasing size (REP 2003, REP 2004, REP 2006
and
REP 2007) were used to compete the interaction of FBS with the labeled bait.
The
results of this test clearly show that as.the size of the PS-ON randomer
increases, so
does its affinity for FBS. This result suggests that the most highly active
anti-viral PS-
ONs will also be the ones to bind with the highest affinity to proteins.
However, it is known in the art that one of the main therapeutic problems for
phosphorothioate antisense oligonucleotides is their side effects due mainly
to an
increased interaction with proteins (specifically with serum proteins) as
described by.
Kandimalla and co-workers (Kandimalla et al. (1998) Bioorg. Med. Chem. Lett.
8:2103-
2108). Therefore, in some cases it may be beneficial to use a suitable
delivery system
53
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
capable of delivering antiviral ONs to the site of action while preventing
their interaction
with serum proteins. In addition, it may be beneficial to use suitable
delivery systems for
combination use of the present sequence independent ONs with other types of
ant-viral
ONs such as antisense oligonucleotides and siRNAs.
To demonstrate certain effects of a delivery system, we tested two different
delivery
technologies which are liposomal based; Cytofectin and DOTAP. We measured the
protection of REP2006 from serum protein interactions by DOTAP and Cytofectin
in our
in vitro FP-based interaction assay. Unencapsulated REP 2006 was able to
compete
bound fluorescent oligo from serum but when REP 2006 was encapsulated with
either
DOTAP or Cytofectin it was no longer able to compete for serum binding. These
data
suggest that encapsulation protects oligos from serum interaction and will
result in better
pharmacokinetic behaviour with fewer side effects.
We also. measured the delivery of the PS-ON randomer REP 2006 (encapsulated
with
either Cytofectin or DOTAP) into 293A cells in the presence of high
concentrations of
serum (50%) by measuring the intracellular concentration of labeled REP 2006
by
fluorometry. These results show that such delivery agents increase the
intracellular
concentration of REP 2006, and also that, in the case of DOTAP, the levels of
intracellular REP 2006 after 24 hours were markedly increased: Finally, we
measured
the protection of REP2006 from serum protein interactions by DOTAP. and
cytofectin in
our in vitro FP-based interaction assay. Unencapsulated REP 2006 was able to
compete bound fluorescent oligo from serum but when REP 2006 was encapsulated
with either DOTAP or cytofectin it was no longer able to compete for serum
binding.
These data suggest that encapsulation protects oligos from serum interaction
and will
result in better pharmacokinetic behaviour with fewer side effects.
Similarly demonstrating the effect of lipid encapsulation of oligonucleotides,
we
monitored the uptake of an additional PS-ON randomer by exposing cultured
cells to
fluorescently labeled randomers and then examined the fluorescence intensity
in lysed
cells after two rounds of washing. The cellular uptake of cells exposed to
250nM REP
2004-FL was tested with no delivery and after encapsulation in one of the
following lipid
based delivery systems; LipofectamineTM (Invitrogen), PolyfectT"' (Qiagen) and
OligofectamineT"' (Invitrogen). After 4 hours, cells were washed twice with
PBS and
lysed using MPER lysis reagent (PROMEGA). The relative fluorescence yield from
equivalent numbers of exposed cells with and without lipid system was
detected. We
observed that in the presence of all three agents tested, there was a
significant increase
in the intracellular PS-ON concentration compared to no delivery.
54
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
In keeping with the test results, the use of a delivery system can serve to
protect
oligonucleotides from serum interactions, reducing side effects and increasing
tissue
distribution and/or can significantly increase the intracellular delivery of
ONs.
Another potential benefit in using a delivery system is to protect the ONs
from
interactions, such as adsorption, with infective virions in order to prevent
amplification of
viral infection through different mechanisms such as increased cellular
penetration of
virions.
Another approach is to accomplish cell specific delivery by associating the
delivery
system with a molecule(s) that will increase affinity with specific cells,
such molecules
being without restriction antibodies, receptor ligands, vitamins, hormones and
peptides.
Additional options for delivery systems are provided below.
Linked ON
In certain embodiments, ONs of the invention are modified in a number of ways
without
compromising their ability to inhibit viral replication. For example, the ONs
are linked or
conjugated, at one or more of their nucleotide residues, to another moiety.
Thus,
modification ofthe oligonucleotides of the invention can involve chemically
linking to the
oligonucleotide one or more moieties or conjugates which enhance the activity,
cellular
distribution, increase transfer across cellular membranes specifically or not,
or
protecting against degradation or excretion, or providing. other advantageous
characteristics. Such advantageous characteristics can, for example, include
lower
serum. interaction, higher viral-protein interaction, the ability to be
formulated for
delivery, a detectable signal, improved pharmacokinetic properties, and lower
toxicity.
Such conjugate groups can be covalently bound to functional groups such as
primary or
secondary hydroxyl groups. For example, conjugate moieties can include a
steroid
molecule, a hon-aromatic lipophilic molecule, a peptide, cholesterol, bis-
cholesterol, an
antibody, PEG, a protein, a water soluble vitamin, a lipid soluble vitamin,
anothe'r ON, or
any other molecule improving the activity and/or bioavailability of ONs.
In greater detail, exemplary conjugate groups of the invention can include
intercalators,
reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers,
SATE, t-
butyl-SATE, groups that enhance the pharmacodynamic properties of oligomers,
andgroups that enhance the pharmacokinetic properties of oligomers. Typical
conjugate
groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate,
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins,
fluorescent nucleobases, and dyes.
Groups that enhance the pharmacodynamic properties, in the context of this
invention,
include groups that enhance oligomer resistance to degradation and/or protect
against
serum interaction. Groups that enhance the pharmacokinetic properties, in the
context
of this invention, inciude groups that improve oligomer uptake, distribution,
metabolism
or excretion. Exemplary conjugate groups are described in International Patent
Application PCT/US92/09196, filed Oct. 23, 1992, which is incorporated herein
by
reference in its entirety.
Conjugate moieties can include but are not limited 'to lipid moieties such as
a cholesterol
moiety (Letsinger et al., Proc. Nat1. Acad. Sci. USA, 1989, 86, 6553-6556),
cholic acid
(Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether,
e.g.,
hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-
309;
Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a
thiocholesterol
(Oberhauser et al., NucL Acids Res., 1992, 20, 533-538), an aliphatic chain,
e.g.,
dodecandiol or undecyl residues (Saison-Behmoaras et at., EMBO J., 1991, 10,
1111-
1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et at.,
Biochimie,
1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-
ammonium
1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et at., Tetrahedron
Lett.,
1995, 36, 3651-3654; Shea et al., Nuc1. Acids Res., 1990, 18, 3777-3783), a
polyamine
or a polyethylene glycol chain (Manoharan et at., Nucleosides & Nucleotides,
1995, 14,
969-973), or adamantane acetic acid (Manoharan et at., Tetrahedron Lett.,
1995, 36,
3651-3654), a paimityl moiety (Mishra et at., Biochim. Biophys. Acta, 1995,
1264, 229-
237), or an octadecylamine or hexylaminocarbonyl-oxycholesterol moiety (Crooke
et al.,
J. Pharmacol Exp. Ther., 1996, 277, 923-937.
The present oligonucleotides may also be conjugated to active drug substances,
for
example without limitation, aspirin, warfarin, phenylbutazone, ibuprofen,
suprofen,
fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-
triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide,
chlorothiazide, a
diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an
antidiabetic, an
antibacterial or an antibiotic.
Exemplary U.S. patents that describe the preparation of. exemplary
oligonucleotide
conjugates include, for example, U.S. Pat. Nos. .4,828,979; 4,948,882;
5,218,105;
5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731;
56
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439;
5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737;
4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; .5,082,830; 5,112,963;
5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506;
5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203,
5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142;
5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and
5,688,941, each
of which is incorporated by reference herein in its entirety.
Another approach is to prepare antiviral ONs as lipophilic pro-
oligonucleotides by
modification with enzymatically cleavable charge neutralizing adducts such as
s-
acetylthio-ethyl or s-pivasloylthio-ethyl (Vives et al., 1999, Nucl Acids Res
27: 4071-
4076). Such modifications have been shown to increase the uptake of ONs into
cells,
and therefore are beneficial for ONs that are active intracellularly.
Design of non-specific ONs
In another approach, an antivirai ON demonstrating low, preferably the lowest
possible,
homology with the human (or other subject organism) genome is designed. The
goal is
to obtain an ON that will show the lowest toxicity due to interactions with
human or
animal genome sequence(s) and mRNAs. The first step is to produce the desired
length
sequence of the ON, e.g., by aligning nucleotides A, C, G, T in a random
fashion,
manually or, more commonly, using a computer program. The second step is to
compare the ON sequence with a library of human sequences such as GenBank
and/or
the Ensemble Human Genome Database. The sequence generation and comparison
can be performed repetitively, if desired, to identify a sequence or sequences
having a
desired low homology level with the subject genome. Desirably, the ON sequence
is at
the lowest homology possible with the entire genome, while also preferably
minimizing
self interaction.
Non-specific ONs with antisense activity
In another approach, an antiviral non-specific sequence portion(s) is/are
coupled with an
antisense sequence portion(s) to increase the activity of the final ON. The
non-specific
portion of the ONs is described in the present invention. The antisense
portion is
complementary to a viral mRNA.
57
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Non-specific ONs with a G-rich motif activity
In another approach, an antiviral non-specific sequence portion(s) is/are
coupled with a
motif portion(s) to improve the activity of the final ON. The non-specific
portion of the ON
is described in the present invention. The motif portion can, as non-limiting
examples,
include, CpG, Gquartet, and/or CG that are described in the literature as
stimulators of
the immune system. Agrawal et al. (2001) Curr. Cancer Drug Targets 3:197-209.
Non-Watson-Crick ONs
Another approach is to use an ON composed of one type or more of non-Watson-
Crick
nucleotides/nucleosides. Such ONs can mimic PS-ONs with some of the following
characteristics similar to PS-ONs: a) the total charge; b) the space between
the units; c)
the length of the chain; d) a net dipole with accumulation of negative charge
on one
side; e) the ability to bind to proteins; f) the ability to bind viral
proteins, g) the ability to
penetrate cells, h) an acceptable therapeutic index, i) an antiviral activity.
The ON has a
preferred phosphorothioate backbone but is not limited to it. Examples of non-
Watson-
Crick nucleotides/nucleosides are described in Kool, 2002,.Acc. Chem. Res.
35:936-
943; and Takeshita et al., (1987) J. Biol. Chem. 262:10171-10179 where ONs
containing synthetic abasic sites are described.
Antiviral polymer
Another approach is to use a polymer mimicking the activity of
phosphorothioate ONs.
As described in the literature, several anionic polymers were shown to have
antiviral
inhibitory activity. These polymers belong to several classes: (1) sulfate
esters of
polysaccharides (dextrin and dextran sulfates; cellulose sulfate); (2)
polymers containing
sulfonated benzene or naphthalene rings and naphthalene sulfonate polymers;
(3)
polycarboxylates (acrylic acid polymers); and acetyl phthaloyl cellulose
(Neurath et al.
(2002) BMC Infect Dis 2:27); and (4) abasic oligonucleotides (Takeshita et
al., 1987, J.
Biol: Chem. 262:10171-10179). Other examples of non-nucleotide antiviral
polymers
are described in the literature. The polymers described herein mimic PS-ONs
described
in this invention and have the following characteristics similar to PS-ONs: a)
the length
of the chain; b) a net dipole with accumulation of negative charge on one
side; c) the
ability to bind to proteins; d) the ability to bind viral protein, e) an
acceptable therapeutic
index, f) an antiviral activity. In order to mimic the effect of a PS-ON, the
antiviral
polymer may preferably be a polyanion displaying similar space between its
units as
58
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
compared to a PS-ON. It may also have the ability to penetrate cells alone or
in
combination with a delivery system.
Antiviral activity of double-stranded PS-ONs
A random sequence (REP 2017) and its complement (either PS modified or
unmodified)
are fluorescently labeled as described elsewhere and tested for their ability
to bind to
purified HSV-1 and HIV-1 proteins by fluorescence polarization as described in
the
present invention. Hybridization was verified by acrylamide gel
electrophoresis.
Unmodified REP 2017 (2017U), either single (ss) or double stranded (ds), had
no
binding activity in either HSV-1 or HIV-1 lysates. However, PS modified. REP
2017,
either single stranded or double stranded, was capable of HSV-1 and HIV-1
interaction.
According to our results described herein, an approach is to use double
stranded ONs
as effective antiviral agents. Preferentially such ONs have a phosphorothioate
backbone but may also have other and/or additional modifications which
increase
antiviral activity and/or stability and/or delivery characteristics as
described herein for
singie stranded ONs.
In vitro assay for drug discovery
An in vitro assay is developed based on fluorescence polarization to measure
the ability
of PS-ONs to bind to viral components, e.g., viral proteins. When a protein
(or another
interactor) binds to the fluorescently labeled bait, the three dimensional
tumbling of the
bait in solution is retarded. The retardation of this tumbling is measured by
an inherent
increase in the polarization of excited light from the labeled bait.
Therefore, increased
polarization (reported as a dimensionless measure [mP]) is correlated with
increased
binding.
One methodology is to use as bait a PS-ON randomer labeled at the 3' end with
FITC
using an inflexible linker (3'-(6-Fluorescein) CPG). This PS-ON randomer is
diluted to
2nM in assay buffer (10mM Tris, pH7.2, 80mM NaCI, 10mM EDTA, 100mM b-
mercaptoethanol and 1% tween 20). This oligo is then mixed with an appropriate
interactor. In this case, we use lysates of sucrose gradient purified HSV-1
(strain
Maclntyre), HIV-1 (strain Mn) or RSV (strain A2) suspended in 0.5M KCI and
0.5%
Triton X-100 (HSV-1 and HIV-1) or 10mM Tris, pH7.5, 150mM NaCI, 1mM EDTA and
0.1% Triton X-100 (RSV). Following bait interaction, the complexes are
challenged with
various unlabelled PS-ONs to assess their ability to displace the bait from
its complex.
59
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
In a preliminary test with three baits of different sizes; 6 (REP 2032-FL), 10
(REP 2003-
FL) and 20 bases (REP 2004-FL), the baits were tested for their ability to
interact with
HSV-1, HIV-1, and RSV lysates. Viral lysate binding to baits of different
sizes was
determined by fluorescence polarization: In the presence of any of the viral
lysates the
degree of binding was dependent on the size of the bait used, with 2004-FL
displaying
the largest shift in mP (binding) in the presence of viral lysate. We note
that this is
similar to the size dependent antiviral efficacy of PS-ON randomers. This bait
was then
used to assess the ability of PS-ONs of different sizes to compete the
interaction of the
bait with the lysate.
The interaction of REP 2004-FL with HSV-1, HIV-1, and RSV lysates was
challenged
with PS-ONs of increasing size. Determination of affinity of PS-ON randomers
for the
viral lysates was detected by fluorescence polarization. Using REP 2004-FL as
the bait,
complex formation with HSV-1 lysate, HIV-1 lysate, or RSV lysate was
challenged with
increasing concentrations of REP 2003, REP 2004, REP 2006 or REP .2007. For
each
-15 viral lysate tested, we note that REP 2003 is unable to compete the bait
away from the
lysatP. The bait interaction was ver,v strong as revealed by the relatively'
weak
competition elicited by the. REP 2004 (unlabeled bait) competitor. However, it
was
observed that as the size of the competitor PS-ON increased above 20 bases,
its ability
to displace the bait became more robust. This indicates an increased affinity
to protein
components in the viral lysate as the PS-ON randomer size increases. This
phenomenon mirrors the increased antiviral activity of larger PS-ON randomers
against
HSV-1, HSV-2, CMV, HIV-1 and RSV.
The similarity between the efficacy in bait competition and antiviral
act'ivity of PS-ON
randomers indicates that this assay paradigm is a good predictor of antiviral
activity.
This assay is robust, easy to perform and very stable, making it a very good
candidate
for a high throughput screen to identify novel antiviral molecules based not
on specific
target identification but on their ability to interact with one or more
components, e.g.,
viral proteins.
While the exemplary method described herein utilizes fluorescence polarization
to
measure interaction with the viral lysate, numerous techniques are known in
the art for
monitoring protein interactions, and can be used in the present methods. These
include'
without restriction surface plasmon resonance, fluorescence resonance energy
transfer
(FRET), enzyme linked immunosorbent assay (ELSIA), gel electrophoresis (to
measure
mobility shift), isothermal titration and differential scanning
microcalorimetry and column
chromatography. These other different techniques can be applied to measure the
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
interaction of ONs with a viral lysate or component, and thus can be useful in
screening
for.compounds which have anti-viral activity.
The method described herein is used to screen for novel compounds from any
desired
source, for example, from a library synthesized by combinatorial chemistry or
isolated by
purification of natural substances. _ It can be used to a) determine
appropriate size,
modifications, and backbones of novel ONs; b) test novel molecules including
novel
polymers; predict a particular virus' susceptibility to novel ONs or novel
compounds; or
d) determine the appropriate suite of compounds to maximally inhibit a
particular virus.
The increased lysate affinity with larger sized PS-ON randomers suggests that
the
antiviral mechanism of action of PS-ON randomers is based on an interaction
with one
or more viral protein components which prevents either the infection or
correct
replication of virions. It also suggests that this, interaction is charge
(size) dependent
and not depehdent on sequence. As these PS-ON randomers have a size dependent
activity across multiple viruses spanning several different families, we
suggest that PS-
ON randomers interfere with common, charge dependent protein-protein
interactions,
protein-DNA/RNA interactions, and/or other molecule-molecule interactions.
These
interactions can include (but are not limited to):
The interaction between individual capsid subunits during capsid formation.
The interaction between the capsid/nucleocapsid protein and the viral genome.
The interaction between the capsid and glycoproteins during budding.
The interaction between glycoproteins and their receptors during infection.
The interaction between other key viral components involved in viral
replication.
These multiple, simultaneous inhibitions of protein-protein interactions
represent a novel
mechanism for antiviral inhibition.
Effect of PS-ON sequence composition on viral lysate interaction
We monitored the ability of PS-ONs of different sequences to interact with
several viral
lysates. In each case, a 20-mer PS-ON is labeled at the 3' end, with FITC as
previously
described herein. The PS-ONs tested consisted of A20, T20, G20, C20, AC10,
AG10,
TC10, TG10, REP 2004 and REP 2017. Each of these sequences is diluted to 4nM
in
assay buffer and incubated in the presence of lug of HSV-1, HIV-1 or RSV
lysate.
Interaction is measured by fluorescence polarization.
The profile of interaction with all sequences tested is similar in all viral
lysates, indicating
that the nature of the binding interaction is very similar. The ability of 20-
mer PS-ONs of
61
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
different sequence compositions (A20, C20, G20, T20, AC10, AG10, TC10, TGIO,
REP2004, REP2017) to bind to viral lysates was measured by fluorescence
polarization.
PS-ONs 3' labeled with FITC were incubated in the presence of lug of HSV-1,
HIV-1 or
RSV lysates. Within each lysate, the PS-ONs of uniform composition (A20, G20,
T20,
C20) were the weakest interactors with A20 being the weakest interactor of
these by a
significant margin. For the rest of the PS-ONs tested, all of them. displayed
a similar,
strong interaction with the exception of TG10, which consistently displayed
the strongest
interaction in each lysate. The binding profiles for these PS-ONs is similar
in all three
viral lysates.
Target identification for PS-ON randomers in HIV-1
The ability of PS-ON randomers to bind to purified HIV-1 proteins was tested
by
fluorescence polarization as described in example 9. Increasing quantities of
purified
HIV-1. p24 or purified HIV-1 gp4l were reacted with REP 2004-FL. We note that
for
both these proteins, there is a protein concentration dependent shift in
fluorescence
polarization, indicating an interaction with both these proteins.
The ability of a range of sizes of PS-ON randomers to bind to these proteins
was also
tested using fluorescent versions of REP 2032, REP 2003, REP 2004, REP 2006
and
REP 2007. We observed that for p24, there is no size dependent interaction
with p24,
however; we did see an increase in gp4l binding in PS-ON randomers larger than
20
bases versus those less than 20 bases. This suggests when PS-ON randomer
length
increases above 20 bases, multiple copies of gp41 can bind to individual
randomers,
increasing their polarization.
This is a significant observation as it demonstrates the potential of larger
ONs to
sequester structural proteins during viral synthesis and limit their
availability for the
formation of new virions.
High affinity oligonucleotides
Another approach is a method to enrich or purify antiviral ON(s) having a
higher affinity
for viral components, such as viral proteins, than the average affinity of the
ONs in a
starting pool of ONs. The method will thus provide one or more non-sequence
complementary ON(s) that will exhibit increased affinity to one or more viral
components, e.g., having a three-dimensional shape contributing to such
elevated
binding affinity. The- rationale is that while ON(s) will act as linear
molecules in binding
with viral components, they can also fold into a 3-dimensional shape that can
enhance
62
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
the interaction with such viral components. Without being limited to the
specific
technique, high affinity ONs can be purified or enriched in the following
ways.
One method for purifying a high affinity ON, or a plurality of high affinity
ONs, involves
using a stationary phase medium with bound viral protein(s) as an affinity
matrix to bind
ONs, which can then be eluted under increasingly stringent conditions (e.g.,
increasing
concentration of salt or other chaotropic agent, and/or increasing temperture
and/or
changes in pH). Such a method can, for example, be carried out by:
(a) loading a pool of ONs onto an exchange column having a viral protein or
several viral proteins or a viral lysate bound to a stationary phase;
(b) displacing (eluting) bound ONs from the column, e.g., -by using a
displacer
solution such as an increasing salt solution;
(c) collecting fractions of eluted ONs at different salt concentration;
(d) cloning and sequencing eluted ONs from different fractions, more
preferably
from a fraction(s) at high salt concentration, such that the ONs eluted at the
high
salt concentration have a greater binding affinity with the viral protein(s);
and
(e) Testing the activity of sequenced ON(s) in assays such binding and/or
viral
inhibiton assay, e.g., a fluorescence polarization-binding assay as decribed
herein and/or in a cellular viral inhibition assay and/or in an animal viral
inhibition
assay.
In a second example, a method derived and modified from the SELEX methodology
(Morris et al (1998) Biocherriistry 95:2902-2907) can be used for, purifying
the high
affinity ON. One implementation of such a method can be performed as:
(a) providing a starting ON pool material, for example, a collection of
synthetic
random ONs containing a high number of sequences, e.g., one hundred trillion
(1014) to ten quadrillion (1016) different sequences. Each ON molecule
contains
a segment of random sequence flanked by primer-binding sequences at each
end to facilitate polymerase chain reaction (PCR). Because the nucleotide
sequences of essentially all of the molecules are unique, an enormous number
of structures are sampled in the population. These structures determine each
molecule's biochemical properties, such as the ability to bind a given viral
target
molecule;
(b) contacting ONs with a viral protein or several viral proteins or a viral
lysate;
(c) selecting ONs that bind to viral protein(s), using a partition
technique(s) that
can partition bound and unbound ONs, such as native gel shifts and
nitrocellulose filtration. Either of these methods physically separates the
bound
63
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
species from the unbound species, allowing preferential recovery of those
sequences that bind best. Also, to select ON (s) that bind to a small protein,
it is
desirable to attach the target to a solid support and use that support as an
affinity purification matrix. Those molecules that are not bound get washed
off
and the bound ones are eluted with free target, again physically separating
bound and unbound species;
(d) amplifying the eluted binding ON(s), e.g., by using PCR using primers
hybridizing with both flanking sequences of ONs;
(e) steps (b) (c) and (d) can be performed multiple times (i.e., multiple
cycles or
rounds of enrichment and amplification) in order to preferentially recover ONs
that display the highest binding affinity to viral protein(s). After several
cycles of
enrichment and amplification, the population is dominated by sequences that
display the desired biochemical property;
(f) cloning and sequencing one or more ONs selected from from an enrichment
cycle, e.g., the last such cycle; and
(g) testing the binding and/or activity of sequenced ON(s) in assays, e.g., in
a
fluorescence polarization binding assay as decribed herein and/or in a
cellular
viral inhibition assay and/or in an animal viral inhibition assay.
Another approach is to apply a modification of a split synthesis methodology
to create
one-bead one-PS-ON and one-bead one-PS2-ON libraries as described in Yang et
al
(2002) Nucl. Acids Res. 30(e132):1-8. Binding and selection of specific beads
to viral
proteins can be done. Sequencing both the nucleic acid bases and the positions
of any
thioate/dithioate linkages can be carried out by using a PCR-based
identification tag of
the selected beads. This approach can allow for the rapid and convenient
identification
of PS-ONs or PS2-ONs that bind to viral proteins and that exhibit potent
antiviral
properties.
Once the specific sequences that bind to the viral proteins with high affinity
are
determined (e.g., by amplification and sequencing of individual sequences),
one or more
such high affinity sequences can be selected and synthesized (e.g., by either
chemical
or enzymatic synthesis) to provide a preparation of high affinity ON(s), which
can be
modified to improve their activity, including improving their pharmacokinetic
properties.
Such high affinity ONs can be used in the present invention.
64
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Prion diseases
Another approach is used in an alternative embodiment of the present invention
for the
treatment, the control of the progression, or the prevention of prion disease.
This fatal
neurodegenerative disease is infectious and can affect both humans and
animals.
Structural changes in the cellular prion protein, PrPC to its scrapie isoform,
PrPSC, are
considered to be the obligatory step in the occurrence and propagation of the
prion
disease. Amyloid polymers are associated with neuropathology of the prion
disease.
The incubation of a prion protein fragment and double stranded nucleic acid
results in
the formation of amyloid fibres (Nandi et al (2002), J Mol Biol 322: 153-161).
ONs
having affinity to proteins such as phosphorothioates are used to compete or
inhibit the
interaction of double stranded nucleic acid with the PrPC and consequently
stop the
formation of the amyloid polymers. Such ONs of different sizes and different
compositions can be used in an appropriate delivery form to treat patients
suffering from
prion diseases or for prophylaxis in high risk situations. Such interfering
ONs can be
identified by measuring folding changes of amyloid polymerase as described by
Nandi
et al. (supra) in the presence of test ONs.
Putative viral etiologies
Another approach is used in another embodiment of the present invention for
the
treatment or prevention of diseases or conditions with putative viral
etiologies as
described without limitation in the following examples. Viruses are putative
causal
agents in diseases and conditions that are not related to a primary viral
infection. For
example, arthritis is associated with HCV (Olivieri et al. (2003) Rheum Dis
Clin North
Am 29:111-122), Parvovirus 819, HIV, HSV, CMV, EBV, and VZV (Stahl et al.
(2000)
Clin Rheumato/19:281-286). Other viruses have also been identified as playing
a role in
different diseases. For example, influenza A in Parkinson's disease (Takahashi
et al.
(1999), Jpn J Infect Dis 52:89-98), Coronavirus, EBV and other viruses in
Multiple
Sclerosis (Talbot et al (2001) Curr Top Microbiol Immunol 253:247-71); EBV,
CMV and
HSV-6 in Chronic Fatigue Syndrome (Lerner et al. (2002) Drugs Today 38:549-
561);
and paramyxoviruses in asthma (Walter et al (2002) J Clin Invest 110:165-175)
and in
Paget's disease; and HBV, HSV, and influrenza in Guillain-Barre Syndrome.
Because of these etiologies, inhibition of the relevant virus using the
present invention
can delay, slow, or prevent development of the corresponding disease or
condition, or at
least some symptoms of that disease.
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Oligonucleotide Modifications and Synthesis
As indicated in the Summary above, modified oligonucleotides are useful in
this
invention. Such modified oligonucleotides include, for example,
oligonucleotides
containing modified backbones or non-natural internucleoside linkages.
Oligonucleotides having modified backbones include those that retain a
phosphorus
atom in the backbone and those that do not have a phosphorus atom in the
backbone.
Such modified oligonucleotide backbones include, for example,
phosphorothioates,
chiral phosphorothioates, phosphorodithioates, phosphotriesters,
aminoalkylphosphotri-
esters, methyl and other alkyl phosphonates including 3'-alkylene
phosphonates, 5'-
alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates
including 3'-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkyiphosphonates, thionoalkylphosphotriesters,
selenophosphates, carboranyl phosphate and boranophosphates having normal 3'-
5'
linkages, 2'-5' linked analogs of these, and those having inverted polarity
wherein one or
more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage.
Oligonucleotides
having inverted polarity typically include a single 3' to 3' linkage at the 3'-
most
internucleotide linkage i.e. a single inverted nucleoside residue which may be
abasic
(the nucleobase is missing or has a hydroxyl group in place thereof). Various
salts,
mixed salts and free acid forms are also included.
Preparation of oligonucleotides with phosphorus-containing linkages as
indicated above
are described, for example, in U.S.- Pat Nos. 3,687,808; 4,469,863; 4,476,301;
5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717;
5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925;
5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361;
5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, each of
which is
incorporated by reference herein in its entirety.
Some exemplary modified oligonucleotide backbones that do not include a
phosphodiester linkage have backbones that are formed by short chain alkyl or
cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl
30. internucleoside linkages, or one or more short chain heteroatomic or
heterocyclic
internucleoside linkages. These include those having morpholino linkages
(formed in
part from the sugar portion of a nucleoside); siloxane backbones; sulfide,
sulfoxide and
sulfone backbones; formacetyl and thioformacetyl backbones; methylene
formacetyl and
thioformacetyl backbones; riboacetyl backbones; alkene containing backbones;
66
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
sulfamate backbones; methyleneimino and methylenehydrazino backbones;
sulfonate
arid sulfonamide backbones; amide backbones; and others having mixed N, 0, S
and
CH2 component parts. Particularly advantageous are backbone linkages that
include
one or more charged moieties. Examples of U.S. patents describing the
preparation of
the preceding oligonucleotides include U.S. Pat. Nos. 5,034,506; 5,166,315;
5,185,444;
5,2141134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434;257;
5,466,677; 5,470,967; 5,489, 677; 5,541,307; 5,561,225; 5,596,086; 5,602,240;
5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312;
5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, each of which is
incorporated by reference herein in its entirety.
Modified oligonucleotides may also contain one or more substituted sugar
moieties. For
example, such oligonucleotides can include one of the following 2'-
modifications: OH; F;
0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-
alkyl,
wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C,
to C,o alkyl
or C2 to C,o alkenyl and alkynyl, or 2'-O-(O-carboran-1-yl)methyl. Particular
examples
are O[(CH2)nO]mCH3, O(CH2)-OCH3, O(CHz),NHZ, O(CH2)nCH3, O(CH2),ONHZ, and
O(CH2),,ON [(CH2),,CH3)]Z, where n and m are from 1 to 10. Other exemplary
oligonucleotides include one of the following 2'-modifications: C, to C,o
lower alkyl,
substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, 0-alkaryl or 0-
aralkyl, SH,
SCH3, OCN, Cl, Br, CN, CF3. OCF3, SOCH3, SOZCH3, ON02, NO2, N3, NH2,
heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino,
substituted silyl,
a reporter group, an intercalator, a group for improving the pharmacokinetic
properties
of an oligonucleotide, or a group for improving the pharmacodynamic properties
of an
oligonucleotide. Examples include 2'-methoxyethoxy (2'-O-CH2CH2OCH3i also
known
as 2'-O-(2-methoxyethyl), or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995,
78, 486-504)
i.e., an alkoxyalkoxy group; 2'-dimethy-Iaminooxyethoxy, i.e., a
O(CH2)20N(CH3)2 group,
also known as 2'-DMAOE; and 2'-dimethylaminoethoxyethoxy (also known as 2'-O-
dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH2)2.
Other modifications incldde Locked Nucleic Acids (LNAs) in which the 2'-
hydroxyl group
is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a
bicyclic sugar
moiety. The linkage can be a methelyne (-CHZ-)- group bridging the 2' oxygen
atom
and the 4' carbon atom wherein n is 1 or 2. LNAs and preparation thereof are
described
in WO 98/39352 and WO 99/14226, which are incorporated herein by reference in
their
entireties.
67
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Other modifications include sulfur-nitrogen bridge modifications, such as
locked nucleic
acid as described in Orum et al. (2001) Curr. Opin. Mol. Ther. 3:239-243.
Other modifications include 2'-methoxy (2'-O-CH3), 2'-methoxyethyl (2'O-CH2-
CH3 ),
2'-ethyl, 2'-ethoxy, 2'-aminopropoxy (2'-OCH2CH2CH2NH2), 2'-allyl (2'-CH2-
CH=CH2),
2'-O-allyl (2'=O-CH2-CH=CH2) and 2'-fluoro (2'-F).
The 2'-modification may be in the arabino (up) position or ribo (down)
position. Similar
modifications may also be made at other positions on the oligonucleotide,
particularly
the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked
oligonucleotides and the 5' position, of the 5' terminal
nucleotide.,Oligonucleotides may
also have sugar mimetics such as cyclobutyl moieties in place of the
pentofuranosyl
sugar. Exemplary U.S. patents describing the preparation of such modified
sugar
structures include, for example, U.S. Pat. Nos. 4,981,957; 5,118,800;
5,319,080;.
5,359,044; 5,393, 878;.5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567, 811;
5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627, 053; 5,639,873; 5,646,265;
5,658,873; 5,670,633; 5,792, 747; and 5,700,920, each of which is incorporated
by
reference herein in its entirety.
Still other modifications include an ON concatemer consisting of multiple
oligonucleotide
sequences 'joined by a linker(s). The linker may, for example, consist of
modified
nucleotides or non-nucleotide units. In some embodiments, the linker provides
flexibility
to the ON concatemer. Use of such ON concatemers can provide a facile method
to
synthesize a final molecule, by joining smaller oligonucleotide building
blocks to obtain
the desired length. For example, a 12 carbon linker (C12 phosphoramidite) can
be used
to join two or more ON concatemers and provide length, stability, and
flexibility.
As used herein, "unmodified" or "natural" bases (nucleobases) include the
purine bases
adenine (A) and guanine (G), and the pyrimidine bases thymine (T); cytosine
(C) and
uracil (U). Oligonucleotides may also include base modifications or
substitutions.
Modified bases include other synthetic and naturally-occurring bases such as 5-
methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-
aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-
propyl
and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-
thiothymine and 2-
thiocytosine, 5-halouracil and cytosine, 5-propynyl(-C=C-CH3) uracil and
cytosine
and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and
thymine, 5-
uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-
hydroxyl and
other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-
trifluoromethyl
68
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
and other 5-substitUted uracils and cytosines, 7-methylguanine and 7-
methyladenine, 2-
F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and
7-
deazaadenine and 3-deazaguanine and 3-deazaadenine. Additional modified bases
include tricyclic pyrimidines such as phenoxazine cytidine(1 H-pyrimido[5,4-
b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-
b][I,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine
cytidine
(e.g. 9-(2-aminoethoxy)-H-pyrimido [5,4-b][1,4]benzoxazin-2(3H)-one),
carbazole
cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-
pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified bases may also
include those in
which the purine or pyrimidine base is replaced with other heterocycles, for
example 7-
deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further
nucleobases include those described in U.S. Pat. No. 3,687,808, those
disclosed in The
Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859,
Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et
al.,
Angewandte Chemie, International Edition, 1991, 30,613, and those disclosed by
Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-
302,
Crooke, S. T. and Lebleu, B., ed., CRC Press, 1993.
Another modification includes phosphorodithioate linkages. Knowing that
phosphorodithioate ONs (PS2-ONs) and PS-ONs have a similar binding affinity to
proteins (Tonkinson et al. (1994) Antisense Res. Dev. 4:269-278)(Cheng et al.
(1997) J.
Mol. Recogn. 10:101-107) and knowing that a possible mechanism of action of
ONs is
binding to viral proteins, it could be desirable to include phosphorodithioate
linkages on
the antiviral ONs described in this invention.
Another approach to modify ONs is to produce stereodefined or stereo-enriched
ONs as
described in Yu at al (2000) Bioorg. Med. Chem. 8:275-284 and in Inagawa et
al. (2002)
FEBS Lett. 25:48-52. ONs prepared by conventional methods consist of a mixture
of
diastereomers by virtue of the asymmetry around the phosphorus atom involved
in the
internucleotide linkage. This may affect the stability of the binding between
ONs and
viral components such as viral proteins. Previous data showed that protein
binding is
significantly stereo-dependent (Yu et al.). Thus, using stereodefined or
stereo-enriched
ONs could improve their protein binding properties and improve their antiviral
efficacy.
The incorporation of modifications such as those described above can be
utilized in
many different incorporation patterns and levels. That is, a particular
modification' need
not be included at each nucleotide or linkage in an oligonucleotide, and
different
69
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
modifications can be utilized in combination in a single oligonucleotide, or
even in a
single nucleotide.
As exarimples and in accordance with the description above, modified
oligonucleotides
containing phosphorothioate or, dithioate linkages may also contain one or
more
substituted sugar moieties particularly modifications at the sugar moieties
including,
without restriction, 2'-ethyl, 2'-ethoxy, 2'-methoxy, 2'-aminopropoxy, 2'-
allyl, 2'-fluoro, 2'-
pentyl, 2'-propyl, 2'-dimethylaminooxyethoxy, and 2'-
dimethylaminoethoxyethoxy. The
2'-modification may be in the arabino (up) position or ribo (down) position. A
preferred
2'-arabino modiflcatio.n is 2'-fluoro. Similar modifications may also be made
at other
positions on the oligonucleotide, particularly the 3' position of the sugar on
the 3'
terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of
5' terminal
nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl
moieties
in place of the pentofuranosyl sugar. Moreover ONs may have a structure of or
comprise a portion consisting of glycol nucleic acid (GNA) with an acyclic
propylene
glycol phosphodiester backbone (Zhang L, et al (2005) J. Am. Chem. Soc..
127(12):4174-5). Such GNA may comprise phosphorothioate linkages and may
comprise only pyrimidine bases.
Oligonucleotide Synthesis
The present oligonucleotides can by synthesized using methods known in the
art. For
example, unsubstituted and substituted phosphodiester (P=O) oligonucleotides
can be
synthesized on an automated DNA synthesizer (e.g., Applied Biosystems model
380B)
using standard phosphoramidite chemistry with oxidation by iodine.
Phosphorothioates
(P=S) can be synthesized as for the phosphodiester oligonucleotides except the
.standard oxidation bottle can be replaced by 0.2 M solution of 311-1,2-
benzodithiole-3-
one 1,1-dioxide in acetonitrile for the step-wise thioation of the phosphite
linkages. The
thioation wait step can be increased to 68 sec, followed by the capping step.
After-
cleavage from the CPG column and deblocking in concentrated ammonium hydroxide
at
55 C. (18 h), the oligonucleotides can be purified by precipitating twice with
2.5 volumes
of ethanol from a 0.5 M NaCI solution.
Phosphinate oligonucleotides can be'prepared asdescribed in U.S. Pat. No.
5,508,270;
alkyl phosphonate oligonucleotides can be prepared as described in U.S. Pat.
No.
4,469,863; 3'-Deoxy-3'-methylene phosphonate oligonucleotides can, be prepared
as
described in U.S. Pat. Nos. 5,610,289 and 5,625,050; phosphoramidite
oligonucleotides
can be prepared as described in U.S. Pat. No. 5,256,775 and U.S. Pat. No.
5,366,878;
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
alkylphosphonothioate oligonucleotides can be prepared as described in
published PCT
applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and
WO 94/02499, respectively); 3'-Deoxy-3'-amino phosphoramidate oligonucleotides
can
be prepared as described iri U.S. Pat. No. 5,476,925; Phosphotriester
oligonucleotides
can be prepared as described in U.S. Pat. No. 5,023,243; boranophosphate
oligonucleotides can be prepared as described in U.S. Pat. Nos. 5,130,302 and
5,177,198; methylenemethylimino linked oligonucleotides, also identified as
MMI linked
oligonucleotides, methylenedimethyl-hydrazo linked oligonucleotides, also
identified as
MDII linked oligonucleotides, and methylenecarbonylamino linked
oligonucleotides, also
identified as amide-3 linked oligonucleotides, and methyleneaminocarbonyl
linked oligo-
nucleotides, also identified as amide-4 linked oligonucleo-sides, as well as
mixed
backbone compounds having, for instance, alternating MMI and P=O or P=S
linkages
can be prepared as described in U.S. Pat. Nos. 5,378, 825, 5,386,023,
5,489,677,
5,602,240 and 5,610,289; formacetal and thioformacetal linked oligonucleotides
can be
prepared as described in U.S. Pat. Nos. 5,264,562 and 5,264,564; and ethylene
oxide
linked oligonucleotides can be prepared as described in U.S. Pat. No.
5,223,618. Each
of the cited patents and patent applications is incorporated by reference
herein in its
entirety.
Oligonucleotide Formulations and Pharmaceutical Compositions
20. The present oligonucleotides can be prepared in an oligonucleotide
formulation or
pharmaceutical composition. Thus, the present oligonucleotides may also be
admixed,
encapsulated, conjugated or otherwise associated with other molecules,
molecule
structures or mixtures of compounds, as for example, liposomes, 'receptor
targeted
molecules, oral, rectal, topical or other formulations, for assisting in
uptake, distribution
and/or absorption. Exemplary United States patents that describe the
preparation of
such uptake, distribution and/or absorption assisting formulations include,
for example,
U.S. Pat. Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291;
5,543,158;
5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921;
5,213,804; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978;
5,462,854; 5,469,854; , 5,512,295; 5,527,528; 51534,259; 5,543,152; 5,556,948;
5,580,575; and 5,595,756, each of which is incorporated herein by reference in
its
entirety.
The oligonucleotides, formulations, and compositions of the invention include
any
pharmaceutically acceptable salts, esters, or salts of such esters, or any
other
compound which, upon administration to an animal including a human, is capable
of
71
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
providing (directly or indirectly) the biologically active metabolite or
residue thereof.
Accordingly, for example, the disclosure is also drawn to prodrugs and
pharmaceutically
acceptable salts of the compounds of the invention, pharmaceutically
acceptable salts
of such prodrugs, and other bioequivalents.
The term "prodrug" indicates a therapeutic agent that is prepared in an
inactive form that
is converted to an active form (i.e., drug) within the body or cells thereof
by the action of
endogenous enzymes or other chemicals and/or conditions. In particular
embodiments,
prodrug versions of the present oligonucleotides are prepared as SATE [(S-
acetyl-2-
thioethyl) phosphate] derivatives according to the methods disclosed in
Gosselin et al.,
WO 93/24510 and in Imbach et al., WO 94/26764 and U.S. Pat. No. 5,770,713,
which
are hereby incorporated by reference in their entireties.
The term "pharmaceutically acceptable salts" refers to physiologically and
pharmaceutically acceptable salts of the present compounds: i.e., salts that
retain the
desired biological activity of the parent compound and do not impart undesired
toxicological effects thereto. Many such pharmaceutically acceptable salts are
known
and can be used in the present invention.
For oligonucleotides, useful examples of pharmaceutically acceptable salts
include but
are not limited to salts formed with cations such as sodium, potassium,
ammonium,
magnesium, calcium, polyamines such as spermine and spermidine, etc.; acid
addition
salts formed with inorganic acids, for example hydrochloric acid, hydrobromic
acid,
sulfuric acid, phosphoric acid, nitric acid and the like; salts formed with
organic acids
such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid,
maleic acid,
fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic
acid, tannic
acid, paimitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic
acid,
methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid,
polygalacturonic acid, and the like; and salts formed from elemental anions
such as
chlorine, bromine; and iodine.
The present invention also includes pharmaceutical compositions and
formulations
which contain the antiviral oligonucleotides of the invention. Such
pharmaceutical
compositions may be administered in a number of ways depending upon whether
local
or systemic treatment is desired and upon the area to be treated. For example,
administration may be topical (including ophthalmic and to mucous membranes
including vaginal and rectal delivery); pulmonary, e.g., by inhalation or
insufflation of
powders or aerosols, including by nebulizer; intratracheal; intranasal;
epidermal and
72
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
transdermal; oral; or parenteral. Parenteral . administration includes
intravenous,
intraarterial, subcutaneous, intraperitoneal or intramuscular injection or
infusion; or
intracranial, e.g., intrathecal or intraventricular, administration.
Pharmaceutical compositions and formulations for topical administration may
include
transdermal patches, ointments, lotions, creams, gels, drops, suppositories,
sprays,
liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or
oily
bases, thickeners and the like may be necessary or desirable. Coated condoms,
gloves
and the like may also be useful. Preferred topical formulations include those
in which the
oligonucleotides of the invention are in admixture with a topical delivery
agent such as
lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents
and
surfactants. Preferred lipids and liposomes include neutral (e.g.
dioleoylphosphatidyl
DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC,
distearolyphosphatidyl
choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic
(e.g.
dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine
DOTMA). Oligonucleotides may be encapsulated within liposomes or may form
complexes thereto, in particular to cationic liposomes. Alternatively,
oligonucleotides
may be complexed to lipids, in particular to cationic lipids. Preferred fatty
acids and
esters include but are not limited arachidonic acid, oleic acid, eicosanoic
acid, laurie
acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid,
linoleic acid,
linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-
monocaprate, 1-
dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C,_,o
alkyl ester
(e.g. isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically
acceptable salt thereof..
Compositions and formulations for oral administration include powders or
granules,
microparticulates, nanoparticulates, suspensions or solutions in water or.non-
aqueous
media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners,
flavoring
agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
Preferred oral
formulations are those in which oligonucleotides of the invention are
administered in
conjunction with one or more penetration enhancers surfactants and chelators.
Exemplary surfactants include fatty acids and/or esters or salts thereof, bile
acids and/or
'salts thereof. Exemplary bile acids/salts include chenodeoxycholic acid
(CDCA) and
ursodeoxychenedeoxycholic acid (UDCA), cholic acid, dehydrocholic acid,
deoxycholic
acid, , glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic
acid,
taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate, sodium
glycodihydrofusidate. Exemplary fatty acids include arachidonic acid,
undecanoic acid,
73
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic
acid, stearic acid,
linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin,
glyceryl 1-
monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine,
or a
monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof
(e.g.
sodium). Also preferred are combinations of penetration enhancers, for
example, fatty
acids/salts in combination with bile acids/salts. A particularly preferred
combination is
the sodium salt of lauric acid, capric acid and UDCA. Further exemplary
penetration
enhancers include polyoxyethylehe-9-lauryl ether, polyoxyethylene-20-cetyl
ether.
Oligonucleotides of the invention may be delivered orally in granular form
including
sprayed dried particles, or complexed to form micro or nanoparticies.
Oligonucleotide
complexing agents include poly-amino acids; polyimines; polyacrytates;
polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized
gelatins,
albumins, starches, acrylates, polyethyleneglycols (PEG) and starches;
polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses,
and
starches. Particularly advantageous complexing agents include chitosan, N-
trimethytchitosan, poly-L-lysine, polyhistidine, polyorithine, polyspermines,
protamine,
polyvinylpyridine, polythiodiethylamino-methylethylene P(TDAE),
polyaminostyrene (e.g.
p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate),
poly(butylcyanoacrylatc),
poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate,
DEAE-
hexylacrylate, DEAE-acrylamide, . DEAE-albumin and DEAE-dextran,
polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-
co-glycolic
acid (PLGA), alginate, and polyethyleneglycol (PEG).
Compositions for vaginal delivery can be in various forms, including for
example, a gel,
cream, tablet, pill, capsule, suppository, film, or any other pharmaceutically
acceptable
form that adheres to the mucosa and does not wash away easily. A large variety
of.
different formulations for vaginal delivery are further described in the art,
for example in
U.S. Pat. No. 4,615,697 and 6,699,494, which are incorporated herein by
reference in
their entireties.
Additionally, additives (such as those described in the Patent 4,615,697
patent) may be
combined in the formulation for maximum or desired efficacy of the delivery
system or
for the comfort of the patient. Such additives include, for example,
lubr'icants, plasticizing
agents, preservatives, gel formers, tablet formers, pill formers, suppository
formers, film
formers, cream formers, disintegrating agents, coatings, binders, vehicles,
coloring
agents, taste and/or odor controlling agents, humectants, viscosity
controlling agents,
pH-adjusting agents, and similar agents.
74
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
In certain embodiments, a composition can include a cross-linked
polycarboxylic acid
polymer formulation, generally described in U.S. Pat. No. 4,615,697. In
general, in such
embodiments at least eighty percent of the monomers of the polymer in such a
formulation should contain at least one carboxyl functionality. The cross-
linking agent
should be present at such an amount as to provide enough bioadhesion to allow
the
system to remain attached to the target epithelial surfaces for a sufficient
time to allow
the desired dosing to take place.
For vaginal administration, such a formulation remains attached to the
epithelial
surfaces for a period of at least about twenty-four to forty-eight hours. Such
results may
be measured clinically over various periods of time, by testing samples from
the vagina
for pH reduction due to the continued presence of the polymer. This preferred
level of
bioadhesion is usually attained when the cross-linking agent is present at
about 0.1 to
6.0 weight percent of the polymer, with about 1.0 to 2.0 weight percent being
most
preferred, as long as the. appropriate level of bioadhesion results.
Bioadhesion can also
be measured by commercially available surface tensiometers utilized to measure
adhesive strength.
The polymer formulation can be adjusted to control the release rate by varying
the
amount of cross-linking agent in the polymer. Suitable cross-linking agents
include
divinyl glycol, divinylbenzene, N,N-diallylacrylamide, 3,4-dihydroxy-1,5-
hexadiene, 2,5-
dimethyl-1,5-hexadiene and similar agents.
A preferred polymer for use in such a formulation is Polycarbophil, U.S.P.,
which is
commercially available from B. F. Goodrich Speciality Polymers of Cleveland,
Ohio
under the trade name NOVEON®-AA1. The United States Pharmacopeia, 1995
edition, United States Pharmacopeial Convention, Inc., Rockville, Md., at
pages 1240-
41, indicates that polycarbophil is a polyacrylic acid, cross-linked with
divinyl glycol.
Other useful bioadhesive polymers that may be used in such a drug delivery
system
formulation are mentioned in the 4,615,697 patent. For example, these inciude
polyacrylic acid polymers cross-linked with, for example, 3.,4-dihydroxy-1,5-
hexadiene,
and polymethacrylic acid polymers cross-linked with, for example, divinyl
benzene.
Typically, these polymers would not be used in their salt, form, because this
would
decrease their bioadhesive capability. Such bioadhesive polymers may be
prepared by
conventional free radical polymerization techniques utilizing initiators such
as benzoyl
peroxide, azobisisobutyronitrile, and the like. Exemplary preparations of
useful
bioadhesives are provided in the 4,615,697 patent.
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Compositions and formulations for parenteral, intrathecal or intraventricular
administration may include sterile aqueous'solutions which may also contain
buffers,
diluents and other suitable additives such as, but not limited to,
penetration. enhancers,
carrier compounds and other pharmaceutically acceptable carriers or
excipients.
Pharmaceutical compositions of the present invention include, but are not
limited to,
solutions, emulsions, and liposome-containing formulations. These compositions
may
be generated from a variety of components that include, but are not limited
to,
preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
The pharmaceutical formulations of the present invention, which may
conveniently be
presented in unit dosage form, may be prepared according to conventional
techniques
well known in the pharmaceutical industry. Such techniques include the step of
bringing
into association the active ingredients with the pharmaceutical carrier(s) or
excipient(s).
In general the formulations are prepared by uniformly and intimately bringing
into
association the active ingredients with liquid carriers or finely divided
solid carriers or
both, and then, if necessary, shaking the product.
The compositions of the present invention may be formulated into any of many
possible
dosage forms such as, but not limited to, tablets, capsules, gel capsules,
liquid syrups,
soft gels, suppositories, and enemas. The compositions of the present
invention may
also be formulated as suspensions in aqueous, non-aqueous or mixed media.
Aqueous
suspensions may further contain substances which . increase the viscosity of
the
suspension including, for example, sodium carboxymethylcellulose, sorbitol
and/or
dextran. The suspension may also contain stabilizers.
In one embodiment of the present invention the pharmaceutical compositions may
be
formulated and used as foams. Pharmaceutical foams include formulations such
as, but
not limited to, emulsions, microemulsions, creams, jellies and liposomes.
While basically
similar in nature these formulations vary in the components and the
consistency of the
final product. The preparation of such compositions and formulations is
generally known
to those skilled in the pharmaceutical and formulation arts and may be applied
to the
formulation of the compositions of the present invention.
Emulsions
The formulations and compositions of the present invention may be prepared and
formulated as emulsions. Emulsions are typically heterogenous systems of one
liquid
dispersed in another in the form of droplets usually exceeding 0.1 pm in
diameter.
76
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
(Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (lids.),
1988,
Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in
Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc.,
New
York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman,
Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2,
p. 335;
Higuchi et at., in Remington's Pharmaceutical Sciences, Mack Publishing Co.,
Easton,
Pa., 1985, p. 301). Emulsions are often biphasic systems comprising of two
immiscible
liquid phases intimately mixed and dispersed with each other. In general,
emulsions
may be either water-in-oil (wlo) or of the oil-in-water (o/w) variety. When an
aqueous
phase is finely divided into and dispersed as minute droplets into a bulk oily
phase the
resulting composition is called a water-in-oil (w/o) emulsion. Alternatively,
when an oily
phase is finely divided into and dispersed as minute droplets into a bulk
aqueous phase
the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions
may
contain additional components in addition to the dispersed phases and the
active drug
which may be present as a solution in either the aqueous phase, oily phase or
itself as a
separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers,
dyes, and
anti-oxidants may also be present in emulsions as needed. Pharmaceutical
emulsions
may also be multiple emulsions that are comprised of more than two phases such
as,
for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-
water (w/o/w)
emulsions. Such complex formulations often provide certain advantages that
simple
binary emulsions do not. Multiple emulsions in which individual oil droplets
of an o/w
emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a
system
of oil droplets enclosed in globules of water stabilized in an oily continuous
provides an
o/w/o emulsion.
Emulsions are characterized by little or no thermodynamic stability. Often,
the dispersed
or discontinuous phase of the emulsion is well dispersed into the external or
continuous
phase and maintained in this form through the means of emulsifiers or the
viscosity of
the formulation. Either of the phases of the emulsion may be a semisolid or a
solid, as is
the case of emulsion-style ointment bases and creams. Other means of
stabilizing
emulsions entail the use of emulsifiers that may be incorporated into either
phase of the
emulsion. Emulsifiers may broadly be classified into four categories:
synthetic
surfactants, naturally occurring emulsifiers, absorption bases, and finely
dispersed
solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker
(Eds.),
1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
77
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Synthetic surfactants, also known as surface active agents, have found wide
applicability in the formulation of emulsions and have been reviewed in the
literature
(Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.),
1988,
Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; ldson, in
Pharmaceutical
Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New
York,
N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and
comprise a
hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the
hydrophobic
nature of the surfactant has been termed the hydrophile/lipophile balance
(HLB) and is a
valuable tool in categorizing and selecting surfactants in the preparation of
forniulations.
Surfactants may be classified into different classes based on the nature of
the
hydrophilic group: non-ionic, anionic, cationic and amphoteric (Rieger, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 285).
Naturally occurring emulsifiers used in emulsion formulations include lanolin,
beeswax,
phosphatides, lecithin and acacia. Absorption bases possess hydrophilic
properties
such that they can soak up water to form w/o emulsions yet retain their
semisolid
consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely
divided
solids have also been used as good emulsifiers especially in combination with
surfactants and in viscous preparations. These include polar inorganic solids,
such as
heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite,
hectorite,
kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium
aluminum
silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
A large variety of non-emulsifying materials are also included in emulsion
formulations
and contribute to the properties of.emulsions. These include fats, oils,
waxes, fatty
acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids,
preservatives and
antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199).
Hydrophilic colloids or hydrocolloids include naturally occurring gums and
synthetic
polymers such as polysaccharides (for example, acacia, agar, alginic acid,
carrageenan,
guar gum, karaya gum, and tragacanth), cellulose derivatives (for example,
carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers
(for
example, carbomers, cellulose ethers, and carboxyvinyl polymers). These
disperse or
swell in water to form colloidal solutions that stabilize emulsions by forming
strong inter-
78
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
facial films around the dispersed-phase droplets and by increasing the
viscosity of the
external phase.
Since emulsions often contain a number of ingredients such as carbohydrates,
proteins,
sterols and phosphatides that may readily support the growth of microbes,
these
formulations often incorporate preservatives. Commonly used preservatives
included in
emulsion formulations include methyl paraben, propyl paraben, quaternary
ammonium
salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric
acid,.
Antioxidants are also commonly added to emulsion formulations to prevent
deterioration
of the formulation. Antioxidants used may be free radical scavengers such as
tocopherols, alkyl gallates, butylated hydroxyanisole, butylated
hydroxytoluene, or
reducing agents such as ascorbic acid and sodium metabisulfite, and
antioxidant
synergists such as citric acid, tartaric acid, and lecithin.
The application of emulsion formulations via dermatological, oral and
parenteral routes
and methods for their manufacture have been reviewed in the literature (Idson,
in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for
oral delivery
have been very widely used because of reasons of ease of formulation, efficacy
from an
absorption and bioavailabiity standpoint. (Rosoff, in Pharmaceutical Dosage
Forms,
Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York,
N.Y.,
volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
Mineral-oil
base laxatives, oil-soluble vitamins and high fat nutritive preparations are
among the
materials that have commonly been administered orally as o/w emulsions.
In one embodiment of the present invention, the compositions of
oligonucleotides are
formulated as microemulsions. A microemulsion may be defined as a system of
water,
oil and amphiphile which is a single optically isotropic and thermodynamically
stable
liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and
Banker
(Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
Typically micro-
emulsions are systems that are prepared by first dispersing an. oil in an
aqueous
surfactant solution and then adding 'a sufficient amount of a fourth
component, generally
an intermediate chain-length alcohol to form a transparent system. Therefore,
microemulsions have also been described as thermodynamically stable,
isotropically
clear dispersions of two immiscible liquids that are stabilized by interfacial
films of
surface-active molecules (Leung and Shah, in: Controlled Release of Drugs:
Polymers
and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages
185-
79
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
215). Microemulsions commonly are prepared via a combination of three to five
components that include oil, water, surfactant, cosurfactant and electrolyte.
Whether the
microemulsion is of the water-in-oil (wlo) or an oil-in-water (o/w) type is
dependent on
the properties of the oil and surfactant used and on the structure and
geometric packing
of the polar heads and hydrocarbon. tails of the surfactant molecules (Schott,
in
Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985,
p.
271).
The phenomenological approach utilizing phase diagrams has been exterisively
studied
and has yielded a comprehensive knowledge, to one skilled in the art, of how
to
formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Lieberman,
Rieger
and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
245; Block,
in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988,
Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional
emulsions,
microemulsions offer the advantage of solubilizing water-insoluble drugs in a
formulation
of thermodynamically stable droplets that are formed spontaneously.
Surfactants used in the preparation of microemulsions include, but are not
limited to,
ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl
ethers,
polyglycerol fatty acid esters, tetraglycerol monolaurate (ML31O),
tetraglycerol
monooleate (M0310), hexaglycerol monooleate (P0310), hexaglycerol pentaoleate
(P0500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (M0750),
decaglycerol sequioleate (S0750), decaglycerol decaoleate (DA0750), alone or
in
combination with cosurfactants. The cosurfactant, usually a short-chain
alcohol such as
ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial
fluidity by
penetrating into the surfactant film and consequently creating a disordered
film because
of the void space generated among surfactant molecules. Microemulsions may,
however, be prepared without the use of cosurfactants and alcohol-free self-
emulsifying
microemulsion systems are known in the art. The aqueous phase may typically
be, but
is not limited to, water, an aqueous solution of the drug, glycerol, PEG300,
PEG400,
polyglycerols, propylene.glycols, and derivatives of ethylene glycol. The oil
phase may
include, but is not limited to, materials such as Captex 300, Captex 355,
Capmul MCM,
fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides,
polyoxyethylated
glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides,
saturated
polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
Microemulsions are particularly of interest from the standpoint of drug
solubilization and
the enhanced absorption of drugs. Lipid based microemulsions (both o/w and
w/o) have
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
been proposed to enhance the oral bioavailability of drugs, including peptides
(Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390;
Ritschet, MetC.
Find. Exp. Clin. PharmacoL, 1993, 13, 205). Micro-emulsions afford advantages
of
improved drug solubilization, protection of drug from enzymatic hydrolysis,
possible
enhancement of drug absorption due to surfactant-induced alterations in
membrane
fluidity and permeability, ease of preparation, ease of oral administration
over solid
dosage forms, improved clinical potency, and decreased toxicity
(Constantinides et at.,
Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Set, 1996, 85,
138-143).
Often microemulsions may form spontaneously when their components are brought
together at ambient temperature. This may be particularly advantageous when
formulating thermolabile drugs, peptides or oligonucleotides. Microemulsions
have also
been effective in the transdermal delivery of active components in both
cosmetic and
pharmaceutical applications. It is expected that the microemulsion
compositions and
formulations of the present invention will facilitate the increased systemic
absorption of
oligonucteotides and nucleic acids from the gastrointestinal tract, as well as
improve the
local cellular uptake of oligonucleotides and nucleic acids within the
gastrointestinal
tract, vagina, buccal cavity and other areas of administration.
Microemulsions of the present invention may also contain additional components
and
additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration
enhancers
to improve the properties of the formulation and to enhance the absorption of
the
oligonucleotides and nucleic acids of the present invention. Penetration
enhancers used
in the microemulsions of the present invention may be classified as belonging
to one of
five broad categories - surfactants, fatty acids; bile salts, chelating
agents, and non-
chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug
Canier
Systems, 1991, p. 92).
Liposomes
There are many organized surfactant structures besides microemulsions that
have been
studied and used for the formulation of drugs. These include monolayers,
micelles,
bilayers and vesicles. Vesicles offer specificity and extended duration of
action for drug
delivery. Thus, as used herein, the term "liposome" refers to a vesicle
composed of
amphiphilic lipids arranged in a spherical bilayer or bilayers, i.e.,
liposomes are
unilamellar or muitilamellar vesicles which have a membrane formed from a
lipophilic
material and an aqueous interior. The aqueous portion typically contains the
composition to be delivered. In order to cross intact mammalian skin, lipid
vesicles must
pass through a series of fine pores, each with a diameter less than 50 nm,
under the
81
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
influence of a suitable transdermal gradient. Therefore, it is desirable to
use a liposome
which is highly deformable and able to pass through such fine pores.
Additional factors
for liposomes include the lipid surface charge, and the aqueous volume of the
liposomes.
Further advantages of liposomes include; liposomes obtained from natural
phospholipids are biocompatible and biodegradable; liposomes can incorporate a
wide
range of water and lipid soluble drugs; liposomes can protect encapsulated
drugs in
their internal compartments from metabolism and degradation (Rosoff, in
Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel
Dekker, Inc., New York, N.Y., volume 1, p. 245).
For topical administration, there is evidence that liposomes present several
advantages
over other formulations. Such advantages include reduced side-effects related
to high
systemic absorption of the administered drug, increased accumulation of the
administered drug at the desired target, and the ability to administer a wide
variety of
drugs, both hydrophilic and hydrophobic, into the skin. Compounds including
analgesics, antibodies, hormones and high-molecular weight DNAs have been
administered to the skin, generally resulting in targeting of the upper
epidermis.
Liposomes fall into two broad classes. Cationic liposomes are positively
charged
liposomes which interact with the negatively charged DNA molecules.to form a
stable
complex. The positively charged DNA/liposome complex binds to the negatively
charged
cell surface and is internalized in an endosome. Due to the acidic pH within
the
endosome, the,liposomes are ruptured, releasing their contents into the cell
cytoplasm
(Wang et at., Biochem. Biophys. Res. (iommun., 1987, 147, 980-985).
Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than
complex with it. Since both the DNA and the lipid are similarly charged,
repulsion rather
than complex formation occurs. The DNA is thus entrapped in the aqueous
interior of
these liposomes. pH-sensitive liposomes have been used, for example, to
deliver DNA
ehcoding the thymidine kinase gene to cell monolayers in culture (Zhou et al.,
Journal of
Controlled Release, 1992, 19, 269-274).
One major type of liposomal composition includes phospholipids other than
naturally-
derived phosphatidylcholine. Neutral liposome compositions, for example, can
be
formed from dimyristoyl phosphatidyicholine (DMPC) or dipalmitoyl
phosphatidylcholine
(DPPC). Anionic liposome compositions generally are formed from dimyristoyl
82
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily
from
dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal
composition is
formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg
PC.
Another type is formed from mixtures of phospholipid and/or
phosphatidylcholine and/or
cholesterol.
Several studies have assessed the topical delivery of liposomal drug
formulations to the
skin. Application of liposomes containing interferon to guinea pig skin
resulted in a
reduction of skin herpes sores while delivery of interferon via other means
(e.g. as a
solution or as an emulsion) were ineffective (Weiner et at., Journal of Drug
Targeting,
1992, 2, 405-410). Further, an additional study tested the efficacy of
interferon
administered as part of a liposomal formulation to the administration of
interferon using
an aqueous system, and concluded that the liposomal formulation was superior
to
aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-
265).
Non-ionic liposomal systems have also been examined to determine their utility
in the
delivery of drugs to the skin, in particular systems comprising non-ionic
surfactant and
cholesterol. Non-ionic liposomal formulations comprising NovasoneTM I
(glyceryl
dilaurate/cholesterol/polyoxyethylene-l0-stearyl ether) and NovasomeTM II
(glyceryl
distearate/cholesterol/polyoxyethylene-1 0-stearyl ether) were used to .
deliver
cyclosporin-A into the dermis of mouse skin. Results indicated that such non-
ionic
liposomal systems were effective in facilitating the deposition of cyclosporin-
A into
different layers of the skin (Hu et at. S.T.P. Pharma. Sci., 1994, 4, 6, 466).
Liposomes also include "sterically stabilized" liposomes, a term which, as
used herein,
refers to liposomes comprising one or more specialized lipids that, when
incorporated
into liposomes, result in enhanced circulation lifetimes relative to liposomes
lacking such
specialized lipids. Examples of sterically stabilized liposomes are those in
which part of
the vesicle-forming lipid portion of the liposome include one or more
glycolipids, such as
monosialoganglioside GM,, or is derivatized with one or more hydrophilic
polymers, such
as a polyethylene glycol (PEG) moiety. Without being bound by any particular
theory, it
is believed that for sterically stabilized liposomes containing gangliosides,
sphingomyelin, or PEG-derivatized lipids, the increase in circulation half-
life of these
sterically stabilized liposomes is due to a reduced uptake into cells of the
reticuloehdothelial system (RES) (Allen et at., FEBS Lett., 1987, 223, 42; Wu
et al.,
Cancer Research, 1993, 53, 3765).
83
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Various liposomes that include one or more glycolipids have been reported in
Papahadjopoulos et al., Ann. N.Y. Acad. Sci., 1987, 507, 64
(monosiatoganglioside GM,,
galactocerebroside sulfate and phosphatidylinositol); Gabizon et at., Proc. -
Natl. Acad.
Sci. USA., 1988, 85, 6949,;Allen et al., US. Pat. No. 4,837,028 and
International
Application Publication WO 88/04924 (sphingomyelin and the ganglioside GM, or
a
galactocerebroside sulfate ester); Webb et al., U.S. Pat. No. 5,543,152
(sphingomyelin);
Lim et al., WO 97/13499 (1,2-sn-dimyristoylphosphatidylcholine).
Liposomes that include lipids derivatized with one or more hydrophilic
polymers, and
methods of preparation are described, for example, in Sunamoto et al., Bull.
Chem. Soc.
Jpn., 1980, 53, 2778 (a nonionic detergent, 2C1215G, that contains a PEG
moiety); Illum
et al., FEBS Lett., 1984, 167, 79 (hydrophilic coating of polystyrene
particles with
polymeric glycols); Sears, U.S. Pat. Nos. 4,426,330 and 4,534, 899 (synthetic
phospholipids modified by the attachment of carboxylic groups of polyalkylene
glycols
(e.g., -PEG)); Klibanov et al., FEBS Lett., 1990, 268, 235
(phosphatidylethanolamine
(PE) derivatized with PEG or PEG stearate); Blume et al., Biochimica et
Biophysica
Acta, 1990, 1029, 91 (PEG-derivatized phospholipids, e.g., DSPE-PEG, formed
from the
combination of distearoylphosphatidylethanolamine (DSPE) and PEG); Fisher,
European Patent No. EP 0 445 131 BI and WO 90/04384 (covalently bound PEG
moieties on liposome external surface); Woodle et al., U.S. Pat. Nos.
5,013,556 and
5,356,633, and Martin et al., U.S. Pat. No. 5,213,804 and European Patent No.
EP 0
496 813 B1 (liposome compositions containing 1-20 mole percent of PE
derivatized with
PEG); Martin et al., WO 91/05545 and U.S. Pat. No. 5,225,212 and in Zalipsky
et al.,
WO 94/20073 (liposomes containing a number of other lipid-polymer conjugates);
Choi
et al., WO 96/10391 (liposomes that include PEG-modified ceramide lipids);
Miyazaki et
al., U.S. Pat. No. 5,540,935, and Tagawa et al., *U.S. Patent No. 5,556,948
(PEG-
containing liposomes that can be further derivatized with functional moieties
on their
surfaces).
Liposomes that include nucleic acids have been described, for example, in
Thierry et al.,
WO 96/40062 (methods for encapsulating high molecular weight nucleic acids in
liposomes); Tagawa et al., U.S. Pat. No. 5,264,221 (protein-bonded liposomes
containing RNA); Rahman et al., U.S. Pat. No. 5,665,710 (methods of
encapsulating
oligodeoxynucleotides in liposomes); Love et al., WO 97/04787 (liposomes that
include
antisense oligonucleotides).
Another type of liposome, transfersomes are highly deformable lipid aggregates
which
are attractive for drug delivery vehicles. (Cevc et al., 1998, Biochim Biophys
Acta.
84
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
. 1368(2):201-15.) Transfersomes may be described as lipid droplets which are
so highly
deformable that they can penetrate through pores which are smaller. than the
droplet.
Transfersomes are adaptable to the environment in which they are used, for
example,
they are shape adaptive, self-repairing, frequently reach their targets
without
fragmenting, and often self-loading. Transfersomes can be made, for example,
by
adding surface edge-activators, usually surfactants, to a standard liposomal
composition.
Surfactants
Surfactants are widely used in formulations such as emulsions (including
microemulsions) and liposomes. The most common way of classifying and ranking
the
properties of the many different types of surfactants, both natural and
synthetic, is by the
use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic
group (also
known as the "head") provides the most useful means for categorizing the
different
surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms,
Marcel
Dekker, Inc., New York, N.Y., 1988, p. 285).
If the surfactant molecule is not ionized, it is classified as a nonionic
surfactant. Nonionic
surfactants are widely used in pharmaceutical and cosmetic products and are
usable
over a wide range' of pH values, and with typical HLB values from 2 to about
18
depending on structure. Nonionic surfactants include nonionic esters such as
ethylene
glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters,
sorbitan
esters, sucrose esters, and ethoxylated esters; and nonionic alkanolamides and
ethers
such as fatty alcohol ethoxylates, propoxylated alcohols, and
ethoxylated/propoxylated.
block polymers are also included in this class. The polyoxyethylene
surfactants are the
most commonly used members of the nonionic surfactant class.
Surfactant molecules that carry a negative charge when dissolved or dispersed
in water
are classified as anionic. Anionic surfactants include carboxylates such as
soaps, acyl
lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl
sulfates and
ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl
isothionates, acyl laurates and sulfosuccinates, and phosphates. The alkyl
sulfates and
soaps are'the most commonly used anionic surfactants.
Surfactant molecules that carry a positive charge when dissolved or dispersed
in water
are classified as cationic. Cationic surfactants include quaternary ammonium
salts and
ethoxylated amines, with the quaternary ammonium salts used most often:
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Surfactant molecules that can carry either a positive or negative charge are
classified as
amphoteric. Amphoteric surfactants include acrylic acid derivatives,
substituted
alkylamides, N-alkylbetaines and phosphatides.
The use of surfactants in drug products, formulations and in emulsions has
been
reviewed in Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New
York,
N.Y., 1988, .p. 285).
Penetration Enhancers
In some embodiments, penetration enhancers are used in or with a composition
to
increase the delivery of nucleic acids, particularly oligonucleotides, to the
skin or across
mucous membranes of animals. Most drugs are present in solution in both
ionized and
nonionized forms. However, usually only lipid soluble or lipophilic drugs
readily cross
cell membranes. It has been discovered that even non-lipophilic drugs may
cross cell
membranes if the membrane to be crossed is treated with a penetration
enhancer. In
addition to aiding the diffusion of non-lipophilic drugs across cell
membranes,
penetration enhancers also enhance the permeability of lipophilic drugs.
Penetration enhancers may be classified as belonging to one of five broad
categories,
i.e., surfactants, fatty acids, bile salts, chelating agents, and ,
non=chelating
nonsurfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier
Systems, 1991,
p.92). Each of these classes of penetration enhancers is described below in
greater
detail.
Surfactants: In connection with the present invention, surfactants (or
"surface-active
agents") are chemical entities which, when dissolved in an aqueous solution,
reduce the
surface tension of the solution or the interfacial tension between the aqueous
solution
and another liquid, with the result that absorption of oligonucleotides
through the
mucosa is enhanced. These penetration enhancers include, for example, sodium
lauryl
sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether)
(Lee et at.,
CriticalReviews in Therapeutic Drug= Carrier Systems, 1991,. p.92); and
perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm.
Pharmacol.,
1988, 40, 252), each of which is incorporated herein by reference in its
entirety.
Fatty acids: Various fatty acids and their derivatives which act as
penetration enhancers
include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid),
myristic acid,
palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate,
tricaprate, monooleih
(1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid,
glycerol 1-
86
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines,
C,.,o alkyl
esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and
diglycerides thereof
(i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate,
etc.) (Lee et al.,
Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92; Muranishi,
Critical
Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al.,
J. Pharm.
Pharmacol., 1992, 44, 651-654), each of which is incorporated herein by
reference in its
entirety.
Bile salts: The physiological role of bile includes the facilitation of
dispersion and
absorption of lipids and fat-soluble vitamins .(Brunton, Chapter 38 in:
Goodman &
Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al.
Eds.,
McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and
their
synthetic derivatives, act as penetration enhancers. Thus the term "bile
salts" includes
any of the naturally occurring components of bile as well as any of their
synthetic
derivatives. The bile salts of the invention include, for example, cholic acid
(or its
pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid
(sodium
dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid
(sodium
glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid
(sodium
glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic
acid
(sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate),
ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF),
sodium
glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al.,
Critical
Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter
39 In:
Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing
Co.,
Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic
Drug
Carrier Systems, 1990, 7, 1-33; Yamamoto ct al., J. Pharm. Exp. Ther., 1992,
263, 25;
Yamashita et al., J. Pharm:. Sci., 1990, 79, 579-583).
Chelating Agents: In the present context, chelating agents can be regarded as
compounds that remove metallic ions from solution by forming complexes
therewith,
with the result that absorption of oligonucleotides through the mucosa is
enhanced. With
regards to their use as penetration enhancers in the present invention,
chelating agents
have the added advantage of'also serving as DNase inhibitors, as most
characterized
DNA nucleases require a divalent metal ion for catalysis and are thus
inhibited by
chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Without
limitation,
chelating agents include disodium ethylenediaminetetraacetate (EDTA), citric
acid,'
salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-
acyl
87
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-
diketones
(enamines)(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems,
1991,
page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems,
1990, 7, .1-
33; Buur et al., J. Control Rel., 1990, 14, 43-51).
Non-chelating non-surfactants: As used herein, non-chelating non-surfactant
penetration enhancing compounds are compounds that do not demonstrate
significant
chelating agent or surfactant activity, but still enhance absorption of
oligonucleotides
through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug
Carrier
Systems, 1990, 7, 1-33). Examples of such penetration enhancers include
unsaturated
cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al.,
Critical
Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and nonsteroidal
anti-
inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone
(Yamashita et al,, J. Pharm. Pharmacol., 1987, 39,621-626).
Agents that enhance uptake of oligonucleotides at the cellular level may also
be added
to the pharmaceutical and other compositions and formulations of the present
invention.
For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No.
5,705,188),
cationic glycerol derivatives, and polycationic molecules, such as polylysine
(Lollo et al.,
PCT Application WO 97/30731), are also known to enhance the cellular uptake of
oligonucleotides.
Other agents may be utilized to enhance the penetration of the administered
nucleic
acids, including glycols such as ethylene glycol and propylene glycol, pyrrols
such as 2-
pyrrol, azones, and terpenes such as limonene and menthone.
Carriers
Certain compositions of the present invention also incorporate carrier
compounds in the
formulation. As used herein, "carrier compound" or "carrier" can refer to a
nucleic acid,
or analog thereof, which is inert (i.e., does not possess biological activity
per se) but is,
recognized as a nucleic acid by in vivo processes that reduce the
bioavailability of a
nucleic acid having biological activity by, for example, degrading the
biologically active
nucleic acid or promoting its removal from circulation. The coadministration
of a nucleic
acid and a carrier compound, often with an excess of the latter substance, can
result in
a substantial reduction of the amount of nucleic acid recovered in the liver,
kidney or
other extracirculatory reservoirs. For example, the recovery of a partially
phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is
88
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-
acetamido-
4'isothiocyano=stilbene-2,2-disulfonic acid (Miyao et al.,AntisenseRes. Dev.,
1995,5,
115-121; Takakura et al., Antisense & NucL Acid Drug Dev., 1996, 6, 177-183),
each of
which is incorporated herein by reference in its entirety. 5 Excipients
In contrast to a carrier compound, a"pharmaceutical carrier" or "excipient" is
a
pharmaceutically acceptable solvent, suspending agent or any other
pharmacologically
inert vehicle for delivering one or more nucleic acids to an animal, and is
typically liquid
or solid. A pharmaceutical carrier is generally selected to provide for the
desired bulk,
consistency, etc., when combined with a nucleic acid and the other components
of a
given pharmaceutical composition, in view of the intended administration mode.
Typical
pharmaceutical carriers include, but are not limited to, binding agents (e.g.,
pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl
methylcellulose, etc.);
fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin,
gelatin, calcium
sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.);
lubricants
(e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic
acid, metallic
stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols,
sodium
benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch
glycotate,
etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).
Pharmaceutically acceptable organic or inorganic excipients suitable for non-
parenteral
administration which do not deleteriously react with nucleic acids can also be
used to
formulate the compositions of the present invention. Suitable pharmaceutically
acceptable carriers include, but are not limited to, water, salt solutions,
alcohols,
polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc,
silicic acid,
viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
Formulations for topical administration of nucleic acids may include sterile
and non-
sterile aqueous solutions, non-aqueous solutions in common solvents such as
alcohols,
or solutions of the nucleic acids in liquid or solid oil bases. The solutions
may also
contain buffers, diluents and other suitable additives. Pharmaceutically
acceptable
organic or inorganic excipients suitable for non-parenteral administration
which do not
deleteriously react with nucleic acids can be used.
89
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Other Pharmaceutical Composition Components
The present compositions may additionally contain other components
conventionally
found in pharmaceutical compositions, at their art-established usage levels.
Thus, for
example, the compositions may contain additional, compatible, pharmaceutically-
active
materials such as, for example, antipruritics, 'astringents, local anesthetics
or anti-
inflammatory agents, or may contain additional materials useful in physically
formulating
various dosage forms of the compositions of the present invention; such as
dyes,
flavoring agents, preservatives, antioxidants, opacifiers, thickening agents
and
stabilizers. However, such materials, when added, should not unduly interfere
with the
biological activities of the components of the compositions of the present
invention. The
formulations can be sterilized and, if desired, mixed with auxiliary agents,
e.g.,
lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for
influencing
osmotic pressure, buffers, colorings, flavorings and/or aromatic substances
and the like
which do not deleteriously interact with the nucleic acid(s) of the
formulation.
Aqueous suspensions may contain substances which increase the viscosity of the
suspension including, for example, sodium carboxymethylcellulose, sorbitol
and/or
dextran, and/or stabilizers.
Certain embodiments of the invention provide pharmaceutical compositions
containing
(a) one or more antiviral oligonucleotides and (b) one or more other
chemotherapeutic
agents which function by a different mechanism. Examples of such
chemotherapeutic
agents include but are not limited to daunorubicin,. daunomycin, dactinomycin,
doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide,
ifosfamide,
cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C,
actinomycin D,
mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen,
dacarbazine,
procarbazine, hexamethylmelamine, pentamethytmetamine, mitoxantrone,
amsacrine,
chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan,
cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine,
hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-
fluorouracil (5-
FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), coichicine, taxol,
vincristine,
vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan,
gemcitabine,
teniposide, cisplatin, and diethylstilbestrol (DES). See, generally, The Merck
Manual of
Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al., eds.,
Rahway, .
NJ. When used with the compounds of the invention, such chemotherapeutic
agents
may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g.,
5-FU and
oligonucleotide for a period of time followed by MTX and oligonucleotide), or
in
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
combination with one or more other such chemotherapeutic agents (e.g., 5-EU,
MTX
and oligonucleotide, or 5-FU,- radiotherapy and oligonucleotide). Anti-
inflammatory
drugs, including but not limited to nonsteroidal anti-inflammatory drugs and
corticosteroids, and antiviral drugs, including but not limited to Ribavirin,
cidofovir,
vidarabine, acyclovir and ganciclovir, may also be combined in compositions of
the
invention. See, generally, The Merck Manual of Diagnosis and Therapy, 15th
Ed.,
Berkow et al., eds., 1987, Rahway, NJ., pages 2499-2506 and 46-49,
respectively).
Other non-oligonucleotide chemotherapeutic agents are also within the scope of
this
invention. Two or more combined compounds may be used together or
sequentially.
EXAMPLES
Example 1: Herpes Simplex Virus
Herpes simplex virus (HSV) affects a significant proportion of the human
population. It
was found in the present invention that random ONs or ON randomers inhibited
the
infectivity of -viruses such as HSV. Using cellular HSV replication assays in
VERO cells
(susceptible to HSV-1 (strain KOS) and HSV-2 (strain MS2) infection) it was
found that a
single stranded PS-ON complementary to the HSV origin of replication.
inhibited
replication of HSV-1 and HSV-2. Surprisingly, control PS-ONs complementary to
human (343 ARS) and plasmid (pBR322/pUC) origins also inhibited viral
infectivity.
Experiments with random sequence PS-ONs and PS-ON randomers demonstrated that
inhibition of 'viral infection increased with increasing ON size. These data
show that
ONs are potent antiviral agents useful for therapeutic treatment of viral
infection.
The inventors have theorized that a potential mechanism for blocking the
spread of
viruses such as HHVs was to prevent the replication of its DNA. With this in
mind,
phosphorothioate oligonucleotides (ONs) complementary to the origin of
replication of
HSV1 and HSV2 were introduced into infected cells. These ONs would cause DNA
triplex formation at the viral origin of replication, blocking the association
of.necessary
trans=acting factors and viral DNA replication. Surprising results are
presented herein of
these experiments which show that, in an experimental paradigm, the potency of
ONs in
inhibiting viral infection increases as their size (length) increases.
Inhibition of HSV-1
The ability of PS-ONs to inhibit HSV-1 is measured in a plaque reduction assay
(PRA).
Immortalized African Green Monkey kidney (VERO) cells are cultured at 37 C and
5%
CO2 in MEM (minimal essential medium) plus 10% fetal calf serum supplemented
with
91
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
gentamycin, vancomycin and amphoterecin B. Cells are seeded in 12 well plates
at a
density which yields a confluent monolayer of cells after 4 days of growth.
Upon
reaching confluency, the media is changed to contain only 5% serum plus
supplements
as described above and cells are then exposed to HSV-1 (strain KOS,
approximately
5. 40-60 PFU total) in the presence of the test compound for 90 minutes. After
viral
exposure, the media is replaced with new "overlay" media containing 5% serum,
1%
human immunoglobulins, supplements as described above and the test compound.
Plaque counting is performed 3-4 days post infection following formalin
fixation and
cresyl violet staining of infected cultures.
All ONs (except where noted otherwise) were synthesized at the University of
Calgary
Core DNA Services lab. ONs (see table 21) are prepared on a.1 or 15 micromol
synthesis scale, deprotected and desalted on a 50cm Sephadex G-25 column. The
resulting ONs are analyzed by UV shadowing gel electrophoresis and are
determined to
contain -95% of the full length, n-1 and n-2 oligo and up to 5% of shorter
oligo species
(these are assumed to have random deletions). For random oligo synthesis,
adenine,
guanosine, cytosine and thymidine amidites are mixed together in equimolar
quantities
to maximize the randomness of incorporation at each position of the ONs during
synthesis.
To test if PS-ONs could inhibit HSV-1, REP 1001, 2001 and 3007 are tested in
the HSV-
1 PRA. It would have been expected that only REP 2001 will show any activity
as this
PS-ON is directed agairist the origin of replication in HSV (the, other two
are directed
against replication origins in humans and plasmids). However all three PS-ONs
showed
anti-HSV-1 activity. The testing was carried out in a plaque reduction assay
conducted
in VERO cells using HSV-1 (strain KOS). Infected cells were treated with
increasing
concentrations of REP 1001, REP 2001, or REP 3007. IC50 values calculated from
linear regressions of the assay results were 2.76, 0.77, and 5.33 micromolar
respectively. Moireover, the potentcy of the anti-HSV-1 effect was found to be
dependent on the size of the oligo.
To confirm the size dependence and relative sequence independence of PS-ONs on
anti-HSV-1 activity, we tested PS-ONs that vary in size (REP 2002, 2003, 2004,
2005
and 2006) along with the antiviral drug Acyclovir. These PS-ONs are rendered
inert with
respect to sequence specific effects by synthesizing each base as a "wobble"
(N) so that
each PS-ON actually represents a population of different random sequences with
the
same size; these PS-ONs are termed "randomers". Plaque reduction assay was
conducted in VERO cells using HSV-1 (strain KOS). Infected cells are treated
with
92
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
increasing concentrations of REP 2001, REP 2002 or REP 3003, REP 2004, REP
2005,
REP 2006, and Acyclovir. ICso values were calculated from linear regressions
of assay
data. The relationship between PS-ON size and IC50 against HSV-1 was
determined by
plotting the IC50 values against the specific size of each PS-ON tested which
showed
anti-HSV-1 activity. The ICso for Acyclovir was used as a reference to a
clinical
correlate. We found that oligos 10 bases or lower have no detectable anti-HSV-
1
activity but as the size of the PS-ON increases above 10 bases, the potency
also
increases (IC50 decreases). We also noted that PS-ONs greater than 20 bases
had IC50
values significantly lower than a clinically accepted anti-HSV-1 drug,
acyclovir.
To better define the effective size range for PS-ON anti-HSV-1 activity, we
tested PS-
ON randomers covering a broader range of sizes from 10 to 120 bases. Plaque
reduction assay was conducted in VERO cells using HSV-1 (strain KOS). A broad
range of PS-ON randomer sizes were tested in increasing concentrations; REP
2003,
REP 2009, REP 2010, REP 2011, REP 2012, REP 2004, REP 2006, REP 2007, and
REP 2008. IC50 values were calculated from linear regressions. We discovered
that
oligos 12 bases and larger -have detectable anti-HSV-1 activity and that the
efficacy
against HSV-1 also increases with increased PS-ON randomer length up to at
least 120
bases. However, the increases in efficacy per base increase in size are
smaller in PS-
ON randomers greater than 40 bases.
2 0 . To compare the efficacy of non-PS-ON randomers, a random sequence PS-ON
and a
HSV-1 specific sequence PS-ON, we tested these three types of modifications in
ONs
10, 20 and 40 bases in size. Plaque reduction assay was conducted in VERO
cells
using HSV-1 (strain KOS). . Unmodified ONs, PS-ONs with a random sequence, and
PS-ONs targeting the start codon of HSV-1 IE110 were tested in increasing
concentrations. The ONs were REP 2013, REP 2014, REP 2015, REP 2016, REP
2017, REP 2018, REP 2019, REP 2020, and REP 2021. IC50 values were calculated
from linear regressions. In this system, unmodified ON randomers have no
detectable
anti-HSV-1 activity at tested sizes. Both random sequence and specific HSV-1
sequence PS-ONs show size dependent anti-HSV-1 activity (no activity is
observed at
10 bases for either of these modifications. A comparison of random sequence,
specific
HSV-1 sequence and randomer PS-ONs showed that for PS-ONs 20 bases in length,
there is an enhancement of anti-HSV-1 activity with the specific HSV-1
sequence but
that at 40 bases in length, all modifications, whether randomer, random
sequence or
specific HSV-1 sequence were equally efficacious against HSV-1.
93
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
To the best of our knowledge, this is the first time IC50s for HSV-1 as low as
0.059 pM
and 0.043 pM are reported for PS-ONs.
Example 2: Inhibition of HSV-2
The ability of PS-ONs to inhibit HSV-2 is measured by PRA. Immortalized
African
Green Monkey kidney (VERO) cells are cultured at 37 C and 5% CO2 in MEM plus
10%
fetal calf serum supplemented with gentamycin, vancomycin and amphoterecin B.
Cells
are seeded in 12 well plates at a density which yields a confluent monolayer
of cells
after 4 days of growth. Upon reaching confluency, the media is changed to
contain only
5% serum plus supplements as described above and cells are then exposed to.HSV-
2
(strain MS2, approximately 40-60 PFU total) in the presence of the test
compound for 90
minutes.. After viral exposure, the media is replaced with new "overlay"
media containing 5% serum, 1% human immunoglobulins, supplements as described
above and the test compound. Plaque counting is performed 3-4 days post
infection
following formalin fixation and cresyl violet staining of infected cultures.
To test if PS-ONs could inhibit HSV-2, REP 1001, 2001 and 3007 are tested in
the HSV-
2 PRA. Plaque reduction, assay was conducted in human fibroblast cells using
HSV-2
(strain MS2), with infected cells treated with increasing concentrations of
REP 1001,
REP 2001, or REP 3007. IC5o.values were calculated from linear regressions. If
the
inhibitory activity were due to an antisense or other sequence complementary
mechanism, it would be expected that only REP 2001 would show any activity as
this
PS-ON is directed against the origin of replication in HSV-1/2 (the other two
are directed
against replication origins in humans and plasmids respectively). However all
three PS-
ONs showed anti-HSV-2 activity. Moreover, the potency of the anti-HSV-2 effect
is
dependent on the size of the PS-ON and independent of the sequence.
To confirm the size dependence and sequence independence of PS-ONs on anti-HSV-
2
activity, we tested PS-ONs that vary in size (REP 2001, 2002, 2003, 2004, 2005
and
2006). These PS-ONs are rendered inert with respect to sequence specific
effects by
synthesizing each base as a "wobble" (N) so that each PS-ON actually
represents a
population of different random sequences with the same size, these PS-ONs are
termed
"randomers". When these PS-ONs are tested in the HSV-2 PRA, we find that PS-
ONs
10 bases or lower had no detectable anti-HSV-2 activity but as the size of the
PS-ON
increases above 10 bases, the potency also increases (ICso decreases). We also
noted
that PS-ONs greater than 20 bases had IC50 values significantly lower than a
clinically
accepted anti-HSV-2 drug, acyclovir TPA -
94
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
To the best of our knowledge, this is the first time an IC50 for HSV-2 as low
as 0.012 pM
has been reported for a PS-ON.
To determine if non-specific sequence composition. has an effect on ON
antiviral activity,
several PS-ONs of equivalent size but differing in their sequence composition
were
tested for anti-HSV1 activity in the HSV-1 PRA. The PS-ONs tested were REP
2006
(N20), REP 2028 (G40), REP 2029 (A40), REP 2030 (T40) and REP 2031 (C40). The
IC50 values generated from the HSV-1 PRA show that REP 2006 (N40) was the most
active of all sequences tested while REP 2029 (A40) was the least active. We
also note
that, all the other PS-ONs were significantly less active than N40 with their
rank in terms
of efficacy being N40>C40>T40>A40 G40.
We also tested the efficacy of different PS ONs having varying sequence
composition
with two different nucleotides. The PS-ON randomer (REP 2006) was
significantly more
efficacious against HSV-1 than AC20 (REP 2055), TC20 (REP 2056) or AG20 (REP
2057) with their efficacies ranked as follows: N40>AG>AC>TC. This data
suggests that
although the anti-viral effect is non-sequence complementary, certain non-
specific
sequence compositions (ie C40 and N40) have more potent anti-viral activity.
We
suggest that this phenomenon can be explained by the fact that, while
retaining intrinsic
protein binding ability, sequences like C40, A40, T40 and G40 bind fewer viral
proteins
with high affinity, probably due to some restrictive tertiary structure formed
in these
sequences. On the other hand, due to the random nature of N40, it retains its
ability to
bind with high affinity to a broad range of anti-viral proteins which
contributes to its
robust anti-viral activity..
Example 3: Inhibition of CMV
The ability of PS-ONs to inhibit CMV is measured in a plaque reduction assay
(PRA).
This assay is identical to the assay used for testing anti-HSV-1 and anti-HSV-
2 except
that CMV (strain AD169) is used as the viral innoculum and human fibroblasts
were
used as cellular host.
To test the size dependence and sequence independence of PS-ONs on anti-CMV
activity, we tested PS-ON randomers that vary in size. Plaque reduction assay
was
conducted in VERO cells using CMV (strain AD169). Infected cells were treated
with
increasing concentrations of REP 2004 (a) or REP 2006 (b). IC50 values were
calculated, from linear regressions, and relationship between PS-ON size and
IC50
against CMV was determined by plotting IC50 values against the specific size
of each
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
PS-ON tested. When these PS-ONs are tested in the CMV PRA, we find that as the
size of the PS-ON increases, the potency also increases (IC5o decreases).
To more clearly elucidate the effective size range for PS-ON anti-CMV
activity, we
tested PS-ON randomers covering a broader range of sizes from 10 to 80 bases.
We
also included several clinically accepted small molecule CMV treatments
(Gancyclovir,
Foscarnet and Cidofovir) as well as 2 versions of a marketed antisense
treatment for
CMVretinitis, (VitraveneTM; commercially available and synthesized by the
University of
Calgary). Plaque reduction assay was conducted in VERO cells using CMV (strain
AD169). Three clinical CMV therapies were tested: Gancyclovir, Foscarnet, and
Cidofovir. A broad range of PS-ON randomer sizes were also tested in
increasing
concentrations; REP 2003,'REP 2004, REP 2006, and REP 2007. Finally, REP 2036
(Vitravene) was tested. as synthesized in house and as commercially available:
IC50
values were calculated from lineat regressions. We discovered that while
increased PS-
ON randomer size leads to increased efficacy, this effect saturates at about
40 bases.
Moreover, the 20, 40 and 80 base PS-ON randomers are all significantly more
efficacious than any of the small molecule treatments tested. In addition, 40
and 80
base PS-ON randomers are more efficacious than Vitravener""
To the best of our knowledge, this is the first time an IC50 for CMV as low as
0.067 pM
has been reported for a PS-ON.
Example 4: Inhibition of HIV-1
The ability of PS-ON randomers to inhibit HIV-1 is measured by two different
assays:
Cytopathic Effect (CPE)
Cytopathic effect is monitored using MTT dye to report the extent of cellular
metabolism.
Immortalized human lymphocyte (MT4) cells are cultured at 37 C and 5% COZ in
MEM
plus 10% fetal calf serum supplemented with antibiotics. Cells are seeded in
96 well
plates in media containing the appropriate test compound and incubated for 2
hours.
After preincubation with the test compound, HIV-1 '(strain NL 4-3) was added
to the
wells (0.0002 TCID5o/cell). After 6 days of additional incubation, CPE is
monitored by
MTT conversion. Cytotoxicity is measured by incubating the drugs for 6 days in
the
absence of viral inoculation. For transformation of MTT absorbance values into
%
survival, the absorbance of uninfected, untreated cells is set to 100% and the
absorbance of infected, untreated cells is set to 0 %.
96
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Replication Assay (RA)
The ability of HIV to replicate is monitored in immortalized human embryonic
kidney
(293A) cells. These cells are cotransfected with two plasmids. One plasmid
contains a
recombinant wild type HIV-1 genome (NL 4-3) having its env gene disrupted by a
luciferase expression cassette (identified as strain CNDO), the other plasmid
contains
the env gene from murine leukemia virus (MLV). These two plasmids provide all
the
protein factors in trans to produce a mature chimeric virus having all the
components
from HIV-1 except the protein products provided in trans from the MLV env
gene.
Virions produced from these cells are infectious and replicative but cannot
produce
another generation of infectious virions because they will lack the env gene
products.
24 hours after transfection, these cells are trypsinized and plated in 96 well
plates. After
the cells have adhered, the media is washed and replaced with media containing
the
test compound. Virus production is allowed to proceed for an additional 24
hours. The
supernatant is then harvested and used to reinfect naive 293A cells. Naive
cells that
are infected are identified by the luciferase gene product. The number of
luciferase
positive cells is a measure of the extent of replication and/or infection by
the
recombinant HIV-1. This assay is also adapted to test the resistance to many
clinically
accepted anti-HIV-1 drugs by using a HIV-1 genome with several point mutations
known
to induce resistance to several different classes of anti-HIV drugs.
Percentage inhibition
is set to 100% for no detectable luciferase positive cells and 0% for the
number of
positive cells in infected, untreated controls.
To test the size dependence and sequence independence of PS-ONs on anti-HIV-1
activity, we tested PS-ON randomers that vary in size. CPE assay was conducted
in
MT4 cells using HIV-1 (strain NL4-3). Infected cells were treated with
increasing
concentrations of REP 2004 or REP 2006. IC50 values were calculated from
linear
regressions. . Cytotoxicity profiles in uninfected MT4 cells were determined
for REP
2004 and REP 2006. We found that as the size of the PS-ON increases, the
potency
also increases (IC50 decreases). We also noted that the PS-ON randomers
exhibited no
significant toxicity to the host cells in this assay.
To the best of our knowledge, this is the first time an IC50 for HIV-1 as low
as 0.011 NM
has been. reported for a PS-ON.
To more clearly elucidate the effective size range for PS-ON 'anti-HIV-1
activity, we
tested more PS-ON randomers covering a broader range of sizes from 10 to 80
bases
97
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
by RA using wild-type HIV-1 (recombinant NL 4-3 (CNDO)). Replication assay was
conducted in 293A cells using recombinant wild type HIV-1 NL4-3 (strain CNDO).
In
addition, we tested four protease inhibitors currently used in the clinic
(aprenavir,
indinavir, lopinavir and saquinavir). Infected cells were treated with,
increasing
concentrations of Amprenavir, Indinavir, Lopinavir, Saquinavir, REP 2003, REP
2004,
REP 2006, and REP 2007. We discovered that PS-ON randomers 10 bases and larger
have anti-HIV-1 activity and that the efficacy against HIV-1 also increases
with
increased PS-ON randomer length but is saturated at about 40 bases. Moreover,
the
40 and 80 base PS-ON randomers were almost equivalent in efficacy with the 4
clinical
controls,
To the best of our knowledge, this is the first time an IC5o for HIV-1 as low
as 0.014 pM
has been reported for a PS-ON.
To test the ability of PS-ON randomers to inhibit a drug resistant strain of
HIV, we
duplicated the above test using the recombinant MDRC4 strain of HIV-1. This
recombinant strain exhibits significant resistance to at least 16 different
clinically
accepted drugs from all classes: nucleotide RT inhibitors, non-nucleotide RT
inhibitors
and protease inhibitors. We found that all the PS-ON randomers tested perform
as well
against the resistant strain as they do against the wild type strain. However,
three of the
four protease inhibitors show a reduction in their efficacy against the mutant
strain, such
that the 40 and 80 base PS-ON randomers were more potent against this
resistant
strain than these drugs.
Example 5: Inhibition of RSV
The ability of PS-ON randomers to inhibit RSV is measured by monitoririg CPE
with
alamar blue (an indirect measure of cellular metabolism). Human larynx
carcinoma
(Hep2) cells are cultured at 37 C and 5% COz in MEM plus 5% fetal calf serum.
Cells
are seeded in 96 well plates at a density which yields a confluent monolayer
of cells
after 5-6 days of growth. The day after plating, cells were infected with RSV
(strain A2,
108.2 TCID50/ml) in the presence of the test compound in a reduced volume for
2 hours.
Following inoculation, the media was changed and was supplemented with test
compound. 6 days after infection,.CPE was monitored by measuring the
fluorescent
conversion of alamar blue. Toxicity of test compounds in Hep2 cells was
monitored by
treating uninfected cells for 7 days and measuring alamar blue conversion in
these cells.
The alamar blue readings in uninfected, untreated cells were set to 100%
survival and
the readings in infected, untreated cells were set to 0% survival.
98
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
To confirm the size dependence and sequence independence of PS-ONs on anti-RSV
activity, we tested PS-ON randomers that vary in size. In addition,. we tested
the
clinically accepted treatment for RSV infection, Ribavirin (VirazoleT""). CPE
assay was
conducted in Hep2 cells using RSV (strain A2). Infected cells are treated with
increasing concentrations of REP 2004, REP 2006, REP 2007, or Ribavirin. IC50
values
were calculated from.linear regressions are reported in each graph.
Cytotoxicity profiles
in uninfected Hep2 'ceils were determined for REP 2004, REP 2006, REP 2007, or
Ribavirin. We -found that as the size of the PS-ON randomer increases, the
potency
also increases but saturates at about 40 bases in size. We also noted that 20,
40 and
80 base PS-ON randomers had IC50 values significantly lower than a clinically
accepted
anti-RSV drug, Ribavirin. PS-ON randomers exhibited no toxicity in Hep2 cells
while
Ribavirin was significantly toxic (therapeutic index = 2.08).
To the best of our knowledge, this is the first time an IC50 for RSV-1 as low
as 0.015 pM
has been reported for a PS-ON.
Example 6: Inhibition of Coxsackie virus B2
The ability of PS-ON randomers to inhibit COX B2 is measured monitoring CPE
with
alamar blue (an indirect measure of cellular metabolism). Rhesus monkey kidney
(LLC-
MK2) cells are cultured at 37 C and 5% COZ in MEM plus 5% fetal calf serum.
Cells
are seeded in 96 well plates at a density which yields a confluent monolayer
of cells
after 5-6 days of growth. The day after plating, cells were infected with COX
B2 (strain
Ohio-1, 107.8 TCID50/ml) in the presence of the test compound in a reduced
volume for 2
hours.. Following inoculation, the media was changed and was supplemented with
test
compound. 6 days after infection, CPE was monitored by measuring the
fluorescent
conversion of alamar blue. Toxicity of test compounds in LLC-MK2 cells was
monitored
by treating uninfected cells for 7 days and measuring alamar blue conversion
in these
cells. The alamar blue readings in uninfected, untreated cells were set to
100% survival
and the readings in infected, untreated cells were set to 0% survival.
We tested the anti-COX B2 activity of REP 2006 in the COX B2 CPE assay. The
CPE
assay was conducted in LLC-MK2 cells using Coxsackievirus B2 (strain Ohio-1).
Infected cells were treated with increasing concentrations of REP 2006. The
cytotoxicity
profile for REP 2006 in LLC-MK2 cells was determined. We found that, while
exhibiting
some slight toxicity in LLC-MK2 cells, this PS-ON randomer was able to
partially rescue
infected LLC-MK2 cells from COX B2 infection.
99
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Example 7: Inhibition of vaccinia virus
We used the vaccinia infection model as an indicator of the efficacy of our
compounds
against poxviruses, including smallpox virus. The ability of PS-ON randomers
to inhibit
Vaccinia is measured by monitoring CPE with alamar blue (an indirect measure
of
cellular metabolism). Vero cells are cultured at 37 C and 5% CO2 in MEM plus
5% fetal
calf serum. Cells are seeded in 96 well plates at a density which yields a
confluent
monolayer of cells after 5-6 days of growth. The day after plating, cells were
infected
with Vaccinia (107=9 TCID5o/ml) in the presence of the test compound in a
reduced
volume for 2 hours. Following inoculation, the media was changed and was
supplemented with test compound (all at 10pM, except for Cidofovir which was
used at
50NM). Five days after infection, the supernatants were harvested. The viral
load in the
supernatant was determined by reinfection of VERO cells with supernatant
diluted 1:100
and the monitoring of CPE 7 days after reinfection by measuring the
fluorescent
conversion of alamar blue.
We tested PS-ON randomers that vary in size (REP 2004, 2006 and 2007). In
addition,
we tested a known effective treatment for Vaccinia infection, Cidofovir
(VistideTM).
Indirect determination of viral load in infected supernatants from vaccinia
infected VERO
cells was determined by measuring the CPE induced by these supernatants in
naive
cells. REP 2004, 2006 and 2007 were tested at 10NM while Cidofovir was tested
at
5OpM. When tested in the Vacinnia CPE assay, we found that treatment with REP
2004, 2006 and 2007 all displayed antiviral activity (ie. resulted in
supernatants which
showed a decreased CPE upon reinfection) but that this activity was weaker
than that
seen for Cidofovir.
Example 8: Inhibition of DHBV, Parainfluenza-3 virus, and Hanta
virus.
Because DHBV, Parainfluenza-3 virus and Hanta virus do not readily generate
measurable plaques or CPE, we tested the efficacy of REP 2006 in these viruses
using
a fluorescence focus forming unit (FFFU) detection. In this assay, REP 2006
(at a final
concentration of 10pM) is mixed with the virus which is then adsorbed onto the
cells.
After adsorption, infected cells are allowed to incubate for an additional 7-
14 days at
which point they are fixed in methanol. Regions of viral replication are
detected by
immunofluorescence microscopy against the appropriate viral antigen. For each
of the
three viruses tested, the specific experimental conditions and results are
described in
Table I below:
100
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Table 1. Inhibition of DHBV, Parainfluenza-3 virus, and Hanta virus.
Virus Cellular Host Antibody for FFFU FFFU count FFFU count
detection (no drug) (10NM REP
2006)
DHBV (HBV Primary duck Mouse anti-DHBV 163+/-38.5 0
surro ate he atoc es I G
Parainfluenza - LLC-MK2 cells Mouse anti-PI3 IgG 288+/-126 0
3
Hanta Virus VERO E6 cells Mouse anti- 232.3+/-38.17 0
(Strain SinNombre
Prospect Hill nucleoprotein I G
This initial data shows that at 10pM, REP 2006 is effective in inhibiting
DHBV,
Parainfluenza-2 and Hanta Virus. We anticipate that given the robust response
in the
preliminary test that IC50 values will be lower. These data support the
efficacy of PS-ON
randomers for the treatment of human infections of Hanta Virus and Hepatitis B
(closely
related to DHBV) as well. as providing a rationale for the immediate treatment
of
pediatric bronchiolitis caused by RSV and Parainfluenza-3, which may not
require
differential diagnosis for treatment to begin.
Example 9: Currently Non-responsive viruses
To date we have not observed a detectable anti-viral efficacy with PS-ON
randomers
(up to 10pM) without using a delivery system, a drug combination, or a
chemical
modification in the following viral systems described in Table 2:
Table 2. Viral Systems
Virus Strain Cellular Host Assay
paradigm
Corona virus (SARS MHV2 (mouse) NCTC-1496 cells Plaque
surrogate) MHV-A59 (mouse) DBT cells reduction
HCoV-OC43 HRT-18 cells
(human)
BVDV (HCV NA BT cells CPE by
surro ate alamar blue
Rhinovirus HGP HeLa cells CPE by
alamar blue
. --r- Adenovirus Human Ad5 293A cells Plaque
reduction
Under the current testing procedures, we did not demonstrate activity.
However, the
lack of demonstrated antiviral activity may be due to limitations of the
particular assays
101
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
used. Additional testing is underway to demonstrate efficacious results with
these
viruses.
.Since our evidence indicates that the.charge characteristics of a PS-ON are
important
for the inhibition of viruses from several different families, we expect that
this charge
dependent mechanism for. the inhibition of viral activity has the. potential
to inhibit the
activity of all encapsidating viruses. The corollary to this is that the lack
of detected anti-
viral efficacy against those viruses listed in Example 9 suggests that the
interaction
between the PS-ON and the structural proteins of these viruses may not strong
be
enough to prevent the interaction of viral proteins during the replication of
these viruses.
In this case, one way of achieving efficacy against these viruses is to alter
the charge
characteristics of the DNA or anti-viral polymer (e.g., substituting
phosphorodithioate for
phosphorothioate linkages in DNA) so their affinity for viral proteins is
increased.
Example 10: Inhibition of Influenza A
The ability of PS-ONs to inhibit the influenza virus (INF) A is measured in a
plaque
reduction assay (PRA). Immortalized Canine kidney (MDCK) cells are cultured at
37 C
and 5 CO2 in MEM plus 10% fetal calf serum supplemented with gentamycin,
vancomycin and amphoterecin B. Cells are seeded in 6 well plates at a density
which
yields a confluent monolayer of cells after 6 days of growth. Upon reaching
confluency,
the media is changed to contain only supplements as described above and cells
are
then exposed to INF A (strain H3N2, approximately 35-70 PFU total) in the
presence of
the test compound for 60 minutes. After viral exposure., the media is replaced
with new
media containing drug only. 24 hours after infection, media is again replaced
with
overlay media containing 4% albumin, 0.025% DEAE dextran, 2mg/ml TPCK-treated
trypsin and 0.8% seaplaque agarose, supplements as described above and no test
compound. Plaque counting is performed 2-3 days post infection following
formalin
fixation and cresyl violet staining of infected cuitures.
We tested the anti INF A activity of a variety of PS-ON randomers in the INF A
P,RA
assay. We found that only REP 2006 showed any measurable antiviral activity
but that
this activity was significant (see following table 3).
Table 3. Activity of PS-ON randomers against INF A (H3N2).
Randome ICso M
REP 2003 >10
REP 2004 >10
REP 2006 -3
102
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Since only the largest randomer seemed to have any activity and we know that
the
activity of randomers in many other viruses was size dependent, we tested the
antiviral
activity of a larger size distribution of randomers using a broader dilution
range. We
discovered that as for other viruses we had tested, the anti-INF A activity of
randomers
became more potent as their length increased but that no significant increase
in activity
was seen for randomers above 40 bases in length.
Table 4. Size dependent anti-INF A activity of PS-ON randomers.
Randome IC50 M
REP 2032 >50
REP 2003 >50
REP 2004 -25
REP 2005 -6.25
REP 2006 -1.25
REP 2007 -r0.625
To determine the mechanism of action of REP 2006 we attempted to determine the
effect of adding REP 2006 (at IC99 concentration) at various times before,
during and
after infection. In this experiment, we observed that even 5 hours (300min)
after
infection, adding REP 2006 resulted in a complete inhibition of INF A activity
(see
following table). These results indicate that at least a significant portion
of the action of
REP 2006 against influenza occurs post infection. Since PS-ON randomers do not
readily enter the cell, PS-ON randomers may also interfere with viral budding
from the
host cell.
103
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Table 5. Time of addition of REP 2006 versus effect on INF A activity.
Time of REP 2006 mixing Infectivity
with virus relative to N
infection min
no drug ctl 100
-30 0
-5 0
0 0
0
30 0
60 0
90 0
120 0
180 0
240 0
300 0
5 Example 11: Tests for Determining if an Oligonucleotide Acts
Predominantly by a Sequence Independent Mode of Action
We have shown herein that the antiviral activity of the present ONs occurs by
a
sequence=independent mode of action. Of course a person skilled in the art
could
prepare sequence-specific ONs, for example an antisense ON targeting a mRNA of
a
particular virus and incorporating all phosphorothioate and 2' 0-methyl
modifications.
However such an ON would have benefited from the ON modifications we have
described herein and the fact that we have demonstrated herein that the
activity of such
a modified ON is sequence independent. Thus, an ON shall be considered to have
sequence-independent activity if it meets the criteria of any one of the 5
tests outlined
below, i.e., if a substantial part of its function is due to a sequence-
independent activity.
The ONs used in the following tests can be prepared following the general
methodology
described in example 12 for the synthesis of PS-ONs.
TEST #1 - Effect of partial degeneracy of a candidate ON on its antiviral
efficacy
This test serves to measure the antiviral activity of a candidate ON sequence
when part
of its sequence is made degenerate. If the degenerate version of the candidate
ON
having the same chemistry retains its activity as described below, 'is it
deemed to have
sequence-independent activity. Candidate ONs will be made degenerate according
to
the following rule:
104
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
L the number of bases in the candidate ON
X the number of bases on each end of the oligo to be made degenerate (but
having the same chemistry as the candidate ON)
If L is even, then X=integer (L/4)
If L is odd, then X=integer ((L+1)/4)
X must be equal to or greater than 4
If the candidate ON is claimed to have an anti-viral activity against a member
of the
herpesviridae, retroviridae, or paramyxoviridae families, the IC50 generation
will be
performed using the assay described herein for that viral family preferably
using the viral
strains indicated. If the candidate ON is claimed to have an anti-viral
activity against a
member of a particular virus family not mentioned above, then the IC50 values
shall be
generated by a test of antiviral efficacy accepted by the pharmaceutical
industry. IC50
values shall be generated using a minimum of seven concentrations of compound,
with
three or more points in the linear range of the dose resporise curve. Using
these tests,
the IC50 of the candidate ON shall be compared to its degenerate counterpart.
If the
IC50 of the partially degenerate ON is less than 5-fold greater than the
original candidate
ON (based on minimum triplicate measurements, standard deviation not to exceed
15%
of mean) then the ON shall be deemed to act predominantly by a sequence
independent mode of action.
TEST #2 - Comparison of antiviral activity of a candidate ON with an ON
randomer.
This test serves to compare the anti-viral efficacy of a candidate ON with the
antiviral
efficacy of a randomer ON of equivalent size and chemistry in the same virus.
If the candidate ON is claimed to have an anti-viral activity against a member
of the
herpesviridae, retroviridae, or paramyxoviridae families, the ICso generation
will be
performed using the assay described herein for that viral family preferably
using the viral
strains indicated. If the candidate ON is claimed. to have an anti-viral
activity against a
member of a particLilar virus family not mentioned above, then the IC50 values
shall be
generated by a test of antiviral efficacy accepted by the pharmaceutical
industry. IC50
values shall be generated using a minimum of seven concentrations of compound,
with
three or more points in the linear range of the dose response curve. Using
this test, the
IC50 of the candidate ON shall be compared to an ON randomer of equivalent
size and
105
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
chemistry. If the IC50 of the ON randomer is less than 5-foid greater than the
candidate
ON (based on minimum triplicate measurements, standard deviation not to exceed
15%
of mean) then the candidate ON shall be deemed to act predominantly by a
sequence
independent mode of action.
TEST #3 - Comparison of antiviral activity of a candidate ON in two non-
homologous viruses from the same viral family
This test serves to compare the efficacy of a candidate ON against a target
virus whose
genome is homologous to the candidate ON. with the efficacy of the candidate
ON
against a second virus whose genome has no homology to that candidate ON but
is in
the same viral family. For example, if a candidate ON is reported to have
activity
against HSV, its activity against HSV will be compared to its activity against
CMV or
VZV etc . The comparison of the relative activities of the candidate ON in the
target
virus and the second virus is accomplished by using the activities of an ON
randomer of
the same length and chemistry in both viruses to normalize the IC5o values for
the
candidate ON obtained in the two viruses.
Thus, if the candidate ON is claimed to have an anti-viral activity against a
certain virus,
then the IC50 generation will be determined in this virus using one of the
assays
described herein for the herpesviridae, retroviridae, or paramyxoviridae
families, or other
assays known in the art. Similarly, IC50 generation will be performed for the
candidate
ON against a second virus using one of the assays as described herein or an
assay
accepted by the industry for a virus whose genome has no homology to the
sequence of
the candidate ON but is from the same viral family. IC50 generation is also
performed for
a randomer of equivalent size and chemistry against each of the viruses. The
IC50 of
the ON randomer against the two viruses are used to normalize the IC50 values
for the
candidate ON against the two viruses as follows:
An equivalent algebraic transformation is applied to the IC50 of the candidate
ON
and the ON randomer in the first (homologous) virus such that the IC50 of the
randomer is now 1.
An equivalent algebraic transformation is applied to the IC50 of the candidate
ON
and the ON randomer in the second (non-homologous) virus such that the IC50 of
the randomer is now 1.
The fold difference in the ICsos for the candidate ON in the homologus versus
the
non-homologous virus is calculated by dividing the transformed IC50 of the
candidate ON in the non-homologous virus by the transformed IC50 of the
candidate ON in the homologous virus.
106
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
The candidate ON shall be deemed to act predominantly by a sequence
independent
mode of action if the fold difference in IC50 between the two viruses is less
than 5.
TEST #4: Antiviral activity of a candidate ON in a different viral family
This test serves to determine if a candidate ON has a drug-like activity in a
virus where
the sequence of the candidate ON is not homologous to any portion of the viral
genome
and the virus is from a different family: Thus the candidate ON shall be
tested using one
of the assays described herein for the herpesviridae, retroviridae or
paramyxoviridae
such that the sequence of the candidate ON tested is not homologous to any
portion of
the genome of the virus to be used. An ICao value shall be generated using a
minimum
of seven concentrations of the candidate ON, with three or more points in the
linear
range. If the resulting dose response curve indicates a drug-like activity
(which can
typically be seen as a decay or sigmoidal curve, having reduced anti-viral
efficacy with
decreasing concentrations of candidate ON) and the IC50 generated from the
curve is
less than 10 pM, the candidate ON shall be deemed to have a drug-like
activity. If the
candidate ON is deemed to have a drug-like activity in a virus from a
different family for
which the candidate ON is not complementary and thus can have no sequence
dependent antisense activity, it shall be considered to act predominantly by a
sequence
independent mode of action.
Test #5. Extracellular antiviral activity of a candidate ON
Our current results indicate that the sequence-independent antiviral activity
of ONs-
occurs outside the cell. The state of the art in ON technology teaches that,
since ONs
are not readily cell permeable, they must be delivered across the cell
membrane by an
appropriate carrier to have antisense activity. Thus, the antiviral activity
of antisense
ONs by definition is dependent on delivery inside cells for activity. If a
particular
sequence-specific candidate ON has in vitro antiviral activity when used naked
(and
therefore having poor intracellular penetration), it must benefit from the
sequence-
independent properties of ONs described in this invention.
If the sequence-specific candidate ON is complementary to a portion of the
genome of
HSV-1, HIV-1 or RSV, then the presence of a sequence-independent antiviral
activity of
the candidate ON shall be determined in the appropriate assay described below.
If the
candidate ON is complementary to a virus which is not HSV-1, HIV-1 or RSV,
then the
antiviral activity of the candidate ON shall be determined using an assay
accepted by
the pharmaceutical industry.
107
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Using the appropriate assay, the antiviral activity of the naked candidate ON
shall be
compared to that of the encapsulated (for transfection) candidate ON (using
identical
candidate ON concentrations in both naked and encapsulated conditions). The
activity
shall be measured by a dose response curve with not less than 7
concentrations, at
least 3 of which fall in the linear range which includes the 50% inhibition of
viral activity.
The IC50 (the concentration which reduces 'viral activity by 50%) shall be
calculated by
linear regression of the linear range of the dose response curve as defined
above. If the
IC50 of the naked candidate ON is less than 5-fold greater than that of the
encapsulated
candidate ON, then the activity of the candidate ON shall be deemed to act
predominantly by a sequence independent mode of action.
Thresholds used in these tests
The purpose of these tests are to determine by a reasonable analysis, if ONs
benefit
from or utilize the sequence-independent antiviral properties of ONs which we
have
described herein and is acting with sequence-independent activity. Of course
anyone
skilled in the art will realize that, given the inherent variability of all
testing
methodologies, especially antiviral testing methods, a determination of
differences in
antiviral activity between two compounds may not be reliably concluded if the
threshold
is set at a 2 or 3 fold difference between the activities of said compounds.
This is due to
the fact that variations from experiment to experiment with the same compound
in these
assays can yield ICsos which vary in this range. Thus, to be reasonably
certain that real
differences between the activities of two compounds (e.g. two ONs) exist, we
set a
threshold of at least a 5-fold difference between the IC50s of said compounds.
This
threshold ensures the reliability of the assessment of the above mentioned
tests.
The thresholds described in tests 1 to 3 and 5 above are the default
thresholds. If
specifically indicated, other thresholds can be used in the comparison tests 1
to 3 and 5
described above. Thus for example, if specifically indicated, the threshold
for
determining whether an ON is acting with sequence-independent activity can be
any of
10-fold, 8-fold, 6-fold, 5-fold, 4-fold, 3-fold, 2-fold, 1.5-fold, or equal.
The threshold
described in test 4 above is also a default threshold. If specifically
indicated, the
threshold for determining whether an ON has sequence-independent. activity in
test 4
can be an IC50 of less than 10pM, 5pM, 1 pM, 0.8 pM, 0.6pM, 0.5pM, 0.4 pM, 0.3
pM,
0.2 pM or 0.1 pM.
Similarly, though the default is that satisfying any one of the above 5 tests
is sufficient, if
specifically indicated, the ON can be required to satisfy any two (e.g.,,tests
1 & 2, 1 & 3,
108
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
1& 4, 1& 5, 2& 3, 2& 4, 2& 5, 3& 4, and 3& 5), any three (e.g., tests 1& 2&
3,.1 &2
&4, 1,&2&5, 1 &3,&4, 1 &3&5,2&3&4,and2&4&5),any4ofthetests(e.g., 1
& 2& 3& 4, 1& 2& 3 & & 5, and 2& 3& 4& 5) at a default threshold, or if
specifically
indicated, at another threshold(s) as indicated above.
.5
Example 12. Methodologies
The following methods are provided for application in the tests described in
example 11.
Oligonucleotide Synthesis
The present oligonucleotides can by synthesized using methods known in the
art. For
example, unsubstituted and substituted phosphodiester (P=O) oligonucleotides
can be
synthesized on an automated DNA synthesizer (e.g., Applied Biosystems model
380B
or Akta Oligopilot 100) using standard phosphoramidite chemistry with
oxidation by
iodine. Phosphorothioates (P=S) can be synthesized as for the phosphodiester
oligonucieotides except the standard oxidation bottle can be replaced by 0.2 M
solution
of 311-1,2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the step-wise
thioation of
the phosphite linkages. The thioation wait step can be increased to 68 sec,
followed by
the capping step.. After cleavage from the support column and deblocking in
concentrated ammonium hydroxide at 55 C. (18 h), the oligonucleotides can be
purified
by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCI solution.
Antiviral assay for herpesviridae
A plaque reduction assay for herpesviridae is performed as follows:
For HSV-1 or HSV-2, VERO, cells (ATCC# CCL-81) are grown to confluence in
12 well tissue culture plates (NUNC or equivalent) at 37 C and 5% CO2 in the
presence of MEM supplemented with 10% heat inactivated fetal calf serum and
gentamycin,.vancomycin and amphoterecin B . Upon reaching confluency, the
media is changed to contain 5% fetal calf serum and antibiotics as detailed
above supplemented with either HSV-1 (strain KOS, 40-60 PFU total). or HSV-2
(strain MS2, 40-60 PFU total). Viral adsorbtion proceeds for 90 minutes, after
which cells are washed and replaced with new "overlay" media containing 5%
fetal calf serum and 1% human immunoglobins. Three to four days after
109
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
adsorbtion, cells are fixed by formalin and plaques are counted following
formalin
fixation and cresyl violet staining..
For CMV, human fibroblasts are grown as specified for VERO cells in the HSV-
1/2
assay. Media components and adsorbtion / overlay procedures are identical with
the
following exceptions:
1. CMV (strain AD169, 40-60 PFU total) is used to infect cells during the
adsorbtion.
2. In the overlay media, 1% human immunoglobins are replaced by 4% sea-
plaque agarose.
For other herpesviridae, testing is to be conducted in the plaque assay
described above
using an appropriate cellular host and 40-60 PFU of virus during the
adsorbtion.
This test is only valid if identifiable plaques are present in the absence of
compound at
the end of the test.
In this test, ICso is the concentration at which 50% of the plaques are
present compared
to the untreated control.
Compound to be tested is present during the adsorption and in the overlay.
Antiviral assay for retroviridae
Assaying for the retroviridae HIV-1 is performed by detection of total p24 in
the
supernatant of HIV-1infected cells by ELISA is performed as follows:
PBMCs were isolated from. fresh human blood obtained from screened donors,
seronegative for HIV and HBV. Peripheral blood cells were pelleted/washed 2-3
times
by low speed centrifugation and resuspension in PBS to remove contaminating
platelets. The washed blood cells were then diluted 1:1 with Dulbecco's
phosphate
buffered saline (PBS) and layered over 14 mL of Lymphocyte Separation Medium
(LSM;
cellgro by Mediatech, Inc.; density 1.078+/- 0.002 g/ml; Cat.# 85-072-CL) in
a 50 mL
centrifuge tube and centrifuged for 30 minutes at 600 X g. Banded PBMCs were
gently
aspirated from the resulting interface and subsequently washed 2X with PBS by
low
speed centrifugation. After the final wash, cells were counted by trypan blue
exclusion
110
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
and resuspended at 1 x 10' cells/mL in RPMI 1640 supplemented with 15 % Fetal
Bovine Serum (FBS), 2 mM L-glutamine, 4 Ng/mL PHA-P. The cells were allowed to
incubate for 48-72 hours at 37 C. After incubation, PBMCs were centrifuged and
resuspended in RPMI 1640 with 15% FBS, 2 mM L-glutamine, 100 U/mL penicillin,
100
pg/mL streptomycin, 10 pg/mL gentamycin, and 20 U/mL recombinant human IL-2.
PBMCs were maintained in this medium at a concentration of. 1-2 x 106 cells/mL
with
biweekly medium changes until used in the assay protocol. Monocytes were
depleted
from the culture as the result of adherence to the tissue culture flask.
For the standard PBMC assay, PHA-P stimulated cells from at least two normal
donors
were pooled, diluted in fresh medium to a final concentration of 1 x 106
cells/mL, and
plated in the interior wells of a 96 well round bottom microplate at 50 NUwell
(5 x 104
cells/well). Test drug dilutions were prepared at a 2X concentration in
microtiter tubes
and 100 pL of each concentration was placed in -appropriate wells in a
standard format.
After a 2-hr preincubation period (cells + drug), 50 pL of a predetermined
dilution of
virus stock was placed in each test well (final MOI 0.1). Wells with cells and
virus alone
were used for virus control. Separate plates were prepared identically without
virus for
drug cytotoxicity studies using an MTS assay system (described below). The
PBMC
cultures were maintained for seven days following infection, at which time
cell-free
supernate samples were collected and assayed for reverse transcriptase
activity as.
described below.
P24 ELISA kits were purchased from Coulter Electronics. The assay is performed
according to the manufacturer's instructions. Control curves are generated in
each
assay to accurately quantify the amount of p24 antigen in each sample. Data
are
obtained by spectrophotometric analysis at 450 nm using a Molecular Devices
Vmax
plate reader. Final concentrations are calculated from the optical density
values
This test is only valid if there is an accumulation of p24 in the tissue
culture supernatant
in the infected, untreated cells.
In this test, IC50 is the concentration at which the amount of p24 detectable
is 50% of the
p24 present in the untreated control.
Compound to be tested is present during the adsorption and in the media after
adsorption.
111
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Antiviral assay for paramyxoviridae
For RSV, a measurement of CPE is performed as follows:
Hep2 cells were plated in 96 well plates and allowed to grow overnight in MEM
plus 5%
fetal calf serum at 37 C and 5% CO2. The next day, cells are infected with
RSV (strain
A2, 108-2 TCID50/ml in 100ul/well) by adsorbtion for 2 hours. Following
adsorbtion,
media is changed and after 7 days growth, CPE is measured by conversion of
Alamar
Blue dye to its fluorescent adduct by living cells.
This test is only valid if CPE measurement (as measured by Alamar Blue
conversion) in
infected cells in the absence of compound is 10% of the conversion measured in
uninfected cells.
For purposes of IC50 comparison, 100% CPE is set at the conversion level seen
in
infected cells and 0% CPE is set at the conversion seen in uninfected cells.
Therefore
IC50 is the concentration of compound which generates 50% CPE.
Compound to be tested is present during the adsorption and in the media after
adsorption.
Example 13. 2'-O Methylated phosphorothioated randomers exhibit
potent antiviral activity with increased pH resistance and lower
serum protein binding.
We show herein that PS-ON randomers do not act via a sequence specific
mechanism
(i.e. their activity does not require them to bind to nucleic acid and their
activity is not
due to a sequence specific aptameric effect). We further show in this example
the effect
of oligonucleotides combining unmodified linkages, phosphorothiate linkages,
2'-O
methyl modified riboses and unmodified ribonucleotides on a 40 base randomer
with
respect to their antiviral activity, serum protein interaction and chemical
stability.
All randomers were prepared using standard solid phase, batch synthesis at the
University of Calgary Core DNA Services lab on a 1 or 15 ~mol synthesis scale,
deprotected and desalted on a 50cm Sephadex G-25 column.
For antiviral activity testing in influenza A (INF A), immortalized Canine
kidney (MDCK)
cells are cultured at 37 C and 5% COZ in MEM plus 10% fetal calf serum
supplemented
112
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
with gentamycin, vancomycin and amphoterecin B. Cells are seeded in 6 well
plates at
a density which yields a confluent monolayer of cells after 6 days of growth.
Upon
reaching confluency, the media is changed to contain only supplements as
described
above and cells are then exposed to INF A (strain H3N2, approximately 35-70
PFU
total) for 60 minutes. After viral exposure, the media is replaced with new
media containing drug only. Plaque counting is performed 2-3 days post
infection
following formalin fixation and cresyl violet staining of infected cultures.
For antiviral testing in HSV, immortalized African Green Monkey kidney (VERO)
cells
are cultured at 37 C and 5% COZ in MEM plus 10% fetal calf serum supplemented
with
gentamycin, vancomycin and amphoterecin B. Cells are seeded in 12 well plates
at a
density which yields a confluent monolayer of cells after 4 days of growth.
Upon
reaching confluency, the media is changed to contain only 5% serum plus
supplements
as described above and cells are then exposed to HSV-1 (strain KOS,
approximately
40-60 PFU total) in the presence of the test compound for 90 minutes. After
viral
exposure, the media is replaced with new "overlay" media containing 5% serum,
1%
human immunoglobulins, supplements as described above and the test compound.
Plaque counting is performed 3-4 days post infectiori following formalin
fixation and
cresyl violet staining of infected cultures.
To determine serum 'protein interaction, a phosphorothioate randomer labeled
at the 3'
20. end with FITC (the bait) is diluted to 2nM in assay buffer (10mM Tris,
pH7.2, 80mM
NaCI, 10mM EDTA, 100mM b-mercaptoethanol and 1% tween 20). This oligo is then
mixed with the appropriate amount of non heat-inactivated FBS. Following
randomer-,
FBS interaction, the complexes are challenged with various unlabelled
randomers to
assess their ability to displace the bait from its complex. Displaced bait is
measured by
fluorescence polarization. The displacement curve was used to determine Kd.
pH resistance was determined by incubation of randomers in PBS adjusted to the
appropriate pH with HCI. 24 hours after incubation, samples were neutralized
with 1 M
TRIS, pH 7.4 and run on denaturing acryalmide gels and visualized following
EtBr
staining.
For theseexperiments, we compared the behaviours of different modified
randomers:
REP 2006, REP 2024, REP 2107, REP 2086 and REP 2060 (see Table 6 in this
example). The antiviral activities of these randomers were tested for
antiviral activity in
HSV and influenza A by plaque reduction assay (see Table 7 in this example).
In these
two viruses, REP 2006, 2024 and 2107 had similar and potent anti-viral
activity, REP
113
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
2060 showed significant anti-HSV activity and REP 2086 had no detectable
antiviral
activity in either HSV-1 or influenza A under these assay conditions.
Table 6. Randomer description
Randomer Description (N A, G, T/U or C)
REP 2006 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
REP 2024 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
REP2107 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
REP 2086 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
REP 2060 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
N= unmodified deoxyribonucleotide, unmodified linkage
N = unmodified deoxyribonucleotide, phosphorothiate linkage
N = 2'-O methyl modified ribose, unmodified linkage
N = 2'-O methyl modified ribose + phosphorothioate linkage
N= unmodified ribonucleotide + phosphorothioate linkage
Table 7. Antiviral activity of various randomers in HSV and influenza A
Randomer IC50 M (HSV) IC50 (pM) (influenza A)
REP 2006 0.1 -2
REP 2024 0.14 -1.5
REP 2107 0.085 -1
REP 2086 No activity no activity
REP 2060 0.85 Not tested
The relative affinity of these randomers for serum proteins was determined as
described
above. The results of these experiments showed that REP 2107 has a lower
affinity to
serum proteins than REP 2006 or REP 2024 (see Table 8 in this example) and
that
there was no interaction detected between REP 2086 and serum proteins.
Moreover, at
saturation of competition, REP 2107 was less effective at displacing bound
bait than
REP 2006 or REP 2024 (see Table 9 in this example).
Table 8. Serum protein affinity of various randomers.
Randomer Kd (nM) (FBS)
2006 13
2024 13
2107 27
2086 no binding
114
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Table 9. Displacement of bait randomer at saturation.
Randomer % displaced bait
2006 75
2024 80
2107 60
2086 no displacement
Finally, we tested the pH stability of these randomers in the range of pH 1 to
pH 7 over
24 hours of incubation at 37 C. While REP 2006 and REP 2024 showed
significant
degredation at pH 3 and complete degredation at pH 2.5, REP 2107, 2086 and
2060
were completely stable at pH 1 after 24h of incubation.
These results duplicate -our previous findings that the phosphorothioation of
ON
randomers is highly beneficial for their antiviral activity. We further
demonstrate here
that the incorporation of 2'-O methyl modifications in PS-ON randomers does
not affect
the antiviral activity of these molecules, even when every ribose in the PS-ON
randomer
contains a 2'-O-methyl modification. Moreover, the fully 2'-O-methylated,
fully
phosphorothioated randomer (REP 2107) has a weaker interaction with serum
proteins
and shows a significantly increased resistance to low pH induced hydrolysis
Example 14. PS-ONs act by a predominantly extracellular mode of
action.
Prior art has taught that the use of delivery agents to increase the
intracellular
concentrations of PS-ONs would be beneficial to their activity. We demonstrate
here
that the antiviral activity of PS-ONs acts predominantly outside the cell and
therefore
would not receive a major benefit from the transfection enhancement of an
intracellular
delivery agent.
In this example, we use a PS-ON made of deoxyribonucleotides (DNA) without
other
modifications such as ribonucleotides (RNA) or 2'-O-methyl modification. It is
safe to
consider that this data will apply to PS-ON bearing additional modifications
because it is
known is the art that these molecules do not penetrate cells in vitro easily
without the
aide of a delivery system or a tranfection agent, especially in cases of
antisense antivity.
For the determination of cellular delivery, HeLa cells were cuitured under
standard
conditions and then incubated with fluorescently labelled REP 2006 (FL-
REP2006, a 3'
fluorescein isothiocynate conjugated 40 base PS-ON randomer), either naked or
encapsulated with a delivery agent (in this case DOTAP [1,2-Dioleoyl-3-
115
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Trimethylammonium-Propane], a cationic lipid). After varioUs times of
incubation, cells
were thoroughly washed with PSB to remove any non-internalized ON and the
cells
were subsequently lysed. The level of intracellular ON in the cell lysate was
determined
using a fluorescerice plate reader.
The determination of antiviral efficacy with naked, DOTAP and PEI
(polyethylene imine)
encapsulated REP 2006 in HSV-1 and influenza was determined as described
above.
The determination of the time of action of REP 2006 during the infectious
cycle of HSV-
I was determined as described above, but adding REP 2006 at various times
before,
during and after infection. In HIV-1, this was determined by adding REP 2006
to HIV-
10. LTR-beta-gal HeLa cells at various time before, during and after
infection. HIV-1
infection was monitored by a colourmetric assay of beta-gal production using
absorbance spectroscopy.
We first determined that DOTAP and PEI could deliver fluorescent REP 2006
inside
cells (see table 10). This data showed that, both DOTAP and PEI were capable
of
delivering FL-2006 (and by inference REP 2006) inside cells.
Table 10. Intracellular concentration of FL-REP 2006 with and without delivery
(pmol/cell)
Incubation time FL-REP2006 FL-REP 2006 + DOTAP FL-REP2006 + PEI
1 hour 6X10" 5X10" 6X10"
6 hours 6X10" 9X10" 3X10
24 hours 6X10 1.7X10" 7X10"
We then determined the activity of encapsulated (DOTAP or PEI) REP2006 in HSV-
1
influenza A (see Table 11 and 12 in this example) These results showed that
encapsulated REP 2006 had no detectable antiviral activity in both HSV-1 and
influenza.
Table 11. Activity of encalsulated REP 2006 in HSV-1 (IC5o, NM)
REP2006 REP2006 + DOTAP REP 2006 + PEI
0.074 No activity No activity
116
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Table 12. Activity of PEI encapsulated REP 2006 in influenza A
(% inhibition of la ue formation)
ON concentration (pM) REP 2006 REP 2006 + PEI
0 0 0
0.625 0 0
0.125 50 0
2.5 75 0
100 0
100 0
Finally, a time of addition study in HSV-1 and HIV-1 was performed where REP
2006
5 was added at various times before, during and after the infection. These
results showed
that in both viruses, REP 2006 was most effective when present before or
during the
infection, indicating that it was a fusion / entry inhibitor in HSV-1 and HIV-
1.
These results demonstrate that the antiviral activity or REP 2006 and PS-ONs
bearing
additional modifications such as, but without restriction, ribonucleotides
(RNA) or 2'-O-
10 methyl, occurs principally outside the cell.
Example 15. REP 2107 exhibits superior nuclease resistance.
40 mer randomers of various chemistries were assessed for their ability to
resist
degredation by various nucleases for 4 hours at 37 C (see Table 13 in this
example).
While most chemistries exhibited resistance to more than one nuclease, only
REP 2107
was resistant to all four nucleases tested. It is important to note that REP
2024 (which
has 2'-O methyl modifications at the 4 riboses at each end of the molecule)
showed the
same resistance profile as its parent molecule REP 2006, being sensitive to S1
nuclease degredation while 2107 (fully 2'-O methyl modified) was resistant to
this
enzyme. These results suggest that REP 2107 will be the most effective of the
tested
oligonucleotides in resisting degredation by nucleases in the blood.
Table 13. Resistance to various nucleases by different randomer chemistries.
Sensitive (S) or Resistant (R) after 4h incubation at 37 C
Exonuclease
Phosphodiesterase S1 Nuclease Ba1 31 I
Randomer II (Fermentas (NEB (NEB
(Sigma P9041) #EN0321) M0213S) M0293S)
REP2015 R S S S
REP2107 R R R R
REP2006 R S R R
REP2086 R R S R
REP2024 R S R R
117
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Example 16. Phosphorothioated polypyrimidine ONs exhibit acid
and nuclease resistance.
To determine the extent of ONs acid resistance of ONs, various 40 base ONs
having
different chemistries and/or sequences are incubated in PBS buffered to
different pH
values for 24 hours at 37 C. The degradation of these ONs was assessed by
urea-
polyacryamide gel electrophoresis (see table 14).
The results of these studies show that randomer ONs (containing both
pyrimidine and
purine nucleotides) are resistant to acidic pH only when they were fully 2'-O-
methylated.
Our data indicated that even partially 2'-O-methylated ONs (gapmers, REP 2024)
do not
display any significant increase in acid resistance. compared to fully
phosphorothioated
ONs. Even fully phosphorothioated randomers show no increased pH resistance
compared to unmodified ONs. In contrast, we noted that the phosphorothioated
40mer
ONs containing only the pyrimidine nucleotides cytosine (polyC, REP 2031) or
thymidine
(polyT, REP 2030) or the polyTC heteropolymer (REP 2056) had equivalent acid.
resistance compared to the fully 2'-O-methylated randomers whether
phosphorothioated
(REP 2107) or not (REP 2086). Contrary to the results for the polypyrimidine
oligonucleotides, phosphorothioated oligonucleotides containing only the
purine
nucleotide adenosine (polyA, REP 2029) or any adenosine or guanosine
nucleotides
(REP 2033, 2055, 2057) showed no greater acid resistance compared to
unmodified
DNA.
These results are significant because the preferred way described in the prior
art to
achieve greater acid resistance compared to phosphorothioated ONs was to add
2'-O-
methyl modifications (or other 2'-ribose modifications) or other
modifications. The
present data demonstrates that the 2'-O-methyl ribose modification or other 2'-
ribose
modifications are not required if the ON is a polypyrimidine (i.e. contains
only pyrimidine
nucleotides [e.g. homopolymers of cytosine or thymidine or a heteropolymer of
cytosines and thymidines]) to achieve pH and nuclease resistance. The presence
of
purines (A or G) even in the presence of pyrimidines, can render ONs acid
labile.
118
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Table 14. Acid stability of various 40 mer ONs
stabilit to various pHs after 24h at 37 C
ON name sequence modification pH 1 pH 2 pH pH
2.5 PH3 4 pH5 pH7
REP 2015 randomer none - - -/+ .+ +++ +++ +++
REP 2006 randomer PS - - -/+ + +++ +++ +++
REP 2086 randomer 2'OMe +++ +++ +++ +++ +++ +++ +++
REP 2107 randomer PS, 2'OMe. +++ +++ +++ +++ +++ +++ +++
REP 2024 randomer PS, 2'OMe a mer + +++ +++ +++
REP 2031 polyC PS +++ +++ +++ +++ +++ +++ ++
REP 2030 polyT PS .... +++ +++ +++ +++ +++ +++
REP 2029 polyA PS - - - - ++ +++ +++
REP2033 polyTG PS - - - - ++ +++ +++
REP 2055 polyAC PS - - - - ++ +++ +++
REP 2056 polyTC PS +++ +++ +++ +++ +++ +++ +++-
REP 2057 polyAG PS - - - - ++ +++ +++
PII = phosphodiesterase II, S1 = S1 nuclease, Exol = Exonuclease 1, PS = all
linkages
phosphorothioated, 2'OMe = all riboses are 2'0 methylated. +++ = no
degradation, ++ = less
than 5-% degradation, -/+ = more than 90% degradation, - = completely degraded
To determine the extent of ON nucleotide composition and modifications on
nuclease
resistance, various 40 base ONs having different nucleotide compositions and
modifications were incubated in the presence of various endo and exonucleases
for 4
hours at 37 C. The degradation of these ONs was assessed by urea-
polyacryamide
gel electrophoresis.
The results of these studies showed that randomer ONs were resistant to all
four
enzymes tested (phosphodiesterase II [Sigma], S1 nuclease [Fermentas], Bal3l
[New
England Biolabs] and exonuclease 1[New England Biolabs]) only when they were
fully
phosphorothioated and fully 2'-O -methylated (see table 15). Omission of any
of these
modifications in randomers resulted in increased sensitivity to one or more of
the
nucleases tested. We noted that the fully phosphorothioated, partially 2'-O -
methylated
randomer (REP 2024) was equivalent in nuclease resistance to REP 2006,
indicated
that 2'-O- methylation may be required on each nucleotide of a
phosphorothioated ON
to achieve the optimal nuclease resistance. However, we noted that the
phosphorothioated 40mer polypyrimidine poly cytosine (poly C, REP 2031) had
equivalent nuclease resistance compared to the fully, phosphorothioated, fully
2'O
methylated randomer (REP 2107).
2.5 These results are significant because the prior art teaches that the
preferred way to
enhance nuclease resistance of phosphorothioated ONs is to add 2'-O -methyl
119.
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
modifications, other 2'- ribose modifications, or other modifications. This
new data
demonstrates that the 2'-O-methyl modification or other 2'-ribose
modifications or any
other modifications are not required to enhance nuclease resistance if the ON
is fully
phosphorothioated and consists of a homopolymer of pyrimidines.
Table 15. Nuclease resistance of various 40 mer ONs
ON sequence modification Nuclease resistance after 4h at 37 C
name PII S1 Bal 31 Exo 1
REP randomer none - - - -
2015
REP randomer PS +++ - ++++ ++++
2006
REP randomer 2'OMe ++++ ++++ - +++
2086
REP randomer PS, 2'OMe ++++ ++++ ++++ ++++
2107
'
2024 randomer P a2mere ++++ - ++++ ++++
REP ol C PS ++++ ++++ ++++ ++++
2031 p y
REP2029 Poly A PS - - ++++ ++++
REP2030 Poly T PS - - ++++ ++++
REP2033 Poly TG PS + - ++++ ++++
REP2055 P01 AC PS + - ++++ ++++
REP2056 P01 TC PS + - ++++ ++++
REP2057 Poly AG PS ++ - ++++ ++++
PII = phosphodiesterase II, S1 = S1 nuclease, Exol = Exonuclease 1, PS = all
linkages
phosphorothioated, 2'OMe = all riboses are 2'O methylated. - = complete
degredation, ++++ = no
degredation, PS = phosphorothioate, 2'OMe = 2'-O-methyl modification of the
ribose.
These results demonstrate that phosphorothioated ONs containing only
pyrimidine
nucleotides, inciuding cytosine and/or thymidine and/or other pyrimidines are
resistant to
low pH and phosphorothioated ONs containing only cytosine nucleotides exhibit
superior nuclease resistance, two important characteristics for oral
administration of an
antiviral ON. Thus, high pyrimidine nucleotide content of an antiviral ON is
advantageous to provide resistance to low pH resistance and high cytosine
content is
advantagaeous to provide improved nuclease resistance. For example, in certain
embodiments, the pyrimidine content of such an oligonucleotide is more than
50%, more
than 60%, or more than 70%, or more than 80%, or, more than 90%, or 100%.
Furthermore, these results show the potential of a method of treatment using
oral
administration of a therapeutically effective amount of at least one
pharmacologically
acceptable ON composed of pyrimidine nucleotides. These results also show the
120
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
potential of ONs containing high levels of pyrimidine nucleotides as a
component of an
antiviral ON formulation.
Example 17. Sequence independent broad spectrum activity of ONs in
vivo.
We show here that a 40 base sequence-independent PS-ON randomer has potent
antiviral activity in six different animal modeis of viral infection (see
table 16). The 40
base PS-ON randomer was introduced to animals by multiple routes of
administration
including subcutaneous, intraperitoneal and aerosol (inhalation). These data
strongly
support the therapeutic potential of sequence independent ONs as broad
spectrum
antivirals.
Table 16. PS-ON randomers have potent broad spectrum in vivo antiviral
activity
Virus (strain) Reduction in viral titer (organ)
(Animal / mode of infection) relative to placebo (route) p-value
Ebola Zaire (Mayinga) 100% survival (n=6) ND
(mouse / IP, lethal model) (intraperitoneal)
Influenza A/HK/68 3.8 log,o (lung) <0.001
(Mouse / IN) (aerosol)
2.67 loglo (spleen) <0.0001
MCMV (Smith) (subcutaneous)
(Mouse / IV) 1.67 logio (spleen)
(intraperitoneal) 0.012
HSV-2 -70% of animals protected from ND
(Mouse / vaginal gel) HSV-2 transmission
Friend's Leukemia Virus 68%(Reduction of infected 0.0084
(Mouse / IV) spienocytes) (subcutaneous)
Respiratory Syncytial Virus (Long) 1.1 loglo (lung) <0.01
(Cotton rat / IN) (aerosol)
ND = not determined
Example 18. Oligonucleotides have antiviral activity in a broad spectrum of
viruses
We show here that a 40 PS-ON randomer has antiviral activity in vitro against
13 viral
families (see table 17).
121
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Table17. PS-ON randomers have broad spectrum in vitro antiviral activity
Family Virus (Strain) Activity Assay Used
IC50 M
HSV-1. (KOS) 0.06 Pla ue reduction
HSV-1 0.2 Inhibition of CPE
Herpesviridae HSV-2 (MS2) 0.1 Pla ue reduction
HSV-2 0.02 Inhibition of CPE
CMV AD169 0.13 Plaque reduction
Human CMV 0.02 Inhibition of CPE
VZV <0.02 Inhibition of CPE
HIV-1 -p24 ELISA
(multiple clinical isolates) 0'1 (in human PBMCs)
Retroviridae HIV-1 (NL4-3) 0.011 Inhibition of CPE
HIV/MLV Chimera 0.014 fluorescence-based
infection assa
Hepadnaviridae HBV 0.007 detection of virions in
the supernatant
Paramyxoviridae RSV (A2) 0.019 inhibition of CPE
Parainfluenza - 3 0.125 plaque reduction
Coronaviridae SARS (Toronto-2) 100 Inhibition of CPE
Ebola Zaire (Mayinga) 0.1 FACS analysis of
Filoviridae infected cells
Marburg (Muskoke) IC99 < I fluorescent plaque
reduction
Arenaviridae Lassa Fever (Josiah) IC99 < 1 reduction of virus in
supernatant
Bunyaviridae Hantavirus (Prospect Hill) IC99 < 10 fluorescent plaque
reduction
vaccinia (WR) -1.5 plaque reduction
Orthopoxviridae vaccinia -0.5 plaque reduction
ectromelia mouse ox -1.5 plaque reduction
West Nile 3.02 inhibition of CPE
(NY-99)
Flaviviridae Yellow Fever 3.47 inhibition of CPE
Dengue -10 plaque reduction
(Den-4)
Togaviridae Western Equine Encephalitis 0.12 inhibition of CPE
Rhabdoviridae Rabies (ERA) IC99 < 1 fluorescent plaque
reduction
Orthomyxoviridae Influenza A -1 la ue reduction
122
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Example 19. In vivo and in vitro anti-influenza activity of PS-ONs
In order to further assess the anti-influenza activity of ONs, REP 2006 was
tested
against different strains of influenza using a hemagluttination assay. REP
2006
displayed a broad spectrum anti-influenza activity as shown in Table 18.
Table 18. Broad spectrum antiviral activity of a REP, 2006 against multiple
strains of
influenza.
Influenza strain Trial 1 IC50 Trial2ICso
mM mM
A/New Caledonia H1 N1 0.014 0.055
A/Taiwan H1N1 0.014 0.055
B/Panama 0.038 0.055
B/Sin a ore 0.038 0.055
A/PR8 H 1 N 1 0.055 0.015
A/HK/68 (H3N2) 0.008 0.0017
ANVSN (H1 N1) 0.038 Not tested
In order to asses the potential of ONs as drugs for the treatment of
influenza, REP 2006
was tested in a mouse model of influenza infection. REP 2006 was prepared at
two
concentrations in water for injection and aerosolized by nebulization where
the outlet
was connected to an Anderson cascade chamber. 20g Balb/c mice were exposed
daily
to aerosolized randomer 1 for 30 minutes using 10mI of REP 2006 at various
concentrations in an aerosol chamber. Mice were intranasally infected with -
100TCID
of influenza A (H3N2, A/Hong Kong/68) and after 4 days of infection, animals
were
sacrificed and lung viral titers were determined by hemagluttination assay.
REP 2006
demonstrated a potent anti-influenza activity in vivo as shown in Table 19.
123
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
Table 19. In vivo efficacy of the REP2006 against influenza A.
Viral titer ANOVA
l0 10/ lung)
Dose Regimen
Treatment mg/mi - SDA
Non-
mg/kg - IP/SC (days) Mean St. dev. Parametric Non-
parametric
Influenza A/HIV68 (n=5) in Balb/c mice
dH2O 0 (SDA) -1,0,1,2 6.6 0.9 NA NA
ribavirin 180 IP -1,0,1,2 3.3 0.6 <0.001 NS
REP 2006 10 SDA -1,0,1,2 2.8 0.9 <0.001 NS
REP 2006 100 (SDA) -1,0,1,2 <2.3 0.0 <0.001 <0.01
Influenza A/HK/68 (n=5) in Balb/c mice
dHZO 0 (SDA) -1,0,1,2 5.8 0.4 NA NA
(SDA) -1,0,1,2 3.9 0.4 <0.001 NS
2X10 SDA ** -1 0,1,2 3.3 0.5 <0.001 <0.01
REP 2006 2X100 SDA ** 1,2 1.1 1.5 <0.001 NS
(IP) 1,2 3.2 0.4 <0.001 NS
20 (SC) 1,2 3.9 0.2 <0.001 NS
SDA = small droplet aerosol, IP = intraperitoneal, SC = subcutaneous)
**indicates two daily doses given 12 hours apart.
5
Example 20. Phosphorothioated polypyrimidine ON exhibits improved antiviral
activity in acidic environment in vivo.
In order to assess the resistance of polypyrimidine ONs to low pH and their
capacity to
10 be active drugs at lower pH in vivo, REP 2031 (PS polyC) was tested in a
HSV-2 vaginal
mouse model. Groups of Female Swiss Webster were administered a 0.1 mi
suspension containing 3 mg of medroxyprogesterone acetate by subcutaneous
injection
7 and 1 days prior to viral challenge, to increase susceptibility to vaginal
HSV-2
infection. The vaginal vault was swabbed twice, first with a moistened type 1
calcium
15 alginate-tipped swab and then with. a dry swab. Animals were treated with
15 NI of
either the candidate solution or a placebo control using a positive
displacement pipetter.
Five minutes later, animals were inoculated by. instillation of 15 NI of a
suspension
containing 10 pfu of HSV-2, strain 186. Vaginal swabs samples were collected
from all
animals on day 2 after inoculation and stored frozen (-80 C) until assayed for
the
20 presence of virus by culture. Mice were evaluated daily up to day 21 after
inoculation,
for evidence of symptomatic infection that can include hair loss and erythema
around
124
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
the perineum, chronic urinary incontinence, hind-limb paralysis, and
mortality. Animals
that did not develop symptoms were defined as infected if virus was isolated
from
vaginal swab samples collected on day 2 after inoculation. Results showed
(Table 20)
that polypyrimidine REP 2031 had an antiviral activity in an acidic
environment, such as
the vagina in this example or the stomach.
Table 20. Vaginal efficacy of ONs against HSV-2
Reduction in viral
Virus (strain) Route of titre (organ)
(Animal / mode of Compound administration and relative to
infection) dosing regimen placebo (logia)
8/12 animals
REP 2006 protected from
(PS -randomer) transmission
Single prophylactic (0/12 in untreated
(186) animals)
(Swiss Webster topical application to
mice/vaginal) vagina
REP 2031 (100mg/ml gel) 12112 animals
(PS-poly C) protected from
transmission
All patents and other references cited in the specification are indicative of
the level of
skill of those skilled in the art to which the invention pertains, and are
incorporated by
reference in their entireties, including any tables and figures, to the same
extent as if
each reference had been incorporated by reference in its entirety
individually.
One skilled in the art would readily appreciate that the present invention is
well adapted
to obtain the ends and advantages mentioned, as well as those inherent
therein. The
methods, variances, and compositions described herein as presently
representative of
preferred embodiments are exemplary and are not intended as limitations on the
scope
of the invention. Changes therein and other uses will occur to those skilled
in the art,
which are encompassed within the spirit of the invention, are defined by the
scope of the
claims.
It will be readily apparent to one skilled in the art that varying
substitutions and
modifications may be made to the invention disclosed herein without departing
from the
scope and spirit of the invention. For example, variations can be made to
synthesis
125
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
conditions and compositions of the oligonucleotides. Thus, such additional
embodiments are within the scope of the present invention and the following
claims.
The invention illustratively described herein suitably may be practiced in the
absence of
any element or elements, limitation or limitations which is not specifically
disclosed
herein. Thus, for example, in. each instance herein any of the terms
"comprising",
"consisting essentially of' and "consisting of' may be. replaced with either
of the other
two terms. The terms and expressions which have been employed are used as
terms of
description and not of limitation, and there is no intention that in the use
of such terms
and expressions of excluding any equivalents of the features shown and
described or
portions thereof, but it is recognized that various modifications are possible
within the
scope of the invention claimed. Thus, it should be understood that although
the present
invention has been specifically disclosed by preferred embodiments and
optional
features, modification and variation of the concepts herein disclosed may be
resorted to
by those skilled in the art, and that such modifications and variations are
considered to
be within the scope of this invention as defined by the appended claims.
In addition, where features or aspects of the invention are described in terms
of
Markush groups or other grouping of alternatives, those skilled in the art
will recognize
that the invention is also thereby described in terms of any individual member
or
subgroup of members of the Markush group or other group.
.20 Also, unless indicated to the contrary, where various numberical values
are provided for
embodiments, additional embodiments are described by taking any 2 different
values as
the endpoints of a range. Such ranges are also within the scope of the
described
invention.
Thus, additional embodiments are within the scope of the invention and within
the
following claims.
126
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
TABLE 21 - DESCRIPTION OF OLIGONUCLEOTIDES
REP 1001 20mer from human autonomously replicating sequence
SEQUENCE TTGATAAATAGTACTAGGAC J(SEQ ID N0:1)
PS =000000000000000000=
REP 2001 22mer from HSV-1 origin of replication
SEQUENCE GAAGCGTTCGCACTTCGTCCCA (SEQ ID N0:2)
PS =~~~~~~~~~~~~~~~~~~~~=
REP 3007 16mer from pUC19/pBR322 origin of replication
SEQUENCE CTTGCGGTATTCGGAA (SEQ ID N0:3)
PS =~~~~~~~~~~~~~~=
REP 2002 5mer randomer
SEQUENCE NNNNN
PS =~~~~
REP 2032 6mer randomer
SEQUENCE NNNNNN
PS =~~~~=
REP 2003 10mer randomer
SEQUENCE NNNNNNNNNN.
PS =~~~~~~~~=
REP 2009 12mer randomer
SEQUENCE NNNNNNNNNNNN
PS =~~s~~~~~~~=
REP 2010 14mer randomer
SEQUENCE NNNNNNNNNNNNNN
PS =~~~~~~~~~~~~=
REP 2011 16mer randomer
SEQUENCE NNNNNNNNNNNNNNNN
PS =00000000000000=
REP 2012 18mer randomer
SEQUENCE NNNNNNNNNNNNNNNNNN
PS =~~~~~~~~~~~~~~~~~
127
RECTIFIED SHEET (RULE 91)
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
u L - 1 L. A
REP 2004 20mer randomer
SEQUENCE NNNNNNNNNNNNNNNNNNNN
PS 0000000000*000000000
REC'D 2 8 DEC 2005
REP 2005 30mer randomer W~P~ PCT
SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
PS =~~~~~~~~~~~~~~~~~~~~~~~~~~~~=
REP 2006 40mer randomer
SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
PS =~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~=
REP 2007 80mer randomer
SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 60
PS =~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~=
SEQUENCE NNNNNNNNNNNNNNNNNNNN 80
PS =~~~~~~~~~~~~~~~~~~=
REP 2008 120mer randomer
SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 60
PS 000000900000000000000000000000000000000000000000000000000000
SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 120
PS 00000000000000000000000000000000*000000000000000000000000000
REP 2013 lOmer randomer
SEQUENCE NNNNNNNNNN
no modification
REP 2014 20mer randomer
SEQUENCE NNNNNNNNNNNNNNNNNNNN
no modification
REP 2015 .40mer randomer
SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
no modification
REP 2016 lOmer random sequence
SEQUENCE TCCGAAGACG (SEQ ID N0:4)
PS =000000000
128
SUBSTITUTE SHEET (RULE 26)
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
V ,4 v~.vL... ....
REP 2017 20mer random sequence
SEQUENCE ACACCTCCGAAGACGATAAC (SEQ ID N0:5)
PS o0000000000000000000
REP 2018 40mer random sequence
SEQUENCE CTACAGACATACACCTCCGAAGACGATAACACTAGACATA (SEQ ID N0:6)
PS o000000000000000000000000000000000000000
REP 2019 lOmer sequence centered around start codon of HSV-1 IE110 protein
(NCBI accession # X04614)
SEQUENCE CCCCCKTGGA (SEQ ID N0:7)
PS o000000000
REP 2020 20mer sequence centered around start codon of HSV-1 IE110 protein
(NCBI accession # X04614)
SEQUENCE TACGACCCCCATGGAGC C (SEQ ID N
PS o0000000000000000000
REP 2021 40mer sequence centered around start codon of HSV-1 IE110 protein
(NCBI accession # X04614)
SEQUENCE TCCAGCCGCATACGACCCCCA G AGCCCCGCCCCGG C(SEQ ID N0:9)
PS o000000000000000000000000000000000000000
REP 2024 40mer randomer
SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
PS o000000000000000000000000000000000000000
2-0 Me 0000 =~~=
REP 2026 40mer randomer
SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
PCH3 0000 0000
REP 2036 21mer commercially marketed antisense against CMV
(vitravine/fomvirisen) SYNTHESIZED INTERNALLY
SEQUENCE GCGTTTGCTCTTCTTCTTGCG (SEQ ID N0:10)
PS o00000000000000000000
129
RECTIFIED SHEET (RULE 91)
CA 02584207 2007-04-13
WO 2006/042418 PCT/CA2005/001623
V/G/ L/V.VLIIILJLII LvVJ u'- 1 L. 4J
REP 2107 40mer RNA randomer
SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN, (SEQ ID N0:27)
PS =~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~=
2-0 Me =~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~=
REP 2086 40mer RNA randomer
SEQUENCE NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN (SEQ ID N0:28)
2-0 Me =~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~=
129c
SUBSTITUTE SHEET (RULE 26)
A!f:..... r.t~rb: ..e-ao- _-- ..., ,..,,._ ......... ..... - ---_. . . .
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 130
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 130
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME:
NOTE POUR LE TOME / VOLUME NOTE:
