Note: Descriptions are shown in the official language in which they were submitted.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 74
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 74
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME:
NOTE POUR LE TOME / VOLUME NOTE:
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
COMPOSITIONS AND METHODS FOR DETECTING, AMPLIFYING, AND/OR
ISOLATING NUCLEIC ACIDS
This application claims priority to U.S. Provisional Patent Application Nos.
60/695,407, filed July 1, 2005, and 60/705,167, filed August 4, 2005.
[001] The invention relates generally to the field of molecular biology.
Certain embodiments of the invention provide compositions, methods, and kits
for
detecting, amplifying, and/or isolating a target nucleic acid sequence in a
sample.
[002] Nucleic acids, such as deoxyribonucleic acid (DNA) and ribonucleic
acid (RNA), are large macromolecules comprised of covalently linked nucleotide
subunits. Nucleic acids encode and transmit from generation to generation the
genetic blueprint of all biological organisms including all multi-cellular
organisms
such as animals and plants, unicellular organisms such as yeast and bacteria,
and
cellular parasites such as viruses. Nucleic acid sequence analysis can be used
to
aid in understanding both an organism's phenotypic traits as well as the
biochemical processes underlying a given trait. Thus, detecting, amplifying,
isolating, and sequencing specific nucleic acid sequences provides a first
step in
gaining insight into many normal or pathological biological process.
[003] A variety of techniques suitable for detecting nucleic acid sequences
have been described (See, e.g., Lodish et al., 2000, Molecular Cell Biology.
4th
ed. New York: W. H. Freeman & Co). Laboratory techniques that amplify a target
nucleic acid sequence allow the skilled artisan to accomplish many different
tasks
with the target sequence. These tasks include detecting minute quantities of
the
target sequence in a sample, sequencing the target sequence, as well as
obtaining sufficient quantities of the target sequence to facilitate joining
various
nucleic acid sequences via cloning techniques.
[004] The polymerase chain reaction (PCR) can be used to amplify a target
nucleic acid sequence. See, e.g., U.S. Patent Nos. 4,683,195; 4,683,202; and
4,800,159. While PCR is useful, the method is not without its shortcomings.
The
reagents used in PCR are typically mixed together just prior to performing the
reaction, requiring multiple pipetting steps that can aerosolize reagents and
sample DNA sequences. Because of the exponential amplification of a target
nucleic acid molecule, PCR is highly sensitive. Minute quantities of
contaminating
-1-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
DNA can undermine the results obtained after amplification by providing false
positive signals. The more each reaction tube is manipulated in the process of
setting up a PCR reaction, the more likely such contaminating DNA will be
introduced into the reaction tube either via contaminated pipette tips or
contaminated PCR reagent solutions.
[005] Thus, there is a need to provide a convenient method to amplify,
detect, and/or sequence a target nucleic acid in a sample, while minimizing
the
effects of human error that result from pipetting errors and PCR reagents
contaminated with foreign DNA. There is also a need to provide PCR reagents
that are stable over a wide range of physical conditions such as temperature.
Stability of the reagents over a wide temperature range can permit reagents to
be
shipped and stored with relative ease and can provide a more economical way of
performing PCR. There is also a need for a more rapid, less labor intensive
means of isolating the target nucleic acid after amplification. In certain
embodiments, the present invention fulfills each of these needs.
SUMMARY OF THE INVENTION
[006] - The invention includes compositions that can be used for amplifying,
detecting, and/or isolating a target nucleic acid sequence in a sample, by
providing a single formulation containing all reagents necessary for a PCR
reaction, except for the sample target nucleic acid sequence or its
complement, in
a single container. The compositions of the invention can also comprise a
solid
support to which the PCR product can be attached after amplification. The
solid
support can facilitate rapid isolation and detection of PCR products. The
invention
includes compositions that can be used for sequencing a target nucleic acid
sequence in a sample, by providing a single formulation containing all
reagents
necessary for a PCR sequencing reaction, except for the sample target nucleic
acid sequence, in a single container. The invention also includes dry
compositions that can be used for detecting, amplifying, and/or isolating a
target
nucleic acid sequence, thereby enhancing the stability and shelf life of the
composition. The invention also includes methods of detecting, amplifying,
and/or
isolating a target nucleic acid sequence in a sample, methods of sequencing a
-2-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
target nucleic acid sequence in a sample, and methods of making the
compositions of the invention. The invention further includes kits useful for
detecting, amplifying, isolating, and/or sequencing a target nucleic acid
sequence
in a sample.
[007] In some embodiments, the invention provides a composition for
detecting, amplifying, and/or isolating a target nucleic acid sequence
comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing with a first part of the
target nucleic acid sequence;
(i) a second oligonucleotide capable of hybridizing with a nucleic acid
sequence complementary to a second part of the target nucleic acid
sequence; and
(j) a third oligonucleotide linked to the at least one solid support and is
capable of hybridizing with a third part of
(1) the target nucleic acid sequence; or
(2) a nucleic acid sequence complementary to the target
nucleic acid sequence;
wherein at least one of (b) the at least one nucleoside triphosphate, (h) the
first
oligonucleotide, and (i) the second oligonucleotide is modified with a label;
and
wherein the composition does not comprise the target nucleic acid sequence or
its
complement.
[008] In some embodiments, the invention provides a composition for
detecting, amplifying, and/or isolating a target nucleic acid sequence
comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
-3-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support modified with a first member of a pair of
binding partners;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of the
target nucleic acid sequence or a sequence that is complementary
to the target nucleic acid sequence; and
(i) a second oligonucleotide capable of hybridizing to a second part of
the target nucleic acid sequence or a sequence that is
complementary to the target nucleic acid sequence and comprising
a second member of the pair of binding partners;
wherein at least one of (b) the at least one nucleoside triphosphate and (h)
the
first oligonucleotide is modified with a label, wherein if the first
oligonucleotide is
capable of hybridizing to the target nucleic acid sequence then the second
oligonucleotide is capable of hybridizing to the complement of the target
nucleic
acid sequence, wherein if the first oligonucleotide is capable of hybridizing
to the
complement of the target nucleic acid sequence-then the second oligonucleotide
is capable of hybridizing to the target nucleic acid sequence, and wherein the
composition does not comprise the target nucleic acid sequence or its
complement.
[009] In some embodiments, the invention provides a composition for
detecting, amplifying, and/or isolating a target nucleic acid sequence
comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support which can be linked to a linker substance;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of
-4-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
the target nucleic acid sequence or a sequence that is
complementary to the target nucleic acid sequence; and
(i) a second oligonucleotide capable of hybridizing to a second part of
the target nucleic acid sequence or a sequence that is
complementary to the target nucleic acid sequence and comprising
the linker substance;
wherein at least one of (b) the at least one nucleoside triphosphate and (h)
the
first oligonucleotide is modified with a label, wherein the second
oligonucleotide is
not linked to the solid support until the target nucleic acid sequence has
been
amplified, wherein if the first oligonucleotide is capable of hybridizing to
the target
nucleic acid sequence then the second oligonucleotide is capable of
hybridizing to
the complement of the target nucleic acid sequence, wherein if the first
oligonucleotide is capable of hybridizing to the complement of the target
nucleic
acid sequence then the second oligonucleotide is capable of hybridizing to the
target nucleic acid sequence, and wherein the composition does not comprise
the
target nucleic acid sequence or its complement.
[010] In some embodiments, the invention provides a composition for
detecting, amplifying, and/or isolating N target nucleic acid sequences
corrmprising:__
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the ith first oligonucleotide is
capable of hybridizing with a first part of the ith target nucleic acid
sequence;
(i) N second oligonucleotides, wherein the ith second oligonucleotide is
capable of hybridizing with a nucieic acid sequence complementary
to a second part of the ith target nucleic acid sequence; and
-5-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(j) N third oligonucleotides, wherein the ith third oligonucleotide is linked
to the it" discrete area on the at least one solid support and is
capable of hybridizing with a third part of
(1) the ith target nucleic acid sequence; or
(2) a nucleic acid sequence complementary to the it"
target nucleic acid sequence;
wherein N is a integer greater than or equal to 1; wherein it" represents in
turn all
integers between 1 and N, including both 1 and N, and is used to designate
target-nucleic-acid-specific elements of the composition; wherein at least one
of
(b) the at least one nucleoside triphosphate, (h) the ith first
oligonucleotide, and (i)
the ith second oligonucleotide is modified with a label; and wherein the
composition does not comprise the target nucleic acid sequence or its
complement.
[011] In some embodiments, the invention provides a composition for
detecting, amplifying, and/or isolating N target nucleic acid sequences
comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) - at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas, wherein the
it" discrete area is modified with an ith first member of a pair of
binding partners;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the ith first oligonucleotide is
capable of hybridizing to a first part of the ith target nucleic acid
sequence or a sequence that is complementary to the it" target
nucleic acid sequence; and
(i) N second oligonucleotides, wherein the ith second oligonucleotide is
capable of hybridizing to a second part of the ith target nucleic acid
sequence or a sequence that is complementary to the ith target
-6-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
nucleic acid sequence and comprises an ith second member of the
pair of binding partners;
wherein N is a integer greater than or equal to 1; wherein ith represents in
turn all
integers between 1 and N, including both 1 and N, and is used to designate
target-nucleic-acid-specific elements of the composition; wherein at least one
of
(b) the at least one nucleoside triphosphate and (h) the first oligonucleotide
is
modified with a label; wherein if the first oligonucleotide is capable of
hybridizing
to the target nucleic acid sequence then the second oligonucleotide is capable
of
hybridizing to the complement of the target nucleic acid sequence, wherein if
the
first oligonucleotide is capable of hybridizing to the complement of the
target
nucleic acid sequence then the second oligonucleotide is capable of
hybridizing to
the target nucleic acid sequence, and wherein the composition does not
comprise
the target nucleic acid sequence or its complement.
[012] In some embodiments, the invention provides a method of making a
composition for detecting, amplifying, and/or isolating a target nucleic acid
sequence comprising:
(1) obtaining the following:
(a) - at least one polymerase; -
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing with a first part of
the target nucleic acid sequence;
(i) a second oligonucleotide capable of hybridizing with a nucleic
acid sequence complementary to a second part of the target
nucleic acid sequence; and
(j) a third oligonucleotide linked to the at least one solid support
and is capable of hybridizing with a third part of
(1) the target nucleic acid sequence; or
-7-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(2) a nucleic acid sequence complementary to the target
nucleic acid sequence;
wherein at least one of (b) the at least one nucleoside triphosphate,
(h) the first oligonucleotide, and (i) the second oligonucleotide is
modified with a label; and wherein the composition does not
comprise the target nucleic acid sequence or its complement; and
(2) combining (a) -(j) in a container thereby forming a composition for
detecting, amplifying, and/or isolating the target nucleic acid
sequence.
[013] In some embodiments, the invention provides a method of making a
composition for detecting, amplifying, and/or isolating a target nucleic acid
sequence comprising:
(1) obtaining the following:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support modified with a first member of a
pair of binding partners;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of
the target nucleic acid sequence or a sequence that is
complementary to the target nucleic acid sequence; and
(i) a second oligonucleotide capable of hybridizing to a second
part of the target nucleic acid sequence or a sequence that is
complementary to the target nucleic acid sequence and
comprising a second member of the pair of binding partners;
wherein at least one of (b) the at least one nucleoside triphosphate
and (h) the first oligonucleotide is modified with a label, wherein if
the first oligonucleotide is capable of hybridizing to the target nucleic
acid sequence then the second oligonucleotide is capable of
-8-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
hybridizing to the complement of the target nucleic acid sequence,
wherein if the first oligonucleotide is capable of hybridizing to the
complement of the target nucleic acid sequence then the second
oligonucleotide is capable of hybridizing to the target nucleic acid
sequence, and
wherein the composition does not comprise the target nucleic acid
sequence or its complement; and
(2) combining (a) - (i) in a container thereby forming a composition for
detecting, amplifying, and/or isolating a target nucleic acid
sequence.
[014] In some embodiments, the invention provides a method of making a
composition for detecting, amplifying, and/or isolating a target nucleic acid
sequence in a sample comprising:
(1) obtaining the following components:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support which can be linked to a linker
substance;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of
the target nucleic acid sequence or a sequence that is
complementary to the target nucleic acid sequence; and
(i) a second oligonucleotide capable of hybridizing to a second
part of the target nucleic acid sequence or a sequence that is
complementary to the target nucleic acid sequence and
comprising the linker substance;
wherein at least one of (b) the at least one nucleoside triphosphate
and (h) the first oligonucleotide is modified with a label, wherein the
second oligonucleotide is not linked to the solid support until the
-9-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
target nucleic acid sequence has been amplified, wherein if the first
oligonucleotide is capable of hybridizing to the target nucleic acid
sequence then the second oligonucleotide is capable of hybridizing
to the complement of the target nucleic acid sequence, wherein if
the first oligonucleotide is capable of hybridizing to the complement
of the target nucleic acid sequence then the second oligonucleotide
is capable of hybridizing to the target nucleic acid sequence, and
wherein the composition does not comprise the target nucleic acid
sequence or its complement; and
(2) combining (a) - (i) in a single container thereby forming a
composition for detecting, amplifying, and/or isolating a target
nucleic acid sequence.
[015] In some embodiments, the invention provides a method of making a
composition for detecting, amplifying, and/or isolating N target nucleic acid
sequences comprising:
(1) obtaining the following:
(a) at least one polymerase;
(b) at least one -nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the ith first oligonucleotide is
capable of hybridizing with a first part of the ith target nucleic
acid sequence;
(i) N second oligonucleotides, wherein the ith second
oligonucleotide is capable of hybridizing with a nucleic acid
sequence complementary to a second part of the ith target
nucleic acid sequence; and
-10-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
wherein at least one of (b) the at least one nucleoside
triphosphate, (h) the it" first oligonucleotide, and (i) the itn
second oligonucleotide is modified with a label; and
(j) N third oligonucleotides, wherein the it" third oligonucleotide is
linked to the it" discrete area on the at least one solid support
and is capable of hybridizing with a third part of
(1) the ith target nucleic acid sequence; or
(2) a nucleic acid sequence complementary to the itn
target nucleic acid sequence,
(2) linking the ith third oligonucleotide to the ith discrete area on the at
least one solid support; and
(3) combining (a) -(j) in a container thereby forming a composition for
detecting, amplifying, and/or isolating N target nucleic acid
sequences;
wherein N is a integer greater than or equal to 1; wherein ith represents in
turn all
integers between 1 and N, including both 1 and N, and is used to designate
target-nucleic-acid-specific elements of the composition; and wherein the
composition does not comprise the target nucleic acid sequence or its-
complement.
[016] In some embodiments, the invention provides a method of making a
composition for detecting, amplifying, and/or isolating N target nucleic acid
sequences comprising:
(1) obtaining the following:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas,
wherein the ith discrete area is modified with an it" first
member of a pair of binding partners;
(g) at least one cryoprotectant;
-11-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(h) N first oligonucleotides, wherein the ith first oligonucleotide is
capable of hybridizing to a first part of the ith target nucleic
acid sequence or a sequence that is complementary to the itn
target nucleic acid sequence; and
(i) N second oligonucleotides, wherein the ith second
oligonucleotide
is capable of hybridizing to a second part of the ith target
nucleic acid sequence or a sequence that is complementary
to the ith target nucleic acid sequence and comprises an itn
second member of the pair of binding partners;
wherein N is a integer greater than or equal to 1; wherein ith
represents in turn all integers between I and N, including
both 1 and N, and is used to designate target-nucleic-acid-
specific elements of the composition; wherein at least one of
(b) the at least one nucleoside triphosphate and (h) the first
oligonucleotide is modified with a label; wherein if the first
oligonucleotide is capable of hybridizing to the target nucleic
acid sequence then the second oligonucleotide is capable-of
hybridizing to the complement of the target nucleic acid
sequence, wherein if the first oligonucleotide is capable of
hybridizing to the complement of target nucleic acid sequence
then the second oligonucleotide is capable of hybridizing to
the target nucleic acid sequence, and wherein the
composition does not comprise the target nucleic acid
sequence; and
(2) combining (a) -(i) in a container thereby forming a composition for
detecting, amplifying, and/or isolating N target nucleic acid
sequences.
[017] In certain embodiments, the method of the invention can comprise
freeze-drying the composition for detecting, amplifying, and/or isolating a
target
nucleic acid sequence. In certain embodiments, the method of the invention can
-12-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
comprise lyophilizing the composition for detecting, amplifying, and/or
isolating a
target nucleic acid sequence.
[018] In various embodiments, the invention provides a method of detecting,
amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining a first composition for detecting, amplifying, and/or
isolating a target nucleic acid sequence produced by the method of
paragraph [012] or [013];
(2) adding a sample containing the target nucleic acid sequence to the
first composition to form a second composition;
(3) alternately heating and cooling the second composition so that
multiple copies of the target nucleic acid sequence are made;
(4) optionally isolating the multiple copies of the target nucleic acid
sequence from step (3); and
(5) optionally detecting the label thereby detecting the target nucleic
acid in the sample.
[019] In certain embodiments, the method of detecting, amplifying, and/or
isolating a target nucleic acid sequence can comprise freeze-drying or
lyophilizing
the composition -of step (1) before performing steps 2-5.
[020] In some embodiments, the invention provides a method of detecting,
amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining a first composition for detecting, amplifying, and/or
isolating a target nucleic acid sequence produced by the method of
paragraph [014];
(2) adding a sample containing the target nucleic acid sequence to the
first composition to form a second composition;
(3) alternately heating and cooling the second composition so that
multiple copies of the target nucleic acid sequence can be made;
(4) linking the second oligonucleotide to the solid support;
(5) optionally isolating the multiple copies of the target nucleic acid
sequence from step (3); and
(6) optionally detecting the label thereby detecting the target nucleic
acid in the sample.
-13-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
[021] In some embodiments, the invention provides a method of detecting,
amplifying, and/or isolating a N target nucleic acid sequences comprising:
(1) obtaining a first composition of paragraph [010] or [011];
(2) adding a sample which may contain the N target nucleic acid
sequences to the first composition to form a second composition;
(3) alternately heating and cooling the second composition such that
multiple copies of each of the N target nucleic acid sequences that
are in the sample are made;
(4) allowing the multiple copies to link to the N discrete areas on the at
least one solid support; and
(5) optionally detecting or isolating the label thereby detecting the N
target nucleic acid sequences in the sample;
wherein N is an integer greater than or equal to 1.
[022] The invention can also provide kits that can be used to carry out the
methods for detecting, amplifying, and/or isolating a target nucleic acid
sequence
according to the invention.
[023] The foregoing general description and the following detailed
description -are exemplary and explanatory only and are not restrictive of the
---
invention as claimed.
BRIEF DESCRIPTION OF THE DRAWINGS
[024] Figure 1 is a graph showing the relationship between the starting
concentration of Bacillus anthracis (B. anthracis) DNA and the
electrochemiluminescent signal detected after PCR amplification of the B.
anthracis DNA. The symbols represent averages of duplicate measurements and
the line is a mathematical curve fit to the measurements.
[025] Figure 2 is a graph showing the electrochemiluminescent signal
generated over time, after PCR amplification of a reconstituted dry
composition to
which B. anthracis genomic DNA was added. Three portions of the genomic B.
anthracis DNA (chromosomal locus BA4070, protective antigen, and capsular
protein B) were measured at two quantities (100 fg and 5 pg of B. anthracis
DNA)
at three times (A. 1 day and 7 days post lyophilization) (B. 28 days post
-14-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
lyophilization). The bars represent the averages of triplicate measurements.
The
error bars represent I standard deviation of the triplicates.
[026] Figure 3 is a graph showing the relationship of the
electrochemiluminescent signal and copy number of Severe Acute Respiratory
Syndrome (SARS) coronavirus after reverse transcriptase and PCR amplification
using premixed reagents. The circle symbols represent averages of duplicate
measurements for compositions that were kept in liquid form and used the same
day the composition was made. The plus symbols represent averages of
duplicate measurements for compositions that were lyophilized to form a dry
composition and used after the dry composition was stored for 5 days at room
temperature. At the RNA copy number near 2,000 particles, the liquid and dry
composition measurements overlap. The line is a mathematical curve fit to the
dry composition measurements.
DETAILED DESCRIPTION OF THE INVENTION
[027] In certain embodiments, the invention provides a composition
comprising premixed reagents for amplifying or detecting a target nucleic acid
sequence in a-sample: In- other embodiments, the invention also provides a--
means for isolating a target nucleic acid sequence. The composition of the
invention can avoid (1) the potential inaccuracies due to measuring errors
that
arise when adding each component separately and (2) the risk of component
contamination with foreign nucleic acids that increases with the number of
times
pipette tips are introduced into each component solution. In addition, the
composition of the invention can be more convenient to use. All components
necessary for detecting, amplifying, and/or isolating a nucleic acid sequence,
except the sample itself, can be inside a single container.
[028] The invention also provides a method of making the composition of
the invention as well as a method of detecting, amplifying, and/or isolating a
target
nucleic acid sequence in a sample. The composition of the invention can be
part
of a kit that is useful for detecting, amplifying, and/or isolating a target
nucleic acid
sequence in a sample.
-15-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
1. Definitions
[029] The term "hybridize" refers to the binding between complementary
oligonucleotides and/or polynucleotides. When two molecules hybridize, they
form a combination of the two molecules through complementary base pairing.
Oligonucleotides can hybridize to oligonucleotides or polynucleotides under a
variety of circumstances. For example, an oligonucleotide can hybridize to a
target sequence or to the complement of a target sequence during a PCR
reaction. In this situation, an oligonucleotide is "capable of hybridizing" to
the
target nucleic acid sequence or its complement under salt and temperature
conditions used for target sequence amplification. A portion of an
oligonucleotide
can also hybridize to a second oligonucleotide in the process of linking the
oligonucleotide to a solid support. For example, a solid support can have
polyA
oligonucleotides 10 residues long covalently attached to the solid support
allowing
an oligonucleotide with 10 thymidine residues at its end to be linked to the
solid
support via hybridization. In this situation, an oligonucleotide is "capable
of
hybridizing" under salt and temperature conditions used for linking an
oligonucleotide to a solid support. An oligonucleotide can also hybridize to a
target sequence to capture or isolate the target sequence. In this situation,
an
oligonucleotide is "capable of hybridizing" under salt and temperature
conditions
used for capturing or isolating a target nucleic acid sequence. The skilled
artisan
can readily determine the appropriate hybridization temperature to capture a
target sequence, given the length of the capture oligonucleotide, the C/G
content
of the oligonucleotide, and the salt concentration of the hybridization
reaction.
[030] The term "complementary" refers to nucleotides that form base pairs.
For example, adenine is complementary to thymidine, adenine is complementary
to uracil, and cytosine is complementary to guanine. Each strand of a double-
stranded oligonucleotide or polynucleotide is complementary when at each
nucleotide position the nucleotides from each strand form base pairs.. The
term
"sufficiently complementary" refers to two sequences that, though they are not
exact complements, can hybridize with each other under a set of hybridization
conditions. For example, one strand can be longer than the other, but still
have
base pairs form at enough positions to result in hybridization. In another
example,
-16-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
the two strands can be the same length and not form base pairs at every
position,
but enough base pairs are formed to result in hybridization. Factors including
the
length of a sequence, the number of G and C residues the sequence has, the
salt
concentration of the hybridization reaction, and the temperature of the
hybridization reaction can determine how much nucleotide mismatching can be
present and still result in hybridization between two sufficiently
complementary
sequences. Appropriate hybridization conditions can be selected by those
skilled
in the art with minimal experimentation as exemplified in Dieffenbach, C.W and
Dvksler, G.S. (1995) PCR primer: a laboratory manual. CSHL press, Cold Spring
Harbor, USA or PCR Protocols: A Guide to Methods and Applications, Innis, M.A.
et al. eds., Academic Press, San Diego, USA 1990. For example, sufficiently
complementary sequences can hybridize to each other at 60 C in the presence of
1.5 mM Mg2+ and 50 mM Na+.
[031] The term "primer" refers to an oligonucleotide that is capable of
hybridizing to a target nucleic acid sequence and allowing the synthesis of a
complementary strand. The term "forward primer" refers to a primer that can
hybridize with the non-coding strand of a DNA molecule. The term "reverse
primer" refers to a-primer-that can hybridize with the coding strand of a DNA-
-
molecule.
[032] The term "oligonucleotide" refers to a molecule comprising nucleotides
or nucleic acid analogs that is less than 100 nucleotides in length. The term
"capture oligonucleotide" refers to an oligonucleotide that tethers an
amplified
target nucleic acid sequence to a solid support. The term "poly A tail" refers
to a
series of adenine nucleotides added to the end of the oligonucleotide. The
term
"poly T tail" refers to a series of thymidine nucleotides added to the end of
the
oligonucleotide. The term "poly A oligonucleotide" refers to an
oligonucleotide
containing only adenine residues. The term "poly T oligonucleotide" refers to
an
oligonucleotide containing only thymidine residues. The terms "poly G tail,"
"poly
U tail," "poly C tail," "poly G oligonucleotide," "poly U oligonucleotide,"
and "poly C
oligonucleotide" are similarly defined.
[033] The term "polynucleotide" refers to a molecule comprising nucleotides
or nucleotide analogs that is 100 nucleotides or greater in length.
-17-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
[034] The term "target nucleic acid sequence" or "target sequence" refers to
a compound comprising nucleic acids or nucleic acid analogs ordered in a
sequence, wherein the compound is sought to be detected, amplified, or
isolated
in a sample. If a nucleic acid is double-stranded, the target nucleic acid
sequence
can be either one of the strands.
[035] The term "nucleic acid" refers to a nucleotide sequence-containing
oligomer or polymer having a backbone formed solely from naturally occurring
nucleotides. The term "nucleic acid analog" means an oligomer or polymer
comprising at least one modified nucleotide or subunits derived directly from
a
modification of nucleotides and/or at least one nucleotide analog.
[036] The term "nucleic acid analog" also refers to synthetic molecules that
can bind to a target nucleic acid sequence or to the complement of a target
nucleic acid sequence. For example, a nucleic acid analog can be comprised of
ribo or deoxyribo nucleotides, modified nucleotides, and/or nucleotide
analogs.
The term "nucleotide analog" refers to a synthetic moiety that can be used in
place
of a natural nucleotide or a modified nucleotide.
[037] The term "nucleoside triphosphate" or "nucleotide" refers to a
nitrogenous base such as a purine or a pyrimidine that can be covalently bound
to
a sugar molecule such as ribose or deoxyribose that can be covalently bound to
3
phosphate groups. Nucleoside triphosphates can encompass both ribonucleoside
and deoxyribonucleoside triphosphates. The term "modified nucleotide" refers
to
a nucleotide that has been chemically modified.
[038] The term "polymerase," as used herein, refers to an enzyme that
catalyzes a reaction between chemical moieties to form larger molecules. For
example, a polymerase can catalyze the polymerization of nucleotides to form
polynucleotides. Nucleic acid polymerases can catalyze the reaction between
nucleoside triphosphates to form linear nucleic acid molecules linked together
by
phosphodiester bonds. The term "processivity" refers to the number of
nucleotides a polymerase can add to a growing nucleic acid chain before the
enzyme falls off of the template-substrate complex.
-18-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
[039] The term "polymerization" refers to the process of chemically
connecting smaller subunits to form a larger molecule. For example, the
polymerization of nucleotides can result in formation of a polynucleotide.
[040] The term "buffering agent" refers to a reagent that can reduce
changes to the concentration of free hydrogen ions in a solution, and thus can
maintain a particular pH or pH range.
[041] The term "cryoprotectant" refers to a compound or composition that
can protect the activity of a biologically active molecule or a reagent during
freezing, drying, and/or reconstitution of the dried substance. The term
"freeze-
dry" refers to rapid freezing and subsequently drying a substance in a vacuum.
The term "lyophilized" or "lyophilization" refers to drying a substance by
freezing it
in a high vacuum or to removing water from a frozen substance by sublimation
under lowered pressure. The terms "lyophilize" and "freeze-dry" are used
interchangeably throughout this specification. Sublimation refers to the
process
by which a solid evaporates without passing through a liquid phase.
[042] Cations can provide a means for neutralizing the negative charges
associated with nucleic acids. Cations useful in the invention can be
monovalent
and divalent cations. The term "monovalent cation" refers to an ion with a net
positive charge of 1. The term "divalent cation" refers to an ion with a net
positive
charge of 2.
[043] The term "linked" or "linking" refers to an association between two
moieties. For example, hybridization can be a form of linking in that it
involves the
association of complementary oligonucleotides and/or polynucleotides.
[044] The term "pair of binding partners" refers to a first entity that can
bind
to a second entity. In general, such complexes are characterized by a
relatively
high affinity and a relatively low to moderate capacity. Nonspecific binding
can
have a low affinity with a moderate to high capacity.
[045] The term "solid support" refers to any material that can be linked to an
oligonucleotide capable of hybridizing to a target nucleic acid sequence.
[046] The term "label" refers to a moiety, molecule, or collection of
molecules that can be attached to an oligonucleotide and/or a polynucleotide,
incorporated into an oligonucleotide and/or a polynucleotide, and/or attached
to a
-19-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
nucleoside triphosphate, wherein the moiety, molecule, or collection of
molecules
can render the polynucleotide, oligonucleotide, or nucleoside triphosphate
detectable by an instrument or method. In some embodiments, labels are capable
of generating, modifying or modulating a detectable signal either directly or
indirectly.
[047] The term "ECL moiety" refers to any compound that can be induced to
repeatedly emit electromagnetic radiation by exposure to an efectrochemical
energy source. Representative ECL moieties are described in Electrogenerated
Chemiluminescence, Bard, Editor, Marcel Dekker, (2004); Knight, A and
Greenway, G. Analyst 119:879-890 1994; and in U.S. Patent Nos. 5,221,605;
5,591,581; 5,858,676; and 6,808,939.
[048] The tem "ECL coreactant," as used herein, pertains to a chemical
compound that either by itself or via its electrochemical reduction or
oxidation
product(s), plays a role in the ECL reaction sequence. Often ECL coreactants
can
permit the use of simpler means for generating ECL (e.g., the use of only half
of
the double-step oxidation-reduction cycle) and/or improved ECL intensity.
[049] The term "container" refers to a vessel that is suitable for carrying
out
a DNA polymerization reaction.
[050] The term "thermostable" refers to the property of being substantially
unaffected by high temperatures. For example, a polymerase can be considered
thermostable if the polymerase maintains at least 50% of its original activity
after 1
hour at 60 C.
[051] The term "dry composition," as used herein, means that the
composition has a moisture content of less than or equal to 5% by weight,
relative
to the total weight of the composition.
[052] The term "liquid-contact," as used herein, refers to the addition of a
liquid to a dry composition, wherein the components of the dry composition are
in
contact with the same liquid. In some embodiments, the liquid is water.
[053] The term "magnetizable bead," as used herein, encompasses
magnetic, paramagnetic, and superparamagnetic beads.
-20-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
[054] The term "and/or", as used herein, means at least one in a series of
alternatives. For example, A, B, and/or C means any of the following: A; B; C;
A
and B; A and C; B and C; A and B and C.
H. Compositions of the Invention
[055] The invention pertains to compositions for amplifying, detecting,
and/or isolating a target nucleic acid sequence in a sample. These
compositions
can provide all reagents necessary for a PCR reaction in a single formulation,
except for the sample target nucleic acid sequence or its complement. In some
embodiments, an end user need only add a target nucleic acid sequence and
possibly water to the composition before beginning amplification of the target
nucleic acid sequence, optimizing consistency between test samples by
minimizing the amount of pipetting needed to prepare a sample. In some
embodiments, at least one of the oligonucleotides present in the compositions
of
the invention serves multiple purposes. For example a single oligonucleotide
can
both prime a PCR reaction and attach the resulting PCR product to a solid
support. Additional examples of multifunctional primers are discussed in the
sections that follow. Finally, the compositions of the invention can be
lyophilized,
thereby improving the composition's stability.
A. Compositions Comprising Two Oligonucleotides
[056] In some embodiments, the composition of the invention can comprise
two oligonucleotides. In these embodiments, one oligonucleotide serves two
functions, to prime the PCR reaction and link the PCR product to a solid
support.
In some embodiments, the other oligonucleotide primes the PCR reaction and
labels the PCR product. In some embodiments, the other oligonucleotide serves
only one function and primes the PCR reaction while the nucleotides that are
incorporated into the PCR product label the PCR product.
[057] An oligonucleotide can be linked to a solid support via a pair of
binding partners. In some embodiments, the invention provides a composition
for
detecting, amplifying, and/or isolating a target nucleic acid sequence
comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
-21-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support modified with a first member of a pair of
binding partners;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of the
target nucleic acid sequence or a sequence that is complementary
to the target nucleic acid sequence; and
(i) a second oligonucleotide capable of hybridizing to a second part of
the target nucleic acid sequence or a sequence that is
complementary to the target nucleic acid sequence and comprising
a second member of the pair of binding partners;
wherein at least one of (b) the at least one nucleoside triphosphate and (h)
the
first oligonucleotide is modified with a label, wherein if the first
oligonucleotide is
capable of hybridizing to the target nucleic acid sequence then the second
oligonucleotide is capable of hybridizing to the complement of the target
nucleic
acid sequence, wherein if-the first oligonucleotide is capable of hybridizing
to the
complement of the target nucleic acid sequence then the second oligonucleotide
is capable of hybridizing to the target nucleic acid sequence, and wherein the
composition does not comprise the target nucleic acid sequence or its
complement.
[058] In certain embodiments, the solid support can comprise a bead
modified with a first member of a pair of binding partners. In certain
embodiments, the bead can be a magnetizable bead. In certain embodiments,
the solid support can comprise magnetizable beads that can be modified with a
first member of a pair of binding partner. In certain embodiments, the solid
support can comprise a bead modified with a first member of a pair of binding
partners wherein the first member comprises an oligonucleotide or a
polynucleotide. In certain embodiments, the solid support can comprise
carboxylated magnetizable beads.
-22-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
[059] In certain embodiments, the second oligonucleotide can be modified
with a second member of the pair of binding partners and either the at least
one
nucleoside triphosphate or the first oligonucleotide can be modified with at
least
one electrochemiluminescent moiety, i.e., ECL moiety. The pair of binding
partners can permit reversible binding between the second oligonucleotide and
the at least one solid support. In some embodiments, the interaction between
the
first member and the second member of a pair of binding partners is (1)
unstable
at temperatures used for amplifying DNA, such that the first and second
members
will not stably bind to each other during the amplification reaction; and (2)
stable at
or below the temperature used for amplifying DNA. For example, binding between
a small number of adenine and thymidine residues is temperature sensitive. In
some embodiments, the solid support can be modified with a poly T tail that is
10,
20, 30, 40, or 50 thymidine residues long or any intermediate length. In some
embodiments, the oligonucleotide primer can have a poly A tail at its 5'-end
that is
10, 20, 30, 40, or 50 adenine residues long or any intermediate length. In
other
embodiments, the poly A tail can be linked to the solid support and the
oligonucleotide primer can have a poly T tail at its 5'-end. In some
embodiments,
the melting-temperature (Tm) of the poly dA or poly dT tail can be at least 10
C
less than the Tm of the PCR primers used. For example, an oligonucleotide
primer can have a poly T tail, wherein the poly T tail has a Tm of 50 C and a
collection of beads could have poly A tails that are the same length as the
primer
poly T tail. This primer and bead could be present together during an
amplification reaction such as PCR and not link to each other during
amplification
because the temperatures used for amplification are higher than 50 C. For
example, a PCR cycle could use temperatures of 95 C for melting, 60 C for
primer hybridization, and 72 C for polymerization. During these temperatures,
the
poly T tail of the primer and the poly A tail of the bead do not interact. But
once
amplification is complete, and the sample cools down to 50 C or less, the poly
T
tail of the primer and the poly A tail of the bead can interact, thereby
attaching the
amplified sequence to the bead.
[060] In some embodiments, the second oligonucleotide can contain one
strand of a restriction endonuclease recognition site that is not contained in
the
-23-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
target nucleic acid sequence. The solid support can be modified with an
oligonucleotide that contains a sufficiently complementary strand of the same
endonuclease recognition site. After amplification of the target nucleic acid
sequence, one strand of the amplified target can be hybridized to the
oligonucleotide linked to the solid support, thereby creating a restriction
endonuclease cleavage site. In certain embodiments, the restriction
endonuclease cleavage can be cleaved allowing the isolation of the amplified
target strand.
[061] An oligonucleotide can also be linked to a solid support via a linker
substance. In such embodiments, the linking oligonucleotide is not linked to
the
solid support until after amplification has occurred. In some embodiments, the
invention provides a composition for detecting, amplifying, and/or isolating a
target
nucleic acid sequence comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least onebuffering agent;
(f) at least one solid support which can be linked to a linker substance;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing to a first part of
the target nucleic acid sequence or a sequence that is
complementary to the target nucleic acid sequence; and
(i) a second oligonucleotide capable of hybridizing to a second part of
the target nucleic acid sequence or a sequence that is
complementary to the target nucleic acid sequence and comprising
the linker substance;
wherein at least one of (b) the at least one nucleoside triphosphate and (h)
the
first oligonucleotide is modified with a label, wherein the second
oligonucleotide is
not linked to the solid support until the target nucleic acid sequence has
been
amplified, wherein if the first oligonucleotide is capable of hybridizing to
the target
nucleic acid sequence then the second oligonucleotide is capable of
hybridizing to
-24-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
the complement of the target nucleic acid sequence, wherein if the first
oligonucleotide is capable of hybridizing to the complement of the target
nucleic
acid sequence then the second oligonucleotide is capable of hybridizing to the
target nucleic acid sequence, and wherein the composition does not comprise
the
target nucleic acid sequence or its complement.
[062] In some embodiments, the second oligonucleotide and the solid
support can be modified with moieties that allow crosslinking to the solid
support.
Such moieties can be, for example, photoactivatable crosslinkers known to the
art.
In certain embodiments, the solid support can comprise a bead.
[063] In some embodiments, the DNA polymerization reaction is a PCR
reaction. In PCR, two primers that hybridize to a sufficiently complementary
member of a specific DNA sequence can be used, thus facilitating the
initiation of
DNA synthesis by the polymerase.
[064] In some embodiments that use two oligonucleotides the first
oligonucleotide is modified with an ECL moiety. In some embodiments that use
two oligonucleotides, the nucleoside triphosphates are modified with an ECL
moiety.
[065] In a more specific exemplary embodiment, the invention provides a
dry composition comprising:
(a) Taq polymerase;
(b) deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-
triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP),
deoxythymidine 5'-triphosphate (dTTP);
(c) potassium chloride;
(d) magnesium chloride;
(e) Tris-HCI;
(f) magnetizable beads covalently linked to the first member of a pair of
complementary oligonucleotides;
(g) trehalose;
(h) a first oligonucleotide labeled with [Ru(bpy)3]2+ or [Ru(sulfo-
bpy)2bpy]2+ and is capable of hybridizing to a first part of the target
nucleic acid sequence; and
-25-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(i) a second oligonucleotide that is capable of hybridizing to a
sequence that is complementary to a second part of the target
nucleic acid sequence and comprising the second member of the
pair of complementary oligonucleotides.
[066] In certain embodiments, the invention provides a dry composition
comprising:
(a) at least one thermostable polymerase;
(b) at least four different nucleoside triphosphates;
(c) at least one salt comprising a monovalent cation;
(d) at least one salt comprising a divalent cation;
(e) at least one buffering agent with an effective buffering capacity in the
pH range of 8.1 to 8.5;
(f) at least one solid support comprising a bead modified with a first
member of a pair of binding partners;
(g) at least one disaccharide;
(h) a first oligonucleotide capable of binding to a first part of the target
nucleic acid sequence; and
(i)- a second oligonucleotide capable of binding to a second part of the
target nucleic acid sequence and modified with a second member of
a pair of binding partners,
wherein at least one of (b) the at least four nucleoside triphosphates and (h)
the
first oligonucleotide is modified with a label.
[067] In certain embodiments, the invention provides a dry composition
comprising:
(a) Taq polymerase;
(b) deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-
triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP),
deoxythymidine 5'-triphosphate (dTTP);
(c) potassium chloride;
(d) magnesium chloride;
(e) Tris-HCI;
-26-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(f) magnetizable beads modified with a first member of a pair of binding
partners;
(g) trehalose;
(h) a first oligonucleotide capable of binding to a first part of the target
nucleic acid sequence; and
(i) a second oligonucleotide capable of binding to a second part of the
target nucleic acid sequence and modified with a second member of
a pair of binding partners,
wherein at least one of (b) the nucleoside triphosphates and (h) the first
oligonucleotide is modified with a label.
[068] Embodiments using two oligonucleotides can be modified to detect,
amplify, or isolate multiple target nucleic acid sequences. Such modifications
are
discussed in greater detail below in the "Multiple Array" section.
B. Compositions Comprising Three Oligonucleotides
[069] In some embodiments, the composition of the invention can comprise
three oligonucleotides, two which act as primers and a third oligo. In some
embodiments, the third oligonucleotide links the PCR product to a solid
support._
In some embodiments, the third oligonucleotide is linked to a solid support
via a
covalent bond. In some embodiments, the third oligonucleotide is reversibly
bound to a solid support. For example, the third oligonucleotide can be linked
to a
solid support via a pair of binding partners. Both of the remaining
oligonucleotides
prime the PCR reaction. In some embodiments, one of the remaining
oligonucleotides also labels the PCR product. In some embodiments, the third
oligonucleotide labels the PCR product while one of the two primer
oligonucleotides attaches the amplified product to a solid support. In some
embodiments, nucleotides that are incorporated into the PCR product label the
PCR product.
[070] In some embodiments, the invention provides a composition for
detecting, amplifying, and/or isolating a target nucleic acid sequence
comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
-27-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
(f) at least one solid support;
(g) at least one cryoprotectant;
(h) a first oligonucleotide capable of hybridizing with a first part of the
target nucleic acid sequence
(i) a second oligonucleotide capable of hybridizing with a nucleic acid
sequence complementary to a second part of the target nucleic acid
sequence; and
(j) a third oligonucleotide linked to the at least one solid support and is
capable of hybridizing with a third part of
(1) the target nucleic acid sequence; or
(2) a nucleic acid sequence complementary to the target
nucleic acid sequence;
wherein at least one of (b) the at least one nucleoside triphosphate, (h) the
first
oligonucleotide, and (i) the second oligonucleotide is modified with a label;
and
wherein the composition does not comprise the target nucleic acid sequence or
its
complement.
[071] Several moieties can be used to bind the third oligonucleotide to the
solid support. In some embodiments, the third oligonucleotide can be linked to
the
solid support via a pair of binding partners such as those discussed above at
paragraphs [058] to [060]. For example, in some embodiments, avidin can bind
to
biotin before beginning the PCR reaction, in which case the avidin/biotin
interaction remains stable throughout the PCR reaction. In some embodiments,
the solid support can be coated with avidin while the third oligonucleotide
can be
biotinylated. In some embodiments, the solid support can be coated with
streptavidin while the third oligonucleotide can be biotinylated. For example,
in
some embodiments, the solid support can be coated with anti-DNP antibodies
while the third oligonucleotide can comprise DNP. In some embodiments, the
solid support can be coated with anti-fluorescein antibodies while the third
oligonucleotide comprises fluorescein.
-28-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
[072] In some embodiments, the third oligonucleotide can be covalently
bound to the solid support, for example, by synthesizing oligonucleotides with
a
primary amine at the 5' end and reacting those oligonucleotides with
carboxylated
magnetizable beads. In some embodiments, the third oligonucleotide can be
covalently attached to the surface of the solid support by a variety of well-
known
chemistries, such as carbodiimide coupling (see, e.g., Katz et. al., 1994, J.
Electroanal. Chem. 367:59; Narvaez et a(., 1997, J. Electroanal. Chem.
430:227)
or maleimide reactions (see, e.g., Marty et al. 2004, CMLS Cellular and
Molecular
Life Sci. 61:1785).
[073] In some embodiments, the third oligonucleotide can be linked to the
solid support by a cleavable linkage, thus providing a means of separating the
target sequence from the solid support after the complex comprising the target
sequence, the third oligonucleotide and the solid support has been isolated.
Cleavage of the linkage between the third oligonucleotide and the solid
support
can be achieved using enzymatic, photolytic or chemical means. Examples of
suitable chemically cleavable groups can be, but are not limited to,
dialkoxysilane,
disulfide, 3'-(S)-phosphorothioate, 5'-(S)-phosphorothioate, and ribose.
Dialkoxysilane can be cleaved -with fluoride ion. Disulfide bonds can be
cleaved
with reducing agents such as dithiothreitol. Phosphorothioate internucleotide
linkage can be selectively cleaved under mild oxidative conditions. Selective
cleavage of ribose linkages can be carried out by treatment with dilute
ammonium
hydroxide. Suitable enzyme cleavable sites can be nucleotides cleavable by
glycosylases or nucleases. A DNA glycosylase can be uracil-DNA glycosylase.
In this method, a uracil can be synthetically incorporated in a
polynucleotide,
replacing a thymidine. The uracil can be site-specifically removed by
treatment
with uracil DNA glycosylase. The cleavable site can also be a restriction
endonuclease cleavable site, such as class Ils restriction enzymes. Examples
include Bpml, Bsgl, BseRl, BsmFl, and Fokl recognition. The sequence of the
third oligonucleotide can be selected so that it incorporates a restriction
endonuclease site present in the target sequence and after binding of the
amplified target to the third oligonucleotide, can be subsequently cleaved to
release the linked polynucleotide. The sequences of these and other
restriction
-29-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
enzyme sites have been described in the art. See New England BioLabs Catalog
(New England Biolabs, Beverly, MA).
[074] The third oligonucleotide can also be cleaved from the solid support
using a photocleavable linker, such as ortho-nitrobenzyl class of
photocleavable
linkers. Photocleavable linkers can be, for example, hydroxymethyl,
hydroxyethyl,
and Fmoc-aminoethyl carboxylic acid.
[075] The skilled artisan will understand that the third oligonucleotide need
not be linked to the at least one solid support before reaching the end-user
as
long as the end-user links the third oligonucleotide to the at least one solid
support
prior to starting the PCR reaction, for example, using photoactivatable
crosslinkers
which can be present in the composition as supplied.
[076] In certain embodiments, the third oligonucleotide can be linked to a
magnetizable bead, providing a means for isolating and/or detecting a target
nucleic acid sequence. The complex comprising the oligonucleotide linked to
the
magnetizable bead and the target sequence can be isolated by subjecting the
complex to a magnetic field.
[077] In certain embodiments that use three oligonucleotides, the third
oligonucleotide can bind to a nucleic acid sequence that overlaps, at least
partially, with a nucleic acid sequence that can bind to the first
oligonucleotide, the
second oligonucleotide or both the first and second oligonucleotides.
[078] Embodiments using three oligonucleotides can be modified to detect,
amplify, or isolate multiple target nucleic acid sequences. Such modifications
are
discussed in greater detail below in the "Multiple Array" section.
[079] In some embodiments that use three oligonucleotides, at least one of
the first oligonucleotide and the second oligonucleotide is modified with an
ECL
moiety. In some embodiments that use three oligonucleotides, the nucleoside
triphosphates are modified with an ECL moiety.
[080] In certain embodiments, the first and second oligonucleotides can
serve as primers in a DNA polymerization reaction. In some embodiments, the
DNA polymerization reaction is a PCR reaction. In PCR, two primers that
hybridize to a sufficiently complementary member of a specific DNA sequence
can
be used, thus facilitating the initiation of DNA synthesis by the polymerase.
-30-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
[081] The following embodiment provides a composition that comprises
particular examples of the components of the composition. For example, a
polymerase such as Taq polymerase, a monovalent cation such as potassium
chloride, a divalent cation such as magnesium chloride, biotin as a linking
substance and so forth. In some embodiments, the invention provides a dry
composition comprising:
(a) Taq polymerase;
(b) deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-
triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP),
deoxythymidine 5'-triphosphate (dTTP);
(c) potassium chloride;
(d) magnesium chloride;
(e) Tris-HCI;
(f) magnetizable beads coated with avidin or streptavidin ;
(g) trehalose;
(h) a first oligonucleotide capable of hybridizing to a first part of a target
nucleic acid sequence and labeled with [Ru(bpy)3]2+ or [Ru(sulfo-
bpy)2bpy]2+;
(i) a second oligonucleotide capable of hybridizing with a nucleic acid
sequence complementary to a second part of the target nucleic acid
sequence; and
(j) a third oligonucleotide, wherein the third oligonucleotide is
biotinylated and is capable of hybridizing to a third part of the target
nucleic acid sequence or to a nucleic acid sequence complementary
to the target nucleic acid sequence.
[082] Some embodiments can use a primary amine as a lining agent. In
some embodiments, the invention provides a dry composition comprising:
(a) Taq polymerase;
(b) deoxycytidine 5'-triphosphate (dCTP), deoxyadenosine 5'-
triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP),
deoxythymidine 5'-triphosphate (dTTP);
(c) potassium chloride;
-31-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(d) magnesium chloride;
(e) Tris-HCI;
(f) carboxylated magnetizable beads;
(g) trehalose;
(h) a first oligonucleotide capable of hybridizing to a first part of a target
nucleic acid sequence and labeled with [Ru(bpy)3]2+ or [Ru(sulfo-
bpY)2bpY]2+;
(i) a second oligonucleotide, capable of hybridizing with a nucleic acid
sequence complementary to a second part of a target nucleic acid
sequence; and
(j) a third oligonucleotide linked to the carboxylated magnetizable
beads through a primary amine at the 5' end, wherein in the third
oligonucleotide is capable of hybridizing to a third part of the target
nucleic acid sequence or to a nucleic acid sequence complementary
to the target nucleic acid sequence.
[083] In certain embodiments, the invention provides a dry composition
comprising:
a - at least one thermostable polymerase;
(b) at least four different nucleoside triphosphates;
(c) at least one salt comprising a monovalent cation;
(d) at least one salt comprising a divalent cation;
(e) at least one buffering agent with an effective buffering capacity in the
pH range of 8.1 to 8.5;
(f) at least one solid support;
(g) at least one disaccharide;
(h) a first oligonucleotide capable of hybridizing to a first part of the
target nucleic acid sequence;
(i) a second oligonucleotide capable of hybridizing to a second part of
the target nucleic acid sequence; and
(j) a third oligonucleotide linked to the at least one solid support and is
capable of hybridizing to a third part of a target nucleic acid
sequence;
-32-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
wherein at least one of the at least four nucleoside triphosphates, the first
oligonucleotide, and second oligonucleotide is modified with an ECL moiety.
C. Compositions for Multiple Arrays
[084] In some embodiments, the invention can be used to detect, amplify,
and/or isolate multiple target nucleic acid sequences. When multiple target
nucleic acid sequences are detected, oligonucleotides that are sufficiently
complementary to each target nucleic acid sequence are linked to discrete
sections of a solid support. Oligonucleotides can be linked to discrete
sections of
a solid support via the linking agents discussed above in paragraphs [058] to
[060], [062], and [071] to [073]. For example, each unique oligonucleotide can
be
linked to a solid support by a unique pair of binding partners, where one of
the
binding partners is attached to a discrete location on the solid support. Or
each
unique oligonucleotide can be linked to a solid support at different discrete
locations. The multiple target nucleic acid sequences can be multiple
sequences
from one organism or target nucleic acid sequences from multiple organisms. In
some embodiments involving multiple target nucleic acid sequences, the solid
support can be a planar structure with discrete areas arranged to capture
different
targets. In some embodiments, each target nucleic acid sequence can have a
different first oligonucleotide; second oligonucleotide; if present, third
oligonucleotide; and if present, pair of binding partners. For example, each
discrete area can be linked to differing third oligonucleotides in order to
detect
different target sequences. This multiple array can be used with the two
oligonucleotide format as discussed above in Section II.A. In some
embodiments,
the invention provides a composition for detecting, amplifying, and/or
isolating N
target nucleic acid sequences comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
(e) at least one buffering agent;
-33-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(f) at least one solid support comprising N discrete areas, wherein the
ith discrete area is modified with an it" first member of a pair of
binding partners;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the ith first oligonucleotide is
capable of hybridizing to a first part of the ith target nucleic acid
sequence or a sequence that is complementary to the it" target
nucleic acid sequence; and
(i) N second oligonucleotides, wherein the ith second oligonucleotide is
capable of hybridizing to a second part of the ith target nucleic acid
sequence or a sequence that is complementary to the ith target
nucleic acid sequence and comprises an ith second member of the
pair of binding partners;
wherein N is a integer greater than or equal to 1; wherein ith represents in
turn all
integers between I and N, including both 1 and N, and is used to designate
target-nucleic-acid-specific elements of the composition; wherein at least one
of
(b) the at least one nucleoside triphosphate and (h) the first oligonucleotide
is
-modified with a label; wherein if the-first oligonucleotide is capable of
hybridizing
to the target nucleic acid sequence then the second oligonucleotide is capable
of
hybridizing to the complement of the target nucleic acid sequence, wherein if
the
first oligonucleotide is capable of hybridizing to the complement of the
target
nucleic acid sequence then the second oligonucleotide is capable of
hybridizing to
the target nucleic acid sequence, and wherein the composition does not
comprise
the target nucleic acid sequence or its complement.
[085] This multiple array can also be used with the three oligonucleotide
format as discussed above in Section II.B. In some embodiments, the invention
provides a composition for detecting, amplifying, and/or isolating N target
nucleic
acid sequences comprising:
(a) at least one polymerase;
(b) at least one nucleoside triphosphate;
(c) at least one monovalent cation;
(d) at least one divalent cation;
-34-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(e) at least one buffering agent;
(f) at least one solid support comprising N discrete areas;
(g) at least one cryoprotectant;
(h) N first oligonucleotides, wherein the ith first oligonucleotide is
capable of hybridizing with a first part of the ith target nucleic acid
sequence;
(i) N second oligonucleotides, wherein the ith second oligonucleotide is
capable of hybridizing with a nucleic acid sequence complementary
to a second part of the ith target nucleic acid sequence; and
Q) N third oligonucleotides, wherein the ith third oligonucleotide is linked
to the ith discrete area on the at least one solid support and is
capable of hybridizing with a third part of
(1) the it" target nucleic acid sequence; or
(2) a nucleic acid sequence complementary to the itn
target nucleic acid sequence;
wherein N is a integer greater than or equal to 1; wherein it" represents in
turn all
integers between I and N, including both 1 and N, and is used to designate
-target-nucleic-acid-specific elements-of the composition; wherein at least
one of
(b) the at least one nucleoside triphosphate, (h) the ith first
oligonucleotide, and (i)
the ith second oligonucleotide is modified with a label; and wherein the
composition does not comprise the target nucleic acid sequence or its
complement.
[086] In certain embodiments, the first and second oligonucleotides can
serve as primers in a DNA polymerization reaction. In some embodiments, the
DNA polymerization reaction is a PCR reaction. In PCR, two primers that
hybridize to a sufficiently complementary member of a specific DNA sequence
can
be used, thus facilitating the initiation of DNA synthesis by the polymerase.
D. General Aspects of the Compositions of the Invention
[087] All of the embodiments discussed in Sections II.A-C above share
several features in common such as, for example, the source from which a
sample can be prepared, types of oligonucleotides used, types of labels used,
-35-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
PCR reaction conditions, and the types of solid supports used. These common
aspects of the compositions of the invention are discussed in the following
section.
1. Samples
[088] A sample can comprise DNA, RNA, or a mixture thereof. The sample
can be a biological sample. The sample can be derived from an in vitro
chemical
synthesis of nucleic acid molecules. The sample can also be prepared from an
organism that contains nucleic acids. Such organisms can be, for example,
bacteria, viruses, protozoa, worms, fungi, invertebrate animals, and
vertebrate
animals.
[089] In certain embodiments, target nucleic acid sequences can be found
in pathogenic bacteria such as: Aeromonas hydrophila and other spp.; Bacillus
anthracis; Bacillus cereus; Botulinum neurotoxin producing species of
Clostridium;
Brucella abortus; Brucella melitensis; Brucella suis; Burkholderia mallei
(formally
Pseudomonas mallei); Burkholderia pseudomallei (formerly Pseudomonas
pseudomallei); Campylobacterjejuni; Chlamydia psittaci; Clostridium botulinum;
Clostridium botulinum; Clostridium perfringens; Coccidioides immitis;
Coccidioides
posa asii; Cowdria ruminantium (Heartwater); Coxiella burnetii; Enterovirulent
Escherichia coli group (EEC Group) such as Escherichia coli - enterotoxigenic
(ETEC), Escherichia coli - enteropathogenic (EPEC), Escherichia coli - 0157:H7
enterohemorrhagic (EHEC), and Escherichia coli - enteroinvasive (EIEC);
Ehrlichia spp. such as Ehrlichia chaffeensis; Francisella tularensis;
Legionella
pneumophilia; Liberobacter africanus; Liberobacter asiaticus; Listeria
monocytogenes; miscellaneous enterics such as Klebsiella, Enterobacter,
Proteus, Citrobacter, Aerobacter, Providencia, and Serratia; Mycobacterium
bovis;
Mycobacterium tuberculosis; Mycoplasma capricolum; Mycoplasma mycoides
mycoides; Peronosclerospora philippinensis; Phakopsora pachyrhizi; Plesiomonas
shigelloides; Ralstonia solanacearum race 3, biovar 2; Rickettsia prowazekii;
Rickettsia rickettsii; Salmonella spp; Schlerophthora rayssiae var zeae;
Shigella
spp.; Staphylococcus aureus; Staphylococcus aureus; Streptococcus;
Synchytrium endobioticum; Vibrio cholerae non-O 1; Vibrio cholerae 01; Vibrio
parahaemolyticus and other vibrios species; Vibrio vulnificus; Xanthomonas
-36-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
oryzae; Xylella fastidiosa (citrus variegated chlorosis strain); Yersinia
enterocolitica and Yersinia pseudotuberculosis; and Yersinia pestis. In
certain
embodiments, target nucleic acid sequences can be found in non-pathogenic
bacteria.
[090] In certain embodiments, target nucleic acid sequences can be found
in viruses belonging to the families Adenoviridae, Arenaviridae, Arterivirus,
Astroviridae, Baculoviridae, Badnavirus, Barnaviridae, Birnaviridae,
Bromoviridae,
Bunyaviridae, Caliciviridae, Capillovirus, Carlavirus, Caulimovirus,
Circoviridae,
Closterovirus, Comoviridae, Coronaviridae, Corticoviridae, Cystoviridae,
Deltavirus, Dianthovirus, Enamovirus, Filoviridae, Flaviviridae, Furovirus,
Fuselloviridae, Geminiviridae, Hepadnaviridae, Herpesviridae, Hordeivirus,
Hypoviridae, Idaeovirus, Inoviridae, Iridoviridae, Leviviridae,
Lipothrixviridae,
Luteovirus, Machlomovirus, Marafivirus, Microviridae, Myoviridae, Necrovirus,
Nodaviridae, Orthomyxoviridae, Paramyxoviridae, Partitiviridae, Parvoviridae,
Phycodnaviridae, Plasmaviridae, Podoviridae, Polydnaviridae, Potexvirus,
Potyviridae, Poxviridae, Reoviridae, Retroviridae, Rhabdoviridae,
Rhizidiovirus,
Sequiviridae, Siphoviridae, Sobemovirus, Tectiviridae, Tenuivirus,
Tetraviridae,
Tobamovirus, Tobravirus, Togaviridae, -Tombusviridae, Totiviridae, Tymovirus,
and Umbravirus.
[091] Examples of such viruses can include, but are not limited to, African
horse sickness virus; African swine fever virus; Akabane virus; Avian
influenza
virus (highly pathogenic); Bhanja virus; Blue tongue virus (Exotic); Camel pox
virus; Cercopithecine herpesvirus 1; Chikungunya virus; Classical swine fever
virus; Coronavirus (SARS); Crimean-Congo hemorrhagic fever virus; Dengue
viruses; Dugbe virus; Ebola viruses; Encephalitic viruses such as Eastern
equine
encephalitis virus, Japanese encephalitis virus, Murray Valley encephalitis,
and
Venezuelan equine encephalitis virus; Equine morbillivirus; Flexal virus; Foot
and
mouth disease virus; Germiston virus; Goat pox virus; Hantaan or other Hanta
viruses; Hendra virus; lssyk-kul virus; Koutango virus; Lassa fever virus;
Louping
ill virus; Lumpy skin disease virus; Lymphocytic choriomeningitis virus;
Malignant
catarrhal fever virus (Exotic); Marburg virus; Mayaro virus; Menangle virus;
Monkeypox virus; Mucambo virus; Newcastle disease virus (VVND); Nipah Virus;
-37-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
Norwalk virus group; Oropouche virus; Orungo virus; Peste Des Petits Ruminants
virus; Piry virus; Plum Pox Potyvirus; Poliovirus; Potato virus; Powassan
virus; Rift
Valley fever virus; Rinderpest virus; Rotavirus; Semliki Forest virus; Sheep
pox
virus; South American hemorrhagic fever viruses such as Flexal, Guanarito,
Junin,
Machupo, and Sabia; Spondweni virus; Swine vesicular disease virus; Tick-borne
encephalitis complex (flavi) viruses such as Central European tick-borne
encephalitis, Far Eastern tick-borne encephalitis, Russian spring and summer
encephalitis, Kyasanur forest disease, and Omsk hemorrhagic fever; Variola
major virus (Smallpox virus); Variola minor virus (Alastrim); Vesicular
stomatitis
virus (Exotic); Wesselbron virus; West Nile virus; Yellow fever virus; South
American hemorrhagic fever viruses such as Junin, Machupo, Sabia, Flexal, and
Guanarito; viruses from the family papovaviridae, including polyomaviruses
such
as SV40, JC and BK and including papillomaviruses (e.g., HPV); parvoviruses
(e.g., B19 and RA-1; viruses from the family Picornaviridae, including
rhinoviruses.
[092] In certain embodiments, target nucleic acid sequences can be found
in parasitic protozoa and worms, such as: Acanthamoeba and other free-living
amoebae; Anisakis sp. -and-other related- worms Ascaris lumbricoides and
Trichuris trichiura; Cryptosporidium parvum; Cyclospora cayetanensis;
Diphyllobothrium spp.; Entamoeba histolytica; Eustrongylides sp.; Giardia
lamblia;
Nanophyetus spp.; Shistosoma spp.; Toxoplasma gondii; and Trichinella.
[093] In certain embodiments, target nucleic acid sequences can be found
in fungi such as: Aspergillus spp.; Blastomyces dermatitidis; Candida;
Coccidioides immitis; Coccidiodes posadasil; Cryptococcus neoformans;
Histoplasma capsulatum; Maize rust; Rice blast; Rice brown spot disease; Rye
blast; Sporothrix schenckii; and wheat fungus.
[094] In certain embodiments, target nucleic acid sequences can be found
in invertebrate animals and vertebrate animals such as mammals, including but
not limited to, humans. In certain embodiments, target nucleic acid sequences
can be found in plants. In certain embodiments, target nucleic acid sequences
can be found in species from the domain Archaea.
-38-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
2. Polynucleotides and Oligonucleotides
[095] The invention provides compositions for detecting, amplifying, and/or
isolating target nucleic acid sequences from a sample. In some embodiments,
target nucleic acid sequences can be polynucleotides. Polynucleotides can vary
in length. For example, a polynucleotide can be 100 to 2000 nucleotides long.
A
polynucleotide can be 100 to 1500 nucleotides long. A polynucleotide can be
100
to 1000 nucleotides long. A polynucleotide can be 100 to 500 nucleotides long.
A
polynucleotide can be 100 to 200 nucleotides long. In some embodiments,
conditions suitable for target sequence amplification can be 72 C. In some
embodiments, conditions suitable for target sequence amplification can be 41
C.
One skilled in the art can readily identify other temperatures suitable for
target
amplification.
[096] In some embodiments, the composition of the invention can contain
oligonucleotides. An oligonucleotide can be 10 to 100 nucleotides long. An
oligonucleotide can be 10 to 90 nucleotides long. An oligonucleotide can be 10
to
70 nucleotides long. An oligonucleotide can be 10 to 50 nucleotides long. An
oligonucleotide can be 10 to 40 nucleotides long. An oligonucleotide can be 10
to
30 nucleotides long: An oligonUcleotide can be 10 to 20 nucleotides long. In
some embodiments, an oligonucleotide can comprise a poly A tail. In some
embodiments, an oligonucleotide can comprise a poly T tail. In some
embodiments, an oligonucleotide can be a poly A oligonucleotide. In some
embodiments, an oligonucleotide can be a poly T oligonucleotide.
[097] In some embodiments, oligonucleotides can be primers. Bases in an
oligonucleotide primer can be joined by a phosphodiester bond or by a linkage
other than a phosphodiester bond, so long as the linkage does not prevent
hybridization to a part of the target nucleic acid sequence. For example,
oligonucleotide primers can have constituent bases joined by peptide bonds
rather
than phosphodiester linkages. In some embodiments, a primer can be prepared
to be sufficiently complementary to a target nucleic acid sequence. Exact
complementarity is not necessary to achieve hybridization in a particular set
of
conditions. Factors including the length of a sequence, the number of G and C
residues the sequence has, the salt concentration of the hybridization
reaction,
-39-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
and the temperature of the hybridization reaction can determine how much
nucleotide mismatching can be present and still result in hybridization
between
two sequences. Appropriate hybridization conditions can be selected by those
skilled in the art with minimal experimentation as exemplified in Dieffenbach,
C.W
and Dvksler, G.S. (1995) PCR primer: a laboratory manual. CSHL press, Cold
Spring Harbor, USA or PCR Protocols: A Guide to Methods and Applications,
Innis, M.A. et al. eds., Academic Press, San Diego, USA 1990.
[098] In certain embodiments, primers can comprise nucleotides, modified
nucieotides, or nucleic acid analogs. A nucleotide can be used as a building
block
to form a polynucleotide. Nitrogenous bases can be, but are not limited to,
cytosine, guanine, adenine, thymidine, uracil, and inosine. Nucleoside
triphosphates can be, but are not limited to, deoxyadenosine triphosphate
(dATP),
deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP),
deoxythymidine triphosphate (dTTP), deoxyuraci( triphosphate (dUTP), and
deoxyinosine triphosphate (dITP), 7-deaza-dGTP, 2-aza-dATP, and N4-methyl-
dCTP. Non-limiting examples of modified nucleotides can be: 5-propynyl-uracil,
2-
thio-5-propynyl-uracil, 5-methyicytosine, pseudoisocytosine, 2-thiouracil and
2-
thiothymine, 2-aminopurine, N9-(2-amino-6-chloropurine), N9-(2,6-
diaminopurine),
hypoxanthine, N9-(7-deaza-guanine), N9-(7-deaza-8-aza-guanine) and N8-(7-
deaza-8-aza-adenine). Nucleic acid analogs can be, but are not limited to,
peptide nucleic acids (PNAs), locked nucleic acids (LNAs), or any derivatized
form
of a nucleic acid.
[099] In some embodiments, the composition can contain at least four
different nucleoside triphosphates. In some embodiments, the at least four
different nucleoside triphosphates can be deoxycytidine 5'-triphosphate
(dCTP),
deoxyadenosine 5'-triphosphate (dATP), deoxyguanosine 5'-triphosphate (dGTP),
and deoxythymidine 5'-triphosphate (dTTP).
3. Labels
[0100] Several types of labels can be used in the composition of the
invention. In certain embodiments, at least one of the oligonucleotides or
nucleoside triphosphates can be modified with a label. Labels can be, but are
not
limited to, fluorophores, haptens, luminescent labels, radioactive labels,
-40-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
electrochemiluminescent moieties (i.e., ECL moieties), quantum dots, beads,
aminohexyl, pyrene, metal particles, spin labels, enzymes, and dyes. Examples
of directly detectable labels include, but are not limited to, ECL moieties,
fluorophores, and enzymatic labels. Examples of indirectly detectable labels
include, but are not limited to, haptens, enzymes, and biotin. Labels also
include
molecular beacons (i.e., a conformation-sensitive label attached to a hairpin
loop-
containing o(igonucleotide) as described, for example, in Kostrikis, L. et
al.,
Science 279:1228-29 1998 and in Tyagi, S. et al., Nat. Biotechnol. 16:49-52
1998. In some embodiments, a label can reduce a detectable signal. For
example, a label can be a substance that quenches or reduces the detectable
signal emitted by a detectable substance. In some embodiments, a label can be
an ECL quencher, such that when the quencher is present as a result of target
nucleic acid amplification, an ECL signal is reduced. For example, an ECL
moiety
can be associated with a bead so when a PCR product containing the quencher is
linked to the bead, the ECL signal is reduced. Reduction of signal can be
detected by comparing the signal from beads with an ECL moiety to beads with
the ECL moiety that have participated in an amplification reaction. Examples
of
quenchers include, but-are-not limited-to, methylviologen carboxylate,
compounds
comprising at least one benzene moiety, and, more particularly, compounds
comprising at least one phenol moiety, quinone moiety, benzene carboxylic
acid,
and/or benzene carboxylate moiety.
[0101] Examples of quenching agents which comprise at least one phenol
moiety, and from which quenching moieties comprising at least one phenol
moiety
may be derived, include, but are not limited to phenol; alkyl-phenois (such as
C1_6
alkyl-phenois including o-alkyl-phenol, m-alkyl-phenol, and p-alkyl-phenol,
such as
o-methyl-phenol (i.e., o-cresol), m-methyl-phenol (i.e., m-cresol), p-methyl-
phenol
(i.e., o-cresol), o-ethyl-phenol, m-ethyl-phenol, p-ethyl-phenol, o-propyl-
phenol, m-
propyl-phenol, and p-propyl-phenol); aryl-phenols (such as C7_10 aryl-phenols,
including o-aryl-phenol, m-aryl-phenol, and p-aryl-phenol, such as p-phenyl-
phenol); halo-phenois (such as o-halo-phenol, m-halo-phenol, and p-halo-
phenol,
such as o-fluoro-phenol, m-fluoro-phenol, and p-fluoro-phenol); hydroxy-
phenois
-41-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(such as o-hydroxy-phenol (i.e., catechol), m-hydroxy-phenol (i.e.,
resorcinol), and
p-hydroxy-phenol (i.e., hydroxyquinone)); and biphenols (such as 4,4'-
biphenol).
[0102] Examples of quenching agents which comprise at least one quinone
moiety and from which quenching moieties comprising at least one quinone
moiety may be derived, include, but are not limited to, quinones (i.e.,
benzoquinones), such as o-quinone (i.e., 1,2-benzoquinone) and p-quinone
(i.e.,
1,4-benzoquinone); alkyl-quinones, such as C1_6 alkyl-quinones including C1_6
alkyl-
1,4-benzoquinones, such as 2-methyl-1,4-benzoquinone, 2-ethyl-1,4-
benzoquinone, 2-n-propyl-1,4-benzoquinone, 2,6-dimethyl-1,4-benzoquinone, and
2,5-dimethyl-1,4-benzoquinone; halo-quinones, such as halo-1,4-benzoquinones,
including 2-fluoro- 1,4-benzoquinone, 2-chloro-1,4-benzoquinone, 2-bromo-1,4-
benzoquinone, 2-iodo-1,4-benzoquinone, 2,6-difluoro-1,4-benzoquinone, 2,5-
difluoro- 1,4-benzoquinone; 2,6-dichloro-1,4-benzoquinone, 2,5-dichloro-1,4-
benzoquinone; 2,6-dibromo-1,4-benzoquinone, and 2,5-dibromo-1,4-
benzoquinone; naphthoquinones, such as 1,2-napththoquinones and 1,4-
naphthoquinones, including 2-methoxy-3-methyl-1,4-naphthoquinone;
anthraquinones, such as 1,2-anthraquinones, 1,4-anthraquinones, 9,10-
anthraquinones, including 1-;5-dihydr-oxy-9,10-anthraquinone, 1,2,3,4-
tetrafluoro-
5,8-dihydroxy-9,10-anthraquinone, 9,1 0-anthraquinone-2-carboxylic acid, 9,10-
anthraquinone-2-sulfonic acid, 9,1 0-anthraquinone-1,5-disulfonic acid, and
9,10-
anthraquinone-2,6-disulfonic acid. Quinone and its derivatives may usually be
chemically modified to possess reactive groups (i.e., to form chemically
activated
species). For example, on one or more reactive groups may be attached (e.g.,
at
the ortho- or meta-positions of 1,4-benzoquinone) optionally via a linker
group,
which then permits the attachment of the quinone-like moiety (as a quenching
moiety) to other molecules. For example, a 1,4-benzoquinone may be derivatized
to possess a carboxylic acid group (i.e., -COOH) attached to an ortho- or meta-
carbon via a linker group, such as an alkyl group. Such a compound is 2-(1-
carboxy-but-2-yl)-5-methyl-1,4-benzoquinone. This carboxylic acid derivative
may
be derivatized to form the N-succinimidyl ester (shown below), which permits
the
easy attachment of the quinone-like quenching moiety to molecules which
possess, for example, an amino group.
-42-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
O O
O
\N
O O
[0103] Examples of quenching agents which comprise at least one benzene
carboxylic acid or benzene carboxylate moiety, and from which quenching
moieties comprising at least one benzene carboxylic acid or benzene
carboxylate
moiety may be derived, include, but are not limited to benzoic acid;
aminobenzoic
acids, such as o-aminophenol, m-aminophenol, and p-aminophenol;
hydroxybenzoic acids, such as o-hydroxyphenol, m-hydroxyphenol, and p-
hydroxyphenoi; and nitrobenzoic acids, such as o-nitrophenol, m-nitrophenol,
and
p-nitrophenol.
[0104] Fluorophores can be, but are not limited to, 5(6)-carboxyfluorescein,
5- or 6-carboxyfluorescein, 6-(fluorescein)-5-(and 6)-carboxamido hexanoic
acid,
fluorescein (i.e., FITC), rhodamine, tetramethyirhodamine, cyanine dyes (i.e.,
Cy2,
Cy3, Cy 3.5, Cy5, Cy5.5, Cy 7), phycoerythrine, conjugates of R-phycoerythrin,
conjugates of allophycoerythrin, cascade blue, Oregon green 488, pacific blue,
-
rhodamine green, optionally substituted coumarin, AMCA, (diethyl-
amino)coumarin, PerCP, phycobiliproteins, R-phycoerythrin (RPE),
allophycoerythrin (APC), Texas Red, Princeton Red, IR dyes, Dyomics (Jena,
Gremany) dyes, tetramethylrhodamine, lissamine, TRITC, and Alexa dyes.
Fluorophores can also include inorganic fluorophores such as particles based
on
semiconductor material like coated CdSe nanocrystallites. See, for example,
the
Dynomics catalogue of Fluorescent Dyes for Bioanalytical and Hightech
Applications (4th edition, 2005) and The Handbook - A Guide to Fluorescent
Probes and Labeling Technologies (10th edition, Invitrogen, Carlsbad, CA,
USA).
[0105] Labels can be haptens or antigens including, but not limited to,
dinitrophenyl (DNP), fluorescein isothiocyanate (FITC), 5(6)-
carboxyfluorescein,
2,4-dinitrophenyl, digoxigenin, rhodamine, bromodeoxy uridine,
acetylaminofluorene, mercury trinitrophenol, estradiol, and biotin.
-43-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
[0106] Luminescent labels can be, but are not limited to, luminol, isoluminol,
acridinium esters, acridinedione 1,2-dioxetanes, pyridopyridazines, green
fluorescent protein (GFP), GFP analogues, reef coral fluorescent proteins
(RCFPs), and RCFP analogues.
[0107] Radioactive labels can be, but are not limited to, radioactive isotopes
of carbon such as'4C, radioactive isotopes of hydrogen such as 3H, radioactive
isotopes of phosphorous such as 32P, and radioactive isotopes of sulfur such
as
355..
[0108] For example, radioactive nucleoside triphosphates are commercially
available from a variety of sources such as New England Nuclear, Boston, MA.
Other examples of nucleoside triphosphates that can be modified with a label
include 5-(3-aminoallyl)-dUTP, and 5-[3-(E)-(4-azido-2,3,5,6-
tetrafluorobenzamido)propenyl-1 ]-2'-deoxyu rid ine-5'-triphosphate.
4. ECL Labels
[0109] In certain embodiments, the label can comprise an ECL moiety. ECL
moieties can be transition metals. For example, the ECL moiety can comprise a
metal-containing organic compound wherein the metal can be chosen, for
example, from ruthenium, osmium, rhenium, iridium, rhodium, platinum,
palladium,
molybdenum, and technetium. For example, the metal can be ruthenium or
osmium. For example, the ECL moiety can be a ruthenium chelate or an osmium
chelate. For example, the ECL moiety can comprise bis(2,2'-
bipyridyl)ruthenium(II) and tris(2,2'-bipyridyl)ruthenium(II). For example,
the ECL
moiety can be ruthenium (11) tris bipyridine ([Ru(bpy)3]2+). The metal can
also be
chosen, for example, from rare earth metals, including but not limited to
cerium,
dysprosium, erbium, europium, gadolinium, holmium, lanthanum, lutetium,
neodymium, praseodymium, promethium, terbium, thulium, and ytterbium. For
example, the metal can be cerium, europium, terbium, or ytterbium.
[0110] Metal-containing ECL moieties can have the formula
M(P)m (L1)n (L2)0 (L3)p (L4)q (L5)r (L6)s
wherein M is a metal; P is a polydentate ligand of M; L1, L2, L3, L4, L5 and
L6 is
ligands of M, each of which can be the same as, or different from, each other;
m is
an integer equal to or greater than 1; each of n, o, p, q, r and s is an
integer equal
-44-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
to or greater than zero; and P, L1, L2, L3, L4, L5 and L6 are of such
composition
and number that the ECL moiety can be induced to emit electromagnetic
radiation
and the total number of bonds to M provided by the ligands of M equals the
coordination number of M. For example, M can be ruthenium. For example, M
can be osmium.
[0111] Some examples of the ECL moiety can have one polydentate ligand
of M. The ECL moiety can also have more than one polydentate ligand. In
examples comprising more than one polydentate ligand of M, the polydentate
ligands can be the same or different. Polydentate ligands can be aromatic or
aliphatic ligands. Suitable aromatic polydentate ligands can be aromatic
heterocyclic ligands and can be nitrogen-containing, such as, for example,
bipyridyl, bipyrazyl, terpyridyl, 1,10 phenanthroline, and porphyrins.
[0112] Suitable polydentate ligands can be unsubstituted, or substituted by
any of a large number of substituents known to the art. Suitable substituents
include, but are not limited to, alkyl, substituted alkyl, aryl, substituted
aryl, aralkyl,
substituted aralkyl, carboxylate, carboxaldehyde, carboxamide, cyano, amino,
hydroxy, imino, hydroxycarbonyl, aminocarbonyl, amidine, guanidinium, ureide,
maleimide-sulfur-containing groups, phosphorus containing groups, and the
carboxylate ester of N-hydroxysuccinimide.
[0113] In some embodiments, at least one of LI, L2, L3, L4, L5 and L6 can
be a polydentate aromatic heterocyclic ligand. For example, at least one of
these
polydentate aromatic heterocyclic ligands can contain nitrogen. Suitable
polydentate ligands can be, but are not limited to, bipyridyl, bipyrazyl,
terpyridyl,
1,10 phenanthroline, a porphyrin, substituted bipyridyl, substituted
bipyrazyl,
substituted terpyridyl, substituted 1,10 phenanthroline or a substituted
porphyrin.
These substituted polydentate ligands can be substituted with an alkyl,
substituted
alkyl, aryl, substituted aryl, aralkyl, substituted aralkyl, carboxylate,
carboxaldehyde, carboxamide, cyano, amino, hydroxy, imino, hydroxycarbonyl,
aminocarbonyl, amidine, guanidinium, ureide, maleimide a sulfur-containing
group, a phosphorus-containing group or the carboxylate ester of N-
hydroxysuccinimide.
-45-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
[0114] Some examples of the ECL moiety can contain two bidentate ligands,
each of which can be bipyridyl, bipyrazyl, terpyridyl, 1,10 phenanthroline,
substituted bipyridyl, substituted bipyrazyl, substituted terpyridyl or
substituted
1,10 phenanthroline.
[0115] Some examples of the ECL moiety can contain three bidentate
ligands, each of which can be bipyridyl, bipyrazyl, terpyridyl, 1,10-
phenanthroline,
substituted bipyridyl, substituted bipyrazyl, substituted terpyridyl or
substituted
1,10-phenanthroline. For example, the ECL moiety can comprise ruthenium, two
bidentate bipyridyl ligands, and one substituted bidentate bipyridyl ligand.
For
example, the ECL moiety can contain a tetradentate ligand such as a porphyrin
or
substituted porphyrin.
[0116] For example, the ECL moiety can have one or more monodentate
ligands, a wide variety of which are known to the art. Suitable monodentate
ligands can be, for example, carbon monoxide, cyanides, isocyanides, halides,
and aliphatic, aromatic and heterocyclic phosphines, amines, stibines, and
arsines.
[0117] For example, one or more of the ligands of M can be attached to
additional chemical labels, such as, for example, radioactive-isotopes,-
fluorescent
components, or additional luminescent ruthenium- or osmium-containing centers.
[0118] For example, the ECL moiety can be tris(2,2'-bipyridyl)ruthenium(II)
tetrakis(pentafluorophenyl)borate. For example, the ECL moiety can be
bis[(4,4'-
carbomethoxy)-2,2'-bipyridine] 2-[3-(4-methyl-2,2'-bipyridine-4-yl)propyl]-1,3-
dioxolane ruthenium (II). For example, the ECL moiety can be
bis(2,2'bipyridine)
[4-(butan-1 -al)-4'-methyl-2,2'-bipyrid ine] ruthenium (II). For example, the
ECL
moiety can be bis(2,2'-bipyridine) [4-(4'-methyl-2,2',bipyridine-4'-yi)-
butyric
acid]ruthenium (II). For example, the ECL moiety can be (2,2'-bipyridine)[cis-
bis(1,2-diphenylphosphino)ethylene]{2-[3-(4-methyl- 2,2'-bipyridine-4'-
yl)propyl]-
1,3-dioxolane}osmium (li). For example, the ECL moiety can be bis(2,2'-
bipyridine) [4-(4'-methyl-2,2'-bipyridine)-butylamine]ruthenium (ll). For
example,
the ECL moiety can be bis(2,2'-bipyridine) [1-bromo-4(4'-methyl-2,2'-
bipyridine-4-
yl)butane]ruthenium (II). For example, the ECL moiety can be bis(2,2'-
-46-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
_Ipynaine)maleimiaonexanoic acid, 4-methyl-2,2'-bipyridine-4'-butylamide
ruthenium (II).
[0119] In some embodiments, the ECL moiety comprises a metal ion chosen
from osmium and ruthenium or a derivative of trisbipyridyl ruthenium (II)
[Ru(bpy)32+]. For example, the ECL moiety can be [Ru(sulfo-bpy)2bpy]2+ whose
structure is
S03'
W
I \ N i SO3Na
I ,.N
~Ru(II)
N N
1
N
S03
NaO3S
wherein W is a functional group attached to the ECL moiety that can react
with a biological material, binding reagent, enzyme substrate or other assay
reagent so as to form a covalent linkage such as an NHS ester,an activated
carboxyl, an amino group, a hydroxyl group, a carboxyl group, a hydrazide, a
maleimide, or a phosphoramidite.
[0120] In some examples of ECL moieties, the moiety does not comprise a
metal. Such non-metal ECL moieties can be, but are not limited to, rubrene and
9,10-diphenylanthracene.
[0121] Preparation of primers comprising ECL moieties is well known in the
art, as described, for example, in U.S. Patent 6,174,709. In certain
embodiments,
the label can be attached to the 5' end or to the 3' end of an oligonucleotide
primer. In certain embodiments, the label can be incorporated directly into an
oligonucleotide primer. Primers can be labeled at an amino group introduced
during synthesis, or can be labeled directly during synthesis using, e.g., tag
NHS
and tag phosphoramidite, respectively, where the tag can be an ECL moiety. In
some embodiments, the tag comprises a fluorophore, hapten, enzymatic label, or
a luminescent label. Likewise, fluorescently labeled nucleoside triphosphates
can
-47-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
be used to produce oligonucleotides. High throughput, automated, synthesis of
oligonucleotides modified with a variety of labels, including fluorophores and
biotin, has been described. See Andrus, et al., 1997, Nucleic Acid Symp. Ser.
37:317. In addition, methods of modifying oligonucleotides with detectable
transition metals including ruthenium, osmium, iron, rhodium, copper, and
ferrocene have been described (see, e.g., Meade et al., 1995, Chem. Int. Engl.
34:352; (hara et al., 1997, Chem. Commun. 1609; Holmin et al., 1999, Inorg.
Chem. 38:174; Hall et al., 1997, J. Am. Chem. Soc. 119:5045; Bashkin et al.,
1994, J. Am. Chem. Soc. 116:5981; Yu et al., 2000, J. Am. Chem. Soc.
122:6767).
5. ECL Coreactants
[0122] In some embodiments, the composition comprises an ECL coreactant.
In some embodiments, coreactants can be chemical compounds which, upon
electrochemical oxidation / reduction, yield, either directly or upon further
reaction,
strong oxidizing or reducing species in solution. A coreactant can be
peroxodisulfate (i.e., S2082-, persulfate) which is irreversibly electro-
reduced to
form oxidizing S04-- ions. The coreactant can also be oxalate (i.e., C2042-)
which
is irreversibly electro-oxidized to form reducing C02-- ions. A class of
coreactants
that can act as reducing agents is amines or compounds containing amine
groups, including, for example, tri-n-propylamine (i.e., N(CH2CH2CH2)3, TPA).
In
some embodiments, tertiary amines can be better coreactants than secondary
amines. In some embodiments, secondary amines can be better coreactants than
primary amines.
[0123] Coreactants include, but are not limited to, lincomycin; clindamycin-2-
phosphate; erythromycin; 1-methylpyrrolidone; diphenidol; atropine; trazodone;
hydroflumethiazide; hydrochlorothiazide; clindamycin; tetracycline;
streptomycin;
gentamicin; reserpine; trimethylamine; tri-n-butylphosphine; piperidine; N,N-
dimethylaniline; pheniramine; bromopheniramine; chloropheniramine;
diphenylhydramine; 2-dimethylaminopyridine; pyrilamine; 2-benzylaminopyridine;
leucine; valine; glutamic acid; phenylaianine; alanine; arginine; histidine;
cysteine;
tryptophan; tyrosine; hydroxyproline; asparagine; methionine; threonine;
serine;
cyclothiazide; trichlormethiazide; 1,3-diaminopropane; piperazine,
chlorothiazide;
-48-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
hydrazinothalazine; barbituric acid; persulfate; penicillin; 1-piperidinyl
ethanol; 1,4-
diaminobutane; 1,5-diaminopentane; 1,6-diaminohexane; ethylenediamine;
benzenesulfonamide; tetramethylsulfone; ethylamine; di-ethylamine; tri-
ethylamine; tri-iso-propylamine; di-n-propylamine; di-iso-propylamine; di-n-
butylamine; tri-n-butylamine; tri-iso-butylamine; bi-iso-butylamine; s-
butylamine; t-
butylamine; di-n-pentylamine; tri-n-pentylamine; n-hexylamine; hydrazine
sulfate;
glucose; n-methylacetamide; phosphonoacetic acid; and/or salts thereof.
[0124] Coreactants also include, but are not limited to, N-ethylmorpholine;
sparteine; tri-n-butylamine; piperazine-1,4-bis(2-ethanesulfonic acid);
triethanolamine; dihydronicotinamide adenine dinucleotide; 1,4-
diazobicyclo(2.2.2)octane; ethylenediamine tetraacetic acid; oxalic acid; 1-
ethylpiperidine; di-n-propylamine; N,N,N',N'-Tetrapropyl-1,3-diaminopropane;
DAB-AM-4, Polypropylenimine tetraamine Dendrimer; DAB-AM-8,
Polypropylenimine octaamine Dendrimer; DAB-AM-16, Polypropylenimine
hexadecaamine Dendrimer; DAB-AM-32, Polypropylenimine dotriacontaamine
Dendrimer; DAB-AM-64, Polypropylenimine tetrahexacontaamine Dendrimer; 3-
(N-Morpholino)propanesulfonic acid; 3-Morpholino-2-hydroxypropanesulfonic
acid;
-Glycyl-glycine; 2-Morpholinoethanesulfonic acid; 2,2-Bis(hydroxymefihyl)-
2,2',2"--
nitrilotriethanol; N-(2-Acetamido)iminodiacetic acid; N,N-Bis(2-
hydroxyethyl)taurine; N-(2-Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid);
N, N-B is (2-h yd roxyethyl)-3-a min o-2- hyd roxyp ro pan esu lfon ic acid; 4-
(N-
Morpholino)butanesulfonic acid; 4-(2-Hydroxyethyl)piperazine-l-(2-
hydroxypropanesulfonic acid) Hydrate; Piperazine-1,4-bis(2-
hydroxypropanesulfonic acid) dihydrate; 4-(2-Hydroxyethyl)piperazine-l-
propanesulfonic acid; N,N-Bis(2-hydroxyethyl)glycine; N-(2-
Hydroxyethyl)piperazine-N'-(4-butanesulfonic acid); and/or salts thereof.
6. Solid Supports
[0125] In certain embodiments, the composition comprises a solid support.
Solid supports can be, but are not limited to, beads, membranes, gels,
hydrogels,
synthetic organic polymers, electrodes, and inorganic oxides. In some
embodiments, a solid support can be used to amplify and/or detect one target
nucleic acid sequence. In some embodiments, solid supports can be used to
-49-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
Jetect multiple target nucleic acid sequences. When multiple target nucleic
acid
sequences are detected, oligonucleotides that are sufficiently complementary
to
each target nucleic acid sequence are linked to discrete sections of the solid
support. Examples of solid supports that can be used with multiple
oligonucleotides include, but are not limited to membranes, semi-conductor
chips,
multiwell plates, and electrodes (See, e.g., U.S. patent application
publication
2004/0189311 and 2005/0052646). For example, a patterned array of electrodes
can be used with some electrodes configured to link to differing nucleic acid
sequences. These electrodes could be used, for example, as working electrodes
in an ECL reaction to detect an ECL label linked to the electrode by the
amplified
target nucleic acid. In some embodiments, the electrodes comprise carbon. In
other embodiments, a solid support can be patterned to allow for amplification
of
different target nucleic acid sequences at discrete sections of the solid
support,
wherein a fluorophore is detectable either by exciting only one section at a
time
and/or detecting fluorescent emissions from sections independently.
[0126] Beads can also be used with multiple oligonucleotide configurations.
For example, if the purpose is to amplify multiple targets, no separation
among the
amplified targets- is required._ In some embodiments, one_ may wish to
distinguish
between the different amplified sequences. This can be done by either making
the labels for the different nucleic acid sequences and separately measuring
each
label (e.g., each label could luminesce at a different wavelength) and/or by
separating beads that bind with only one amplified target nucleic acid
sequence.
Beads can be separated by using beads comprising at least one differing
property
such as, but not limited to, different sizes, different density, different
magnetic
content, different fluorescent tags acting as a bead barcode (e.g., xMAP from
Luminex Corp, Austin, TX, USA), etc. Separated beads can then be detected
either individually or as a group sharing the same target.
[0127] Beads that can be used with the invention include, but are not limited
to, polystyrene beads. Beads can also include magnetizable beads including
superparamagnetic beads. In certain embodiments, the solid support can
comprise carboxylated magnetizable beads. Beads can also include metallic
beads, including gold beads. In some embodiments, beads can have a diameter
-50-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
in the range of 0.01 pm - 100 pm, 0.1 pm - 50 pm, 1 pm - 20 pm, 0.5 pm - 10
pm,
0.05 pm - 5 pm, 1 pm - 3 pm, or 0.1 pm - 1 pm.
[0128] Membranes that can be used with the invention comprise, for
example, nitrocellulose, nylon, polyvinylidene fluoride (PVDF) or carboxylated
polyvinylidene (U.S. Patent No.: 6,037,124). Membranes can be coated with
various materials, including polyvinyl benzyl dimethyl hydroxyethyl ammonium
chloride, polyvinyl benzyl benzoyl aminoethyl dimethyl ammonium chloride,
polyvinyl benzyl tributyl ammonium chloride, copolymers of polyvinyl benzyl
trihexyl ammonium chloride and polyvinyl benzyl tributyl ammonium chloride,
copolymers of polyvinyl benzyl benzoyl dimethyl ammonium chloride and
polyvinyl
aminoethyl dimethyl ammonium chloride, and copolymers of polyvinyl benzyl
phenyl ureidoethyl dimethyl ammonium chloride and polyvinyl benzyl benzoyl
dimethyl ammonium chloride (U.S. Patent No.: 5,336,596).
[0129] Gels and hydrogels that can be used with the invention comprise, for
example, acrylamide, cellulose and agarose gels.
[0130] Synthetic organic polymers can be, but are not limited to, such as
polyacrylic, vinyl polymers, acrylate, polymethacrylate, polyacrylamide,
polyacylonitriles, polyolefins, and carbohydrate polymers. Examples of
carbohydrate polymers can be, but are not limited to, agarose, cellulose,
hyaluronic acid, chitin, acyl gellan, dextran, carboxymethylcellulose,
carboxymethyl starch, carboxymethyl chitin, poly(lactide-co-ethylene glycol)
and
polyethylene glycol. Solid supports can be comprised of polystyrene,
Sepharose , or Sephadex .
[0131] Electrodes can comprise any conductive material including, but not
limited to, carbon, carbon black, carbon nanotubes, silver, silver/silver
chloride,
gold, platinum, iridium, indium-tin-oxide (ITO) and platinum/iridium alloys.
[0132] Inorganic oxides can be, but are not limited to, silica, zirconia,
carbon
clad zirconia (U.S. Patent No.:5,182,016), titania, ceria, alumina, manganese,
magnesia (i.e., magnesium oxide), calcium oxide, and controlled pore glass
(CPG). The solid support can also comprise combinations of some of the above-
mentioned supports including, but not limited to, dextran-acrylamide.
-51-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
7. Linking Agents
[0133] In some embodiments, a solid support can be linked to one or more
oligonucleotides. In some embodiments, covalent bonds can link the
oligonucleotides to a solid support. In some embodiments, oligonucleotides can
be linked to a solid support via hybridization. In some embodiments, non-
covalent
associations can link the two moieties. Non-covalent associations can be, but
are
not limited to, ionic interactions, hydrogen bonds, and van der Waals forces.
In
some embodiments, oligonucleotides can be passively absorbed onto a solid
support (e.g., a carbon electrode). In some embodiments, a solid support can
be
linked to an oligonucleotide via a pair of binding partners. Typically,
specific
interactions between the binding partners can occur when the affinity constant
Ka
is higher than 106 M"1, or is higher than 108 M"1. A higher affinity constant
can
indicate greater affinity, and thus greater specificity. For example,
antibodies can
bind antigens with an affinity constant in the range of 106 M-1 to 109 M"' or
higher.
If desired, nonspecific binding can be reduced without substantially affecting
specific binding by varying the binding conditions using routine techniques
known
in the art. The conditions can be defined, for example, in terms of molecular
concentration, ionic strength of the solution, temperature, time allowed for
binding,
or concentration of other molecules in a binding reaction.
[0134] Examples of pairs of binding partner can be, but are not limited to,
sufficiently complementary nucleic acid sequences. Sufficiently complementary
nucleic acid sequences can hybridize as DNA/DNA hybrids, RNA/RNA hybrids, or
DNA/RNA hybrids. For example, in some embodiments, adenine nucleotides in
one DNA sequence can hybridize with thymidine nucleotides in another DNA
sequence. In some embodiments, adenine nucleotides in a RNA sequence can
hybridize with thymidine nucleotides in a DNA sequence.
8. Lyophilization or Freeze Drying
[0135] In certain embodiments the compositions of the invention can be
frozen and then dried (i.e., freeze-dried) to form dry compositions. In
certain
embodiments, the composition of the invention can be lyophilized to form dry
compositions. Using lyophilization to stabilize biological reagents is
described, for
example in U.S. Patent No. 5,834,254 and in U.S. Patent Application No.
-52-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
10/147,965. Examples of dry compositions include compositions that have a
moisture content of less than or equal to 3% by weight, relative to the total
weight
of the composition and compositions that have a moisture content ranging from
0% to 3% by weight, relative to the total weight of the composition. Forming a
dry
composition can provide a means for protecting the activity of the reagents
comprising the composition from fluctuations of various physical parameters
such
as temperature. Thus, in certain embodiments, the invention provides a dry
composition that can be stable at ambient temperature and can be useful for
detecting, amplifying, and/or isolating a target nucleic acid sequence. In
various
embodiments, the dry composition can have longer shelf-lives compared to a
mixture comprising the same reagents that is not dry and can be stable over a
wide range of temperatures: from, for example, -40 C to 60 C; -40 C to 4 C; 0
C
to 40 C; 0 C to 100 C; 4 C to 60 C; 10 C to 30 C; 10 C to 60 C; 15 C to 45 C;
20 C to 60 C; or 25 C to 40 C.
[0136] In some embodiments, the composition comprises a cryoprotectant.
A variety of cryoprotectants have been described. See, e.g., Clegg et al.
1982,
Cryobiology 19: 306; Carpenter et al., 1987, Cryobiology 24: 455.
Cryoprotectants suitable for use in the instant invention can be, but are-not
limited
to, disaccharides, polysaccharides, and polyalcohols. In certain embodiments,
the
cryoprotectant can be trehalose. In certain embodiments, the cryoprotectant
can
be mannitol, lactose, maltose, sucrose, dextrose, and/or polyvinylpyrrolidone
(PVP). Combinations of more than one cryoprotectant can also be contemplated.
Disaccharides can be, but are not limited to, trehalose.
9. Containers for Use with the Invention
[0137] Containers can be, but are not limited to, multiwell plates and tubes,
including, e.g., microcentrifuge tubes. In some embodiments, the containers
that
may hold the dry composition can be hermetically sealed. In some embodiments,
the container can be sealed with an elastomeric, thermoset, or a thermoplastic
material, such as EVA or Santoprene , that has been pressed into the
container's
opening. In some embodiments, the container can be sealed with a laminate
comprising a metallic layer, such as a foil microplate seal. In various
embodiments, the container can be sealed with a laminate comprising a
thermally
-53-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
modifiable layer, such as a laminate that can be heat-sealed to the container.
In
some embodiments, the container can be sealed with a laminate comprising an
adhesive layer that can bond the laminate to the container.
[0138] In some embodiments, the container comprises at least one
enclosure, such as one or more sealed enclosures (containers) inside a sealed
outer container (e.g., a sealed bag). In some embodiments, the sealed outer
container can, for example, comprise polyethylene, polyester, aluminum,
nickel, a
trilaminate of polyester-foil-polyethylene, or a bilaminate of polyester-
polyethylene.
In some embodiments, a desiccant can be added between the innermost
enclosure and the outermost enclosure. The desiccant can, for example,
comprise calcium oxide, calcium chloride, calcium sulfate, silica, amorphous
silicate, aluminosilicates, clay, activated alumina, zeolite, or molecular
sieves. In
some embodiments, a humidity indicator can be added between the innermost
enclosure and the outermost enclosure. The humidity indicator can, for
example,
be used as an indication that the dry composition is still sufficiently dry
that its
stability has not been compromised. In some embodiments, the humidity
indicator
can be viewed through the outermost enclosure. In certain embodiments, the
humidity indicator can be a card_or disc wherein the humidity is indicated by
a
color change, such as one designed to meet the US military standard MS20003.
[0139] In some embodiments, the humidity barrier created by the container
can be sufficient to keep the dry composition dry when the external conditions
are
37 C and 100% relative humidity for 10 days, 20 days, 40 days, 67 days, 3
months, 6 months, 12 months, 18 months, 24 months, or longer.
[0140] In some embodiments, the humidity barrier created by the container
can be sufficient to keep the dry composition dry when the external conditions
are
25 C and 100% relative humidity for 1 day, 1 week, 1 month, 3 months, 6
months,
12 months, 18 months, 24 months, or longer.
[0141] In some embodiments, the humidity barrier created by the container
can be sufficient to keep the dry composition dry when the external conditions
are
4 C and 30% relative humidity for 3 months, 6 months, 12 months, 18 months, 24
months, or longer.
-54-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
10. Polymerases
[0142] Polymerases include, but are not limited to, DNA polymerases and
RNA polymerases. Some polymerases, such as Klenow fragment, can use DNA
as a template. Other polymerases can use RNA as a template. These RNA-
dependent polymerases can be, but are not limited to, reverse transcriptase.
Yet
other polymerases, for example Tth polymerase and TZ05 polymerase, can use
DNA or RNA as a template. Thus exemplary polymerases can be a DNA-
dependent DNA polymerase, an RNA-dependent DNA polymerase, a DNA-
dependent RNA polymerase, and an RNA-dependent RNA polymerase. A
polymerase can have a combination of these activities. For example, reverse
transcriptase can be a DNA-dependent DNA polymerase and an RNA-dependent
DNA polymerase.
[0143] A polymerase can have other activities associated with it besides
polymerase activity. For example, a polymerase can also have RNAase activity
that confers the ability to degrade RNA. Reverse transcriptase's RNAase
activity
can allow this polymerase to degrade RNA in a RNA/DNA hybrid molecule.
Moreover, a polymerase such as Taq polymerase can have high processivity. A
polymerase such as terminal deoxynucleotidyl transferase can have Iow
processivity. A polymerase such as Klenow fragment can have moderate
processivity.
[0144] In some embodiments, the polymerase can be a thermostable
polymerase. In some embodiments, the polymerase can be derived from a
mesophilic organism, thus having maximum polymerase activity in the range of
20-40 C. Polymerases from mesophilic organisms can be, but are not limited to,
phi29 DNA polymerase (from the Bacillus subtilis), T4 DNA polymerase (from a
strain of Escherichia coli that carries a T4 DNA Polymerase overproducing
plasmid), T7 DNA polymerase (from T7 phage), and Klenow fragment (from
Escherichia coli). Thermostable polymerases can be derived from thermophilic
organisms. For example, thermostable polymerases can be derived from
thermophilic archaea. Thermostable polymerases can also be derived from
thermophilic bacteria. Thermostable polymerases can also be derived from
thermophilic Eukarya. Examples of thermostable polymerases include, but are
-55-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
not limited to, Taq polymerase derived from Thermus aquaticus, Pfu polymerase
derived from Pyrococcus furiosus, vent polymerase derived from Thermococcus
litoralis, Tli polymerase derived from Thermococcus litoralis, DyNAzymeTM
polymerase derived from Thermus brockianus, or Isis DNA polymeraseTM derived
from Pyrococcus abyssi. Yet other thermostable polymerases can be, for
example Tth polymerase and TZ05 polymerase.
11. Cations, Detergents, and Carrier Proteins
[0145] In some embodiments, monovalent cations can be provided by at
least one salt comprising a monovalent cation. Examples of monovalent cations
can be, but are not limited to, sodium (Na+), potassium (K+), ammonium (NH4+),
silver (Ag+), and quaternary ammonium cations such as tetramethylammonium
ions and tetraethylammonium ions. In some embodiments, divalent cations can
be provided by at least one salt comprising a divalent cation. Examples of
divalent cations can be, but are not limited to, magnesium (Mg2{), manganese
(Mn2+), calcium (Ca2+), and copper (Cu2+). In some embodiments, the salt can
be
chosen from at least one of potassium chloride and magnesium chloride.
[0146] In some embodiments, a buffering agent can be any buffer that has an
effective buffering capacity in the pH range of 6.0 to 9Ø In certain
embodiments,
a suitable buffer can be any buffer that has an effective buffering capacity
in the
pH range of 8.0 to 8.8. In some embodiments, the buffering agent can be a
buffer
having an effective buffering capacity in the pH range of 8.1 to 8.5. In some
embodiments, the buffering agent can be Tris-HCI. Buffering agents can be, but
are not limited to, N,N-Bis(2-hydroxyethyl)glycine,
Tris(hydroxymethyl)aminomethane hydrochloride, and N-
[Tris(hydroxymethyl)methyl]glycine. Buffering agents may shift the pH of a
solution as function of temperature. For example,
Tris(hydroxymethyl)aminomethane hydrochloride has a temperature dependence
in the range of -0.028 pH to -0.021 units/ C. Accordingly, ali pH values
herein
should be interpreted as the pH of the solution at 23 C.
[0147] In certain embodiments, a composition of the invention can comprise
a detergent. Examples of detergents can be, but are not limited to, ionic, non-
ionic, and zwitterionic detergents. Examples of detergents can be, but are not
-56-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
limited to, Tween 20, Triton X-1 00, Thesit (polyoxyethylene 9 lauryl
ether).
Other exemplary detergents can be found in the Sigma-Aldrich catalog.
[0148] In some embodiments, a composition of the invention can comprise a
carrier protein. Carrier proteins include, but are not limited to bovine serum
albumin.
III. Methods of Making Compositions of the Invention
A. Methods for Making Compositions Comprising Two
Oligonucleotides
[0149] Compositions of the invention can generaliy be made by gathering the
components present in the composition and combining those ingredients in one
composition. In some embodiments, the invention provides a method of making a
composition for detecting, amplifying, and/or isolating a target nucleic acid
sequence comprising obtaining the ingredients recited in the composition of
paragraphs [057], [061], [065], [066], or [067] and combining these
ingredients
thereby forming a composition for detecting, amplifying, and/or isolating a
target
nucleic acid sequence. In various embodiments, the ingredients used in these
methods have the characteristics described in Sections II.A and II.D above.
B. Methods for Making Compositions Comprising Three
Oligonucleotides
[0150] Compositions of the invention can generally be made by gathering the
components present in the composition and combining those ingredients in one
composition. In some embodiments, the invention provides a method of making a
composition for detecting, amplifying, and/or isolating a target nucleic acid
sequence comprising obtaining the ingredients recited in the composition of
paragraphs [070], [081], [082], or [083] and combining these ingredients
thereby
forming a composition for detecting, amplifying, and/or isolating a target
nucleic
acid sequence. In various embodiments, the ingredients used in these methods
have the characteristics described in Sections II.B and II.D above.
-57-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
C. Methods of Making Compositions for Multiple Arrays
[0151] Compositions of the invention can generally be made by gathering the
components present in the composition and combining those ingredients in one
composition. In some embodiments, components associated with the solid phase
(e.g., different oligonucleotides linked to different beads or different areas
of a
solid phase) can be made separately and then combined with the rest of the
ingredients. In some embodiments, the invention provides a method of making a
composition for detecting, amplifying, and/or isolating a target nucleic acid
sequence comprising obtaining the ingredients recited in the composition of
paragraph [084] or [085] and combining these ingredients thereby forming a
composition for detecting, amplifying, and/or isolating a target nucleic acid
sequence. In various embodiments, the ingredients used in these methods have
the characteristics described in Sections II.C and II.D above.
D. General Aspects of Making the Composition of the Invention
[0152] In some embodiments, the method of making a composition of the
invention can comprise lyophilizing the components once they are combined by
first freezing the composition described above and then dehydrating the
composition. In some embodiments, the composition can be frozen by placing it
in a commercial freezer at an appropriate temperature. For example, the
composition can be frozen by placing the container at -20 C for 2-30 minutes.
Alternatively, the composition can be frozen by placing it in an ice bath, for
example an ethanol-dry ice bath, for 2-30 minutes.
[0153] In some embodiments, the components of the composition can be
combined to result in various concentrations of each component. In some
embodiments, the polymerase can be present at a concentration of 25 to 250
units/milliliter. In some embodiments, the nucleoside triphosphates can be
present
at a concentration of 100 to 500 nanomolar. In some embodiments, the
monovalent cations can be present at a concentration of 50 to 150 millimolar.
In
certain embodiments, where the solid support is a bead, the beads can be
present
at a concentration of 200 to 2000 milligrams/liter. In some embodiments, the
cryoprotectant can be present at a concentration of 4 to 15 g/100 milliliter.
In some
-58-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
embodiments, the first oligonucleotide can be present at a concentration of
300 to
500 nanomolar. In some embodiments, the second oligonucleotide can be
present at a concentration of 300 to nanomolar. In some embodiments, the third
oligonucleotide can be present at a concentration of 1011 to 1019 copies per
m2 of
the solid support. In some embodiments, the third oligonucleotide can be
present
at a concentration of 1013 to 1018 copies per m2 of the solid support. In some
embodiments, the third oligonucleotide can be present at a concentration of
1015
to 1017 copies per m2 of the solid support.
IV. Methods of Detecting, Amplifying, and/or Isolating Target Nucleic
Acids
[0154] In some embodiments, the invention provides a method of detecting,
amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining a first composition for detecting, amplifying, and/or
isolating a target nucleic acid sequence produced by any of the
methods of paragraphs [0149] or [0150];
(2) adding a sample containing the target nucleic acid sequence to the
first composition to form a second composition;
(3) alternately heating and cooling the second composition so that
multiple copies of the target nucleic acid sequence are made;
(4) optionally isolating the multiple copies of the target nucleic acid
sequence from step (3); and
(5) optionally detecting the label thereby detecting the target nucleic
acid in the sample.
[0155] In some embodiments, the invention provides a method of detecting,
amplifying, and/or isolating a target nucleic acid sequence comprising:
(1) obtaining a first composition for detecting, amplifying, and/or
isolating a target nucleic acid sequence produced by any of the
methods of paragraph [0149];
(2) adding a sample containing the target nucleic acid sequence to the
first composition to form a second composition;
(3) alternately heating and cooling the second composition so that
multiple copies of the target nucleic acid sequence can be made;
-59-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
(4) linking the second oligonucleotide to the solid support;
(5) optionally isolating the multiple copies of the target nucleic acid
sequence from step (3); and
(6) optionally detecting the label thereby detecting the target nucleic
acid in the sample.
[0156] In some embodiments, the invention provides a method of detecting,
amplifying, and/or isolating a N target nucleic acid sequences comprising:
(1) obtaining a first composition of paragraph [084] or [085];
(2) adding a sample which may contain the N target nucleic acid
sequences to the first composition to form a second composition;
(3) alternately heating and cooling the second composition such that
multiple copies of each of the N target nucleic acid sequences that
are in the sample are made;
(4) allowing the multiple copies to link to the N discrete areas on the at
least one solid support; and
(5) optionally detecting or isolating the label thereby detecting the N
target nucleic acid sequences in the sample;
wherein- N is an integer greater than or equal to 1.
[0157] In various embodiments of methods of amplifying or detecting,
amplifying, and/or isolating a target nucleic acid sequence, the compositions
of
paragraphs [057], [061], [070], [084], and [085] can be modified to encompass
the
various embodiments described in Section II above. In various embodiments of
the methods of amplifying or detecting, amplifying, and/or isolating a target
nucleic
acid sequence, the compositions produced by the methods of paragraphs [0149],
[0150], and [0151] can be modified to encompass the various embodiments
described in Section II above.
[0158] In certain embodiments, the methods can comprise performing a PCR
reaction where all of the necessary reagents, except the sample containing the
target nucleic acid, are premixed in a container. The sample can be added to
the
premixed reagents before starting a PCR reaction. In some embodiments, the
amplified target nucleic acid sequence can be removed from the container after
PCR and isolated via standard techniques, such as on an agarose gel, for
further
-60-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
study or manipulation. In some embodiments, the amplified target nucleic acid
sequence can bind to the solid support. Depending on the solid support used,
the
container can be centrifuged or exposed to a magnetic source to concentrate
the
PCR products before detecting or isolating the products by detecting the label
associated with the PCR products.
[0159] Once the DNA amplification reaction is complete, the reaction
container can be cooled to a temperature at which the amplification products
can
bind to the solid support via the pair of binding partners. In some
embodiments,
the interaction between the first member and the second member of a pair of
binding partners is unstable at temperatures 10 C lower than the lowest
temperature in the amplification reaction and stable at temperatures above 20
C.
For example, the interaction between the first member and the second member of
a pair of binding partners can be unstable at about the same temperature as
the
lowest temperature in the amplification reaction and stable at temperatures
above
30 C. The nucleic acid sequences used for the pair of binding partners can be
a
mixture of nucleotides to provide, for example, the desired thermal stability
and
unique binding for measuring one or more target sequences.
- [0160] In some embodiments, multiple target nucleic acid sequences can be
amplified, detected, or isolated by using the solid support to separate the
labeled
and amplified target sequences. In some embodiments, the invention can detect
N target nucleic acid sequences, where N is an integer greater than or equal
to 1;
2; 10; 20; 30; 40; 50; 60; 70; 80; 90; 100; 200; 300; 400; 500; 600; 700; 800;
900;
1000; 2000; 3000; 4000; 5000; 10,000; 50,000; 100,000; 300,000; 500,000;
700,000 or 1,000,000. In some embodiments, 2:5 N<_ 1,000,000. In some
embodiments, 2:5 N<_ 1,000. In some embodiments, 2:5 N<_ 1,000. In some
embodiments, 2 s N 5 100. In some embodiments, 2 s N s 30. in some
embodiments, 2:5 N< 10. In some embodiments, N>_ 10. In some embodiments,
N _ 50.
[0161] In some embodiments, each target nucleic acid sequence can be
amplified with 1 pair of oligonucleotides. In some embodiments, "i" target
nucleic
acid sequences can be amplified with "i" pairs of oligonucleotides, wherein
"i" is an
integer between I and N and wherein each pair of oligonucleotides amplifies a
-61-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
different target nucleic acid sequence. In some embodiments, each target
nucleic
acid sequence can be amplified with pairs of oligonucleotides containing
nucleic
acid sequences unique to each target nucleic acid sequence. For example, if 10
different target nucleic acid sequences are to be detected, 10 different pairs
of
oligonucleotides are used, each pair amplifying one of the 10 different target
nucleic acid sequences. In some embodiments using three oligonucleotides, each
target nucleic acid sequence can be amplified with a pair of oligonucleotides
containing nucleic acid sequences common to more than one target nucleic acid
sequence. In such embodiments, the sequence of the third oligonucleotide can
be unique to each target nucleic acid sequence.
[0162] In some embodiments involving multiple target nucleic acid
sequences, the solid support can be a planar structure with discrete areas
arranged to capture different targets. In some embodiments, the discrete areas
can be electrodes, wherein each electrode is surrounded by an electrical
insulator.
For example, each discrete area can comprise a working electrode and a counter
electrode separated from each other and from other discrete areas by
electrical
insulators. The working electrode can be prepared to capture a target nucleic
acid
sequence. For example, each discrete area can be linked to differing third
oligonucleotides in order to detect different target sequences. In some
embodiments, the counter electrode can be shared across multiple working
electrodes and therefore the counter electrodes are not considered to be in
the
discrete areas. In some embodiments, each target nucleic acid sequence can
have a different first oligonucleotide; second oligonucleotide; if present,
third
oligonucleotide; and if present, pair of binding partners.
[0163] For example, each discrete area can be linked to a different first
member of pairs of binding partners where the pairs of binding partners can
permit
reversible binding between the different second oligonucleotides and the
different
discrete areas. In some embodiments, the interaction between the first members
and the second members of the pairs of binding partners are (1) unstable at
temperatures used for amplifying DNA, such that the first and second members
will not stably bind to each other during the amplification reaction; and (2)
stable
below the temperature used for amplifying DNA. Once the DNA amplification
-62-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
reactions are complete, the reaction container can be cooled to a temperature
at
which the amplification products bind to their respective discrete areas via
the pair
of binding partners.
[0164] In some embodiments, electrochemiluminescence can be used to
detect multiple target nucleic acid sequences by using electrodes as the
discrete
areas of the solid support, each area being arranged to specifically bind to
one of
the target sequences. In some embodiments, fluorescence can be used to detect
multiple target nucleic acid sequences with each discrete area of the solid
support
being arranged to specifically bind to one of the target sequences.
[0165] In certain embodiments, the method of detecting, amplifying, and/or
isolating a target nucleic acid sequence further comprises forming a dry
composition from the composition of step (1) (e.g., by freeze-drying or
lyophilizing)
before performing steps 2-5 described at the beginning of section IV. In some
embodiments, the components can be frozen. For example, the dry composition
may be formed by first snap freezing the composition of step (1) in, for
example, a
dry ice ethanol bath or in liquid nitrogen. After freezing, the components can
be
lyophilized at temperatures and pressures that maintain the sample in a solid
state, for example, a temperature of -30 C to 0 C and a pressure of 10 to 20
millitorr for a time sufficient to reduce the water content to 0% to 5%, e.g.,
1 to 48
hours. Longer durations and lower pressures are also contemplated. After
initial
water removal at cold temperatures, the lyophilization temperature may, in
some
cases, be increased to as high as 37 C to accelerate the rate of water removal
in
the reduced pressure environment. In some embodiments, rehydration can occur
when at least one of water, buffer, or the sample containing the target
nucleic acid
sequence is added to the dried composition of step (1). The skilled artisan
will
understand that if rehydration is achieved by adding water and/or buffer, the
sample can be added subsequently, but prior to commencing the PCR reaction.
Alternatively, water and/or buffer could be added after the sample is added
but
prior to commencing the PCR reaction.
[0166] Those skilled in the art can use PCR to amplify DNA or RNA
sequences. PCR involves subjecting each sample to a series of amplification
cycles. Typically, each amplification cycle can include (1) a melting step in
which
-63-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
double-stranded nucleic acids separate into single strands, (2) an annealing
step
in which first and second oligonucleotides, also called primers in the context
of
PCR, hybridize to sufficiently complementary sequences contained in the target
nucleic acid, and (3) a primer extension or polymerase step in which a
polymerase
enzyme extends the primers by adding nucleoside triphosphates to the growing
polynucleotide, thus creating multiple copies of the target nucleic acid. In
some
embodiments, when the target nucleic acid sequence is an RNA sequence, the
composition of the invention can comprise an RNA dependent polymerase such
as reverse transcriptase, to convert the RNA into DNA, and a DNA-dependent
polymerase to facilitate amplification of the resulting DNA sequence.
[0167] In some embodiments, the target DNA is a single-stranded target
nucleic acid molecule. The PCR melting step can eliminate secondary structure
in
the single-stranded target. Only the primer sufficiently complementary to the
single strand can initially hybridize with the target sequence during the
first
amplification cycle. Once the first amplification step is complete, the target
DNA is
then double-stranded, allowing both primers to bind to their sufficiently
complementary sequences in subsequent PCR cycles.
[0168] Suitable melting temperatures are in the-range of 85 C to 99 C. The -
duration of the melting step can be in the range of 10 seconds to 5 minutes.
In
some embodiments, the target nucleic acid sequence can be incubated at 95 C
for 30 seconds to allow strand separation and/or secondary structure removal.
In
some embodiments, the target nucleic acid sequence can be incubated at 97 C
for 15 seconds to allow strand separation and/or secondary structure removal.
[0169] The temperature and amount of time needed for optimal primer
annealing to the target sequence can vary according to the primer sequence,
primer length, and primer concentration in the PCR reaction. For example, in
certain embodiments, the annealing temperature can be 5 C below the melting
temperature (Tm) of the primer. In general, an approximate primer Tm can be
calculated by adding 2 C for each A or T in the primer and 4 C for each G or C
in
the primer. Alternatively, Tm can be calculated using the following formulas.
For
sequences that are less than 14 nucleotides long: Tm = (wA+xT) x 2 + (yG+zC) x
4. For sequences that are more than 13 nucleotides long: Tm = 64.9 + 41 x (yG
+
-64-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
zC - 16.4)/(wA + xT + yG + zC). In each formula, w, x, y, and z are the number
of
As, Ts, Gs, and Cs in the nucleotide sequence for which the Tm can be
calculated. In some embodiments, suitable temperatures for annealing primers
to
a target nucleic acid sequence can be in the range of 45 C to 65 C. In some
embodiments, the duration of the annealing step can be in the range of 2
seconds
to 5 minutes. In some embodiments, suitable temperatures for annealing primers
to a target nucleic acid sequence can be in the range of 55 C to 72 C. In some
embodiments, the concentration of each primer in the PCR reaction can be 0.1
pM to 0.5 pM. In some embodiments, the concentration of each primer in the
PCR reaction can be 0.2 pM. The skilled artisan can easily determine the
appropriate annealing temperature and primer concentration to achieve optimal
primer binding and specificity.
[0170] Successful primer extension can depend on the length of the target
nucleic acid sequence, the concentration of the target nucleic acid sequence
in
the PCR reaction, and upon the temperature at which polymerization occurs. In
some embodiments, primer extension temperatures can range from 60 C to 85 C
or 70 C to 75 C. In some embodiments, the primer extension temperature can be
72 C.- The duration of the primer extension step can be in the range of I
second
to 30 minutes or in the range of 20 seconds to 5 minutes. In some embodiments,
the PCR reaction can be incubated at 72 C for one minute to allow primer
extension.
[0171] The number of amplification cycles required for successful target
nucleic acid amplification can depend on the concentration of the target
nucleic
acid sequence in the PCR reaction. In some embodiments, the PCR reaction can
undergo 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40, or 40 to
45
amplification cycles.
[0172] Optionally, prior to beginning the amplification cycles, the PCR
reaction can be pre-incubated to minimize secondary structure in the target
nucleic acid sequence and to maximize the completeness of target sequence
double strand separation. In some embodiments, the temperature for this pre-
incubation step can be in the range of 85 C to 99 C, and the duration of this
step
can be in the range of 1 to 10 minutes. In addition, a final primer
-65-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
extension/polymerization step can be added after the cycling is complete to
allow
the amplified copies to replicate the target sequence in its entirety. In some
embodiments, this final step can be performed at a temperature in the range of
70 C to 75 C for a duration of 1 to 15 minutes.
[0173] !n some embodiments, the PCR reaction container can be
manipulated after completion of the PCR reaction. In some embodiments, when
the PCR reaction is complete, the contents of the container can be mixed in
order
to resuspend the third oligonucleotide linked to the solid support. In some
embodiments where the interaction between an oligonucleotide and the solid
support is unstable at high temperatures, the contents of the container can be
mixed at a temperature where the interaction is stable to facilitate the
linkage of
the oligonucleotide to the solid support.
[0174] In some embodiments, the contents of the container can be heated to
a temperature in the range of 85 C to 99 C for I to 15 minutes to permit the
double stranded nucleic acid product of the PCR reaction to melt into single
strands. In some embodiments using a third oligonucleotide linked to the solid
support, the third oligonucleotide can hybridize to the target sequence by
lowering
the temperature to the range of 20 C to 65 C for-a duration in the range of 5
minutes to 2 hours. ln some embodiments where the interaction between the
third
oligonucleotide and the solid support is unstable at high temperatures, the
PCR
reaction can be incubated at a temperature where the interaction is stable to
facilitate the linkage of the oligonucleotide to the solid support and where
the third
oligonucleotide can hybridize to the target nucleic acid sequence. For
example,
the third oligonucleotide can contain a poly-T tail at its 5' terminus that
does not
bind to the target nucleic acid sequence. This single-stranded poly T tail can
bind
to a poly A oligonucleotide that can be covalently bound to the solid support,
using
2 C for each A/T pair.
[0175] The target sequence can then be physically separated from the rest
of the contents of the container. In some embodiments, physical separation can
be achieved through gravity. In some embodiments, the container can be
centrifuged, e.g. 1,000 x g for 10 minutes. ln certain embodiments where the
solid
support is a magnetizable bead, separation can be achieved by applying a
-66-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
magnetic field to the container and decanting, aspirating, or otherwise
removing
the unbound reagents, thereby isolating the target nucleic acid sequence.
[0176] In some embodiments, the target sequence can be detected after the
PCR reaction is complete. Where the label is an ECL moiety or fluorophore, the
amplified target sequence can be placed in a cell connected to a
photomultiplier
tube. One skilled in the art will recognize that the target sequence can be
isolated
and detected in the cell of an instrument designed for this purpose, e.g., an
M-
SERIES M1-M Analyzer (BioVeris Corp., Gaithersburg, MD). Where the label is a
radioactive isotope, the amplified target sequence can be detected using, for
example, a gamma counter, a Geiger counter, or a scintillation counter.
V. Kits
[0177] In some embodiments, the invention also provides kits for carrying out
the methods of detecting, amplifying, and/or isolating target nucleic acids.
In
some embodiments, kits of the invention can comprise at least one of the
compositions of paragraphs [057], [061], [070], [084], and [085]. In some
embodiments, a kit can comprise a container in which kit components can be
packaged. In some embodiments, a kit can comprise directions on how to use the
kit components to detect, amplify, and/or isolate target nucleic acids.
EXAMPLES
Example 1: Detection of DNA from pathogenic bacteria
[0178] Three oligonucleotides were designed to hybridize to a portion of the
DNA sequence encoding the protective antigen of B. anthracis. The sequence of
the first oligonucleotide was as follows:
5'- TAGAAGGATATACGGTTGATGT-3' SEQ ID NO. 1
SEQ ID NO. 1 is a forward primer.
The second oligonucleotide's sequence was as follows:
5'- TGTCTTGCCTCTGGTGAT-3' SEQ ID NO. 2
SEQ ID NO. 2 is a reverse primer.
The two oligonucleotide primers amplified a PCR product 193 bases long. SEQ
ID NO. 2 was synthesized with a ruthenium at the 5' end by phosphoramidite
chemistry using the methods described in US patent 5,597,910.
-67-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
The third oligonucleotide, used to capture the resulting labeled PCR product,
had
the following sequence:
5'- C6 amino-GGTTACAGGACGGATTGATA -3' SEQ ID NO. 3
This oligonucleotide was sufficiently complementary to the same target strand
as
the unlabeled PCR primer at a location on the target nucleic acid sequence
between the locations where the first and second oligonucleotides hybridized
to
the target nucleic acid sequence. The third oligonucleotide was synthesized
with
a primary amine group at the 5'-terminus, purchased from Biosource
International
(Camarillo, CA). The capture oligonucleotides were coupled to Dynal 2.8-micron
carboxylated superparamagnetic beads (Dynal Biotech, Brown Deer, WI, M-270
carboxylated beads, part number 143.06) by using [1-ethyl-3-
(dimethylaminopropyl)carbodiimide] hydrochloride as a cross-linking agent.
Briefly, 200 pl M-270 carboxylated beads (30 mg/mI) were prepared for coupling
by washing twice with 200 pl 0.01 M sodium hydroxide and three times with 200
pl
deionized water. The washed beads were resuspended in 140 pl of a solution
containing 25 mM 2-morpholinoethanesulfonate buffer (MES, Sigma Aldrich, St.
Louis, MO) pH 5.0 and 30 pM amino-labeled oligonucleotide. The mixture was
incubated at-room temperature with end-over-end mixing for 30 minutes, and
then
60 pl freshly made solution of 100 mg/mI [1-ethyl-3-
(dimethylaminopropyl)carbodiimide hydrochloride (EDC, Pierce Biotechnology,
Rockford, IL) in 100 mM MES pH 5.0 was added and incubated 18 hours at 4 C.
Unreacted oligonucleotide was removed by washing the beads four times with 400
pl 10 mM Tris-HCI pH 8.0, 0.1 mM EDTA, 0.1% Tween20 (Sigma Aldrich, St.
Louis, MO). Conjugated beads were resuspended in 400 pl of the same buffer
(15 mg beads/ml) and stored at 4 C.
[0179] A liquid formulation of the following reagents was prepared: 5 mM
Tris-HCI pH 8.3 25 mM KCI, 2.5 mM MgCi2, 0.1 mM dATP, 0.1 mM dCTP, 0.1 mM
dGTP, 0.1 mM dTTP, 0.1 pM unlabeled PCR primer in 10 mM Tris pH 8.0, 0.1 mM
EDTA, 0.1 pM ([Ru(bpy)3]2+-labeled PCR primer in 10 mM Tris pH 8.0, 0.1 mM
EDTA, 2.5% w/v trehalose, 0.125% v/v Tween 20, 0.02 units/pl Taq DNA
polymerase, 0.3 pg of the above-described oligonucleotide-superparamagnetic
beads coupled to the third oligonucleotide. Buffer, magnesium chloride
solution
-68-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
and Taq DNA polymerase were purchased from Applied Biosystems. A dNTP mix
solution was purchased from Bioline. Trehalose and Tween 20 were purchased
from Sigma Aldrich. Oligonucleotides were purchased from Biosource.
[0180] Fifty microliters of the liquid formulation was placed in 0.2 mi
polypropylene PCR tubes, snap frozen in a dry ice ethanol bath, and dried by
lyophilization for 46 hours in a Labconco model 7934000 lyophilizer with a
shelf
temperature -30 C. The dry formulations were used the same day for the
following
experiments. PCR reactions were prepared by adding 25 pl water to each tube.
One microliter of 200 pg/iai B. anthracis DNA, prepared using a silica spin
column
(Qiagen) from the Sterne strain was added to the highest concentration tube,
and
six serial dilutions of DNA were performed in the reaction mixes. The PCR
tubes
were capped, mixed briefly, and then placed in a thermal cycler (MJ Research
PTC-200) to undergo 35 cycles of DNA amplification. The PCR tubes were pre-
incubated at 95 C for 7 minutes before starting the amplification cycles. Each
amplification cycle consisted of incubating the PCR tubes at 95 C for 30
seconds,
55 C for 30 seconds, and then at 72 C for 1 minute. After completing the 35
cycles, the PCR tubes were incubated at 72 C for 4 minutes.
- [0181] The reactions were then mixed briefly to resuspend the beads, heated
for 5 minutes at 95 C, and then incubated for 30 minutes at 40 C to permit the
capture oligonucleotide to hybridize with the PCR products. Labeled via the
incorporated labeled primer, the PCR products were then diluted with 210 pi of
phosphate-buffered saline (PBS) and the amount of [Ru(bpy)3]2+ bound to the
beads was quantified in a BioVeris M-SERIES Ml R Analyzer (BioVeris Corp.,
Gaithersburg, MD). As shown in Figure 1, the results demonstrated a
correlation
between the ECL signal detected and the amount of target B. anthracis DNA
present.
Example 2: Stability of the lyophilized product
[0182] PCR reaction mixtures were prepared for amplifying and detecting
DNA sequences that encode a portion of the following B. anthracis targets:
protective antigen, capsular protein B, and a chromosomal locus. The following
primer pairs were used for each target
Protective antigen:
-69-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
forward primer: SEQ ID NO. 1
reverse primer: SEQ ID NO. 2
Capsular protein B:
forward primer: 5'- AGATATTCCAACGCAAGAGT -3' SEQ ID NO.
4
reverse primer: 5'- CCACTCCATATACAATCCGAT -3' SEQ ID NO.
Chromosomal locus BA4070:
forward primer: 5'- TAAGGAGGAGGTAATATGGAG -3' SEQ ID
NO. 6
reverse primer: 5'- CAGTAGGGAAAGTTGGGAGTT -3' SEQ ID
NO. 7.
The sequences of the capture oligonucleotides were as follows:
Protective antigen:
SEQ ID NO. 3
Capsular protein B:
5'- C6 amino-TTATGTCTCGTATGCGTCC -3' SEQ ID NO. 9
Chromosomal locus BA4070:
5'- C6 amino-AATCAGCCAATCAACATTAA -3' SEQ ID NO. 10.
As described in Example 1, capture oligonucleotides were synthesized with a
primary amine group at the 5'-terminus. Each reaction mix consisted of 10 mM
Tris-HCI pH 8.3, 50 mM KCI, 4 mM MgCI2, 0.2 mM dATP, 0.2 mM dCTP, 0.2 mM
dGTP, 0.4 mM dUTP, 5% w/v trehalose, 0.25% Tween 20, 0.02% bovine serum
albumin (BSA), 0.2 pM unlabeled forward primer, 0.2 pM [Ru(bpy)3]2+-labeled
reverse primer, 0.6 pg M-270 superparamagnetic beads linked to a capture
oligonucleotide (prepared as in Example 1), and 0.04 units/tal Taq DNA
polymerase. A total of 6 ml of each mix was made, 4 ml of which was
lyophilized.
The reverse primers were synthesized with a ruthenium-chelate detectable group
at the 5'-terminus, as described in Example 1.
[0183] Twenty-five microliter aliquots of the reaction mix were dispensed into
0.2 ml PCR reaction tubes and snap frozen in a dry ice-ethanol bath. The
frozen
tubes were placed in a model 7934000 Labconco lyophilizer and dried using a
-70-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
program of increasing shelf temperature: -30 C for 1.5 hr, ramp to -10 C over
the
next 12 hours, ramp to 0 C over the next 6 hours, and finished by 20 hours at
C. The dried reaction tubes were stored at 37 C in aluminum foil pouches
containing 5 g silica gel desiccant packets (Ulead). At one day, 7 days, and
28
days post-lyophilization, reaction tubes were reconstituted by adding 0, 0.1,
or 5
pg B. anthracis DNA suspended in 25 pl of water. The PCR tubes were capped,
mixed briefly, and then placed in a MJ Research PTC225 thermal cycler to
undergo 38 cycles of DNA amplification. The PCR tubes were pre-incubated at
95 C for 7 minutes before starting the amplification cycles. Each
amplification
cycle consisted of incubating the PCR tubes at 95 C for 15 seconds and 50 C
for
30 seconds repeated 38 times. The samples were then incubated at 72 C for 2
minutes
[0184] The reactions were then mixed briefly to resuspend the beads, heated
for 5 minutes at 95 C, and then incubated for 30 minutes at 40 C to permit the
capture oligonucleotide to hybridize with the PCR products. Labeled via the
incorporated labeled primer, the PCR products were then diluted with 210 ial
of
water and the amount of [Ru(bpy)3]2+ bound to the beads was quantified in a
BioVeris M-SERIES -M1 R Analyzer (BioVeris Corp., Gaithersburg, MD). As-
shown in Figure 2A and 2B, the reaction mixtures provided detectable PCR
products at each DNA concentration tested. Thus, the reaction mixtures for all
three target sites were stable for at least 28 days when stored at 37 C.
Example 3: Detection of RNA
[0185] A reaction mixture was prepared to amplify and detect a portion of the
RNA genome of the coronavirus that causes Severe Acute Respiratory Syndrome
(SARS). The oligonucleotides used had the following sequences:
forward primer: 5'- AAGCAGCCCACTGTGACTC -3' SEQ ID NO.
11
reverse primer: 5'- Ru(bpy)32+-CATAACCAGTCGGTACAGCT -3'
SEQ ID NO. 12
capture oligonucleotide: 5- C6 amino-
GAAGCTATTCGTCACGTTCG -3' SEQ ID NO. 13.
-71 -
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
The primers and capture oligonucleotide were prepared as described above in
Examples I and 2. The reaction mixture contained 20 mM Tris-HCI pH 8.3, 100
mM KCI, 2 mM magnesium chloride, 0.2 mM dATP, 0.2 mM dCTP, 0.2 mM dGTP,
0.4 mM dUTP, 5% trehalose, 0.2 pM unlabeled forward primer, 0.2 pM
[Ru(bpy)3]2+-labeled reverse primer, 0.6 pg superparamagnetic beads (1 pm
diameter MyOneTM carboxylated beads from Dynal Biotech, part number 650.12)
linked to the capture oligonucleotide, and 0.15 units/pI Thermus sp. Z05
polymerase (Applied Biosystems, Foster City, CA). Superparamagnetic beads
were prepared as described in Example 1.
[0186] Twenty-five microliters of the reaction mixture were dispensed into
0.2 ml PCR reaction tubes. The tubes were snap frozen on dry ice, and were
placed in a VirTis Ultra 35 lyophilizer precooled to -30 C. The temperature
was
held at -30 C for 360 minutes, increased to -10 C at 0.1 C/min, held at -10
C for
480 minutes, increased to 0 C at 0.1 C/min, held at 0 C for 300 minutes,
increased to 10 C at 0.1 C/min, held at 10 C for 300 minutes, increased to 25
C
at 0.17 C/min, and held at 25 C for 13 hours. The pressure throughout was 15-
19
millitorr. Dried reactions were reconstituted by adding 25 pl deionized water.
The
test template for the reconstituted reactions was SARS-CoV Armored RNA
(Ambion, Austin, TX). Three microliters Armored RNA (1 x 105 particles) were
activated by heating for 3 minutes at 75 C, and then added to an RT-PCR
reaction. Dilutions of RNA were performed by serially transferring 3 lal to
six
tubes. The PCR tubes were capped, mixed briefly, and then placed in a in a MJ
Research PTC-200 thermal cycler to undergo 40 cycles of amplification. The
PCR tubes were first pre-incubated at 65 C for 30 minutes to allow synthesis
of an
initial DNA strand from the RNA template. Samples were then incubated at 95 C
for 1 minute to allow the strands of the resulting RNA/DNA hybrids to separate
before starting the amplification cycles. Each amplification cycle consisted
of
incubating the PCR tubes at 95 C for 15 seconds and 55 C for 30 seconds. After
completing the 40 cycles, the PCR tubes were incubated at 45 C for 30 minutes
to
permit the capture oligonucleotide to hybridize with the PCR products. Labeled
via the incorporated labeled reverse primer, the PCR products were then
diluted
with 210 pl of PBS and the amount of [Ru(bpy)3]2+ bound to the beads was
-72-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
quantified in a BioVeris M-SERIES Ml R Analyzer (BioVeris Corp.,
Gaithersburg,
MD). As shown in Figure 3, the intensity of the resulting ECL signal
correlated
with the viral RNA copy number present in the sample.
[0187] All references cited herein are incorporated by reference in their
entirety. To the extent publications and patents or patent applications
incorporated by reference contradict the disclosure contained in the
specification,
the specification is intended to supersede and/or take precedence over any
such
contradictory material.
[0188] All numbers expressing quantities of ingredients, reaction conditions,
and so forth used in the specification and claims are to be understood as
being
modified in all instances by the term "about." Accordingly, unless indicated
to the
contrary, the numerical parameters set forth in the specification and attached
claims are approximations that can vary depending upon the desired properties
sought to be obtained by the present invention. At the very least, and not as
an
attempt to limit the application of the doctrine of equivalents to the scope
of the
claims, each numerical parameter should be construed in light of the number of
significant digits and ordinary rounding approaches.
-[0189] Many modifications and variations of this- invention can be made --
without departing from its spirit and scope, as will be apparent to those
skilled in
the art. For example, although the specification refers to PCR for nucleic
amplification, other amplification techniques are also within the scope of the
invention, such as target polynucleotide amplification methods such as self-
sustained sequence replication (3SR) and strand-displacement amplification
(SDA); methods based on amplification of a signal attached to the target
polynucleotide, such as "branched chain" DNA amplification; methods based on
amplification of probe DNA, such as ligase chain reaction (LCR) and QB
replicase
amplification (QBR); transcription-based methods, such as ligation activated
transcription (LAT) and nucleic acid sequence-based amplification (NASBA); and
various other amplification methods, such as repair chain reaction (RCR) and
cycling probe reaction (CPR).
[0190] The specification is most thoroughly understood in light of the
teachings of the references cited within the specification. The embodiments
within
-73-
CA 02613101 2007-12-20
WO 2007/005626 PCT/US2006/025619
the specification provide an illustration of embodiments of the invention and
should not be construed to limit the scope of the invention. The skilled
artisan
readily recognizes that many other embodiments are encompassed by the
invention. All publications and patents cited in this disclosure are
incorporated by
reference in their entirety. To the extent the material incorporated by
reference
contradicts or is inconsistent with this specification, the specification will
supersede any such material. The citation of any references herein is not an
admission that such references are prior art to the present invention. It is
intended that the specification and examples be considered as exemplary only,
with a true scope and spirit of the invention being indicated by the following
claims.
-74-
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 74
NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 74
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME:
NOTE POUR LE TOME / VOLUME NOTE:
