Note: Descriptions are shown in the official language in which they were submitted.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE I)E CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME DE _2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
AN INTEGRATED APPROACH FOR GENERATING MULTIDOMAIN
PROTEIN THERAPEUTICS
1. FIELD OF THE INVENTION
[0001] The invention relates to a method for therapeutic protein development
that
allows generation of proteins of both high therapeutic efficacy and optimal
forinulation
characteristics, e.g., high solubility and long shelf life. The present
invention also relates to a
method for evaluating one or more metrics, which provide an indication of the
shelf life of a
multidomain protein formulation.
2. BACKGROUND OF THE INVENTION
[0002] A wide variety of biologically active proteins and polypeptides can now
be
produced in sufficiently large quantities for use as drugs. For example, the
development of
the hybridoma method and recombinant DNA techniques have made it possible to
produce
antibodies on large scale. This has allowed wide use of pharmaceutical
compositions
containing proteins, such as antibodies, for treating a variety of diseases.
Such treatments
normally require administering to a patient the proteins at high
concentrations.
[0003] However, a protein that has desired therapeutic properties may not have
sufficiently high solubility. Even for those proteins that have high
solubility, high
concentration liquid formulations tend to have short shelf lives and may lose
biological
activity as a result of chemical and physical instabilities during the
storage. Additionally,
proteins are generally more viscous at high concentrations, which can
complicate packaging,
storage and delivery of the protein therapeutic. Furthermore, chemical
instability may be
caused by deamidation, racemization, hydrolysis, oxidation, beta elimination
or disulfide
exchange, and physical instability may be caused by protein denaturation,
aggregation,
precipitation or adsorption. Among those, aggregation, deamidation and
oxidation are known
to be the most common causes of antibody degradation (Wang et al., 1988, J.
ofParenteral
Science & Technology 42 (Suppl.):S4-S26; Cleland et al., 1993, Critical
Reviews in
Tlzerapeutic Drug Carrier Systeins 10(4):307-377; Manning et al., 1989, Pharm.
Res. 6:903-
918). Aggregate formation during storage of a liquid protein composition can
adversely
affect the biological activity of the protein, resulting in loss of
therapeutic efficacy and/or an
increase in immunogenicity in humans. Aggregate forination may also cause
other problems
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
such as blockage of tubing, membranes, or puinps when the protein coinposition
is
administered using an infusion system.
[0004] Due to the instability of proteins in liquid pharmaceutical
formulations,
protein therapeutics are often packaged in the lyophilized form along with a
suitable liquid
mediuin for reconstitution. Although lyophilization improves storage stability
of the
composition, inany proteins exhibit decreased activity, either due to storage
in the dried state
(Pikal, 1990, Biophann. 27:26-30) or as a result of aggregate fonnation or
loss of catalytic
activity upon reconstitution as a liquid fonnulation (see, for exainple,
Carpenter et al., 1991,
Develop. Biol. Standard 74:225-239; Broadhead et al., 1992, Drug Devel. Ind.
Pharm.
18:1169-1206; Mumenthaler et al., 1994, Phann. Res. 11:12-20; Carpenter et
al., 1988,
Cryobiology 25:459-470; and Roser, 1991, Biopharm. 4:47-53). Lyophilized
formulations
of antibodies also require a prolonged process for lyophilization and high
cost for
manufacturing. A lyophilized formulation has to be reconstituted aseptically
and accurately
by healthcare practitioners prior to administering to patients. The
reconstitution procedure is
cumbersome and the time limitation after the reconstitution can cause great
inconveniences in
administering the formulation to patients, leading to significant waste, if
not reconstituted
properly or if the reconstituted dose is not used within six (6) hours and
must b"e discarded.
Reconstitution may also increase the possibility of incorrect dosing. Thus, a
lyophilized
formulation which is more stable and is readily reconstituted with little loss
in potency is
desirable.
[0005] A desirable alternative to lyophilized formulations is liquid
formulations of
protein therapeutics having concentrations comparable to or higher than the
reconstituted
lyophilized formulations. Such liquid formulations of protein therapeutics can
be
administered to a subject without the need of reconstitution, thereby allowing
healthcare
practitioners much quicker and easier administration of protein therapeutics
to a patient. In
addition, the manufacturing process of the liquid formulation protein
therapeutics is simpler
and more efficient than the manufacturing process for the lyophilized version
because all
stages of the manufacturing of the liquid formulations are carried out in an
aqueous solution,
involving no drying process, such as lyophilization. Accordingly, it is also
more cost
effective. The development of high concentration, ready-to-use, liquid
formulations of
protein therapeutics has thus attracted great attention in the
biopharmaceutical industry.
[0006] Stability of proteins and polypeptides in phannaceutical formulations,
both
liquid and lyophilized, can be affected, for example, by factors such as pH,
ionic strength,
2
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
temperature, repeated cycles of freeze-thaw, and exposure to mechanical shear
forces such as
occur during processing. Various highly stable, high concentration liquid
formulations have
been successfully developed. For example, liquid formulations of antibodies
that are stable
for more than 5 years when stored at 4 C have been reported. U.S. Patent No.
6,525,102
discloses a stabilized liquid polypeptide-containing pharmaceutical
composition. The
composition comprises an ainino acid base, which serves as the primary
stabilizing agent of
the polypeptide, and an acid and/or its salt form to buffer the solution
within an acceptable
pH range for stability of the polypeptide. The compositions are near isotonic.
The ' 102
patent also discloses methods for increasing stability of a polypeptide in a
liquid
pharmaceutical composition and for increasing storage stability of such a
pharmaceutical
coinposition. Lyophilized formulations are common and their stability and
reconstitution
characteristics may be modified by the addition of stabilizers and/or
excipients. However,
the development of such liquid and lyophilized formulations depends on the
particular protein
therapeutics, and often requires significant optimization efforts. Thus,
improving the stability
of pharinaceutical compositions containing protein therapeutics of a
phannaceutically
effective concentration remains a challenge. An additional challenge is
providing for
formulations which have low enough viscosity to be readily manufactured and/or
administered at high concentrations.
[0007] In a traditional approach to therapeutic protein (e.g., antibody)
development,
the protein that has a desired activity and/or property (e.g., binding
affinity) is first generated.
The protein is then submitted for formulation development to determine the
optimal
fonnulation and storage conditions. Traditional screening and optimization
processes require
lengthy stability studies which are both time consuming and can only examine a
limited
number of potential formulations. If the protein should fail to meet the
formulation
requirements, the whole drug development process essentially fails. Thus,
there is a need for
methods that allow incorporating formulation considerations into early stages
of the drug
development process. In addition, since the desired shelf life can be as long
as one year or
longer, methods relying monitoring the formulations in real time are
inefficient. Attempts
have been made to develop methods for rapidly screening formulations. For
example, U.S.
Patent No. 6,232,085 discloses a multi-variable method for optimizing the
shelf life of a
protein which is capable of denaturing due to a therinal change. The method
comprises
contacting the target molecule with one or more of a multiplicity of different
molecules or
different biochemical conditions in each of a inultiplicity of containers,
simultaneously
3
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
heating the inultiplicity of containers, measuring in each of the containers a
physical change
associated with the thermal denaturation of the target molecule resulting from
heating,
generating a thermal denaturation curve for the target molecule as a function
of temperature
for each of the containers, coinparing each of the denaturation curves to (i)
each of the other
thermal denaturation curves and to (ii) the thermal denaturation curve
obtained for the target
under a reference set of biochemical conditions, and ranking the efficacies of
multiplicity of
different molecules or the different biochemical conditions according to the
change in each of
the thermal denaturation curves. However, such methods are cuinbersome and do
not address
the address the intrinsic properties or characteristics, such as, pI and Tin,
of the protein to be
formulated.
[0008] The intrinsic properties of proteins not only affect their formulation
characteristics but may have serious iinplications for their therapeutic use
as well. For
example, studies have shown that recombinant toxins made up of a cell-
targeting Fv portion
of an antibody fused to a toxin have non-specific dose limiting toxicities
(e.g., non-specific
liver toxicities) which are attributable to the high isoelectric point (pI) of
the Fv portion of the
molecule. Lowering the pI of the Fv portion of these recombinant toxins by
site directed
inutagenesis reduced their non-specific toxicity in animal models without
altering reducing
their antitumor activity (Onda et al., 1999, J. hnmunol., 163: 6072-77, Onda
et al., 2001,
Cancer Res., 61: 5070-77). Likewise, lowering the pI of a radiolabelled anti-
tumor dsFv
(disulfide stabilized Fv) by chemical modification increased renal clearance
thereby
decreasing the buildup of radioactivity in the kidney (Kim et al., 2002, Nucl.
Med. Biol., 29:
795-801).
[0009] In other studies the transendothelial migration and endocytosis of
antibodies
was enhanced by cationization to increase the pI. The cationized antibodies
retained their
binding affinity and were rapidly internalized into cells with minimal non-
specific toxicity or
immunogenicity (Pardrige et al., 1998, J. Pharmaol. Exp. Therap., 286: 548-
54).
Cationization of antibodies has also been shown to enhance the delivery of
antibodies across
the blood brain barrier (Triguero et al., 1989, PNAS, 86: 4761-4765) These
data indicate
that there may be an optimal pI for certain therapeutic proteins, such as
antibodies or
chimeric proteins made up of antibody domains. Particularly those proteins
which carry a
toxin, are required in large doses for optimal therapeutic response or those
which are required
intracellularly or in extravascular compartments.
4
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0010] Thus, there is a need for more efficient methods that allow quick
indication of
the shelf life and/or clinical properties of protein formulations based on the
intrinsic
properties of the protein. Additionally, because certain intrinsic properties,
such as pI and
Tin, are generally not selection criterion when therapeutic proteins (e.g.,
antibodies) are
developed, proteins which are therapeutically active may have suboptimal
formulation or
clinical properties. Methods to engineer certain intrinsic properties, such as
pI and Tm,
downstream of, or concurrently with development would allow the rapid
production of
proteins with preferred formulation and therapeutic characteristics.
[0011] Discussion or citation of a reference herein shall not be construed as
an
admission that such reference is prior art to the present invention.
3. SUMMARY OF THE INVENTION
[0012] The invention is based in part on the discovery of the inventors that
certain
therapeutic and/or formulation and/or manufacturing characteristics of a
multidomain protein
can be evaluated by examining individual domains that form the protein. One or
more
metrics representing the physical and/or chemical and/or structural
characteristics of protein
domains are determined and individual domains are then selected based on their
metrics. The
individual domains may be examined in the context of the intact multidomain
protein or as
isolated domains. For example, the physical/chemical (including structural)
characteristics of
a Fab or an Fc domain in an antibody may determine the biodistribution and/or
non-specific
toxicity and/or stability and/or solubility and/or viscosity of the antibody.
An approach
incorporating selecting appropriate domains having optimal therapeutic and/or
formulation
characteristics prior to or concurrently with the generation of the full
protein improves the
overall drug development efficiency. This approach thus allows generation of
proteins of
both high therapeutic efficacy and optimal formulation characteristics, e.g.,
high solubility
and long shelf life.
[0013] The invention provides an integrated approach to therapeutic protein
development which incorporates therapeutic and/or formulation and/or
manufacturing
considerations in the early screening and development process. The approach
involves
evaluating one or more individual domains of a protein to identify domains
that have both the
desired biological activity and desired therapeutic and/or formulation
characteristics. For
example, a plurality of different variants of a domain that have been
determined to have the
desired biological activity can be screened to identify one or more variants
that have certain
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
desired therapeutic and/or formulation characteristics, e.g., having desired
stability and/or
solubility. The identified domain variants are then used in the construction
of the full
multidomain proteins. For exainple, in therapeutic antibody development, after
affinity
screening of an expression library (e.g., a phage display library), Fab
domains having high
binding affinity can be screened for their formulation characteristics, e.g.,
solubility and/or
stability. One or more Fab domains having desired formulation characteristics,
e.g., having
high solubility and/or stability, are selected and each used with an
appropriate Fc domain in
the construction of the full antibodies. Different candidate (including
variant/modified
domains) Fc domains can also be screened for formulation characteristics,
e.g., solubility and
stability, to select an Fc domain that has the desired formulation
characteristics. The
constructed antibodies are then submitted for furtller formulation
development.
[0014] The invention further provides methods for the development of a
therapeutic
multidomain protein by engineering one or more domains of the multidomain
protein to have
the desired therapeutic and/or forinulation characteristics such as for
example,
biodistribution, non-specific toxicity, solubility and/or stability. For
example, a domain
having a desired biological activity can be modified by replacing one or more
amino acid
residues in said domain to generated a modified domain or a population of
modified domains
which are then screened for their therapeutic characteristics, e.g.,
biodistribution and/or non-
specific toxicity. One or more modified domains having desired therapeutic
characteristics
are selected and each used in the construction of the full multidomain
protein.
[0015] The present invention also provides a method for evaluating the shelf
life, i.e.,
the long term stability, of a protein preparation comprising a multidomain
protein based on a
thermal denaturation and/or renaturation behavior of a multidoinain protein in
a liquid protein
preparation. It is contemplated that the multidomain protein may comprise a
domain whose
unfolding leads to aggregation of the multidomain protein in the liquid
protein preparation.
The liquid protein preparation can be a solution of the multidomain protein of
a particular
concentration, e.g., a concentration from about 5 to 300 mg/ml. The liquid
protein
preparation can also comprise other substances, including but not limited to,
salts, ligands,
co-factors, and so on. The method thus can also be used for determining the
optimal
conditions, e.g., the constituents and the optimal concentration of each such
constituent.
[0016] The invention provides a method of generating one or more multidomain
proteins, comprising (a) evaluating for each of a plurality of candidate
domains one or more
metrics representing one or more therapeutic and/or formulation and/or
manufacturing
6
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
characteristics of the domain, wherein the plurality of candidate domains
exhibits a biological
activity above a predetennined threshold level; (b) selecting one or more
domains from the
plurality based on the metrics; and (c) optionally, constructing a full
inultidomain protein
using each domain selected in step (b) and one or more other domains. In one
embodiment,
the method of the invention is used to generate one or more antibodies. In a
specific
einbodiment, the domain is an antigen binding domain (e.g., Fab domain). In
one
embodiment, the metrics of the invention include one or more paraineters
characterizing the
stability of a candidate domain. In another embodiment, the metrics of the
invention include
one or more parameters characterizing the solubility, biodistribution or non-
specific toxicity
of a candidate domain. In a specific einbodiment, the paraineters
characterizing stability of a
candidate domain include the Tm value of the domain, and the parameters
characterizing
solubility, biodistribution or non-specific toxicity of a candidate domain
include the pI value
of the domain. The metrics of the invention may further include metrics
characterizing
stability of a candidate domain under one or more different conditions
selected from the
group consisting of different pH values, different temperatures, different
shear stresses, and
different freeze/thaw cycles.
[0017] The plurality of candidate domains can be an antigen binding domains
(e.g.,
Fab domains). In such cases, the biological activity may be the antigen
binding domain's
binding affinity to a target antigen. In certain embodiments, at least some of
the antigen
binding domains bind different epitopes of the antigen. In a specific
embodiment, the
plurality of antigen binding domains are obtained by screening an expression
library (e.g., a
phage display library) with the antigen. In another specific embodiment, the
plurality of
antigen binding domains are obtained by digesting a plurality of monoclonal
antibodies.
Each selected antigen binding is then combined with one or more other domains
(e.g.,
constant region domains) to generate one or more inultidomain proteins.
[0018] The plurality of candidate domains can be constant region domains. In
such
cases, the biological activity may be the constant region domain's binding
affinity to constant
region domain receptors and/or ligands (e.g., FcRn, Clq, FcyRs) and/or ability
to mediate
effector functions (e.g., ADCC, CDC). In a specific embodiment, the plurality
of constant
region domains are obtained by screening an expression library with a constant
region
domain ligand. Each selected constant region domain is then combined with
another domain
(e.g., a antigen binding domain, a cellular receptor domain) to generate one
or more
multidomain proteins.
7
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0019] In one embodiment, metrics of the invention include one or more
parameters
characterizing stability of an antigen binding domain (e.g., Fab domain). In
another
embodiment, inetrics include one or more parameters characterizing solubility,
biodistribution or non-specific toxicity of an antigen binding domain. In a
specific
einbodiment, the paraineters characterizing stability of an antigen binding
domain include a
Tm value of the antigen binding domain, and the parameters characterizing
solubility,
biodistribution or non-specific toxicity of an antigen binding domain comprise
a pI value of
the antigen binding domain. The metrics of the invention may further include
metrics
characterizing stability of the antigen binding domain under one or more
different conditions
selected from the group consisting of different pH values, different
teinperatures, different
shear stresses, and different freeze/thaw cycles.
[0020] In one embodiment, metrics of the invention include one or more
parameters
characterizing stability of a constant region domain (e.g., Fc domain). In
another
embodiment, metrics include one or more parameters characterizing solubility,
biodistribution or non-specific toxicity of a constant region domain. In a
specific
embodiment, said the parameters characterizing stability of said constant
region domain
include a Tin value of the constant region domain, and the parameters
characterizing
solubility, biodistribution or non-specific toxicity of the constant region
domain include a pI
value of the constant region domain. The metrics of the invention may further
include
metrics characterizing stability of the constant region domain under one or
more different
conditions selected from the group consisting of different pH values,
different temperatures,
different shear stresses, and different freeze/thaw cycles.
[0021] In one embodiment, the method of generating one or more multidomain
proteins further comprises, before using the selected domain to construct a
full multidoinain
protein (prior to said step (c)), the steps of (i) evaluating for each of a
plurality of other
candidate domains one or more metrics; and (ii) selecting another domain from
the plurality
of other candidate domains based on the metrics. In one embodiment, the
metrics comprise
one or more paraineters characterizing stability of the second domain. In
another
embodiment, the metrics of the invention include one or more parameters
characterizing
solubility, biodistribution or non-specific toxicity of the second domain. In
one embodiment,
the parameters characterizing stability of the second domain include a Tm
value of the second
domain, and the parameters characterizing solubility, biodistribution or non-
specific toxicity
of said second domain include a pI value of the second domain. The metrics of
the invention
8
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
may further include metrics characterizing stability of the second domain
under one or more
different conditions selected from the group consisting of different pH
values, different
temperatures, different shear stresses, and different freeze/thaw cycles. In
one embodiment,
the second domain is a constant region domain. In a specific einbodiment, the
first domain is
an antigen binding domain (e.g., Fab domain) and the second domain is an
antibody constant
region domain (e.g., Fc domain).
[0022] In a specific einbodiinent, the invention provides a method of
generating one
or more antibodies which bind to a given target, coinprising (a) identifying a
plurality of
candidate antigen binding domains exhibiting a binding affinity for the target
above a
predetennined threshold level; (b) determining the Tin and/or pI values for
each of the
plurality of candidate antigen binding domains; (c) selecting one or more
antigen binding
domains from the plurality based on their Tm and/or pI values; and (d)
constructing an
antibody using each antigen binding domain selected in step (c) and one or
more other
domains. In one embodiment, at least some of the antigen binding domains bind
different
epitopes of the target.
[0023] The invention also provides a method of screening one or more
multidomain
proteins, such as antibodies, which bind to a given target, comprising (a)
evaluating for each
of a plurality of multidomain proteins one or more metrics of the invention
representing one
or more therapeutic and/or formulation and/or manufacturing characteristics of
candidate
domains of the multidomain proteins, wherein the plurality of multidomain
proteins exhibits
a biological activity above a predetermined threshold level; and (b) selecting
one or more
multidomain proteins from the plurality based on the metrics representing one
or more
therapeutic and/or formulation and/or manufacturing characteristics of said
multidomain
proteins.
[0024] The invention also provides a method of engineering a multidomain
protein to
improve one or more therapeutic and/or formulation and/or manufacturing
characteristics
without significantly altering other biological activities. The method
comprises making one
or more modifications (e.g., amino acid substitutions), wherein the
modifications (e.g., anlino
acid substitutions) are such that they improve one or more of the
characteristics of the
multidomain protein.
[0025] In the method of engineering a multidomain protein to have improved
improve
one or more therapeutic and/or formulation and/or manufacturing
characteristics without
significantly altering other biological activities, the multidomain protein
can be an antibody
9
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
and the biological activities include, but are not limited to, one or more of
the following
biological activities: antigen binding, serum half-life, complement fixation,
Fc receptor
binding and antigen-dependent cytotoxicity of the antibody.
[0026] The invention also provides a method of evaluating long term stability
of a
multidomain protein in a solution, wherein long term stability is defined as
less than 5%,
10%, or 20% aggregation upon storage for a predetermined period of time (e.g.,
1 to 6
months) at a predeterinined teinperature (e.g., 4 C). The method comprises (a)
providing a
solution of a multidomain protein; (b) denaturing one or more domains of a
inultidomain
protein by heating the solution of the inultidoinain protein; (c) deterinining
if the domains
refold upon cooling; and (d) classifying the inultidoinain protein as having
long term stability
in the solution if the domains are detennined to refold in step (c).
[0027] The invention also provides a method of identifying in a multidomain
protein
one or more domains, the unfolding of which causes aggregation of the
multidomain protein
in a solution, comprising (a) denaturing the one or more domains by heating
the solution of
the multidomain protein; (b) determining if one or more of the domains refold
upon cooling;
and (c) identifying one or more domains that do not refold upon cooling in
step (b), thereby
identifying a domain or domains, the,unfolding of which causes aggregation of
the
multidomain protein in the solution.
[0028] The invention also provides a method of engineering a multidomain
protein to
have improved long term stability in a solution, wherein said long term
stability is defined as
less than 5%, less than 10%, or less than 20% aggregation upon storage for a
predetermined
period of time at a predetermined temperature. The method comprises (a)
modifying a
domain of a multidomain protein by replacing one or more amino acid residues
in the domain
to generated a modified domain; (b) denaturing the modified domain by heating
a solution of
a multidomain protein comprising the modified domain; (c) determining if the
modified
domain in the multidomain protein refolds upon cooling; and (d) classifying
the multidomain
protein containing the modified domain as having improved long term stability
if the
modified domain is determined to refold in step (c). In certain embodiments,
the unfolding
of the domain prior to modification causes the aggregation of the multidomain
protein. In the
method of engineering a multidomain protein to have improved long tenn
stability, the
multidomain protein can be an antibody. It is contemplated that steps (a) to
(d) may be
performed on an isolated domain. For exainple, a Fab domain may be isolated,
modified
denatured, renatured and classified. In one embodiment, the identified domain
having
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
improved long tenn stability is used in the generation of a inultidomain
protein. In another
embodiment, the modified domain is an antigen binding domain (e.g., Fab
domain). In still
another einbodiment, the modified domain is a constant region domain (e.g., Fc
domain).
[0029] The invention further provides a method of screening for a multidomain
protein which has improved long tenn stability in a solution, wherein long
term stability is
defined as less than 5%, 10%, or 20% aggregation upon storage for a
predetennined period of
time at a predetermined temperature comprising (a) denaturing respectively two
or more
multidomain proteins that are members of a population of multidoinain
proteins, wherein
each inultidoinain protein comprises a different modified domain, the modified
domains
having one or more amino acid residues substituted, wherein the denaturing is
accoinplished
by heating a solution of one of the multidomain proteins coinprising a
modified domain; (b)
deterinining if the modified domain in each of the multidomain proteins
denatured in step (a)
refolds upon cooling; and (c) identifying the multidomain proteins containing
a modified
domain determined to refold in step (b) as having improved long term
stability. In one
embodiment, the method further comprises generating the population of
multidomain
proteins comprising different modified domains. In certain embodiments the
unfolding of the
domain prior to modification causes aggregation of the multidomain protein.
[0030] In the method of screening for a multidomain protein which has improved
long term stability, the multidomain protein can be an antibody. In one
embodiment, the
domain is an antigen binding domain (e.g., a Fab domain). In another
embodiment, the
domain is a constant region domain (e.g., a Fc domain). It is contemplated
that the methods
of the invention may be performed on an isolated domain or doinains. In one
embodiment,
the modified domain determined to refold upon cooling is used in the
generation of a
multidomain protein. In one embodiment, said denaturation and renaturation
steps are carried
out by generating a thermal denaturation/renaturation curve, e.g., using
differential scanning
calorimetry.
[0031] The invention provides a method of engineering a multidomain protein to
have
improved stability. The method comprises (a) modifying a domain of a
multidomain protein
by replacing one or more amino acid residues in the domain to generated a
modified domain;
(b) determining the Tm of the modified domain; and (c) classifying the
multidomain protein
containing the modified domain as having improved stability if the domain is
determined to
have a higher Tm in step (b). Accordingly, the invention also provides
engineered
multidomain proteins which have a higher Tm than the multidomain protein prior
to being
11
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
engineered. The invention also provides engineered multidomain proteins which
have
improved stability than the multidomain protein prior to being engineered. In
certain
embodiments, the Tm of the domain prior to modification is either low or
contributes to the
inultidomain protein have a low Tm.
[0032] The invention provides a method of engineering a multidomain protein to
have
improved solubility and/or lower viscosity. The method comprises (a) modifying
a domain
of a multidomain protein by replacing one or more amino acid residues in the
domain to
generated a modified domain; (b) determining the pI of the modified domain;
and (c)
classifying the multidoinain protein containing the modified domain as having
improved
solubility and/or viscosity if the modified domain is determined to have a
higher pI in step
(b). In another embodiment of the method, the pI of the multidomain protein
containing the
modified domain is determined in step (b) and the inultidomain protein
containing the
modified domain is classified as having iinproved solubility and/or viscosity
if the
multidomain protein containing the modified domain is deterinined to have a
higher pI in step
(b). Accordingly, the invention also provides engineered multidomain proteins
which have a
higher pl relative to the multidomain protein prior to being engineered. The
invention also
provides engineered multidomain proteins which have improved solubility and/or
lower
viscosity relative to the multidomain protein prior to being engineered. In
certain
embodiments, the pI of the domain prior to modification is either low or
contributes to the
multidomain protein have a low pI.
[0033] The invention further provides a method of engineering a multidomain
protein
to have reduced non-specific toxicity. The method comprises (a) modifying a
domain of a
multidomain protein by replacing one or more ainino acid residues in the
domain to generated
a modified domain; (b) determining the pI of the modified domain; and (c)
classifying the
multidomain protein containing the modified domain as having reduced non-
specific toxicity
if the modified domain is detennined to have a lower pI in step (b). In
another embodiment
of the method, the pI of the multidomain protein containing the, modified
domain is
determined in step (b) and the multidomain protein containing the modified
domain is
classified as having reduced non-specific toxicity if the multidomain protein
containing the
modified domain is determined to have a lower pI in step (b). Accordingly, the
invention
also provides engineered multidomain proteins which have a lower pI relative
to the
multidomain protein prior to being engineered. The invention also provides
engineered
multidomain proteins which have reduced non-specific toxicity relative to the
multidomain
12
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
protein prior to being engineered. In certain embodiments, the domain prior to
modification
either has a pI or contributes to the multidomain protein having a pI which
results in non-
specific toxicity.
[0034] In addition, the invention provides a method of engineering a
multidomain
protein to have a specific biodistribution (e.g., intracellular,
extravascular, extracellular). The
method comprises (a) modifying a domain of a multidomain protein by replacing
one or more
amino acid residues in the domain to generated a modified domain; (b)
determining the pI of
the modified domain; and (c) classifying the inultidomain protein containing
the modified
domain as having reduced intracellular localization if the modified domain is
determined to
have a lower pI in step (b) or as having increased intracellular and/or
extravascular
localization if the modified domain is determined to have a higher pI in step
(b). In another
embodiment of the method, the pI of the multidomain protein containing the
modified
domain is determined in step (b) and the multidomain protein containing the
modified
domain is classified as having reduced intracellular localization if the
multidoinain protein
containing the modified domain is deterinined to have a lower pI in step (b)
or as having
increased intracellular and/or extravascular localization if the multidomain
protein
containing the modified domain is deterinined to have a higher pI in step (b).
Accordingly,
the invention also provides engineered multidomain proteins which have a
specific
biodistribution. Specifically, the invention provides engineered multidomain
proteins which
have increased intracellular and/or extravascular localization relative to the
multidomain
protein prior to being engineered. The invention also provides engineered
multidomain
proteins which have reduced intracellular localization relative to the
multidomain protein
prior to being engineered. In certain embodiments, the domain prior to
modification either
has a pI or contributes to the multidomain protein having a pI which
determines the
biodistribution.
4. BRIEF DESCRIPTION OF THE FIGURES
[0035] FIG. 1. The DSC thermogram of the full length Ca-hGl Mab molecule is
shown in the top panel, while the bottom panel is an overlay of the
thermograms obtained
from purified Fab and Fc fraginents of Ca-hGl Mab molecule. Two discrete peaks
are seen
for the Fc domain at approximately 68 C and 83 C. A single peak is seen for
the Fab
fragment at approximately 87 C.
13
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0036] FIG. 2. Deconvolution of the DSC thermogram of the full length Ca-hGl
Mab
(see Fig. 1). Three discrete peaks are seen with Tin values of 60 C, 83 C and
87 C.
[0037] FIG. 3. Overlay of inultiple DSC scans of the full length Ca-hGl Mab,
demonstrating reversibility over multiple heating and cooling cycles when
heated to 72 C.
[0038] FIG. 4. Overlay of inultiple DSC scans of the full length Ca-hGl Mab,
demonstrating less reversibility over multiple heating and cooling cycles when
heated to 87 C
than seen for heating to 72 C (see FIG. 3).
[0039] FIG. 5. Overlay of inultiple DSC scans of the Fab fragment of Ca-hGl
Mab,
demonstrating less reversibility over inultiple heating and cooling cycles
when heated to 85 C
than seen for heating to 72 C (see FIG. 3).
[0040] FIG. 6. Overlay of inultiple DSC scans of the Fab fragment of Ca-hG1
Mab,
demonstrating less reversibility over multiple heating and cooling cycles when
heated to 87 C
than seen for heating to 68 C (see FIG. 7).
[0041] FIG. 7. Overlay of multiple DSC scans of the Fc fraginent of Ca-hGl
Mab,
demonstrating reversibility over multiple heating and cooling cycles when
heated to 68 C.
[0042] FIG. 8. Overlay of multiple DSC scans of the Fe fraginent of Ca-hGl
Mab,
demonstrating poor reversibility over inultiple heating and cooling cycles
when heated to
83 C than seen for heating to 68 C (see FIG. 7).
[0043] FIG. 9. Overlay of DSC scans of full length Mabs Ba-hGl and Ca-hG1
showing dramatically different profiles. Ba-hGl has a major peak at -72 C
while the major
peak for Ca-hGl is seen at -87 C.
[0044] FIG. 10. The DSC thermograin of the full length Ba=hG1 Mab molecule is
shown in the top panel, while the bottom panel is an overlay of the
thermograms obtained
from purified Fab and Fe fraginents of Ba-hGl Mab molecule. Two discrete peaks
are seen
for the Fe domain at approximately 67 C and 83 C. Two overlapping peaks are
seen for the
Fab fragment at approximately 72 C and 76 C.
[0045] FIG. 11. Deconvolution of the DSC thermogram of the full length Ba-hGl
Mab (see Fig. 10). Three discrete peaks are seen with Tm values of 71 C, 82 C
and 93 C.
[0046] FIG. 12. Overlay of multiple DSC scans of full length Ba-hGl Mab,
demonstrating less reversibility over multiple heating and cooling cycles when
heated to 70 C
than seen for the Fab fragment alone heated to 71 C (see FIG. 14).
14
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0047] FIG. 13. Overlay of multiple DSC scans of full length Ba-hGl Mab,
demonstrating less reversibility over multiple heating and cooling cycles when
heated to 73 C
than seen for the Fab fragment alone heated to 71 C (see FIG. 14).
[0048] FIG. 14. Overlay of multiple DSC scans of the Fab fragment of Ba-hGl
Mab,
demonstrating reversibility over multiple heating and cooling cycles when
heated to 71 C.
[0049] FIG. 15. Overlay of multiple DSC scans of the Fab fragment of Ba-hGl
Mab,
deinonstrating less reversibility over multiple heating and cooling cycles
when heated to 76 C
than seen for heating to 71 C (see FIG. 14).
[0050] FIG. 16. Overlay of multiple DSC scans of the Fe fraginent of Ba-hG1
Mab,
demonstrating reversibility over inultiple heating and cooling cycles wlien
heated to 67 C.
[0051] FIG. 17. Graphical representation of the IEF and DSC analysis for a
different
panel of antibodies. Antibodies Ca-hGl, Cal-hGl and Cal-hGla are highly
related,
recognizing the same protein epitope and differing by only a few amino acids.
The remaining
antibodies, As-hGl, Ba-hGl and Da-hGl are unrelated.
[0052] FIG. 18. Analysis of a panel of different antibodies which bind to a
variety of
epitopes present on a single protein. These antibodies have a common Fc domain
and vary
only in their Fab regions A) Isoelectric focusing (IEF) demonstrate that there
is a wide range
of pI values (e.g., -7.8 to -9.2) for the different antibodies. B)
Differential scamiing
calorimetry (DSC) analysis indicates that there is a wide range of Tm values
(e.g., -66 C to
-90 C) for the different antibodies. C) Graphical representation of the IEF
and DSC analysis
for the panel of antibodies.
[0053] FIG. 19. Graphical representation of the IEF and DSC analysis for a
different
panel of antibodies which bind to a variety of epitopes present on a single
protein. Also
plotted are several antibodies used in earlier studies and two chimeric
antibodies generated by
combining the heavy and light chains from two different antibodies. All of
these antibodies
have a common Fe domain and vary only in their Fab regions.
[0054] FIG. 20. Grapliical representation of the IEF and DSC analysis of a
panel of
antibodies which are identical except for mutations in their hinge region.
[0055] FIG. 21. Viscosity analysis for several of the antibodies analyzed in
Fig 17.
Each antibody was analyzed at 100 mg/ml, in addition Ba-hGl was analyzed at
126 mg/ml,
138 mg/ml and 150 mg/ml.
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0056] FIG. 22. Aggregation rate vs. Fab Tm. Panel A plots the aggregation
rate of
several Ba-hGl, Da-hGl, Ca-hG1 and Ca1-hGl in relation to the Tm of the Fab
region.
Panel B plots the aggregation over tiine for the isolated Fc region and Fab
domains of Ca-
hGl and Ba-hGl.
[0057] FIG. 23. Antibody naming scheme used in this application. First 3
characters
identify the antigen binding domain: the capital letter designates the target,
the lower case
letter designates a particular epitope of the target, the number designates
the variant of the
antibody (for simplicity reasons, 0 is often omitted). The last 4 characters
identify the Fc
domain: the first 3 characters identify the Fc domain, the last lower case
letter designates the
Fc variant. The example in FIG. 23, Aal-hG1a, thus identifies variant "1" of
an antibody that
binds epitope "a" of target "A" and has variant "a" of a huinan gamma-1 (hGl)
as its Fe
domain.
[0058] FIG. 24. Ribbon diagram of CH2 and CH3 of the human Fe showing the
location of the initial five residues where substitutions were made. This
illustration is a side
view of a human Fc showing only one CH2 domain (top) and one CH3 domain
(bottom).
Residues that were substituted are spacefilled. The red indicates a region
where mutations
may affect Clq, FcyR, FcRn, and protein A binding, the blue indicates a region
where
mutations may affect FcyR and FcRn binding, and the green indicates a region
where
mutations may affect FcRn and protein A binding. The yellow region is where
the two CH3
domains pack against each other.
[0059] FIG. 25. Ribbon diagram of CH2 and CH3 of the human Fe showing the
location of six additional residues where substitutions were made. The
orientation is the
same as in Figure 1 and the coloration conveys the same meaning as described
in Figure 1.
Substituted residues are spacefilled.
[0060] FIG. 26. IEF gel of the first ten single substitutions made. The pI was
determined by measuring the migration of the band with the highest intensity
in a given lane.
The wild type antibody control (WT) was produced in NSO cells.
[0061] FIG. 27. IEF gel of the double and triple substitutions. The triple
substitutions E345K Q362K D401N and E345K Q362K D401 K probably have too high
of a
pI to be resolved on this gel and ran off. WT antibody produced both in 293H
and NSO cells
were run for coinparison.
16
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0062] FIG. 28. IEF gel of the second 12 single substitutions made. The pI was
determined by ineasuring the migration of the band with the highest intensity
in a given lane.
wild type (WT) antibody produced both in 293H and NSO cells were run for
coinparison.
[0063] FIG 29. Correlation of pI shift vs. nominal charge change. Plotted are
the
values for the delta change in pI vs. the delta change in the charge for each
of the substituted
antibodies. The correlation is largely linear.
[0064] FIG 30. Overlay of DSC therinograms of the wild type and single
substituted
anti-IL9 antibodies with altered pI. The Tm profiles of E345Q, E345K, R355Q,
R355E,
Q362E and Q362K(in the left panel) are very similar to that of the wild type
antibody each
having one major peak at -76 C. The Tm profiles of K340Q, K340E and D401K have
a
distinct peak between about 62 C and -70 C in addition to the major peak at -
76 C.
[0065] FIG 31. Overlay of DSC thermograms of the wild type and triple
substituted
anti-IL9 antibodies with altered pI.
[0066] FIG 32. Overlay of DSC thermograms of the wild type Fa-hGl antibody and
the two variants Fa-hGlb and Fa-hG4a. The major peak representing the Tm of
the Fab
domain is at 70.4 C for both Fa-hGl and Fa-hG4a and at 70.9 C for Fa-hGlb.
[0067] FIG 33. IEF gel of the wild type Fa-hGl antibody and the two variants
Fa-
hGlb and Fa-hG4a. The pI of the major protein bands are 8.35, 8.18 and 713 for
Fa-hGl, Fa-
hGlb and Fa-hG4a, respectively.
5. DETAILED DESCRIPTION OF THE INVENTION
[0068] The invention is based in part on the discovery of the inventors that
certain
therapeutic and/or formulation and/or manufacturing characteristics of a
multidomain protein
(e.g., antibody) can be evaluated by examining individual domains that form
the protein. One
or more metrics representing the physical and/or chemical and/or structural
characteristics of
protein domains are determined and individual domains are then selected based
on their
metrics. The individual domains may be examined in the context of the intact
multidomain
protein or as isolated domains. For example, the physical/chemical (including
structural)
characteristics of a Fab or an Fc domain in an antibody may determine the
biodistribution
and/or non-specific toxicity and/or stability and/or solubility and/or
viscosity of the antibody.
An approach incorporating selecting appropriate domains having optimal
therapeutic and/or
formulation characteristics prior to or concurrently with the generation of
the full protein
improves the overall drug development efficiency. This approach thus allows
generation of
17
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
proteins of both high therapeutic efficacy and optimal formulation
characteristics, e.g., high
solubility and long shelf life.
[0069] The invention provides an integrated approach to therapeutic protein
development which incorporates therapeutic and/or fonnulation and/or
manufacturing
considerations in the early screening and development process. The approach
involves
evaluating one or more individual candidate domains of a protein to identify
domains that
have both the desired biological activity and desired therapeutic and/or
formulation
characteristics. For example, a plurality of different variants of a domain
(also encoinpassed
by the terms "domain variant(s)," "variant domain(s)" and "candidate
domain(s)") that have
been determined to have the desired biological activity can be screened to
identify one or
more variants that have certain desired therapeutic and/or formulation
characteristics based
on certain metrics (e.g., Tm and/or pI). The identified domain variants are
then used in the
construction of the full multidomain proteins. For exainple, in therapeutic
antibody
development, after affinity screening of an expression library (e.g., a phage
display library),
candidate Fab domains having high binding affinity can be screened for their
fonnulation
characteristics, e.g., solubility and/or stability. One or more Fab domains
having desired
fonnulation characteristics, e.g., having high solubility and/or stability,
are selected and each
used with an appropriate Fc domain in the construction of the full antibodies.
Different
candidate Fc domains can also be screened for formulation characteristics,
e.g., solubility and
stability, to select an Fc domain that has the desired formulation
characteristics. The
constructed antibodies are then submitted for further forinulation
development.
[0070] The invention further provides methods for the development of a
therapeutic
multidomain protein by engineering one or more domains of the inultidomain
protein to have
the desired therapeutic and/or fonnulation characteristics such as for
example,
biodistribution, non-specific toxicity, solubility and/or stability. For
example, a domain
having a desired biological activity can be modified by replacing one or more
amino acid
residues in said domain to generated a modified domain (also encoinpassed by
the terms
"domain variant(s)," "variant domain(s)" and "candidate domain(s)") or a
population of
modified domains which are then screened for their therapeutic
characteristics, e.g.,
biodistribution and/or non-specific toxicity by comparing certain metrics
(e.g., Tm and/or pI)
of the modified domains to those of the unmodified domain. One or more
modified domains
having desired therapeutic characteristics based on their metrics (e.g.,
having a desired Tm
and/or pI) are selected and each used in the construction of the full
multidomain protein.
18
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0071] The present invention also provides a method for evaluating the shelf
life, i.e.,
the long term stability, of a protein preparation comprising a inultidomain
protein based on a
thermal denaturation and/or renaturation behavior of a multidomain protein in
a liquid protein
preparation. It is contemplated that the inultidomain protein may comprise a
domain whose
unfolding leads to aggregation of the multidomain protein in the liquid
protein preparation.
The liquid protein preparation can be a solution of the multidomain protein of
a particular
concentration, e.g., a concentration from about 5 to 300 ing/ml. The liquid
protein
preparation can also comprise other substances, including but not limited to,
salts, ligands,
co-factors, and so on. The method thus can also be used for determining the
optimal
conditions, e.g., the constituents and the optimal concentration of each such
constituent.
[0072] The inventor has discovered that the aggregation of a inultidoinain
protein in a
solution is the result of therinal unfolding (also referred to herein as
"thermal denaturation" or
simply "denaturation") of a particular domain or domains in the protein, and
that thermal
denaturation and/or renaturation behavior of a multidomain protein comprising
the particular
domain or domains provides an indication of the long term stability and, thus,
the shelf life,
of a liquid formulation of the multidomain protein.
[0073] The pI of certain therapeutic multidomain proteins is known to affect
their
biodistribution and/or their non-specific toxicity profiles. The inventor has
further discovered
that the viscosity and solubility of a multidomain protein in a solution
correlates with the pI
of the multidomain protein and/or a particular domain or domains in the
protein, relative to
the pH of the solution. Thus, the pI of a multidomain protein and/or one or
more individual
domains provides an indication of viscosity and solubility of a liquid
formulation of the
multidomain protein in addition to other therapeutic characteristics.
Additionally, the
inventor has discovered that the pI of multidomain proteins can be modified to
alter those
characteristics which are governed by the pI of a protein.
5.1. Methods For Development Of Multidomain Protein Therapeutics
[0074] The invention provides a method for protein drug development that
incorporates therapeutic and/or formulation and/or manufacturing
considerations in the early
screening process. A protein drug is a formulated drug form of a therapeutic
protein which
can be used in the treatinent or prevention of a disease. The formulation of
the drug aids
and/or optimizes the clinical effect of the protein, i.e., the pharmacological
effect of the
protein. The development of a therapeutic protein depends on the physical,
chemical, and
19
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
pharmacokinetic properties of the protein. The manufacturing process of a
protein drug,
including production, purification, storage, and any downstream processing of
the protein,
also depends on the physical and chemical properties of the protein.
[0075] As used herein, the "therapeutic characteristics" of a protein include
physical,
chemical, and pharmacokinetic properties of the protein which affect the
pharlnacological
effect of the protein drug form. Examples of therapeutic characteristics of a
protein include,
but are not liinited to, biodistribution, non-specific toxicity and clearance
profiles of the
protein.
[0076] As used herein, the fonnulation and/or manufacturing characteristics of
a
protein include physical, chemical, and phannacokinetic properties of the
protein which
affect the pharmacological effect of the protein drug form and/or the
production, purification,
storage and any downstream processing of the protein. For simplicity reasons,
the
formulation and/or manufacturing characteristics of a protein are often
referred to herein
jointly as simply the "formulation characteristics." Examples of formulation
characteristics
of a protein include, but are not limited to, stability (e.g., thermal
stability and/or storage
stability, also terined shelf life), solubility and viscosity of the protein.
[0077] The invention provides a method for the generation of multidomain
proteins
having both high biological activities and optimal therapeutic and/or
formulation and/or
manufacturing characteristics. The method comprises evaluating the biological
activities and
the therapeutic and/or foimulation and/or manufacturing characteristics of
individual domains
of a multidomain protein, and identifying domains that exhibit both desired
biological
activities, e.g., desired level of target binding affinity and/or desired
serum half-life, etc., and
desired therapeutic and/or formulation and/or manufacturing characteristics,
e.g., desired
level of solubility and/or stability. In certain enlbodiments, the therapeutic
and/or
formulation and/or manufacturing characteristics of individual domains of a
multidomain
protein are evaluated by metrics of the invention which include one or more
parameters
characterizing therapeutic and/or formulation characteristics including but
not limited to
stability, solubility, biodistribution and non-specific toxicity. In certain
embodiments,
individual domains that exhibits an optimal combination of biological
activities and
therapeutic and/or formulation and/or manufacturing characteristics are
identified. In certain
other embodiments, different domains which when combined in a protein exhibit
an optimal
combination of biological activities and therapeutic and/or formulation and/or
manufacturing
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
characteristics are identified. The identified domains are then used to
construct the full
protein.
[0078] In one embodiment, the method of generating one or more multidomain
proteins for therapeutic uses, comprises (a) evaluating for each of a
plurality of candidate
domains one or more metrics representing one or more therapeutic and/or
formulation and/or
manufacturing characteristics of the first domain, wherein the plurality of
candidate domains
exhibits a biological activity above a predeterinined threshold level; (b)
selecting one or more
domains from the plurality based on the metrics; and (c) optionally,
constructing a full
multidomain protein using each domain selected in step (b) and one or more
other domains.
In one embodiment, the metrics include one or more paraineters characterizing
stability of the
candidate domain. In another embodiment, the inetrics include one or more
parameters
characterizing solubility, biodistribution or non-specific toxicity of the
candidate domain.
[0079] Thus, the present invention provides a method comprising screening a
plurality of candidate domains to identify one or more domains that have both
the desired
biological activities, e.g., desired target binding affinity, and desired
therapeutic and/or
formulation characteristics, e.g., biodistribution, non-specific toxicity,
stability, solubility and
viscosity. Each of the candidate domains is also referred to as a variant of
the domain. The
method comprises evaluating the candidate domains for both their biological
activities and
their therapeutic and/or formulation properties. One or more candidate domains
which
exhibit an optimal combination of biological activities and therapeutic and/or
formulation
characteristics are selected for constructing the full multidomain proteins.
[0080] In one embodiment, the method of generating one or more multidomain
proteins for therapeutic uses further comprises, before using the selected
domain to construct
a full multidomain protein (prior to said step (c)), the steps of (i)
evaluating for each of a
plurality of other candidate domains one or more metrics; and (ii) selecting a
another domain
from the plurality of other candidate domains based on the metrics. In one
embodiment, the
metrics include one or more parameters characterizing stability of the other
candidate
domain. In another embodiment, the metrics include one or more parameters
characterizing
solubility, biodistribution or non-specific toxicity of the other candidate
domain.
[0081] The present invention also provides a method for screening a plurality
of
candidate domains to identify one or more domains that have both the desired
biological
activities, e.g., desired target binding affinity, and desired metrics
representing their
therapeutic and/or formulation characteristics. in the context of the full
multidomain protein.
21
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
Thus, the present invention provides a method to evaluate one or more domains
of a
multidoinain protein in an intact multidomain protein. By screening a
plurality of intact
multidomain proteins for one or more candidate domains which exhibit an
optimal
combination of biological activities therapeutic and/or fonnulation
characteristics, the need to
construct the full inultidomain protein is eliminated. In one einbodiment, the
method
comprises screening a plurality of antigen binding domains that bind a given
target antigen in
the context of an intact full length antibody molecule, to identify one or
more antigen binding
domains that have desired therapeutic and/or fonnulation characteristics.
[0082] The present invention further provides a method to engineer a domain to
improve one or more therapeutic and/or forinulation characteristic. In one
embodiment,
specific modifications (e.g., ainino acids substitutions, additions or
deletions) are engineered
into a domain to modify one or more desired therapeutic and/or formulation
characteristics.
[0083] In one embodiment, the formulation characteristics of a candidate
protein
domain is evaluated by evaluating one or more metrics of the invention (also
referred to
herein as simply "metrics") characterizing the formulation characteristics of
the candidate
domain. In one embodiment, the metrics include one or more parameters
characterizing the
stability of a domain. In another embodiment, the metrics include one or more
parameters
characterizing the solubility, biodistribution or non-specific toxicity of a
domain. In a
specific embodiment, the one or more parameters characterizing stability of
the domain
include a Thennal melting temperature (Tm) value of the domain. The Tm of a
candidate
domain, e.g., a Fab domain, can be a good indicator of the thermal stability
of a protein
containing the domain and may further provide an indication of the shelf-life
of a protein
containing the domain. A lower Tm indicates more aggregation/less stability,
whereas a
higher Tm indicates less aggregation/ more stability. Thus, candidate domains
having higher
Tin are preferable for incorporation into a full inultidomain protein (e.g.,
an antibody). In
one embodiment, candidate domains having a Tm greater than a predetermined
threshold
value are selected. In some embodiments, one or more candidate domains that
have a Tm
value higher than at least 50 C, 55 C, 60 C, 65 C, 70 C, 75 C, 80 C, 85 C, 90
C, 95 C,
100 C, 105 C, 110 C, 115 C or 120 C are selected for construction of the full
multidomain
protein. In specific embodiments, the candidate domains are antigen binding
domains (e.g.,
Fab domain, scFv, etc.).
[0084] Thermal melting teinperatures (Tm) of a protein domain can be measured
using any standard method known in the art. For example, Vermeer et al.
studied the
22
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
unfolding and denaturation of a monoclonal mouse anti-rat IgG of isotype 2b by
differential
scanning calorimetry (DSC) and circular dichroism (CD) spectroscopy (Vermeer
et al., 2000,
Biophys. J. 78:394-404; Venneer et al., 2000, Colloids Surfaces A:
Physicochem. Eng.
Aspects. 161:139-150; Vermeer et al., 2000, J. Colloid Interface Sci. 225:394-
397; Venneer
et al., 2000, Biophys. J. 79:2150-2154). They showed that the
folding/unfolding of the IgG
can be characterized by two main transitions that are themselves
superpositions of various
steps. The bimodal distribution observed in both DSC and CD experiments did
not depend
on the scan rate in the experiments. The two transitions appeared to be
independent, and the
unfolding was irreversible. The IgG was then digested into isolated Fab and Fc
fragments
(Vermeer et al., 2000, Biophys. J. 79: 2150-2154). The secondary structure as
well as the
thermodynamic stability of the two isolated fragments were studied and
compared with those
of the intact immunoglobulin. It was shown that the two peaks observed for
intact IgG can be
assigned to the Fab and Fc fragments, respectively. Vermeer et al. also showed
that, in
addition to induction by heat, the structural perturbation of IgG in general
could also be
triggered by changing the pH (Vermeer et al., 2000, Biophys. J. 78:394-404) or
by interaction
with a hydrophobic environment, e.g., adsorption onto Teflon surfaces or
interaction with
surfactants (Vermeer et al., 1998, Biochim. Biophys. Acta. 1425:1-12; Vermeer
et al., 2000,
Colloids Surfaces A: Physicochem. Eng. Aspects. 161:139-150; Vermeer et al.,
2000, J.
Colloid Interface Sci. 225:394-397).
[0085] In one embodiment, the Tm of a protein domain is measured using a
sainple
containing isolated protein domain molecules. In another embodiment, the Tm of
a protein
domain is measured using a sample containing an intact inultidomain protein
that contains the
domain to be analyzed. In the latter case, the Tm of the domain is deduced
from the data of
the protein by analyzing only those data points corresponding to the domain of
interest. In
one embodiment, the Tm of a protein or protein domain is measured with a VP-
DSC
(MicroCal, LLC) using a scan rate of 1.0 C/min and a temperature range of 25 -
120 C. A
filter period of 8 seconds is used along with a 5 minute pre-scan
therinostating. In a specific
example, samples are prepared by dialysis into 25 mM Histidine-HC1, pH 6 using
Pierce
dialysis cups (3.5 kD). Average Mab concentrations are 50 ghnL as determined
by A280.
Melting temperatures are determined following manufacturer procedures using
Origin
software supplied with the system. Briefly, multiple baselines are run with
buffer in both the
sample and reference cell to establish thermal equilibrium. After the baseline
is subtracted
from the sample thermogram, the data are concentration normalized and fitted
using the
23
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
deconvolution function. In another embodiment, stability of the candidate
domains are
evaluated using a method described in Section 5.2. The one or more metrics may
further
include metrics characterizing stability of the domain under one or more
different conditions
selected from the group consisting of different pH values, different
teinperatures, different
shear stresses, and different freeze/thaw cycles.
[0086] In another specific embodiment, the one or more parameters
characterizing the
solubility, biodistribution or non-specific toxicity of the domain includes an
Isoelectric Point
(pI) value of the domain. The pI of a protein is defined as the pH at which a
polypeptide
carries no net charge. It is known in the art that protein solubility is
typically lowest when
the pH of the solution is equal to the isoelectric point (pI) of the protein.
It is thus possible to
evaluate the solubility of a protein for a given pH, e.g., pH 6, based on its
pI. The pI of a
protein is also a good indicator of the viscosity of the protein in a liquid
forinulation. High pI
indicates high solubility and low viscosity (especially important for high
concentration
formulations). In one embodiment, candidate domains having a pI greater than a
predetermined threshold value are selected. As described above, the pI of a
protein also
plays a role in biodistribution and non-specific toxicity of multidomain
proteins. For
example, it is known in the art that reducing the pI of recombinant toxins
results in lower
non-specific toxicity and renal accumulation. Alternatively, increases the pI
of antibodies is
known to increase their intracellular and/or extravascular localization. One
of skill in the art
can readily determine which therapeutic characteristics are most desirable for
a particular
multidomain protein. In some einbodiments, one or more candidate domains that
have a pI
value higher than about 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0 are
selected for construction
of the full multidomain protein. In other embodiments, one or more candidate
domains that
have a pI value less than about 9.0, 8.5, 8.0, 7.5, 7.0, 6.5, 6.0, 5.5, or 5.0
are selected for
construction of the full multidomain protein. It will be understood by one
skilled in the art
that a single protein will have multiple charge forms. Without wishing to be
bound by any
particular theory, the charge of a protein can be modified by a number of
different
mechanisms including but not limited to, amino acid substitution,
cationization, deamination,
carboxyl-terminal amino acid heterogeneity, phosphorylation and glycosylation.
As used
herein the pI value is defined as the pI of the predominant charge form.
[0087] The pI of a protein may be determined by a variety of methods including
but
not limited to, isoelectric focusing and various computer algorithms (see for
example
Bjellqvist et al., 1993, Electy-ophof esis 14:1023). In one embodiment, pI is
determined using
24
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
a Pharmacia Biotech Multiphor 2 electrophoresis system with a multi teinp 3
refrigerated
bath recirculation unit and an EPS 3501 XL power supply. Pre-cast ampholine
gels
(Amersham Biosciences, pI range 2.5-10) are loaded with 5 g of protein. Broad
range pI
inarlcer standards (Amersham, pI range 3-10, 8 L) are used to deterinine
relative pI for the
Mabs. Electrophoresis is performed at 1500 V, 50 mA for 105 minutes. The gel
is fixed
using a Sigma fixing solution (5x) diluted with purified water to 1 x.
Staining is perfonned
overnight at room temperature using Simply Blue stain (Invitrogen). Destaining
is carried
out with a solution that consisted of 25% ethanol, 8% acetic acid and 67%
purified water.
Isoelectric points are determined using a Bio-Rad Densitometer relative to
calibration curves
of the standards. The one or more metrics may further include metrics
characterizing
stability of the domain under one or inore different conditions selected from
the group
consisting of different pH values, different temperatures, different shear
stresses, and
different freeze/thaw cycles.
[0088] It will be understood by one skilled in the art that the evaluation of
candidate
domains may be performed on isolated domains or alternatively, each domain may
be
evaluated in the context of the intact multidomain protein. The latter
approach is particularly
useful when a plurality of multidomain proteins differ from each other in a
single domain. It
will be further understood, that an intact multidomain protein comprising a
modified domain
may be evaluated to determine the effect of a modified domain on one or more
metrics of the
invention representing one or more therapeutic and/or formulation and/or
manufacturing
characteristics. It will also be understood by one skilled in the art that the
selected domains,
whether evaluated as isolated domains or in the context of an intact
multidomain protein, may
be incorporated into multidomain proteins. For example, a Fab fragment
evaluated and
selected in the context of an intact antibody may be utilized in the
generation of a chimeric
protein comprising a toxin. As used herein, the term "evaluate candidate
domains" and
grammatical variations thereof, specifically encompass the evaluation of both
isolated
candidate domains and the evaluation of candidate domains in the context of an
intact
multidomain protein or fraginent thereof.
[0089] Thus, the invention provides a method of screening a plurality of
multidomain
proteins to identify one or more multidomain proteins that have both the
desired biological
activities and the desired therapeutic and/or formulation characteristics
comprising (a)
evaluating for each of a plurality of different multidomain proteins one or
more metrics
representing one or more therapeutic and/or formulation and/or manufacturing
characteristics
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
of candidate domains of the multidomain proteins, wherein the plurality of
different
multidomain proteins exhibits a biological activity above a predetermined
threshold level;
and (b) selecting one or more multidomain proteins from the plurality based on
the metrics of
the candidate domains. In one einbodiinent, the method further comprises
generating the
population of different inultidomain proteins. In certain embodiments, the
multidomain
protein is an antibody. In otlier einbodiinents the modified domain is an
antigen binding
domain. In still other einbodiinents, the modified domain is an Fc domain or
fragment
thereof.
[0090] The invention also provides a method for engineering a multidomain
protein
for preferred therapeutic and/or formulation properties. In one embodiment,
the method
comprises engineering one or more domains to improve the protein's formulation
characteristics. In another embodiment, the method comprises engineering one
or more
domains to improve the inultidomain protein's therapeutic characteristics. In
still another
embodiinent, the method comprises engineering one or more domains to iinprove
both the
inultidomain protein's therapeutic and formulation characteristics. In
specific embodiments,
the engineered domain exhibits improved therapeutic and/or formulation
characteristics
without reducing significantly the protein's pharmacological characteristics.
In another
specific embodiment, the engineered domain exhibits improved therapeutic
and/or
formulation characteristics without substantially affecting the protein's
pharmacological
characteristics. Accordingly, the invention also provides engineered
multidomain proteins
having preferred therapeutic and/or formulation properties. In certain
embodiments, the
engineered multidomain proteins having preferred therapeutic and/or
formulation properties
comprise a modified domain. In specific embodiment, the engineered multidomain
proteins
having preferred therapeutic and/or formulation properties comprise a modified
antibody
domain (e.g., antigen binding domain, Fc domain).
[0091] In a specific embodiinent, the invention provides a method of
engineering a
multidomain protein to have improved stability. In certain embodiments, the
multidomain
protein comprises a domain which either has a low Tm or contributes to the
multidomain
protein having a low Tm. In one embodiment, a domain of a inultidomain protein
is modified
by substituting one or more amino acid residues in the domain such that the
stability of the
domain is increased. In another embodiment, a domain is modified such that its
Tm value is
increased. The method comprises (a) modifying a domain of a multidomain
protein by
replacing one or more amino acid residues in the domain to generated a
modified domain; (b)
26
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
detennining the Tm of the modified domain; and (c) classifying a multidoinain
protein
containing the modified domain as having improved stability if the modified
domain is
determined to have a higher Tm in step (b). In some einbodiments a domain is
modified such
that it has a Tm greater.than the Tm of the domain prior to modification. In
certain
embodiments, the Tin of the modified domain is increased by at least 2 C, at
least 4 C, at
least 6 C, at least 8 C, at least 10 C, at least 15 C, at least 20 C, at least
25 C, at least 30 C,
or least 40 C. In some embodiments, a domain is engineered such that it has a
Tm greater
than a predeterinined threshold value. In certain embodiments, the
predetennined Tm
threshold value is at least 50 C, 55 C, 60 C, 65 C, 70 C, 75 C, 80 C, 85 C, 90
C, 95 C,
100 C, 105 C, 110 C, 115 C, or 120 C. In certain embodiments, the multidomain
protein is
an antibody. In other embodiments said modified domain is an antigen binding
domain. In
still other embodiments, said modified domain is an Fc domain or fragment
thereof.
[0092] As described above, the Tm of a domain may be evaluated in an intact
multidomain protein. Accordingly, the present invention provides method of
engineering a
multidomain protein to have improved stability in which the Tm of intact
multidomain
protein comprising a modified domain is determined. Optionally, or
alternatively, the
method of engineering a multidomain protein to have improved stability
comprises (a)
modifying the domain by replacing one or more amino acid residues in the
domain to
generated a modified domain; (b) determining the Tm of the inultidomain
protein containing
the modified domain; and (c) classifying a multidomain protein containing the
modified
domain based on the Tm of the multidomain protein containing the modified
domain
determined in step (b).
[0093] The non-specific toxicity and/or biodistribution and/or solubility
and/or
viscosity of a protein may be optimized by altering the number and location of
ionizable
residues in the protein to adjust the pI. For example the pI of a polypeptide
can be
manipulated by making the appropriate amino acid substitutions. For example,
at each amino
acid residue of a protein, there are several possible changes that can be
made: charged
residues can be changed to uncharged residues or residues with the opposite
charge and
uncharged residues can be changed to residues with either a positive or
negative charge. The
maximum change in charge that can occur is where a charged amino acid is
substituted with
another amino acid of opposite charge (e.g., by substituting an aspartic acid
for a lysine or
arginine). Replacing a charged residue with an uncharged residue (e.g., by
substituting a
charged amino acid such as a lysine, for an uncharged residue such as alanine)
serves will
27
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
reinove a charge but not add opposite charge and thus will result in a smaller
pI change. The
acidic amino acids aspartic acid (D) and glutamic acid (E) are deprotonated at
or near
physiological pH and carry a negative charge. The basic amino acids lysine (K
) and arginine
(R) are protonated at or near physiological pH and carry a positive charge.
Substitutions of D
and E with either K or R, or vice versa, are likely to have the greatest
impact on pI. Specific
amino acid substitutions are described below and detailed in Example 4.
[0094] Without wishing to be bound by any particular theory, amino acid
substitutions of a protein that result in clianges of the pI of said protein
may improve non-
specific toxicity and/or biodistribution and/or solubility and/or the
viscosity of the protein.
One skilled in the art would be able to deterinine ainino acid substitutions
that is most
appropriate for a particular protein to achieve a desired pI. The pI of a
protein may be
detennined by a variety of methods including but not limited to isoelectric
focusing. It can
also be estimated using any one of the various computer algorithms (see for
example
Bjellqvist et al., 1993, Electrophoresis 14:1023). In certain embodiments, the
invention
provides engineered multidomain proteins that have improved non-specific
toxicity and/or
biodistribution and/or solubility and/or lower viscosity. In a specific
embodiment, the
engineered multidomain proteins that have improved non-specific toxicity
and/or
biodistribution solubility and/or lower viscosity coinprise a modified domain
having different
pI than the same domain prior to modification.
[0095] In a specific embodiment, the invention provides a method of
engineering a
multidomain protein to have improved solubility and/or lower viscosity. In
certain
embodiments, the multidomain protein comprises a domain which either has a low
pI or
contributes to the multidomain protein having a low pI. The method comprises
(a) modifying
a domain of the multidomain protein by replacing one or more amino acid
residues in the
domain to generated a modified domain; (b) determining the pI of the modified
domain; and
(c) classifying a multidomain protein containing the modified domain as having
improved
solubility and/or viscosity if the modified domain is determined to have a
higher pI in step
(b). In one embodiment a domain is engineered such that it has a pI greater
than the pI of the
domain prior to modification. In some specific embodiments, the pI of the
modified domain
is increased by at least 0.5, at least 1.0, at least 2.0, at least 3.0, at
least 4.0, at least 5.0, or at
least 10Ø In one embodiment, a domain is engineered such that it has a pI
greater thaii a
predetermined threshold value. In some specific embodiments, the predetermined
pI
threshold value is about 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9Ø
28
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0096] In certain embodiments, the invention provides engineered multidomain
proteins that have improved solubility and/or lower viscosity. In a specific
embodiment, the
engineered inultidomain proteins that have improved solubility and/or lower
viscosity
comprise a modified domain having a higher pI than the same domain prior to
modification.
In certain embodiments, the multidomain protein is an antibody. In other
embodiments said
modified domain is an antigen binding domain. In still other embodiments, said
modified
domain is an Fc domain or fragment thereof.
[0097] In other specific embodiments, the invention provides a method of
engineering
a inultidoinain protein to have reduced non-specific toxicity. In certain
einbodiinents, the
multidomain protein coinprises a domain which either has a pI or contributes
to the
multidomain protein having a pI which results in non-specific toxicity. The
method
comprises (a) modifying a domain of a multidomain protein by replacing one or
more amino
acid residues in the domain to generated a modified domain; (b) determining
the pI of the
modified domain; and (c) classifying the multidomain protein containing the
modified
domain as having reduced non-specific toxicity if the modified domain is
deterinined to have
a lower pI in step (b). In one embodiment a domain is engineered such that it
has a pI less
than the pI of the domain prior to modification. In some specific embodiments,
the pI of the
modified domain is decreased by at least 0.5, at least 1.0, at least 2.0, at
least 3.0, at least 4.0,
at least 5.0, or at least 10Ø In one embodiment, a domain is engineered such
that it has a pI
less than a predetermined threshold value. In some specific embodiments, the
predetermined
pI threshold value is about 9.0, 8.5, 8.0, 7.5, 7.0, 6.5, 6.0, 5.5 or 5Ø
[0098] In certain embodiments, the invention provides engineered multidomain
proteins that have reduced non-specific toxicity. In a specific embodiment,
the engineered
multidomain proteins that have reduced non-specific toxicity coinprises a
modified domain
having a lower pI than the same domain prior to modification. In certain
embodiments, the
multidomain protein is an antibody. In other embodiments said modified domain
is an
antigen binding domain. In still other embodiments, said modified domain is an
Fc domain
or fraginent thereof.
[0099] In additional embodiments, the invention provides a method of
engineering a
multidomain protein to have a specific biodistribution (e.g., intracellular,
extravascular,
extracellular). In certain embodiments, the multidomain protein comprises a
domain which
either has a pI or contributes to the multidomain protein having a pI which
determines the
biodistribution. The method comprises (a) modifying a domain of a multidomain
protein by
29
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
replacing one or more ainino acid residues in the domain to generated a
modified domain; (b)
determining the pI of the modified domain; and (c) classifying a multidomain
protein
containing the modified domain as having reduced intracellular localization if
the modified
domain is determined to have a lower pI in step (b) or as having increased
intracellular and/or
extravascular localization if the modified domain is detennined to have a
higher pI in step
(b). In one embodiment a domain is modified such that it has a pI greater than
the pI of the
domain prior to modification. In some specific embodiments, the pI of the
modified domain
is increased by at least 0.5, at least 1.0, at least 2.0, at least 3.0, at
least 4.0, at least 5.0, or at
least 10Ø In one embodiment, a domain is modified such that it has a pI
greater than a
predetermined threshold value. In another einbodiinent a domain is modified
such that it has
a pI less than the pI of the domain prior to modification. In some specific
embodiments, the
pI of the modified domain is decreased by at least 0.5, at least 1.0, at least
2.0, at least 3.0, at
least 4.0, at least 5.0, or at least 10Ø In another embodiment, a domain is
engineered such
that it has a pI less than a predetermined threshold value. In some specific
embodiments, the
predetermined pI threshold value is about 9.0, 8.5, 8.0, 7.5, 7.0, 6.5, 6.0,
5.5 or 5Ø
[0100] In certain embodiments, the invention provides engineered multidomain
proteins that have increased intracellular and/or extravascular localization.
In a specific
embodiment, the engineered multidomain proteins that have increased
intracellular and/or
extravascular localization comprise a modified domain having a higher pI than
the saine
domain prior to modification. In other embodiments, the invention provides
engineered
multidomain proteins that have reduced intracellular localization. In a
specific embodiment,
the engineered multidomain proteins that have reduced intracellular
localization comprise a
modified domain having a lower pI than the same domain prior to modification.
In certain
embodiments, the multidomain protein is an antibody. In other embodiments said
modified
domain is an antigen binding domain. In still other embodiments, said modified
domain is an
Fc domain or fragment thereof.
[0101] As described above, the pI of a domain may be evaluated in an intact
inultidomain protein. Accordingly, the present invention provides methods of
engineering a
multidomain protein to have improved non-specific toxicity and/or
biodistribution solubility
and/or lower viscosity in which the pI of intact multidomain protein
coinprising a modified
domain is determined. Optionally, or alternatively, the methods of engineering
a
inultidomain protein to have improved non-specific toxicity and/or
biodistribution solubility
and/or lower viscosity described above comprise: (a) modifying a domain of a
multidomain
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
protein by replacing one or more amino acid residues in the domain to
generated a modified
domain; (b) determining the pI of the multidomain protein containing the
modified domain;
and (c) classifying a multidomain protein containing the modified domain based
on the pI of
the multidomain protein containing the modified domain determined in step (b).
[0102] In certain embodiments, the modified Fc domain coinprises a
replaceinent at
one or more ainino acid residues selected from the group consisting of K338,
A339, K340,
G341, Q342, R344, E345, R355, E356, E357, M358, T359, K360, N361, Q362, L365,
T366,
K370, N390, Y391, K392, T393, T394, V397, L398, D399, S400, D401, F405, 1(409,
L410,
D413 and K414 as numbered by the EU index as set forth in Kabat. In specific
embodiments, the modified Fc domain comprises one or more ainino acid
replacements from
the group consisting of K338 to any uncharged residue (e.g., Q but generally
not P or C),
K338D, K338E, A339D, A339E, A339K, A339R, K340 to any uncharged residue (e.g.,
Q
but generally not P or C), K340D, K340E, G314D, G314E, G314K, G314R, Q342D,
Q342E,
Q342K, Q342R, R344 to any uncharged residue (e.g., Q but generally not P or
C), R344D,
R344E, E345 to any uncharged residue (e.g., Q but generally not P or C),
E345K, E345R,
R355 to any uncharged residue (e.g., Q but generally not P or C), R355D,
R355E, E356 to
any uncharged residue (e.g., Q but generally not P or C), E356K, E356R, E357
to any
uncharged residue (e.g., Q but generally not P or C), E357K, E357R, M358D,
M358E,
M358K, M358R, T359D, T359E, T359K, T359R, K360 to any uncharged residue (e.g.,
Q
but generally not P or C), K360D, K360E, N361D, N361E, N361K, N361R, Q362D,
Q362E,
Q362K, Q362R, L365D, L365E, L365K, L365R, T366D, T366E, T366K, T366R, K370 to
any uncharged residue (e.g., Q but generally not P or C), K370D, K370E, N390D,
N390E,
N390K, N390R, Y391D, Y391E, Y391K, Y391R, K392 to any uncharged residue (e.g.,
Q
but generally not P or C), K392D, K392E, T393D, T393E, T393K, T393R, T394D,
T394E,
T394K, T394R, V397D, V397E, V397K, V397R, L398D, L398E, L398K, L398R, D399 to
any uncharged residue (e.g., Q but generally not P or C), D399K, D399R, S400D,
S400E,
S400K, S400R, D401 to any uncharged residue (e.g., Q but generally not P or
C), D401K,
D401R, F405D, F405E, F405K, F405R, K409 to any uncharged residue (e.g., Q but
generally not P or C), K409D, K409E, L410D, L410E, L410K, L410R, D413 to any
uncharged residue (e.g., Q but generally not P or C), D413K, D413R, K414 to
any uncharged
residue (e.g., Q but generally not P or C), K414D and K414E as numbered by the
EU index
as set forth in Kabat.
31
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0103] In certain embodiments, the engineered Fe domain with a higher pI
comprises
a replacement at one or more amino acid residues selected from the group
consisting of
A339, G341, Q342, E345, E356, E357, M358, T359, N361, Q362, L365, T366, N390,
Y391,
T393, T394, V397, L398, D399, S400, D401, F405, L410 and D413 as nuinbered by
the EU
index as set forth in Kabat. In specific einbodiinents, the engineered Fc
domain with a higher
pI comprises one or more amino acid replacements selected from the group
consisting of
A339K, A339R, G314K, G314R, Q342K, Q342R, E345 to any uncharged residue (e.g.,
Q
but generally not P or C), E345K, E345R, E356 to any uncharged residue (e.g.,
Q but
generally not P or C), E356K, E356R, E357 to any uncharged residue (e.g., Q
but generally
not P or C), E357K, E357R, M358K, M358R, T359K, T359R, N361K, N361R, Q362K,
Q362R, L365K, L365R, T366K, T366R, N390K, N390R, Y391K, Y391R, T393K, T393R,
T394K, T394R, V397K, V397R, L398K, L398R, D399 to any uncharged residue (e.g.,
Q but
generally not P or C), D399K, D399R, S400K, S400R, D401 to any uncharged
residue (e.g.,
Q but generally not P or C), D401K, D401R, F405K, F405R, L410K, L410R, D413 to
any
uncharged residue (e.g., Q but generally not P or C), D413K and D413R as
numbered by the
EU index as set forth in Kabat.
[0104] In certain embodiments, the engineered Fc domain with a lower pI
coinprises
a replacement at one or more amino acid residues selected from the group
consisting of
K338, A339, K340, G341, Q342, R344, R355, M358, T359, K360, N361, Q362, L365,
T366,
K370, N390, Y391, K392, T393, T394, V397, L398, S400, F405, 1(409, L410, and
K414 as
numbered by the EU index as set forth in Kabat. In specific embodiments, the
engineered Fc
domain with a lower pI comprises one or more amino acid replacements selected
from the
group consisting of K338 to any uncharged residue (e.g., Q but, generally not
P or C), K338D,
K338E, A339D, A339E, K340 to any uncharged residue (e.g., Q but generally not
P or C),
K340D, K340E, G314D, G314E, Q342D, Q342E, R344 to any uncharged residue (e.g.,
Q but
generally not P or C), R344D, R344E, R355 to any uncharged residue (e.g., Q
but generally
not P or C), R355D, R355E, M358D, M358E, T359D, T359E, K360 to any uncllarged
residue (e.g., Q but generally not P or C), K360D, K360E, N361D, N361E, Q362D,
Q362E,
L365D, L365E, T366D, K370 to any uncharged residue (e.g., Q but generally not
P or C),
K370D, K370E, N390D, N390E, Y391D, Y391E, K392 to any uncharged residue (e.g.,
Q
but generally not P or C), K392D, K392E, T393D, T393E, T394D, T394E, V397D,
V397E,
L398D, L398E, S400D, S400E, F405D, F405E, K409 to any uncharged residue (e.g.,
Q but
generally not P or C), K409D, K409E, L410D, L410E, K414-to any uncharged
residue (e.g.,
32
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
Q but generally not P or C), K414D and E'-414E as nuinbered by the EU index as
set forth in
Kabat.
[0105] It is contemplated that evaluation of candidate domains is generally to
be
performed under substantially similar conditions. For exainple, each candidate
domain,
evaluated as an intact multidomain protein or as an isolated domain thereof,
is preferably at a
similar or identical concentration and is in a similar or identical buffer.
Furthermore, all
manipulations (e.g., pipetting, inixing, heating, cooling, etc.) are to be
perfonned in a
substantially similar manner for each candidate domain being evaluated
whenever possible.
[0106] In another embodiment, candidate domains are further evaluated under
one or
more particular biochemical conditions, e.g., conditions under which the
fonnulated drug is
stored and/or used. For example, pH affects the shelf life of a protein. The
coinposition of
the solvent, e.g., water, also affects the shelf life of a protein. Glycerol
alters the solvation
properties of water to favor the native conformation of proteins. Ligands and
cofactors in the
solution may also affect the shelf life of a protein. Other biochemical
parameters that have
been shown to affect protein shelf life are: protein concentration,
temperature, glutathione
redox buffers (GSH, GSSG), the presence of detergents, and the presence of
other additives,
such as glycerol, arginine-HCl, polyethylene glycol (PEG), and organic
solvents. Thus, the
candidate domains can be evaluated under various conditions to gain more
insights into the
domains fonnulation characteristics, such pH dependence, ionic strength
dependence,
concentration of salts of the Hofineister series, glycerol concentration,
sucrose concentration,
arginine concentration, dithiothreitol concentration, metal ion concentration,
shear stress, and
freeze/thaw stress, etc. For example, the stability of the candidate domains
can be
determined under a plurality of different biochemical conditions, either
different levels of a
particular type of conditions, such as different pH values, different
temperatures, different
sucrose concentrations, or a combination of different types and levels of
conditions.
[0107] Some exemplary biochemical conditions described below are of particular
interest. In some embodiments, the formulation may contain histidine with a
concentration
ranging from about 1 mM to about 100 mM, about 10 mM to about 50 mM, or about
20 mM
to about 30 mM. Histidine can be in the form of L-histidine, D-histidine, or a
mixture
thereof, but L-histidine is the most preferable. Histidine can be also in the
form of hydrates.
Histidine may be used in a form of pharmaceutically acceptable salt, such as
hydrochloride
(e.g., monohydrochloride and dihydrochloride), hydrobromide, sulfate, acetate,
etc. The
purity of histidine should be at least 98%, or at least 99%, or at least
99.5%.
33
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0108] The pH of the formulation should not be equal to the isoelectric point
of the
particular multidomain protein (e.g., antibody) to be used in the formulation
and may range
from about 5.0 to about 7, or about 5.5 to about 6.5, or about 5.8 to about
6.2, and or about
6Ø
[0109] In addition to histidine and a multidomain protein (e.g., an antibody),
the
formulations may further comprise one or more amino acids (e.g., glycine) at a
concentration
of less than 100 mM, less than 50 mM, less than 3.0 mM, less than 2.0 mM, or
less than 1.8
mM, and most preferably 1.6 mM. The amount of amino acid in the formulation
should not
cause a significant buffering effect so that protein precipitation at its
isoelectric point can be
avoided. An ainino acid may be also used in a forin of pharinaceutically
acceptable salt, such
as hydrochloride, hydrobromide, sulfate, acetate, etc. The purity of the amino
acid should be
at least 98%, or at least 99%, or 99.5%. In a specific embodiment, glycine is
included in the
formulations of the present invention.
[0110] Optionally, the formulations may further comprise other excipients,
such as
saccharides (e.g., sucrose, mannose, trehalose, etc.), polyols (e.g., Tween)
and sugar alcohols
(e.g., mannitol, sorbitol, etc.). In one embodiment, the other excipient is a
saccharide. In a
specific embodiment, the saccharide is sucrose, which is at a concentration
ranging from
between about 1% to about 20%, or about 5% to about 15%, or about 8% to 10%.
In another
embodiment, the other excipient is a polyol. Preferably, however, the
fonnulations of the
present invention do not contain mannitol. In a specific embodiment, the
polyol is
polysorbate (e.g., Tween 20), which is at a concenfration ranging fiom between
about 0.001%
to about 1%, or about 0.01 to about 0.1.
[0111] In one embodiment, candidate domains are evaluated by one or more
particular physical manipulations. For example candidate domains can be
repeatedly
subjected to shearing forces such as puinping, shaking, vortexing and the like
to determine
their ability to withstand shear stress such as those encountered during
manufacture and
shipping.
[0112] In a specific embodiment, the present invention provides a method for
therapeutic antibody development. As used herein, the terms "antibody" and
"antibodies"
refer to monoclonal antibodies, multispecific antibodies, human antibodies,
humanized
antibodies, camelised antibodies, chimeric antibodies and anti-idiotypic (anti-
Id) antibodies.
The terms "antibody fragment" and "antibody domain" refer to any distinct
region of
antibody including but not limited to, "antigen binding domains" which bind an
epitope, such
34
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
as, Fab fragments, F(ab') fragments, Fv doinains, Fd domain, "constant region
domains" such
as, CH1, hinge domain and Fc domains and any portions thereof, including for
example, CH2
and CH3 domains. Single-chain Fvs (scFv), disulfide-linked Fvs (sdFv), and
similar
recombinantly generated antigen binding domains are also encompassed by the
terins
"antibody fragment" and "antibody doinain". In particular, antibodies include
immunoglobulin molecules and iminunologically active fragments of
immunoglobulin
molecules, as well as antibody domain fusion proteins i.e., inolecules that
contain an antigen
binding site or other antibody domain, fused to another protein domain
including but not
liinited to non-iinmunoglobulin proteins, an Fc domain or fragment thereof. As
outlined
herein, the terms "antibody" and "antibodies" specifically include the Fc
variants described
herein, full length antibodies and variant Fc-Fusions coinprising Fc domains,
or fraginents
thereof, comprising at least one novel amino acid residue described herein
fused to an
immunologically active fragment of an immunoglobulin or to other proteins as
described
herein. Such variant Fc fusions include but are not limited to, scFv-Fc
fusions, variable
region (e.g., VL and VH) -Fc fusions, scFv-scFv-Fc fusions. Immunoglobulin
molecules can
be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl,
IgG2, IgG3, IgG4,
IgAl and IgA2) or subclass.
[0113] The present invention also specifically encompasses antibodies with
multiple
specificities (e.g., an antibody with specificity for two or more discrete
antigens (reviewed in
Cao et al., 2003, Adv Drug Deliv Rev 55:171; Hudson et al., 2003, Nat Med
1:129)). For
example, bispecific antibodies contain two different binding specificities
fused together. In
the siinplest case a bispecific antibody would bind to two adjacent epitopes
on a single target
antigen, such an antibody would not cross-react with other antigens.
Alternatively, bispecific
antibodies can bind to two different antigens, such an antibody specifically
binds to two
different molecules such as a heterologous polypeptide or solid support
material, but not to
other unrelated molecules (e.g., BSA). See, e.g., PCT publications WO
93/17715; WO
92/08802; W091/00360; WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991);
U.S. Pat.
Nos. 4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al.,
J. Immunol.
148:1547-1553 (1992). While such molecules normally will only bind two
antigens (i.e.
bispecific antibodies), antibodies with additional specificities such as
trispecific antibodies
are encompassed by the instant invention. Accordingly, the multidomain
proteins of the
present invention may be antibodies that are monospecific, bispecific,
trispecific or of greater
multispecificity.
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0114] It will be understood that Fc domain as used herein includes the
polypeptides
comprising the constant region of an antibody excluding the first constant
region
immunoglobulin domain. Thus Fc refers to the last two constant region
immunoglobulin
domains of IgA, IgD, and IgG, and the last three constant region
iinmunoglobulin domains of
IgE and IgM, and the flexible hinge N-terminal to these domains. For IgA and
IgM Fc may
include the J chain. For IgG, the Fc domain comprises immunoglobulin domains
Cgamma2
and Cgamma3 (Cy2 and Cy3) and the hinge between Cgammal (Cy1) and Cgamina2
(Cy2).
Although the boundaries of the Fc domain may vary, the human IgG heavy chain
Fc domain
is usually defined to coinprise residues C226 or P230 to its carboxyl-
terminus, wherein the
nuinbering is according to the EU index as in Kabat et al. (1991, NIH
Publication 91-3242,
National Technical Information Service, Springfield, VA). The "EU index as set
forth in
Kabat" refers to the residue numbering of the huinan IgGl EU antibody as
described in Kabat
et al. supra. Fc may refer to this domain in isolation, or this region in the
context of an
antibody, antibody fragment, or Fc fusion protein. An Fc containing protein
may be an
antibody, Fc fusion, or any protein or protein domain that coinprises an Fc
domain. The
present invention also encompasses proteins comprising variant Fc domains,
which are non
naturally occurring variants of an Fc. Note: Polyinorphisms have been observed
at a number
of Fc positions, including but not liinited to Kabat 270, 272, 312, 315, 356,
and 358, and thus
slight differences between the presented sequence and sequences in the prior
art may exist.
[0115] The method for therapeutic antibody development comprises screening a
plurality of candidate antibody domains (e.g., Fab, Fc and Fv) that have high
biological
activity (e.g., binding affinity to a target antigen (e.g., antigen, Fc-
receptor), effector function
(e.g., ADCC, CDC)) for one or more metrics characterizing the therapeutic
and/or
formulation characteristics. In one embodiment, the metrics include one or
more parameters
characterizing stability of said antibody domain. In another embodiment, the
metrics include
one or more parameters characterizing solubility, biodistribution or non-
specific toxicity of
said antibody domain. In a specific embodiment, said one or more parameters
characterizing
stability of said antibody domain comprise a Tm value of said antibody domain,
and said one
or more parameters characterizing solubility, biodistribution or non-specific
toxicity of said
antibody domain comprise a pI value of said antibody domain.
[0116] The present invention also provides a method of generating one or more
antibodies for therapeutic uses. In one embodiment, the method of generating
one or more
antibodies for therapeutic uses, comprises (a) evaluating for each of a
plurality of candidate
36
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
antibody domains one or more metrics representing one or more therapeutic
and/or
formulation and/or manufacturing characteristics of the antibody domain,
wherein the
plurality of candidate antibody domains exhibits a biological activity above a
predetermined
threshold level; (b) selecting one or more antibody domains from the plurality
based on the
metrics; and (c) optionally, constructing an antibody using each antibody
domain selected in
step (b) and one or more other domains.
[0117] In another embodiment, the method of generating one or more antibodies
for
therapeutic uses further coinprises, before using the selected antibody domain
to construct an
antibody (prior to step (c)), the steps of (i) evaluating for each of a
plurality of candidate
other antibody domains one or more metrics; and (ii) selecting another
antibody domain from
the plurality of candidate other antibody domains based on the metrics.
[0118] In one embodiment, the plurality of candidate antibody domains can be
an
antigen binding domains (e.g., Fab domains). In such cases, the biological
activity may be
the aritigen binding domain's binding affinity to a target antigen. In certain
embodiments, at
least some of the antigen binding domains bind different epitopes of the
target antigen. In a
specific embodiment, the plurality of antigen binding domains are obtained by
screening an
expression library (e.g., a phage display library) with the target antigen. In
another specific
embodiment, the plurality of antigen binding domains are obtained by digesting
a plurality of
monoclonal antibodies. Eacli selected antigen binding domain is then combined
with another
protein domain (e.g., Fc domain) to generate one or more multidomain proteins.
In a specific
embodiment, each selected antigen binding domain is combined with another
antigen binding
domain which may bind to the same or a different target antigen. In another
specific
embodiment, each selected antigen binding domain is combined with an antibody
constant
domain.
[0119] In another embodiment, the plurality of candidate antibody domains can
be Fc
domains. In such cases, the biological activity may be the Fc domain's binding
affinity to
constant region domain receptors an/or ligands (e.g., FcRn, Clq, FcyRs) and/or
ability to
mediate effector functions (e.g., ADCC, CDC). In a specific einbodiment, the
plurality of Fc
domains are obtained by screening an expression library (e.g., a phage display
library) with
one or more of the constant region domain receptors an/or ligands. Each
selected Fc is then
combined with another protein domain (e.g., a Fab domain, a cellular receptor
domain) to
generate one or more multidomain proteins.
37
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0120] The methods described above for screening and/or engineering protein
domains for their non-specific toxicity, biodistribution, solubility and
thermal stability can be
used. One or more antibody domains having reduced non-specific toxicity and/or
desired
biodistribution and/or high solubility and/or thermal stability are selected
and used for
constructing the full antibodies by combining thein with the appropriate
domain(s) to
generate a full antibody. In one embodiment, one or more candidate antibody
domains that
have a Tin value higher than at least 50 C, 55 C, 60 C, 65 C, 70 C, 75 C, 80
C, 85 C, 90 C,
95 C, 100 C, 105 C, 110 C, 115 C, or 120 C are selected for construction of
the full
antibody. In another embodiment, one or more candidate antibody domains that
have a pI
value higher than about 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5 or 9.0 are
selected for construction
of the full antibody domain containing inultidomain protein. In another
embodiment, one or
more candidate antibody domains that have a pI value less than about 9.0, 8.5,
8.0, 7.5, 7.0,
6.5, 6.0, 5.5 or 5.0 are selected for construction of the fall antibody domain
containing
multidomain protein
[0121] In a specific embodiment, a plurality of antigen binding domains (e.g.,
Fab,
scFv, etc.) that bind a given target antigen witli an affinity above a chosen
threshold level are
obtained by affinity screening of an expression library (e.g., a phage display
library). One or
more metrics characterizing the antigen binding domains' therapeutic and/or
formulation
properties are then evaluated for each of the antigen binding domains. The
plurality of
antigen binding domains are ranked according to the one or more metrics. In
one
embodiment, the plurality of antigen binding domains are ranked according to
their Tm
values, and one or more antigen binding domains are selected from the top of
the ranked list.
In another embodiment, the plurality of antigen binding domains are ranked
according to
their pI values, and one or more antigen binding domains are selected from the
top of the
ranked list. In still another embodiment, the plurality of antigen binding
domains are ranked
according to a combined Tm and pI rank, and one or more antigen binding
domains are
selected from the top of the ranked list. The selected antigen binding domains
are then used
for construction of the full antigen binding domain containing multidomain
proteins (e.g.,
antibodies, diabodies, etc.).
[0122] In another specific embodiment, a plurality of antibody constant region
domains (e.g., Fc, CH2, CH3, etc) are evaluated for one or more metrics
characterizing the
constant region domains' therapeutic and/or formulation properties (e.g.,
solubility and
thermal stability). The plurality of antigen binding domains are ranked
according to the one
38
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
or more metrics. In one embodiment, the plurality of constant region domains
are ranked
according to their Tm values, and one or more constant region domains are
selected from the
top of the ranked list. In another embodiment, the plurality of constant
region domains are
ranked according to their pI values, and one or more constant region domains
are selected
from the top of the ranked list. In still another embodiment, the plurality of
constant region
domains are ranlced according to a combined Tm and pI ranlc, and one or more
constant
region domains are selected from the top of the ranked list. The selected
constant region
domains are then used for construction of the full antigen binding domain
containing
multidomain proteins (e.g., antibodies, diabodies, etc.). In certain
embodiments, one or more
candidate antibody constant region domains that have a Tm value higher than at
least 50 C,
55 C, 60 C, 65 C, 70 C, 75 C, 80 C, 85 C, 90 C, 95 C, 100 C, 105 C, 110 C, 115
C, or
120 C are selected for construction of the full antibody constant region
domain containing
multidomain protein (e.g., antibody). In other embodiments, one or more
candidate antibody
constant region domains that have a pI value higher than about 5.0, 5.5, 6.0,
6.5, 7.0, 7.5, 8.0,
8.5 or 9.0 are selected for construction of the full antibody constant region
domain containing
multidomain protein (e.g., antibody, Fc-fusion protein, etc.). In still other
embodiments, one
or more candidate antibody constant region domains that have a pI value lower
than about
9.0, 8.5, 8.0, 7.5, 7.0, 6.5, 6.0, 5.5, or 5.0 are selected for construction
of the full antibody
constant region domain containing multidomain protein.
[0123] In a specific embodiment, the invention provides a method for
engineering an
antibody for preferred therapeutic and/or formulation properties. In one
embodiment, the
method comprises engineering the antigen binding (e.g., Fab) and/or constant
region (e.g.,
Fc) domains to improve the protein's therapeutic and/or formulation
characteristics. The
method comprises making one or more modification (e.g., amino acid
substitutions), the
modifications are such that they improve one or more of the characteristics of
said antibody.
[0124] In addition to binding antigen, antibodies are known to bind to a
number of
ligands via their constant region domain including, Fe receptors (e.g., FcRn,
FcyRs) and the
complement protein C 1 q. The binding interactions of the constant region
domain are
essential for a variety of effector functions and downstream signaling events
such as antibody
dependent cell-mediated cytotoxicity (ADCC) activity and coinplement dependent
cytotoxicity (CDC). In certain embodiments, the engineered antibody exhibits
improved
therapeutic and/or formulation characteristics without reducing significantly
the antibody's
pharinacological characteristics, e.g., the antibody's binding specificity,
binding affinity
39
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
and/or avidity to its target, or the antibody's effector functions, e.g., Fc-
receptor (FcR) and/or
Clq binding, antibody dependent cellular cytotoxicity (ADCC), coinplement
dependent
,cytotoxicity (CDC), and/or serum half life. In another embodiment, the
engineered antibody
exhibits iinproved therapeutic and/or formulation characteristics and improved
pharmacological characteristics, e.g., the antibody's binding specificity,
binding affinity
and/or avidity to its target, or the antibody's Fc effector functions, e.g.,
FcR binding, ADCC,
CDC, and/or seruin half life.
[0125] "Antibody-dependent cell-mediated cytotoxicity" or "ADCC" refers to a
fonn
of cytotoxicity in which secreted Ig bound onto Fe receptors (FeRs) present on
certain
cytotoxic cells (e.g., Natural Killer (NK) cells, neutrophils, and
macrophages) enables these
cytotoxic effector cells to bind specifically to an antigen-bearing target
cell and subsequently
kill the target cell with cytotoxins. Specific high-affinity IgG antibodies
directed to the
surface of target cells "arm" the cytotoxic cells and are absolutely required
for such killing.
Lysis of the target cell is extracellular, requires direct cell-to-cell
contact, and does not
involve complement. It is contemplated that, in addition to antibodies, other
proteins
comprising Fc domain, specifically Fc fusion proteins, having the capacity to
bind
specifically to an antigen-bearing target cell will be able to effect cell-
mediated cytotoxicity.
For simplicity, the cell-mediated cytotoxicity resulting from the activity of
an Fc fusion
protein is also referred to herein as ADCC activity.
[0126] The ability of any particular protein comprising an Fc to mediate lysis
of the
target cell by ADCC can be assayed. To assess ADCC activity a protein
comprising an Fc is
added to target cells in combination with immune effector cells, which may be
activated by
the antigen antibody complexes resulting in cytolysis of the target cell.
Cytolysis is generally
detected by the release of label (e.g. radioactive substrates, fluorescent
dyes or natural
intracellular proteins) from the lysed cells. Useful effector cells for such
assays include
peripheral blood mononuclear cells (PBMC) and Natural Killer (NE-) cells.
Specific
examples of in vitro ADCC assays are described in Wisecarver et al., 1985
79:277-282;
Bruggemann et al., 1987, JExp Med 166:1351-1361; Wilkinson et al., 2001, J,
Imnzunol
Methods 258:183-191; Patel et al., 1995 JlnaTnunol Methods 184:29-38 and
herein (see
Example 3). Alternatively, or additionally, ADCC activity of the protein
comprising an Fc
may be assessed in vivo, e.g., in an animal model such as that disclosed in
Clynes et al., 1998,
PNAS USA 95:652-656.
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0127] "Coinplement dependent cytotoxicity" and "CDC" refer to the lysing of a
target cell in the presence of complement. The complement activation pathway
is initiated by
the binding of the first component of the complement system (C 1 q) to a
molecule, an
antibody for exaznple, complexed with a cognate antigen. To assess coinplement
activation, a
CDC assay, e.g. as described in Gazzano-Santoro et al., 1996, J. Irnrnunol.
Methods, 202:163,
may be perforzned.
[01281 In one embodiment, the pI of an engineered antibody binding doinain is
between pH 5.0 and pH 10Ø In one embodiment, substitutions resulting in
alterations in the
pI of the antigen binding domain will not significantly diminish its binding
affinity for an
antigen. In one embodiment, the pI of an engineered antibody constant region
domain is
between pH 5.0 and pH 10Ø In still another embodiment, substitutions
resulting in
alterations in the pI of the constant region domain will not significantly
diminish its effector
binding and/or function. It is also contemplated that substitutions resulting
in alterations in
the pI in an antibody domain may be selected such that both the pI and other
pharmacological
characteristics of the antibody domain, e.g., the antibody's binding
specificity, binding
affinity and/or avidity to its target, or the antibody's Fc effector functions
are improved. The
inventors have found that certain modifications of the hinge region do not
change the pI and
Tm of the antibody significantly. Thus, in one embodiment, the invention
provides a method
for engineering an antibody to iinprove the antibody's biological activity
without reducing
the antibody's therapeutic and/or formulation properties.
[0129] In one embodiment, the modifications of an antibody domain as described
herein may be combined with known modifications of the Fe domain such as those
disclosed
in Duncan et al, 1988, Nature 332:563-564; Lund et al., 1991, J. Iynmunol
147:2657-2662;
Lund et al, 1992, Mol Immunol 29:53-59; Alegre et al, 1994, Transplantation
57:1537-1543;
Hutchins et al., 1995, Proc Natl. Acad Sci USA 92:11980-11984; Jefferis et al,
1995,
In-tmunol Lett. 44:111-117; Lund et al., 1995, Faseb J9:115-119; Jefferis et
al, 1996,
Immunol. Lett 54:101-104; Lund et al, 1996, Immunol 157:4963-4969; Armour et
al., 1999,
EuN Jlmnzunol 29:2613-2624; Idusogie et al, 2000, Jln2munol 164:4178-4184;
Reddy et al,
2000, Jlnznaunol 164:1925-1933; Xu et al., 2000, Cell Imfrzunol 200:16-26;
Idusogie et al,
2001, Jlnimunol 166:2571-2575; Shields et al., 2001,..TBiol Chem 276:6591-
6604; Jefferis et
al, 2002, Imrnunol Lett 82:57-65; Presta et al., 2002, Biocliem Soc Trans 3
0:487-490); U.S.
Pat. Nos. 5,624,821; 5,885,573; 5,677,425; 6,165,745; 6,277,375; 5,869,046;
6,121,022;
5,624,821; 5,648,260; 6,528,624; 6,194,551; 6,737,056; 6,821,505; 6,277,375;
U.S. Patent
41
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
Publication No. 2004/0002587; PCT Publication Nos. WO 00/42072 and WO
99/58572; WO
94/29351; WO 02/060919; WO 04/029207; WO 04/099249; WO 04/063351. Also
encompassed by the present invention are Fc domains which coinprise deletions,
additions
and/or modifications. Still other
modifications/substitutions/additions/deletions of the Fc
domain will be readily apparent to one slcilled in the art.
[0130] In one embodiment, the antibodies inay be engineered to include
modifications in the Fc domain, typically to alter one or more functional
properties of the
antibody, such as serum half-life, coinplement fixation, Fc receptor binding,
and/or antigen-
dependent cellular cytotoxicity, without reducing the antibodies' pI and Tm.
Furthermore, an
antibody may be chemically modified (e.g., one or more cheinical moieties can
be attached to
the antibody) or be modified to alter its glycosylation, again to alter one or
more functional
properties of the antibody.
[0131] In one embodiment, the amino acid sequence of the Fc domain is modified
by
deleting, adding and/or substituting at least amino acid residue to alter one
or more of the
functional properties of the antibody described above. This approach is
described further in
Duncan et al, 1988, Nature 332:563-564; Lund et al., 1991, J. Iinmunol
147:2657-2662; Lund
et al, 1992, Mollmmunol 29:53-59; Alegre et al, 1994, Transplantation 57:1537-
1543;
Hutchins et al., 1995, Proc Natl. Acad Sci USA 92:11980-11984; Jefferis et al,
1995,
Inamunol Lett. 44:111-117; Lund et al., 1995, Faseb J 9:115-119; Jefferis et
al, 1996,
Inzmunol Lett 54:101-104; Lund et al, 1996, Jln2ntunol 157:4963-4969; Armour
et al., 1999,
Eur Jlmmunol 29:2613-2624; Idusogie et al, 2000, Jlmmunol 164:4178-4184; Reddy
et al,
2000, Jlm.munol 164:1925-1933; Xu et al., 2000, Cell Inamunol 200:16-26;
Idusogie et al,
2001, Jlmmunol 166:2571-2575; Shields et al., 2001, JBiol Chem 276:6591-6604;
Jefferis et
al, 2002, Immunol Lett 82:57-65; Presta et al., 2002, Biochem Soc Tyans 30:487-
490); U.S.
Patent Nos. 5,624,821; 5,885,573; 5,677,425; 6,165,745; 6,277,375; 5,869,046;
6,121,022;
5,624,821; 5,648,260; 6,194,551; 6,737,056 U.S. Patent Application Nos.
10/370,749 and
PCT Publications WO 94/2935; WO 99/58572; WO 00/42072; WO 04/029207.
[0132] In still another embodiment, the glycosylation of antibodies is
modified. For
example, an aglycoslated antibody can be made (i.e., the antibody lacks
glycosylation).
Glycosylation can be altered to, for example, increase the affinity of the
antibody for a target
antigen. Such carbohydrate modifications can be accomplished by, for example,
altering one
or more sites of glycosylation within the antibody sequence. For example, one
or more
amino acid substitutions can be made that result in elimination of one or more
variable region
42
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
framework glycosylation sites to thereby eliminate glycosylation at that site.
Such
aglycosylation may increase the affinity of the antibody for antigen. Such an
approach is
described in further detail in U.S. Patent Nos. 5,714,350 and 6,350,861.
[0133] Additionally or alternatively, an antibody can be made that has an
altered type
of glycosylation, such as a hypofucosylated antibody having reduced amounts of
fucosyl
residues or an antibody having increased bisecting G1cNAc structures. Such
altered
glycosylation patterns have been demonstrated to increase the ADCC ability of
antibodies.
Such carbohydrate modifications can be engineered by, for exainple, expressing
the antibody
in a host cell with altered glycosylation macllinery. Cells with altered
glycosylation
machinery have been described in the art and can be used as host cells in
which to express
recombinant antibodies of the invention to thereby produce an antibody with
altered
glycosylation. See, for example, Shields, R.L. et al. (2002) J. Biol. Chena.
277:26733-26740;
Umana et al. (1999) Nat. Biotech. 17:176-1, as well as, European Patent No: EP
1,176,195;
PCT Publications WO 03/035835; WO 99/54342. Additional, methods for generating
engineered glycoforms are known in the art, and include but are not limited to
those
described in Davies et al., 20017 Biotechnol Bioeng 74:288-294; Shields et al,
2002, JBiol
Chem 277:26733-26740; Shinkawa et al., 2003, JBiol Clzem 278:3466-3473) U.S.
Pat. No.
6,602,684; U.S. Ser. No. 10/277,370; U.S. Ser. No. 10/113,929; PCT WO
00/61739A1; PCT
WO 01/292246A1; PCT WO 02/311140A1; PCT WO 02/30954A1; PotillegentTM
technology
(Biowa, Inc. Princeton, N.J.); G1ycoMAbTM glycosylation engineering technology
(GLYCART biotechnology AG, Zurich, Switzerland). See, e.g., WO 00061739;
EA01229125; US 20030115614; Okazaki et al., 2004, JMB, 336: 1239-49.
[0134] In another enibodiment, the antibodies may be engineered to include
modifications in the antigen binding domain to alter the therapeutic and/or
formulation
characteristics of the antibody, without reducing the binding characteristics
of the antibody
for its antigen. The method comprises making one or more modification (e.g.,
amino acid
substitutions), said modifications are such that they improve said one or more
of the
therapeutic and/or formulation characteristics of said antibody. One skilled
in the art will
understand that amino acid substitutions and other modifications of an
antibody may alter its
binding characteristics (examples of binding characteristics include but are
not limited to,
binding specificity, equilibrium dissociation constant (KD), dissociation and
association rates
(K,ff and Kon respectively), binding affinity and/or avidity) and that certain
alterations are
more or less desirable. For example a modification that preserves or enhances
antigen
43
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
binding would generally be more preferable then one that diminished or altered
antigen
binding. It will be further understood, that antibodies may be engineered to
include
modifications in the constant region domain to alter the therapeutic and/or
formulation
characteristics of the antibody, without reducing the binding characteristics
of the constant
region to its receptors or ligands (e.g., FcRs, Clq). The binding
characteristics of an antibody
for a target antigen or constant region domain ligand may be determined by a
variety of
methods including but not limited it, equilibrium methods (e.g., enzyine-
linked
irmnunoabsorbent assay (ELISA) or radioinnnunoassay (RIA)), or kinetics (e.g.,
BIACORE analysis; see Example 2), for example. Otller commonly used methods
to
examine the binding characteristics of antibodies are described in Using
Antibodies: A
Labof ator_y Manual, Cold Spring Harbor Laboratory Press, NY, Harrow et al.,
1999 and
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY;
Harlow et al.,
1989.
[01351 It is well known in the art that the affinity constant (Ka) is defined
as kon/kaff
and that the equilibrium dissociation constant (KD) is defined as ko~lko,t. It
is generally
understood that an antibody with a high Ka is preferable to an antibody with a
low Ka and that
an antibody with a low KD is preferable to an antibody with a high KD.
However, in some
instances the value of the kan or koff may be more relevant than the value of
the KD. One
skilled in the art can determine which kinetic parameter is most important for
a given antigen
binding domain and application. In one embodiment, the methods of the
invention will result
in modified antigen binding and/or constant region domains with improved
therapeutic and/or
formulation characteristics and one or more binding characteristics (e.g.,
binding specificity,
KD, Koff, I",n, binding affinity and/or avidity) that are improved by at least
2%, or by at least
5%, or by at least 10%, or by at least 20 %, or by at least 30%, or by at
least 40%, or by at
least 50%, or by at least 60%, or by at least 70%, or by at least 80% when
compared to
kinetic parameters of the antigen binding and/or constant region domain
without said
modification.
[0136] In another einbodiment, the methods of the invention will result in
modified
antigen binding and/or constant region domains that have improved therapeutic
and/or
formulation characteristics, but do not have substantially diminished binding
characteristics.
For example, the methods of the invention will generate antigen binding and/or
constant
region domains that exhibit iinproved formulation characteristics, but
preferably have no
reduction in any binding characteristic (e.g., binding specificity, KD, Koff,
Kon, binding
44
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
affinity and/or avidity), or have one or more antigen binding characteristics
that are reduced
by less than 1%, or by less than 5%, or by less than 10%, or by less than 20
%, or by less than
30%, or by less than 40%, or by less than 50%, or by less than 60%, or by less
than 70%, or
by less than 80% when compared to antigen binding of the antibody without said
substitution.
[0137] In yet another embodiment, the methods of the invention will result in
the
selection of antigen binding and/or constant region domains with a binding
activity above a
predetermined threshold having improved therapeutic and/or formulation
characteristics. In
certain einbodiments, the binding activity is the affinity constant or K a
(koõ/koff) of the domain
for a particular target/ligand/receptor. In a specific embodiment, the Ka is
at least 1 02M 1, at
least 5x 102M 1, at least 103M 1, at least 5x 103M 1, at least 104M-1 , at
least 5 x 104IVr1, at least
l O51Vr1, at least 5x 105M 1, at least 106M 1, at least 5 X 106M 1, at least
107M 1, at least
5x107M-1, at least 108Nr1, at least 5X 108M 1, at least 109M 1, at least 5x
109M 1, at least
1010M 1> at least 5x 101M-1> at least 101rM 1> at least 5X1011M 1> at least
10121Vr1> at least
5x1012M, at least 1013NI 1, at least 5X1013M-1, at least 1014M 1, at least 5x
10141Vr1, at least
1015IV-1, or at least 5x 1015M-1 In other embodiments, the binding activity is
the equilibriuin
dissociation constant (KD) of the domain for a particular
target/ligand/receptor. As described
above, one of skill in the art will recognize that a molecule having a higher
binding affinity
will generally have a lower KD value. Accordingly, in a specific einbodiinent
the KD is less
than 10-5 M, or less than 10-6 M, or less than 10-7 M, or less than 10"$ M, or
less than 10"9 M,
or less than 10-10 M, or less than 10-11 M, or less than 10"12 M, or less than
10-13 M.
[0138] In one embodiment, selected or engineered antigen binding and/or
constant
region domains are then used to construct a full antigen binding and/or
antibody constant
domain containing multidomain protein (e.g., antibody) using methods known in
the art.
Such multidomain proteins can then be submitted to formulation development to
determine
the optimal formulations.
[0139] There are various methods available for assessing the stability of
protein drug
formulations (e.g., multidomain protein formulations), based on the physical
and chemical
structures of the proteins (e.g., antibodies or fragments thereof) as well as
on their biological
activities. For example, to study denaturation of proteins, methods such as
charge-transfer
absorption, thermal analysis, fluorescence spectroscopy, circular dichroism,
NMR, and
HPSEC, are available. See, for example, Wang et al., 1988, J. of Parenteral
Science &
Technology 42 (Suppl):S4-S26.
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0140] The rCGE and HPSEC are the most common and simplest methods to assess
the formation of protein aggregates, protein degradation, and protein
fragmentation.
Accordingly, the stability of the formulations may be assessed by these
methods.
[0141] In certain embodiments, the concentration of the multidomain protein
formulations is at least 15 mg/lnl, at least 20 mg/ml, at least 25 mg/ml, at
least 30 mghnl, at
least 35 mg/ml, at least 40 ing/ml, at least 45 mg/inl, at least 50 mg/inl, at
least 55 ing/ml, at
least 60 mg/ml, at least 65 mg/ml, at least 70 mg/ml, at least 75 mg/ml, at
least 80 mg/ml, at
least 85 mg/ml, at least 90 mg/ml, at least 95 mg/ml, at least 100 mg/lnl, at
least 105 mg/hnl,
at least 110 mg/lnl, at least 115 mg/lnl, at least 120 mg/mi, at least 125
ing/ml, at least 130
mg/ml, at least 135 mg/ml, at least 140 ing/ml, at least 150 mg/ml, at least
200 mg/ml, at least
250 mg/ml, or at least 300 mg/ml.
[0142] In certain embodiments, the formulations of the multidomain protein
exhibit
stability at the teinperature ranges of 38 C-42 C for at least 30 days, at
least 45 days, or at
least 60 days and, in some einbodiments, not more than 120 days, of 20 C-24 C
for at least 6
months, or at least 1 year, of 2 C-8 C (in particular, at 4 C) for at least 6
months, at least 1
year, at least 2 years, at least 3 years, at least 4 years, or at least 5
years and at -20 C for at
least 1 year, at least 2 years, at least 3 years, at least 4 years, or at
least 5 years, as assessed by
high performance size exclusion chromatography (HPSEC). Namely, the
formulations have
low to undetectable levels of aggregation and/or fragmentation, as defined
herein, after the
storage for the defined periods as set forth above. Preferably, no more than
5%, no more than
4%, no more than 3%, no more than 2%, no more than 1%, no more than 0.5% of
the protein
or protein fragment forms an aggregate as measured by HPSEC, after the storage
for the
defined periods as set forth above. In specific embodiments, formulations of
the inultidomain
protein exhibit almost no loss in biological activities of the multidomain
protein during the
prolonged storage under the condition described above, as assessed by various
assays
including, but not limited to, enzyme-linked immunosorbent assay (ELISA) and
radioimmunoassay to measure the ability of, for exainple, an antiboaly or
antibody fragment
to specifically bind to a target antigen, by a C3a/C4a assay to measure the
coinplement
activating ability of the antibody and by chromium release assay to measure
the ADCC
activity of the antibody. The formulations retain after the storage for the
above-defined
periods more than 80%, more than 85%, more than 90%, more than 95%, more than
98%,
more than 99%, or more than 99.5% of the initial biological activities of the
formulation prior
to the storage.
46
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0143] For example, the stability of the formulations may be evaluated by
HPSEC or
rCGE, wherein the percent area of the peaks represents the non-degraded
protein. In
particular, approximately 250 gg of, for example, the antibody or antibody
fragment that
specifically binds to a target antigen (approximately 25 gl of a liquid
formulation comprising
mg/mi said antibody or antibody fraginent) is injected onto a TosoH Biosep TSK
G3000SWXL coluinn (7.8 n1m x 30 cm) fitted with a TSK SW x1 guard column (6.0
min CX
4.0 cm). The antibody or antibody fraginent is eluted isocratically with 0.1 M
disodium
phosphate containing 0.1 M sodium sulfate and 0.05% sodiuin azide, at a flow
rate of 0.8 to
1.0 ml/min. Eluted protein is detected using UV absorbance at 280 mn. A
suitable reference
standard is run in the assay as a control, and the results are reported as the
area percent of the
product monomer peak compared to all other peaks excluding the included volume
peak
observed at approximately 12 to 14 minutes. Pealcs eluting earlier than the
monomer peak are
recorded as percent aggregate.
[0144] In certain embodiinents, the formulations of the inultidomain protein
exhibit
low to undetectable levels of aggregation as measured by HPSEC or rCGE, that
is, no more
than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1%,
or no
more than 0.5% aggregate by weight protein, and low to undetectable levels of
fragmentation,
that is, 80% or higher, 85% or higher, 90% or higher, 95% or higher, 98% or
higher, or 99%
or higher, or 99.5% or higher of the total peak area in the peak(s)
representing intact protein.
In the case of SDS-PAGE, the density or the radioactivity of each band stained
or labeled
with radioisotope can be measured and the % density or % radioactivity of the
band
representing non-degraded multidomain protein can be obtained.
[0145] The stability of the fonnulations can be also assessed by any assays
that
measure the biological activity of the multidomain protein in the formulation.
For example,
the biological activities of antibodies include, but are not limited to,
antigen-binding activity,
compleinent-activation activity, Fc-receptor binding activity, and so forth.
Antigen-binding
activity of the antibodies can be measured by any method known to those
skilled in the art,
including but not limited to ELISA, radioimmunoassay, Western blot, BlAcore,
and the like.
Complement-activation activity can be measured by a C3a/C4a assay in the
system where the
antibody which specifically binds to an antigen is reacted in the presence of
the complement
components with the cells expressing the antigen. Also see Harlow et al.,
Antibodies: A
Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988). An
ELISA based
assay, e.g., may be used to compare the ability of an antibody or fragment
thereof to
47
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
specifically bind to a target antigen to a suitable reference standard. In
this assay, plates are
coated with the target antigen and the binding signal of a set concentration
of a suitable
reference standard is compared to the binding signal of the saine
concentration of a test
antibody or antibody fragment.
[0146] The purity of the inultidomain protein formulations may be measured by
any
method well-lcnown to one of skill in the art such as, e.g., HPSEC. The
sterility of the
multidomain protein formulations may be assessed by methods well known in the
art. For
example, sterile soybean-casein digest inediuin and fluid thioglycollate
medium are
inoculated with a test protein formulation by filtering a liquid protein
formulation through a
sterile filter having a nominal porosity of 0.45 m. When using the
SterisureTM or SteritestTM
method, each filter device is aseptically filled with approximately 100 ml of
sterile soybean-
casein digest medium or fluid thioglycollate medium. When using the
conventional method,
the challenged filter is aseptically transferred to 100 ml of sterile soybean-
casein digest
medium or fluid tllioglycollate medium. The media are incubated at appropriate
temperatures
and observed three times over a 14 day period for evidence of bacterial or
fungal growth.
[0147] The methods described above can be used to generate antibody
therapeutics
targeting any infectious organisms, including but not limited to any viruses
and bacteria.
[0148] The methods described above can also be used to generate antibody
therapeutics targeting other antigens, including but not limited to 17-1A,
a4(37 integrin
receptor, AFP, CB L, CD 11, CD 11 a, CD 14, CD 147, CD 18, CD20, CD22, CD23,
CD25,
CD3, CD33, CD4, CD40, CD40L, CD44, CD52, CD64 (FcR), CD80, CEA, Complement
(C5), CTLA-4, EGF receptor, Ep-CAM, E-selectin, Factor VII, FcRI receptors,
Gamina
Interferon, GD2-ganglioside, gp IIIb/IIIa, gp72, HER-2, HLA-DR 10 beta, HLA-DR
antigen,
ICAM-3, IgE, IL-4, IL5, IL-5, IL-8, inhibitor of P38MAP kinase, inosine
monophosphate
dehydrogenase, ganglioside GD3, MUC-1, nuC242, PEM antigen, SK-1 antigen, TNF
alpha,
VEGF, VEGF-receptor, and VLA-4.
[0149] In certain specific embodiments, the methods described above can also
be
used to generate antibody therapeutics that specifically binds to an antigen
of RSV, an
antigen of human metapneumovirus (hMPV), integrin a,03, CD2, CD 19, EphA2,
EphA4, or
IL-9. Additional nonlimiting therapeutic targets are described in section 5.3
below.
48
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
5.2. Methods For Evaluating And/Or Improving The Shelf Life Of A Formulations
Comprising A Multidomain Protein
[0150] The invention also provides a method for evaluating the shelf-life of a
multidomain protein formulation. The methods of the invention involves
evaluating the
thermal denaturation and/or renaturation behavior of a inultidomain protein in
a liquid
preparation, which comprises a multidomain protein of interest having a domain
the
unfolding of which leads to aggregation of the inultidomain protein in the
liquid protein
preparation. In one embodiment, the denaturation/renaturation behavior of the
liquid protein
preparation is determined by measuring a thermal denaturation/renaturation
curve. The
method then provides an indicator for the shelf life of the preparation based
on the thermal
denaturation and/or renaturation curve. For example, if the domain does not
refold upon
cooling or denatures at a low temperature, the multidomain protein is likely
to have a short
shelf life.
[0151] The invention also provides a method of evaluating long term stability
of a
multidomain protein in a solution, wherein the long term stability is defined
as less than 5%,
less than 10%, or less than 20% aggregation upon storage for a predetermined
period of time
at a predetermined temperature. The method comprises (a) providing a solution
of a
multidomain protein; (b) denaturing one or more domains of the multidomain
protein by
heating the solution of the multidomain protein; (c) determining if the
domains refold upon
cooling; and (d) classifying the multidomain protein as having long term
stability in the
solution if the domains are determined to refold in step (c). It is
conteinplated that the
stability of a multidomain protein may be evaluated in a number of different
solutions thereby
identifying a particular solution useful for stabilizing a multidomain
protein. Alternatively,
or optionally, the method may be utilized to compare several different
inultidomain proteins
having a desired biological activity above a predetermined threshold level,
wherein each
multidomain protein is forinulated in a solution having identical coinponents
with the
exception of the multidomain protein.
[0152] It is contemplated that a multidomain protein may comprise a domain the
'unfolding of which causes aggregation of the multidomain protein.
Accordingly, the
invention also provides a method for identifying a domain in a multidomain
protein, which
domain is responsible for aggregation of the protein. In one embodiment, the
method of
identifying one or more domain in a multidomain protein, which is responsible
for
aggregation comprises (a) denaturing one or more domains of the multidomain
protein by
49
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
heating said solution; (b) determining if one or more of said domains refold
upon cooling;
and (c) identifying one or more domains that do not refold upon cooling in
step (b), thereby
identifying a domain or domains, the unfolding of which causes aggregation of
said
inultidomain protein in said solution.
[0153] The invention also provides a method of engineering a multidomain
protein to
have improved long term stability in a solution, wherein said long term
stability is defined as
less than 5%, less than 10%, or less than 20% aggregation upon storage for a
predeterinined
period of time at a predetermined teinperature. The method of engineering a
multidomain
protein to have improved long tenn stability in a solution comprises (a)
modifying a domain
of the multidomain protein by replacing one or more ainino acid residues in
the domain to
generated a modified domain; (b) denaturing the modified domain by heating a
solution of a
multidomain protein comprising the modified domain; (c) determining if said
modified
domain in the multidomain protein refolds upon cooling; and (d) classifying
the multidomain
protein containing the modified domain as having improved long term stability
if the
modified domain is determined to refold in step (c). In one embodiment, the
multidomain
protein is an antibody. It is contemplated that steps (a) to (d) may be
perfonned on an
isolated domain. For example, a Fab domain, the unfolding of which causes
aggregation of
an antibody, may be isolated, modified denatured, renatured and classified. In
one
embodiment, the identified domain having iinproved long term stability is used
in the
generation of a multidomain protein. In one embodiment, the multidomain
protein is an
antibody. In another embodiment, the domain is an antigen binding domain. In
yet another
embodiment, the domain is a constant region domain. In certain embodiinents,
the
multidomain protein comprises a domain the unfolding of which causes
aggregation of the
multidomain protein in the solution.
[0154] The invention further provides a method of screening for a multidomain
protein which has improved long term stability in a solution, wherein the long
term stability
is defined as less than 5%, less than 10%, or less than 20% aggregation upon
storage for a
predetermined period of time at a predetermined temperature. In certain
embodiments, a
multidomain protein comprises a domain the unfolding of which causes
aggregation of the
multidomain protein in a solution. In one embodiment, the method comprises (a)
denaturing
respectively two or more multidomain proteins that are members of a population
multidomain
proteins, wherein each multidomain proteins comprises a different modified
domain, the
modified domain having one or more ainino acid residues substituted, wherein
the denaturing
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
is accomplished by heating a solution of one of the inultidomain proteins
comprising the
modified domain; (b) determining if the different modified domains in each
multidomain
protein denatured in step (a) refolds upon cooling; and (c) identifying the
multidomain
proteins containing a modified domain that is detennined to refold in step (b)
as having
improved long term stability. In one embodiment, the method further comprises
generating
the population of different nlultidomain proteins. It is contemplated that
steps (a) to (c) may
be performed on isolated domains. For example, a Fab domain, the unfolding of
which
causes aggregation of an antibody, may be isolated and modified to generate a
population of
different modified domains two or more of which may then be screened by the
method. In
one embodiment, the identified domain having improved long term stability is
used in the
generation of a inultidomain protein. In a specific embodiment the multidomain
protein is an
antibody. In one einbodiment, the domain is an antigen binding domain (e.g., a
Fab domain).
In another embodiment, the domain is a constant region domain.
[0155] In certain einbodiments, the denaturation and renaturation (i.e.,
refolding upon
cooling) steps are carried out by generating a therinal
denaturation/renaturation curve, e.g.,
using differential scanning calorimetry. The magnitude of the change in a
physical property
associated with the thermal denaturation of the multidomain protein as a
result of heating is
measured over a range of temperatures to generate a therinal
denaturation/renaturation curve.
It is contemplated that the temperature range encompasses the desired storage
teinperature
range.
[0156] As used herein, a"thermal denaturation/renaturation cuive" is a plot of
a
change in a physical property associated with the denaturation or renaturation
of a protein as
a function of temperature. See, for example, Davidson et al., Nature Structure
Biology 2:859
(1995); Clegg, R. M. et al., Proc. Natl. Acad. Sci. U.S.A. 90:2994-2998
(1993). Any
physical property of the protein which changes during denaturation, e.g., the
emission of light
or heat, the absorption of light or heat, scattering of light, and dichroism,
may be used for
monitoring the structural change of the protein. Examples of such physical
properties include
fluorescent emission, fluorescent energy transfer, absorption of ultraviolet
or visible light,
changes in polarization of light, and light scattering. Fluorescence emission
can be intrinsic
to a protein or can be due to a fluorescence reporter molecule.
[0157] As used herein, "aggregation" refers to a physical interaction between
the
protein or polypeptide molecules that result in formation of multimers. The
multimers may
remain soluble, or precipitate out of solution.
51
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0158] The multidomain protein formulation can be a solution of the
inultidomain
protein of a suitable concentration, e.g., a concentration of 20, 30, 40, 50,
100 mg/ml or
higher. The liquid multidomain protein formulation can also comprise other
constituents,
including but are not limited to, salts, ligands, co-factors, etc. The
concentration and
constituents of the liquid multidomain protein formulation are selected such
that the thennal
denaturation/renaturation behavior of the multidomain protein in the liquid
inultidoinain
protein fonnulation reflects the long terin stability of the liquid
multidomain protein
formulation whose shelf life is to be evaluated. In one embodiment, the
concentration of the
inultidomain protein in the liquid inultidomain protein fonnulation being
analyzed differs
from the concentration of the multidomain protein in a liquid protein
formulation by no more
than 50%, 20%, 10%, 5% or 1%. In a specific embodiment, the concentration of
the
multidomain protein in the liquid multidoinain protein formulation being
analyzed is
substantially the same as the concentration of the multidomain protein in a
multidomain
protein fonnulation.
[0159] The multidomain protein can comprise other amino acid residues or
domains
in addition to the aggregation-causing domain.
[0160] The concentration of a multidomain protein in a liquid formulation is
at least
15 mg/ml, at least 20 mg/ml, at least 25 mg/ml, at least 30 mg/ml, at least 35
mghnl, at least
40 mg/ml, at least 45 mg/ml, at least 50 mg/ml, at least 55 mg/ml, at least 60
mg/ml, at least
65 mg/ml, at least 70 mg/ml, at least 75 ing/ml, at least 80 ing/ml, at least
85 mg/ml, at least
90 mg/ml, at least 95 mg/ml, at least 100 mg/ml, at least 105 mg/ml, at least
110 ing/ml, at
least 115 mg/ml, at least 120 mg/ml, at least 125 mg/ml, at least 130 mg/ml,
at least 135
mg/ml, at least 140 mg/ml, at least 150 mg/ml, at least 200 mg/ml, at least
250 mg/ml, or at
least 300 mg/ml.
[0161] The formulations may also comprise other substances, e.g., histidine,
glycine,
saccharides (e.g., sucrose, mannose, trehalose, etc.), polyols, (e.g., Tween)
and sugar alcohols
(e.g., mannitol, sorbitol, etc.). The concentration of histidine which is
included in the
formulations ranges from 1 mM to 100 mM, or from 5 mM to 50 mM. Histidine can
be in
the form of L-histidine, D-histidine, or a mixture thereof, but L-histidine is
generally
preferred. Histidine can be also in the form of hydrates. Histidine may be
used in a form of
pharmaceutically acceptable salt, such as hydrochloride (e.g.,
monohydrochloride and
dihydrochloride), hydrobromide, sulfate, acetate, etc. The purity of histidine
should be at
least 98%, preferably at least 99%, and most preferably at least 99.5%.
52
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0162] The concentration of an ainino acid to be used in a formulation can be
at a
concentration of less than 150 mM, less than 100 mM, less than 75 mM, less
than 50 mM,
less than 25 mM, less than 10 mM, less than 5.0 mM, or less than 2.0 mM. The
ainount of
amino acid in the formulation should not cause a significant buffering effect
so that protein
precipitation at its isoelectric point can be avoided. An amino acid may be
also used in a
form of pharmaceutically acceptable salt, such as hydrochloride, hydrobromide,
sulfate,
acetate, etc. The purity of the ainino acid should be at least 98%, or at
least 99%, or at least
99.5%.
[0163] The saccharide can be sucrose at a concentration ranging from between
about
1% to about 20%, preferably about 5% to about 15%, and more preferably about
8% to 10%.
The polyol can be polysorbate (e.g., Tween 20) at a concentration ranging from
between
about 0.001% to about 1%, or about 0.01% to about 0.1%.
[0164] The pH of the formulation should not be equal to the isoelectric point
of the
particular multidomain protein to be used in the formulation and may range
from about 5.0 to
about 8.0, or about 5.5 to about 6.5, or about 6.0 to about 7.0, or about 6.5
to about 7.5, or
about 7.0 to about 8.0, or about 5.8 to about 6.2, and or about 6Ø
[0165] Liquid fonnulations preferably exhibit stability at the temperature
ranges of
38oC-42oC for at least 15 days and, in some einbodiments, not more than 25
days, of 20oC-
24oC for at least 1 month, at least 2 months, at least 4 months, or at least 6
months, of 2oC-
8oC (in particular, at 4oC) for at least 6 months, at least 1 year, at least
1.5 years, at least 2
years, at least 3 years or at least 4 years and at -20oC for at least 1 year,
at least 2 years, at
least 3 years, at least 4 years, or at least 5 years, as assessed by high
performance size
exclusion chromatography (HPSEC). Namely, the formulations, more specifically
liquid
formulations, have low to undetectable levels of aggregation and/or
fragmentation, as defined
herein, after the storage for the defined periods as set forth above. In
certain embodiments,
no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more
than 1%,
and or no more than 0.5% of the multidomain protein forms an aggregate as
measured by
HPSEC, after the storage for the defined periods as set forth above.
[0166] In one embodiment, a suitable solution of a multidomain protein that
comprises a domain whose unfolding leads to aggregation of the multidomain
protein whose
shelf life is of interest is provided, wherein the solution stabilizes the
domain. In another
embodiment, a suitable solution of a multidomain protein comprising an
engineered domain
having improved long term stability is provided.
53
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0167] A lyophilized formulation preferably exhibits no significant changes
observed
at a refrigerated temperature (2-8 C) for at least 12 months, preferably 2
years, and more
preferably 3 years; or at room temperature (23-27 C) for at least 3 montlis,
preferably 6
months, and more preferably 1 year. The criteria for stability are as follows:
No more than
10%, or no more than 5%, of the protein domain is degraded as measured by
HPSEC. The
rehydrated solution is colorless, or clear to slightly opalescent by visual
analysis. The
concentration, pH and osmolality of the fonnulation have no more than +/- 10%
change.
Potency is within 70-130, preferably 80- 120 % of the control. No more than
10%,
preferably 5% of clipping is observed. No more than 10%, or no more than 5% of
aggregation is formed.
[0168] The methods of screening and/or evaluating the long term stability of a
inultidomain protein in a solution of the invention can provide an indicator
of the shelf life of
a plurality of formulations of different multidomain proteins, e.g., a
plurality of different
monoclonal antibodies. In one embodiment, a suitable solution of a multidomain
protein is
provided for each multidomain protein. Alternatively, the methods of screening
and/or
evaluating the long term stability of a multidomain protein in a solution of
the invention can
provide an indicator of the shelf life of a plurality of different solutions
comprising the saine
multidomain protein. In another embodiment, a multidomain protein is
formulated in a
number of different solutions. In certain embodiments, each multidomain
protein comprises
a domain whose unfolding leads to aggregation of the corresponding multidomain
protein. In
other embodiments, each multidomain protein comprises a variant of a domain
whose
unfolding leads to aggregation of the corresponding multidomain protein. A
thermal
denaturation curve is measured for each of such multidomain proteins. The
multidomain
proteins are then ranked based on the denaturation temperatures of the
multidomain proteins.
The lower denaturation temperature corresponds to lower stability, and thus is
indicative of a
shorter shelf life.
[0169] In one embodiment, the methods of screening and/or evaluating the long
term
stability of a multidomain protein in a solution is used as an indicator of
the shelf life of a
plurality of formulations of different modified multidomain proteins. Each of
the plurality of
modified multidomain proteins comprises a domain in a modified form, e.g.,
having one or
more amino acid residues in the domain substituted. A suitable solution of a
multidomain
protein comprising a modified domain is provided for each modified multidomain
protein. A
thermal denaturation curve is measured for each of such multidomain proteins.
The modified
54
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
multidomain proteins are then ranked based on the denaturation temperatures of
the
multidomain proteins. One or more modified monoclonal multidomain protein may
be
selected based on the rank order. In a specific embodiment, the multidomain
protein is an
antibody.
[0170] The methods of screening and/or evaluating the long term stability of a
multidomain protein in a solution can also be used for identifying biochemical
conditions that
optimize the stability of, and hence the shelf life of, a formulation of a
multidomain protein.
For example, pH affects the shelf life of a protein. For a liquid formulation
the composition
of the solvent, e.g., water, also affect the shelf life of a protein. For
exainple, glycerol alters
the solvation properties of water to favor the native conformation of
proteins. Ligands and
cofactors in the solution may also affect the shelf life of a protein. Other
biochemical
parameters that have been shown to affect protein folding are: protein
concentration,
temperature, glutatllione redox buffers (GSH, GSSG), the presence of
detergents, and the
presence of other additives, such as glycerol, arginine-HCI, polyethylene
glycol (PEG), and
organic solvents. Various conditions can be optimized, including pH optimum,
ionic strength
dependence, concentration of salts of the Hofineister series, glycerol
concentration, sucrose
concentration, arginine concentration, dithiothreitol concentration, metal ion
concentration,
etc. Such biological conditions can be evaluated based on the thermal
denaturation curve of
the multidomain protein under the conditions. In one embodiment, a plurality
of different
conditions are ranked, and the optimal one is selected.
[0171] In one einbodiment, the thermal denaturation/renaturation curve is
obtained
using differential scanning calorimetry (DSC). In this embodiment, a DSC
thermogram of
the denaturation/renaturation of the multidomain protein is obtained. Methods
of using DSC
to study the denaturation of proteins are well known in the art (see, e.g.,
Vermeer et al., 2000,
Biophys. J. 78:394-404; Vermeer et al., 2000, Biophys. J. 79: 2150-2154). DSC
can detect
fine-tuning of interactions between the individual domains of a protein
(Privalov et al., 1986,
Methods Enzymol. 131:4-51).
[0172] In one embodiment, DSC measurements are performed using a Setaram
Micro-DSC III (Setaram, Caluire, France). The samples are placed in the
calorimeter in a 1
ml sample cell against a 1 ml reference cell containing the appropriate blank
solution. The
cells are stabilized for 4 h at 25 C inside the calorimeter before heating up
to the final
temperature at a selected heating rate. The transition temperature and
enthalpy are
determined using the Setaram software (Setaram, Version 1.3).
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0173] In another embodiment, DSC measurements are performed using a VP-DSC
(MicroCal, LLC). In one einbodiment, a scan rate of 1.0 C/min and a
teinperature range of
25 -120 C are einployed. A filter period of 8 seconds is used along with a 5
minute pre-scan
thermostating. Multiple baselines are run with buffer in both the sample and
reference cell to
establish thermal equilibriuin. After the baseline is subtracted from the
sample thermogram,
the data are concentration normalized and fitted using the deconvolution
function. Melting
temperatures are determined following manufacturer procedures using Origin
software
supplied with the system.
[0174] In another einbodiment, the thermal denaturation/renaturation curve is
obtained using circular dichroism (CD) spectroscopy. Changes in the secondary
structure of
IgG as a function of temperature and/or, e.g., pH, can be studied by CD
spectroscopy
(Fasman, 1996, Circular Dichroism and the Confonnational Analysis of
Biomolecules.
Plenum Press, New York). The advantage of this technique are that the
spectroscopic signal
is not affected by the presence of the surrounding solution and that well-
defined procedures
are available to elucidate the secondary structure based on reference spectra
of the different
structure eleinents (de Jongh et al., 1994, Biochemistry. 33:14521-14528). The
fractions of
the secondary structural elements can be obtained from the CD spectra.
[0175] In one embodiment, the CD spectra are measured with a JASCO
spectropolarimeter, model J-715 (JASCO International Co., Tokyo, Japan). A
quartz cuvette
of 0.1 cm light path length is used. Temperature regulation is carried out
using a JASCO
PTC-348WI (JASCO International) thermocouple. Temperature scans are recorded
at a
selected heating rate using the Peltier thermocouple with a resolution of 0.2
C and a time
constant of 16 s. Wavelength scans, in the far-UV region (0.2 nm resolution)
are obtained by
accuinulation of a plurality of scans with a suitable scan rate
[0176] The thermal denaturation/renaturation curve can also be measured by
light
spectrophotometry. When a protein in a solution denatures in response to
heating, the
molecules aggregate and the solution scatters light more strongly. Aggregation
leads to
changes in the optical transparency of the sainple, and can be measured by
monitoring the
change in absorbance of visible or ultraviolet light of a defined wavelength.
[0177] In still another embodiment, fluorescence spectroscopy is used to
obtain the
thermal denaturation/renaturation curve. In one embodiment, intrinsic protein
fluorescence,
e.g., intrinsic tryptophan fluorescence, is monitored. In another embodiment,
fluorescence
probe molecules are monitored. Methods of perfortning fluorescence
spectroscopy
56
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
experiments are well known to those skilled in the art. See, for example,
Bashford, C. L. et
al., Spectrophotometry and Spectrofluorometry: A Practical Approach, pp. 91-
114, IRL Press
Ltd. (1987); Bell, J. E., Spectroscopy in Biocheinistry, Vol. I, pp. 155-194,
CRC Press
(1981); Brand, L. et al., Ann. Rev. Biochem. 41:843 (1972).
[0178] The methods of the invention can be practiced using an array fonnat, in
which
a plurality of different liquid multidomain protein preparations is evaluated
siinultaneously
(see, U.S. Patent No. 6,232,085). The array format is particular useful for
evaluating the
potential shelf life of a plurality of formulations of different multidomain
proteins, e.g., a
plurality of modified monoclonal antibodies, or the shelf life of a
inultidoinain protein under
a plurality of different biochemical conditions.
5.3. Multidomain Proteins
[0179] In one embodiment the methods of the present invention are useful for
the
generation of inultidomain proteins with improved manufacturing
characteristics (referred to
herein as "multidomain proteins of the invention") that specifically bind to a
target molecule.
Such multidomain proteins include but are not limited to antibodies including
antibody
domain fusion proteins. In one embodiment, a multidomain protein of the
invention
specifically binds a nonpolypeptide target. In another embodiment, a
multidomain protein of
the invention specifically binds a polypeptide target. In another embodiment,
administration
of a multidomain protein of the invention to a mammal suffering from a disease
or disorder
can result in a therapeutic benefit in that mammal.
[0180] Antibody domain fusion proteins include Fc fusion proteins, which
combines
an Fc domain or fragment thereof, with a fusion partner, which in general can
be any protein,
polypeptide, peptide, including, but not limited to, the target-binding region
of a receptor, an
adhesion molecule, a ligand, an enzyme, or some other protein or protein
domain. Antibody
domain fusion proteins also include antigen binding domain fusion proteins,
which combines
an antigen binding domain or fragment thereof, with a fusion partner, which in
general can be
any protein, polypeptide, peptide, including, but not limited to, another
antigen binding
domain, the target-binding region of a receptor, an adhesion molecule, a
ligand, an enzyine, a
toxin or some other protein or protein domain. It will be understood that the
role of the
fusion partner is determined by the therapeutic goal. For example the role of
the non-Fc part
of an Fc fusion is generally to mediate target binding, and thus it is
functionally analogous to
the variable regions of an antibody while the role of the fusion partner of an
antigen binding
57
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
domain fusion protein may be to mediate binding to a second target in the case
of a second
antigen binding domain or to provide a cytotoxic agent in the case of a toxin.
[0181] Virtually any molecule may be targeted by and/or incorporated into a
inultidomain protein of the invention including, but not limited to, following
list of proteins,
subunits, domains, motifs, and epitopes belonging to the following list of
cellular proteins:
renin; a growth hormone, including human growth horinone and bovine growth
hormone;
growth hormone releasing factor; parathyroid honnone; thyroid stimulating
hormone;
lipoproteins; alpha- 1 - antitrypsin; insulin A-chain; insulin B-chain;
proinsulin; follicle
stimulating hormone; calcitonin; luteinizing horinone; glucagon; clotting
factors such as
factor VII, factor VIIIC, factor IX, tissue factor (TF), and von Willebrands
factor; anti-
clotting factors such as Protein C; atrial natriuretic factor; lung
surfactant; a plasminogen
activator, such as urokinase or huinan urine or tissue-type plasminogen
activator (t-PA);
bombesin; thrombin; hemopoietic growth factor; tumor necrosis factor (TNF)
proteins such
as TNF-alpha, TNF-beta, TNFbeta2, TNFc, TNFalphabeta, 4-1BBL as well as
members of
the TNF superfamily members such as, TNF-like wealc inducer of apoptosis
(TWEAK'), and
LIGHT, B lymphocyte stimulator (B1yS); members of the TNF receptor superfamily
including TNF-RI, TNF-RII, TRAIL receptor-1, Transmembrane activator and CAML
interactor (TACI) and OX40L; Fas ligand (FasL); enkephalinase; RANTES
(regulated on
activation normally T-cell expressed and secreted); human macrophage
inflammatory protein
(MIP-1-alpha); a serum albumin such as human serum albumin; Muellerian-
inhibiting
substance; relaxin A-chain; relaxin B-chain; prorelaxin; mouse gonadotropin-
associated
peptide; a microbial protein, such as beta-lactamase; DNase; IgE; a cytotoxic
T-lymphocyte
associated antigen (CTLA), such as CTLA-4; inhibin; activin; vascular
endothelial growth
factor (VEGF); receptors for hormones or growth factors such as, for exainple,
EGFR (ErbB-
1), VGFR; interferons such as alpha interferon (a-IFN), beta interferon ((3-
IFN) and gamma
interferon (y-IFN); interferon alpha receptor (IFNAR) subunits 1 and/or 2 and
other receptors
such as, Al, Adenosine Receptor, Lymphotoxin Beta Receptor, BAFF-R, endothelin
receptor; protein A or D; rheumatoid factors; a neurotrophic factor such as
bone-derived
neurotrophic factor (BDNF), neurotrophin-3,-4,-5, or -6 (NT-3, NT-4, NT-5, or
NT-6), or a
nerve growth factor; platelet-derived growth factor (PDGF); fibroblast growth
factor such as
aFGF and (3FGF; epidermal growth factor (EGF); transforming growth factor
(TGF) such as
TGF-alpha and TGF-beta, including TGF-1, TGF-2, TGF-3, TGF-4, or TGF-5;
insulin-like
growth factor-I and-11(IGF-I and IGF-II); des (1-3)-IGF-I (brain IGF-I),
insulin-like growth
58
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
factor binding proteins, keratinocyte growth factor; growth factor receptors
such as, FGFR-3,
IGFR; CD proteins such as CD2, CD3, CD3E, CD4, CD 8, CD11, CD11a, CD14, CD16,
CD18, CD19, CD20, CD22, CD23, CD25, CD27, CD27L, CD28, CD29, CD30, CD30L,
CD32, CD33 (p67 protein), CD34, CD38, CD40, CD40L, CD52, CD54, CD56, CD63,
CD64, CD80 and CD147; erytliropoietin; osteoinductive factors; iinmunotoxins;
a bone
morphogenetic protein (BMP); an interferon such as interferon-alpha,-beta, and-
gamma;
colony stimulating factors (CSFs), such as M-CSF, GM-CSF, and G-CSF;
interleukins (ILs),
e.g., IL-1 to IL-13 and IL-15, IL-18, IL-23; EPO; superoxide disinutase; T-
cell receptors
alpha/beta; surface membrane proteins; decay accelerating factor; transport
proteins; hoining
receptors; addressins; regulatory proteins; chemokine family meinbers such as
the eotaxins,
the MIPs, MCP-1, RANTES; cell adhesion molecules such as selectins (L-
selectin, P-
selectin, E-selectin) LFA-1, LFA-3, Mac 1, p150.95, VLA-1, VLA-4, ICAM-l, ICAM-
3,
EpCAM and VCAM, a4/p7 integrin, and Xv/p3 integrin, integrin alpha subunits
such as
CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, alpha7, alpha8, alpha9, alphaD,
CD11a,
CDl lb, CD51, CDl ic, CD41, alphallb, alphalELb; integrin beta subunits such
as, CD29,
CD 18, CD61, CD104, beta5, beta6, beta7 and beta8; Integrin subunit
combinations including
but not limited to, aV(33, aV05 and a4(37; cellular ligands such as, TNF-
related apoptosis-
inducing ligand (TRAIL), A proliferation-inducing ligand (APRIL), B Cell
Activating Factor
(BAFF), a member of an apoptosis pathway; IgE; blood group antigens; flk2/flt3
receptor;
obesity (OB) receptor; mpl receptor; CTLA-4; protein C; an Eph receptor such
as EphA2,
EphA4, EphB2, etc.; immune system markers, receptors and ligands such as CTLA-
4, T cell
receptor, B7-1, B7-2, IgE, Human Leukocyte Antigen (HLA) such as HLA-DR, CBL;
complement proteins such as coinplement receptor CR1, C1Rq and other
complement factors
such as C3, and C5; blood factors including tissue factor, factor VII; a
glycoprotein receptor
such as Gplba, GPIIb/IIIa and CD200; and fragments of any of the above-listed
polypeptides.
[0182] Also contemplated are multidomain proteins of the invention that
specifically
bind cancer antigens including, but not limited to, ALK receptor (pleiotrophin
receptor),
pleiotrophin; KS 1/4 pan-carcinoma antigen; ovarian carcinoma antigen (CA125);
prostatic
acid phosphate; prostate specific antigen (PSA); melanoma-associated antigen
p97;
melanoma antigen gp75; high molecular weight melanoma antigen (HMW-MAA);
prostate
specific meinbrane antigen; carcinoembryonic antigen (CEA); carcinoembryonic
antigen-
related cell adhesion molecule (CEACAMI); cytokeratin tumor-associated
antigen; human
milk fat globule (HMFG) antigen; tumor-associated antigen expressing Lewis Y
related
59
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
carbohydrate; colorectal tumor-associated antigens such as: CEA, tuinor-
associated
glycoprotein-72 (TAG-72), C017-1A, GICA 19-9, CTA-1 and LEA; Burkitt's
lymphoma
antigen-38.13; CD19; huinan B-lyinphoma antigen-CD20; CD33; melanoma specific
antigens such as ganglioside GD2, ganglioside GD3, ganglioside GM2 and
ganglioside GM3;
tuinor-specific transplantation type cell-surface antigen (TSTA); virally-
induced tumor
antigens including T-antigen, DNA tumor viruses and Envelope antigens of RNA
tumor
viruses; oncofetal antigen-alpha-fetoprotein sucli as CEA of colon, 5T4
oncofetal trophoblast
glycoprotein and bladder tumor oncofetal antigen; differentiation antigen such
as huinan lung
carcinoma antigens L6 and L20; antigens of fibrosarcoma; human leulceinia T
cell antigen-
Gp37; neoglycoprotein; sphingolipids; breast cancer antigens such as EGFR
(Epidermal
growth factor receptor); NY-BR-16; NY-BR-16 and HER2 antigen (p185HER2);
Her2/neu
(ErbB-2), Her3 (ErbB-3), Her4 (ErbB-4), polymorphic epithelial mucin (PEM)
antigen;
epithelial membrane antigen (EMA); Melanoma-associated antigen MUC18; MUC 1;
malignant human lymphocyte antigen-APO-1; differentiation antigen such as I
antigen found
in fetal erythrocytes; primary endoderm I antigen found in adult erythrocytes;
preimplantation embryos; I(Ma) found in gastric adenocarcinomas; M18, M39
found in
breast epithelium; SSEA-1 found in myeloid cells; VEP8; VEP9; Myl; VIM-D5;
D156-22
found in colorectal cancer; TRA-1-85 (blood group H); SCP-1 found in testis
and ovarian
cancer; C14 found in colonic adenocarcinoma; F3 found in lung adenocarcinoma;
AH6 found
in gastric cancer; Y hapten; Ley found in embryonal carcinoma cells; TL5
(blood group A);
EGF receptor found in A431 cells; El series (blood group B) found in
pancreatic cancer;
FC10.2 found in embryonal carcinoma cells; gastric adenocarcinoma antigen; CO-
514 (blood
group Lea) found in Adenocarcinoma; NS-10 found in adenocarcinomas; CO-43
(blood
group Leb); G49 found in EGF receptor of A431 cells; MH2 (blood group
ALeb/Ley) found
in colonic adenocarcinoma; 19.9 found in colon cancer; gastric cancer mucins;
T5A7 found
in myeloid cells; R24 found in melanoma; 4.2, GD3, D1.1, OFA- 1, GM2, OFA-2,
GD2, and
Ml:22:25:8 found in einbryonal carcinoma cells and SSEA-3 and SSEA-4 found in
4 to 8-
cell stage embryos; Cutaneous Tcell Lymphoma antigen; MART-1 antigen; Sialy Tn
(STn)
antigen; Anaplastic lymphoma kinase (ALK) found in large cell lymphoma; Colon
cancer
antigen NY-CO-45; Lung cancer antigen NY-LU-12 variant A; Adenocarcinoma
antigen
ARTl; Paraneoplastic associated brain-testis-cancer antigen (onconeuronal
antigen MA2;
paraneoplastic neuronal antigen); Neuro-oncological ventral antigen 2 (NOVA2);
Hepatocellular carcinoma antigen gene 520; TUMOR-ASSOCIATED ANTIGEN CO-029;
Tumor-associated antigens MAGE-C 1(cancer/testis antigen CT7), MAGE-B 1(MAGE-
XP
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
antigen), MAGE-B2 (DAM6), MAGE-2, MAGE-4a, MAGE-4b and MAGE-X2; Cancer-
Testis Antigen (NY-EOS-1); placental alkaline phosphatase (PLAP) and
testicular PLAP-like
alkaline phosphatase, transferrin receptor; Heparanase I; EphA2 associated
with numerous
cancers and fraginents of any of the above-listed polypeptides.
[0183] Other exeinplary polypeptide targets include but not limited to the
following
list of proteins, subunits, domains, motifs, and epitopes belonging to the
following list of
microbial proteins: human cytomegalovirus (HCMV) proteins such as, envelope
glycoprotein, gB, internal matrix proteins of the virus, pp65 and pp 150,
immediate early (IE)
proteins; human immunodeficiency virus (HIV) proteins such as, Gag, Pol, Vif
and Nef
(Vogt et al., 1995, Vaccine 13: 202-208); HIV antigens gp120 and gp160 (Achour
et al.,
1995, Cell. Mol. Biol. 41: 395-400; Hone et al., 1994, Dev. Biol. Stand. 82:
159-162); gp4l
epitope of human immunodeficiency virus (Eckhart et al., 1996, J. Gen. Virol.
77: 2001-
2008); hepatitis C virus (HCV) proteins such as, nucleocapsid protein in a
secreted or a
nonsecreted form, core protein (pC); El (pEl), E2 (pE2) (Saito et al., 1997,
Gastroenterology
112: 1321-1330), NS3, NS4a, NS4b and NS5 (Chen et al., 1992, Virology 188:102-
113);
severe acute respiratory syndrome (SARS) corona virus proteins include but are
not limited
to, the S (spike) glycoprotein, small envelope protein E(the E protein), the
membrane
glycoprotein M (the M protein), the hemagglutinin esterase protein (the HE
protein), and the
nucleocapsid protein (the N-protein) See, e.g., Marra et al., "The Genome
Sequence of the
SARS-Associated Coronavirus," Science Express, May 2003); Mycobacterium
tuberculosis
proteins such as the 30-35 kDa (a.k. a. antigen 85, alpha-antigen) that is
normally a
lipoglycoprotein on the cell surface, a 65-kDa heat shock protein, and a 36-
kDa proline-rich
antigen (Tascon et al. (1996) Nat. Med. 2: 888-92), Ag85A, Ag85b (Huygen et
al., 1996, Nat.
Med. 2: 893-898), 65-kDa heat shock protein, hsp65 (Tascon et al., 1996, Nat.
Med. 2: 888-
892), MPB/MPT51 (Miki et al., 2004, Infect. Immun. 72:2014-21), MTSP 11, MTSP
17 (Lim
et al., 2004, FEMS Microbiol. Lett. 232:51-9 and supra); Herpes simplex virus
(HSV)
proteins such as gD glycoprotein, gB glycoprotein; proteins from intracellular
parasites such
as Leishmania include LPG, gp63 (Xu and Liew, 1994, Vaccine 12: 1534- 1536; Xu
and
Liew, 1995, Immunology 84: 173-176), P-2 (Nylen et al., 2004, Scand. J.
Immunol. 59:294-
304), P-4 (Kar et al. 2000, J Biol. Chem. 275:37789-97), LACK (Kelly et al.,
2003, J Exp.
Med. 198:1689-98); microbial toxin proteins such as Clostridium perfringens
toxin; in
addition, exemplary antigen peptides of human respiratory syncytial virus
(hRSV), human
61
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
metapneumovirus (HMPV) and Parainfluenza virus (PIV) are detailed in: Young et
al., in
Patent publication W004010935A2.
[0184] One skilled in the art will appreciate that the aforementioned lists of
targets
refers not only to specific proteins and biomolecules, but the biochemical
pathway or
pathways that comprise them. For exainple, reference to CTLA-4 as a target
antigen implies
that the ligands and receptors that make up the T cell co-stiinulatory
pathway, including
CTLA-4, B7-1, B7-2, CD28, and any other undiscovered ligands or receptors that
bind these
proteins, are also targets. Thus target, as used herein, refers not only to a
specific
biomolecule, but the set of proteins that interact with the target and the
ineinbers of the
biochemical pathway to which the target belongs. One skilled in the art will
further
appreciate that any of the aforementioned target antigens, the ligands or
receptors that bind
thein, or other members of their corresponding biochemical pathway, may be
operably linked
to the multidomain proteins or a portion thereof of the present invention in
order to generate a
fusion protein. Thus for example, a multidomain fusion that targets EGFR could
be
constructed by operably linking a multidomain protein or portion thereof to
EGF, TGFa, or
any other ligand, discovered or undiscovered, that binds EGFR. Accordingly, a
multidomain
protein or portion thereof of the present invention could be operably linked
to EGFR in order
to generate an fusion that binds EGF, TGFa, or any other ligand, discovered or
undiscovered,
that binds EGFR. Thus virtually any polypeptide, whether a ligand, receptor,
or some other
protein or protein domain, including but not limited to the aforementioned
targets and the
proteins that compose their corresponding biochemical pathways, may be
operably linked to
the multidomain proteins of the present invention or a portion thereof to
develop a fusion.
[0185] In one embodiment the multidomain protein of the invention is an
antibody or
an antibody domain fusion protein. Numerous methods useful for the generation
of
antibodies or antibody domain fusion proteins are well known in the art.
Several nonlimiting
examples are described below in section 5.4. In a specific embodiment the
methods of the
present invention are utilized to generate and/or screen antibody or antibody
domain fusion
proteins which have preferred/improved manufacturing characteristics.
[0186] A number of specific multidomain proteins, namely antibodies and
antibody
domain fusion proteins (e.g., Fc fusions) that are approved for use, in
clinical trials, or in
development may benefit from the methods of the present invention. Said
antibodies and
antibody domain fusion proteins (e.g., Fc fusions) are herein referred to as
"clinical products
and candidates". Thus in specific embodiments, the methods of the present
invention may
62
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
find use in a range of clinical products and candidates. For exainple the
engineering and
screening methods of the present invention may find use developing an antibody
with
improved manufacturing characteristics that has binding and functional
characteristics
substantially similar to rituximab (Rituxan , IDEC/Genentech/Roche) (see for
exainple U.S.
Pat. No. 5,736,137), a chimeric anti-CD20 IgGI antibody approved to treat Non-
Hodgkin's
lymphoma; HuMax-CD20 (Genmab), an anti-CD20 (see for exainple PCT WO
04/035607);
an anti-CD20 antibody described in U.S. Pat. No. 5,500,362; AME-133 (Applied
Molecular
Evolution) humanized and optimized anti-CD20 Mab; hA20 (Iminunoinedics, Inc.)
a
huinanized anti-CD20 Mab; HumaLYMTM (Intracel) a fully human anti-CD20 Mab;
trastuzumab (Herceptin , Genentech) a humaiiized anti-Her2/neu antibody
approved to treat
breast cancer (see for example U.S. Pat. No. 5,677,171); pertuzumab (rhuMab-
2C4,
OmnitargTM, Genentech); an anti-Her2 antibody described in U.S. Pat. No.
4,753,894;
cetuximab (Erbitux(D, Imclone) (U.S. Pat. No. 4,943,533; PCT WO 96/40210), a
chimeric
anti-EGFR antibody in clinical trials for a variety of cancers; ABX-EGF
(Abgenix/Immunex/Amgen) described in U.S. Pat. No. 6,235,883; HuMax-EGFr
(Genmab)
described in U.S. patent application No. 10/172,317; 425, EMD55900, EMD62000,
and
EMD72000 (Merck KGaA) (U.S. Pat. No. 5,558,864); ICR62 (Institute of Cancer
Research)
(PCT WO 95/20045); TheraCIM hR3 (YM Biosciences, Canada and Centro de
Immunologia
Molecular, Cuba) (U.S. Pat. Nos. 5,891,996; 6,506,883); mAb-806 (Ludwig
Institute for
Cancer Research, Memorial Sloan-Kettering) (Jungbluth et al. 2003, Proc Natl
Acad Sci
USA. 100(2):639-44); KSB-102 (KS Biomedix); MR1-1 (IVAX, National Cancer
Institute)
(PCT WO 01/62931); and SC100 (Scancell) (PCT WO 01/88138); alemtuzuinab
(Campath ,
Genzyme), a huinanized monoclonal anti CD52 IgGl antibody currently approved
for
treatment of B-cell chronic lymphocytic leukemia; muromonab-CD3 (Orthoclone
OKT3 ,
Ortho Biotech/Johnson & Johnson), an anti-CD3 antibody; OrthoClone OKT4A
(Ortho
Biotech), a humanized anti-CD4 IgG antibody; ibritumomab tiuxetan (Zevalin0,
IDEC/Schering AG), a radiolabeled anti-CD20 antibody; gemtuzuinab ozogamicin
(Mylotarg , Celltech/Wyeth), an anti-CD33 (p67 protein) antibody; alefacept
(Amevive ,
Biogen), an anti-LFA-3 Fc fusion; abciximab (ReoPro RO, Centocor/Lilly), a
anti-glycoprotein
IIb/IIIa receptor on the platelets for the prevention of clot formation;
basiliximab (Simulect ,
Novartis) an anti-CD25 antibody; infliximab (Remicade , Centocor), an anti-
TNFalpha
antibody; adalimumab (Humira , Abbott), an anti-TNFalpha antibody; HumicadeTM
(Ce1lTech), an anti-TNFalpha antibody; etanercept (Enbrel , Immunex/Amgen), an
anti-
TNFalpha Fc fusion; ABX-CBL (Abgenix), an anti-CD147 antibody; ABX-IL8
(Abgenix),
63
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
an anti-lL8 antibody; ABX-MA1 (Abgenix), an anti-MUC18 antibody; Pemtumomab
(R1549, 90Y-muHMFGl, Antisoma), an anti-MUCl antibody; Therex (R1550,
Antisoma),
an anti-MUC1 antibody; AngioMab (AS1405, Antisoina), HuBC-1 and Thioplatin
(AS1407)
being developed by Antisoma; natalizumab (AntegrenO, Biogen), an anti-alpha-4-
beta-1
(VLA-4) and alpha-4-beta-7 antibody; ANTOVATM (Biogen). a humanized anti-CD40L
IgG
antibody; VLA-1 mAb (Biogen), an anti-VLA-1 integrin antibody; LTBR mAb
(Biogen), an
anti-lyinphotoxin beta receptor (LTBR) antibody; CAT-152 (Cambridge Antibody
Technology), an anti-TGF02 antibody; J695 (Cambridge Antibody
Technology/Abbott), an
anti-IL-12 antibody; CAT-192 (Cainbridge Antibody Technology/Genzyme); an anti-
TGF(31
antibody; CAT-213 (Cambridge Antibody Technology), an anti-Eotaxinl antibody;
LyinphoStat-BTM an anti-Blys antibody and TRAIL-R1mAb, an anti-TRAIL-Rl
antibody
both being developed by Cainbridge Antibody Technology and Human Genome
Sciences,
Inc.; bevacizumab (AvastinTM, rhuMAb-VEGF, Genentech) an anti-VEGF antibody;
an anti-
HER receptor fainily antibody (Genentech); Anti-Tissue Factor antibody
(Genentech);
Omalizumab (XolairTM, Genentech) an anti-IgE antibody; Efalizumab (RaptivaTM,
Genentech/Xoma), an anti-CD 11 a antibody; MLN-02 Antibody (formerly LDP-02,
Genentech /Millenium Pharmaceuticals), a humanized anti-a4(37 antibody; HuMax
CD4
(Genmab), an anti-CD4 antibody being; HuMax-IL 15 (Genmab and Aingen), an anti-
IL15
antibody; HuMax-Inflam (Genmab/Medarex),; HuMax-Cancer (Genmab/Medarex/Oxford
GcoSciences), an anti-Heparanase I antibody; HuMax-Lymphoma (Genmab/Amgen);
HuMax-TAC (Genmab); IDEC-131 (IDEC Pharmaceuticals), an anti-CD40L antibody;
Clenoliximab (IDEC-151, IDEC Pharmaceuticals), an anti-CD4 antibody; IDEC-114
(IDEC
Pharmaceuticals), an anti-CD80 antibody; IDEC-152 (IDEC Pharmaceuticals), an
anti-CD23;
anti-macrophage migration factor (MIF) antibodies being developed by IDEC
Pharmaceuticals; BEC2 (Imclone), an anti-idiotypic antibody; IMC-1C11
(Imclone), an anti-
KDR antibody; DC101 (Imclone), an anti-flk-1 antibody; anti-VE cadherin
antibodies being
developed by Imclone; labetuzumab (CEA-CideTM, Immunomedics), an anti-
carcinoembiyonic antigen (CEA) antibody; Epratuzumab (LymphoCideTM,
Immunomedics),
an anti-CD22 antibody; AFP-Cide (Immunomedics); MyelomaCide (Immunomedics);
LkoCide (Iminunomedics); ProstaCide (Immunomedics); MDX-010 (Medarex), an anti-
CTLA4 antibody; MDX-060 (Medarex), an anti-CD30 antibody; MDX-070 (Medarex);
MDX-018 (Medarex); MDX-CD4 (Medarex/Eisai/Gemnab), a human anti-CD4 IgG
antibody; OsidemTM (IDM-1, Medarex/Immuno-Designed Molecules), an anti-Her2
antibody; HuMaxTM-CD4 (Medarex/Genmab), an anti-CD4 antibody; HuMax-IL15
64
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
(Medarex/Genmab); CNTO 148 (Medarex/Centocor/J&J), an anti-TNFa antibody; CNTO
1275 (Centocor/J&J), an anti-cytokine antibody; CNTO 95 (Centocor/J&J), a
human Integrin
av antibody (PCT publication WO 02/12501); MOR101 and MOR102 (MorphoSys), anti-
intercellular adhesion molecule-1 (ICAM-1) (CD54) antibodies; MOR201
(MorphoSys), an
anti-fibroblast growth factor receptor 3 (FGFR-3) antibody; visilizumab
(Nuvion , Protein
Design Labs), an anti-CD3 antibody; HuZAFTM (Protein Design Labs), an anti-
gamma
interferon antibody; Anti-a5(31 Integrin (Protein Design Labs); anti-IL-12
(Protein Design
Labs); ING-1 (Xoma), an anti-Ep-CAM antibody; MLN01 (Xoma), an anti-Beta2
integrin
antibody; ZENAPAX (daclizuinab, Roche Pharmaceuticals) an iinmunosuppressive,
humanized anti-CD25 monoclonal antibody for the prevention of acute renal
allograft
rejection; CDP860 (Celltech, UK), a humanized, PEGylated anti-CD18 F(ab')2;
PR0542
(Progenics/Genzyme Transgenics), an anti-HIV gp120 antibody fused with CD4;
C14 (ICOS
Pharm), an anti-CD 14 antibody; OVAREXTM (Altarex), a murine anti-CA 125
antibody;
PANOREXTM (Glaxo Wellcome/Centocor), a murine anti-17-IA cell surface antigen
IgG2a
antibody; VITAXINTM (MedImmune, PCT publication No. WO 2003/075957), a
humanized
anti-aVj33 integrin antibody; siplizuinab (MEDI-507, Medlmmune, WO 99/03502),
a
humanized form of the murine monoclonal anti-CD2 antibody, BTI-322;
palivizuinab
(SynagisOO, Medlmmune), a humanized neutralizing anti-RSV antibody; MEDI-524
(Numax,
MedImmune), an affinity optimized humanized anti RSV antibody; Zamyl (Smart
M195,
Protein Design Lab/Kanebo), a humanized anti-CD33 IgG antibody; Remitogen
(Smart
1D10, Protein Design Lab/Kanebo) which is a humanized anti-HLA antibody;
ONCOLYMTM (Lym-1, Techniclone) is a radiolabelled murine anti-HLA DR antibody;
Efalizuinab (GeneteclVXoma), a humanized monoclonal anti-CD11a antibody; ICM3
(ICOS
Pharm), a humanized anti-ICAM3 antibody; IDEC-114 (IDEC Pharm/Mitsubishi), a
primatized anti-CD80 antibody; eculizumab (5G1.1, Alexion Pharm) A humanized
anti-
complement factor 5(C5) antibody; pexelizumab (5G1.1-SC, Alexion Pharm) a
fully
humanized single chain monoclonal antibody; LDP-01 (Millennium/Xoma), a
humanized
anti-(32-integrin IgG antibody. In specific embodiments, the multidomain
proteins of the
invention are not Numax"~' or an antigen-binding fragment thereof (e.g., a Fab
fragment of
Numax ).
5.4. Generation Of Antibodies
[0187] In one embodiment, the multidomain proteins of the invention are
antibodies
that specifically bind to a target molecule. Nonlimiting examples of target
molecules are
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
described above (see section 5.3). Antibodies that specifically bind any
target (also referred
to herein as "antigen") can be produced by any method known in the art for the
synthesis of
antibodies, in particular, by chemical synthesis or preferably, by recombinant
expression
techniques.
[0188] Polyclonal antibodies specific for an antigen can be produced by
various
procedures well-lcnown in the art. For example, a human antigen can be
administered to
various host animals including, but not limited to, rabbits, mice, rats, etc.
to induce the
production of sera containing polyclonal antibodies specific for the huinan
antigen. Various
adjuvants may be used to increase the immunological response, depending on the
host
species, and include but are not limited to, Freund's (complete and
incoinplete), mineral gels
such as aluminum hydroxide, surface active substances such as lysolecithin,
pluronic polyols,
polyanions, peptides, oil emulsions, keyhole limpet hemocyanins,
dinitrophenol, and
potentially useful lluman adjuvants such as BCG (bacille Calmette-Guerin) and
corynebacterium parvum. Such adjuvants are also well known in the art.
[0189] Monoclonal antibodies can be prepared using a wide variety of
techniques
known in the art including the use of hybridoina, recombinant, and phage
display
technologies, or a combination thereof. For example, monoclonal antibodies can
be produced
using hybridoma techniques including those known in the art and taught, for
example, in
Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory
Press, 2nd
ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas
563-681
(Elsevier, N.Y., 1981) . The term "monoclonal antibody" as used herein is not
limited to
antibodies produced through hybridoina technology. The term "monoclonal
antibody" refers
to an antibody that is derived from a single clone, including any eukaryotic,
prokaryotic, or
phage clone, and not the method by which it is produced.
[0190] Methods for producing and screening for specific antibodies using
hybridoma
technology are routine and well known in the art. Briefly, mice can be
immunized with a
non-murine antigen and once an immune response is detected, e.g., antibodies
specific for the
antigen are detected in the mouse serum, the mouse spleen is harvested and
splenocytes
isolated. The splenocytes are then fused by well known techniques to any
suitable myeloma
cells, for example cells from cell line SP20 available from the ATCC.
Hybridomas are
selected and cloned by limited dilution. The hybridoma clones are then assayed
by methods
known in the art for cells that secrete antibodies capable of binding the
antigen. Ascites fluid,
66
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
which generally contains high levels of antibodies, can be generated by
immunizing mice
with positive hybridoma clones.
[0191] Monoclonal antibodies can be generated by the method comprising
culturing a
hybridoma cell secreting an antibody of the invention wherein, preferably, the
hybridoma is
generated by fusing splenocytes isolated from a mouse immunized with a non-
murine antigen
with myeloma cells and then screening the hybridomas resulting from the fusion
for
hybridoma clones that secrete an antibody able to bind to the antigen.
[0192] Antibody fragments which recognize specific particular epitopes
(referred to
herein as "antigen binding domain(s)") may be generated by any technique known
to those
of skill in the art. For exainple, Fab and F(ab')2 fragments of the invention
may be produced
by proteolytic cleavage of immunoglobulin molecules, using enzyines such as
papain (to
produce Fab fragments) or pepsin (to produce F(ab')2 fragments). F(ab')2
fragments contain
the variable region, the light chain constant region and the CH1 domain of the
heavy chain.
Further, the antibodies of the present invention can also be generated using
various phage
display methods known in the art.
[0193] In phage display methods, functional antibody domains are displayed on
the
surface of phage particles which carry the polynucleotide sequences encoding
thein. In
particular, DNA sequences encoding VH and VL domains are amplified from animal
cDNA
libraries (e.g., human or murine cDNA libraries of affected tissues). The DNA
encoding the
VH and VL domains are recombined together with an scFv linker by PCR and
cloned into a
phagemid vector. The vector is electroporated in E. coli and the E. coli is
infected with
helper phage. Phage used in these methods are typically filamentous phage
including fd and
M13 and the VH and VL domains are usually recombinantly fused to either the
phage gene
III or gene VIII. Phage expressing an antigen binding domain that binds to a
particular
antigen can be selected or identified with antigen, e.g., using labeled
antigen or antigen bound
or captured to a solid surface or bead. Examples of phage display methods that
can be used
to make the antibodies of the present invention include those disclosed in
Brinkman et al.,
1995, J. Immunol. Methods 182:41-50; Aines et al., 1995, J. Immunol. Methods
184:177-
186; Kettleborough et al., 1994, Eur. J. Iinmunol. 24:952-958; Persic et al.,
1997, Gene
187:9-18; Burton et al., 1994, Advances in Immunology 57:191-280;
International
application No. PCT/GB91/O1 134; International publication Nos. WO 90/02809,
WO
91/10737, WO 92/01047, WO 92/18619, WO 93/11236, WO 95/15982, WO 95/20401, and
W097/13844; and U.S. Patent Nos. 5,698,426, 5,223,409, 5,403,484, 5,580,717,
5,427,908,
67
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
5,750,753, 5,821,047, 5,571,698, 5,427,908, 5,516,637, 5,780,225, 5,658,727,
5,733,743 and
5,969,108.
[0194] As described in the above references, after phage selection, the
antibody
coding regions from the phage can be isolated and used to generate whole
antibodies,
including human antibodies, or any other desired antigen binding fragment, and
expressed in
any desired host, including maininalian cells, insect cells, plant cells,
yeast, 'and bacteria, e.g.,
as described below. Techniques to recombinantly produce Fab, Fab' and F(ab')2
fraginents
can also be employed using methods lcnown in the art such as those disclosed
in PCT
publication No. WO 92/22324; Mullinax et al., 1992, BioTechniques 12(6):864-
869; Sawai et
al., 1995, AJRI 34:26-34; and Better et al., 1988, Science 240:1041-1043.
[0195] To generate whole antibodies, PCR primers including VH or VL nucleotide
sequences, a restriction site, and a flanking sequence to protect the
restriction site can be used
to amplify the VH or VL sequences in scFv clones. Utilizing cloning techniques
known to
those of skill in the art, the PCR amplified VH domains can be cloned into
vectors expressing
a VH constant region, e.g., the human gamma 4 constant region, and the PCR
amplified VL
domains can be cloned into vectors expressing a VL constant region, e.g.,
human kappa or
lamba constant regions. Preferably, the vectors for expressing the VH or VL
domains
coinprise a promoter, a secretion signal, a cloning site for the variable
domain, constant
domains, and a selection marker such as neomycin. The VH and VL domains may
also
cloned into one vector expressing the necessary constant regions. The heavy
chain
conversion vectors and light chain conversion vectors are then co-transfected
into cell lines to
generate stable or transient cell lines that express full-length antibodies,
e.g., IgG, using
techniques known to those of skill in the art.
[0196] Methods for making bispecific antibodies are known in the art.
Traditional
production of full-length bispecific antibodies is based on the coexpression
of two
immunoglobulin heavy chain-light chain pairs, where the two chains have
different
specificities (Millstein et al.,1983, Nature, 305:537-539). Because of the
random assortment
of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce
a
potential mixture of different antibody molecules, of which only one has the
correct
bispecific structure. Purification of the correct molecule, which is usually
done by affinity
chromatography steps, is rather cumbersome, and the product yields are low.
Similar
procedures are disclosed in WO 93/08829, and in Traunecker et al., 1991, EMBO
J.,
10:3655-3659. A more directed approach is the generation of a Di-diabody a
tetravalent
68
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
bispecific antibody. Methods for producing a Di-diabody are known in the art
(see e.g., Lu et
al., 2003, J Immunol Methods 279:219-32; Marvin et al., 2005, Acta
Pharmacolical Sinica
26:649).
[0197] According to a different approach, antibody variable domains with the
desired
binding specificities (antibody-antigen combining sites) are fused to
immunoglobulin
constant domain sequences. The fusion preferably is with an immunoglobulin
heavy chain
constant domain, coinprising at least part of the hinge, CH2, and CH3 regions.
It is preferred
to have the first heavy-chain constant region (CH1) containing the site
necessary for light
chain binding, present in at least one of the fusions. DNAs encoding the
immunoglobulin
heavy chain fusions and, if desired, the immunoglobulin light chain, are
inserted into separate
expression vectors, and are co-transfected into a suitable host organism. This
provides for
great flexibility in adjusting the inutual proportions of the three
polypeptide fragments in
einbodiments when unequal ratios of the three polypeptide chains used in the
construction
provide the optimum yields. It is, however, possible to insert the coding
sequences for two or
all three polypeptide chains in one expression vector when, the expression of
at least two
polypeptide chains in equal ratios results in high yields or when the ratios
are of no particular
significance.
[0198] In one embodiment of this approach, the bispecific antibodies are
composed
of a hybrid immunoglobulin heavy chain with a first binding specificity in one
arm, and a
hybrid immunoglobulin heavy chain-light chain pair (providing a second binding
specificity)
in the other arm. It was found that this asymmetric structure facilitates the
separation of the
desired bispecific compound from unwanted immunoglobulin chain combinations,
as the
presence of an immunoglobulin light chain in only one half of the bispecific
molecule
provides for a facile way of separation. This approach is disclosed in WO
94/04690. For
further details of generating bispecific antibodies see, for example, Suresh
et al., 1986,
Methods in Enzymology, 121:210. According to another approach described in
W096/27011, a pair of antibody molecules can be engineered to maximize the
percentage of
heterodimers which are recovered from recombinant cell culture. The preferred
interface
comprises at least a part of the CH3 domain of an antibody constant domain. In
this method,
one or more small amino acid side chains from the interface of the first
antibody molecule are
replaced with larger side chains (e.g. tyrosine or tryptophan). Compensatory
"cavities" of
identical or similar size to the large side chain(s) are created on the
interface of the second
antibody molecule by replacing large amino acid side chains with smaller ones
(e.g. alanine
69
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
or threonine). This provides a mechanism for increasing the yield of the
heterodiiner over
other unwanted end-products such as homodimers.
[0199] Bispecific antibodies include cross-linked or "heteroconjugate"
antibodies.
For example, one of the antibodies in the heteroconjugate can be coupled to
avidin, the other
to biotin. Such antibodies have, for example, been proposed to target immune
systein cells to
unwanted cells (U.S. Pat. No. 4,676,980), and for treatment of HIV infection
(WO 91/00360,
WO 92/200373, and EP 03089). Heteroconjugate antibodies may be made using any
convenient cross-linking metllods. Suitable cross-linking agents are well
lcnown in the art,
and are disclosed in U.S. Pat. No. 4,676,980, along with a number of cross-
linking
techniques.
[0200] For some uses, including in vivo use of antibodies in humans and in
vitro
detection assays, it may be preferable to use humanized antibodies or chimeric
antibodies.
Completely human antibodies and humanized antibodies are particularly
desirable for
therapeutic treatinent of human subjects. Human antibodies can be made by a
variety of
inethods known in the art including phage display methods described above
using antibody
libraries derived from human iminunoglobulin sequences. See also U.S. Patent
Nos.
4,444,887 and 4,716,111; and International publication Nos. WO 98/46645, WO
98/50433,
WO 98/24893, W098/16654, WO 96/34096, WO 96/33735, and WO 91/10741.
[0201] Hunian antibodies can also be produced using transgenic mice which are
incapable of expressing functional endogenous immunoglobulins, but which can
express
human immunoglobulin genes. For example, the human heavy and light chain
immunoglobulin gene complexes may be introduced randomly or by homologous
recombination into mouse embryonic stem cells. Alternatively, the human
variable region,
constant region, and diversity region may be introduced into mouse embryonic
stem cells in
addition to the human heavy and light chain genes. The mouse heavy and light
chain
immunoglobulin genes may be rendered non-functional separately or
simultaneously with the
introduction of human iminunoglobulin loci by homologous recombination. In
particular,
homozygous deletion of the JH region prevents endogenous antibody production.
The
modified embryonic stem cells are expanded and microinjected into blastocysts
to produce
chimeric mice. The chimeric mice are then bred to produce homozygous offspring
which
express human antibodies. The transgenic mice are immunized in the normal
fashion with a
selected antigen, e.g., all or a portion of a polypeptide. Monoclonal
antibodies directed
against the antigen can be obtained from the immunized, transgenic mice using
conventional
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
hybridoma teclinology. The human immunoglobulin transgenes harbored by the
transgenic
mice rearrange during B cell differentiation, and subsequently undergo class
switching and
somatic mutation. Thus, using such a technique, it is possible to produce
therapeutically
useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology
for producing
human antibodies, see Lonberg and Huszar (1995, Int. Rev. Irrununol. 13:65-
93). For a
detailed discussion of this technology for producing human antibodies and
human
monoclonal antibodies and protocols for producing such antibodies, see, e.g.,
International
publication Nos. WO 98/24893, WO 96/34096, and WO 96/33735; and U.S. Patent
Nos.
5,413,923, 5,625,126, 5,633,425, 5,569,825, 5,661,016, 5,545,806, 5,814,318,
and 5,939,598.
In addition, companies such as Abgenix, Inc. (Freemont, CA) and Genpharm (San
Jose, CA)
can be engaged to provide human antibodies directed against a selected antigen
using
technology similar to that described above.
[0202] A chimeric antibody is a molecule in which different portions of the
antibody
are derived from different immunoglobulin molecules. Methods for producing
chimeric
antibodies are known in the art. See e.g., Morrison, 1985, Science 229:1202;
Oi et al., 1986,
BioTechniques 4:214; Gillies et al., 1989, J. hnmunol. Methods 125:191-202;
and U.S.
Patent Nos. 5,807,715, 4,816,567, 4,8 16397, and 6,311,415.
[0203] A humanized antibody is an antibody or its variant or fragment thereof
which
is capable of binding to a predetermined antigen and which comprises a
framework region
having substantially the amino acid sequence of a human iminunoglobulin and a
CDR having
substantially the amino acid sequence of a non-human iinmunoglobulin. A
humanized
antibody comprises substantially all of at least one, and typically two,
variable domains (Fab,
Fab', F(ab')2, Fabc, Fv) in which all or substantially all of the CDR
regions correspond
to those of a non-human immunoglobulin (i.e., donor antibody) and all or
substantially all of
the framework regions are those of a huinan iminunoglobulin consensus
sequence.
Preferably, a humanized antibody also comprises at least a portion of an
immunoglobulin
constant region (Fc), typically that of a human immunoglobulin. Ordinarily,
the antibody
will contain both the light chain as well as at least the variable domain of a
heavy chain. The
antibody also may include the CH1, hinge, CH2, CH3, and CH4 regions of the
heavy chain.
The humanized antibody can be selected from any class of immunoglobulins,
including IgM,
IgG, IgD, IgA and IgE, and any isotype, including IgG1, IgG2, IgG3 and 1gG4.
Usually the
constant domain is a complement fixing constant domain where it is desired
that the
humanized antibody exhibit cytotoxic activity, and the class is typically
IgGl. Where such
71
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
cytotoxic activity is not desirable, the constant domain may be of the IgG2
class. The
humanized antibody may comprise sequences from more than one class or isotype,
and
selecting particular constant domains to optimize desired effector functions
is within the
ordinary skill in the art. The framework and CDR regions of a humanized
antibody need not
correspond precisely to the parental sequences, e.g., the donor CDR or the
consensus
framework may be mutagenized by substitution, insertion or deletion of at
least one residue
so that the CDR or frameworlc residue at that site does not correspond to
either the consensus
or the import antibody. Such mutations, however, will not be extensive.
Usually, at least
75% of the humanized antibody residues will correspond to those of the
parental frameworlc
and CDR sequences, more often 90%, and most preferably greater than 95%. A
huinanized
antibody can be produced using variety of techniques known in the art,
including but not
limited to, CDR-grafting (see e.g., European Patent No. EP 239,400;
International
Publication No. WO 91/09967; and U.S. Patent Nos. 5,225,539, 5,530,101, and
5,585,089),
veneering or resurfacing (see e.g., European Patent Nos. EP 592,106 and EP
519,596; Padlan,
1991, Molecular Immunology 28(4/5):489-498; Studnicka et al., 1994, Protein
Engineering
7(6):805-814; and Roguska et al., 1994, PNAS 91:969-973), chain shuffling (see
e.g., U.S.
Patent No. 5,565,332), and techniques disclosed in, e.g., U.S. Pat. No.
6,407,213, U.S. Pat.
No. 5,766,886, International Publication No. WO 9317105, Tan et al., J.
Immunol.
169:1119-25 (2002), Caldas et al., Protein Eng. 13(5):353-60 (2000), Morea et
al., Methods
20(3):267-79 (2000), Baca et al., J. Biol. Chem. 272(16):10678-84 (1997),
Roguska et al.,
Protein Eng. 9(10):895-904 (1996), Couto et al., Cancer Res. 55 (23
Supp):5973s - 5977s
(1995), Couto et al., Cancer Res. 55(8):1717-22 (1995), Sandhu JS, Gene
150(2):409-10
(1994), and Pedersen et al., J. Mol. Biol. 235(3):959-73 (1994). Often,
framework residues in
the framework regions will be substituted with the corresponding residue from
the CDR
donor antibody to alter, preferably improve, antigen binding. These framework
substitutions
are identified by methods well known in the art, e.g., by modeling of the
interactions of the
CDR and framework residues to identify framework residues important for
antigen binding
and sequence comparison to identify unusual framework residues at particular
positions.
(See, e.g., Queen et al., U.S. Patent No. 5,585,089; and Riechmann et al.,
1988, Nature
332:323.)
[0204] Further, the antibodies of the invention can, in turn, be utilized to
generate
anti-idiotype antibodies that "mimic" a receptor using techniques well known
to those skilled
in the art. (See, e.g., Greenspan & Bona, 1989, FASEB J. 7(5): 437-444; and
Nissinoff,
72
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
1991, J. Immunol. 147(8): 2429-2435). For example, antibodies of the invention
which bind
to and competitively inhibit the binding of an receptor (as determined by
assays well lcnown
in the art and disclosed infra) to its ligands can be used to generate anti-
idiotypes that
"mimic" the ligand and, as a consequence, bind to and neutralize the receptor
and/or its
ligands. Such neutralizing anti-idiotypes or Fab fragments of such anti-
idiotypes can be used
in therapeutic regimens to neutralize a ligand and/or its receptor. The
invention provides
methods employing the use of polynucleotides comprising a nucleotide sequence
encoding an
antibody of the invention or a fragment thereof.
[0205] The invention provides polynucleotides coinprising a nucleotide
sequence
encoding an antibody or fragment thereof that specifically binds to an antigen
and having one
or more ainino acid substitutes for iinproved therapeutic and/or formulation
and/or
manufacturing characteristics. The invention also encompasses polynucleotides
that
hybridize under high stringency, intermediate or lower stringency
hybridization conditions to
polynucleotides that encode an antibody of the invention.
[0206] The polynucleotides may be obtained, and the nucleotide sequence of the
polynucleotides determined, by any method known in the art. The nucleotide
sequence of
antibodies specific for a desired antigen can be obtained, e.g., from the
literature or a
database such as GenBank. Nucleotide or alternatively, if the amino acid
sequence of an
antibody or fragment thereof that specifically binds to an antigen is known,
the nucleotide
sequences encoding the antibody or a fragment thereof (e.g., a CDR) can be
determined using
methods well known in the art, i.e., nucleotide codons known to encode
particular amino
acids are assembled in such a way to generate a nucleic acid that encodes the
antibody. Such
a polynucleotide encoding the antibody may be assembled from chemically
synthesized
oligonucleotides (e.g., as described in Kutmeier et al., 1994, BioTechniques
17:242), which,
briefly, involves the synthesis of overlapping oligonucleotides containing
portions of the
sequence encoding the antibody, annealing and ligating of those
oligonucleotides, and then
amplification of the ligated oligonucleotides by PCR.
[0207] Alternatively, a polynucleotide encoding an antibody may be generated
from
nucleic acid from a suitable source. If a clone containing a nucleic acid
encoding a particular
antibody is not available, but the sequence of the antibody molecule is known,
a nucleic acid
encoding the immunoglobulin may be chemically synthesized or obtained from a
suitable
source (e.g., an antibody eDNA library, or a cDNA library generated from, or
nucleic acid,
preferably poly A+ RNA, isolated from, any tissue or cells expressing the
antibody, such as
73
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
hybridoma cells selected to express an antibody of the invention) by PCR
amplification using
synthetic primers hybridizable to the 3' and 5' ends of the sequence or by
cloning using an
oligonucleotide probe specific for the particular gene sequence to identify,
e.g., a cDNA
clone from a cDNA library that encodes the antibody. Amplified nucleic acids
generated by
PCR may then be cloned into replicable cloning vectors using any method well
known in the
art.
[0208] Once the nucleotide sequence of the antibody is determined, the
nucleotide
sequence of the antibody may be inanipulated using methods well known in the
art for the
manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site
directed
inutagenesis, PCR, etc. (see, for exainple, the techniques described in
Current Protocols in
Molecular Biology, F.M. Ausubel et al., ed., Jolln Wiley & Sons (Chichester,
England,
1998); Molecular Cloning: A Laboratory Manual, 3rd Edition, J. Sambrook et
al., ed., Cold
Spring Harbor Laboratory Press (Cold Spring Harbor, NY, 2001); Antibodies: A
Laboratory
Manual, E. Harlow and D. Lane, ed., Cold Spring Harbor Laboratory Press (Cold
Spring
Harbor, NY, 1988); and Using Antibodies: A Laboratory Manual, E. Harlow and D.
Lane,
ed., Cold Spring Harbor Laboratory (Cold Spring Harbor, NY, 1999)), to
generate antibodies
having a different amino acid sequence, for example to create amino acid
substitutions,
deletions, and/or insertions.
[0209] In a specific embodiment, one or more of the CDRs is inserted within
framework regions using routine recombinant DNA techniques. The frainework
regions may
be naturally occurring or consensus framework regions, and preferably human
framework
regions (see, e.g., Chothia et al., 1998, J. Mol. Biol. 278: 457-479 for a
listing of human
framework regions). Preferably, the polynucleotide generated by the
combination of the
framework regions and CDRs encodes an antibody that specifically binds to a
particular
antigen. Preferably, as discussed supra, one or more amino acid substitutions
may be made
within the framework regions, and, preferably, the amino acid substitutions
improve binding
of the antibody to its antigen. Additionally, such methods may be used to make
amino acid
substitutions or deletions of one or more variable region cysteine residues
participating in an
intrachain disulfide bond to generate antibody molecules lacking one or more
intrachain
disulfide bonds. Other alterations to the polynucleotide are encompassed by
the present
invention and within the skill of the art.
74
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
5.5. Generation Of Antibody Domain Fusion Proteins Conjugates And Derivatives
[0210] As described above multidomain proteins include but are not limited to
antibodies which also encompasses antibody-like and antibody-domain fusion
proteins. An
antibody-like molecule is any molecule that has been generated with a desired
binding
property, see, e.g., PCT Publication Nos. WO 04/044011; WO 04/058821; WO
04/003019
and WO 03/002609. Antibody-domain fusion proteins may incorporate one or more
antibody
domains or fragments thereof, such as the Fc domain or the variable domain
with a fusion
partner which in general can be an protein, including, but not limited to, a
ligand, an enzyine,
the ligand portion of a receptor, an adhesion protein, or some other protein
or domain. For
example, the heterologous polypeptides may be fused or conjugated to a Fab
fragment, Fd
fragment, Fv fragment, F(ab)2 fragment, a VH domain, a VL domain, a VH CDR, a
VL
CDR, or fragment thereof. A large number of antibody-domain molecules are
known in the
art including, but not limited to, diabodies (dsFv)2 (Bera et al., 1998, J.
Mol. Biol. 281:475-
83); minibodies (homodimers of scFv-CH3 fusion proteins)(Pessi et al., 1993,
Nature
362:367-9), tetravalent di-diabody (Lu et al., 2003 J. Immunol. Methods
279:219-32),
tetravalent bi-specific antibodies called Bs(scFv)4-IgG (Zuo et al., 2000,
Protein Eng.
13:361-367) and Fc domain fusions (See, e.g., Chamow et al., 1996, Trends
Biotechnol
14:52-60; Ashkenazi et al., 1997, Curr Opin Immunol 9:195-200; Heidaran et
al., 1995,
FASEB J. 9:140-5.).
[0211] In one embodiment, a multidomain comprises an antibody domain that
binds
to a molecule (i.e., target antigen) including, but not limited to, those
disclosed herein (see
Section 5.3) fused to a fusion partner. Fusion partners include, but are not
limited to,
peptides, polypeptides, proteins, small molecules, mimetic agents, synthetic
drugs, inorganic
molecules, and organic molecules. In one embodiment, a fasion partner is a
polypeptide
comprising at least 5, at least 10, at least 20, at least 30, at least 40, at
least 50, at least 60, at
least 70, at least 80, at least 90 or at least 100 contiguous amino acid
residues, and is
heterologous to the amino acid sequence of the antibody domain. In certain
embodiments,
said fusion partner is a bioactive molecule. The nucleotide sequences encoding
a bioactive
molecule may be obtained fxom any information available to those of skill in
the art (i.e.,
from Genbank, the literature, or by routine cloning).
[0212] The fusion does not necessarily need to be direct, but may occur
through
linker sequences. Such linker molecules are commonly known in the art and
described in
Denardo et al., 1998, Clin Cancer Res 4:2483; Peterson et al., 1999, Bioconjug
Chem 10:553;
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
Zimmerman et al., 1999, Nucl Med Biol 26:943; Garnett, 2002, Adv Drug Deliv
Rev 53:171.
For example, antibody domains may be used to target heterologous polypeptides
to particular
cell types, either in vitro or in vivo, by fusing or conjugating the
heterologous protein to
antibodies domains specific for particular cell surface receptors. Antibody
domains fused or
conjugated to heterologous polypeptides may also be used in in vitro
iinmunoassays and
purification methods using methods known in the art. See e.g., International
publication No.
WO 93/21232; European Patent No. EP 439,095; Naramura et al., 1994, Iminunol.
Lett.
39:91-99; U.S. Patent No. 5,474,981; Gillies et al., 1992, PNAS 89:1428-1432;
and Fell et
al., 1991, J. Immunol. 146:2446-2452.
[0213] Methods for fusing or conjugating polypeptides to antibody portions are
well
known in the art. See, e.g., U.S. Patent Nos. 5,336,603, 5,783,181, 5,622,929,
5,359,046,
5,349,053, 5,447,851, 5,723,125, 5,908,626, 5,844,095, and 5,112,946; European
Patent Nos.
EP 307,434 and EP 367,166 and EP 394,827; PCT Publication Nos. WO 96/04388, WO
91/06570 WO 96/22024, WO 97/34631, and WO 99/04813; Ashkenazi et al., 1991,
Proc.
Natl. Acad. Sci. USA 88: 10535-10539; Traunecker et al., 1988, Nature, 331:84-
86; Zheng et
al., 1995, J. hnmunol. 154:5590-5600; and Vil et al., 1992, Proc. Natl. Acad.
Sci. USA
89:11337- 11341.
[0214] Multidomain proteins (e.g., an antibody domain fusion protein) can be
produced by standard recombinant DNA techniques or by protein synthetic
techniques, e.g.,
by use of a peptide synthesizer. For example, a nucleic acid molecule encoding
a
multidomain protein (e.g., an antibody domain fusion protein) can be
synthesized by
conventional techniques including automated DNA synthesizers. Alternatively,
PCR
amplification of gene fragments can be carried out using anchor primers which
give rise to
complementary overhangs between two consecutive gene fragments which can
subsequently
be annealed and reamplified to generate a chimeric gene sequence (see, e.g.,
Current
Protocols in Molecular Biology, Ausubel et al., eds., John Wiley & Sons,
1992). The
nucleotide sequence coding for a multidomain protein (e.g., an antibody domain
fusion
protein) can be inserted into an appropriate expression vector, i.e., a vector
that contains the
necessary elements for the transcription and translation of the inserted
protein-coding
sequence. A variety of host-vector systems may be utilized in the present
invention to
express the protein-coding sequence. These include but are not limited to
mammalian cell
systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect
cell systems infected
with virus (e.g., baculovirus); microorganisms such as yeast containing yeast
vectors; or
76
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA. The
expression elements of vectors vary in their strengths and specificities.
Depending on the
host-vector system utilized, any one of a number of suitable transcription and
translation
eleinents may be used.
[0215] Additional fusion proteins, e.g., of antibody domains that specifically
bind an
antigen (e.g., supra), may be generated through the techniques of gene-
shuffling, motif-
shuffling, exon-shuffling, and/or codon-shuffling (collectively referred to as
"DNA
shuffling"). DNA shuffling may be employed to alter the activities of
antibodies of the
invention or fragments thereof (e.g., antibodies or fragments thereof with
higher affinities and
lower dissociation rates). See, generally, U.S. Patent Nos. 5,605,793;
5,811,238; 5,830,721;
5,834,252; and 5,837,458, and Patten et al., 1997, Curr. Opinion Biotechnol.
8:724-33;
Harayama, 1998, Trends Biotechnol. 16(2): 76-82; Hansson, et al., 1999, J.
Mol. Biol.
287:265-76; and Lorenzo and Blasco, 1998, Biotechniques 24(2): 308- 313.
Antibodies or
fragments thereof, or the encoded antibodies or fragments thereof, may be
altered by being
subjected to random mutagenesis by error-prone PCR, random nucleotide
insertion or other
methods prior to recoinbination. One or more portions of a polynucleotide
encoding an
antibody or antibody fragment, which portions specifically bind to an Antigen
may be
recombined with one or more components, motifs, sections, parts, domains,
fragments, etc. of
one or more heterologous molecules.
[0216] Moreover, antibodies or fragments thereof can be fused to marker
sequences,
such as a peptide to facilitate purification. In certain embodiments, the
marker amino acid
sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector
(QIAGEN,
Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which
are
coinmercially available. As described in Gentz et al., 1989, Proc. Natl. Acad.
Sci. USA
86:821-824, for instance, hexa-histidine provides for convenient purification
of the fusion
protein. Other peptide tags useful for purification include, but are not
limited to, the
hemagglutinin "HA" tag, which corresponds to an epitope derived from the
influenza
hemagglutinin protein (Wilson et al., 1984, Cell 37:767) and the "flag" tag.
[0217] Antibodies and antibody domain fusion proteins include derivatives that
are
modified (i.e., by the covalent attachment of any type of molecule to an
antibody or antibody
domain fusion protein) such derivatives are collectively referred to herein as
"antibody
derivatives". For example, but not by way of limitation, the antibody
derivatives include
antibodies and antibody domain fusion proteins that have been modified, e.g.,
by
77
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
glycosylation, acetylation, pegylation, phosphorylation, amidation,
derivatization by known
protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand
or other protein,
etc. Any of numerous chemical modifications may be carried out by known
techniques,
including, but not limited to, specific chemical cleavage, acetylation,
formylation, metabolic
synthesis of tunicainycin, etc. Additionally, the derivative may contain one
or more non-
classical amino acids.
[0218] Antibodies or antibody domain fusion proteins with increased in vivo
half-
lives can be generated by attaching to said antibodies or antibody domain
fusion proteins,
polymer molecules such as high molecular weight polyethyleneglycol (PEG). PEG
can be
attached to said antibodies or antibody domain fusion proteins with or without
a
multifunctional linker either through site-specific conjugation of the PEG to
the N- or C-
terminus of said antibodies or antibody fragments or via epsilon-amino groups
present on
lysine residues. Linear or branched polymer derivatization that results in
minimal loss of
biological activity will be used. The degree of conjugation will be closely
monitored by
SDS-PAGE and mass spectrometry to ensure proper conjugation of PEG molecules
to the
antibodies. Unreacted PEG can be separated from antibody-PEG conjugates by,
e.g., size
exclusion or ion-exchange chromatography.
[0219] Further, antibodies or antibody domain fusion proteins can be
conjugated to
albumin in order to make them more stable in vivo or have a longer half life
in vivo. The
techniques are well known in the art, see e.g., International Publication Nos.
WO 93/15199,
WO 93/15200, and WO 01/77137; and European Patent No. EP 413, 622. The present
invention encompasses the use of antibodies or antibody domain fusion proteins
conjugated
or fused to one or more moieties, including but not limited to, peptides,
polypeptides,
proteins, fusion proteins, nucleic acid molecules, small molecules, mimetic
agents, synthetic
drugs, inorganic molecules, and organic molecules.
[0220] In certain embodiments, antibody domains are conjugated to a diagnostic
or
detectable agent. Such multidomain proteins can be useful for monitoring or
prognosing the
development or progression of a cancer as part of a clinical testing
procedure, such as
detennining the efficacy of a particular therapy. Such diagnosis and detection
can be
accomplished by coupling the antibody to detectable substances including, but
not limited to
various enzymes, such as but not limited to horseradish peroxidase, alkaline
phosphatase,
beta-galactosidase, or acetylcholinesterase; prosthetic groups, such as but
not limited to
streptavidin/biotin and avidin/biotin; fluorescent materials, such as but not
limited to,
78
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
umbelliferone, fluorescein, fluorescein isothiocynate, rhodamine,
dichlorotriazinylamine
fluorescein, dansyl chloride or phycoerythrin; luininescent materials, such as
but not limited
to, luminol; bioluminescent materials, such as but not limited to, luciferase,
luciferin, and
aequorin; radioactive materials, such as but not limited to iodine (1311,
1251, 1231, 1211,),
carbon (14C), sulfur (35S), tritium (3H), indium (115In, 113In, 112In,
111In,), and
technetium (99Tc), thallium (201Ti), gallium (68Ga, 67Ga), palladium (103Pd),
molybdenum
(99Mo), xenon (133Xe), fluorine (18F), 153Sm, 177Lu, 159Gd, 149Pm, 140La,
175Yb,
166Ho, 90Y, 47Sc, 186Re, 188Re,142 Pr, 105Rh, 97Ru, 68Ge, 57Co, 65Zn, 85Sr,
32P,
153Gd, 169Yb, 51Cr, 54Mn, 75Se, 113Sn, and 117Tin; positron einitting metals
using
various positron emission toinographies, noradioactive paramagnetic metal
ions, and
molecules that are radiolabelled or conjugated to specific radioisotopes.
[0221] An antibody or an antibody domain may be conjugated to a therapeutic
moiety
such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic
agent or a radioactive
metal ion, e.g., alpha-emitters. A cytotoxin or cytotoxic agent includes any
agent that is
detrinzental to cells. Examples include ribonuclease, monomethylauristatin E
and F,
paclitaxel, cytochalasin B, grainicidin D, ethidium bromide, emetine,
mitomycin, etoposide,
tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin,
dihydroxy
anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1 -
dehydrotestosterone,
glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin,
epirubicin, and
cyclophosphamide and analogs or homologs thereof. Therapeutic agents include,
but are not
limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-
thioguanine, cytarabine,
5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa
chlorambucil,
melphalan, carmustine (BCNU) and lomustine (CCNU), cyclothosphamide, busulfan,
dibromomannitol, streptozotocin, mitomycin C, and cisdichlorodiamine platinum
(II) (DDP)
cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and
doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and
anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine and
vinblastine). A more
extensive list of therapeutic moieties can be found in PCT publications WO
03/075957.
[0222] Further, an antibody or antibody domain may be conjugated to a
therapeutic
agent or drug moiety that modifies a given biological response. Therapeutic
agents or drug
moieties are not to be construed as limited to classical chemical therapeutic
agents. For
example, the drug moiety may be a protein or polypeptide possessing a desired
biological
activity. Such proteins may include, for example, a toxin such as abrin, ricin
A, Onconase (or
79
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
another cytotoxic RNase), pseudomonas exotoxin, cholera toxin, or diphtheria
toxin; a
protein such as tumor necrosis factor, a-interferon, (3-interferon, nerve
growth factor, platelet
derived growth factor, tissue plasminogen activator, an apoptotic agent, e.g.,
TNF-a, TNF-(3,
AIM I (see, International Publication No. WO 97/33899), AIM II (see,
International
Publication No. WO 97/34911), Fas Ligand (Takahashi et al., 1994, J. Immunol.,
6:1567),
and VEGI (see, International Publication No. WO 99/23105), a thrombotic agent
or an anti-
angiogenic agent, e.g., angiostatin or endostatin; or, a biological response
modifier such as,
for example, a lymphokine (e.g., interleukin-1 ("IL-1"), iiiterleukin-2 ("IL-
2"), interleukin-6
("IL-6"), granulocyte macrophage colony stimulating factor ("GM-CSF"), and
granulocyte
colony stiinulating factor ("G-CSF")), or a growth factor (e.g., growth
hormone ("GH")).
[0223] Moreover, an antibody can be conjugated to therapeutic moieties such as
a
radioactive materials or macrocyclic chelators useful for conjugating
radiometal ions (see
above for exainples of radioactive materials). In certain embodiments, the
macrocyclic
chelator is 1,4,7,1 0-tetraazacyclododecane-N,N',N",N" -tetraacetic acid
(DOTA) which can
be attached to the antibody via a linker molecule. Such linker molecules are
commonly
known in the art and described in Denardo et al., 1998, Clin Cancer Res.
4:2483; Peterson et
al., 1999, Bioconjug. Chem. 10:553; and Zimmerman et al., 1999, Nucl. Med.
Biol. 26:943.
[0224] Techniques for conjugating therapeutic moieties to antibodies are well
kl7own.
Moieties can be conjugated to antibodies by any method known in the art,
including, but not
limited to aldehyde/Schiff linkage, sulphydryl linkage, acid-labile linkage,
cis-aconityl
linkage, hydrazone linkage, enzymatically degradable linkage (see generally
Garnett, 2002,
Adv Drug Deliv Rev 53:171). Techniques for conjugating therapeutic moieties to
antibodies
are well known, see, e.g., Arnon et al., "Monoclonal Antibodies For
Immunotargeting Of
Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy,
Reisfeld et al.
(eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies
For Drug
Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp.
623-53 (Marcel
Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer
Therapy: A
Review", in Monoclonal Antibodies '84: Biological And Clinical Applications,
Pinchera et
al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of
The
Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal
Antibodies
For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic
Press 1985),
and Thorpe et al., 1982, Iminunol. Rev. 62:119.
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0225] Alternatively, an antibody or antibody domain can be conjugated to a
second
antibody to form an antibody heteroconjugate as described by Segal in U.S.
Patent No.
4,676,980.
5.6. Production Of Multidomain Proteins
[0226] Recombinant expression of a multidoinain protein, derivative, analog or
fragment thereof, (e.g., an antibody or fusion protein), requires construction
of an expression
vector containing a polynucleotide that encodes the iilultidomain protein
(e.g., antibody, or
fusion protein). Once a polynucleotide encoding a inultidomain protein (e.g.,
antibody, or
fusion protein) has been obtained, the vector for the production of the
multidomain protein
(e.g., antibody, or fusion protein) may be produced by recombinant DNA
technology using
techniques well known in the art. Thus, methods for preparing a protein by
expressing a
polynucleotide containing a inultidomain protein (e.g., antibody, or fusion
protein) encoding
nucleotide sequence are described herein. Methods that are well known to those
skilled in the
art can be used to construct expression vectors containing multidomain protein
(e.g.,
antibody, or fusion protein) coding sequences and appropriate transcriptional
and
translational control signals. These methods include, for example, in vitro
recombinant DNA
techniques, synthetic techniques, and in vivo genetic recombination. The
invention, thus,
provides replicable vectors comprising a nucleotide sequence encoding a
multidoinain protein
of the invention, operably linked to a promoter. Such vectors may include the
nucleotide
sequence encoding the constant region of the antibody molecule (see, e.g.,
International
Publication No. WO 86/05807; International Publication No. WO 89/01036; and
U.S. Patent
No. 5,122,464) and the variable domain of the antibody, or a polypeptide for
generating an
multidomain protein may be cloned into such a vector for expression of the
full length
antibody chain (e.g. heavy or light chain), or complete inultidomain protein
comprising a
fusion of a non-antibody derived polypeptide and a an antibody domain.
[0227] The expression vector is transferred to a host cell by conventional
techniques
and the transfected cells are then cultured by conventional techniques to
produce a
multidomain. Thus, the invention includes host cells containing a
polynucleotide encoding a
multidomain protein of the invention, operably linked to a heterologous
promoter. In specific
embodiments for the expression of multidomain proteins comprising double-
chained
antibodies, vectors encoding both the heavy and light chains may be co-
expressed in the host
cell for expression of the entire immunoglobulin molecule, as detailed below.
81
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0228] A variety of host-expression vector systems may be utilized to express
the
multidomain proteins of the invention (e.g., antibody or fusion protein
molecules) (see, e.g.,
U.S. Patent No. 5,807,715). Such host-expression systems represent vehicles by
which the
coding sequences of interest may be produced and subsequently purified, but
also represent
cells which may, when transfonned or transfected with the appropriate
nucleotide coding
sequences, express an multidomain protein of the invention in situ. These
include but are not
limited to microorganisms such as bacteria (e.g., E. coli and B. subtilis)
transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors
containing multidomain protein coding sequences; yeast (e.g., Saccharomyces
Pichia)
transformed with recombinant yeast expression vectors containing multidomain
protein
coding sequences; insect cell systems infected with recoiubinant virus
expression vectors
(e.g., baculovirus) containing multidomain protein coding sequences; plant
cell systems
infected with recombinant virus expression vectors (e.g., cauliflower mosaic
virus, CaMV;
tobacco mosaic virus, TMV) or transformed with recoinbinant plasmid expression
vectors
(e.g., Ti plasmid) containing inultidomain protein coding sequences; or
mammalian cell
systems (e.g., COS, CHO, BHK, 293, NSO, and 3T3 cells) harboring recombinant
expression
constructs containing promoters derived from the genome of mammalian cells
(e.g.,
metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late
promoter; the
vaccinia virus 7.5K promoter). In certain embodiments, bacterial cells such as
Escherichia
coli, or eukaryotic cells, are used for the expression of a multidomain
protein which is a
recombinant antibody or fusion protein molecules. For example, mammalian cells
such as
Chinese hamster ovary cells (CHO), in conjunction with a vector such as the
major
intermediate early gene promoter element from human cytomegalovirus is an
effective
expression system for antibodies (Foecking et al., 1986, Gene 45:101; and
Cockett et al.,
1990, Bio/Technology 8:2). In a specific embodiment, the expression of
nucleotide
sequences encoding a multidomain protein of the invention (e.g., antibody or
fusion protein)
is regulated by a constitutive promoter, inducible promoter or tissue specific
promoter.
[0229] In bacterial systems, a number of expression vectors may be
advantageously
selected depending upon the use intended for the multidomain protein (e.g.,
antibody or
fusion protein) being expressed. For example, when a large quantity of such a
protein is to be
produced, for the generation of pharmaceutical compositions of a multidomain
protein,
vectors that direct the expression of high levels of fusion protein products
that are readily
purified may be desirable. Such vectors include, but are not limited to, the
E. coli expression
82
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
vector pUR278 (Ruther et al., 1983, EMBO 12:1791), in which the multidoinain
protein
coding sequence may be ligated individually into the vector in frame with the
lac Z coding
region so that a lac Z-fusion protein is produced; pIN vectors (Inouye &
Inouye, 1985,
Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem.
24:5503-
5509); and the like. pGEX vectors may also be used to express foreign
polypeptides as
fusion proteins with glutathione 5-transferase (GST). In general, such fusion
proteins are
soluble and can easily be purified fioin lysed cells by adsorption and binding
to matrix
glutathione agarose beads followed by elution in the presence of free
glutathione. The pGEX
vectors are designed to include thrombin or factor Xa protease cleavage sites
so that the
cloned target gene product can be released from the GST moiety.
[0230] In an insect systein, Autographa califomica nuclear polyhedrosis virus
(AcNPV) is used as a vector to express foreign genes. The virus grows in
Spodoptera
frugiperda cells. The multidomain protein (e.g., antibody or fusion protein)
coding sequence
may be cloned individually into non-essential regions (for example the
polyhedrin gene) of
the virus and placed under control of an AcNPV promoter (for example the
polyhedrin
promoter).
[0231] In mammalian host cells, a nuinber of viral-based expression systems
maybe
utilized. In cases where an adenovirus is used as an expression vector, the
multidomain
protein (e.g., antibody or fusion protein) coding sequence of interest may be
ligated to an
adenovirus transcription/translation control complex, e.g., the late promoter
and tripartite
leader sequence. This chimeric gene may then be inserted in the adenovirus
genome by in
vitro or in vivo recombination. Insertion in a non-essential region of the
viral genome (e.g.,
region El or E3) will result in a recombinant virus that is viable and capable
of expressing the
multidomain protein (e.g., antibody or fusion protein) in infected hosts
(e.g., see Logan &
Shenk, 1984, Proc. Natl. Acad. Sci. USA 8 1:355-359). Specific initiation
signals may also
be required for efficient translation of inserted multidomain protein coding
sequences. These
signals include the ATG initiation codon and adjacent sequences. Furthermore,
the initiation
codon must be in phase with the reading frame of the desired coding sequence
to ensure
translation of the entire insert. These exogenous translational control
signals and initiation
codons can be of a variety of origins, both natural and synthetic. The
efficiency of expression
may be enhanced by the inclusion of appropriate transcription enhancer
elements,
transcription terminators, etc. (see, e.g., Bittner et al., 1987, Methods in
Enzymol. 153:516-
544).
83
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
(0232] The expression of a multidomain protein (e.g., antibody or fusion
protein) may
be controlled by any promoter or enhancer element known in the art. Promoters
which may
be used to control the expression of the gene encoding an multidomain protein
(e.g., antibody
or fusion protein) include, but are not limited to, the SV40 early promoter
region (Bernoist
and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3' long
terminal
repeat of Rous sarcoma virus (Yamamoto, et al., 1980, Cell 22:787-797), the
herpes
thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A.
78:1441-
1445), the regulatory sequences of the metallothionein gene (Brinster et al.,
1982, Nature
296:39-42), the tetracycline (Tet) promoter (Gossen et al., 1995, Proc. Nat.
Acad. Sci. USA
89:5547-5551); prokaryotic expression vectors such as the (3-lactainase
promoter (Villa-
Kamaroff et al., 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-373 1), or the
tac promoter
(DeBoer et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25; see also "Useful
proteins from
recoinbinant bacteria" in Scientific American, 1980, 242:74-94); plant
expression vectors
comprising the nopaline synthetase promoter region (Herrera-Estrella et al.,
Nature 303:209-
213) or the cauliflower mosaic virus 35S RNA promoter (Gardner et al., 1981,
Nucl. Acids
Res. 9:2871), and the promoter of the photosynthetic enzyme ribulose
biphosphate
carboxylase (Herrera-Estrella et al., 1984, Nature 310:115-120); promoter
elements from
yeast or other fungi such as the Gal 4 promoter, the ADC (alcohol
dehydrogenase) promoter,
PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter, and the
following
aniinal transcriptional control regions, which exhibit tissue specificity and
have been utilized
in transgenic animals: elastase I gene control region which is active in
pancreatic acinar cells
(Swift et al., 1984, Cell 38:639-646; Ornitz et al., 1986, Cold Spring Harbor
Symp. Quant.
Biol. 50:399-409; MacDonald, 1987, Hepatology 7:425-515); insulin gene control
region
which is active in pancreatic beta cells (Hanahan, 1985, Nature 315:115-122),
immunoglobulin gene control region which is active in lyinphoid cells
(Grosschedl et al.,
1984, Cell 38:647-658; Adames et al., 1985, Nature 318:533-538; Alexander et
al., 1987,
Mol. Cell. Biol. 7:1436-1444), mouse mammary tumor virus control region which
is active in
testicular, breast, lymphoid and mast cells (Leder et al., 1986, Cell 45:485-
495), albuinin
gene control region which is active in liver (Pinkert et al., 1987, Genes and
Devel. 1:268-
276), alpha-fetoprotein gene control region which is active in liver (Krumlauf
et al., 1985,
Mol. Cell. Biol. 5:1639-1648; Hammer et al., 1987, Science 235:53-58; alpha 1-
antitrypsin
gene control region which is active in the liver (Kelsey et al., 1987, Genes
and Devel. 1:161-
171), beta-globin gene control region which is active in myeloid cells (Mogram
et al., 1985,
Nature 315:338-340; Kollias et al., 1986, Cell 46:89-94; myelin basic protein
gene control
84
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
region which is active in oligodendrocyte cells in the brain (Readhead et al.,
1987, Cell
48:703-712); myosin light chain-2 gene control region which is active in
skeletal muscle
(Sani, 1985, Nature 314:283-286); neuronal-specific enolase (NSE) whicll is
active in
neuronal cells (Morelli et al., 1999, Gen. Virol. 80:571-83); brain-derived
neurotrophic
factor (BDNF) gene control region which is active in neuronal cells (Tabuchi
et al., 1998,
Biochein. Biopllysic. Res. Com. 253:818-823); glial fibrillary acidic protein
(GFAP)
promoter which is active in astrocytes (Goines et al., 1999, Braz J Med Biol
Res 32(5):
619-631; Morelli et al., 1999, Gen. Virol. 80:571-83) and gonadotropic
releasing hormone
gene control region which is active in the hypothalamus (Mason et al., 1986,
Science
234:1372-1378).
[0233] Expression vectors containing inserts of a gene encoding a multidomain
protein (e.g., antibody or fusion protein) can be identified by three general
approaches: (a)
nucleic acid hybridization, (b) presence or absence of "marker" gene
functions, and (c)
expression of inserted sequences. In the first approach, the presence of a
gene encoding a
peptide, polypeptide, protein or a fusion protein in an expression vector can
be detected by
nucleic acid hybridization using probes conlprising sequences that are
homologous to an
inserted gene encoding the peptide, polypeptide, protein or the fusion
protein, respectively.
In the second approach, the recombinant vector/host system can be identified
and selected
based upon the presence or absence of certain "marker" gene functions (e.g.,
thymidine
kinase activity, resistance to antibiotics, transformation phenotype,
occlusion body formation
in baculovirus, etc.) caused by the insertion of a nucleotide sequence
encoding a multidomain
protein (e.g., antibody or fusion protein) in the vector. For example, if the
nucleotide
sequence encoding the inultidomain protein (e.g., antibody or fusion protein)
is inserted
within the marker gene sequence of the vector, recombinants containing the
gene encoding
the multidomain protein (e.g., antibody or fusion protein) insert can be
identified by the
absence of the marker gene function. In the third approach, recombinant
expression vectors
can be identified by assaying the gene product (e.g., antibody or fusion
protein) expressed by
the recombinant. Such assays can be based, for exainple, on the physical or
functional
properties of the fusion protein in in vitro assay systems, e.g., binding with
anti-bioactive
molecule antibody.
[0234] In addition, a host cell strain may be chosen which inodulates the
expression
of the inserted sequences, or modifies and processes the gene product in the
specific fashion
desired. Expression from certain promoters can be elevated in the presence of
certain
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
inducers; thus, expression of the genetically engineered fusion protein may be
controlled.
Furthermore, different host cells have characteristic and specific mechanisms
for the
translational and post-translational processing and modification (e.g.,
glycosylation,
phosphorylation of proteins). Appropriate cell lines or host systems can be
chosen to ensure
the desired modification and processing of the foreign protein expressed. For
example,
expression in a bacterial system will produce an unglycosylated product and
expression in
yeast will produce a glycosylated product. Eukaryotic host cells that possess
the cellular
machinery for proper processing of the primary transcript (e.g.,
glycosylation, and
phosphorylation) of the gene product may be used. Such mainmalian host cells
include, but
are not limited to, CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, WI38, NSO, and
in
particular, neuronal cell lines such as, for exainple, SK-N-AS, SK-N-FI, SI<--
N-DZ human
neuroblastomas (Sugimoto et al., 1984, J. Natl. Cancer Inst. 73: 51-57), SI"_-
N-SH huinan
neuroblastoma (Biochim. Biophys. Acta, 1982, 704: 450-460), Daoy human
cerebellar
medulloblastoma (He et al., 1992, Cancer Res. 52: 1144-1148) DBTRG-05MG
glioblastoma
cells (Kruse et al., 1992, In Vitro Cell. Dev. Biol. 28A: 609-614), IMR-32
human
neuroblastoma (Cancer Res., 1970, 30: 2110-2118), 1321N1 human astrocytoma
(Proc. Natl
Acad. Sci. USA, 1977, 74: 4816), MOG-G-CCM human astrocytoma (Br. J. Cancer,
1984,
49: 269), U87MG human glioblastoma-astrocytoma (Acta Pathol. Microbiol.
Scand., 1968,
74: 465-486), A172 human glioblastoma (Olopade et al., 1992, Cancer Res. 52:
2523-2529),
C6 rat glioma cells (Benda et al., 1968, Science 161: 370-371), Neuro-2a mouse
neuroblastoma (Proc. Natl. Acad. Sci. USA, 1970, 65: 129-136), NB41A3 mouse
neuroblastoma (Proc. Natl. Acad. Sci. USA, 1962, 48: 1184-1190), SCP sheep
choroid plexus
(Bolin et al., 1994, J. Virol. Methods 48: 211-221), G355-5, PG-4 Cat normal
astrocyte
(Haapala et al., 1985, J. Virol. 53: 827-833), Mpf ferret brain (Trowbridge et
al., 1982, In
Vitro 18: 952-960), and normal cell lines such as, for example, CTX TNA2 rat
normal cortex
brain (Radany et al., 1992, Proc. Natl. Acad. Sci. USA 89: 6467-6471) such as,
for example,
CRL7030 and Hs578Bst. Furthermore, different vector/host expression systems
may effect
processing reactions to different extents.
[0235] For long-term, high-yield production of recombinant proteins, stable
expression is often preferred. For example, cell lines which stably express a
multidomain
protein of the invention (e.g., antibody or fusion protein) may be engineered.
Rather than
using expression vectors that contain viral origins of replication, host cells
can be
transformed with DNA controlled by appropriate expression control elements
(e.g., promoter,
86
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
enhancer, sequences, transcription tenninators, polyadenylation sites, etc.),
and a selectable
marlcer. Following the introduction of the foreign DNA, engineered cells may
be allowed to
grow for 1-2 days in an enriched medium, and then are switched to a selective
medium. The
selectable marker in the recombinant plasmid confers resistance to the
selection and allows
cells to stably integrate the plasmid into their chromosomes and grow to form
foci that in turn
can be cloned and expanded into cell lines. This method may advantageously be
used to
engineer cell lines that express a multidomain protein that specifically binds
to an antigen.
Such engineered cell lines may be particularly useful in screening and
evaluation of
coinpounds that affect the activity of a multidomain protein (e.g., a
polypeptide or a fusion
protein) that specifically binds to an antigen.
[0236] A number of selection systems may be used, including but not limited to
the
herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223),
hypoxanthine-
guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl.
Acad. Sci.
USA 48:2026), and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell
22:817) genes
can be einployed in tk-, hgprt- or aprt- cells, respectively. Also,
antimetabolite resistance can
be used as the basis of selection for dhfr, which confers resistance to
methotrexate (Wigler et
al., 1980, Natl. Acad. Sci. USA 77:3567; O'Hare et al., 1981, Proc. Natl.
Acad. Sci. USA
78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg,
1981, Proc.
Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the
aminoglycoside G-418
(Colberre-Garapin et al., 1981, J. Mol. Biol. 150:1); and hygro, which confers
resistance to
hygromycin (Santerre et al., 1984, Gene 30:147) genes.
[0237] Once an inultidomain protein (e.g., antibody, pr a fusion protein) has
been
produced by recombinant expression, it may be purified by any method known in
the art for
purification of a protein, for example, by chromatography (e.g., ion exchange,
affinity,
particularly by affinity for the specific antigen after Protein A, and sizing
column
chromatography), centrifugation, differential solubility, or by any other
standard technique
for the purification of proteins.
[0238] The expression levels of an multidomain protein (e.g., antibody or
fusion
protein) can be increased by vector amplification (for a review, see
Bebbington and
Hentschel, The use of vectors based on gene amplification for the expression
of cloned genes
in mainmalian cells in DNA cloning, Vol.3. (Academic Press, New York, 1987)).
For
example, when a marker in the vector system expressing a multidomain protein
(e.g.,
antibody or fusion protein) is amplifiable, increase in the level of inhibitor
present in culture
87
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
of host cell will increase the nuinber of copies of the marker gene. Since the
amplified region
is associated with the multidomain protein gene, production of the multidomain
protein will
also increase (Crouse et al., 1983, Mol. Cell. Biol. 3:257).
[0239] The host cell may be co-transfected witli two expression vectors of the
invention. For example, the first vector encoding a heavy chain derived
polypeptide and the
second vector encoding a light chain derived polypeptide. The two vectors may
contain
identical selectable markers, which enable equal expression of heavy and light
chain
polypeptides. Alternatively, a single vector may be used which encodes, and is
capable of
expressing, a fusion protein or both heavy and light chain polypeptides. The
coding
sequences for the fusion protein or heavy and light chains may comprise cDNA
or genomic
DNA.
5.7. Preparation Of Liquid Formulations Of Multidomain Proteins
[0240] The liquid formulations of inultidomain proteins, such as antibodies,
can be
prepared using any method known in the art. In one embodiment, a liquid
preparation can be
prepared by a method comprising: purifying the inultidomain proteins fiom
conditioned
medium (either single lots or pooled lots of inediuin) and concentrating a
fraction of the
purified multidomain proteins to a final concentration from about 15 mg/ml,
about 20 mg/ml,
about 30 mg/ml, about 40 mghnl, about 50 mg/ml, about 60 mg/ml, about 70
mg/ml, about
80 mg/ml, about 90 mg/ml, about 100 mg/ml, about 110 mg/ml, about 125 mg/ml,
about 150
mg/ml, about 200 mg/ml, about 250 mg/ml, or about 300 mg/ml.
[0241] In a specific embodiment, the liquid formulations can be prepared by a
method comprising concentrating a fraction containing the purified antibody or
a fraginent to
a final antibody or fragment concentration of fioin about 15 mg/ml, about 20
mg/ml, about 30
mg/ml, about 40 mg/ml, about 50 mg/ml, about 60 ing/ml, about 70 mg/ml, about
80 mg/ml,
about 90 mg/ml, about 100 mg/ml, about 110 mg/ml, about 125 mg/ml, about 150
mg/inl,
about 200 mghnl, about 250 mg/inl, or about 300 mg/ml using a semipermeable
membrane
with an appropriate molecular weight (MW) cutoff (e.g., 30 kD cutoff for whole
antibody
molecules and F(ab')2 fragments; and 10 kD cutoff for antibody fragments, such
as Fab
fragments) and difiltrating the concentrated antibody fraction into the
formulation buffer
using the same membrane. Conditioned medium containing antibody or a fragment
thereof
that specifically binds to a target antigen is subjected to CUNO filtration
and the filtered
antibody is subjected to HS50 cation exchange chromatography. The fraction
from the HS50
88
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
cation exchange chromatography is then subjected to rProtein A affinity
chromatography
followed by low pH treatment. Following low pH treatment, the antibody
fraction is subject
to super Q 650 anion exchange chromatography and then nanofiltration. The
fraction of the
antibody obtained after nanofiltration is then subjected to diafiltration to
concentrate the
antibody fraction into the formulation buffer using the same meinbrane.
[0242] The formulation buffer can comprise histidine at a concentration
ranging from
about 1 mM to about 100 mM, about 10 mM to about 50 mM, or about 20 mM to
about 30
mM. The formulations may further comprise an amino acid at a concentration of
less than
100 mM, less than 50 mM, less than 3.0 mM, less than 2.0 mM, or less than 1.8
mM. The
amount of amino acid in the formulation should not cause a significant
buffering in order to
avoid multidomain protein precipitation at its isoelectric point. The pH of
the formulation
may range from about 5.0 to about 7.0, or about 5.5 to about 6.5, or about 5.8
to about 6.2, or
about 6Ø To obtain an appropriate pH for a particular multidomain protein,
it is generally
understood that histidine (and glycine, if added) is first dissolved in water
to obtain a buffer
solution with higher pH than the desired pH and then the pH is brought down to
the desired
level by adding HCI. This way, the formation of inorganic salts (e.g.,
formation of NaCl
when, for example, histidine hydrochloride is used as histidine and pH is
raised to a desired
level by adding NaOH) can be avoided.
[0243] The liquid formulations can be prepared as unit dosage forms by
preparing a
vial containing an aliquot of the liquid forinulation for a one-time use. For
example, a unit
dosage per vial may contain 1 ml, 2 ml, 3 ml, 4 ml, 5 ml, 6 ml, 7 ml, 8 ml, 9
ml, 10 ml, 15 ml,
or 20 ml of different concentrations of a multidomain protein ranging from
about 15 mg/ml to
about 300 ing/ml. If necessary, these preparations can be adjusted to a
desired concentration
by adding a sterile diluent to each vial. In a specific embodiment, the
multidomain protein is
an antibody that binds to a target antigen.
[0244] The liquid fomlulations of the present invention may be sterilized by
various
sterilization methods, including sterile filtration, radiation, etc. In a
specific embodiment, the
difiltrated antibody formulation is filter-sterilized with a presterilized 0.2
or 0.22-micron
filter.
5.8. Preparation Of Lyophilized Formulations Of Multidomain Proteins
[0245] Lyophilization is a freeze drying process that is often used in the
preparation of
pharmaceutical products to preserve their biological activity. The liquid
composition is
89
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
prepared, then lyophilized to form a dry calce-like product. The process
generally involves
drying a previously frozen sample in a vacuum to remove the ice, leaving the
non- water
components intact, in the form of a powdery or cake-like substance. The
lyophilized product
can be stored for prolonged periods of time, and at elevated temperatures,
without loss of
biological activity, and can be readily reconstituted into a particle-free
solution by the
addition of an appropriate diluent. An appropriate diluent can be any liquid
which is
biologically acceptable and in which the lyophilized powder is coinpletely
soluble. Water,
particularly sterile, pyrogen-free water, is a preferred diluent, since it
does not include salts or
other compounds which may affect the stability of the inultidomain protein.
The advantage
of lyophilization is that the water content is reduced to a level that greatly
reduce the various
molecular events which lead to instability of the product upon long-term
storage. The
lyophilized product is also more readily able to withstand the physical
stresses of shipping.
The reconstituted product is preferably substantially particle free, thus it
can be administered
without prior filtration.
[0246] The following criteria are important in developing stable lyophilized
protein
products. Protein unfolding during lyophilization should be minimized. Various
degradation
pathways should be minimized. Residual moisture should be low. A strong and
elegant cake
structure should be obtained. A reconstitution time 15 should be short, for
example, less than
60 minutes, or less then 40 minutes, or less then 20 minutes, or less then 10
minutes, or less
then 5 minutes, or less than 2 minutes, or less than 1 minute.
[0247] The protein in the pre-lyophilized formulation has a high concentration
of at
least 5 mg/ml, or at least 10 mghnl, or at least 25 mg/ml, or at least 50
mg/ml or greater. The
ph of the formulation may range from about 5.0 to about 7.0, or about 5.5 to
about 6.5, or
about 5.8 to about 6.2, or about 6. Examples of buffers that control the ph in
this range
include succinate (such as sodium succinate), gluconate, histidine, citrate
and other organic
acid buffers. Histidine is a preferred buffer for subcutaneous, intramuscular
and peritoneal
injection. A specific buffer contains about 5-30 mm histidine.
[0248] A surfactant may be added to the protein formulation. exemplary
surfactants
include nonionic surfactants such as polysorbates (e.g. polysorbates 20, 80,
such as tween 20,
tween 80) or poloxamers (e.g. poloxamer 188). The amount of surfactant added
is such
that it reduces aggregation of the formulated protein and/or minimizes the
formation of
particulates in the formulation and/or reduces protein adsorption onto the
container. The
surfactant also reduces the reconstitution time of the lyophilized
formulation. For example,
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
the surfactant is present in the formulation in an amount from about 0.001% to
about 0.5%, or
from about 0. 005% to about 0.1 % or from about 0.01% to about 0.05%.
[0249] Lyophilized formulations may optional contain one or more of the
following, an
excipient, such as saccharides, polyols and sugar alcohols, a bullcing agent
that provides good
lyophilized cake properties, such as serine, glycine, mannitol, and tonicity
modifiers such as
salts (e.g., NaCI, KCI, MgC12, CaC12).
5.9. Administration Of Formulations Of Multidomain Proteins
[0250] The formulated protein drug can be adininistrated to a subject in an
effective
ainount for treating or preventing a disease condition in the subject. The
subject is preferably
a mammal such as non-primate (e.g., cows, pigs, horses, cats, dogs, rats etc.)
and a primate
(e.g., monkey such as a cynomolgous monkey and a human). In a specific
embodiment, the
subject is a human.
[0251] Various delivery systems are known and can be used to administer the
formulated drug. Methods of administering forinulations include, but are not
limited to,
parenteral administration (e.g., intradermal, intramuscular, intraperitoneal,
intravenous and
subcutaneous), epidural administration, topical administration, pulmonary
administration, and
mucosal administration (e.g., intranasal and oral routes). In a specific
embodiment, liquid
formulations, including reconstituted lyophilized formulations, of a
therapeutic protein are
administered intramuscularly, intravenously, subcutaneously or,
intramuscularly. The
forinulations may be administered by any convenient route, for exainple by
infusion or bolus
injection, by absorption through epithelial or mucocutaneous linings (e.g.,
oral mucosa, rectal
and intestinal mucosa, etc.) and may be administered together with other
biologically active
agents. Administration can be systemic or local. In addition, pulmonary
administration can
be employed, e.g., by use of an inhaler or nebulizer.
[0252] The formulation of the present invention can be packaged in a
hermetically
sealed container such as an ampoule or sachette indicating the quantity of
multidomain
protein. It is contemplated that the formulations of the present invention are
in a hermetically
sealed container indicating the quantity and concentration of multidomain
protein. in certain
embodiments, the formulation of the present invention is supplied in a
hermetically sealed
container at least 15 mg/ml, 20 mg/ml, 30 mg/ml, 40 mg/ml, 50 mg/ml, 60 mg/ml,
70 mg/ml,
80 mg/ml, 90 mg/ml, 100 mg/ml, 150 mg/ml, 200 mg/ml, 250 mg/ml, or 300 mg/ml,
in a
quantity of about 1 ml, 2 ml, 3 ml, 4 ml, 5 ml, 6 ml, 7 ml, 8 ml, 9 ml, 10 ml,
15 ml, or 20 ml.
91
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0253] The amount of the formulations of the present invention which will be
effective
in the treatinent, prevention, management or amelioration of a disease, one or
more
syinptoins thereof, or an undesirable condition associated with the disease,
can be detennined
by standard clinical techniques. For example, the dosage of a drug formulation
which will be
effective in the treatinent, prevention, management or amelioration of a
disease can be
determined by adnlinistering the formulation to an animal model (e.g., a
cotton rat or
monkey) and measuring the serum titer of the active protein, e.g., the serum
titer of the
inultidoinain protein. Accordingly, a dosage of the formulation that results
in a seruin titer of
at least 1 g/ml, at least 2 g/ml, at least 5 ghnl, at least 10 g/ml, at
least 20 gg/ml, at
least 25 g/ml, at least 35 g/ml, at least 40 g/ml, at least 50 g/ml, at
least 75 g/ml, at
least 100 g/ml, at least 125 g/ml, at least 150 g/ml, at least 200 ghnl,
at least 250 g/ml,
at least 300 gghnl, at least 350 g/ml, at least 400 ghnl, or at least 450
g/ml can be
administered to a human for the treatment, prevention, management or
amelioration of a
disease. In addition, in vitro assays may optionally be employed to help
identify optimal
dosage ranges. In specific embodiments, the multidomain protein is an antibody
that bind to
a target antigen
[0254] The precise dose to be employed in the formulation will also depend on
the
route of administration, and the seriousness of the disease, and should be
decided according
to the judginent of the practitioner and each patient's circumstances.
Effective doses may be
extrapolated from dose-response curves derived from in vitro or animal model
(e.g., the
cotton rat or cynomolgous monkey) test systems.
[0255] For antibodies, proteins, polypeptides, peptides and fusion proteins,
the dosage
administered to a patient may be about 0.1 mg/kg to 30 mg/kg of the patients
body weight.
For example, generally, humaii antibodies have a longer half-life within the
human body than
antibodies from other species due to the immune response to the foreign
polypeptides. Thus,
lower dosages of human antibodies and less frequent administration is often
possible.
Further, the dosage, volume and frequency of administration of liquid
formulations, including
reconstituted lyophilized formulations, of the present invention may be
reduced by
increasing the concentration of an antibody or a fragment thereof in the
formulations,
increasing affinity and/or avidity of the antibody or a fragment thereof,
and/or increasing the
half-life of the antibody or a fragment thereof.
[0256] Exemplary doses of a small molecule include milligram or microgram
amounts
of the small molecule per kilogram of subject or sample weight (e.g., about 1
microgram per
92
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
kilograin to about 500 milligrams per kilogram, about 100 micrograms per
kilogram to about
milligrams per kilogram, or about 1 microgram per kilogram to about 50
micrograms per
kilogram).
6. EXAMPLES
[0257] The following examples are presented by way of illustration of the
present
invention, and is not intended to limit the present invention in any way. In
the examples, to
show the structural relationships ainong the antibodies, a naming scheme
illustrated in Fig. 23
is used. In the naining scheme, the first 3 characters identify the antigen
binding domain: the
capital letter designates the target, the lower case letter designates a
particular epitope of the
target, the number designates the variant of the antibody (for simplicity
reasons, number 0 is
often omitted). The last 4 characters identify the Fc domain: the first 3
characters identify the
source and subclass of the Fc domain, the last lower case letter designates
the Fc variant. The
example in FIG. 23, Aal-hG1a, thus identifies the "1" variant of an antibody
that binds
epitope "a" of target "A" and has variant "a" of a human gamma-1 (hGl) as its
Fc domain.
Such a naming scheme allows easy deterinination, e.g., that antibodies Aa-hGl
and Aal-hGl
are different variants of an antibody that both bind to the same epitope of
the same target and
have the same Fc domain, or that antibodies Aa-hGl and Ab-hGl are different
antibodies that
bind to different epitopes of the same target and have the same Fc region, and
so on.
6.1. EXAMPLE 1: Contribution Of Fab And Fc Domains To Tm Values And Stability
[0258] The Fab and Fc fragments of Ca-hG1 and Ba-hG1 were generated in order
to
learn more about the properties of the antibody Components. One long-term goal
in studies
of intact Mabs and their fragments is to understand the relationship between
stability and
structure. Currently it is known that Ca-hG1 is more stable with respect to
aggregation when
compared to Ba-hGl. This stability is further confirmed using the battery of
analytical
stability indicating assays. This stability difference offers an opportunity
to compare
properties of each antibody and to determine if there are measurable
differences that can be
exploited to understand the stability of these specific Mabs and more broadly
applied to
additional antibodies.
[0259] Fab and Fc domains were generated from full Mabs Ca-hGl and Ba-hG1
using papain. A commercial kit from Pierce (Immunopure Fab Preparation Kit
Pierce
product # 44885: Immunopure IgG Binding Buffer, Immunopure IgG Elution Buffer,
93
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
Affinitypak Immobilized Protein A Column, Iminobilized Papain, Cysteine
Monohydrochloride, Phosphate Buffer, and Serum Separators) was used to digest
the intact
antibodies. Ca-hGl was successfully digested using the method described in the
kit. Ba-hGl
required an alternate chromatography step. For Ba-hGl, both the Fab and Fc
bound to the
protein A column. Purification of these components required anion exchange
chromatography (Hitrap DEAE FF 5 ml -Amersham Product #17-5154-01). In
addition to
chromatography optimization, enzymology was optimized to achieve the best
cleavage of the
Mab in a reasonable time.
[0260] Fab and Fc domains were generated from Ca-hGl using the following
steps:
A) adding antibody to papain and incubating overnight at 37 C, - 10 mg of IgG
per
digestion; B) separating crude digest from immobilized enzyine; C) applying
digest to
protein A column; D) eluting the Fab fraginent in unretained fraction at pH-
8.0; E) eluting the
Fc fragment at pH-3.0; and F) dialyzing the fragments into a required buffer.
[0261] Fab and Fc domains were generated from Ba-hGl using the above procedure
with the following modification: Using double enzyme to Mab ratio, increasing
agitation,
increasing incubation time to 24 hrs, omitting protein A column, buffering
exchange digested
solution into equilibration buffer for DEAE column (Start Buffer: 10 mM NaCI,
10 mM Tris
pH-7.8, Elution Buffer: 100 mM NaCl, 10 mM Tris pH-7.8). The Fab portion of
the antibody
was in the unretained fraction which was eluted during sample loading. The Fc
fragment was
eluted with the 100 mM NaCl buffer. Table 1 summarizes the Fab and Fc
fragments obtained
by the procedures.
Table 1. Fab And Fe Obtained
Fragment Ca-hG1 Ba-hG1
Fab Purified No Recovery
Fc Purified Fc +Fab Mix
[0262] Differential Scanning Calorimetry (DSC) was used to examine the melting
curve of the full length monoclonal antibody (Mab) Ca-hGl (FIG. 1, Top).
Deconvolution of
the thermogram of the full length Mab reveals that at least three separate Tm
values (Tml =
69 C, Tm2 = 83 C And Tm3 = 87 C) make up the curve (FIG. 2). Fab and Fc domain
fraginents were generated from Ca-hGl and the purified fragments were analyzed
individually by DSC (FIG. 1, bottom). The results show that individual Tm
values in a full
antibody may be assigned to individual domains with the largest peak generated
by the Fab
domain (FIG. 1 bottom, also see FIG. 10 bottom). Analysis of the peaks
generated by the Fc
94
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
domain indicate that the Tin of the CH2 region is represented by the first
pealc in the Fc DSC
profile and the Tm of the CH3 region is represented by the second peak (FIG. 1
bottom, also
see FIG. 10 bottom).
[0263] The reversibility of melting was exainined at two different
temperatures for
the full length Ca-hGl Mab (FIGS. 3 and 4), The Fab domain (FIGS. 5 and 6) and
the Fe
domain (FIGS. 7 and 8). The results show that instability of the full antibody
is a result of
the instability of the Fab domain.
[0264] The DSC profiles of an unrelated full length Mab, Ba-hGl, were also
measured and compared to Ca-hG1 (FIG. 9). To determine which domain
contributes the
most to the differences in the Tm profile, The DSC profiles of the Fab and Fc
domains of Ba-
hGl were deterinined individually. In FIG. 10, the top panel shows the DSC
profile for the
intact Ba-hGl antibody and the bottom panel shows the profiles for the Fe and
Fab domains.
As was seen for Ca-hGl, the largest peak is generated by the melting of the
Fab domain. As
expected, the Fe region generated two smaller peaks which correspond to those
seen for the
identical Fe region isolated from Ca-hGl (compare FIG. 1 and 10, bottom
panels).
Deconvolution of the full antibody DSC profile indicates that at least three
separate Tm
values (Tinl = 71 C, Tm2 = 82 C And Tm3 = 93 C) make up the curve of full
length Ba-hGl
(FIG. 11). The reversibility of melting was examined for the full length Ba-
hGl Mab (FIGS.
12 and 13), The Fab domain (FIGS. 14 and 15) and the Fc domain (FIG. 16). The
results also
indicate that instability of the full antibody is a result of the instability
of the Fab domain.
[0265] A comparison of the DSC profiles of Ba-hGl and Ca-hGl shows that the
Fab
domain contributes the most to the difference between the profiles for the two
different Mab
molecules (compare FIG. 1, bottom panel and FIG. 9, bottom panel). The results
show that
Ba-hGl is less stable than Ca-hGl because the Fab domain of Ba-hG1 is less
stable than the
Fab domain of Ca-hGl. Thus, the stability of an antibody may be predicted by
evaluating the
stability of the Fab domain.
6.2. EXAMPLE 2: Examination Of The Contribution Of The Variable Domain To Tm
And pI Values
[0266] Fab fragments from 6 individual antibodies, several of which recognize
the
same epitope (Ca-hGl, Cal-hG1 and Cal-hGla) were isolated. The Tm and pl for
each was
determined. The Fab fragments from Ca-hGl and Cal-hGl differ by only about 13
amino
acids, while Cal-hGl and Cal-hG1a differ by only 3 amino acids. These three
highly related
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
molecules show only small differences in their pI and Tm values. In contrast,
the completely
unrelated molecules, Aa-hGl, Ba-hGl and Da-hGl, show very different profiles
(FIG. 17).
[0267] To examine the contribution of the Fab region to Tm and pI values in
the
context of a full length antibody, 18 individual Fab clones isolated from a
single phage
display library were converted into full length IgGl and purified from
transient transfections.
These molecules differ only in their variable regions. The subsequent analysis
of these
clones demonstrate that they have a wide range of characteristics. For
example, they exhibit
dissociation constants (Kd) between a high of about 330 nM to a low of just 22
nM (data not
shown). The Tm values of the Fab fragments, determined by DSC analysis of the
intact
antibodies, range from a low of just about 70 C to a high of about 90 C (FIGS.
18B and
18C). pI values of the intact antibodies also showed a wide range with the
antibodies having
pl values from 7.8 - 9.0 (FIGS. 18A and 18C).
[0268] FIG. 19 shows Tm and pI values of an additional panel of antibodies
that bind
to a variety of different epitopes present on a single protein as well as the
previously analyzed
Cal-hGl and two chimeric antibodies (Ha-hGl, Ia-hGl) generated by combining
the heavy
and light chains from two different antibodies. These antibodies also have a
common Fc
domain and vary only in their Fab domains. As was seen above, the different
Fab domains
result in a wide range of both pI and Tm values. In contrast, FIG. 20 shows
the Tm and pI
values of a panel of antibodies which differ by only a few amino acids in the
hinge domain.
These hinge variants, which have identical Fab domains, vary little in either
their pI or Tm.
Note that for the hinge variants for which a pI was determined, the amino acid
changes made
did not alter the net charge based on amino acid sequence.
[0269] FIG. 21 shows the viscosities of a 100 mg/mL solution of Ca-hGl, Cal-
hGl,
Ba-hGl and Da-hGl as a function of temperature. It can be seen that the
antibody with the
lowest pI, Da-hGl, had the highest viscosity under the conditions measured.
Also shown is
the viscosity of Ba-hGl as a function of temperature at increasing
concentrations (100, 126,
138 and 150 mg/mL). The higher the concentration the higher the viscosity of
the antibody
solution. Accordingly, for the formulation of high concentration liquid
formulations it is
generally desirable to use an antibody with a lower inherent viscosity. These
studies indicate
that the pI of an antibody provides a measure indicative of the viscosity of
the antibody in
solution.
[0270] FIG. 22A shows the aggregation rates of the Ba-hGl, Ca-hGl, Cal-hGl and
Da-hGl antibodies at -40 C as a function of the Tm of the Fab. It can be seen
that the
96
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
aggregation rate increases for antibodies having a lower Fab Tm. As shown in
Table 2 this
trend is also consistent for these molecules when stored at room temperature
(25 C) and 5 C.
These results indicate that increased Fab Tm values correlate with reduced
aggregation rates
over a wide temperature range. Two of these antibodies, Ba-hG1 and Ca-hGl,
were chosen
for further analysis.
[0271] The Fab and Fc fragments of Ba-hGl and Ca-hGl were isolated and the
stability at 40 C of each fragment was exainined. FIG 22B shows the
aggregation profiles of
the Fab and Fe fragments of Ba-hG1 and Ca-hGl over time at 40 C. The ratio of
the
aggregation rates of both the Fab fragments and the full length Mabs are shown
in Table 2.
The ratio for the Fab fragments (Ba-hGl/Ca-hGl) is about 2.8 which is similar
to ratio of the
aggregation rates for the intact antibodies, about 2.4 (see Table 2). The
aggregation rate of
the Fe region is similar to that seen for the Ba-hGl Fab fraginent. Together
these data
indicate that the Fab domain plays a significant role in the formation of
aggregates in the
intact antibodies and that the aggregation rate of the intact antibody is
influenced by the Tm
of the Fab domain. Furthermore, these data also indicate that an increase in
the Tm of the
Fab region reduced the tendency for an antibody to aggregate over time and
results in a more
stable molecule. Accordingly, rapid screening by heating a cooling cycles
using DSC can be
used as a measure for the propensity of and antibody to form aggregate upon
storage.
Table 2. Aggregation Rates
Aggregation Rate (% aggregate/month)
MAb 20 C 5 C 40 C Ratio
Ba-hGl 0.19 0.06 Fab of Ba-hGl to Fab of Ca-hG1 2.8
Da-hGl 0.25 0.04 Mab of Ba-hGl to Mab of Ca-hGl 2.4
Ca-hGl 0.08 0.01
Cal-hGl 0.06 0.02
[0272] These results show that antibodies with various preferred
characteristics can
be screened using relevant in vitro and in vivo studies to determine the most
desirable
combination of characteristics. For example, for targeting a particular
target, e.g., target "E",
a panel of antibodies that bind different antigens of the target, have
different Tm values, and
97
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
different pI values may be screened to obtain one or more that have desired
combinations of
these characteristics.
6.3. EXAMPLE 3: Examination Of The Contribution Of The Fe Hinge Region To Tm
And pI Values
[0273] A number of different inutations were generated in the hinge region of
the
antibody Fa6-hGl. The Tin of the Fab domain of the parental antibody and each
hinge
mutant was determined by DSC analysis of the intact antibodies (FIG. 20). In
addition, the pI
values of the parent and several of the mutants were detennined (FIG. 20).
Note that for the
hinge variants for which a pI was determined, the amino acid changes made did
not alter the
net charge based on amino acid sequence and as expected has little effect on
the pI. In
addition, the Tm values for these closely related molecules are nearly
identical indicating that
the sequence of hinge has little influence on the Tm of the Fab.
6.4. EXAMPLE 4: Engineering The Fc Domain To Alter The pI
[0274] A series of amino acid residue substitutions were generated in the Fc
domain
(human IgGl) of an anti-IL9 antibody to raise or lower the isoelectric point
(pI). The
substitutions were selected to have minimal impact on effector functions such
as antibody-
dependent cell-mediated cytotoxicity (ADCC) and complement-dependent
cytotoxicity
(CDC). The substitutions were also chosen to prevent disruption of the binding
sites for
protein A (a protein used for antibody purification) and FcRn (a receptor that
mediates IgG
homeostasis). Using the crystal structure of the human Fc as a guide, residues
in the
following regions: 339-375 and 390-414' (using the EU numbering scheme as
described in
Kabat et al., 1991, NIH Publication 91-3242, National Technical Information
Service,
Springfield, VA) were selected for substitution. Within these regions,
prolines were excluded
as possible sites for substitution because of the likelihood that prolines are
necessary to
maintain the protein fold. Ribbon diagrams of the human Fc CH2-CH3 regions are
shown in
Figures 24 and 25. The red indicates a region where mutations may affect C 1
q, FcyR, FcRn,
and protein A binding, the blue indicates a region where substitutions may
affect FcyR and
FcRn binding, and the green indicates a region where substitutions may affect
FcRn and
protein A binding. The yellow region is where the two CH3 domains pack against
each
other. The location of the residues selected for substitution are indicated in
pink and are
space filled.
98
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0275] The pI of a protein is defined as the pH at which the protein carries
no net
charge. At a pH below the protein's pI, the protein carries a net positive
charge and at a pH
above the protein's pI the protein carries a net negative charge. The acidic
amino acids
aspartic acid (D) and glutamic acid (E) are deprotonated at or near
physiological pH and
carry a negative charge. The basic amino acids lysine (K-) and arginine (R)
are protonated at
or near physiological pH and carry a positive charge. At each ainino acid
residue of a
protein, there are two possible changes that can be made: charged residues can
be changed to
uncharged residues or residues with the opposite charge and uncharged residues
can be
changed to residues with either a positive or negative charge. The maximum
change in
charge that can occur is where an amino acid is substituted with another amino
acid of
opposite charge. Replacing a charged residue with an uncharged residue serves
only to
remove charge, not add opposite charge and is less effective than replacing a
cliarged residue
with one of opposite charge. Substitutions of D and E with either K or R, or
vice versa, are
likely to have the greatest impact on pI. When choosing what residue should
substitute for a
given residue in the wild type sequence, the MHC type II immunogenicity of the
new residue
was checked using the website:
http://www.syfpeithi.de/scripts/MHCServer.dll/hoine.htm. It
was discovered that introducing a polar uncharged residue for a charged
residue was less
likely to be immunogenic than introducing a nonpolar residue for a charged
residue.
[0276] Five sites were initially chosen for substitution, K340, E345, R355,
Q362,.and
D401 (Figure 24). Site-directed mutagenesis was performed on the anti-IL9
antibody using a
Stratagene QuikChange II XL kit. The modified antibodies were produced in 293H
cells and
purified using protein A. Isoelectric focusing gels (IEF) were run to
deterinine the pI
changes. The IEF gels are shown Figures 26 and 27 and the pI values and net
changes are
summarized in Table 3. The trend for pI changes was as expected. The wild type
produced
in 293H cells was used as a basis for comparison in Figures 26 and 27. The pI
of wild type
produced in NSO cells was found to be nearly identical to that seen for
antibody produced in
293H cells (Figure 27, compare lanes 1 and 2). K340E had a lower pI than K340Q
and both
of these were lower than the pI of the wild type. The same pattern was
observed for R355E
and R355Q. E345K had a higher pI than E345Q and both of these mutants had a
higher pI
than wild type. This same pattern was also observed for D401K and D401N.
Replacement
of the residue Q362, which does not carry a charge, with E lowered the pI and
replacement of
the residue Q362 with K increased the pI. The largest magnitude change that
lowered the pI
was -0.62, R355E, and the largest magnitude change that increased the pI was
0.47, E345K.
99
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0277] After analyzing that data on the single substitutions, combinatorial
substitutions were made. As expected, combinatorial substitutions had a
greater impact on pI
than single mutations alone (Figure 27 and Table 3). The K340E R355E double
substitutions
showed a larger decrease in charge than the R355E Q362E double substitutions (-
1.03 and -
0.82, respectively). This decrease resulted from the switching in charge of
two residues
while in the R355E Q362E double substitution only the residue R355 was
switched to its
opposite charge. Both the E345K D401N and E345K D401K double substitution gave
a
greater magnitude increase in pI than any of the single inutations (0.68 and
0.62,
respectively), although switching the charge of both residues didn't result in
a greater
increase in the pI. Their pls fall very close to each other and are probably
within the
experimental error of the gel (note the smearing of the band in Figure 27).
The K340E
R355E Q362E and K340Q R355E Q362E triple substitutions followed the expected
pattern
and had the largest pI decreases of any of the substitutions. The E345K Q362K
D401K and
E345K Q362K D401N triple substitutions ran off the gel shown in Figure 27
which
suggested that their pls were largely increased.
[0278] Several additional sites for substitution, G341, Q342, R344, E356,
M358,
T359, N361, L365, N390, L398, and K409, were also chosen (Figure 25). The pI
could not
be determined for the M358K substitution because the proteins were too faint
to make a clear
determination. The change in pI for the remaining substitutions followed the
same trends as
was seen for the first set of single substitutions (Figure 28 and Table 3).
These data
demonstrate that targeted substitutions within the Fc domain are useful for
engineering the pI
of an antibody. In addition, these data indicate that targeted substitutions
will prove useful
for engineering the pI of other therapeutic molecules such as Fc fusion
proteins.
[0279] Differential Scanning Calorimetry (DSC) was used to exainine the
melting
curves of the single and triple substitutions to examine the effect of each
substitution on the
Tm of the substituted antibodies. The E345Q, E345K, R355Q, R335E, Q362E and
Q362K
substitutions have similar Tm profiles as wild type (Figure 30, left panel),
while the K340Q,
K340E and D401K substitutions resulted in altered Tm profiles (Figure 30,
right panel). The
triple substitutions, which both contain a substitution at position D401, show
a similar
alteration in Tm profiles as the single substitution D401K (compare Figure 30,
left panel and
Figure 31). These results indicate that substitutions may be selected to both
engineer the pI
and the Tm of protein domains such as, for example, the Fc domain.
Table 3. Isoelectric points of single, double, and triple mutants.
100
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
Name pl pl Change from WT Charge Change from,WT
Wild Type 8.15 0 0
K340Q 7.88 -0.27 -1
K340E 7.57 -0.58 -2
E345Q 8.37 0.22 1
E345K 8.62 0.47 2
R355Q 7.79 -0.36 -1
R355E 7.53 -0.62 -2
Q362E 7.83 -0.32 -1
Q362K 8.36 0.21 1
D401 N 8.34 0.19 1
D401 K 8.49 0.34 2
K340E R355E 7.12 -1.03 -4
R355E Q362E 7.33 -0.82 -3
E345K D401 N 8.83 0.68 3
E345K D401 K 8.77 0.62 4
K340E R355E Q362E 6.80 -1.35 -5
K340Q R355E Q362E 6.99 -1.16 -4
E345K Q362K D401 K ND' ND~ 5
E345K Q362K D401 N ND~ ND~ 4
Q342E 7.88 -0.27 -1
Q342K 8.32 0.17 1
R344Q 7.90 -0.25 -1
R344E 7.66 -0.49 -2
E356Q 8.31 0.16 1
E356K 8.59 0.44 2
L365Ea 8.20 0.05 -1
L365Ka 8.22 0.07 1
L398E 7.92 -0.23 -1
L398K 8.31 0.16 1
K409Qa 7.93 -0.22 -1
K409Ea 7.77 -0.38 -2
G341D 7.97 -0.18 -1
G341K 8.45 0.3 +1
M358E 7.95 -0.2 -1
M358K ND$ ND$ +1
T359E 7.94 -0.21 -1
T359K 8.45 0.3 +1
N361D 7.90 -0.25 -1
N361K 8.44 0.29 +1
N390D 7.90 -0.25 -1
N390K 8.39 0.24 +1
E345KQ362K 8.73 0.58 +3
athis position is a buried residue
ND~ indicates that the value could not be determined using the present IEF gel
method likely equal to
or more than 9.0
ND$ indicates that the value could not be determined because the proteins did
not run clearly on the
gel or was too faint
101
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
6.5. EXAMPLE 5: pl and Tm Analysis For Candidate Selection
[0280] Two variants of an antibody, designated Fa-hGl, were generated for
consideration as clinical candidates. For ease of administration high
concentration liquid
formulations are desired. The first variant, designated Fa-hGlb, was generated
by making
several substitutions in the Fc region of the molecule, one of which (L235E)
reduces the
charge by 1.0 and is expected to modestly reduced the pI (see Example 4
above). The second
variant, designated Fa-hG4a, was generated by replacing the human IgG1 Fc
region with a
human IgG4 Fc region and engineering several substitutions including L235E.
Based on
amino acid sequence analysis Fa-hG4a will have a charge change of -4 coinpared
to the wild
type antibody. The three antibodies were analyzed to deterinine their Tin and
pI values.
[0281] The DSC profiles of each antibody are shown overlaid in Figure 32. As
described above, the Tm of the largest peak is used as the Tin of the Fab
domain. The Tm of
the Fab domain of the parental antibody was seen to be 70.4 C and the Tm of
the Fa-hG4a
and Fa-hGlb variants was 70.4 C and 70.9 C, respectively. These data
demonstrate that the
alterations of the Fc region did not change the major Tm peak of the Fab
region. However,
the DSC profile of Fa-hG4a dropped off dramatically above -71 C indicating
that this
antibody may have precipitated due to instability introduced by the addition
of the variant
IgG4 Fc region.
[0282] Isoelectric focusing gels (IEF) were run to determine the pI of each
antibody.
The wild type antibody had a pl of -8.35 (position of the major protein peak
in Figure 33).
The Fa-hGlb variant showed a modest reduction to -8.18 while the pl of Fa-hG4a
was
significantly reduced to -7.13 (Figure 33). The reduction in pl seen for the
Fa-hGlb variant
is in agreement with the change in pl seen for siinilar substitutions (see
Table 3). The Fa-
hG4a variant had a net pI change of -1.22 and a total charge change of -4
which is also in
agreement with the change in pl seen for similar substitutions (see Table 3).
[0283] For selection of a clinical candidate, both the Tm and the pI of the
antibody
are taken into account. In this case, although the Tm of the Fab domain for
eacll of the
variants differed by less then 0.5 C, the DSC profile of the Fa-hG4a antibody
indicated that
this variant may be subject to some additional instability. Analysis of the pl
revealed that the
Fa-hG4a variant had a relatively low pl (-7.13). Accordingly, based on the
correlation of
low pI with increased viscosity and the potential instability revealed by DSC
analysis of the
Fa-hG4a variant, the Fa-hGlb variant was selected as a clinical candidate.
102
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
6.6. Methods
[0284] Isoelectric Focusinz Gel Electrophos-esis: Isoelectric points were
determined
using a Pharmacia Biotech Multiphor 2 electrophoresis system with a multi
teinp 3
refrigerated bath recirculation unit and an EPS 3501 XL power supply. Pre-cast
ainpholine
gels (Amersham Biosciences, pI range 2.5-10 or pI range 3.5-9.5) were loaded
with 5-8 g of
protein. Protein samples were dialyzed in 10 mM Histidine pH-6 before loading
on the gel as
required. Broad range pI marker standards (Ainershain, pI range 3-10, 8 L)
were used to
determine relative pI for the Mabs. Electrophoresis was performed at 1500 V,
50 mA for 105
minutes. The gel was fixed using a Sigma fixing solution (5x) diluted with
purified water to
1x. Staining was performed overnight at room temperature using Simply Blue
stain
(Invitrogen). Destaining was carried out with a solution that consisted of 25%
ethanol, 8%
acetic acid and 67% purified water. Isoelectric points were determined using a
Bio-Rad's
GS-800 calibrated densitometer relative to calibration curves of the
standards.
[0285] Differential Scanning Calorimetfy: Thennal melting temperatures (Tin)
were
measured with a VP-DSC (MicroCal, LLC) using a scan rate of 1.0 C/min and a
temperature
range of 25 -120 C. A filter period of 8 seconds was used along with a 5-15
minute pre-scan
thermostating. Samples were prepared by dialysis into 10 mM Histidine-HCI, pH
6 using
Pierce dialysis cups (3.5 kD). Average Mab concentrations were 50 g/mL to 790
g/mL as
determined by A280. Melting temperatures were determined following
manufacturer
procedures using Origin software supplied with the system. Briefly, multiple
baselines were
run with buffer in both the sample and reference cell to establish thermal
equilibrium. After
the baseline was subtracted from the sainple thermogram, the data were
concentration
normalized and fitted using the deconvolution function.
[0286] Viscosity deter'naination: Viscosity of mAB solutions were performed
using a
ViscoLab 4000 Viscometer System (Cambridge Applied Systems) equipped with a
ViscoLab
Piston (SN:7497, 0.3055", 1-20 cP) and S6S Reference Standard (Koehler
Instrument
Company, Inc.). The viscometer was connected to a water bath and the systein
equilibrated
to 20 C. Piston was checked using S6S viscosity reference standard (8.530 cP @
20.00 C).
Check piston was also checked using RODI H20 (1.00 cP @ 20.0 C). The piston
was
cleaned and rinsed thoroughly with soap and water between measurements of each
different
solution type. The system was then cooled to < 2 C. When the system
temperature was at or
below 2 C, sample was loaded into the chamber and the piston was lowered into
the sample.
103
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
After sample was equilibrated to the temperature of the chamber, measureinent
was initiated.
The temperature was increased at 1 C increments every 7-10 minutes to a final
temperature
of > 25 C. The temperature was adjusted on the water bath but the recorded
temperature was
what was displayed on the viscometer. The viscosity result was recorded
iminediately prior
to increasing the temperature. The piston remained in motion during
measureinents to
minimize the need for re-equilibration.
[0287] Site Directed Mutageraesis: mutagenesis was performed according to the
manufacturer's instructions using a Stratagene QuikChange II XL kit and the
primers listed in
Table 4.
Table 4. Primers used for site directed mutagenesis
Primer Sequence$ SEQ ID NO.
K340Q-F CCATCTCCAAAGCCCAGGGGCAGCCCCGAGAACC 1
K340Q-R GGTTCTCGGGGCTGCCCCTGGGCTTTGGAGATGG 2
K340E-F CCATCTCCAAAGCCGAGGGGCAGCCCCGAGAACC 3
K340E-R GGTTCTCGGGGCTGCCCCTCGGCTTTGGAGATGG 4
E345Q-F GCCAAAGGGCAGCCCCGACAGCCACAGGTGTACACCC 5
E345Q-R GGGTGTACACCTGTGGCTGTCGGGGCTGCCCTTTGGC 6
E345K-F GCCAAAGGGCAGCCCCGAAAGCCACAGGTGTACACCC 7
E345K-R GGGTGTACACCTGTGGCTTTCGGGGCTGCCCTTTGGC 8
R355Q-F CCCTGCCCCCATCCCAGGAGGAGATGACCAAGAACC 9
R355Q-R GGTTCTTGGTCATCTCCTCCTGGGATGGGGGCAGGG 10
R355E-F CCCTGCCCCCATCCGAGGAGGAGATGACCAAGAACC 11
R355E-R GGTTCTTGGTCATCTCCTCCTCGGATGGGGGCAGGG 12
Q362E-F GGAGATGACCAAGAACGAGGTCAGCCTGACCTGCC 13
Q362E-R CCAGGCAGGTCAGGCTGACCTCGTTCTTGGTCATCTCC 14
Q362K-F GGAGATGACCAAGAACAAGGTCAGCCTGACCTGCC 15
Q362K-R CCAGGCAGGTCAGGCTGACCTTGTTCTTGGTCATCTCC 16
D401 N-F CGCCTCCCGTGCTGGACTCCAACGGCTCCTTCTTCC 17
D401 N-R GGAAGAAGGAGCCGTTGGAGTCCAGCACGGGAGGCG 18
D401 K-F CGCCTCCCGTGCTGGACTCCAAGGGCTCCTTCTTCC 19
D401K-R GGAAGAAGGAGCCCTTGGAGTCCAGCACGGGAGGCG 20
L365E-for GACCAAGAACCAGGTCAGCGAGACCTGCCTGGTCAAAGGC 21
L365E-rev GCCTTTGACCAGGCAGGTCTCGCTGACCTGGTTCTTGGTC 22
L365K-for GACCAAGAACCAGGTCAGCAAGACCTGCCTGGTCAAAGGC 23
L365K-rev GCCTTTGACCAGGCAGGTCTTGCTGACCTGGTTCTTGGTC 24
K409Q-for GCTCCTTCTTCCTCTATAGCCAGCTCACCGTGGACAAGAGC 25
K409Q-rev GCTCTTGTCCACGGTGAGCTGGCTATAGAGGAAGAAGGAGC 26
K409E-for GCTCCTTCTTCCTCTATAGCGAGCTCACCGTGGACAAGAGC 27
K409E-rev GCTCTTGTCCACGGTGAGCTCGCTATAGAGGAAGAAGGAGC 28
Q342E-for CCATCTCCAAAGCCAAAGGGGAGCCCCGAGAACCACAGGTG 29
Q342E-rev CACCTGTGGTTCTCGGGGCTCCCCTTTGGCTTTGGAGATGG 30
Q342K-for CCATCTCCAAAGCCAAAGGGAAGCCCCGAGAACCACAGGTG 31
Q342K-rev CACCTGTGGTTCTCGGGGCTTCCCTTTGGCTTTGGAGATGG 32
R344Q-for CTCCAAAGCCAAAGGGCAGCCCCAGGAACCACAGGTGTACACCC 33
R344Q-rev GGGTGTACACCTGTGGTTCCTGGGGCTGCCCTTTGGCTTTGGAG 34
R344E-for CTCCAAAGCCAAAGGGCAGCCCGAGGAACCACAGGTGTACACCC 35
R344E-rev GGGTGTACACCTGTGGTTCCTCGGGCTGCCCTTTGGCTTTGGAG 36
E356Q-for CCCTGCCCCCATCCCGGCAGGAGATGACCAAGAACCAGG 37
E356Q-rev CCTGGTTCTTGGTCATCTCCTGCCGGGATGGGGGCAGGG 38
104
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
E356K-for CCCTGCCCCCATCCCGGAAGGAGATGACCAAGAACCAGG 39
E356K-rev CCTGGTTCTTGGTCATCTCCTTCCGGGATGGGGGCAGGG 40
L398E-for CAAGACCACGCCTCCCGTGGAGGACTCCGACGGCTCCTTCTTCC 41
L398E-rev GGAAGAAGGAGCCGTCGGAGTCCTCCACGGGAGGCGTGGTCTTG 42
L398K-for CAAGACCACGCCTCCCGTGAAGGACTCCGACGGCTCCTTCTTCC 43
L398K-rev GGAAGAAGGAGCCGTCGGAGTCCTTCACGGGAGGCGTGGTCTTG 44
G341 D-F CCATCTCCAAAGCCAAAGACCAGCCCCGAGAACCACAGG 45
G341 D-R CCTGTGGTTCTCGGGGCTGGTCTTTGGCTTTGGAGATGG 46
G341 K-F CCATCTCCAAAGCCAAAAAGCAGCCCCGAGAACCACAGG 47
G341 K-R CCTGTGGTTCTCGGGGCTGCTTTTTGGCTTTGGAGATGG 48
M358E-F CCCCCATCCCGGGAGGAGGAAACCAAGAACCAGGTCAGCC 49
M358E-R GGCTGACCTGGTTCTTGGTTTCCTCCTCCCGGGATGGGGG 50
M358K-F CCCCCATCCCGGGAGGAGAAGACCAAGAACCAGGTCAGCC 51
M358K-R GGCTGACCTGGTTCTTGGTCTTCTCCTCCCGGGATGGGGG 52
T359E-F CCATCCCGGGAGGAGATGGAGAAGAACCAGGTCAGCC 53
T359E-R GGCTGACCTGGTTCTTCTCCATCTCCTCCCGGGATGG 54
T359K-F CCATCCCGGGAGGAGATGAAGAAGAACCAGGTCAGCC 55
T359K-R GGCTGACCTGGTTCTTCTTCATCTCCTCCCGGGATGG 56
N361 D-F CCCGGGAGGAGATGACCAAGGACCAGGTCAGCCTGACCTGC 57
N361 D-R GCAGGTCAGGCTGACCTGGTCCTTGGTCATCTCCTCCCGGG 58
N361 K-F CCCGGGAGGAGATGACCAAGAAGCAGGTCAGCCTGACCTGC 59
N361 K-R GCAGGTCAGGCTGACCTGCTTCTTGGTCATCTCCTCCCGGG 60
N390D-F GCAATGGGCAGCCGGAGAACGACTACAAGACCACGCCTCCCG 61
N390D-R CGGGAGGCGTGGTCTTGTAGTCGTTCTCCGGCTGCCCATTGC 62
N390K-F GCAATGGGCAGCCGGAGAACAAGTACAAGACCACGCCTCCCG 63
N390K-R CGGGAGGCGTGGTCTTGTACTTGTTCTCCGGCTGCCCATTGC 64
$ Underlined indicates location of mutation
[0288] Expression and Purification of Mutated anti IL9 Antibodies: 293H cells
were
grown in Dulbecco's Modified Eagle Medium (DMEM) liquid (4.5 g/L D-glucose),
with L-
glutamine, and pyridoxine HCI, but no sodium pyruvate, plus 1% nonessential
amino acids
plus 10% fetal bovine serum. Transfections were performed by mixing 20,ug of
each of the
heavy and light chain vectors per T175 flask (two flasks were used per mutant)
with 1.5 ml of
Opti-MEM I. This mixture was then combined with 1.5 ml of Opti-MEM I
containing 70 ,ul
of Lipofectamine 2000 and left to sit at room temperature for %2 hour. Three
mis of this
mixture was added to a T175 containing 27 mis of DMEM plus 1% nonessential
ainino acids
plus 5% ultra low bovine IgG fetal bovine serum. Three harvests were performed
spaced
three days apart. The harvested media was then spun at 1000 rpm and filtered
through a 0.2
pm filter. Next, the antibodies were purified using protein A and were
concentrated to
between 0.1 and 1 mg/ml. Samples were dialyzed into 10 mM Histidine pH 6 and
protein
concentration adjusted to approximately 1 inghnl.
[0289] Stability oflntactAntibodies: Intact antibodies were concentrated to
100
mg/ml in 10 mM Histidine pH 6. Samples were incubated at three temperatures 2-
8 C, 23-
27 C, and 38-42 C and analyzed by SEC at predetermined time points. Samples
were diluted
to 10 mg/ml and 250 gg was injected onto the SEC column (see, SEC Analysis).
105
CA 02614181 2007-12-31
WO 2007/005612 PCT/US2006/025590
[0290] Stability of Fab and Fc Frag-,nients: Fab and Fc fragments were
isolated using
papain digestion followed by column chromatography (also see, Example 1). The
antibodies
studied all had the same Fc region. Sample purity was analyzed and confirmed
by SDS-
PAGE and SEC. Fab and Fc fragments in 10 mM Histidine pH 6 were concentrated
to 50
mg/inl. The concentrated material was incubated at 38-42 C and sampled to
monitor
aggregate. The sample was diluted to 2 mg/ml and 70 g was injected onto the
SEC column
(see, Size Exclusion Chromatography (SEC) Analysis).
[0291] Size Exclusion Claromatozf aphy (SEC) Anal sis: SEC analysis was
conducted
on an Agilent 1100 High Performance Liquid Chromatography (HPLC) System with a
flow
rate of 1 mL/min. A TOSOH BIOSEP TSK G3000SWXL column (7.8 mm x 30 cm) with
guard column was used for the analysis. The mobile phase consisted of 100 mM
Sodiuin
Phosphate Dibasic Anhydrous, 100 mM Sodium Sulfate, and 0.05 % Sodium Azide pH
6.8.
7. REFERENCES CITED
[0292] All references cited herein are incorporated herein by reference in
their
entirety and for all purposes to the same extent as if each individual
publication or patent or
patent application was specifically and individually indicated to be
incorporated by reference
in its entirety for all purposes. In addition, United States provisional
Patent Application Nos.
60/696,113 filed July 1, 2005 and 60/788,692 filed April 4, 2006 are
incorporated by
reference in their entirety for all purposes.
[0293] Many modifications and variations of the present invention can be made
without departing from its spirit and scope, as will be apparent to those
skilled in the art. The
specific embodiments described herein are offered by way of example only, and
the invention
is to be limited only by the terms of the appended claims along with the full
scope of
equivalents to which such claims are entitled.
106
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
