Note: Descriptions are shown in the official language in which they were submitted.
CA 02616940 2008-01-30
1
NOVEL SERINE PROTEASE BSSP2
This application is a divisional of Canadian Patent
Application 2,350,080, which is derived from national phase
entry of International Patent Application PCT/JP99/06475.
FIELD OF THE INVENTION
The present invention relates to isolated
polynucleotides of human and mouse serine proteases
(hereinafter referred to as "hBSSP2" and "mBSSP2",
respectively, and, in the case when no differentiation from one
another is needed, these are simply referred to as "BSSP2"), and
their homologous forms, mature forms, precursors and
polymorphic variants as well as a method for detecting
thereof. Further, it relates to hBSSP2 and mBSSP2 proteins,
compositions containing hBSSP2 and mBSSP2 polynucleotides
and proteins, as well as their production and use.
BACKGROUND OF THE INVENTION
In general, proteases are biosynthesized as
inactive precursors. They undergo limited hydrolysis in
molecules to convert into activated type proteases. In so
far as enzymes are proteases, they have an activity for
hydrolyzing a peptide bond, while their action modes are
varied according to the type of protease. According to a
particular kind of catalytic site, proteases are divided
into serine proteases, cysteine proteases, aspartate
CA 02616940 2008-01-30
2
proteases, metal proteases and the like. Proteases of each
kind have a variety of properties, ranging from a protease
having general digestive properties to a protease having
various regulatory domains and strict substrate specificity,
thereby specifically hydrolyzing only characteristic
proteins.
Further, proteins undergo various processing even
after translation to produce active proteins. In many
secretory proteins, proteins are first synthesized on the
ribosome in cytoplasm as an inactive precursor (pro-form)
which comprises an active protein bearing at the N-terminus
thereof a peptide of about 15 to 60 amino acids responsible
for secretion (secretory signal). This peptide region
provides the mechanism for passing through the cell
membrane and is removed upon cleavage by a specific
protease during the passage through the membrane, in almost
all cases, to produce the mature form. A secretory
signal has a broad hydrophobic region comprising
hydrophobic amino acids in the middle of the sequence, and
basic amino acid residues at a site close to the N-terminus.
A secretory signal is a synonym of a signal peptide. In
addition, in some proteins, a peptide moiety which
functions as a secretory signal is further attached to the
N-terminus of the inactive precursor (pro-form) Such a
protein is called a prepro-protein (prepro-form).
CA 02616940 2008-01-30
3
For example, trypsin is present as a prepro-form
immediately after translation into amino acids. After
being secreted from cells, it is present as a pro-form and
is converted into active trypsin in the duodenum upon limited
hydrolysis by enteropeptidase or by trypsin itself.
The optimal pH range of serine proteases is
neutral to weak alkaline and, in general, many of them have
a molecular weight of about 30,000 or lower. All proteases
of blood coagulation, fibrinolysis and complement systems
having a large molecular weight belong to trypsin-like
serine proteases. They have many regulator domains and
form a protease cascade which is of high importance to
reactions in a living body.
Recently, cDNAs and amino acid sequences of many
novel proteases have been determined by PCR for consensus
sequences of serine proteases using oligonucleotide primers.
According to this method, novel proteases have been found
by various researchers such as Yamamura et al. (Yamanura, Y
et al., Biochem. Biophys. Res. Commun., 239, 386, 1997),
Gschwend, et al. (Gschwend, T. P. et al., Mol. Cell.
Neurosci., 9. 207, 1997), Chen et al. (Chen, Z-L, et al., J.
Neurosci., 15, 5088, 1995) and others.
SEQ ID NO: 3 of JP 9-149790 A discloses neurosin
as a novel serine protease. Neurosin has also been
reported in Biochimica et Byophysica Acta, 1350, 11-14,
CA 02616940 2008-01-30
4
1997. By this, there is provided a method for mass
production of neurosin using the serine protease gene and a
method for screening specific inhibitors using the enzyme.
In addition, the screening method has been shown to be
useful for screening medicines for treating various
diseases.
Serine proteases expressed in a brain-nerve
system such as neurosin are considered to play various
roles in the brain-nerve system. Therefore, there is a
possibility that isolation of a gene encoding a novel
protease expressed in a brain-nerve system and production
of a protein using the gene would be useful for diagnosis
or therapeutic of various diseases related to the brain-
nerve system.
Nowadays, in general, clinical diagnosis of
Alzheimer's disease is conducted based on the diagnosis
standard of DSM-IIIR and NINCDS-ADRDA (Mckhann, G. et al.,
Neurology, 34. 939, 1994) or the diagnosis standard of DSM-
IV (American Psychiatric Association; Diagnostic and
statistical manuals of mental disorders, 4th ed.,
Washington DC, American Psychiatric Association, 1994).
However, these standards are conditioned by decline of
recognition functions which causes severe disability in
daily life and social life. It is pointed out that this
diagnosis is less scientifically objective because the
CA 02616940 2008-01-30
diagnosis may be influenced by the level of an individual's
social life and further the specialty and experience of a
physician who diagnoses particular conditions. In addition,
definite diagnosis of Alzheimer's disease is conducted by
5 pathohistological analyses and, in this respect,
substantial inconsistency between clinical diagnosis and
autopsy diagnosis has been found.
At present, image diagnosis is employed as a,
supplemental means in clinical diagnosis of Alzheimer's
diagnosis and it is possible to analyze brain functions,
for example, decline of metabolism and atrophy in specific
sites such as the hippocampus, parietal lobe of cerebral cortex
and the like, which are specific for Alzheimer's disease, by
PET and SPECT. However, to define Alzheimer's disease
based on lowering of blood flow from the parietal lobe to the
temporal lobe is very dangerous. In addition, there are very few
reports showing that MRS testing is useful for patients with
dementia, including those having Alzheimer's disease. Further,
although CT-MRI image diagnosis is used, a lesion of white
matter such as atrophy of the brain, PVL or the like is not
specific for Alzheimer type dementia. Since it has been
reported that brain atrophy proceeds as a patient gets older,
the above observation is not necessarily found in Alzheimer
type dementia. Furthermore, since an image obtained by MRI
varies according to strength of the magnetic field,
CA 02616940 2008-01-30
6
performance of the apparatus and imaging conditions,
numerical data obtain in different facilities cannot be
compared with each other except atrophic change. In
addition, there is a limit to image measurement. Further,
enlargement of the ventricle can be recognized in vascular
dementia cases and there are cases wherein atrophy of the
hippocampus is observed after ischemia of basilar artery.
Under these circumstances, many researchers have
desired to develop biological diagnosis markers as a
means for providing better precision and objectivity for
clinical diagnosis of Alzheimer's disease. At the same
time, the following important roles in the future will be
expected.
1) Objective judgment systems for the effect of
medicaments for treating Alzheimer's disease.
2) Detection of Alzheimer's disease before a
diagnosis standard is met, or disease conditions are
manifested.
Further, data obtained in different facilities
should be comparable with each other using the same diagnosis
marker. Therefore, development of biological diagnosis
markers is recognized to be a most important field
of Alzheimer's disease studies and its future
prospects are highly anticipated. Approaches to development of.
biological diagnosis markers up to now are divided into
CA 02616940 2008-01-30
7
those based on constitute components of characteristic
pathological changes of Alzheimer's disease such as senile
plaque and neurofibril change, and those based on
other measures. Examples of the former include
cerebrospinal fluid tau protein, AR and its precursor, QAPP.
Examples of the latter include mydriasis test with
cholilytic drug, Apo E and other genes relating to
Alzheimer's disease. However, no good results have been obtained
thus far.
Serine proteases are also considered to play
an important role in cancer cells. The
extermination of cancer by surgical treatment or topical
irradiation of radioactive ray is difficult because of the metastasis
capability of cancer. For solid tumor cells to spread. in a
body, they must first loosen their adhesion to original
adjacent cells, followed by separating from an original
tissue, passing through other tissues to reach blood vessel
or lymph node, entering into the circulatory system through
stratum basal and endothelial layer of the vessel, leaving
from the circulatory system at some point in the body, and
surviving and proliferating in a new environment. While
adhesion to adjacent epidermal , cells is lost when
expression of cadherin, which is an intercellular adhesive
molecule of epithelium, is stopped, to break through tissues
is considered to depend on proteolytic enzymes which
decompose an extracellular matrix.
CA 02616940 2008-01-30
8
Enzymes which decompose the matrix mainly include
metal proteases (Rha, S. Y. et al., Breast Cancer Research
Treatment, 43, 175, 1997) and serine proteases.
They cooperate to decompose matrix protein such as collagen,
laminin and fibronectin. Among serine proteases known to
be involved in decomposition of the matrix, in particular,
there is urokinase type plasminogen activator (U-PA). U-PA
acts as a trigger specific for protein
decomposition chain reactions. Its direct target is
plasminogen. It is present in blood abundantly and is a
precursor of an inactive serine protease which accumulates
in reconstructed sites of tissues such as injured sites and
tumors as well as inflammatory sites. In addition,
proteases which are involved in metastasis and
infiltration of cancers, for example, a tissue factor,
include lysosomal type hydrolase and collagenase.
At present, cancer is the top cause of death in
Japan and more than 200,000 people die from cancer per year. Thus,
specific substances which can be used as markers for
diagnosis and therapy or prophylaxis of cancer are studied
intensively. Such specific substances are referred to as
tumor markers or tumor marker relating biomarkers. They
are utilized in aid of diagnosis before treatment of cancer,
for presuming carcinogenic organ and pathological tissue
type, for monitoring effect of treatment, for finding
CA 02616940 2008-01-30
9
recurrence early, for presuming prognosis, and the like.
At present, tumor markers are essential in clinical
analyses. Among them, alpha fetoprotein (AFP) which has
high specificity to hepatocellular carcinoma and yolk sac
tumor (Taketa K. et al., Tumour Biol., 9, 110, 1988), and
carcinoembronic antigen (CEA) are used worldwide. In the
future, tumor markers will be required more and more, and
it is desired to develop, for example, organ specific
markers and tumor cell specific markers which are highly
reliable in the serologic diagnosis of cancer. Up to now,
humanglandular kallikrein (hK2) which is a serine protease
expressed at human prostatic epithelial cells has been
reported as a marker for prostatic cancer. And, hK2 has
78% homology with the sequence of prostatic specific
antigen (PSA) and PSA is also used widely as a biochemical
marker of prostatic cancer (Mikolajczyk, S. d. et al.,
Prostate, 34, 44, 1998; Pannek, J. et al., Oncology, 11,
1273, 1997; Chu, T. M. et al., Tumour Biology, 18, 123,
1997; Hsieh, M. et al., Cancer Res., 57, 2651, 1997).
Further, hK2 is reported to be useful as a marker for not
only prostatic cancer but also stomach cancer (Cho, J. Y.
et al.. Cancer, 79, 878, 1997). Moreover, CYFRA (CYFRA 21-
1) for measuring cytokeratin 19 fragment in serum is
reported to be useful for lung cancer (Sugiyama, Y. et al.,
Japan J. Cancer Res., 85, 1178, 1994). Gastrin release
CA 02616940 2008-01-30
peptide precursor (ProGRP) is reported to be useful as a
tumor marker (Yamaguchi, K. et al., Japan, J. Cancer Res.,
86, 698, 1995).
5 OBJECTS OF THE INVENTION
Thus, it is desirable
to provide a novel serine protease which can be used for
treating or diagnosing various diseases such as Alzheimer's
disease (AD), epilepsy, cancer, inflammation, infertility,
10 prostatomegaly and the like in various tissues such as the
brain, lung, prostate, testicle, skeletal muscle, liver and
the like, and can be used as an excellent marker instead of
those presently used.
SUMMARY OF THE INVENTION
Under these circumstances, the present inventors
have succeeded in cloning of cDNA encoding novel human and
mouse serine proteases.
In summary, the lst feature of the present
invention is amino acid sequences of biologically active
mature serine proteases BSSP2 and nucleotide sequences
encoding the amino acid sequences.
That is, they are the amino acid sequence
composed of 238 amino acids (mature type BSSP2 (SEQ ID NO:
2)) and a nucleotide sequence encoding the amino acid
CA 02616940 2008-01-30
11
sequence (the 1st to 714th bases of SEQ ID NO: 1) In
addition, they include amino acid sequences substantially
similar to SEQ ID NO: 2 and nucleotide sequences encoding
such similar amino acid sequences. Further, they include
modified derivatives of proteins having these amino acid
sequences. An amino acid sequence substantially similar to
a given amino acid sequence used herein means an amino acid
sequence derived from the given amino acid sequence by
modification such as substitution, deletion, addition
and/or insertion of one to several amino acids while
maintaining the same property as that of the protein having
the given amino acid sequence. The modified derivative of
the proteins includes, for example, phosphate adduct, sugar
chain adduct, metal adduct (e.g., calcium adduct), the
protein fused to another protein such as albumin etc.,
dimer of the protein, and the like.
In the nucleotide sequences in the Sequence
Listing hereinafter, the symbol "n" represents that any of
the normal bases of a nucleic acid, i.e., adenine (a),
cytosine (c), guanine (g) and thymine (t) is present at
that position.
The 2nd feature of the present invention is an
amino acid sequence composed of 273 amino acids [type 1
BSSP2 (SEQ ID NO: 4)] wherein 35 amino acids of -35th to -
1st amino acids represented by SEQ ID NO: 4 are added to
CA 02616940 2008-01-30
12
the N-terminus side of the mature BSSP2 amino acid sequence
(SEQ ID NO: 2) and a nucleotide sequence encoding the amino
acid sequence (247th to 1065th bases of SEQ ID NO: 3). In
addition, this feature includes amino acid sequences
substantially similar to SEQ ID NO: 4 and nucleotide
sequences encoding these substantially similar amino acid
sequences. Further, this feature includes modified
derivatives of proteins having these amino acid sequences.
The 3rd feature of the present invention is an
amino acid sequence composed of 311 amino acids [type 2
BSSP2 (SEQ ID NO: 6)] wherein 73 amino acids of -73rd to -
1st amino acids represented by SEQ ID NO: 6 are added to
the N-terminus side of the mature BSSP2 amino acid sequence
(SEQ ID NO: 2) and a nucleotide sequence encoding the amino
acid sequence (516th to 1448th bases of SEQ ID NO: 5). In
addition, this feature includes amino acid sequences
substantially similar to SEQ ID NO: 6 and nucleotide
sequences encoding these substantially similar amino acid
sequences. Further, this feature includes modified
derivatives of proteins having these amino acid sequences.
The 4th feature of the present invention is an
amino acid sequence composed of 445 amino acids [type 3
BSSP2 (SEQ ID NO: 8)] wherein 207 amino acids of -207th to
-1st amino acids represented by SEQ ID NO: 8 are added to
the N-terminus side of the mature BSSP2 amino acid sequence
CA 02616940 2008-01-30
13
(SEQ ID NO: 2) and a nucleotide sequence encoding the amino
acid sequence (116th to 1450th bases of SEQ ID NO: 7). In
addition, this feature includes amino acid sequences
substantially similar to SEQ ID NO: 8 and nucleotide
sequences encoding these substantially similar amino acid
sequences. Further, this feature includes modified
derivatives of proteins having these amino acid sequences.
The 5th feature of the present invention is an
amino acid sequence of a biologically active, mature human
serine protease, hBSSP2, and a nucleotide sequence encoding
the amino acid sequence. That is, they are an amino acid
sequence [mature type hBSSP2 (SEQ ID NO: 10) composed of
240 amino acids represented by SEQ ID NO: 10 (1st to 240th
amino acids) and a nucleotide sequence encoding the amino
acid sequence (807th to 1526th bases of SEQ ID NO: 9). In
addition, this feature includes amino acid sequences
substantially similar to SEQ ID NO: 10 (1st to 240th amino
acids) and nucleotide sequences encoding these
substantially similar amino acid sequences. Further, this
feature includes modified derivatives of proteins having
these amino acid sequences.
The 6th feature of the present invention is an
amino acid sequence composed of 457 amino acids (-217th to
240th amino acids of SEQ ID NO: 10) wherein 217 amino acids
of -217th to -1st amino acids represented by SEQ ID NO: 10
CA 02616940 2008-01-30
14
are added to the N-terminus side of the mature human serine
protease hBSSP2 amino acid sequence (1st to 240 amino acids
of SEQ ID NO: 10) and a nucleotide sequence encoding the
amino acid sequence (156th to 1526th bases of SEQ ID NO: 9).
In addition, this feature includes amino acid sequences
substantially similar to SEQ ID NO: 10 and nucleotide
sequences encoding these substantially similar amino acid
sequences. Further, this feature includes modified
derivatives of proteins having these amino acid sequences.
The 7th feature of the present invention is an
amino acid sequence composed of 217 amino acids of -217th
to -1st amino acids of SEQ ID NO: 10 and a nucleotide
sequence encoding the amino acid sequence (156th to 806th
bases of SEQ ID NO: 9). In addition, this feature includes
amino acid sequences substantially similar to the amino
acid composed of 217 amino acids of -217th to -1st SEQ ID
NO: 10 and nucleotide sequences encoding these
substantially similar amino acid sequences. Further, this
feature includes modified derivatives of proteins having
these amino acid sequences.
The present invention also relates to the
nucleotide sequences represented by SEQ ID NOS: 1, 3, 5, 7
and 9 as well as nucleotide sequences similar to them.
The 8th feature of the present invention is a
vector comprising the nucleotide sequence according to any
CA 02616940 2011-03-23
of the above 1st to the 7th features, and transformant
cells transformed with the vector.
The 9th feature of the present invention is a
process for producing BSSP2 protein from the transformed
5 cells of the 8th feature.
The 10th feature of the present invention is a
transgenic non-human animal, wherein the expression level
of BSSP2 gene has been altered.
The 11th feature of the present invention is an
10 antibody against BSSP2 protein or its fragment and a
process for producing thereof.
The 12th feature of the present invention is a
method for determining BSSP2 protein or its fragment in a
specimen using the antibody of the 11th feature.
15 The 13th feature is a diagnostic marker of
diseases comprising BSSP2 protein.
In accordance with one aspect of the present
invention there is provided a protein comprising an amino
acid sequence of 240 amino acids represented by the 1st to
240th amino acids of SEQ ID NO: 10.
In accordance with another aspect of the present
invention there is provided a nucleotide sequence
'represented by the 807th to 1526th bases of SEQ ID NO: 9; a
nucleotide sequence encoding an amino acid sequence
represented by the 1st to 240th amino acids of SEQ ID
NO: 10; or a nucleotide sequence hybridizable with a
CA 02616940 2011-03-23
15a
nucleotide sequence which is complementary to the above
nucleotide sequence under stringent conditions and encoding
a protein having similar properties to that of a protein
comprising the amino acid sequence represented by the 1st to
240th amino acids of SEQ ID NO: 10.
In accordance with yet another aspect of the
present invention there is provided a protein comprising an
amino acid sequence of 457 amino acids represented by the -
217th to 240th amino acids of SEQ ID NO: 10.
In accordance with still yet another aspect of
the present invention there is provided a nucleic acid
molecule consisting of: a nucleotide sequence represented by
the 156th to 1526th bases of SEQ ID NO: 9; a nucleotide
sequence encoding an amino acid sequence represented by the
-217th to 240th amino acids of SEQ ID NO: 10; or a
nucleotide sequence hybridizable with a nucleotide sequence
which is complementary to the above nucleotide sequence of
SEQ ID NO: 9 under incubation in a solution containing 5 x
SSC, 5% Denhardt's solution (0.1% BSA, 0.1% Ficol1R 1400,
0.1% PVP), 0.5% SDS and 20 pg/ml denatured salmon sperm DNA
at 37 C overnight and encoding a protein having serine
protease activity.
In accordance with still yet another aspect of
the present invention there is provided a protein comprising
an amino acid sequence of 217 amino acids represented by the
-217th to -1st amino acids of SEQ ID NO: 10.
CA 02616940 2011-03-23
15b
In accordance with still yet another aspect of
the present invention there is provided a nucleic acid
molecule consisting of: a nucleotide sequence represented by
the 156th to 806th bases of SEQ ID NO: 9; a nucleotide
sequence encoding an amino acid sequence represented by the
-217th to -1st amino acids of SEQ ID NO: 10; or a nucleotide
sequence hybridizable with a nucleotide sequence which is
complementary to the above nucleotide sequence of SEQ ID
NO: 9 under incubation in a solution containing 5 x SSC, 5%
Denhardt's solution (0.1% BSA, 0.1% FicollR 1400, 0.1% PVP),
0.5% SDS and 20 pg/ml denatured salmon sperm DNA at 37 C
overnight and encoding a protein having serine protease
activity.
In accordance with still yet another aspect of
the present invention there is provided a nucleotide
sequence represented by SEQ ID NO: 9; or a nucleotide
sequence hybridizable with a nucleotide sequence which is
complementary to the above nucleotide sequence under
incubation in a solution containing 5 x SSC, 5% Denhardt's
solution (0.1% BSA, 0.1% FicollR 1400, 0.1% PVP), 0.5% SDS
and 20 pg/ml denatured salmon sperm DNA at 37 C overnight
and encoding a protein having serine protease activity.
In accordance with still yet another aspect of
the present invention there is provided a vector comprising
a promoter and a polynucleotide operably linked thereto
comprising a nucleotide sequence as described above.
CA 02616940 2011-03-23
15c
In accordance with still yet another aspect of
the present invention there is provided a cell comprising
any one of the nucleotide sequences described above which
is transformed with the vector as described above.
In accordance with still yet another aspect of
the present invention there is provided a process for
producing a protein, which comprises culturing cells
transformed with the nucleotide sequence described above,
and collecting human Brain-Specific Serine Protease 2
(hBSSP2) produced by the cells.
In accordance with still yet another aspect of
the present invention there is provided a cell whose
expression level of BSSP2 gene has been altered, wherein the
BSSP2 gene comprises SEQ ID NO: 9.
In accordance with still yet another aspect of
the present invention there is provided an isolated cell of
a knockout mouse whose BSSP2 gene function is deficient,
wherein the BSSP2 gene comprises SEQ ID NO: 9.
Hereinafter, unless otherwise stated, the
nucleotide sequence represented by each SEQ ID NO: includes
the above-described various fragments thereof, and similar
nucleotide sequences and their fragments. Likewise, the
amino acid sequence represented by each SEQ ID NO: includes
the above-described various fragments thereof, similar
nucleotide sequences and their fragments, and modified
CA 02616940 2011-03-23
15d
derivatives thereof. In addition, unless otherwise stated,
BSSP2, hBSSP2, and mBSSP2 include proteins having the
CA 02616940 2008-01-30
16
above-described respective amino acid sequences.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 illustrates the results of northern
blotting using mRNAs prepared from mice in Example 2
hereinafter;
Fig. 2 illustrates the results of northern
blotting using mRNAs prepared from mice in Example 2
hereinafter
Fig. 3 is a plasmid constructed by the method of
Example 4 hereinafter;
Fig. 4 illustrates the construction of plasmid
pFBTrypSigTag/BSSP2 according to the method of Example 4
hereinafter;
Fig. 5 illustrates the detection of hBSSP2 mRNA
by northern hybridization;
Fig. 6 illustrates the detection of hBSSP2 mRNA
by RT-PCR; and
Fig. 7 illustrates the expression of hBSSP2 by a
baculovirus system.
DETAILED DESCRIPTION OF THE INVENTION
The nucleotide sequences encoding hBSSP2 or
mBSSP2 of the present invention can be obtained by
preparing mRNAs from cells expressing the protein and
CA 02616940 2008-01-30
17
converting it into double stranded DNAs according to a
conventional manner. For preparing mRNA, guanidine
isothiocyanate-calcium chloride method (Chirwin, et al.,
Biochemistry, 18, 5294, 1979) or the like can be used. For
preparing poly (A) + RNA from total RNAs, there can be used
affinity chromatography using a carrier, for example,
Sepharosetm, latex particles, etc., to which oligo (dT) is
attached, and the like. The above-obtained RNA can be used
as a template and treated with reverse transcriptase by
using, as a primer, oligo (dT) which is complementary to
the poly (A) strand at the 3'-terminus, or a random primer,
or a synthesized oligonucleotide corresponding to a part of
the amino acid sequence of hBSSP2 or mBSSP2 to obtain a
hybrid mRNA strand comprising DNA or cDNA complementary to
the mRNA. The double stranded DNA can be obtained by
treating the above-obtained hybrid mRNA strand with E. coli
RNase, E. coli DNA polymerase and E. coli DNA ligase to
convert into a DNA strand.
It is also possible to carry out cloning by RT-
PCR method using primers synthesized on the basis of the
nucleotide sequence of hBSSP2 or mBSSP2 gene and using
hBSSP2 or mBSSP2 expressing cell poly (A) + RNA as a
template. Alternatively, the desired cDNA can be obtained
without using PCR by preparing or synthesizing a probe on
the basis of the nucleotide sequence of hBSSP2 or mBSSP2
CA 02616940 2008-01-30
18
gene and screening a cDNA library directly. Among genes
obtained by these methods, the gene of the present
invention can be selected by confirming a nucleotide
sequence thereof. The gene of the present invention can
also be prepared according to a conventional method using
chemical syntheses of nucleic acids, for example,
phosphoamidite method (Mattencci, M. D. et al., J. Am. Chem.
Soc., 130, 3185, 1981) and the like.
By using the thus-obtained hBSSP2 or mBSSP2 gene,
their expression in various tissues can be examined.
In the case of northern blotting analysis, mBSSP2 shows
the expression in the head of a 15-20 days old mouse fetus, and
in the lung, prostate and testicle of a 3 month-old mouse.
hBSSP2 shows the expression in the brain, skeletal muscle and
liver (see Figs. 1, 2 and 5). In the case of RT-PCR analysis,
mBSSP2 shows the expression in the brain and testicle of a 12
day-old mouse, and hBSSP2 shows the expression in the brain and
skeletal muscle. Then, the novel proteases of the present
invention are presumed to play various roles in brain,
prostate, lung, testicle, skeletal muscle and liver. For
example, in the brain, there is a possibility that they can be
used for treatment and diagnosis of brain diseases such as
Alzheimer's disease (AD), epilepsy, brain tumor and the
like. Further, in other tissues, there is a possibility
that BSSP2 of the present invention and a gene encoding it
CA 02616940 2008-01-30
19
can be used for treatment and diagnosis of various diseases
such as cancer, inflammation, infertility, prostatomegaly
and the like. Further, it is presumed they may have a
certain influence on blood coagulation, fibrinolysis and
complement systems. Furthermore, there is a possibility
that inhibitors of serine proteases can be used for
treatment and diagnosis of Alzheimer's disease, epilepsy,
cancer, inflammation, infertility, prostatomegaly and the
like.
The novel mouse serine protease can be divided
into types 1, 2 and 3. It has been shown that type 1 is
composed of 273 amino acids, type 2 is composed of 311
amino acids, and type 3 is composed of 445 amino acids.
These amino acid sequences contain a common amino acid
sequence of 238 amino acids whose N-terminus side starts
with Ile-Val-Gly-Gly-Gln-Ala-Val as the mature serine
protease. Further, the amino acid sequence of the mature
serine protease contains a consensus sequence having serine
protease activity. Since there are two or more amino acid
sequences which are characteristic of sugar chain binding
sites, the amino acid sequence is presumed to have at least
two sugar chains.
Furthermore, in the novel human serine protease
(hBSSP2), there are a transmembrane region and a scavenger
receptor cysteine rich-like domain in the N-terminus side
CA 02616940 2008-01-30
of hBSSP2 mature protein as seen from SEQ ID NO: 10.
The term "pro part" used herein means a part of a
pro-form, i.e., the pro-form from which the corresponding
active type protein part is removed. The term "pre part"
5 used herein means a part of a prepro-form, i.e., the
prepro-form from which the corresponding pro-form is
removed. The term "prepro part" used herein means a part
of a prepro-form, i.e., the prepro-form from which the
corresponding active type protein part is removed.
10 The amino acid sequence represented by SEQ ID NO:
2 is the BSSP2 mature or active type protein composed of
238 amino acids, and the nucleotide sequence encoding the
amino acid sequence represented by SEQ ID NO: 1 is composed
of 714 bases. The present inventors have shown that the
15 serine protease activity is maintained even when one to
several amino acids of the N-terminus of the mature type
protein of the present invention is deleted or added, while
the sequence represented by SEQ ID NO: 2 is preferred.
The amino acid sequence represented by SEQ ID NO:
20 4 is type 1 BSSP2 protein composed of 273 amino acids, and
the nucleotide sequence encoding the amino acid sequence
represented SEQ ID NO: 3 is composed of 1685 bases. The
sequence of the -35th to -1st amino acids is the prepro or
pro part and the amino acid sequence represented by SEQ ID
NO: 4 is considered to be a precursor type of the BSSP2
CA 02616940 2008-01-30
21
protein.
The amino acid sequence represented by SEQ ID NO:
6 is type 2 BSSP 2 protein composed of 311 amino acids and
the nucleotide sequence encoding the amino acid sequence
represented by SEQ ID NO: 5 is composed of 2068 bases. The
sequence of the -73rd to -1st amino acids is the prepro or
pro part and the amino acid sequence represented by SEQ ID
NO: 6 is considered to be a precursor type of BSSP2 protein.
The amino acid sequence represented by SEQ ID NO:
8 is type 3 BSSP2 protein composed of 445 amino acids and
the nucleotide sequence encoding the amino acid sequence
represented by SEQ ID NO: 7 is composed of 2070 bases. The
amino acid sequence of the -207th to -1st amino acids is
the prepro or pro part and the amino acid sequence
represented by SEQ ID NO: 8 is considered to be a precursor
type of BSSP2 protein.
SEQ ID NOS : 4, 6 and 8 contain the common amino
acid sequence represented by SEQ ID NO: 2 as the mature
BSSP2 protein. Further, each of amino acid sequences of
-25th to -238th amino acids in SEQ ID NOS: 4, 6 and 8 is the
consensus sequence.
The amino acid sequence represented by SEQ ID NO:
10 is hBSSP2 protein composed of 457 amino acids and the
nucleotide sequence encoding the amino acid sequence
represented by SEQ ID NO: 9 is composed of 1371 bases.
CA 02616940 2008-01-30
22
Since a transmembrane region and a scavenger receptor
cysteine rich-like domain are present in the amino acid
sequence of the -217th to -1st amino acids of SEQ ID NO: 10,
it is considered that hBSSP2 exhibits its activity not only
in the form of the mature protein but also in the form of
an adduct of the -217th to -1st amino acids.
In general, many genes of eucaryote exhibit
polymorphism and, sometimes, one or more amino acids are
substituted by this phenomenon. Further, even in such case,
sometimes, a protein maintains its activity. Then, the
present invention includes a gene encoding a protein
obtained by modifying a gene encoding any one of the amino
acid sequences represented by SEQ ID NOS: 2, 4, 6, 8 and 10,
artificially, in so far as the protein has the
characteristic function of the gene of the present
invention. Further, the present invention includes a
protein which is a modification of any one of amino acid
sequences represented by SEQ ID NOS : 2, 4, 6, 8 and 10 in
so far as the protein has the characteristics of the
present invention. Modification is understood to include
substitution, deletion, addition and/or insertion. In
particular, the present inventors have shown that, even
when several amino acids are added to or deleted from the
N-terminus amino acid of the BSSP2 mature protein
represented by SEQ ID NO: 2, the resultant sequence
CA 02616940 2008-01-30
23
maintains its activity.
That is, the present invention includes a protein
comprising any one of amino acid sequences described in SEQ
ID NOS: 2, 4, 6, 8 and 10; an amino acid sequence encoded
by any one of nucleotide sequences represented by SEQ ID
NOS: 1, 3, 5, 7 and 9; or one of these amino acid sequences
wherein one to several amino acids have been substituted,
deleted, added and/or inserted, and belonging to
serine protease family.
Each codon for the desired amino acid itself
is known and can be selected freely. For example,
codons can be determined according to a conventional manner
by taking into consideration the frequency of use of codons
in a host to be utilized (Grantham, R. et al., Nucleic
Acids Res., 9, r43, 1989). Therefore, the present
invention also includes a nucleotide sequence appropriately
modified by taking into consideration the degeneracy of a
codon. Further, these nucleotide sequences can be modified
by a site directed mutagenesis using a primer composed of a
synthetic oligonucleotide encoding the desired modification
(Mark, D. F. et al., Proc. Natl. Acad. Sci. USA., 81, 5662,
1984), or the like.
Furthermore, the DNA of the present invention
includes DNA which is hybridizable to any one of nucleotide
sequences described in SEQ ID NOS: 1, 3, 5, 7 and 9 or
CA 02616940 2008-01-30
24
nucleotide sequences complementary to these nucleotide
sequences in so far as the protein encoded by the
nucleotide sequence has the same properties as those of the
BSSP2 of the present invention. It is considered that many
sequences which are hybridizable to a given sequence
under stringent conditions have a similar activity to that
of a protein encoded by the given sequence. The stringent
conditions according to the present invention include, for
example, incubation in a solution containing 5 x SSC, 5%
Denhardt's solution (0.1% BSA, 0.1% Ficol 1400, 0.1% PVP),
0.S% SDS and 20 pg/ml denatured salmon sperm DNA at 37 C
overnight, followed by washing with 2 x SSC containing 0.1%
SDS at room temperature. Instead of SSC, SSPE can be
appropriately used.
Probes for detecting a BSSP2 gene can be designed
based on any one of the nucleotide sequences described in SEQ
ID NOS : 1, 3, 5, 7 and 9. Or, primers can be designed for
amplifying DNA or RNA containing the nucleotide sequence,
The design of probes or primers can be carried out routinely by a
person skilled in the art. An oligonucleotide having a
designed nucleotide sequence can be synthesized chemically.
And, when a suitable label is added to the oligonucleotide,
the resultant oligonucleotide can be utilized in various
hybridization assays. Or, it can be utilized in nucleic
acid synthesis reactions such as PCR. An oligonucleotide
CA 02616940 2008-01-30
to be utilized as a primer has, preferably, at least 10
bases, more preferably 15 to 50 bases in length. An
oligonucleotide to be utilized as a probe has, preferably,
100 bases to full length.
5 Moreover, it is possible to obtain a promoter
region and an enhancer region of a BSSP2 gene present in
the genome based on the cDNA nucleotide sequence of BSSP2
provided by the present invention. Specifically, these
control regions can be obtained according to the same
10 manner as described in JP 6-181767 A; J. Immunol., 155,
2477, 1995; Proc. Natl. Acad. Sci., USA, 92, 3561, 1995 and
the like. The promoter region used herein means a DNA
region which is present upstream from a transcription
initiation site and controls expression of a gene. The
15 enhancer region used herein means a DNA region which is
present in an intron, a 5'-non-translated region or a 3'-
non-translated region and enhances expression of a gene.
The present invention also relates to a vector
comprising the nucleotide sequence represented by SEQ ID
20 NO: 1 or a nucleotide sequence encoding the amino acid
sequence represented by SEQ ID NO: 2; the nucleotide
sequence represented by SEQ ID NO: 3 or a nucleotide
sequence encoding the amino acid sequence represented by
SEQ ID NO: 4; the nucleotide sequence represented by SEQ ID
25 NO: 5 or a nucleotide sequence encoding the amino acid
CA 02616940 2008-01-30
26
sequence represented by SEQ ID NO: 6; the nucleotide
sequence represented by SEQ ID NO: 7 or a nucleotide
sequence encoding the amino acid sequence represented by
SEQ ID NO: 8; or the nucleotide sequence represented by SEQ
ID NO: 9 or a nucleotide sequence encoding the amino acid
sequence represented by SEQ ID NO: 10; or a nucleotide
sequence similar to them. A nucleotide sequence similar to
a given nucleotide sequence used herein means a nucleotide
sequence which is hybridizable to the given nucleotide
sequence or its complementary nucleotide sequence under the
above-described stringent conditions and encodes a protein
having the same properties as those of the protein encoded
by the nucleotide sequence.
The vector is not specifically limited in so far
as it can express the protein of the present invention.
Examples thereof include pBAD/His, pRSETA, pcDNA2.1,
pTrcHis2A, pYES2, pBlueBac4.5, pcDNA3.1 and pSecTag2
manufactured by Invitrogen, pET and pBAC manufactured by
Novagen, pGEM manufactured by Promega, pBluescriptll
manufactured by Stratagene, pGEX and pUC18/19 manufactured
by Pharmacia, PfastBACl manufactured by GIBCO and the like.
Preferably, a protein expression vector
is used. This expression vector
CA 02616940 2008-01-30
27
is constructed by using pCRII-TOPO vector described in the
Examples hereinafter, or a commercially available
expression vector, for example pSecTag2A vector or
pSecTag2B vector (Invitrogen) and integrating a secretory
signal nucleotide sequence suitable for expression of the
protein of the present invention, in the 31 downstream side
thereof, a Tag nucleotide sequence, a cleavable nucleotide
sequence and a cloning site, into which a nucleotide
sequence encoding a target protein can be inserted, in this
order. More specifically, it is preferred to use a trypsin
signal as the secretory signal, a nucleotide sequence
encoding polyhistidine as the Tag nucleotide sequence, and
a nucleotide sequence encoding an amino acid sequence which
is susceptible to enzyme-specific cleavage, i.e., a
nucleotide sequence encoding the amino acid sequence of
Asp-Asp-Asp-Asp-Lys (said amino acid sequence is recognized
by enterokinase, and the recombinant fusion protein is
cleaved at the C-terminus part thereof) as the cleavable
nucleotide sequence.
Furthermore, the present invention provides
transformed cells having the nucleotide sequence of the
present invention in an expressible state by means of the
above vector. Preferably, host cells to be used for the
transformed cells of the present invention are animal cells
and insect cells. However, host cells include any cells
CA 02616940 2008-01-30
28
(including those of microorganisms) which can express a
nucleotide sequence encoding the desired protein in the
expression vector of the present invention and can secrete
extracellularly.
The animal cells and insect cells used herein
include cells derived from human beings,
fly worms or silk worms. Examples of cells include CHO cell,
COS cell, BHK cell, Vero cell, myeloma cell, HEK293 cells,
HeLa cell, Jurkat cell, mouse L cell, mouse C127 cell,
mouse FM3A cell, mouse fibroblast, osteoblast, cartilage
cell, S2, Sf9, Sf21, High Five"'
cell and the like.
The protein of the present invention can
be expressed as a recombinant fused protein so as to
facilitate isolation, purification and recognition. The
recombinant fused protein used herein means a protein
expressed as an adduct wherein a suitable peptide chain is
added to the N-terminus and/or C-terminus of the desired
protein expressed by a nucleotide sequence encoding the
desired protein. The recombinant protein used herein means
that obtained by integrating a nucleotide sequence encoding
the desired protein in the expression vector of the present
invention and cut off an amino acid sequence which derived
from nucleic acids other than those encoding the desired
protein from the expressed recombinant fused protein, and
CA 02616940 2008-01-30
29
is substantially the same as the protein of the present.
invention.
Introduction of the above vector into host cells
can be carried out by, for example, transfection according
to lipopolyamine method, DEAE-dextran method, Hanahan
method, lipofectin method or calcium phosphate method,
microinjection, eletroporation and the like.
As described above, the present invention also
relates to a process for producing hBSSP2 or mBSSP2
comprising culturing cells transformed with the above
nucleotide sequence of the present invention and collecting
the produced hBSSP2 or mBSSP2. The culture of cells and
separation and purification of the protein can be carried
out by a known method.
The present invention also relates to an
inhibitor of the novel serine protease of the present
invention. Screening of the inhibitor can be carried out
according to a known method such as comparing the
enzyme activity upon bringing into contact with a candidate
compound with the enzyme activity that occurs without contacting
the candidate compound, or the like.
The present invention relates to a non-human
transgenic animal whose expression level of hBSSP2 or
mBSSP2 gene has been altered. The hBSSP2 or mBSSP2 gene
used herein includes cDNA, genomic DNA or synthetic DNA
CA 02616940 2008-01-30
encoding hBSSP2 or mBSSP2. In addition, expression of a
gene includes any steps of transcription and translation.
The non-human transgenic animal of the present invention is
useful for studies of functions or expression control of
5 hBSSP2 or mBSSP2, elucidation of mechanisms of diseases in
which hBSSP2 or mBSSP2 is presumed to be involved, and
development of disease model animals for screening and
safety test of medicine.
In the present invention, expression of a gene
10 can be modified artificially by mutagenizing at a part of
several important sites which control normal gene
expression (enhancer, promoter, intron, etc.) such as
deletion, substitution, addition and/or insertion to
increase or decrease an expression level of the gene in
15 comparison with its inherent expression level. This
mutagenesis can be carried out according to a known method
to obtain the transgenic animal.
In a narrow sense, the transgenic animal means an
animal wherein a foreign gene is artificially introduced
20 into reproductive cells by gene recombinant techniques. In
a broad sense, the transgenic animal includes an antisense
transgenic animal the function of whose specific gene is
inhibited by using antisense RNA, an animal whose specific
gene is knocked out by using embryonic stem cells (ES
25 cells), and an animal into which point mutation DNA is
CA 02616940 2008-01-30
31
introduced, and the transgenic animal means an animal into
which a foreign gene is stably introduced into a chromosome
at an initial stage of ontogeny and the genetic character
can be transmitted to the progeny.
The transgenic animal used herein should be
understood in a broad sense and includes any vertebrates
other than a human being. The transgenic animal of the
present invention is useful for studies of functions or
expression control of BSSP2, elucidation of mechanisms of
diseases associated with cells expressing in a human being,
and development of disease model animals for screening and
safety test of medicine.
As a technique for creating the transgenic animal,
a gene is introduced into a nucleus in a pronucleus stage
of egg cells with a micropipette directly under a phase-
contrast microscope (microinjection, U.S. Patent 4,873,191).
There are also methods using embryonic stem cell (ES
cell), and the like. In addition, there are newly
developed methods such as a method wherein a gene is
introduced into a retroviral vector or adenoviral vector*to
infect egg cells, a sperm vector method wherein a gene is
introduced into egg cells through sperms, and the like.
A sperm vector method is a gene recombinant
technique wherein a foreign gene is incorporated into sperm
cells by adhesion, electroporation, etc., followed by
CA 02616940 2008-01-30
32
fertilization of egg cells to introduce the foreign gene
into the egg cells (M. Lavitranoet et al., Cell, 57, 717,
1989) . Alternatively, an in vivo site specific gene
recombinant technique such as that using cre/loxP
recombinase system of bacteriophage P1, FLP recombinase
system of Saccharomyces cerevisiae, etc. can be used.
Furthermore, introduction of a transgene of the desired
protein into a non-human animal using a retroviral vector
has been reported.
For example, a method for creating a transgenic
animal by microinjection can be carried out as follows:
First, a transgene primarily composed of a
promoter responsible for expression control, a gene
encoding a specific protein and a poly A signal is required.
It is necessary to confirm expression modes and amounts
between respective systems because an expression mode and
amount of a specific molecule is influenced by a promoter
activity, and transgenic animals differ from each other
according to a particular system due to the difference in a
copy number of an introduced transgene and a introduction
site on a chromosome. An intron sequence which is spliced
may be previously introduced before the poly A signal
because it has been found that an expression amount varies
due to a non-translation region and splicing. Purity of a
gene to be used for introduction into fertilized egg cells
CA 02616940 2008-01-30
33
should be as high as possible. This is of importance.
Animals to be used include a mouse for collecting
fertilized eggs (5 to 6 week old), a male mouse for mating,
a false pregnancy female mouse, a seminiferous tubal-
ligated mouse, and the like.
For obtaining fertilized egg cells efficiently,
ovulation may be induced with gonadotropin or the like.
Fertilized egg cells are recovered and a gene in an
injection pipette is injected into male pronucleus of the
egg cells by microinjection. For returning the injected
egg cells to a fallopian tube, an animal (false pregnancy
female mouse, etc.) is provided and about 10 to 15
eggs/mouse are transplanted. Then, genomic DNA is
extracted from the end part of the tail to confirm whether
the transgene is introduced into newborn mouse or not.
This confirmation can be carried out by detection of the
transgene with southern blot technique or PCR technique, or
by positive cloning wherein a marker gene, which is
activated only when homologous recombination is caused, has
been introduced. Further, transcribed products derived
from the transgene are detected by northern blot technique
or RT-PCR technique to confirm expression of the transgene.
Or, western blotting can be carried out with a specific
antibody to a protein.
The knockout mouse of the present invention is
CA 02616940 2008-01-30
34
treated so that the function of mBSSP2 gene is lost. A
knockout mouse means a transgenic mouse any of whose genes
are destroyed by homologous recombination technique so that
its function is deficient. A knockout mouse can be created
by carrying out homologous recombination with ES cells and
selecting embryonic stem cells wherein either of allele
genes are modified or destroyed. For example, embryonic
stem cells whose genes are manipulated at blastocyte or
morula stage of fertilized eggs are injected to obtain a
chimera mouse wherein cells derived from the embryonic stem
cells are mixed with those derived from the embryo. The
chimera mouse (chimera means a single individual formed by
somatic cells based on two or more fertilized eggs) can be
mated with a normal mouse to create a heterozygote mouse
wherein all of the allele genes have been modified or
destroyed. Further, a homozygote mouse can be created by
mating heterozygote mice.
Homologous recombination means recombination
between two genes whose nucleotide sequences are the same
or very similar to each other in terms of gene
recombination mechanism. PCR can be employed to select
homologous recombinant cells. A PCR reaction can be
carried out by using a part of a gene to be inserted and a
part of a region where the insertion is expected as primers
to find the occurrence of homologous recombination in cells
CA 02616940 2008-01-30
which give an amplification product. Further, to cause
homologous recombination in a gene expressed in embryonic
stem cells, homologous recombinant cells can readily be
selected using a known method or its modification. For
5 example, cells can be selected by joining a neomycin
resistant gene to a gene to be introduced to impart
neomycin resistance to cells after introduction.
The present invention also provide an antibody
recognizing hBSSP2 or mBSSP2 or a fragment thereof. The
10 antibody of the present invention includes an antibody
against a protein having the amino acid sequence described
in any of SEQ ID NOS: 2, 4, 6, 8 and 10 or its fragment.
An antibody against hBSSP2 or mBSSP2 or a fragment thereof
(e.g., polyclonal antibody, monoclonal antibody, peptide
15 antibody) or an antiserum can be produced by using hBSSP2
or mBSSP2 or a fragment thereof, etc. as an antigen
according to a known process for producing an
antibody or an antiserum.
The hBSSP2 or mBSSP2 of a fragment thereof is
20 administered to a site of a warm-blooded animal where an
antibody can be produced by administration thereof as such
or together with a diluent or carrier. For enhancing the
antibody production, upon administration, Freund's complete
adjuvant or Freund's incomplete adjuvant may be
25 administered, Normally, the administration is carried out
CA 02616940 2008-01-30
36
once every 1 to 6 weeks, 2 to 10 times in all. Examples of
the warm-blooded animal to be used include monkey, rabbit, dog,
guinea pig, mouse, rat, sheep, goat, chicken and the like
with mouse and rat being preferred. As rats, for example,
Wistar and SD rats are preferred. As mice, for example,
BALE/c, C57BL/6 and ICR mice are preferred.
To produce monoclonal antibody producer cells,
individuals whose antibody titer have been recognized are
selected from warm-blooded animals, e.g., a mouse immunized
with an antigen. Two to 5 days after the last immunization,
the spleen or lymph node of the immunized animal is
collected and antibody producer cells contained therein are
subjected to cell fusion with myeloma cells to prepare a
monoclonal antibody producer hybridoma. The antibody titer
in an antiserum can be determined by, for example, reacting
the antiserum with a labeled hBSSP2 or mBSSP2 as described
hereinafter, followed by measurement of the activity bound
to the antibody. The cell fusion can be carried out
according to a known method, for example, that described by
Koehler and Milstein (Nature, 256, 495, 1975) or its
modifications (J. Immunol. Method, 39, 285, 1980; Eur. J.
biochem, 118, 437, 1981; Nature, 285, 446, 1980) . As a
fusion promoting agent, there are polyethylene glycol (PEG),
Sendai virus and the like. Preferably, PEG is used.
Further, for improving fusion efficiency, lectin, poly-L-
CA 02616940 2008-01-30
37
lysine or DMSO can be appropriately added.
Examples of myeloma cells include X-63Ag8, NS-1,
P3U1, SP2/0, AP-1 and the like with SP2/0 being preferred.
The preferred ratio of the number of the antibody producer
cells (spleen cells) : the number of spleen cells are 1
20 to 20 : 1. PEG (preferably PEG 1000 to PEG 6000) is
added at a concentration of about 10 to 80% and the mixture
is incubated at 20 to 40 C, preferably 30 to 37 C for 1 to
minutes to carry out the cell fusion efficiently.
10 Screening of anti-hBSSP2 or mBSSP2 antibody producer
hybridomas can be carried out by various methods. For
example, a supernatant of a hybridoma culture is added to a
solid phase to which hBSSP2 or mBSSP2 antigen is adsorbed
directly or together with a carrier (e.g., microplate),
followed by addition of an anti-immunoglobulin antibody (in the
case where the cells used in cell fusion are those of a mouse,
anti-mouse immunoglobulin antibody is used) or protein A to
detect the anti-hBSSP2 or mBSSP2 monoclonal antibody
attached to the solid phase. Or, a supernatant of a
hybridoma culture is added to a solid phase to which an
anti-immunoglobulin antibody or protein A is adsorbed,
followed by addition of hBSSP2 or mBSSP2 labeled with a
radioactive substance, an enzyme, etc., to detect the anti-
hBSSP2 or mBSSP2 monoclonal antibody attached to the solid
phase.
CA 02616940 2008-01-30
38
Selection and cloning of the anti-hBSSP or mBSSP
monoclonal antibody can be carried out according to a per
se known method or its modification. Normally, a HAT
(hypoxanthine, aminopterin, thymidine)-added medium for
culturing animal cells is used. Any culture medium can be
used for selection, cloning and growth, in so far as the
hybridoma can grow. For example, there can be used RPMI
culture medium containing 1 to 20%, preferably 10 to 20%
fetal bovine serum, a serum-free medium for culturing
hybridomas. Preferably, the culture is carried out at a
temperature of about 37 C. Normally, the culture time is 5
days to 3 weeks, preferably 1 weeks to 2 weeks. Normally,
the culture is carried out under 5% CO2. The antibody
titer of a supernatant of a hybridoma culture can be
measured according to the same manner as that of the above-
described measurement of anti-BSSP2 antibody titer in an
antiserum. That is, examples of the measurement to be used
include radioimmunoassay (RIA), enzyme-linked immunosorbent
assay (ELISA), FIA (fluorescence immunoassay), plaque assay,
agglutination reaction method, and the like. Among them,
ELISA as shown below is preferred.
Screening by ELISA
A protein prepared according to the same
operation as that for an immunogen is immobilized on the
surface of each well of an ELISA plate. Next, BSA, MSA,
CA 02616940 2008-01-30
39
OVA, KLH, gelatin, skimmed milk, or the like is immobilized
on each well to prevent non-specific adsorption. A
supernatant of a hybridoma culture is added to each well
and is allowed to- stand for a given time so that an
immunological reaction proceeds. Each well is washed with
a washing solution such as PBS or the like. Preferably, a
surfactant is added to this washing solution. An enzyme
labeled secondary antibody is added and allowed to stand
for a given time. The enzyme to be used for the label,
can include R-galactosidase, alkaline phosphatase,
peroxidase and the like. After washing each well with the
same washing solution, a substrate solution of the labeled
enzyme is added so that an enzymatic reaction proceeds.
When the desired antibody is present in the supernatant of
a hybridoma culture, the enzymatic reaction proceeds and
the color of the substrate solution is changed.
Normally, cloning can be carried out by a
known method such as semi-solid agar method, limiting
dilution method and the like. Specifically, after
confirming a well in which the desired antibody is produced
by the above-described method, cloning is carried out to
obtain a single clone. For cloning, it is preferred to
employ limiting dilution method wherein hybridoma cells are
diluted so that one colony is formed per one well of a
culture plate. For cloning by limiting dilution method,
CA 02616940 2008-01-30
feeder cells can be used, or a cell growth factor such as
interleukin 6, etc. can be added to improve colony forming
capability. In addition, cloning can be carried out by
using FACS and single cell manipulation method. The cloned
5 hybridoma is preferably cultured in a serum-free culture
medium and an optimal amount of an antibody is added to its
supernatant. The single hybridoma thus obtained can be
cultured using a flask or a cell
culture device, or cultured in the abdominal cavity of an
10 animal (J. Immunol. Meth., 53, 313, 1982) to obtain a
monoclonal antibody. When culturing in a flask, there can
be used a cell culture medium (e.g., IMDM, DMEM, RPMI1640,
etc.) containing 0 to 20% of FCS. When culturing in the
abdominal cavity of an animal, the animal to be used is
15 preferably the same species or the same line as that from
which the myeloma cells used in the cell fusion are derived,
a thymus deficient nude mouse or the like, and the
hybridoma is transplanted after administration of a mineral
oil such as pristane, etc. After 1 to 2 weeks, myeloma
20 cells are proliferated in the abdominal cavity to obtain
ascites containing a monoclonal antibody.
The monoclonal antibody of the present invention
which does not cross-react with other proteins can be
obtained by selecting a monoclonal antibody which
25 recognizes an epitope specific to hBSSP2 or mBSSP2. In
CA 02616940 2008-01-30
41
general, an epitope presented by an amino acid sequence
composed of at least 3, preferably 7 to 20 successive amino
acid residues in an amino acid sequence which constitutes a
particular protein is said to be an inherent epitope of the
protein. Then, a monoclonal antibody recognizing an
epitope constituted by a peptide having an amino acid
sequence composed of at least 3 successive amino acid
residue selected from the amino acid residues disclosed in
any of SEQ ID NOS: 2, 4, 6 and 8, can be said to be the
monoclonal antibody specific for BSSP2 of the present
invention. An epitope common to the BSSP2 family can be
selected by selecting an amino acid sequence conservative
among the amino acid sequences described in SEQ ID NOS: 2,
4, 6, 8 and 10. Or, in the case of a region containing an
amino acid sequence specific for each sequence, a
monoclonal antibody which can differentiate respective
proteins can be selected.
Separation and purification of the anti-hBSSP2 or
mBSSP2 monoclonal antibody, like a conventional polyclonal
antibody, can be carried out according to the same manner
as those of immunoglobulins. Known purification
methods can be used such as, for example, salting
out, alcohol precipitation, isoelectric precipitation,
electrophoresis, ammonium sulfate precipitation, absorption
and desorption with an ion exchange material (e.g., DEAE),
CA 02616940 2008-01-30
42
ultrafiltration, gel filtration, or specific purification
by collecting only an antibody with an antibody-binding
solid phase or an active adsorber such as protein A or
protein G, etc., and dissociating the binding to obtain the
antibody. To prevent formation of aggregates during
purification or decrease in the antibody titer, for example,
human serum albumin is added at a concentration of 0.05 to
2%. Alternatively, amino acids such as glycine, a-alanine,
etc., in particular, basic amino acids such as lysine,
arginine, histidine, etc., saccharides such as glucose,
mannitol, etc., or salts such as sodium chloride, etc. can
be added. In the case of IgM antibody, since it is very liable
to be aggregated, it may be treated with R-propionilactone
and acetic anhydride.
The polyclonal antibody of the present invention
can be produced according to a known method or its
modification. For example, an immunogen (protein antigen)
or a complex thereof with a carrier protein is
prepared and, according to the same manner as that in the
above monoclonal antibody production, a warm-blooded animal
is immunized. A material containing an antibody against
the protein of the present invention or its fragment is
collected from the immunized animal and the antibody is
separated and purified to obtain the desired antibody. As
for a complex of an immunogen and a carrier protein for
CA 02616940 2008-01-30
43
immunizing a warm-blooded animal, the type of carrier
protein and the mixing ratio of a carrier and a hapten are
not specifically limited in so far as an antibody against
hapten immunized by cross-linking with the carrier is
efficiently produced. For example, there can be used about
0.1 to 20, preferably about 1 to 5 parts by weight of
bovine serum albumin, bovine cycloglobulin, hemocyanin, etc.
coupled with one part by weight of a hapten. For coupling
a carrier and a hapten, various condensing agents can be
used. Examples thereof include glutaraldehyde,
carbodiimide or maleimide active ester, active ester agents
having thiol group or dithiopyridyl group, and the like.
The condensed product is administered as such or together
with a carrier or diluent to a site of a warm-blooded
animal where an antibody can be produced. For enhancing
the antibody production, upon administration, Freund's
complete adjuvant or Freund's incomplete adjuvant may be
administered. Normally, the administration is carried out
once every 2 to 6 weeks, 3 to 10 times in all. The
polyclonal antibody can be collected from blood, ascites,
or the like, preferably blood of the immunized animal. The
polyclonal antibody titer in an antiserum can be measured
according to the same manner as measurement of the above
monoclonal antibody titer in the antiserum. Separation and
purification of the polyclonal antibody, like the above
CA 02616940 2008-01-30
44
monoclonal antibody, can be carried out according to the
same manner as those of immunoglobulins.
The monoclonal antibody and polyclonal antibody
against hBSSP2 or mBSSP2 or a fragment thereof can be
utilized for diagnosis and treatment of diseases associated
with cells expressing hBSSP2 or mBSSP2. By using these
antibodies, hBSSP2 or mBSSP2 or a fragment thereof can be
determined based on their immunological binding to hBSSP2
or mBSSP2 or a fragment thereof of the present invention.
Specifically, examples of a method for determining hBSSP2
or mBSSP2 or a fragment thereof in a specimen using
these antibodies include a sandwich method wherein the
antibody attached to an insoluble carrier and the labeled
antibody are reacted with hBSSP2 or mBSSP2 or a fragment
thereof to form a sandwich complex and the sandwich complex
is detected, as well as a competitive method wherein
labeled hBSSP2 or mBSSP2, and hBSSP2 or mBSSP2 or a
fragment thereof in the specimen are competitively reacted
with the antibody and hBSSP2 or mBSSP2 or a fragment
thereof in the specimen is determined based on the amount
of the labeled antigen reacted with the antibody.
As a sandwich method for determining hBSSP2 or
mBSSP2 or a fragment thereof, there can be used a two step
method, a one step method and the like. In the two step method,
first, the immobilized antibody is reacted with hBSSP2 or
CA 02616940 2008-01-30
mBSSP2 or a fragment thereof and then unreacted materials
are completely removed by washing, followed by addition of
the labeled antibody to form immobilized antibody-hBSSP2 or
mBSSP2-labeled antibody. In the one step method, the
5 immobilized antibody, labeled antibody and hBSSP2 or mBSSP2
or a fragment thereof are added at the same time.
Examples of an insoluble carrier used for the
determination include synthetic resins such as polystyrene,
polyethylene, polypropylene, polyvinyl chloride, polyester,
10 polyacrylate, nylon, polyacetal, fluorine plastic, etc.;
polysaccharides such as cellulose, agarose, etc.; glass;
metal; and the like. An insoluble carrier may be shaped in
various forms, for example, tray, sphere, fiber, rod plate,
container, cell, test tube, and the like. The antibody
15 adsorbed by a carrier is stored at a cold place in the
presence of an appropriate preservative such as sodium
azide or the like.
For immobilization of the antibody, a known
chemical bonding method or a physical adsorption can be
20 used. Examples of a chemical bonding method include a
method using glutaraldehyde; maleimide method using N-
succinimidyl-4-(N-maleimidomethyl) cyclohexane-1-
carboxylate, N-succinimidyl-2-maleimide acetate or the
like; carbodiimide method using 1-ethyl-3-(3-
25 dimethylaminopropyl)carbodiimide hydrochloride; or the like.
CA 02616940 2008-01-30
46
In addition, there are maleimidobenzoyl-N-
hydroxysuccinimide ester method, N-succinimidyl-3-(2-
pyridylthio)propionic acid method, bisdiazobenzidine method,
and dipalmityllysine method. Or, it is possible to capture
a complex formed beforehand by reacting a 'material to be
tested with two antibodies, whose epitopes are different,
with an immobilized a 3rd antibody against the antibody.
For labeling, it is preferred to use enzymes,
fluorescent substances, luminous substances, radioactive
substances, metal chelates, or the like. Examples of
enzymes include peroxidase, alkaline phosphatase, f3-D-
galactosidase, malate dehydrogenase, Staphylococcus
nuclease, 6-5-steroidisomerase, a-glycerol phosphate
dehydrogenase, triose phosphate isomerase, horseradish
peroxidase, asparaginase, glucose oxidase, ribonuclease,
urease, catalase, glucose-6-phosphate dehydrogenase,
glucoamylase, acetylcholinesterase and the like. Examples
of fluorescent substances include fluorescein
isothiocyanate, phycobiliprotein, rhodamine, phycoerythrin,
phycocyanin, allophycocyanin, o-phthalaldehyde, and the
like. Examples of luminous substances include
isoluminol, lucigenin, luminol, aromatic acridinium ester,
imidazole, acrdinium salt and its modified ester, luciferin,
luciferase, aequorin and the like. Examples of
radioactive substances include 1251, 1271, 1311, 14C, 3H, 32P, 35S
CA 02616940 2008-01-30
47
and the like. The labeling material is not limited to these
and any material which can be used for immunological
determination can be used. Further, a low molecular weight
hapten such as biotin, dinitrophenyl, pyridoxal or
fluorescamine may be attached to the antibody. Preferably,
horseradish peroxidase is used as a labeling enzyme. This
enzyme can be reacted with various substrates and can
readily be attached to the antibody by periodate method.
When an enzyme is used as a labeling material, a
substrate and, if necessary, a coloring enzyme is used for
measuring its activity. In the case of using peroxidase as the
enzyme, H202 is used as a substrate and a coloring
agent such as 2,2'-azino-di-[3-
ethylbenzthiazoline sulfonic acid] ammonium salt (ABTS),
5'-aminosalicylic acid, o-phenylenediamine, 4-
aminoantipyrine, 3,3',5,5'-tetramethylbenzidine or the like can
be used. In the case of using alkaline phosphatase as the enzyme,
o-nitrophenylphosphate, p-nitrophenylphosphoric acid, or
the like can be used as a substrate. In the case of using 13-D-
galactosidase as the enzyme, fluorescein-d-(13-D-
galactopyranoside), 4-methylumbelliphenyl-R-D-
galactopyranoside, or the like can be used as a substrate.
The present invention also includes a kit comprising the
above monoclonal antibody, polyclonal antibody and reagents.
As a cross-linking agent, a known cross-linking
CA 02616940 2008-01-30
48
agent such as N,N'-o-phenylenedimaleimide, 4-(N-
maleimidomethyl) cyclohexanoate-N-succinimide ester, 6-
maleimidohexanoate-N-succinimide ester, 4,4'-
dithiopyridine or the like can be utilized. The reaction
of these cross-linking agents with enzymes and antibodies
can be carried out by a known method according to
properties of a particular cross-linking agent. Further,
as the antibody, a fragment thereof, for example, Fab', Fab,
F(b12) can be used as the case may be. A labeled enzyme
can be obtained by the same treatment regardless of whether
the antibody is polyclonal or monoclonal. When the above
labeled enzyme obtained by using a cross-linking agent is
purified by a known method such as affinity chromatography
or the like, an immunoassay system having higher
sensitivity can be obtained. The enzyme-labeled and
purified antibody is stored at a dark cold place with
addition of a stabilizer such as thimerosal, glycerin or
after lyophilization.
An objective to be determined is not specifically
limited in so far as it is a sample containing BSSP2 or a
fragment thereof, or a sample containing a precursor of
BSSP2 or a fragment thereof and includes body fluids such
as plasma, serum, blood, serum, urine, tissue fluid,
cerebrospinal fluid and the like.
The following Examples further illustrate the
CA 02616940 2008-01-30
49
present invention in detail but are not construed to limit
the scope thereof.
Example 1: Cloning of novel serine protease mBSSP2 gene
The cloning was carried out by PCR using a mouse
brain cDNA library (Clontech) as a template and nucleotide
sequences corresponding to an amino acid sequence common to
serine proteases represented by
Primer 1: GTG CTC ACN GCN GCB CAY TG (SEQ ID NO: 20)
Primer 2: CCV CTR WSD CCN CCN GGC GA (SEQ ID NO: 21)
as primers. Namely, 5 pl of the template, 5 pl of 10 x
ExTaq buffer, 5 pl of dNTP, 10 pmol of each of the above
primers and 0.5 pl of ExTaq (TAKARA) were added and the
total volume was adjusted to 50 pl with sterilized water.
PCR was carried out by repeating a cycle of heating at 94 C
for 0.5 minute, at 55 C for 0.5 minute and then at 72 C for
1 minutes, 30 times. The PCR product was mixed with pCR
II-TOPO vector attached to TOPO TA cloning kit (Invitrogen)
and the mixture was allowed to stand at room temperature
for 5 minutes. Then, according to a conventional manner, E.
coli Top 10 attached to the kit was transformed and applied
to an LB (Amp+) plate containing 100 pg/ml of ampicillin.
According to a conventional manner, a plasmid was extracted
from each colony obtained and its nucleotide sequence was
determined by cycle sequencing with a fluorescence
CA 02616940 2008-01-30
sequencer (ABI). Homology of the sequence of each clone
was examined by means of GenBankT'. Regarding an unknown
sequence, i.e., BSSP2 gene, the full length cDNA was
obtained by 5' RACE and 3' RACE and, according to the same
5 manner as described above, the nucleotide sequence was
determined. Namely, BSSP2 clone specific primers, GSP1
primers [mBSSP2.2 (SEQ ID NO: 27) or mBSSP2.0 (SEQ ID NO:
22)] and GSP2 primers [mBSSP2R2 (SEQ ID NO: 28) or mBSSP2.1
(SEQ ID NO: 23)] were prepared. PCR was carried out by
10 using mouse brain Marathon-ReadyT" cDNA (Clontech), APl
primer attached to this reagent and either of the above
GSP1 primers and heating at 94 C for 2 minutes once and
repeating a cycle of heating at 94 C for 30 seconds, at
C for 30 seconds and then at 72 C for 30 seconds., 35
15 times. Then, 5 pi of the PCR product diluted to 1/100, 5
pil of 10 x buffer, 5 pl of dNTP, 10 pmol of either of 10 pM
of the above GSP2 primer, 10 pmol of AP2 primer attached to
the above reagent and 0.5 unit of ExTaq were admixed and
adjusted to 50 pl with sterilized water. Then, according
20 to the same manner as the above, PCR was carried out. The
PCR product was cloned by the above TOPO TA cloning kit and
sequenced to obtain the upstream and downstream regions of
the above clone. At this time, as for a clone which seemed
not to cover the full length of a protein, the specific
25 primers shown hereinafter were prepared based on the newly
CA 02616940 2008-01-30
51
found nucleotide sequence. Further, based on this sequence,
the primers capable of amplifying ORF as shown hereinafter
[mBSSPF7 (SEQ ID NO: 26), mBSSP2R/E (SEQ ID NO: 29) ] were
prepared and PCR carried out using mouse brain Marathon-
ready cDNA as a template to confirm that these clones were
identical. This was cloned into pCR II-TOPO vector
attached to TOPO TA cloning kit to obtain the plasmid pCR
II/mBSSP2= containing the full length cDNA clone. The
nucleotide sequence of DNA contained in this plasmid is
shown in SEQ ID NO: 7 and the amino acid sequence of mSSP2
protein deduced from the nucleotide sequence is shown in
SEQ ID NO: 8. Further, two different types of clones were
obtained. The nucleotide sequences of these DNA are shown
in SEQ ID NOS: 3 and 5, respectively. The amino acid
sequences of mBSSP2 proteins deduced from these nucleotide
sequences are shown in SEQ ID NOS: 4 and 6. These novel
proteases are divided into types 1, 2 and 3. Type 1 is
composed of 273 amino acids, type 2 is composed of 311
amino acids and type 3 is composed of 445 amino acids.
These amino acid sequences contained the common amino acid
sequence composed of 238 amino acids whose N-terminus side
started with Ile-Val-Gly-Gly-Gln-Ala-Val as the mature
serine protease. Further, in the amino acid sequence of
the mature serine protease, a consensus sequence having a
serine protease activity was contained. Furthermore, since
CA 02616940 2008-01-30
52
there were two or more amino acid sequence specific for a
sugar chain bonding site, it was presumed that the amino
acid sequence had at least two sugar chains.
Table 1
SEQ Name of Direc- Sequence Use
ID primer tion
NO:
22 mBSSP2.0 Forward ATGGTGGAGAAGATCATTCCT RACE
23 mBSSP2.1 Forward TACAGTGCCCAGAACCATG RACE
24 mBSSPF4 Forward CTCAACTCTCTGCTAGACCG RACE
25 mBSSP2F5 Forward ATAGTTGGCGGCCAAGCTGT mature
26 mBSSPF7 Forward CCCAGCAGAACTTACTGCCT FL*
27 mBSSP2.2 Reverse TGTTGCAGAGGTGGGTGCTG RACE
28 mBSSP2R2 Reverse TACCATTGTGTCCTGCAGTGT RACE
29 mBSSP2R5/E Reverse TGAATTCTGCTGCTTCTTCGGCTAGCG FL*
*: for full length
Example 2: Expression mBSSP2 gene in mice internal organs
According to the protocol of QuickPrep Micro mRNA
purification KitTm(Amersham-Pharmacia), mRNAs were isolated
from various internal organs of Balb/c mice or their
fetuses. They were subjected to electrophoresis according
to a conventional manner and transcribed to a nylon
membrane. A probe was prepared separately by isolating a
part of a nucleotide sequence encoding the mature protein
CA 02616940 2008-01-30
53
of mBSSP2 from pCR II/mBSSP2, purifying it and labeling it
with a-32P dCTP. The probe was diluted with 5 x SSC and
reacted with the above membrane filter at 65 C for a whole
day and night. Then, the filter was washed twice each with
2 x SSC/0.1% SDS at room temperature for 30 minutes, 1 x
SSC/0.1% SDS at room temperature for 30 minutes and 0.1 x
SSC/0.1% SDS at 65 C for 30 minutes. The filter was
exposed to an imaging plate for FLA2000Th(Fuji Film) for one
day to analyze the expression. The results shown in the
drawings are those obtained using mRNAs prepared from the
head of fetuses of mice and mRNAs prepared from brain of 5-
day-, 10-day-, 14-day-, 18-day-, 30-day-, 3-month-, 7-month
and 1-year-old mice (Fig. 1) and mRNAs prepared from
various internal organs of 3-month-old mice (Fig. 2). In
addition, the mRNAs of mice prepared above were subjected
to RT-PCR by using Ready To Go RT-PCR Beads' (Amersham-
Pharmacia) and mBSSP2 gene specific primers (SEQ ID NOS: 25
and 29) according to the protocol attached to the kit.
As seen from Figs. 1 and 2, in the case of northern
blotting analysis, the expression of mBSSP2 was recognized
in head of 15th to 20th day fetuses of mice and, as to the
3-month-old mice, the expression was recognized in prostate
and testicle. Further, according to the results of RT-PCR,
the expression was recognized in the head of 12-day-old mice
and the testicle of 3-month-old mice.
CA 02616940 2008-01-30
54
Example 3: Expression of novel serine protease mature
protein encoded by mBSSP2 gene
(1) Construction of expression plasmid
A cDNA region encoding the mature protein of
BSSP2 protein was amplified by PCR using the plasmid pCR
II/mBSSP2 as a template (the sequence of the 1st to 717th
bases of SEQ ID NO: 1 was amplified using the primers
having the sequences represented by SEQ ID NOS: 25 and 29).
The PCR product was ligated to pTrc-HisB (Invitrogen) which
had been digested with BamHI and blunted with mung bean
nuclease. E. coli JM109 was transformed by the resultant product
and colonies formed were analyzed by PCR to obtain E. coli
containing the desired serine protease expressing plasmid
pTrcHis/mBBSP2.
The resultant E. coli was designated E. coli
pTrcHis/mBSSP2 and deposited at the National Institute of
Bioscience and Human-Technology (NIBH), Agency of
Industrial Science & Technology of 1-1-3 Higashi, Tsukuba-
shi, Ibaraki-ken, Japan on October 29, 1998 under the
accession number of FERM P-17033.
(2) Expression of protein by E. coli containing
expression plasmid
A single colony of E. coli having the expression
plasmid was inoculated in 10 ml of LB (Amp+) culture medium
CA 02616940 2008-01-30
and incubated at 37 C overnight. This was inoculated in
250 ml of LB (Amp') culture medium and incubated at 37 C.
When the absorbance at 600 nm became 0.5, 250 pl of 0.1 M
IPTG (isopropyl-R-D-(-)-thiogalactopyranoside) was added
5 and the incubation was continued for an additional 5 hours.
The E. coli was centrifuged and suspended in a cell
disruption buffer (10 mM phosphate buffer pH 7.5, 1 mM
EDTA) and sonicated on ice to disrupt E. co'i. This was
centrifuged at 14,000 r.p.m. for 20 minutes to obtain a
10 precipitate. The precipitate was washed twice with a cell
disruption buffer containing 0.5% Triton X-100TH and washed
with water to remove Triton X-100T". Then, the resultant
mixture was dissolved by soaking in a denaturation buffer
containing 8 M urea (8M urea, 50 mM Tris pH8.5, 20 mM 2ME)
15 at 37 C for 1 hour. The solution was passed through TALONTM
metal affinity resin (Clontech), washed with the
denaturation buffer containing 10 mM imidazole, and then
eluted with the denaturation buffer containing 100 mM
imidazole to purify the solution. The purified product was
20 dialyzed against PBS for 3 days with exchanging the buffer
every other night to obtain the protein mBSSP2-His.
Example 4: Expression of - novel serine protease mature
protein encoded by mBSSP2 gene by using pFBTrypSigTag/BSSP2
25 (1) Construction of pFBTrypSigTag/BSSP2
CA 02616940 2008-01-30
56
The sequences represented by SEQ ID NOS: 11 and
12 were subjected to annealing and digested with NheI and
BamHI. The resultant fragment was inserted into pSecTag2A
(Invitrogen) to obtain pSecTrypHis. Twenty units of BAmHI
was added to 5 pg of pSecTrypHis vector and the vector was
cleaved at 37 C over 4 hours. Then, 6 units of mung bean
nuclease (TAKARA) was added thereto and reacted at room
temperature (25 C) for 30 minutes to blunt the terminal
ends. Further, the 3'-terminus side of the cloning site
was digested cleaved with 20 units of XhoI, 1 unit of
bacterial alkaline phosphatase (TAKARA) was added thereto
and the reaction was carried out at 65 C for 30 minutes.
According to the same manner as that described in
JP 9-149790 A or Biochim. Biophys. Acta, 1350, 11, 1997,
mRNA was prepared from COLO201 cells and cDNA was
synthesized to obtain the plasmid pSPORT/neurosin. cDNA of
an active region of neurosin was obtained from
pSPORT/neurosin by PCR using primers. having the sequences
represented by SEQ ID NOS: 13 and 14. Ten units of XhoI
was reacted with the PCR product at 37 C for 3 hours to
cleave XhoI site at the 3'-side thereof. This was inserted
into pSecTrypHis by TAKARA ligation kit to obtain
pSecTrypHis/neursoin (Fig. 3).
Amplification was carried out using
primers having sequences represented by SEQ ID NOS: 15
CA 02616940 2008-01-30
57
and 16 so that the peptide of Leu-Val-His-Gly was present
at the C-terminus of the part from trypsin signal to the
enterokinase recognition site of pSecTrypHis/neurosin.
This was inserted between NheI and 'Hindlll sites of
pSecTag2A to construct the plasmid pTrypSig.
One pg (0.1 pl) of the plasmid pSecTab2A was
treated with the restriction enzymes NheI and BamHI to
completely remove a region encoding the leader sequence of
IgGk. One hundred pmol portions of DNAs represented by SEQ
ID NOS: 40 and 41 were added to the resultant solution and
the mixture was heated at 70 C for 10 minutes and subjected
to annealing by allowing to stand at room temperature for
30 minutes. Two pl of I solution of DNA ligation kit Ver.
2 (TAKARA) was added to 1 pl portions of His secretory
signal sequence treated by NheI and BamHI and pSecTag2A and
the reaction was carried out at 16 C for 30 minutes.
To the reaction mixture was add 0.1 ml of E. coli
competent cell XL1-BlueT(STRATAGENE) and reacted on ice for
30 minutes. Then, the reaction mixture was subjected to
heat shock at 42 C for 60 seconds. After standing on ice
for 2 minutes, 0.9 ml of SOCTh culture medium (Toyo Boseki
K.K.) was added thereto and the mixture was shaken with a
shaker at 37 C for 1 hour. The mixture was centrifuged at
5,000 r.p.m. for 1 minutes and the supernatant was
discarded. The precipitated competent cells were suspended
CA 02616940 2008-01-30
58
in the liquid remaining in the centrifuge tube and the
suspension was applied to 2 ampicillin LB plates containing
100 pg/ml of ampicillin in the ratio of 1 : 10. The plates
were incubated at 37 C for one night. Among the colonies
formed, a colony into which DNA of His secretory signal was
inserted was selected by PCR to obtain pTrypHis.
A sequence of about 200 bp containing His Tag
region of pTrypHis was amplified by using primers having
the sequence represented by SEQ ID NOS: 16 and 17 and a
fragment of about 40 bp containing His Tag and enterokinase
recognizing site formed by digestion of Hindlll and BamHI
was inserted into pTrypSig to construct pTrypSigTag (Fig.
4A).
cDNA was prepared by PCR of the sequence from
trypsin signal to enterokinase recognizing site of
pTrypSigTag using primers having the sequences represented
by SEQ ID NOS 14 and 18 and cut out by digestion with BglII
and BamHI. It was inserted into BamHI site of pFastBACl.
The insertion direction was confirmed by PCR using primers
having sequences represented by SEQ ID NOS: 14 and 19.
A clone into which the cDNA was inserted in the direction
toward transcription and translation was selected to obtain
pFBTrypSigTag.
Twenty units of BamHI was added to 5 pg of
pFBTrypSigTag vector and the vector was cleaved at 37 C
CA 02616940 2008-01-30
59
over 4 hours, followed by addition of 6 units of mung bean
nuclease (TAKARA) and reaction at room temperature (25 C)
for 30 minutes to blunt the terminal ends. Further, the
3'-side of the cloning site was cleaved by 20 units of
EcoRI, followed by addition of 1 unit of bacterial alkaline
phosphatase (TAKARA). The reaction was carried out at 65 C
for 30 minutes.
cDNA of the active region of mBSSP2 was obtained
by PCR according to a conventional manner using
pTrcHis/mBSSP2 or pCRII/mBSSP2 prepared from E. coli
pTrcHis/mBSSP2 (accession No. FERM P-17033). The resultant
cDNA was inserted into pFBTrypSigTag to obtain
pFBTrypSigTag/mBSSP2 (Fig. 4B). At this time, correct
insertion of mBSSP2 was confirmed by determining the
sequence.
Bacmid DNA was transformed with
PFBTrypSigTag/mBSSP2 according to a protocol of Gibco BRL
BAC-TO-BAC baculovirus expression system to prepare a
recombinant bacmid having chimera BSSP2 fused with
trypsinogen signal peptide, HisTag and enterokinase
recognizing site. When this was expressed in Sf-9 cell
according to a manual of BAC-TO-BAC baculovirus expression
system, it was secreted in the culture supernatant from 2
days after infection of the virus.
(2) Determination of enzyme activity
CA 02616940 2008-01-30
The recombinant fused protein mSSP2 obtained in
the culture supernatant was passed through a chelate column
to purify it and, after dialysis, its enzyme activity was
determined. First, the culture supernatant was applied to
5 a chelate column (Ni-NTA-Agarose, Qiagen) with PBS buffer
and eluted stepwise with a solution of imidazole (Wako Pure
Chemical Industries, Ltd.) dissolved in PBS. The resultant
imidazole-eluted fraction was applied to a PD-JOTM column
(Pharmacia) to exchange to PBS buffer. Fifty p1 of this
10 sample was mixed with 10 pl of enterokinase (1 U/1 pl,
Invitrogen) and the reaction was carried out at room
temperature for 60 minutes. Each of various synthetic
substrates (Peptide Laboratory, Boc-Gln-Ala-Arg-MCA, Boc-
Phe-Ser-Arg-MCA, Bz-Arg-MCA, Boc-Val-Leu-Lys-MCA, Pyr-Gly-
15 Arg-MCA, Pro-Phe-Arg-MCA, Boc-Val-Pro-Arg-MCA, Z-Arg-Arg-
MCA, Arg-MCA, Z-Phe-Arg-MCA) was dissolved in DMSO and
diluted with 1 M Tris-HC1 (pH 8.0) to obtain a substrate
solution. Fifty pl of 0.2 M substrate solution was added
thereto and further the reaction was carried out at 37 C.
20 After one hour, the fluorescence of AMC (7-amino-4-
methylcoumalin) formed by the enzymatic reaction was
measured at 380 nm of excitation wavelength and 460 nm of
fluorescence wavelength to determine the activity.
As a result, the recombinant fused protein mBSSP2
25 has been shown to have serine protease activity.
CA 02616940 2008-01-30
61
Example 5: Cloning of hBSSP2 gene
Reverse transcription of 1 pg of mRNA of human
fetus brain (Clontech) was carried out by using Superscript
II' (Gibco BRL) and oligo dT-Not I primer (5'
GGCCACGCGTCGACTAGTA C(T)1, 3') to obtain cDNA. By using
this as a template, PCR was carried out with primers
prepared from mBSSP2 nucleotide sequence and represented by
SEQ ID NOS: 30 and 31 to obtain a cDNA fragment of hBSSP2.
Namely, 5 pl of the template, 5 pl of 10 x ExTaq buffer
(TAKARA), 5 pl of dNTPs, 10 pmol portions of the above
primers and 0.5 pl of ExTaq (TAKARA) were adjusted to 50 pl
with sterilized water and PCR was carried out by repeating
a cycle of heating at 94 C for 0.5 minute, at 55 C for 0.5
minute and then at 72 C for 1 minute, 35 times. The PCR
reactions described hereinafter were carried out according
to the same manner as the above composition and conditions
except the template and primers. The PCR product was mixed
with pGEM-T Easy vector (Promega) and Takaram Ligation
Solution I (TAKARA) and the reaction was carried out at
16 C for 2 hours. Then, according to the same manner, E.
coli JM109 was transformed and applied to a LB (Amp+) plate.
A plasmid was extracted from each colony formed according
to a conventional manner and its nucleotide sequence was
determined by dideoxy method. As for a clone having
CA 02616940 2008-01-30
62
homology to mBSSP2, full length cDNA was obtained by 5'
RACE and 3' RACE and its sequence was determined as
described above. PCR was carried out by using the above
cDNA as a template and primers having the sequences
represented by SEQ ID NOS: 30 and 37. 3' RACE was carried
out by PCR using a 1/100 dilution of the above PCR product
as a template and primers having the sequences represented
by SEQ ID NOS: 32 and 37. As for 5' RACE, cDNA for RACE
was prepared from human fetal brain mRNA (Clontech) by
using Superscript II and SMART RACE TM cDNA amplification kit
(Clontech). PCR of this cDNA was carried out by using a
primer of 10 x Universal Primer Mix (attached to the kit)
and a primer having the sequence represented by SEQ ID NO:
33. Further, PCR was carried out by using the 1/100
dilution of the latter PCR product, a template, Nested PCR
Primer (attached to the kit) and a primer having the
sequence represented by SEQ ID NO: 34. The finally
obtained PCR product was subjected to TA cloning as
described above and the nucleotide sequence was determined
to obtain the upstream and downstream regions of the above
clone. In addition, primers for amplifying the full length
cDNA as represented by SEQ ID NOS: 35 and 36 were prepared
based on the resultant nucleotide sequence and PCR was
carried out by using the above synthetic cDNA as a template.
This PCR product was cloned into pGEM-T Easy vector to
CA 02616940 2008-01-30
63
obtain the plasmid pGEM-TE/hBSSP2 containing the full
length cDNA clone. The DNA sequence contained in this
plasmid is shown in SEQ ID NO: 9 and hBSSP2 protein deduced
from the nucleotide sequence is shown in SEQ ID NO: 10.
E. coli containing this plasmid was designated E.
coli pGEM-TE/hBSSP2 and deposited at National Institute of
Bioscience and Human-Technology (NIBH), Agency of
Industrial Science & Technology of 1-1-3 Higashi, Tsukuba-
shi, Ibaraki-ken, Japan on July 27, 1999 under the
accession number of FERM P-17487.
Table 2
SEQ Name of Direc- Sequence Use
ID primer tion
NO:
30 BSSP2SPF Forward ACTGCTGCCCACTGCATG for part
31 BSSP2SPR Reverse CAGGGGTCCCCCGCTGTCTCC for part
32 hBSSP2F11 Forward GCTCTCAACTTCTCAGACAC RACE
33 hBSSP2R12 Reverse ACTCAGCTACCTTGGCGTAG RACE
34 hBSSP2R11 Reverse CCTGGAGCATATCCGAGCTG RACE
35 hBSSR2F12 Forward GCTTTACAACAGTGCTAC WB*
36 hBSSP2R13/E Reverse TGGAATTCGAGGAAACAGCAGGACTCAG WB*
37 TACTAGTCGACGCGTGGCC
*: whole body
Example 6: Detection of hBSSP2 mRNA by northern blotting
CA 02616940 2008-01-30
64
Poly A + RNA extracted from respective tissues of
human adults and fetuses were blotted on a membrane
(Clontech) and the membrane was subjected to northern
hybridization with a hBSSP2 probe. The probe was labeled
by Takara BcaBEST random labeling kit (TAKARA) according to
random priming method using a cDNA fragment which was
amplified by using the full length of hBSSP2 as a template
and the sequences represented by SEQ ID NOS : 34 and 35 as
primers. The hybridization was carried out at 60 C
overnight and the filter was finally washed with 0.1 x SSC
and 0.1% SDS. The radioactivity was detected by FLA-2000'
(Fuji Film). The signal corresponding to the adult brain
was recognized at about 2.4 kb, the signal corresponding to
the adult skeletal muscle was recognized at 7 kb and 1.3 kb
and further the signal of the fetus liver was recognized at
7 kb (Fig. 5). The signal of the adult brain is considered
to correspond to the exact nucleotide sequence and the
others are considered to correspond to polymorphic forms
resulted from the difference in splicing.
Example 7: Detection of hBSSP2 mRNA by RT-PCR
mRNAs of human tissues purchased from Clontech
were subjected to RT-PCR against hBSSP2 by using Ready To
Go RT-PCR Beadstm (Amer-sham-Pharmacia) according to the
protocol attached to the kit. Expression of hBSSP2 was
CA 02616940 2008-01-30
recognized in brain and skeletal tissue (Fig. 6). No clear
band was obtained in the pancreas due to the combination of
primers. This is considered to be non-specific
amplification by a large amount of a serine protease
5 present in the pancreas.
Example 8: Expression of hBSSP2 by baculovirus system
The signal sequence of human trypsinogen 2 and
(His) 6 Tag and a sequence encoding the cleavage site of
10 enterokinase were inserted into pFastBacl (Gibco BRL) to
obtain the plasmid pFBTrypSigTag. The mature form of
hBSSP2 was inserted into the plasmid pFBTrypSigTag so that
it was located in the flame (Fig. 4B.). The mature form of
hBSSP2 amplified by the sequences represented by SEQ ID
15 NOS: 38 and 36 was cleaved by EcoRI and, according to the
same manner as described with respect to mBSSP2, it was
inserted into pFBTrySigTag to construct
pFastBacTrypSigTag/hBSSP2. At this time, correct insertion
of BSSP2 was confirmed by determining the nucleotide
20 sequence by using the fluorescent labeled sequence
represented by SEQ ID NO: 39. Bacmid DNA was transformed
with PFBTrypSigTag/hBSSP2 according to a protocol of Gibco
BRL BAC-TO-BAC baculovirus expression system to prepare a
recombinant bacmid having chimera BSSP2 fused with
25 trypsinogen signal peptide, HisTag and enterokinase
CA 02616940 2008-01-30
66
recognizing site. When this was expressed in Sf-9 cell
according to a manual of BAC-TO-BAC baculovirus expression
system and the culture supernatant from 3 days after
infection of the virus subjected to western blot technique
with anti-DDDDK antibody, a specific band was detected to
confirm expression of hBSSP2 (Fig. 7).
Table 3
SEQ Name of Direc- Sequence Use
ID primer tion
NO:
38 hBSSP2F13 Forward ACTGCTGCCCACTGCATG for part
39 FBTrypSigTagF5 GCGCTAGCAGATCTCCATGAATCTACTCCTGATCC NS*
*: nucleotide sequence
INDUSTRIAL UTILITY
According to the present invention, there are
provided isolated human and mouse serine protease (hBSSP2
and mBSSP2) polynucleotides, their homologous forms, mature
forms, precursors and polymorphic variants. Further,
according to the present invention, there are provided
hBSSP2 and mBSSP2 proteins as well as compositions
containing hBSSP2 and mBssP2 polynucleotides and proteins,
their production and use.
CA 02616940 2008-01-30
67
SEQUENCE LISTING FREE TEXT
SEQ ID NO: 11: Designed oligonucleotide to
construct plasmid pSecTrypHis.
SEQ ID NO: 12: Designed oligonucleotide to
construct plasmid pSecTrypHis.
SEQ ID NO: 13: Designed oligonucleotide primer to
amplify neurosin-encoding sequence.
SEQ ID NO: 14: Designed oligonucleotide primer to
amplify neurosin-encoding sequence.
SEQ ID NO: 15: Designed oligonucleotide primer to
amplify a portion of plasmid pSecTrypHis/Neurosin.
SEQ ID NO: 16: Designed oligonucleotide primer to
amplify a portion of plasmid pSecTrypHis/Neurosin.
SEQ ID NO: 17: Designed oligonucleotide primer to
amplify a portion of plasmid pTrypHis.
SEQ ID NO: 18: Designed oligonucleotide primer to
amplify a portion of plasmid pTrypSigTag.
SEQ ID NO: 19: Designed oligonucleotide primer to
amplify a portion of.plasmid pFBTrypSigTag.
SEQ ID NO: 20: Designed oligonucleotide primer to
amplify conserved region of serine proteases-encoding
sequence; n is a, c, g or t.
SEQ ID NO: 21: Designed oligonucleotide primer to
amplify conserved region of serine proteases-encoding
sequence; n is a, c, g or t.
CA 02616940 2008-01-30
68
{ SEQ ID NO: 22: Designed oligonucleotide primer
designated as mBSSP2.0 for RACE for mBSSP2 (forward).
SEQ ID NO: 23: Designed oligonucleotide primer
designated as mBSSP2.1 for RACE for mBSSP2 (forward).
SEQ ID NO: 24: Designed oligonucleotide primer
designated as mBSSPF4 for RACE for mBSSP2 (forward).
SEQ ID NO: 25: Designed oligonucleotide primer
designated as mBSSP2F5 to amplify mature mBSSP2-encoding
region (forward).
SEQ ID NO: 26: Designed oligonucleotide primer
designated as mBSSPF7 to amplify full-length mBSSP2-
encoding mRNA (forward).
SEQ ID NO: 27: Designed oligonucleotide primer
designated as mBSSP2.2 for RACE for mBSSP2 (reverse).
SEQ ID NO: 28: Designed oligonucleotide primer
designated as mBSSP2R2 for RACE for mBSSP2 (reverse).
SEQ ID NO: 29: Designed oligonucleotide primer
designated as mBSSP2R5/E to amplify full-length mBSSP2-
encoding mRNA (reverse).
SEQ ID NO: 30: Designed oligonucleotide primer
designated as BSSP2SPF to amplify a portion of hBSSP2
(forward).
SEQ ID NO: 31: Designed oligonucleotide primer
designated as BSSP2SPR to amplify a portion of hBSSP2
(reverse).
CA 02616940 2008-01-30
69
SEQ ID NO: 32: Designed oligonucleotide primer
designated as hBSSP2F11 for RACE for hBSSP2 (forward).
SEQ ID NO: 33: Designed oligonucleotide primer
designated as hBSSP2R12 for RACE for hBSSP2 (reverse).
SEQ ID NO: 34: Designed oligonucleotide primer
designated as hBSSP2R11 for RACE for hBSSP2 (reverse).
SEQ ID NO: 35: Designed oligonucleotide primer
designated as hBSSP2F12 to amplify full length hBSSP2
(forward).
SEQ ID NO: 36: Designed oligonucleotide primer
designated as hBSSP2R13/E to amplify full length hBSSP2
(reverse).
SEQ ID NO: 37: Designed oligonucleotide primer
for RACE for hBSSP2.
SEQ ID NO: 38: Designed oligonucleotide primer
designated as hBSSP2F13 to amplify a portion of hBSSP2
(forward).
SEQ ID NO: 39: Designed oligonucleotide primer
designated as FBTrpsigtagF5 to detect hBSSP2.
SEQ ID NO: 40: Designed oligonucleotide to
construct plasmid pTrypHis.
SEQ ID NO: 41: Designed oligonucleotide to
construct plasmid pTrypHis.
CA 02616940 2008-11-05
SEQUENCE LISTING
<110> FUSO PHARMACEUTICAL INDUSTRIES, LTD.
<120> NOVEL SERINE PROTEASE BSSP2
<130> 46465-NP1
<140> 2,616,940 (divisional of CA 2,350,080)
<141> 1999-11-19
<150> PCT/JP99/06475
<151> 1999-11-19
<150> JP 10/347785
<151> 1998-11-20
<160> 41
<210> 1
<211> 717
<212> DNA
<213> mouse
<400> 1
ata gtt ggc ggc caa get gtg get tct ggg cgc tgg cca tgg caa get agc 51
Ile Val Gly Gly Gln Ala Val Ala Ser Gly Arg Trp Pro Trp Gln Ala Ser
1 5 10 15
gtg atg ctt ggc tcc cgg cac acg tgt ggg gcc tct gtg ttg gca cca cac 102
Val Met Leu Gly Ser Arg His Thr Cys Gly Ala Ser Val Leu Ala Pro His
20 25 30
tgg gta gtg act get gcc cac tgc atg tac agt ttc agg ctg tcc cgc cta 153
Trp Val Val Thr Ala Ala His Cys Met Tyr Ser Phe Arg Leu Ser Arg Leu
35 40 45 50
tcc agc tgg cgg gtt cat gca ggg ctg gtc agc cat ggt get gtc cga caa 204
Ser Ser Trp Arg Val His Ala Gly Leu Val Ser His Gly Ala Val Arg Gln
55 60 65
CA 02616940 2008-11-05
71
cac cag gga act atg gtg gag aag atc att cct cat cct ttg tac agt gcc 255
His Gin Gly Thr Met Val Glu Lys Ile Ile Pro His Pro Leu Tyr Ser Ala
70 75 80 85
cag aac cat gac tat gat gtg get ctg ctg cag ctc cgg aca cca atc aac 306
Gin Asn His Asp Tyr Asp Val Ala Leu Leu Gin Leu Arg Thr Pro Ile Asn
90 95 100
ttc tca gac acc gtg gac get gtg tgc ttg ccg gcc aag gag cag tac ttt 357
Phe Ser Asp Thr Val Asp Ala Val Cys Leu Pro Ala Lys Glu Gln Tyr Phe
105 110 115
cca tgg ggg tcg cag tgc tgg gtg tct ggc tgg ggc cac acc gac ccc agc 408
Pro Trp Gly Ser Gin Cys Trp Val Ser Gly Trp Gly His Thr Asp Pro Ser
120 125 130 135
cat act cat agc tca gat aca ctg cag gac aca atg gta ccc ctg ctc agc 459
His Thr His Ser Ser Asp Thr Leu Gin Asp Thr Met Val Pro Leu Leu Ser
140 145 150
acc cac ctc tgc aac agc tca tgc atg tac agt ggg gca ctt aca cac cgc 510
Thr His Leu Cys Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu Thr His Arg
155 160 165 170
atg ttg tgt get ggc tac ctg gat gga agg gca gac gca tgc cag gga gac 561
Met Leu Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gin Gly Asp
175 180 185
agc ggg gga ccc ctg gta tgt ccc agt ggt gac acg tgg cac ctt gta ggg 612
Ser Gly Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His Leu Val Gly
190 195 200
gtg gtc agc tgg ggt cgt ggc tgt gca gag ccc aat cgc cca ggt gtc tat 663
Val Val Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro Gly Val Tyr
205 210 215 220
gcc aag gta gca gag ttc ctg gac tgg atc cat gac act gtg cag gtc cgc 714
Ala Lys Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val Gin Val Arg
225 230 235
tag 717
<210> 2
<211> 238
<212> PRT
<213> mouse
CA 02616940 2008-11-05
72
<400> 2
Ile Val Gly Gly Gln Ala Val Ala Ser Gly Arg Trp Pro Trp Gln Ala Ser
1 5 10 15
Val Met Leu Gly Ser Arg His Thr Cys Gly Ala Ser Val Leu Ala Pro His
20 25 30
Trp Val Val Thr Ala Ala His Cys Met Tyr Ser Phe Arg Leu Ser Arg Leu
35 40 45 50
Ser Ser Trp Arg Val His Ala Gly Leu Val Ser His Gly Ala Val Arg Gin
55 60 65
His Gin Gly Thr Met Val Glu Lys Ile Ile Pro His Pro Leu Tyr Ser Ala
70 75 80 85
Gln Asn His Asp Tyr Asp Val Ala Leu Leu Gln Leu Arg Thr Pro Ile Asn
90 95 100
Phe Ser Asp Thr Val Asp Ala Val Cys Leu Pro Ala Lys Glu Gln Tyr Phe
105 110 115
Pro Trp Gly Ser Gln Cys Trp Val Ser Gly Trp Gly His Thr Asp Pro Ser
120 125 130 135
His Thr His Ser Ser Asp Thr Leu Gin Asp Thr Met Val Pro Leu Leu Ser
140 145 150
Thr His Leu Cys Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu Thr His Arg
155 160 165 170
Met Leu Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gin Gly Asp
175 180 185
Ser Gly Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His Leu Val Gly
190 195 200
Val Val Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro Gly Val Tyr
205 210 215 220
Ala Lys Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val Gln Val Arg
225 230 235
<210> 3
<211> 1685
<212> DNA
<213> mouse
<400> 3
ctcacatgta tctttcagaa taaatggaga ggatcttctg cttcaagtac aagtaagagc 60
tcggccagac tggctcctgg tatgccatga gggccggagc ccagccctgg gcatgcacat 120
CA 02616940 2008-11-05
73
ctgcaagagt cttgggcata tcaggcttac tcaacacaag gccgtgaatc tgtctgacat 180
caagctcaac agatcccagg agtttgctca actctctgct agaccgggag gccttgtaga 240
ggaggc atg gaa gcc cag gta ggg ctt ctg tgg gtt agc get aac tgt cct 291
Met Glu Ala Gln Val Gly Leu Leu Trp Val Ser Ala Asn Cys Pro
-35 -30 -25
tct ggc cga att gtt tct ctc aaa tgt tct gag tgt ggg gca agg cct ctg 342
Ser Gly Arg Ile Val Ser Leu Lys Cys Ser Glu Cys Gly Ala Arg Pro Leu
-20 -15 -10 -5
get tct cga ata gtt ggc ggc caa get gtg get tct ggg cgc tgg cca tgg 393
Ala Ser Arg Ile Val Gly Gly Gin Ala Val Ala Ser Gly Arg Trp Pro Trp
-1 1 5 10
caa get agc gtg atg ctt ggc tcc cgg cac acg tgt ggg gcc tct qtg ttg 444
Gln Ala Ser Val Met Leu Gly Ser Arg His Thr Cys Gly Ala Ser Val Leu
15 20 25 30
gca cca cac tgg gta gtg act get gcc cac tgc atg tac agt ttc agg ctg 495
Ala Pro His Trp Val Val Thr Ala Ala His Cys Met Tyr Ser Phe Arg Leu
35 40 45
tcc cgc cta tcc agc tgg cgg gtt cat gca ggg ctg gtc agc cat ggt get 546
Ser Arg Leu Ser Ser Trp Arg Val His Ala Gly Lou Val Ser His Gly Ala
50 55 60 65
gtc cga caa cac cag gga act atg gtg gag aag ate att cct cat cct ttg 597
Val Arg Gln His Gin Gly Thr Met Val Glu Lys Ile Ile Pro His Pro Leu
70 75 80
tac agt gcc cag aac cat gac tat gat gtg get ctg ctg cog ctc cgg aca 648
Tyr Ser Ala Gin Asn His Asp Tyr Asp Val Ala Leu Leu Gln Leu Arg Thr
85 90 95
cca atc aac ttc tca gac acc gtg gac get gtg tgc ttg ccg gcc aag gag 699
Pro Ile Asn Phe Ser Asp Thr Val Asp Ala Val Cys Leu Pro Ala Lys Glu
100 105 110 115
cag tac ttt cca tgg ggg tog cag tgc tgg gtg tct ggc tgg ggc cac acc 750
Gin Tyr Phe Pro Trp Gly Ser Gin Cys Trp Val Ser Gly Trp Gly His Thr
120 125 130
gac ccc agc cat act cat agc tca gat aca ctg cag gac aca atg gta ccc 801
Asp Pro Ser His Thr His Ser Ser Asp Thr Leu Gln Asp Thr Met Val Pro
135 140 145 150
ctg ctc agc acc cac ctc tgc aac agc tca tgc atg tac agt ggg gca ctt 852
Leu Leu Ser Thr His Leu Cys Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu
155 160 165
CA 02616940 2008-11-05
74
aca cac cgc atg ttg tgt get ggc tac ctg gat gga agg gca gac gca tgc 903
Thr His Arg Met Leu Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys
170 175 180
cag gga gac agc ggg gga ccc ctg gta tgt ccc agt ggt gac acg tgg cac 954
Gin Gly Asp Ser Gly Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His
185 190 195 200
ctt gta ggg gtg gtc agc tgg ggt cgt ggc tgt gca gag ccc aat cgc cca 1005
Leu Val Gly Val Val Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro
205 210 215
ggt gtc tat gcc aag gta gca gag ttc ctg gac tgg atc cat gac act gtg 1056
Gly Val Tyr Ala Lys Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val
220 225 230 235
cag gtc cgc tagccgaaga agcagcagca gccacctgtg acgccgagct gtggatcgcc 1115
Gin Val Arg
catggatcac cccagtctgg gggccagcat ctgggtcact gggcctctcc ccaaaggctc 1175
tgacttcgag ttcatctttc tcatctgaga acctccacaa caggaaaagg agtctgcggc 1235
tagattggga atgatggtga gaggaaggga taggaggaca gaagagacag cagaggcttc 1295
tggaagcatc tgggagactg ctcctctgct ccccccacac cccacgtgca tccactgggg 1355
gatgctggag atgcccaatc cttgtttctt gtggggccac tggaaggcta agtccaactt 1415
tagaggatgc cctgtctcga gagttactag gaagataagg ttaaggttgg acaagctcag 1475
gtaaaggcac ggaagtcaag atcccctctc ccccgtgcgg tcctgttctg aggtaagcta 1535
atagccccgc accaggcaga ggtctacagg gtaagaagga tgcagttggg ctacacgacg 1595
ctatttttca aatgatgttt ctgtaaattg gttgagagag ttttgttatt aaacagaaat 1655
tatgtataaa aaaaaaaaaa aaaaaaaaaa 1685
<210> 4
<211> 273
<212> PRT
<213> mouse
<400> 4
Met Glu Ala Gln Val Gly Leu Leu Trp Val Ser Ala Asn Cys Pro
-35 -30 -25
Ser Gly Arg Ile Val Ser Leu Lys Cys Ser Glu Cys Gly Ala Arg Pro Leu
-20 -15 -10 -5
Ala Ser Arg Ile Val Gly Gly Gln Ala Val Ala Ser Gly Arg Trp Pro Trp
-1 1 5 10
CA 02616940 2008-11-05
Gln Ala Ser Val Met Leu Gly Ser Arg His Thr Cys Gly Ala Ser Val Leu
15 20 25 30
Ala Pro His Trp Val Val Thr Ala Ala His Cys Met Tyr Ser Phe Arg Leu
35 40 45
Ser Arg Leu Ser Ser Trp Arg Val His Ala Gly Leu Val Ser His Gly Ala
50 55 60 65
Val Arg Gln His Gln Gly Thr Met Val Glu Lys Ile Ile Pro His Pro Leu
70 75 80
Tyr Ser Ala Gin Asn His Asp Tyr Asp Val Ala Leu Leu Gln Leu Arg Thr
90 95
Pro Ile Asn Phe Ser Asp Thr Val Asp Ala Val Cys Leu Pro Ala Lys Glu
100 105 110 115
Gln Tyr Phe Pro Trp Gly Ser Gln Cys Trp Val Ser Gly Trp Gly His Thr
120 125 130
Asp Pro Ser His Thr His Ser Ser Asp Thr Leu Gln Asp Thr Met Val Pro
135 140 145 150
Leu Leu Ser Thr His Leu Cys Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu
155 160 165
Thr His Arg Met Leu Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys
170 175 180
Gin Gly Asp Ser Gly Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His
185 190 195 200
Leu Val Gly Val Val Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro
205 210 215
Gly Val Tyr Ala Lys Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val
220 225 230 235
Gin Val Arg
<210> 5
<211> 2068
<212> DNA
<213> mouse
<400> 5
ctggctgggc tgttgaatca atcccgacat gaggacagga gcctcaccct gcccagcaga 60
acttactgcc ttatatcagt gcagctgact catatgagtc caacactgga tgaccaaagc 120
ccaatggaga ttcggtgcac ggaagagggt gctgggcctg ggatcttcag aatggagttg 180
ggagaccaga ggcaatccat ttctcagtcc caacgctggt gctgcctgca acgtggctgt 240
CA 02616940 2008-11-05
76
gtaatactgg gcgtcctggg gctgctggct ggagcaggca ttgcttcatg gctcttagtg 300
ttgtatctat ggccggctgc ctctccatcc atctctggga cgttgcagga ggaggagatg 360
actttgaact gtccaggagt gagctgtgag gaagagctcc ttccatctct tcccaaaaca 420
gaataaatgg aggggatctt ctgcttcaag tacaagtaag agctcggcca gacgggctcc 480
tggtctgcca tgagggctgg agccccgccc tgggc atg cac atc tgc aag agt ctt 536
Met His Ile Cys Lys Ser Leu
-70
ggg cat atc agg ctt act caa cac aag gcc gtg aat ctg tct gac atc aag 587
Gly His Ile Arg Leu Thr Gin His Lys Ala Val Asn Leu Ser Asp Ile Lys
-65 -60 -55 -50
ctc aac aga tcc cag gag ttt get caa ctc tct get aga ccg gga ggc ctt 638
Leu Asn Arg Ser Gin Glu Phe Ala Gln Leu Ser Ala Arg Pro Gly Gly Leu
-45 -40 -35
gta gag gag gca tgg aag ccc agc get aac tgt cct tct ggc cga att gtt 689
Val Glu Glu Ala Trp Lys Pro Ser Ala Asn Cys Pro Ser Gly Arg Ile Val
-30 -25 -20
tct ctc aaa tgt tct gag tgt ggg gca agg cct ctg get tct cga ata gtt 740
Ser Leu Lys Cys Ser Glu Cys Gly Ala Arg Pro Leu Ala Ser Arg lie Val
-15 -10 -5 -1 1
ggc ggc caa get gtg get tct ggg cgc tgg cca tgg caa get agc gtg atg 791
Gly Gly Gln Ala Val Ala Ser Gly Arg Trp Pro Trp Gin Ala Ser Val Met
10 15
ctt ggc tcc cgg cac acg tgt ggg gcc tct gtg ttg gca cca cac tgg gta 842
Leu Gly Ser Arg His Thr Cys Gly Ala Ser Val Leu Ala Pro His Trp Val
20 25 30 35
gtg act get gcc cac tgc atg tac agt ttc agg ctg tcc cgc cta tcc agc 893
Val Thr Ala Ala His Cys Met Tyr Ser Phe Arg Leu Ser Arg Leu Ser Ser
40 45 50
tgg cgg gtt cat gca ggg ctg gtc agc cat ggt get gtc cga caa cac cag 944
Trp Arg Val His Ala Gly Leu Val Ser His Gly Ala Val Arg Gin His Gln
55 60 65 70
gga act atg gtg gag aag atc att cct cat cct ttg tac agt gcc cag aac 995
Gly Thr Met Val Glu Lys Ile lie Pro His Pro Leu Tyr Ser Ala Gln Asn
75 80 85
cat gac tat gat gtg get ctg ctg cag ctc cgg aca cca atc aac ttc tca 1046
His Asp Tyr Asp Val Ala Leu Leu Gln Leu Arg Thr Pro Ile Asn Phe Ser
90 95 100
CA 02616940 2008-11-05
77
gac acc gtg gac get gtg tgc ttg ccg gcc aag gag cag tac ttt cca tgg 1097
Asp Thr Val Asp Ala Val Cys Leu Pro Ala Lys Glu Gin Tyr Phe Pro Trp
105 110 115 120
ggg tcg cag tgc tgg gtg tct ggc tgg ggc cac acc gac ccc agc cat act 1148
Gly Ser Gin Cys Trp Val Ser Gly Trp Gly His Thr Asp Pro Ser His Thr
125 130 135
cat agc tca gat aca ctg cag gac aca atg gta ccc ctg ctc agc acc cac 1199
His Ser Ser Asp Thr Leu Gin Asp Thr Met Val Pro Leu Leu Ser Thr His
140 145 150 155
ctc tgc aac agc tca tgc atg tac agt ggg gca ctt aca cac cgc atg ttg 1250
Leu Cys Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu Thr His Arg Met Leu
160 165 170
tgt get ggc tac ctg gat gga agg gca gac gca tgc cag gga gac agc ggg 1301
Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gin Gly Asp Ser Gly
175 180 185
gga ccc ctg gta tgt ccc agt ggt gac acg tgg cac ctt gta ggg gtg gtc 1352
Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His Leu Val Gly Val Val
190 195 200 205
agc tgg ggt cgt ggc tgt gca gag ccc aat cgc cca ggt gtc tat gcc aag 1403
Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro Gly Val Tyr Ala Lys
210 215 220
gta gca gag ttc ctg gac tgg ate cat gac act gtg cag gtc cgc tagccga 1455
Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val Gin Val Arg
225 230 235
agaagcagca gcagccacct gtgacgccga gctgtggatc gcccatggat caccccagtc 1515
tgggggccag catctgggtc actgggcctc tccccaaagg ctctgacttc gagttcatct 1575
ttctcatctg agaacctcca caacaggaaa aggagtctgc ggctagattg ggaatgatgg 1635
tgagaggaag ggataggagg acagaagaga cagcagaggc ttctggaagc atctgggaga 1695
ctgctcctct gctcccccca caccccacgt gcatccactg ggggatgctg gagatgccca 1755
atccttgttt cttgtggggc cactggaagg ctaagtccaa ctttagagga tgccctgtct 1815
cgagagttac taggcagata aggttaaggt tggacaagct caggtaaagg cacggaagtc 1875
aagatcccct ctcccccgtg cggtcctgtt ctgaggtaag ctaatagccc cgcaccaggc 1935
agaggtctac agggtaagaa ggatgcagtt gggctacacg acgctatttt tcaaatgatg 1995
tttctgtaaa ttggttgaga gagttttgtt attaaacaga aattatgtat aaaaaaaaaa 2055
aaaaaaaaaa aaa 2068
<210> 6
<211> 311
CA 02616940 2008-11-05
78
<212> PRT
<213> mouse
<400> 6
Met His Ile Cys Lys Ser Leu
-70
Gly His Ile Arg Leu Thr Gin His Lys Ala Val Asn Leu Ser Asp Ile Lys
-65 -60 -55 -50
Leu Asn Arg Ser Gin Glu Phe Ala Gin Leu Ser Ala Arg Pro Gly Gly Leu
-45 -40 -35
Val Glu Glu Ala Trp Lys Pro Ser Ala Asn Cys Pro Ser Gly Arg Ile Val
-30 -25 -20
Ser Leu Lys Cys Ser Glu Cys Gly Ala Arg Pro Leu Ala Ser Arg Ile Val
-15 -10 -5 -1 1
Gly Gly Gin Ala Val Ala Ser Gly Arg Trp Pro Trp Gln Ala Ser Val Met
10 15
Leu Gly Ser Arg His Thr Cys Gly Ala Ser Val Leu Ala Pro His Trp Val
20 25 30 35
Val Thr Ala Ala His Cys Met Tyr Ser Phe Arg Leu Ser Arg Leu Ser Ser
40 45 50
Trp Arg Val His Ala Gly Leu Val Ser His Gly Ala Val Arg Gin His Gln
55 60 65 70
Gly Thr Met Val Glu Lys Ile Ile Pro His Pro Leu Tyr Ser Ala Gin Asn
75 80 85
His Asp Tyr Asp Val Ala Leu Leu Gin Leu Arg Thr Pro Ile Asn Phe Ser
90 95 100
Asp Thr Val Asp Ala Val Cys Leu Pro Ala Lys Glu Gin Tyr Phe Pro Trp
105 110 115 120
Gly Ser Gin Cys Trp Val Ser Gly Trp Gly His Thr Asp Pro Ser His Thr
125 130 135
His Ser Ser Asp Thr Leu Gln Asp Thr Met Val Pro Leu Leu Ser Thr His
140 145 150 155
Leu Cys Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu Thr His Arg Met Leu
160 165 170
Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gln Gly Asp Ser Gly
175 180 185
Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His Leu Val Gly Val Val
190 195 200 205
CA 02616940 2008-11-05
79
Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro Gly Val Tyr Ala Lys
210 215 220
Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val Gin Val Arg
225 230 235
<210> 7
<211> 2070
<212> DNA
<213> mouse
<400> 7
cccagcagaa cttactgcct tatatcagtg cagctgactc atatgccctg gtgtggggct 60
gctggatctt caaccactat ttctccagag tccaacactg gatgaccaaa gccca atg 118
Met
gag att cgg tgc acg gaa gag ggt got ggg cct ggg atc ttc aga atg gag 169
Glu Ile Arg Cys Thr Glu Glu Gly Ala Gly Pro Gly Ile Phe Arg Met Glu
-205 -200 -195 -190
ttg gga gac cag agg caa tcc att tct cag tcc caa cgc tgg tgc tgc ctg 220
Leu Gly Asp Gin Arg Gin Ser Ile Ser Gln Ser Gin Arg Trp Cys Cys Leu
-185 -180 -175
caa cgt ggc tgt gta ata ctg ggc gtc ctg ggg ctg ctg got gga gca ggc 271
Gin Arg Gly Cys Val Ile Leu Gly Val Leu Gly Leu Leu Ala Gly Ala Gly
-170 -165 -160
att get tca tgg ctc tta gtg ttg tat cta tgg cca get gcc tct cca tcc 322
Ile Ala Ser Trp Leu Leu Val Leu Tyr Leu Trp Pro Ala Ala Ser Pro Ser
-155 -150 -145 -140
atc tct ggg acg ttg cag gag gag gag atg act ttg aac tgt cca gga gtg 373
Ile Ser Gly Thr Leu Gin Glu Glu Glu Met Thr Leu Asn Cys Pro Gly Val
-135 -130 -125
agc tgt gag gaa gag ctc ctt cca tct ctt ccc aaa aca gta tct ttc aga 424
Ser Cys Glu Glu Glu Leu Leu Pro Ser Leu Pro Lys Thr Val Ser Phe Arg
-120 -115 -110 -105
ata aat gga gag gat ctt ctg ctt caa gta caa gta aga get cgg cca gac 475
Ile Asn Gly Glu Asp Leu Leu Leu Gin Val Gin Val Arg Ala Arg Pro Asp
-100 -95 -90
tgg ctc ctg gtc tgc cat gag ggc tgg agc ccc gcc ctg ggc atg cac atc 526
Trp Leu Leu Val Cys His Glu Gly Trp Ser Pro Ala Leu Gly Met His Ile
-85 -80 -75
CA 02616940 2008-11-05
tgc aag agt ctt ggg cat atc agg ctt act caa cac aag gcc gtg aat ctg 577
Cys Lys Ser Leu Gly His Ile Arg Leu Thr Gin His Lys Ala Val Asn Leu
-70 -65 -60 -55
tct gac atc aag ctc aac aga tcc cag gag ttt get caa ctc tot got aga 628
Ser Asp Ile Lys Leu Asn Arg Ser Gin Glu Phe Ala Gin Leu Ser Ala Arg
-50 -45 -40
ccg qga qgc ctt gta gag gag gca tgg aag ccc agc get aac tgt cct tct 679
Pro Gly Gly Leu Val Glu Glu Ala Trp Lys Pro Ser Ala Asn Cys Pro Ser
-35 -30 -25 -20
ggc cga att gtt tct ctc aaa tgt tot gag tgt ggg gca agg cct ctg got 730
Gly Arg Ile Val Ser Leu Lys Cys Ser Glu Cys Gly Ala Arg Pro Leu Ala
-15 -10 -5
tot cga ata gtt ggc ggc caa get gtg got tot ggg cgc tgg cca tgg caa 781
Ser Arg Ile Val Gly Gly Gin Ala Val Ala Ser Gly Arg Trp Pro Trp Gin
-1 1 5 10 15
get ago gtg atg ctt ggc tcc cgg cac acg tgt ggg gcc tct gtg ttg gca 832
Ala Ser Val Met Leu Gly Ser Arg His Thr Cys Gly Ala Ser Val Leu Ala
20 25 30
cca cac tgg gta gtg act get gcc cac tgc atg tac agt ttc agg ctg too 883
Pro His Trp Val Val Thr Ala Ala His Cys Met Tyr Ser Phe Arg Leu Ser
35 40 45
cgc cta too agc tgg cgg gtt cat gca ggg ctg gtc agc cat ggt get gtc 934
Arg Leu Ser Ser Trp Arg Val His Ala Gly Leu Val Ser His Gly Ala Val
50 55 60 65
cga caa cac cag gga act atg gtg gag aag atc att cct cat cct ttg tac 985
Arg Gln His Gin Gly Thr Met Val Glu Lys Ile Ile Pro His Pro Leu Tyr
70 75 80
agt gcc cag aac cat gac tat gat gtg get ctg ctg cag otc cgg aca cca 1036
Ser Ala Gln Asn His Asp Tyr Asp Val Ala Leu Leu Gin Leu Arg Thr Pro
90 95 100
atc aac ttc tca gac acc gtg gac get gtg tgc ttg ccg goo aag gag cag 1087
Ile Asn Phe Ser Asp Thr Val Asp Ala Val Cys Leu Pro Ala Lys Glu Gin
105 110 115
tac ttt cca tgg ggg tog cag tgc tgg gtg tot ggc tgg ggc can acc gac 1138
Tyr Phe Pro Trp Gly Ser Gln Cys Trp Val Ser Gly Trp Gly His Thr Asp
120 125 130
CA 02616940 2008-11-05
81
ccc agc cat act cat agc tca gat aca ctg cag gac aca atg gta ccc ctg 1189
Pro Ser His Thr His Ser Ser Asp Thr Leu Gin Asp Thr Met Val Pro Leu
135 140 145 150
ctc agc acc cac ctc tgc aac agc tca tgc atg tac agt ggg gca ctt aca 1240
Leu Ser Thr His Leu Cys Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu Thr
155 160 165
cac cgc atg ttg tgt get ggc tac ctg gat gga agg gca gac gca tgc cag 1291
His Arg Met Leu Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gln
170 175 180 185
gga gac agc ggg gga ccc ctg gta tgt ccc agt ggt gac acg tgg cac ctt 1342
Gly Asp Ser Gly Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His Leu
190 195 200
gta ggg gtg gtc agc tgg ggt cgt ggc tgt gca gag ccc aat cgc cca ggt 1393
Val Gly Val Val Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro Gly
205 210 215
gtc tat gcc aag gta gca gag ttc ctg gac tgg atc cat gac act gtg cag 1444
Val Tyr Ala Lys Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val Gln
220 225 230 235
gtc cgc tagccgaaga agcagcagca gccacctgtg acgccgagct gtggatcgcc 1500
Val Arg
catggatcac cccagtctgg gggccagcat ctgggtcact gggcctctcc ccaaaggctc 1560
tgacttcgag ttcatctttc tcatctgaga acctccacaa caggaaaagg agtctgcggc 1620
tagattggga atgatggtga gaggaaggga taggaggaca gaagagacag cagaggcttc 1680
tggaagcatc tgggagactg ctcctctgct ccccccacac cccacgtgca tccactgggg 1740
gatgctggag atgcccaatc cttgtttctt gtggggccac tggaaggcta agtccaactt 1800
tagaggatgc cctgtctcga gagttactag gcagataagg ttaaggttgg acaagctcag 1860
gtaaaggcac ggaagtcaag atcccctctc ccccgtgcgg tcctgttctg aggtaagcta 1920
atagccccgc accaggcaga ggtctacagg gtaagaagga tgcagttggg ctacacgacg 1980
ctatttttca aatgatgttt ctgtaaattg gttgagagag ttttgttatt aaacagaaat 2040
tatgtataaa aaaaaaaaaa aaaaaaaaaa 2070
<210> 8
<211> 445
<212> PRT
<213> mouse
CA 02616940 2008-11-05
82
<400> 8
Met
Glu Ile Arg Cys Thr Glu Glu Gly Ala Gly Pro Gly Tie Phe Arg Met Glu
-205 -200 -195 -190
Leu Gly Asp Gin Arg Gin Ser Ile Ser Gin Ser Gin Arg Trp Cys Cys Leu
-185 -180 -175
Gin Arg Gly Cys Val Ile Leu Gly Val Leu Gly Leu Leu Ala Gly Ala Gly
-170 -165 -160
Ile Ala Ser Trp Leu Leu Val Leu Tyr Leu Trp Pro Ala Ala Ser Pro Ser
-155 -150 -145 -140
Ile Ser Gly Thr Leu Gin Glu Glu Glu Met Thr Leu Asn Cys Pro Gly Val
-135 -130 -125
Per Cys Glu Glu Glu Leu Leu Pro Ser Leu Pro Lys Thr Val Ser Phe Arg
-120 -115 -110 -105
Ile Asn Gly Glu Asp Leu Leu Leu Gin Val Gin Val Arg Ala Arg Pro Asp
-100 -95 -90
Trp Leu Leu Val Cys His Glu Gly Trp Ser Pro Ala Leu Gly Met His Ile
-85 -80 -75
Cys Lys Ser Leu Gly His Tie Arg Leu Thr Gin His Lys Ala Val Asn Leu
-70 -65 -60 -55
Ser Asp Ile Lys Leu Asn Arg Ser Gin Glu Phe Ala Gin Leu Ser Ala Arg
-50 -45 -40
Pro Gly Gly Leu Val Glu Glu Ala Trp Lys Pro Ser Ala Asn Cys Pro Ser
-35 -30 -25 -20
Gly Arg Ile Val Ser Leu Lys Cys Ser Glu Cys Gly Ala Arg Pro Leu Ala
-15 -10 -5
Ser Arg Tie Val Gly Gly Gin Ala Val Ala Ser Gly Arg Trp Pro Trp Gin
-1 1 5 10 15
Ala Ser Val Met Leu Gly Ser Arg His Thr Cys Gly Ala Ser Val Leu Ala
20 25 30
Pro His Trp Val Val Thr Ala Ala His Cys Met Tyr Ser Phe Arg Leu Ser
35 40 45
Arg Leu Ser Ser Trp Arg Val His Ala Gly Leu Val Ser His Gly Ala Val
50 55 60 65
Arg Gln His Gin Gly Thr Met Val Glu Lys Ile Ile Pro His Pro Leu Tyr
70 75 80
Ser Ala Gln Asn His Asp Tyr Asp Val Ala Leu Leu Gin Leu Arg Thr Pro
85 90 95 100
CA 02616940 2008-11-05
83
Ile Asn Phe Ser Asp Thr Val Asp Ala Val Cys Leu Pro Ala Lys Glu Gin
105 110 115
Tyr Phe Pro Trp Gly Ser Gin Cys Trp Val Ser Gly Trp Gly His Thr Asp
120 125 130
Pro Ser His Thr His Ser Ser Asp Thr Leu Gln Asp Thr Met Val Pro Leu
135 140 145 150
Leu Ser Thr His Leu Cys Asn Ser Ser Cys Met Tyr Ser Gly Ala Leu Thr
155 160 165
His Arg Met Leu Cys Ala Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gin
170 175 180 185
Gly Asp Ser Gly Gly Pro Leu Val Cys Pro Ser Gly Asp Thr Trp His Leu
190 195 200
Val Gly Val Val Ser Trp Gly Arg Gly Cys Ala Glu Pro Asn Arg Pro Gly
205 210 215
Val Tyr Ala Lys Val Ala Glu Phe Leu Asp Trp Ile His Asp Thr Val Gin
220 225 230 235
Val Arg
<210> 9
<211> 2265
<212> DNA
<213> human
<400> 9
acgagggata cagggagggg ccatgtgcga accagggaga cctcatcttc caaccaagct 60
tgctgggctt gcatttaatc aatgcatggc cagagaacag gagcggaaca ttgcctagta 120
gaccctgagg ctttacaaca gtgctactga cccct 155
atg agc ctg atg ctg gat gac caa ccc cct atg gag gcc cag tat gca gag 206
Met Ser Leu Met Leu Asp Asp Gin Pro Pro Met Glu Ala Gin Tyr Ala Glu
-215 -210 -205
gag ggc cca gga cct ggg atc ttc aga gca gag cct gga gac cag cag cat 257
Glu Gly Pro Gly Pro Gly Ile Phe Arg Ala Glu Pro Gly Asp Gin Gin His
-200 -195 -190 -185
ccc att tct cag gcg gtg tgc tgg cgt tcc atg cga cgt ggc tgt gca gtg 308
Pro Ile Ser Gin Ala Val Cys Trp Arg Ser Met Arg Arg Gly Cys Ala Val
-180 -175 -170
CA 02616940 2008-11-05
84
ctg gga gcc ctg ggg ctg ctg gcc ggt gca ggt gtt ggc tca tgg ctc cta 359
Leu Gly Ala Leu Gly Leu Leu Ala Gly Ala Gly Val Gly Ser Trp Leu Leu
-165 -160 -155 -150
gtg ctg tat ctg tgt cct get gcc tct cag ccc att tcc ggg ace ttg cag 410
Val Leu Tyr Leu Cys Pro Ala Ala Ser Gin Pro Ile Ser Gly Thr Leu Gln
-145 -140 -135
gat gag gag ata act ttg agc tgc tca gag gcc agc get gag gaa get ctg 461
Asp Glu Glu Ile Thr Leu Ser Cys Ser Glu Ala Ser Ala Glu Glu Ala Leu
-130 -125 -120
ctc cct gca ctc ccc aaa aca gta tct ttc aga ata aac agc gaa gac ttc 512
Leu Pro Ala Leu Pro Lys Thr Val Ser Phe Arg Ile Asn Ser Glu Asp Phe
-115 -110 -105 -100
ttg ctg gaa gcg caa gtg agg gat cag cca cgc tgg ctc ctg gtc tgc cat 563
Leu Leu Glu Ala Gin Val Arg Asp Gln Pro Arg Trp Leu Leu Val Cys His
-95 -90 -85
gag ggc tgg age ccc gcc ctg ggg ctg cag atc tgc tgg age ctt ggg cat 614
Glu Gly Trp Ser Pro Ala Leu Gly Leu Gln Ile Cys Trp Ser Leu Gly His
-80 -75 -70 -65
ctc aga ctc act cac cac aag gga gta aac ctc act gac atc aaa ctc aac 665
Leu Arg Leu Thr His His Lys Gly Val Asn Leu Thr Asp Ile Lys Leu Asn
-60 -55 -50
agt tcc cag gag ttt get cag ctc tct ect aga ctg gga ggc ttc ctg gag 716
Ser Ser Gin Glu Phe Ala Gin Leu Ser Pro Arg Leu Gly Gly Phe Leu Glu
-45 -40 -35
gag gcg tgg cag ccc agg aac aac tgc act tct ggt caa gtt gtt tcc ctc 767
Glu Ala Trp Gln Pro Arg Asn Asn Cys Thr Ser Gly Gln Val Val Ser Leu
-30 -25 -20 -15
aga tgc tct gag tgt gga gcg agg ccc ctg get tcc cgg ata gtt ggt ggg 818
Arg Cys Ser Glu Cys Gly Ala Arg Pro Leu Ala Ser Arg Ile Val Gly Gly
-10 -5 -1 1
cag tct gtg get cct ggg cgc tgg ccg tgg cag gcc agc gtg gcc ctg ggc 869
Gin Ser Val Ala Pro Gly Arg Trp Pro Trp Gin Ala Ser Val Ala Leu Gly
10 15 20
ttc egg cac acg tgt ggg ggc tct gtg cta gcg cca cgc tgg gtg gtg act 920
Phe Arg His Thr Cys Gly Gly Ser Val Leu Ala Pro Arg Trp Val Val Thr
25 30 35
CA 02616940 2008-11-05
get gca cat tgt atg cac agt ttc agg ctg gcc cgc ctg tcc agc tgg cgg 971
Ala Ala His Cys Met His Ser Phe Arg Leu Ala Arg Leu Ser Ser Trp Arg
40 45 50 55
gtt cat gcg ggg ctg gtc agc cac agt gcc gtc agg ccc cac caa ggg get 1022
Val His Ala Gly Leu Val Ser His Ser Ala Val Arg Pro His Gin Gly Ala
60 65 70
ctg gtg gag agg att atc cca cac ccc ctc tac agt gcc cag aat cat gac 1073
Leu Val Glu Arg Ile Ile Pro His Pro Leu Tyr Ser Ala Gln Asn His Asp
75 80 85
tac gac gtc gcc ctc ctg agg ctc cag acc get ctc aac ttc tca gac act 1124
Tyr Asp Val Ala Leu Leu Arg Leu Gln Thr Ala Leu Asn Phe Her Asp Thr
95 100 105
gtg ggc get gtg tgc ctg ccg gcc aag gaa cag cat ttt ccg aag ggc tcg 1175
Val Gly Ala Val Cys Leu Pro Ala Lys Glu Gin His Phe Pro Lys Gly Ser
110 115 120
cgg tgc tgg gtg tct ggc tgg ggc cac acc cac cct agc cat act tac agc 1226
Arg Cys Trp Val Ser Gly Trp Gly His Thr His Pro Ser His Thr Tyr Ser
125 130 135 140
tog gat atg ctc cag gac acg gtg gtg ccc ttg ttc agc act cag ctc tgc 1277
Ser Asp Met Leu Gin Asp Thr Val Val Pro Leu Phe Ser Thr Gin Leu Cys
145 150 155
aac agc tct tgc gtg tac agc gga gcc ctc acc ccc cgc atg ctt tgc get 1328
Asn Ser Ser Cys Val Tyr Ser Gly Ala Leu Thr Pro Arg Met Leu Cys Ala
160 165 170
ggc tac ctg gac gga agg get gat gca tgc cag gga gat agc ggg ggc ccc 1379
Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gln Gly Asp Ser Gly Gly Pro
175 180 185 190
cta gtg tgc cca gat ggg gac aca tgg cgc cta gtg ggg gtg gtc agc tgg 1430
Leu Val Cys Pro Asp Gly Asp Thr Trp Arg Leu Val Gly Val Val Ser Trp
195 200 205
ggg cgt gcg tgc gca gag ccc aat cac cca ggt gtc tac gcc aag gta get 1481
Gly Arg Ala Cys Ala Glu Pro Asn His Pro Gly Val Tyr Ala Lys Val Ala
210 215 220 225
gag ttt ctg gac tgg atc cat gac act get cag gac tcc ctc ctc 1526
Glu Phe Leu Asp Trp Ile His Asp Thr Ala Gin Asp Ser Leu Leu
230 235 240
tgagtcctgc tgtttcctcc agtctcactg cacaccactg cctcatgctt cctggggcct 1586
ccagcagctc cactaatgga ggagaggcag tagcctccga cacagaacgc atggacctcc 1646
CA 02616940 2008-11-05
86
tactactgtg tgtgaggaac agtcactacc cactggccag ccacccagcc aacaggtctc 1706
tcctcttggg ccctgatttc agagtcctct ttctcactag agactcaatg acagaagaga 1766
ggctgggact tggttgggca tgctgtggtt gctgagggat gagggggagg agagaggtag 1826
gagctggaga tgaagagact gctagaagca gcaggaagcc tgcccttctg ccctctcccc 1886
tccctgcccc tgtgtgagtc ttttagggag ggtgactggg aggtgccccc cgtcccacct 1946
ttttcctgtg ctctaggtgg gctaagtgcc tccctagagg actccatggc tgagaggctc 2006
ctgggcagat ggggtcaagg ctgggccagt cccagatgaa gcctatggga gtcaggaccc 2066
tctccactct ccctctccac tccccttcct gttctcacct ggctgtggtt ggccctgtgt 2126
ggggtgggta cactggaaaa caagaaggtt ggagttggtc taggacattg gttttaaatg 2186
acagttctgt gaactggtcc aaggaggttc tgttattaaa gtgatatatg gtcttgaaaa 2246
aaaaaaaaaa aaaaaaaaa 2265
<210> 10
<211> 457
<212> PRT
<213> human
<400> 10
Met Ser Leu Met Leu Asp Asp Gin Pro Pro Met Glu Ala Gin Tyr Ala Glu
-215 -210 -205
Glu Gly Pro Gly Pro Gly Ile Phe Arg Ala Glu Pro Giy Asp Gin Gin His
-200 -195 -190 -185
Pro Ile Ser Gin Ala Val Cys Trp Arg Ser Met Arg Arg Gly Cys Ala Val
-180 -175 -170
Leu Gly Ala Leu Gly Leu Leu Ala Gly Ala Gly Val Gly Ser Trp Leu Leu
-165 -160 -155 -150
Val Leu Tyr Leu Cys Pro Ala Ala Ser Gin Pro Ile Ser Gly Thr Leu Gin
-145 -140 -135
Asp Glu Glu Ile Thr Leu Ser Cys Ser Glu Ala Ser Ala Glu Glu Ala Leu
-130 -125 -120
Leu Pro Ala Leu Pro Lys Thr Val Ser She Arg Ile Asn Ser Glu Asp Phe
-115 -110 -105 -100
Leu Leu Glu Ala Gin Val Arg Asp Gin Pro Arg Trp Leu Leu Val Cys His
-95 -90 -85
Glu Gly Trp Ser Pro Ala Leu Gly Leu Gin Ile Cys Trp Ser Leu Gly His
-80 -75 -70 -65
Leu Arg Leu Thr His His Lys Gly Val Asn Leu Thr Asp lie Lys Leu Asn
-60 -55 -50
CA 02616940 2008-11-05
87
Ser Ser Gln Glu Phe Ala Gln Leu Ser Pro Arg Leu Gly Gly Phe Leu Glu
-45 -40 -35
Glu Ala Trp Gln Pro Arg Asn Asn Cys Thr Ser Gly Gln Val Val Ser Leu
-30 -25 -20 -15
Arg Cys Ser Glu Cys Gly Ala Arg Pro Leu Ala Ser Arg lie Val Gly Gly
-10 -5 -1 1
Gln Ser Val Ala Pro Gly Arg Trp Pro Trp Gln Ala Ser Val Ala Leu Gly
10 15 20
Phe Arg His Thr Cys Gly Gly Ser Val Leu Ala Pro Arg Trp Val Val Thr
25 30 35
Ala Ala His Cys Met His Ser Phe Arg Leu Ala Arg Leu Ser Ser Trp Arg
40 45 50 55
Val His Ala Gly Leu Val Ser His Ser Ala Val Arg Pro His Gln Gly Ala
60 65 70
Leu Val Glu Arg Ile Ile Pro His Pro Leu Tyr Ser Ala Gln Asn His Asp
75 80 85
Tyr Asp Val Ala Leu Leu Arg Leu Gln Thr Ala Leu Asn Phe Ser Asp Thr
90 95 100 105
Val Gly Ala Val Cys Leu Pro Ala Lys Glu Gln His Phe Pro Lys Gly Ser
110 115 120
Arg Cys Trp Val Ser Gly Trp Gly His Thr His Pro Ser His Thr Tyr Ser
125 130 135 140
Ser Asp Met Leu Gln Asp Thr Val Val Pro Leu Phe Ser Thr Gln Leu Cys
145 150 155
Asn Ser Ser Cys Val Tyr Ser Gly Ala Leu Thr Pro Arg Met Leu Cys Ala
160 165 170
Gly Tyr Leu Asp Gly Arg Ala Asp Ala Cys Gin Gly Asp Ser Gly Gly Pro
175 180 185 190
Leu Val Cys Pro Asp Gly Asp Thr Trp Arg Leu Val Gly Val Val Ser Trp
195 200 205
Gly Arg Ala Cys Ala Glu Pro Asn His Pro Gly Val Tyr Ala Lys Val Ala
210 215 220 225
Glu Phe Leu Asp Trp Ile His Asp Thr Ala Gln Asp Ser Leu Leu
230 235 240
<210> 11
<211> 99
<212> DNA
CA 02616940 2008-11-05
88
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide to construct plasmid pSecTrypHis
<400> 11
aagcttggct agcaacacca tgaatctact cctgatcctt acctttgttg ctgctgctgt 60
tgctgccccc tttgacgacg atgacaagga tccgaattc 99
<210> 12
<211> 99
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide to construct plasmid pSecTrypHis
<400> 12
gaattcggat ccttgtcatc gtcgtcaaag ggggcagcaa cagcagcagc aacaaaggta 60
aggatcagga gtagattcat ggtgttgcta gccaagctt 99
<210> 13
<211> 15
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer to amplify neurosin-encoding sequence
<400> 13
ttggtgcatg gcgga 15
<210> 14
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer to amplify neurosin-encoding sequence
<400> 14
tcctcgagac ttggcctgaa tggtttt 27
CA 02616940 2008-11-05
89
<210> 15
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer to amplify a portion of plasmid
pSecTrypHis/Neurosin
<400> 15
gcgctagcag atctccatga atctactcct gatcc 35
<210> 16
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer to amplify a portion of plasmid
pSecTrypHis/Neurosin
<400> 16
tgaagcttgc catggaccaa cttgtcatc 29
<210> 17
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer to amplify a portion of plasmid
pTrypHis @
<400> 17
ccaagcttca ccatcaccat caccat 26
<210> 18
<211> 17
<212> DNA
<213> Artificial Sequence
CA 02616940 2008-11-05
<220>
<223> Designed oligonucleotide primer to amplify a portion of plasmid
pTrypSigTag
<400> 18
gcacagtcga ggctgat 17
<210> 19
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer to amplify a portion of plasmid
pFBTrypSigTag
<400> 19
caaatgtggt atggctg 17
<210> 20
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer to amplify conserved region of serin
proteases-encoding sequence
<220>
<221> UNSURE
<222> 9, 12
<223> n is a, c, g or t.
<400> 20
gtgctcacng cngcbcaytg 20
<210> 21
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
CA 02616940 2008-11-05
91
<223> Designed oligonucleotide primer to amplify conserved region of serin
proteases-encoding sequence
<220>
<221> UNSURE
<222> 12, 15
<223> n is a, c, g or t.
<400> 21
ccvctrwsdc cnccnggcga 20
<210> 22
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as mBSSP2.0 for RACE for
mBSSP2 (forward)
<400> 22
atggtggaga agatcattcc t 21
<210> 23
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as mBSSP2.l for RACE for
mBSSP2 (forward)
<400> 23
tacagtgccc agaaccatg 19
<210> 24
<211> 20
<212> DNA
<213> Artificial Sequence
CA 02616940 2008-11-05
92
<220>
<223> Designed oligonucleotide primer designated as mBSSPF4 for RACE for
mBSSP2 (forward)
<400> 24
ctcaactctc tgctagaccg 20
<210> 25
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as mBSSP2F5 to amplify
mature mBSSP2-encoding region (forward)
<400> 25
atagttggcg gccaagctgt 20
<210> 26
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as mBSSPF7 to amplify
full-length mBSSP2-encoding mRNA (forward)
<400> 26
cccagcagaa cttactgcct 20
<210> 27
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as mBSSP2.2 for RACE for
mBSSP2 (reverse)
CA 02616940 2008-11-05
93
<400> 27
tgttgcagag gtgggtgctg 20
<210> 28
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as mBSSP2R2 for RACE for
mBSSP2 (reverse)
<400> 28
taccattgtg tcctgcagtg t 21
<210> 29
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as mBSSP2R5/E to amplify
full-length mBSSP2-encoding mRNA (reverse)
<400> 29
tgaattctgc tgcttcttcg gctagcg 27
<210> 30
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as BSSP2SPF to amplify a
portion of hBSSP2 (forward)
<400> 30
actgctgccc actgcatg 18
<210> 31
<211> 21
CA 02616940 2008-11-05
94
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as BSSP2SPR to amplify a
portion of hBSSP2 (reverse)
<400> 31
caggggtccc ccgctgtctc c 21
<210> 32
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as hBSSP2Fll for RACE for
hBSSP2 (forward)
<400> 32
gctctcaact tctcagacac 20
<210> 33
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as hBSSP2R12 for RACE for
hBSSP2 (reverse)
<400> 33
actcagctac cttggcgtag 20
<210> 34
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as hBSSP2R11 for RACE for
hBSSP2 (reverse)
CA 02616940 2008-11-05
<400> 34
cctggagcat atccgagctg 20
<210> 35
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as hBSSP2F12 to amplify
full length hBSSP2 (forward)
<400> 35
gctttacaac agtgctac 18
<210> 36
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as hBSSP2R13/E to amplify
full length hBSSP2 (reverse)
<400> 36
tggaattcga ggaaacagca ggactcag 28
<210> 37
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer for RACE for hBSSP2
<400> 37
tactagtcga cgcgtggcc 19
<210> 38
<211> 18
<212> DNA
CA 02616940 2008-11-05
96
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as hBSSP2Fl3 to amplify a
portion of hBSSP2 (forward)
<400> 38
actgctgccc actgcatg 18
<210> 39
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide primer designated as FBTrpsigtagF5 to detect
hBSSP2
<400> 39
gcgctagcag atctccatga atctactcct gatcc 35
<210> 40
<211> 117
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide to construct plasmid pTrypHis
<400> 40
aagcttggct agcaacacca tgaatctact cctgatcctt acctttgttg ctgctgctgt 60
tgctgccccc tttcaccatc accatcacca tgacgacgaL gacaaggatc cgaattc 117
<210> 41 r
<211> 117
<212> DNA
<213> Artificial Sequence
<220>
<223> Designed oligonucleotide to construct plasmid pTrypHis
CA 02616940 2008-11-05
97
<400> 41
gaattcggat ccttgtcatc gtcgtcatgg tgatggtgat ggtgaaaggg ggcagcaaca 60
gcagcagcaa caaaggtaag gatcaggagt agattcatgg tgttgctagc caagctt 117
