CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
VARIANTS IN COMPLEMENT REGULATORY GENES
PREDICT AGE-RELATED MACULAR DEGENL+'RATION
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims benefit of U.S. provisonal application No.
60/772,989, filed February 13, 2006, the entire contents ol' which are
incorporated
herein by reference.
FIELD
[0002] This application relates to methods of predicting an individual's
genetic
susceptibility to age-related macular degeneration.
ACKNOWLEDGMENT OF GOVERNMENT SUPPORT
[0003] This invention was made in part by an agency of the US governinent with
United States government support pursuant to Grant Nos. EY13435 (RA) and
EY 11515 (GSH) from the National Institutes of Health and with the assistance
of
Federal funds from the National Cancer Institute, National Institutes of
Health, under
Contract No. NOI-CO-124000. The United States governinent has certain rights
in
the invention.
BACKGROUND
[0004] Age-related macular degeneration (AMD) is a degenerative eye disease
that
affects the macula, which is a photoreceptor-rich area of the central retina
that
provides detailed vision. AMD results in a sudden worsening of central vision
that
usually only leaves peripheral vision intact. AMD is the most common form of
irreversible blindness in developed countries. The disease typically presents
with a
decrease in central vision in one eye, followed within months or years by a
similar
loss of central vision in the other eye. Clinical signs of the disease include
the
presence of deposits (dnisen) in the macula.
[0005] Despite being a major public healtli burden, the etiology and
pathogenesis of
AMD are still poorly understood. Numerous studies have implicated inflammation
in
the pathobiology of AMD (Anderson et al. (2002) Anz. J. Ophtlzahnol. 3 34:41 l-
31;
1
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Hageman et ul. (2001) Pi-og. Retin. E)-e Res. 20:705-32; Mullins et al. (2000)
Faseb J.
14:835-46; Johnson et a!. (2001) E..x7.). Eye Re.s. 73:887-96; Crabb et a1.
(2002) Pi-oc.
Natl. Acad. Sci. U.S.A. 99:14682-7; Bok, D. (2005) Pr.nc:. Ntttl. Ac=crd.
Sc:i. U.S.A.
102:7053-4). Dysfunction of the coinplement pathway niay induce significant
bystander damage to macular cells, leading to atrophy, degeneration, and the
elaboration of choroidal neovascular membranes, similar to damage that occui-s
in
other complement-inediated disease processes (Hageman et crl. (2005) Proc.
Ncitl.
Acad Sci. U.S.A. 102:7227-32; Morgan and Walport (1991) Ivlrnranol. Today
12:301-
6; Kinoshita (1991) 1mnnrrnol. Toekry 12:291-5; Holers and '1'hurrnan (2004)
Mol.
Inimunol. 41:147-52). There niay be a strong genetic contribution to the
disease. For
example, variants in the FBLN6, ABCA4, and APOE genes have been implicated as
risk factors. Recently, it was discovered that a variant in the complement
factor H
gene (CFH), which encodes a major inhibitor of the alternative complement
pathway,
is associated with increased risk of developing AMD (Haines et crl. (2005)
Science
308:419-21; Klein et crl. (2005) Science 308:385-9; Edwards el al. (2005)
Science
308:421-4; Hageman et al. (2005) Proc. Natl. Acad. Sci. U.S.A. 102:7227-32).
[00061 Due to the prevalerice of the disease and the limited treatment
available,
methods for identifying subjects at risk for developing AMD are needed.
SUMMARY
[0007J Polymorphisms and genotypes that are protective for age-related macular
degeneration (AMD) liave been identified. Methods are provided for identifying
a
subject at increased risk for developing AMD. These methods include, but are
not
limited to, analyzing the subject's factor B(BF) and/or complement component 2
(C2)
genes, and determining whether the subject has at least one protective
polymorphism.
Examples of such protective polymorphisms include (a) R32Q in BF (rs641153);
(b)
L9H in BF (rs4151667); (c) IVS 10 in C2 (rs547154); and (d) E318D in C2
(rs9332739). Alternatively, the method may be implemented by detecting a
protein
variant in the subject. If the subject does not have at least one protective
polymorphism, the subject is at increased risk for developing AMD. In oine
embodiment of this aspect, ftlrther analysis of the subject's CFH gene is
performed.
In some embodiments, the subject's genotype may be analyzed at the CFH locus
to
2
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
determine if the subject has at least one protective genotype. In one
embodiment the
subject's genotype may be analyzed at either the BF or C2 locus and at the CFH
locus
to determine if the subject has at least one protective genotype. As disclosed
hereafter, in several instances, it will be informative to learn whether the
subject is
homozygous or heterozygous for the polymorphism.
[0008] Examples of protective genotypes include: (a) heterozygous for the R32Q
polyinorphism in BF (rs641 153); (b) heterozygous for the L9H polymorphism in
BF
(rs4151667); (c) heterozygous for the IVS 10 polymorphism in C2 (rs547154);
(d)
heterozygous for the E318D polymorphism in C2 (rs9332739); (e) homozygous for
the delrl'I' polymoi-phism in CFH; (f) honiozygous for the R 150R polymorphism
in
BF (rs1048709); and (g) homozygous for Y402 in CFH. If the subject does not
have
at least one protective genotype, the subject is at increased risk for
developing AMD.
[0009] The invention provides a method for assessing the risk of development
of, or
likely progression of, macular degeneration or other coniplement inediated
disease in
a human subject. Underlying the methods are discoveries made through genetic
association studies relating certain genetic features to risk or protective
phenotypes of
complement related disease, in this case, age related macular degeneration.
The
methods of the invention include the steps of obtaining a biological sainple
from a
human subject, and analyzing the sample by any validated technique known in
the art
to deterniine whether the subject can-ies one or more of:
A or G at rs641153 of the BF gene, which translates to an R or Q at position
32 of the human BF protein;
A or T at rs4151667 of the BF gene, which translates to an L or H at position
9
of the human BF protein;
G or T at rs547154 of the C2 gene, which is in intron 10;
C or G at rs9332379 of the C2 gene, which translates to an E or D at position
318 of the human C2 protein;
A or G at rs 1048709 of the BF gene, which translates to a R at position 150;
de1TT in the CFH gene; and
C or T at rs] 061170 of the CFH gene, which translates to a Y or H at position
402 of the human CFH protein.
3
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
[0010] In certain einbodiments the sample is zinalyied to detcrmine whether
the
subject carries one or more of':
A or G at rs641 153 of the BF gene, which translates to an R or Q at position
32 of the human BF protein;
A or T at rs4151667 of the BF gene, which translates to an L or H at position
9
of the hunian BF protein;
G or T at rs547154 of the C2 gene, which is in intron 10; and,
C or G at rs9332379 of the C2 gene, which translates to an E or D at position
318 of the human C2 protein.
[0011] In some embodiments, the sample is an accessible body fluid, such as
blood
or a blood component, or urine. When assessment is done at the DNA or mRNA
level, cellular material will be required to enable detection of a genotype
from a cell
of the subject.
[0012] In some embodiments, the subject may have been diagnosed with a
condition including AMD, early AMD, choroidal neovascularization (CNV), or
geographic atrophy (GA). In one embodiment, the subject has symptoms of
disease,
e.g., early stage niacular degeneration symptoms such as the development of
drusen.
Some of the subjects may present with drusen development. The subject may be
asymptomatic of macular degeneration or other complement related disease, in
which
case, the analysis essentially provides a screening procedure which can be
done on the
population generally or on some segment that is thought to be at increased
risk, such
as individuals with a family history of coinplement related disease. Yet
additional
subjects may be at high risk for acquiring AMD. ln one embodiment the subject
has
the Y402H SNP.
[0013] Thus, in another aspect; the invention provides a kit for assessing the
risk of
development of, or likely progression of, macular degeneration or other
complement
mediated disease in a human subject. The kit includes a collection of reagents
for
detecting in a sample from the subject one or more, preferably two or more of
the
polymorphisms or allelic variants listed above. It may comprise
oligonucleotides,
typically labeled oligonucleotides, designed to detect a variant using any
number of
methods known to the art. The kit rnay include, for example, PCR priiners for
amplifying a target polynucleotide sequence when the target is a polymorphism,
or a
4
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
specific binding protein, e.g., a monoclonal antibody, that recognizes and
binds
specifically to an allelic variant of a target protein as a basis for
obtaining the relevant
genetic/proteomic information from the saniple. In a preferred embodinient,
the kit
contains oligonucleotides immobilized on a solid support.
[0014) Depending on the format, the components in a kit for identifying a
subject at
increased risk for developing age-related maculat= degeneration (AMD) will
include
one or more reagents for detecting at least one protective polymorphism in the
subject. Such reagents allow detection of at least one protective
polytnorphism
including: (a) R32Q in BF (rs641 153); (b) L9H in BF (rs4151667); (c) IVS 10
in C2
(rs547154); and (d) E318D in C2 (r59332739). The reagents in such kits inay
include
one or more oligonucleot ides that detect the protective polymorphisni. Other
kit
components can include one or more reagents foi- amplifying a target sequence,
where
the target sequence encompasses one or more of the protective polymorphisms.
In
some versions of the kit, the one or niore oligonucleotides are immobilized on
a solid
support.
[0015] In a related aspect the invention provides microarrays for identifying
a
subject at increased risk for developing AMD. In further aspects, this
invention
provides microarrays containing oligonucleotide probes capable of hybridizing
under
stringent conditions to one or more nucleic acid inolecules liaving a
protective
polymorphism. Exaniples of such protective polymorphisms include: (a) R32Q in
BF
(rs641153); (b) L9H in BF (rs4151667); (c) IVS 10 in C2 (rs547154); and (d)
E318D
in C2 (rs9332739). Such microarrays can further contain oligonucleotide probes
capable of hybridizing under stringent conditions to one or more additional
nucleic
acid molecules having a polymorphism that includes, for example, (a) the de1TT
polymoiphism in CFH; (b) the R 150R polymorphism in BF, and (c) the Y402H
polymorphism in CFH.
[0016] The foregoing and other features and advantages of the disclosure will
become more apparent from the following detailed description of several
embodiments.
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
SEQUENCES
[0017] The nucleic and amino acid sequenceti listed in the accompanying
sequence
listing are shown using standard letter abbreviations i'oi- nucleotide bases,
and three
letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of
each
nucleic acid sequence is shown, but the coniplenientary strand is understood
as
included by any reference to the displayed strand. All sequence database
accession
numbers referenced herein are understood to refer to the version of the
sequence
identified by that accession number as it was available on the designated
date. In the
accompanying sequence listing:
[0018] SEQ ID NO:1 is based on the SNP with refSNP ID:rs641 l53 as available
through NCBI on January 30, 2006 (revised January 5, 2006). This SNP has an A
or a
G at nucleotide position 22, generating an R32Q variant (glutarnine instead of
arginine at amino acid position 32) in the BF gene. The sequence provided for
R32Q
is CCACTCCATGGTCTTTGGCCCRGCCCCAGGGATCCTGCTCTCT where R=A
or G(SEQ ID NO: l).
[0019] SEQ ID NO:2 shows the SNP with refSNP ID:rs4151667 as available
through NCBI on January 30, 2006 (revised January 5, 2006). This SNP has an A
or
a T at nucleotide position 26, generating an L9H variant (histidine instead of
leucine
at amino acid position 9) in the BF gene. The sequence provided for rs4151667
is
ATGGGGAGCAATCTCAGCCCCCAACRCTGCCTGATGCCCTITATCTTGGGC
where R= A or T (SEQ ID NO:2).
[0020] SEQ ID NO:3 is based on the SNP with refSNP ID:rs547154 as available
through NCBI on January 30, 2006 (revised January 5, 2006). This SNP has a G
or a
T at nucleotide position 23 in intron 10 of the C2 gene. The sequence provided
for
rs547154 is
GAGGAGCCCGCCAGAGGCCCGTRTTGGGAACCTGGACACAGTGCCC where
R is G or T. (SEQ ID NO:3).
[0021] SEQ ID NO:4 shows the SNP with refSNP ID:rs9332739 as available
through NCBI on January 30, 2006 (revised January 5, 2006). This SNP has a C
or a
G at nucleotide position 26, generating an E318D variant (aspai=tic acid
instead of
glutamic acid at amino acid position 318) in the C2 gene. The sequence
provided for
rs9332739 is
6
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
ACGACAACTCCCGGGATATGACTGARGTGATCAGCAGCCTGGAAAATGCC
A where R is C or G (SEQ ID NO:4).
[0022] SEQ ID NO:5 shows the SNP with refSNP ID:i:51048709 as available
through NCBI on Januai-y 30, 2006 (revised January 5, 2006). This SNP has an A
or
a G at nucleotide position 26 in the BF gene. This SNP does not cause an amino
acid
change at position 150 (R 150R). The sequence provided for rs 1048709 is
ATCGCACCTGCCAAGTGAATGGCCGRTGGAGTGGGCAGACAGCGATCTGT
G where R is A or G (SEQ ID NO:5).
[0023] SEQ ID NOS:6 and 7 show the delTT polymorphism sequences. The deITT
polymorphism is a 2bp insertion/deletion polymorphisrn. The sequences are as
follows:
CCTTG CTATTACATA CTA ATTC ATA A CTTTTT l"'I"TTCG TTTTA G A A A G G CC C
TGTGGACA (SEQ ID NO:6); and
CCTTGCTATTACATACTAATTCATA ACTTTTT
TFI=CGTTITAGAAAGGCCCTGTGGACA (SEQ ID NO:7).
[0024] SEQ ID NO:8 shows the SNP with refSNP ID:rs 1061170 as available
through
NCBI on January 30, 2006 (revised January 5, 2006). This SNP has a C or a T at
nucleotide 1277 in exon 9 (nucleotide 26 in the below sequence), generating a
Y402H
variant (histidine instead of tyrosine at amino acid position 402) in the CFH
gene.
The sequence provided for rs1061170 is TTTGGAAAATGGATATAATCAAAATR
ATGGAAGAAAGTTTGTACAGGGTAA where R is C or T (SEQ ID NO:8).
[0025] SEQ ID NO:9 shows the entire BF amino acid sequence with 9H & 32R)
mgsnlspqhc lmpfilglls ggvtttpwsl arpqgscsle gveikggsfr llqegqaley
vcpsgfypyp vqtrtcrstg swstlktqdq ktvrkaecra ihcprphdfe ngeywprspy
ynvsdeisfh cydgytlrgs anrtcqvngr wsgqtaicdn gagycsnpgi pigtrkvgsq
yrledsvtyh csrgltlrgs qrrtcqeggs wsgtepscqd=sfmydtpqev aeaflsslte
tiegvdaedg hgpgeqqkr,(,k ivldpsgsmn iylvldgsds igasnftgak kclvnliekv
asygvkpryg lvtyatypki wvkvseadss nadwvtkqln einyedhklk sgtntkkalq
avysmmswpd dvppegwnrt rhviilmtdg lhnmggdpit videirdlly igkdrknpre
dyldvyvfgv gplvnqvnin alaskkdrneq hvfkvkdmen ledvfyqmid esqslslcgm
vwehrkgtdy hkqpwqakis virpskghes cmgavvseyf vltaahcftv ddkehsikvs
vggekrdlei evvlfhpnyn ingkkeagip efydydvali klknklkygq tirpiclpct
egttralrlp ptttcqqqke ellpaqdika lfvseeekkl trkevyikng dkkgscerda
qyapgydkvk disevvtprf lctggvspya dpntcrgdsg gplivhkrsr fiqvgviswg
7
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
vvdvcknqkr qkqvpahard fhinlfqvlp wlkeklqded lgfl (SEQ ID NO:9)
[0026] SEQ ID NO:10 shows the entire BF amino acid sequence with 9L & 32Q:
mgsnlspqlc lmpfilglls ggvtttpwsl aqpqgscsle gveikggsfr llqegqaley
vcpsgfypyp vqtrtcrstg swstlktqdq ktvrkaecra ihcprphdfe ngeywprspy
ynvsdeisfh cydgytlrgs anrtcqvngr wsgqtaicdn gagycsnpgi pigtrkvgsq
yrledsvtyh csrgltlrgs qrrtcqeggs wsgtepscqd sfmydtpqev aeaflsslte
tiegvdaedg hgpgeqqkrik ivldpsgsmn iylvldgsds igasnftgak kclvnliekv
asygvkpryg lvtyatypki wvkvseadss nadwvtkqln einyedhklk sgtntkkalq
avysmmswpd dvppegwnrt rhviilmtdg lhnmggdpit videirdily igkdrknpre
dyldvyvfgv gplvnqvnin alaskkdneq hvfkvkdmen ledvfyqmid esqslslcgm
vwehrkgtdy hkqpwqakis virpskghes cmgavvseyf vltaahcftv ddkehsikvs
vggekrdlei evvlfhpnyn ingkkeagip efydydvali klknklkygq tirpiclpct
egttralrlp ptttcqqqke ellpaqdika lfvseeekkl trkevyikng dkkgscerda
qyapgydkvk disevvtprf lctggvspya dpntcrgdsg gplivhkrsr fiqvgviswg
vvdvcknqkr qkqvpahard fhinifqvlp wlkeklqded lgfl (SEQ ID NO:10)
[0027] SEQ ID NO:11 shows the entire BF amino acid sequence with 9H & 32Q:
mgsnlspqhc lmpfilglls ggvtttpwsl aqpqgscsle gveikggsfr llqegqaley
vcpsgfypyp vqtrtcrstg swstlktqdq ktvrkaecra ihcprphdfe ngeywprspy
ynvsdeisfh cydgytlrgs anrtcqvngr wsgqtaicdn gagycsnpgi pi.gtrkvgsq
yrledsvtyh csrgltlrgs qrrtcqeggs wsgtepscqd sfmydtpqev aeaflsslte
tiegvdaedg hgpgeqqkrlk ivldpsgsmn iylvldgsds igasriftgak kclvnliekv
asygvkpryg lvtyatypki wvkvseadss nadwvtkqln einyedhklk sgtntkkalq
avysmmswpd dvppegwnrt rhviilmtdg lhnmggdpit videirdlly igkdrknpre
dyldvyvfgv gplvnqvnin alaskkdneq hvfkvkdmen ledvfyqmid esqslslcgm
vwehrkgtdy hkqpwqakis virpskghes crngavvseyf vltaahcftv ddkehsikvs
vggekrdlei evvlfhpnyn ingkkeagip efydydvali kiknklkygq tirpiclpct
egttralrlp ptttcqqqke ellpaqdika lfvseeekkl trkevyikng dkkgscerda =
qyapgydkvk disevvtprf lctggvspya dpntcrgdsg gplivhkrsr fiqvgviswg
vvdvcknqkr qkqvpahard fhinlfqvlp wlkeklqded lgfl (SEQ ID NO:11)
[0028] SEQ ID NO: ] 2 shows the entire C2 amino acid sequence with 318D:
mgplmvlfcl lflypglads apscpqnvni sggtftlshg wapgslltys cpqglypspa
srlckssgqw qtpgatrsls kavckpvrcp apvsfengiy tprlgsypvg gnvsfecedg
filrgspvrq crpngmwdge tavcdngagh cpnpgislga vrtgfrfghg dkvryrcssn
lvltgssere cqgngvwsgt epicrqpysy dfpedvapal gtsfshmlga tnptqktkes
lgrkiqiqrs ghlnlylild csqsvsendf lifkesaslm vdrifsfein vsvaiitfas
epkvlmsvln dnsrdmtdvi sslenanykd heng.tgtnty aalnsvylmm nnqmrllgme
tmawqeirha iilltdgksn mggspktavd hireilninq krndyldiya igvgkldvdw
relnelgskk dgerhafilq dtkalhqvfe hmldvskltd ticgvgnmsa nasdqertpw
8
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
hvtikpksqe tcrgalisdq wvltaahcfr dgndhslwrv nvgdpksqwg kefliekavi
spgfdvfakk nqgilefygd diallklaqk vkmstharpi clpctmeanl alrrpqgstc
rdhenellnk qsvpahfval ngsklninik mgvewtscae vvsqektmfp nltdvrevvt
dqflcsgtqe despckgesg gavflerrfr ffqvglvswg lynpclgsad knsrkraprs
kvppprdfhi nlfrmqpwlr qhlgdvlnfl pl (SEQ ID N0:12)
[0029] SEQ ID NO:13 shows the 9 BF amino acid sequence with 32Q: ws] aqpqgs
(SEQ ID NO:13). .
[0030] SEQ ID NO:14 shows the 9 BF amino acid sequence with 9H: lspqhclmp
(SEQ ID NO:14).
[0031] SEQ ID NO: I 5 shows the 7 C2 amino acid sequence with 318D: dmtdvis
(SEQ ID NO:15)f
BRIEF DESCRIPTION OF THE FIGURES
[0032] Figure I is a diagram and haplotype analysis of the SNPs in BF and C2.
The
SNPs used in the study are shown along with the predicted haplotypes, odds
ratios
(OR), P values (P) and frequencies in the combined cases (CAS) and controls
(CON).
The 95% confidence interval for H7 is (0.33-0.61) and for H 10 is (0.23-0.56).
The
ancestral (chimpanzee) haplotype is designated as Anc. Examples of haplotype
H2
(NCBI Accession No. AL662849, as available on February 8, 2006), H5 (NCBI
Accession No. AL645922 and NCBI Accession No. NG004658, as available on
February 8, 2006) and H7 (NCBI Accession No. NG_000013, as available on
February 8, 2006) have been sequenced and no additional non-synonymous
variants
in either the C2 or BF genes are present (Stewart et al. (2004) Genome Res.
14:1176-
87).
[0033] Figure 2 shows combined complement gene analyses. Individual SNP
analyses revealed several possible combinations of SNPs that protect an
individual
from developing AMD. To test these, an empirical model was first applied. Fig.
2A
shows a model graphic, interpreted as giving four possible cotnbinations of
genotypes
that would protect from AMD. These are: (1) rs641153 (R32Q) is G/A and
rs1061170 (Y402H) is C/T; (2) rs547154 is G/A and rs1061170 is C/C; (3)
rs4151667
(L9H) is T/A and rs 1061170 is C/T; (4) rs4151667 is T/A and rs 1061170 is
C/C.
Application of this model resulted in the distributions shown in Fig. 2B for
the Iowa,
Columbia, and combined cohorts, respectively. These distributions were
subjected to
9 -
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Fisher's exact test and evidenced p-values of P = 0.00237, P= 4.28 x 10-$ and
P =
7.90 x 1910. For'comparative purposes, Exemplar software generated a
protective
model that provided a"best fit" to the data using a machine-learning method
know as
Genetic Algorithms. The resulting best performing model is depicted in Fig.
2C.
This model describes four possible individual or combinations of genotypes
that
protect from AMD; i.e., combinations resulting in the model being "ti-ue."
These
genotypes are: (1) rs 1048709 (R 150R) is G/G and rs 1061170 is C/C; or (2)
rs547154
is G/A; or (3) rs4151667 is T/A; or (4) CFH intron I variant is de1TT. The
model
perforniance is shown in Fig. 2D for the Iowa, Columbia, and combined cohorts.
These distributions evidenced p-values of P= 7.49 x 10"5, P = 2.97 x 10-" and
P
1.69 x 10-23 , respectively.
[0034] Figure 3 shows immunolocalization of BF (Fig. 3A); Ba (a fragment of
the
full-length factor B) (Fig. 3B); and C3 (Fig. 3C) along the retinal pigment
epithelium
(RPE)-choroid (CH) complex in sections from an unfixed eye of a 72 year old
donor
with early stage AMD. Anti-BF antibody (Quidel; reaction product is red)
labels
drusen (D), particularly along their rims, Bruch's membrane, and the choroidal
stroma. Anti-Ba antibody (Quidel; reaction product is pui=ple) labels Bruch's
membrane and RPE-associated patches. Note that the distribution of BF is
similar to
that of C3. Brown coloration in the RPE cytoplasm and choroid is due to
rnelanin.
Bruch's membrane (BM); Retina (R).
DETAILED DESCRIPTION
[0035] Provided herein are sequence polymorphisms that were discovered to
confer
a protective effect against age-related macular degeneration (AMD). These
polymorphisms include those found in the fctctor B (BF) and connplement
component
2 (C2) genes. Protective polymorphisms also include the delTT polymorphism in
the
CFH gene. Identifying subjects with these polymorphisms, as well as subjects
with
the recently discovered risk haplotype (Y402H in the conapl.ernent f'trctar
H(CFH)
gene), will aid in diagnosing those subjects at genetic risk for AMD.
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Ternis
[0036] The following explanations of terms and methods are provided to better
describe the present disclosure and to guide those of ordinary skill in the
art in the
practice of'the present disclosure. The singular forms "a," "an," and "the"
refer to one
or more than one, unless the context clearly dictates otherwise. For example,
the term
"including a nucleic acid" includes single or plural nucleic acids and is
considered
equivalent to the phrase "including at least one nucleic acid." The terin "or"
refers to
a single element of stated alternative elements or a combination of two or
more
elements, unless the context clearly indicates otherwise. As used herein,
"comprises"
means "includes." Thus, "comprising A or B," means "including A, B, or A and
B,"
without excluding additional elements. For example, the phrase "mutations or
polymorphisms" or "one or inore mutations or polymorphisms" means a mutation,
a
polymorphism, or combinations thereof, wherein "a" can refer to more than one.
[0037) Although methods and materials similar or equivalent to those described
herein can be used in the practice or testing of the present disclosure,
suitable methods
and rnaterials are described below. The materials, methods, and examples are
illustrative only and not intended to be limiting.
[0038] Unless otherwise noted, technical terms are used according to
conventional
usage. Definitions of cominon terms in molecular biology may be found in
Benjamin
Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-
9);
Kendrew et al. (eds.), The Encycl.opedia of Molecular Biology, published by
Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.),
Molecular Biology and Biotechnology: a Coynprehensive Desk Reference,
published
by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
[0039] Age-related macular degeneration: A medical condition wherein the light
sensing cells in the macula malfunction and over time cease to work. In
macular
degeneration the final form or the disease results in missing or blurred
vision in the
central, reading part of vision. The outer, peripheral part of the vision
remains intact.
AMD is further divided into a "dry," or nonexudative, form and a "wet," or
exudative,
form. Eighty five to ninety percent of cases are categorized as "dry" macular
degeneration where fatty tissue, known as drusen, will slowly build up behind
the
11
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
retina. The classic lcsion in dry macular degeneration is geographic atrophy.
Ten to
fifteen percent of cases involve the growth of abnormal blood vessels under
the retina.
These cases are called "wet" rnacular degeneration due to the leakage of blood
and
other fluid from behind the retina into the eye. Wet macular degeneration
usually
begins as the dry forni. If allowed to continue without treatment it usually
completely
destroys the macular structure and function. Choroidal neovascularization is
the
development of abnormal blood vessels beneath the retinal pigment epithelium
(RPE)
layer of the retina.
[0040] Medical, photodynamic, laser photocoagulation and laser treatment of
wet
maculai- degeneration are available. Risk factors for AMD include aging,
smoking,
family history, exposure to sunlight especially blue light, hypertension,
cardiovascular
risk factors such as high cholesterol and obesity, high fat intake, oxidative
stress, and
race.
[0041 ] AMD is an example of a disease characterized by alternative complement
cascade disregulation, which also includes membrane proliferative
glomerulonephritis
(MPGN) and a predisposition to develop aortic aneurism. Methods described
herein
for detection or increased risk of developing AMD may also be used to detect
increased risk for other diseases characterized by alternative coinplement
cascade
disregulation (e.g., MPGN).
[0042] A{lele: Any one of a number of viable DNA codings of the same gene
(sometimes the te'rm refers to a non-gene sequence) occupying a given locus
(position) on a chromosome. An individual's genotype for that gene will be the
set of
alleles it happens to possess. In an organism which has two copies of each of
its
chromosomes (a diploid organism); two alleles make up the individual's
genotype. In
a diploid organism, when the two copies of the gene are identical - that is,
have the
same allele - they are said to be homozygous for that gene. A diploid organism
which
has two different alleles of the gene is said to be heterozygous.
[0043] As used herein, the process of "detecting alleles" may be referred to
as
"genotyping, determining or identifying an allele or polymorphism," or'any
similar
phrase. The allele actually detected will be manifest in the genomie DNA of a
subject, but may also be detectable from RNA or protein sequences transcribed
or
translated from this region.
12
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
.
[0044;1 Amplification: The use of a technique that increases the number of
copies of
a nucleic acid molecule in a saniple. An example of in vitro amp] ification is
the
polymerase chain reaction (PCR), in whieh a biological sample obtained from a
subject is contacted with a paii- of oligonucleotide primers, under conditions
that
allow for hybridization of the primers to a nucleic acid molecule in the
sample. The
primers are extended under suitable conditions, dissociated froni the
template, and
then re-annealed, extended, and dissociated to amplify the number of copies of
the
nucleic acid molecule. The product of amplification can be characterized by
such
techniques as electrophoresis, restriction endonuclease cleavage patterns,
oligonucleotide hybridization or ligation, and/or nucleic acid sequencing.
[0045] Other examples of amplification methods include strand displacement
amplification, as disclosed in U.S. Patent No. 5,744,311; transcription-free
isothermal
amplification, as disclosed in U.S. Patent No. 6,033,881; repair chain
reaction
amplification, as disclosed in PCT Publication No. WO 90/01069; ligase chain
reaction amplification, as disclosed in EP-A-320,308; gap filling ligase chain
reaction
amplification, as disclosed in U.S. Patent No. 5,427,930; and NASBA'''M RNA
transcription-free amplification, as disclosed in U.S. Patent No. 6,025,134.
An
amplification method can be modified, including for example by additional
steps or
coupling the amplification with anothei- protocol.
[0046] Array: An arrangement of molecules, particularly biological
macromolecules (such as polypeptides or nucleic acids) or cell or tissue
samples, in
addressable locations on or in a substrate. A "microarray" is an array that is
miniaturized so as to require or be aided by microscopic examination for
evaluation or
analysis. These arrays are sometimes called DNA chips, or - generally -
biochips;
thoiugh more formally they are referred to as microarrays, and the process of
testing
the gene patterns of an individual is sometimes called microarray profiling.
DNA
array fabrication chemistry and structure is varied, typically made up of
400,000
different features, each holding DNA from a different human gene, but some
employing a solid-state chemistry to pattern as many as 780,000 individual
features.
[0047] The array of molecules ("features") makes it possible to carry out a
very
large number of analyses on a sample at one time. In certain example arrays,
one or
more molecules (such as an oligonucleotide probe) will occur on the array a
plurality
13
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
oi'times (such as twice), for instance to provide internal controls. The
number of
addressable locations on the array can vary, foi- example from a few (such as
three) to
at least 50, at least 100, at least 200, at least 250, at least 300, at least
500, at least
600, at least 1000, at least 10,000, or more. In particular examples, an array
includes
nucleic acid molecules, such as oligonucleotide sequences that are at least 15
nucleotides in length, such as about 15-40 nucleotides in length, such as at
least 18
nucleotides in length, at least 21 nucleotides in length, or even at least 25
nucleotides
in length. In one example, the molecule includes oligonucleotides attached to
the
al-ray via theii= 5'- or 3'-end.
[0048] Within an array, each arrayed sample is addressable, in that its
location can
be reliably and consistently determined within the at least two dimensions of
the
array. The feature application iocation on an array can assume different
shapes. For
example, the array can be regular (such as arranged in uniform rows and
columns) or
irregular. Thus, in ordered arrays the location of each sample is assigned to
the
sample at the time when it is applied to the array, and a key may be provided
in order
to correlate each location with the appropriate target or feature position.
Often,
ordered arrays are arranged in a symmetrical grid pattern, but samples could
be
arranged in other patterns (such as in radially distributed lines, spiral
lines, orordered
clusters). Addressable arrays usually are computer readable, in that a
computer can
be programmed to correlate a particular address on the an=ay with information
about
the sample at that position (such as hybridization or binding data, including
for
instance signal intensity). In some examples of computer readable formats, the
individual features in the array are arranged regularly, for instance in a
Cartesian grid
pattern, which can be correlated to address information by a computer.
[0049] Also contemplated herein are protein-based arrays, where the probe
molecules are or include proteins, or where the target molecules are or
include
proteins, and arrays including nucleic acids to which proteins/peptides are
bound, or
vice versa.
[0050] Binding or stable binding: An association between two substances or
molecules, such as the hybridization of one nucleic acid molecule to another
(or itself)
and the association of an antibody with a peptide. An oligonucleotide molecule
binds
or stably binds to a target nucleic acid molecule if a sufficient amount of
the
14
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
oligonucleotide molecule forms base pairs or is hybridized to its target
nucleic acid
molecule, to pei-,nit detection of that binding. Binding can be detected by
any
procedure known to one skilled in the art, such as by physical or functional
properties
of the target:oligonucleotide complex. For example, binding can be detectcd
functionally by determining whether binding has an observable effect upon a
biosynthetic process such as expression of a gene, DNA replication,
transcription,
translation, and the like.
[0051] Physical methods of detecting the binding of complementary strands of
nucleic acid molecules, include but are not limited to, such methods as DNase
I or
chemical footprinting, gel shift and affinity cleavage assays, Northern
blotting, dot
blotting and light absorption detection procedures. For example, one method
involves
observing a change in light absorption of a solution containing an
oligonucleotide (or
an analog) and a target nucleic acid at 220 to 300 nm as the temperature is
slowly
increased. If the oligonucleotide or analog has bound to its target, there is
a sudden
increase in absorption at a characteristic temperature as the oligonucleotide
(or
analog) and target disassociate from each other, or melt. In another example,
the
method involves detecting a signal, such as a detectable label, present on one
or both
complementary strands.
[0052] The binding between an oligomer and its target nucleic acid is
frequently
characterized by the temperature (T,,) at which 50% of the oligomer is nielted
from its
target. A higher (T,,,) means a stronger or more stable complex relative to a
complex
with a lower (T,,,).
[0053] Complement component 2 (C2): Part of the classical pathway of the
complement system. Activated Cl cleaves C2 into C2a and C2b. C2a leads to
activation of C3. Deficiency of C2 has been reported to be associated with
certain
autoimmune diseases, including systemic lupus erythematosus, Henoch-Schonlein
purpura, or polymyositis. C2 is a member of EC 3.4.21.43. It is also known as
classical-complement-pathway C3/C5 convertase.
[0054] Complement Factor H: Otherwise known as beta-IH; a serum glycoprotein
that controls the function of the alternative complement pathway and acts as a
cofactor with factor I (C3b inactivator). It regulates the activity of the C3
convertases
such as C4b2a.
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
[0055] Complementarity and percentage complementarity: Molecules with
complementary nucleic acids forni a stable duplex or triplex when the strands
bind,
(hybridize), to each other by foriYiing Watson-Crick, Hoogsteen or reverse
Hoogsteen
base pairs. Stable binding occurs when an oligonucleotide molecule remains
detectably bound to a target nucleic acid sequence under the required
conditions.
[0056] Complementarity is the degree to which bases in one nucleic acid strand
base pair with the bases in a second nucleic acid strand. Complementarity is
conveniently described by percentage, that is, the proportion of nucleotides
that form
base pairs between two strands or within a specific region or domain of two
strands.
For example, if 10 nucleotides of a 15-nucleotide oligonucleotide forni base
paii-s
with a targeted region of a DNA molecule, that oligonucleotide is said to have
66.67%
complementarity to the region of DNA targeted.
[0057] In the present disclosure, "sufficient complementarity" means that a
sufficient number of base pairs exist between an oligonucleotide molecule and
a target
nucleic acid sequence (such as a CFH, BF or C2 sequence) to achieve detectable
binding_ When expressed or measured by percentage of base pairs formed, the
percentage compleinentarity that fulfills this goal can range from as little
as about
50% complementarity to full (100%) complementary. In general, sufficient
complementarity is at least about 50%, for example at least about 75%
complementarity, at least about 90% complementarity, at least about 95%
complementarity, at least about 98% complementarity, or even at least about
100%
complementarity.
[0058) A thorough treatment of the qualitative and quantitative considerations
involved in establishing binding conditions that allow one skilled in the art
to design
appropriate oligonucleotides for use under the desired conditions is provided
by Beltz
et al. (1983) Methods Enzymol 100:266-285; and by Sambrook et al: (ed.),
Molecular Cloning: A Laboralory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, 1989.
[0059] DNA (deoxyribonucleic acid): A long chain polymer which includes the
genetic material of most living organisms (some viruses have genes including
ribonucleic acid, RNA). The repeating units in DNA polymers are four different
nucleotides, each of which includes one of the four bases (adenine, guanine,
cytosine
16
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
and thymine) bound to a deoxyribose sugar to which a phosphate group is
attached.
Triplets of nucleotides, referred to as codons, in DNA molecules code for
amino acid
in a polypeptide. The tertn codon is also used for the corresponding (and
complenientary) sequences of three nucleotides in the mRNA into which the DNA
sequence is transcribed.
[0060) Drusen: Deposits that accumulate between the RPE basal lamina and the
inner collagenous layer of Bruch's membrane (see, for example, van der Schaft
et n!.
(1992) OphthalmoK. 99:278-86; Spraul et al. (1997) Arch. Ophthalnzol. 115:267-
73;
and Mullins et cr1., Histochemical comparison of ocular "drusen" in monkey and
hunlan, In M. LaVail, J. Hollyfield, and R. Anderson (Eds.), in Degenerative
Retinal
Diseases (pp. 1-10). New York: Plenuni Press, 1997). Hard drusen are small
distinct
deposits comprising homogeneous eosinophilic niaterial and are usually round
or
heniispherical, without sloped borders. Soft drusen are larger, usually not
homogeneous, and typically contain inclusions and spherical profiles. Some
drusen
may be calcified. The term "diffuse di-usen," or "basal linear deposit," is
used to
describe amorphous material which forms a layer between the inner collagenous
layer
of Bruch's membrane and the retinal pigment epithelium (RPE). This material
can
appear similar to soft drusen histologically, with the exception that it is
not mounded.
[0061] Factor B(BF): A proactivator of complement 3 in the alternate pathway
of
complement activation. Factor b is converted by factor d to c3 convertase. BF
is a
member of EC 3.4.21.47. Factor B circulates in the blood as a single chain
polypeptide. Upon activation of the alternative pathway, it is cleaved by
complement
factor d yielding the noncatalytic chain Ba and the catalytic subunit Bb. The
active
subunit Bb is a serine protease which associates with C3b to form the
alternative
pathway C3 convertase. BF is also known as alternative-complement-pathway
C3/C5
convertase.
[0062] Genetic predisposition or risk: Susceptibility of a subject to a
genetic
disease, such as AMD. However, such susceptibility may or may not result in
actual
development of the disease.
[0063] Haplotype: The genetic constitution of an individual cliromosome. In
diploid organisms, a haplotype contains one member of the pair of alleles for
each
site. A haplotype can refer to only one locus or to an entire genome.
Haplotype can
17
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
also refer to a set of single nucleotide polymorphisms (SNPs) found to be
statistically
associated on a single chroniatid.
[0064] Hybridization: Oligonucleotides and their analogs hybridize by hydrogen
bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen
bonding, between complementary bases. Generally, nucleic acid consists of
nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and
thymine
(T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form
hydrogen bonds between a pyrimidine and a purine, and the bonding of the
pyriniidine to the purine is referred to as "base pairing." More specifically,
A will
hydrogen bond to T or U, and G will bond to C. "Complementary" refers to the
base
pairing that occurs between to distinct nucleic acid sequences or two distinct
regions
of the same nucleic acid sequence.
[0065] "Specifically hybridizable" and " specifically complementary" are terms
that indicate a sufficient degree of complementarity such that stable and
specific
binding occurs between the oligonucleotide (or its analog) and the DNA or RNA
target. The oligonucleotide or oligonucleotide analog need not be 100%
complementary to its target sequence to be specifically hybridizable. An
oligonucleotide or analog is specifically hybridizable when binding of the
oligonucleotide or analog to the target DNA or RNA molecule interferes with
the
normal function of the target DNA or RNA, and there is a sufficient degree of
complementarity to avoid non-specific binding of the oligonucleotide or analog
to
non-target sequences under conditions where specific binding is desired, for
example
under physiological conditions in the case of in vivo assays or systems. Such
binding
is referred to as specific hybridization.
[0066] Hybridization conditions resulting in particular degrees of stringency
will
vary depending upon the nature of the hybridization method of choice and the
composition and length of the hybridizing nucleic acid sequences. Generally,
the
temperature of hybridization and the ionic strength (especially the Na+ and/or
Mg++
concentration) of the hybridization buffer will determine the stringency of
hybridization, though wash times also influence stringency. Calculations
regarding
hybridization conditions required for attaining particular degrees of
stringency are
discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual,
2nd
18
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY,
1989,
chapters 9 and 1 1; and Ausubel el al. Shoi-t Pi-otocolti in Molecular
Biology, 4th ed.,
John Wiley & Sons, Inc., 1999.
[0067] For puiposes of the present disclosure, "stringent conditions"
encoinpass
conditions under which hybridization will only occur if there is less than 25%
mismatch between the hybridization molecule and the target sequence.
"Stringent
conditions" may be broken down into particular levels of stringency for more
precise
definition. Thus, as used herein, "moderate stringency" conditions are those
under
which molecules with more than 25% sequence mismatch will not hybridize;
conditions of "mediuin stringency" are those under which molecules with inore
than
15% mismatch will not hybridize, and conditions of "high stringency" are those
under
which sequences with more than 20% mismatch will not hybridize. Conditions of
"very high stringency" are those under which sequences with more than 10%
mismatch will not hybridize.
[0068] The following is an exemplary set of hybridization conditions and is
not
meant to be limiting:
VerYHigh Stringency (detects sequences that share 90% identity)
Hybridization: 5x SSC at 65 C for 16 hours
Wash twice: 2x SSC at room temperature (RT) for 15 minutes each
Wash twice: 0.5x SSC at 65 C for 20 minutes each
High Stringency (detects secuences that share 80% identity or greater)
Hybridization: 5x; 6x SSC at 65 C-70 C for 16-20 hours
Wash twice: 2x SSC at RT for 5-20 minutes each
Wash twice: 1x SSC at 55 C-70 C for 30 minutes each
Low Stringency (detects sequences that share greater than 50% identity)
Hybridization: 6x SSC at RT to 55 C for 16-20 hours
Wash at least twice: 2x-3x SSC at RT to 55 C for 20-30 minutes each
[0069] Isolated: An "isolated" biological coinponent (such as a nucleic acid
molecule, protein, or organelle) has been substantiaily separated or purified
away
from other biological components in the cell of the organism in which the
component
naturally occurs, such as other chromosomal and extra-chromosomal DNA and RNA,
19
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
proteins and organelles. Nucleic acid inolecules and proteins that have been
"isolated" include nucleic acid molecules and proteins purified by titandard
purification methods. The term also embraces nucleic acid nlolecules and
proteins
prepared by recombinant expression in a host cell as well as chemically
synthesized
nucleic acid molecules and proteins.
[0070] Linkage disequilibrium (LD): The non-random association of alleles at
two
or more loci, not necessarily on the same chromosome. LD describes a situation
in
which some combinations of alleles or genetic markers occur more or less
frequently
in a population than would be expected from a random formation of haplotypes
from
alleles based on their frequencies. The expected frequency of occurrence of
two
alleles that are inherited independently is the frequency of the first allele
multiplied by
the frequency of the second allele. Alleles that co-occur at expected
frequencies are
said to be in linkage equilibrium.
[0071] Locus: The position of a gene (or other significant sequence) on a
chromosome.
[0072] Mutation: Any change of the DNA sequence within a gene or chromosome.
In some instances, a mutation will alter a characteristic or trait
(phenotype), but this is
not always the case. Types of mutations include base substitution point
mutations
(e.g., transitions or transversions), deletions, and insertions. Missense
inutations are
those that introduce a different amino acid into the sequence of the encoded
protein;
nonsense mutations are those that introduce a new stop codon. In the case of
insertions or deletions, mutations can be in-frame (not changing the frame of
the
overall sequence) or frame shift mutations, which may result in the misreading
of a
large number of codons (and often leads to abnormal termination of the encoded
product due to the presence of a stop codon in the alternative frame).
[0073] This term specifically encompasses variations that arise through
somatic
mutation, for instance those that are found only in disease cells, but not
constitutionally, in a given individual. Examples of such somatically-acquired
variations include the.point mutations that frequently result in altered
function of
various genes that are involved in development of cancers. This term also
encompasses DNA alterations that are present constitutionally, that alter the
function
of the encoded pi=otein in a readily demonstrable manner, and that can be
inherited by
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
the children of an affected individual. In this respect, the term ovcrlaps
with
"polymorphism," as defined below, but generally refers to the subset of
constitutional
alterations_
[0074] Nucleic acid molecule: A polyrneric forin of nucleotides, which n-iay
include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and
synthetic forms and mixed polymers of the above. A nucleotide refers to a
ribonucleotide, deoxynucleotide or a modified form of either type of
nucleotide. A
"nucleic acid niolecule" as used herein is synonymous with "nucleic acid" and
"polynucleotide." A nucleic acid molecule is usually at least 10 bases in
length, unless
otherwise specified. The terni includes single and double stranded forins of
DNA. A
polynucleotide may include either or both naturally occurring and modified
nucleotides linked together by naturally occurring and/or non-naturally
occurring
nucleotide linkages.
[0075] Nucleotide: Includes, but is not limited to, a monomer that includes a
base
linked to a sugar, such as a pyrimidine, purine or synthetic analogs thereof,
or a base
linked to an amino acid, as in a peptide nucleic acid (PNA). A nucleotide is
one
monomer in a polynucleotide. A nucleotide sequence refers to the sequence of
bases
in a polynucleotide.
[0076] Oligonucleotide: A nucleic acid molecule generally comprising a length
of
300 bases or fewer. The term often refers to single stranded
deoxyribonucleotides,
but it can refer as well to single or double stranded ribonucleotides, RNA:DNA
hybrids and double stranded DNAs, among others. The term "oligonucleotide"
also
includes oligonucleosides (that is, an oligonucleotide minus the phosphate)
and any
other organic base polymer. In some examples, oligonucleotides are about 10 to
about 90 bases in length, for example, 12, 13, 14, 15, 16, 17, 18, 19 or 20
bases in
length. Other oligonucleotides are about 25, about 30, about 35, about 40,
about 45,
about 50, about 55, about 60 bases, about 65 bases, about 70 bases, about 75
bases or
about 80 bases in length. Oligonucleotides may be single stranded, for
example, for
use as probes or primers, or may be double stranded, for example, for use in
the
construction of a mutant gene. Oligonucleotides can be either sense or anti
sense
oligonucleotides. An oligonucleotide can be modified as discussed above in
reference
to nucleic acid molecules. Oligonucleotides can be obtained from existing
nucleic
21
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
acid sources (for example, genomic or cDNA), but can also be synthetic (for
example,
produced by laboratory oi- in vitru oligonucleotide synthesis).
[0077] Polymorphism: A variation in the gene sequence. The polymorphisms can
be those variations (DNA sequence differenccs) which are generally.found
between
individuals or different ethnic groups and geographic locations which, while
having a
different sequence, produce functionally equivalent gene products. The term
can also
refer to variants in the sequence which can lead to gene products that are not
functionally equivalent. Polymorphisms also encompass variations which can be
classified as alleles and/or mutations which can produce gene products which
may
have an altered function. Polyinorphisrns also encompass variations which can
be
classified as alleles and/or mutations which either produce no gene product or
an
inactive gene product or an active gene product produced at an abnormal rate
or in an
inappropriate tissue or in response to an inappropriate stiinulus. Further,
the term is
also used interchangeably with allele as appropriate.
[0078] Polymorphisms can be referred to, for instance, by the nucleotide
position at
which the variation exists, by the change in amino acid sequence caused by the
nucleotide variation, or by a change in some other characteristic of the
nucleic acid
molecule or protein that is linked to the vai-iation.
[0079] Probes and Primers: A probe comprises an identifiable, isolated nucleic
acid that recognizes a target nucleic acid sequence. Probes include a nucleic
acid that
is attached to an addressable location, a detectable label or other reporter
molecule
and that hybridizes to a target sequence. Typical labels include radioactive
isotopes,
enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent
agents,
haptens, and enzymes. Methods for labeling and guidance in the choice of
labels
appropriate for various purposes are discussed, for example, in Sambrook et
al. (ed.),
Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, 1989 and Ausubel et al. Short
Protocols
in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999.
[0080] Primers are short nucleic acid molecules, for instance DNA
oligonucleotides
nucleotides or more in length, for example that hybridize to contiguous
complementary nucleotides or a sequence to be amplified. Longer DNA
oligonucleotides may be about 15, 20, 25, 30 or 50 nucleotides or inore in
length.
22
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Primers can be annealed to a complementary target DNA strand by nucleic acid
hybridization to form a hybrid between the primer and the target DNA strand,
and
then the prinier extended along the target DNA strand by a DNA polymerase
enzyrne.
Primer pairs can be used for amplification of a nucleic acid sequence, for
exarnple, by
the PCR or other nucleic-acid amplification methods known in the art, as
described
below.
[0081] Methods for preparing and using nucleic acid probes and primers are
described, for example, in Sambrook er a!. (ed.), Molecular Cloning: A
Laboratory
Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor,
NY, 1989; Ausubel et a/. Short Protocols in Molecular Biology, 4th ed., John
Wiley
& Sons, Inc., 1999; and Innis et al. PCR Protocols, A Guide to Methods and
Applications, Academic Press, Inc., San Diego, CA, 1990. Amplification primer
pairs
can be derived from a known sequence, for exaniple, by using computer programs
intended for that purpose such as Prinier (Version 0.5, (D 1991, Whitehead
Institute
for Biomedical Research, Cambridge, MA). One of ordinary skill in the art will
appreciate that the specificity of a particular probe or primer increases with
its length.
Thus, in order to obtain greater specificity, probes and primers can be
selected that
include at least 20, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides of
a target
nucleotide sequences.
[0082] Sample: A sample obtained from a human or non-human mammal subject.
As used herein, biological samples include all samples useful for genetic
analysis in
subjects, including, but not limited to: cells, tissues, and bodily fluids,
such as blood;
derivatives and fractions of blood (such as serum or plasma); extracted galls;
biopsied
or surgically removed tissue, including tissues that are, for example,
unfixed, frozen,
fixed in formalin and/or embedded in paraffin; tears; milk; skin scrapes;
surface
washings; urine; sputwn; cerebrospinal fluid; prostate fluid; pus; bone marrow
aspirates; BAL; saliva; cervical swabs; vaginal swabs; and oropharyngeal wash.
[0083] Single Nucleotide Polymorphism or SNP: A DNA sequence variation,
occurring when a single nueleotide: adenine (A), thymine (T), cytosine (C) or
guanine
(G) - in the genome differs between members of the species. As used herein,
the term
"single nucleotide polymorphism" (or SNP) includes mutations and
polymorphisms.
SNPs may fall within coding sequences (CDS) of genes oi- between genes
(intergenic
'23
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
regions). SNPs within a CDS change the codon, which niay or rnay not change
the
ainino acid in the protein sequence. The fot-nier may constitute different
alleles. The
latter are called silent mutations and typically occur in the third position
of the codon
(called the wobble position).
[0084] Subject: Human and non-human mammals (such as veterinary subjects).
Methods for Jdentijying cr Subject at Increased Risk for AMD
[0085] Methods are provided for identifying a subject at increased risk of
developing age-related macular degeneration (AMD). These n7ethods include
analyzing the subject's fcrc=tor B (BF) and/or coMplement component 2 (C2)
genes,
and determining whether the subject has at least one protective polymorphism,
wherein the protective polymorphism is selected from the group consisting of:
a)
R32Q in BF (rs641 153); b) L9H in BF (rs4151667); c) IVS 10 in C2 (r5547154);
and
d) E318D in C2 (rs9332739). If the subject does not have at least one
protective
polymorphism, the subject is at increased risk for developing AMD. The method
may
further include analyzing the subject's CFH gene, or any other desired gene.
As
described herein, the de1TT polymorphism in the CFH gene has been identified
as
being protective for AMD.
[00861 The methods niay also include analyzing the subject's genotype at
either the
BF or C2 locus and at the CFH locus, and determining if the subject has at
least one
protective genotype selected from the group consisting of: a) heterozygous for
the
R32Q polymorphism in BF (rs641153); b) heterozygous for the L9H polymorphism
in BF (rs4151667); c) heterozygous for the IVS 10 polymorphism in C2
(rs547154);
d) heterozygous for the E318D polymorphism in C2 (rs9332739); e) homozygous
for
the de1TT polymorphism in CFH; and f) homozygous for the R150R polymorphism in
BF (rs 1048709) and homozygous for Y402 in CFH; wherein if the subject does
not
have at least one protective genotype, the subject is at increased risk for
developing
AMD. The method may alternatively include analyzing the subject's genotype at
both the BF and C2 locus, and at the CFH locus. The methods provided herein
are
also useful for identifying a subject at decreased risk of developing AMD, by
determining if the subject has at least one of the above-identified
polymorphisms or
genotypes.
24
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
[0087) The analysis of a subject's genetie material for the prescnce or
absence of
particular polymorphisms is perfoi-nied by obtaining a sample froni the
subject. This
sample may be froin any pai-t of the subject's body that DNA or RNA can be
isolated
from. Analysis may also be pei-formed on protein isolated from a sample.
Examples
of such samples are discussed in more detail below. The subject may have been
diagnosed with AMD, including early AMD, choroidal neovascularization, or
geographic atrophy. The subject lnay liave symptoms of AMD, such as drusen,
pigmentary alterations, exudative changes such as hemorrhages, hard exudates,
or
subretinal/sub-RPE/intraretinal fluid, decreased visual acuity, blurred
vision, distorted
vision (metamorphopsia), central scotomas, or trouble discerning colors.
Alternatively, the subject may not have been diagnosed with AMD, but may be in
a
high risk group, based on family history, age, race, or lifestyle choices.
These
lifestyle choices include, but are not limited to, smoking, exposure to
sunlight
(especially blue light), hypei-tension, cardiovasculai- risk factors such as
high
cholesterol and obesity, high fat intake, and oxidative stress. Subjects at
risk for
developing AMD also include those that are heterozygous or homozygous for the
risk
haplotype Y4021-1 in the CFH gene.
[00881 Techniques for determining the presence or absence of a particular
polymorphism or genotype of interest are well known in the art. Examples of
these
methods are discussed below, and the particular method used is not intended to
be
limiting. In addition, analyzing a subject's BF, C2 or CFH genes for the
particular
polymorphisms disclosed herein is also intended to include detection of any
mutations
that confer the same amino acid change as found in the polymorphism. For
example,
the L9H polymorphism in BF changes the nucleotide codon for the 9,h amino acid
from CTC to CAC, generating a histidine instead of a leucine. This change
could also
be specified by the nucleotide codon CAT. The E318D polymorphism in C2 changes
the nucleotide codon for the 318t1' amino acid from GAG to GAC, generating an
aspartic acid instead of a glutamic acid. This change could also be specified
by the
nucleotide codon GAT. The R 150R polymorphism in BF changes the nucleotide
codon for the 1501h amino acid from CGG to CGA. This change does not change
the
amino acid encoded (arginine). Arginine could also be encoded by CGT or CGC.
'In
addition, arginine could be encoded by AGA or AGG. The Y402H polymorphism in
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
CFH changes the nucleotide codon for the 402"`i amino aci(i from a TAT to a
CAT,
generating a histidine instead of a tyrosine. This change could also be
specified by
the nucleotide codon CAC. Any of these nucleotide codons, or others capable of
being identified by one of skill in the art, can be detected in a subject.
[0089] The methods of the invention may identify at least about 5%, about 10%,
about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%,
about 50%, about 55%, about 60%, about 65%, about 70% of subjects that will
develop AMD.
AMD Preven.tutive Therap.),
[0090] The present disclosure also provides methods of avoiding or reducing
the
incidence of AMD in a subject determined to be genetically predisposed to
developing AMD. For example, if in using the nlethods described above a
mutation
or protective polymorphism in the BF, C2 and/or CFH genes is not identified in
a
subject at risk for AMD based on any of the risk factors described above, a
lifestyle
choice may be undertaken by the subject in order to avoid or i-educe the
incidence of
AMD or to delay the onset of AMD. For example, the subject may quit smoking;
modify diet to include less fat intake; increase the intake of antioxidants,
including
vitamins C and E, beta-carotene, and zinc; or take prophylactic doses of
agents that
retard the development of retinal neovascularization. Treatment for such
individuals
could involve vaccines against certain pathogens, or antibiotics, or antiviral
or fungal
drugs. Treatment could also involve anti-inflammatory di-ugs, or complement
inhibitors. In some examples, the treatment selected is specific and tailored
for the
subject, based on the analysis of that subject's genetic profile.
Methods for Detecting Known Polymorphisms
[0091] Methods for detecting known polymoiphisms include, but are not limited
to,
restriction fragment length polymorphism (RFLP), single strand conformational
polymorphism (SSCP) mapping, nucleic acid sequencing, hybridization,
fluorescent
in situ hybridization (FISH), PFGE analysis, RNase protection assay, allele-
specific
oligonucleotide (ASO), dot blot analysis, allele-specific PCR amplification
(ARMS),
oligonucleotide ligation assay (OLA) and PCR-SSCP. Also useful are the
recently
26
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
developed techniques of mass spectroscopy (such as Matrix Assisted Laser
Desorption/Ionization (MALDI) or MALDI- Time Of Flight (MALDI-TOF); and
DNA microchip technology for the detection of muteltlons. See, for example,
Chapters 6 and 17 in Humez 1Vloleculai- Genetics 2. Eds. Torn Strachan and
Andrew
Read. New York: John Wiley & Sons Inc., 1999.
[0092] These techniques may include amplifying the nucleic acid before
analysis.
Amplification techniques are known to those of skill in the art and are
discussed
below.
[0093] When a polyniorphism causes a nucleotide change that creates or
abolishes
the recognition site of a restriction enzyme, that restriction enzyme may be
used to
identify the polymorphism. Polymorphic alleles can be distinguished by PCR
amplifying across the polymorphic site and digesting the PCR product with a
relevant
restriction endonuclease. The different products may be detected using a size
fractionation method, such as gel electrophoresis. Alternatively, restriction
fragment
length polymorphism (RFLP) may be used. In cases where the polyniorphism does
not result in a restriction site difference, differences between alleles may
be detected
by amplification-created restriction site PCR. In this method, a primer is
designed
from sequence immediately adjacent to, but not encompassing, the restr-iction
site.
The primer is deliberately designed to have a single base mismatch in a
noncritical
position which does not prevent hybridization and amplification of both
polymorphic
sequences. This nucleotide mismatch, together with the sequence of the
polymorphic
site creates a restriction site not present in one of the alleles.
[0094] Single strand conformational polymorphism (SSCP) mapping detects a band
that migrates differentially because the sequence change causes a difference
in single-
strand, intramolecular base pairing. Single-stranded DNA molecules differing
by
only one base frequently show different electrophoretic mobilities in
nondenaturing
gels. Differences between normal and mutant DNA mobility are revealed by
hybridization with labeled probes. This method does not detect all sequence
changes,
especially if the DNA fragment size is greater than about 500 bp, but can be
optimized to detect most DNA sequence variation. The reduced detection
sensitivity
is a disadvantage, but the increased throughput possible with SSCP makes it an
attractive alternative to direct sequencing for mutation detection on a
research basis.
27
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
The fragments which have shifted mobility on SSCP gels are then sequenced to
deterniine the exact nature of the DNA sequence variation.
[0095] Direct DNA sequencing, either manual sequencing or automated
fluorescent
sequencing can detect sequence variation.
[0096) The detection of specific alleles may also be performed using Taq
polymerase (Holland et al. (1991) Proc. Ncrtl. Acacl. Sci. U.S.A. 88:7276-80;
Lee et ul.
(1999) J. Mnl. Biol. 285:73-83). This is based on the fact that Taq polymerase
does
not possess a proofreading 3' to 5' exonuclease activity, but possesses a 5'
to 3'
exonuclease activity. This assay involves the use of two conventional PCR
primers
(forward and reverse), which are specific for the target sequence, and a third
primer,
designed to bind specifically to a site on the target sequence downstream of
the
forward primer binding site. The third primer is generally labeled with two
fluorophores, a reporter dye at the 5' end, and a quenclier dye, having a
different
emission wavelength compared to the reporter dye, at the 3' end. The third
primer
also carries a blocking group at the 3' terminal nucleotide, so that it cannot
by itself
prime any new DNA synthesis. During the PCR reaction, Taq DNA polymerase
synthesizes a new DNA strand primed by the forward primer and as the enzyme
approaches the third primer, its 5' to 3' exonuclease activity processively
degrades the
third primer from its 5' end. The end result is that the nascent DNA strand
extends
beyond the third primer binding site and the reportei- and quenclier dyes are
no longer
bound to the same molecule. As the reporter dye is no longer near the quencher
dye,
the resulting increase in reporter emission intensity may be detected.
[0097] A polymorphism may be identified using one or more hybridization probes
designed to hybridize with the particular polymorphism in the desired gene. A
probe
used for hybridization detection methods should be in some way labeled so as
to
enable detection of successful hybridization events. This may be achieved by
in vitro
methods such as nick-translation, replacing nucleotides in the probe by
radioactively
labeled nucleotides, or by random primer extension, in which non-labeled
molecules
act as a template for the syntliesis of labeled copies. Other standard methods
of
labeling probes so as to detect hybridization are known to those skilled in
the art.
[0098] For DNA fragments up to about 2 kb in length, single-base changes can
be
detected by chemical cleavage at the mismatched bases in mutant-normal
28 -
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
hetei-oduplexes. For example, a strand of the DNA not including the
polymorphism of
interest is i-adiolabeled at one end and then is hybridized with a strand of
the subject
DNA. The resulting heteroduplex DNA is treated with hydroxylamine or osmium
tetroxide, which modifies any C or C and T, respectively, in mismatched single-
stranded regions; the niodified backbone is susceptible to cleavage by
piperidine. The
shortened labeled fragment is detected by gel electrophoresis and
autoradiography in
comparison with DNA not including the polymorphism of interest.
[0099] Mismatches are hybridized nucleic acid duplexes in which the two
strands
are not 100% complementary. Lack of total homology may be due to deletions,
insertions, inversions or substitutions. Mismatch detection can be used to
detect point
mutations in the gene or in its mRNA product. While these techniques are less
sensitive than sequencing, they are simpler to perform on a large number of
samples.
An example of a mismatch cleavage technique is the RNase protection method.
This
method involves the use of a labeled riboprobe which is complementary to one
variation of the polymorphism being detected (generally the polymorphism not
associated with protection from AMD). The riboprobe and either mRNA or DNA
isolated from the subject are annealed (hybridized) together and subsequently
digested
with the enzyme RNase A which is able to detect some mismatches in a duplex
RNA
structure. If a mismatch is detected by RNase A, it cleaves at the site of the
mismatch. Thus, when the annealed RNA preparation is separated on an
electrophoretic gel matrix, if a mismatch has been detected and cleaved by
RNase A,
an RNA product will be seen which is smaller than the full length duplex RNA
for the
riboprobe and the mRNA or DNA. The riboprobe need not be the full length of
the
mRNA or gene but can be a segment of either. Alternatively, mismatches can be
detected by shifts in the electrophoretic mobility of mismatched duplexes
relative to
matched duplexes.
[0100] DNA sequences of the BF, C2 or CFH genes which have been amplified by
use of PCR may also be screened using allele-specific probes or
oligonucleotides
(ASO). These probes are nucleic acid oligomers, each of which contains a
region of
the gene sequence harboring a known mutation or polymorphism. For example, one
oligomer may be about 30 nucleotides in length, corresponding to a portion of
the BF,
C2 or CFH gene sequence. By use of a battery of such allele-specific probes,
PCR
29
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
amplification products can be screened to identify the presence of one or more
polyniorphisms provided herein. Hybridization of allele-specific probes with
amplified BF, C2 or CFH sequences can be performed, for example, on a nylon
filter.
Reverse dot-blotting may also be used. For example, a screen for more then one
polymoi-phism may be perfornied using a series of ASOs specific for each
polymorphic allele, spotted onto a single membrane which is then hybridized to
labeled PCR-amplified test DNA. These assays may range from manually-spotted
arrays of small numbers to very large ASO arrays on "gene chips" that can
potentially
detect large numbers of polymorphisms. Hybridization to a particular probe
undcr
high stringency hybridization conditions indicates the presence of the same
polymorphism in the tissue as in the allele-specific probe. Such a technique
can
utilize probes which are labeled with gold nanoparticles to yield a visual
color result
(Elghanian et al. (1997) Science 277:1078-81).
[0101] Allele-specific PCR amplification is based on a method called
amplification
refractory mutation system (ARMS) (Newton et at. (1989) Nucleic Acids Res.
17:2503-16). In this method, oligonucleotides with a mismatched 3'-residue
will not
function as primers in the PCR under appropriate conditions. Paired PCR
reactions
are carried out with two primers, one of which is a common primer, and one
that
exists in two slightly different versions, one specific for each polymorphism.
The
allele-specific primers are designed to be idcntical to the sequence of the
two alleles
over a region preceding the position'of the variant nucleotide, up to and
terminating in
the variant nucleotide itself. Therefore, if the particular polymorphism or
mutation is
not present, an amplification product is not observed. In general, additional
control
primers are used to amplify an unrelated sequence. The location of the common
primer can be designed to give products of different sizes for different
polymorphisms, so that the PCR products from multiplexed reactions form a
ladder
on a gel. The polymorphism-specific primers may be label with different
fluorescent
or other labels, or may be given 5' extensions of different sizes. This method
may be
adapted for use in real-time PCR.
[0102] In the oligonucleotide ligation assay (OLA), two oligonucleotides are
designed to hybridize to adjacent sequences in the target. The site at which
they join
is the site of the polymorphism. DNA ligase will join the two oligonucleotides
only if
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
they are perfectly hybridized (Nickerson et erl. (1990) Proc. Neitl. Accid.
Sci. U.S.A.
87:8923-7). The assay may use various formats, including ELISA analysis or a
fluorescence sequencher.
[0103] The technique of nucleic acid analysis using inicrochip technology may
also
be used. In this technique, potentially thousands of distinct oligonucleotide
probes are
built up in an array on a silicon chip. Nucleic acid to be analyzed is
fluorescently
labeled and hybridized to the probes on the chip. It is also possible to study
nucleic
acid-protein interactions using these nucleic acid microchips. Using this
technique
one can determine the presence of mutations or even sequence the nucleic acid
being
analyzed or one can measure expression levels of a gene of interest. The
method is
one of parallel processing of many, even thousands, of probes at once and can
tremendously increase the rate of analysis.
[0104] Alteration of BF, C2 or CFH mRNA expression can be detected by any
technique known in the art. These include Northern blot analysis, PCR
amplification
and RNase protection. Diminished mRNA expression indicates an altei-ation of
the
wild-type gene. Allele detection techniques may be protein based if a
particular allele
produces a protein with an amino acid variant. For example, epitopes specific
for the
amino acid variant can be detected with monoclonal antibodies. Alternatively,
monoclonal antibodies immunoreactive with BF, C2 or CFH can be used to screen
a
tissue. Lack of cognate antigen would indicate a mutation. Antibodies specific
for
products of mutant alleles could also be used to detect mutant gene product.
Such
immunological assays can be done in any convenient formats known in the art.
These
include Western blots, immunohistochemical assays and ELISA assays. Any means
for detecting an altered protein can be used to detect alteration of the wild-
type BF,
C2 or CFH gene. Functional assays, such as protein binding determinations, can
be
used. In addition, assays can be used which detect BF, C2 or CFH biochemical
function. Finding a mutant BF, C2 or CFH gene product indicates alteration of
a
wild-type BF, C2 or CFH gene.
Amplification of Nucleic Acid Molecules
[0105] The nucleic acid samples obtained from the subject may be amplified
from
the clinical sample prior to detection. In one embodiment, DNA sequences are
amplified. In another embodiment, RNA sequences are amplified.
31
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
[0106] Any nucleic acid amplification metliod can be used. In one specific,
non-
limiting example, polymerase chain reaction (PCR) is used to amplify the
nucleic acid
sequences associated with AMD. Other exemplary methods include, but are not
limited to, RT-PCR and transcription-mediated amplification (TMA), cloning,
polymerase chain reaction of specific alleles (PASA), ligase chain reaction,
and
nested polymerase chain reaction.
[0107] A pair of primers may be utilized in the amplification reaction. One or
both
of the primers can be labeled, for example with a detectable radiolabel,
fluorophore,
or biotin molecule. The pair of primers may include an upstream primer (which
binds
5' to the downstream primer) and a downstream primer (which binds 3' to the
upstream primer). The pair of primers used in the amplification reaction may
be
selective primers which permit amplification of a nucleic acid involved in
AMD.
[0108] An additional pair of primers can be included in the aniplification
reaction as
an internal control. For example, these primers can be used to amplify a
"housekeeping" nucleic acid molecule, and serve to provide confirmation of
appropriate amplification. In another example, a target nucleic acid molecule
including primer hybridization sites can be constructed and included in the
amplification reactor. One of skill in the art will readily be able to
identify primer
pairs to serve as internal control primers.
[0109] Amplification products may be assayed in a variety of ways, including
size
analysis, restriction digestion followed by size analysis, detecting specific
tagged
oligonucleotide primers in the reaction products, allele-specific
oligonucleotide
(ASO) hybridization, sequencing, hybridization, and the like.
[0110] PCR-based detection assays include multiplex amplification of a
plurality of
polymorphisms simultaneously. For example, it is well known in the art to
select
PCR primers to generate PCR products that do not overlap in size and can be
analyzed simultaneously. Alternatively, it is possible to amplify different
polymorphisms with primers that are differentially labeled and thus can each
be
detected. Other techniques are known in the art to allow multiplex analyses of
a
plurality of polymorphisms. A fragment of a gene may be amplified to produce
copies
and it may be determined whether copies of the fragment contain the pai-
ticular
protective polymorphism or genotype.
32
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Innmt.tn.cadetec:tion of'Protective Prc,teins
[0111) In one embodiment of the invention, a protein assay is carried out to
characterize polymorphisms in a subject's C2 or BF genes, e.g., to detect or
identify
protective proteins. Methods that can be adapted for detection of variant
proteins are
well known and include analytical biochemical methods such as electrophoresis
(including capillary electrophoresis and two-dimensional clectrophoresis),
chromatographic methods such as high performance liquid chromatography (HPLC),
thin layer chromatography (TLC), hyperdiffusion chromatography, mass
spectrometry, and various immunological methods such as fluid or gel
precipitin
reactions, immunodiffusion (single or double), immunoelecti=ophoresis,
radioimmnunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs),
immunofluorescent assays, western blotting and others.
[0112] For example, a number of well established immunological binding assay
formats suitable foi- the practice of the invention are known (see, e.g.,
Harlow, E.;
Lane, D. Antibodies: A laboratory manual. Cold Spring Harbor, N.Y.: Cold
Spring
Harbor Laboratory; 1988; and Ausubel et al., (2004) Current Protocols in
Molecular
Biology, John Wiley & Sons, New York NY. The assay may be, for example,
competitive or non-conpetitive. Typically, immunological binding assays (or
immunoassays) utilize a "capture agent" to specifically bind to and, often,
immobilize
the analyte. In one embodiment, the capture agent is a moiety that
specifically binds
to a variant C2 or BF polypeptide or subsequence. The bound protein may be
detected using, for example, a detectably labeled anti-C2/BF antibody. In one
embodiment, at least one of the antibodies is specific for the variant form
(e.g., does
not bind to the wild-type C2 or BF polypeptide.
[0113] Thus, in one aspect the method involves obtaining a biological sample
from
a subject (e.g., blood, serum, plasma, or urine); contacting the sample with a
binding
agent that distinguishes a protective and nonprotective form of C2 or BF, and
detecting the formation of a complex between the binding agent and the
nonprotective
form of C2 or BF, if present. It will be understood that panels of antibodies
may be
used to detect protective proteins in a patient sample.
[0114J The invention also provides antibodies that specifically binds a
protective
C2 or DF protein but does not specifically bind a wild-type polypeptide (i.e.,
a C2 or
33 --
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
BF protein not associated with protection). The antibodies bind an epitope
found in
only the protective form. For example, an antibody niay not bind a wild-type
BF
(encoded by Genbank Accession Nos. NM_001710; AAB67977) or C2 (encoded by
Genbank Accession Nos. NM_000063; NP_000054) but binds to a BF or C2 variant,
as described above (i.e., a protein having one of the polymorphisins described
herein
as being protective for AMD). For example, the antibody may recognize a BF
protein
having glutamine at position 32 or histidine at position 9 or a C2 with an
aspatric acid
at position 318.
[0115) The antibodies can be polyclonal or monoclonal, and are made according
to
standard protocols. Antibodies can be made by injecting a suitable animal with
a
protective protein or fragments thereof. Monoclonal antibodies are screened
according to standard protocols (Koehler and Milstein 1975, Nature 256:495;
Dower
et al., WO 91/17271 and McCafferty et al., WO 92/01047; and Vaughan et al.,
1996,
Nnture Biotechnology, 14: 309; and references provided below). Monoclonal
antibodies may be assayed for specific immunoreactivity with the protective
polypeptide, but not the corresponding wild-type polypeptide, using methods
known
in the art. For methods, including antibody screening and subtraction methods;
see
Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New
York (1988); Current Protocols in Immunology (J.E. Coligan et al., eds., 1999,
including supplements through 2005); Goding, Monoclonal Antibodies, Principles
and Practice (2d ed.) Academic Press, New York (1986); Burioni et al., 1998,
"A
new subtraction technique for molecular cloning of rare antiviral antibody
specificities from phage display libraries" Res Virol. 149(5):327-30; Ames et
al.,
1994, Isolation of neutralizing anti-C5a monoclonal antibodies from a
filamentous
phage monovalent Fab display library. J Immunol. l 52(9):4572-81; Shinohara et
al.,
2002, Isolation of monoclonal antibodies recognizing rare and dominant
epitopes in
plant vascular cell walls by phage display subtraction. J Irnnzunol Methods
264(1-
2):187-94. Immunization or screening can be directed against a full-length
protective
protein or, alternatively (and often more conveniently), against a peptide or
polypeptide fragment comprising an epitope known to differ between the variant
and
wild-type forms. Antibodies cati be expressed as tetramers containing two
light and
two heavy chains, as separate heavy chains, light chains, as Fab, Fab'
F(ab')2, and Fv,
34
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
or as single chain antibodies in which heavy and light chain variable domains
are
linked through a spacer.
Aniplifr`catiora of'Nuc=leic Acid Molecules
[0116] The nucleic acid samples obtained from the subject may be amplified
from
the clinical sample prior to detection. In one embodiment, DNA sequences are
amplified. In another embodiment, RNA sequences are amplified.
[0117] Any nucleic acid amplification method can be used. In one specific, non-
limiting exainple, polymerase chain reaction (PCR) is used to amplify the
nucleic acid
sequences associated with AMD. Other exemplary methods include, but are not
limited to, RT-PCR and transcription-mediated amplification (TMA), cloning,
polymerase chain reaction of specific alleles (PASA), ligase chain reaction,
and
nested polymerase chain reaction.
[0118]. A pair of primers may be utilized in the amplification reaction. One
or botli
of the primers can be labeled, for example with a detectable radiolabel,
fluorophore,
or biotin molecule. The pair of primers may include an upstream primer (which
binds
5' to the downstream primer) and a downstream primer (which binds 3' to the
upstream primer). The pair of primers used in the amplification reaction may
be
selective primers which permit amplification of a nucleic acid involved in
AMD.
[0119] An additional pair of primers can be included in the amplification
reaction as
an internal control. For example, these primers can be used to amplify a
"housekeeping" nucleic acid molecule, and serve to provide confirmation of
appropriate amplification. In another example, a target nucleic acid molecule
including primer hybridization sites can be constructed and included in the
amplification reactor. One of skill in the art will readily be able to
identify primer
pairs to serve as internal control primers.
[0120] Amplification products may be assayed in a variety of ways, including
size
analysis, restriction digestion followed by size analysis, detecting specific
tagged
oligonucleotide primers in the reaction products, allele-specific
oligonucleotide
(ASO) hybridization, sequencing, hybridization, and the like.
[0121] PCR-based detection assays include multiplex amplification of a
plurality of
polymorphisms simultaneously. For example, it is well known in the art to
select
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
PCR primers to generate PCR products that do not overlap in size and can be
analyzed simultaneously. Alternatively, it is possible to amplify different
polymoiphisms with primers that are differentiall=y labeled and thus can each
be
detected. Other techniques ai-e known in the art to allow multiplex analyses
of a
plurality of polymoiphisms. A fragment of a gene may be amplitied to produce
copies
and it may be determined whether copies of the fragment contain the particular
protective polymorphism or genotype.
Co rplenrent fae=tor H (CFH)
[0122] The CFH gene is located on chromosome Iq in a region repeatedly linked
to
AMD in family-based studies. Recently, threc independent studies have revealed
that
a polymorphism, a T-->C substitution at nucleotide 1277 in exon 9, which
results a
tyrosine to histidine change (Y402H) in the complement factor H gene makes a
substantial contribution to AMD susceptibility (Klein et al.. (2005) Scietzce
308:385-
389; Haines et al. (2005) Science.308:419-421; Edwards et crl. (2005)
Science.308:421-424). These studies reported odd ratios for AMD ranging
between
3.3 and 4.6 for carriers of the C allele and between 3.3 and 7.4 for CC
homozygotes.
Subsequently, this association was confirrned by two other studies (Zareparsi
et al.
(2005) Am. J. Huni. Genet. 77:149-153; Hageman et al.. (2005) Proc. Ncttl.
Acad. Sci.
U.S.A. 102:7227-7232). In one study, seven other common SNPs were found to be
associated with AMD in addition to the Y402H polymorphism (Hageman et al..
(2005) Proc. Natl. Acad. Sci. U.S.A. 102:7227-7232).
[0123] Pairwise linkage analysis showed that these seven polymorphisms were in
linkage disequilibrium and one common at-rislt haplotype with a set of these
polymorphisms were detected in 50% of cases versus 29% of controls [OR=2.46,
95%
CI'(1.95-3.11)]. Homozygotes for this haplotype were found in 24.2% of cases
and
8.3% of the controls. Also two common protective haplotypes were found in 34%
of
controls and 18% of cases [OR=0.48, 95% CI (0.33-0.69)] and [OR=0.54, 95% CI
(0.33-0.69)].
36
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Factor B cuid CvtaTplement Component 2
t0124] Activation of the alternative pathway is initiated by factor D-
catalyzed
cleavage of C3b-bound factor B (BF), resulting in the formation of the C3Bb
complex
(C3 convertase). This complex is stabilized by the regulatory protein
properdin,
whereas its dissociation is accelerated by regulatory proteins including CFH.
BF and
C2 are paralogous genes located only 500 bp apart on human chromosome 6p21. C2
functions in the classical complement pathway. These two genes, along with
genes
encoding complement components 4A (C4A) and 4B (C4B), comprise a
"complotype" (compleinent haplotype) that occupies approximately 100-120kb
between HLA-B and HLA-DR/DQ in the major histocompatibility complex (MHC)
class III region.
Clirrical Samples
[0125] Appropriate samples for use with the current disclosure in determining
a
subject's genetic predisposition to AMD include any conventional clinical
samples,
including, but not limited to, blood or blood-fractions (such as serum or
plasma),
mouthwashes or buccal scrapes, chorionic villus biopsy samples, semen, Guthrie
cards, eye fluid, sputum, lymph fluid, urine and tissue. Most simply, blood
can be
drawn and DNA (or RNA) extracted from the cells of the blood. Alteration of a
wild-
type BF, C2, and/or CFH allele, whether, for example, by point mutation or
deletion,
can be detected by any of the means discussed herein.
[0126] Techniques for acquisition of such samples are well known in the art
(for
example see Schluger et al. (1992) J. Exp. Med. 176:1327-33, for the
collection of
serum samples). Serum or other blood fractions can be prepared in the
conventional
manner. For example, about 200 L of serum can be used for the extraction of
DNA
for use in amplification reactions.
[0127] Once a sample has been obtained, the sample can be used directly,
concentrated (for example by centrifugation or filtration), purified, or
combinations
thereof, and an amplification reaction performed. For example, rapid DNA
preparation can be performed using a commercially available kit (such as the
InstaGene Matrix, BioRad, Hercules, CA; the NucliSens isolation kit, Organon
Teknika, Netherlands). In one example, the DNA preparation method yields a
37
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
nucleotide preparation that is accessible to, and amenable to, nucleic acid
amplification.
Microcrrruys
[0128] In particular examples, methods for detecting a polymorphism in the BF,
C2,
and/or CFH genes use the arrays disclosed herein. Such arrays can include
nucleic
acid niolecules. In one example, the array includes nucleic acid
oligonucleotide
probes that can hybridize to polymorphic BF, C2, and/or CFH gene sequences,
such
as those polymorphisnis discussed herein. Certain of such arrays (as well as
the
methods deseribed herein) can include other polymorphisms associated with risk
or
protection from developing AMD, as well as other sequences, such as one or
more
probes that recognize one or more housekeeping genes.
[0129] The arrays herein termed "AMD detection arrays," are used to deteranine
the
genetic susceptibility of a subject to developing AMD. In one example, a set
of
oligonucleotide probes is attached to the surface of a solid support for use
in detection
of a polymorphism in the BF, C2, and/or CFH genes, such as those amplified
nucleic
acid sequences obtained from the subject. Additionally, if an internal control
nucleic
acid sequence was amplified in the amplification reaction (see above), an
oligonucleotide probe can be included to detect the presence of this amplified
nucleic
acid molecule.
[0130] The oligonucleotide probes bound to the array can specifically bind
sequences amplified in an amplification reaction (such as under high
stringency
conditions). Oligonucleotides comprising at least 15, 20, 25, 30, 35, 40, or
more
consecutive nucleotides of the BF, C2, and/or CFH genes may be used.
[0131] The methods and apparatus in accordance with the present disclosure
take
advantage of the fact that under appropriate conditions oligonucleotides form
base-
paired duplexes with nucleic acid molecules that have a complementary base
sequence. The stability of the duplex is dependent on a number of factors,
including
the length of the oligonucleotides, the base composition, and the composition
of the
solution in which hybridization is effected. The effects of base composition
on
duplex stability may be reduced by carrying out the hybridization in
particular
38
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
solutions, for example in the presence of high concentrationti of tertiary or
quaternary
amines.
[0132] The thermal stability of the duplex is also dependent on the degree of
sequence similarity between the sequences. By carrying out the hybridization
at
temperatures close to the anticipated T,,,'s of the type of duplexes expected
to be
formed between the target sequences and the oligonucleotides bound to the
art'ay, the
rate of formation of mis-matched duplexes niay be substantially reduced.
[0133] The length of each oligonucleotide sequence elnployed in the array can
be
selected to optimize binding of target BF, C2, and/or CFH nucleic acid
sequences.
An optimum length for use with a pat-ticular BF, C2, and/or CFH nucleic acid
sequence under specific screening conditions can be determined empirically.
Thus,
the length for each individual element of the set of oligonucleotide sequences
including in the array can be optimized for screening. In one example,
oligonucleotide probes are from about 20 to about 35 nucleotides in length or
about
25 to about 40 nucleotides in length.
[0134] The oligonucleotide probe sequences forming the array can be directly
linked to the support, for example via the 5'- or 3'-end of the probe. In one
example,
the oligonucleotides are bound to the solid support by the 5' end. However,
one of
skill in the art can determine whether the use of the 3' end or the 5' end of
the
oligonucleotide is suitable for bonding to the solid support. In general, the
internal
complementarity of an oligonucleotide probe in the region of the 3' end and
the 5' end
determines binding to the support. Alternatively, the oligonucleotide probes
can be
attached to the support by non- BF, C2, and/or CFH sequences such as
oligonucleotides or other molecules that serve as spacers or linkers to the
solid
support.
[0135] In another example, an array includes protein sequences, which include
at
least one BF, C2, and/or CFH protein (or genes, cDNAs or other polynucleotide
molecules including one of the listed sequences, or a fragment thereof), or a
fragment
of such protein, or an antibody specific to such a protein or protein
fragment. The
.proteins or antibodies forming the array can be directly linked to the
support. =.
Alternatively, the proteins or antibodies can be attached to the support by
spacers or
linkers to the solid support.
39
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
[0136] Abnormalities in BF, C2, and/or CFH proteins can be detected using, for
instance, a BF, C2, and/or CFH protein-specific binding agent, which in some
instances will be detectably labeled. In certain examples, therefore,
detecting an
abnormality includes contacting a sample from the subject with a BF, C2,
and/or CFH
protein-specific binding agent=, and detecting whether the binding agent is
bound by
the sample and thereby measuring the levels of the BF, C2, and/or CFH protein
present in the sample, in which a difference in the level of BF, C2, and/or
CFH
protein in the sample, relative to the level of BF, C2, and/or CFH protein
fotind an
analogous sample from a subject not predisposed to developing AMD, or a
standard
BF, C2, and/or CFH protein level in analogous samples from a subject not
having a
predisposition for developing AMD, is an abnormality in that BF, C2, and/or
CFH
molecule.
[0137j In particular examples, the microarray material is formed from glass
(silicon
dioxide). Suitable silicon dioxide types for the solid support include, but
are not
limited to: aluminosilicate, borosilicate, silica, soda lime, zinc titania and
fused silica
(for example see Schena, Micronrruiy Anerlysis. John Wiley & Sons, Ine,
Hoboken,
New Jersey, 2003). The attachment of nucleic acids to the surface of the glass
can be
achieved by methods known in the art, for example by surface treatments that
form
from an organic polymer. Particular examples include, but are not limited to:
polypropylene, polyethylene, polybutylene, polyisobutylene, polybutadiene,
polyisoprene, polyvinylpyrrolidine, polytetrafluroethylene, polyvinylidene
difluroide,
polyfluoroethylene-propylene, polyethylenevinyl alcohol, polymethylpentene,
polycholorotrifluoroethylene, polysulfornes, hydroxylated biaxially oriented
polypropylene, aminated biaxially oriented polypropylene, thiolated biaxially
oriented
polypropylene, etyleneacrylic acid, thylene methacrylic acid, and blends of
copolymers thereof (see U.S. Patent No. 5,985,567, herein incorporated by
reference), organosilane compounds that provide chemically active amine or
aldehyde
groups, epoxy or polylysine treatment of the microarray. Another example of a
solid
support surface is polypropylene.
[0138] In general, suitable characteristics of the material that can be used
to form
the solid support surface include: being amenable to surface activation such
that upon
activation, the surface of the support is capable of covalently attaching a
biomolecule
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
such as an oligonucleotide thereto; amenability to "in situ" synthesis oi'
bioinolecules;
being chemically inert such that at the areas on the support not occupied by
the
oligonucleotides are not anienable to non-specific binding, or when non-
specific
binding occurs, such materials can be readily removed from the surface without
removing the oligonucleotides.
[0139] In one example, the surface treatment is amine-containing silane
derivatives.
Attachment of nucleic acids to an amine surface occurs via interactions
between
negatively charged phosphate groups on the DNA backbone and positively charged
aniino groups (Schena, Microan=ay Analysis. John Wiley & Sons, Inc, Hoboken,
New
Jersey, 2003, herein incorporated by reference). In another example, reactive
aldehyde groups are used as surface treatment. Attachment to the aldehyde
surface is
achieved by the addition of 5'-amine group or amino linkei- to the DNA of
interest.
Binding occurs when the nonbonding electron pair on the amine linker acts as a
nucleophile that attacks the electropositive carbon atom of the aldehyde
group.
[0140] A wide variety of array formats can be employed in accordance with the
present disclosure. One example includes a linear array of oligonucleotide
bands,
generally referred to in the art as a dipstick. Another suitable format
includes a two-
dimensional pattern of discrete cells (such as 4096 squares in a 64 by 64
array). As is
appreciated by those skilled in the art, other array formats including, but
not limited to
slot (rectangular) and circular arrays are equally suitable for use (see U.S.
Patent No.
5,981,185, herein incorporated by reference). In one example, the array is
formed on
a polymer medium, which is a thread, membrane or film. An example of an
organic
polymer medium is a polypropylene sheet having a thickness on the order of
about I
mm (0.001 inch) to about 20 mm, although the thickness of the film is not
critical and
can be varied over a fairly broad range. Particularly disclosed for
preparation of
arrays at this time are biaxially oriented polypropylene (BOPP) films; in
addition to
their durability, BOPP films exhibit a low background fluorescence. In a
particular
example, the array is a solid phase, Allele-Specific Oligonucleotides (ASO)
based
nucleic acid array.
(0141] The array formats of the present disclosure can be included in a
variety of
different types of formats. A "format" includes any format to which the solid
support
can be affixed, such as microtiter plates, test tubes, inorganic sheets,
dipsticks, and the
41
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
like. For example, when the solid support is a polypropylene thread, one or
niore
polypropylene threads can be al'fixed to a plastic dipstick-type clevice=,
polypropylene
membranc5 can be affixed to glass slides. The particular forniat is, in and of
itself,
unimportant. All that is necessary is that the solid support can be affixed
thereto
without affecting the functional behavior of the solid support or any
biopolymer
absorbed thereon, and that the format (such as the dipstick or slide) is
stable to any
materials into which the device is introduced (such as clinical samples and
hybridization solutions).
[0142] The arrays of the present disclosure can be prepared by a variety of
approaches. In one example, oligonucleotide or protein sequences are
synthesized
separately and then attached to a solid suppoi-t (see U.S. Patent No.
6,013,789, herein
incorporated by reference). In another example, sequences are synthesized
directly
onto the support to provide the desired array (see U.S. Patent No. 5,554,501,
herein
incorporated by reference). Suitable methods for covalently coupling
oligonucleotides and proteins to a solid support and for directly synthesizing
the
oligonucleotides or proteins onto the support are known to those working in
the field;
a summary of suitable methods can be found in Matson et crl. (1994) Anal.
Biochern.
217:306-10_ In one example, the oligonucleotides are synthesized onto the
support
using conventional chemieal techniques for preparing oligonucleotides on solid
supports (such as see PCT Publication Nos. WO 85/01051 and WO 89/10977, or
U.S.
Patent No. 5,554,501, each of which are herein incoiporated by reference).
[0143] A suitable array can be produced using automated means to synthesize
oligonucleotides in the cells of the array by laying down the precursors for
the four
bases in a predetermined pattern. Briefly, a multiple-channel autornated
chemical
delivery system is employed to create oligonucleotide probe populations in
parallel
rows (corresponding in number to the number of channels in the delivery
system)
across the substrate. Following completion of oligonucleotide synthesis in a
first
direction, the substrate can then be rotated by 90 to permit synthesis to
proceed
within a second (2 ) set of rows that are now perpendicular to the first set.
This
process creates a multiple-channel =array whose intersection generates a
plurality of
discrete cells.
42
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
[0144] In particular exatnpies, the oligonucleotide probes on the array
include one
or niore labels, that permit detection of oligonucleotide probeaarget sequence
hybridization complexes.
Kits
[0145] The present disclosure provides for kits that can be used to determine
whether a subject, such as an otherwise healthy human subject, is genetically
predisposed to AMD. Such kits allow one to determine if a subject has one or
more
genetic mutations or polymorphisms in BF, C2 or CFH gene sequences.
[0146] The kits contain reagents useful for determining the presence or
absence of
at least one polymorphism in a subject's BF, C2 or CFH genes, such as probes
or
primers that selectively hybridize to a BF, C2 or CFH polymorphic sequence
identified herein. Such kits can be used with the methods described herein to
determine a subject's BF, C2, or CFH genotype or haplotype.
[0147] Oligonucleotide probes and/or primers may be supplied in the form of a
kit
for use in detection of a specific BF, C2, or CFH sequence, such as a SNP or
haplotype described herein, in a subject. In such a kit, an appropriate amount
of one
or more of the oligonucleotide primers is provided in one or more containers.
The
oligonucleotide primers may be provided suspended in an aqueous solution or as
a
freeze-dried or lyophilized powder, for instance. The container(s) in which
the
oligonucleotide(s) are supplied can be any conventional container that is
capable of
holding the supplied form, for instance, microfuge tubes, ampoules, or
bottles. In
some applications, pairs of primers may be provided in pre-measured single use
amounts in individual, typically disposable, tubes or equivalent containers.
With such
an arrangement, the sample to be tested for the presence of a BF, C2, or CFH
polymorphism can be added to the individual tubes and amplification carried
out
directly.
[0148] The amount of each oligonucleotide primer supplied in the kit can be
any
appropriate amount, depending for instance on the market to which the product
is
directed. For instance, if the kit is adapted for research or clinical use,
the amount of
each oligonucleotide primer provided would likely be an amount sufficient to
prime
several PCR amplification reactions. Those of ordinary skill in the art know
the
amount of oligonucleotide primer that is appropriate for use in a single
amplification
43
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
reaction. General guidelines may for instance be found in Innis et al. (PCR
Protocols,
A Guide to Methods and Applications, Acadeniic Press, Inc., San Diego, CA,
1990),
Sambrook et ul. (In Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor,
New York, 1989), and Ausubel et al. (In Current Protocols in Molecular
Biology,
Greene Publ. Assoc. and Wiiey-Intersciences, 1992).
[0149] A kit may include more than two primers, in order to facilitate the in
vitro
amplification of BF, C2, or CFH-encoding sequences, for instance a specific
target
BF, C2, or CFH gene or the 5' or 3' flanking region thereof.
[0150] In some embodiments, kits may also include the reagents necessary to
carry
out nucleotide amplification reactions, including, for instance, DNA sample
preparation reagents, appropriate buffers (e.g., polymei-ase buffer), salts
(e.g.,
magnesium chloride), and deoxyribonucleotides (dNTPs).
[0151] Kits may in addition include either labeled or unlabeled
oligonucleotide
probes for use in detection of BF, C2, or CFH polymorphisms or haplotypes. In
certain embodiments, these probes will be specific for a potential polymorphic
site
that may be present in the target amplified sequences. The appropriate
sequences for
such a probe will be any sequence that includes one or more of the identified
polymorphic sites, such that the sequence the probe is complementary to a
polymorphic site and the surrounding BF, C2, or CFH sequence. By way of
example,
such probes are of at least 6 nucleotides in length, and 'the polymorphic site
occurs at
any position within the length of the probe. It is often beneficial to use
longer probes,
in order to ensure specificity. Thus, in some embodiments, the probe is at
least 8, at
least 10, at least 12, at least 15, at least 20, at least 30 nucleotides or
longer.
[0152] It may also be advantageous to provide in the kit one or more control
sequences for use in the amplification reactions. The design of appropriate
positive
control sequences is well known to one of ordinary skill in the appropriate
art. By
way of example, control sequences may comprise human (or non-human) BF, C2, or
CFH nucleic acid molecule(s) with known sequence at one or znore target SNP
positions, such as those described herein. Controls may also comprise non-BF,
C2, or
CFH nucleic acid molecules.
[0153] In some embodiments, kits may also include some or all of the reagents
necessary to carry out RT-PCR in, vitro amplification reactions, including,
for
44
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
instance, RNA sample preparation reagents (including for example, an RNase
inhibitor), appi-opriate btiffers (for example, polymerase buffer), salts (for
example,
magnesium chloride), and deoxyribonucleotides (dNTPs).
[0154] Such kits may in addition include either labeled or unlabeled
oligonucleotide
probes for use in detection of the in -iitro amplified target sequences. The
appropriate
sequences for such a probe will be any sequence that falls between the
annealing sites
of the two provided oligonucleotide primers, such that the sequence the probe
is
complementary to is amplified during the PCR reaction. In cer-tain
einbodiments,
these probes will be specific for a potential polymorphism that may be present
in the
target amplified sequences.
[0155] It may also be advantageous to provide in the kit one or more conti-ol
sequences for use in the RT-PCR reactions. The design of appropriate positive
control sequences is well known to one of ordinary skill in the appropriate
art.
[0156] Kits for the detection or analysis of BF, C2, or CFH protein expression
(such
as over- or under-expression, or expression of a specific isoform) are also
encompassed. Such kits may include at least one target protein specific
binding agent
(for example, a polyclonal or monoclonal antibody or antibody fragment that
specifically recognizes a BF, C2, or CFH protein, or a specific poly-noiphic
form of a
BF, C2, or CFH protein) and may include at least one control (such as a
determined
amount of target BF, C2, or CFH protein, or a sample containing a determined
amount of BF, C2, or CFH protein). The BF, C2, or CFH-protein specific binding
agent and control may be contained in separate containers. The antibodies may
have
the ability to distinguish between polymorphic forms of BF, CD and/or CFH
protein.
[0157] BF, C2, or CFH protein or isoform expression detection kits may also
include a means for detecting BF, C2, or CFH:binding agent complexes, for
instance
the agent may be detectably labeled. If the detectable agent is not labeled,
it may be
detected by second antibodies or protein A, for example, which may also be
provided
in some kits in one or more separate containers. Such techniques are well
known.
[0158] Additional components in specific kits may include instructions for
carrying
out the assay. Instructions will allow the tester to determine BF, C2, or CFH
expression level. Reaction vessels and auxiliary reagents such as chromogens,
buffers, enzymes, etc_ may also be included in the =kits. The instructions can
provide
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
calibration curves or charts to compare with the determined (for example,
experimentally measured) values.
[01591 Also provided are kits that allow diffet=entiation between individuals
who are
homozygous versus heterozygous fo-- specific SNPs (or haplotypes) of the BF,
C2, or
CFH genes as described herein. Examples of such kits provide the materials
necessary to perform oligonucleotide ligation assays (OLA), as described in
Nickerson et ct/. (1990) Proc. Natl. Acad. Sci. U.S.A. 87:8923-8927. In
specific
embodiments, these kits contain one or more microtiter plate assays, designed
to
detect polymorphism(s) in a BF, C2, or CFH sequence of a subject, as described
herein. Insti-uctions in these kits will allow the tester to determine whether
a specified
BF, C2, or CFH allele is present, and whether it is homozygous or
heterozygous. It
may also be advantageous to provide in the kit one or more control sequences
for use
in the OLA reactions. The design of appropriate positive control sequences is
well
known to one of ordinary skill in the appropriate art.
[0160] The kit may involve the use of a number of assay formats including
those
involving nucleic acid binding, such binding to filters, beads, or microtiter
plates and
the like. Techniques may include dot blots, RNA blots, DNA blots, PCR, RFLP,
and
the like.
[0161] Microarray-based kits are also provided. These microarray kits may be
of
use in genotyping analyses. In general, these kits include one or more
oligonucleotides provided immobilized on a substrate, for example at an
addressable
Iocation. The kit also includes instructions, usually written instructions, to
assist the
user in probing the array. Such instructions can optionally be provided on a
computer
readable medium
[0162] Kits may additionally include one or more buffers for use during assay
of the
provided array. For instance, such buffers may include a low stringency wash,
a high
stringency wash, and/or a stripping solution. These buffers may be provided in
bulk,
where each container of buffer is large enough to hold sufficient buffer for
several
probing or washing or stripping procedures. Alternatively, the buffers can be
provided in pie-measured aliquots, which would be tailored to the size and
style of
array included in the kit. Certain kits may also provide one or more
containers in
which to carry out array-probing reactions.
46
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
[0163] Kits may in addition include one or more containers of detector
molecules,
such as antibodies or probes (or mixtures of antibodies, mixtures of probes,
or
mixtures of the antibodies and probes), for detecting biomolecules captured on
the
array. The kit may also include either labeled or unlabeled control probe
molecules,
to provide for internal tests of either the labeling procedure or probing ot'
the array, or
both. The control probe molecules may be provided suspended in an aqueous
solution
or as a freeze-dried or lyophilized powder, for instance. The container(s) in
which the
controls are supplied can be any conventional container that is capable of
holding the
supplied form, for instance, microfuge tubes, ampoules, or bottles. In some
applications, control probes may be provided in pre-measured single use
amounts in
individual, typically disposable, tubes or equivalent containers.
[0164] The amount of each control probe supplied in the kit can be any
particular
amount, depending for instance on the market to which the product is directed.
For
instance, if the kit is adapted for research or clinical use, sufficient
control probe(s)
likely will be provided to perform several controlled analyses of the array.
Likewise,
where multiple control probes are provided in one kit, the specific probes
provided
will be tailored to the market and the accompanying kit. In certain
embodiments, a
plurality of different control probes will be provided in a single kit, each
control probe
being from a different type of specimen found on an associated array (for
example, in
a kit that provides both eukaryotic and prokaryotic specimens, a prokaryote-
specific
control probe and a separate eukaryote-specific control probe may be
provided).
[0165] In some embodiments of the current invention, kits may also include the
reagents necessary to carry out one or more probe-labeling reactions. The
specific
reagents included will be chosen in order to satisfy the end user's needs,
depending on
the type of probe molecule (for example, DNA or RNA) and the method of
labeling
(for example, radiolabel incorporated during probe synthesis, attachable
fluorescent
tag, etc.).
[0166] Further kits are provided for the labeling of probe molecules for use
in
assaying arrays provided herein. Such kits rnay optionally include an array to
be
assayed by the so labeled probe molecules.
[0167] The disclosure is illustrated by the following non-limiting Examples.
47
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
EXAMPLES
Example 1.
Materials ancl Methods
[0168] Subjects: Two independent groups of AMD cases and age-matched controls
of European-American descent over the age of 60 were used in this study. These
groups consisted of 350 unrelated subjects with clinically documented AMD
(mean
age 79.5 +/- 7.8) and 114 unrelated, control individuals (mean age 78.4 +/-
7.4;
matched by age and ethnicity) from the University of Iowa, and 548 unrelated
subjects with clinically documented AMD (mean age 71.32 +/- 8.9 years), and
275
unrelated, matched by age and ethnicity, controls (mean age 68.84 +/- 8.6
years) from
Columbia University. Subjects were examined by trained ophthalmologists.
[0169] Stereoscopic fundus photographs were graded according to standardized
classification systems as described in Hageman, 2005, supra; Bird et al..
(1995) Surv.
Ophthahnol. 39:367-74; and Klaver et al.. (2001) In.vest. Ophthal.iaiol. Vis.
Sci.
42:2237-41. Controls did not exhibit any distinguishing signs of macular
disease nor
did they have a known family history of AMD (stages 0 and I a). AMD subject
were
subdivided into phenotypic categories based on the classification of their
most severe
eye at the time of their recruitment. Genomic DNA was generated from
peripheral
blood leukocytes using QlAamp DNA Blood Maxi kits (Qiagen, Valencia, CA).
[0170] Studies were conducted under the protocols approved by the
Institutional
Review Boards of Columbia University and the University of Iowa. Informed
consent was obtained from all study subjects prior to participation.
[0171] Immunohistochemistry: Posterior poles were processed, sectioned and
labeled with antibody directed against factor Ba (Quidel), as described in
Anderson el
al. (2002)Am. J. Ophthal.mol. 134:411-31. Adjacent sections were incubated
with
secondary antibody alone, to serve as controls. Some immunolabeled specimens
were
prepared and viewed by confocal laser scanning rnicroscopy, as described
(Anderson
et al., 2002, supra). =
[0172] Mutation Screening and Analysis: Coding and adjacent intronic regions
of
BF and C2 were examined for variants using SSCP analyses, denaturing high
performance liquid chromatography (DHPLC) and direct sequencing. Primers for
SSCP, DHPLC and DNA sequencing analyses were designed to amplify each exon
48
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
and its adjacent intronic regions using MacVector software (San Diego, CA).
PCR-
derived amplicons were screened for sequence variation, as described in
Allikniets et
al. (1997) Science 277:1805-1807 and in Hayashi et al. (2004) Ophthalmic=
Genet.
25:1 1 1-9. All changes detected by SSCP and DHPLC were confirmed by
bidit-ectional sequencing according to standard pi-otocols.
[0173] Genotyping: Single nucleotide polymorphisms (SNPs) were discovered
through data mining (Ensembi database, dbSNP; Celera Discovery System) and
through sequencing. Assays for variants with greater than 10% frequency in
test
populations were purchased from Applied Biosystems as Validated, Inventoried
SNP
Assays-On-Demand, or submitted to an Applied Biosystems Assays-By-Design
pipeline. The technique employed was identical to that described in Hageinan
et al.,
2005, supra. Briefly, 5ng of DNA were subjected to 50 cycles on an ABI 9700
384-
well thermocycler, and plates were read in an Applied Biosystems 7900 HT
Sequence
Detection System.
[0174] Statistical Analysis: Genotypes were tabulated in Microsoft EXCEL and
presented to SPSS (SPSS, Inc.) for contingency table analysis as described in
Hageman et al.., 2005, suprec, and Klaver et al.., 2001, suprcr. Compliance to
Hardy7
Weinberg Equilibrium was checked using SAS/Genetics (SAS Institute, Inc.,
Cary,
NC), and all SNPs in both cases and controls survived a cut off of p<0.05. For
haplotype estimation we used snphap (written by David Clayton; Cambridge
Institute
for Medical Research, Cambridge, United Kingdom), downloaded from the
Cambridge Institute for Medical Research website http://www-
gene.cimr.cain.ac.uk/clayton/software/), SNPEM (Written by Dr. Nicholas Schork
and M. Daniele Fallin and obtained from D. Fallin), and PHASE version 2.11
(written
by Matthew Stephens; University of Washington, Seattle, WA, and available from
his
web site at www.stat.washington.edu/stephens/software.html). The haplotype
analysis strategy used was first to obtain haplotype estimates using the
Expectation
Maximization (EM) or Gibbs sampling algorithm, second, to identify htSNPs
representing a minimal informative set within a region of linkage
disequilibrium, and
third, to assess these for significant association with AMD. Linkage
disequilibrium
was assessed (not shown) using the graphical tools available at the Innate
Immunity
PGA website (www.innateimmunity.net). All p-values are two-tailed and X2
values
49
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
are presented as asymptotic significance. Overall type I error rates (a), were
retrospectively calculated using the method of Benjamini and Hochberg (1995)
J. R.
Stat. Soc. Ser. B 57:289-300 as implemented at the Innate Iminunity PGA
website
(https:/linnateimmunity.net/11PGA2/Bioinformatics/multipletestfdrform), and
were
below 2x 10-3.
[0175] Significant haplotypes were subjected to permutation testing in both
SNPEM
and PHASE. The protective SNP model drawn in Fig. 2A was presented to Exemplar
2.2 (available on the Sapio sciences website at http://www.sapiosciences.com)
and
statistically evaluated by that software for fitness against the three
datasets (Iowa,
Columbia and Combined) presented in Fig. 2B. Generation of the genetic
algorithm
(GA) derived model (shown as Fig. 2C) involved Exemplar software. The GA
options were set to: 1500 AND/OR models, of 15 iterations each, with a model
size
no larger than 5 (which permits 16 possible genotypes). Further details of the
genetic
algorithm implementation and significance testing are included as Example 2.
[0176] A Classification & Regression Tree Analysis was performed with the SPSS
version 14.0 statistical package with the appropriate module on the Columbia,
Iowa
and combined data recoded as with (+) or without (-) minor alleles. Models
were
automatically generated using each of the three datasets that incorporated
both CFH
and C2/BF loci as contributors to the dependent outcome.
Results
[0177] All 18 BF exons, including 50-80 bp of flanking intronic regions, were
analyzed initially by denaturing HPLC in approximately 90 AMD cases and 90
controls from a cohort ascertained at Columbia University. Seventeen sequence
variants, including eight missense changes, were identified and the L9H
(rs4151667)
and R32Q (rs641153) alleles were more frequent in controls than in cases
(Table 1).
Haplotype-tagging SNPs (htSNPs) within BF and its adjacent homolog C2 were
identified (Fig. 1) and genotyped in a Columbia University cohort comprised of
548
AMD cases and 275 controls. These analyses revealed four variants that were
significantly associated with AMD_ The L9H variant in BF, which was in nearly
complete linkage disequilibrium (LD) with the E318D variant in C2 (rs9332739),
was
highly protective for AMD (X2=13.8 P=0.00020, OR=0.37 [95%CI=0.18-0.60]). The
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
R32Q allele in BF was in nearly complete LD with the rs547154 SNP in intron 10
of
C2, and was also highly protective (X2=33.7, P=6.43X 10-9, OR=0.32 [95%C1=0.21-
0.48] ).
[0178] Genotyping of an independent cohort of 350 cases and 114 controls fronz
the
University of Iowa confirmed these findings. For example, the C2 E318D/BF L9H
SNP pair was significantly associated with AMD in this cohort (X2=10.6,
P=0.0012,
OR=0.34 [95%CI=0.18-0.671. To analyze haplotypes across the C2 and BF loci,
the
data from the two cohorts were combined (Table 2). The common haplotype (H1,
Fig. 1) conferred a significant risk for AMD (X2= 10.3, P=0.0013, OR= 1.32
[95%CI=l.1-1.6]). The haplotype tagged by the BF R32Q SNP (1-17), compared to
all
other haplotypes, was highly protective for AMD (X2=26.9, P=2.1 X 10-7,
OR=0.45
[95%CI=0.33-0.61] and the C2 E318D/BF L9H-containing haplotype (H 10) was also
significantly protective (X2=21.6, P=3.4X10-6, OR=0.36 [95%CI=0.23-0.56])
(Fig.
1). The H I haplotype, when employed as the reference haplotype, produced
slightly
more significant results for H7 (X2=29.6, OR=0.42 (0.32-0.58)) and for H 10
(X2=24.9 OR=0.33 [0.21-0.52)). Analysis with the SNPEM program also
demonstrated that the same haplotypes were significantly associated with the
disease,
confirining the hypothesis that alleles in the C2 and/or BF gene are
predictive of risk
for AMD. Individuals with the two protective haplotypes (either homozygous for
H7,
H10, or 7/10 compound heterozygotes) were found in 3.4% of the controls, but
in
only 0.77% of the cases (X2= 12.2, P=0.00048, OR=0.22 [0.087-0.56]). The odds
ratio of subjects with two protective alleles was approximately half of that
of the
subjects with one protective allele, consistent with a co-dominant model.
[0179] The observed associations were highly significant when the entire AMD
subject cohort was compared to controls, or when major subtypes of AMD,
including
early AMD (eAMD), choroidal neovascularization (CNV) and geographic atrophy
(GA), were analyzed separately. The GA group (a total of 133 subjects froin
the 2
cohorts) deviated from the general trend in some cases, similar to our
observations
related to CFH (Hageman et al., 2005, supra). Specifically, the haplotype
tagged by
the R32Q allele demonstrated the strongest protection against the disease - OR
was
0.22 when the GA group was compared to controls vs. 0.45 when the rest of AMD
samples were subjected to the same analysis. Although this deviation may be
51
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
significant in terms of varying etiology of the disease, it did not reach
statistical
significance (the confidence intervals overlapped), most likely due to the
small
number of GA cases.
[0180] Combined analyses were initially performed by stratifying the subjects
according to status at the CFH Y402H allele. Protection conferred by C2/BF was
strongest in CFH 402H homozygotes (OR=0.27), interinediate in 402H/Y
heterozygotes (OR=0.36), and weakest in 402Y homozygotes (OR=0.44). However,
the confidence intervals of all these estimates overlapped. The effect was
principally
due to a trend in which the frequency of C2/BF protective alleles was greatest
in
402H hornozygotes (the "risk" genotype); 40% of these subjects in the control
cohort
carried at least one protective allele. In contrast, controls that were 402H/Y
or 402Y
had progressively lower frequencies of C21BF protection (32% and 26%
respectively). In other words, individuals at high risk due to their CFH
genotype,
who did not develop AMD, have a high frequency of protective allele(s) at the
C2/BF
locus.
[0181] To identify possible combinations of CFH and C2/BF SNPs that are
protective for AMD, as suggested by the individual SNP analysis, the analyses
of the
available data was performed by two means; first by an empirical hand-built
model
and then by a machine-learned model using the Exemplar software (Fig. 2). The
first
model was a hypothesized (hand-built) model, as one would create by an
empirical
inspection of the data (Fig. 2A). The model description is provided as panel
A, and is
interpreted as giving four possible combinations of genotypes that would
protect from
AMD (combinations that result in the model being "true"). When this model was
applied against the samples, the distributions shown in panel B were obtained
separately for each cohort and for the combined cohorts (Fig. 2B). The case
percentage is the percentage of cases for which the model was false; in other
words,
they did not have protection as described by the model. The control percentage
is the
percentage of controls that did have the protective factors described by the
model,
meaning the model was true. These distributions were subjected to significance
testing by Fisher's exact test and evidenced p-values of P=0.00237, P=4.28X10-
8 and
P=7.90X10-10, respectively. Following this, the Exemplar software was tasked
to
generate a protective model that provided a "best fit" to the data using a
machine-
52
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
iearning method called Genetic Algorithms; i.e., we tested the hypothesis that
the
machine-lezu=ning software can outperform the hand-built model. Models were
learned on the Columbia cohort; the resulting fittest models were retained and
then
applied to the Iowa cohort as a verification test (out-of-sample verification)
on an
independent cohort. Finally, the models were applied to the combined sample
set.
The resulting best performing niodel is depicted in Fig. 2C. This model
describes
four possible individual (or coinbinations of) genotypes that would protect
from AMD
(i.e. combinations resulting in the model being "true"). The model performance
is
shown in Fig. 2D for the Iowa, Columbia, and combined cohorts, respectively.
These
distributions were subjected to significance testing by Fisher's exact test
and
evidenced p-values of P=7.49X 10-s, P=2.97X 10"2' and P=1.69X 10'21,
respectively.
The method was further validated by randomizing the case and control
designations
and performing 3000 permutations of the dataset. The actual data was more
significant than any of these
permutations.
[0I82] In summary, combined analysis of these haplotypes with the variation in
CFH by the Exemplar software revealed that 56% of unaffected controls harbor
at
least one protective CFH or C2/BF haplotype, while 74% of AMD subjects lack
any
protective haplotype at these loci. Tnspection of the data shows that
approximately
60% of the risk in cases and 65% of the protection of controls is due to the
effect of
the CFH locus, and the remainder (40% and 35%, respectively) to the C21BF
locus.
The machine-Iearned model outperformed the hand built model, allowing for
significantly better predictions of a clinical outcome. A classification and
regression
tree (C&RT) analysis provided results that support the role of C21BF in AMD,
producing similar trees as did the Genetic Algorithm analysis. Using the
Columbia
dataset alone, the C&RT model accounts for 37% of cases through C2IBF allele
presence, using Iowa, 36%, and the combined analysis produced a slightly
weaker
effect of 27 %. These estimates are all consistent with the 35-40% estimated
contribution of the C2/BF locus from the genetic algorithm analysis. The
detailed
description of the methods and specific analyses are provided in the Example
2.
[0183] BF and C2 are expressed in the neural retina, RPE, and choroid. PCR
amplicons of the appropriate sizes for BF and C2 gene products were detected
from
53
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
isolated RPE, the RPE/choroid complex, and the neural retina, from hunian
donor
eyes with (two donors aged 67 and 94) and without (two donors aged 69 and 82)
AMD (data not shown). BF protein was present in ocular drusen, within Bruch's
membrane, and less prominently in the choroidal stroma (Fig. 3A). Ba (a BF-
derived
peptide) immunoreactivity was less pronounced, but distinctly present in
patches
associated with RPE cells and throughout Bruch's nzembrane (Fig. 3B). The
distribution of BF is similar to that of C3 (Fig. 3C), both of which are
essentially
identical to that of CFH and C5b-9 (Hageman et al.., 2005, sarpra).
[0184] In summary, these data show that variants the complement pathway-
associated genes C2 and BF are significantly associated with AMD. Protective
haplotypes in the C2/BF locus contain nonsynonymous SNPs in the BF gene, an
important activator of the alternative complement pathway. Available data
confirms
the hypothesis that the AMD phenotype may be modulated by abnormal BF
activity.
Indeed, the BF protein containing glutamine at position 32 (resulting from one
of the
two BF SNPs tagging a protective haplotype), has been shown to have reduced
hemolytic activity compared to the more frequent arginine 32 form (Lokki and
Koskimies (1991) Immunogenetics 34:242-6). The same study did not document a
functional effect for the R32W variant, which was not associated with AMD in
the
current study. Based on these data, we suggest that an activator with reduced
enzymatic activity provides a lower risk for chronic complement response that
can
lead to drusen formation and AMD. This hypothesis is compatible with our
previous
proposal that insufficient inhibition of the alternative complement cascade
due to
variation in CFH results in chronic damage at the retinal pigment
epithelium/Bruch's
membrane interface (Hageman et al., 2005, supra; Anderson, 2002, supra;
Hageman,
2001, supra). Another BF htSNP, L9H, resides in the signal peptide. While the
functional consequence of this variant has not been directly demonstrated,
this variant
could modulate BF secretion.
[0185] The genetic and functional data suggests that variation in BF is likely
causal
for the observed association with AMD. This is based on the fact that the two
haplotype-tagging variants in BF are non-conservative and one of the two is
documented to have a direct functional relevance (a reduced hemolytic
activity),
whereas the variants in C2 are a conservative change and an intronic SNP. In
54
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
addition, BF participates direc'tly in the alternative pathway, a pathway that
also
involves CFH. A direct role cannot be ruled out for C2, however, particularly
since
both C2 and BF regulate the production of C3. C2 and BF have nearly identical
modular structures, including sei=ine protease domains within their carboxy
teirmini
and three CCP modules within their amino termini. Additional support for BF
being
the gene involved in pathogenesis of AMD comes froin studies of drusen
composition. While the majority of proteins involved in the alternative
pathway
(CFH, BF, etc.) are found in drusen, their analogs from the classical pathway,
such as
C2 and C4, are not (Mullins et al. (2000) Faseb J. 14:835-46; Crabb et crl.
(2002)
Proc. Ncitl. Accid. Sci. U.S.A. 99:14682-7). These data further suggest that
the SNPs
iri C2 gene are associated with AMD due to extensive LD with BF.
[0186] Several coinmon functional variants in both C2 and BF have been
described
(Davis and Forristal (1980) J. Lab. Clin. Med. 96:633-9; Raum et al. (1979)
A1n. J.
Hi.int. Genet. 31:35-41.; Alper et al. (2003) J. Clin. Inununol. 23:297-305),
but most
of these are rare. All misseiise alleies with frequencies greater than 2% in
European
populations as judged from the re-sequencing data on both genes available at
the
SeattleSNPs project website (www.pga.mbt.washington.edu/) have been analyzed.
Moi-eover, no additional nonsynonymous variants in either gene have been found
after
complete sequencing of several HLA haplotypes, including examples of our
haplotypes H2 , H5, and H7 (Stewart et al. (2004) Genoine Res. 14:1176-87).
[0187] Because C2 and BF reside in the HLA locus together with many other
genes
involved in inflammation, one must consider the possibility that the
associations
observed in this study are due to LD with adjacent loci (Larsen and Alper
(2004)
Curr., Opin. Immunol. 16:660-7). Five lines of evidence, however, suggest that
the
C2/BF locus is the main contributor to the observed association. First, only
modest
LD between C21BF and adjacent class III loci is observed in HapMap data.
Second,
MHC class II loci and BF haplotypes H7 and H10 do not show strong LD. Third,
in a
whole genome scan performed by Klein et al. (2005) Science 308:385-9, the MHC
locus did not demonstrate a statistically significant association with AMD.
Their
analysis, performed with the Affymetrix Mapping 100K Array, included 80 SNPs
across the MHC locus; however, the array did not contain any of the 8 SNPs
typed in
this study (https://www.affymetrix.com/analysis/netaffx/index.affx). Fourth,
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
cstiinatcd recombination rates from HapMap data indicate regions of high
recombination on both sides of the C21BF locus (Myers et al. (2005) Science
310:321-
324). Finally, the single published study on MHC in AMD demonstrates modest
protection for tlie class I locus Bk4001 (P=0.027) and the class Il locus DRB
1'r 1301
(P=0.009) (Goverdhan et a!. (2005) Invest. Onhlhtrlrnnl. Vis. Sci. 46:1726-
34). Since
the protective alleles identified in this study were associated with AMD at a
substantially higher statistical significance it is very unlikely that the
C21BF
association is due to LD with these and/or other loci in the MHC.
Table 1. Sequence variants in the BF gene detected by DHPLC screening.
Nucleotide Amino Acid Allele Frequency in Cases
Exon Changes Changes AMD Total N GA E Controls
1 c.26 T>A L9H 18/1092 10/546 2/178 6/368 23/546
2 c.94 C>T R32W 109/1096 52/546 20/182 37/368 55/550
2 c.95 G>A R32Q 44/1096 21/546 4/182 19/368 61/550
3 c.405 C>T Y135Y 1/184 1/184 0/184
4 c.504 G>A P168P 4/184 4/184 6/184
4 c.600 C>T S200S 0/184 0/184 2/184
c.673 C>T Y252Y 2/184 2/184 5/184
5 c.754 G>A G252S 7/184 7/184 6/184
6 c.897+17C>A 2/184 2/184 1/184
8 c.1137 C>T R379R 1/184 1/184 0/184
9 c.1169-35T>A 1/184 1/184 0/184
12 c.1598 A>G K533R 3/184 3/184 9/184
14 c.1693 A>G K565E 9/182 9/182 4/184
14 c.1697 A>C E566A 9/182 9/182 4/184
c.1856-14C>T 13/182 13/182 21/184
15 c.1933 G>A V6451 1/182 1/182 0/184
18 c.*23 C>T 4/182 4/182 7/182
56
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Table 2. Association analysis of C2/I3F variants in combined Columbia and Iowa
cohorts
#
Gene dbSNP# Location # Cases Controls X2 P OR 95%Cl
C2 rs9332739 E318D 897 381 21.2 4.14E-06 0.36 0.23-0.56
C2 rs547154 IVS 10 894 382 28.7 8.45E-08 0.44 0.33-0.60
BF rs4151667 L9H 903 383 21.3 3.93E-06 0.36 0.23-0.56
BF rs641153 R32Q 551 269 33.7 6.43E-09 0.32 0.21-0.48
BF rs1048709 R150R 892 381 0.12 NS
BF rs4151659 K565E 902 384 1.1 NS
BF rs2072633 IVS 17 893 379 4.05 0.044 0.84 0.70-0.99
Example 2. Exeinplar Statistical Methods -
[0188] Sapio Sciences collaborated with the NCI to analyze genotyping data.
The
NCI provided -1360 total samples with 10 bi-allelic SNP's genotyped. The data
was
presented to Sapio with numeric representations of alleles. A script was
written to
convert the data to Exemplar-friendly format, by converting the alleles to
genotype
numeric representations ("l l" became "I" for AA, "1 2" became "2" for AB and
"2
2" became "3" for BB, "0 0" was a nocall and was converted to "0") and to
dedup
the samples. The phenotype was age-related macular degeneration (AMD). There
were several subclasses of AMD identified, but for this analysis the data was
used as a
whole to determine if there was a common genotype underlying the various AMD
phenotypes.
[0189] Sapio Sciences utilized its Exemplar Genotyping Analysis Suite to
analyze
the supplied data. Exemplar performs several association based analyses for
case-
control studies. The modules utilized for the analysis were:
= Genetic Algorithm Module (GA Module) - This module implements a
machine learning approach to finding logical combinations of SNP's (models)
based
studies.
= Association Study Module (AS Module) - This module calculates many
useful statistics like Chi Square, Yates, Fisher Exact,=Odds Ratio, Relative
risk,
Linkage Disequilibrium, D', r2 and Haplotype Estimates.
57
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
[0190] Exemplar typically finds models correlating with a phenotype. In other
words, the models predict the factoi:5 contributing to getting the phenotype,
not to
protection froni it, although protective factors can be inferred from the
models. For
example, if` a modet indicates that samples having...RSOOI as BB OR RS001 as
AB...correlate with having the phenotype, then it can be inferred that those
with
RS001 as AA are protected fronl the phenotype.
[0191] Exemplar models are logical combinations of SNP's. The models can be
hand-built to test hypothesis, or the Genetic Algorithni can be utilized to
attempt to
find
anodels with high utility. Genetic Algorithms are a machine learning method
that
excels at finding patterns within large data spaces. The GA utilizes the two-
thirds,
one-third, validation m`ethod. This is accomplished by randomly assigning 2/3
of the
cases and controls to the training set. The GA then learns models on this
training
set. When it completes the learning phase, it applies the best performing
models to
the test set (the remaining 1/3 of data). The best performing models across
test and
training are returned to the user. In this study, even though only a small
number of
SNP's were being interrogated, the large number of samples made it difficult
for a
human to effectively discern patterns that would be applicable across all the
data. For
this reason, the GA was utilized to find more complex patterns with higher
utility.
The benefit of these types of models over traditional approaches is in their
ability to
incorporate multiple loci from across the genome in making a prediction. This
enables one model to identify what is often a complex interaction of
polymorphisms
that correlate with outcomes.
[0192] This study was unique in that its focus was on finding models that were
protective against AMD. As this deviates from the normal Exemplar approach of
finding additive models, a change had to be made to the input data. By simply
instructing Exemplar that the cases were controls, and vice versa, it would
then learn
models that demonstrated why a sample would not get the phenotype. In other
words,
it would be finding the combinations of SNP's that conferred protection.
[0193] Study Group information: Data was provided from two separate cohorts,
the
Iowa cohort and the Columbia cohort. The Columbia data was a larger group with
about 830 total samples of which 560 were cases and 270 were controls. The
Iowa
58 '
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
cohort had about 529 total samplcti with 414 cases and 1 15 controls. Having
two
sample groups allowed model building to be done with the GA Module on one
cohoi-t
and the efficacy of the resultant models out-of-sample to be tested on the
remaining
cohort.
[0194] Study Results: Multiple statistics were generated for each SNP/genotype
in
the input dataset. Statistics were generated by building 2 x 2 contingency
tables and
doing proper counts of genotypes (Note that this is not allele counts, but
genotype
counts where the two genotypes not being calculated are collapsed into one
value).
The values for each cell of the 2 x 2 table are provided in the tables under
the
headings Case True, Case False, Control True, Control False. All statistics
were two-
tailed calculations.
[0195] Tables 3 through 6 show statistics on the Iowa and Columbia cohort side
by
side. NOTE: The "Category" column is the genotype where: I corresponds to AA,
2
to AB and 3 to BB. Table 7 shows statistics for the combined cohorts.
Table 3. Columbia and Iowa Side-By-Side Chi Square Statistics
U . . ..:... .:. . ... .: o ~. ~, . . 5 .~. _
..:Ca 'c = ==8coro Square
=='.Controlr.{Connol, ' ,= . ? ...... = =,;t: ~Caao; , -
Coae,::~>.=Cont;ol;Y~"Cotttrpta.
~''-=SHP: IeD ry~~ ~?..'. . . . . ~ ,. i ' ' `'5~.. ~..= . Y;.
' ... ,.,t Ttua .=,'Falsa =, iruo , , . Fbtsa :. = ...., _,r'.'=.. *S,
=.~Y,,:,,.._ . ~. 7nio .: =: F6lso'.:' ~:Tiuo<a~..tFb K`a
RS1061147 = ==, 3 58.05 110 433 121 141 ,=RS1061t70 3 34.46 64 287 =52 62
5181061170 3 53=45 114 432 120 142 1151061147 3 33.75 65 28? 52 62
R51061147 1 34,62 160 383 28 234 5151061170 1 23.27 127 224 14 100
RS1061170 1 28.19 150 369 33 229 5101061147 I 23.11 127 225 14 100
RS537154 1 25.84 601 47 212 57 INDELTT 3 12.22 269 70 69 41
RS547154 2 20.63 43 605 50 219 5150332739 I 9.31 334 19 98 W.
1NDELT7 3 20.56 413 143 158 111 5154151667 I 8.59 335 20 98 16
INDELiT 1 1921 7 549 18 251 114DELT1 I 8.29 6 332 8 102
RS4151667 1 11.85 632 18 246 24 5109332739 2 7.72 19 334 15 99
R52072633 3 11.61 56 485 $1 218 R54151667 2 7.07 20 335 16 00
1159332739 1 10.86 527 19 243 24 1NDE1.T[ 2 5.98 64 274 33 77
5154151667 2 10.58 t8 532 23 246 RS547164 1 2.49 304 44 02 21
5159332739 2 9.65 10 527 23 244 110647154 2 2.06 43 306 20 93
INDELTT 2 9.24 136 420 93 176 5151049709 2 1.86 103 250 41 73
1151061170 2 5.23 274 272 10.4 t53 1151561170 2 0,42 760 191 48 66
51S1061147 2 3.62 273 270 113 149 5101061147 2 0.39 160 102 48 66
RS3753396 3 3.48 8 Stt 9 250 5151048709 1 0.31 '..'30 123 71 43
14*2072071 1 1.93 245 296 109 1E0 H59103396 1 0.15 238 04 80 30
1153763396 1 1,61 403 146 179 80 1102072633 1 0.09 121 233 36 74
5152872633 2 1.08 240 301 109 160
5104151659 2 0.22 22 527 9 260
1151048709 1 0=02 412 129 202 66
59
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Table 4. Columbia and Iowa Side-By-Side Chi Square Yates Statistics
.., Cue ='.Can4 :' = GoMr. ? orit " ' " = nv . a'se =;::iCorqro i~' ' ontr
:.SRP ==;~Gt~gory ' Seari == 3NP = ' Caagory = ~ Saun ' 'Truo Fals~== Ttuu: ;
".Fals~ - = 'Trw Fa164 ' = True" =.=. FbLw.'
YRS7001147 3 58.79 110 433 121 141 R51061170 3 33.01 64 ^c87 52 62
R51061170 3 52.25 114 432 120 142 RS1061147 3 32.32 65 287 52 62
R51061147 1 33.78 160 363 28 234 RS1081170 1 22.15 127 224 14 I(q
RS1061170 t 25?0 158 388 33 229 R51081147 1 22.00 127 225 14 100
= R5547154 1 24J2 501 47 212 57 INDELT7 3 1).34 268 70 69 41
INDELTT 3 1904 413 143 158 111 RS9332739 1 0.10 334 19 98 16
R5547164 2 19.58 43 505 59 219 RS4151667 1 7.45 335 20 96 16
INDELTT 1 t6.41 7 549 18 251 RS0322729. 2 6.61 t9 334 15 99
RS2072633 3 10.87 56 485 51 218 INDELTT 1 6.57 6 332 8 102
RS4161667 I 10=72 532 18 245 24 RS4151667 2 6.03 20 335 15 99
RS9332739 I 9.79 527 19 243 24 INDELTT 2 536 64 274 33 77
R54151667 2 9.50 18 532 23 246 RSI048709 3 Z13 2D 333 2 112
INDELTT 2 675 136 420 93 176 RS547154 1 2.02 304 44 92 21
RS9332739 2 663 19 527 23 244 RS517154 2 1.64 43 305 20 93
R51001170 2 4.09 274 272 109 153 RS1048709 2 1.56 103 250 41 73
885537154 3 3.46 4 544 7 262 RS4151659 1 1.21 343 12 114 1
8851061147 2 3.34 273 270 113 149 RS4151659 2 1,21 12 343 1 114
8853753396 3 2.57 B 541 9 260 RS1061170 2 0.29 160 191 48 Co
8852072533 1 1.47 245 296 109 160 R51061147 2 0.27 160 192 40 65
R53753396 1 1.40 403 146 179 80 891048709 t 0.20 230 123 71 43
R32072633 2 0.93 240 301 109 160 RS3753396 I 00a 258 04 80 32
R54151059 2 0.97 22 527 9 260 8S2072633 1 0.03 121 233 36 74
R51048709 1 000 4t2 129 202 6!'i 8851061170 3 39,01 64 287 52 62
Table 5. Columbia and Iowa Side-By-Side Fishers Exact Statistics
.:
00~~....r;Y:=A t ~ .. . . .1 CBSar ~ Cps4,~,y itolfis~rCOmtbl `=''" ' '
::l:i~` S Ss,~COttlrol ^'y.CoeV k-.rSHpraC tagnn!,~=s<_P=Va1va . f,T'tuo,
~Frta ri<~'=:T~rue-ill=<:.=C-ai~o . SNP~'~ Ciats9orY:~=.~ PY6fuC:.'S'r T~=nn,
¾~:FA~Ibe~' a:i7rw~n'. ... 1'
RS19611i7 3 1=11E=13 1i0 433 121 141 R31081170 9 = 1.56E 08 64 267 'S2 62
RS1061170 3 6.32E=13 114 432 120 142 8851081147 3 2.13E=08 65 287 52 62
8851061147 1 5.33E-10 160 303 28 234 RS1tY.1170 1 323E=07 127 224 14 100
R61061170 1 857E-08 158 368 33 2'N. R51001117 1 3.52E=07 127 225 14 loo
RS547154 I 6.79E=07 50t 47 212 57 INDELTT 3 5.12E=04 268 70 69 41
INDELTT 3 5.26E-06 413 143 158 111 859332739 1 0.0034399 3134 19 98 16
R554/154 2 8,45E-06 43 505 50 2i9 8854151667 1 0.0046824 335 20 98 16
INDELTT I 4.89E=05 7 540 18 251 8859332739 2 00070934 19 334 15 99
RS2072633 3 6.155.04 56 485 51 218 INDELTI 1 0.0082008 6 332 B 102
RS4151667 1 7.59E-04 532 IB 245 24 R54151867 2 0,0094281 20 335 t5 09
859332739 1 0.001202 527 69 243 24 INDELTT 2 0.0116306 64 274 33 77
RS4151667 2 0.00t399 /8 532 23 246 851048709 3 0,0636773 20 333 2 112
INDEL7T 2 0.001690 136 420 93 176 R5547154 I 0.0500174 304 44 02 21
8859332739 2 0.002166 18 527 23 244 RS547164 2 0.1022405 43 305 20 93
RS1061170 2 0.0113402 274 272 109 153 8S1048709 2 0.1067809 103 260 41 73
RS1081147 2 0,033770 273 270 113 149 R54151059 1 0.1321014 343 12 114 1
R5547164 3 0.035149 4 544 7 262 RS4151659 2 0,1321014 12 343 1 114
RS3753396 3 0.058108 8 541 9 250 R54151667 3 0,2430704 0 355 1 113
8520721533 I 0.112603 245 296 109 160 hS9372739 3 0.2441113 0 353 1 113
853753300 1 0.118293 493 146 179 BO 851061170 2 0.2949213 160 191 48 66
1152072633 2 0.167401 240 301 109 160 881061147 2 0,3032103 160 192 40 66
RS9332739 3 0.328413 0 546 I 266 861040709 1 0.3266887 230 123 71 43
1*54151667 3 0.328440 0 550 1 268 R53753396 1 0.3921321 258 94 80 22
R94161659 2 0.401117 22 627 0 260 8S2072633 1 0.436606f 121 233 36 74
RS1048709 1 0.470495 412 129 202 65 86SIt761170 3 1.56E-08 64 287 52 62
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Table 6. Columbia and Iowa Side-By-Side Odds Ratio Statistics
.. = ..= =
_ ~ ' ont ' ' ma = .' r Corb . mr =
4COas . Cose . ".` Coni SN7 Cts9ory=: et nl
6N? =. =' C"t!g'ory . Sto ~ 9cor~
.. .. .' Truc Felsv = 7~uo Foho 7rue Fo6e ' Tiuc=.. . Fals~
RS1061147 1 3.491 160 383 28 234 R51061170 I 4.050 127 224 14 100
RS4151667 1 2.895 532 t8 245 24 RS1061147 1 4032 127 225 14 100
4t~sfii `Sdtt'~'""s~'=~" ~Q~ ?=2;bG6,K. 501 47 212 57 RSit51659 2 3980 12 343
1 114
1d1i:.Y~.~t.'r.U~..tt'i~. . .- ~.= . ~
RS1061170 1 2,826 ISO 388 33 229 RS1048709 3 3363 20 333 2 112
RS0332739 1 2.739 527 M. 243 24 RS9332739 1 2870 334 19 98 16
INDELTT 3 2.029 413 143 158 111 RS4151667 t 2.735 335 20 98 1E
RS1001170 2 1.414 274 272 109 163 INDEL17 3 2.275 268 70 69 41
RS1061147 2 1.333 273 270 113 149 R5647,Y~54tj jM1i~ d17t'~4 ~ .1'577r t`; 304
44 92 21
'~`W!~=`~'=L`':t::N:= . '`fL~ . . a~i=
RS3753398 1 1 294 403 146 179 80 RS1061170 2 1 152 16O 191 48 66
RS2072633 1 1.215 245 296 109 160 RS1001147 2 1.146 160 192 48 66
RS41151659 2 1.206 22 577 9 260 RS1038709 1 1 132 230 123 71 43
RS2072633 2 1.170 240 301 169 160 RS3753356 1 t.098 258 94 80 32
R51048709 1 1.026 412 123 202 65 RS2072633 1 1.067 121 233 36 74
RS10.18709 2 1.005 122 419 60 207 RS1048709 2 0.734 103 250 41 73
iNDELTT 2 0.613 136 420 93 176 RS547154 . 0 656 43 305 20 93
RS2072633 3 0.494 56 485 51 218 INDELTT 2 0 545 64 274 33 77
R53753396 3 0.411 B 541 9 250 RS4151667 2 0.39a 2P 335 t5 99
RS9332739 2 0.382 19 527 23 244 RS93.12739 2 0375 19 334 15 99
RS547154 2 0.373 43 -05 50 210 RS1061147 3 0.270 65 287 52 6?.
RS4151067 2 0 362 18 5.'i2 23 246 RS1061170 3 0.266 64 267 52 62
RS1081170 3 03F2 114 432 120 142 RS4151659 1 0.251 343 12 114 1
R91061147 3 0.296 110 433 121 141 INDELTT 1 0230 6 332 8 102
R5547154 3 O.2T5 4 544 . 262
INDELTT 1 0.178 7 549 fA 251
61
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Table 7. Combined Cohorts Chi Square Statistics
. . -. . = Square
Case Case Control
StVP' .' ' Cafiagary Scare Con ro ,,.
Ti.ue . False = True fials~i , t
RS1061170 3 89.16 178 719 172 204
RS1061170 1 51.05 285 612 47 329
INDELTT '3 34.49 681 213 227 152
{NDEL1T 1 26.19 13 881 26 353
RS547154 1 24.58 805 91 304 78
RS547154 2 19.03 86 810 70 312
RS4151667 1 18.4.5 867 38 343 40
RS9332739 1 18.39 861 38 341 40
INDELTT 2 16.52 200 694 126 253
RS4151667 2 15.87 38 867 38 346
RS9332739 2 15.82 38 861 38 343
RS2072633 3 7.39 113 782 70 309
RS547154 3 6.28 5 891 8 374
RS1061170 2 4.68 434 463 157 219
RS3753396 3 4.13 15 886 13 368
RS1061147 2 3.29 433 462 161 215
RS3753396 1 1.66 661 240 259 112
RS1048709 3 1.44 27 867 7 374
RS2072633 2 1.11 416 479 164 215
RS4151659 1 1.09 870 . 34 374 10
RS4151659 2 1.09 34 870 10 374
RS2072633 1 0.77 366 529 145 234
62
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Table 8. Combined Cohoris Chi Square Yates Statistics
= . -, . . . - Yates
','.' i =. -- ,-.-5 ~,S~fr~;r".'a=rs: :.,..;...
C Ca 1, Cori
' SNP 'Ca#eg'ory , s ::,, S~~e.::;~,::.,~ ase Case : : ntro trol ~.
l1@
,,;. =. , .. . . _ _, a.~.;;. . Tr Fatse Tiue Fals~ : t
'FiS1061170 3 87.86 178 719 '172 204
RS1061170 1 50.05 285 612 47 329
INDELTT 3 33.70 681 213 227 152
{4DELTT 1 24.40 13 881 26 353
RS547154 1 23.69 805 91 304 78
RS547154 2 18.23 86 810 70 312
RS4151667 1 17.37 867 38 343 40
RS9332739 1 17.31 861 38 341 40
INDELTT 2 15.95 200 694- 126 253
RS4151667 2 14.86 38 867 38 345
RS9332739 2 14.81 38 861 38 343
RS2072633 3 6.92 113 782 70 309
RS547154 3 4.84 5 891 8 374
RS1061170 2 4.42 434 463 157 219
RS3753396 3 3.32 15 886 13 358
RS1061147 2 3.07 433 462 161 215
RS3753396 1 1.48 661 240 259 112
RS1048709 3 1.02 27 867 7 374
RS2072633 2 0.98 416 479 164 215
RS4151659 1 0.77 870 34 374 10
RS4151659 2 0.77 34 870 10 374
/
RS2072633 1 0.66 366 529 145 234
63
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Table 9. Combined Cohorts Fishers Exact Statistic
. . -. . .
..::._:. .
..... =s. ~.,; =:. .. -= v _ y. ~~ o::,",7r r .1 .~' i. u < !,n y ..il+~
:=,;= ,
= ..
~ro 1~
True : = . FalS+~ :,True se ;;
R51061170 3 4.81 E-20 178 719 172 204
RS1061170 1 1.OBE-13 285 612 47 329
tlJDELTT 3 5.56E-09 681 213 227 152
RS547154 1 1.17E-06 805 91 304 78
INDELTT 1 1.45E-06 13 881 26 353
RS547154 2 4.68E-05 86 810 70 312
RS4151667 1 3.14E-05 867 38 343 40
RS9332739 1 3.21 E-05 861 38 341 40
INDELTT 2 4.10E-05 200 694 126 253
RS4151667 2 1.04E-04 38 867 38 345
RS9332739 2 1.06E-04 38 861 38 343
RS2072633 3 0.0048033 113 782 70 309
RS547154 3 0.0173168 5 891 8 374
RS106i170 2 0.0176623 434 463 157 219
RS3753396 3 0.0379421 15 886 13 358
RS1061147 2 0.0397575 433 462 161 215
RS4151667 3 0.0882608 0 905 2 381
64
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Table 10. Combined Cohorts Odds Ratio Statistics
= = - = = = O= = - " =
, ..,,..
~ se ase un#r~ - r~tro
SI<iP ~~`": Ca~g4ry Scors+ ry ; ii _ y G:
True ? ; t False T.'rus . ' Fal~a:
RS1061170 1 3.260 285 612 47 329
RS4151667 1 2.661 867 38 343 40
RS9332739 1 2.658 861 38 341 40
RS547154 1 2.270 805 91 304 78
INDELTT 3 2.141 681 213 227 152
RS1048709 3 1.664 27 867 7 374
RS4151659 2 1.462 34 870 10 374
RS1061170 2 1.308 434 463 157 219
RS1061147 2 1.252 433 462 161 215
RS3753396 1 1.191 661 240 259 112
RS2072633 2 1.139 416 479 164 215
RS2072633 1 1.117 366 529 145 234
RS1048709 1 1.008 642 252 273 108
RS4151659 1 0.684 870 34 374 10
RS2072633 3 0.638 113 782 70 309
INDELTT 2 0.579 200 694 126 253
RS547154 2 0.473 86 810 70 312
RS3753396 3 0.466 15 886 13 358
RS9332739 2 0.398 38 861 38 343
RS4151667 2 0,398 38 867 38 345
RS1061170 3 0.294 178 719 172 204
RS547154 3 0.262 5 891 8 374
INDELTT 1 0.200 13 881 26 353
RS1061170 1 3.260 285 612 47 329
[0196] Clearly many of these SNP's were highly statistically significant in
both
cohorts. This was mainly due to the a priori information that led to their
selection for
this
study. Particularly notable was RS1061170 as 3(BB a.k.a T/T) with fishers
p<4.81E-
20, indicating its strong potential as a protective genotype. In the side by
side
comparisons it becomes clear that there are some differences between the Iowa
and
Columbia cohorts.
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
101971 To further assess which SNP's/Genotypes are protective or contributive,
Fishers was used as a basis for genotype penetration variance. To do this the
genotype percentage was calculated for cases and controls and the absolute
value of
their difference was calculated. Table 1 1 provides this information and is
sorted in
order of highest frequency difference.
Table 11. Genotype Penetration Variance
P Genotype . . D Protective
RS106117U 3 19.84% 45.74% 25.90% p
RS1061170 1 31.77% 12.50% 19.27% c
INDELIT 3 76.17% 59.89 :0 16.28% c
INDELTT 2 22.37% 33.25% 10.87% p
RS547154 1 89.84% 79.58% 10.26% c
RS547154 2 9.60n`o 18.32% 8.73 ;o p
RS1061170 2 48.38% 41.76% 6.63% c
RS9332739 1 95.77% 89.50% 6.27% c
RS4151667 1 95.80% 89.56% 6.24% c
RS2072633 3 12.639b 18.47% 5.84% p
RS9332739 2 4.28 io 9.97% 5.75% p
RS4151667 2 4.201%6 9.92% 5.72% p
RS1061147 2 48.3814 6 42.82 ! 5.56% c
INDELTT 1 1.45% 6.86% 5.41% p
[0198] Hypothesized Protective Models: In this study, preliminary work
indicated
possible combinations of SNP's that would protect from AMD. To test this
hypothesis, a hand-built model was constructed per an NCI specification. The
model
graphic appears in Fig. 2A. This model can be written as an IF statement as
follows:
IF RS547154 is G/A and RS1061170 is T/T or
RS547154 is G/A and RS 1061170 is C/C or
RS4151667 is T/A and RS 1061170 is C/T or
RS4151667 is T/A and RS 1061170 is C/C
THEN The Person is protected from AMD.
Therefore, this model gives four possible combinations of genotypes that would
protect from AMD (combinations that result in the model being "true"):
1. RS547154 as G/A AND RS 1061170 as T/T
= Controls 8.82%, Cases 5.45%
66
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
2. RS547154 as G/A AND RS 1061 170 as C/C
= Controls 7.22%, Cases 1.93%
3. RS4151667 as T/A AND RS 1061 170 as C/T
= Controls 4.8%,Cases 2.02%
4. RS4151667 as T/A AND RS 1061170 as C/C
= Controls 3.47%, Cases .79%
When this model was applied against the samples, the following resulted for
the
combined Iowa and Columbia cohot-ts:
= 794 cases did not have the protective factors (the model was false)...90.12%
= 88 controls did have the protective factors (the model was true)...23.52%
= 87 of the cases did havc protective factors...9.88%
= 286 of the controls did not have the protective factors ... 76.47
NOTE: statistics on all models were calculated by applying the inodel against
the
combined cohorts and tracking its True Positive(TP), False Negative(FN), False
Postive(FP) and True Negative(TN) rates. These numbers were then placed in a 2
x 2
tables from which all statistics were generated. Table 12 shows the statistics
for each
cohort.
Table 12. NCI Hypothesized Protective Model Statistics
Iowa& . b . . .
f r rx ,},f~. .~"z' a,'Jr, CO~~i. :,:{ :? ...f..õ',_~.-'t =+~%-?r ~; ~ F.~,;VA
U r,i,.;4ek .r.. t r t i i.,, .~,t. ~3.w..._.., ..
. . . ..,. .. . _
P=7.902ee-1 P-4.284e- P=0.0023
,,,.. .FishetsY
Uilds Aa~ioà 2.8081 3.270 2.360
S1d Error: 0.466
tyõ ,.~~`4=7~~~=':
95 loCl: 2.027<0.R.<3.88
Inverse OR:.3
4,G~fii SCjaate~ 40.791 P=4.473E-11 32.92 P-9.563E-9 10.27 PR0.001
';`';;`iYateS 39.661 P=3.020E-1 31.65 P=1.837E-8 9.33 P=0.002
[0199] Genetic Algorithm (GA) Derived Model(s): In an attempt to see if the GA
Module could find better combinations of SNP's, the GA module was tasked to
learn
models on the inverted data (to learn protective models). Various parameter
settings
were utilized including:
= Model Type: indicates whether the model can have and's and or's, and's
only, or or's only.
67
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
= Model Size: indicates an upper limit for how many SNP's can be in the
models
= GA Specific Parameters: such as generations, number of models, etc.
[0200] Generally speaking, AND-only models of small size are preferable. The
reasons for this are two-fold. First, an AND-only model requires that all its
SNP's be
true for the model to be true, and its interpretation is therefore
unambiguous, whereas
models with OR's do not require all SNP's to be present for the model to be
true,
which introduces a level of uncertainty. Secondly, smaller models are easier
to
interpret due to having fewer SNP's to assess.
[0201] Exemplar utilizes a two-third, one-third validation method to avoid
over-
fitting to the input data with the desired outcome of having more generally
applicable
results.
[0202] Further, given that there were two distinct study groups, this allowed
models
to be built only on the Columbia data and the resultant models to be tested
against the
Iowa cohort. If the model(s) performance is consistent across the two groups,
this is a
strong indication of the general applicability of the model(s). This would be
particulal-ly challenging given the interesting statistical differences
between the two
groups as discussed in the above statistics section. Given such variance, it
was highly
possible that the GA would find high fitness models on the Columbia data, but
would
perform poorly on the Iowa data.
[0203] The GA did find a model that performed well across Columbia, Iowa and
the
combined dataset. The models performance on the Columbia data was superior to
the
Iowa data, as would be expected given that the model was trained on the
Columbia
data. Nonetheless, the model performance is notable given that the GA had no
prior
knowledge of the Iowa data and there was significant statistical difference
between
key SNP's between the two cohorts. The resultant best model outperformed the
hand
built hypothesized model on the combined coliorts (RS 1061170). Initially, the
model
included an additional section with `INDELTT is homozygous AND RS547154 is
GG," but upon further inspection, this section was determined to be extraneous
to
model interpretation and was therefore eliminated to produce the model with
identical
performance. A graphic of the final model may be found in Fig. 2C.
68
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
[0204] The GA specific Optionti for this task were as follows:
Models: 1500 - this is the number of models the GA built internally as a
foundation
for evolving new generations of models
[0205] Iterations: 25 - this is the number of evolutionary iterations the
models went
through to find a solution
[0206] Model Size: 5 - this allowed for the niodels to have a maximuin of 16
genotypes to appear in a single model
[0207] Model Type: AND/OR's - this let the GA build models that could use both
and's and or's
[0208] This model can be written as an IF statement as follows:
IF RS 1048709 is G/G and RS 1061 170 is TfT or
RS547154 is G/A or
RS4151667 is T/A or
INDELTT is +/+
THEN The person is protected from AMD.
[0209] This model gives four possible individual or combinations of genotypes
that
would protect from AMD (combinations resulting in the model being "true"):
1. RS 1048709 as G/G and RS 1061170 as T/T
= Occurred in 14.20% cases, 34.31 % controls
2. RS547154 as G/A
= Occurred in 9.6% cases, 18.32% controls
3. RS4151667 as T/A
= Occurred in 4.2% cases, 9.92% controls
4. INDELTT as +/+
= Occurred in 1.45% cases, 6.86% controls
[0210] When this model was applied against the samples, the following resulted
for
the combined Iowa and Columbia cohorts:
= 682 of the cases did not have the protective factors (74.78%), 230 did.
= 204 of the controls had the protective factors (55.74%), 162 did not.
[0211] Table 13 shows the statistics for each cohort. The GA performed well
across the board. Overall, those with the protective factors described by the
model
were 3.6581 tiines less likely to get AMD than those without the protective
factors.
69
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
Table 13. Genetic Algorithm Derived Model Statistics
Iowa , . . . .
coie<; aluia Saa :Vatu' or ,;Val'ue
Fishers P 1.689e-23 P= 2.974e-22 P=0.000074
`~'Odds. Ratio 3.6581
}:.:,.. . .
- ;';F''- ;~ =L ' Std Error: 0.4792
y: : ; - =: 4.727 2.251
950/. C12.8298<014<4.7288
=Y..1n== "=d:~'.::;,,~,:s
Irnierse OR:.27
n~ .n.t:=
: Cill =SqU8~8' 103.128 P=3.141 E-24 96.451 P=9.148E-2 13.1 P=0.00028
, : _:,.= : r
-Yates 101.801 P=6.138E-24 94.88 13=2.016E-2 12.3 P=0.0004
[0212] Given the clear statistical difference in several key SNP's between the
two
cohorts, finding a single model that would more accurately predict
outcomes/protection was a challenge for both humans and machine learning
alike.
The hand built model performed admirably, and interestingly identified the
identical
heterozygous pairing of SNP's that the GA did (RS547 ] 54 as AB, RS4151667 as
AB), including the same OR'ing together of those SNP's.
[0213] Despite the difficulty of the task, the GA performed well on the out of
sample test (Fishers Iowa p<0.0000749). The GA outperformed the hand built
model
on all cohorts. Nonetheless, the hand built model does a very adequate job of
predicting outcomes. Other variants of this model were tested but were unable
to
improve on its performance. Given the many possible combinations of
SNP's/Genotypes/logical operators, this is to be expected and hence the value
of the
machine learning approach wbich can test 10's of thousands of model variations
within a reasonable timeframe.
[0214] Given the highly statistical significance of the single SNP (RS 1061170
as
T/T: x2=97.25), one might conclude that by itself it can predict risk for AMD.
In
order to test whether the single SNP or the multi-loci models would have
potential
suitability for prediction of protection in the general population,
permutation testing
was conducted on the data. The Permutation testing showed that the single SNP
was
much more likely to produce a statistically significant result with=random
mixing of
the data than either the GA or hand built models with a mean chi square score
of
4.8153 over 3000 perinutations versus, 3.3157 for the GA and 1.2207 for the
hand
built. On the Odds Ration evaluation, the single SNP had 625 permutations with
an
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
OR> 1.5 versus 133 for the GA model and 46 for the hand built model. The hand
built
model simply represents of combination of genotypes that is rarely occurring
in any
sample. On balance, the GA model exhibited the best true case control
performance
and permutation results.
[0215] When the model statistics, ROC plots and permutation tests are looked
at
collectively, it appears that the multi-loci model approach to predict
outcomes is
superior to any single loci across diverse groups. Conclusion
[0216] In conclusion, this study extends and refines the role of the
alternative
con--plement pathway in the pathobiology of AMD and further strengthens the
proposed model that infection and/oi- inflammation play a major role in this
common
disease (Hageman et al., 2005, supra; Anderson et al., 2002, supra; Hageman et
a1.,
2001, su.1.7ra).
Example 3. Administration of Protective BF or C2 Protein to Prevent
Development
of AMD
[0217] A subject presents with signs and/or symptoms of AMD, including drusen.
The subject tests negative for the protective polymorphisms R32Q and L9I-I in
BF,
and IVS 10 and E318D in C2. It is recommended that the subject be treated with
protective BF protein (having the R32Q polymorphism). The subject is
administered
intravenously an amount of protective BF in aqueous saline sufficient to bring
the
serum concentration of BF to between 9 and 31 mg/dL, once a month for six
months.
At this time, the subject is monitored for drusen as well as the presence of
other signs
= and/or symptoms of AMD. If the signs and/or symptoms of AMD have not
progressed, administration of protective BF is continued, once a month
indefinitely,
with monitoring of the clinical status of the patient as frequently as
indicated, but at
least once every six months.
[0218] In other clinical regimens, the protective BF protein is administered
intranasally once each day to provide more sustained exposure to the
protective
effects of the protein.
[02191 All publications and patent applications mentioned in the specification
are
indicative of the level of skill of those skilled in the art to which this
invention
71
CA 02638916 2008-08-08
WO 2007/095185 PCT/US2007/003696
pertains. All publications and patent applications are herein incorporated by
reference
to the same extent as if each individual publication oi- patent application
was
specifically and individually indicated to be incorporated by reference.
[0220] In view of the many possible embodiments to which the principles of our
invention may be applied, it should be recognized that the illustrated
embodiment is
only a preferred example of the invention and should not be taken as a
limitation on
the scope of the invention. Rather, the scope of the invention is defined by
the
following claims. We therefore claim as our invention all that comes within
the scope
and spirit of these clainis.
72
