Note: Descriptions are shown in the official language in which they were submitted.
CA 02648243 2013-09-23
NANOPARTICLE AND POLYMER FORMULATIONS FOR THYROID HORMONE
ANALOGS, ANTAGONISTS, AND FORMULATIONS THEREOF
FIELD OF THE INVENTION
This invention relates to nanoparticle and polymer conjugate forms of thyroid
hormone,
thyroid hormone analogs and derivatives thereof. Methods of using such
compounds and
pharmaceutical compositions containing same are also disclosed. The invention
also relates to
methods of preparing such compounds and to a sustained release and long
residing ophthalmic
formulation and the process of preparing the same.
BACKGROUND OF THE INVENTION
Thyroid hormones, such as L-thyroxine (T4) and 3,5,3'-triiodo-L-thyronine
(T3), and
their analogs such as GC-1, DITPA, Tetrac and Triac, regulate many different
physiological
processes in different tissues in vertebrates. It was previously known that
many of the actions
of thyroid hormones are mediated by the thyroid hormone receptor ("TR"). A
novel cell
surface receptor for thyroid hormone (L-thyroxine, T4;, T3) has been described
on integrin
aVf33. The receptor is at or near the Arg-Gly-Asp (RGD) recognition site on
the integrin. The
aVr33 receptor is not a homologue of the nuclear thyroid hormone receptor
(TR), but activation
of the cell surface receptor results in a number of nucleus-mediated events,
including the
recently-reported pro-angiogenic action of the hormone and fibroblast
migration in vitro in the
human dermal fibroblast monolayer model of wound-healing.
Tetraiodothyroacetic acid (tetrac) is a deaminated analogue of T4 that has no
agonist
activity at the integrin, but inhibits binding of T4 and T3 by the integrin
and the pro-angiogenic
action of agonist thyroid hormone analogues at aVI33. Inhibition of the
angiogenic action of
thyroid hormone has been shown in the chick chorioallantoic membrane (CAM)
model and in
the vessel sprouting model involving human dermal microvascular endothelial
cells (HDMEC).
In the absence of thyroid hormone, tetrac blocks the angiogenic activity of
basic fibroblast
growth factor (bFGF, FGF2), vascular endothelial growth factor (VEGF) and
other pro-
1
CA 02648243 2013-09-23
angiogenic peptides. Tetrac is effective in the CAM and HDMEC models. This
inhibitory
action of tetrac is thought to reflect its influence on the RGD recognition
site that is relevant to
pro-angiogenic peptide action.
Evidence that thyroid hormone can act primarily outside the cell nucleus has
come from
studies of mitochondrial responses to T3 or T2, from rapid onset effects of
the hormone at the
cell membrane and from actions on cytoplasmic proteins. The recent description
of a plasma
membrane receptor for thyroid hormone on integrin aVf33 has provided some
insight into
effects of the hormone on membrane ion pumps, such as the Na+/H+ antiporter,
and has led to
the description of interfaces between the membrane thyroid hormone receptor
and nuclear
events that underlie important cellular or tissue processes, such as
angiogenesis and
proliferation of certain tumor cells.
Circulating levels of thyroid hormone are relatively stable; therefore,
membrane-
initiated actions of thyroid hormone on neovascularization or on cell
proliferation or on
membrane ion channels¨as well, of course, as gene expression effects of the
hormone
mediated by TR mentioned above¨may be assumed to contribute to 'basal
activity' or
setpoints of these processes in intact organisms. The possible clinical
utility of cellular events
that are mediated by the membrane receptor for thyroid hormone may reside in
inhibition of
such effect(s) in the contexts of neovascularization or tumor cell growth.
Indeed, we have
shown that blocking the membrane receptor for iodothyronines with
tetraiodothyroacetic acid
(tetrac), a hormone-binding inhibitory analogue that has no agonist activity
at the receptor, can
arrest growth of glioma cells and of human breast cancer cells in vitro.
Tetrac is a useful probe
to screen for participation of the integrin receptor in actions of thyroid
hormone.
Integrin aVf33 binds thyroid hormone near the Arg-Gly-Asp (RGD) recognition
site of
the protein; the RGD site is involved in the protein-protein interactions
linking the integrin to
extracellular matrix (ECM) proteins such as vitronectin, fibronectin and
laminin. Also
initiated at the cell surface integrin receptor is the complex process of
angiogenesis, monitored
in either a standard chick blood vessel assay or with human endothelial cells
in a sprouting
assay. This hormone-dependent process requires MAPK activation and elaboration
of basic
fibroblast growth factor (bFGF; FGF2) that is the downstream mediator of
thyroid hormone's
effect on angiogenesis. Tetrac blocks this action of T4 and T3, as does RGD
peptide and small
2
CA 02648243 2013-09-23
molecules that mimic RGD peptide. It is possible that desirable
neovascularization can be
promoted with local application of thyroid hormone analogues, e.g., in wound-
healing, or that
undesirable angiogenesis, such as that which supports tumor growth, can be
antagonized in part
with tetrac.
Thyroid hormone can also stimulate the proliferation in vitro of certain tumor
cell lines.
Murine glioma cell lines have been shown to proliferate in response to
physiological
concentrations of T4 by a mechanism initiated at the integrin receptor and
that is MAPK-
dependent. In what may be a clinical corollary, a prospective study of
patients with far
advanced glioblastoma multiforme (GBM) in whom mild hypothyroidism was induced
by
propylthiouracil showed an important survival benefit over euthyroid control
patients. We have
found that human breast cancer MCF-7 cells proliferated in response to T4 by
a mechanism
that was inhibited by tetrac. A recent retrospective clinical analysis showed
that hypothyroid
women who developed breast cancer did so later in life than matched euthyroid
controls and
had less aggressive, smaller lesions at the time of diagnosis than controls.
Thus, the trophic
action of thyroid hormone on in vitro models of both brain tumor and breast
cancer appears to
have clinical support.
The cellular or tissue actions of thyroid hormone that are known to be
initiated at
integrin aVf33 and that require transduction of the hormone signal via MAPK
are summarized
below. The integrin is a signal transducing protein connecting signals from
extracellular matrix
(ECM) proteins to the cell interior (outside-in) or from cytoplasm and
intracellular organelles
to ECM (inside-out). Binding of L-thyroxine (T4) or 3,5,3'-triiodo-L-thyronine
(T3) to
heterodimeric aVf33 results in activation of mitogen-activated protein kinase
(MAPK;
ERK1/2). Activated MAPK (phosphoMAPK, pMAPK) translocates to the cell nucleus
where it
phosphorylates transactivator proteins such as thyroid hormone receptor-131
(TR131), estrogen
receptor-a (ERa) or signal transducer and activator of transcription¨la
(STAT1a). Among the
genes consequently transcribed are basic fibroblast growth factor (bFGF), that
mediates thyroid
hormone-induced angiogenesis) and other proliferation factors important to
cell division of
tumor cells.
Depicted in FIG. 30_is the ability of tetraiodothyroacetic acid (tetrac) to
inhibit the
action of T4 and T3 at the integrin; tetrac blocks the binding of
iodothyronines to the integrin
3
CA 02648243 2013-09-23
receptor. Also shown is crosstalk between the integrin and epidermal growth
factor receptor
(EGFR). Here, the presence of thyroid hormone at the cell surface alters the
function of EGFR
to allow the latter to distinguish EGF from TGF-a, another growth factor that
binds to EGFR.
There is thus a need in the art for thyroid hormone analogs that can bind to
the cell
surface receptor while not being able to enter the cell. Such reformulated
hormone analogues
would not express intracellular actions of the hormone and thus if absorbed
into the circulation
would not have systemic thyroid hormone analog actions.
SUMMARY OF THE INVENTION
The invention is based, in part, on the discovery that thyroid hormone,
thyroid hormone
analogs, their polymeric and nanoparticle forms, act at the cell membrane
level and have pro-
angiogenic properties that are independent of the nuclear thyroid hormone
effects.
Accordingly, these thyroid hormone analogs, polymeric forms, and nanoparticles
can be used
to treat a variety of disorders. Similarly, the invention is also based on the
discovery that
thyroid hormone analog antagonists inhibit the pro-angiogenic effect of such
analogs, and can
also be used to treat a variety of disorders.
Accordingly, in one aspect the invention features methods for treating a
condition
amenable to treatment by promoting angiogenesis by administering to a subject
in need thereof
an amount of a polymeric form of thyroid hormone, or an analog thereof,
effective for
promoting angiogenesis. Examples of such conditions amenable to treatment by
promoting
angiogenesis are provided herein and can include occlusive vascular disease,
coronary disease,
erectile dysfunction, myocardial infarction, ischemia, stroke, peripheral
artery vascular
disorders, cerebrovascular, limb ischemia, and wounds.
Examples of thyroid hormone analogs are also provided herein and can include
triiodothyronine (13), levothyroxine (T4), T4 or T3 N-Methyl, T4 or T3 N-
Ethyl, T4 or T3 N-
Triphenyl, T4 or T3 N-Propyl, T4 or 13 N-Isopropyl, T4 or T3 N-tertiary butyl,
3,5-dimethy1-
4-(4'-hydroy-3'-isopropylbenzy1)-phenoxy acetic acid (GC-1), or 3,5-
diiodothyropropionic
4
CA 02648243 2013-09-23
acid (DITPA), tetraiodothyroacetic acid (TETRAC), and triiodothyroacetic acid
(TRIAC).
Additional analogs are in Figure 20 Tables A-D. The analogs can be conjugated
to polyvinyl
alcohol, acrylic acid ethylene co-polymer, polylactic acid, or agarose. The
conjugation is via
covalent or non-covalent bonds depending on the polymer used.
In one embodiment the thyroid hormone, thyroid hormone analogs, or polymeric
forms
thereof are administered by parenteral, oral, rectal, or topical means, or
combinations thereof.
Parenteral modes of administration include, for example, subcutaneous,
intraperitoneal,
intramuscular, or intravenous modes, such as by catheter. Topical modes of
administration can
include, for example, a Band-Aid .
In another embodiment, the thyroid hormone, thyroid hormone analogs, or
polymeric
forms thereof can be encapsulated or incorporated in a microparticle,
liposome, or polymer.
The polymer can include, for example, polyglycolide, polylactide, or co-
polymers thereof. The
liposome or microparticle has a size of about less than 200 nanometers, and
can be
administered via one or more parenteral routes, or another mode of
administration. In another
embodiment the liposome or microparticle can be lodged in capillary beds
surrounding
ischemic tissue, or applied to the inside of a blood vessel via a catheter.
Thyroid hormone, thyroid hormone analogs, or polymeric forms thereof according
to
the invention can also be co-administered with one or more biologically active
substances that
can include, for example, growth factors, vasodilators, anti-coagulants, anti-
virals, anti-
bacterials, anti-inflammatories, immuno-suppressants, analgesics,
vascularizing agents, or cell
adhesion molecules, or combinations thereof. In one embodiment, the thyroid
hormone analog
or polymeric form is administered as a bolus injection prior to or post-
administering one or
more biologically active substance.
Growth factors can include, for example, transforming growth factor alpha
("TGFa"),
transforming growth factor beta ("TGF13"), basic fibroblast growth factor,
vascular endothelial
growth factor, epithelial growth factor, nerve growth factor, platelet-derived
growth factor, and
vascular permeability factor. Vasodilators can include, for example,
adenosine, adenosine
derivatives, or combinations thereof. Anticoagulants include, but are not
limited to, heparin,
heparin derivatives, anti-factor Xa, anti-thrombin, aspirin, clopidgrel, or
combinations thereof
CA 02648243 2013-09-23
In another aspect of the invention, methods are provided for promoting
angiogenesis
along or around a medical device by coating the device with a thyroid hormone,
thyroid
hormone analog, or polymeric form thereof according to the invention prior to
inserting the
device into a patient. The coating step can further include coating the device
with one or more
biologically active substance, such as, but not limited to, a growth factor, a
vasodilator, an anti-
coagulant, or combinations thereof Examples of medical devices that can be
coated with
thyroid hormone analogs or polymeric forms according to the invention include
stents,
catheters, cannulas or electrodes.
In a further aspect, the invention provides methods for treating a condition
amenable to
treatment by inhibiting angiogenesis by administering to a subject in need
thereof an amount of
an anti-angiogenesis agent effective for inhibiting angiogenesis. Examples of
the conditions
amenable to treatment by inhibiting angiogenesis include, but are not limited
to, primary or
metastatic tumors, diabetic retinopathy, and related conditions. Examples of
the anti-
angiogenesis agents used for inhibiting angiogenesis are also provided by the
invention and
include, but are not limited to, tetraiodothyroacetic acid (TETRAC),
triiodothyroacetic acid
(TRIAC), monoclonal antibody LM609, XT 199 or combinations thereof Such anti-
angiogenesis agents can act at the cell surface to inhibit the pro-
angiogenesis agents.
In another aspect, the invention provides for primary or adjunctive anti-
proliferative
treatment of certain cancers. Examples of the cancerous conditions amenable to
this treatment
include, but are not limited to, glioblastoma multiforme, lung cancer,
nonthyroidal head-and-
neck cancer, thyroid cancer, breast cancer and ovarian cancer. Examples of the
agents used for
anti-proliferative action are provided by the invention and include, but are
limited to,
tetraiodothyroacetic acid (TETRAC), triiodothyroacetic acid (TRIAC),
monoclonal antibody
LM609, XT 1999 or combinations thereof These agents act at the cell surface
integrin
receptor for thyroid hormone to inhibit cancer cell proliferation.
In one embodiment, the anti-angiogenesis agent is administered by a
parenteral, oral,
rectal, or topical mode, or combination thereof In another embodiment, the
anti-angiogenesis
agent can be co-administered with one or more anti-angiogenesis therapies or
chemotherapeutic
agents.
6
CA 02648243 2013-09-23
In yet a further aspect, the invention provides compositions (i.e., angiogenic
agents) that
include thyroid hormone, and analogs conjugated to a polymer. The conjugation
can be
through a covalent or non-covalent bond, depending on the polymer. A covalent
bond can
occur through an ester or anhydride linkage, for example. Examples of the
thyroid hormone
analogs are also provided by the instant invention and include levothyroxine
(T4),
triiodothyronine (T3), 3,5-dimethy1-4-(4'-hydroy-3'-isopropylbenzy1)-phenoxy
acetic acid
(GC-1), or 3,5-diiodothyropropionic acid (DITPA). In one embodiment, the
polymer can
include, but is not limited to, polyvinyl alcohol, acrylic acid ethylene co-
polymer, polylactic
acid, or agarose.
In another aspect, the invention provides for pharmaceutical formulations
including the
angiogenic agents according to the present invention in a pharmaceutically
acceptable carrier.
In one embodiment, the pharmaceutical formulations can also include one or
more
pharmaceutically acceptable excipients.
The pharmaceutical formulations according to the present invention can be
encapsulated
or incorporated in a liposome, microparticle, or polymer. The liposome or
microparticle has a
size of less than about 200 nanometers. Any of the pharmaceutical formulations
according to
the present invention can be administered via parenteral, oral, rectal, or
topical means, or
combinations thereof. In another embodiment, the pharmaceutical formulations
can be co-
administered to a subject in need thereof with one or more biologically active
substances
including, but not limited to, growth factors, vasodilators, anti-coagulants,
or combinations
thereof.
In other aspects, the present invention concerns the use of the polymeric
thyroid
hormone analogs and pharmaceutical formulations containing said hormone, for
the restoration
of neuronal functions and enhancing survival of neural cells. For the purpose
of the present
invention, neuronal function is taken to mean the collective physiological,
biochemical and
anatomic mechanisms that allow development of the nervous system during the
embryonic and
postnatal periods and that, in the adult animal, is the basis of regenerative
mechanisms for
damaged neurons and of the adaptive capability of the central nervous system
when some parts
of it degenerate and can not regenerate.
Therefore, the following processes occur in order to achieve neuronal
function:
7
CA 02648243 2013-09-23
denervation, reinnervation, synaptogenesis, synaptic repression, synaptic
expansion, the
sprouting of axons, neural regeneration, development and organisation of
neural paths and
circuits to replace the damaged ones. Therefore, the suitable patients to be
treated with the
polymeric thyroid hormone analogs or combinations thereof according to the
present invention
are patients afflicted with degenerative pathologies of the central nervous
system (senile
dementia like Alzheimer's disease, Parkinsonism, Huntington's chorea,
cerebellar-spinal
adrenoleucodystrophy), trauma and cerebral ischemia.
In a preferred embodiment, methods of the invention for treating motor neuron
defects,
including amyotrophic lateral sclerosis, multiple sclerosis, and spinal cord
injury comprise
administering a polymeric thyroid hormone analog, or combinations thereof, and
in
combination with growth factors, nerve growth factors, or other pro-
angiogenesis or
neurogenesis factors. Spinal cord injuries include injuries resulting from a
tumor, mechanical
trauma, and chemical trauma. The same or similar methods are contemplated to
restore motor
function in a mammal having amyotrophic lateral sclerosis, multiple sclerosis,
or a spinal cord
injury. Administering one of the aforementioned polymeric thyroid hormone
analogs alone or
in combination with nerve growth factors or other neurogenesis factors also
provides a
prophylactic function. Such administration has the effect of preserving motor
function in a
mammal having, or at risk of having, amyotrophic lateral sclerosis, multiple
sclerosis, or a
spinal cord injury. Also according to the invention, polymeric thyroid hormone
analogs alone
or in combination with nerve growth factors or other neurogenesis factors
administration
preserves the integrity of the nigrostriatal pathway.
Specifically, methods of the invention for treating (pre- or post-
symptomatically)
amyotrophic lateral sclerosis, multiple sclerosis, or a spinal cord injury
comprise administering
a polymeric thyroid hormone analog alone or in combination with nerve growth
factors or
other neurogenesis factors. In a particularly-preferred embodiment, the
polymeric thyroid
hormone analog alone or in combination with nerve growth factors or other
neurogenesis
factors is a soluble complex, comprising at least one polymeric thyroid
hormone analog alone
or in combination with nerve growth factors or other neurogenesis factors.
In one aspect, the invention features compositions and therapeutic treatment
methods
comprising administering to a mammal a therapeutically effective amount of a
morphogenic
8
CA 02648243 2013-09-23
protein ("polymeric thyroid hormone analog alone or in combination with nerve
growth factors
or other neurogenesis factors"), as defined herein, upon injury to a neural
pathway, or in
anticipation of such injury, for a time and at a concentration sufficient to
maintain the neural
pathway, including repairing damaged pathways, or inhibiting additional damage
thereto.
In another aspect, the invention features compositions and therapeutic
treatment
methods for maintaining neural pathways. Such treatment methods include
administering to the
mammal, upon injury to a neural pathway or in anticipation of such injury, a
compound that
stimulates a therapeutically effective concentration of an endogenous
polymeric thyroid
hormone analog. These compounds are referred to herein as polymeric thyroid
hormone
analogs alone or in combination with nerve growth factors or other
neurogenesis factors-
stimulating agents, and are understood to include substances which, when
administered to a
mammal, act on tissue(s) or organ(s) that normally are responsible for, or
capable of, producing
a polymeric thyroid hormone analog alone or in combination with nerve growth
factors or
other neurogenesis factors and/or secreting a polymeric thyroid hormone analog
alone or in
combination with nerve growth factors or other neurogenesis factors, and which
cause
endogenous level of the polymeric thyroid hormone analogs alone or in
combination with
nerve growth factor or other neurogenesis factors to be altered.
In particular, the invention provides methods for protecting neurons from the
tissue
destructive effects associated with the body's immune and inflammatory
response to nerve
injury. The invention also provides methods for stimulating neurons to
maintain their
differentiated phenotype, including inducing the redifferentiation of
transformed cells of
neuronal origin to a morphology characteristic of untransformed neurons. In
one embodiment,
the invention provides means for stimulating production of cell adhesion
molecules,
particularly nerve cell adhesion molecules ("N-CAM"). The invention also
provides methods,
compositions and devices for stimulating cellular repair of damaged neurons
and neural
pathways, including regenerating damaged dendrites or axons. In addition, the
invention also
provides means for evaluating the status of nerve tissue, and for detecting
and monitoring
neuropathies by monitoring fluctuations in polymeric thyroid hormone analogs
alone or in
combination with nerve growth factors or other neurogenesis factors levels.
In one aspect of the invention, the polymeric thyroid hormone analogs alone or
in
9
CA 02648243 2013-09-23
combination with nerve growth factors or other neurogenesis factors described
herein are useful
in repairing damaged neural pathways of the peripheral nervous system. In
particular,
polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other
neurogenesis factors are useful for repairing damaged neural pathways,
including transected or
otherwise damaged nerve fibers. Specifically, the polymeric thyroid hormone
analogs alone or
in combination with nerve growth factor or other neurogenesis factors
described herein are
capable of stimulating complete axonal nerve regeneration, including
vascularization and
reformation of the myelin sheath. Preferably, the polymeric thyroid hormone
analogs alone or
in combination with nerve growth factors or other neurogenesis factors are
provided to the site
of injury in a biocompatible, bioresorbable carrier capable of maintaining the
polymeric thyroid
hormone analogs alone or in combination with nerve growth factors or other
neurogenesis
factors at the site and, where necessary, means for directing axonal growth
from the proximal
to the distal ends of a severed neuron. For example, means for directing
axonal growth may be
required where nerve regeneration is to be induced over an extended distance,
such as greater
than 10 mm. Many carriers capable of providing these functions are envisioned.
For example,
useful carriers include substantially insoluble materials or viscous solutions
prepared as
disclosed herein comprising laminin, hyaluronic acid or collagen, or other
suitable synthetic,
biocompatible polymeric materials such as polylactic, polyglycolic or
polybutyric acids and/or
copolymers thereof. A preferred carrier comprises an extracellular matrix
composition derived,
for example, from mouse sarcoma cells.
In a particularly preferred embodiment, a polymeric thyroid hormone analog
alone or in
combination with nerve growth factors or other neurogenesis factors is
disposed in a nerve
guidance channel which spans the distance of the damaged pathway. The channel
acts both as a
protective covering and a physical means for guiding growth of a neurite.
Useful channels
comprise a biocompatible membrane, which may be tubular in structure, having a
dimension
sufficient to span the gap in the nerve to be repaired, and having openings
adapted to receive
severed nerve ends. The membrane may be made of any biocompatible,
nonirritating material,
such as silicone or a biocompatible polymer, such as polyethylene or
polyethylene vinyl
acetate. The casing also may be composed of biocompatible, bioresorbable
polymers,
including, for example, collagen, hyaluronic acid, polylactic, polybutyric,
and polyglycolic
CA 02648243 2013-09-23
acids. In a preferred embodiment, the outer surface of the channel is
substantially impermeable.
The polymeric thyroid hormone analogs alone or in combination with nerve
growth
factors or other neurogenesis factors may be disposed in the channel in
association with a
biocompatible carrier material, or it may be adsorbed to or otherwise
associated with the inner
surface of the casing, such as is described in U.S. Pat. No. 5,011,486,
provided that the
polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other
neurogenesis factors is accessible to the severed nerve ends.
In another aspect of the invention, polymeric thyroid hormone analogs alone or
in
combination with nerve growth factors or other neurogenesis factors described
herein are useful
to protect against damage associated with the body's immune/inflammatory
response to an
initial injury to nerve tissue. Such a response may follow trauma to nerve
tissue, caused, for
example, by an autoimmune dysfunction, neoplastic lesion, infection, chemical
or mechanical
trauma, disease, by interruption of blood flow to the neurons or glial cells,
or by other trauma to
the nerve or surrounding material. For example, the primary damage resulting
from hypoxia or
ischemia-reperfusion following occlusion of a neural blood supply, as in an
embolic stroke, is
believed to be immunologically associated. In addition, at least part of the
damage associated
with a number of primary brain tumors also appears to be immunologically
related. Application
of a polymeric thyroid hormone analog alone or in combination with nerve
growth factors or
other neurogenesis factors, either directly or systemically alleviates and/or
inhibits the
immunologically related response to a neural injury. Alternatively,
administration of an agent
capable of stimulating the expression and/or secretion in vivo of polymeric
thyroid hormone
analogs alone or in combination with nerve growth factors or other
neurogenesis factors
expression, preferably at the site of injury, may also be used. Where the
injury is to be induced,
as during surgery or other aggressive clinical treatment, the polymeric
thyroid hormone analogs
alone or in combination with nerve growth factors or other neurogenesis
factors or agent may
be provided prior to induction of the injury to provide a neuroprotective
effect to the nerve
tissue at risk.
Generally, polymeric thyroid hormone analogs alone or in combination with
nerve
growth factors or other neurogenesis factors useful in methods and
compositions of the
invention are dimeric proteins that induce morphogenesis of one or more
eukaryotic (e.g.,
11
CA 02648243 2013-09-23
mammalian) cells, tissues or organs. Tissue morphogenesis includes de novo or
regenerative
tissue formation, such as occurs in a vertebrate embryo during development. Of
particular
interest are polymeric thyroid hormone analogs alone or in combination with
nerve growth
factors or other neurogenesis factors that induce tissue-specific
morphogenesis at least of bone
or neural tissue. As defined herein, a polymeric thyroid hormone analog alone
or in
combination with nerve growth factor or other neurogenesis factors comprises a
pair of
polypeptides that, when folded, form a dimeric protein that elicits
morphogenetic responses in
cells and tissues displaying thyroid receptors. That is, the polymeric thyroid
hormone analogs
alone or in combination with nerve growth factors or other neurogenesis
factors generally
induce a cascade of events including all of the following in a morphogenically
permissive
environment: stimulating proliferation of progenitor cells; stimulating the
differentiation of
progenitor cells; stimulating the proliferation of differentiated cells; and,
supporting the growth
and maintenance of differentiated cells. "Progenitor" cells are uncommitted
cells that are
competent to differentiate into one or more specific types of differentiated
cells, depending on
their genomic repertoire and the tissue specificity of the permissive
environment in which
morphogenesis is induced. An exemplary progenitor cell is a hematopoeitic stem
cell, a
mesenchymal stem cell, a basement epithelium cell, a neural crest cell, or the
like. Further,
polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other
neurogenesis factors can delay or mitigate the onset of senescence- or
quiescence-associated
loss of phenotype and/or tissue function. Still further, polymeric thyroid
hormone analogs
alone or in combination with nerve growth factors or other neurogenesis
factors can stimulate
phenotypic expression of a differentiated cell type, including expression of
metabolic and/or
functional, e.g., secretory, properties thereof. In addition, polymeric
thyroid hormone analogs
alone or in combination with nerve growth factor or other neurogenesis factors
can induce
redifferentiation of committed cells (e.g., osteoblasts, neuroblasts, or the
like) under appropriate
conditions. As noted above, polymeric thyroid hormone analogs alone or in
combination with
nerve growth factors or other neurogenesis factors that induce proliferation
and/or
differentiation at least of bone or neural tissue, and/or support the growth,
maintenance and/or
functional properties of neural tissue, are of particular interest herein.
12
CA 02648243 2013-09-23
Of particular interest are polymeric thyroid hormone analogs alone or in
combination
with nerve growth factors or other neurogenesis factors which, when provided
to a specific
tissue of a mammal, induce tissue-specific morphogenesis or maintain the
normal state of
differentiation and growth of that tissue. In preferred embodiments, the
present polymeric
thyroid hormone analog alone or in combination with nerve growth factors or
other
neurogenesis factors induce the formation of vertebrate (e.g., avian or
mammalian) body
tissues, such as but not limited to nerve, eye, bone, cartilage, bone marrow,
ligament, tooth
dentin, periodontium, liver, kidney, lung, heart, or gastrointestinal lining.
Preferred methods
may be carried out in the context of developing embryonic tissue, or at an
aseptic, unscarred
wound site in post-embryonic tissue.
Other aspects of the invention include compositions and methods of using
thyroid
hormone analogs and polymers thereof for imaging and diagnosis of
neurodegenerative
disorders, such as, for example, Alzheimer's disease. For example, in one
aspect, the invention
features T4 analogs that have a high specificity for target sites when
administered to a subject
in vivo. Preferred T4 analogs show a target to non-target ratio of at least
4:1, are stable in vivo
and substantially localized to target within 1 hour after administration. In
another aspect, the
invention features pharmaceutical compositions comprised of a linker attached
to the T4
analogs for Technetium, indium for gamma imaging using single photon emission
("SPECT")
and with contrast agents for MRI imaging. Additionally, halogenated analogs
that bind TTR
can inhibit the formation of amyloid fibrils and thus can be utilized for the
prevention and
treatment of Alzheimer's disease. Such compounds can also be used with
positron emission
tomography ("PET") imaging methods.
In other aspects, the invention also includes compositions and methods for
modulating
actions of growth factors and other polypeptides whose cell surface receptors
are clustered
around integrin aVi33, or other cell surface receptors containing the amino
acid sequence Arg-
Gly-Asp ("RGD"). Polypeptides that can be modulated include, for example,
insulin, insulin-
like growth factors, epidermal growth factors, and interferon-y.
The details of one or more embodiments of the invention have been set forth in
the
accompanying description below. Although any methods and materials similar or
equivalent to
those described herein can be used in the practice or testing of the present
invention, the
13
CA 02648243 2013-09-23
preferred methods and materials are now described. Other features, objects,
and advantages of
the invention will be apparent from the description and from the claims. In
the specification
and the appended claims, the singular forms include plural references unless
the context clearly
dictates otherwise. Unless defined otherwise, all technical and scientific
terms used herein
have the same meaning as commonly understood by one of ordinary skill in the
art to which
this invention belongs.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Effects of L-T4 and L-T3 on angiogenesis quantitated in the chick
CAM
assay. A, Control samples were exposed to PBS and additional samples to 1 nM
T3 or 0.1
mon T4 for 3 days. Both hormones caused increased blood vessel branching in
these
representative images from 3 experiments. B, Tabulation of mean SEM of new
branches
formed from existing blood vessels during the experimental period drawn from 3
experiments,
each of which included 9 CAM assays. At the concentrations shown, T3 and T4
caused similar
effects (1.9-fold and 2.5-fold increases, respectively, in branch formation).
**P<0.001 by 1-
way ANOVA, comparing hormone-treated with PBS-treated CAM samples.
Figure 2. Tetrac inhibits stimulation of angiogenesis by T4 and agarose-linked
T4
(T4-ag). A, A 2.5-fold increase in blood vessel branch formation is seen in a
representative
CAM preparation exposed to 0.1 mon T4 for 3 days. In 3 similar experiments,
there was a
2.3-fold increase. This effect of the hormone is inhibited by tetrac (0.1
gmol/L), a T4 analogue
shown previously to inhibit plasma membrane actions of T4.13 Tetrac alone does
not stimulate
angiogenesis (C). B, T4-ag (0.1 Knol/L) stimulates angiogenesis 2.3-fold (2.9-
fold in 3
experiments), an effect also blocked by tetrac. C, Summary of the results of 3
experiments that
examine the actions of tetrac, T4-ag, and T4 in the CAM assay. Data (means
SEM) were
obtained from 10 images for each experimental condition in each of 3
experiments. **P<0.001
by ANOVA, comparing T4-treated and T4¨agarose-treated samples with PBS-treated
control
samples.
Figure 3. Comparison of the proangiogenic effects of FGF2 and T4. A, Tandem
effects of T4 (0.05 mon) and FGF2 (0.5 1.1g/mL) in submaximal concentrations
are additive
14
CA 02648243 2013-09-23
in the CAM assay and equal the level of angiogenesis seen with FGF2 (1 [i.g/mL
in the absence
of T4). B, Summary of results from 3 experiments that examined actions of FGF2
and T4 in the
CAM assay (means SEM) as in A. *13<0.05; **P<0.001, comparing results of
treated samples
with those of PBS-treated control samples in 3 experiments.
Figure 4. Effect of anti-FGF2 on angiogenesis caused by T4 or exogenous FGF2.
A, FGF2 caused a 2-fold increase in angiogenesis in the CAM model in 3
experiments, an
effect inhibited by antibody (ab) to FGF2 (8 lag). T4 also stimulated
angiogenesis 1.5-fold, and
this effect was also blocked by FGF2 antibody, indicating that the action of
thyroid hormone in
the CAM model is mediated by an autocrine/paracrine effect of FGF2 because T4
and T3 cause
FGF2 release from cells in the CAM model (Table 1). We have shown previously
that a
nonspecific IgG antibody has no effect on angiogenesis in the CAM assay. B,
Summary of
results from 3 CAM experiments that studied the action of FGF2-ab in the
presence of FGF2 or
T4. *P<0.01; **P<0.001, indicating significant effects in 3 experiments
studying the effects of
thyroid hormone and FGF2 on angiogenesis and loss of these effects in the
presence of
antibody to FGF2.
Figure 5. Effect of PD 98059, a MAPK (ERK1/2) signal transduction cascade
inhibitor, on angiogenesis induced by T4,T3, and FGF2. A, Angiogenesis
stimulated by T4
(0.1 mon) and T3 (1 nmol/L) together is fully inhibited by PD 98059 (3 !mon).
B,
Angiogenesis induced by FGF2 (1 lig/mL) is also inhibited by PD 98059,
indicating that the
action of the growth factor is also dependent on activation of the ERK1/2
pathway. In the
context of the experiments involving T4¨agarose (T4-ag) and tetrac (Figure2)
indicating that
T4 initiates its proangiogenic effect at the cell membrane, results shown in A
and B are
consistent with 2 roles played by MAPK in the proangiogenic action of thyroid
hormone:
ERK1/2 transduces the early signal of the hormone that leads to FGF2
elaboration and
transduces the subsequent action of FGF2 on angiogenesis. C, Summary of
results of 3
experiments, represented by A and B, showing the effect of PD98059 on the
actions of T4 and
FGF2 in the CAM model. *P<0.01; **P<0.001, indicating results of ANOVA on data
from 3
experiments.
Figure 6. T4 and FGF2 activate MAPK in ECV304 endothelial cells. Cells were
prepared in M199 medium with 0.25% hormone-depleted serum and treated with T4
(0.1
CA 02648243 2013-09-23
grnol/L) for 15 minutes to 6 hours. Cells were harvested and nuclear fractions
prepared as
described previously. Nucleoproteins, separated by gel electrophoresis, were
immunoblotted
with antibody to phosphorylated MAPK (pERK1 and pERK2, 44 and 42 kDa,
respectively),
followed by a second antibody linked to a luminescence-detection system. AP-
actin
immunoblot of nuclear fractions serves as a control for gel loading in each
part of this figure.
Each immunoblot is representative of 3 experiments. A, T4 causes increased
phosphorylation
and nuclear translocation of ERK1/2 in ECV304 cells. The effect is maximal in
30 minutes,
although the effect remains for >6 hours. B, ECV304 cells were treated with
the ERK1/2
activation inhibitor PD 98059 (PD; 30 mon) or the PKC inhibitor CGP41251
(CGP; 100
nmol/L) for 30 minutes, after which 10 -7 M T4 was added for 15 minutes to
cell samples as
shown. Nuclei were harvested, and this representative experiment shows
increased
phosphorylation (activation) of ERK1/2 by T4 (lane 4), which is blocked by
both inhibitors
(lanes 5 and 6), suggesting that PKC activity is a requisite for MAPK
activation by T4 in
endothelial cells. C, ECV304 cells were treated with either T4 (10 -7 mol/L),
FGF2 (10 ng/mL),
or both agents for 15 minutes. The figure shows pER1(1/2 accumulation in
nuclei with either
hormone or growth factor treatment and enhanced nuclear pERK1/2 accumulation
with both
agents together.
Figure 7. T4 increases accumulation of FGF2 cDNA in ECV304 endothelial cells.
Cells were treated for 6 to 48 hours with T4 (10 -7 mol/L) and FGF2 and GAPDH
cDNAs
isolated from each cell aliquot. The levels of FGF2 cDNA, shown in the top
blot, were
corrected for variations in GAPDHcDNA content, shown in the bottom blot, and
the corrected
levels of FGF2 are illustrated below in the graph (mean SE of mean; n = 2
experiments).
There was increased abundance of FGF2 transcript in RNA extracted from cells
treated with
T4 at all time points. *P<0.05; **P<0.01, indicating comparison by ANOVA of
values at each
time point to control value.
Figure 8. 7 Day Chick Embryo Tumor Growth Model. Illustration of the Chick
Chorioallantoic Membrane (CAM) model of tumor implant.
Figure 9. T4 Stimulates 3D Wound Healing. Photographs of human dermal
fibroblast cells exposed to T4 and control, according to the 3D Wound Healing
Assay
described herein.
16
CA 02648243 2013-09-23
Figure 10. T4 Dose-Dependently Increases Wound Healing, Day 3. As indicated by
the graph, T4 increases wound healing (measured by outmigrating cells) in a
dose-dependent
manner between concentrations of 0.1 M and 1.01.1M. This same increase is not
seen in
concentrations of T4 between 1.0pM and 3.0 M.
Figure 11. Effect of unlabeled T4 and T3 on "25-T4 binding to purified
integrin.
Unlabeled T4 (104M to 10-"M) or T3 (104M to 10-8M) were added to purified
aV133 integrin
(2m/sample) and allowed to incubate for 30 min. at room temperature. Two
microcuries of I-
125 labeled T4 was added to each sample. The samples were incubated for 20
min. at room
temperature, mixed with loading dye, and run on a 5% Native gel for 24 hrs. at
4 C at 45mA.
Following electrophoresis, the gels were wrapped in plastic wrap and exposed
to film. I-125_T4
binding to purified aVf33 is unaffected by unlabeled 14 in the range of 10-1'M
to 10-7M, but is
competed out in a dose-dependent manner by unlabeled 14 at a concentration of
10-6M. Hot 14
binding to the integrin is almost completely displaced by 10'M unlabeled 14.
13 is less
effective at competing out T4 binding to aVI33, reducing the signal by 11%,
16%, and 28% at
10-6m, 10-5M, and 10-4M 13, respectively.
Figure 12. Tetrac and an RGD containing peptide, but not an RGE containing
peptide compete out T4 binding to purified aVP3. A) Tetrac addition to
purified aV133
reduces 1-125-labeled 14 binding to the integrin in a dose dependent manner.
10-8M tetrac is
ineffective at competing out hot 14 binding to the integrin. The association
of T4 and aVI33
was reduced by 38% in the presence of 10-7M tetrac and by 90% with 10-5M
tetrac. Addition
of an RGD peptide at 10-5M competes out 14 binding to aVf33. Application of 10-
5M and 10-
4M RGE peptide, as a control for the RGD peptide, was unable to diminish hot
14 binding to
purified aVI33. B) Graphical representation of the tetrac and RGD data from
panel A. Data
points are shown as the mean S.D. for 3 independent experiments.
Figure 13. Effects of the monoclonal antibody LM609 on T4 binding to aV113. A)
LM609 was added to aVf33 at the indicated concentrations. One fig of LM609 per
sample
reduces "25-labeled 14 binding to the integrin by 52%. Maximal inhibition of
14 binding to the
integrin is reached when concentrations of LM609 are 2pg per sample and is
maintained with
antibody concentrations as high as iktg. As a control for antibody
specificity, 10m/sample
Cox-2 mAB and 10fig/sample mouse IgG were added to aVf33 prior to incubation
with T4 B)
17
CA 02648243 2013-09-23
Graphical representation of data from panel A. Data points are shown as the
mean S.D. for 3
independent experiments.
Figure 14. Effect of RGD, RGE, tetrac, and the mAB LM609 on T4-induced
MAPK activation. A) CV-1 cells (50-70% confluency) were treated for 30 min.
with 10-7 M
T4 (10-v M total concentration, 10-1 M free concentration. Selected samples
were treated for 16
hrs with the indicated concentrations of either an RGD containing peptide, an
RGE containing
peptide, tetrac, or LM609 prior to the addition of 14. Nuclear proteins ere
separated by SDS-
PAGE and immunoblotted with anti-phospho-MAPK (pERK1/2) antibody. Nuclear
accumulation of pERK1/2 is diminished in samples treated with 10-6 M RGD
peptide or higher,
but not significantly altered in samples treated with 10-4 M RGE. pERK1/2
accumulation is
decreased 76% in CV1 cells treated with 10-6M tetrac, while 10-5M and higher
concentrations
of tetrac reduce nuclear accumulation of pERK1/2 to levels similar to the
untreated control
samples. The monoclonal antibody to aV133 LM609 decrease accumulation of
activated
MAPK in the nucleus when it is applied to CV1 cultures a concentration of
11g/ml. B)
Graphical representation of the data for RGD, RGE, and tetrac shown in panel
A. Data points
represent the mean S.D. for 3 separate experiments.
Figure 15. Effects of siRNA to aV and 133 on T4 induced MAPK activation. CV1
cells were transfected with siRNA (100 nM final concentration) to aV, 133, or
aV and (33
together. Two days after transfection, the cells were treated with 10-7M 14.
A) RT-PCR was
performed from RNA isolated from each transfection group to verify the
specificity and
functionality of each siRNA. B) Nuclear proteins from each transfection were
isolated and
subjected to SDS-PAGE.
Figure 16. Inhibitory Effect of aVI33 mAB (LM609) on T4-stimulated
Angiogenesis
in the CAM Model. A) Samples were exposed to PBS, T4 (0.1 p,M), or T4 plus
10mg/m1
LM609 for 3 days. Angiogenesis stimulated by T4 is substantially inhibited by
the addition of
the aVI33 monoclonal antibody LM609. B) Tabulation of the mean SEM of new
branches
formed from existing blood vessels during the experimental period. Data was
drawn from 3
separate experiments, each containing 9 samples in each treatment group. C, D)
Angiogenesis
stimulated by T4 or FGF2 is also inhibited by the addition of the aV133
monoclonal antibody
LM609 or XT 199.
18
CA 02648243 2013-09-23
Figure 17. Polymer Compositions of Thyroid Hormone Analogs - Polymer
Conjugation Through an Ester Linkage Using Polyvinyl Alcohol. In this
preparation
commercially available polyvinyl alcohol (or related co-polymers) can be
esterified by
treatment with the acid chloride of thyroid hormone analogs, namely the acid
chloride form.
The hydrochloride salt is neutralized by the addition of triethylamine to
afford triethylamine
hydrochloride which can be washed away with water upon precipitation of the
thyroid hormone
ester polymer form for different analogs. The ester linkage to the polymer may
undergo
hydrolysis in vivo to release the active pro-angiogenesis thyroid hormone
analog.
Figure 18. Polymer Compositions of Thyroid Hormone Analogs - Polymer
Conjugation Through an Anhydride Linkage Using Acrylic Acid Ethylene Co-
polymer.
This is similar to the previous polymer covalent conjugation however this time
it is through an
anhydride linkage that is derived from reaction of an acrylic acid co-polymer.
This anhydride
linkage is also susceptible to hydrolysis in vivo to release thyroid hormone
analog.
Neutralization of the hydrochloric acid is accomplished by treatment with
triethylamine and
subsequent washing of the precipitated polyanhydride polymer with water
removes the
triethylamine hydrochloride byproduct. This reaction will lead to the
formation of Thyroid
hormone analog acrylic acid co-polymer + triethylamine. Upon in vivo
hydrolysis, the thyroid
hormone analog will be released over time that can be controlled plus acrylic
acid ethylene Co-
polymer.
Figure 19. Polymer Compositions of Thyroid Hormone Analogs - Entrapment in a
Polylactic Acid Polymer. Polylactic acid polyester polymers (PLA) undergo
hydrolysis in
vivo to the lactic acid monomer and this has been exploited as a vehicle for
drug delivery
systems in humans. Unlike the prior two covalent methods where the thyroid
hormone analog
is linked by a chemical bond to the polymer, this would be a non-covalent
method that would
encapsulate the thyroid hormone analog into PLA polymer beads. This reaction
will lead to the
formation of Thyroid hormone analog containing PLA beads in water. Filter and
washing will
result in the formation of thyroid hormone analog containing PLA beads, which
upon in vivo
hydrolysis will lead to the generation of controlled levels of thyroid hormone
plus lactic acid.
19
CA 02648243 2013-09-23
Figure 20. Thyroid Hormone Analogs Capable of Conjugation with Various
Polymers. A-D show substitutions required to achieve various thyroid hormone
analogs which
can be conjugated to create polymeric forms of thyroid hormone analogs of the
invention.
Figure 21. In vitro 3-D Angiogenesis Assay Figure 21 is a protocol and
illustration
of the three-dimensional in vitro sprouting assay for human micro-vascular
endothelial on
fibrin-coated beads.
Figure 22. In Vitro Sprout Angiogenesis of HOMEC in 3-D Fibrin Figure 22 is an
illustration of human micro-vascular endothelial cell sprouting in three
dimensions under
different magnifications
Figures 23A-E. Release of platelet-derived wound healing factors in the
presence
of low level collagen
Figures 24A-B. Unlabeled T4 and T3 displace [125I]-T4 from purified integrin.
Unlabeled T4 (10" M to 10-4 M) orT3 (10-8 to 1 0-4 M) were added to purified
ocV(33 integrin (2
p,g/sample) prior to the addition of [12511-T4 (a) [125I]-T4 binding to
purified aVi33 was
unaffected by unlabeled T4 in the range of 10-11 M to 10-7 M, but was
displaced in a
concentration-dependent manner by unlabeled T4 at concentrations > 1 0-6 M. T3
was less
effective at displacing T4 binding to aVi33. (b) Graphic presentation of the
T4and T3 data
shows the mean S.D. of 3 independent experiments.
Figures 25A-B. Tetrac and an RGD-containing peptide, but not an RGE-containing
peptide, displace T4 binding to purified aVI33. (a) Pre-incubation of purified
aV133 with tetrac
or an RGD-containing peptide reduced the interaction between the integrin and
[125I]-T4 in a
dose-dependent manner. Application of 10-5 M and 10-4 M RGE peptide, as
controls for the
RGD peptide, did not diminish labeled T4 binding to purified cc\/33. (b)
Graphic presentation
of the tetrac and RGD data indicates the mean S.D. of results from 3
independent
experiments.
Figures 26A-B. Integrin antibodies inhibit T4 binding to aV[33. The antibodies
LM609
and SC73 12 were added to aV[33 at the indicated concentrations ( g/m1) 30 min
prior to the
addition of [125I]-T4. Maximal inhibition of T4 binding to the integrin was
reached when the
concentration of LM609 was 2 pg/m1 and was maintained with antibody
concentrations as high
CA 02648243 2013-09-23
as 8 Kg/ml. SC7312 reduced T4 binding to aV133 by 46% at 2 ig/m1
antibody/sample and by
58% when 81.1g/m1 of antibody were present. As a control for antibody
specificity, 10 tig/ml of
anti-aV133 mAb (P1F6) and 10 ig/m1 mouse IgG were added to aV133 prior to
incubation with
T4. The graph shows the mean S.D. of data from 3 independent experiments.
Figures 27A-B. Effect of RGD and RGE peptides, tetrac, and the mAb LM609 on T4-
induced MAPK activation. (a) Nuclear accumulation of pERK1/2 was diminished in
samples
treated with 10-6 M RGD peptide or higher, but not significantly altered in
samples treated with
up tole M RGE. pERK1/2 accumulation in CV-1 cells treated with 10-5 M tetrac
and T4 were
similar to levels observed in the untreated control samples. LM609, a
monoclonal antibody to
aV133, decreased accumulation of activated MAPK in the nucleus when it was
applied to CV-1
cultures in a concentration of 1 fig/ml. (b) The graph shows the mean S.D.
of data from 3
separate experiments. Immunoblots with a-tubulin antibody are included as gel-
loading
controls.
Figures 28A-B. Effects of siRNA to aV and 133 on T4-induced MAPK activation.
CV-
1 cells were transfected with siRNA (100 nM final concentration) to aV, 133,
or aV and 133
together. Two days after transfection, the cells were treated with 10-7 M T4
or the vehicle
control for 30 min. (a) RT-PCR was performed with RNA isolated from each
transfection
group to verify the specificity and functionality of each siRNA. (b) Nuclear
proteins from each
set of transfected cells were isolated, subjected to SDS-PAGE, and probed for
pERK1/2 in the
presence or absence of treatment with T4. In the parental cells and in those
treated with
scrambled siRNA, nuclear accumulation of pERK1/2 with T4 was evident. Cells
treated with
siRNA to aV or 133 showed an increase in pERK1/2 in the absence of T4, and a
decrease with
T4 treatment. Cells containing aV and 133 siRNAs did not respond to T4
treatment.
Figures 29A-B. Inhibitory effect of aV133 mAb (LM609) on T4-stimulated
angiogenesis in the CAM model. CAMS were exposed to filter disks treated with
PBS, T4 (10-
7 M),or T4 plus10 fig/m1 LM609 for 3 days. (a) Angiogenesis stimulated by T4
was
substantially inhibited by the addition of the aV133 monoclonal antibody
LM609. (b)
Tabulation of the mean SEM of new branches formed fiom existing blood
vessels during the
experimental period is shown. ***P<0.001, comparing results of T4/LM609-
treated samples
21
CA 02648243 2013-09-23
with T4-treated samples in 3 separate experiments, each containing 9 images
per treatment
group. Statistical analysis was performed by 1-way ANOVA.
Figure 30. Depicts the ability of tetraiodothyroacetic acid (tetrac) to
inhibit the action of
T4, T3 and iodothyronines to the integrin receptor.
Figure 31a. Depict results of Tetrac doped nanoparticles coated with PVA and
examined
for the optimum loading and zeta potential of Tetrac.
Figure 31b. Depicts the results the amount of Tetrac encapsulated in a
nanoparticle using
of PLGA nanoparticles coated with Tween-80 and prepared by single emulsion
method using
polyvinyl alcohol (PVA) as a stabilizer. The size of the nanoparticles were
determined by using
dynamic light scatter.
Figure 32. Depicts a structural representation of a Tetrac conjugated
to a nanopolymer
via an ester linkage.
Figure 33a. Depicts depicts the size distribution spectra of PLGA
nanoparticles
encapsulating Tetrac (no stabilizer used) and FIGURE33b depcits the size
distribution of PLGA
nanoparticles encapsulating Tetrac with 1% PVA solution used as a stabilizer.
Figure 33b. Depicts the size distribution of PLGA nanoparticles encapsulating
Tetrac
with 1% PVA solution used as a stabilizer.
Figure 34. Depicts results of CAM model studies of b-FGF-induced
angiogenesis
demonstrating potent anti-angiogenesis efficacy for free tetrac and Tetrac -
PLGA Nanoparticles.
Figure 35. Depicts a schematic diagram for the preparation of PLGA
nanoparticles co-
encapsulating tetrac and Temozolomide.
Figure 36a. Depicts Collagen-hydroxypatite nanospheres prepared by using water-
in-oil
emulsion methods, then, conjugating the nanoparticles to thyroxine (T4) using
the carbidiimide
chemistry.
Figure 36b. Depicts the preliminary release kinetics demonstrating that
biodegradable
nanoparticles are capable of releasing encapsulated materials.
Figure 37a. Depicts chromatographs and spectra of a T4 standard, 501IM diluted
with
water and T4-collagen nanoparticle samples eluted on C18 column, DWL:225nm.
22
CA 02648243 2013-09-23
Figure 37b. Depicts the chromatographs and spectra results of a T4 collagen
nanoparticle
diluted with water and then filtrated through a 300KD membrane.
Figure 38a. Depicts chromatographs and spectra of 14 standard. 5011M diluted
with .5
NAOH.
Figure 38b. Depicts chromatographs and spectra of T4-collagen nanoparticles
incubated
with .5M NAOH for 2 hours and then filtrated through a 300KD membrane.
Figure 39a. Depicts a schmatic diagram of the preparation of GC1 encapsulated
PEG-
PGLA nanoparticles.
Figure 39b. Depicts a schematic diagram for the preparation of 13 encapsulated
PEG-
PGLA nanoparticles.
Figures 40a to 40c. Depict a schematic representation showing synthesis of
different
kinds of TETRAC encapsulated Nanoparticles and their surface modification.
Figure 41. Depicts the resulting measurements of nanoparticles purified
by dialysis
for about 12 hours by using appropriate dialysis membrane. The addition of the
stabilizer gives
the monodispersity and stability to the nanoparticles in aqueous solution. The
size distribution
and zeta potential were determined using zeta size analyzer.
Figure 42. Depicts FGF2 (1 ,g/m1) placed on the CAM filter disk induced
blood
vessel branch formation by 2.4-fold (P < 0.001) compared with PBS-treated
membranes. The
addition of tetrac (75ng/filter disc) inhibited the proangiogenic response to
FGF2, while tetrac
alone had no effect on angiogenesis.
Figure 43. Depicts a tetrac dose response curve used to find maximum
inhibition of
FGF2 stimulated angiogenesis.
Figure 44. Depicts test results studying the inhibition of Tetrac on
the pro-
angiogenic effect of VEGF and 13.
Figure 45. Depicts results of Tetrac inhibition on tube formation.
Figure 46. Depicts a visual representation of the graphically presented
results of
Figure 45.
Figures 47a and 47b. Depict the results of the effects of tetrac inhibition on
mRNA
and gene expression.
23
CA 02648243 2013-09-23
Figures 48a and 48b. Depict the results of the effects of tetrac inhibition on
mRNA
expression of angiopoietin-2 in a dose response fashion that the inhibition
did not effect the
mRNA levels of angiopoietin-1.
Figures 49a to 49c. Depicts the results of the Affymetrix GeneChip analysis.
Figures 50a to 50d. Depicts the results of microarray experiments to examine
changes
in MMP expression following VEGF treatment with and without tetrac.
Figure 51. Depicts a synthesis schematic using a long alipathic group
and palmitoyl
chloride.
Figure 52. Depicts a synthesis schematic of the conjugation of T4-Boc
to polyarginine.
Figure 53. Depicts a method for using PEG-PLGA nanoparticles to
encapsulate N-
protected 14 are prepared by single emulsion method.
Figure 54. Depict the results of testing PRIAB1 using chlorioallantoic
membrane
(CAM) assay before conjugation to T4.
DETAILED DESCRIPTION OF THE INVENTION
Disclosed herein are a new class of thyroid hormone molecules that act on the
cell-
surface, termed "Thyro-integrin molecules." These molecules selectively
activate the receptor
on the cell surface. Thyroid hormone is pro-angiogenic, acting via a mechanism
that is
mitogen-activated protein kinase (MAPK/ERK1/2)- and fibroblast growth factor
(FGF2)-
dependent.
Effects of the hormone on tumor cells are mediated by a novel cell surface
receptor on integrin
aVb3. Our recent discovery that thyroid hormone acts by means of this receptor
located at the
plasma membrane of cells has led to the discovery that polymer-conjugated
thyroid hormone
analogs and nanoparticluate thyroid hormone analogs can bind to the cell
surface receptior
while not being able to enter the cell.
Within the scope of the present invention are nanoparticulate thyroid hormone
analogs
and polymer conjugates thereof that cannot gain access to the cell interior
and whose activities
24
CA 02648243 2013-09-23
must therefore be limited to the integrin receptor. The nanoparticulate
hormone analogs are
polylysyl glycolic acid (PLGA) derivatives, either esters or the more stable
ether-bond
formulations. Agarose-T4 is a model of the nanoparticulate that we have shown
to be fully
active at the integrin receptor. The reformulated hormone analogs will not
express intracellular
actions of the hormone and thus if absorbed into the circulation will not have
systemic thyroid
hormone analog actions.
The molecules of the present invention can thus selectively activate the
receptor. When
this receptor is activated, a cascade of changes in protein mediators takes
place, culminating in
a signal which can modify the activity of nuclear transactivator proteins,
such as STAT
proteins, p53 and members of the superfamily of nuclear hormone receptors.
Nongenomic actions of thyroid hormone are those which are independent of
intranuclear binding of hormone by the nuclear T3 receptor (TR). These actions
are initiated
largely at the cell surface. By conjugating known thyroid hormone analogs to
synthetic
polymers, a new family of hormones is created that acts exclusively at the
cell surface receptor,
but allows endogenous hormone to continue to enter the cell and act on
mitochondria or
directly on nuclear TR. Depending upon the hormone analogue that is
conjugated, angiogenesis
or wound-healing can be supported or actions on tumor cell growth and
angiogenesis can be
antagonized.
Decribed in detail below are formulations and uses of the thyroid hormone
polymer
conjugates and nanoparticles within the scope of the present invention.
Definitions
For convenience, certain terms used in the specification, examples and claims
are
collected here. Unless otherwise defined, all technical and scientific terms
used herein have the
same meaning as commonly understood by one of ordinary skill in the art to
which this
invention pertains.
As used herein, the term "angiogenic agent" includes any compound or substance
that
promotes or encourages angiogenesis, whether alone or in combination with
another substance.
Examples include, but are not limited to, T3, T4, T3 or T4-agarose, polymeric
analogs of T3,
T4, 3,5-dimethy1-4-(4'-hydroy-3'-isopropylbenzy1)-phenoxy acetic acid (GC-1),
or DITPA. In
CA 02648243 2013-09-23
contrast, the terms "anti-angiogenesis agent" or anti-angiogenic agent" refer
to any compound
or substance that inhibits or discourages angiogenesis, whether alone or in
combination with
another substance. Examples include, but are not limited to, TETRAC, TRIAC, XT
199, and
mAb LM609.
As used herein, the term "myocardial ischemia" is defined as an insufficient
blood
supply to the heart muscle caused by a decreased capacity of the heart
vessels. As used herein,
the term "coronary disease" is defined as diseases/disorders of cardiac
function due to an
imbalance between myocardial function and the capacity of coronary vessels to
supply
sufficient blood flow for normal function. Specific coronary
diseases/disorders associated with
coronary disease which can be treated with the compositions and methods
described herein
include myocardial ischemia, angina pectoris, coronary aneurysm, coronary
thrombosis,
coronary vasospasm, coronary artery disease, coronary heart disease, coronary
occlusion and
coronary stenosis.
As used herein the term "occlusive peripheral vascular disease" (also known as
peripheral arterial occlusive disorder) is a vascular disorder-involving
blockage in the carotid or
femoral arteries, including the iliac artery. Blockage in the femoral arteries
causes pain and
restricted movement. A specific disorder associated with occlusive peripheral
vascular disease
is diabetic foot, which affects diabetic patients, often resulting in
amputation of the foot.
As used herein the terms "regeneration of blood vessels," "angiogenesis,"
"revascularization," and "increased collateral circulation" (or words to that
effect) are
considered as synonymous. The term "pharmaceutically acceptable" when
referring to a natural
or synthetic substance means that the substance has an acceptable toxic effect
in view of its
much greater beneficial effect, while the related the term, "physiologically
acceptable," means
the substance has relatively low toxicity. The term, "co-administered" means
two or more
drugs are given to a patient at approximately the same time or in close
sequence so that their
effects run approximately concurrently or substantially overlap. This term
includes sequential
as well as simultaneous drug administration.
"Pharmaceutically acceptable salts" refers to pharmaceutically acceptable
salts of
thyroid hormone analogs, polymeric forms, and derivatives, which salts are
derived from a
variety of organic and inorganic counter ions well known in the art and
include, by way of
26
CA 02648243 2013-09-23
example only, sodium, potassium, calcium, magnesium, ammonium, tetra-alkyl
ammonium,
and the like; and when the molecule contains a basic functionality, salts of
organic or inorganic
acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate,
maleate, oxalate and the
like can be used as the pharmaceutically acceptable salt. The term also
includes both acid and
base addition salts.
"Pharmaceutically acceptable acid addition salt" refers to those salts which
retain the
biological effectiveness and properties of the free bases, which are not
biologically or otherwise
undesirable, and which are formed with inorganic acids such as hydrochloric
acid, hydrobromic
acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic
acids such as acetic
acid, propionic acid, pyruvic acid, maleic acid, malonic acid, succinic acid,
fumaric acid,
tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid,
ethanesulfonic acid,
p-toluenesulfonic acid, salicylic acid, and the like. Particularly preferred
salts of compounds of
the invention are the monochloride salts and the dichloride salts.
"Pharmaceutically acceptable base addition salt" refers to those salts which
retain the
biological effectiveness and properties of the free acids, which are not
biologically or otherwise
undesirable. These salts are prepared from addition of an inorganic base or an
organic base to
the free acid. Salts derived from inorganic bases include, but are not limited
to, the sodium,
potassium, lithium, ammonium, calcium, magnesium, zinc, aluminum salts and the
like.
Preferred inorganic salts are the ammonium, sodium, potassium, calcium, and
magnesium salts.
Salts derived from organic bases include, but are not limited to, salts of
primary, secondary,
and tertiary amines, substituted amines including naturally occurring
substituted amines, cyclic
amines and basic ion exchange resins, such as isopropylamine, trimethylamine,
diethylamine,
triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, 2-
diethylaminoethanol,
trimethamine, dicyclohexylamine, lysine, arginine, histidine, caffeine,
procaine, hydrabamine,
choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine,
purines,
piperazine, piperidine, N-ethylpiperidine, polyamine resins and the like.
Particularly preferred
organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine,
dicyclohexylamine, choline and caffeine.
"Ureido" refers to a radical of the formula --N(H)--C(0)--NH2.
It is understood from the above definitions and examples that for radicals
containing a
27
CA 02648243 2013-09-23
substituted alkyl group any substitution thereon can occur on any carbon of
the alkyl group.
The compounds of the invention, or their pharmaceutically acceptable salts,
may have
asymmetric carbon atoms in their structure. The compounds of the invention and
their
pharmaceutically acceptable salts may therefore exist as single enantiomers,
diastereoisomers,
racemates, and mixtures of enantiomers and diastereomers. All such single
enantiomers,
diastereoisomers, racemates and mixtures thereof are intended to be within the
scope of this
invention. Absolute configuration of certain carbon atoms within the
compounds, if known, are
indicated by the appropriate absolute descriptor R or S.
Separate enantiomers can be prepared through the use of optically active
starting
materials and/or intermediates or through the use of conventional resolution
techniques, e.g.,
enzymatic resolution or chiral HPLC.
As used herein, the phrase "growth factors" or "neurogenesis factors" refers
to
proteins, peptides or other molecules having a growth, proliferative,
differentiative, or trophic
effect on cells of the CNS or PNS. Such factors may be used for inducing
proliferation or
differentiation and can include, for example, any trophic factor that allows
cells of the CNS or
PNS to proliferate, including any molecule which binds to a receptor on the
surface of the cell
to exert a trophic, or growth-inducing effect on the cell. Preferred factors
include, but are not
limited to, nerve growth factor ("NGF"), epidermal growth factor ("EGF"),
platelet-derived
growth factor ("PDGF"), insulin-like growth factor ("IGF"), acidic fibroblast
growth fator
("aFGF" or "FGF-1"), basic fibroblast growth factor ("bFGF" or "FGF-2"), and
transforming
growth factor-alpha and -beta ("TGF-a" and "TGF-r3").
"Subject" includes living organisms such as humans, monkeys, cows, sheep,
horses,
pigs, cattle, goats, dogs, cats, mice, rats, cultured cells therefrom, and
transgenic species
thereof. In a preferred embodiment, the subject is a human. Administration of
the
compositions of the present invention to a subject to be treated can be
carried out using known
procedures, at dosages and for periods of time effective to treat the
condition in the subject. An
effective amount of the therapeutic compound necessary to achieve a
therapeutic effect may
vary according to factors such as the age, sex, and weight of the subject, and
the ability of the
therapeutic compound to treat the foreign agents in the subject. Dosage
regimens can be
adjusted to provide the optimum therapeutic response. For example, several
divided doses may
28
CA 02648243 2013-09-23
be administered daily or the dose may be proportionally reduced as indicated
by the exigencies
of the therapeutic situation.
"Administering" includes routes of administration which allow the compositions
of the
invention to perform their intended function, e.g., promoting angiogenesis. A
variety of routes
of administration are possible including, but not necessarily limited to
parenteral (e.g.,
intravenous, intra-arterial, intramuscular, subcutaneous injection), oral
(e.g., dietary), topical,
nasal, rectal, or via slow releasing microcaiTiers depending on the disease or
condition to be
treated. Oral, parenteral and intravenous administration are preferred modes
of administration.
Formulation of the compound to be administered will vary according to the
route of
administration selected (e.g., solution, emulsion, gels, aerosols, capsule).
An appropriate
composition comprising the compound to be administered can be prepared in a
physiologically
acceptable vehicle or carrier and optional adjuvants and preservatives. For
solutions or
emulsions, suitable carriers include, for example, aqueous or
alcoholic/aqueous solutions,
emulsions or suspensions, including saline and buffered media, sterile water,
creams,
ointments, lotions, oils, pastes and solid carriers. Parenteral vehicles can
include sodium
chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated
Ringer's or fixed
oils. Intravenous vehicles can include various additives, preservatives, or
fluid, nutrient or
electrolyte replenishers (See generally, Remington 's Pharmaceutical Science,
16th Edition,
Mack, Ed. (1980)).
"Effective amount" includes those amounts of pro-angiogenic or anti-angiogenic
compounds which allow it to perform its intended function, e.g., promoting or
inhibiting
angiogenesis in angiogenesis-related disorders as described herein. The
effective amount will
depend upon a number of factors, including biological activity, age, body
weight, sex, general
health, severity of the condition to be treated, as well as appropriate
pharmacokinetic
properties. For example, dosages of the active substance may be from about
0.01mg/kg/day to
about 500mg/kg/day, advantageously from about 0.1mg/kg/day to about
100mg/kg/day. A
therapeutically effective amount of the active substance can be administered
by an appropriate
route in a single dose or multiple doses. Further, the dosages of the active
substance can be
proportionally increased or decreased as indicated by the exigencies of the
therapeutic or
prophylactic situation.
29
CA 02648243 2013-09-23
"Pharmaceutically acceptable carrier" includes any and all solvents,
dispersion media,
coatings, antibacterial and antifungal agents, isotonic and absorption
delaying agents, and the
like which are compatible with the activity of the compound and are
physiologically acceptable
to the subject. An example of a pharmaceutically acceptable carrier is
buffered normal saline
(0.15M NaC1). The use of such media and agents for pharmaceutically active
substances is
well known in the art. Except insofar as any conventional media or agent is
incompatible with
the therapeutic compound, use thereof in the compositions suitable for
pharmaceutical
administration is contemplated. Supplementary active compounds can also be
incorporated
into the compositions.
"Additional ingredients" include, but are not limited to, one or more of the
following:
excipients; surface active agents; dispersing agents; inert diluents;
granulating and
disintegrating agents; binding agents; lubricating agents; sweetening agents;
flavoring agents;
coloring agents; preservatives; physiologically degradable compositions such
as gelatin;
aqueous vehicles and solvents; oily vehicles and solvents; suspending agents;
dispersing or
wetting agents; emulsifying agents, demulcents; buffers; salts; thickening
agents; fillers;
emulsifying agents; antioxidants; antibiotics; antifungal agents; stabilizing
agents; and
pharmaceutically acceptable polymeric or hydrophobic materials. Other
"additional
ingredients" which may be included in the pharmaceutical compositions of the
invention are
known in the art and described, e.g., in Remington 's Pharmaceutical Sciences.
Thyro-integrin molecules
The Role of Thyroid Hormone, Analogs, and Polymeric Conjugations in Modulating
the
Actions of Polypeptides Whose Cell Surface Receptors are Clustered Around
Integrin ccv133, or
other RGD-containing Compounds
Disclosed herein are a new class of thyroid hormone molecule that work on the
cell-
surface, termed "Thyro-integrin molecules." These molecules selectively
activate the cell
surface receptor for thyroid hormone (L-thyroxine, T4; T3) that has been
described on integrin
aVf33. The receptor is at or near the Arg-Gly-Asp (RGD) recognition site on
the integrin. The
ccV133 receptor is not a homologue of the nuclear thyroid hormone receptor
(TR), but activation
of the cell surface receptor results in a number of nucleus-mediated events,
including the
CA 02648243 2013-09-23
recently-reported pro-angiogenic action of the hormone and fibroblast
migration in vitro in the
human dermal fibroblast monolayer model of wound-healing.
Integrin aV133 is a heterodimeric plasma membrane protein with several
extracellular
matrix protein ligands containing an an amino acid sequence Arg-Gly-Asp
("RGD"). Using
purified integrin, we discovered that integrin aVP3 binds T4 and that this
interaction is
perturbed by ccV133 antagonists. Radioligand-binding studies revealed that
purified aVI33 binds
T4 with high affinity (EC50, 371 pM), and appears to bind T4 preferentially
over T3. This is
consistent with previous reports that show MAPK activation and nuclear
translocation, as well
as hormone-induced angiogenesis, by T4, compared to T3. Integrin aV(33
antagonists inhibit
binding of T4 to the integrin and, importantly, prevent activation by T4 of
the MAPK signaling
cascade. This functional consequence-MAPK activation--of hormone-binding to
the integrin,
together with inhibition of the MAPK-dependent pro- angiogenic action of
thyroid hormone by
integrin aV133 antagonists, allow us to describe the iodothyronine-binding
site on the integrin
as a receptor. It should be noted that 3-iodothyronamine, a thyroid hormone
derivative, may
bind to a trace amine receptor (TAR I), but the actions of this analog
interestingly are antithetic
to those of T4 and T3.
The traditional ligands of integrins are proteins. That a small molecule,
thyroid
hormone, is also a ligand of an integrin is a novel finding. The present
invention also discloses
that, resveratrol, a polyphenol with some estrogenic activity, binds to
integrin aV133 with a
functional cellular consequence, apoptosis, different from those that result
from the binding of
thyroid hormone. The site on the integrin at which T4 binds is at or near the
RGD binding
groove of the heterodimeric integrin. It is possible, however, that aV(33
binds T4 elsewhere on
the protein and that the occupation of the RGD recognition site by tetrac or
by RGD-containing
peptides allosterically blocks the T4 binding site or causes a conformational
change within the
integrin that renders the T4 site unavailable.
Accordingly, the modulation by T4 of the laminin-integrin interaction of
astrocytes may be a
consequence of binding of the hormone to the integrin. The possibility thus
exists that at the
cell exterior thyroid hormone may affect the liganding by integrin aVi33 of
extracellular matrix
proteins in addition to laminin.
31
CA 02648243 2013-09-23
Actions of T4 that are nongenomic in mechanism have been well documented in
recent
years. A number of these activities are MAPK-mediated. We have shown that
initial steps in
activation of the MAPK cascade by thyroid hormone, including activation of
protein kinase C,
are sensitive to GTPyS and pertussis toxin, indicating that the plasma
membrane receptor for
thyroid hormone is G protein-sensitive. It should be noted that certain
cellular functions
mediated by integrin aV133 have been shown by others to be G protein-
modulated. For
example, site-directed mutagenesis of the RGD binding domain abolishes the
ability of the
nucleotide receptor P2Y2 to activate Go, while the activation of Gq, was not
affected. It has
been demonstrated that an integrin-associated protein, IAP/CD47, induced
smooth muscle cell
migration via Grmediated inhibition of MAPK activation.
In addition to linking the binding of 14 and other analogs by integrin aV133
to
activation of a specific intracellular signal transduction pathway, the
present invention also
discloses that the liganding of the hormone by the integrin is critical to
induction by 14 of
MAPK-dependent angiogenesis. In the CAM model, significant vessel growth
occurs after 48-
72 h of T4 treatment, indicating that the plasma membrane effects of 14 can
result in complex
transcriptional changes. Thus, what is initiated as a nongenomic action of the
hormone--
transduction of the cell surface T4 signal--interfaces with genomic effects of
the hormone that
culminate in neovascularization. Interfaces of nongenomic and genomic actions
of thyroid
hormone have previously been described, e.g., MAPK-dependent phosphorylation
at Ser-142 of
TR131 that is initiated at the cell surface by 14 and that results in shedding
by TR of corepressor
proteins and recruitment of coactivators. The instant invention also discloses
that 14 stimulates
growth of C-6 glial cells by a MAPK-dependent mechanism that is inhibited by
RGD peptide,
and that thyroid hormone causes MAPK-mediated serine- phosphorylation of the
nuclear
estrogen receptor (ERa) in MCF-7 cells by a process we now know to be
inhibitable by an
RGD peptide. These findings in several cell lines all support the
participation of the integrin in
functional responses of cells to thyroid hormone.
Identification of aV(33 as a membrane receptor for thyroid hormoneindicates
clinical
significance of the interaction of the integrin and the hormone and the
downstream
consequence of angiogenesis. For example, aV133 is overexpressed in many
tumors and this
32
CA 02648243 2013-09-23
overexpression appears to play a role in tumor invasion and growth. Relatively
constant
circulating levels of thyroid hormone can facilitate tumor-associated
angiogenesis. In addition
to demonstrating the pro-angiogenic action of T4 in the CAM model here and
elsewhere, the
present invention also discloses that human dermal microvascular endothelial
cells also form
new blood vessels when exposed to thyroid hormone. Local delivery of aVf33
antagonists or
tetrac around tumor cells might inhibit thyroid hormone- stimulated
angiogenesis. Although
tetrac lacks many of the biologic activities of thyroid hormone, it does gain
access to the
interior of certain cells. Anchoring of tetrac, or specific RGD antagonists,
to non-immunogenic
substrates (agarose or polymers) would exclude the possibility that the
compounds could cross
the plasma membrane, yet retain as shown here the ability to prevent T4-
induced angiogenesis.
The agarose-T4 used in the present studies is thus a prototype for a new
family of thyroid
hormone analogues that have specific cellular effects, but do not gain access
to the cell interior.
Accordingly, the Examples herein identify integrin aV133 as a cell surface
receptor for
thyroid hormone (L-thyroxine, T4) and as the initiation site for T4-induced
activation of
intracellular signaling cascades. ocVf33 dissociably binds radiolabeled T4
with high affinity;
radioligand-binding is displaced by tetraiodothyroacetic acid (tetrac), aVf33
antibodies and by
an integrin RGD recognition site peptide. CV-1 cells lack nuclear thyroid
hormone receptor but
bear plasma membrane aV133; treatment of these cells with physiological
concentrations of T4
activates the MAPK pathway, an effect inhibited by tetrac, RGD peptide and
ocV133 antibodies.
Inhibitors of T4-binding to the integrin also block the MAPK-mediated pro-
angiogenic action
of T4. T4-induced phosphorylation of MAPK is blocked by siRNA knockdown of aV
and 133.
These findings indicate that T4 binds to aV133 near the RGD recognition site
and show that
hormone-binding to aVf33 has physiologic consequences.
The compositions of the present invention are based, in part, on the discovery
that
thyroid hormone, thyroid hormone analogs, and their polymeric forms, act at
the cell membrane
level and have pro-angiogenic properties that are independent of the nuclear
thyroid hormone
effects. Accordingly, these thyroid hormone analogs and polymeric forms (i.e.,
angiogenic
agents) can be used to treat a variety of disorders. Similarly, the invention
is also based on the
discovery that thyroid hormone analog antagonists inhibit the pro-angiogenic
effect of such
33
CA 02648243 2013-09-23
analogs, and can also be used to treat a variety of disorders. These
compositions and methods
of use therefore are described in detail below.
Compositions
Disclosed herein are angiogenic and anti-angiogenic agents comprising thyroid
hormones, analogs thereof, polymer conjugations, and nanoparticles of the
hormones and their
analogs. The disclosed compositions can be used for promoting angiogenesis to
treat disorders
wherein angiogenesis is beneficial. Additionally, the inhibition of these
thyroid hormones,
analogs and polymer conjugations can be used to inhibit angiogenesis to treat
disorders
associated with such undesired angiogenesis. As used herein, the term
"angiogenic agent"
includes any compound or substance that promotes or encourages angiogenesis,
whether alone
or in combination with another substance.
Pro-angiogenic agents of the present invention are thyroid hormone agonists
and
include thyroid hormone, analogs, and derivatives either alone or in covalent
or non-covalent
conjugation with polymers. Examples include, but are not limited to, T3, T4,
T3 or T4-
agarose, polymeric analogs of T3, T4, 3,5-dimethy1-4-(4'-hydroy-3'-
isopropylbenzy1)-phenoxy
acetic acid (GC-1), or DITPA. Anti-angiogenic agents of the present invention
include thyroid
hormone antagonists, analogs, and derivatives either alone or in covalent or
non-covalent
conjugation with polymers. Examples of such anti-angiogenic thyroid hormone
antagonists include, but are not limited to, TETRAC, TRIAC, XT 199, and mAb
LM609.
Examples of representative thyroid hormone agonists, antagonists, analogs and
derivatives are shown below, and are also shown in Figure 20, Tables A-D.
Table A shows T2,
T3, T4, and bromo-derivatives. Table B shows alanyl side chain modifications.
Table C shows
hydroxy groups, diphenyl ester linkages, and D-configurations. Table D shows
tyrosine
analogs. The formulae of some of the representative compounds are illustrated
below.
34
CA 02648243 2013-09-23
HO I HO I
OH OH
I go I 0 = I 0
NH2 NH2
0 41 0 461
I T4 1 T3
H3C
HO HO CH3
0_ OH
40 I * H3C 00H
:_-
0= = 0
I DITPA H3C GC-1
HO HO I
I
I la 0 0 I 4i I 0
OH
0 .
I
HO 0 Triac I Tetrac
Polymer Conjugations
Polymer conjugations are used to improve drug viability. While many old and
new
therapeutics are well-tolerated, many compounds need advanced drug discovery
technologies
to decrease toxicity, increase circulatory time, or modify biodistribution.
One strategy for
improving drug viability is the utilization of water-soluble polymers. Various
water-soluble
polymers have been shown to modify biodistribution, improve the mode of
cellular uptake,
change the permeability through physiological barriers, and modify the rate of
clearance
through the body. To achieve either a targeting or sustained-release effect,
water-soluble
CA 02648243 2013-09-23
polymers have been synthesized that contain drug moieties as terminal groups,
as part of the
backbone, or as pendent groups on the polymer chain.
Representative compositions of the present invention include thyroid hormone
or
analogs thereof conjugated to polymers. Conjugation with polymers can be
either through
covalent or non-covalent linkages. In preferred embodiments, the polymer
conjugation can
occur through an ester linkage or an anhydride linkage. An example of a
polymer conjugation
through an ester linkage using polyvinyl alcohol is shown in Figure 17. In
this preparation
commercially available polyvinyl alcohol (or related co-polymers) can be
esterified by
treatment with the acid chloride of thyroid hormone analogs, including the
acid chloride form.
The hydrochloride salt is neutralized by the addition of triethylamine to
afford triethylamine
hydrochloride which can be washed away with water upon precipitation of the
thyroid hormone
ester polymer form for different analogs. The ester linkage to the polymer may
undergo
hydrolysis in vivo to release the active pro-angiogenesis thyroid hormone
analog.
An example of a polymer conjugation through an anhydride linkage using acrylic
acid
ethylene co-polymer is shown in Figure 18. This is similar to the previous
polymer covalent
conjugation, however, this time it is through an anhydride linkage that is
derived from reaction
of an acrylic acid co-polymer. This anhydride linkage is also susceptible to
hydrolysis in vivo
to release thyroid hormone analog. Neutralization of the hydrochloric acid is
accomplished by
treatment with triethylamine and subsequent washing of the precipitated
polyanhydride
polymer with water removes the triethylamine hydrochloride byproduct. This
reaction will
lead to the formation of Thyroid hormone analog acrylic acid co-polymer +
triethylamine.
Upon in vivo hydrolysis, the thyroid hormone analog will be released over time
that can be
controlled plus acrylic acid ethylene Co-polymer.
Another representative polymer conjugation includes thyroid hormone or its
analogs
conjugated to polyethylene glycol (PEG). Attachment of PEG to various drugs,
proteins and
liposomes has been shown to improve residence time and decrease toxicity. PEG
can be
coupled to active agents through the hydroxyl groups at the ends of the chains
and via other
chemical methods. PEG itself, however, is limited to two active agents per
molecule. In a
different approach, copolymers of PEG and amino acids were explored as novel
biomaterials
which would retain the biocompatibility properties of PEG, but which would
have the added
36
CA 02648243 2013-09-23
advantage of numerous attachment points per molecule and which could be
synthetically
designed to suit a variety of applications.
A variety of synthetic, natural and biopolymeric origin side groups with
efficient
biodegradable backbone polymers can be conjugated to thyroid hormone anaolgs.
Poly alkyl
glycols, polyesters, poly anhydride, poly saccharide, and poly amino acids are
available for
conjugation. Below are respresentative examples of conjugated thyroid hormone
analogs.
Polymer Conjugate Structures from Natural, Synthetic and Polypeptide Polymer
Chain.
H2N
0 I
HO
0
14111 R 0
0 0
- n
0 R I
0
OH
NH2
n = chain length
R=H, Bifunctional PEG-linked-T3
R=I, Bifunctional PEG-linked-T4
PEG Based Thyroid Compounds Polymer Conjugated Delivery Systems
37
CA 02648243 2013-09-23
0
I
0
411
0
H2N
OH
Methoxy-PEG- Linked -T4 Thyroid Product's Polymer Conjugate
H ,CH3 H CH3H z_CH3
¨0
0
¨
0 0
I
0_____ OH I al so N H2
0 0 I
1
I 46 0, OH
(D OH NH2
NH2
R = Repeating unit of HEMA chain
Poly-(HEMA)-Linked-T4-Conjugate
38
CA 02648243 2013-09-23
.R
0Q NH
CH3
AI
Poly-(viny- co-maleic anhydride) immobilized conjugate
A= Thyroid Constituent (conjugated through amine end)
NH
0 CH3 0
0
r=11-1
H3C 0 CH3 0 ¨
R= Repeating Chain Unit
A = Thyroid Constituent (conjugated through carboxyl end)
Poly-(lactide-co-lysine) immobilized conjugate
OH
0-R2 OH 0-R2 0
0 0
0 HO 0 0 HO
0 - R
RI-1 HO 0 HO NH
OH NH OH -
o--
RI = Monomers of saccharide chain
R2 = Thyroid Constituents
Hyaluronic Acid Bound Conjugates
39
CA 02648243 2013-09-23
0
R
R HN 0
) __ 0 \/\--R
0
HN / __ NH
/ /NH itR 0
NH-
0
H2N1 / R
/---3
NH
'
R
0
(NH R
NH R-Z NH-(
\
R \-----i Or_ 7
\ 0
R \r0
\ 0
NH/NH ___________________ V R
C) H2N/ NH
R
R NH
0 R
0
R = Thyroid Constituents T3/T4/DITPA/GC-1
Immobilized Thyroid Constituents on Multifunctional Polyamidoamine
OH OH OH
0 ta 000
NH NH NH I
H-N NH NH NHH 0] A i
0 0101 001 n
OH OH OH OH
A = Conjugated Selected Thyroid Constituent
CA 02648243 2013-09-23
Mobilized Thyroid Polypeptide Conjugate
Biodegradable and biocompatible polymers have been designated as probable
carriers
for long term and short time delivery vehicles including non hydrolysable
polymeric
conjugates. PEGs and PEOs are the most common hydroxyl end polymers with a
wide range of
molecular weights to choose for the purpose of solubility (easy carrier mode),
degradation
times and ease of conjugation. One end protected Methoxy-PEGs will also be
employed as a
straight chain carrier capable of swelling and thereby reducing the chances of
getting protein
attached or stuck during the subcellular transportation. Certain copolymers of
ethylene and
vinyl acetate, i.e. EVAc which have exceptionally good biocompatibility, low
crystallinity and
hydrophobic in nature are ideal candidate for encapsulation mediated drug
delivery carrier.
Polymers with demonstrated high half-life and in-system retention properties
will be
undertaken for conjugation purpose. Among the most common and recommended
biodegradable polymers from lactic and glycolic acids will be used. The
copolymers of L-
lactide, and L-lysine is useful because of its availability of amine
functional groups for amide
bond formation and this serves as a longer lasting covalent bonding site of
the carrier and
transportable thyroid compound linked together through the carboxyl moiety in
all the thyroid
constituents.
The naturally occurring polysaccharides from cellulose, chitin, dextran,
ficoll, pectin,
carrageenan (all subtypes), and alginate and some of their semi-synthetic
derivatives are ideal
carriers due to its high biocompatibility, bio systems familiar degradation
products (mono
saccharide from glucose and fructose), hydrophilic nature, solubility, protein
immobilization/interaction for longer term stability of the polymer matrix.
This provides a shell
for extra protection for polymer matrix from degradation over time and adding
to the effective
half life of the conjugate.
Protein & Polypeptide from serum albumin, collagen, gelatin and poly-L-lysine,
poly-
L-alanine, poly-L-serine are natural amino acids based drug carrier with
advantage of
biodegradation, biocompatibility and moderate release times of the carrier
molecule. Poly-L-
serine is of further interest due to its different chain derivatives, e.g.,
poly serine ester, poly
41
CA 02648243 2013-09-23
serine imine and conventional poly serine polymeric backbone with available
sites for specific
covalent conjugation.
Synthetic hydrogels from methacrylate derived polymers have been frequently
used in
biomedical applications because of their similarity to the living tissues. The
most widely used
synthetic hydrogels are polymers of acrylic acid, acrylamide and 2-
hydroxyethyl methacrylate
(HEMA). The poly HEMA are inexpensive, biocompatible, available primary
alcohol side
chain elongation functionality for conjugation and fit for ocular, intraocular
and other
ophthalmic applications which makes them perfect drug delivery materials. The
pHEMA are
immune to cell attachment and provides zero cell motility which makes them an
ideal candidate
for internal delivery system.
Synthetic thyroid analog DITPA conjugation library design program has been
achieved
with the development of crude DITPA conjugated products. PVA and PEG
hydrophilic
polymer coupling can also be mediated through Dicycolhexyl Carbodiimide and by
other
coupling reagents of hydrophilic and hydrophobic nature. Following is a list
of polymer
conjugates within the scope of the present invention (Table 9).
Table 9: Library of Designated Polymer Conjugates for Possible Preparation
based on
Chemical Class Reactivities & Stability Data.
Sr. Polymer Properties (H Hydrolysable, NH
No. Non Hydrolysable, RR Retarded
Release)
1 PEO H
2 m-PEG H
3 PVA Hydrophilic, H
4 PLLA Hydrophilic, H
PGA Hydrophilic, 1-1
6 Poly L-Lysine NH
7 Human Serum Albumin Protein, NH
8 Cellulose Derivative Polysaccharide, RR
(Carbomethoxy/ ethyl/
hydroxypropyl)
9 Hyaluronic Acid Polysaccharide, RR
Folate Linked Cyclodextrin/Dextran RR
11 Sarcosine/ Amino Acid spaced RR
Polymer
42
CA 02648243 2013-09-23
12 Alginate/ Carrageenan Polysaccharide, RR
13 Pectin/ Chitosan Polysaccharide, RR
14 Dextran Polysaccharide, RR
15 Collagen Protein, NH
16 Poly amine Aminic, NH
17 Poly aniline Aminic, NH
18 Poly alanine Peptidic, RR
19 Polytryptophan Peptidic, NH/ RR
20 Polytyrosine Peptidic, NH/ RR
Another representative polymer conjugation includes thyroid hormone or its
analogs in
non-covalent conjugation with polymers. This is shown in detail in Figure 19.
A preferred non-
covalent conjugation is entrapment of thyroid hormone or analogs thereof in a
polylactic acid
polymer. Polylactic acid polyester polymers (PLA) undergo hydrolysis in vivo
to the lactic
acid monomer and this has been exploited as a vehicle for drug delivery
systems in humans.
Unlike the prior two covalent methods where the thyroid hormone analog is
linked by a
chemical bond to the polymer, this would be a non-covalent method that would
encapsulate the
thyroid hormone analog into PLA polymer beads. This reaction will lead to the
formation of
Thyroid hormone analog containing PLA beads in water. Filter and washing will
result in the
formation of thyroid hormone analog containing PLA beads, which upon in vivo
hydrolysis
hydrolysis will lead to the generation of controlled levels of thyroid hormone
plus lactic acid.
A. Polymer Conjugate Synthesis of TRs Agonist or Antagonist and
Nanoparticles
There are two functional groups in the TRs agonist or antagonist molecules: a
carboxylic
acid and a hydroxyl group. To synthesize the TRs agonist or antagonist/polymer
conjugates, the
reaction site can be either of the two. Possible agonists and antagonists
within the ecope of the
present invention are shown in the tables below. Two possible synthesis routes
are described
below:
1) With the carboxylic acid group located on the a, 13 or 7 position relative
to the inner
phenyl ring. The acid group can be activated and then reacted with hydroxyl
and amino groups
to form ester and amide. The candidate polymers include PVA, PEG-NH2,
poly(lysine) and
related polymers. The schematic synthesis route is shown in Sketch 1A.
43
CA 02648243 2013-09-23
2) The hydroxyl group located on the outer phenyl is shown in Sketch 2A.
Sketch 1A: Schematic Route of TRs agonist or antagonist/Polymer Conjugates
Synthesis via the
Carboxylic acid Group
ho PVA, PEG-NH2
R¨COOH
catalyst
PVA
in
OH OH OH OH 0
OsR " 1-1
OH
H
PEG y R
0
Catalyst: CDI(1,1'-carbonyldiimidazole)
DCC(N,N'-Dicyclohexylcarbodiimide)
44
CA 02648243 2013-09-23
Sketch 2A: Schematic Route of TRs agonist or antagonist/Polymer Conjugates
Synthesis via
Hydroxyl Group
Ri
0
HO 11
COOH COOH COOH
COOH COOH I1
Ri Ri Ri
Catalyst
COOH H CO 0
OH = 0
COO
COOH
1 1
R1 = H poly(acrylic acid)
Me poly(methacrylic acid)
Catalyst: CD1(1,1'-carbonyldiimidazole)
DCC(N,N-Dicyclohekilcarbodiimide)
CA 02648243 2013-09-23
Representative thyroid agonists (Pro-angiogenic) within the scope of the
present
invention include T3, T4, DITPA, GC-1 and analogs and derivatives thereof
Illustrative
embodiments are shown below.
Number
1
o
NH2
2
Me Me
Me 40 0
Me
3
i o
4
Me Br
Me 40 0 40
Br
Me CI
Me is 0
11111. CI
~Awn&
46
CA 02648243 2013-09-23
6
0
Me
Me
47
CA 02648243 2013-09-23
Representative thyroid antagonists (anti-angiogenic) within the scope of the
present
invention are shown below.
Number Structure Code
A
I
I 0 0 OH
401 5
I
Tetrac
HO
I
B Me Br
Me
0 0 40
0 DIBRT
HO Br
OH
Me Me
0-
1+
1\1
0 0
Me
C NH-3
0
HO SI la
Me 0
OH
Me Me
D
N 1 Br
I
0
/ 0 ilb 0
HO Br
OH
Me Me
48
CA 02648243 2013-09-23
0,, +,0
E o N 0 1-850
F3c NI-1,,N1-114õ:õ
11110
o
F
0 o
, ('OH0
40 0
I
G Me
)
0(CH2)10 Me
1101
HO Me 111.1 0'.0
OH
Me Me
H
Br
00
40 0
Br (CH2)2 OH
49
CA 02648243 2013-09-23
B. Polymer Conjugate Synthesis of T4 and Nanoparticles Thereof
There are three functional groups in T4 molecules: one carboxylic acid group,
one
amine group and one hydroxyl group.
To synthesize the T4/polymer conjugates, the reaction site can be any one of
the three.
1) With carboxylic acid group. Acid group can be activated and reaction with
hydroxyl
and amine group to form ester and amide. Due to the high reactivity of amine
group in
the T4, the amine group should be protected before the conjugating reaction,
and then
de-protected reaction. Otherwise, the self polymerization will form the T4
oligomers.
The candidate polymers include PVA, PEG-NH2, poly (lysine) and related
polymers.
The Schematic synthesis route is shown in Sketch 1B.
2) With the amine group. The amine group can reacted with polymer with
activated
carboxylic acid or with halogen group. If the polymer has a large amount of
excess of
activated acid group, the reaction can go through directly. Poly
(methylacrylic acid) and
poly (acrylic acid) can be used in this way. The scheme is shown in Sketch 2B.
3) With the hydroxyl group. Due to the existence of a higher reactive amine
group, the
direct reaction of T4 with a polymer with carboxylic acid is difficult. This
amine group
must be protected before the reaction and de-protected after the conjugating
reaction.
The common protected group can be acetate (Ac) or BOC group. The scheme is
shown
in Sketch 3B.
Sketch 1B: Schematic Route of T4/Polymer Conjugates Synthesis via Carboxylic
Acid
Group
CA 02648243 2013-09-23
COOH
0 0
BOC
HN¨BOC
COOH
HO * 0 (Ac)20
COOH
NH2
HO 0 *
Protect
HN¨Ac
PVA
PVA, PEG-NH2 OH OH 0
0
0 OH
R¨NH
0
PEG 0 OH
R¨NH
Catalyst: CDI(1,1'-carbonyldiimidazole)
DCC(N,N.-Dicyclohexylcarbodiimide)
R = Ac or BOC
PVA
de-protect
OH OH 0
0
0 44101 OH
H2N
0
PEG OC)19-N 0 OH
H2N
R = Ac or BOC
51
CA 02648243 2013-09-23
Sketch 2B: Schematic Route of T4/Polymer Conjugates Synthesis via Amine Group
H2N 1.1
0 = - OH
COOH COOH HOOC
COOH COOH
Catalyst
COOH COOH
COOH (?\
HN
= 1
HOOC 0 1-
R = H poly(acry1ic acid)
Me poly(methacrylic acid)
Catalyst: CDI(1,1'-carbonyldiimidazole)
DCC(N,N'-Dicyclohexylcarbodiimide)
52
CA 02648243 2013-09-23
Sketch 38: Schematic Route of T4/Polymer Conjugates Synthesis via Hydroxyl
Group
i I
COOH
HO 110 0 411
NH2
I I
IProtect by
Ac or BOC
Ri Ri Ri Ri I I
. HN¨R2
HO - . 0
+
COOH COOH COOH
COOH I I
COOH
Ri Ri Ri Ri
Catalyst I I
________________ *
COOH
COOH if. . = HN¨R2
COOH 0 0-- 0
COOH
I I
Pi Ri R1 P1
de-protect I11 I
41 N
COOH H2
COOH 0 0 - 0 00
COOH
COOH
I I
R1= H poly(acrylic acid) R2 = Ac OR BOC
Me poly(methacrylic acid)
Catalyst: CDI(1,1'-carbonyldiimidazole)
DCC(N,N'-Dicyclohexylcarbodiimide)
53
CA 02648243 2013-09-23
It is contemplated that the T4 polymer conjugates, nanopolymers and
nanoparticles
described herein can be used in a variety of indications including, but not
limited to, aneurism,
surgery (including dental, vascular, or general), heart attack (e.g., acute
myocardial infarction)
to be delivered using devices such as a defibrillator and other means, topical
applications such
as ointments, cream, spray, or sheets (such as for skin applications), or
immobilized on a stent
or other medical device and implanted at the tissue site for sustained local
delivery in
myocardial infarction, stroke, or peripheral artery disease patients to
achieve collateral artery
formation over an extended period of time ranging from weeks to months.
C. Polymer Conjugate Synthesis of GC-1 and Nanoparticles Thereof
There are two functional groups in GC-1 molecules: one carboxylic acid group,
and one
hydroxyl group. To synthesize the GC-1/polymer conjugates, the reaction site
can be anyone
of the two.
1) With carboxylic acid group. Acid group can be activated and react with
hydroxyl and amine group to form ester and amide. The candidate polymers
include PVA, PEG-NH2, poly (lysine), poly (arginine) and related polymers. The
Schematic synthesis route is shown in Sketch 1C.
2) With the hydroxyl group. The scheme is shown in Sketch 2C.
54
CA 02648243 2013-09-23
Sketch 1C: Schematic Route of GC-1/Polymer Conjugates Synthesis via Carboxylic
acid Group.
Me
HO Me
11 Me COOH PVA, PEG-NH2
. 0) catalyst _
Me
PVA = ,
OH OH 0 Me Me
0 M 10 H
Me
0$
Me
PEG
Ir '0
0 401
Me Me
HO0
Catalyst: CD1(1,1'-carbonyldiimidazole)
DCC(N,N'-Dicyclohexylcarbodiimide) Me Me
CA 02648243 2013-09-23
Sketch 2C: Schematic Route of GC-1 / Polymer Conjugates Synthesis via Hydroxyl
Group.
R1 R1 R1 R1
11 0=
COOH COOH COOH
COOH COOH
Ri Ri Ri Ri
Catalyst
____________ Do.
COOH COOH ,Th 411 0 #
COOH 0
COON
R1 = H poly(acrylic acid)
Me poly(methacrylic acid)
Catalyst: CDI(1,1'-carbonyldiimidazole)
DCC(N,N'-Dicyclohexylcarbodiimide)
D. Polymer Conjugate Synthesis of Tetrac and Nanoparticles Thereof
There are two functional groups in Tetrac molecules: one carboxylic acid
group, and
one hydroxyl group. To synthesize the Tetrac / polymer conjugates, the
reaction site can be
any one of the three.
1) With carboxylic acid group. Acid group can be activated and reaction with
hydroxyl
and amine group to form ester and amide. The candidate polymers include PVA,
PEG-
NH2, poly (lysine) and related polymers. The Schematic synthesis route is
shown in
Sketch 1D.
2) The scheme with the hydroxyl group is shown in Sketch 2D.
Sketch 1D: Schematic Route of Tetrac/Polymer Conjugates Synthesis via
Carboxylic acid
Group
56
CA 02648243 2013-09-23
COOH
HO-4. 0 4. PVA, PEG-NH2
catalyst
PVA
OH OH 0
0
0 =
- OH
0
PEG 01C;cr.N
11 0 40 -OH
Catalyst: CDI(1,1'-carbonyldiimidazole)
DCC(N,N'-Dicyclohexylcarbodiimide)
57
CA 02648243 2013-09-23
Sketch 2D: Schematic Route of Tetrac/Polymer Conjugates Synthesis via Hydroxyl
Group
Ri Ri Ri Ri
HO -- 0 411
COOH COOH COOH
COOH COOH
Ri Ri Ri Ri
Catalyst
COOH COOH
COOH 0 0¨=0 40
COOH
R1 = H poly(acrylic acid)
Me poly(methacrylic acid)
Catalyst: CDI(1,1'-carbonyldiimidazole)
DCC(N,Nr-Dicycloheqlcarbodiimide)
Still further, compositions of the present invention include thyroid hormone
analogs
conjugated to retinols (e.g., retinoic acid (L e., Vitamin A), which bind to
the thyroid hormone
binding protein transthyretin ("TTR") and retinoic binding protein ("RBP").
Thyroid hormone
analogs can also be conjugated with halogenated stilbesterols, alone or in
combination with
retinoic acid, for use in detecting and suppressing amyloid plaque. These
analogs combine the
advantageous properties of T4-TTR, namely, their rapid uptake and prolonged
retention in
brain and amyloids, with the properties of halogen substituents, including
certain useful
halogen isotopes for PET imaging including fluorine-18, iodine-123, iodine-
124, iodine-131,
bromine-75, bromine-76, bromine-77 and bromine-82. Below are representative
examples of
thyroid hormone analogs conjugated to retinols and halogenated stilbestrols.
E. Retinoic Acid Analogs
58
CA 02648243 2013-09-23
HC CH CH3 CH3 0
\, OH
I
CH3
Thyroid Hormone Analog Conjugated with Retinoic Acid
I
I 0
H3 CH3 CH3 CH3 0 0
Si
0 1
1 1 0
CH3 H2N
OH T4-Retinoic Acid
1
H3c CH3 CH3 cH3 o I si 0
0
I 0
CH3 H2N
HO
T3-Retinoic Acid
i
H3c CH3 CH3 CH3 0 0 0
I.
0 I
0
0 CH3
HO
DITPA-Retinoic Acid
59
CA 02648243 2013-09-23
OCH3
H3C CH3 0
CH3 CH3 0 0
1 0 H3C
I 0
..Z--.CH3 H3C CH3
y
HO
GC-1- Retinoic Acid
i
1
H3c CH3 cH3 cH3 o * o
*
0
I I
cH3 HO O
TRIAC-Retinoic Acid
1
i o
H3 cH3 cH3 cH3 o /0
o 1
I i
c H3 HO O
TETRAC-Retinoic Acid
Halogenated Stilbestrol Analogs
H3C 0 OH
HO * CH3
Diethylstilbestrol
T4 Analogs, Halogenated Stilbesterols, and Retinoic Acid
CA 02648243 2013-09-23
H3C,..............õ-....,õ
H3C 0 I
--....... -.....,
. 0 CH3 CH3 H3C CH3
CH3 CH3 CH3 0
0 I.1 CH3
CH3
CH3
Retinoic Acid-Diethylstilbestrol-Retinoic Acid
Nanoparticles
Furthermore, nanotechnology can be used for the creation of useful materials
and
structures sized at the nanometer scale. One drawback with biologically active
substances is
fragility. Nanoscale materials can be combined with such biologically active
substances to
dramatically improve the durability of the substance, create localized high
concentrations of the
substance and reduce costs by minimizing losses. Therefore, additional
polymeric conjugations
include nano-particle formulations of thyroid hormones and analogs thereof. In
such an
embodiment, nano-polymers and nano-particles can be used as a matrix for local
delivery of
thyroid hormone and its analogs. This will aid in time controlled delivery
into the cellular and
tissue target.
The present invention provides nanoparticle formulations of thyroid hormone
analogs
containing hydrophobic anti-oxidant, anti-inflammatory, and anti-angiogenesis
compounds.
This invention also provides sustained release and long residing ophthalmic
formulation, so
that the release of the entrapped drug can be controlled and the process of
preparing the same.
Within the scope of the present invention are nanoparticulate thyroid hormone
analogues (T4, T3, GC-1, DITPA, and tetrac) that cannot gain access to the
cell interior and
whose activities must therefore be limited to the integrin receptor. The
nanoparticulate
hormone analogues are polylysyl glycolic acid (PLGA) derivatives, either
esters or the more
stable ether-bond formulations. Agarose-T4 is a model of the nanoparticulate
that we have
shown to be fully active at the integrin receptor. The reformulated hormone
analogues will not
express intracellular actions of the hormone and thus if absorbed into the
circulation will not
have systemic thyroid hormone analogues actions.
61
CA 02648243 2013-09-23
As used herein, the term "nanoparticle" refers to particles between about 1 nm
and less
than 1000 nm in diameter. In suitable embodiments, the diameter of the
nanoparticles of the
present invention will be less than 500 nm in diameter, and more suitably less
than about 250
nm in diameter. In certain such embodiments, the nanoparticles of the present
invention will be
between about 10 nm and about 200 nm, between about 30 nm and about 100 nm, or
between
about 40 nm and about 80 nm in diameter. As used herein, when referring to any
numerical
value, "about" means a value of 10% of the stated value (e.g. "about 100 nm"
encompasses a
range of diameters from 90 nm to 110 nm, inclusive).
In accordance with the present invention, there is provided a nanoparticle
conjugate
comprising a nanoparticle conjugated to a plurality of thyroid hormone analogs
or polymer
conjugates. Thyroid hormone analogs which can be the basis of nanoparticles
include, but are
not limited to, T3, T4, DITPA, GC-1, and Tetrac. A key element in the
nanoparticle formation
is the linkage bridge between the thyropid hormone molecule and the
nanoparticles. The
thyroid hormone analog is conjugated to the nanoparticle by means of an ether
(- 0-) or
sulfhydryl linkage (sulfur (-S-) through the alcohol moiety of the thyroid
hormone analog
molecule. Conjugations through the alcohol moiety have more activity than
conjugations
through the COOH moiety of the thyroid hormone analog molecule. The NH2 group
of
thyroid hormone analogs, such as T3 and T4, can also be blocked with a
protecting group (R
group). Suitable R groups within the scope of the present invention include
BOC, acetyl,
methyl, ethyl, or isopropyl. For T4 unmodified, R =H. Additionally, when the
thyroid
hormone is T4 or T3 with a protecting group at the NH2, the suitable
protecting group at the
NH2 of T4 or T3 can include N-Methyl, N-Ethyl, N-Triphenyl, N-Propyl, N-
Isopropyl, N-
tertiary butyl and other functional groups.
The nanoparticle may have a diameter in the range of about 1 to < 1000 nm.
Nanoparticles within the present invention may have up to approximately 100
molecules of
thyroid hormone analogs per nanoparticle. The ratio of thyroid hormone
molecules per
nanoparticle ranges from a ratio of 1 thyroid hormone molecule per 1
nanoparticle (shown also
as 1:1) up to 100 thyroid hormone molecules per nanoparticle (shown also as
100:1). More
preferably, the range is from 15:1-30:1 thyroid hormone analog molecules per
nanoparticle, and
more preferably from 20:1-25:1 thyroid hormone analog molecules per
nanoparticle.
62
CA 02648243 2013-09-23
Suitable nanoparticles within the scope of the present invention include PEG-
PLGA
nanoparticles conjugated with T4, T3, DITPA, GC-1, or tetrac. Additionally,
temozolomide
can be encapsulated in PLGA nanoparticles. One of the major advantages of
nanoparticles is its
ability to co-encapsulate multiple numbers of encapsulating materials in it
altogether. So, these
PLGA nanoparticles also have the tremendous potential to co-encapsulate T4,
13, DITPA, GC-
1, or Tetrac and temozolomide altogether. Furthermore, due to the presence of
free ¨COOH
group on the surface of the nanoparticles these nanoparticles can be
conjugated to different
targeting moieties and can be delivered to a desired site. In a preliminary
study we were able to
target few cell lines by using specific antibody attached to the Nanoparticles
for tumor specific
site directed delivery. Additional embodiments of nanoparticles within the
resent invention
include T4, T3, DITPA, GC-1, or tetrac collagen conjugated nanoparticles
containing calcium
phosphate; 14, T3, DITPA, GC-1, or tetrac conjugated with mono- or di-PEGOH
via a stable
ether linkage.
Furthermore, the Nanoparticles encapsulate the thyroid hormone agonists,
partial
agonists or antagonists inside the Nanoparticles or immobilized on the cell
surface of the
Nanoparticles via a chemical linkage. Representative embodiments of
nanoparticles within the
scope of the present invention are illustrated below.
63
CA 02648243 2013-09-23
A. Nanoparticles of TR Agonists and Antagonists
TRs agonist or antagonist conjugated Nanopolymer via an ester linkage
0
OH OH 011 n
+
R¨COOH
DMF / N2
TR agonist
0 OH OH OH 0
R=0
OH OH
64
CA 02648243 2013-09-23
TRs agonist or antagonist conjugated with mono- or di-PEGOH via a stable ether
linkage
HO R¨OH HC)\
R¨COOH H. R¨CO
TR agonist OR
Tosyl chloride
Me
MeOH
'43-[(3A0
DMAP, Pyridine
mPEG-OH
HO
R¨COMeIojoTsNaH
OR DMF/THF
acid hydrolysis
me,0,,_40,00,RõcoOR __________________________________ 11.
me,0-E10.400)1COOH
Immobilized TRs agonist or antagonist with mono or di-PEG(OH)
CA 02648243 2013-09-23
Another suitable nanoparticle embodiment is the preparation of TR agonists
conjugated
PEG-PLGA nanoparticles. Void nanoparticles will be prepared first. Amino-PEG-
PLGA
polymer will be chose to prepare the nanoparticles. The TH analog will be
activated by using
epichlorohydrin. This epoxy activated TH agonist will react readily with amino
terminated
PEG-PLGA nanoparticles.
ROH ____________________________________ 311,
Epichlorohydrin TH analog Epoxy activated TH agonist
iwNH2
H2 H2
1)12.(N1-12
PEG-PLGA nanoparticles
OH
(
H2 0
TH agonist conjugated PEG-PLGA nanoparticles
66
CA 02648243 2013-09-23
B. T4 Nanoparticles
Another suitable embodiment of a nanoparticle within the present invention
includes T4
immobilized to mono or di-PEG-OH through a stable ether linkage, as shown
below.
I 2 NH I
Tosyl chloride
HO-0,0 it, OH 1-100-0 it 0¨ + .......0,,,Oic...--,,v-O-Ts OH
I 0 I 0 DMAP, Pyridine
mPEG-OH
Thyroid Hormone
Or
1NaH,
analog
DMF / THF
I 0
0
0 11 0---
)ri I NH2
0 acid hydrolysis
1
I 0
H
0"T'.1rICI'`.0 . 0 411 0-
i NH2
Immobilized T4 with mono or di-PEG(OH)
67
CA 02648243 2013-09-23
C. GC-1 Nanoparticles
A representative embodiment of a nanoparticle within the present invention
includes
also the encapsulation of GC-1 in PEG-PLGA Nanoparticles, conjugated via an
ester linkage,
as shown below.
tro:NrHA
Me R
R
Me
HO Me
0
OH n
R ¨ R
NJ N N \N ¨ n
\-- \1N + 41 0/ _____________________ D.-
0 OH OH OH
0
DMF / fsi
Me OGC-1 GC-1"--
.-No
GC-1
Another suitable embodiment of a nanoparticle within the present invention
includes a GC-1
conjugate with mono- or di-PEGOH via a stable ether linkage, as shown below.
68
CA 02648243 2013-09-23
Me Me
, Me HO Me
/ \ Tosyl chloride
Me
OH R¨OH it Me 0 R
0/ 0--H, + H001-s ..4_____
______________________________________________________________
meõ.,0....,...2:)0H
n
Me Me DMAP, Pyridine
mPEG-OH
GC-1
I NaH
DMF/THF
0-R
I
Me Me 0
.(0 Me 0 0 0
meo
n
me
acid hydrolysis
1
OH
Me Me
Me,0,--.., 0..0 so Me 0 0
n 0
Me
Immobilized GC-1 with mono or di-PEG (OH)
Another suitable embodiment of a nanoparticle within the present invention
includes
GC-1 conjugated PEG-PLGA nanoparticles. In this case void nanoparticles will
be prepared
first. Amino-PEG-PLGA polymer will be chosen to prepare the nanoparticles. GC-
1 will be
activated by using epichlorohydrin. This activated GC-1 will react readily
with amino
terminated PEG-PLGA nanoparticles, as shown below.
69
CA 02648243 2013-09-23
Me Me
HO Me ________________________________ Me
0+1
\/C1 + 41 Me \ /
0 41 Me
Me Me
Epichlorohydrin
GC-1 Epoxy
activated GC-1
Nr)wiH NH2
*2 NH2
H2 / (c.
2
2
PEG-PLGA nanoparticles it Me
Me
_________________ DI Me
Me it
0¨)____
OH
0
GC-1 conjugated PEG-PLGA nanoparticles
CA 02648243 2013-09-23
Additional GC-1 analogs Nanoparticles encapsulated or immobilized are shown
below.
New Analogs of GC-1 me
H
N
. 4* Me
Me
HO 0---====\
le. 0 Me Me
3 ij
A ti
OH Me
Me 4
.. .
. .
. ,
.. ,
.. .
,
.., ..
. ,
HO Me
Me w iiio . Ho
. ----------------------------- 10 40 me .
\ . .
. .., a ....... ..
. .. . me
0 OH
. OH
1 Me Me 5
GO:
. .=".
. .
, .
,
, ...
,
. .
HO . Me I' '='k Me
Me loi,"
0 V *
Me . HO0. 0
OH HO Me OH
8 ASpr Me
Me
6
Me 40 .
. .
OH
7
71
CA 02648243 2013-09-23
D. Tetrac Nanoparticles
Representative tetrac nanoparticles within the scope of the present invention
are shown
in FIG. 31a and 31b. Tetrac doped nanoparticles coated with PVA were
synthesized and
characterized. Several sets of nanoparticles were examined for the optimum
loading of Tetrac.
Also the size and zeta potential of the void and tetrac doped nanoparticles
were examined.
There was a significant difference in size and zeta potential between Tetrac
doped and void
nanoparticles coated with Tween-80 were found. The average size of the
nanoparticles
slightly increase (void-178nm, tetrac doped-193nm) in the case of tetrac doped
nanoparticles.
It is determied that the amount of Tetrac inside the nanoparticles by HPLC. It
was found that
the concentration of tetrac is 540m/m1 of the nanoparticles. As seen in FIG.
31b, PLGA
nanoparticles coated with Tween-80 were prepared by single emulsion method
using
polyvinyl alcohol (PVA) as a stabilizer. The size of the nanoparticles were
determined by using
dynamic light scatter. The amount of tetrac encapsulated in the nanoparticles
was determined
using HPLC.
1 1
1 1 o
o II
II CH2-
+ Ho 0 -OH lOto=0 4I cH,--C-OH
40 410 C _0. 72,---
0 0 I I
I 1
Epichlorohydrin Tetrac Epoxy
activated Tetrac
NH2
p i
Nhiiii ii
NH2
lNH2 NH2
NH2 NH OV\
0
II
0 11 0 le CH2 - 0 -OH
I I
Tetrac conjugated PEG-PLGA nanoparticles
FIG. 32 depicts an additional representation of a Tetrac conjugated
Nanopolymer via an
ester linkage.
72
CA 02648243 2013-09-23
Below is a suitable embodiment of a Tetrac conjugate with mono- or di-PEGOH
via a stable
ether linkage.
4 = .
RCH
14 0-õ T)
ctiaice
,0".\,,Q(z)nto-Nõuls
0 0 121VPI9
Rfidre
rrFEGCH
a
aulog NIF1-1
DVF/11-F
0
/0õ,"057.,-0\z÷. =
aid
)1-1
hycklyzis
0
/0/0k/N= = H
Immobilized Tetrac with mono or di-PEG(OH)
73
CA 02648243 2013-09-23
E. T3 Nanoparticles
Another suitable embodiment is a preparation of T3 conjugated PEG-PLGA
nanoparticles. The conjugation of is similar to the conjugation of GC-1. Only
in this case, the
highly reactive amine group present in T3 will be blocked first by using
either acetate (Ac) or
BOC group. Then, it will be activated with epicholorohydrin. Finally, after
conjugation to T3 it
will be deprotected, as shown below.
Protection of amine group with acetate (Ac) or BOC.
HO 1
(BOC)20
I IN OH
______________________________________ D. 0
0 III \ 0
I
HO I
0 I Hisl OH
0 II ----
0
I
(AC)20 HO 1 Ac
/
______________________________ 1... 0 I HN OH
0 . \
0
I
74
CA 02648243 2013-09-23
/
HO i \ __ 0 I
0
BOC
I
HN/ HN 0H BOC
+ C) I/ ----w. 0 I 1
OH
\o
0
I
I
Epichlorohydrin
T3 protected with BOG Epoxy activated T3
Ai(
H2 NH2
H2
2 H2 NH2
PEG-PLGA nanoparticlesI
OH
0
2
0 I
HN fB0C
OH
0 0 0
I
PEG-PLGA nanoparticles conjugated with T3
CA 02648243 2013-09-23
F. DITPA
Additional suitable nanoparticle embodiments include DITPA analogs, as shown
below.
HO
40 I 0 0 H
0*
I
DITPA ¨ 3, 5 Iodine could be replaced by Methyl or halogen group
Uses of Thyroid Hormone Analogs
The thyroid hormone analogs of the present invention are T3, T4, GC-1, DITPA,
tetrac,
triac and polymer conjugates and nanoparticles thereof. T3, T4, GC-1 and DITPA
and their
conjugates and as nanoparticles are pro-angiogenic, and are also referred to
herein as thyroid
hormone agonists. Tetrac and triac and their conjugates and as nanoparticles
are anti-
angiogenic and anti-proliferative, and are also referred to herein as thyroid
hormone
antagonists.
Thyroid hormone analogs of the present invention can be used to treat
disorders of the
skin. These disorders include wound healing, noncancer skin conditions and
cancerous skin
conditions. Wound healing encompasses surgical incisions and traumatic injury.
T4, T3, GC-1
and DITPA, both unmodified and as nanoparticles, can be used for wound
healing. These
thyroid hormone analogs work by angiogenesis and by enhancing fibroblast and
white blood
cell migration into the area of the wound. T4, modified and as a nanoparticle,
has, in addition,
platelet aggregating activity that is relevant to early wound healing. The
actions of T4, T3,
GC-1 and DITPA nanoparticles are limited to the cell surface. Because they do
not enter the
cell, they avoid systemic side effects when they escape the local application
site. Examples of
these intracellular systemic side effects include the mild hyperthyroid state
and, specifically at
pituitary thyrotropic cells, suppression of thyrotropin (TSH) release.
Noncancer skin disorders
76
CA 02648243 2013-09-23
that can be treated by compositions of the present invention, specifically
tetrac, triac and other
anti-angiogenic and anti-proliferative thyroid hormone analogues, both
unmodified and as
nanoparticles or polymer conjugates, include, but are not limited to, rosacea,
angiomas,
telangiectasias, poikiloderma of Civatte and psoriasis. Examples of cancerous
skin disorders
that can be treated by compositions of the present invention are basal cell
carcinoma, squamous
cell carcinoma of the skin and melanoma. Compositions to be used for such
purposes are
tetrac, triac and other anti-angiogenic and anti-proliferative thyroid hormone
analogues, both
unmodified and as nanoparticles or polymer conjugates. For skin disorders, the
compositions
of the present invention can be administered as topical cutaneous
applications, such as
solutions, sprays, incorporated into gauze pads or into synthetic sheets.
Non-cancer skin disorders that can be treated by compositions of the present
invention,
including tetrac, tetrac and analogs encapsulated or immobilized to
Nanoparticles include, but
are not limited to, rosacea, angiomas, telangiectasias, poikiladerma,
psoriasis. For skin
disorders, the compositions of the present invention can be administered as
topical cutaneous
(such as solutions, sprays, or incorporated into gauze pads or other synthetic
sheets).
The thyroid hormone analogs of the present invention, including tetrac, triac
and other
anti-proliferative and anti-angiogenic thyroid hormone analogs, both
unmodified and as
nanoparticles or polymer conjugates can also be used to treat cancers of
organs in addition to
the skin. These cancers include, but are not limited to, glioma and
glioblastoma, nonthyroidal
head-and-neck tumors, thyroid cancer, lung, breast and ovary. Tetrac and triac
nanoparticles or
polymer conjugates, administered systemically or locally, do not gain access
to the interior of
cells and work exclusively at the cell surface integrin receptor for thyroid
hormone. This
attribute of the formulations eliminates undesired side thyromimetic effects
of unmodified
tetrac and triac, including hyperthyroidism and suppression of thyrotropin
(TSH) release by
pituitary thyrotropic cells. Tetrac can be administered in doses from about
200-2000 ug/day or
up to about 700 ug/m2.
The thyroid hormone analogs of the present invention, including tetrac, triac,
analogs,
other thyroid antagonists, and polymer conjugates and nanoparticles thereof,
can also be used
to treat cancer, including, but not limited to, glioma, head and neck, skin,
lung, breast, and
77
CA 02648243 2013-09-23
thyroid. In this embodiment, tetrac can be administered either with or without
nanoparticles.
Tetrac nanoparticles reduce the risk of hypothyroidism, as the nanoparticles
will not be able to
enter the call. For thyroid cancer, both tetrac and tetrac nanoparticles are
co-administered or
Tetrac encapsulated and/or immobilized on the Nanoparticles surface via stable
chemical
bonding are administered. Tetrac or tetrac Nanoparticles can be administered
in a doses of
from about 0.001 to 10 mg / Kg.
The thyroid hormone analogs of the present invention, including tetrac, triac,
analogs,
thyroid antagonists, and polymer conjugates and nanoparticles thereof, can
also be used to treat
eye disorders, including diabetic retinopathy and macular degeneration. Tetrac
and analogs can
be given unmodified, as a polymer conjugate, or as nanoparticles either
systemically or as eye
drops.
The thyroid hormone analogs of the present invention, including T3, T4, GC-1,
DITPA,
and polymer conjugates and nanoparticles thereof, can also be used to treat
atherosclerosis,
including coronary or carotid artery disease, ischemic limb disorders,
ischemic bowel disorders.
Preferred embodiments are T3, GC-1, DITPA polymeric forms with poly L-arginine
or poly L-
lysine or nanoparticles thereof. Additionally, the compositions of the present
invention can be
used in combination with biodegradable and non-biodegradable stents or other
matrix.
The thyroid hormone analogs of the present invention can also be administered
to treat
disorders involving cell migration, such as those involving glia neurons, and
potentiated NGFs.
Such disorders to be treated include neurological diseases. Additionally,
thyroid hormone
analogs of the present invention can be used for hematopoietic and stem cell-
related disorders.
They can be administered at the time of bone marrow transplant for cells to
reproduce faster.
The present compositions can also be used for diagnostic imaging, including
imaging for
Alzheimer's by using125 Iodine labeled tetrac nanoparticles. Since Alzheimer's
plaques have
transthyretin that bind tetrac, this can be used for early detection. The
compositions of the
present invention can also be used in conjunction with defibrillators and for
treatment of viral
agents, such as West Nile and HIV.
Details of the uses for the present compositions in both promoting and
inhibiting
angiogenesis are described in detail below.
78
CA 02648243 2013-09-23
Promoting Angiogenesis
The pro-angiogenic effect of thyroid hormone analogs, polymeric forms, or
nanoparticles thereof depends upon a non-genomic initiation, as tested by the
susceptibility of
the hormonal effect to reduction by pharmacological inhibitors of the MAPK
signal
transduction pathway. Such results indicate that another consequence of
activation of MAPK
by thyroid hormone is new blood vessel growth. The latter is initiated
nongenomically, but of
course, requires a consequent complex gene transcription program. The ambient
concentrations
of thyroid hormone are relatively stable. The CAM model, at the time we tested
it, was
thyroprival and thus may be regarded as a system, which does not reproduce the
intact
organism.
The availability of a chick chorioallantoic membrane (CAM) assay for
angiogenesis has
provided a model in which to quantitate angiogenesis and to study possible
mechanisms
involved in the induction by thyroid hormone of new blood vessel growth. The
present
application discloses a pro-angiogenic effect of T4 that approximates that in
the CAM model of
FGF2 and that can enhance the action of suboptimal doses of FGF2. It is
further disclosed that
the pro-angiogenic effect of the hormone is initiated at the plasma membrane
and is dependent
upon activation by T4 of the MAPK signal transduction pathway. As provided
above, methods
for treatment of occlusive peripheral vascular disease and coronary diseases,
in particular, the
occlusion of coronary vessels, and disorders associated with the occlusion of
the peripheral
vasculature and/or coronary blood vessels are disclosed. Also disclosed are
compositions
and methods for promoting angiogenesis and/or recruiting collateral blood
vessels in a patient
in need thereof. The compositions include an effective amount of Thyroid
hormone analogs,
polymeric forms, and derivatives. The methods involve the co-administration of
an effective
amount of thyroid hormone analogs, polymeric forms, and derivatives in low,
daily dosages for
a week or more with other standard pro-angiogenesis growth factors,
vasodilators,
anticoagulants, thrombolytics or other vascular-related therapies.
The CAM assay has been used to validate angiogenic activity of a variety of
growth
factors and compounds believed to promote angiogenesis. For example, T4 in
physiological
concentrations was shown to be pro-angiogenic in this in vitro model and on a
molar basis to
79
CA 02648243 2013-09-23
have the activity of FGF2. The presence of PTU did not reduce the effect of
T4, indicating that
de-iodination of T4 to generate T3 was not a prerequisite in this model. A
summary of the pro-
angiogenesis effects of various thyroid hormone analogs is listed in Table
below.
Pro-angiogenesis Effects of Various Thyroid Hormone Analogs in the CAM Model
TREATMENT ANGIOGENESIS INDEX
PBS (Control) 89.4 9.3
DITPA (0.01uM) 133.0 11.6
DITPA (0.1uM) 167.3 12.7
DITPA (0.2mM) 117.9 5.6
GC-1 (0.01 uM) 169.6 11.6
GC-1 (0.1 uM) 152.7 9.0
T4 agarose (0.1uM) 195.5 + 8.5
T4 (0.1uM) 143.8 7.9
FGF2 (1 ug) 155 9
n = 8 per group
The appearance of new blood vessel growth in this model requires several days,
indicating that the effect of thyroid hormone was wholly dependent upon the
interaction of the
nuclear receptor for thyroid hormone (TR) with the hormone. Actions of
iodothyronines that
require intranuclear complexing of TR with its natural ligand, T3, are by
definition, genomic,
and culminate in gene expression. On the other hand, the preferential response
of this model
system to T4¨rather than T3, the natural ligand of TR¨raised the possibility
that angiogenesis
might be initiated nongenomically at the plasma membrane by T4 and culminate
in effects that
require gene transcription. Non-genomic actions of T4 have been widely
described, are usually
initiated at the plasma membrane and may be mediated by signal transduction
pathways. They
do not require intranuclear ligand of iodothyronine and TR, but may interface
with or modulate
CA 02648243 2013-09-23
gene transcription. Non-genomic actions of steroids have also been well
described and are
known to interface with genomic actions of steroids or of other compounds.
Experiments
carried out with T4 and tetrac or with agarose-T4 indicated that the pro-
angiogenic effect of T4
indeed very likely was initiated at the plasma membrane. Tetrac blocks
membrane-initiated
effects of T4, but does not, itself, activate signal transduction. Thus, it is
a probe for non-
genomic actions of thyroid hormone. Agarose-T4 is thought not to gain entry to
the cell interior
and has been used to examine models for possible cell surface-initiated
actions of the hormone.
Investigations of the pro-angiogenic effects of thyroid hormone in the chick
chorioallantoic
membrane ("CAM") model demonstrate that generation of new blood vessels from
existing
vessels was promoted two- to three-fold by either L-thyroxine (T4) or 3,5,3'-
triiodo-L-thyronine
(T3) at 10-7 ¨ 10-9 M. More interestingly, T4-agarose, a thyroid hormone
analog that does not
cross the cell membrane, produced a potent pro-angiogenesis effect comparable
to that obtained
with T3 or T4.
In part, this invention provides compositions and methods for promoting
angiogenesis
in a subject in need thereof Conditions amenable to treatment by promoting
angiogenesis
include, for example, occlusive peripheral vascular disease and coronary
diseases, in particular,
the occlusion of coronary vessels, and disorders associated with the occlusion
of the peripheral
vasculature and/or coronary blood vessels, erectile dysfunction, stroke, and
wounds. Also
disclosed are compositions and methods for promoting angiogenesis and/or
recruiting collateral
blood vessels in a patient in need thereof The compositions include an
effective amount of
polymeric forms of thyroid hormone analogs and derivatives and an effective
amount of an
adenosine and/or nitric oxide donor. The compositions can be in the form of a
sterile,
injectable, pharmaceutical formulation that includes an angiogenically
effective amount of
thyroid hormone-like substance and adenosine derivatives in a physiologically
and
pharmaceutically acceptable carrier, optionally with one or more excipients.
Myocardial Infarction
A major reason for heart failure following acute myocardial infarction is an
inadequate
response of new blood vessel formation, i.e., angiogenesis. Thyroid hormone
and its analogs
are beneficial in heart failure and stimulate coronary angiogenesis. The
methods of the
81
CA 02648243 2013-09-23
invention include, in part, delivering a single treatment of a thyroid hormone
analog at the time
of infarction either by direct injection into the myocardium, or by simulation
of coronary
injection by intermittent aortic ligation to produce transient isovolumic
contractions to achieve
angiogenesis and/or ventricular remodeling.
Accordingly, in one aspect the invention features methods for treating
occlusive
vascular disease, coronary disease, myocardial infarction, ischemia, stroke,
and/or peripheral
artery vascular disorders by promoting angiogenesis by administering to a
subject in need
thereof an amount of a polymeric form of thyroid hormone, or an analog
thereof, effective for
promoting angiogenesis.
Examples of polymeric forms of thyroid hormone analogs are also provided
herein and
can include triiodothyronine (T3), levothyroxine (14), (GC-1), or 3,5-
diiodothyropropionic
acid (DITPA) conjugated to polyvinyl alcohol, acrylic acid ethylene co-
polymer, polylactic
acid, Poly L-arginine, poly L-Lysine.
The methods also involve the co-administration of an effective amount of
thyroid
hormone-like substance and an effective amount of an adenosine and/or NO donor
in low, daily
dosages for a week or more. One or both components can be delivered locally
via catheter.
Thyroid hormone analogs, and derivatives in vivo can be delivered to capillary
beds
surrounding ischemic tissue by incorporation of the compounds in an
appropriately sized
Nanoparticles. Thyroid hormone analogs, polymeric forms and derivatives can be
targeted to
ischemic tissue by covalent linkage with a suitable antibody.
The method may be used as a treatment to restore cardiac function after a
myocardial
infarction. The method may also be used to improve blood flow in patients with
coronary artery
disease suffering from myocardial ischemia or inadequate blood flow to areas
other than the
heart including, for example, occlusive peripheral vascular disease (also
known as peripheral
arterial occlusive disease), or erectile dysfunction.
Wound Healing
The actions of thyroid hormone that are initiated at the integrin receptor and
that are
relevant to wound-healing in vivo are platelet aggregation, angiogenesis and
fibroblast in-
migration. Thyroid hormone can also enhance in-migration of white blood cells.
82
CA 02648243 2013-09-23
Wound angiogenesis is an important part of the proliferative phase of healing.
Healing
of any skin wound other than the most superficial cannot occur without
angiogenesis. Not only
does any damaged vasculature need to be repaired, but the increased local cell
activity
necessary for healing requires an increased supply of nutrients from the
bloodstream.
Moreover, the endothelial cells which form the lining of the blood vessels are
important in
themselves as organizers and regulators of healing.
Thus, angiogenesis provides a new microcirculation to support the healing
wound. The
new blood vessels become clinically visible within the wound space by four
days after injury.
Vascular endothelial cells, fibroblasts, and smooth muscle cells all
proliferate in coordination to
support wound granulation. Simultaneously, re-epithelialization occurs to
reestablish the
epithelial cover. Epithelial cells from the wound margin or from deep hair
follicles migrate
across the wound and establish themselves over the granulation tissue and
provisional matrix.
Growth factors such as keratinocyte growth factor (KGF) mediate this process.
Several models
(sliding versus rolling cells) of epithelialization exist.
As thyroid hormones regulate metabolic rate, when the metabolism slows down
due to
hypothyroidism, wound healing also slows down. The role of topically applied
thyroid
hormone analogs or polymeric forms in wound healing therefore represents a
novel strategy to
accelerate wound healing in diabetics and in non-diabetics with impaired wound
healing
abilities. Topical administration can be in the form of attachment to a band-
aid. Additionally,
nano-polymers and nano-particles can be used as a matrix for local delivery of
thyroid hormone
and its analogs. This will aid in time-controlled delivery into the cellular
and tissue target.
Accordingly, another embodiment of the invention features methods for treating
wounds by promoting angiogenesis by administering to a subject in need thereof
an amount of
a polymeric or nanoparticulate form of thyroid hormone, or an analog thereof,
effective for
promoting angiogenesis. For details, see Examples 9A and 9B.
For nanoparticles, T4 as the PLGA formulation, when applied locally to
surgical or
traumatic wounds via gauze pads or adsorbed to synthetic films, will enhance
wound-healing
by the mechanisms described above. For small cutaneous wounds or abrasions,
derivatized T4
may be made available for clinical use in OTC gauze pads or films.
83
CA 02648243 2013-09-23
T4 as the PLGA formulation, when applied locally to cutaneous ulcers via gauze
pads or
adsorbed to synthetic films, will enhance wound-healing by the mechanisms
described above.
Because it does not cause platelet aggregation, nanoparticulate T3 is less
desirable for these
applications.
Additional wound healing uses include the use for mucus membrane related
disorders,
including post-biopsy radiation-induced inflammation, GI tract ulceration, to
curb internal
bleeding, post-tooth extraction for dental patients on anti-coagulant therapy.
For these uses,
nanoparticles or polymer conjugates may be used.
Ophthalmic
The present invention is also directed to sustained release and long residing
ophthalmic
formulation of thyroid hormone analogs having thermo-sensitivity, muco-
adhesiveness, and
small particle size (10 < 1000 nm). The said formulation comprises micelle
solution of random
block co-polymer having hydrophobic or hydrophilic thyroid hormone
antagonists. The
invention also provides a process of preparing said formulations with
different particle size and
different surface charges (positive, negative or neutral) in eye drops or
ointment.
Most ocular diseases are treated with topical application of solutions
administered as
eye drops or ointment. One of the major problems encountered with the topical
delivery of
ophthalmic drugs is the rapid and extensive pre-corneal loss caused by
drainage and high tear
fluid turn over. After instillation of an eye-drop, typically less than 2-3%
of the applied drug
penetrates the cornea and reaches the intra-ocular tissue, while a major
fraction of the instilled
dose is often absorbed systematically via the conjunctiva and nasolacrimal
duct. Another
limitation is relatively impermeable corneal barrier that limits ocular
absorption.
Because of the inherent problems associated with the conventional eye-drops
there is a
significant efforts directed towards new drug delivery systems for ophthalmic
administration
such as hydrogels, micro- and nanoparticles, liposomes and collagen shields.
Ocular drug
delivery is an approach to controlling and ultimately optimizing delivery of
the drug to its
target tissue in the eye. Most of the formulation efforts aim at maximizing
ocular drug
absorption through prolongation of the drug residence time in the cornea and
conjunctival sac
84
CA 02648243 2013-09-23
as well as to slow drug release from the delivery system and minimizing pre-
corneal drug loss
without the use of gel that has the blurring effect on the vision.
To overcome the problem of blurred vision and poor bio-availability of drug by
using
bulk gel in ophthalmic formulations, it has been suggested that colloidal
carriers would have
better effect. Nanopailicles as drug carriers for ocular delivery have been
revealed to be more
efficient than liposomes and in addition to all positive points of liposomes,
these nanoparticles
are exceptionally stable entity and the sustained release of drug can be
modulated.
There have been studies on the use of co-polymeric materials for ophthalmic
drugs and
particularly noteworthy are the attempts to incorporate hydrophobic drugs into
the hydrophobic
core of the copolymer micelles. The pharmaceutical efficacy of these
formulations depends on
the specific nature and properties of the co-polymeric materials and the
compound used.
Moreover, the long residence time and sustained release of drug on cornea
surface have not
been achieved by other biocompatible formulations.
Neuronal
Contrary to traditional understanding of neural induction, the present
invention is partly
based on the unexpected finding that mechanisms that initiate and maintain
angiogenesis are
effective promoters and sustainers of neurogenesis. These methods and
compositions are
useful, for example, for the treatment of motor neuron injury and neuropathy
in trauma, injury
and neuronal disorders. This invention discloses the use of various pro-
angiogenesis strategies
alone or in combination with nerve growth factor or other neurogenesis
factors. Pro-
angiogenesis factors include polymeric thyroid hormone analogs as illustrated
herein. The
polymeric thyroid hormone analogs and its polymeric conjugates alone or in
combination with
other pro-angiogenesis growth factors known in the art and with nerve growth
factors or other
neurogenesis factors can be combined for optimal neurogenesis.
Disclosed are therapeutic treatment methods, compositions and devices for
maintaining
neural pathways in a mammal, including enhancing survival of neurons at risk
of dying,
inducing cellular repair of damaged neurons and neural pathways, and
stimulating neurons to
maintain their differentiated phenotype. Additionally, a composition
containing polymeric
CA 02648243 2013-09-23
thyroid hormone analogs, and combinations thereof, in the presence of anti-
oxidants and/or
anti-inflammatory agents demonstrate neuronal regeneration and protection.
The present invention also provides thyroid hormones, analogs, and polymeric
conjugations, alone or in combination with nerve growth factors or other
neurogenesis factors,
to enhance survival of neurons and maintain neural pathways. As described
herein, polymeric
thyroid hormone analogs alone or in combination with nerve growth factors or
other
neurogenesis factors are capable of enhancing survival of neurons, stimulating
neuronal CAM
expression, maintaining the phenotypic expression of differentiated neurons,
inducing the
redifferentiation of transformed cells of neural origin, and stimulating
axonal growth over
breaks in neural processes, particularly large gaps in axons. Morphogens also
protect against
tissue destruction associated with immunologically-related nerve tissue
damage. Finally,
polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other
neurogenesis factors may be used as part of a method for monitoring the
viability of nerve
tissue in a mammal.
The present invention also provides effects of polymeric thyroid hormones on
synapse
formation between cultured rat cortical neurons, using a system to estimate
functional synapse
formation in vitro. Exposure to 10-9 M polymeric thyroid hormones, 3,5,3'-
triiodothyronine or
thyroxine, caused an increase in the frequency of spontaneous synchronous
oscillatory changes
in intracellular calcium concentration, which correlated with the number of
synapses formed.
The detection of synaptic vesicle-associated protein synapsin I by
immunocytochemical and
immunoblot analysis also confirmed that exposure to thyroxine facilitated
synapse formation.
The presence of amiodarone, an inhibitor of 5'-deiodinase, or amitrole, a
herbicide, inhibited
the synapse formation in the presence of thyroxine. Thus, the present
invention also provides a
useful in vitro assay system for screening of miscellaneous chemicals that
might interfere with
synapse formation in the developing CNS by disrupting the polymeric thyroid
system.
As a general matter, methods of the present invention may be applied to the
treatment of
any mammalian subject at risk of or afflicted with a neural tissue insult or
neuropathy. The
invention is suitable for the treatment of any primate, preferably a higher
primate such as a
human. In addition, however, the invention may be employed in the treatment of
domesticated
mammals which are maintained as human companions (e.g., dogs, cats, horses),
which have
86
CA 02648243 2013-09-23
significant commercial value (e.g., goats, pigs, sheep, cattle, sporting or
draft animals), which
have significant scientific value (e.g., captive or free specimens of
endangered species, or
inbred or engineered animal strains), or which otherwise have value.
The polymeric thyroid hormone analogs alone or in combination with nerve
growth
factors or other neurogenesis factors described herein enhance cell survival,
particularly of
neuronal cells at risk of dying. For example, fully differentiated neurons are
non-mitotic and
die in vitro when cultured under standard mammalian cell culture conditions,
using a
chemically defined or low serum medium known in the art. See, for example,
Charness, J. Biol.
Chem. 26: 3164-3169 (1986) and Freese, et al., Brain Res. 521: 254-264 (1990).
However, if a
primary culture of non-mitotic neuronal cells is treated with polymeric
thyroid analog alone or
in combination with nerve growth factor or other neurogenesis factors, the
survival of these
cells is enhanced significantly. For example, a primary culture of striatal
basal ganglia isolated
from the substantia nigra of adult rat brain was prepared using standard
procedures, e.g., by
dissociation by trituration with pasteur pipette of substantia nigra tissue,
using standard tissue
culturing protocols, and grown in a low serum medium, e.g., containing 50%
DMEM
(Dulbecco's modified Eagle's medium), 50% F-12 medium, heat inactivated horse
serum
supplemented with penicillin/streptomycin and 4 g/1 glucose. Under standard
culture
conditions, these cells are undergoing significant cell death by three weeks
when cultured in a
serum-free medium. Cell death is evidenced morphologically by the inability of
cells to remain
adherent and by changes in their ultrastructural characteristics, e.g., by
chromatin clumping and
organelle disintegration. Specifically, cells remained adherent and continued
to maintain the
morphology of viable differentiated neurons. In the absence of thyroid analog
alone or in
combination with nerve growth factor or other neurogenesis factors treatment,
the majority of
the cultured cells dissociated and underwent cell necrosis.
Dysfunctions in the basal ganglia of the substantia nigra are associated with
Huntington's chorea and parkinsonism in vivo. The ability of the polymeric
thyroid hormone
analogs alone or in combination with nerve growth factors or other
neurogenesis factors
defined herein to enhance neuron survival indicates that these polymeric
thyroid hormone
analogs alone or in combination with nerve growth factors or other
neurogenesis factors will
be useful as part of a therapy to enhance survival of neuronal cells at risk
of dying in vivo due,
87
CA 02648243 2013-09-23
for example, to a neuropathy or chemical or mechanical trauma. The present
invention further
provides that these polymeric thyroid hormone analogs alone or in combination
with nerve
growth factors or other neurogenesis factors provide a useful therapeutic
agent to treat
neuropathies which affect the striatal basal ganglia, including Huntington's
chorea and
Parkinson's disease. For clinical applications, the polymeric thyroid hormone
analogs alone or
in combination with nerve growth factors or other neurogenesis factors may be
administered or,
alternatively, a polymeric thyroid hormone analog alone or in combination with
nerve growth
factors or other neurogenesis factors-stimulating agent may be administered.
The thyroid hormone compounds described herein can also be used for nerve
tissue
protection from chemical trauma. The ability of the polymeric thyroid hormone
analogs alone
or in combination with nerve growth factors or other neurogenesis factors
described herein to
enhance survival of neuronal cells and to induce cell aggregation and cell--
cell adhesion in
redifferentiated cells, indicates that the polymeric thyroid hormone analogs
alone or in
combination with nerve growth factors or other neurogenesis factors will be
useful as
therapeutic agents to maintain neural pathways by protecting the cells
defining the pathway
from the damage caused by chemical trauma. In particular, the polymeric
thyroid hormone
analogs alone or in combination with nerve growth factors or other
neurogenesis factors can
protect neurons, including developing neurons, from the effects of toxins
known to inhibit the
proliferation and migration of neurons and to interfere with cell--cell
adhesion. Examples of
such toxins include ethanol, one or more of the toxins present in cigarette
smoke, and a variety
of opiates. The toxic effects of ethanol on developing neurons induces the
neurological damage
manifested in fetal alcohol syndrome. The polymeric thyroid hormone analogs
alone or in
combination with nerve growth factors or other neurogenesis factors also may
protect neurons
from the cytotoxic effects associated with excitatory amino acids such as
glutamate.
For example, ethanol inhibits the cell--cell adhesion effects induced in
polymeric
thyroid analog alone or in combination with nerve growth factor or other
neurogenesis factors-
treated NG108-15 cells when provided to these cells at a concentration of 25-
50 mM. Half
maximal inhibition can be achieved with 5-10 mM ethanol, the concentration of
blood alcohol
in an adult following ingestion of a single alcoholic beverage. Ethanol likely
interferes with the
homophilic binding of CAMs between cells, rather than their induction, as
polymeric thyroid
88
CA 02648243 2013-09-23
analog alone or in combination with nerve growth factor or other neurogenesis
factors-induced
N-CAM levels are unaffected by ethanol. Moreover, the inhibitory effect is
inversely
proportional to polymeric thyroid analog alone or in combination with nerve
growth factor or
other neurogenesis factors concentration. Accordingly, it is envisioned that
administration of a
polymeric thyroid analog alone or in combination with nerve growth factor or
other
neurogenesis factors or polymeric thyroid analog alone or in combination with
nerve growth
factor or other neurogenesis factors-stimulating agent to neurons,
particularly developing
neurons, at risk of damage from exposure to toxins such as ethanol, may
protect these cells
from nerve tissue damage by overcoming the toxin's inhibitory effects. The
polymeric thyroid
analog alone or in combination with nerve growth factor or other neurogenesis
factors
described herein also are useful in therapies to treat damaged neural pathways
resulting from a
neuropathy induced by exposure to these toxins.
The in vivo activities of the polymeric thyroid hormone analogs alone or in
combination
with nerve growth factors or other neurogenesis factors described herein also
are assessed
readily in an animal model as described herein. A suitable animal, preferably
exhibiting nerve
tissue damage, for example, genetically or environmentally induced, is
injected intracerebrally
with an effective amount of a polymeric thyroid hormone analogs alone or in
combination with
nerve growth factor or other neurogenesis factors in a suitable therapeutic
formulation, such as
phosphate-buffered saline, pH 7. The polymeric thyroid hormone analogs alone
or in
combination with nerve growth factors or other neurogenesis factors preferably
is injected
within the area of the affected neurons. The affected tissue is excised at a
subsequent time point
and the tissue evaluated morphologically and/or by evaluation of an
appropriate biochemical
marker (e.g., by polymeric thyroid hormone analogs alone or in combination
with nerve
growth factors or other neurogenesis factors or N-CAM localization; or by
measuring the dose-
dependent effect on a biochemical marker for CNS neurotrophic activity or for
CNS tissue
damage, using for example, glial fibrillary acidic protein as the marker. The
dosage and
incubation time will vary with the animal to be tested. Suitable dosage ranges
for different
species may be determined by comparison with established animal models.
Presented below is
an exemplary protocol for a rat brain stab model.
Briefly, male Long Evans rats, obtained from standard commercial sources, are
89
CA 02648243 2013-09-23
anesthetized and the head area prepared for surgery. The calvariae is exposed
using standard
surgical procedures and a hole drilled toward the center of each lobe using a
0.035K wire, just
piercing the calvariae. 25 ml solutions containing either polymeric thyroid
analog alone or in
combination with nerve growth factor or other neurogenesis factors (e.g., OP-
1, 25 mg) or PBS
then is provided to each of the holes by Hamilton syringe. Solutions are
delivered to a depth
approximately 3 mm below the surface, into the underlying cortex, corpus
callosum and
hippocampus. The skin then is sutured and the animal allowed to recover.
Three days post surgery, rats are sacrificed by decapitation and their brains
processed
for sectioning. Scar tissue formation is evaluated by immunofluorescence
staining for glial
fibrillary acidic protein, a marker protein for glial scarring, to
qualitatively determine the
degree of scar formation. Glial fibrillary acidic protein antibodies are
available commercially,
e.g., from Sigma Chemical Co., St. Louis, Mo. Sections also are probed with
anti-OP-1
antibodies to determine the presence of OP-1. Reduced levels of glial
fibrillary acidic protein
are anticipated in the tissue sections of animals treated with the polymeric
thyroid analog alone
or in combination with nerve growth factor or other neurogenesis factors,
evidencing the ability
of polymeric thyroid analog alone or in combination with nerve growth factor
or other
neurogenesis factors to inhibit glial scar formation and stimulate nerve
regeneration.
CA 02648243 2013-09-23
Brain Imaging, Diagnosis, and Therapies of Neurodegenerative Diseases
The present invention relates to novel pharmaceutical and radiopharmaceuticals
useful
for the early diagnosis, prevention, and treatment of neurodegenerative
disease, such as, for
example, Alzheimer's disease. The invention also includes novel chemical
compounds having
specific binding in a biological system and capable of being used for positron
emission
tomography (PET), single photon emission (SPECT) imaging methods, and magnetic
resonance (MRI) imaging methods. The ability of T4 and other thyroid hormone
analogs to
bind to localized ligands within the body makes it possible to utilize such
compounds for in situ
imaging of the ligands by PET, SPECT, MRI, and similar imaging methods. In
principle,
nothing need be known about the nature of the ligand, as long as binding
occurs, and such
binding is specific for a class of cells, organs, tissues or receptors of
interest.
PET imaging is accomplished with the aid of tracer compounds labeled with a
positron-
emitting isotope (Goodman, M. M. Clinical Positron Emission Tomography, Mosby
Yearbook,
1992, K. F. Hubner et al., Chapter 14). For most biological materials,
suitable isotopes are few.
The carbon isotope, "C, has been used for PET, but its short half-life of 20.5
minutes limits its
usefulness to compounds that can be synthesized and purified quickly, and to
facilities that are
proximate to a cyclotron where the precursor Cli starting material is
generated. Other isotopes
have even shorter half-lives. N13 has a half-life of 10 minutes and 015 has an
even shorter half-
life of 2 minutes. The emissions of both are more energetic than those of C11.
Nevertheless,
PET studies have been carried out with these isotopes (Hubner, K. F., in
Clinical Positron
Emission Tomography, Mosby Year Book, 1992, K. F. Hubner, et al., Chapter 2).
A more
useful isotope, 18F, has a half-life of 110 minutes. This allows sufficient
time for incorporation
into a radio-labeled tracer, for purification and for administration into a
human or animal
subject. In addition, facilities more remote from a cyclotron, up to about a
200 mile radius, can
make use of F18 labeled compounds. Disadvantages of '8F are the relative
scarcity of
fluorinated analogs that have functional equivalence to naturally-occurring
biological materials,
and the difficulty of designing methods of synthesis that efficiently utilize
the starting material
generated in the cyclotron. Such starting material can be either fluoride ion
or fluorine gas. In
the latter case only one fluorine atom of the bimolecular gas is actually a
radionuclide, so the
91
CA 02648243 2013-09-23
gas is designated F-F18. Reactions using F-F18 as starting material therefore
yield products
having only one half the radionuclide abundance of reactions utilizing K. F18
as starting
material. On the other hand, F48 can be prepared in curie quantities as
fluoride ion for
incorporation into a radiopharmaceutical compound in high specific activity,
theoretically 1.7
Ci/nmol using carrier-free nucleophilic substitution reactions. The energy
emission of F18 is
0.635 MeV, resulting in a relatively short, 2.4 mm average positron range in
tissue, permitting
high resolution PET images.
SPECT imaging employs isotope tracers that emit high energy photons (.gamma.-
emitters). The range of useful isotopes is greater than for PET, but SPECT
provides lower
three-dimensional resolution. Nevertheless, SPECT is widely used to obtain
clinically
significant information about analog binding, localization and clearance
rates. A useful isotope
for SPECT imaging is /123 cc-gamma.-emitter with a 13.3 hour half life.
Compounds labeled
with 1123 can be shipped up to about 1000 miles from the manufacturing site,
or the isotope
itself can be transported for on-site synthesis. Eighty-five percent of the
isotope's emissions are
159 KeV photons, which is readily measured by SPECT instrumentation currently
in use. The
compounds of the invention can be labeled with Technetium. Technetium-99m is
known to be
a useful radionuclide for SPECT imaging. The T4 analogs of the invention are
joined to a Tc-
99m metal cluster through a 4-6 carbon chain which can be saturated or possess
a double or
triple bond.
Use of F'8 labeled compounds in PET has been limited to a few analog
compounds.
Most notably, 18F-fluorodeoxyglucose has been widely used in studies of
glucose metabolism
and localization of glucose uptake associated with brain activity. i8F4, -
fluorodopa and other
dopamine receptor analogs have also been used in mapping dopamine receptor
distribution.
Other halogen isotopes can serve for PET or SPECT imaging, or for conventional
tracer
labeling. These include 75Br, 76Br, 77Br and 82Br as having usable half-lives
and emission
characteristics. In general, the chemical means exist to substitute any
halogen moiety for the
described isotopes. Therefore, the biochemical or physiological activities of
any halogenated
homolog of the described compounds are now available for use by those skilled
in the art,
including stable isotope halogen homolog. Astatine can be substituted for
other halogen
isotypes. 210
At for example, emits alpha particles with a half-life of 8.3h. Other isotopes
also
92
CA 02648243 2013-09-23
emit alpha particles with reasonably useful half-lives. At-substituted
compounds are therefore
useful for brain therapy, where binding is sufficiently brain-specific.
Numerous studies have demonstrated increased incorporation of carbohydrates
and
amino acids into malignant brain cells. This accumulation is associated with
accelerated
proliferation and protein synthesis of such cells. The glucose analog 18F-2-
fluoro-2-deoxy-D-
glucose (2-FDG) has been used for distinguishing highly malignant brain brains
from normal
brain tissue or benign growths (DiChiro, G. et al. (1982) Neurology (NY)
32:1323-1329.
However, fluorine-18 labeled 2-FDG is not the agent of choice for detecting
low grade brain
brains because high uptake in normal tissue can mask the presence of a brain.
In addition,
fluorine-18 labeled 2-FDG is not the ideal radiopharmaceutical for
distinguishing lung brains
from infectious tissue or detecting ovarian carcinoma because of high uptake
of the 2-FDG
radioactivity in infectious tissue and in the bladder, respectively. The
naturally occurring amino
acid methionine, labeled with carbon-11, has also been used to distinguish
malignant tissue
from normal tissue. But it too has relatively high uptake in normal tissue.
Moreover, the half-
life of carbon-11 is only 20 minutes; therefore Cll methionine can not be
stored for a long
period of time.
Cerebrospinal fluid ("CSF") transthyretin ("TTR"), the main CSF thyroxine (T4)
carrier
protein in the rat and the human is synthesized in the choroid plexus ("CP").
After injection of
1251-T4 in the rat, radioactive T4 accumulates first in the CP, then in the
CSF and later in the
brain (Chanoine JP, Braverman LE. The role of transthyretin in the transport
of thyroid
hormone to cerebrospinal fluid and brain. Acta Med Austriaca. 1992; 19 Suppl
1:25-8).
Compounds of the invention provide substantially improved PET imaging for
areas of
the body having amyloid protein, especially of the brain. All the available
positron-emitting
isotopes which could be incorporated into a biologically-active compound have
short half-lives.
The practical utility of such labeled compounds is therefore dependent on how
rapidly the
labeled compound can be synthesized, the synthetic yield and the radiochemical
purity of the
final product. Even the shipping time from the isotope source, a cyclotron
facility, to the
hospital or laboratory where PET imaging is to take place, is limited. A rough
calculation of the
useful distance is about two miles per minute of half-life. Thus C", with a
half-life of 20.5m is
restricted to about a 40 mile radius from a source whereas compounds labeled
with F18 can be
93
CA 02648243 2013-09-23
used within about a 200 mile radius. Further requirements of an 18F-labeled
compound are that
it have the binding specificity for the receptor or target molecule it is
intended to bind, that non-
specific binding to other targets be sufficiently low to permit distinguishing
between target and
non-target binding, and that the label be stable under conditions of the test
to avoid exchange
with other substances in the test environment. More particularly, compounds of
the invention
must display adequate binding to the desired target while failing to bind to
any comparable
degree with other tissues or cells.
A partial solution to the stringent requirements for PET imaging is to employ
.gamma-
emitting isotopes in SPECT imaging. 1123 is a commonly used isotopic marker
for SPECT,
having a half-life of 13 hours for a useful range of over 1000 miles from the
site of synthesis.
Compounds of the invention can be rapidly and efficiently labeled with 1123
for use in SPECT
analysis as an alternative to PET imaging. Furthermore, because of the fact
that the same
compound can be labeled with either isotope, it is possible for the first time
to compare the
results obtained by PET and SPECT using the same tracer.
The specificity of brain binding also provides utility for I-substituted
compounds of the
invention. Such compounds can be labeled with short-lived 1231 for SPECT
imaging or with
longer-lived 1251 for longer-term studies such as monitoring a course of
therapy. Other iodine
and bromine isotopes can be substituted for those exemplified.
In general, the radioactive imaging agents of the present invention are
prepared by
reacting radioactive 4-halobenzyl derivatives with piperazine derivatives.
Preferred are F-18
labeled 4-fluorobenzyl derivatives for PET-imaging. A general method for the
preparation of
4-fluoro-18 F-benzyl halides is described in Iwata et al., Applied
Radiation and Isotopes
(2000), Vol. 52, pp. 87-92.
For Single Photon Emission Computed Tomography ("SPECT"), 99mTc-labeled
compounds are preferred. A general synthetic pathway for these compounds
starts with non-
radioactive TH analogs within the present invention that are reacted with
99mTc -binding
chelators, e.g. N2 S2 -Chelators. The synthesis of the chelators follows
standard procedures, for
example, the procedures described in A. Mahmood et al., A N2 S2 -Tetradentate
Chelate for
Solid-Phase Synthesis: Technetium, Rhenium in Chemistry and Nuclear Medicine
(1999), Vol.
5, p. 71, or in Z. P. Zhuang et al., Bioconjugate Chemistry (1999), Vol. 10,
p. 159.
94
CA 02648243 2013-09-23
One of the chelators is either bound directly to the nitrogen in the --N(R4)R5
group of
the non-radioactive compounds of the TH analogs of the present invention, or
via a linker
moiety comprising an alkyl radical having one to ten carbon atoms, wherein the
alkyl radical
optionally contains one to ten --C(0)-- groups, one to ten --C(0)N(R)--
groups, one to ten --
N(R)C(0)-- groups, one to ten --N(R)-- groups, one to ten --N(R)2 groups, one
to ten hydroxy
groups, one to ten --C(0)0R-- groups, one to ten oxygen atoms, one to ten
sulfur atoms, one to
ten nitrogen atoms, one to ten halogen atoms, one to ten aryl groups, and one
to ten saturated or
unsaturated heterocyclic rings wherein R is hydrogen or alkyl. A preferred
linker moiety is --
C(0)--CH2 --N(H)--.
The compounds of the invention therefore provide improved methods for brain
imaging
using PET and SPECT. The methods entail administering to a subject (which can
be human or
animal, for experimental and/or diagnostic purposes) an image-generating
amount of a
compound of the invention, labeled with the appropriate isotope and then
measuring the
distribution of the compound by PET if F18 or other positron emitter is
employed, or SPECT if
1123 or other gamma emitter is employed. An image-generating amount is that
amount which is
at least able to provide an image in a PET or SPECT scanner, taking into
account the scanner's
detection sensitivity and noise level, the age of the isotope, the body size
of the subject and
route of administration, all such variables being exemplary of those known and
accounted for
by calculations and measurements known to those skilled in the art without
resort to undue
experimentation.
It will be understood that compounds of the invention can be labeled with an
isotope of
any atom or combination of atoms in the structure. While F18, 1123, and 1125
have been
emphasized herein as being particularly useful for PET, SPECT and tracer
analysis, other uses
are contemplated including those flowing from physiological or pharmacological
properties of
stable isotope homolog and will be apparent to those skilled in the art.
The invention also provides for technetium (Tc) labeling via Tc adducts.
Isotopes of Tc,
notably Tc99m, have been used for brain imaging. The present invention
provides Tc-complexed
adducts of compounds of the invention, which are useful for brain imaging. The
adducts are
Tc-coordination complexes joined to the cyclic amino acid by a 4-6 carbon
chain which can be
saturated or possess a double or triple bond. Where a double bond is present,
either E (trans) or
CA 02648243 2013-09-23
Z (cis) isomers can be synthesized, and either isomer can be employed.
Synthesis is described
for incorporating the 99mTc isotope as a last step, to maximize the useful
life of the isotope.
The following methods were employed in procedures reported herein. "F-Fluoride
was
produced from a Seimens cyclotron using the 180(p,n) 18F reaction with 11 MeV
protons on
95% enriched 180 water. All solvents and chemicals were analytical grade and
were used
without further purification. Melting points of compounds were determined in
capillary tubes
by using a Buchi SP apparatus. Thin-layer chromatographic analysis (TLC) was
performed by
using 250-mm thick layers of silica gel G PF-254 coated on aluminum (obtained
from
Analtech, Inc.). Column chromatography was performed by using 60-200 mesh
silica gel
(Aldrich Co.). Infrared spectra (IR) were recorded on a Beckman 18A
spectrophotometer with
NaC1 plates. Proton nuclear magnetic resonance spectra (1H NMR) were obtained
at 300 MHz
with a Nicolet high-resolution instrument.
In another aspect, the invention is directed to a method of using a compound
of the
invention for the manufacture of a radiopharmaceutical for the diagnosis of
Alzheimer's disease
in a human. In another aspect, the invention is directed to a method of
preparing compounds of
the invention.
The compounds of the invention as described herein are the thyroid hormone
analogs or
other TTR binding ligands, which bind to TTR and have the ability to pass the
blood-brain
barrier. The compounds are therefore suited as in vivo diagnostic agents for
imaging of
Alzheimer's disease. The detection of radioactivity is performed according to
well-known
procedures in the art, either by using a gamma camera or by positron emission
tomography
(PET).
Preferably, the free base or a pharmaceutically acceptable salt form, e.g. a
monochloride
or dichloride salt, of a compound of the invention is used in a galenical
formulation as
diagnostic agent. The galenical formulation containing the compound of the
invention
optionally contains adjuvants known in the art, e.g. buffers, sodium chloride,
lactic acid,
surfactants etc. A sterilization by filtration of the galenical formulation
under sterile conditions
prior to usage is possible.
The radioactive dose should be in the range of 1 to 100 mCi, preferably 5 to
30 mCi,
and most preferably 5 to 20 mCi per application. TH compositions within the
scope of the
96
CA 02648243 2013-09-23
present invention can be used as diagnostic agents in positron emission
tomography (PET).
The compounds of the present invention may be administered by any suitable
route,
preferably in the form of a pharmaceutical composition adapted to such a
route, and in a dose
effective to bind TTR in the brain and thereby be detected by gamma camera or
PET.
Typically, the administration is parenteral, e.g., intravenously,
intraperitoneally,
subcutaneously, intradermally, or intramuscularly. Intraveneous administration
is preferred.
Thus, for example, the invention provides compositions for parenteral
administration which
comprise a solution of contrast media dissolved or suspended in an acceptable
carrier, e.g.,
serum or physiological sodium chloride solution.
Aqueous carriers include water, alcoholic/aqueous solutions, saline solutions,
parenteral
vehicles such as sodium chloride, Ringer's dextrose, etc. Examples of non-
aqueous solvents are
propylene glycol, polyethylene glycol, vegetable oil and injectable organic
esters such as ethyl
oleate. Other pharmaceutically acceptable carriers, non-toxic excipients,
including salts,
preservatives, bufers and the like, are described, for instance, in
REMMINGTON'S
PHARMACEUTICAL SCIENCES, 15th Ed. Easton: Mack Publishing Co., pp. 1405-
1412
and 1461-1487 (1975) and THE NATIONAL FORMULARY XIV., 14th Ed.
Washington:
American Pharmaceutical Association (1975). Aqueous carriers, are preferred.
Pharmaceutical composition of this invention are produced in a manner known
per se
by suspending or dissolving the compounds of this invention--optionally
combined with the
additives customary in galenic pharmacy--in an aqueous medium and then
optionally sterilizing
the suspension or solution. Suitable additives are, for example,
physiologically acceptable
buffers (such as, for instance, tromethamine), additions of complexing agents
(e.g.,
diethylenetriaminepentaacetic acid) or--if required--electrolytes, e.g.,
sodium chloride or--if
necessary--antioxidants, such as ascorbic acid, for example.
If suspensions or solutions of the compounds of this invention in water or
physiological
saline solution are desirable for enteral administration or other purposes,
they are mixed with
one or several of the auxiliary agents (e.g., methylcellulose, lactose,
mannitol) and/or tensides
(e.g., lecithins, "Tween11", "MyrjTm") and/or flavoring agents to improve
taste (e.g., ethereal
oils), as customary in galenic pharmacy.
The compositions may be sterilized by conventional, well known sterilization
97
CA 02648243 2013-09-23
techniques, or may be sterile filtered. The resulting aqueous solutions may be
packaged for use
as is, or lyophilized, the lyophilized preparation being combined with a
sterile solution prior to
administration. The compositions may contain pharmaceutically acceptable
auxiliary
substances as required to approximate physiological conditions, such as pH
adjusting and
buffering agents, tonicity adjusting agents, wetting agents and the like, for
example, sodium
acetate, sodium lactate, sodium chloride, potassium chloride, calcium
chloride, sorbitan
monolaurate, triethanolamine oleate, etc.
For the compounds according to the invention having radioactive halogens,
these
compounds can be shipped as "hot" compounds, i.e., with the radioactive
halogen in the
compound and administered in e.g., a physiologically acceptable saline
solution. In the case of
the metal complexes, these compounds can be shipped as "cold" compounds, i.e.,
without the
radioactive ion, and then mixed with Tc-generator eluate or Re-generator
eluate.
Inhibiting Angiogenesis
The invention also provides, in another part, compositions and methods for
inhibiting
angiogenesis in a subject in need thereof. Conditions amenable to treatment by
inhibiting
angiogenesis include, for example, primary or metastatic tumors and diabetic
retinopathy. The
compositions can include an effective amount of tetraiodothyroacetic acid
(TETRAC),
triiodothyroacetic acid (TRIAC), monoclonal antibody LM609, or combinations
thereof. Such
anti-angiogenesis agents can act at the cell surface to inhibit the pro-
angiogenesis agents. The
compositions can be in the form of a sterile, injectable, pharmaceutical
formulation that
includes an anti-angiogenically effective amount of an anti-angiogenic
substance in a
physiologically and pharmaceutically acceptable carrier, optionally with one
or more
excipients.
In a further aspect, the invention provides methods for treating a condition
amenable to
treatment by inhibiting angiogenesis by administering to a subject in need
thereof an amount of
an anti-angiogenesis agent effective for inhibiting angiogenesis. The
compositions of the
present invention can be used to inhibit angiogenesis associated with cancers,
including head
98
CA 02648243 2013-09-23
and neck, glioma, skin, lung, breast, and thyroid. The thyroid hormne
antagonists, like tetrac,
can be administered as polymer conjugates or as nanoparticles.
Nature of cellular actions of tetrac that are initiated at the plasma
membrane:
Acting at the plasma membrane receptor for thyroid hormone, tetrac inhibits
the
proangiogenic effects of T4 and T3 in standard assays of neovascularization
(chick
chorioallantoic membrane, human dermal microvascular endothelial cells).
Tetrac blocks the
action of agonist thyroid hormone analogues (T4, T3) on growth of human and
animal cancer
cells in vitro, as well as in certain in vivo models. Among the human cancer
cell models whose
proliferation is inhibited by tetrac are breast cancer and lung cancer. Among
animal tumor
cells are glioma cells that are models for human brain cancer, such as
glioma/glioblastoma.
Action of tetrac initiated at the plasma membrane in the absence of agonist
thyroid
hormone analogues:
The proximity of the hormone receptor site to the RGD site on the integrin
underlies the
ability of tetrac, in the absence of hormone agonists such as T4 and T3, to
block the pro-
angiogenic activities of polypeptide endothelial growth factors, such as, but
not limited to,
vascular endothelial growth factor (VEGF) and basic fibroblast growth factor
(bFGF).
Tetrac for Inducing Apoptosis in Glioma and Thyroid Cancer Cells
The figures below demonstrate that tetrac is capable of inducing apoptosis in
C6 glioma
cells and in thyroid cancer cells (BHP 2-7). Thus, at least part of the
decrease in proliferation
of cancer cells when they are exposed to tetrac is programmed cell death
(apoptosis). When
proliferation slows in studies of any cancer cells, the issue is whether the
cells survive in a cell
cycle arrest mode or whether they die. Cell death is more desirable than cell
cycle arrest.
Tetrac for Viral Agents
Tetrac may be used for the West Nile virus. Certain viral agents, such as the
West Nile
Virus, whose cell entry depends on the alpha v beta 3 integrin via the RGD
binding site can be
treated with tetrac.
99
CA 02648243 2013-09-23
Tetrac for Human Lung Cancer
The thyroid hormone/tetrac effect involves the estrogen receptor (ER) in both
small cell
and non-small cell human lung carcinoma cells. L-thyroxine (T4) and 3,5,3'-
triiodo-L-
thyronine (T3) cause proliferation of small cell and non-small cell human lung
carcinoma lines
and do so via a mechanism that requires the presence in the tumor cells of
estrogen receptor-
alpha (ERalpha). Tetraiodothyroacetic acid (tetrac) is a probe for the
involvement of the cell
surface receptor for thyroid hormone on integrin alphaVbeta3 in the cellular
actions of T4 and
T3. Tetrac, either free or as a nanoparticle, blocks this proliferative action
of T4 and T3 on
lung carcinoma cells. This indicates that the cell surface receptor for
thyroid hormone on
integrin alphaVbeta3 mediates the T4 and T3 effects. We have also blocked the
proliferative
actions of T4 and T3 on lung cancer cells with anti-alphaV and anti-beta3 and
with RGD
peptide. These observations further support the role of the integrin receptor
for thyroid
hormone in promotion by T4 and T3 of proliferation of lung cancer cells.
Tetrac, either free or as the nanoparticle, is an attractive and novel
strategy for
management of human lung carcinoma. In addition to its anti-proliferative
action, tetrac, either
free or as the naoparticle, is anti-angiogenic, inhibiting new blood vessel
growth that supports
lung carcinoma growth. Thus, tetrac has at least two discrete actions that are
relevant to
inhibition of lung tumor growth.
Among the nanoparticulate formulations of tetrac are tetrac linked by ester or
ether
bond to polylysyl glycolic acid (PLGA) or to collagen or other molecules of
sufficient size to
prohibit cell entry by tetrac. These formulations limit actions of tetrac to
the cell surface
receptor for thyroid hormone on integrin alphaVbeta3.
Cancer-Related New Blood Vessel Growth:
Examples of the conditions amenable to treatment by inhibiting angiogenesis
include,
but are not limited to, primary or metastatic tumors, including, but not
limited to glioma and
breast cancer. In such a method, compounds which inhibit the thyroid hormone-
induced
angiogenic effect are used to inhibit angiogenesis. Details of such a method
is illustrated in
Example 12. Thyroid hormone antagonists such as tetrac, analogs, polymer
conjugates, and
100
CA 02648243 2013-09-23
nanoparticles thereof can also be used as an anti-angiogenic agent to inhibit
angiopoeitin-2.
This inhibition can help prevent cancer-related new blood vessel growth, as
angiopoeitin-2
destabilizes blood vessels around tumors, making those blood vessels more
susceptible to the
induction of sprouts by VEGF.
Diabetic Retinopathy:
Examples of the conditions amenable to treatment by inhibiting angiogenesis
include,
but are not limited to diabetic retinopathy, and related conditions. In such a
method,
compounds which inhibit the thyroid hormone-induced angiogenic effect are used
to inhibit
angiogenesis. Details of such a method is illustrated in Examples 8A and B.
It is known that proliferative retinopathy induced by hypoxia (rather than
diabetes)
depends upon alphaV (aV) integrin expression (E Chavakis et al., Diabetologia
45:262-267,
2002). It is proposed herein that thyroid hormone action on a specific
integrin alphaVbeta-3
(aVP3) is permissive in the development of diabetic retinopathy. Integrin
aVil3 is identified
herein as the cell surface receptor for thyroid hormone. Thyroid hormone, its
analogs, and
polymer conjugations, act via this receptor to induce angiogenesis.
Dermatology - Nanoparticulate Tetraiodothyroacetic Acid (Tetrac) to Diminish
Size of
Cutaneous Telangiectasias and Angiomas:
Thyroid hormone antagonists such as tetrac, analogs, polymer conjugates, and
nanoparticles thereof can also be used to treat non-cancer skin disorders.
This therapeutic
and/or cosmetic action of derivatized tetrac is based on its anti-angiogenic
activity. Applied
locally as an ointment or cream to cutaneous telangiectasias or spider
angiomas, derivatized
tetrac will oppose the pro-angiogenic actions on endothelial cells of
endogenous (circulating)
thyroid hormone and of polypeptide vascular growth factors. Systemic effects
of the locally
applied hormone analogue as a PLGA derivative will be negligible. For low-
grade
telangiectasias or angiomas, derivatized tetrac may be made available for
clinical use in OTC
preparations.
Because tetrac opposes the platelet aggregation action of thyroid hormone,
trauma at the
site of application of tetrac could lead to local bleeding. This is a risk
with existing, untreated
101
CA 02648243 2013-09-23
telangiectasias and angiomas. Successful diminution with application of tetrac
of the size of
such vascular lesions will, however, reduce the risk of local ecchymoses.
Additional dermatological topical applications for nanoparticulate-conjugated
thyroid
antagonists include poikiloderma of civatte (long term exposure to sunlight
leading to facial
neovascularization and dilated blood vessels), acne or facial rosacea,
psoriasis alone or in
combination with Vitamin D analogs, and skin cancer.
Available anti-angiogenic agents are too expensive for use for the cutaneous
lesions
targeted here. These agents may also be unsuitable for cutaneous application
because they are
not locally absorbed.
Methods of Treatment and Formulations:
Thyroid hormone analogs, polymeric forms, and derivatives can be used in a
method for
promoting angiogenesis in a patient in need thereof. The method involves the
co-administration
of an effective amount of thyroid hormone analogs, polymeric forms, and
derivatives in low,
daily dosages for a week or more. The method may be used as a treatment to
restore cardiac
function after a myocardial infarction. The method may also be used to improve
blood flow in
patients with coronary artery disease suffering from myocardial ischemia or
inadequate blood
flow to areas other than the heart, for example, peripheral vascular disease,
for example,
peripheral arterial occlusive disease, where decreased blood flow is a
problem.
The compounds can be administered via any medically acceptable means which is
suitable for the compound to be administered, including oral, rectal, topical
or parenteral
(including subcutaneous, intramuscular and intravenous) administration. For
example,
adenosine has a very short half-life. For this reason, it is preferably
administered intravenously.
However, adenosine A,A2 agonists have been developed which have much
longer half-
lives, and which can be administered through other means. Thyroid hormone
analogs,
polymeric forms, and derivatives can be administered, for example,
intravenously, oral, topical,
intranasal administration.
In some embodiments, the thyroid hormone analogs, polymeric forms, and
derivatives are
administered via different means.
102
CA 02648243 2013-09-23
The amounts of the thyroid hormone, its analogs, polymeric forms, and
derivatives required
to be effective in stimulating angiogenesis will, of course, vary with the
individual being treated
and is ultimately at the discretion of the physician. The factors to be
considered include the
condition of the patient being treated, the efficacy of the particular
adenosine A2 receptor agonist
being used, the nature of the formulation, and the patient's body weight.
Occlusion-treating
dosages of thyroid hormone analogs or its polymeric forms, and derivatives are
any dosages that
provide the desired effect.
The compounds described above are preferably administered in a formulation
including
thyroid hormone analogs or its polymeric forms, and derivatives together with
an acceptable carrier
for the mode of administration. Any formulation or drug delivery system
containing the active
ingredients, which is suitable for the intended use, as are generally known to
those of skill in the
art, can be used. Suitable pharmaceutically acceptable carriers for oral,
rectal, topical or parenteral
(including subcutaneous, intraperitoneal, intramuscular and intravenous)
administration are known
to those of skill in the art. The carrier must be pharmaceutically acceptable
in the sense of being
compatible with the other ingredients of the formulation and not deleterious
to the recipient
thereof.
Formulations suitable for parenteral administration conveniently include
sterileaqueous
preparation of the active compound, which is preferably isotonic with the
blood of the
recipient. Thus, such formulations may conveniently contain distilled water,
5% dextrose in
distilled water or saline. Useful formulations also include concentrated
solutions or solids
containing the compound of formula (I), which upon dilution with an
appropriate solvent give a
solution suitable for parental administration above.
For enteral administration, a compound can be incorporated into an inert
carrier in
discrete units such as capsules, cachets, tablets or lozenges, each containing
a predetermined
amount of the active compound; as a powder or granules; or a suspension or
solution in an
aqueous liquid or non-aqueous liquid, e.g., a syrup, an elixir, an emulsion or
a draught. Suitable
carriers may be starches or sugars and include lubricants, flavorings,
binders, and other
materials of the same nature.
A tablet may be made by compression or molding, optionally with one or more
accessory ingredients. Compressed tablets may be prepared by compressing in a
suitable
103
CA 02648243 2013-09-23
machine the active compound in a free-flowing form, e.g., a powder or
granules, optionally
mixed with accessory ingredients, e.g., binders, lubricants, inert diluents,
surface active or
dispersing agents. Molded tablets may be made by molding in a suitable
machine, a mixture of
the powdered active compound with any suitable carrier.
A syrup or suspension may be made by adding the active compound to a
concentrated,
aqueous solution of a sugar, e.g., sucrose, to which may also be added any
accessory
ingredients. Such accessory ingredients may include flavoring, an agent to
retard crystallization
of the sugar or an agent to increase the solubility of any other ingredient,
e.g., as a polyhydric
alcohol, for example, glycerol or sorbitol.
Formulations for rectal administration may be presented as a suppository with
a conventional
carrier, e.g., cocoa butter or Witepsol S55 (trademark of Dynamite Nobel
Chemical, Germany),
for a suppository base.
Alternatively, the compound may be administered in liposomes or microspheres
(or
microparticles). Methods for preparing liposomes and microspheres for
administration to a
patient are well known to those of skill in the art. U.S. Pat. No. 4,789,734,
the contents of
which are hereby incorporated by reference, describes methods for
encapsulating biological
materials in liposomes. Essentially, the material is dissolved in an aqueous
solution, the
appropriate phospholipids and lipids added, along with surfactants if
required, and the material
dialyzed or sonicated, as necessary. A review of known methods is provided by
G. Gregoriadis,
Chapter 14, "Liposomes," Drug Carriers in Biology and Medicine, pp. 287-341
(Academic
Press, 1979).
Microspheres formed of polymers or proteins are well known to those skilled in
the art,
and can be tailored for passage through the gastrointestinal tract directly
into the blood stream.
Alternatively, the compound can be incorporated and the microspheres, or
composite of
microspheres, implanted for slow release over a period of time ranging from
days to months.
See, for example, U.S. Pat. Nos. 4,906,474, 4,925,673 and 3,625,214, and Jein,
TIPS 19:155-
157 (1998).
In one embodiment, the thyroid hormone analogs or its polymeric forms, and
adenosine
derivatives can be formulated into a liposome or microparticle, which is
suitably sized to lodge
in capillary beds following intravenous administration. When the liposome or
microparticle is
104
CA 02648243 2013-09-23
lodged in the capillary beds surrounding ischemic tissue, the agents can be
administered locally
to the site at which they can be most effective. Suitable liposomes for
targeting ischemic tissue
are generally less than about 200 nanometers and are also typically
unilamellar vesicles, as
disclosed, for example, in U.S. Pat. No. 5,593,688 to Baldeschweiler, entitled
"Liposomal
targeting of ischemic tissue.
Preferred microparticles are those prepared from biodegradable polymers, such
as
polyglycolide, polylactide and copolymers thereof. Those of skill in the art
can readily
determine an appropriate carrier system depending on various factors,
including the desired rate
of drug release and the desired dosage.
In one embodiment, the formulations are administered via catheter directly to
the inside
of blood vessels. The administration can occur, for example, through holes in
the catheter. In
those embodiments wherein the active compounds have a relatively long half
life (on the order
of 1 day to a week or more), the formulations can be included in biodegradable
polymeric
hydrogels, such as those disclosed in U.S. Pat. No. 5,410,016 to Hubbell et
al. These polymeric
hydrogels can be delivered to the inside of a tissue lumen and the active
compounds released
over time as the polymer degrades. If desirable, the polymeric hydrogels can
have
microparticles or liposomes which include the active compound dispersed
therein, providing
another mechanism for the controlled release of the active compounds.
The formulations may conveniently be presented in unit dosage form and may be
prepared by any of the methods well known in the art of pharmacy. All methods
include the
step of bringing the active compound into association with a carrier, which
constitutes one or
more accessory ingredients. In general, the formulations are prepared by
uniformly and
intimately bringing the active compound into association with a liquid carrier
or a finely
divided solid carrier and then, if necessary, shaping the product into desired
unit dosage form.
The formulations can optionally include additional components, such as various
biologically active substances such as growth factors (including TGF-.beta.,
basic fibroblast
growth factor (FGF2), epithelial growth factor (EGF), transforming growth
factors .alpha. and
.beta. (TGF alpha. and beta.), nerve growth factor (NGF), platelet-derived
growth factor
(PDGF), and vascular endothelial growth factor/vascular permeability factor
(VEGFNPF)),
105
CA 02648243 2013-09-23
antiviral, antibacterial, anti-inflammatory, immuno-suppressant, analgesic,
vascularizing agent,
and cell adhesion molecule.
In addition to the aforementioned ingredients, the formulations may further
include one
or more optional accessory ingredient(s) utilized in the art of pharmaceutical
formulations, e.g.,
diluents, buffers, flavoring agents, binders, surface active agents,
thickeners, lubricants,
suspending agents, preservatives (including antioxidants) and the like.
Formulations and Methods of Treatment
Polymeric thyroid hormone analogs alone or in combination with nerve growth
factors
or other neurogenesis factors inducers, or agonists of polymeric thyroid
hormone analogs alone
or in combination with nerve growth factors or other neurogenesis factors
receptors of the
present invention may be administered by any route which is compatible with
the particular
polymeric thyroid hormone analog alone or in combination with nerve growth
factors or other
neurogenesis factors, inducer, or agonist employed. Thus, as appropriate,
administration may
be oral or parenteral, including intravenous and intraperitoneal routes of
administration. In
addition, administration may be by periodic injections of a bolus of the
polymeric thyroid
hormone analog alone or in combination with nerve growth factors or other
neurogenesis
factors, inducer or agonist, or may be made more continuous by intravenous or
intraperitoneal
administration from a reservoir which is external (e.g., an i.v. bag) or
internal (e.g., a
bioerodable implant, or a colony of implanted, polymeric thyroid analog alone
or in
combination with nerve growth factor or other neurogenesis factors-producing
cells).
Therapeutic agents of the invention (i.e., polymeric thyroid hormone analogs
alone or
in combination with nerve growth factors or other neurogenesis factors,
inducers or agonists of
polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other
neurogenesis factors receptors) may be provided to an individual by any
suitable means,
directly (e.g., locally, as by injection, implantation or topical
administration to a tissue locus) or
systemically (e.g., parenterally or orally). Where the agent is to be provided
parenterally, such
as by intravenous, subcutaneous, intramolecular, ophthalmic, intraperitoneal,
intramuscular,
buccal, rectal, vaginal, intraorbital, intracerebral, intracranial,
intraspinal, intraventricular,
intrathecal, intracisternal, intracapsular, intranasal or by aerosol
administration, the agent
106
CA 02648243 2013-09-23
preferably comprises part of an aqueous or physiologically compatible fluid
suspension or
solution. Thus, the polymeric thyroid hormone analogs alone or in combination
with nerve
growth factors or other neurogenesis factors carrier or vehicle is
physiologically acceptable so
that in addition to delivery of the desired agent to the patient, it does not
otherwise adversely
affect the patient's electrolyte and/or volume balance. The fluid medium for
the agent thus can
comprise normal physiologic saline (e.g., 9.85% aqueous NaC1, 0.15M, pH 7-
7.4).
Association of the dimer with a polymeric thyroid hormone analog pro domain
results
in the pro form of the polymeric thyroid hormone analog which typically is
more soluble in
physiological solutions than the corresponding mature form.
Useful solutions for parenteral administration may be prepared by any of the
methods
well known in the pharmaceutical art, described, for example, in REMINGTON'S
PHARMACEUTICAL SCIENCES (Gennaro, A., ed.), Mack Pub., 1990. Formulations of
the
therapeutic agents of the invention may include, for example, polyalkylene
glycols such as
polyethylene glycol, oils of vegetable origin, hydrogenated naphthalenes, and
the like.
Formulations for direct administration, in particular, may include glycerol
and other
compositions of high viscosity to help maintain the agent at the desired
locus. Biocompatible,
preferably bioresorbable, polymers, including, for example, hyaluronic acid,
collagen,
tricalcium phosphate, polybutyrate, lactide, and glycolide polymers and
lactide/glycolide
copolymers, may be useful excipients to control the release of the agent in
vivo. Other
potentially useful parenteral delivery systems for these agents include
ethylene-vinyl acetate
copolymer particles, osmotic pumps, implantable infusion systems, and
liposomes.
Formulations for inhalation administration contain as excipients, for example,
lactose, or may
be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether,
glycocholate and
deoxycholate, or oily solutions for administration in the form of nasal drops,
or as a gel to be
applied intranasally. Formulations for parenteral administration may also
include glycocholate
for buccal administration, methoxysalicylate for rectal administration, or
cutric acid for vaginal
administration. Suppositories for rectal administration may also be prepared
by mixing the
polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other
neurogenesis factors, inducer or agonist with a non-irritating excipient such
as cocoa butter or
other compositions which are solid at room temperature and liquid at body
temperatures.
107
CA 02648243 2013-09-23
Formulations for topical administration to the skin surface may be prepared by
dispersing the polymeric thyroid hormone analogs alone or in combination with
nerve growth
factors or other neurogenesis factors, inducer or agonist with a
dermatologically acceptable
carrier such as a lotion, cream, ointment or soap. Particularly useful are
carriers capable of
forming a film or layer over the skin to localize application and inhibit
removal. For topical
administration to internal tissue surfaces, the agent may be dispersed in a
liquid tissue adhesive
or other substance known to enhance adsorption to a tissue surface. For
example,
hydroxypropylcellulose or fibrinogen/thrombin solutions may be used to
advantage.
Alternatively, tissue-coating solutions, such as pectin-containing
formulations may be used.
Alternatively, the agents described herein may be administered orally. Oral
administration of proteins as therapeutics generally is not practiced, as most
proteins are readily
degraded by digestive enzymes and acids in the mammalian digestive system
before they can
be absorbed into the bloodstream. However, the polymeric thyroid hormone
analogs alone or
in combination with nerve growth factors or other neurogenesis factors
described herein
typically are acid stable and protease-resistant (see, for example, U.S. Pat.
No. 4,968,590). In
addition, OP-1, has been identified in mammary gland extract, colostrum and 57-
day milk.
Moreover, the OP-1 purified from mammary gland extract is morphogenically-
active and is
also detected in the bloodstream. Maternal administration, via ingested milk,
may be a natural
delivery route of TGF-13 superfamily proteins. Letterio, et al., Science 264:
1936-1938 (1994),
report that TGF-13 is present in murine milk, and that radiolabelled TGF-fl is
absorbed by
gastrointestinal mucosa of suckling juveniles. Labeled, ingested TGF-13
appears rapidly in
intact form in the juveniles' body tissues, including lung, heart and liver.
Finally, soluble form
polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other
neurogenesis factors, e.g., mature polymeric thyroid hormone analogs alone or
in combination
with nerve growth factors or other neurogenesis factors with or without anti-
oxidant or anti-
inflammatory agents. These findings, as well as those disclosed in the
examples below, indicate
that oral and parenteral administration are viable means for administering TGF-
13 superfamily
proteins, including the polymeric thyroid analog alone or in combination with
nerve growth
factor or other neurogenesis factors, to an individual. In addition, while the
mature forms of
certain polymeric thyroid analog alone or in combination with nerve growth
factor or other
108
CA 02648243 2013-09-23
neurogenesis factors described herein typically are sparingly soluble, the
polymeric thyroid
analog alone or in combination with nerve growth factor or other neurogenesis
factors form
found in milk (and mammary gland extract and colostrum) is readily soluble,
probably by
association of the mature, morphogenically-active form with part or all of the
pro domain of the
expressed, full length polypeptide sequence and/or by association with one or
more milk
components. Accordingly, the compounds provided herein may also be associated
with
molecules capable of enhancing their solubility in vitro or in vivo.
Where the polymeric thyroid hormone analogs alone or in combination with nerve
growth factors or other neurogenesis factors is intended for use as a
therapeutic for disorders of
the CNS, an additional problem must be addressed: overcoming the blood-brain
barrier, the
brain capillary wall structure that effectively screens out all but selected
categories of
substances present in the blood, preventing their passage into the brain. The
blood-brain barrier
can be bypassed effectively by direct infusion of the polymeric thyroid
hormone analogs into
the brain, or by intranasal administration or inhalation of formulations
suitable for uptake and
retrograde transport by olfactory neurons. Alternatively, the polymeric
thyroid hormone
analogs can be modified to enhance its transport across the blood-brain
barrier. For example,
truncated forms of the polymeric thyroid hormone analogs alone or in
combination with nerve
growth factors or other neurogenesis factors or a polymeric thyroid hormone
analog alone or in
combination with nerve growth factor or other neurogenesis factors-stimulating
agent may be
most successful. Alternatively, the polymeric thyroid hormone analogs alone or
in combination
with nerve growth factors or other neurogenesis factors, inducers or agonists
provided herein
can be derivatized or conjugated to a lipophilic moiety or to a substance that
is actively
transported across the blood-brain barrier, using standard means known to
those skilled in the
art. See, for example, Pardridge, Endocrine Reviews 7: 314-330 (1986) and U.S.
Pat. No.
4,801,575.
The compounds provided herein may also be associated with molecules capable of
targeting the polymeric thyroid hormone analogs alone or in combination with
nerve growth
factors or other neurogenesis factors, inducer or agonist to the desired
tissue. For example, an
antibody, antibody fragment, or other binding protein that interacts
specifically with a surface
molecule on cells of the desired tissue, may be used. Useful targeting
molecules may be
109
CA 02648243 2013-09-23
designed, for example, using the single chain binding site technology
disclosed in U.S. Pat. No.
5,091,513. Targeting molecules can be covalently or non-covalently associated
with the
polymeric thyroid hormone analogs alone or in combination with nerve growth
factors or other
neurogenesis factors, inducer or agonist.
As will be appreciated by one of ordinary skill in the art, the formulated
compositions
contain therapeutically-effective amounts of the polymeric thyroid hormone
analogs alone or
in combination with nerve growth factors or other neurogenesis factors,
inducers or agonists
thereof. That is, they contain an amount which provides appropriate
concentrations of the agent
to the affected nervous system tissue for a time sufficient to stimulate a
detectable restoration
of impaired central or peripheral nervous system function, up to and including
a complete
restoration thereof. As will be appreciated by those skilled in the art, these
concentrations will
vary depending upon a number of factors, including the biological efficacy of
the selected
agent, the chemical characteristics (e.g., hydrophobicity) of the specific
agent, the formulation
thereof, including a mixture with one or more excipients, the administration
route, and the
treatment envisioned, including whether the active ingredient will be
administered directly into
a tissue site, or whether it will be administered systemically. The preferred
dosage to be
administered is also likely to depend on variables such as the condition of
the diseased or
damaged tissues, and the overall health status of the particular mammal. As a
general matter,
single, daily, biweekly or weekly dosages of 0.00001-1000 mg of a polymeric
thyroid analog
alone or in combination with nerve growth factor or other neurogenesis factors
are sufficient in
the presence of anti-oxidant and / or anti-inflammatory agents, with 0.0001-
100 mg being
preferable, and 0.001 to 10 mg being even more preferable. Alternatively, a
single, daily,
biweekly or weekly dosage of 0.01-1000 g/kg body weight, more preferably 0.01-
10 mg/kg
body weight, may be advantageously employed. A Nanoparticle contains between 1
and 100
thyroid hormone molecules per nanoparticle either encapsulated or immobilized
on the
Nanoparticle surface via chemical bonding. The Nanoparticle can co-encapsulate
thyroid
hormone analogs along with chemotherapeutic agents, or other known pro-
angiogenesis or anti-
angiogenesis agents. Furthermore, the Nanoparticle contains inside the
chemotherapeutic
agents, pro- or anti-angiogenesis agents and the thyroid hormone analogs are
immobilized on
the surface of the Nanoparticles via stable chemical bonding. The surface of
the Nanoparticles
110
CA 02648243 2013-09-23
contain site directing moiety such av133 ligand bonded to the surface via
stable chemical
bonding.
The present effective dose can be administered in a single dose or in a
plurality (two or more)
of installment doses, as desired or considered appropriate under the specific
circumstances. A
bolus injection or diffusable infusion formulation can be used. If desired to
facilitate repeated
or frequent infusions, implantation of a semi-permanent stent (e.g.,
intravenous, intraperitoneal,
intracisternal or intracapsular) may be advisable.
The polymeric thyroid hormone analogs alone or in combination with nerve
growth
factors or other neurogenesis factors, inducers or agonists of the invention
may, of course, be
administered alone or in combination with other molecules known to be
beneficial in the
treatment of the conditions described herein. For example, various well-known
growth factors,
hormones, enzymes, therapeutic compositions, antibiotics, or other bioactive
agents can also be
administered with the polymeric thyroid hormone analogs alone or in
combination with nerve
growth factors or other neurogenesis factors. Thus, various known growth
factors such as NGF,
EGF, PDGF, IGF, FGF, TGF-a, and TGF-13, as well as enzymes, enzyme inhibitors,
antioxidants, anti-inflammatory agents, free radical scavenging agents,
antibiotics and/or
chemoattractant/chemotactic factors, can be included in the present polymeric
thyroid hormone
analogs alone or in combination with nerve growth factors or other
neurogenesis factors
formulation.
The following examples are intended to further illustrate certain embodiments
of the
invention and are not intended to limit the scope of the invention.
Examples 1-7
The following materials and methods were useed for examples 1-7. All reagents
were
chemical grade and purchased from Sigma Chemical Co. (St. Louis, MO) or
through VWR
Scientific (Bridgeport, NJ). Cortisone acetate, bovine serum albumin (BSA) and
gelatin
solution (2% type B from bovine skin) were purchased from Sigma Chemical Co.
Fertilized
chicken eggs were purchased from Charles River Laboratories, SPAFAS Avian
Products &
Services (North Franklin, CT). T4, 3,5,3'-triiodo-L-thyronine (T3),
tetraiodothyroacetic acid
111
CA 02648243 2013-09-23
(tetrac), T4 ¨agarose, 6-N-propy1-2-thiouracil (PTU), RGD-containing peptides,
and RGE-
containing peptides were obtained from Sigma; PD 98059 from Calbiochem; and
CGP41251
was a gift from Novartis Pharma (Basel, Switzerland). Polyclonal anti-FGF2 and
monoclonal
anti- p-actin were obtained from Santa Cruz Biotechnology and human
recombinant FGF2 and
VEGF from Invitrogen. Polyclonal antibody to phosphorylated ERK1/2 was from
New
England Biolabs and goat anti-rabbit IgG from DAKO. Monoclonal antibodies to
aVf33 (SC73
12) and a-tubulin (E9) were purchased from Santa Cruz Biotechnology (Santa
Cruz, CA).
Normal mouse IgG and HRP-conjugated goat anti-rabbit Ig were purchased from
Dako
Cytomation (Carpinteria, CA). Monoclonal antibodies to aV133 (LM609) and aVI35
(P1F6), as
well as purified aVI33, were purchased from Chemicon (Temecula, CA). L-['251]-
T4(specific
activity, 1250 tiCi/1õtg) was obtained from Perkin Elmer Life Sciences
(Boston, MA).
Chorioallantoic membrane (CAM) Model of Angiogenesis: In vivo
Neovascularization
was examined by methods described previously. 9-12 Ten-day-old chick embryos
were
purchased from SPAFAS (Preston, CT) and incubated at 37 C with 55% relative
humidity. A
hypodermic needle was used to make a small hole in the shell concealing the
air sac, and a
second hole was made on the broad side of the egg, directly over an avascular
portion of the
embryonic membrane that was identified by candling. A false air sac was
created beneath the
second hole by the application of negative pressure at the first hole, causing
the CAM to
separate from the shell. A window approximately 1.0 cm 2 was cut in the shell
over the
dropped CAM with a small-crafts grinding wheel (Dremel, division of Emerson
Electric Co.),
allowing direct access to the underlying CAM. FGF2 (lps/mL) was used as a
standard
proangiogenic agent to induce new blood vessel branches on the CAM of 10-day-
old embryos.
Sterile disks of No. 1 filter paper (Whatman International) were pretreated
with 3 mg/mL
cortisone acetate and 1 mmol/L PTU and air dried under sterile conditions.
Thyroid hormone,
hormone analogues, FGF2 or control solvents, and inhibitors were then applied
to the disks and
the disks allowed to dry. The disks were then suspended in PBS and placed on
growing CAMs.
Filters treated with T4 or FGF2 were placed on the first day of the 3-day
incubation, with
antibody to FGF2 added 30 minutes later to selected samples as indicated. At
24 hours, the
112
CA 02648243 2013-09-23
MAPK cascade inhibitor PD 98059 was also added to CAMs topically by means of
the filter
disks.
Microscopic Analysis of CAM Sections:
After incubation at 37 C with 55% relative humidity for 3 days, the CAM tissue
directly beneath each filter disk was resected from control and treated CAM
samples. Tissues
were washed 3X with PBS, placed in 35-mm Petri dishes (Nalge Nunc), and
examined under
an SV6 stereomicroscope (Zeiss) at X50 magnification. Digital images of CAM
sections
exposed to filters were collected using a 3-charge¨coupled device color video
camera system
(Toshiba) and analyzed with Image-Pro software (Media Cybernetics). The number
of vessel
branch points contained in a circular region equal to the area of each filter
disk were counted.
One image was counted in each CAM preparation, and findings from 8 to 10 CAM
preparations were analyzed for each treatment condition (thyroid hormone or
analogues, FGF2,
FGF2 antibody, PD 98059). In addition, each experiment was performed 3 times.
The resulting
angiogenesis index is the mean SEM of new branch points in each set of
samples.
FGF2 Assays:
ECV304 endothelial cells were cultured in M199 medium supplemented with 10%
fetal
bovine serum. ECV304 cells (106 cells) were plated on 0.2% gel-coated 24-well
plates in
complete medium overnight, and the cells were then washed with serum-free
medium and
treated with 14 or T3 as indicated. After 72 hours, the supernatants were
harvested and assays
for FGF performed without dilution using a commercial ELISA system (R&D
Systems).
MAPK Activation:
ECV304 endothelial cells were cultured in M199 medium with 0.25% hormone-
depleted serum 13 for 2 days. Cells were then treated with T4 (10-7 mol/L) for
15 minutes to 6
hours. In additional experiments, cells were treated with T4 or FGF2 or with
14 in the
presence of PD 98059 or CGP41251. Nuclear fractions were pre-pared from all
samples by our
method reported previously, the proteins separated by polyacrylamide gel
electrophoresis, and
transferred to membranes for immunoblotting with antibody to phosphorylated
ERK 1/2. The
appearance of nuclear phosphorylated ERK1/2 signifies activation of these MAPK
isoforms by
14.
113
CA 02648243 2013-09-23
Reverse Transcription¨Polymerase Chain Reaction:
Confluent ECV304 cells in 10-cm plates were treated with T4 (10-7 mol/L) for 6
to 48
hours and total RNA extracted using guanidinium isothiocyanate (Biotecx
Laboratories). RNA
(1 jig) was subjected to reverse transcription¨polymerase chain reaction (RT-
PCR) using the
Access RT-PCR system (Promega). Total RNA was reverse transcribed into cDNA at
48 C for
45 minutes, then denatured at 94 C for 2 minutes. Second-strand synthesis and
PCR
amplification were performed for 40 cycles with denaturation at 94 C for 30 s,
annealing at
60 C for 60 s, and extension at 68 C for 120 s, with final ex-tension for 7
minutes at 68 C after
completion of all cycles. PCR primers for FGF2 were as follows: FGF2 sense
strand 5'-
TGGTATGTGGCACTGAAACG-3' (SEQ ID NO:1), antisense strand 5'
CTCAATGACCTGGCGAAGAC-3' (SEQ ID NO:2); the length of the PCR product was 734
bp. Primers for GAPDH included the sense strand 5'-AAGGTCATCCCTGAGCTGAACG-3'
(SEQ ID NO:3), and antisense strand 5'-GGGTGTCGCTGTTGAAGTCAGA-3' (SEQ ID
NO:4); the length of the PCR product was 218 bp. The products of RT-PCR were
separated by
electrophoresis on 1.5% agarose gels and visualized with ethidium bromide. The
target bands
of the gel were quantified using LabImage software (Kapelan), and the value
for
[FGF2/GAPDH]X10 calculated for each time point.
Statistical Analysis:
Statistical analysis was performed by 1-way analysis of variance (AN OVA)
comparing
experimental with respective control group and statistical significance was
calculated based on
P <0.05.
In vivo angio genesis in Matrigel FGF2 or Cancer cell lines implant in mice:
In Vivo
Murine Angiogenesis Model:
The murine matrigel model will be conducted according to previously known
methods
and those methods were implemented in our laboratory. Briefly, growth factor
free matrigel
(Becton Dickinson, Bedford MA) will be thawed overnight at 4 C and placed on
ice. Aliquots
of matrigel will be placed into cold polypropylene tubes and FGF2, thyroid
hormone analogs or
cancer cells (1 x 106 cells) will be added to the matrigel. Matrigel with
Saline, FGF2, thyroid
hormone analogs or cancer cells will be subcutaneously injected into the
ventral midline of the
mice. At day 14, the mice will be sacrificed and the solidified gels will be
resected and
114
CA 02648243 2013-09-23
analyzed for presence of new vessels. Compounds A-D will be injected
subcutaneously at
different doses. Control and experimental gel implants will be placed in a
micro centrifuge tube
containing 0.5 ml of cell lysis solution (Sigma, St. Louis, MO) and crushed
with a pestle.
Subsequently, the tubes will be allowed to incubate overnight at 4 C and
centrifuged at 1,500 x
g for 15 minutes on the following day. A 200 til aliquot of cell lysate will
be added to 1.3 ml
of Drabkin's reagent solution (Sigma, St. Louis, MO) for each sample. The
solution will be
analyzed on a spectrophotometer at a 540 nm. The absorption of light is
proportional to the
amount of hemoglobin contained in the sample.
Tumor growth and metastasis - Chick Chorioallantoic Membrane (CAM) model of
tumor implant:
The protocol is as previously described (Kim et al., 2001). Briefly, 1 x 107
tumor cells
will be placed on the surface of each CAM (7 day old embryo) and incubated for
one week.
The resulting tumors will be excised and cut into 50 mg fragments. These
fragments will be
placed on additional 10 CAMs per group and treated topically the following day
with 25 IA of
compounds (A-D) dissolved in PBS. Seven days later, tumors will then be
excised from the egg
and tumor weights will be determined for each CAM. Figure 8 is a diagrammatic
sketch
showing the steps involved in the in vivo tumor growth model in the CAM.
The effects of TETRAC, TRIAC, and thyroid hormone antagonists on tumor growth
rate, tumor angiogenesis, and tumor metastasis of cancer cell lines can be
determined.
Tumor growth and metastasis -Experimental Model of Metastasis:
Briefly, B16 murine malignant melanoma cells (ATCC, Rockville, MD) and other
cancer lines will be cultured in RPMI 1640 (Invitrogen, Carlsbad, CA),
supplemented with
10% fetal bovine serum, penicillin and streptomycin (Sigma, St. Louis, MO).
Cells will be
cultured to 70% confluency and harvested with trypsin-EDTA (Sigma) and washed
twice with
phosphate buffered saline (PBS). Cells will be re-suspended in PBS at a
concentration of either
2.0 x 105cells/m1 for experimental metastasis. Animals: C57/BL6 mice (Harlan,
Indianapolis,
Indiana) weighing 18-21 grams will be used for this study. All procedures are
in accordance
with IACUC and institutional guidelines. The anti-cancer efficacy for TETRAC,
TRIAC, and
115
CA 02648243 2013-09-23
other thyroid hormone antagonists at different doses and against different
tumor types can be
determined and compared.
Effect of thyroid hormone analogues on angiogenesis:
T4 induced significant increase in angiogenesis index (fold increase above
basal) in the
CAM model. T3 at 0.001-1.0 !AM or T4 at 0.1-1.0 iiM achieved maximal effect in
producing 2-
2.5 fold increase in angiogenesis index as compared to 2-3 fold increase in
angiogenesis index
by 1 lig of FGF2 (Table 1 and Figure la and lb). The effect of 14 in promoting
angiogenesis
(2-2.5 fold increase in angiogenesis index) was achieved in the presence or
absence of PTU,
which inhibit T4 to T3 conversion. 13 itself at 91-100 nM)-induced potent pro-
angiogenic
effect in the CAM model. 14 agarose produced similar pro-angiogenesis effect
to that achieved
by 14. The pro-angiogenic effect of either 14 or T4-agarose was 100% blocked
by TETRAC or
TRIAC.
Enhancement of pro-angiogenic activity of FGF2 by sub-maximal concentrations
of T4:
The combination of 14 and FGF2 at sub-maximal concentrations resulted in an
additive
increase in the angiogenesis index up to the same level like the maximal pro-
angiogenesis
effect of either FGF2 or 14 (Figure 2).
Effects of MAPK cascade inhibitors on the pro-angiogenic actions of T4 and
FGf2 n the
CAM model:
The pro-angiogenesis effect of either 14 or FGF2 was totally blocked by PD
98059 at
0.8 ¨ 8 lig (Figure 3).
Effects of specific integrin avfl3 antagonists on the pro-angiogenic actions
of 1'4 and
FGf2 n the CAM model:
The pro-angiogenesis effect of either T4 or FGF2 was totally blocked by the
specific
monoclonal antibody LM609 at 10 lig (Figure 4a and 4b).
The CAM assay has been used to validate angiogenic activity of a variety of
growth
factors and other promoters or inhibitors of angiogenesis. In the present
studies, 14 in
physiological concentrations was shown to be pro-angiogenic, with comparable
activity to that
of FGF2. The presence of PTU did not reduce the effect of 14, indicating that
de-iodination of
14 to generate 13 was not a prerequisite in this model. Because the appearance
of new blood
116
CA 02648243 2013-09-23
vessel growth in this model requires several days, we assumed that the effect
of thyroid
hormone was totally dependent upon the interaction of the nuclear receptor for
thyroid
hormone (TR). Actions of iodothyronines that require intranuclear complexing
of TR with its
natural ligand, 13, are by definition, genomic, and culminate in gene
expression. On the other
hand, the preferential response of this model system to T4¨rather than T3, the
natural ligand of
TR raised the possibility that angiogenesis might be initiated non-gnomically
at the plasma
membrane by T4 and culminate in effects that require gene transcription. Non-
genomic actions
of 14 have been widely described, are usually initiated at the plasma membrane
and may be
mediated by signal transduction pathways. They do not require intranuclear
ligand binding of
iodothyronine and TR, but may interface with or modulate gene transcription.
Non-genomic
actions of steroids have also been well-described and are known to interface
with genomic
actions of steroids or of other compounds. Experiments carried out with 14 and
tetrac or with
agarose-T4 indicated that the pro-angiogenic effect of 14 indeed very likely
was initiated at the
plasma membrane. We have shown elsewhere that tetrac blocks membrane-initiated
effects of
14, but does not, itself, activate signal transduction . Thus, it is a probe
for non-genomic actions
of thyroid hormone. Agarose-T4 is thought not to gain entry to the cell
interior and has been
used by us and others to examine models for possible cell surface-initiated
actions of the
hormone.
These results suggest that another consequence of activation of MAPK by
thyroid hormone is
new blood vessel growth. The latter is initiated nongenomically, but of course
requires a
consequent complex gene transcription program.
The ambient concentrations of thyroid hormone are relatively stable. The CAM
model,
at the time we tested it, was thyroprival and thus may be regarded as a
system, which does not
reproduce the intact organism. We propose that circulating levels of 14 serve,
with a variety of
other regulators, to modulate the sensitivity of vessels to endogenous
angiogenic factors, such
as VEGF and FGF2.
Three-Dimensional Angiogenesis Assay.
In Vitro Three-Dimensional Sprout Angiogenesis of Human Dermal Micro-Vascular
Endothelial Cells (HDMEC) Cultured on Micro-Carrier Beads Coated with Fibrin:
Confluent HDMEC (passages 5-10) were mixed with gelatin-coated Cytodex-3 beads
117
CA 02648243 2013-09-23
with a ratio of 40 cells per bead. Cells and beads (150-200 beads per well for
24-well plate)
were suspended with 5 ml EBM + 15% normal human serum, mixed gently every hour
for first
4 hours, then left to culture in a CO2 incubator overnight. The next day, 10
ml of fresh EBM +
5% HS were added, and the mixture was cultured for another 3 hours. Before
experiments, the
culture of EC-beads was checked; then 500 ul of PBS was added to a well of 24-
well plate, and
100 ul of the EC-bead culture solution was added to the PBS. The number of
beads was
counted, and the concentration of EC/beads was calculated.
A fibrinogen solution (1 mg/ml) in EBM medium with or without angiogenesis
factors
or testing factors was prepared. For positive control, 50 ng/ml VEGF + 25
ng/ml FGF2 was
used. EC-beads were washed with EBM medium twice, and EC-beads were added to
fibrinogen solution. The experiment was done in triplicate for each condition.
The EC-beads
were mixed gently in fibrinogen solution, and 2.5 ul human thrombin (0.05
U/ul) was added in
1 ml fibrinogen solution; 300 ul was immediately transfered to each well of a
24-well plate.
The fibrinogen solution polymerizes in 5-10 minutes; after 20 minutes, we
added EBM + 20%
normal human serum + 10 ug/ml aprotinin. The plate was incubated in a CO2
incubator. It takes
about 24-48 hours for HDMEC to invade fibrin gel and form tubes.
A micro-carrier in vitro angiogenesis assay previously designed to investigate
bovine
pulmonary artery endothelial cell angiogenic behavior in bovine fibrin gels
[Nehls and
Drenckhahn, 1995a, b] was modified for the study of human microvascular
endothelial cell
angiogenesis in three-dimensional ECM environments (Figures 1 and 2). Briefly,
human
fibrinogen, isolated as previously described [Feng et al, 1999], was dissolved
in M199 medium
at a concentration of 1 mg/ml (pH 7.4) and sterilized by filtering through a
0.22 micron filter.
An isotonic 1.5 mg/ml collagen solution was prepared by mixing sterile
Vitrogee 100 in 5X
M199 medium and distilled water. The pH was adjusted to 7.4 by 1N NaOH. In
certain
experiments, growth factors and ECM proteins (such as VEGF, bFGF, PDGF-BB,
serum,
gelatin, and fibronectin) were added to the fibrinogen or collagen solutions.
About 500 EC-
beads were then added to the 1 mg/ml fibrinogen or 1.5 mg/ml collagen
solutions.
Subsequently, EC-beads¨collagen or EC-beads¨fibrinogen suspension (500 EC-
beads/nil) was
plated onto 24-well plates at 300 ul/well. EC-bead-collagen cultures were
incubated at 37 C to
form gel. The gelling of EC-bead-fibrin cultures occurred in less than 5
minutes at room
118
CA 02648243 2013-09-23
temperature after the addition of thrombin to a final concentration of 0.5
U/ml. After gelation, 1
ml of fresh assay medium (EBM supplemented with 20% normal human serum for
HDMEC or
EBM supplemented with 10% fetal bovine serum was added to each well. The
angiogenic
response was monitored visually and recorded by video image capture.
Specifically, capillary
sprout formation was observed and recorded with a NikonDiaphot-TMD inverted
microscope
(Nikon Inc.; Melville, NY), equipped with an incubator housing with a Nikon
NP-2
thermostat and SheldonTM #2004 carbon dioxide flow mixer. The microscope was
directly
interfaced to a video system consisting of a Dage-MTI1 CCD-72S video camera
and Sony A 12"
PVM-122 video monitor linked to a Macintosh G3 computer. The images were
captured at
various magnifications using Adobe photoshop . The effect of angiogenic
factors on sprout
angiogenesis was quantified visually by determining the number and percent of
EC-beads with
capillary sprouts. One hundred beads (five to six random low power fields) in
each of triplicate
wells were counted for each experimental condition. All experiments were
repeated at least
three times.
Cell culture:
The African green monkey fibroblast cell line, CV-1 (ATCC, Manassas, VA),
which
lacks the nuclear receptor for thyroid hormone, was plated at 5000 cells/cm2
and maintained in
DMEM, supplemented with 10% (v/v) heat-inactivated FBS, 100 U/ml penicillin,
100 11g/m1
streptomycin, and 2mM L-glutamine. All culture reagents were purchased from
Invitrogen
Corporation (Carlsbad, CA). Cultures were maintained in a 37 C humidified
chamber with 5%
CO2. The medium was changed every three days and the cell lines were passaged
at 80%
confluency. For experimental treatment, cells were plated in 10-cm cell
culture dishes (Corning
Incorporated, Corning, NY) and allowed to grow for 24 h in 10% FBS-containing
medium. The
cells were then rinsed twice with phosphate buffered saline (PBS) and fed with
serum-free
DMEM supplemented with penicillin, streptomycin, and HEPES. After 48 h
incubation in
serum-free media, the cells were treated with a vehicle control (final
concentration of 0.004 N
KOH with 0.4% polyethyleneglycol [v/v]) or T4 (10-7 M final concentration) for
30 min; media
were then collected and free T4 levels were determined by enzyme immunoassays.
Cultures
incubated with 10-7 M total T4 have 10-9 to 10-19 M free T4. Following
treatment, the cells were
harvested and the nuclear proteins prepared as previously described.
119
CA 02648243 2013-09-23
Transient transfections with siRNA:
CV-1 cells were plated in 10-cm dishes (150,000 cells/dish) and incubated for
24 h in
DMEM supplemented with 10% FBS. The cells were rinsed in OPTI-MEM (Ambion ,
Austin,
TX) and transfected with siRNA (100 nM fmal concentration) to aV, 133, or aV
and 133
together using siPOR14 (Ambiont) according to manufacturer's directions.
Additional sets of
CV-1 cells were transfected with a scrambled siRNA, to serve as a negative
control. Four hours
post-transfection, 7 ml of 10% FBS-containing media was added to the dishes
and the cultures
were allowed to incubate overnight. The cells were then rinsed with PBS and
placed in serum-
free DMEM for 48 h before treatment with T4.
RNA isolation and RT-PCR:
Total RNA was extracted from cell cultures 72 h post- transfection using the
RNeasy
kit from Qiagenn (Valencia, CA) as per manufacturer's instructions. Two
hundred nanograms
of total RNA was reverse-transcribed using the Access RT-PCR system (Promega
, Madison,
WI) according to manufacturer's directions. Primers were based on published
species-specific
sequences: aV (accession number NM-002210) F-5'-TGGGATTGTGGAAGGAG and R-5'-
AAATCCCTGTCCATCAGCAT (319 bp product), 133 (NM000212) F-5'-
GTGTGAGTGCTCAGAGGAG and R-5'-CTGACTCAATCTCGTCACGG (5 15 bp product),
and GAPDH (AF261085) F-5'-GTCAGTGGTGGACCTGACCT and R-5'-
TGAGCTTGACMGTGGTCG (212 bp product). RT-PCR was performed in the Flexigene
thermal cycler eom TECHNE (Burlington, NJ). After a 2 min incubation at 95"C,
25 cycles of
the following steps were performed: denaturation at 94'C for 1 min, annealing
at 57'C for 1
min, and extension for 1 min at 68 C for 25 cycles. The PCR products were
visualized on a
1.8% (wlv) agarose gel stained with ethidium bromide.
Western blotting:
Aliquots of nuclear proteins (10 pig/lane) were mixed with Laemmli sample
buffer and
separated by SDS-PAGE (10% resolving gel) and then transferred to
nitrocellulose membranes.
After blocking with 5% non-fat milk in Tris-buffered saline containing 1%
Tween-/k20 (TBST)
for 30 min, the membranes were incubated with a 1:1000 dilution of a
monoclonal antibody to
phosphorylated p44/42 MAP kinase (Cell Signaling Technology, Beverly, MA) in
TBST with
5% milk overnight at 4 C. Following 3x10-min washes in TBST, the membranes
were
120
CA 02648243 2013-09-23
incubated with HRP-conjugated goat anti-rabbit Ig (1:1000 dilution) ftomfrom
DakoCytomation (Carpinteria, CA) in TBST with 5% milk for 1 h at room
temperature. The
membranes were washed 3x5 min in TBST and immunoreactive proteins were
detected by
chemiluminescence (ECL, Amersham). Band intensity was determined using the
VersaDoc
5000 Imaging system (Bio-Rad , Hercules, CA).
Radioligand binding assay:
Two tig of purified aV133 was mixed with indicated concentrations of test
compounds
and allowed to incubate for 30 min at room temperature. [1251]-T4 (2 fiCi) was
then added and
the mixture was allowed to incubate an additional 30 mm at 20 C. The samples
were mixed
with sample buffer (50% glycerol, 0.1M Tris-HC1, pH 6.8, and bromophenol blue)
and runout
on a 5% basic-native gel for 24 h at 45 mA in the cold. The apparatus was
disassembled and the
gels were placed on filter paper, wrapped in plastic wrap, and exposed to
film. Band intensity
was determined using the VersaDoc 5000 Imaging system.
Chick chorioallantoic membrane (CAM) assay (aV133 studies):
Ten-day-old chick embryos were purchased from SPAFASTM (Preston, CT) and were
incubated at 37 C with 55% relative humidity. A hypodermic needle was used to
make a small
hole in the blunt end of the egg and a second hole was made on the broad side
of the egg,
directly over an avascular portion of the embryonic membrane. Mild suction was
applied to the
first hole to displace the air sac and drop the CAM away from the shell. Using
a Dremel
model craft drill (Dremel , Racine, WI), a approx. 1.0 cm2 window was cut in
the shell over the
false air sac, allowing access to the CAM. Sterile disks of No.1 filter paper
(Whatman ,
Clifton, NJ) were pretreated with 3 mg/ml cortisone acetate and
lrnMmpropylthiouracil and air
dried under sterile conditions. Thyroid hormone, control solvents, and the mAb
LM609 were
applied to the disks and subsequently dried. The disks were then suspended in
PBS and placed
on growing CAMS. After incubation for 3 days, the CAM beneath the filter disk
was resected
and rinsed with PBS. Each membrane was placed in a 35 mm Petri dish and
examined under an
SV6 stereo-microscope at SOX magnification. Digital images were captured and
analyzed with
Image-Pro ll software (Mediacybemetics). The number of vessel branch points
contained in a
circular region equal to the filter disk were counted. One image from each of
8-10 CAM
121
CA 02648243 2013-09-23
preparations for each treatment condition was counted, and in addition each
experiment was
performed 3 times.
Example 1. Effect of Thyroid Hormone on Angiogenesis:
As seen in Figure lA and summarized in Figure 1B, both L-T4 and L-T3 enhanced
angiogenesis in the CAM assay. T4, at a physiologic total concentration in the
medium of 0.1
lunol/L, increased blood vessel branch formation by 2.5-fold (P<0.001). T3 (1
nmol/L) also
stimulated angiogenesis 2-fold. The possibility that T4 was only effective
because of
conversion of T4 to T3 by cellular 5'-monodeiodinase was ruled out by the
finding that the
deiodinase inhibitor PTU had no inhibitory effect on angiogenesis produced by
T4. PTU was
applied to all filter disks used in the CAM model. Thus, T4 and T3 promote new
blood vessel
branch formation in a CAM model that has been standardized previously for the
assay of
growth factors.
Example 2. Effects of T4¨Agarose and Tetrac:
We have shown previously that T4¨agarose stimulates cellular signal
transduction
pathways initiated at the plasma membrane in the same manner as T4 and that
the actions of T4
and T4¨agarose are blocked by a deaminated iodothyronine analogue, tetrac,
which is known to
inhibit binding of T4 to plasma membranes. In the CAM model, the addition of
tetrac (0.1
mon) inhibited the action of T4 (Figure 2A), but tetrac alone had no effect on
angiogenesis
(Figure 2C). The action of T4¨agarose, added at a hormone concentration of 0.1
prnol/L, was
comparable to that of T4 in the CAM model (Figure 2B), and the effect of
T4¨agarose was also
inhibited by the action of tetrac (Figure 2B; summarized in 2C).
Example 3. Enhancement of Proangiogenic Activity of FGF2 by a Submaximal
Concentration of T4:
Angiogenesis is a complex process that usually requires the participation of
polypeptide
growth factors. The CAM assay requires at least 48 hours for vessel growth to
be manifest;
thus, the apparent plasma membrane effects of thyroid hormone in this model
are likely to
result in a complex transcriptional response to the hormone. Therefore, we
determined whether
122
CA 02648243 2013-09-23
FGF2 was involved in the hormone response and whether the hormone might
potentiate the
effect of subphysiologic levels of this growth factor. T4 (0.05 rnol/L) and
FGF2 (0.5 pg/mL)
individually stimulated angiogenesis to a modest degree (Figure 3). The
angiogenic effect of
this submaximal concentration of FGF2 was enhanced by a subphysiologic
concentration of T4
to the level caused by 1.0 pg FGF2 alone. Thus, the effects of submaximal
hormone and growth
factor concentrations appear to be additive. To define more precisely the role
of FGF2 in
thyroid hormone stimulation of angiogenesis, a polyclonal antibody to FGF2 was
added to the
filters treated with either FGF2 or T4, and angiogenesis was measured after 72
hours. Figure 4
demonstrates that the FGF2 antibody inhibited angiogenesis stimulated either
by FGF2 or by
T4 in the absence of exogenous FGF2, suggesting that the T4 effect in the CAM
assay was
mediated by increased FGF2 expression. Control IgG antibody has no stimulatory
or inhibitory
effect in the CAM assay.
Example 4. Stimulation of FGF2 Release From Endothelial Cells by Thyroid
Hormone:
Levels of FGF2 were measured in the media of ECV304 endothelial cells treated
with
either T4 (0.1 mon) or T3 (0.01 mon) for 3 days. As seen in the Table below,
T3
stimulated FGF2 concentration in the medium 3.6-fold, whereas T4 caused a 1.4-
fold increase.
This finding indicates that thyroid hormone may enhance the angiogenic effect
of FGF2, at
least in part, by increasing the concentration of growth factor available to
endothelial cells.
Effect of T4 and T3 on Release of FGF2 From ECV304
Endothelial Cells
Cell Treatment FGF2 (pg/mL/106 cells)
Control 27.7 3.1
T3 (0.01 mon) 98.8 0.5*
T3 + PD 98059 (2 mon) 28.4 3.2
T3 + PD 98059 (20 mon) 21.7 3.5
T4 (0.1 mon) 39.2 2.8t
T4 +PD 98059 (2 ttmol/L) 26.5 4.5
T4 + PD 98059 (20 iimol/L) 23.2 4.8
*P<0.001, comparing T3-treated samples with control samples by ANOVA;
tP<0.05, comparing T4-treated samples with control samples by ANOVA.
123
CA 02648243 2013-09-23
Example 5. Role of the ERK1/2 Signal Transduction Pathway in Stimulation of
Angiogenesis by Thyroid Hormone and FGF2:
A pathway by which T4 exerts a nongenomic effect on cells is the MAPK signal
transduction cascade, specifically that of ERK1/2 activation. We know that 14
enhances
ERK1/2 activation by epidermal growth factor. The role of the MAPK pathway in
stimulation
by thyroid hormone of FGF2 expression was examined by the use of PD 98059 (2
to 20
Rmol/L), an inhibitor of ERK1/2 activation by the tyrosine¨threonine kinases
MAPK kinase-1
(MEK1) and MEK2. The data in the Table demonstrate that PD 98059 effectively
blocked the
increase in FGF2 release from ECV304 endothelial cells treated with either T4
or T3. Parallel
studies of ERK1/2 inhibition were performed in CAM assays, and representative
results are
shown in Figure 5. A combination of T3 and T4, each in physiologic
concentrations, caused a
2.4-fold increase in blood vessel branching, an effect that was completely
blocked by 3 mon
PD 98059 (Figure 5A). FGF2 stimulation of branch formation (2.2-fold) was also
effectively
blocked by this inhibitor of ERK1/2 activation (Figure 5B). Thus, the
proangiogenic effect of
thyroid hormone begins at the plasma membrane and involves activation of the
ERK1/2
pathway to promote FGF2 release from endothelial cells. ERK1/2 activation is
again required
to transduce the FGF2 signal and cause new blood vessel formation.
Example 6. Action of Thyroid Hormone and FGF2 on MAPK Activation: Stimulation
of
phosphorylation and nuclear translocation of ERK1/2 MAPKs was studied in
ECV304 cells
treated with T4 (10-7 mol/L) for 15 minutes to 6 hours. The appearance of
phosphorylated
ERK1/2 in cell nuclei occurred within 15 minutes of T4 treatment, reached a
maximal level at
30 minutes, and was still apparent at 6 hours (Figure 6A). This effect of the
hormone was
inhibited by PD 98059 (Figure 6B), a result to be expected because this
compound blocks the
phosphorylation of ERK1/2 by MAPK kinase. The traditional protein kinase C
(PKC)-a, PKC-
13, and PKC-y inhibitor CGP41251 also blocked the effect of the hormone on
MAPK activation
in these cells, as we have seen with 14 in other cell lines. Thyroid hormone
enhances the
action of several cytokines and growth factors, such as interferon- y13 and
epidermal growth
factor. In ECV304 cells, T4 enhanced the MAPK activation caused by FGF2 in a
15-minute co
incubation (Figure 6C). Applying observations made in ECV304 cells to the CAM
model, we
124
CA 02648243 2013-09-23
propose that the complex mechanism by which the hormone induces angiogenesis
includes
endothelial cell release of FGF2 and enhancement of the autocrine effect of
released FGF2 on
angiogenesis.
Example 7. RT-PCR in ECV304 Cells Treated With Thyroid Hormone:
The final question addressed in studies of the mechanism of the proangiogenic
action of
T4 was whether the hormone may induce FGF2 gene expression. Endothelial cells
were treated
with T4 (10-7 mol/L) for 6 to 48 hours, and RT-PCR¨based estimates of FGF2 and
GAPDH
RNA (inferred from cDNA measurements; Figure 7) were performed. Increase in
abundance of
FGF2 cDNA, corrected for GAPDH content, was apparent by 6 hours of hormone
treatment
and was further enhanced by 48 hours.
Example 8A. Retinal Neovascularization model in mice (diabetic and non-
diabetic):
To assess the pharmacologic activity of a test article on retinal
neovascularization,
Infant mice are exposed to a high oxygen environment for 7 days and allowed to
recover,
thereby stimulating the formation of new vessels on the retina. Test articles
are evaluated to
determine if retinal neovascularization is suppressed. The retinas are
examined with
hematoxylin-eosin staining and with at least one stain, which demonstrates
neovascularization
(usually a Selectin stain). Other stains (such as PCNA, PAS, GFAP, markers of
angiogenesis,
etc.) can be used. A summary of the model is below:
Animal Model
= Infant mice (P7) and their dams are placed in a hyper-oxygenated
environment (70-
80%) for 7 days.
= On P12, the mice are removed from the oxygenated environment and placed
into a
normal environment
= Mice are allowed to recover for 5-7 days.
= Mice are then sacrificed and the eyes collected.
= Eyes are either frozen or fixed as appropriate
= The eyes are stained with appropriate histochemical stains
= The eyes are stained with appropriate immunohistochemical stains
125
CA 02648243 2013-09-23
= Blood, serum, or other tissues can be collected
= Eyes, with special reference to microvascular alterations, are examined
for any and all
findings. Neovascular growth will be semi quantitatively scored. Image
analysis is also
available.
Example 8B: Thyroid Hormone and Diabetic Retinopathy:
A protocol disclosed in J de la Cruz et al., J Pharmacol Exp Ther 280:454-459,
1997, is
used for the administration of Tetrac to rats that have streptozotocin (STZ)-
induced experimental
diabetes and diabetic retinopathy. The endpoint is the inhibition by Tetrac of
the appearance of
proliferative retinopathy (angiogenesis).
Example 9A. Wound Healing and Hemostatic Treatment Using Novel Pharmaceutical
Polymeric Formulation of Thyroid Hormone and Analogs:
The present invention also includes a novel wound healing and hemostatic
treatment
that include an immobilized thyroid hormone analog, preferably T4 analogs,
calcium chloride,
and collagen. This novel formulation significantly controls both venous and
arterial
hemorrhage, reduces bleeding time, generates fibrin/platelet plug, releases
platelet-derived
wound healing factors in a sustained manner in the presence of low level
collagen, and safe.
Development of such a wound healing and hemostatic dressing can be very
valuable for short
and long-term use in Combat Casualty Care. Pharmaceutical formulation of
immobilized L-
thyroxine (T4) and globular hexasaccharide in a hydrogel or dressing
containing collagen and
calcium chloride can be optimized. This novel Wound healing and Hemostatic (WH
formulation) treatment in hydrogel or dressing can also include the addition
of a microbicidal.
L-thyroxine conjugated to polymer or immobilized on agarose demonstrated
potent
stimulation of angiogenesis through activation of an adhesion cell surface
receptor (integrin
av[33) leading to activation of an intracellular signaling event, which in
turn leads to up-
regulation of various growth factor productions. Additionally, immobilized T4
induced
epithelial, fibroblast, and keratinocyte cell migration. Immobilized T4, but
not T3 or other
analogs, enhanced collagen-induced platelet aggregation and secretion, which
would promote
formation of the subject's own platelet plug. Furthermore, immobilized T4 also
promotes
126
CA 02648243 2013-09-23
white blood cell migration, which could be critical for fighting infection.
Hence, immobilized
T4 can help the body make more of a compound used to regenerate damaged blood
vessels,
and it also increased the amount of white blood cells that makes free radicals
in the wound site.
Free radicals help clear potentially pathogenic bacteria from a wound.
Thus, T4 or T4-agarose (10-100 nM), but not T3, DIPTA, or GC-1, is effective
in
enhancing platelet aggregation and secretion (de-granulation). Accordingly, T4
(or analogs
and polymeric conjugations thereof, e.g., T4-agarose), in combination with 10
mM calcium
chloride, and with or without collagen, is preferred for wound healing. See
Figures 23A-E.
Thromboelastography:
Thromboelastography (TEG) has been used in various hospital settings since its
development by Hafted in 1948. The principle of TEG is based on the
measurement of the physical
viscoelastic characteristics of blood clot. Clot formation was monitored at 37
C in an oscillating
plastic cylindrical cuvette ("cup") and a coaxially suspended stationary
piston ("pin") with a 1 mm
clearance between the surfaces, using a computerized Thrombelastograph (TEG
Model 3000,
Haemoscope, Skokie, IL). The cup oscillates in either direction every 4.5
seconds, with a 1 second
mid-cycle stationary period; resulting in a frequency of 0.1 Hz and a maximal
shear rate of 0.1 per
second. The pin is suspended by a torsion wire that acts as a torque
transducer. With clot formation,
fibrin fibrils physically link the cup to the pin and the rotation of the cup
as affected by the
viscoelasticity of the clot (Transmitted to the pin) is displayed on-line
using an IBM-compatible
personal computer and customized software (Haemoscope Corp., Skokie, IL). The
torque
experienced by the pin (relative to the cup's oscillation) is plotted as a
function of time.
TEG assesses coagulation by measuring various parameters such as the time
latency for
the initial initiation of the clot (R), the time to initiation of a fixed clot
firmness (k) of about 20
mm amplitude, the kinetic of clot development as measured by the angle (a),
and the
maximum amplitude of the clot (MA). The parameter A measures the width of the
tracing at
any point of the MA. Amplitude A in mm is a function of clot strength or
elasticity. The
amplitude on the TEG tracing is a measure of the rigidity of the clot; the
peak strength or the
shear elastic modulus attained by the clot, G, is a function of clot rigidity
and can be calculated
from the maximal amplitude (MA) of the TEG tracing.
127
CA 02648243 2013-09-23
The following parameters were measured from the TEG tracing:
= R, the reaction time (gelation time) represents the latent period before
the establishment
of a 3-dimensional fibrin gel network (with measurable rigidity of about 2 mm
amplitude).
= Maximum Amplitude (MA, in mm), is the peak rigidity manifested by the
clot.
= Shear elastic modulus or clot strength (G, dynes/cm2) is defined by:
G = (5000A) / (100-A).
Blood clot firmness is an important parameter for in vivo thrombosis and
hemostasis
because the clot must stand the shear stress at the site of vascular injury.
TEG can assess the
efficacy of different pharmacological interventions on various factors
(coagulation activation,
thrombin generation, fibrin formation, platelet activation, platelet-fibrin
interaction, and fibrin
polymerization) involved in clot formation and retraction. The effect of
endotoxin (0.63 ug),
Xa (0.25 nM), thrombin (0.3 mU), and TF (25 ng) on the different clot
parameters measured by
computerized TEG in human whole blood is shown in Table 3.
Blood Sampling:
Blood was drawn from consenting volunteers under a protocol approved by the
Human
Investigations Committee of William Beaumont Hospital. Using the two syringe
method,
samples were drawn through a 21 gauge butterfly needle and the initial 3 ml
blood was
discarded. Whole blood (WB) was collected into siliconized Vacutainerl tubes
(Becton
Dickinson, Rutherford, NJ containing 3.8% trisodium citrate such that a ratio
of citrate whole
blood of 1:9 (v/v) was maintained. TEG was performed within 3 hrs of blood
collection.
Calcium was added back at 1-2.5 mM followed by the addition of the different
stimulus.
Calcium chloride by itself at the concentration used showed only a minimal
effect on clot
formation and clot strength.
Clot formation is initiated by thrombin-induced cleavage of Fibrinopeptide A
from
fibrinogen. The resultant fibrin monomers spontaneously polymerize to form
fibril strands that
undergo linear extension, branching, and lateral association leading to the
formation of a three-
dimensional network of fibrin fibers. A unique property of network structures
is that they
behave as rigid elastic solids, capable of resisting deforming shear stress.
This resistance to
128
CA 02648243 2013-09-23
deformation can be measured by elastic modulus-an index of clot strength.
Unlike
conventional coagulation tests (like the prothrombin time and partial
thromboplastin time) that
are based only on the time to the onset of clot formation, TEG allows
acquisition of
quantitative information allowing measurement of the maximal strength attained
by clots. Via
the GPIIb/IIIa receptor, platelets bind fibrin(ogen) and modulate the
viscoelastic properties of
clots. Our results demonstrated that clot strength in TF-TEG is clearly a
function of platelet
concentration and platelets augmented clot strength ¨8 fold under shear.
Different platelet
GPIIb/IIIa antagonists (class I versus class II) behaved with distinct
efficacy in inhibiting
platelet-fibrin mediated clot strength using TF-TEG under shear.
Statistical analysis:
Data are expressed as mean SEM. Data were analyzed by either paired or group
analysis using the Student t test or ANOVA when applicable; differences were
considered
significant at P <0.05.
Effect of Calcium Chloride versus Tissue Factor on clot dynamics in citrated
human
whole blood using TEG
25 ng TF + 2.25 mM Ca+2 10 mM Ca+2
TEG Parameters (Mean SEM) (Mean SEM)
r (min) 29.7 + 2.3 14.5 + 2.5*
K (min) 5.8 1.0 7.0 + 0.7
a (angle) 45.0 + 2.6 47.3 + 2.7
MA (mm) 58.2 + 1.7 56.5 + 2.2
Data represent mean SEM, n =4, * P <0.01.
Platelet aggregation and de-granulation in whole blood using Impedance
Technique:
The Model 560 Whole-Blood Aggregometer and the associated Aggro-Link Software
from the
Chrono-Log Corporation were used in this study. Two electrodes are placed in
diluted blood
129
CA 02648243 2013-09-23
and an electrical impulse is sent from one to the other. As the platelets
aggregate around the
electrodes, the Chrono-Log measures the impedance of the electrical signal in
ohms of
resistance.
Blood Sampling:
Whole blood was drawn daily from healthy donors between the ages of 17 and 21
into
4.5 milliliter Vacutainer31 vials with 3.8% buffered sodium citrate (Becton
Dickinson,
Rutherford, New Jersey). The blood was kept on a rocker to extend the life of
the platelets, and
experiments were done within 5 hours of phlebotomy.
Procedure: For the control, 500 microliters of whole blood, 500 microliters of
0.9% saline, and
a magnetic stir bar were mixed into a cuvette, and heated for five minutes to
37 degrees
Celsius. Sub-threshold aggregation was induced with 5 microliters of 1-2 Him'
Collagen,
which the Aggregometer measured for 6-7 minutes. The effects of T4, T4-agarose
versus T3
and other thyroid hormone analogs on collagen-induced aggregation and
secretion were tested.
Ingerman-Wojenski C, Smith JB, Silver MJ. Evaluation of electrical
aggregometry: comparison
with optical aggregometry, secretion of ATP, and accumulation of radio labeled
platelets. J Lab
Clin Med. 1983 Jan;101(1):44-52.
Cell migration assay:
Human granulocytes are isolated from shed blood by the method of Mousa et al.
and
cell migration assays carried out as previously described (Methods In Cell
Science, 19 (3): 179-
187, 1997, and Methods In Cell Science 19 (3): 189-195, 1997). Briefly, a
neuroprobe 96 well
disposable chemotaxis chamber with an 8 m pore size will be used. This
chamber allow for
quantitation of cellular migration towards a gradient of chemokine, cytokine
or extracellular
matrix proteins. Cell suspension (45 1 of 2 x 106) will be added to a
polypropylene plate
containing 5 tl of test agents such as flavanoids or thyroid hormone
derivatives and incubated
for 10 minutes at 22 C. IL8 (0.1 ¨100 ng) with or without T3/ T4 (33 I) at
0.001 ¨ 0.1 !AM
will be added to the lower wells of a disposable chemotaxis chamber, then
assemble the
chamber using the pre-framed filter. Add 25 1.1.1 of cell / test agent
suspension to the upper filter
130
CA 02648243 2013-09-23
wells then incubate overnight (22 hours at 37 C, 5% CO2) in a humidified cell
culture
incubator. After the overnight incubation, non-migrated cells and excess media
will be gently
removed using a 12 channel pipette and a cell scraper. The filters will then
washed twice in
phosphate buffered saline (PBS) and fixed with 1% formaldehyde in PBS buffer.
Membranes
of migrated cells will be permeated with Triton X-100 (0.2 %) then washed 2-3
times with
PBS. The actin filaments of migrated cells will be stained with Rhodamine
phalloidin (12.8
IU/ml) for 30 minutes (22 C). Rhodamine phalloidin will be made fresh weekly
and reused
for up to 3 days, when stored protected from light at 4 C. Chemotaxis will be
quantitatively
determined by fluorescence detection using a Cytofluort) II micro-filter
fluorimeter (530
excitation / 590 emission). All cell treatments and subsequent washings will
be carried out
using a uniquely designed treatment/wash station (Methods In Cell Science, 19
(3): 179-187,
1997). This technique will allow for accurate quantitation of cell migration
and provide
reproducible results with minimal inter and intra assay variability.
Cellular Migration assays:
These assays were performed using a Neuroprobel 96 well disposable chemotaxis
chamber with an 8 m pore size. This chamber allowed for quantitation of
cellular migration
towards a gradient of either vitronectin or osteopontin. Cultured cells were
removed following
a standardized method using EDTA / Trypsin (0.01% / 0.025%). Following
removal, the cells
were washed twice and resuspended (2x106 /m1) in EBM (Endothelial cell basal
media,
Clonetics Inc.). Add either vitronectin or osteopontin (33 1) at 0.0125 -100
g/m1 to the lower
wells of a disposable chemotaxis chamber, and then assemble using the
preframed filter. The
cell suspension (45 1) was added to a polypropylene plate containing 5 I of
test agent at
different concentrations and incubated for 10 minutes at 22 C. Add 25 1 of
cell / test agent
suspension to the upper filter wells then incubate overnight (22 hours at 37
C) in a humidified
cell culture incubator. After the overnight incubation, non-migrated cells and
excess media
were gently removed using a 12 channel pipette and a cell scraper. The filters
were then
washed twice in PBS (no Ca+2 or Mg+2) and fixed with 1% formaldehyde.
Membranes of
migrated cells were permeated with Triton X-100 (0.2 %) then washed 2-3 times
with PBS.
The actin filaments of migrated cells were stained with rhodamine phalloidin
(12.8 IU/ml) for
131
CA 02648243 2013-09-23
30 minutes (22 C). Rhodamine phalloidin was made fresh weekly and reused for
up to 3 days,
when stored protected from light at 4 C. Chemotaxis was quantitatively
determined by
fluorescence detection using a Cytofluor II (530 excitation / 590 emission).
All cell treatment
and subsequent washings were carried out using a uniquely designed
treatment/wash station.
This station consisted of six individual reagent units each with a 30 ml
volume capacity.
Individual units were filled with one of the following reagents: PBS,
formaldehyde, Triton X-
100, or rhodamine-phalloidin. Using this technique, filters were gently dipped
into the
appropriate solution, thus minimizing migrated cell loss. This technique
allowed for maximum
quantitation of cell migration and provided reproducible results with minimal
inter and intra
assay variability.
Migration toward the extracellular Matrix Protein Vitronectin
Treatments Mean EC Migration
(Fluorescence Units) + SD
A. Non-Specific Migration 270 + 20
No Matrix in LC
B. Vitronectin (25 ug) in LC 6, _ 116 + 185
C. T3 (0.1 uM) UC /
Vitronectin (25 ug) in LC 22, + 016 385
_
D. T4 (0.1 uM) UC /
Vitronectin (25 ug) in LC 13,083 + 276
C + XT199 (10 uM) 4,550 225
D + XT199 (10 uM) 3,890 + 420
C + PD (0.8 ug) 7,555 + 320
D + PD (0.8 ug) 6,965 + 390
LC = Lower Chamber, UC = Upper chamber
Similar data were obtained with other potent and specific avb3 antagonists
such as LM609 and
SM256
132
CA 02648243 2013-09-23
Example 9B. In vitro human epithelial and fibroblast wound healing:
The in vitro 2-dimensional wound healing method is as described in Mohamed S,
Nadijcka D,
Hanson, V. Wound healing properties of cimetidine in vitro. Drug Intell Clin
Pharm 20: 973-
975; 1986. Additionally, a 3-dimensional wound healing method already
established in our
Laboratory will be utilized in this study (see below). Data show potent
stimulation of wound
healing by thyroid hormone.
In Vitro 3D Wound Healing Assay of Human Dermal Fibroblast Cells:
Step 1: Prepare contracted collagen gels:
1) Coat 24-well plate with 350u12%BSA at RI for 2hr,
2) 80% confluent NHDF(normal human dermal fibroblast cells, Passage 5-9) are
trypsinized and neutralized with growth medium, centrifuge and wash once with
PBS
3) Prepare collagen-cell mixture, mix gently and always on ice:
Stock solution Final Concentration
5xDMEC lxDMEM
3mg/m1 vitrogen 2mg/m1
ddH20 optimal
NHDF 2x10-5 cells/ml
FBS 1%
4) Aspire 2%BSA from 24 well plate, add collagen-cell mixture 350
ul/well, and incubate the plate in 37 C CO2 incubator.
5) After 1 hr, add DMEM+5%FBS medium 0.5m1/well, use a lOul tip
Detach the collagen gel from the edge of each well, then incubate for 2days.
The
fibroblast cells will contract the collagen gel
Step 2: Prepare 3D fibrin wound clot and embed wounded collagen culture
1) Prepare fibrinogen solution (1mg/m1) with or without testing regents. 350u1
fibrinogen
solution for each well in eppendorf tube.
Stock solution Final Concentration
5xDMEC lxDMEM
Fibrinogen 1mg/m1
133
CA 02648243 2013-09-23
ddH20 optimal
testing regents optimal concentration
FBS 1% or 5%
2) Cut each contracted collagen gel from middle with scissors. Wash the gel
with PBS and
transfer the gel to the center of each well of 24 well plate
3) Add 1.5u1 of human thrombin (0.25U/up to each tube, mix well and then add
the
solution around the collagen gel, the solution will polymerize in 10 mins.
After 20mins, add DMEM+1%(or 5%) FBS with or without testing agent, 450u1/well
and
incubate the plate in 37 C CO2 incubator for up to 5 days. Take pictures on
each day.
In vivo wound healing in diabetic rats:
Using an acute incision wound model in diabetic rats, the effects of thyroid
hormone
analogs and its conjugated forms are tested. The rate of wound closure,
breaking strength
analyses and histology are performed periodically on days 3-21.
Methods:
Animals (Mice and Rats) in the study are given two small puncture wounds - WH
is
applied to one of the wounds, and the other was covered with saline solution
as a control.
Otherwise, the wounds are left to heal naturally.
The animals are euthanised five days after they are wounded. A small area of
skin ¨ 1 to
1.5 millimetres ¨ is excised from the edges of the treated and untreated
wounds.
Wound closure and time to wound closure is determined. Additionally, the
levels of
tenascin, a protein that helps build connective tissue, in the granulation
tissue of the wounds is
determined. The quality of the granulation tissue (i.e. rough, pinkish tissue
that normally forms
as a wound heals, new capillaries and connective tissue) is also determined.
Materials and Methods:
Chronic granulating wounds are prepared by methods well known in the art. Male
Sprague Dawley rats weighing 300 to 350 grams are acclimatized for a week in
our facility
prior to use. Under intraperitoneal Nembutal-4' anesthesia (35mg/kg), the rat
dorsum is shaved
and depilated. Animals are individually caged and given food and water ad
libitum. All
experiments were conducted in accordance with the Animal Care and Use
Committee
guidelines of the Department of Veterans Affairs Medical Center, Albany, NY.
134
CA 02648243 2013-09-23
Histological characterization of this wound with comparison to a human chronic
granulating wound had previously been performed. Sixty four rats are then
divided into eight
treatment groups (n=8 / group). Animals are treated with topical application
of vehicle (vehicle
controls) on days 5, 9, 12, 15, and 18. The vehicle control can be either
agarose (Group 1) or
the polymeric form (Group 2) that will be used in conjugation of L-thyroxine.
Wounds treated
with T4-agarose (Groups 3-5) or T4-polymer (Groups 6-8) at 1, 10, 100 tig/cm2
in the presence
of 10 pg globular hexasaccharide, 10 tig collagen, and 10 mM calcium chloride
to be applied
topically on days 5, 9, 12, 15, and 18. All wounds are left exposed. Every 48
hours the outlines
of the wounds can be traced onto acetate sheets, and area calculations can be
performed using
computerized digital planimetry.
Three full-thickness, transverse strips of granulation tissue are then
harvested from the
cephalad, middle, and caudal ends of the wounds on day 19 and fixed in 10-
percent buffered
formalin. Transverse sections (5 m) are taken from each specimen and stained
with
hematoxylin and eosin. The thickness of the granulation tissue can be
estimated with an ocular
micrometer at low power. High-powered fields are examined immediately below
the superficial
inflammatory layer of the granulation tissue. From each strip of granulation
tissue five adjacent
high-powered fields can be photographed and coded. Enlarged prints of these
exposures are
then used for histometric analysis in a blinded fashion. Fibroblasts, "round"
cells (macrophages,
lymphocytes, and neutrophils), and capillaries are counted. In addition the
cellularity of each
section is graded for cellularity on a scale of 1 (reduced cell counts) to 5
(highly cellular).
Statistical analysis:
Serial area measurements were plotted against time. For each animal's data a
Gompertz
equation will be fitted (typical r 2=0.85). Using this curve the wound half-
life can be
estimated. Comparison between groups is performed using life table analysis
and the Wilcoxon
rank test. These statistical analyses are performed using the SAS (SAS/STAT
Guide for
Personal Computers, Version 6 Edition, Cary, North Carolina, 1987, p 1028) and
BMDP
(BMDP Statistical Software Manual, Los Angeles, BMDP Statistical Software,
Inc. 1988)
packages on a personal computer.
Cell counts for the different treatment groups are pooled and analyzed using a
one-way
analysis of variance. Post-hoc analyses of differences between groups can be
carried out using
135
CA 02648243 2013-09-23
Tukey's test (all pairwise multiple-comparison test) with p <0.05 considered
significant. Sigma
Stat statistical software (Jandel Scientific, Corte Madera, California) will
be used for data
analysis.
Example 10. Rodent Model of Myocardial Infarction:
The coronary artery ligation model of myocardial infarction is used to
investigate
cardiac function in rats. The rat is initially anesthetized with xylazine and
ketamine, and after
appropriate anesthesia is obtained, the trachea is intubated and positive
pressure ventilation is
initiated. The animal is placed supine with its extremities loosely taped and
a median
sternotomy is performed. The heart is gently exteriorized and a 6-0 suture is
firmly tied
around the left anterior descending coronary artery. The heart is rapidly
replaced in the chest
and the thoracotomy incision is closed with a 3-0 purse string suture followed
by skin closure
with interrupted sutures or surgical clips. Animals are placed on a
temperature regulated
heating pad and closely observed during recovery. Supplemental oxygen and
cardiopulmonary
resuscitation are administered if necessary. After recovery, the rat is
returned to the animal
care facility. Such coronary artery ligation in the rat produces large
anterior wall myocardial
infarctions. The 48 hr. mortality for this procedure can be as high as 50%,
and there is
variability in the size of the infarct produced by this procedure. Based on
these considerations,
and prior experience, to obtain 16-20 rats with large infarcts so that the two
models of thyroid
hormone delivery discussed below can be compared, approximately 400 rats are
required.
These experiments are designed to show that systemic administration of thyroid
hormone either before or after coronary artery ligation leads to beneficial
effects in intact
animals, including the extent of hemodynamic abnormalities assessed by
echocardiography and
hemodynamic measurements, and reduction of infarct size. Outcome measurements
are
proposed at three weeks post-infarction. Although some rats may have no
infarction, or only a
small infarction is produced, these rats can be identified by normal
echocardiograms and
normal hemodynamics (LV end-diastolic pressure < 8mm Hg).
Thyroid Hormone Delivery:
There are two delivery approaches. In the first, thyroid hormone is directly
injected into
the pen-infarct myocardium. As the demarcation between normal and ischemic
myocardium is
136
CA 02648243 2013-09-23
easily identified during the acute open chest occlusion, this approach
provides sufficient
delivery of hormone to detect angiogenic effects.
Although the first model is useful in patients undergoing coronary artery
bypass
surgery, and constitutes proof of principle that one local injection induces
angiogenesis, a
broader approach using a second model can also be used. In the second model, a
catheter
retrograde is placed into the left ventricle via a carotid artery in the
anesthetized rat prior to
inducing myocardial infarction. Alternatively, a direct needle puncture of the
aorta, just above
the aortic valve, is performed. The intracoronary injection of the thyroid
hormone is then
simulated by abruptly occluding the aorta above the origin of the coronary
vessels for several
seconds, thereby producing isovolumic contractions. Thyroid hormone is then
injected into the
left ventricle or aorta immediately after aortic constriction. The resulting
isovolumic
contractions propel blood down the coronary vessels perfusing the entire
myocardium with
thyroid hormone. This procedure can be done as many times as necessary to
achieve
effectiveness. The number of injections depends on the doses used and the
formation of new
blood vessels.
Echocardiography:
A method for obtaining 2-D and M-mode echocardiograms in unanesthetized rats
has
been developed. Left ventricular dimensions, function, wall thickness and wall
motion can be
reproducibly and reliably measured. The measurement are carried out in a
blinded fashion to
eliminate bias with respect to thyroid hormone administration.
Hemodynamics:
Hemodynamic measurements are used to determine the degree of left ventricular
impairment. Rats are anesthetized with isoflurane. Through an incision along
the right anterior
neck, the right carotid artery and the right jugular vein are isolated and
cannulated with a
pressure transducing catheter (Millar, SPR-612, 1.2 Fr). The following
measurements are
then made: heart rate, systolic and diastolic BP, mean arterial pressure, left
ventricular systolic
and end-diastolic pressure, and + and -dP/dt. Of particular utility are
measurements of left
ventricular end-diastolic pressure, progressive elevation of which correlates
with the degree of
myocardial damage.
Infarct Size:
137
CA 02648243 2013-09-23
Rats are sacrificed for measurement of infarct size using TTC methodology.
Morphometry:
Microvessel density [microvessels/mm2] will be measured in the infarct area,
pen-
infarct area, and in the spared myocardium opposing the infarction, usually
the posterior wall.
From each rat, 7-10 microscopic high power fields [x400] with transversely
sectioned
myocytes will be digitally recorded using Image Analysis software.
Microvessels will be
counted by a blinded investigator. The microcirculation will be defined as
vessels beyond third
order arterioles with a diameter of 150 micrometers or less, supplying tissue
between arterioles
and venules. To correct for differences in left ventricular hypertrophy,
microvessel density will
be divided by LV weight corrected for body weight. Myocardium from sham
operated rats will
serves as controls.
Example 11. Effects of the aVI33 antagonists on the pro-angiogenesis effect of
T4 or
FGF2:
The aVf33 inhibitor LM609 totally inhibited both FGF2 or T4-induced pro-
angiogenic
effects in the CAM model at 10 micrograms (Figure 16).
Example 12. Inhibition of Cancer-Related New Blood Vessel Growth:
A protocol disclosed in J. Bennett, Proc Natl Acad Sci USA 99:2211-2215, 2002,
is
used for the administration of tetraiodothyroacetic (Tetrac) to SCID mice that
have received
implants of human breast cancer cells (MCF-7). Tetrac is provided in drinking
water to raise
the circulating level of the hormone analog in the mouse model to 10-6 M. The
endpoint is the
inhibitory action of tetrac on angiogenesis about the implanted tumors.
Example 13. Pro-angiogenesis Promoting Effect of Thyroid Hormone and Analogs
Thereof at Subthreshold Levels of VEGF and FGF2 in an in vitro Three-
dimensional
Micro-vascular Endothelial Sprouting Model:
Either T3, T4, T4-agarose, or fibroblast growth factor 2 (FGF2) plus vascular
endothelial
growth factor (VEGF) produced a comparable pro-angiogenesis effect in the in
vitro three-
dimensional micro-vascular endothelial sprouting model. The pro-angiogenesis
effect of the
138
CA 02648243 2013-09-23
thyroid hormone analogs were blocked by PD 98059, an inhibitor of the mitogen-
activated protein
kinase (MAPK; ERK1/2) signal transduction cascade. Additionally, a specific
av133 integrin
antagonist (XT199) inhibited the pro-angiogenesis effect of either thyroid
hormone analogs or T4-
agarose. Data also demonstrated that the thyroid hormone antagonist Tetrac
inhibits the thyroid
analog's pro-angiogenesis response. Thus, those thyroid hormone analogs tested
are pro-
angiogenic, an action that is initiated at the plasma membrane and involves
avr33 integrin receptors,
and is MAPK-dependent.
The present invention describes a pro-angiogenesis promoting effect of T3, T4,
or T4-
agarose at sub-threshold levels of VEGF and FGF2 in an in vitro three-
dimensional micro-vascular
endothelial sprouting model. The invention also provides evidence that the
hormone effect is
initiated at the endothelial cell plasma membrane and is mediated by
activation of the ocv133
integrin and ERK1/2 signal transduction pathway.
Enhancement by T3, T4, or T4¨agarose of the angiogenesis activity of low
concentrations of VEGF and FGF2 in the three-dimensional sprouting assay was
demonstrated.
Either T3, T4 at 10-7-10-8 M, or T4¨agarose at 10-7 M total hormone
concentration was
comparable in pro- angiogenesis activity to the maximal concentrations of VEGF
and FGF2
effect in this in vitro model. Although new blood vessel growth in the rat
heart has been
reported to occur concomitantly with induction of myocardial hypertrophy by a
high dose of
T4, thyroid hormone has not been regarded as an angiogenic factor. The present
example
establishes that the hormone in physiologic concentrations is pro-angiogenic
in a setting other
than the heart.
tragarose reproduced the effects of T4, and this derivative of thyroid hormone
is
thought not to gain entry to the cell interior; it has been used in our
laboratory to examine
models of hormone action for possible cell surface-initiated actions of
iodothyronines. Further,
experiments carried out with T4 and tetrac also supported the conclusion that
the action of T4 in
this model was initiated at the plasma membrane. Tetrac blocks membrane-
initiated effects of
T4.
Since thyroid hormone non-genomically activates the MAPK (ERK1/2) signal
transduction pathway, the action of the hormone on angiogenesis can be MAPK-
mediated.
139
CA 02648243 2013-09-23
When added to the CAM model, an inhibitor of the MAPK cascade, PD 98059,
inhibited the
pro-angiogenic action of T4. While this result was consistent with an action
on transduction of
the thyroid hormone signal upstream of an effect of 14 on FGF2 elaboration, it
is known that
FGF2 also acts via an MAPK-dependent mechanism. 14 and FGF2 individually cause
phosphorylation and nuclear translocation of ERK1/2 in endothelial cells and,
when used in
sub-maximal doses, combine to enhance ERK1/2 activation further. To examine
the possibility
that the only MAPK-dependent component of hormonal stimulation of angiogenesis
related
exclusively to the action of FGF2 on vessel growth, cellular release of FGF2
in response to T4
in the presence of PD 98059 was measured. The latter agent blocked the hormone-
induced
increase in growth factor concentration and indicated that MAPK activation was
involved in
the action of T4 on FGF2 release from endothelial cells, as well as the
consequent effect of
FGF2 on angiogenesis.
Effect of Thyroid Hormone on Angiogenesis:
Either T4, 13, or T4-agarose at 0.01-0.1 laM resulted in significant (P <0.01)
stimulation of angiogenesis, see the Table below. This is shown to be
comparable to the pro-
angiogenesis efficacy of FGF2 (50 ng/ml) plus VEGF (25 ng/ml).
In Vitro Pro-angiogenesis Effect of Growth Factors, Thyroid Hormone,
and Analogs in the Three-Dimensional Human Micro-vascular Endothelial
Sprouting Assay
Treatment Groups Mean Tube Vessel Length (mm) SD
Control 0.76 0.08
FGF2 (25 ng) + VEGF (50 ng) 2.34 0.25*
T3 (20 ng) 1.88 0.21*
14(23 ng) 1.65 0.15*
T4-agarose (23 ng) 1.78 0.20*
Data (means SD) were obtained from 3 experiments. Cells were pre-treated
with Sub-
threshold level of FGF2 (1.25 ng/ml) + VEGF(2.5 ng/ml).
Data represent mean + SD, n = 3, *p <0.01 by ANOVA, comparing treated to
control.
140
CA 02648243 2013-09-23
Effects of Tetrac on thyroid pro-angiogenesis action:
T3 stimulates cellular signal transduction pathways initiated at the plasma
membrane.
These pro-angiogenesis actions are blocked by a deaminated iodothyronine
analogue, tetrac,
which is known to inhibit binding of 14 to plasma membranes. The addition of
tetrac (0.1 IAM)
inhibited the pro-angiogenesis action of either 13, T4, or T4-agarose (Tables
5-7). This is
shown by the inhibition of number of micr-vascular endothelial cell migration
and vessel length
(Table 5-7).
Role of the ERK1/2 Signal Transduction Pathway in Stimulation of Angiogenesis
by
Thyroid Hormone:
Parallel studies of ERK1/2 inhibition were carried out in the three-
dimensional micro-
vascular sprouting assays. Thyroid hormone and analog at 0.01-0.1 M caused
significant
increase in tube length and number of migrating cells, an effect that was
significantly ( P <
0.01) blocked by PD 98059 (Tables 5-7). This is shown by the inhibition of
number micro-
vascular endothelial cell migration and vessel length (Table 5-7).
Role of the Integrin ay133 in Stimulation of Angiogenesis by Thyroid Hormone:
Either 13, T4, or T4-agarose at 0.01-0.1 M¨mediated pro-angiogenesis in the
presence
of sub-threshold levels of VEGF and FGF2 was significantly (P <0.01) blocked
by the av133
integrin antagonist XT199 (Tables 5-7) . This is shown by the inhibition of
number of micro-
vascular endothelial cell migration and vessel length, se the Tables below.
Thus, the pro-angiogenesis effect of thyroid hormone and its analogs begins at
the
plasma membrane av133 integrin and involves activation of the ERK1/2.
Pro-angiogenesis Mechanisms of the Thyroid Hormone T3 in the Three-Dimensional
Human Micro-vascular Endothelial Sprouting Assay
Mean number of Mean vessel Length
HDMEC treatment Migrated cells SD (mm) SD
Control 88 14 0.47 0.06
T3 (0.1 uM) 188 15* 0.91 0.04*
13 (0.1 UM) PD98059 (3 ug) 124 29 0.48 0.09
141
CA 02648243 2013-09-23
T3 (0.1 UM) + XT199 (2 ug) 118 18 0.47 0.04
T3 (0.1 uM) + tetrac (0.15 ug) 104 15 0.58 0.07
Human dermal micro-vascular endothelial cells (HDMVC) were used. Cells were
pretreated
with FGF2 (1.25 ng/ml) + VEGF (2.5 ng/ml). Images were taken at 4 and 10X, day
3. Data
represent mean + SD, n = 3, * P < 0.01.
Pro-angiogenesis Mechanisms of the Thyroid Hormone T4 in the
Three-Dimensional Human Micro-vascular Endothelial Sprouting Assay
Mean number of Mean Vessel
HDMEC treatment Migrated cells SD Length (mm) SD
Control 88 14 0.47 0.06
T4 (0.1 uM) 182 11* 1.16 0.21*
T4(0.1 UM) PD98059 (3 ug) 110 21 0.53 0.13
T4(0.1 UM) XT199 (2 ug) 102 13 0.53 0.05
T4 (0.1 UM) Tetrac (0.15 ug) 85 28 0.47 0.11
Human dermal micro-vascular endothelial cells (HDMVC) were used. Cells were
pretreated
with FGF2 (1.25 ng/ml) + VEGF (2.5 ng/ml). Images were taken at 4 and 10X, day
3. Data
represent mean + SD, n = 3, * P < 0.01.
Pro-angiogenesis Mechanisms of the Thyroid Hormone TeAgarose in the Three-
Dimension Human Micro-vascular Endothelial Sprouting Assay
Mean number of Mean Vessel Length
HDMEC treatment Migrated cells SD (mm) SD
Control 88 14 0.47 0.06
Teagarose (0.1 uM) 191 13* 0.97 0.08*
Teagarose (0.1 uM) + PD98059 (3 ug) 111 8 0.56 0.03
Teagarose (0.1 uM) + XT199 (2 ug) 106 5 0.54 0.03
Teagarose (0.1 uM) + Tetrac (0.15 ug) 87 14 0.45
0.09
142
CA 02648243 2013-09-23
Human dermal micro-vascular endothelial cells (HDMVC) were used. Cells were
pretreated with FGF2 (1.25 ng/ml) + VEGF (2.5 ng/ml). Images were taken at 4
and 10X day
3. Data represent mean + SD, n = 3, * P < 0.01.
Example 14. In vitro Model for Evaluating Polymeric Thyroid Analogs Transport
Across the Blood-Brain Barrier
Described below is an in vitro method for evaluating the facility with which
selected
polymeric thyroid analog alone or in combination with nerve growth factor or
other
neurogenesis factors likely will pass across the blood-brain barrier. A
detailed description of
the model and protocol are provided by Audus, et al., Ann. N.Y. Acad. Sci 507:
9-18 (1987).
Briefly, microvessel endothelial cells are isolated from the cerebral gray
matter of fresh
bovine brains. Brains are obtained from a local slaughter house and
transported to the
laboratory in ice cold minimum essential medium ("MEM") with antibiotics.
Under sterile
conditions the large surface blood vessels and meninges are removed using
standard dissection
procedures. The cortical gray matter is removed by aspiration, then minced
into cubes of about
1 mm. The minced gray matter then is incubated with 0.5% dispase (BMB,
Indianapolis, Ind.)
for 3 hours at 37 C. in a shaking water bath. Following the 3 hour digestion,
the mixture is
concentrated by centrifugation (1000x g for 10 min.), then resuspended in 13%
dextran and
centrifuged for 10 min. at 5800x g. Supernatant fat, cell debris and myelin
are discarded and
the crude microvessel pellet resuspended in 1 mg/ml collagenase/dispase and
incubated in a
shaking water bath for 5 hours at 37 C. After the 5-hour digestion, the
microvessel suspension
is applied to a pre-established 50% Percoll gradient and centrifuged for 10
min at 1000x g. The
band containing purified endothelial cells (second band from the top of the
gradient) is
removed and washed two times with culture medium (e.g., 50% MEM/50% F-12
nutrient mix).
The cells are frozen (-80 C.) in medium containing 20% DMSO and 10% horse
serum for later
use.
After isolation, approximately 5x105 cells/cm2 are plated on culture dishes or
5-12 mm
pore size polycarbonate filters that are coated with rat collagen and
fibronectin. 10-12 days
after seeding the cells, cell monolayers are inspected for confluency by
microscopy.
Characterization of the morphological, histochemical and biochemical
properties of
143
CA 02648243 2013-09-23
these cells has shown that these cells possess many of the salient features of
the blood-brain
barrier. These features include: tight intercellular junctions, lack of
membrane fenestrations,
low levels of pinocytotic activity, and the presence of gamma-glutamyl
transpeptidase, alkaline
phosphatase, and Factor VIII antigen activities.
The cultured cells can be used in a wide variety of experiments where a model
for
polarized binding or transport is required. By plating the cells in multi-well
plates, receptor and
non-receptor binding of both large and small molecules can be conducted. In
order to conduct
transendothelial cell flux measurements, the cells are grown on porous
polycarbonate
membrane filters (e.g., from Nucleopore, Pleasanton, Calif.). Large pore size
filters (5-12 mm)
are used to avoid the possibility of the filter becoming the rate-limiting
barrier to molecular
flux. The use of these large-pore filters does not permit cell growth under
the filter and allows
visual inspection of the cell monolayer.
Once the cells reach confluency, they are placed in a side-by-side diffusion
cell
apparatus (e.g., from Crown Glass, Sommerville, N.J.). For flux measurements,
the donor
chamber of the diffusion cell is pulsed with a test substance, then at various
times following the
pulse, an aliquot is removed from the receiver chamber for analysis.
Radioactive or
fluorescently-labelled substances permit reliable quantitation of molecular
flux. Monolayer
integrity is simultaneously measured by the addition of a non-transportable
test substance such
as sucrose or inulin and replicates of at least 4 determinations are measured
in order to ensure
statistical significance.
Example 15. Traumatic Injury Model
The fluid percussion brain injury model was used to assess the ability of
polymeric
thyroid hormone analogs alone or in combination with nerve growth factors or
other
neurogenesis factors to restore central nervous system functions following
significant traumatic
brain injury.
I. Fluid Percussion Brain Injury Procedure
The animals used in this study were male Sprague-Dawley rats weighing 250-300
grams (Charles River). The basic surgical preparation for the fluid-percussion
brain injury has
been previously described. Dietrich, et al., Acta Neuropathol. 87: 250-258
(1994) incorporated
144
CA 02648243 2013-09-23
by reference herein. Briefly, rats were anesthetized with 3% halothane, 30%
oxygen, and a
balance of nitrous oxide. Tracheal intubation was performed and rats were
placed in a
stereotaxic frame. A 4.8-mm craniotomy was then made overlying the right
parietal cortex, 3.8
mm posterior to bregma and 2.5 mm lateral to the midline. An injury tube was
placed over the
exposed dura and bonded by adhesive. Dental acrylic was then poured around the
injury tube
and the injury tube was then plugged with a gelfoam sponge. The scalp was
sutured closed and
the animal returned to its home case and allowed to recover overnight.
On the next day, fluid-percussion brain injury was produced essentially as
described by
Dixon, et al., J. Neurosurg. 67: 110-119 (1987) and Clifton, et al., J. Cereb.
Blood Flow Metab.
11: 114-121(1991). The fluid percussion device consisted of a saline-filled
Plexiglas cylinder
that is fitted with a transducer housing and injury screw adapted for the
rat's skull. The metal
screw was firmly connected to the plastic injury tube of the intubated
anesthetized rat (70%
nitrous oxide, 1.5% halothane, and 30% oxygen), and the injury was induced by
the descent of
a pendulum that strikes the piston. Rats underwent mild-to-moderate head
injury, ranging from
1.6 to 1.9 atm. Brain temperature was indirectly monitored with a thermistor
probe inserted into
the right temporalis muscle and maintained at 37-37.5 C. Rectal temperature
was also
measured and maintained at 37 C. prior to and throughout the monitoring
period.
Behavioral Testing:
Three standard functional/behavioral tests were used to assess sensorimotor
and reflex
function after brain injury. The tests have been fully described in the
literature, including
Bederson, et al., (1986) Stroke 17: 472-476; DeRyck, et al., (1992) Brain Res.
573: 44-60;
Markgraf, et al., (1992) Brain Res. 575: 238-246; and Alexis, et al., (1995)
Stroke 26: 2338-
2346.
A. The Forelimb Placing Test
Forelimb placing to three separate stimuli (visual, tactile, and
proprioceptive) was
measured to assess sensorimotor integration. DeRyck, et al., Brain Res. 573:44-
60 (1992). For
the visual placing subtest, the animal is held upright by the researcher and
brought close to a
table top. Normal placing of the limb on the table is scored as "0," delayed
placing (<2 sec) is
scored as "1," and no or very delayed placing (>2 sec) is scored as "2."
Separate scores are
obtained first as the animal is brought forward and then again as the animal
is brought sideways
145
CA 02648243 2013-09-23
to the table (maximum score per limb=4; in each case higher numbers denote
greater deficits).
For the tactile placing subtest, the animal is held so that it cannot see or
touch the table top with
its whiskers. The dorsal forepaw is touched lightly to the table top as the
animal is first brought
forward and then brought sideways to the table. Placing each time is scored as
above
(maximum score per limb=4). For the proprioceptive placing subtest, the animal
is brought
forward only and greater pressure is applied to the dorsal forepaw; placing is
scored as above
(maximum score per limb=2). Finally, the ability of animals to place the
forelimb in response
to whisker stimulation by the tabletop was tested (maximum score per limb=2).
Then subscores
were added to give the total forelimb placing score per limb (range=0-12).
B. The Beam Balance Test
Beam balance is sensitive to motor cortical insults. This task was used to
assess gross
vestibulomotor function by requiring a rat to balance steadily on a narrow
beam. Feeney, et al.,
Science, 217: 855-857 (1982); Goldstein, et al., Behav. Neurosci. 104: 318-325
(1990). The test
involved three 60-second training trials 24 hours before surgery to acquire
baseline data. The
apparatus consisted of a 3/4-inch-wide beam, 10 inches in length, suspended 1
ft. above a table
top. The rat was positioned on the beam and had to maintain steady posture
with all limbs on
top of the beam for 60 seconds. The animals' performance was rated with the
scale of Clifton,
et al., J. Cereb Blood Flow Metab. 11: 1114-121(1991), which ranges from 1 to
6, with a score
of 1 being normal and a score of 6 indicating that the animal was unable to
support itself on the
beam.
C. The Beam Walking Test
This was a test of sensorimotor integration specifically examining hindlimb
function.
The testing apparatus and rating procedures were adapted from Feeney, et al.,
Science, 217:
855-857 (1982). A 1-inch-wide beam, 4 ft. in length, was suspended 3 ft. above
the floor in a
dimly lit room. At the far end of the beam was a darkened goal box with a
narrow entryway. At
equal distances along the beam, four 3-inch metal screws were positioned,
angling away from
the beam's center. A white noise generator and bright light source at the
start of the beam
motivated the animal to traverse the beam and enter the goal box. Once inside
the goal box, the
stimuli were terminated. The rat's latency to reach the goal box (in seconds)
and hindlimb
performance as it traversed the beam (based on a 1 to 7 rating scale) were
recorded. A score of
146
CA 02648243 2013-09-23
7 indicates normal beam walking with less than 2 foot slips, and a score of 1
indicates that the
rat was unable to traverse the beam in less than 80 seconds. Each rat was
trained for three days
before surgery to acquire the task and to achieve normal performance (a score
of 7) on three
consecutive trials. Three baseline trials were collected 24 hours before
surgery, and three
testing trials were recorded daily thereafter. Mean values of latency and
score for each day
were computed.
Example 16. T4 is a ligand of aVf33 integrin
To determine if T4 is a ligand of the aVI33 integrin, 2 tig of commercially
available
purified protein was incubated with [1251]T4, and the mixture was run out on a
non-denaturing
polyacrylamide gel. ocVf33 binds radiolabeled T4 and this interaction was
competitively
disrupted by unlabeled T4, which was added to aV133 prior to the [1251]T4
incubation, in a
concentration-dependent manner (Figure 24). Addition of unlabeled T4 reduced
binding of
integrin to the radiolabeled ligand by 13% at a total T4 concentration of 10-7
M total (3x10-1 M
free T4), 58% at 10-6 M total (1.6x10-9 M free), and inhibition of binding was
maximal with 10-
M unlabeled T4. Using non-linear regression, the interaction of aVi33 with
free T4 was
determined to have a Kd of 333 pM and an EC50 of 371 pM. Unlabeled T3 was less
effective in
displacing [125I]T4-binding to aV133, reducing the signal by 28% at 104 M
total T3.
Example 17. T4 binding to aV133 is blocked by tetrac, RGD peptide and integrin
antibody
We have shown previously that T4-stimulated signaling pathways activated at
the cell
surface can be inhibited by the iodothyronine analog tetrac, which is hown to
prevent binding
of T4 to the plasma membrane. In our radioligand-binding assay, while 10-8 M
tetrac had no
effect on [1251M-binding to purified aVr33, the association of T4 and aV133
was reduced by
38% in the presence of 10-7 M tetrac and by 90% with 10-5 M tetrac (Figure
25). To determine
specificity of the interaction, an RGD peptide, which binds to the
extracellular matrix-biding
site on ccV[33, and an RGE peptide, which has a glutamic acid residue instead
of an aspartic
acid residue and thus does not bind ocV(33, were added in an attempt to
displace T4 from
147
CA 02648243 2013-09-23
binding with the integrin. Application of an RGD peptide, but not an RGE
peptide, reduced the
interaction of [1251]T4 with aV133 in a dose-dependent manner (Figure 25).
To further characterize the interaction of T4 with aV133, antibodies to aV133
or aVf35
were added to purified aVf33 prior to addition of [1251]T4. Addition of 1
jig/m1 of aVf33
monoclonal antibody LM609 reduced complex formation between the integrin and
T4 by 52%,
compared to untreated control samples. Increasing the amount of LM609 to 2
fig, 4 fig, and 8
1.1g/m1 diminished band intensity by 64%, 63% and 81%, respectively (Figure
26). Similar
results were observed when a different ccVP3 monoclonal antibody, SC7312, was
incubated
with the integrin. 5C7312 reduced the ability of T4 to bind aV133 by 20% with
1 jig/m1 of
antibody present, 46% with 2 fig, 47% with 4 fig, and by 59% when 8 1.1g/m1 of
antibody were
present. Incubation with monoclonal antibodies to aV and P3, separately, did
not affect
[125I]T4-binding to GNP, suggesting that the association requires the binding
pocket generated
from the heterodimeric complex of aVf33 and not necessarily a specific region
on either
monomer. To verify that the reduction in band intensity was due to specific
recognition of
aVP3 by antibodies, purified aV133 was incubated with a monoclonal antibody to
aV135
(P1F6) or mouse IgG prior to addition of [1251114, neither of which influenced
complex
formation between the integrin and radioligand (Figure 26).
Example 18. T4-stimulated MAPK activation is blocked by inhibitors of hormone
binding and of integrin GNP
Nuclear translocation of phosphorylated MAPK (pERK1/2) was studied in CV-1
cells
treated with physiological levels of T4 10-7 M total hormone concentration, 10-
10 M free
hormone) for 30 min. Consistent with results we have previously reported, T4
induced nuclear
accumulation of phosphorylated MAPK in CV-1 cells within 30 min (Figure 27).
Pre-
incubation of CV-1 cells with the indicated concentrations of ccV133
antagonists for 16 h
reduced the ability of T4 to induce MAPK activation and translocation.
Application of an RGD
peptide at 10-8 and 10-7 M had a minimal effect on MAPK activation. However,
10-6 M RGD
peptide inhibited MAPK phosphorylation by 62% compared to control cultures and
activation
was reduced maximally when 10-5 M RGD (85% reduction) and 10-4 M RGD (87%
reduction)
148
CA 02648243 2013-09-23
were present in the culture media. Addition of the nonspecific RGE peptide to
the culture
media had no effect on MAPK phosphorylation and nuclear translocation
following T4
treatment in CV-1 cells.
Tetrac, which prevents the binding of T4 to the plasma membrane, is an
effective
inhibitor of T4-induced MAPK activation. When present at a concentration of 10-
6 M with T4,
tetrac reduced MAPK phosphorylation and translocation by 86% when compared to
cultures
treated with T4 alone (Figure 27). The inhibition increased to 97% when 10-4 M
tetrac was added to the culture media for 16 h before the application of T4.
Addition of aV(33
monoclonal antibody LM609 to the culture media 16 h prior to stimulation with
T4 also
reduced T4-induced MAPK activation. LM609 at 0.01 and 0.001 g/m1 of culture
media did
not affect MAPK activation following T4 treatment. Increasing the
concentration of antibody in
the culture media to 0.1, 1, and 10 Him' reduced levels of phosphorylated MAPK
found in the
nuclear fractions of the cells by 29%, 80%, and 88%, respectively, when
compared to cells
treated with T4 alone.
CV-1 cells were transiently transfected with siRNA to aV, 133 or both aV and
133 and
allowed to recover for 16 h before being placed in serum-free media. Following
T4 treatment
for 30 min, the cells were harvested and either nuclear protein or RNA was
extracted. Figure
28A demonstrates the specificity of each siRNA for the target integrin
subunit. CV-1 cells
transfected with either the aV siRNA or both aV and 133 siRNAs showed
decreased aV
subunit RT-PCR products, but there was no difference in aV mRNA expression
when cells
were transfected with the siRNA specific for 133, or when exposed to the
transfection reagent in
the absence of exogenous siRNA. Similarly, cells transfected with 133 siRNA
had reduced
levels of 133 mRNA, but relatively unchanged levels of aV siRNA. The addition
of T4 for 30
min did not alter mRNA levels for either aV or 133, regardless of the siRNA
transfected into the
cells.
Activated MAPK levels were measured by western blot in CV-I cells transfected
with
siRNAs to aV and 133, either individually or in combination (Figure 28B). CV-I
cells treated
with scrambled negative control siRNA had slightly elevated levels of T4-
induced activated
MAPK when compared to the parental cell line. Cells exposed to the
transfection reagent alone
149
CA 02648243 2013-09-23
display similar levels and patterns of MAPK phosphorylation as the non-
transfected CV-1
cells. When either ocV siRNA or 113 siRNA, alone or in combination, was
transfected into CV-
1 cells, the level of phosphorylated MAPK in vehicle-treated cultures was
elevated, but the
ability of T4 to induce a further elevation in activated MAPK levels was
inhibited.
Example 19. Hormone-induced angiogenesis is blocked by antibody to aVi33
Angiogenesis is stimulated in the CAM assay by application of physiological
concentrations of T4 (Figure 29A and summarized in Figure 29B). 10-7 M T4
placed on the
CAM filter disk induced blood vessel branch formation by 2.3-fold (P <0.001)
when compared
to PBS-treated membranes. Propylthiouracil, which prevents the conversion of
T4 to T3, has no
effect on angiogenesis caused by T4. The addition of a monoclonal antibody,
LM609 (10
11g/filter disk), directed against ocV133, inhibited the pro-angiogenic
response to T4.
Example 20. Preparation of Tetrac Nanoparticle Formulations and Uses - PLGA
Poly(lactic-co-glycolic acid) (PLGA) nanoparticles encapsulating Tetrac were
prepared
by single emulsion method. A homogeneous solution of PLGA and the Tetrac were
obtained
by mixing 30mg of PLGA and 1.6mg of Tetrac in 1 ml of acetone. PLGA
nanoparticles were
prepared with and without the presence of a stabilizer (polyvinyl alcohol was
used as a
stabilizer). 100u1 of this solution containing both the PLGA and Tetrac were
added to 10 ml of
deionized water and stir it for 2 hours. For the synthesis of the
nanoparticles with a stabilizer
100u1 of the above mentioned solution was added to 1% PVA solution drop wise
with constant
stirring. The nanoparticles were purified by dialysis or about 12 hours by
using appropriate
dialysis membrane. The addition of the stabilizer gives the monodispersity and
stability to the
nanoparticles in aqueous solution. FIG. 33a depicts the
size distribution spectra of PLGA nanoparticles encapsulating Tetrac (no
stabilizer used) and
FIG.33b depcits the size distribution of PLGA nanoparticles encapsulating
Tetrac with 1%
PVA solution used as a stabilizer.
150
CA 02648243 2013-09-23
Studies in the CAM model of b-FGF-induced angiogenesis demonstrated potent
anti-
angiogenesis efficacy for free tetrac and Tetrac - PLGA Nanoparticles are
depicted in FIG. 34.
Example 21. Preparation of PLGA nanoparticles co-encapsulating tetrac and
Temozolomide
Another suitable nanoparticle includes PLGA nanoparticles co-encapsulating
tetrac and
Temozolomide. One of the major advantage of nanoparticles is its ability to co-
encapsulate
multiple numbers of encapsulating materials in it altogether.
A schematic diagram for the preparation of PLGA nanoparticles co-encapsulating
tetrac and
Temozolomide is depicted in FIG. 35.
Example 22. T4 Collagen Conjugated Nanoparticles containing Calcium Phosphate
Collagen-hydroxypatite nanospheres can be prepared by using water-in-oil
emulsion methods.
Then, the nanoparticles can be conjugated to thyroxine (T4) using the
carbidiimide chemistry depicted
in FIG.36a.
There us also tremendous potential for encapsulation of T4 and its analogue in
PLGA
nanoparticles by using double emulsion methods. FIG. 36b discloses our
preliminary release kinetics
demonstrating that these biodegradable nanoparticles are capable of releasing
encapsulating materials.
The release kinetics from inside the collagen Nanoparticles demonstrated 40%
release in the
first 2 hours with sustained slow release over 20 hours. T4 was immobilized to
the outside of the
Nanoparticles with > 99% stability as in FIG. 37a-38a. Formulation for wound
healing contains T4-
immobilized on collagen Nanoparticles and calcium phosphate Nanoparticles
inside or can be placed
outside the collagen Nanoparticles for topical formulation. FIG.37a and 37b
depict chromatographs
and spectra of T4-collagen nanoparticle samples eluted on C18 column,
DWL:225nm. FIG. 37a
151
CA 02648243 2013-09-23
depicts a T4 standard, 50 M diluted with water and FIG. 37b depicts a T4
collagen nanoparticle
diluted with water and then filtrated through a 300KD membrane. FIG. 38a
depicts a T4 standard.
50p,M diluted with .5 NAOH while 38B depicts T4-collagen nanoparticles
incubated with .5M NAOH
for 2 hours and then filtrated through a 300KD membrane.
Example 23. Preparation of GC-1 encapsulated PEG-PLGA Nanoparticles.
PEG-PLGA Nanoparticles encapsulating GC-lare prepared by single emulsion
method.
A solution of PEG-PLGA is prepared in DMSO (e.g. 80mg/m1). Another solution of
GC-1 is
prepared in DMSO (e.g. 15g/m1) separately. Now equal amount of the both
solution are mixed
(PEG-PLGA and GC-1). Now, 100 ul of this solution is added to 1% PVA
(polyvinyl alcohol)
solution with constant stirring. After 4 hours the whole solution containing
the Nanoparticles
encapsulating GC-1 is subjected to dialysis to remove the impurities. A
schematic diagram of
the preparation of GC1 encapsulated PEG-PGLA nanoparticles is depicted in FIG.
39a.
Example 24. Preparation of GC-1 or T3 Encapsulated PEG-PLGA nanoparticles
PEG-PLGA nanoparticles encapsulating GC-1 or T3 will be prepared by single
emulsion method. A solution of PEG-PLGA will be prepared in DMSO (e.g.
80mg/m1).
Another solution of GC-1 or T3 will be prepared in DMSO (e.g. 15g/m1)
separately. Then,
equal amount of both solution will be mixed (PEG-PLGA and GC-1 or T3). 100 1
of this
solution will be added to 1% PVA (polyvinyl alcohol) solution with constant
stirring. After 4
hours the whole solution containing the nanoparticles encapsulating GC-1 or T3
will be
subjected to dialysis to remove the impurities. A schematic diagram for the
preparation of T3
encapsulated PEG-PGLA nanoparticles is depicted in FIG. 39B.
Example 44: New formulations
Novel formulations of tetrac include linkage to nanoparticles, a construct
that precludes
entry of tetrac into the cell and limits its activity to the plasma membrane
integrin receptor.
152
CA 02648243 2013-09-23
The hydrophobic drug used for entrapment is in solution form or in powder form
and
the solvent used for dissolving the drug is selected from dimethylformamide
(DMF),
dimethylsulphoxide (DMSO), dichloromethane, ethylacetate, ethanol.
The block copolymer micelles are made of mucoadhesive and thermosensitive
polymer
components, and when instilled, it penetrates the mucin membrane, adhere to
the membrane
pores and at body temperature, it becomes more hydrophobic to release the drug
faster.
The random block copolymer of micelles of the present invention may be
prepared by
mixing monomers such as vinylpyrrolidone (VP), N-isopropyl is acrylamide
(NIPAAM) and
acrylic acid(AA) in presence of N,N' methylene bis acrylamide (MBA) and
polymerizing the
mixture by free radical polymerization reaction using ammnonium persulphate as
catalyst. The
hydrophobic moiety of the polymeric chain remain buried inside the micelles
which help
dissolution of drug and the hydrophilic moiety such as carboxylic acids are
extended outside
the surface of the micelles. The clear solution of the micellar dispersion in
aqueous solution can
be instilled in the patient's eyes much more effectively and the sustained
release of the drug
encapsulated inside the micelles enhances the therapeutic effect of the drug.
In order to incorporate one or more drugs mentioned above into the block
copolymer
micelles, various methods described below may be used alone or in combination.
(i) Stirring: A drug is added to an aqueous solution of a block copolymer, and
stirred for
2 to 24 hours to obtain micelles containing drug.
(ii) Heating: A drug and an aqueous solution of a block copolymer are mixed
and stirred
at 30 C to 80 C for 5 minutes to a couple of hours and then cooled to room
temperature while
stirring to obtain micelles containing the drug.
(iii) Ultrasonic Treatment: A mixture of a drug and an aqueous solution of a
block
copolymer is subjected to an ultrasonic treatment for 10 minutes to 30 minutes
and then stirred
at room temperature to obtain micelles containing the drug.
(iv) Solvent Evaporation: A drug is dissolved in an organic solvent such as
chloroform
and was added to an aqueous solution of micelles. Subsequently the organic
solvent was
evaporated slowly while stirring, and then filtered to remove free drug.
(v) Dialysis: The polymeric micelles solution was added to an organic solution
of drug
and the mixture is dialyzed against a buffer solution and then water.
153
CA 02648243 2013-09-23
The micelle solution of block copolymers is prepared by dissolving amphiphilic
monomers in an aqueous medium to obtain micelles, adding aqueous solutions of
cross-linking
agent, activator and initiator into the said micelles, subjecting the said
mixture to
polymerization in presence of an inert gas at 30° C.-40° C. till
the polymerization
of micelles is complete.
The purification step is done by dialysis. The dialysis is carried out for 2-
12 hours to
eliminate unreacted monomers and free hydrophobic compound (s), if any, in the
aqueous
phase. A hydrophobic drug may be incorporated into the polymeric micelles of
the present
invention during the time of polymerization wherein the drug is dissolved into
the micelles of
the monomers in aqueous solution and the polymerization is done in presence of
the drug. As
the drug held in the hydrophobic core of the micelles is released on the
cornea surface in a
controlled manner for a long time, the composition of the present invention is
suitable for
formulating drugs, which are not amenable to conventional formulating
techniques or using
non mucoadhesive micelles.
Example 25. Design of Nanoparticles Formulation for Ocular Use
In the initial experiments three different kinds of nanoparticulate
formulations based on
different polymers will be prepared. The efficacy of these nanoparticles with
different variation
like surface charge, size and mucoadesiveness will be examined. TETRAC will be
encapsulated in all of these nanoparticles formulations. Broadly PLGA,
chitosan and custom
made co-polymeric nanoparticles with different ratio of N-isopropylacrylamide,
N-3-
aminopropylmethacrylamide hydrochloride, and acrylic acid will be synthesized.
The goal is to design different Nanoformulation for TETRAC enhanced ocular
kinetics. We
will define two different options where the nanoparticles stay on the corneal
membrane and
deliver TETRAC and another option is to increase nano-uptake across the
corneal membrane.
The size and surface charge as well as the nature of the nano material will be
adjusted to attain
optimal eye drop formulation for TETRAC.
154
CA 02648243 2013-09-23
A schematic representation showing synthesis of different kinds of TETRAC
encapsulated
Nanoparticles and their surface modification is depicted in FIG. 40a ¨ 40c.
Analysis of Nanoparticles:
Based on the original method developed by PRI a modified HPLC analytical
method
specific for TETRAC Nanoparticles will be developed. Development of analytical
method for
indirect quantitation of TETRAC inside the nanoparticles is also on agenda.
From a set, half of
the total amount of the nanoparticles will be disintegrated in 50% acetone and
analyzed directly
by HPLC for total amount of free and encapsulated TETRAC. On the other hand
the other half
of nanoparticles will be filtered through a 100KD centrifugal filter membrane
device, and the
filtrate will be analyzed by HPLC for the total amount of free TETRAC. Thus,
the difference
between the amounts of TETRAC in the two analyses would represent the amount
of TETRAC
inside the nanoparticles.
The sample preparation protocol would have to be tested for each kind of
nanoparticles,
and adjusted accordingly.
In Vitro Release Kinetics:
To study the release kinetics, a known amount of the nanoparticles formulation
encapsulating
TETRAC will be suspended in desired medium in which the release kinetics are
to be studied.
The solution will be distributed as 500u1 aliquots in micro-centrifuge tubes.
At predetermined
intervals of time the solutions will be filtered through centrifugal filter
membrane device
(100KD cut off) as indicated above to separate free TETRAC from the loaded
nanoparticles.
The concentration of free TETRAC will be determined by HPLC.
%Re lease =[TETRAC] f x100
[TETRAC] 0
Wherein [TETRACRt is the concentration of TETRAC in the filtrate at time t and
[TETRAC]0
is the total amount of the encapsulated TETRAC
In Vivo Experiments
Preliminary in vivo experiment will be performed to test the efficacy of the
nanoparticles formulations in New Zealand White rabbits' eyes as compared to a
control of the
155
CA 02648243 2013-09-23
drug without nanoparticles. The procedure of application, collection method of
the aqueous
humor etc. will be described in details in the animal protocol. The remaining
portion of each
eye will be saved and stored frozen at -80 C for possible future analysis.
Four eyes from two rabbits will be used for each formulation at each testing
point (n=4).
Aqueous humor samples will be collected at 30 and 90 minutes after topical
drug
administration, where two animals will be sacrificed for each time point. This
will require at
least 40 rabbits to be sacrificed during the course of the study.
Samples from aqueous humor collected will be frozen at -80 C until the time of
analysis
if necessary.
All samples will be analyzed by HPLC. The new specific method for analysis of
TETRAC in Nanoparticles will be use for analyzing TETRAC, both free and
encapsulated.
Filtration of the aqueous humor through 100KD filters will be used as
described earlier to study
the two forms of TETRAC.
Depending on the results from the in vivo release kinetics, three formulations
will be
selected for Phase II. One pilot batch for each formulation will be prepared.
The characteristics
and stability of these selected formulations will be further studies
Example 26. Preparation of Nanoparticles Containing Tetrac or analogs:
The suspension formulation for the PK and toxicology studies are made using
the
following procedure:
1. Weight out 50 mg tetrac, add to 10 ml 0.5% CMC (caboxymethylcellulose)
2. Mix well until tetrac is suspended
3. Mix before use.
Another formulation that was made and used for intravenous administration was
made
using the procedure outlined below:
1. Dissolve 200 mg Tetrac in 1.0 ml DMSO
2. Add 1.0 ml Tweent) 80, and stir for 5 minutes. Check that all Tweeri 80 has
dissolved.
3. Add drop wise (while stirring) 10 ml PBS.
4. Adjust the pH to 7.4 using 1.0M dibasic sodium phosphate, added slowly
while stirring.
5. Q.S to 20 ml with PBS
156
CA 02648243 2013-09-23
6. Dilute in PBS to 5 mg/ml (1:1 dilution).
Example 27. Measurement of Particle Size by Dynamic Light Scattering
Experiment:
The nanoparticles were purified by dialysis or about 12 hours by using
appropriate
dialysis membrane. The addition of the stabilizer gives the monodispersity and
stability to the
nanoparticles in aqueous solution. The size distribution and zeta potential
were determined
using zeta size analyzer. The resulting measurements are depicted in FIG. 41.
Example 28. Inhibition of Angiogeneis by Tetraiodothyroacetic Acid (Tetrac):
Deaminated thyroid hormone analog, Tetraiodothyroacetic acid (tetrac) is a
novel,
inexpensive anti-angiogenic agent whose activity is proposed to represent an
interaction
between the thyroid hormone receptor and the RGD recognition site on integrin
aV133.
This study was designed to examine the effects tetrac on angiogensesis induced
by
VEGF and FGF2. Induction of angiogenesis by VEGF and FGF2 involves binding of
these
growth factors to integrin aN/133 on endothelial cells. Such binding involves
ligand protein-
specific domains on the integrin, as well as an Arg-Gly-Asp (RGD) recognition
site that
generically identifies the protein ligands of aVr33 and several other
integrins. RGD peptides
also block the proangiogenic actions of T4 and T3, suggesting that the RGD
recognition site and
the thyroid hormone-tetrac receptor site on integrin aVP3 are near to one
another. Without
intending to be bound by theory, because of the proximity of the RGD
recognition site and
hormone-tetrac binding domain on aVI33, tetrac is anti-angiogenic in the
absence of thyroid
hormone. That is, occlusion of the thyroid hormone receptor site might alter
the abilities of
VEGF and FGF2 to interact with the integrin at the RGD site.
MATERIAL AND METHODS
Reagents
T4 08% pure by HPLC), T3, tetrac, cortisone acetate, and propylthiouracil
(PTU) were
purchased from Sigma-Aldrich Corp. (St. Louis, MO). FGF2 and VEGF were
purchased from
Invitrogen Life Technologies, Inc. (Carlsbad, CA). Matrigel was purchased from
BD
Bioscience (San Jose, CA).
157
CA 02648243 2013-09-23
Cell culture
Human dermal microvascular endothelial cells (HMVEC-d; Clonetics, San Diego,
CA)
were grown on culture flasks coated with type I collagen (1 mg/ml) and
maintained in
endothelial growth media-2 (EGM-2MV; Clonetics) supplemented with bovine brain
extract
(12 ROO, recombinant human epidermal growth factor(10 ng/ml), 10% (vol/vol)
heat-
inactivated fetal bovine serum (FBS), hydrocortisone (1 fig/m1), 100 U/ml
penicillin, 100 fig/m1
streptomycin, and 2 mM L-glutamine. All culture additives were purchased from
Invitrogen.
Cultures were maintained in a 37 C humidified chamber with 5% CO2. The medium
was
changed every 3 d, and the cell lines were passaged at 80% confluence.
Chick Chorioallantoic Membrane Assay (Chick CAM Assay)
Ten-day-old chick embryos were purchased from SPAFAS (Preston, CT) and were
incubated at 37 C with 55% relative humidity. Chick CAM assays were performed
as
previously described. Briefly, a hypodermic needle was used to make a small
hole in the blunt
end of the egg, and a second hole was made on the broad side of the egg,
directly over an
avascular portion of the embryonic membrane. Mild suction was applied to the
first hole to
displace the air sac and drop the CAM away from the shell. Using a Dremel
model craft drill
(Dremel, Racine, WI); an approximately 1.0-cm2 window was cut in the shell
over the false air
sac, allowing access to the CAM. Sterile disks of no. 1 filter paper (Whatman,
Clifton, NJ)
were pretreated with 3 mg/ml cortisone acetate and 1 mM propylthiouracil and
air dried under
sterile conditions. Thyroid hormone, control solvents, and experimental
treatments were
applied to the disks and subsequently dried. The disks were then suspended in
PBS and placed
on growing CAMs. After incubation for 3 d, the CAM beneath the filter disk was
resected and
rinsed with PBS. Each membrane was placed in a 35-mm petri dish and examined
under an
SV6 stereomicroscope at x50 magnification. Digital images were captured and
analyzed with
Image-Pro software (Media Cybernetics, Silver Spring, MD). The number of
vessel branch
points contained in a circular region equal to the filter disk was counted.
In Vitro Sprouting Assay
Confluent HMVEC-d cells (passage 5-10) were mixed with gelatin-coated Ctodex-3
beads (Sigma) with a ratio of 40 cells per bead. Cells and beads (150-200
beads per well for
24-well plate) were suspended with 5 ml endothelial basal medium (EBM) + 15%
(vol/vol)
158
,
CA 02648243 2013-09-23
normal human serum (HS) and mixed gently for 4 h at room temperature, then
incubated
overnight in 37 C CO2 incubator. Cultures were treated with 10 ml of fresh EBM
+ 15% HS
for 3 h. One hundred p.1 of the HMVEC/bead culture was mixed with 500 I of
phosphate-
buffered saline (PBS) and placed in 1 well of a 24 well plate. The number of
beads/well was
counted, and the concentration of beads/EC was calculated.
Human fibrinogen, isolated as previously described, was dissolved in EBM at a
concentration of 1 mg/ml (pH 7.4) and filter sterilized and supplemented with
the angiogenesis
factors to be tested. VEGF (30 ng/ml) + FGF2 (25 ng/ml) were used as a
positive control. The
HMVEC/bead culture was washed twice with EBM medium and added to fibrinogen
solution.
The cultures were mixed gently, and 2.5p,1 human thrombin (0.05 U/ 1) was
added and 300p1
of the culture was transferred to each well of a 24-well plate and allowed to
incubate for 20
min. EBM+ 20% normal HS and 10 pg/ml aprotinin were added and the plate was
incubated in
a CO2 incubator for 48h. For each condition, the experiment was carried out in
triplicate.
Capillary sprout formation was observed and recorded with a Nikon Diaphot-TMD
inverted microscope (Nikon Inc.; Melville, KY. USA), equipped with an
incubator housing
with a Nikon KP-2 thermostat and Sheldon #2004 carbon dioxide flow mixer The
microscope
was directly interfaced to a video system consisting of a Dage-MTI CCD-725
video camera and
Sons 12" PVM-12Z video monitor linked to a Macintosh G3 computer. The images
were
captured at various magnifications using Adobe PhotoShop. The effect of the
pro-angiogenesis
factors on sprout angiogenesis was quantified visually by determining the
number and percent
of BC-beads with capillary sprouts. One hundred beads (5 to 6 random low power
fields) in
each of triplicate wells were counted for each experimental condition. All
experiments were
repeated at least three times.
Real Time Reverse Transcription-Polymerase Chain Reaction
Total RNA was isolated using the Ambion Aqueous kit (Austin, TX). The quality
and
quantity of the isolated RNA was determined by Bio-Rad Experion automated
electrophoresis
system (Hercules, CA). One jag of total RNA was reverse transcribed using
Advantage RT-for-
PCR Kit (Clontech; Mountain View, CA). PCR was performed using Cepheid Smart
Cycler
(Sunnyvale, CA) by mixing 2 L cDNA, 10 1, Sybergreen master mix (Qiagen;
Valencia, CA)
and 0.5 I, of 20 M gene-specific primers. Samples were incubated for 20 mm
at 25 C and
159
CA 02648243 2013-09-23
amplified in 35 PCR cycles with 30 s at 95 C and 90 s at 60 C (two-step PCR).
The threshold
cycle values (Ct) were determined from semi-log amplification plots (log
increase in
fluorescence versus cycle number). The specificity and the size of the PCR
products were
tested by adding a melt curve at the end of the amplifications and by running
the PCR products
on 2% agarose gel and sequencing the bands. All values were normalized to
cyclophilin A.
PCR primers were as follows: Angio-1, 5'- GCAACTGGAGCTGATGGACACA-3' (sense)
and
5'-CATCTGCACAGTCTCTAAATGGT-3' (antisense), amplicon 116 bp; Angio-2, 5'-
TGGGATTTGGTAACCCTTCA-3' (sense) and 5'- GTAAGCCTCATTCCCTTCCC-3'
(antisense), amplicon 122 bp; integrin aõ, 5'- TTGTTGCTACTGGCTGTTTTG-3'
(sense) and
5'- TCCCTTTCTTGTTCTTCTTGAG-3' (antisense), amplicon 89 bp; integrin [33, 5'-
GTGACCTGAAGGAGAATCTGC-3' (sense) and 5'- TTCTTCGAATCATCTGGCC-3'
(antisense), amplicon 184 bp; and cyclophilin A, 5'- CCCACCGTGTTCTTCGACAT-3'
(sense) and 5'-
CCAGTGCTCAGAGCACGAAA-3' (antisense), amplicon 116 bp.
Microarray Analysis: Ten micrograms of total RNA from HMVEC-d cells was
amplified and
biotin-labeled according to GeneChip Expression Analysis Technical Manual
(Affymetrix,
Santa Clara, CA). Fragmented cRNA was hybridized with human gene chip U133
PLUS 2
(Affymetrix); chips were washed and stained with streptavidin R-phycoerythrin
(Molecular
Probes, Eugene, OR). The chips were scanned and the data were analyzed with
Microarray
Suite and Data Mining Tool (Affymetrix).
Tetrac Inhibition of Hormone-Stimulated Angiogenesis: Angiogenesis is
stimulated in the
CAM assay by application of physiological concentrations of FGF2, VEGF, and
T3. As shown
in FIG.42, FGF2 (1 g/m1) placed on the CAM filter disk induced blood vessel
branch
formation by 2.4-fold (P <0.001) compared with PBS-treated membranes. The
addition of
tetrac (75ng/filter disc) inhibited the proangiogenic response to FGF2, while
tetrac alone had no
effect on angiogenesis.
A tetrac dose response curve was performed to find maximum inhibition of FGF2
stimulated angiogenesis. As shown in FIG.43, seventy five ng/filter disc and
100 ng/filter disc
inhibited angiogenesis by 57% and 59% respectively. When the tetrac
concentration was
increased to 1 pg/filter disc, FGF2 stimulated angiogenesis was inhibited 74%.
Maximal
160
CA 02648243 2013-09-23
inhibition was observed when the tetrac concentrations were further increased
to 3 g/ filter disc
and this was maintained at 511g/filter disc.
Tetrac similarly inhibits the pro-angiogenic effect of VEGF and T3 by 52% and
66%
respectively, as shown in FIG. 44.
Tetrac Inhibition of Tube Formation: HMVEC-d cells were cultured on matrigel
for 24 hrs
and stimulated with VEGF (50 ng/ml) in the presence or absence of increasing
amounts of
tetrac. Tetrac inhibited the tube formation induced by VEGF as demonstrated by
a reduction in
the number of junctions, and number of tubes and a decrease in total tubule
length, as shown in
FIG.45.
This effect is depicted in the in FIG.46.
The number of tube junctions decreased from 32.0+9.6 (0 M tetrac) to 18.0+1.5,
4.7+1.8, and 3.0+2.5 with 1 M, 2.5 M, and 10 M tetrac, respectively.
Similarly, the number
of tubes decreased from 212.3+21.3 (0 M tetrac) to 180.0+4.0 (1 M tetrac),
150.0+8.1 (2.5 M
tetrac), and 81.3+24.8 (10 M tetrac). The total tube length was also decreased
in a dose
dependent manner; with maximal decrease of 70% of the tube length observed at
10 M tetrac
and was maintained at 25 M and 50 M tetrac (data not shown).
mRNA Expression of Integrins aV and p3, and Angiopoietin -2 are Decreased by
Tetrac:
HMVEC-d cells were grown on matrigel and stimulated with VEGF (50 ng/ml) with
and
without Tetrac for 2 hours. Messenger RNA was isolated and real-time RT-PCR
was
performed for integrin aV and integrin 133, as shown in FIG. 47a and 47b.
Tetrac inhibited mRNA expression of both integrin aV and integrin p3 in a dose
response fashion. aV mRNA levels decreased from 0.1149+0.0124 relative
fluorescent units
(RFUs) in VEGF treated cells to 0.0618+0.00927 RFUs following treatment 1 M
tetrac and
decreased further following treatment with 3 M tetrac. Expression of integrin
133, whose
expression is much lower than integrin aV, decreased following tetrac
treatment in a similar
161
CA 02648243 2013-09-23
manner as integrin aV. VEGF treated cells expressed 0.0299+0.0026 RFUs of 33.
Expression
was decreased to 0.0160+0.0013 and 0.0159+0.0016 RFUs with 1[M and 3[tM
tetrac,
respectively. Real-time RT-PCR for angiopoietin-1 and angiopoietin-2 was
performed and it
was found that tetrac inhibited mRNA expression of angiopoietin-2 in a dose
response fashion
and did not affect the mRNA levels of angiopoietin-1, as shown in Figures 48a
and 48b.
In addition, incubation of HMVEC-d cells overnight with tetrac and VEGF did
not further alter
angiopoietin-1 and angiopoietin-2 expression (data not shown).
Microarray Analysis
To further identify possible mechanisms of tetrac inhibition of VEGF-
stimulated
angiogenesis, microarray analysis was performed using the Human U133 Plus 2.0
array from
Affymetrix. HDMEC cells were incubated with VEGF at 50 ng/ml for 24 hours with
and
without Tetrac (3 uM). The results of the Affymetrix GeneChip analysis
indicated that three
different angiopoietin-like transcripts were differentially expressed in the
HMVEC-d cells. As
shown in FIG. 49a-49c, Angiopoietin-like 1 (ANGPTL-1, probe set ID# 231773)
expression
was increased 5.9 fold following VEGF treatment. The stimulated increase in
expression was
decreased below baseline levels if the cells were co-treated with tetrac and
VEGF.
Angiopoietin-like 2 (ANGPTL-2, probe set ID# 239039) expression was increased
1.6 fold
following VEGF treatment when compared to the untreated control. The addition
of tetrac
reduced the expression of ANGPTL-2 near the baseline levels. Interestingly,
angiopoietin-like
3 (ANGPTL-3, probe set ID# 231684) expression was unaffected by treatment of
HMVEC-d
cells with VEGF. However, tetrac reduced expression of ANGPTL-3 1.9 fold when
compared
to both the untreated control and VEGF treated samples. These data further
suggest that tetrac
can inhibit the expression of target genes that are necessary for the
stimulation of angiogenesis.
Matrix mettaloproteinases (MMPs) have been clearly implicated in angiogenesis.
Both
synthetic and endogenous MMP inhibitors block angiogenesis in both in vitro
and in vivo
models. We used the microarray to examine changes in MMP expression following
VEGF
treatment with and without tetrac. HMVEC-d cells treated with VEGF have a 5.1-
fold increase
in MMP-15 expression and a 2.9-fold increase in MMP-19 expression. As shown
in_FIG.50a ¨
50d, when the cells are co-treated with tetrac (3 M), the expression of MMP-15
and MMP-19
are decreased by 3.2-fold and 8.7-fold, respectively. Interestingly, MMP-24
expression is
162
CA 02648243 2013-09-23
slightly decreased by VEGF treatment, but is further depressed by the addition
of tetrac.
Expression of tissue inhibitor of metalloproteinase 3 (TIMP-3), which is a
potent inhibitor of
several members of the MMP family, is increased 5.4-fold following VEGF and
tetrac
treatment when compared to VEGF treated HMVEC-d cells. This suggests that part
of the
mechanism of tetrac inhibition of VEGF-stimulated angiogenesis is regulated by
increases in
TIMP expression, which in turn blocks the MMPs role in cytoskeletal
reorganization that
occurs during angiogenesis.
There is much clinical interest currently in anti-angiogenic compounds,
primarily for
adjunctive use in the setting of cancers. As demonstrated above, the small
molecule, tetrac,
directed at the plasma membrane receptor for thyroid hormone has potent anti-
angiogenic
activity. While tetrac is an antagonist of the cell surface-initiated actions
of thyroid hormone,
tetrac in the absence of thyroid hormone is now shown to inhibit angiogenic
activity of VEGF
and FGF2 in chick and human endothelial cell assays. Thus, tetrac has the
desirable quality of
targeting an integrin by which angiogenic VEGF and FGF2 signals are transduced
in
endothelial cells, but also inhibits the trophic action of physiological
concentrations of thyroid
hormone on the proliferation of certain tumor cells, including human estrogen
receptor (ER)-
positive breast cancer MCF-7 cells and murine glioma cell models of
glioblastoma.
Without intending to be bound by any theory, it is speculated that thyroid
hormone has
several effects on tumors at the cellular or molecular level. These effects
include a direct
proliferative effect on tumor cells, a direct effect on the migration of
cancer cells that may
support metastasis and indirect support of tumor growth via pro-angiogenic
action. In the
setting of cancers, unmodified tetrac and triac or modified as nanoparticles
or polymer
conjugates, acting as anti-thyroid hormone agents, may have therapeutic
application.
Significant survival benefit has recently been obtained with administration of
tetrac to a
mouse model of intracranial implants of murine glioma cells. Additionally, a
recent prospective
clinical study indicates that thyroid hormone is a growth factor for
glioblastoma multiforme
(GBM) and that induction of mild hypothyroidism in GBM patients has a
substantial survival
benefit. A retrospective analysis of breast cancer experience in hypothyroid
patients at M.D.
Anderson Cancer Center showed that hypothyroidism conferred a reduced risk of
breast cancer
163
CA 02648243 2013-09-23
and, when the latter occurred in hypothyroid women, was associated with less
aggressive
lesions. Without intending to be bound by any theory, it is speculated that
two effects of thyroid
hormone are seen, a directly proliferative effect on tumor cells, and indirect
support of tumor
growth via angiogenesis. In the settings of these two types of cancer, tetrac
may have
therapeutic application.
Example 29. Novel T4/Polymeric Conjugates and TilNanoparticle Conjugates:
The thyroid gland is the source of two fundamentally different types of
hormones. The
iodothyronine hormones include thyroxine (T4) and 3, 5, 3'-triiodothyronine
(T3). They are
essential for normal growth and development and play an important role in
energy metabolism.
The thyroid hormones are aromatic amino acids ultimately derived from
thyrosine. They are
chemically and biosynthetically similar to L-DOPA and 5-hydroxytryptophan, the
biosynthetic
precursors of the neurotransmitters dopamine and serotonine (5-
hydoxytryptamine),
respectively. The chemical structures of T4 and T3 and their biosynthetic
analogs are shown
below.
HO =
COOH
NH2
Thyrosine
164
CA 02648243 2013-09-23
HO " I COOH
=
NH,
0 =
1.4
HO I
1.1
NH,
13
OH HO
HO * HO *
COOH
T
NH, NH,
L-DOPA Dopamine
,COOH
HO HO
= \ NH, fat \ NH,
5-Hydroxytryptophan 5-Hydoxytryptamine
The conjugation of either 13 or T4 with a polymer or immobilization of 13 or
T4with
nanoparticles will result in particles with a diameter which does not allow
the conjugate to
cross the nucleus membrane. Thus, only the cell surface activity of T3 or T4
may be obtained
without any undesirable genomic effects.
Both 13 and 14 bear three functional groups which may react to form a polymer
conjugate: one carboxylic acid group, one amine group, and one hydroxyl group.
To synthesize the 13 or T4/polymer conjugates, using T4 for illustrative
purposes, the reaction
site can be any of the following:
1) The carboxylic acid group: The acid group can react to form an ester or an
amide. Due to
the high reactivity of the amino group in 14, this one should be protected
before the
conjugating reaction, and then deprotected. Otherwise, the self polymerization
will form the
T4 oligomers. The candidate polymers include PVA, PEG-NH2, poly(lysine) and
related
polymers.
165
CA 02648243 2013-09-23
2) The amine group: The amine group can react with a polymer carrying a
carboxylic acid
function or a halogen group. If the polymer has a large amount of activated
acid group, the
reaction can go through directly. Poly(methylacrylic acid) and poly(acrylic
acid) can be
used in this way.
3) The hydroxyl group: Due to the existence of a higher reactive amino
group, the direct
reaction of T4 with a polymer containing a carboxylic acid is difficult. This
amino group
must be protected before the reaction and deprotected after the conjugating
reaction. The
common protecting group can be acetic anhydride (Ac20), N-methyl, N-ethyl, N-
Triphenyl
or ditertbutyldicarbonate (B0C20) group.
For each of the following embodiments, T3 may be used instead of T4.
Protection of the amino group of L- T4
The protection of the amino group of L-T4 can be done using acetic anhydride
(Ac20),
ditertbutyldicarbonate (B0C20) and butyric anhydride (Bu20) as the protecting
agents, or
using any suitable long alipathic groups. An example of a synthesis schematic
using a long
alipathic group, palmitoyl chloride, is shown in the synthesis schematic of
FIG. 51.
A schematic of the protection of the amino group of L-T4 using
ditertbutyldicarbonate
(B0C20) (T4-B0C) is shown below.
HO 4. 0 40
COOH
H2N C1411805
Mol. Wt.: 218.25
Ci5H1114N04
Mol. Wt.: 776.87
(Boc)20
14
DMF HO II 0 411
r.t COOH
HN
0
C20E-11914N06
Mol. Wt.: 876.99
T4-Boc
166
CA 02648243 2013-09-23
L-T4 was selectively protected taking in consideration the reactivity of the
amino group
compared to the one of the phenol and the zwiterionic form of the commercial L-
T4. This was
done using an equimolar amount of products, a mineral base (Na2CO3) or an
organic base
(TEA) in polar solvent (DMA or DMF). The compounds PRIAB1, PRIAB4 and PRIAB5
were
synthesized under the following reaction conditions shown below.
I I
HO io I 0 COO (Boc)õ (1.0 eq.) HO so I 0 COOH
NH3 _________________________ V. HN,
I 0 I 0 Boc
Na2CO3(4.0 eq.)
I DMF, a. t., 17 h I
PRIAB1
I I
_
HO 401 I 0 COO HO I COOH
(Boc)20 (1.06q.)
NH3 _=,.. 40 40 HN,
I 0 TEA (1.26q.) I 0 Boc
DMF, a. t., 1h
I I
50%
PRIAB1
0
Boc = 0
Me I Me
Me
I I
HO0 I 40 COO- HO 401 I 0 COOH
* (Bu)20 (1.0 eq.)
NH3 ¨pp.. 1 HN,
I 0 0 Bu
TEA (1.2 eq.)
I DMF, a. t., 5 min. I
50%
PRIAB4
0
Bu = KMe
167
CA 02648243 2013-09-23
HO I COO NH3 HO ri& I COOH
(Ac)20 (1.0 eq.)
HN,
1W
I IW 0 0 Ac
TEA (1.2 eq.)
DMF, a. t., 5 min.
PRIAB5
0
Ac = KMe
The general procedure to get the analytically pure samples for testing is set
forth below,
using PRIAB1 as an example:
2-[(tert-butoxycarbonyl)amino]-3-[4-(4-hydroxy-3,5-diiodophenoxy)-3,5-
diiodophenyl]propanoic acid (PRIAB1).
White solid; Yield 50%; Recrist. Solvt.: AcOEt ; Rf= 0.79 (DCM/Me0H 5/5) ; Mp=
212 C;
IR (v cm-1): 3407.41 (NH); 1701.65 (CO); 1660.49 (CO) ; 1HNMR (DMSO-d6) 8
(ppm): 1.34
(s, 9H, 3 CH3); 2.71-2.79 (t, J= 11.7 Hz, 1H, CH); 3.04-3.08 (dd, J= 13.6 Hz,
J= 2.0 Hz, 2H,
CH2); 4.16 (br, 1H, NH); 7.05 (s, 2H, ArH); 7.82 (s, 2H, ArH); 11.68 (br, 1H,
OH) ; MS
(ESI+): 899.7 [M+Na1+; 821.7 [M-tBu]; 777.7 [M-Boc]
PRIAB2, PRIAB6 and PRIAB12 (shown below) were also synthesized, deprotected
and tested
for purity, in a similar manner as described above.
168
CA 02648243 2013-09-23
PRIAB2
Ho
0
0
=OH
NH
4/
PRIAB6
HO,
0
I I
CH3
NI H
HO 0
PRIAB12
HO
0
I I
CH3
NH
HO 0
These novel N-substituted groups (N-Methyl, N-Ethyl or N-Triphenyl) showed
comparable
pro-angiogenesis efficacy to that of b-FGF or L-T4 as shown in the Table below
in the CAM
model.
169
CA 02648243 2013-09-23
Effect of L-T4 analogs PRIAB2, PRIAB6, PRIAB12 in CAM Model of Angiogenesis
Treatment Branch pts SEM % Inhibition SEM
PBS 76.0 8.5
FgF (1.25pg/mI)) 137.9 7.5
PRIAB2 (0.1pM) (T4 analog) 136.0 18.1
PRIAB6 (0.1pM) (T4 analog) 136.2 12.4
PRIAB12 (0.1pM) (T4 analog) 121.7 13.6
Activation of Ti-BOC
T4-BOC may be activated using epichlorohydrin, or other suitable activating
agent (e.g.,
epibromohydrin). For example, a synthesis schematic of activated T4-BOC
intermediates is
shown below.
0 0 110
OH + \
HOOC II
0
0 411
50 C
HN 0 C)2
overnight
NaH HOOC
Synthesis of Novel Ti/Polymeric Conjugates: Activated T4-BOC can be conjugated
to
different polymers, including without limitation PVA, PEG, PolyLysine,
PolyArgine.
Conjugation of T4 to a polymer through the phenolic hydroxyl group may be
desirable because
T4 and T3 are each conjugated to glucuronic acid and sulfonic acid in the
liver during
170
CA 02648243 2013-09-23
degradation. For example, a synthesis schematic of the conjugation of
activated T4-Boc to
PolyLysine is shown below.
1 I
0 .
0¨'1 0 11 OH + Br j\ r.t
D.
--->¨
2 his
HOOC I I K2CO3
,
f 0
li¨CF 1
61-12
...
6H2
w 0 -
tN¨CH8¨* 61-12
C
I I H2 H2
OH 1
61-12 - 0
6-12 -->-0 11 HN 411 0 lik O NHN, ,
61-12 I I
HOOC
NH2
A synthesis schematic of the conjugation of T4-Boc to PolyArginine is shown in
FIG. 52.
A schematic showing protection of 14 using acetic anhydride (Ac20) or
ditertbutyldicarbonate (B0C20), deptrotection, and subsequent conjugation to
PVA or PEG, is
shown below.
171
CA 02648243 2013-09-23
COOH
HN¨BOC
Hp
COOH HO * 0 I
BOC20
I 411 I
COOH
NH2
0 (Ac)20 HN¨Ac
Protect
kO 0 I
PVA
PVA, PEG-NH2
OH OH OH OH 0 rOH
Catalyst: CDI (1,1'-carbonyldiimidazole) 0
DCC (N,N'-Dicyclohexylcarbodiimide) ,NH
0
PEG
0
R¨NH
R = Ac or BOC
I 0
deprotect PVA
- n
OH OH OH OH 0
0
ik I
H2N
PEG
0
(:) I
0
H2N
R = Ac or BOC
qr -0H
172
CA 02648243 2013-09-23
Preparation of Nanoparticle encapsulated T4
Subsequent to conjugation, e.g., conjugation to PEG, the T4/PEG conjugates may
be
used for immobilization with nanoparticles by any method known to one of
ordinary skill in the
art. For example, without limitation, PEG-PLGA nanoparticles encapsulating N-
protected T4
are prepared by single emulsion method as follows (and depicted in FIG. 53).
Solutions of
PEG-PLGA and N-protected T4 are prepared in DMSO separately (e.g. 80 mg/ml PEG-
PLGA
and 15 mg/ml N-protected T4) then mixed in equal amounts. 100 1 of this
solution is added to
1% PVA (polyvinyl alcohol) solution with constant stirring. After 4 hours the
whole solution
containing the nanoparticles encapsulating T4 is subjected to dialysis to
remove the impurities.
Preparation of T4 conjugated PEG-PLGA nanoparticles
T4/PEG conjugates may be used for immobilization with nanoparticles by
conjugation
to a nanoparticles using a suitable conjugation method known to one of
ordinary skill in the art.
As an illustrative example, the highly reactive amino group present in T4 was
blocked first by
using either acetic anhydride (Ac20) or ditertbutyldicarbonate (B0C20), then
activated with
epicholorohydrin, and conjugated to nanoparticles, as shown in the schematic
below.
HO I
(BOC)20 BOC
_____________________________ "- I 11 I HN OH
HOI
0 II 0
I 40 I H2N OH ____
0 44. 0
(Ac)20 HO
Ac
11. 40HN OH
0 4. 0
173
CA 02648243 2013-09-23
HO 1 /
0
,B0C ,
I . I HN OH
\ ____________________________________________ 0 1
\ CI +
0 411 0 __________________________ B0C
0 I 44100 I HN, OH
Epichlorohydrin I
T4 protected with BOC
I
Epoxy activated T 4
14.12 NH2
*IFI,
OH
H2 )1111kN / C-
2 2 0 I
BOC
PEG-PLGA nanoparticles I . I HN OH
_________________ al
0 lit 0
I
PEG-PLGA nanoparticles conjugated with T 4
Pharmacological tests
PRIAB1, PRIAB4 and PR1AB5, as described above were tested using the chick
chlorioallantoic membrane (CAM) assay before conjugation. The results are
presented herein
for PRIAB1 and depicted in FIG. 54a-54c.
Treatment Branch pts SEM
PBS 65.2 14.9
T4 (0.1pM) 137.3 8.8
PRIAB1 (0.1pM) 173 9.9
The results of the tests were surprising. The test results showed a clear pro-
angiogenesis
action by the protected T4 analogs and the bulkiest protective group showed
the merest activity.
Due to the formation of an amide bound, the free doublet of electrons carried
by the secondary
nitrogen of those molecules is displaced toward the carbonyl which renders the
amine non-
nucleophylic (deactivation of the amine by the carbonyl group is shown below).
Nevertheless
it is still basic.
174
CA 02648243 2013-09-23
R H R'
\N+ (
=NE
0 R 0
New analogs designed to carry a protected amino group (differing in
bulkiness), which render
the amine basic and nucleophilic are shown below:
HO 40 I .A000OH
HNMe
0
Me = CH3
HO 10I COOH
0 HN \ Et
Et = CH2CH3
HO 10 I is ..ACOOH
0 HN \ Tr
Tr = CPh3
The results of the present and future investigations on the T4 analogs and
their
nanoparticles counterparts represent a major step in enhancing the knowledge
of the
nongenomic action of 14 toward the stimulation of new blood vessel formation.
If positive, the
results of the alkylated T4 analogs may lead to start numerous new biological
assays. These
results may contribute towards the design of new dual TR- av133 agonists or
antagonists.
175
CA 02648243 2013-09-23
EXAMPLE 30. Collateral regeneration in coronary, Carotid or peripheral
tissues:
Experimental Limb Ischemic Model:
The present study was carried out on three main groups of rabbits (8-12 months
of age):
a) ischemic, untreated serving as control group and b) ischemic receiving L-T4
analogs, and c)
ischemic group receiving DITPA analogs. Animals were allowed free access to
water and food
and housed in separate cages at 22 C ambient temperature and 12hour light/dark
cycle.
Immediately after surgery rabbits were injected with a single i.m. dose of
tetracycline. Thyroid
analogs were given as a loading s.c. dose (1 mg/animal) followed by daily oral
administration
of the drug (1 mg/animal).
To investigate the feasibility of using thyroid analogs to stimulate
angiogenesis and
augment collateral vessel development in vivo, we used a rabbit model of hind
limb ischemia.
Briefly, under aneasthesia (a mixture of ketamine 10 mg/kg and xylazine 2.5
g/kg, i.m.), rabbits
were subjected to longitudinal incision which was extended inferiorly from the
inguinal
ligament to a point just proximal to the patella. Through this incision, the
femoral artery was
dissected free, along its entire length; all branches of the femoral artery
(including the inferior
epigastric, deep femoral, lateral circumflex and superficial epigastric
arteries) will be dissected
free. Extensive dissection of the popliteal and saphenous arteries, was
followed by ligation of
the external iliac artery and all of the arteries mentioned earlier. This was
followed by
complete excision of the femoral artery from its proximal origin as a branch
of the external iliac
artery to the point distally where it bifurcates to form the saphenous and
popliteal arteries.
Therefore, the blood supply to the distal limb will depend on the collateral
arteries which might
originate from the ipsilateral internal iliac artery. Muscle samples were
taken from the medial
thigh.
Angiography:
Development of collateral vessels in the ischemic limb was evaluated by aortic
angiography one month after surgery or treatment. As agngiography was
performed at the end
of the study period, the injections were made through a catheter introduced
into the aorta.
Intra-arterial injection of contrast media (5m1Isovue-370). Images of the
ischemic limb from
different groups was recorded.
176
CA 02648243 2013-09-23
After angiogram, the animals were sacrificed and blood samples were collected
and
tissue sections prepared from the hind limb muscles and embedded in paraffin
for subsequent
immunostaining.
Immunohisochemistry study:
Expression of CD31:
Paraffin embedded section were deparaffinied, rehydrated and subjected to
antigen
retrieval using microwave and citrate buffer, pH 6.1 for 10 minutes. The
sections were then
incubated with CD31 monoclonal mouse anti-human (DAKO) diluted 1:1000 in Tris
buffered
saline. This antibody strongly labels endothelial cells and is a good marker
in determination of
capillaries. The antigen ¨antibody complex was visualized using DAB and
followed by
counterstaining.
Assessment of capillary density:
Capillaries identified by positive staining for CD31 were counted by a single
observer
blinded to the treatment regimen under a 40x objective. (mean number of
capillaries per muscle
fiber). A total of 10 different fields from tissue sections were randomly
selected, the number of
capillaries counted and the capillary density was determined by calculating
the capillary/muscle
fiber ratio.
Other Embodiments
While the invention has been described in conjunction with the detailed
description
thereof, the foregoing description is intended to illustrate and not limit the
scope of the
invention, which is defined by the scope of the appended claims. Other
aspects, advantages,
and modifications are within the scope of the following claims.
177
