Note: Descriptions are shown in the official language in which they were submitted.
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
1
DERMIS-DERIVED CELLS FOR TISSUE ENGINEERING APPLICATIONS
STATEMENT OF GOVERNMENT INTEREST
This disclosure was developed at least in part using funding from the National
Institutes of Health, Grant Number RO1 AR47839-2. The U.S. government may have
certain
rights in the invention.
CROSS-REFERENCE TO RELATED APPLICATIONS
This application a continuation-in-part of International Application No.
PCT/US2005/24269 filed July 8, 2005, which claims the benefit of U.S.
Provisional
Application Serial No. 60/586,862 filed on July 9, 2004; this application also
claims the
benefit of U.S. Provisional Application No. 60/789,851, filed April 5, 2006,
and also claims
the benefit of U.S. Provisional Application No. 60/789,853, filed April 5,
2006, and also
claims the benefit of U.S. Provisional Application No. 60/789,855, filed April
5, 2006 all of
which are incorporated herein by reference.
SEQUENCE LISTING
This disclosure includes a sequence listing submitted as a text file pursuant
to 37
C.F.R. 1.52(e)(v) named sequence listing.txt, created on March 15, 2007,
with a size of
2,809 bytes, which is incorporated herein by reference. The attached sequence
descriptions
and Sequence Listing comply with the rules governing nucleotide and/or amino
acid
sequence disclosures in patent applications as set forth in 37 C.F.R. 1.821-
1.825. The
Sequence Listing contains the one letter code for nucleotide sequence
characters and the three
letter codes for amino acids as defined in conformity with the IUPAC-IUBMB
standards
described in Nucleic Acids Res. 13:3021-3030 (1985) and in the Biochemical J.
219 (No.
2):345-373 (1984). The symbols and format used for nucleotide and amino acid
sequence
data comply with the rules set forth in 37 C.F.R. 1.822.
BACKGROUND
Tissue engineering is an area of intense effort today in the field of
biomedical
sciences. The development of methods of tissue engineering and replacement is
of particular
importance in tissues that are unable to heal or repair themselves, such as
articular cartilage.
Articular cartilage is a unique avascular, aneural and alymphatic load-bearing
live tissue,
which is supported by the underlying subchondral bone plate. Articular
cartilage damage is
common and does not normally self-repair. Challenges related to the cellular
component of
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
2
an engineered tissue include cell sourcing, as well as expansion and
differentiation. Findings
of recent well-designed studies suggest that autologous chondrocyte
implantation is the most
efficacious technique for repairing symptomatic full-thickness hyaline
articular cartilage
defects, which engender a demand for cell-based strategies for cartilage
repair. Further
studies have also attempted to engineer cartilage via the combination of
biodegradable or
biocompatible scaffolds with differentiated chondrocytes. According to these
studies, it is
unlikely that a sufficient supply of differentiated chondrocytes will be
available for clinical
applications.
Numerous studies have focused on cell sources from tissues other than
cartilage for
cartilage tissue engineering. Embryonic stem (ES) cells represent a valuable
source for this
purpose. The application of ES cells in this area, however, is still limited
particularly because
of ethical considerations. A number of researchers have investigated various
adult tissues
including bone marrow, muscle, and adipose tissue as alternative cell sources
for cartilage
tissue engineering. However, autologous procurement of these tissues has
potential
limitations.
Skin is the largest organ in the body and is relatively easily accessible with
minimal
insult to the donor. The skin dermis is considered, therefore, one of the best
autologous
source organs to isolate stem/progenitor cells for future therapeutic
applications not only in
the replacement of skin, but also as an alternative cell source for several
other organs outside
of skin. Recently accumulating evidence indicates that skin dermis contains
cells that can
generate multiple lineages including neurons, glia, smooth muscle cells and
adipocytes. Thus,
cells from the skin dermis may prove to be a useful alternative cell source
for articular
cartilage tissue engineering. There is increasing evidence which suggests that
human dermal
fibroblasts cultured with demineralized bone powder acquire a chondroblast
phenotype and
express cartilage-specific matrix proteins. However, evidence shows that there
are several
types of fibroblasts in the skin dermis with different functions, which
suggests the limitation
of these cells. Although the existence of chondrogenic precursor cells in skin
dermis has long
been postulated, thus far it has been impossible to induce these heterogeneous
cells to
differentiate into chondrocytes exclusively, either in vivo or in vitro.
Previous studies using dermal fibroblasts showed that demineralized bone
powder
could induce the formation of colonies exhibiting a chondrocytic phenotype.
However, no
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
3
further evidence exists to show whether these chondroinduced cells can be
considered to
originate from stem cells, fully mature fibroblasts, or a dermal subpopulation
of cells with
latent chondrogenic potential. Although a number of researchers have
investigated techniques
to isolate subpopulations from the dermis for different purposes, none of
these
subpopulations has been isolated specifically for cartilage regeneration.
Thus, there is an
absence of well defined and efficient protocols for the selective isolation
and proliferation of
dermis-derived cells, followed by directing their differentiation into the
chondrogenic lineage
in vitro.
SUMMARY
The present disclosure, according to certain example embodiments, is generally
in the
field of improved methods for tissue engineering. More particularly, the
present disclosure
relates to methods for inducing differentiation of dermis-derived cells to
serve as a source of
chondrocytes and associated methods of use in the formation tissue engineered
constructs. As
used herein, a "construct" or "tissue engineered construct" refers to a three-
dimensional mass
having length, width, and thickness, and which comprises living mammalian
tissue produced
in vitro.
In certain embodiments, the present disclosure provides a modified rapid
adhering
process that involves isolating aggrecan sensitive isolated dermis (ASID)
cells for
chondrogenic differentiation and allowing differentiated cells to self-
assemble into a tissue
engineering construct. Dermis derived cells are attractive since they provide
autologous cells
without causing complications at the donor site, due to the high regenerative
capacity of skin.
These cells can also be harvested with a low degree of invasiveness. The
methods of the
present disclosure are advantageous in preparing autologous cells to be
transplanted to any
patient for whom repair of damaged tissues by regeneration therapy will be
needed. With
regard to the availability of ASID cells for clinical use, ASID cells can be
obtained with a
low degree of invasiveness and without causing complications at the donor site
due, to their
high regenerative capacity. Thus, the methods of the present disclosure also
provide
therapeutic strategy that uses the self-assembly of chondroinduced ASID cells
to produce
tissue in vitro for use as an autologous transplant in vivo.
Tissue engineered constructs formed by ASID cells may exhibit cartilage
specific
ECM components throughout, while constructs formed using other dermis derived
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
4
subpopulations often result in heterogeneous matrices. Thus, the methods of
the present
disclosure provide substantially homogeneous tissue engineered constructs. The
methods of
the present disclosure may reduce the likelihood of heterogeneous cell
subpopulations
spontaneously differentiating into divergent lineages and, in the case of
fibroblasts, decreases
the risk of fibrochondrocytic formation.
DRAWINGS
Some specific example embodiments of the disclosure may be understood by
referring, in part, to the following description and the accompanying
drawings.
FIGURE 1 shows a photomicrograph image of fibroblasts grown on 2.5 g/cm2
aggrecan-coated TCP surface. (A) Edge of the well (original magnification
=10x). (B) Center
of the well (original magnification 4x).
FIGURE 2 shows a photomicrograph image of eosin stained aggrecan-coated TCP
surface. (A) Schematic representation of a well. Panels B, C, D, and E show
the center of the
well. Panels F, G, H, and I show the edge of the well. (B, F) control; (C, G)
2.5 g/cm2; (D,
H) 5 g/cm2; (E, I) 10 g/cm2.
FIGURE 3 shows a photomicrograph image of the morphology of aggrecan sensitive
isolated dermis (ASID) cells and normal fibroblasts grown on a tissue culture
treated
polystyrene after 7 Days of culture. (A) ASID; (B) Fibroblasts.
FIGURE 4 is a graph of the effect of different aggrecan concentrations on the
expression of collagen type I and II in ASID cells. (A) Collagen type I (B)
Collagen type II.
FIGURE 5 is a photomicrograph image showing aggrecan induced morphological
changes in chondrocytes, ASID cells and fibroblasts after 1 day in culture.
(A) chondrocytes
with aggrecan; (B) chondrocytes without aggrecan; (C) ASID cells with
aggrecan; (D) ASID
cells without aggrecan; (E) fibroblasts with aggrecan; (F) fibroblasts without
aggrecan.
FIGURE 6 is a photomicrograph image showing the detection of extracellular
matrix
of cartilage in ASID cells after 1 day in culture. (A, B) Safranin-O stain for
proteoglycans;
(C, D) Immunohistological stain for collagen type II protein; (A, C) Aggrecan
treated
surface; (B, D) Without aggrecan treated surface.
FIGURE 7 is a graph of the effect of aggrecan coated surfaces on aggrecan
expression
of ASID cells as a function of time in culture.
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
FIGURE 8 are graphs of the effect of aggrecan coated surfaces on collagen type
I and
type II expression of ASID cells cultured for a period of 2 weeks. A) Collagen
type I
expression B) Collagen type II expression and C) Ratio of Collagen type II to
collagen type I
FIGURE 9 shows fluorescent images illustrating organization of vinculin and F-
actin
5 in chondrocytes, ASID cells and fibroblasts after 36 hrs. Vinculin was
stained with Alexa 488
(green), F-actin was stained with rhodamine phalloidin (red), Nucleus was
stained with DAPI
(blue). (A, B, C, D, E, F) vinculin, (a, b, c, d, e, f) F-actin, Original
magnification, 63x.
FIGURE 10 is a graph of the collagen type I and II expression of ASID cells
cultured
on tissue culture treated and non-tissue culture treated polystyrene, with or
without aggrecan
over a period of 14 days.
FIGURE 11 is a graph of the effect of aggrecan on aggrecan expression of ASID
cells
cultured on tissue culture and non-tissue culture treated polystyrene coated
with or without
aggrecan.
FIGURE 12 is a photomicrograph image of the detection of proteoglycans in ASID
cells cultured in normal medium and chondrogenic medium at day 1. (A) ASID
cells cultured
on non-tissue culture treated polystyrene with normal medium; (B) ASID cells
cultured on
non-tissue culture treated polystyrene with chondrogenic medium; (C)
Fibroblasts cultured on
non-tissue culture treated polystyrene with normal medium; (D) Fibroblasts
cultured on non-
tissue culture treated polystyrene with chondrogenic medium; (E) ASID cells
cultured on
aggrecan-coated non-tissue culture treated polystyrene with normal medium; (F)
ASID cells
cultured on aggrecan-coated non-tissue culture treated polystyrene with
chondrogenic
medium; (G) Fibroblasts cultured on aggrecan-coated non-tissue culture treated
polystyrene
with normal medium; (H) Fibroblasts cultured on aggrecan-coated non-tissue
culture treated
polystyrene with chondrogenic medium; Original magnification = 4x.
FIGURE 13 is a photomicrograph image of the detection of proteoglycans in ASID
cells cultured in aggrecan-coated non-tissue culture treated polystyrene wells
with normal
medium and chondrogenic medium over a period of 14 days. (A) Normal medium at
day 1;
(B) Normal medium at day 7; (C) Normal medium at day 14; (D) Chondrogenic
medium at
day 1; (E) Chondrogenic medium at day 7; (F) Chondrogenic medium at day 14;
Original
magnification = l Ox.
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
6
FIGURE 14 is a photomicrograph of the detection of type II collagen in ASID
cells
cultured on aggrecan-coated non-tissue culture treated polystyrene wells with
normal medium
and chondrogenic medium over a period of14 days. (A) Normal medium at day 1;
(B)
Normal medium at day 7; (C) Normal medium at day 14; (D) Chondrogenic medium
at day
1; (E) Chondrogenic medium at day 7; (F) Chondrogenic medium at day 14;
Original
magnification = l Ox.
FIGURE 15 is a graph of the effect of aggrecan on collagen type I gene
expression of
ASID cells and fibroblasts grown on non-tissue culture treated polystyrene
with or without
aggrecan coating over a period of 14 days.
FIGURE 16 is a graph of the effect of aggrecan on cartilage oligomeric protein
gene
expression of ASID cells and fibroblasts grown on non-tissue culture treated
polystyrene with
or without aggrecan coating over a period of 14 days.
FIGURE 17 is a graph of the effect of aggrecan on aggrecan abundance (A) and
aggrecan gene expression (B) of ASID cells and fibroblasts grown on non-tissue
culture
treated polystyrene with or without aggrecan coating over a period of 14 days.
FIGURE 18 is a graph of the detection of cartilage matrix protein collagen
type II in
ASID cells and fibroblasts cultured on non-tissue culture treated polystyrene
with or without
aggrecan coating at day 1, 7 and 14.
FIGURE 19 is a photomicrograph image of oil red stain for differentiated ASID
cells
after four weeks of culture.
FIGURE 20 is a photomicrograph image of constructs formed using self-assembly
of
ASID cells and fibroblasts. (A) Fibroblasts grown in an agarose well for 1
day. (B)
Fibroblasts grown in an agarose well for 14 days. (C) Construct formed by
fibroblasts after
culture for 14 days. (D) ASID cells grown in an agarose well for 1 day. (E)
ASID cells grown
in an agarose well for 14 days. (F) Construct formed by ASID cells after
culture for 14 days.
FIGURE 21 is a photomicrograph image showing the detection of extracellular
matrix
of cartilage in constructs formed by ASID cells and fibroblasts. (A, B, C)
Fibroblasts; (D, E,
F) ASID cells; (A, D) Collagen type I stain; (B, E) Collagen type II stain;
(C, F) Safranin-O
stain.
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
7
FIGURE 22 is a photomicrograph image of constructs formed using self-assembly
of
ASID cells and fibroblast cells after culture on aggrecan-coated non-tissue
culture treated
polystyrene for a period of 14 days.
FIGURE 23 is a photomicrograph image showing the detection of cartilage
specific
extracellular matrix in constructs self-assembled by (A) chondrocytes, (B)
ASID cells, and
(C) fibroblasts. All were cultured on aggrecan-coated non-tissue culture
treated polystyrene
for 14 days.
FIGURE 24 shows detection of cartilage-specific extracellular matrix ASID
cells
cultured for 1-14 days on aggrecan-coated surfaces. Using Safranin-O, all
nodules stained
positively for glycosaminoglycans (GAGs) (A-C). Irmnunohistologic staining was
positive
for type II collagen (Col II) (D-F), which is evidence of chondrocytic nodule
formation.
FIGURE 25 shows expression and synthesis of cartilage specific markers in ASID
cells compared with fibroblasts. Reverse transcriptase-polymerase chain
reaction results
showed significant inhibition of type I collagen (Col I) gene expression for 1-
7 days in both
cell populations (A). On aggrecan coated surfaces (ACS), aggrecan and
cartilage oligomeric
protein (COMP) gene expression was significantly increased in ASID cells
compared with
fibroblasts on days 7 and 14 (B and C). Enzyme linked immunosorbent assay
showed that
aggrecan coating of surfaces resulted in higher levels of type II collagen in
ASID cell cultures
than in fibroblast cultures (D) at every time point tested. These data suggest
that the extent of
chondroinduction undergone ASID cells when exposed to ACS is significantly
greater than
that undergone by fibroblasts. Values are the mean and SD. * = P <0.05 versus
fibroblasts.
FIGURE 26 shows reorganization of filamentous actin (F-actin) and vinculin in
chondrocytes, ASID cells, and fibroblasts after 36 hours of monolayer culture
on aggrecan-
coated surfaces. F-actin was stained with rhodamine and phalloidin (red) (A-
C). Vinculin was
stained with Alexa Fluor 488 (green) (D-F). Nuclei were stained with 4', 6
diamidino-2-
phenylindole (blue) (G-I). A punctated distribution of F-actin was seen at the
periphery of
chondrocytes (A) and ASID cells (B), while a dense collection of F-actin was
seen
throughout the fibroblasts (C). The organization of vinculin mirrored that of
F-actin in each
group. Combined images with all 3 stains were also created (J-L). On uncoated
control
surfaces, the 3 cell groups exhibited similar F-actin and vinculin
distribution (results not
shown). (Original magnification X 63.)
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
8
FIGURE 27 shows detection of cartilage specific extracellular matrix (ECM) in
constructs self-assembled for 2 weeks using chondrocytes, ASID cells, and
floating ASID (F-
ASID) cells. Sections taken from chondrocyte constructs were stained for
glycosaminoglycans (GAGs) (A), type II collagen (Col II) (D), chondroitin 4-
sulfate (G),
chondroitin 6-sulfate (J), and type I collagen (M). Spherical chondrocytes
were noted within
a matrix containing GAGs, type JI collagen, chondroitin 4-sulfate, and
chondroitin 6-sulfate,
indicative of cartilage formation. ASID constructs also stained positively for
the same
cartilage specific ECM (B, E, H, and K). Type I collagen was not observed
within
chondrocyte or ASID constructs (M and N). In contrast, constructs from F-ASID
cells
exhibited negligible GAG staining (C), poor type JI collagen staining (F)
(arrows) poor
chondroitin 4-sulfate staining (I), and negligible chondroitin 6-sulfate
staining (L), while
staining for type I collagen (0) (arrows) was observed. Bars =50 m.
The patent or application file contains at least one drawing executed in
color. Copies
of this patent or patent application publication with color drawing(s) will be
provided by the
Office upon request and payment of the necessary fee.
While the present disclosure is susceptible to various modifications and
alternative
forms, specific example embodiments have been shown in the figures and are
herein
described in more detail. It should be understood, however, that the
description of specific
example embodiments is not intended to limit the invention to the particular
forms disclosed,
but on the contrary, this disclosure is to cover all modifications and
equivalents as illustrated,
in part, by the appended claims.
DESCRIPTION
The methods of the present disclosure generally comprise providing aggrecan
sensitive isolated dermis cells and seeding the cells onto an aggrecan coated
surface. The
term "aggrecan sensitive isolated dermis cells" or "ASID cells" as used herein
refers to any
plastic rapidly adhering subpopulation of skin cells that are capable of
chondrogenic
differentiation when cultured on aggrecan. The term "chondrogenic
differentiation" as used
herein refers to any process that would result in cells that produce
glycosaminoglycans and
collagen type II. The term "construct" or "tissue engineered construct" as
used herein refers
to a three-dimensional mass having length, width, and thickness, and which
comprises living
mammalian tissue produced in vitro. As used herein, "self-assemble" or "self-
assembly" as
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
9
used herein refers to a process in which specific local interactions and
constraints between a
set of components cause the components to autonomously assemble, without
external
assistance, into the final desired structure through exploration of
alternative configurations.
Chondrogenic Differentiation of Dermis-Derived Cells
The ASID cells used in conjunction with the methods of the present disclosure
are
fibroblastic cells. ASID cells are a subpopulation of dermis derived
fibroblastic cells that may
be characterized by their fast attachment to the bottom surface of a culture
flask and have the
potential for chondrogenic differentiation when seeded on aggrecan-coated
surfaces.
Aggrecan has been found to play an essential role in the chondrogenesis
process and the
subsequent maintenance of the chondroncyte phenotype in vivo. Seeded or
chondroinduced
ASID cells are phenotypically, morphologically, and functionally similar to
chondrocytes.
ASID may be derived from the dermis layer of the skin using methods known in
the
art. The cells are generally derived from an autologous source so as to avoid
biocompatibility
issues. After isolation of the cells from the source, the cells may be
cultured to form a
homogenous culture of cells.
To induce chondrogenic differentiation, homogenous cultured ASID cells may be
seeded on aggrecan coated surfaces (ACS). The aggrecan may be coated on the
ACS at a
concentration of 10 g/cm2 of well surface. For example, 2x105 cells in
culture medium may
be seeded per well in 24 well plates coated with aggrecan (bottom well area
approximately 2
cm2). Generally, the cells may be cultured on the ACS for a period of about
seven days. To
verify that chondrogenic differentiation has occurred, differentiation assays
may be
performed to detect the presence of chondrocyte-specific extracellular matrix.
For example,
the presence of cartilage markers, such as proteoglycans and collagen type II
may be detected
using methods known to those of ordinary skill in the art. In other
embodiments, cartilage
specific matrix gene expression may be evaluated using methods currently known
in the art.
For example, the cells may be assessed by semiquantitative RT-PCR analysis to
determine
the expression of cartilage specific matrix genes.
Hydrogel coating of culture vessels
The culture vessels may be coated with hydrogel in conjunction with the
methods of
present disclosure. "Hydrogel" as used herein refers to a colloid in which the
particles are in
the external or dispersion phase and water is in the internal or dispersed
phase. Generally,
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
suitable hydrogels are non-toxic to the cells, are non-adhesive, do not induce
chondrocyte
attachment, allow for the diffusion of nutrients, do not degrade significantly
during culture,
and are firm enough to be handled.
In certain embodiments, the bottoms and sides of well plates may be coated
with 2%
5 agarose (w/v). While 2% agarose is used in certain embodiments, in other
embodiments, the
agarose concentration may be in the range of about 0.5% to about 4% (w/v). The
use of lower
concentrations of agarose offers the advantage of reduced costs; however, at
concentrations
below about 1% the agarose does not stiffen enough for optimal ease of
handling. As an
alternative to agarose, other types of suitable hydrogels may be used, such
as, for example,
10 alignate.
Self-assembly of Chondrogenically Induced ASID Cells
The chondrogenically induced ASID cells are seeded on hydrogel coated culture
vessels and allowed to self-assemble. For example, 4.8x106 chondrogenically
induced ASID
cells in medium may be seeded per well in 24 well plates (bottom well area
approximately 2
cm2). The chondrogenically induced ASID cells are allowed to self-assemble on
the hydrogel
coated culture vessel. The self-assembly may result in the formation of non-
attached
constructs on the hydrogel surfaces. It is preferable to use hydrogel coated
culture vessels
instead of tissue culture treated surfaces since articular chondrocytes seeded
onto standard
tissue culture treated plastic (TCP) readily attach, spread, and
dedifferentiate.
In certain embodiments, the self-assembly process may occur in culture vessels
that
are shaken continuously on an orbital shaker and then pressurized.
In certain embodiments, the pressurization of the cells may occur in a
pressure
chamber. Pressurization of the samples during the self-assembly process may
aid in increased
extracellular matrix synthesis and enhanced mechanical properties. In certain
embodiments,
the cells may be pressurized to 10 MPa at 1 Hz using a sinusoidal waveform
function. In other
embodiments, the cells may be pressurized during self-assembly of the cells.
In particular embodiments, a loading regimen (e.g. compressive, tensile, shear
forces)
may be applied to the cells during self-assembly based on physiological
conditions of the
native tissue in vivo. Loading of the cells during self-assembly and/or
construct development
may cause enhanced cartilage specific gene expression and protein expression
in the
constructs.
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
11
In particular embodiments, the cells may be treated with staurosporine, a
protein
kinase C inhibitor and actin disrupting agent, during the self-assembly
process to reduce
synthesis of aSMA, a contractile protein. Reducing aSMA in the constructs via
staurosporine
treatment may reduce construct contraction and may also upregulate ECM
synthesis.
In other embodiments, the cells may be treated with growth factors to increase
construct growth and matrix synthesis. Suitable examples of growth factors
that may be used
with the methods of the present disclosure include, but are not limited to,
TGF-01 and IGF-I.
The dosing of the growth factors may be intermittent or continuous throughout
the period of
the self-assembly process. One of ordinary skill in the art, with the benefit
of this disclosure,
will be able to determine the appropriate dosing regimen and amount and type
of growth
factor to provide to the developing constructs.
Hydrogel Molds
In certain embodiments, the chondrogenically induced ASID cells may be seeded
on a
hydrogel coated culture vessel, allowed to self-assemble into a tissue
engineered construct,
and molded into a desired shape. The self-assembly of the cells into a
construct may occur on
hydrogel coated culture vessels for about 1 to about 7 days before being
transferred to a
shaped hydrogel negative mold for molding the construct into the desired
shape.
Alternatively, rather than seeding the chondrogenically induced ASID cells on
a
hydrogel coated culture vessel, in certain embodiments, the cells may be
seeded directly onto
a shaped hydrogel negative mold. The shaped hydrogel negative mold may
comprise agarose.
Other non-adhesive hydrogels, e.g. alignate, may be used in conjunction with
the methods of
the present disclosure. In other embodiments, the hydrogel mold may be a two
piece structure
comprising, a shaped hydrogel negative mold and a shaped hydrogel positive
mold. The
shaped hydrogel negative and positive molds may comprise the same non-adhesive
hydrogel
or may be a comprised of different non-adhesive hydrogels.
In certain embodiments, the cells may be seeded on a hydrogel coated culture
vessel
and allowed to self-assemble into a construct. The construct may be
transferred to a shaped
hydrogel negative mold. A shaped hydrogel positive mold may be applied to the
negative
mold to form a mold-construct assembly. The mold-construct assembly may then
further be
cultured. As used herein, the term "mold-construct assembly" refers to a
system comprising a
construct or cells within a custom-shaped positive and a shaped negative
hydrogel mold.
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
12
In certain embodiments, the molds may be shaped from a 3-D scanning of a total
joint
to result in a mold fashioned in the shape of said joint. In other
embodiments, the molds may
be shaped from a 3-D scanning of the ear, nose, or other non-articular
cartilage to form molds
in the shapes of these cartilages. In certain embodiments, the mold may be
shaped to be the
same size as the final product. In other embodiments, the molds may be shaped
to be smaller
than the final product. In certain embodiments, the molds may be fashioned to
a portion of a
joint or cartilage so that it serves as a replacement for only a portion of
said joint or cartilage.
Other examples of shaped hydrogel molds and methods of developing scaffoldless
tissue engineered constructs that may be useful in conjunction with the
methods of the
present disclosure may be found in co-pending application entitled "A Shape-
Based
Approach for scaffoldless Tissue Engineering," the disclosure of which is
incorporated by
reference herein.
Analysis of the Constructs
The properties of constructs may be tested using any number of criteria
including, but
not limited to, morphological, biochemical, and biomechanical properties,
which also may be
compared to native tissue levels. In this context, morphological examination
includes
histology using safranin-O and fast green staining for proteoglycan and GAG
content, as well
as picro-sirius red staining for total collagen, immunohistochemistry for
collagens I and II,
and confocal and scanning electron microscopies for assessing cell-matrix
interactions.
Biochemical assessments includes picogreen for quantifying DNA content, DMMB
for
quantifying GAG content, hydroxyproline assay for quantifying total collagen
content, and
ELISA for quantifying amounts of specific collagens (I and II), and RT-PCR for
analysis of
mRNA expression of proteins associated with the extracellular matrix (e.g.
collagen and
aggrecan).
Constructs also may be evaluated using one or more of incremental tensile
stress
relaxation incremental compressive stress relaxation, and biphasic creep
indentation testing to
obtain moduli, strengths, and viscoelastic properties of the constructs.
Incremental
compressive testing under stress relaxation conditions may be used to measure
a construct's
compressive strength and stiffness. Incremental tensile stress relaxation
testing may be used
to measure a construct's tensile strength and stiffness. Additionally,
indentation testing under
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
13
creep conditions may be used to measure a construct's modulus, Poisson's
ratio, and
permeability.
Without wishing to be bound by theory or mechanism, although both collagen II
and
GAG are excellent predictors of biomechanical indices of cartilage
regeneration, typically
only collagen II exhibits a positive correlation. Though seemingly this
hypothesis is
counterintuitive for compressive properties, as GAG content is usually thought
to correlate
positively with compressive stiffness, our results show that in self-assembled
constructs,
GAG is negatively correlated with the aggregate modulus (R 2=0.99), while
collagen II is
positively correlated (R2=1.00).
The constructs of the present disclosure may be assessed morphologically
and/or
quantitatively. Quantitatively, the constructs of the present disclosure may
be evaluated using
a functionality index (FI ) as described in Eq. 1. The functionality index is
an equally
weighted analysis of ECM production and biomechanical properties that includes
quantitative
results corresponding to the constructs' salient compositional characteristics
(i.e., amounts of
collagen II and GAG) and biomechanical properties (compressive and tensile
moduli and
strengths).
FI=1 111_(cat-Ga~ J+ 1 (C"-C4,11 +_1 1 (1c.-Ea) 1 1 (Snar ~ad ~ 1 ~~at ~d
4 Qa, Czar 2 1L 2 Ecnt 2 ~at 2
Eq. (1)
In this equation, G represents the GAG content per wet weight, C represents
the
collagen II content per wet weight, ET represents the tensile stiffness
modulus, Ec represents
the compressive stiffness modulus, ST represents the tensile strength, and Sc
represents the
compressive strength. Each term is weighted to give equal contribution to
collagen, GAG,
tension, and compression properties. The subscripts nat and sac are used to
denote native and
self-assembled construct values, respectively. The aggregate modulus is not
used in Eq. 1, as
it is expected to mirror the compressive modulus obtained from incremental
compressive
stress relaxation. Similarly, the amount of collagen I is not be used in Eq.
1, as this type of
collagen may not appear in a measurable fashion; however, if the amount of
collagen I is
non-negligible, Fl may be altered accordingly to account for it.
Each term grouped in parentheses in Eq. 1 calculates how close each construct
property is with respect to native values, such that scores approaching 1
denote values close
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
14
to native tissue properties. Equal weight is given to GAG, collagen II,
stiffness (equally
weighted between compression and tension), and strength (also equally weighted
between
compression and tension). This index, Fl, will be used to assess the quality
of the construct
compared to native tissue values, with a lower limit of 0 and an unbounded
upper limit, with
a value of 1 being a construct possessing properties of native tissue.
However, the FI can
exceed 1 if optimization results in constructs of properties superior to
native tissue.
Methods of Using the Tissue Engineered Constructs
A hydrogel coated culture vessel or shaped hydrogel negative mold is seeded
with
chondrogenically induced ASID cells to produce new tissue, such as tissue of
the knee
meniscus, tendons, and ligaments. The hydrogel coated culture vessel or shaped
hydrogel
negative mold is typically seeded with cells; the cells are allowed to self-
assemble to form a
tissue engineered construct. In certain embodiments, applications of the
tissue engineered
construct include the replacement of tissues, such as cartilaginous tissue,
the knee meniscus,
joint linings, the temporomandibular joint disc, tendons, or ligaments of
mammals.
The constructs may be treated with collagenase, chondroitinase ABC, and BAPN
to
aid in the integration of the constructs with native, healthy tissue
surrounding the desired
location of implantation. The integration capacity of a construct with native
tissue is crucial
to regeneration. A wound is naturally anti-adhesive, but debridement with
chondroitinase
ABC and/or collagenase removes anti-adhesive GAGs and enhances cell migration
by
removing dense collagen at the wound edge. BAPN, a lysyl oxidase inhibitor,
may cause the
accumulations of matrix crosslinkers and may, thus, strengthen the interface
between the
construct and native tissue at the desired location of implantation.
The tissue engineered constructs may be implanted into a subject and used to
treat a
subject in need of tissue replacement. In certain embodiments, the constructs
may be grown
in graded sizes (e.g. small, medium, and large) so as to provide a resource
for off-the-shelf
tissue replacement. In certain embodiments, the constructs may be formed to be
of custom
shape and thickness. In other embodiments, the constructs may be devitalized
prior to
implantation into a subject.
To facilitate a better understanding of the present disclosure, the following
examples
of specific embodiments are given. In no way should the following examples be
read to limit
or define the entire scope of the invention.
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
EXAMPLES
Example 1: ASID Cell Culture Conditions
Examples of constructs of the present disclosure were prepared using adult
goat skins
from 5 animals. The skins were separated from underlying adipose tissue using
sterile
5 scissors, washed in sterile phosphate-buffered saline (PBS) and cut into
small pieces (lxl
cm2). The skin tissue was then digested with 0.5% dispase in 4 C overnight and
then fixed
onto a sterile plate, with the epidermis upward. The epidermis was removed by
scraping with
a blade and the dermis was meticulously cleaned to remove all adipose tissue
and blood
coagulates in vessels. The dermis was washed three times in sterile PBS, and
minced into
10 small pieces (2-3 mm2), and digested in PBS solution containing 200U/ml
collagenase type II
(Worthington, Lakewood, NJ) at 37 C for 15 h under gentle shaking conditions.
After
incubation, the cell suspension was suspended in Dulbecco's modified Eagle's
medium
(Gibco) containing 10% fetal bovine serum, 1% penicillin-streptomycin
(Gibco/Invitrogen,
Carlsbad, CA) and 1% fungizone (Gibco/Invitrogen) and centrifuged at 1,200 rpm
for 5 min
15 at room temperature. The supernatant was aspirated away. Cells were
resuspended in cell
culture medium and seeded in flasks. Media changes were performed every 3-4
days. After
cells reached confluency, cells were treated with 0.5% dispase for 15 minutes,
and the
floating cells were discarded. Then, after cultured for 3 days, cells were
harvested as normal
fibroblast and passaged using a solution containing 0.25% trypsin and 5 mM
EDTA (Sigma).
To obtain a homogeneous culture of ASID cells, harvested cells were seeded in
a
tissue culture treated flask and allowed to attach for 10 min, after which the
floating cells
were discarded. The remaining cells were washed 3 times with PBS and continued
to be
cultured in culture medium.
To induce chondrogenic differentiation, 24 well tissue culture treated plates
were
coated with aggrecan at a concentration of l0 g/cm2. Wells were rinsed with
PBS prior to
plating. ASID cells of passage 2 were plated at a concentration of 2x105
cells/well in 0.3 ml
of medium. After 24 hrs, 0.7 ml medium was added in each well to reach a final
volume of 1
ml. Triplicate samples from either control tissue culture plates or aggrecan-
coated plates were
collected at 24 hrs, 1 wk and 2 wk time points. Tissue culture treated 24 well
plates without
aggrecan were used as control. Chondrocytes and fibroblasts were used as a
standard for
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
16
comparison. Differentiation assays were then performed to detect chondrogenic
differentiation.
Example 2: Assessment of Aggrecan Coating of Well Surface on Fibroblast
Morphology
The effects of an aggrecan-coated surfaces on fibroblast morphology and
organization
were studied 24 hours after seeding. Cells grown on tissue culture treated
polystyrene showed
random cell orientation (data not shown), while cells grown on aggrecan-coated
surfaces
were oriented following a circular pattern (FIGURE 1). To understand the
circle-like fashion
of fibroblasts grown on aggrecan-coated surface, the distribution of aggrecan
on TCP
surfaces was then investigated.
For aggrecan distribution test, 24 well plates were coated with different
concentrations of aggrecan (2.5 g/cm2, 5 g / cm2 and 10 g / cm2). After
aggrecan-coating,
wells were stained with eosin for 1 min and washed with water twice. Negative
control
surface was pre-coated with water. Well surface were photographed using a
Nikon CoolPix
990 digital camera mounted on a Nikon Eclipse TS- 100 inverted microscope.
As shown in FIGURE 2, the data illustrated that the aggrecan-coated surfaces
formed
micropatterned templates (parallel ridge/groove type structures) compared to
the tissue
culture treated control. Furthermore, the ridge width of these grooves
increased with the
increase of aggrecan concentration, while groove width decreased. The highest
coating
density resulted in grooves with ridge width/groove width of about 100-200/1-
10 m in
aggrecan 10 g/cm2 groups.
The data suggested an optimal concentration of aggrecan (l0 g/cm2) for
subsequent
experiments. The choice was based on the observation that at this
concentration there was
wider aggrecan coverage on the surface of aggrecan (10 g/cm2). It is expected
that the nature
of the conditioning biomolecules (in this case, aggrecan) and their position
on the surface will
have direct consequences on the recruitment, attachment, proliferation and
differentiation of
cells.
Aggrecan is highly negatively-charged and functions to bind and organize water
molecules and repel negatively charged molecules within the articular
cartilage. In addition,
the aggrecan molecule is too large and immobile to redistribute itself; thus
the addition of
water causes aggrecan-rich matrix network to swell and expand, and results in
substrate
topography variation as well as surfaces charge variation in vivo. Based on
these in vivo
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
17
characteristics of aggrecan, it was hypothesized that aggrecan can be used as
a specific ECM
molecule to coat TCP surfaces for ASID cells to chondrogenically
differentiate. After
aggrecan coating, it was found that aggrecan molecules deposit on TCP surfaces
and orient
into special grooves. These grooves can be detected by staining with eosin, an
acid dye that
normally has an affinity for positively charged components (FIGURE 2). Also,
the ridge
dimensions of these aggrecan grooves show a dose-dependent increase, which
implies a
topography change might happen on TCP surfaces (FIGURE 2G, H and I). The
results
revealed that aggrecan-coated surfaces could supply a modified surface with
specific
topography, charge density and/or chemical composition for cells to attach.
FIGURE 4 A and
B show the effect of different aggrecan concentration on the expression of
collagen type I and
II in ASID cells, further suggesting an optimal concentration of aggrecan of
10 g/cm2.
Example 3: Chondrogenic Differentiation in Mono-layer culture.
For differentiation assays, 24 well tissue culture treated plates were coated
with
aggrecan at a concentration of 10 g/cm2. Wells were rinsed with PBS prior to
plating. Then,
chondrocytes, ASID cells and fibroblasts of passage 2 were plated at a
concentration of 2x105
cells/well in 0.3 ml of medium. After 24 hrs, 0.7 ml medium was added in each
well to reach
a final volume of I ml. Triplicate samples from either control tissue culture
treated plates or
aggrecan-coated plates were collected at 24 hrs, 1 wk and 2 wk time points.
Tissue culture
treated 24 well plates were used as control.
To evaluate the chondrogenic differentiation percentage of fibroblast and ASID
cells,
the aggrecan treated samples were compared after 24 hrs according to their
chondrocytic
nodules formation. FIGURE 5 shows aggrecan induced morphological changes in
chondrocytes, ASID cells, and fibroblasts after 1 day in culture. Fibroblasts
plated on tissue
culture treated plastic alone attached to the surface, elongated, and spread
to become spindle-
shaped cells, maintaining a fibroblastic appearance. The majority of
fibroblasts were shown
to align strictly along the direction of the ridges/grooves formed by
aggrecan. In sharp
contrast, ASID cells grown on aggrecan-coated surfaces appeared to be small,
round cells
suspended in culture medium when first plated. After one day in culture on
aggrecan, ASID
cells were displaying rounded morphology aggregates. FIGURE 5E shows that
different
dimensions of the ridge/groove patterns only affected fibroblast distribution.
All
concentrations of aggrecan induced different degrees of directional migration
of fibroblasts
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
18
with the growing direction aligning the microgrooves. However, the wider
microgrooves
seemed to trap more fibroblast than the narrow ones.
The morphological differences between fibroblasts and ASID cells grown on
aggrecan-coated surfaces was used to evaluate their abilities for chondrogenic
differentiation.
Almost all ASID cells formed nodules, while no or very few nodules formed in
fibroblast
groups (See FIGURE 5C, E). It seems that fibroblasts preferred the TCP surface
rather than
aggrecan-coated surface as evidenced by FIGURE 3 B and FIGURE 5E, which
implied the
weak interaction between fibroblast and aggrecan. Certainly, some of the
response to the
chemical composition of the substrate is due to the surface topography, but
surface chemistry
plays a significant role as well. The influence of substrate on morphogenesis
depends on cell
type as well as cellular properties such as cytoskeletal organization, cell
adhesion and the
interaction of the cell with other cells. It has also been demonstrated herein
that chondrocytes
respond sensitively to aggrecan-coated surfaces by organizing themselves into
nodules
(FIGURE 5A), suggesting a different interacting pathway against aggrecan-
coated surface
between chondrocytes and fibroblasts. Interestingly, ASID cells employed an
aggrecan-
sensitive pathway significantly different from fibroblasts, but similar to
that of chondrocytes
by forming nodules with similar size and numbers on aggrecan-coated surfaces
(FIGURE 5A,
C), suggesting similar cell-matrix interaction mechanisms may exist between
ASID cells and
chondrocytes when cultured on an aggrecan substrate.
Example 4: Detection of Cartilage Extracellular Matrix
24 well tissue culture treated plates were coated with aggrecan at a
concentration of
l0 g/cm2. Wells were rinsed with PBS prior to plating. Chondrocytes, ASID
cells and
fibroblasts of passage 2 were plated at a concentration of 2x105 cells/well in
0.3 ml of
medium. After 24 hrs, 0.7 ml medium was added in each well to reach a final
volume of 1 ml.
Triplicate samples from either control tissue culture plates or aggrecan-
coated plates were
collected at 24 hrs, 1 wk and 2 wk time points. Tissue culture treated 24 well
plates were used
as control.
To detect the presence of proteoglycans, at each time point, medium was
carefully
removed from the wells, and cells were washed with PBS. After a 10-min
fixation in
formalin, cells were rinsed with water and stained with Fast Green for 10 min.
After a
subsequent water wash, a brief incubation in acetic acid was performed.
Immediately
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
19
following the acid, Safranin 0 was added to the wells for 2 min. After a water
rinse, cells
were photographed using a Nikon CoolPix 990 digital camera mounted on a Nikon
Eclipse
TS- 100 inverted microscope.
To detect the presence of collagen type II, wells were rinsed with PBS, fixed
and
pretreated with 0.3% hydrogen peroxide in PBS for 30 min at room temperature
in order to
block endogenous peroxidase activity. After washing with PBS three times, the
cells were
then treated with horse serum (Vectastain ABC kit) for 20 min to prevent non-
specific
binding. The cells were then incubated with the primary antibody (Chondrex,
Redmond, WA)
overnight at 4 C. The negative controls were incubated with PBS in place of
primary
antibody. After washing with PBS three times, the cells were then incubated
with secondary
biotinylated antirabbit goat IgG (Vectastain ABC kit) at room temperature for
30 min and
then washed a further three times in PBS. Collagen type II was then visualized
by using the
streptavidin-biotin detection system (Vectastain ABC kit) and the substrate of
diaminobenzidine tetrachloride (DAB) (Vector Laboratories, Burlingame, CA).
FIGURE 6 shows the results of staining. Safranin-0 staining performed on all
tested groups found that all ASID cells nodules formed in aggrecan-coated
wells stained
positive for proteoglycans, while ASID cells on uncoated surfaces did not
stain. Additionally,
immunohistochemistry for type II collagen showed all nodules of cells cultured
on aggrecan-
coated surfaces stained positively, while ASID cells on uncoated surfaces did
not stain
(FIGURE 6, right). As seen by Safranin 0 staining and immunohistological
staining, the cells
synthesized chondrocyte-specific matrix in greater abundance than controls
cells. This
change in morphology and increase in matrix production suggest a chondrocytic
phenotype.
Furthermore, because these nodules are Safranin-0 stain positive and type II
collagen
immunohistological stain positive, this suggests that ASID cells undergo a
chondrogenic
process via a pathway related to aggrecan mediated signal transfer.
Example 5: Detection of Gene Expression by Semi Quantitative RT-PCR Analysis
of Cell
Grown on Tissue Culture Treated Pol ystyrene With or Without Aggrecan.
RNA was isolated from the cultured cells using an Ambion RNAqueous kit from
Ambion (Austin, TX). Briefly, provided lysis buffer was added to rinsed cells
in the wells.
The wells were scraped with the pipette tip to ensure complete lysis and cell
collection.
Samples were processed through the RNA isolation spin columns as described in
the
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
provided protocol. Elution was achieved in two steps using 30 1 of elution
buffer. RNA was
treated with DNase for 15 min at 65 C, followed by heating at 95 C for 10 min.
RNA was
stored at -80 C prior to use for reverse transcription reactions. For the
reverse transcription
reaction, 600ng of RNA was incubated with buffer, 1mM dNTPs, 1 mM random
hexamers,
5 RNase inhibitor and 100 U Stratagene StrataScript RT enzyme (La Jolla, CA)
at 42 C for 60
minute. After transcription was complete, samples were either stored at -20 C
or used
immediately for PCR amplification using the Rotor-gene 3000 real-time PCR
machine
(Corbett Research, Sydney, AU). The real-time analysis used a 10 minute
denaturing step,
followed by 45 cycles of 30 seconds at 95 C, 30 seconds at 58 C, and 1 minute
at 72 C,
10 followed by a 2 minute extension. Fluorescence measurements were taken
every cycle at
60 C to provide a quantitative, real-time analysis of the genes analyzed.
Primer sequences
and concentrations are provided in Table 1 below.
Table 1: Primer sequences used for semi-quantitative real time PCR.
Primer Forward Sequence (5' to 3') SEQUENCE ID. Accession Product
name Reverse Sequence (5' to 3') Number Size
Probe Sequence (5' to 3')
GAPDH ACCCTCAAGATTGTCAGCAA SEQ. ID NO. 1 U85042 86bp
ACGATGCCAAAGTGGTCA SEQ. ID NO. 2
CCTCCTGCACCACCAACTGCTT SEQ. ID NO. 3
Type I CATTAGGGGTCACAATGGTC SEQ. ID NO. 4 NM_1745 97bp
collagen TGGAGTTCCATTTTCACCAG SEQ. ID NO. 5 20
ATGGATTTGAAGGGACAGCCTGGT SEQ. ID NO. 6
Type II AACGGTGGCTTCCACTTC SEQ. ID NO. 7 X02420 69bp
collagen GCAGGAAGGTCATCTGGA SEQ. ID NO. 8
ATGACAACCTGGCTCCCAACACC SEQ. ID NO. 9
Aggrecan GCTACCCTGACCCTTCATC SEQ. ID NO. 10 U76615 76bp
AAGCTTTCTGGGATGTCCAC SEQ. ID NO. 11
TGACGCCATCTGCTACACAGGTGA SEQ. ID NO. 12
15 The effect of aggrecan on cartilage specific matrix gene expression was
then
investigated. ASID cells and fibroblasts were grown on either aggrecan-coated
tissue culture
polystyrene or tissue culture treated polystyrene without aggrecan for 14
days. Steady-state
levels of mRNA from each test group were collected for type II collagen and
aggrecan
measurement using quantitative real-time PCR. The aggrecan-coated surfaces
strongly
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
21
reduced aggrecan expression of ASID cells from day 1 to day 7 compare to those
of tissue
culture treated control surface (FIGURE 7) However, at 14 days the effect of
aggrecan on
aggrecan gene expression faded away. In contrast, no obvious differences could
be observed
between fibroblast groups with or without aggrecan (data not shown). Aggrecan
treatment
can inhibit aggrecan gene expression in ASID cells.
In addition, aggrecan treatment can inhibit collagen type I expression in ASID
cells
(FIGURE 8 A). As messenger RNA is detectable at an earlier stage than the
protein itself,
expression of collagen type II message was determined by RT-PCR at each time
point.
Collgen type I expression was also determined to be correlated with
fibroblastic
characteristics. Initial results showed that collagen type II gene expression
could only be
detected in ASID cells grown on the aggrecan-coated surfaces. An obvious
inhibit of collagen
type I gene expression was also observed at day 1 and day 7 in ASID cells
grown on
aggrecan-coated surfaces. However the expression of collagens type II and I
were highly
time-dependent and the ratio of collagen type II to I(CII/CI), defined as an
index of cell
differentiation in chondrocytes, was significantly higher at the beginning of
the culture
(FIGURE 8C). At the end of the experimental culture time, no collagen type II
was detected
in all tested groups (FIGURE 8B). Parallel experiment showed that there are no
differences
between fibroblasts groups (data not shown).
FIGURE 10 and FIGURE 11 indicate the effect of aggrecan on aggrecan and
collagen
type I and II expression of ASID cells cultured on tissue culture treated and
non-tissue culture
treated polystyrene coated with or without aggrecan. The results indicate that
aggrecan-
coated non-tissue culture surfaces are better for ASID expression of collagen
I and collagen
II. The ratio of collagen I and collagen II indicate that non-tissue culture
treated surfaces are
better differentiated (FIGURE 10). FIGURE Il indicates that aggrecan
expression was
suppressed in the presence of aggrecan coating. As a result, further
investigation using non-
tissue culture treated surfaces was performed. The results of the study of
ASID cells and
fibroblasts cultured on non-tissue culture treated plates with or without
aggrecan can be seen
in FIGURES 15-18. Gene expression of collagen type I can be seen in FIGURE 15
across all
groups over a 14 day period of culture. Cartilage oligomeric protein gene
expression can be
seen in FIGURE 16. FIGURE 17A and B show aggrecan abundance and gene
expression
over the 14 day culture period. FIGURE 18 shows the collagen type II abundance
in cell
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
22
types over the 14 day culture period. These data suggest that the extent of
chondroinduction
undergone by ASID cell cultures when cultured on aggrecan coated surfaces is
higher than
the degree of chondroinduction undergone by fibroblasts cultured under the
same conditions.
Example 6: Assessment of the Effect of Different Media on ASID Cells and
Fibroblasts
Cultured on Non-Tissue Treated Polystyrene With or Without Aggrecan.
24 well non-tissue culture treated plates were coated with aggrecan at a
concentration
of 10gg/cm2. Wells were rinsed with PBS prior to plating. ASID cells and
fibroblasts of
passage 2 were plated at a concentration of 2x105 cells/well in 0.3 ml of
medium (either
culture medium or chondrogenic medium). After 24 hrs, 0.7 ml medium was added
in each
well to reach a final volume of 1 ml. Triplicate samples from either control
non-tissue culture
plates or aggrecan-coated plates were collected at 24 hrs, 1 wk and 2 wk time
points. Non-
tissue culture treated wells without aggrecan were used as control.
Chondrogenic medium
comprises Dulbecco's Modified Eagle Medium (DMEM) with 4.5 g/L-glucose and L-
glutamine supplemented with 10-7 M dexamethasone, 50 g/ml ascorbic acid, 40
g/ml
proline, 100 g/mi sodium pyruvate, and 50 mg/ml ITS+Premix.
FIGURE 12, FIGURE 13, and FIGURE 14 indicate the results of this study. Large
quantities of Safranin-O stained positive nodules could be found in both
aggrecan treated
groups with normal medium and chondrogenic medium (FIGURE 12). No nodule could
be
found in the groups grown on non aggrecan-coated surface with normal medium.
The data
imply that chondrogenic medium combined with non-tissue culture treated
surfaces enhance
nodule formation of ASID cells at day 1. No nodules could be found in
fibroblast group with
normal medium from day 1 to day 14.
Furthermore, no nodules could be found in ASID cells in normal medium after
day 7,
while large quantities of nodules could be found in chondrogenic medium
groups. These
nodules stain positive with Safranin-O for proteoglycans (FIGURE 13) and stain
positive for
type II collagen (FIGURE 14). Compared to previous experiments performed with
tissue
culture treated plates, aggrecan is required to get nodules on tissue culture
treated surfaces,
whereas with non-tissue culture treated surfaces, aggrecan is not needed but
could obviously
improve the formation of nodules. Non-tissue culture surfaces combined with
chondrogenic
medium could keep the nodules in culture for as long as 14 days.
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
23
Example 7: Immunofluorescence of Cell Samples
Cell adhesion to the ECM plays a key role in the assembly of cells into
functional
multicellular organisms. To further our understanding of regulatory mechanisms
between the
testing groups in our study, P2 chondrocytes, ASID cells and fibroblasts were
cultured on
aggrecan-coated surfaces for 36 hrs.
Cells for use in immunofluorescence experiments were grown directly on tissue
culture treated plastic coverslips with and without aggrecan coating. After
cultured for 36 hrs,
they were rinsed with PBS, fixed in 4% paraformaldehyde, and permeabilized
with a Triton-
X solution. The cells were then blocked for 30 min in 1% BSA. For vinculin
visualization,
cells were incubated with monoclonal anti-vinculin IgG (1:300; Sigma),
followed by Alexa
488-conjugated goat anti-mouse IgG (1:200, Molecular Probes, Eugene, OR). F-
actin was
visualized by a 30 min exposure to rhodamine phalloidin (2 U/per coverslip;
Molecular
Probes, Eugene, OR). After three final PBS washes, coverslips were then
mounted between a
microscope slide and glass coverslip using ProLong Gold with DAPI (Molecular
Probes,
Eugene, OR). These samples were viewed with an Axioplan 2 microscope (Carl
Zeiss,
Oberkochen, Germany) and a CooISNAP-HQ CCD camera (Photometrics, Tuscon, AZ).
Images were acquired and analyzed using Metamorph 4.15 (Universal Imaging
Corp.,
Downingtown, PA). After 36 hrs in culture, differences in the organization of
F-actin and
vinculin of chondrocytes, ASID cells and fibroblasts grown on aggrecan-coated
surfaces, as
compared with cells grown on uncoated surfaces, were much more prominent.
Although all cells grown on aggrecan-coated surfaces exhibited high levels of
F-actin
and vinculin than cells grown on uncoated surfaces, obvious differences were
seen among
these aggrecan treated groups. Similar response patterns were observed in
chondrocytes and
ASID cells to aggrecan stimuli, which is obviously different from those found
in fibroblasts.
For F-actin, chondrocytes and ASID cells on aggrecan-coated surfaces showed
patterns
consisting of numerous, pronounced stress fibers running throughout the cell,
parallel to each
other or to the cell membrane of extended processes. By contrast, large
numbers of
fibroblasts developed poor stress fibers around a small volume of cytoplasm
(FIGURE 9a, d
and e). Similar vinculin-positive focal contacts pattern between chondrocytes
and ASID cells
grown on aggrecan-coated surfaces were also shown, with restricted vinculin
distribution to
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
24
the cell periphery (FIGURE 9 A, C), while much lower vinculin-positive focal
contacts were
observed in fibroblasts grown on aggrecan-coated surfaces (FIGURE 9 E).
Similar shape, size, and cytoskeletal effects were observed between
chondrocytes and
ASID cells (FIGURE 9A, C and a, c). Chondrocyte and ASID cells grown on
aggrecan-
coated surfaces showed an increase in the presence of actin stress fibers and
vinculin-
containing focal adhesion points than cells grown on the uncoated TCP
surfaces, and
occupied larger surface area on the substratum. It is important to note that
chondrocytes and
ASID cells are shown to perform similar f-actin and vinculin reorganization,
which implied
similar cell-ECM interaction and the consequent cellular events. Although the
organization of
f-actin in the current study was very similar to those reported for
chondrocytes grown on
monolayer, unlike chondrocytes grown in a monolayer, chondrocytes in situ
contained no
stress fibers, further work will be needed to illustrate the cytoskeleton
reorganization under
3D culture condition. No significant differences were found in both fibroblast
groups.
Example 8: Analysis of the Morphology of Constructs
After culture on aggrecan coated non-tissue culture treated surfaces for 14
days, ASID
cells, fibroblasts, and chondrocytes were transferred to hydrogel coated well
surfaces and
allowed to self-assemble.
The bottoms and sides of 96-well plates were coated with 100 1 2% agarose
(w/v),
and the plates were shaken vigorously to remove excess agarose. The surface
area at the
bottom of the well in a 96-well plate is 0.2 cm2. Chilled plates were then
rinsed with culture
medium before the introduction of cells.
Chondrogenically induced ASID cells were then introduced into the hydrogel-
coated
wells at 4.8x106 cells per well in 300 l of culture medium (4.8 x 106
cells/0.2 cm2 of
hydrogel coated surface). The cells aggregated within 24 hrs, from which time
500 gl of the
medium was changed every 2 days. After 2 weeks of culture, these cell
aggregates were
analyzed for extracellular matrix production. Fibroblasts and chondrocytes
were used as
control cells.
FIGURE 20 is an image of developing constructs formed from fibroblasts and
ASID cells.
ASID cells self-assemble into cartilage-like constructs, outperforming
fibroblast constructs;
they also formed a much bigger construct than fibroblasts. FIGURE 22 is an
image of
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
constructs formed by self-assembly of ASID cells and fibroblasts cultured on
aggrecan-
coated non-TCP surfaces for 14 days. The results indicate that ASID cells self-
assemble
better than the fibroblast group. Chondrocytes formed a much bigger construct
than both
ASID cells and fibroblasts (not shown). Both ASID and fibroblast constructs
contracted,
5 while no or light contraction was found in the chondrocyte group.
Example 9: Detection of Cartilage Specific Extracellular Matrix in the
Constructs
The constructs were stained using Safranin-O and immunohistochemical staining
to
detect the presence of proteoglycans and collagen, as described above. FIGURE
21 indicates
the results of staining. ASID cell constructs produce less collagen type I
than the fibroblast
10 constructs. FIGURE 23 indicates the results of staining of ASID cell
constructs, fibroblast
constructs, and chondrocyte constructs. All cells were initially cultured on
aggrecan-coated
non-tissue culture treated surfaces for 14 days. Large quantities of
proteoglycan and collagen
type II were shown in chondrocyte and ASID groups, while less cartilage
specific
extracellular matrix were shown in fibroblast group. Slight collagen type I
was shown in
15 fibroblast group, while no or less collagen type II was found in this
group. Moreover, as
illustrated in FIGURE 19, oil red staining indicated differentiated ASID
cells.
The present findings demonstrated that a specific subpopulation of
fibroblastic cells
could be isolated from goat skin dermis considering their fast adhering
characteristic to TCP
surfaces(FIGURE 3), and these cells were demonstrated to have the potential of
20 chondrogenic differentiation on aggrecan-coated surfaces by producing rich
cartilage specific
extracellular matrix (FIGURE 6) and expressing cartilage specific gene (FIGURE
7 and
FIGURE 8). The data presented herein also shows that ASID cells rearranged
their
cytoskeleton organization by aggrecan-coated surfaces stimuli as chondrocytes
did under
same experimental condition (FIGURE 8). Thus, the reorganization of f-actin
and vinculin
25 induced by the specific cell-matrix interaction may imply subsequent
changes in various
ASID cells events, which may ultimately lead to chondrogenic phenotype
formation of these
cells (FIGURE 4).
Example 10: Chondroinduction of ASID cells in Monolayer Culture
Full-thickness abdomen skin specimens were obtained from 5 goats, separated
from
underlying adipose tissue, and digested with 0.5% Dispase at 4 C overnight.
The epidermis
was then removed by scraping with a blade, and meticulously cleaned to remove
all adipose
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
26
tissue and blood coagulates in vessels. The dermis specimens were then washed,
minced, and
digested in phosphate buffered saline (PBS) containing 200 units/ml type II
collagenase
(Worthington, Lakewood, NJ) at 37 C for 15 hours with gentle rocking. After
incubation, the
cell suspensions were diluted at a ratio of 1:4 with expansion medium
(Dulbecco's modified
Eagle's medium [DMEM; Gibco, Grand Island, NY] supplemented with 10% fetal
bovine
serum [FBS; BioWhittaker, Walkersville, MD], 1% penicillin-streptomycin-
amphotericin B
[BioWhittaker], and 1% nonessential amino acids [Life Technologies,
Gaithersburg, MD])
and centrifuged at 300g for 5 minutes. The cell pellets were resuspended in
expansion
medium and cultured in flasks. Cell yields were 5-12 million/ cm2 of skin.
Medium was
changed every 3-4 days. After confluence, cells were treated with 0.5% Dispase
for 15
minutes, and the floating cells were discarded. After another 3 days of
culture, cells from
each animal were lifted using a solution containing 0.25% trypsin and 5 mM
EDTA (Sigma,
St. Louis, MO). These cells were combined and either plated to serve as the
fibroblast control
or purified to obtain ASID cells.
To obtain the ASID subpopulation, the lifted cells were seeded in a tissue
culture-
treated flask and allowed to attach for 10 minutes, after which the floating
cells (F- ASID)
were removed. The attached cells, which represented <10% of the entire
population, were
washed 3 times with PBS and continued to be cultured in expansion medium for
another 5
days. The cells were then harvested as ASID cells for use in the subsequent
chondroinduction
process. For the monolayer portion of this study, day 0 was defined as the day
that cells were
to be seeded onto the aggrecan surface.
ASID cells were chondroinduced by plating on aggrecan coated surfaces (ACS).
The
concentration of aggrecan (Sigma) was 10 g/cm2 per 24-well plate. ASID cells,
chondrocytes, and fibroblasts were seeded on ACS at a concentration of 2 x 105
cells/well in
0.3 ml of expansion medium. After 24 hours, I ml of chemically defined medium
(DMEM
containing 1% penicillin-streptomycin-amphotericin B, 1% nonessential amino
acids, 10
ng/ml transforming growth factor (31 [PeproTech, Rocky Hill, NJ], 100 ng/ml
recombinant
human insulin like growth factor [PeproTech], 10-7 M dexamethasone [Sigma], 50
g/ml
ascorbic acid-2-phosphate [Acros Organics, Geel, Belgium], 0.4 mM proline
[Acros
Organics], and 50 mg/ml ITS+ Premix [BD Biosciences, Bedford, MA]) was changed
in each
well to reach a final volume of 1 ml, and the medium was changed every 2 days
for 2 weeks.
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
27
As positive controls, goat articular cartilage chondrocytes were obtained as
previously
described in Hu JC, Athanasiou KA. A self-assembling process in articular
cartilage tissue
engineering. Tissue Eng 2006; 12:969-79.
Example 11: Chondroinduction Effects of AggLprecan on ASID Cells in Monolayer
Culture.
Triplicate samples from each cell group were collected at 24 hours, 1 week,
and 2
weeks and assessed for chondrocyte specific matrix using the following
analyses. For
chondrocytic nodule formation, samples were collected and photographed using a
CoolPix
990 digital camera (Nikon, Melville, NY) mounted on an Axioplan 2 microscope
(Zeiss,
Oberkochen, Germany).
For glycosaminoglycan (GAG) detection, Safranin 0 staining was performed after
10
minutes of formalin fixation. Cells were incubated with 1% acetic acid, and
Safranin 0 was
applied for 2 minutes. Cells were then photographed after a water rinse.
Type II collagen (CII) was detected using immunohistochemistry. Briefly,
formalin
fixed cells were incubated with CII primary antibody (Chondrex, Redmond, WA)
and
detected using the Vectastain ABC kit (Vector, Burlingame, CA) according to
the
instructions provided. A quantitative sandwich enzyme linked immunosorbent
assay (ELISA)
for CII was also performed, using a monoclonal capture antibody (6009) and a
polyclonal
detection antibody (7006) (Chondrex).
All nodules formed using ASID cells on ACS stained positively for GAGs (FIGURE
24A-C) and for CII (FIGURE 24D-F). All cells grown on uncoated surfaces were
negative
for both stains. The formation of nodules exhibits GAGs and CII matrix
provided evidence of
chondroinduction of ASID cells.
Example 12: Quantification of Cartilage-Specific Matrix Gene Expression and
Protein
Production.
Semiquantitative reverse transcriptase-polymerase chain reaction (PCR)
analyses
were performed to measure the expression of type I collagen (CI), CII,
cartilage oligomeric
protein (COMP), and aggrecan. RNA isolated using an RNAqueous kit (Ambion,
Austin,
TX) was reverse-transcribed using StrataScript RT enzyme and kit (Stratagene,
La Jolla, CA)
at 600 ng RNA per reaction. After transcription, PCR was performed using the
Rotor-Gene
3000 real-time PCR system (Corbett Life Science, Sydney, New South Wales,
Australia).
The real-time analysis consisted of 15 minutes at 95 C, followed by 55 cycles
of 15 seconds
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
28
at 95 C, and 30 seconds at 60 C. Primer and probe sequences and concentrations
are shown
in Table 1 above. The day 0 control was obtained by isolating messenger RNA
(mRNA) from
fibroblasts prior to seeding onto ACS.
The effect of ACS on cartilage-specific matrix gene expression and on protein
production was investigated. ASID cells and fibroblasts were grown either on
ACS or on
uncoated surfaces for 14 days. Expression of mRNA for 3 positive markers of
chondroinduction (aggrecan, CII, and COMP) and 1 negative marker of
chondroinduction
(CI) was measured. In addition, ELISA was used to determine the actual protein
synthesis
level of CII.
After exposure to ACS, expression of CI immediately decreased in both ASID
cells
and fibroblasts, although this suppression was initially more pronounced in
ASID cells. This
suppression did not persist beyond 7 days (FIGURE 25A).
By comparing the expression and synthesis of cartilage-specific markers, ASID
cells
were shown to possess a greater chondroinduction potential compared with
fibroblasts
(FIGURE 25). Specifically, after seeding onto ACS, aggrecan gene expression in
ASID cells
was significantly higher (P < 0.05) than that in fibroblasts at 7 and 14 days
(FIGURE 25B).
Similarly, COMP expression by ASID cells was also significantly higher (P <
0.05) than that
in fibroblasts (FIGURE 25C) at 7 and 14 days. By day 14, COMP expression in
ASID cells
was 5-fold higher than in fibroblasts. More important, protein synthesis
levels of CII
(FIGURE 25D), another cartilage- specific marker, were found to mirror COL2
gene
expression (data not shown) and were significantly higher (P < 0.05) at all
time points in
ASID cell populations when compared with fibroblasts (FIGURE 25D).
Example 13: Initiation of Chondroinduction by Fluorescence Imaging of
Cytoskeletal
Organization of ACS.
Immunofluorescence was used to detect filamentous actin (F-actin) and
vinculin.
After 36 hours of culture on ACS or uncoated control surfaces, cells were
rinsed with PBS,
fixed in 4% paraformaldehyde, permeabilized with Triton X-100, and blocked
with 1%
bovine serum albumin. For vinculin visualization, cells were incubated with
monoclonal anti-
vinculin IgG (Sigma), followed by incubation with Alexa Fluor 488-conjugated
goat anti-
mouse IgG (Molecular Probes, Eugene, OR). F-actin was visualized using
rhodamine and
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
29
phalloidin staining (Molecular Probes). Slides were viewed using an Axioplan 2
microscope
with a CoolSnapHQ CCD camera (Photometrics, Tucson, AZ).
Since cells adhere to the extracellular substratum by focal adhesion, we
investigated
whether ACS had any effect on this event. After 36 hours in culture, cells
were labeled with
phalloidin and rhodamine, which specifically bind to the F-actin cytoskeleton,
and with anti-
vinculin antibodies. Differences were observed among cell groups cultured on
ACS
(FIGURE 26), but not among cells cultured on uncoated surfaces (results not
shown).
Fibroblasts seeded on ACS formed strong polarized F-actin fiber bundles
distributed
throughout the cytoplasm, accompanied by abundant stress fibers (FIGURE 26C).
In contrast,
the formation of F-actin fiber bundles was significantly inhibited in both
chondrocytes and
ASID cells (FIGURE 26A and B). In these cells, F-actin was preferentially lost
from the
central cytoplasm and became concentrated at the cell periphery. Treatment
with antivinculin
antibodies revealed that the distribution of vinculin in each cell mirrored F-
actin distribution
(FIGURE 26D and F).
Example 14: Fabrication of In Vitro Cartilage-Like Constructs and Histologic
Evaluation of
Engineered Constructs
Using the chondroinduction evaluation described above, 7 days was chosen as
the
optimal ACS exposure time for chondroinduction. Thus, chondrocytes, ASID
cells, or F-
ASID cells were plated on 24-well ACS at 2 x 105 cells/well. After 7 days,
cells were
harvested by scraping and were seeded to form self- assembled constructs, as
previously
described in Hu JC, Athanasiou KA. A self-assembling process in articular
cartilage tissue
engineering. Tissue Eng 2006;12:969-79. Briefly, a silicon-positive die
consisting of
cylindrical prongs (3 mm diameter x 10 mm long) was used to form a 2% agarose
mold. The
mold was then separated from the silicon-positive die and saturated with
defined medium
containing 1% FBS. For each construct, cells harvested from the 24 wells were
combined and
suspended in 50 l of defined medium with 1% FBS and seeded into the agarose
molds.
Within 24 hours, the cells formed attached constructs, and these constructs
were maintained
in the agarose molds for 2 weeks. Medium was changed every 2 days. For the 3 D
portion of
this study, day 0 was defined as the day that cells were seeded into the
agarose wells.
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
After 2 weeks, constructs were collected to evaluate cartilage-specific matrix
deposition, using Safranin 0 to determine GAG distribution and
immunohistochemistry to
detect CII, CI, chondroitin 4-sulfate, and chondroitin 6-sulfate.
Results are expressed as the mean SD. Data were assessed by 3-factor
analysis of
5 variance. P values less than 0.05 were considered significant.
Cells in all groups aggregated and formed constructs in vitro, 2 weeks after
self-
assembly. Samples from each group were then collected and sectioned for
histologic
evaluation. Histologic and immunohistochemical studies in cartilage ECM from
ASID
constructs revealed strong and even staining for GAGs, CII, chondroitin 4
sulfate, and
10 chondroitin 6-sulfate (FIGURE 27 B, E, H, and K). In contrast, the F-ASID
groups stained
poorly for all the above-mentioned cartilage components (FIGURE 27C, F, I, L,
and 0). CI
was not observed in either the chondrocyte or the ASID constructs, while
colonies of cells
positive for CI (FIGURE 270, arrows) were detected in F-ASID groups. This, in
combination
with the observation that a trace amount of CII was localized in colonies
within F-ASID cells
15 (FIGURE 27F, arrows), implies that complex heterogeneous cell populations
exist within the
F-ASID constructs in terms of their chondroinduction potential.
As illustrated above, a modified rapid adherence process was developed to
isolate
ASID cells from goat dermis for chondroinduction. Instead of selecting all
rapidly adhering
cells from the dermis, the Dispase-sensitive subpopulations are first removed
(since these
20 populations also contain rapidly adhering cells). Rapidly adhering cells
from the remaining
sub populations are then isolated based on their adherence time. Cells that
adhered to the
plastic surface within 10 minutes were chosen because they produced the
highest nodule
numbers when seeded on ACS compared with cells from other time points (data
not shown).
The preceding examples illustrate that ASID cells were chondroinduced when
seeded
25 on ACS, and were phenotypically, morphologically, and functionally similar
to chondrocytes.
In situ activity of ASID cells might be suppressed in the in vivo
microenvironment through
signaling from skin ECM and/or from mature fibroblasts. However, in vitro or
ectopically,
the chondroinduction process may be initiated due to the presence of an
enriched
environment of ASID cells and/or exposure to aggrecan or other cartilage-
specific ECM
30 components.
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
31
Chondrocytes, ASID cells, and fibroblasts were seeded on ACS in this study.
Fibroblasts showed a spindle-like morphology on ACS 24 hours after seeding.
However, we
found that chondrocytes responded sensitively to ACS by organizing into
nodules, suggesting
the presence of a different interacting pathway between chondrocytes and
fibroblasts. ASID
cells used an aggrecan-sensitive pathway significantly different from that of
fibroblasts.
However, ASID cells formed nodules similar in size and number to those in
chondrocytes on
ACS, suggesting that analogous early-stage cell-matrix interaction mechanisms
may exist
between ASID cells and chondrocytes when cultured on ACS.
Consistent with the morphologic findings, the ECM results also show that ASID
cells
have a higher potential for chondroinduction compared with unpurified,
heterogeneous
fibroblast subpopulations. Throughout the entire experimental period, nodules
formed by
ASID cells seeded on ACS were shown to stain positively for Safranin 0 and for
CII. In
contrast, both ASID and fibroblast cells seeded on uncoated surfaces showed
negative
staining for both GAG and CII under the same conditions, which is common for
dermis-
derived cells. ASID cells exposed to ACS expressed cartilage marker genes more
rapidly and
more potently than did fibroblasts. Moreover, ACS appeared to inhibit the
fibroblastic
phenotype in ASID cells, as evidenced by significant inhibition of collagen
type I gene
expression at 1 day and 7 days.
However, it was also observed that collagen type I gene expression recovered
with
time in each cell group, and, since higher levels of expression of other
cartilage specific
markers were seen from 7 days onward, 7 days was chosen as the transition
between
monolayer and 3-D culture. Compared with 3-D culture, 2-dimensional (2-D)
surfaces
appeared less optimal for chondroinduction. This was confirmed by
immunohistochemistry
of 3-D cultures. Indeed, CI was not observed in self-assembled ASID
constructs, while
cartilage- specific markers were retained (FIGURE 27B, E, H, and K). Taken
together, these
findings confirmed that ASID cells have higher chondroinduction potential than
fibroblasts
when exposed to ACS.
The influence of substrate on morphogenesis depends on cell type as well as
cellular
properties such as cytoskeletal organization, cell adhesion, and cell-cell
interactions. To
further an understanding of the regulatory mechanisms of aggrecan,
chondrocytes, ASID
cells, and fibroblasts were cultured on ACS for 36 hours. Chondrocytes and
ASID cells were
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
32
found to organize their F-actin on ACS in a similar pattern, which was
significantly different
from that of fibroblasts. Fewer stress fibers were found in ASID cells and
chondrocytes than
in fibroblasts. Furthermore, the distribution of vinculin in each group
mirrored its F-actin
distribution (FIGURE 26). The observed F-actin patterns of ASID cells and
chondrocytes in
this study were similar to those reported for chondrocytes in monolayer. This
implies that the
2 cell types have similar cell-matrix interactions.
Studies of a number of cell types have shown that F-actin organization plays
an
important role in a large number of cellular events, including shape
alteration, cell signaling,
secretion, and ECM assembly. Any one or a combination of the above described
events may
thus be precipitated by the F-actin organization brought about by cell matrix
interactions.
Indeed, chondrocytes were found to respond to ECM components, including
hyaluronic acid)
and CI), by reorganizing their F-actin in vitro, resulting in the regulation
of various
chondrocyte behaviors such as cell shape determination, chondrogenesis
initiation,
chondrocytic phenotype maintenance, and chondrocyte hypertrophy. Again, any
one or a
combination of these events may have occurred as chondrocytes were seeded onto
ACS. In
this study, specific cell-matrix interactions led to F-actin and vinculin
reorganization. This
reorganization may have resulted in the subsequent changes in various ASID
cell events that
ultimately led to chondrogenic phenotype formation of these cells in 2-D.
These specific cell
matrix interactions may also lead to a temporal and spatial self-assembly
process in 3-D.
The assembly of cells into functional multicellular organisms in 3 dimensions
involves F-actins, the primary sites at which cells detect and adhere to their
ECM. Points of
F-actin and vinculin colocalization have been shown to be sites where
chondrocytes adhere to
the articular cartilage ECM. For these purposes, a self-assembly process has
recently been
developed. By using this scaffoldless approach with chondrocytes, cartilage-
like constructs
have successfully been obtained that mimic native cartilage in terms of
biochemical and
biomechanical properties. Although the exact mechanisms of the self-assembly
process
initiated and accomplished by chondrocytes are not known, temporal and spatial
interactions
between the chondrocytes and their ECM environments have been suggested to be
essential
for successful cartilage development.
When chondroinduced ASID cells were seeded in agarose molds, they aggregated
and
self-assembled into cartilage-like constructs, as expected. Two weeks after
seeding, the
CA 02648648 2008-10-03
WO 2007/136936 PCT/US2007/066085
33
constructs were sectioned for cartilage-specific ECM detection. Similar to
constructs formed
by chondrocytes, high levels of total GAG, CII, chondroitin 4-sulfate, and
chondroitin 6-
sulfate were found in ASID constructs (FIGURE 27A, B, D, E, G, H, J, and K),
which
indicated cartilage formation. In contrast, F-ASID cell constructs showed poor
staining for all
of the above mentioned cartilage-specific matrices; instead, colonies of cells
that stained
positively for CI were detected. Furthermore, compared with the homogeneous
distribution of
cartilage specific ECM in ASID constructs, colonies of cells that stained
positively for CI
(FIGURE 27 0, arrows) and CII (FIGURE 27F, arrows) showed an uneven
distribution of
different dermis derived sub populations in the F-ASID constructs. This
further supports the
hypothesis that subpopulations of dermis derived cells must first be purified,
in order to
obtain cells that can undergo chondroinduction in a uniform manner.
Differences in ECM levels between chondrocyte constructs and ASID constructs
still
exist. This may be remedied by optimizing the protocol to use different
adhesion times to
select for ASID cells with higher chondroinduction potential. In addition to
ACS, optimized
combinations of growth factors might be important in chondroinduction and the
subsequent
self-assembly of the ASID cells.
Notwithstanding that the numerical ranges and parameters setting forth the
broad
scope of the invention are approximations, the numerical values set forth in
the specific
examples are reported as precisely as possible. Any numerical value, however,
inherently
contain certain errors necessarily resulting from the standard deviation found
in their
respective testing measurements.
Therefore, the present invention is well adapted to attain the ends and
advantages
mentioned as well as those that are inherent therein. While numerous changes
may be made
by those skilled in the art, such changes are encompassed within the spirit of
this invention as
illustrated, in part, by the appended claims.
