ANTI-VIRAL AGENTS THAT ACTIVATE RNASE L

AGENTS ANTI-VIRAUX QUI ACTIVENT L'ARNSE L

English Abstract

RNase L Activators and methods of using the same are disclosed herein.

French Abstract

L'invention concerne des activateurs d'ARNse L et des méthodes pour les utiliser.

Claims

-21-

CLAIMS

What is claimed is:
1. A pharmaceutical composition comprising a pharmaceutically acceptable
carrier or diluent and a compound represented by the following structural
formula:

Image
or a pharmaceutically acceptable salt thereof, wherein:
Ring A and Ring B are optionally and independently substituted at
any one or more substitutable ring carbon atoms;
Y is CH, N or N+-O-;
Z1 and Z2 are independently O or S;
Z3 is CR1 or N;
R1 is -H, -C(O)H, -C(O)R20, -C(O)OR30 or a C1-C5 alkyl group
optionally substituted with one or more groups selected from halogen,
hydroxyl, -OR20, nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR30, -OC(O)H and
-OC(O)R20 or R1 is a group represented by the following structural formula:
Image
R2 is -H or a C1-C5 alkyl group optionally substituted with one or
more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H,
-C(O)R20, -C(O)OR20, -OC(O)H or -OC(O)R20;
each R20 is independently C1-C3 alkyl or C1-C3 haloalkyl; and



-22-

R30is C1-C3 alkyl, C1-C3 haloalkyl or a group represented by a
structural formula selected from:

Image
2. The pharmaceutical composition of Claim 1 wherein Z1 is O and Z2 is S.
3. The pharmaceutical composition of Claim 2 wherein the compound is
represented by the following Structural Formula:



-23-


Image
or a pharmaceutically acceptable salt thereof.
4. The pharmaceutical composition of Claim 1 whereiin:
Ring A is substituted at any one or more substitutable ring carbon atoms with
halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H,
-C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R2l, or a C1-C3 alkyl group substituted
with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21 or Ring A is
optionally substituted with a group represented by the following structural
formula:

Image
Ring B is substituted at any one or more substitutable ring carbon atoms with
halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21,
-C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40,
-CH2OCH2R40, -OCH2R40 or a C1-C3 alkyl group substituted with hydroxyl,
-OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21;



-24-


each R21 is independently H, C1-C3 alkyl or C1-C3 haloalkyl
R40 is -COOH, -PO3H2, -SO3H, -PO2H or -SO2H.

5. The pharmaceutical composition of Claim 4 whereiin:
Ring B is substituted at any one or more substitutable ring carbon
atoms with halogen, C1-C3 alkyl, C 1-C3 haloalkyl, nitro, cyano, hydroxy, -
OR21,
-C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40, -CH2OCH2R40 or
a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H
or -OC(O)R21;
each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl.
6. The pharmaceutical composition of Claim 4 or 5 wherein each R20 is
independently C1-C3 alkyl, each R21 is independently C1-C3 alkyl, each R30
is independently C1-C3 alkyl and R2 is -H.

7. The pharmaceutical composition of Claim 2 wherein the compound is
represented by the following Structural Formula:

Image
or a pharmaceutically acceptable salt thereof.

8. The pharmaceutical composition of Claim 7 wherein:
Ring A is substituted at any one or more substitutable ring carbon
atoms with halogen, C 1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy,
-OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3



-25-

alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or
-OC(O)R 21 or with a group represented by the following structural formula:

Image
Ring B is substituted at any one or more substitutable ring carbon
atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy,
-OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40,
-CH2OCH2R40 or a C1-C3 alkyl group substituted with hydroxyl, -OR21,
keto, -C(O)OR21, -OC(O)H or -OC(O)R21;
each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl; and
R40 is -COOH, -PO3H2, -SO3H, -PO2H or -SO2H.

9. The pharmaceutical composition of Claim 8 wherein each R21 is
independently C1-C3 alkyl, and R2 is -H.

10. The pharmaceutical composition of Claim 2 wherein the compound is
represented by the following Structural Formula:

Image
or a pharmaceutically acceptable salt thereof.



-26-

11. The pharmaceutical composition of Claim 10 wherein:
Ring A is substituted at any one or more substitutable ring carbon
atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy,
-OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3
alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or
-OC(O)R21 or with a group represented by the following structural formula:

Image
Ring B is substituted at any one or more substitutable ring carbon
atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy,
-OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40,
-CH2OCH2R40 or a C1-C3 alkyl group substituted with hydroxyl, -OR21,
keto, -C(O)OR21, -OC(O)H or -OC(O)R21;
each R21 i s independently C1-C3 alkyl or C1-C3 haloalkyl; and
R40 is -COOH, -P03H2, -SO3H, -PO2H or -SO2H.

12. The pharmaceutical composition of Claim 11 wherein each R21 is
independently C1-C3 alkyl and R2 is -H.

13. The pharmaceutical composition of Claim 1 wherein the compound is
represented by a structural formula selected from:



-27-


Image
or a pharmaceutically acceptable salt thereof.

14. A pharmaceutical composition comprising a pharmaceutically acceptable
carrier or diluent and a compound represented by the following structural
formula:

Image
or a pharmaceutically acceptable salt thereof, wherein:
Z3 and Z4 are independently O or S;


-28-
Ring C and Ring D are optionally and independently substituted at
any one or more substitutable ring carbon atoms;
R3 is -H or a C1-C5 alkyl group optionally substituted with one or
more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H,
-C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20; and
each R20 is independently C1-C3 alkyl or haloalkyl.

15. The pharmaceutical composition of Claim 14 wherein the compound is
represented by the following structural formula:

Image
or a pharmaceutically acceptable salt thereof.

16. The pharmaceutical composition of Claim 15 wherein Ring C is optionally
substituted at any one or more substitutable ring carbon atoms with C1-C3
alkyl, halogen, =O, hydroxyl or C1-C3 alkoxy.

17. The pharmaceutical composition of Claim 16 wherein Ring D is optionally
substituted at any one or more substitutable carbon atoms with halogen, C1-
C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21,
-C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3 alkyl group substituted with
halogen, hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21 and
each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl.
18. The pharmaceutical composition of Claim 17 wherein R3 is -H.
19. The pharmaceutical composition of Claim 18 wherein Ring C is
unsubstituted.


-29-
20. The pharmaceutical composition of Claim 14 wherein the compound is
represented by a structural formula selected from:
Image
or a pharmaceutically acceptable salt thereof:

21. A pharmaceutical composition comprising a pharmaceutically acceptable
carrier or diluent and a compound represented by the following structural
formula:



-30-



Image
or a pharmaceutically acceptable salt thereof, wherein:
Z5 and Z6 are independently O or S;
Ring E and Ring F are optionally and- independently substituted at
any one or more substitutable ring carbon atoms;
R6 is -H or a C1-C5 alkyl group optionally substituted with one or
more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H,
-C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20;
R7 and R8 are independently -H, a C1-C5 alkyl group or a C1-C5
haloalkyl group; and
each R20 is independently C1-C3 alkyl or haloalkyl.

22. The pharmaceutical composition of Claim 21 wherein Z5 is S and Z6 is O.
23. The pharmaceutical composition of Claim 22 wherein Ring E and Ring F are
optionally and independently substituted at any one or more substitutable
carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano,
hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a
C1-C3 alkyl group substituted with halogen, hydroxyl, -OR21, keto,
-C(O)OR21, -OC(O)H or -OC(O)R21; and
each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl.
24. The pharmaceutical composition of Claim 23. wherein R6 is -H.



-31-


25. The pharmaceutical composition of Claim 24 wherein R7 and R8 are
independently -H or a methyl.

26. The pharmaceutical composition of Claim 21 wherein the compound is
represented by the following structural formula:

Image
or a pharmaceutically acceptable salt thereof.

27. A pharmaceutical composition comprising a pharmaceutically acceptable
carrier or diluent and a compound represented by the following structural
formula:

Image
or a pharmaceutically acceptable salt thereof, wherein:
X1 and X2 are independently CH2, NH or O;
x3 is -O-C(O)-, -O-C(S)-, -S-C(O)-, -S-C(S)-, -C(O)-, C(S)-, -CH2-,
-CH(CH3)-, -NHC(O)-, -C(O)NH-, -NHC(S)- or -C(S)NH-;
Z8 and Z9 are independently S or O;
Ring G is optionally substituted at any one or more substitutable ring
carbon atoms;



-32-



R9 is a C1-C5 alkyl group optionally substituted with one or more
groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H,
-C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20;
R10 and R11 are independently -H or a C1-C5 alkyl group optionally
substituted with one or more groups selected from halogen, hydroxyl, -OR20,
nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20;
R12 is -H; a C1-C5 alkyl group optionally substituted with one or
more groups represented by R21; a monocyclic aromatic group optionally
substituted at any one or more substitutable ring carbon atoms with a group
represented by R22; or a monocyclic C1-C3 aralkyl group optionally
substituted at any one or more substitutable ring carbon atoms with R23;
each R20 is independently C1-C3 alkyl or C1-C3 haloalkyl;
each R21 is independently halogen, hydroxyl, -OR20, nitro, cyano,
-C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H or -OC(O)R20;
each R22 and R23 is independently C1-C3 alkyl, C1-C3 haloalkyl,
nitro, cyano, hydroxy, -OR24, -C(O)H, -C(O)R24, -C(O)OR24, -OC(O)H,
-OC(O)R24 or C1-C3 alkyl substituted with hydroxyl, -OR24, keto,
-C(O)OR24, -OC(O)H or -OC(O)R24 and
R24 is C1-C3 alkyl or C1-C3 haloalkyl.

28. The pharmaceutical composition of Claim 27 wherein R12 is -H; a C1-C5
alkyl group optionally substituted with a group represented by R21; a phenyl
group optionally substituted with a group represented by R22; or a C1-C3
phenalkyl group optionally substituted at any one or more substitutable ring
carbon atoms with R23.

29. The pharmaceutical composition of Claim 28 wherein the compound is
represented by the following structural formula.



-33-



Image
or a pharmaceutically acceptable salt thereof.

30. The pharmaceutical composition of Claim 29 wherein the compound is
represented by the following structural formula:

Image
or a pharmaceutically acceptable salt thereof, wherein X3 is -O-C(O)- or
-C(O)-.

31. The pharmaceutical composition of Claim 30 wherein wherein the compound
is represented by the following structural formula:

Image
or a pharmaceutically acceptable salt thereof.

32. The pharmaceutical composition of Claim 31 wherein Ring G is optionally
substituted at any one or more ring carbon atoms with halogen, C1-C3 alkyl,



-34-

C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR25, -C(O)H, -C(O)R25,
-C(O)OR25, -OC(O)H, -OC(O)R25 or C1-C3 alkyl substituted with hydroxyl,
-OR25, keto, -C(O)OR25, -OC(O)H or -OC(O)R25 and
each R25 is independently C1-C3 alkyl or C1-C3 haloalkyl.

33. The pharmaceutical composition of Claim 32 wherein R9 is a C1-C5 alkyl
group optionally substituted with halogen, hydroxyl, C1-C3 alkoxy or C1-C3
haloalkoxy.

34. The pharmaceutical composition of Claim 33 wherein R12 is-H; an alkyl
group optionally substituted with a group represented by R21; or a benzyl
group optionally substituted at any one or more substitutable ring carbon
atoms with R23;
R21 halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloalkoxy;
each R23 is independently C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano,
hydroxy, -OR24, -C(O)H, -C(O)R24, -C(O)OR24, -OC(O)H, -OC(O)R24 or
C1-C3 alkyl substituted with hydroxyl, -OR24, keto, -C(O)OR24, -OC(O)H or
-OC(O)R24.

35. The pharmaceutical composition of Claim 34 wherein R10 is methyl,
halomethyl or hydroxymethyl.

36. The pharmaceutical composition of Claim 35 wherein R9 is C1-C5 alkyl;
R10 is -C(Cl)3; and R12 is C1-C5 alkyl or benzyl.

37. The pharmaceutical composition of Claim 27 wherein the compound is
represented by a structural formula selected from:



-35-



Image
or a pharmaceutically acceptable salt thereof.

38. A method of treating a subject with a viral infection, comprising
administering an effective amount of the pharmaceutical composition of any
one of Claims 1-37 to the subject.

39. The method of Claim 38 wherein the viral infection is caused by a virus
with
a single-stranded RNA(s) genome.



-36-


40. The method of Claim 38 wherein the virus is orthomyxoviruses (e.g.
influenza viruses), paramyxoviruses (e.g. respiratory syncytial virus &
human parainfluenza virus-3), rhabdoviruses (e.g. rabies virus), togaviruses
(e.g. rubella virus and eastern equine encephalitis virus), picomaviruses
(e.g.
poliovirus & Coxsackieviruses), flaviviruses (e.g. West Nile virus, Dengue
virus, and hepatitis C virus), bunyaviruses (e.g. LaCrosse virus, Rift Valley
fever virus & Hantavirus), retroviruses (e.g. the gammaretrovirus XMRV and
the lentiviruses HIV-1 & -2), filoviruses (e.g. Ebolavirus, hemorrhagic fever
virus) or hepatitis B virus (a DNA virus with a genomic RNA intermediate).

41. The method of Claim 38 wherein the viral infection is caused by a virus
with
a DNA genome.

42. The method of Claim 41 wherein the virus is human papillomavirus, herpes
simplex virus-1 and -2, cytomegalovirus, or human herpesvirus-8.

43. The method of Claim 41 wherein the virus is Variola virus (smallpox
virus),
Monkeypox virus, Molluscum contagiosum virus, Epstein-Barr virus,
adenovirus, varicella-zoster virus, human herpesvirus 6, human herpesvirus
7, B19 parvovirus, adeno-associated virus, BK virus, and JC virus, human
papillomavirus, herpes simplex virus-1 and -2, cytomegalovirus, or human
herpesvirus-8.

44. A method for treating a subject with cancer comprising administering to
the
subject an effective amount of the pharmaceutical composition of any one of
Claims 1-37.

45. The method of Claim 44 wherein the cancer is prostate cancer, ovarian
cancer, brain cancer or bone cancer.



-37-


46. A method for treating restenosis in a subject comprising administering to
the
subject an effective amount of the pharmaceutical composition of any one of
Claims 1-37.

47. A compound represented by the following structural formula:
Image
or a pharmaceutically acceptable salt thereof, wherein:
Ring A and Ring B are optionally and independently substituted at
any one or more substitutable ring carbon atoms;
Y is CH, N or N+-O-;
Z1 and Z2 are independently O or S;
Z3 is CR1 or N;
R1 is -H, -C(O)H, -C(O)R20, -C(O)OR30 or a C1-C5 alkyl group
optionally substituted with one or more groups selected from halogen,
hydroxyl, -OR20, nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR30, -OC(O)H and
-OC(O)R20 or R1 is a group represented by the following structural formula:
Image

R2 is -H or a C1-C5 alkyl group optionally substituted with one or
more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H,
-C(O)R20, -C(O)OR20, -OC(O)H or -OC(O)R20;
each R20 is independently C1-C3 alkyl or C1-C3 haloalkyl; and



-38-



R30 is C1-C3 alkyl, C1-C3 haloalkyl or a group represented by a structural
formula selected from:

Image
provided that the compound is not represented by a structural formula
selected from:

Image



-39-



Image
or a pharmaceutically acceptable salt thereof.

48. The compound of Claim 47 wherein Z1 is O and Z2 is S.

49. The compound of Claim 48 wherein the compound is represented by the
following Structural Formula:



-40-



Image
or a pharmaceutically acceptable salt thereof.
50. The compound of Claim 47 whereiin:
Ring A is substituted at any one or more substitutable ring carbon
atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy,
-OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3
alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or
-OC(O)R21 or Ring A is optionally substituted with a group represented by
the following structural formula:

Image
Ring B is substituted at any one or more substitutable ring carbon
atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy,
-OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40,
-CH2OCH2R40, -OCH2R40 or a C1-C3 alkyl group substituted with hydroxyl,
-OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21;



-41-


each R21 is independently H, C1-C3 alkyl or C1-C3 haloalkyl; and
R40 is -COOH, -PO3H2, -SO3H, -PO2H or -SO2H.

51. The compound of Claim 50 whereiin:
Ring B is substituted at any one or more substitutable ring carbon
atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -
OR21,
-C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40, -CH2OCH2R40 or
a C1-C3 alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H

or -OC(O)R21;
each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl.

52. The compound of Claim 50 or 51 wherein each R20 is independently C1-C3
alkyl, each R21 is independently C1-C3 alkyl, each R30 is independently C1-
C3 alkyl and R2 is -H.

53. The compound of Claim 48 wherein the compound is represented by the
following Structural Formula:

Image
or a pharmaceutically acceptable salt thereof.
54. The compound of Claim 53 wherein:
Ring A is substituted at any one or more substitutable ring carbon
atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy,
-OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3



-42-


alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or
-OC(O)R21 or with a group represented by the following structural formula:

Image
Ring B is substituted at any one or more substitutable ring carbon
atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy,
-OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40,
-CH2OCH2R40 or a C1-C3 alkyl group substituted with hydroxyl, -OR21,
keto, -C(O)OR21, -OC(O)H or -OC(O)R21;
each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl; and
R40 is -COOH, -PO3H2, -SO3H, -PO2H or -SO2H.

55. The compound of Claim 54 wherein each R21 is independently C1-C3 alkyl,
and R2 is -H.

56. The compound of Claim 48 wherein the compound is represented by the
following Structural Formula:

Image
or a pharmaceutically acceptable salt thereof.



-43-


57. The compound of Claim 56 wherein:
Ring A is substituted at any one or more substitutable ring carbon
atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy,
-OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3
alkyl group substituted with hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or
-OC(O)R21 or with a group represented by the following structural formula:

Image
Ring B is substituted at any one or more substitutable ring carbon
atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy,
-OR21, -C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21, -(CH2)3R40,
-CH2OCH2R40 or a C1-C3 alkyl group substituted with hydroxyl, -OR21,
keto, -C(O)OR21, -OC(O)H or -OC(O)R21;
each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl; and
R40 is -COOH, -PO3H2, -SO3H, -PO2H or -SO2H.

58. The compound of Claim 57 wherein each R21 is independently C1-C3 alkyl
and R2 is -H.

59. A compound represented by the following structural formula:



-44-



Image
or a pharmaceutically acceptable salt thereof, wherein:
Z3 and Z4 are independently O or S;
Ring C and Ring D are optionally and independently substituted at
any one or more substitutable ring carbon atoms;
R3 is -H or a C1-C5 alkyl group optionally substituted with one or
more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H,
-C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20; and
each R20 is independently C1-C3 alkyl or haloalkyl, provided that the
compound is not represented by a structural formula selected from:
Image



-45-


or a pharmaceutically acceptable salt thereof.

60. The compound of Claim 59 wherein the compound is represented by the
following structural formula:

Image
or a pharmaceutically acceptable salt thereof.

61. The compound of Claim 60 wherein Ring C is optionally substituted at any
one or more substitutable ring carbon atoms with C1-C3 alkyl, halogen, =O,
hydroxyl or C1-C3 alkoxy.

62. The compound of Claim 61 wherein Ring D is optionally substituted at any
one or more substitutable carbon atoms with halogen, C1-C3 alkyl, C1-C3
haloalkyl, nitro, cyano, hydroxy, -OR21, -C(O)H, -C(O)R21, -C(O)OR21,
-OC(O)H, -OC(O)R21 or a C1-C3 alkyl group substituted with halogen,
hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H or -OC(O)R21 and
each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl.
63. The compound of Claim 62 wherein R3 is -H.

64. The compound of Claim 63 wherein Ring C is unsubstituted.
65. A compound represented by the following structural formula:



-46-



Image
or a pharmaceutically acceptable salt thereof, wherein:
Z5 and Z6 are independently O or S;
Ring E and Ring F are optionally and independently substituted at
any one or more substitutable ring carbon atoms;
R6 is -H or a C1-C5 alkyl group optionally substituted with one or
more groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H,
-C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20;
R7 and R8 are independently -H, a C1-C5 alkyl group or a C1-C5
haloalkyl group; and
each R20 is independently C1-C3 alkyl or haloalkyl, provided that the
compound is represented by a structural formula other than:

Image
or a pharmaceutically acceptable salt thereof.
66. The compound of Claim 65 wherein Z5 is S and Z6 is O.



-47-


67. The compound of Claim 66 wherein Ring E and Ring F are optionally and
independently substituted at any one or more substitutable carbon atoms with
halogen, C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano, hydroxy, -OR21,
-C(O)H, -C(O)R21, -C(O)OR21, -OC(O)H, -OC(O)R21 or a C1-C3 alkyl
group substituted with halogen, hydroxyl, -OR21, keto, -C(O)OR21, -OC(O)H
or -OC(O)R21; and
each R21 is independently C1-C3 alkyl or C1-C3 haloalkyl.
68. The compound of Claim 67 wherein R6 is -H.

69. The compound of Claim 68 wherein R7 and R8 are independently -H or a
methyl.

70. A compound represented by the following structural formula:
Image
or a pharmaceutically acceptable salt thereof, wherein:
X1 and X2 are independently CH2, NH or O;
X3 is -O-C(O)-, -O-C(S)-, -S-C(O)-, -S-C(S)-, -C(O)-, C(S)-, -CH2-,
-CH(CH3)-, -NHC(O)-, -C(O)NH-, -NHC(S)- or -C(S)NH-;
Z8 and Z9 are independently S or O;
Ring G is optionally substituted at any one or more substitutable ring
carbon atoms;
R9 is a C1-C5 alkyl group optionally substituted with one or more
groups selected from halogen, hydroxyl, -OR20, nitro, cyano, -C(O)H,
-C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20;



-48-


R10 and R11 are independently -H or a C1-C5 alkyl group optionally
substituted with one or more groups selected from halogen, hydroxyl, -OR20,
nitro, cyano, -C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H and -OC(O)R20;
R12 is -H; a C1-C5 alkyl group optionally substituted with one or
more groups represented by R21; a monocyclic aromatic group optionally
substituted at any one or more substitutable ring carbon atoms with a group
represented by R22; or a monocyclic C1-C3 aralkyl group optionally
substituted at any one or more substitutable ring carbon atoms with R23;
each R20 is independently C1-C3 alkyl or C1-C3 haloalkyl;
each R21 is independently halogen, hydroxyl, -OR20, nitro, cyano,
-C(O)H, -C(O)R20, -C(O)OR20, -OC(O)H or -OC(O)R20;
each R22 and R23 is independently C1-C3 alkyl, C1-C3 haloalkyl,
nitro, cyano, hydroxy, -OR24, -C(O)H, -C(O)R24, -C(O)OR24, -OC(O)H,
-OC(O)R24 or C1-C3 alkyl substituted with hydroxyl, -OR24, keto,
-C(O)OR24, -OC(O)H or -OC(O)R24 and
R24 is C1-C3 alkyl or C1-C3 haloalkyl, provided that the compound
is not represented by a structural formula selected from:



-49-



Image
or a pharmaceutically acceptable salt thereof.

71. The compound of Claim 70 wherein R12 is -H; a C1-C5 alkyl group
optionally substituted with a group represented by R21; a phenyl group
optionally substituted with a group represented by R22; or a C1-C3 phenalkyl
group optionally substituted at any one or more substitutable ring carbon
atoms with R23.




-50-


72. The compound of Claim 71 wherein the compound is represented by the
following structural formula.

Image
or a pharmaceutically acceptable salt thereof.

73. The compound of Claim 72 wherein the compound is represented by the
following structural formula:

Image
or a pharmaceutically acceptable salt thereof, wherein X3 is -O-C(O)- or
-C(O)-.

74. The compound of Claim 73 wherein the compound is represented by the
following structural formula:

Image
or a pharmaceutically acceptable salt thereof.



-51-

75. The compound of Claim 74 wherein Ring G is optionally substituted at any
one or more ring carbon atoms with halogen, C1-C3 alkyl, C1-C3 haloalkyl,
nitro, cyano, hydroxy, -OR25, -C(O)H, -C(O)R25, -C(O)OR25, -OC(O)H,
-OC(O)R25 or C1-C3 alkyl substituted with hydroxyl, -OR25, keto,
-C(O)OR25, -OC(O)H or -OC(O)R25 and
each R 25 is independently C1-C3 alkyl or C1-C3 haloalkyl.

76. The compound of Claim 75 wherein R9 is a C1-C5 alkyl group optionally
substituted with halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloalkoxy.
77. The compound of Claim 76 wherein R12 is-H; an alkyl group optionally
substituted with a group represented by R21; or a benzyl group optionally
substituted at any one or more substitutable ring carbon atoms with R23;
R21 halogen, hydroxyl, C1-C3 alkoxy or C1-C3 haloalkoxy;
each R23 is independently C1-C3 alkyl, C1-C3 haloalkyl, nitro, cyano,
hydroxy, -OR24, -C(O)H, -C(O)R24, -C(O)OR24, -OC(O)H, -OC(O)R24 or
C1-C3 alkyl substituted with hydroxyl, -OR24, keto, -C(O)OR24, -OC(O)H or
-OC(O)R24.

78. The compound of Claim 77 wherein R10 is methyl, halomethyl or
hydroxymethyl.
79. The compound of Claim 78 wherein R9 is C1-C5 alkyl; R10 is -C(Cl)3; and
R12 is C1-C5 alkyl or benzyl.

Description

CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-1-

ANTI-VIRAL AGENTS THAT ACTIVATE RNASE L
GOVERNMENT SUPPORT
The invention was supported, in whole or in part, by a grant NIH (NCI)
1R01 CA044059-21 from National Institutes of Health. The Governrnent has
certain rights in the invention.

RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Application No.
60/795,069, filed April 25, 2006, the entire teachings of which are
incorporated
herein by reference.

BACKGROUND OF THE INVENTION
Preclinical studies on RNase L, an antiviral enzyme in the interferon (IFN)
system, have suggested that it is an important target for cancer therapeutics
and
antiviral agents (Adah SA, Bayly SF, Cramer H, Silverman RH, Torrence PF.
(Curr
Med Chem. 2001 Aug;8(10):1189-212). For example, the hereditary prostate
cancer 1(HPCI) susceptibility locus was recently mapped to the RNase L gene
(Carpten J, Nupponen N, Isaacs S, Sood R, Robbins C, Xu J, Faruque M, Moses T,
Ewing C, Gillanders E, Hu P, Bujnovszky P, Makalwska I, Baffoe-Bonni A, Faith
D, Smith J, Stepah D, Wiley K, Brownstein M, Gildea D, Kelly B, Jenkins R,
Hostetter G, Matikainen M, Schleutker J, Klinger K, Conners T, Xiang Y, Wang
Z,
Demarzo A, Papdopoulos N, Kallioniemi O-P, Burk R, Meyers D, Gronberg H,
Meltzer P, Silverman R, Bailey-Wilson J, Walsh P, Isaacs W, Trent J. Nature
Genetics 2002, Jan 22). Also, the gene that confers resistance to flaviviruses
including West Nile virus was mapped to a gene in the RNase L pathway (OAS l
b)
(Perelygin AA, Scherbik SV, Zhulin IB, Stockman BM, Li Y, Brinton MA. Proc
Natl Acad Sci USA. 2002 Jul 9;99(14):9322-7). In nature, RNase L is activated
during the interferon antiviral response by small, unusual oligoadenylates
with 2',5'-


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-2-
intemucleotide linkages (known as "2-5A") (Kerr IM, Brown RE Proc Natl
AcadSci USA. 1978 Jan;75(l):256-60; Zhou A, Hassel BA, Silverman RH. Cell.
1993 Mar 12;72(5);753-65). In addition, it has been previously demonstrated
that
RNase L participates in the anti-cell proliferation activity of IFN (Hassel
BA, Zhou
A, Sotomayor C, Maran A, Silverman RH. EMBO J. 1993 Aug;12(8):3297-304).
2-5A'induces through RNase L the degradation of ribosomal RNA (rRNA) and
messenger RNA (mRNA), thereby reducing levels of protein synthesis, properties
that if applied to aortic smooth muscle cells, coiuld prevent restenosis
following
angioplasty. 2-5A, however, has undesirable properties for a therapeutic agent
in
that: 1) it is unstable in serum and in cells due to the action of
phosphodiesterases
and phosphatases; and 2) it is an intracellular mediator which does not
transit the
cell membranes. Thus, there is a need for new activators of RNase L for
clinical use.
SUMMARY OF THE INVENTION
The invention is based on the discovery of a number of compounds which
activate RNase L (see Example 3) (hereinafter the "disclosed RNase L
activators").
These RNase L activators have antiviral activity (see Example 6) , including
against
Parainfluenza Virus 3 (HPIV3), Picomavirus and Encephalomyocarditis Virus
(EMCV). The disclosed activators of RNase L also inhibit smooth muscle cell
proliferation in vitro (see Example 7), and therefore have utility in treating
restenosis. It has also unexpectedly been found that the disclose RNase
activators
are not cytotoxic (Example 5). Based on these discoveries, novel RNase L
activators, pharmaceutical compositions comprising these RNase L activators
and
methods of treatment with these RNase L activators are disclosed herein.
The disclosed RNase activators, pharmaceutical compositions comprising the
same and methods of treating using the same are described with particularity
in the
claims.

BRIEF DESCRIPTION OF THE DRAWINGS
Figures lA-1F are graphs showing the dose-response and kinetics of RNase
L activation versus concentration in -M (Figures 1 A-1 C) or versus time in
minutes
(Figures 1D-1E) with 2-5A or small molecule activators. Assays were by the
RNase


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-3-

L FRET method and were performed at 22 C. (A, D) ppp(A2'p5'A)2; (B, E)
Compound 1; and (C,F) Compound 2.
Figure 2 shows the structures of small molecule activators of RNase L
(Compounds 1-12) and their EC50 concentrations required for 50% degradation in
the RNA FRET probe. NA means no activity.
Figure 3 shows (A,B) Altemative ribonuclease assays and (C) RNase L
dimerization assays for 2-5A, compound 1(C-1) and compound 2 (C-2). (A) 25 nM
trimeric 2-5A (lanes 1, 2), 25 ^-M C-1 (lanes 3, 4), 25 -M C-2 (lanes 5, 6)
with or
without 25nM RNase L in presence of the RNA substrate,
GGACUUUUUUUCCCUUUUUUUCC[32P]pCp, at 22 C for 30 min. (B) 25nM
trimeric 2-5A (lanes 2, 3), 25 -M C-1 (lanes 4, 5), 25 -M C-2 (lanes 6, 7) was
incubated with or without 25nM RNase L and RNA, C7U2C12-[32P]pCp, at 22 C for
30 min. The cleaved RNAs were separated in 20% acrylamide/7 M urea/TBE
sequencing gels. (C) Covalent cross-linking of RNase L by dimethyl
suberimidate
(DMS). DMS was incubated with RNase L and trimer 2-5A (lanes 2 to 5), C-1
(lanes 6 to 9), or C-2 (lanes 10 to 13). After SDS-polyacrylamide gel
electrophoresis, the proteins were transferred to nitrocellulose and probed
with
monoclonal antibody against RNase L.
Figures 4A and 4B are graphs showing the displacement of 2-5A-biotin
binding with RNase L by compounds 1 and 2 as determined by surface plasmon
resonance. Biotinylated 2-5A was immobilized on streptavidin biosensor chip
(Biacore). RNase L (10 nM) in presence of varying concentration of either
compound 1(A) or compound 2 (B) was allowed to flow over the chip at a rate of
20 l/min for five min. Sensograms were recorded and analyzed using Bia-
evaluationTM software. R,,,. in each case was plotted against the increasing
concentration of the compound in -M.

Figures 5A-5C are graphs showing the cytotoxicity of Compounds 1 and 2 to
DU125 cells in an MTS conversion assay. The cytoxicity is measured by the
absorbance at 490 nanometers versus concentration in -M on Day 1(Figure 5A),


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-4-
Day 2 (Figure 5B) and Day 3 (Figure 5C). The results for Compound I are
represented with blue; and the results for Compound 2 are represented with
red.
Figures 6A-6B are graphs showing the cytotoxicity of Compounds I and 2 to
Hela M cells in an MTS conversion assay. The cytoxicity is measured by the

absorbance at 490 nanometers versus concentration in -M on Day 1. The results
for
.Compound 1 are represented with blue; and the results for Compound 2 are
represented with red. Figure 6A shows results for Hela M cells expressing
RNase L;
Figure 6B shows results for Hela M cells expressing a nuclease-dead mutant of
RNase L.
Figure 7 shows photographs under inverted fluorescence microscope
showing that Compound 2 suppresses replication of HPIV3/GFP. HeLa M cells
deficient in RNase L were used as empty vector control cells, expressing wild
type
RNase L or in expressing a nuclease-dead mutant (R667A) RNase L. Pictures were
captured using an inverted fluorescence microscope.
Figure 8 is a bar graph showing the antiviral effect of compound 2 at varying
concentrations in -M against encephalomyocardutus virus (EMCV), as measured
by the number of plagues x 10"7.
Figure 9 includes a bar graph showing the growth of MEF RL+'+ cells grown
with 0, 25, and 50 M of Compound 2. The bar graph shows the percentage of
viral
plaques obtained as compared to the control (0 M compound 2, 100% = 2.5 x] 04
PFU/mL). Increasing the concentration of compound 2 decreased the appearance
of
viral yield as determined by the plaque assay. Directly under each compound 2
concentration is the corresponding agar plate, stained with neutral red.
Again, the
plates indicate the decreased viral yield with increasing compound 2'
coneentration
as determined by the plaque assay.
Figure 10 is a bar graph showing the percentage of viral plaques obtained for
MEF RL+~+, BSC 40, and MEF RL '~" cells grown in the absence or presence of
compound 2. Compound 2 inhibited the viral titer for MEF RL+l+ and BSC 40
cells.
Cells lacking the RNase L gene were resistant to compound 2. (Untreated
controls
(0 M compound 2 added) in PFU/mL counts at 100%: MEF RL+'+: 2.5 x 10 ; BSC
40: 2.5 x 104; and MEF RL -/-: 3.5 x 104).


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-5-

Figure 11 is a photograph of treated (50 M compound 2) and untreated ( 0
M compound 2 added) MEF RL+l+ cells on agar plates stained with neutral red.
Presence of compound 2 resulted in the decreased viral plaque count.
Figure 12: Table containing the actual viral plaque counts as determined by
the plaque assay for both MEF RL"+ and MEF RL-1" cells. Viral yield in MEF
RL+i+
cells decreased in the presence of compound 2. Compound 2 did not decrease
viral
yield in MEF RL-1- cells. The viral dilution indicate that a 10-fold viral
dilution
resulted in a 10-fold decrease viral plaque count.

DETAILED DESCRIPTION OF THE INVENTION
A "subject" is preferably a human but can also be a veterinary animal, farm
animal or laboratory animal in need of treatment for a viral infection, cancer
or
restensosis.
Viral infections which can be treated with the disclosed RNase L activators
include viruses with single-stranded RNA(s) for their genome. Examples include
orthomyxoviruses (e.g. influenza viruses), paramyxoviruses (e.g. respiratory
syncytial virus & human parainfluenza virus-3), rhabdoviruses (e:g. rabies
virus),
togaviruses (e.g. rubella virus and eastern equine encephalitis virus),
picornaviruses
(e.g. poliovirus & Coxsackieviruses), flaviviruses (e.g. West Nile virus,
Dengue
.20 virus, and hepatitis C virus), bunyaviruses (e.g. LaCrosse virus, Rift
Valley fever
virus & Hantavirus), retroviruses (e.g. the gammaretrovirus XMRV and the
lentiviruses HIV-1 & -2), filoviruses (e.g. Ebolavirus, hemorrhagic fever
virus) or
hepatitis B virus (a DNA virus with a genomic RNA intermediate).
The disclosed RNase L activators can also be used to treat infections from
certain DNA viruses, including human papillomavirus, herpes simplex virus-1
and -
2, cytomegalovirus, and human herpesvirus-8. Additionally, the disclosed RNase
L
activators can also be used to treat infections from certain DNA viruses
including
Variola virus (smallpox virus), Monkeypox virus, Molluscum contagiosum virus,
Epstein-Barr virus, adenovirus, varicella-zoster virus, human herpesvirus 6,
human
herpesvirus 7, B19 parvovirus, adeno-associated virus, BK virus, and JC virus
as
well.


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-6-
Transfection of PC3 or DU145 cells with 2-5A causes apoptosis (Xiang Y,
Wang Z, Murakami J, Plummer S, Klein EA, Carpten JD, Trent JM, Isaacs WB,
Casey G, Silverman RH. Cancer Res. 2003 Oct 15; 63(20):6795-801). Both
DU145 and PC3, cell lines derived from metastatic brain and bone prostate
cancer
cases respectively, are wild type for RNase L. In addition, 2-5A transfection
causes
caspase-dependent apoptosis in human ovarian carcinoma cells through a
mitochondrial pathway (Rusch L, Zhou A, Silverman RH. Jlnterferon Cytokine
Res. 2000 Dec;20(12):1091-100). Furtheirnore, 2-5A linked to antisense against
telomerase RNA caused apoptosis and anti-tumor activities against DU145 tumors
in nude mice (Kondo Y, Koga S, Komata T, Kondo S. Oncogene. 2000 Apr
27;19(18):2205-11). Based on the foregoing, the disclosed activators of RNase
L
can be used to treat cancers.
Examples of cancers which can be treated with the disclosed RNase L
activators include, but are not limited to, human sarcomas and carcinomas,
e.g.,
fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma,
chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma,
lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor,
leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast
cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell
carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma,
papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary
carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct
carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor,
cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma,
bladder
carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma,
craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic
neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma and
retinoblastoma. The disclosed RNase L activators are commonly used to treat
prostate cancer, ovarian cancer, brain cancer or bone cancer.
Restenosis is a condition which can develop in blood vessels which have
undergone coronary procedures or peripheral procedures with PTCA balloon
catheters (e.g. percutaneous transluminal angioplasty). Restenosis is the


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-7-

development of scar tissue from about three to six months after the procedure
and
results in narrowing of the blood vessel. Restenosis is caused excessive
smooth
muscle proliferation. Because the disclosed RNase L activators inhibit smooth
muscle proliferation, it is believed that these compounds can be used to
inhibit, treat
and/or prevent restenosis.
The term "alkyl" as used herein means saturated straight-chain or branched
hydrocarbons. "Haloalkyl" is an alkyl substituted with one or more halogens.
The
term "halogen" means F, Cl, Br or I. Preferably the halogen in a haloalkyl or
haloalkoxy is F.
The term "aromatic group" used alone or as part of a larger moiety as in
"aralkyl", includes carbocyclic aromatic rings and heteroaryl rings. The term
"aromatic group" may be used interchangeably with the terms "aryl", "aryl
ring"
"aromatic ring", "aryl group" and "aromatic group". "Aralkyl" is an alkyl
group
substituted with an aromatic group. "Phenalkyl" is an alkyl group substituted
with a
phenyl group.
A "monocyclic aromatic group" is an aromatic group with only one ring.
Carbocyclic aromatic ring groups have only carbon ring atoms and include
monocyclic aromatic rings such as phenyl.
The term "heteroaryl", "heteroaromatic", "heteroaryl ring", "heteroaryl
group" and "heteroaromatic group", used alone or as part of a larger moiety as
in
"heteroaralkyl" or "heteroarylalkoxy" refers to an aromatic group with one or
more
heteroatoms such as nitrogen, sulfur or oxygen as a ring atom. Monocylic
heteroaryl
groups have five or six members and one or more ring heteroatoms, such as
nitrogen, oxygen and sulfur. Examples of monocyclic heteroaryl groups include
2-
furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-
isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxadiazolyl, 5-oxadiazolyl, 2-
oxazolyl, 4-
oxazolyl, 5-oxazolyl, 3-pyrazolyl, 4-pyrazolyl, 1-pyrrolyl, 2-pyrrolyl, 3-
pyrrolyl, 2-
pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, 3-
pyridazinyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-triazolyl, 5-triazolyl,
tetrazolyl, 2-
thienyl and 3-thienyl.
A "substitutable ring carbon atom" in an aromatic group is a ring carbon
atom bonded to a hydrogen atom. The hydrogen can be optionally replaced with a


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-8-
suitable substituent group. Thus, the term "substitutable ring carbon atom"
does not
include ring carbon atoms which are shared when two rings are fused. In
addition,
"substitutable ring carbon atom" does not include ring carbon atoms when the
structure depicts that they are already attached to a moiety other than
hydrogen.
Examples of suitable substituents on a substitutable ring carbon atom of an
aryl (e.g., phenyl) group include halogen, R , -OR , -O(haloalkyl), -SR ,
trialkylsilyl,
boronate, alkylboronate, dialkylboronate, -NO2, -CN, -N(R')z, -NR' C02R ,
-NR'C(O)R , -NR'NR'C(O)R , -N(R')C(O)N(R')2, -NR'NR'C(O)N(R')2,
-NR'NR'C02R , -C(O)C(O)R , -C(O)CH2C(O)R , -C02R , -C(O)R , -C(O)N(R )2,
-OC(O)R , -OC(O)N(R )2, -S(O)2R , -SO2N(R')2, -S(O)R , -NR'SO2N(R')2, -
NR'S02R , -C(=S)N(R')2, -NR'-C(=NH)-N(R')2 and -C(=NH)-N(R')z or two
adjacent ring carbon atoms may be substituted with 1,2-methylene-dioxy or 1,2-
ethylene-dioxy.
Each R is independently hydrogen or an alkyl group.
Each R' is hydrogen or an alkyl group.
When specifying that an aralkyl group has a certain number of carbon atoms,
it is to be understood that it is the number of carbon atoms in the alkyl
portion of the
aralkyl that is being specified. For example, a C 1-C2 aralkyl group has one
or two
carbon atoms in the alkyl portion.
Pharmaceutically acceptable salts include acid salts of a disclosed RNase L
activator containing an amine or other basic group and can be obtained by
reacting
the compound with a suitable organic or inorganic acid, such as hydrogen
chloride,
hydrogen bromide, acetic acid, perchloric acid and the like. Other examples of
such
salts include sulfates, methanesulfonates, nitrates, maleates, acetates,
citrates,
fumarates, tartrates [e.g. (+)-tartrates, (-)-tartrates or mixtures thereof
including
racemic mixturesJ, succinates, benzoates and salts with amino acids such as
glutamic
acid.
Salts of a disclosed RNase L activator containing a carboxylic acid or other
acidic functional group can be prepared by reacting with a suitable base. Such
a
pharmaceutically acceptable salt may be made with a base which affords a
pharmaceutically acceptable cation, which includes alkali metal salts
(especially
sodium and potassium), alkaline earth metal salts (especially calcium and


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-9-

magnesium), aluminum salts and ammonium salts, as well as salts made from
physiologically acceptable organic bases such as trimethylamine,
triethylamine,
morpholine, pyridine, piperidine, picoline, dicyclohexylamine, N,N'-
dibenzylethylenediamine, 2-hydroxyethylamine, bis-(2-hydroxyethyl)amine, tri-
(2-

hydroxyethyl)amine, procaine, dibenzylpiperidine, N-benzyl-(3-phenethylamine,
dehydroabietylamine, N,N'-bisdehydroabietylamine, glucamine, N-

methylglucamine, collidine, quinine, quinoline, and basic amino acid such as
lysine
and arginine.
"Treatment" or "treating" refers to both therapeutic and prophylactic
treatment.
An "effective amount" is the quantity of a disclosed RNase L activator in
which a beneficial clinical outcome (prophylactic or therapeutic) is achieved
when
the compound is administered to a subject in need of treatment. For the
treatment of
a viral infection, a "beneficial clinical outcome" includes a reduction in the
severity
of the symptoms associated with the disease (e.g., fever), a reduction in the
longevity of the disease and/or a delay in the onset of the symptoms
associated with
the disease compared with the absence of the treatment. For the treatment of
cancer,
a beneficial clinical outcome includes a reduction in tumor mass, a reduction
in the
rate of tumor growth, a reduction in metastasis, a reduction in the severity
of the
symptoms associated with the cancer and/or an increase in the longevity of the
subject compared with the absence of the treatment. For restenosis, a
"beneficial
clinical outcome" includes a slowing or reduction in the narrowing of a blood
vessel
which has undergone angioplasty. The precise amount of a disclosed RNase L
activator administered to a subject will depend on the type and severity of
the
disease or condition and on the characteristics of the subject, such as
general health,
age, sex, body weight and tolerance to drugs. It will also depend on the
degree,
severity and type of disease or condition. The skilled artisan will be able to
determine appropriate dosages depending on these and other factors. Effective
amounts of the disclosed RNase L activator typically range between about 0.1
mg/kg
body weight per day and about 1000 mg/kg body weight per day, and preferably
between 1 mg/kg body weight per day and 100 mg/kg body weight per day.


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-10-
The disclosed RNase L activators and pharmaceutically acceptable salts,
solvates and hydrates thereof can be used in pharmaceutical preparations in
combination with a pharmaceutically acceptable carrier or diluent. Suitable
pharmaceutically acceptable carriers include inert solid fillers or diluents
and sterile
aqueous or organic solutions. The disclosed RNase L activator will be present
in
such pharmaceutical compositions in amounts sufficient to provide the desired
dosage amount in the range described herein. Techniques for formulation and
administration of the compounds of the instant invention can be found in
Remington: the Science and Practice of Pharmacy, 19`h edition, Mack Publishing
Co., Easton, PA (1995).
For oral administration, the disclosed RNase L activator or salts thereof can
be combined with a suitable solid or liquid carrier or diluent to form
capsules,
tablets, pills, powders, syrups, solutions, suspensions and the like.
The tablets, pills, capsules, and the like contain from about 1 to about 99
weight percent of the active ingredient and a binder such as gum tragacanth,
acacias,
corn starch or gelatin; excipients such as dicalcium phosphate; a
disintegrating_agent
such as corn starch, potato starch, alginic acid; a lubricant such as
magnesium
stearate; and a sweetening agent such as sucrose lactose or saccharin. When a
dosage unit form is a capsule, it may contain, in addition to materials of the
above
type, a liquid carrier such as a fatty oil.
Various other materials may be present as coatings or to modify the physical
form of the dosage unit. For instance, tablets may be coated with shellac,
sugar or
both. A syrup or elixir may contain, in addition to the active ingredient,
sucrose as a
sweetening agent, methyl and propylparabens as preservatives, a dye and a
flavoring
such as cherry or orange flavor.
For parental administration the disclosed RNase L activators or salts thereof
can be combined with sterile aqueous or organic media to form injectable
solutions
or suspensions. For example, solutions in sesame or peanut oil, aqueous
propylene
glycol and the like can be used, as well as aqueous solutions of water-soluble
pharmaceutically-acceptable salts of the compounds. Dispersions can also be
prepared in glycerol, liquid polyethylene glycols and mixtures thereof in
oils. Under


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-11-
ordinary conditions of storage and use, these preparations contain a
preservative to
prevent the growth of microorganisms.
In addition to the formulations described previously, the disclosed RNase L
activators may also be formulated as a long acting formulation, such as a
depot
preparation. Such long acting formulations may be administered by
implantation,
or, for example, subcutaneously by intramuscular injection.
Preferably disclosed RNase L activators or pharmaceutical formulations
containing these compounds are in unit dosage form for administration to a
mammal. The unit dosage form can be any unit dosage form known in the art
including, for example, a capsule, an IV bag, a tablet, or a vial. The
quantity of the
disclosed RNase L activator in a unit dose of composition is an effective
amount and
may be varied according to the particular treatment involved. It may be
appreciated
that it may be necessary to make routine variations to the dosage depending on
the
age and condition of the patient. The dosage will also depend on the route of
administration which may be by a variety of routes including oral, aerosol,
rectal;
transdermal, subcutaneous, intravenous, intramuscular, intraperitoneal and
intranasal.

Synthetic Strategy:

Compounds of the generalized Formula III will be synthesized following the
procedure described by Faull and Hull [Faull and Hull. "Some reactions of
Ethyl 2-
Anilino-4oxo-4,5-dihydrothiophen-3carboxylate." Perkin Transactions 1, 1981,
1078-1082 ]. Z2 in Formula I is either S (isothiocyanate) or O(isocyanate).
Condensation with substituted benzaldehydes will generate compounds of the
structure depicted in Formula IV. Modification of Ring A is achieved by
selection
of substituted aldehydes. Modification of Ring B is described in Scheme 3 and
4.
Scheme 1:


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
- 12-

N NaH
zC V
DME Z2 ~~~ rt N O' + Rz piperidine R2

/ EtOH ",,~OR
G O OR OR
O O O O
Ii lll IV
The synthesis of Compound 1 follows this scheme directly.
Isothiocyanatobenzene
(V) will be coupled with ethyl 4-chloro-3-oxobutanoate (VI) under Faull and
Hull
conditions. Condensation of the 2,3-dihydrothiophene intermediate (VII) with 3-

hydroxybenzaldehyde will yield compound 1.

Scheme 2:

H0
C\\
N
NaH
DME s ~ / oH
rt NH O' NH
t V -- / piperidina
EtOH
iTi G O ~ O O
O O
VI VII Compound I

Modification of the substituents on Ring B will be accomplished prior to the
Faull-
Hull synthesis described in Scheme 1. A representative synthetic strategy to
produce Compound XII is shown in Scheme 3. Readily available (E)-methyl 3-(3-
nitrophenyl)acrylate (VIII) can be catalytically reduced the corresponding
amine
.(IX). Formation of the isothiocyanate (X) via the coupling of the amine and
carbon
disulfide in the presence of DCC yields the starting reactant similar to I in
Scheme 1.
Production of Compound XII follows the subsequent Faull-Hull synthetic
procedure.

Scheme 3:


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-13-

O O O
Pd/C; Atm H2 CSZ' ~C
1:1 MeOHROI Pyridin; n

O2N H,N 9=C~1
V Il l IX x
1. Piperidine, EtOH
~ p A; 4h HO ON
N
D E I ~ - ~
rt; Sh
3
N// 2. NaCN; HMPA NH
O~\ 75'C; 24 h
~

O O O O\\-
O O
xi Compound X II

Phosphonate compound XVIII will be prepared as shown in Scheme 4.
Commercially available 3-aminophenol (XIII) will be protected via standard
methodology with dibenzylpyrocarbonate in dioxane/H20 (1:1) with NaOH or Et3N
(to yield XIV). Deprotonation of the protected aminophenol with sodium hydride
and coupling with the previously described p-toluenesulfonyloxymethane
phosphonate in DMF (to yield compound XV) is followed by removal of the
beinzyloxycarbonyl protective group by transfer hydrogenation (to yield
compound
XVI). Conversion of the free amine to the isothiocyanate and condensation with
ethyl 4-chloro-3-oxobutanoate to form the thiophene ring are directly
analogous
with synthesis of compound XII. Following the coupling of the thiophene ring
with
3-hydroxybenzaldehyde, selective deprotection of the dimethyl phosphonate
ester
(XVII) is then accomplished with aqueous pyridine to produce compound XVIII.

Scheme 4:


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-14-

\ MaC; ~Ta \
I (PhCH2OC0}to I O~OMo I O OMe
Dioxane. H20 NaN/DAT CCzN / o p
H=N OH NaOH or Et3N CtxN OH
OMe
xnr xiv xv

HO
1 . Cs2; DCC 1 / / /~~I,oMa
Pd/C Pyridine; rt O p
EtOH O 2. NaH
rt ~~II~oMo DME; rt s I
NH OMe
H=N P 3. Piperdine EcOH;
i A \ /
XVI OMe HO XVIl
O O
O
HO 1 \ I ~ ~oH
Aq. Pyridine O p

S NH IH
O O
O
Compound XVIII

The invention is illustrated by the following examples, which are not
intended to be limiting in any way.
EXEMPLIFICATION
Example 1- Assay For Identifying Agents that Activate RNase L

The assay is based on fluorescence resonance energy transfer (FRET). The
method includes recombinant human RNase L produced in insect cells, from a
baculovirus vector, and purified by FPLC (Thakur CS, Xu Z, Wang Z, Novince Z,
Silverman RH. A convenient and sensitive fluorescence resonance energy
transfer
assay for RNase L and 2',5' oligoadenylates. Methods Mol Med 2005;116:103-13).
The cleavable RNA substrate is a 36-nucleotide synthetic oligoribonucleotide
with a
fluorophore (6-carboxyfluorescein, FAM) at the 5'-terminus and a quencher
(black
hole quencher-1, BHQ1), at the 3'-terminus. The RNA sequence is from the
intergenic-region of the paramyxovirus, respiratory syncytial virus (RSV)
genomic


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
- 15-

RNA. The RSV sequence was chosen because it contains several cleavage sites
for
RNase L (UU or UA) in an optimal context for cleavage. To demonstrate the
effectiveness of the assay, RNA cleavage reactions were performed in 96-well
black
microtiter plates containing RNase L, the cleavable FRET RNA substrate and 2-
5A.
The EC50 is routinely obtained (concentration of activator to give 50% maximum
activation) of 0.3 nM with authentic trimer 2-5A [p3A(2'p5'A)2] as the
activator of
RNase L (Fig. 1 A). The dephosphorylated trimer, A(2'p5'A)2, was unable to
activate
RNase L, consistent with prior findings (Fig. I A&D). Dong B, Xu L, Zhou A,
Hassel BA, Lee X, Torrence PF, Silverman RH. Intrinsic molecular activities of
the
interferon-induced 2-5A-dependent RNase. JBiol Chem 1994;269(19):14153-8. The
inactive, dephosphorylated 2-5A molecule is referred to as "core 2-5A". The
signal-
to-noise ratio was about 10:1 and the assay was very robust. There was no
increase
in the signal with time in reactions containing the RNA but lacking either
RNase L
or 2-5A.
Example 2 - Identification of RNase L Inhibitors
High throughput screening was performed as described in Example 1 on the
ChemBridge DIVERset of 34,000 small molecules (ChemBridge Co., San Diego).
Compounds providing at least 4-fold signals over background were chosen as
potential positives for ie-testing.
Seven "hits" were obtained (Fig. 2, compounds I to 7). The hits had
molecular weights that range from 298 to 470 Da and were capable of activating
RNase L in micromolar range (EC50's between 22 and 99 -M) (Figs. I and 2). The
kinetics of RNA cleavage in the FRET assay show near maximal activation by
pppA(2'p5'A)2 in 15 min, whereas compounds I and 2 required 60 to 90 min to
achieve maximal level of RNA degradation (Fig. 1D-F).
Other compounds related in structure to these activators were identified in
ChemBridge repository using a searchable database (http://www.hit2lead.com).
Two compounds related in structure to compound 1, were either active
(compounds
8-11) or inactive (compound 12) (Fig. 2).


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-16-
Example 3- Compounds 1 and 2 Activate RNase L in Ribonuclease Assays with
Labeled Substrates
To verify that these compounds are in fact capable of activating RNase L,
alternative, conventional ribonuclease assays were performed with two
different 32P-
labeled RNA substrates (Fig. 3A&B). In these assays, 25 M of compound 1(Fig.
3A, lanes 3&4), and 25 M compound 2 (Fig. 3A, lanes 5&6) were incubated in
the
presence and absence of purified human RNase L with the synthetic RNA
substrate
GGACUUUUUUUCCCUUUUUUUCC-[32P]pCp (SEQ ID NO.: 1). RNase L
activated by 2-5A or compounds 1 or 2 cleaved the substrate on the 3' side of
the
UU dinucleotide sequence, consistent with our FRET assay findings.
RNase L activation by lead compounds 1 and 2 was further supported using a
sequence specific substrate C7U2C12 (Fig. 3B) (SEQ ID NO.: 2). Compouind 1
(25 M) (lanes 4&5), and compound 2(254M) (lanes 6&7) were separately
incubated in the presence and absence of RNase L with the radiolabeled RNA
substrate. RNase L activated by 2-5A, compound I or compound 2 cleaved the
substrate on the 3'-side of the UU dinucleotide sequence. In the absence of
activator
no product band was detected.
RNase L dimerization is a prerequisite for the nuclease activation. To monitor
dimerization of RNase L, protein cross-linking assays were performed (Fig.
3C).
The oligomeric state of RNase L was determined in western blots probed with
monoclonal antibody against RNase L. Monomer RNase L converted to dimer in
the presence of 2-5A, compound 1, or compound 2 (Fig. 3C). These data show
that
micromolar levels of compounds 1& 2 activate RNase L and cause the enzyme to
dimerize.
Example 4- Compounds 1 and 2 Interact With the 2-5A Analog Binding Domain
Domain of RNase L
A 2-5A competition binding assay using surface plasmon resonance on a Biacore
model 3000T"' was used to determine if the activators interact with the 2-5A
binding
domain of RNase L. 2-5A analog used in these assays [p5'(A2'p)3A linked
through
its 2',3' terminal ribose to biotin] was generously provided for these efforts
by Dr. H.
Sawai (Gunma University, Japan). Streptavidin chips (Biacore Inc.) were pre-
coated


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-17-
with 2-5A-biotin. Mixtures of RNase L (10 nM) and varying concentrations of
compounds 1 or compound 2 or RNase L by itself were passed over the chips.
Sensograms were recorded and the maximum resonance units (R,,,.) at
equilibrium were plotted as a function of the compound concentrations using
Bia-
evaluationTM software (Fig. 4). A dose-dependent decrease in the resonance
response occurred with either compound 1 or 2. The data indicate that these
compounds compete with 2-5A for RNase L binding. Analysis of the data
indicated
that the binding constants (Kd) for compounds 1 and 2 are 18 M and 12 M,
respectively.
Example 5 - Compounds 1 and 2 Are Not Cytotoxic Based on Tetrazolium
Conversion Assay
Cytotoxicity of compounds 1 and 2 was evaluated by MTS (tetrazolium)
conversion assays (Promega). Treatments with compound 1 at 50 -M for 3 days
reduced cell viability to 76.3% and 98.2% of control (untreated) levels for
DU145

and HeLa cells, respectively. Treatments with compound 2 (also at 50 -M for 3
d)
reduced cell viability as a percentage of untreated cells to 95.2% and 86.5%
for
DU145 and HeLa cells, respectively. The results for DU145 cells are shown in
Figure 5; and the results for Hela M cells are shown in Figure 6. As can be
seen
from the results, these compounds lack significant cytotoxcity.

Example 6 - Compound 2 Shows Antiviral Activity Against Parainfluenza Virus 3,
Picornavirus and Encephalomyocarditis Virus
To detenmine antiviral activity, cells were infected with a recombinant human
parainfluenza virus 3 (HPIV3) in which green fluorescent protein (GFP) cDNA
was
inserted between the P and M genes (provided by collaborator A. Banerjee)
(Fig. 7).
The cell lines used are HeLa M cells which are deficient in RNase L or HeLa M
cells stably expressing either wild type RNase L or a nuclease-dead mutant
(R667A)
RNase L (from a CMV promoter in vector pcDNAneo). Cells were infected at an
MOI of 0.1 with HPIV3/GFP in serum free medium (DMEM) for lh. Media was
removed, cells were washed in PBS and complete media with 10% FBS in the


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
-18-
absence or presence of 50 -M compound 2 was added. At 24 h post-infection,
cells
were examined under an inverted fluorescence microscope. It is apparent that
characteristic syncytia (green) were observed with HPIV3/GFP infection of both
the
treated and untreated RNase L-deficient HeLa M cells with vector alone or
expressing mutant (R667A) RNase L. In contrast, compound 2 sharply inhibited
virus growth and suppressed formation of syncytia in cells expressing the wild
type
RNase L. Fluorescence measurements indicated that compound 2 reduced viral
growth by 8-fold in the wild type RNase L expressing cells, whereas there was
only
a 1.2-fold reduction in viral growth in the other two cell lines. In similar
experiments, compound 1 also had antiviral activity. The antiviral activity of
compound 2 was also obtained against the encephalomyocarditis virus (see
Figure 8)
and picornavirus (data not shown). Therefore, these compounds, which have low
'
toxicity, could have general antiviral activity and are candidate antiviral
drugs.
Example 7- The Disclosed Activators of RNase L Inhibit Smooth Muscle Cell
Proliferation
The proliferation of the clonal cell line A10 (derived from the thoracic aorta
of DB I X embryonic rat and possesses many of the properties characteristic of
smooth muscle cells,) was determined using the colorimetric CellTiter 96
AQ1eoõS
Cell Proliferation Assay as described (Promega). This method uses the
tetrazolium
compound [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-
sulfophenyl)-2H-tetrazolium, MTS] and phenazine methosulfate (PMS), an
electron
coupling reagent. Cells were seeded (3 x 10¾ cells/well) in 96 well culture
plates
and treated with different concentrations of the compounds for 24 h. CeilTiter
960
AQ1eO1S reagents (30% v/v dilution in PBS), 50 01, were added to each well.
Plates

were incubated at 37E C for 2 h and absorbance measured at 490 nm with a 96-
well
plate reader (Molecular Devices, model Spectra Max 340). Results demonstrate
that
smooth cell proliferation was inhibited thus indicating that these compounds
may
function as a new class of therapeutic agents for the prevention of
restenosis.
Compound I was tested.


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
- 19-

Example 8 - Compound 2 Shows Antiviral Activity Against Vaccinia Virus
(Strain:
Western Reserve (WR)), a DNA virus in the pox virus family.
Experimental Protocol:
Virus strain: Western Reserve (WR)
Cells:
Immortalized mouse embryonic fibroblasts (MEFs) were grown in RPMI
supplemented with 10% FBS and p/s. Baby hamster kidney (BHK2 1) cells and
african green monkey kidney cells (BSC40) were grown in Dulbecco's modified
Eagle medium supplemented with 10% fetal bovine serum, p/s and 1-glu.
Titer: BHK21 (baby hamster kidney cells) for plaque assays
MOI: Vaccinia Virus (Western Reserve) 5 PFU using no media serum for
infection (virus stock: 1x109PFU/ml)
Compounds : compound 2 at 0, 25 and 50uM in triplicates.
lnfection: 24h post infection samples were collected from each sample.
Method:
MEF (RNase L)RL+'+, MEF (RNase L) RL -1" and BSC 40 cells were plated in 6
well plates, 80 - 85% confluent cells were infected with Vaccinia Virus (WR)
at
5PFU/ml using serum free media. After 45min, cells were washed with PBS and
cells re-fed with fresh media with compound 2.
After 24hr post infection media was removed, the cells were scraped in PBS and
frozen and thawed twice before the titers of the viruses were determined on
BHK21
cells, the indicator cell line.
Plaque assay:
BHK21 cells were plated in 12 well plates, complete monolayer of the cells
were
infected with different dilutions of virus using serum free media. After 45min
post
infection, media was removed and the cells washed twice with PBS and replaced
with Agar media [mix of 2% agarose +(2x MEM + 20%FBS)], after two days
second layer of agar media was added with 0.05% neutral red in order to count
the
plaques.
The results are shown in Figures 9, 10, 11, and 12 and are described in the
brief
description of the figures section.


CA 02650028 2008-10-21
WO 2007/127212 PCT/US2007/009959
- 20 -

While this invention has been particularly shown and described with references
to
preferred embodiments thereof, it will be understood by those skilled in the
art that
various changes in form and details may be made therein without departing from
the
scope of the invention encompassed by the appended claims.