Note: Descriptions are shown in the official language in which they were submitted.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
BACTERIAL STRAINS, COMPOSITIONS INCLUDING SAME AND
PROBIOTIC USE THEREOF
FIELD AND BACKGROUND OF THE INVENTION
The present invention relates to novel bacterial strains, compositions
including
same and methods of using such strains in probiotic treatment of
gastrointestinal
disorders.
Probiotics are defined as living organisms, which exert a positive effect on a
host gastro-intestinal (GI), system. The most commonly used probiotics are
strains
of the lactic acid bacteria (LAB), particularly those classified to the
Lactobacillus,
Lactococcus, and Enterococcus genera.
It is well known that during periods of low resistance (e.g., stress or
disease, at
birth or following antibiotic treatments) undesirable microorganisms are able
to
proliferate in the gastrointestinal tract. Thus, maintaining a normal, healthy
flora of
microorganism in the gastrointestinal (GI) tract is critical during stressful
periods.
The goal of probiotic therapy is to increase the number and activity of
health=
promoting microorganisms until normal GI flora can be reestablished.
Several mechanisms responsible for the protective action of probiotics have
been proposed. These include, (i) the production of inhibitory substances
(e.g.,
antibiotics, organic acids, hydrogen peroxide and bacteriocins) which may
reduce cell
viability, affect bacterial metabolism and reduce toxin production; (ii)
blocking of
adhesion sites by competitive inhibition of bacterial adhesion sites on
intestinal
epithelial surfaces [Conaway (1987) J. Dairy Sci. 70:1-12; Goldin (1992) Dig.
Dis.
Sci. 37:121-128; Kleeman and Klaenhammer (1982) J. Dairy Sci. 1982;65:2063-
2069]; (iii) competition for nutrients; (iv) degradation of toxin receptors,
which is the
postulated mechanism by which S. boulardii protects animals against C.
difficile
intestinal disease through the degradation of the toxin receptor on the
intestinal
mucosa [Castagliuolo (1996) Infect. Immun. 64:5225-5232; Castagliuolo Infect.
lmmun. (1999) 67:302-307 Pothoulakis (1993) Gastroenterology 104:1108-1115];
(v)
and stimulation of non-specific immunity [Fukushima Int. J. Food Microbiol.
(1998)
42:39-44; Link-Amster FEMS Immunol. Med. Microbiol. (1994) 10:55-63; Malin
Ann. Nutr. Metab. (1996) 40:137-1-45].
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
2
Although the effectiveness of probiotic therapy has been demonstrated by
numerous studies and thus is now accepted as suitable therapy for a number of
disorders, probiotic treatment can lead to a number of side effects including
systemic
infections, deleterious metabolic activities, excessive immune stimulation in
5. susceptible individuals and gene transfer [Marteau (2001) Safety aspects of
probiotic
products. Scand. J. Nutr., 45, 1, 22-24]. For example, two cases of L.
rhamnosus
infection were traced to possible probiotic consumption [Rautio (1999) Clin.
Infect.
Dis. 28:1159-60; Mackay (1999) Clin. Microbiol. Infect. 5:290-292]. Thirteen
cases
of Saccharomyces fungemia were caused by vascular catheter contamination
[Hennequin (2000) Eur. J. Clin. Microbiol. Infect. Dis. 19:16-20] and Bacillus
infections linked to probiotic consumption all in patients with underlying
disease
[Spinosa (2000) Microb. Ecol. Health Dis. 12:99-101; Oggioni (1998) J. Clin.
Microbiol. 36:325-326]. Alternatively, Enterococcus is emerging as an
important
cause of nosocomial infections and isolates are increasingly vancomycin
resistant.
Non-pathogenic lactose-positive E. coli comprise the main group of healthy
aerobic microflora in the intestine of humans and animals, providing
microbiological
balance and playing an important role in alimentation and immunity.
The present inventors have previously found a single species of a non-
pathogenic probiotic microorganism, designated E. coli BU-230-98, ATCC Deposit
No. 202226 (DSM 12799) (E. coli M17), which is capable of restoring normal GI
flora of a variety of rnammals and avian. A probiotic composition comprising
this
probiotic organism suspended in the formulation was found to be effective in
the
treatment and prevention of various gastrointestinal disorders. The probiotic
formulation per se was also found effective as a body weight gain enhancer and
as an
immuno-stimulator in mammals and avian (See U.S. Pat. Nos. 6,500,423 assigned
to
"The Bio Balance Corp." and related applications each of which is incorporated
herein
by reference).
The probiotic activities of E. coli BU-230-98, ATCC Deposit No. 202226
(DSM 12799) render it a favorable therapeutic tool for the treatment of a
myriad of
gastrointestinal and gastrointestinal related disorders, suggesting that
assayable,
antibiotic-resistant strains of this bacterial species may be of regulatory
importance
and used in conjunction with antibiotic treatment.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
3
SUMMARY OF THE INVENTION
According to one aspect of the present invention there is provided a
biologically pure culture of an E. coli M17 bacterial strain exhibiting
nalidixic acid
resistance.
According to another aspect of the present invention there is provided a
probiotic composition comprising, as an active ingredient, the bacterial
strain and a
carrier or diluent.
According to further features in preferred embodiments of the invention
lo described below, the composition comprising 103-1010 of bacterial cells of
the
bacterial strain per gram of the composition.
According to still further features in the described preferred embodiments the
carrier comprises a formulation for maintaining viability of the bacterial
strain.
According to still further features in the described preferred embodiments the
-15 formulation comprises a volatile fraction of a plant extract.
According to still further features in the described preferred embodiments the
composition further comprises an antifungal agent.
According to still further features in the described preferred embodiments the
compositions further comprises an antibiotic.
20 According to still further features in the described preferred embodiments
the
composition further comprises a probiotic microorganism selected from the
group
consisting of a yeast cell, a mold and a bacterial cell.
According to still further features in the described preferred embodiments the
carrier is a colonization carrier.
25 According to yet another aspect of the present invention there is provided
a
food additive comprising as an active ingredient, the bacterial strain and a
carrier
suitable for human consumption.
According to still further features in the described preferred embodiments the
colonization carrier is selected from the group consisting of a saccharide, a
modified
30 saccharide and a combination thereof.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
4
According to still another aspect of the present invention there is provided a
feed additive comprising as an active ingredient, the bacterial strain and a
carrier
suitable for animal consumption.
According to still further features in the described preferred embodiments the
carrier is selected from the group consisting of limestone, saccharides and
wheat
midds.
According to an additional aspect of the present invention there is provided a
foodstuff comprising the bacterial strain.
According to still further features in the described preferred embodiments the
foodstuff is a milk product.
According to yet an additional aspect of the present.invention there is
provided
a method of treating a gastrointestinal disorder, the method comprising
administering
to a subject in need thereof a therapeutically effective amount of the
bacterial strain,
thereby treating the gastrointestinal disorder.
According to still further features in the described preferred embodiments the
gastrointestinal disorder is selected from the group consisting of pouchitis,
ulcerative
colitis, Crohn's disease, inflammatory bowel disease, celiac disease, small
bowel
bacterial overgrowth, gastroesophageal reflux disease, diarrhea, Clostridium
difficile
colitis and/or antibiotic associated diarrhea, irritable bowel syndrome,
irritiable pouch
syndrome, acute diarrhea, traveller's diarrhea, lactose intolerance, HIV-
associated
diarrhea, sucrose isomaltase deficiency, carcinogenesis, enteral feeding
associated
diarrhea, and disorders which are associated with enteropathogens, non-erosive
esophageal reflux disease (NERD) and associated small bowel bacterial
overgrowth,
functional dyspesia, necrotizing enterocolitis, diabetes gastropathy and
constipation.
According to still further features in the described preferred embodiments the
bacterial strain comprises all the identifying characteristics of ATCC Deposit
No.
PTA-7295.
According to still further features in the described preferred embodiments the
E. coli M17 is ATCC Deposit No. 202226 (DSM 12799).
According to still further features in the described preferred embodiments the
E. coli M 17 is selected from the group consisting of BU-239, BU-230-98, BU230-
O1
and ATCC Deposit No. 202226 (DSM 12799).
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
According to still further features in the described preferred embodiments the
bacterial strain comprises a genomic nucleic acid sequence selected from the
group
consisting of SEQ ID NO: 1-9.
According to still further features in the described preferred embodiments the
5 bacterial strain is capable of proliferating and colonizing in a mammalian
gastrointestinal tract.
According to still an additional aspect of the present invention there is
provided a method of detecting presence of the bacterial strain in a fecal
sample, the
method comprising detecting bacterial growth in the presence of nalidixic
acid,
thereby detecting presence of the bacterial strain in the fecal sample.
According to a further aspect of the present invention there is provided a
biologically pure culture of an E. coli having all identifying characteristics
of ATCC
Deposit No. PTA-7295.
The present invention successfully addresses the shortcomings of the presently
known configurations by providing novel bacterial strains, compositions
including
same and probiotic use thereof.
Unless otherwise defined, all technical and scientific terms used herein have
the same meaning as commonly. understood by one of ordinary skill in the art
to
which this invention belongs. Although methods and materials similar or
equivalent
to those described herein can be used in the practice or testing of the
present
invention, suitable methods and materials are described below. In case of
conflict, the
patent specification, including definitions, will control. In addition, the
materials,
methods, and examples are illustrative only and not intended to be limiting.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
6
BRIEF DESCRIPTION OF THE DRAWINGS
The invention is herein described, by way of example only, with reference to
the accompanying drawings. With specific reference now to the drawings in
detail, it
is stressed that the particulars shown are by way of example and for purposes
of
illustrative discussion of the preferred embodiments of the present invention
only, and
are presented in the cause of providing what is believed to be the most useful
and
readily understood description of the principles and conceptual aspects of the
invention. In this regard, no attempt is made to show structural details of
the
invention in more detail than is necessary for a fundamental understanding of
the
- invention, the description taken with the drawings making apparent to those
skilled in
the art how the several forms of the invention may be embodied in practice.
In the drawings:
FIG. I shows Pulsed Field Gel Electrophoresis of the M17 parental strain and
the nalidixic acid-resistanf (M17sNAR) derivatives generated according to the
teachings of the present invention. Each strain was digested with XbaI. The
Markers
consist of lambda concatamers. MC 1061, which is a K- 12 derivative of E. coli
and is
genetically unrelated to M17, was run as a negative control. The strains are
indicated
above the relevant lane of the image.
FIG. 2 shows Amplified Fragment Length Polymorphism (AFLP) analyses of
the M17 parental and M 17sNAR strains. DNA from M17, M 17sNAR, and ECOR
strains
was subjected to AFLP analysis using the EcoRI-A + Msel GA primer combination.
The reaction products were resolved by denaturing gel polyarcylamide gel
electrophoresis on a Li-Cor/NEN 4200 global analyzer. The strain is indicated
above
the appropriate lane containing the resolved reaction products.
FIGs. 3a-d are graphs showing the shedding of total coliforms and M17SNAR in
fecal samples of canines dosed with M17sNAR. Animals [dogs 3028 (Figure 3a)
and
3029 (Figure 3b) were male; dogs 3032 (Figure 3c) and 3033 (Figure 3d) were
female] were dosed with 1 X 1013 colony forming units of M17sNAR on fourteen
consecutive days after day 0 (the high dose intake in the Ricerca study).
'Fecal
samples were collected and total coliforms enumerated in duplicate on VRBA
media
while M17SNAR was enumerated on VRBA + 25 g/mi nalidixic acid. Nalidixic acid-
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
7
resistant colonies were confirmed with the Contig 127 PCR assay. Results are
shown
separately for each animal.
FIG. 4 is a scheme showing whole genome shotgun sequencing approach for
E. coli M 17sN,vt.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The present invention is of bacterial strains, which can be used in the
treatment of gastrointestinal and immune-related disorders.
The principles and operation of the present invention may be better understood
with reference to the drawings and accompanying descriptions.
Before explaining at least one embodiment of the invention in detail, it is to
be
understood that the invention is not limited in its application to the details
set forth in
the following description or exemplified by the Examples. The invention is
capable
of other embodiments or of being practiced or carried out in various ways.
Also, it is
to be understood that the phraseology and terminology employed herein is for
the
purpose of description and should not be regarded as limiting.
The present inventors have previously found a single species of a non-
pathogenic probiotic microorganism, E. coli BU-230-98, ATCC Deposit No. 202226
(DSM 12799), which is capable of restoring normal GI flora of a variety of
mammals
and avian. A probiotic composition comprising this probiotic organism was
found to
be effective in the treatment and prevention of various gastrointestinal
disorders. The
probiotic composition was also found effective as a body weight gain enhancer
and as
an immuno-stimulator in mammals and avian (See U.S. Pat. Nos. 6,500,423
assigned
to "The Bio Balance Corp." and related applications each of which is
incorporated
.25 herein by reference).
The probiotic activities of E. coli BU-230-98, ATCC Deposit. No. 202226
(DSM 12799) (M17) render it a favorable therapeutic tool for the treatment of
a
myriad of gastrointestinal disorders and related disorders (e.g., immune
related),
indicating that antibiotic resistant strains of this bacterial species may be
of regulatory
importance and used in combination with antibiotic treatment.
While reducing the present invention to practice the present inventors have
isolated, through laborious experimentations, spontaneously occurring
nalidixic acid-
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
8
resistant mutant derivatives of E. coli BU-230-98, ATCC Deposit No. 202226
(DSM
12799), termed M17sNAR and developed a method for specific enumeration and
confirmation of this strain in fecal samples.
As illustrated hereinbelow and in the Examples section which follows, the
present inventors have enriched and selected from a parental stock of E. coli
BU-230-
98, ATCC Deposit No. 202226 (DSM 12799), naturally-occurring, nalidixic acid-
resistant mutants. The nalidixic acid-resistant strain termed M 17sNAR ATCC
Deposit
No. 7295, is indistinguishable from the parental strain by PFGE and AFLP
analyses.
Unique nucleic acid sequences of the M17sNAx genome were then identified by
whole
io genome sequencing and computational analysis followed by PCR analysis
against a
panel of E. coli strains. Introduction of the M17sNAR into composite fecal
samples,
followed by selective plating on VRBA and confirmation by nucleic acid
analysis
showed that the M17sNAR could be specifically quantified in spiked fecal
samples.
The limit of detection of the assay was estimated to be 33 CFU/ml of M17sNAR
in a
fecal sample. Given the combination of selective plating on VRBA + nalidixic
acid
and the confirmation by nucleic acid analysis, the assay appears to be highly
specific
for detecting and quantifying E. coli M17sNAR in fecal samples.
Thus, according to one aspect of the present invention there is provided a
biologically pure. culture of an E. coli M17 bacterial strain exhibiting
nalidixic acid
resistance (see Example 1 of the Examples section which follows).
As used herein a " E. coli M17 bacterial strain" refers to the strain per se
and
non-pathogenic derived strains which maintain a probiotic activity and
biochemical
characteristics as listed in Tables 1-3, below.
"Probiotic activity" as used herein refers to the property of inhibiting the
growth of at least one pathogen. Testing the inhibition of pathogen growth may
be
effected on solid medium in which culture supernatants of candidate isolated
bacteria
are observed for their property of inhibiting the growth of a pathogen when
applied to
the surface of the solid medium. Typically, a paper disc impregnated with the
culture
supematant of a candidate probiotic strain is placed on the surface of an agar
plate
seeded with the pathogen. Probiotic bacterial supematants cause a ring of
clear agar or
of reduce growth density indicating inhibition of the pathogen in the vicinity
of the
disc. There are other tests for inhibition which are available or could be
devised,
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
9
including direct growth competition tests, in vitro or in vivo which can
generate a
panel of probiotic bacteria similar to that described herein. The bacterial
strains
identified by any such test are within the category of probiotic bacteria, as
the term is
used herein.
Examples of such strains and in vitro characteristics of same are provided in
Tables 1-3 below. According to a preferred embodiment of this aspect of the
present
invention, the E. coli M17 bacterial strain is BU-239, BU-230-98, BU-230-01
and
ATCC Deposit No. 202226 (DSM 12799).
lo Table 1- In Vitro Characterization Studies: Various E. coli Probiotic
Strains
Strain/Code BU 239 BU 230-98 BU 230-01
(original M-17) (BioBalance, M-17 (BioBalance, M-17
Industrial Stock) Industrial Stock)
Serotype 02 02 02
Physical Characterization Gram negative Gram negative rods Gram negative rods
rods
Metabolic Characterization Ferments Ferments glucose Ferments glucose
glucose
Reduces nitrates to Reduces nitrates to
Reduces nitrates nitrites nitrites
to nitrites
Oxidase neg. Oxidase neg.
Oxidase neg. Catalase pos. Catalase pos.
Catalase pos.
Table 2- Fermentation Profile jor Various E. coli strain M-1 7 Samples using
API
20E
E. coll strain M-17,
BU-239 ATCC 202226 E. coli strain AI 17
Fermentation Substrate (Original E. coli (DSM 12799) (Taresevich
strain M-17) (BioBalance Institute, Moscow,
Deposited Master Omcial Sample)
Seed Stock)
Ortho-nitrophenyl-beta-D- + + +
galactopyranoside
Arginine dih drolase - - -
Lysine decarboxylase + + +
Omithine decarboxylase + + +
Citrate
- - -
H2S - - -
Urease - - -
T to han deaminase - .- -
Indole + + +
Vo es-Proskauer - - -
Gelatin - - -
Glucose + + +
Mannitol + + +
Inositiol - - -
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
E. coli strain M-17,
BU-239 ATCC 202226 E. coll strain M-17
Fermentation Substrate (Original E. coli (DSM 12799) (Taresevich
strain M-17) (BioBalance Institute, Moscow,
Deposited Master Official Sample)
Seed Stoek
Sorbitol + + +
Rhamnose + + +
Sucrose + + +
Melibiose + + +
- - -
Amygdalin
Arabinose + + +
Table 3- In Vitro Characterization Studies: Presence of Virulence Factors in
E. "
coli Strain 11I 17 as Detected by PCR
Category of Type of Virulence E coli Strain M-17 Isolate
Pathogenic E coli Virulence Factor
Factor(s) Designation(s) BU-239 ATCC Tarasevich
(original) 202226 (Russian)
(DSM
12799)
Uropathogenic Adhesion Type I (Fim A) + + +
factors AFA - - -
SFA - - -
Uropathogenic - Adhesion PapC - - -
septicemic factors PapG - - -
P fimbriae)
Uropathogenic -
septicemic - Aerobactin iuc - - -
meningitis assoc.
Enterohemorragic - Hemolysins 1-11yA, HIyC - - -
uro atho enic Ehx - - -
Enterohemorragic - Attaching and pas
enteropathogenic effacing gene - - -
Intimin eae - - -
Enterohemorragic Shigatoxins Stx1, Stx2 - - -
VT2vpl, - - -
VT2vh
SLT I, SLT II
Flagellar FIiC - - -
antigen
O s6rogroup 0157 - - -
H sero e H7 - - -
Enteropathogenic Attaching and EAE - - -
effacing factor
Bundle forming bfp - - -
pili
Enteroaggregative Adhesion aggR - - -
factors AAF/I - - -
Toxin EAST1 - - -
Enterotoxigenic Adhesion CFA 1, - - -
factors CFA2 - - -
(CS l coo) - - -
CFA2 (CS3
cst)
Adhesion F4 (K88)
- - -
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
11
Category of Type of Virulence E coli Strain M-17 Isolate
Pathogenic E coli Virulence Factor
Factor(s) Designation(s) BU-239 ATCC Tarasevich
(original) 202226 (Russian)
(DSM
12799)
factors (shared F5 (K99) - - -
by porcine and F18 - - ' -
bovine F41 - - -
Enterotoxins LT, StaH - - -
STaP, STb - - -
Extraintestinal Adhesion factor CS31a - - -
Autotransporter Tsh - - -
As mentioned the E. coli BU-239 bacterial strain of the present invention
exhibits nalidixic acid resistance.
As used herein the phrase "nalidixic acid resistance" refers to the ability of
the
culture of this aspect of the present invention to multiply even in the
presence of the
quinolone antibiotic, nalidixic acid (NegGram). Cultures of the present
invention are
preferably resistant to at least 5 gg/mi nalidixic acid, more preferably at
least 15
g/mi nalidixic acid, even more preferably 25 gg/mi nalidixic acid, even more
preferably 50 g/mi nalidixic acid, even more preferably 100 g/mi nalidixic
acid.
The isolation, identification and culturing of the bacterial strains of the
present
invention (i.e., nalidixic acid resistant BU-239 strains) can be effected
using standard
microbiological techniques. Examples of such techniques may be found in
Gerhardt,
P. (ed.) Methods for General and Molecular Microbiology. American Society for
Microbiology, Washington, D.C. (1994) and Lennette, E. H. (ed.) Manual of
Clinical
.15 Microbiology, Third Edition. American Society for Microbiology,
Washington, D.C.
(1980).
Isolation of the bacterial strains of the present invention is preferably
effected
by streaking the specimen (e.g., E. coli BU-230-98) on a solid medium (e.g.,
nutrient
agar plates) to obtain a single colony which is characterized by the
phenotypic traits
described hereinabove (e.g., Gram negative, capable of lactose fermentation
and
nalidixic acid resistance) and to reduce the likelihood of working with a
culture which
has become contaminated and/or has accumulated mutations.
The bacterial strains of the present invention can be propagated in a liquid
medium under conditions which are described in the Examples section.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
12
Medium for growing the bacterial strains of the present invention includes a
carbon source, a nitrogen source and inorganic salts as well as specially
required
substances such as vitamins, amino acids, nucleic acids and the like (Examples
1 of
the Examples section which follows describes embodiments of medium
compositions
Which can be used in accordance with the present invention).
Examples of suitable carbon sources which can be used for growing the
bacterial strains of the present invention include, but are not limited to,
starch,
peptone, yeast extract,. amino acids, sugars such as glucose, arabinose,
mannose,
glucosamine, maltose, and the like; salts of organic acids such as acetic
acid, fumaric
acid, adipic acid, propionic acid, citric acid, gluconic acid, malic acid,
pyruvic acid,
malonic acid and the like; alcohols such as ethanol and glycerol and the like;
oil or fat
such as soybean oil, rice bran oil, olive oil, corn oil, sesame oil. The
amount of the
carbon source added varies according to the kind of carbon source and is
typically
between 1 to 100 gram per liter medium. Preferably, glucose, starch, and/or
peptone
-15 is contained in the medium as a major carbon source, at a concentration of
0.1-5%
(WN).
Examples of suitable nitrogen sources which can be used for growing the
bacterial strains of the present invention include, but are not limited to,
amino acids,
yeast 'extract, tryptone, beef extract, peptone, potassium nitrate, ammonium
nitrate,
ammonium chloride, ammonium sulfate, ammonium phosphate, ammonia or
combinations thereof. The amount of nitrogen source varies according the
nitrogen
source, typically between 0.1 to 30 gram per liter medium.
As the inorganic salts, potassium dihydrogen phosphate, dipotassium
hydrogen phosphate, disodium hydrogen phosphate, magnesium sulfate, magnesium
chloride, ferric sulfate, ferrous sulfate, ferric chloride, ferrous chloride,
manganous
sulfate, manganous chloride, zinc sulfate, zinc chloride, cupric sulfate,
calcium
chloride, sodium chloride, calcium carbonate, sodium carbonate can be used
alone or
in combination. The amount of inorganic acid varies according to the kind of
the
inorganic salt, typically between 0.00 1 to 10 gram per liter medium.
Examples of specially required substances include, but are not limited to,
vitamins, nucleic acids, yeast extract, peptone, meat extract, malt extract,
dried yeast
and combinations thereof.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
13
Cultivation is effected at a temperature, which allows the growth of the
probiotic bacterial strains of the present invention, essentially, between 28
C and 46
C. A preferred temperature range is 30-37 C.
For optimal growth, the medium is preferably adjusted to pH 7.0 - 7.4.
It will be appreciated that commercially available media may also be used to
culture the bacterial strains of the present invention, such as Luria Broth
available
from Difco, Detroit, MI.
Bacterial cells thus obtained are isolated using methods, which are well known
in the art. Examples include, but are not limited to, membrane filtration and
centrifugal separation.
The pH may be adjusted using sodium hydroxide and the like and the culture
may be air dried or dried using a freeze dryer, until the water content
becomes equal
to 4 % or less.
Once a lot of the bacterial strains of the present invention is generated, it
is
preferably quality qualified. Such qualification may include testing
resistance to
nalidixic acid, lactose fenmentation, resistance to gastric acidity,
gastrointestinal tract
colonization, resistance to bile acid, which correlates with gastric survival
in vivo,
adherence to mucus and/or human epithelial cells and cell lines, antimicrobial
activity
against potentially pathogenic bacteria, ability to reduce pathogen adhesion
to
surfaces and bile salt hydrolase activity [Conway (1987) J. Dairy Sci. 70:1-
12].
Newly isolated strains are preferably further characterized as being
molecularly indistinguishable from the parental strain while still exhibiting
nalidixic
acid resistance. This may be attributed to the presence of genomic sequences
such as
set forth in SEQ ID NO: 1-9 or homologous sequences (e.g., above about 80 %,
90 %
or 95 % identity).
Using the above methodology, the present inventors were able to isolate the
strains of the present invention, displaying varying levels of antibiotic
resistance as
listed in Table 7 below.
According to a preferred embodiment of this aspect of the present invention
the strain has all identifying characteristics of the strain deposited under
the Budapest
Treaty in the American Type Culture Collection (ATCC) on December 22, 2005, as
strain PTA - 7295 (referred to herein as M 17sNAR).
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
14
The probiotic bacterial strains of the present invention exhibit antibiotic
resistance and as such may be adventitiously used, from a regulatory point of
view,
for the treatment of a variety of gastrointestinal disorders, simply because
tracking of
same in fecal samples is now allowed. Additionally, co-treatment with the
strains of
the present invention with nalidixic acid is now allowed, thus maintaining a
viable
gastrointestinal flora while practicing antibiotic treatment such as for
urinary tract
infection.
Thus, according to still another aspect of the present invention there is
provided a method of treating or preventing a gastrointestinal disorder in a
subject.
lo The method is effected by administering to a subject in need thereof a
therapeutically effective amount of the probiotic bacterial strains of the
present
invention.
As used herein the term "treating" refers to alleviating or diminishing a
symptom associated with a disorder. Preferably, treating cures, e.g.,
substantially
eliminates, the symptoms associated with the disorder.
Subjects which may be treated with the bacterial cultures of the present
invention include humans and animals which may benefit from probiotic
treatment.
Examples include but are not limited to mammals, reptiles, birds, fish and the
like.
Examples of gastrointestinal disorders which may be treated using the
probiotic strains of the present invention include, but are not limited to,
'pouchitis
(e.g., associated with ileal pouch-anal anastomosis post ulcerative colitis),
ulcerative
colitis, Crohn's disease, inflanunatory bowel disease, celiac disease and
associated
small bowel bacterial overgrowth, gastroesophageal reflux disease and
associated
small bowel bacterial overgrowth, small bowel bacterial overgrowth, diarrhea
and
high stool output in patients with ileostomy, antibiotic-associated diarrhea,
Clostridium difficile colitis and/or antibiotic associated diarrhea, irritable
bowel
syndrome, irritiable pouch syndrome, acute diarrhea, traveller's diarrhea,
lactose
intolerance, HIV-associated diarrhea, sucrose isomaltase deficiency,
carcinogenesis,
enteral feeding associated diarrhea, and disorders which are associated with
enteropathogens such as Helicobacter pylori, Campylobacter jejuni,
Campylobacter
coli,' Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus
pyogenes,
Streptococcus pneumoniae, Enterococcus faecalis, Haemophilus influenzae,
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
Escherichia colf, Klebsiella pneumoniae, Enterobacter cloacae, Citrobacter
freundii,
Serratia marcescens, Pseudomonas aeruginosa and Pseudomonas maltophilia,
Salmonella sp. Viruses such as rotavirus and fungi such as Candida albicans
and
Aspergillusfumigatus, and combinations of these species.
5 Additional disorders which may be treated using the strains of the present
invention include, but are not limited -to, non-erosive esophageal reflux
disease
(NERD) and associated small bowel bacterial overgrowth, functional dyspesia,
necrotizing enterocolitis, diabetes gastropathy, constipation (associated with
the
changes in gastrointestinal microflora), uro-genital tract associated
diseases, urinary
10 bladder infections (uterine infections and infections of the cervix, vagina
and vulva
commonly occur.in human beings and domestic animals, especially following
birth).
Typical infecting organisms of the endometrium (i.e., uterine mucosa) and
contiguous
mucosal surfaces in the lower genital tract include, for example, 0-hemolytic
streptococci, Candida albicans, Klebsiella pneumoniae, coliform bacteria
including
15 Escherichia coli, Corynebacterium pyogenes and C. vaginale, various
Campylobacter
or Trichomonas species such as T. vaginalis, and the like (see U.S. Pat. No.
5,667,817). Other urogenital pathogens include but are not limited to
Chlamydia
trachomatis, Neisseria gonorrhoeae, herpes simplex virus, HIV, papillomavirus
and
Treponema pallidum.], respiratory diseases associated with pathogenic bacteria
including but not limited to, Staphylococcus aureus, Streptococcus pneumoniae,
beta-
hemolytic streptococci and Haemophilus influenza; rheumatoid arthritis [Malin
(1996)
Br J Rheumatol;35:689-94], allergies associated with reduced microbial
stimulation
associated with the western world lifestyle (i.e., improvement of hygiene and
reduced
family size). Atopic diseases such as associated with the decrease in
Lactobacillus
and Eubacterium combined with higher counts of Clostridium ssp [Biorksten et
al.
Clin. Exp. Allergy (1999) 29:342-346].
It will be appreciated that the bacterial strains of the present invention may
be
used to treat other diseases or disorders (i.e., extraintestinal), which may
be treated by
probiotics.
The ability of the bacterial strains of the present invention to treat
bacterial,
fungal or viral infections in other organs is an outcome of stimulating
multiple
defense mechanisms [reviewed by Isolauri (2001) Am. J. Clin. Nut. 73:444S-
450S]
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
16
including promotion of a nonimmunologic gut defense barrier which may inhibit
translocation of potential pathogens and thus prevent infections of the blood
stream
and other tissues or organs. Another defense mechanism is improvement of the
intestine's immunologic barrier, particularly through intestinal
immunoglobulins A
responses and alleviation of intestinal inflammatory responses which produce a
gut
stabilizing effect. As well as by immune regulation, particularly through
balance
control of proinflammatory and anti-inflammatory cytokines.
Examples of extraintestinal diseases which can be treated with the probiotic
cultures of the present invention include, but are not limited to
appendicitis,
autoiminune disorders, multiple sclerosis, rheumatoid arthritis, coeliac
disease, small
bowel or gastric overgrowth associated with diabetic gastropathy, organ
transplantation, periodontal disease, urogenital diseases (vaginal, urethral
and
perineal), surgical associated trauma, surgical-induced metastatic disease,
sepsis,
weight loss, anorexia, fever control, cachexia, wound healing, ulcers, gut
barrier 15 function, allergy, asthma, respiratory disorders, rhinovirus-
associated diseases (e.g.,
otitis media, sinusitis, asthma and pulmonary diseases), hepatic diseases
(e.g., hepatic
encephalopathy) constipation, nutritional disorders, epidermal disorders,
psoriasis,
anthrax and/or acne vulgaris [see Exarrmples 5-8, U.S. Pat. Application No.
20030113306, Rolfe (2000) Journal of Nutrition 130:396S-402S and Background
section].
Typical concentration range of probiotic microorganisms administered,
according to this aspect of the present invention, is 103 to 1013 cells per
day.
Preferably, at least about 106, at least about 107 , at least about 1010 cells
per day are
used in probiotic administration (see U.S. Pat. Nos. 6,221,350 and 6,410,305).
However, it will be appreciated that the amount of bacteria to be administered
will
vary according to a number of parameters including subject's size, type of
disorder
and severity of symptoms.
The bacterial cultures of the present invention can be formulated in a
nutritional composition (e.g., foodstuff, food additive or feed additive). For
example,
the bacterial strains of the present invention may be included in fermented
milk
. products (i.e., nutraceuticals), such as described in U.S. Pat. No.
6,156,320.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
17
Alternatively, the bacterial strain of the present invention may be formulated
in a pharmaceutical composition, where it is mixed with a pharmaceutically
acceptable carrier preferably for oral or enteral administration route,
selected
according to the intended use.
Herein the term "active ingredient" refers to the bacterial. preparation
accountable for the biological effect.
As used herein a "pharmaceutical composition" refers to a preparation of one
or more of the active ingredients described herein with other chemical
components
such as physiologically suitable carriers and excipients. The purpose of a
pharmaceutical composition is to facilitate administration of a compound to an
organism.
Hereinafter, the phrases "physiologically acceptable carrier" and
"pharmaceutically acceptable carrier" which may be interchangeably used refer
to a
carrier or a diluent that does not cause significant irritation to an organism
and does
not abrogate the biological activity and properties of the administered
compound. An
adjuvant is included under these phrases. One of the ingredients included in
the
pharmaceutieally acceptable carrier can be for example polyethylene glycol
(PEG), a
biocompatible polymer with a wide range of solubility in both organic and
aqueous
media.
Herein the term "excipient" refers to an inert substance added to a
pharmaceutical composition to further facilitate administrationof an active
ingredient.
Examples, without limitation, of excipients include calcium carbonate, calcium
phosphate, various sugars and types of starch, cellulose derivatives, gelatin,
vegetable
oils and polyethylene glycols.
Techniques for formulation and administration of drugs may be found in
"Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, latest
edition, which is incorporated herein by reference.
In addition to carriers the pharmaceutical compositions or nutritional
compositions of the present invention may also include, colonization carriers,
formulations for maintaining viability of the bacterial strain (e.g., volatile
fraction of a
plant extract, see U.S. Pat. No. 6,500,423), nutrients, antibiotics, anti-
fungal agents,
antioxidants, plant extracts, buffering agents, coloring agents, flavorings,
vitamins and
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
18
minerals, which are selected according to the intended use and the route of
administration employed.
Colonization carriers - The compositions of the present invention may
include a colonization carrier which transports the probiotic microorganisms
to the
large bowel or other regions of the gastrointestinal tract. Typically the
carrier is a
saccharide such as amylose, inulin, pectin, guar gum, chitosan, dextrans,
cyclodextrins, alginate and chondroitin sulphate [Chourasia and Jain (2003) J.
Pharm.
Pharmaceut. Sci. 6:33-66].
Preferably, modified and/or unmodified resistant starches are used as
lo colonization carriers (see U.S. Pat. No. 6,221,350).
The phrase "resistant starch" refers to starch forms defined as RS 1, RS2, RS3
and RS4 as defined in Brown, McNaught and Moloney (1995) Food Australia 47:
272-275. Typically, a resistant starch is used in a probiotic composition
since it is
essentially not degraded until it reaches the large bowel. Therefore it
provides a
t5 readily available substrate for fermentation by the probiotic
microorganisms once they
reach the large bowel. Preferably, the resistant starch is a high amylose
starch,
including but not limited to maize starch having an amylose content of 50 %
w/w or
more, particularly 80 % w/w or more, rice and wheat starch having an amylose
content of 27 % w/w or more and; particular granular size ranges of starches
having
20 anamylose content of 50 % or more and enhanced resistant starch content,
these
starches including maize, barley, wheat and legumes. Other forms of resistant
starch
derived from sources such as bananas or other fruit types, tubers such as
potatoes, and
mixtures or combinations thereof can also be used in accordance with the
present
invention.
25 It will be appreciated that it may be advantageous to chemically modify the
starch, such as by, altering the charge, density or hydrophobicity of the
granule and/or
granule surface to enhance the attachment compatibility between the
microorganism
and the resistant starch. Chemical modifications, such as etherification,
esterification,
acidification and the like are well known in the art and may be utilized to
modify the
30 starch. Alternatively, modifications can be induced physically or
enzymically such as
described in U.S. Pat. No. 6,221,350.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
19
The colonizing carrier may also be an oligosaccharide. Oligosaccharides are
known to increase the number of probiotic microorganisms in the
gastrointestinal
tract. Examples of commercially available oligosaccharides which can be used
as
colonizing carriers include but are not limited fructo-, galacto-, malto-,
isomalto-,
gentio-, xylo-, palatinose-, soybean- (including raffnose and stachyose),
chito-,
agaro-, neoagaro-, a-gluco-, P-gluco-, cyclo-inulo-, glycosylsucrose,
lactulose,
lactosucrose and xylsucrose.
The oligosaccharide can be used in the composition in a concentration of about
0.01 to 10 % (w/w). Preferably the concentration of the oligosaccharide is
about 0.05
to5%.
Preferably, a combination of starch and an oligosaccharide is used as the
colonizing agent of this aspect of the present invention.
Antibiotics - The compositions of the present invention may include nalidixic
acid preferably at a range selected from 0.1-10 g/mL.
Anti-fungal agents - The compositions of the present invention may include a
therapeutically-effective amount of an anti-fungal agent. Typical anti-fungal
agents
which may be utilized include, but are not limited to: Clotrimazole,
Fluconazole,
Itraconazole, Ketoconazole, Miconazole, Nystatin, Terbinafine, Terconazole,
Tioconazole, and the Iike.
Antioxidants, buffering agents, plant extracts, coloring agents, flavorings,
vitamins and minerals - The compositions of the present invention may include
antioxidants, buffering agents, plant extracts and other agents such as
coloring agents,
flavorings, vitamins or minerals. For example, the composition of the present
invention may contain one or more of the following minerals: calcium citrate
(15-350
.25 mg); potassium gluconate (5-150 mg); magnesium citrate (5-15 mg); and
chromium
picollinate (5-200 g). In addition, a variety of salts may. be utilized,
including
calcium citrate, potassium gluconate, magnesium citrate and chromium
picollinate.
Chemicals are commercially available from Spectrum Quality Products, Inc
(Gardena,
Calif.),. Sigma Chemicals (St. Louis, Mo.), Seltzer Chemicals, Inc.,
(Carlsbad, Calif.)
and Jarchem Industries, Inc., (Newark, N.J.). Examples of plant extracts,
which can
be used in accordance with the present invention include but are not limited
to
chamomile, bur-marigold, St. John's wort, ginger and other approved plant
extracts
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
which are FDA approved [ for review see O'Hara M, Kiefer D, Farrell K, Kemper
K.
Arch Farn Med. (1998) Nov-Dec;7(6):523-36.; Modesto A, Lima KC, de Uzeda M.
ASDC J Dent Child. (2000) Sep-Oct;67(5):338-44,302; Lee KG, Shibamoto T. J
Agric Food Chem. (2002) Aug 14;50(17):4947-52J.
5 Thickening agents - Thickening agents may. be added to the compositions
such as polyvinylpyrrolidone, polyethylene glycol or carboxymethylcellulose.
Carriers - The active agents (e.g., bacterial cells) of the compositions of
the
present invention are combined with a carrier, which is physiologically
compatible
with the tissue of the species to which it is administered (i.e., suitable for
human
10 consumption or animal consumption). The carriers., according to this aspect
of the
present invention can be solid-based, dry materials for formulation into
tablet, capsule
or powdered form. Altematively, the carrier can be of liquid or gel-based
materials
for formulations into liquid or gel forms. The specific type of carrier, as
well as the
final formulation depends, in part, upon the selected route(s) of
administration.
15 Typical carriers for dry formulations include, but are not limited to:
alginate
(e.g., calcium alginate), trehalose, malto-dextrin, rice flour, micro-
crystalline cellulose
(MCC), magnesium stearate, inositol, fructo-oligosaccharides (FOS), gluco--
oligosaccharide (GOS), dextrose, sucrose, and the like. Where the composition
is dry
and includes evaporated oils that may cause the composition to cake (i.e.,
adherence
20 of the component spores, salts, powders and oils), it is preferred to
include dry fillers,
which distribute the components and prevent caking. Exemplary anti-caking
agents
include MCC, talc, diatomaceous earth, amorphous silica, gelatin, saccharose,
skimmed dry milk powder, starch and the like, which are typically added in an
amount of from approximately 1% to 95% by weight. It will be appreciated that
dry
formulations, which are subsequently rehydrated (e.g., liquid formula) or
given in the
'dry state (e.g., chewable wafers, pellets or tablets) are preferred to
initially hydrated
formulations. Dry formulations (e.g., powders) may be - added to supplement
commercially available foods (e.g., liquid formulas, strained foods, or
drinking water
supplies).
-30 Suitable liquid or gel-based carriers include but are not limited to:
water and
physiological salt solutions; urea; alcohols and derivatives (e.g., methanol,
ethanol,
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
21
propanol, butanol); glycols (e.g., ethylene glycol, propylene glycol, and the
like).
Preferably, water-based carriers have a neutral pH value (i.e., pH 7.0).
Preservatives may also be included within the carrier including methylparaben,
propylparaben, benzyl alcohol and ethylene diamine tetraacetate salts. The
compositions of the present invention may also include a plasticizer such as
glycerol
or polyethylene glycol (with a preferred molecular weight of MW=800 to
20,000).
The composition of the carrier can be varied so long as it does not interfere
significantly with the pharmacological activity of the active ingredients or
the
viability of the bacterial strains of the present invention. Other types of
carriers,
which can be used according to this aspect of the present invention are
described
hereinbelow.
Nutrient supplements - A nutrient supplement component of the compositions
of the present invention can include any of a variety of nutritional agents,
which are
well known in the art, including vitamins, minerals, essential and non-
essential amino
acids, carbohydrates, lipids, foodstuffs, dietary supplements, and the like.
Thus, the.
compositions of the present invention can include fiber, enzymes and other
nutrierits.
Preferred fibers include, but are not limited to: psyllium, rice bran, oat
bran, corn
bran, wheat bran, fruit fiber and the like. Dietary or supplementary enzymes
such as
lactase, amylase, glucanase, catalase and the like can also be included.
Vitamins for
use in the compositions of the present invention include vitamins B, C, . D,
E, folic
acid, K, niacin, and the like. Typical vitamins are those, recommended for
daily
consumption and in the recommended daily amount (RDA).
The pharmaceutical composition of the present invention is fonmulated
. according to the intended use. A review of conventional formulation
techniques can
be found in e.g. "The Theory and Practice of Industrial Pharmacy" (Ed. Lachman
L. et
al, 1986) or Laulund (1994).
Preferably, the compositions of the present invention are formulated for
enteral administration.
As used herein the phrase "enteral administration" refers to administration of
a
pharmacological agent through any part of the gastro-intestinal tract, such as
rectal
administration, colonic administration, intestinal administration (proximal or
distal)
and gastric administration.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
22
For oral administration, the compounds can be formulated readily by
combining the active compounds with pharmaceutically acceptable carriers well
known in the art. Such carriers enable the compounds of the invention to be
formulated as tablets, pills, dragees, capsules, liquids, gels, syrups,
slurries,
suspensions, and the like, for oral ingestion by a patient. Pharmacological -
preparations for oral use can be made using a solid excipient, optionally
grinding the
resulting mixture, and processing the mixture of granules, after adding
suitable
auxiliaries if desired, to obtain tablets or dragee cores. Suitable excipients
are, in
particular, fillers such as alginate (e.g., calcium alginate), sugars,
including lactose,
sucrose, mannitol, or sorbitol; cellulose preparations such as, for example,
maize
starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth,
methyl
cellulose, hydroxypropylmethyl-cellulose, sodium carbomethylcellulose; and/or
physiologically acceptable polymers such as polyvinylpyrrolidone (PVP). If
desired,
disintegrating agents may be added, such as cross-linked polyvinyl
pyrrolidone, agar,
or alginic acid or a salt thereof such as sodium alginate.
Dragee cores are provided with suitable coatings. For this purpose,
concentrated sugar solutions may be used which may optionally contain gum
arabic,
talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium
dioxide,
lacquer solutions and suitable. organic solvents or solvent mixtures.
Dyestuffs or
pigments may be added to the tablets or dragee coatings for identification or
to
characterize different combinations of active compound doses.
Pharmaceutical compositions, which can be used orally, include push-fit
capsules made of gelatin as well as soft, sealed capsules made of gelatin and
a
plasticizer, such as glycerol or sorbitol. The push-fit capsules may contain
the active
ingredients in admixture with filler such as lactose, binders such as
starches,
lubricants such as talc or magnesium stearate and, optionally, stabilizers. In
soft
capsules, the active ingredients may be dissolved or suspended in suitable
liquids,
such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In
addition,
stabilizers may be added. All formulations for oral administration should be
in
dosages suitable for the chosen route of administration.
lt will be appreciated that the compositions of the present invention can be
encapsulated into an enterically-coated, time-released capsule or tablet. The
enteric
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
23
coating allows the capsule/tablet to remain intact (i.e., undissolved) as it
passes
through the gastrointestinal tract, until such time as it reaches the small
intestine.
For buccal administration, the compositions may take the form of tablets or
lozenges formulated in conventional manner.
A number of examples for parenteral administration of live bacteria cells are
.known in the art [see for example, Tjuvajev (2001) J. Control Release 74(1-
3):313-5.
Rosenberg (2002) J. Immunother. 25:218-25; Sheil (2004) Gut 53(5):694-700; and
Matsuzaki (2000) Immunol. Cell Biol. 78(1):67-73]. It will be appreciated that
bacteria cells of the present invention may also be administered in an
attenuated form
so as to modulate immune responses [Matsuzaki (2000) Immunol. Cell Biol.
78(1):67-73].
The preparation of the present invention may also be formulated in rectal
compositions such as suppositories or retention enemas, using, e.g.,
conventional
suppository bases such as cocoa butter or other glycerides.
Formulations suitable for genital application include solutions.
Pharmaceutical compositions of the present invention may be manufactured
by processes well known in the art, e.g., by means of conventional mixing,
dissolving,
granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping
or
lyophilizing processes.
Formulations suitable for vaginal administration may be presented as
pessaries, tampons, creams, gels, pastes, jelly, foams or sprays or aqueous or
oily
suspensions, solutions or emulsions (f.e., liquid formulations), or films
containing
carriers as are known in the art to be appropriate (described in details in
U.S. Pat. No.
5,756,681).
Compositions suitable for application to the vagina are disclosed in U.S. Pat.
NOs: 2,149,240, 2,330,846, 2,436,184, 2,467,884, 2,541,103, 2,623,839,
2,623,841,
3,062,715, 3,067,743, 3,108,043, 3,174,900, 3,244,589, 4,093,730, 4,187,286,
4,283,325, 4,321,277, 4,368,186, 4,371,518, 4,389,330, 4,415,585, 4,551,148,
4,999,342, 5,013,544, 5,227,160, 5,229,423, 5,314,917, 5,380,523, and
5,387,611.
For transurethral administration the composition contains one or more selected
carriers excipients, such as water, silicone, waxes, petroleum jelly,
polyethylene
glycol (PEG), propylene glycol (PG), liposomes, sugars such as mannitol and
lactose,
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
24
and/or a variety of other. materials, with polyethylene glycol and derivatives
thereof.
It is preferred that the pharmaceutical compositions contain one or more
transurethral
permeation enhancers,- i.e., compounds which act to increase the rate at which
the
selected drug permeates through the urethral membrane. Examples of suitable
permeation enhancers include dimethylsulfoxide (DMSO), dimethyl formamide
(DMF), N,N-dimethylacetamide (DMA), decylmethylsulfoxide, polyethylene glycol
monolaurate (PEGML), glycerol monolaurate, lecithin, the 1-substituted
azacycloheptan-2-ones, particularly 1-n-dodecylcyclaza-cycloheptan-2-one
(available
under the trademark AzoneRTM from Nelson Research & Development Co., Irvine,
to Calif.), SEPARTm (available from Macrochem Co., Lexington, Mass.), alcohols
(e.g.,
ethanol), surfactants including, for example, TergitolR"m, Nonoxynol-9RTM and
TWEEN-80RTM, and lower alkanols such as ethanol. As disclosed in W091/16021,
transurethral administration of an agent can be carried out in a number of
different
ways. For example, the agent can be introduced into the urethra from a
flexible tube,
squeeze bottle, pump or aerosol spray. The agent may also be contained in
coatings,
pellets or suppositories, which are absorbed, melted or bioeroded in the
urethra. In
certain embodiments, the agent is included in a coating on the exterior
surface of a
penile insert.
Formulations of the present invention are selected so as to maintain bacterial
viability. However, when the use of attenuated bacteria is desired,
formulations of the
present invention may be selected of a broader range.
Pharmaceutical compositions suitable for use in context of the present
invention include compositions wherein the active ingredients are contained in
an
amount effective to achieve the intended purpose. More specifically, a
therapeutically
effective amount means an amount of active ingredients effective to prevent,
alleviate
or arimeliorate symptoms of disease or prolong the survival of the subject
being treated.
Determination of a therapeutically effective amount is well within the
capability of those, skilled in the art.
Typically bacteria species of the present invention (i.e., active ingredient)
may
constitute 1-90 %, more preferably 5-90 %, even more preferably 10-90 % by
weight
of the final composition and still more preferably 15-88% % by weight
contained
within a formulation suitable for administration. Alternatively , the
composition of
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
the present invention may contain at least 106, more preferably at least 10g,
even more
preferably at least lOtO viable bacteria per one dose of composition.
Toxicity and therapeutic efficacy of the active ingredients described herein
can
be determined by standard pharmaceutical procedures in vitro, in cell cultures
or
5 experimental animals (see Examples 1-4 of the Examples section which
follows).
The data obtained from these in vitro and cell culture assays and animal
studies can be
used in formulating a range of dosage for use in human. The dosage may vary
depending upon the dosage form employed and the route of administration
utilized.
The exact formulation, route of administration and dosage can be chosen by the
lo individual physician in view of the patient's condition. (See e.g., Fingl,
et al., 1975, in
"The Pharmacological Basis of Therapeutics", Ch. 1 p.1).
Depending on the severity and responsiveness of the condition to be treated,
dosing can be of a single or a plurality of administrations, with course of
treatment
lasting from several days to several weeks or until cure is effected or
diminution of
15 the disease state is achieved.
The amount of a composition to be administered will, of course, be dependent
on the subject being treated, the severity of the affliction, the manner of
administration, the judgment of the prescribing physician, etc.
Compositions including the preparation of the present invention formulated in
20 a compatible pharmaceutical carrier may also be prepared, placed in an
appropriate
container, and labeled for treatment of an indicated condition.
Compositions of the present invention may, if desired, be presented in a pack
or dispenser device, such as an FDA approved kit, which may contain one or
more
unit dosage forms containing the active ingredient. The pack may, for example,
25 comprise metal or plastic foil, such as a blister pack. The pack or
dispenser device
may be accompanied by instructions for administration. The pack or dispenser
may
also be accommodated by a notice associated with the container in a form
prescribed
by a governmental agency regulating the manufacture, use or sale of
pharmaceuticals,
which notice is reflective of approval by the agency of the form of the
compositions
or human or veterinary administration. Such notice, for example, may be of
labeling
approved by the U.S. Food and Drug Administration for prescription drugs or of
an
approved product insert.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
26
To ensure that bacteria of the present invention are able to withstand
conditions of product manufacture (e.g., food industry hazardous conditions),
product
(either pharmaceutical compositions, food additives, feed) shelf life and
transit
through the gastro-intestinal tract, bacterial cells are preferably
encapsulated.
Methods of encapsulating live bacterial cells are well known in the art (see
e.g., U.S. Patent to General Mills Inc. such as U.S. Pat. No. 6,723,358). For
example,
micro-encapsulation with alginate and and Hi-MaizeTM starch followed by freeze-
drying has been proved successful in prolonging shelf-life of bacterial cells
in dairy
products [see e.g., Kailasapathy et al. Curr Issues Intest Microbiol. 2002
Sep;3(2):39-
48]. Alternatively, entrapment of viable probiotic in sesame oil emulsions may
also
be used [see e.g., Hou et al. J. Dairy Sci. 86:424-428].
As mentioned hereinabove, the probiotic compositions of the present invention
can be provided to animals using methods, which are well known in the art.
Typically, the probiotic composition is introduced into the animal's
gastrointestinal tract via a feed additive, which is added to a feed diet.
Alternative
methods of administration are liquid ingestion, paste or gel ingestion,
boles, powder
dusting surface of animal and the like. .
In addition to probiotic bacterial cells, the feed additive may include, for
example, carrier materials such as, limestone and wheat midds (see U.S. Pat.
No.
6,410,305). The feed additive can be added to the animal's regular diet at a
rate of
0.01 to 10 and preferably about 0.5 to 2.5 pounds of additive per ton of
animal feed.
The feed additive may contain about 0.3% to about 20% by weight of
probiotic bacterial cells. Preferably the feed additive contains 7 % to 15 %
by weight
probiotic premix and most preferably about 10 % to 13 % by weight.
It will be further appreciated that the probiotic microorganisms of the
present
invention may not adhere to the intestinal epithelium. Thus in the absence of
a repeat
dosage, the bacteria remain in the gastrointestinal tract for maximal time of
approximately 3-5 days and are considered to be a transient flora (see Figures
3a-d).
The relatively rapid gastrointestinal-clearance time and inability to adhere
to the
gastrointestinal epithelium of the strains of the present invention, has the
advantage of
preventing the later development of bacteremia in, for example,
immunocompromised
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
27
individuals. Fecal shedding assay as shown in Example 6 of the Examples
section
may be used to assess removal of the bacteria from the treated subject.
The bacterial strains and or compositions of the present invention can be
included in a product identified for treating a particular disorder such as
described
above. Typically, the product is in the form of a package containing the
bacterial cells
or compositions including same, or in combination with packaging material. The
packaging material is selected to retain bacterial viability and includes a
label or
instructions for, for example, use of the components of the package. The
instructions
indicate the contemplated use of the packaged component, as described herein
for the
methods or compositions of the invention, contents (e.g., genus, species,
strain
designation), minimum numbers of viable bacteria at end of shelf-life, pro.per
storage
conditions and corporate contact details for consumer information. The label
may
also provide information related to the freshness of the product. This
information
may include a date of manufacture, a "sell be" date or a "best before date". A
"sell
by" date specifies by which date the product should have been sold to the
consumer.
A "best before" date specifies by when the product should be disposed of by
vendor
or consumer. Alternatively or additionally "active labeling" may be used. For
example, U.S. Pat. Nos. 4,292,916, 5,053,339 5,446,705 and 5,633,835 describe
color
changing devices for monitoring the shelf-life of perishable products. These
devices
are initiated by physically bringing into contact reactive layers so that the
reaction
will start, and this action can only conveniently be performed at the time of
packaging. This approach is suitable for monitoring the degradation of
foodstuffs
which lose freshness throughout the entire distribution chain. U.S. Pat. No.
5,555,223
describes a process for attaching timing indicators to packaging, including
the step of
setting the timer clock at the exact time of production.
Depending upon the intended use, the product may optionally contain either
combined or in separate packages one or more of the following components:
colonization carriers, flavorings, carriers, and the like components. For
example, the
product can include the probiotic of the present invention for use in
combination with
a conventional liquid product, together with instructions for combining the
probiotic
with the formula for use in a therapeutic method.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
28
The bacterial strains of the present invention can also be used as
pharmaceutical delivery systems. It will be appreciated that such delivery
systems are
inherently safer than the use of attenuated pathogens in humans, including
infants, the
elderly and individuals whose immune function is impaired [Grangette (2001)
Infect.
5. Immun. 69:1547-1553].
The bacterial strains of the present invention can also be modified to express
heterologous expression products using expression systems, which are well
known in
the art. This approach was used to reduce colitis in mice intragastrically
administered
with the IL-10-secreting L. lactis strain [Steidler (2000) Science 289:1352-
1355].
As used herein the term "about" refers to 10 %.
Additional objects, advantages, and novel features of the present invention
will become apparent to one ordinarily skilled in the art upon examination of
the
following examples, which are not intended to be limiting. Additionally, each
of the
various embodiments and aspects of the present invention as delineated
hereinabove
and as claimed in the claims section below finds experimental support in the
following examples.
EXAMPLES
Reference is now made to the. following examples, which together with the
above descriptions, illustrate the invention in a non limiting fashion.
Generally, the nomenclature used herein and the laboratory procedures utilized
in the present invention include molecular, biochemical, microbiological and
recombinant DNA techniques. Such techniques are thoroughly explained in the
literature. See, for example, "Molecular Cloning: A laboratory Manual"
Sambrook et
al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel,
R. M.,
ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John
Wiley and
Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular
Cloning",
John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA",
Scientific
American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory
Manual Series", Vols. 1-4,.Cold Spring Harbor Laboratory Press, New York
(1998);
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
29
methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531;
5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III
Cellis, J. E., ed. (1994); "Current Protocols in Immunology" Volumes I-III
Coligan J.
E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th
Edition),
Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected
Methods
in Cellular Immunology", W. H. Freeman and Co., New York (1980); available
immunoassays are extensively described in the patent and scientific
literature, see, for
example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987;
3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074;
4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis"
Gait, M.
J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J.,
eds.
(1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., Eds.
(1984);
"Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and
Enzymes"
IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984)
and
"Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To
Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et
al.,
"Strategies for Protein Purification and Characterization - A Laboratory
Course
Manual" CSHL Press (1996); all of which are incorporated by reference as if
fully set
forth herein. Other general references are provided throughout this document.
The
procedures therein are believed to be well known in the art and are provided
for the
convenience of the reader. All the information contained therein is
incorporated
herein by reference.
BACKGROUND
The overall objective of this study is to develop an assay for detection of
the
M17 strain of Escherichia coli (M17) in fecal samples collected from mammalian
sources. The approach used was to first isolate a spontaneously occurring
nalidixic
acid-resistant mutant derivative of M17 and second to develop a method for
specific
enumeration and confirmation of this strain from fecal samples.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
Materials
Materials - Vendors of chemicals are listed in Table 4 below:
Table 4
5 Chemical Source Quality Item No. CAS No.
Nalidixic Acid Sigma-Aldrich N-8878
Agar ACROS 400395000 9002- l 8-0
10 Agarose (PFGE) BioWhittaker 50150
Agarose (horizontal gels) Fisher BP160
VRBA Becton Dickson 211695
Tris I-ICl (?) Fisher BP152 77-86-1
Boric Acid Fisher BP168 10043-35-3
15 EDTA Fisher BP120 6381-92-6
Sodium dodecyl-sulfate EMD 7910 151-21-3
Phenol Fisher B P 1750 108-95-2
Ethidium Bromide Promega H5041
DNTPs Takara 4030
20 PCR Buffer Sigma P-2192
deoxyribonucleotide triphosphates (dATP, dCTP, dGTP, dTTP)
Vendor details of biological materials are listed in Table 5 below.
25 Table 5
Microbial
Agent Source Lot No Production
date
M17 Benchmark Biolabs M17-01-001 04/07/2005
30 ECOR collection Thomas Whittamb
AOS strains John Maurer`
ATCC202226 (DSM 12799) American Type Culture Collection
Prairie Village, KS
Dept. of Food Safety and Toxicology, Michigan State Univ
www.foodsafe.msu.edu/whittam/ecor/
Dept. Of Avian Medicine, Univ. of Georgia College of Veterinary Medicine,
Athens, GA.
Biological Source Catalog/Product No.
Reagents
AFLP Template Prep kit Li-Corb, B50623-01
Taq Polymerase Takara` R007A
Proteinase K IBId 5N0250
Xbal Restriction Enzyme NEB` R0145S
Lambda concatamers NEB N0350S
AFLP labeled primers Li-Cor
AFLP unlabeled primers Li-Cor
Amplified Fragment Length Polymorphism
Li-Cor, inc. 4308 Progressive Ave, Lincoln, NE, 68504
`Takara Bio Inc., Seta 3-4-1, Otsu, Shiga, 520-2193, Japan
IBI/Shelton Scientific, 230 Long Hill Cross Rd., Shelton, CT 06484
`New England Biolabs, 240 Country Rd, Ipswich, MA 01938-2723
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
31
Disposable Materials - Vendor details of disposable materials are listed in
Table 6 below.
Table 6
Item Source Item No.
Petri dishes VWR Scientific 25384-302
Cryovials Wheaton 985734
96-well PCR plates GeneMate T-3049-1
96-well Culture plates Corning 3799
Micropipette tips 200 L DOT Scientific ERY-0200
Micropipette tips 10 L Midwest Scientific NKD-96-10
Microcentrifuge tubes DOT Scientific 509-FTG
mL Sterile disp. Tubes Fisher Scientific 14-959-70C
Equipment - Vendor details of laboratory equipment are listed infra.
Automated DNA Sequencers - Li-Cor/NEN model 4200 Global IR2
automated DNA sequencer (item No. 9942-155). Dual laser/detector (685 nm and
785 nm diode lasers with silicon avalanche photodiode detectors), complete
with
Netwinder server (80 Gb storage, server software, operating system). Operating
software: e-Seq Version (Item No. 9942-154).
Pulsed Field Gel Electrophoresis - Bio-Rad CHEF DRII Pulsed Field Gel
Electrophoresis system + chiller system (item No. 170-3725). 100/120 V
electrophoresis cell with drive module, control module, variable-speed pump,
14 x 13
cm casting stand with frame and platform, comb holder, 15-well, 1.5 mm thick
comb,
screened cap, disposable plug molds, and 12 ft Tygon tubing.
Horizontal Agarose Gel Electrophoresis - Owl Scientific, Model Al GatorTM
Large Gel Electrophoresis System
Gel Size: 13cm W x 25cm
30= Owl Scientific, Model B1A EasyCastTM Mini Gel Electrophoresis System
Gel Size: 7cmW x 8 cm
Polymerase Chain Reaction Thermocyclers (Manufacturer, Location) -
Whatman-Biometra TI, 96-well programmable thermocycler (item No 050-91).
= Whatman-Biometra T Gradient, 96-well programmable temperature-gradient
thermocycler (item No. 050-80 1)
Imaging system - Syngene Ingenious imaging system, 8 bit monochrome
imaging camera with 768 x 582 pixel resolution, manual zoom lens, darkroom +
20 X
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
32
30 cm UV2 (302 nm/365 nm wavelength) transilluminator, GeneSnap image capture
software and GeneTools image analysis software.
EXAMPLE 1
Isolation of a nalidixic acid-resistant mutant of the M17 Escherichia coli
strain
Experimental Procedures
The M17 strain of Escherichia coli is known to be sensitive to the antibiotic
nalidixic acid. Only a small number of E. coli strains isolated from human
clinical
to samples are known to be resistant to nalidixic acid and other quinilone
antibiotics (4,
8, 9). Because nalidixic acid resistance, which is associated with mutations
in gyrA
or parC, occurs spontaneously in vitro and is only observed at low frequencies
in
clinical samples, it is well suited as a simple means for marking the M17
strain.
To isolate a nalidixic acid-resistant mutant derivative of M 17, an M17 E.
coli
culture was grown for 16 hours at 37 C in Luria Broth and 0.1 mL portions of
the
culture were then spread onto the surface of Luria agar supplemented with 15
g/mL
Nalidixic acid. The agar plates were then incubated for 16 hours at 37 C. Two
colonies (M 17 15-1 and M 17 15-2) were then selected, streaked onto Luria
agar
supplemented with 15 g/mL nalidixic acid, and inoculated into 5 mL of Luria
broth
with 15 g/mL of nalidixic acid and incubated for 16 hours at 37 C. 0.1 mL
portions
of the Luria broth cultures were then spread onto the surface of Luria agar
plates
supplemented with 50 g/mL nalidixic acid. A total of four colonies were
chosen
from each original parent (M17 15-1 or M17-15-2), these colonies were labeled
M17
50-1 thru M17 50-4 (from M17 15-1 parent) and M17 50-5 thru M17 50-8 (from the
M17 15-2 parent). The M17 50-1 thru M1750-8 colonies were then streaked onto
Luria agar with 50 g/mL nalidixic acid, inoculated into Luria broth
supplemented
with 50 g/mL nalidixic acid, and incubated for 16 hours at 37 T. Portions of
each
Luria broth culture (0.1 mL) were then spread onto the surface of Luria agar
plates
supplemented with 100 g/mL nalidixic acid. The plates were incubated
overnight at
37 C. A single colony from the Luria agar with 100 g/mL nalidixic acid
plates
derived from each parental strain (M17 50-1 thru M17 50-8) was chosen, and
labeled
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
33
M17 100-1 thru M17 100-8, streaked onto Luria agar supplemented with 100 g/mL
nalidixic acid and grown for 16 hours at 37 C.
Preparation of freezer stocks of nalidixic acid-resistant M17 derivatives.
Single colonies from the M17 15-1, M17 15-2, M17 50-1 thru M1750-8 and M17
100-1 thru M 17 100-8 cultures were grown in Luria broth supplemented with the
appropriate amount of naliixic acid and (15, 50, or 100 g/mL) and grown to an
optical density of 0.5 (600 nm). From each culture, 0.7mL was removed to
sterile
cryogenic tubes, mixed with 0.3mL sterile 50% glycerol, and rocked at room
temperature for 45 minutes. The glycerol-treated cells were then stored at -80
C.
Results
From the parental nalidixic acid-sensitive M17 strain, two individual colonies
resistant to 15 pg/mL of nalidixic acid were chosen. A series of four
derivatives each
from the M15 15-1 and M17 15-2 parental stfains were then isolated which were
resistant to 50 g/mL nalidixic acid. A single derivative, resistant to 100
gg/mL of
nalidixic acid was then obtained from each of the M17 50-1 thru M17 50-8
strains. A
1 mL aliquot of each M17 nalidixic acid-resistant derivative listed in Table 7
below
was then frozen at -80 C for long-term storage.
Table 7- Nalidixic acid resistant derivatives of M17
Stock Strain Nalidixic acid concentration Parent
in isolation plate
M17 15-1 15 pg/mL M17
M1715-2 15 pgImL M17
M17 50-1 50 gglmL M17 15-1
M17 50-2 50 jig/mL M17 15-1
M15 50-3 50 jig/mL M17 15-1
M 17 50-4 50 jig/mL M 17 15-1
M 17 50-5 50 g/mL M 17 15-2
M17 50-6 50 jig/mL M17 15-2
M17 50-7 50 RgIML M17 15-2
M 17 50-8 50 g/mL M17.15-2
M17 100-1 100 gglmL M17 50-1
M17 100-2 100 jig/mL M17 50-2
M17 100-3 100 jig/mL M17 50-3
M 17 100-4 100 mL M 17 50-4
M17 100-5 100 jig/mL M17 50-5
M17 100-6 100 g/mL M17 50-6
M17 100-7 100 [tgImL M 17 50-7
M 17 100-8 100 pg/mL M17 50-8
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
34
EXAMPLE 2
Characterization of the MI7sNAR strains of the present invention
A series of molecular genetics and biochemical assays were run to
chatacterize the strains of the present invention.
Experimental Procedures
Pulsed Field Gel Electrophoresis (PFGE) Confirmation of Nalidixic acid-
resistant M17 derivatives - PFGE was performed to confirm nalidixic acid-
resistant
derivatives of M17 are indeed M17 derivatives. PFGE was performed using the
CDC
protocol, "Laboratory Protocol for Molecular Subtyping of Escherichia coli
0157:H7
by Pulsed Field Gel Electrophoresis." see www.cdc.gov/pulsenet/protocols.htm
Centers for. Disease Control and Prevention. Standardized molecular subtyping
of
foodborne bacterial pathogens by pulsed-field gel electrophoresis: a manual.
Atlanta:
National Center for Infectious Diseases; 1996 (updated 2000). Briefly, a Luria
agar
plate was streaked from frozen stock cultures of the M17 parent strain and the
M17
100-1 thru M17 100-8 nalidixic acid resistant derivatives onto Luria agar or
Luria
agar supplemented with 10 gg/mL Nalidixic acid and grown for 16 hours at 37
C.
Using a sterile microbiological loop, about 20 L of cells were transferred
from each
plate to a tube containing I mL of Suspension Buffer (100mM Tris, 100mM EDTA,
pH 8.0). The suspension was adjusted to an absorbance value at 610 nm of 1.35
using
additional cells or suspension buffer as necessary. The cell suspension (0.4
mL) from
each strain was then mixed with 20 L of Proteinase K (stock concentration 20
mg/mL), and inverted several times. 0.4 mL of molten agarose was then mixed
with
the cells and immediately dispensed into the plug molds of the CHEF II-DR PFGE
apparatus. After solidification, the plugs were then removed into 50 mL screw
cap
tubes using a spatula and 5 mL of Cell Lysis Buffer [50mM tris, 50mM EDTA, 1%
Sarkosyl (sodium lauryl sarcosine) pH 8.0]. Twenty-five microliters (25 l) of
Proteinase K (20 mg/mL stock concentration) was then added and the plugs were
incubated for 2 hours at 54 C. The lysis buffer was removed by decanting and
the
plugs were washed briefly by swirling in 10 mL of sterile water. The water was
then
decanted and the plugs were washed 4 times for 15 minutes each in 10. mL of TE
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
buffer. After a final rinse in 10 mM Tris, I mM EDTA pH 8.0 (TE), the plugs
were
stored at 4 C in sterile TE buffer.
Restriction digests were performed by placing 2 mm slices of the plug into a
sterile 1.5 mL microcentrifuge tube and adding 0.1 mL of Restriction Buffer.
5 Restriction Buffer for Xbal restriction enzyme included 10mM Tris, 10mM
MgC12,.
50mM NaCI, 1mM Dithiothreitol, pH 7.9. After 15 minutes of incubation at 37
C,
the Restriction Buffer was decanted and 0.1 mL of Restriction Buffer + 30
units of
Xbal restriction enzyme was added. The samples were then incubated for 2 hours
at
37 C. After incubation, samples were decanted and 0.2mL of 0.5X TBE buffer
was
t 0 added.
The analytical agarose gel was cast by mixing ac slurry of 1% SKG. agarose in
0.5X TBE and melting the agarose. After cooling in a 60 C water bath, the
agarose
was then poured into the CHEF II-DR gel form and the comb carefiilly placed
into the
molten gel. After 1 hour of solidification "at room temperature, the comb was
15 removed and the restriction-digested plugs placed into the appropriate
wells, being
sure to push the gel slice to the front of the well and removing any bubbles.
A small
volume of molten agarose was then added to fill the remaining area in the
wells. The
gel was then placed into the CHEF DRII PFGE tank, being sure to place the gel
within the gel frame of the chamber. The chamber was then filled with 0.5 X
TBE (1
20 M Tris, 1 M Boric Acid, 20 mM EDTA, pH 8.3 diluted to 0.5X concentration
with
water for electrophoresis).and electrophoresed under the following conditions:
Initial A time: 2.2s
Final A time: 54.2s
Start Ratio: 1.0
25 Voltage: 200V (6V/Cm)
Run Time: 22 hr
Following electrophoresis, the gel was stained for 15 minutes in a solution of
0.02 g/ml Ethidium bromide and destained for 30 minutes in water. The stained
DNA was visualized by placing the gel onto a 302 nm UV lightbox and imaged
with
30 CCD camera.
Amplifted Fragment Length Polymorphism (AFLP) - AFLP reactions were.
performed according to.Li-Cor, Inc. Document #988-07304, Rev. 1. Template DNA
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
36
was prepared by standard methods and redissolved in 10 mM Tris, 1 mM EDTA pH
7.5. Genomic DNA was extracted from the bacterial strains by standard methods
(5).
The DNA samples were dissolved in 10 mM Tris-0.1 mM EDTA pH 8Ø A total of
100 ng of DNA from each sample was digested with EcoRl and Msei. Double-
stranded, synthetic DNA adapters, containing short single strand sequences
complementary to the EcoRI and Msel overhangs were then ligated to the
digested
DNA fragments. Fragments with ligated adapters were then diluted and amplified
by
PCR in pre-amplificatioii reactions using PCR primers specific for the
adapters. The
amplified fragments then served as templates for selective amplification in
which
t0 fluorescently labeled primers are used in conjunction with unlabeled
primers. The
selective amplification uses primers that are complementary to the adapter
sequences
with an additional 2 bases at the 3'end. This selectively amplified (and
labels) DNA
fragments in which the 2 bases immediately adjacent to the original EcoRI or
MseI
site are complementary to the 3' base of the primers. Lastly, the labeled
selective
amplification products were resolved by denaturing polyacrylamide gel
electrophoresis on a Li-Cor/NEN 4200 global analyzer (automated DNA
sequencer).
Results
To confirm the genetic relationship of the M17 100-1 thru M 17 100-8 strains
to the original M17 parental strain, PFGE analysis was performed on each
strain and
the parental M17 strain. As shown in Figure, The M17 100-1 thru M17100-8
derivatives are all indistinguishable from the M 17 parental strain.
Based on PFGE Confirmation, all nalidixic acid-resistant derivatives are
genetically indistinguishable from the M17 parent. The M17 parent and M17 100-
1
thru M17 100-8 derivative strains were then streaked onto Violet Red Bile Agar
to
test for lactose fermentation. All strains were lactose positive. Therefore,
the M17
100-8 strain was chosen as the nalidixic acid-resistant M17 derivative for all
further
studies. This strain was designated M17sNAR (Sucrose-positive, Nalidixic Acid
Resistant).
Further analysis of the genetic relatedness of M17 and the M17sNAR derivative
was conducted by AFLP analysis. Total DNA from the M17 parental, M17sNAR, 14
different ECOR strains (6) and two genetically unrelated serotype 02 strains
(AOS 1
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
37
and AOS19) was subjected to AFLP using the fluorescently labeled EcoRl-A and
unlabeled Msel-GA primers. The reaction products were resolved by gel
electrophoresis and the resulting image used to compare the banding patterns.
As
shown in Figure 2, all of the resolvable, fluorescently-labeled AFLP products
from
M17 and M17sNAR are identical in size, whereas the fragment patterns produced
from
the different ECOR strains and the AOS strains show several differences
compared to
M 17 and M 17sNAR. Therefore, the M 17 parent and M 17sNAR . derivative are
indistinguishable by both PFGE arid AFLP.
EXAMPLE .3
DNA sequence analysis to identify unique genetic signatures of
the M17sr,AR genome
Experimental Procedures
1 5 Preparation of Genomic DNA for DNA sequence analysis - For DNA
sequencing, total genomic DNA from the M17100-8 SNAR isolate was prepared.
This clone was grown overnight on Luria agar with 100 g/mL nalidixic acid.
Following 16 hours of growth at 37 C, a loopful of cells was transferred to
500 mL of
Luria broth supplemented with 100 g/mL nalidixic acid and grown for 18 hours
at
37 C with shaking at 200 rpm. The cells were then harvested by centrifugation
in a
Backman J2 high speed centrifuge at 6,000 rpm for 10 minutes using 250 mL
bottles
in a JA10 rotor. The cells were then resuspended in 25 mL of 10mM Tris-TmM
EDTA (pH 7.5) with 2 mg/mL lysozyme. After 10 minutes of incubation at room
temperature, 2.5 mL of 1% Sodium Dodecyl-Sulfate supplemented with 5 mg/mL
Proteinase K and incubated at 50 C for 90 minutes. 25 mL of phenol (saturated
with
10mM tris-1mM EDTA pH 8.0) was then added and the bottles were rocked for 3
hours on high speed. The phases were then separated by centrifugation at 8,000
rpm
for 15 minutes in a Beckman J2 High-speed centrifuge using a JA10 rotor. The
aqueous phase (20 mL) was then removed to a beaker and 2 mL of 3 M Sodium
Acetate (pH 5.2) was added and mixed with swirling. The DNA was then
precipitated
by the addition of 40 mL of ethanol. Precipitated DNA was spooled onto a glass
from
the interface and the spooled DNA washed by submerging several times into 70%
ethanol. The DNA was finally dissolved in 1 mL of 10mM Tris-1mM EDTA.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
38
Dissolved DNA was then dialyzed for 2 hours against sterile water (1 Liter)
for three
consecutive changes of water. DNA was then transferred to the laboratory of
Dr.
Vivek Kapur - The Biomedical Genomics Center at the University of Minnesota
sequence analysis.
Identffication of MI7sNAR unique sequences from the genome sequence - A
single file containing all of the assembled DNA sequences (contigs) from
alignments
of shotgun reads from the M17sNAR libraries was obtained from Dr. Vivek Kapur
(A.
Benson computer, D:/Midland Genomics/BioBalance/M17 Genome
data\0812 0003.contigs.fasta.txt). Individual contigs resulting from alignment
of
l0 >200 sequence runs were obtained from the file and used to create text
files in fastA
format. The fastA files were then BLAST searched against the E. coli CFT073
genome sequence (GenBankAccession No. NC004431) using the BLAST2 algorithm
(7) available at the NCBI website
(www.ncbi.nim.nih.gov/blast/bl2seq/wblast2.cgi).
Coordinates from the alignments were then entered into Microsoft Excel
spreadsheets
and segments of non-alignment were determined by identifying coordinates of
sequence segments that do NOT produce BLAST alignments. Only segments of non-
alignment > 1,000 bases were considered for further analyses.
Segments from each M17sNAR contig corresponding to non-aligning regions
were obtained from the contig files using the Extract DNA program available
from
the Pathogenomics Sequence Analysis facility of the University of Minnesota
(www.pathogenomics.ahc.umn.edu/ExtractDna.htm). Each of the non-aligning
segments was then used to create a.tExt file in fastA fonmat and finally used
to search
the entire Genbank database at NCBI using the BLASTn algorithm (1, 2).
Segments
not yielding significant alignment were then considered as candidates for
regions of
genome sequence unique to M17sN,ut.
Design of PCR primers for amplification of M17SNAR unique genome
regions - From the text files containing the unique segments of M 17sNAR, PCR
primers were designed using the PRIME program from the Wisconsin Package
(Genetics Computer Group package www.accelrys.com/products/gcg/). The
parameters used in designing the primers are as follows:
PCR primers should produce products between 500 bases and 3 kilobases in
length.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
39
PCR primers should be positioned within the region of unique sequence.
PCR primer pairs should have melting points that are within 2 C of each
other.
PCR primers from each unique region should give products that are of distinct
size so they can be multiplexed. Potential primer combinations are listed in
Table 11
below.
Optimization and validation of MI 7SNAR unique genome regions by PCR
In order to optimize the PCR reactions for detection of M 17sNAR-specific
genome segments (Ml7SSGS), a single PCR primer combination from the list of
candidates (see Table 11 below) was tested against M 17sHAR chromosomal DNA to
determine if a specific product of the predicted size was produced. The
reactions
were run at different melting temperatures using the TGradient thermocycler.
(Biometra). The gradients were centered at 59 C with 15 C variance on the
low and
. 15 high ends. The reactions were run using 1 ng of M17SNAR DNA in a 20 L
reaction
volume with 1 X PCR buffer (containing 2.5 mM MgC12 final concentration), 250
M
dNTPs, 1 unit of Taq DNA polymerase, and I M each primer. The reaction volume
was made to 20 L for each reaction using sterile water. Reactions were heated
to 95
C for 2.5 minutes and then 30 cycles of 95 C for 30 seconds, melting
temperature
(56 or 63 degrees depending on primer set) for 45 seconds, 45 seconds at 72
C. After
cycles, the reaction was extended for 5 minutes at 72 C and held at 4 C until
ready for gel electrophoresis.
Once terminated PCR reactions were supplemented with 2 L of loading dye
(0.21 % Bromphenol Blue, 0.21 % Xylene cyanol, 50% glycerol). A total of 15 L
of
.25 the reactions was then loaded onto a 0.8 % agarose gel prepared in 1 X TAE
containing I ng/mL of ethidium bromide. The gel was then electrophoresed for
1.5
hours at 100 Volts/Cm. The electrophoresed PCR products were then visulalized
by
placing the gel onto a 302 nm UV lightbox and imaged with CCD camera.
Results
.30 . Although the fragment pattems derived from different AFLP pcimer
combinations can distinguish M17sNAR from different E. coli strains, a more
simplistic
approach to distinguish M17SNAR from other E. coli strains is to use a
combination of
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
the nalidixic acid resistance (where the trait of nalidixic acid resistance is
used to
selectively grow resistant bacteria-i.e. identify only those bacteria in the
feces which
can grow in the presence of nalidixic acid-and then confirm their identity as
M17sNAR using specific genetic tests) and to selectively grow nalidixic acid-
resistant
5~ bacteria from fecal samples and confirm their identity as M17sNAR using a
genetic test
for a DNA segment that is unique to the M 17 parent and M 17sNAR derivative.
To
identify a segment of DNA unique to M 17 and M17sNAR, the M 17sNAR genome was
subjected to whole genome DNA sequence analysis. Genomic DNA was extracted
-from M17sNAR. The DNA was subsequently physically sheared into different size
l0 fragment lengths and three different clone libraries were generated, each
having
different average insert sizes (4 Kilobases, 10 Kilobases, and 40 Kilobases).
Each of
these libraries was then subjected to high-throughput shotgun DNA sequence
analysis
and the sequence reads were assembled into large contiguous DNA sequences
based
on their overlap. As is common practice, the shotgun DNA sequencing phase
included
.15 DNA sequence analysis of enough clones such that each segment of the
entire
genome would be sequenced multiple times in independent overlapping clones.
As illustrated in Table 8 below [Ewing, B., L. Hillier, M. Wendl, and
P. Green. 1998. Base-calling of automated sequencer traces using Phred. I.
Accuracy
assessment. Genome Res Vol. 8 (3), 175-185], the high-throughput shotgun
20 sequencing phase of the E.coli M17sNAR genome resulted in 57,408 distinct
high-
quality 'reads' representing 36,265,538 bases with good quality scores,
providing an
approximately 8-fold coverage of the genome. Based on the total number of
Phred20
bases, the paired-end sequence reads from the 4 Kb genome library provided the
most
coverage of the genome sequence. The 10kb and Fosmid libraries provided larger
25 physical links from paired-end 'reads' and facilitated ordering and
orienting
contiguous sequence `blocks' in the assembly process.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
41
Table 8- DNA Sequence 'reads' generated by the high-throughput sequencing
of the three libraries
Libraries
4kb insert 10kb insert Fosmid (40kb insert)
Total 'reads' 27,648 13,728 16,032
Pass rate* 91.54% 83.75% 85.03%
Average Phred20 bases** 725 763 670
erread
Total Phred20 bases 18,349,009 8,772,363 9,144,166
* Pass rate: defined as a`read' containing >100 cumulative Phred20 bases'*
"= Phred20 bases: Bases which receive a quality score of 20 or more when
subjected to Phred analysis,
a base-calling program developed at the University of Washington Genome
Center.
During the assembly phase, sequence data, vector. sequences were removed
and the sequence was quality screened based on Phred quality score information
[see
1o Ewing B, Green P: Basecalling of automated sequencer traces using phred.
II. Error
probabilities. Genome Research 8:186-194 (1998); Ewing.B, Hillier L, Wendl M,
Green P: Basecalling of automated sequencer traces using phred. I. Accuracy
assessment. Genome Research 8:175-185 (1998)].
All the sequence 'reads' from the libraries were first compared to each other.
Identities between the sequences of different 'reads' were noted, and then
used to
align the sequences into contiguous stretches of sequence called contigs.
Because of
small variations in the quality of the sequence from independent reads, two
different
'reads' of the same segment of DNA may not be identical. Therefore, enough
clones
from the different libraries are sequenced to generate multiple overlapping
reads of
each base so that it is independently confitmed.
Contig building software, which builds contigs based on the "quality" of each
base in a`read', was used to ultimately build the DNA sequence into large
contiguous
stretches of sequence. Any gaps, discrepancies or ambiguities in the sequence
were
also identified. Contigs were then ordered and linked together into larger
supercontigs by using paired 'reads' lying in different contigs. Using this
approach, a
total of 464 contigs were assembled and the details are listed in Table 9
below.
Whole genome assembly was performed using the Paracel Genome AssemblerTM,
version 2.6.2, coupled with the Agencourt's LIMS system while, Paracel's
scaffold
viewer and Consed (version 13.0) were used to finish the assembly.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
42
Table 9. Summa of the sequence assembly
Contigs Total # Total length
Su erconti 71 4420860
Conti s(>2 kb) 313 4706396
Conti s<2 kb) 80 na*
Total # of conti s 464 Na
* na, Not applicable
Strategy to identify unique sequences in the M17sNAR strain - Parallel
approaches were used to identify potential unique sequences.
All 464 total contigs were provided -electronically as *.txt files of the
individual contig sequences in FASTA format
(www.ncbi.nlm.nih.gov/blast/html/search.html). A pairwise BLAST analysis was
consequently done of entire contigs against the E. coli CFT073 genome sequence
and
subsequently identified the non-aligning regions from the M17 contigs. These
non-
aligned sequences were then used in pairwise BLAST to identify any sequence
homology against the E. coli MG1655 (K-12) and E. coli EDL933 (0157:H7) and
Sakai (0157:H7) genome sequences. Segments not showing significant alignment
(sequence homology) to either the E. coli CFT073, =K-12, or 0157:H7 genomes
were
then used in a BLAST search against the entire nr NCBI database
(www.ncbi.nlm_nih.govBLAST/).
In a parallel approach, a BLAST analysis was effected with each of the 464
contigs first split up into 200 bp (base pair) fragments and then individually
blasted
against two specialized databases. The first database constructed was an
`E.coli'
database, in which four strains of E. coli
(www.ncbi.nlm.nih.gov/genomes/lproks.cgi)
were included to create a database named NCBIrefseq_ecoli.dna (Escherichia
coli
strains included were CFT073, K12, 0157:H7 Sakai and 0157:H7 EDL933). For the
second database, all bacterial genomes present in the NCBI database were
consolidated to create a`Bacterial' database and named
NCBIrefseq_bacteria.dna.
Next, each of the 200 bp fragments was subjected to a blastn analysis against
both
consolidated NCBI databases of both E. coli and bacteria, described above.
Sequences with `no hits,' were identified to be unique sequences.
Results of alignments: identiftcation of MI7sNAR unique genome segments -
Using the large-fragment, pair-wise alignment approach several segments from
different contigs ofthe M17sNAR genome sequence were identified which did not
yield significant alignments to any sequence from all publicly available
sequences in
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
43
the nr database of NCBI. These candidate unique segments are indicated in
Table 10,
below. These segments were then referred to as candidate M l 7sNAR unique
sequences.
Table 10 Coordinates of aligning and non-aligning unique DNA sequences from
the M17 enome sequence
Contig Contig Length Coordinates of Unique segment
Number Unique segments length
315,599 292,869-294,947 2,078
11 128,617 45,040-46,133 1,093
17 67,917 3,603-14,778 11,175
17 67,917. 34,624-54,505 19,881
17 67,917 65,633-67550 1,917
36 130,495 88,527-93,269 4,743
41 75,562 23,625-25,532 1,907
41 75,562 30,174-36,945 6,771
127 40,938 21,584-24,327 2,743
291 32,242 3,566-5,534 1,968
291 32,242 19,653-21,193 1,540
291 32,242 27,379-30,296 2,917
291 32,242 30,418-3 l 598 1,180
Results from optimization and validation of PCR analysis for M17SNAR
unique segments - To experimentally test the uniqueness of the test the
uniqueness of
.10 the candidate M17sNAK unique sequences, PCR primers were designed to
amplify
segments within several of the unique regions. The PCR primers were then used
in
PCR reactions performed on the M17 and M17sNAR strains to first optimize the
PCR
reactions. Optimizations were performed using temperature gradients centered
at 59
C and +/-.7.5 C above and below this temperature. The PCR products from each
reaction were run alongside one another on an analytical agarose gel, stained
with
ethidium bromide, and imaged over a 302 nm UV lightbox using a CCD camera. The
relative intensity of fluorescence from the stained DNA bands was quantified
using
GeneTools software (Syngene) software. As shown in Table 11, below, optimal
PCR
conditions were developed for PCR primers detecting unique regions in Contig
10,
Contig 11, Contig 13, Contig 36, Contig 41, Contig 127, and Contig 291. The
Contig
127 PCR primers, which have the highest average melting temperature and
produced
optimal PCR reactions at the upper end of the optimization curve, were
subsequently
chosen for further validation against E. coli strains representing the genetic
diversity
of naturally occurring E. coli populations.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
44
Table 11 - Optimization o PCR assa s for candidate M17SNAR uni ue regions
PCR Predicted Optimized
Primer combination Contig_coordinates product melting PCR
(SEQ ID NO.) length temperature melting b
tem rature
C I OFOR
GAAAAACCCACCGACATCAAC (10) C10292,453 2,455 65.2
63
CIOREV C10_294,908 65_8
ATATCAGCACCCCCACCAAGII
C I I FOR
TAACCAGCGGCATCATCAG(12) CI144,112 2,214 64.8 63
C I I REV C 1146,326 64_3
CGGCAAGAAAAACGAATCAC13
C l3FOR
TCCAGCAAGAAAACAACCAC(14) C13 38,896 3,019 62.7 63
CI3REV C13 41,915 60.4
GATACTGATGATGCCACCAC(15)
C36FOR
CATCCACAATTCCCCAATCC(16) C36_89,356 1,105 66.1 53
C36REV C36_90,461 58.3
ACCTCTGCTGAACACATAAACI7
C41 FOR
CAAGCAGGGAAGCATCAAC(i8) C41_32,457 1,536 63.4 63
C41 RE V C41_33,993 61.2
TATCAACAGGAGCCACCAC(19)
C127FOR
TACCCCTCATTGCTCATCCC(20) C127_22,666 1,155 66_0 63
C 127RE V C 127_23,821 63.1
GATTACCCCACAAAAACTGACC 21
C291 FOR
TGAGCAGTGCCATCAACAG(22) C291_28,506 1,466 63-9 63
C291 REV C291_29,972 64_3
CAAAAGCCGAATTAAACGGAG23
'Coordinate for the 5' nucleotide of the respective primer is indicated
bmelting temperature predicted from the PRIME program in the GCG package
bmelting temperature producing most significant amount of PCR product
EXAMPLE 4
The M17sNAR strains ojtlte present invention are molecularly distinct
from other E. coli strains
Experimental Procedures
Once the reactions were optimized for each PCR primer combination, the
combinations were confirmed by testing them in PCR reactions against a panel
of E.
coli strains designed to represent the genetic diversity of the total E. coli
population
(ECOR collection) and to represent common serotype 02 strains. The collection
consists of the 72 ECOR strains, described originally by Ochman and Selander
in
1984 (6), which has been extensively studied and is generally regarded . as
representative of the population structure of the species. A set of five
different strains
having an 02 serotype was also used to test for the uniqueness of the M17sNAR
segment in genetically unrelated E. coli strains that share the 02 serotype
with
M17SNAR. Each strain of the 77-strain set was grown for 16 hours at 37 C in
Luria
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
Broth and the cells harvested by centrifugation in a JAIO rotor. DNA was then
extracted from each strain according to standard methods (5). DNA samples were
dissolved in 10 mM Tris-1 mM EDTA pH 8.0 and stored at 4 C. For each PCR
reaction, the DNA samples were diluted 1:100 in sterile water and a 2 L
volume of
5 the diluted DNA was added to the reaction. The reaction mixtures each
contained 2
L of the diluted DNA, 1 L each of the relevant primers (final concentration I
uM) 2
L of lOX PCR buffer (Takara), 2 L of 250mM dNTP mixture (Takara), I unit of
Taq DNA polymerase (Takara) and 11 gL of sterile water. The reactions were
then
cycled in a Biometra thermocycler using the following cycling conditions: 2.5
10 minutes at 95 C, followed by 30 cycles of 30 seconds at 95 C, 45 seconds
at 53 C
(Primer combination C 127) or 56 C (Primer combination C291), 45 seconds at
72 C.
A final extension of 5 minutes at 72 C was performed after the thirty cycles
and the
reactions were held at 4 C until ready for gel electrophoresis.
To the completed PCR reactions, 2 gL of loading dye (0.21 % Bromphenol
'15 Blue, 0.21 % Xylene cyanol, 50 % glycerol) was added. A total of 15 L of
the
reactions was then loaded onto a 0.8 % agarose gel prepared in 1 x TAE
containing 1
ng/mL of ethidium bromide. The gel was then electrophoresed for 1.5 hours at
100
Volts/Cm. The electrophoresed PCR products were then visulalized by placing
the
gel onto a 302 nm UV lightbox and imaged with CCD camera.
20 To experimentally test candidate M 17sNAR unique sequences, PCR primers
were designed to amplify segments within several of the unique regions. The
PCR
primers were then used in PCR reactions performed on the M17 and M17sNAR
strains
to first optimize the PCR reactions. Optimizations were performed using
temperature
gradients centered at 59 C and +/- 7.5 C above and below this temperature. The
PCR
25 products from each reaction were run alongside one another on an analytical
agarose
ge1, stained with ethidium bromide, and imaged over a 302 nm UV lightbox using
a
CCD camera. The relative intensity of fluorescence from the stained DNA bands
was
quantified using GencTools software (Syngene) software. As shown in Table 5,
optimal PCR conditions were developed for PCR primers detecting unique regions
in
30 Contig 10, Contig 11, Contig 13, Contig 36, Contig 41, Contig 127, and
Contig 291.
The Contig 127 PCR primers, which have the highest average melting temperature
and produced optimal PCR reactions at the upper end of the optimization curve,
were
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
46
subsequently chosen for further validation against E. coli strains
representing the ':
genetic diversity of naturally occurring E. coli populations.
To validate the specificity of the Contig 127 PCR assay, the optimized Contig
127 PCR reactions were next tested against genomic DNA from a panel of E. coli
strains representing the genetic diversity of naturally occurring E. coli
populations
(ECOR collection) as well as additional serotype 02 strains (AOS strains) that
are
genetically unrelated to the serotype 02 M17sNAR strains. . Purified genomic
DNA
from each of the 72 ECOR strains, each AOS strain, the M17sNAR strain, and the
M17
parental strain were subjected to PCR in individual reactions with -the Contig
127
primers using the following conditions:
Template DNA 100 ng
C127FOR 1 pmol/uL
C127REV l pmol/uL
I X PCR buffer '
dNTPs 250uM '
Taq polymerase 1 'Unit
Water to 20 L
The PCR reactions were heated for 2.5 minutes at 95 C followed by 30 cycles
of 95 C for 30 seconds, 63 C for 45 seconds, 72 C for 45 seconds. The
reactions
were extended for 5 minutes at 72 C and finally held at 4 C until
electrophoretic
separation. For agarose gel electrophoresis, loading dye was added and the
reactions
were loaded into a 0.8% agarose gel. After electrophoresis, the gels imaged
over a.
UV lightbox using CCD camera. As shown in Table 12, only M17 and M17sN,ax
produced the expected 1,155 base PCR product from the Contig 127 PCR assay.
All
other strains failed to yield any PCR product from this reaction. Based on the
strains
that were tested in this validation, our results indicate that the Contig 127
PCR assay
is highly selective for M17srrnR.
Results
Table 12 below, summarizes the results of contig 127 analysis in the strains
of
the present invention and other E. coli strains tested.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
47
Table 12 - Validation of Contig 127 PCR reaction on MI7SNAR, ECOR strains, and
additional serotype 02 strains.
Isolate 0 H Host Contig_127 PCR result
M17 2 HN Human +
M 17SNAR 2 HN Human +
AOSI 2 HN Avain -
AOS11 2 HN Avain -
AOS19 2 HN Avian -
AOS29 2 HN Avain -
AOS36 2 HN Avain -
ECOR-01 ON HN human (Female, 19 ) -
ECOR-02 ON H32 human (Male)
-
ECOR-03 01 NM do -
ECOR-04 ON HN human (Female, 5yr)
-
ECOR-05 079 NM human (Female, 56yr)
-
ECOR-06 ON 'NM human (Male, 8yr)
-
ECOR-07 085 HN orangutan
-
ECOR-08 086 NM human (Female, 20 r -
ECOR-09 ON NM human (Female)
-
ECOR-10 06 H10 human (Female)
-
ECOR-11 06 H10 human (Female)
-
ECOR-12 07 H32 human (Female)
-
ECOR-13 ON FIN human (Female)
-
ECOR-14 OM- HN human (Female)
-
ECOR-15 025 NM human (Female)
-
ECOR-16 ON Hl0 leopard
-
ECOR-17 0106 NM pig
-
ECOR48 05 NM Celebese ape
-
ECOR-19 05 HN Celebese a -
ECOR-20 089 HN steer -
ECOR-21 0121 HN steer -
ECOR-22 ON HN steer -
ECOR-23 086 H43 elephant
-
ECOR-24 015 NM human (Female)
-
ECOR-25 ON HN dog
-
ECOR-26 0104 H21 infant -
ECOR-27 0104 NM giraffe
-
ECOR-28 0104 NM human (Female, 4yr) -
ECOR-29 0150 H21 kangaroo rat -
ECOR-30 0113 H21 bison -
ECOR-31 079 H43 leopard -
ECOR-32 07 H21 giraffe -
ECOR-33 07 H21 sheep -
ECOR-34 088 NM dog -
ECOR-35 01 NM human (Female, 36yr) -
ECOR-36 079 H25 human (Female, 20 r -
ECOR-37 ON HN marmoset -
ECOR-38 07 NM hucnan (Female, 21 r -
ECOR-39 07 NM human -
ECOR-40 07 NM human -
ECOR-41 07 NM human (Female, 22yr)
-
ECOR-42 ON H26 human (Male)
-
ECOR-43 ON HN human (Female)
-
ECOR-44 ON HN cougar
-
ECOR-45 ON HM pig
-
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
48
Isolate 0 H Host Contig_127 PCR resulte
ECOR-46 01 H6 ape
-
-
ECOR-47 OM H 18 sheep
ECOR-48 ON HM human (Female)
-
ECOR-49 02 NM human (Female)
-
ECOR-50 02 HN human (Female) -
ECOR-51 025 HN infant -
ECOR-52 025 HI orangutan -
ECOR-53 04 HN human (Female, 4 r -
ECOR-54 025 HI human -
ECOR-55 025 HI. human (Female) -
ECOR-56 06 H 1 human (Female) -
ECOR-57 ON NM gorilla
-
ECOR-58 0112. H8 lion -
ECOR-59 04 H40 human (Male) -
ECOR-60 04 HN human (Female) -
ECOR-6l 02 NM human (Female) -
ECOR-62 02 NM human (Female) -
ECOR-63 ON NM human (Female) -
ECOR-64 075 NM human (Female) -
ECOR-65 ON H 10 Celebese a e. -
ECOR-66 04 H40 Celebese ape
-
ECOR-67 04 H43 goat
-
ECOR-68 ON NM giraffe
-
ECOR-69 ON NM Celebese ape
-
ECOR-70 078 NM orilla -
ECOR-71 078 NM human -
ECOR-72 0144 H8 human -
1,155 base PCR product present, - No PCR product
EXAMPLE 5
Enumeration and confirmation of M17sNaR in spiked
fecal samples Experimental Procedures
Experimental Procedures
A combination of selective plating of on Violet Red Bile Agar (VRBA) and
PCR confirmation was used to determine if M17sNAR could be selectively
enumerated
in a spiked fecal sample. For these experiments, a composite fecal sample was
prepared by mixing 10 gram samples from 100 independent human fecal samples
into
a single composite. The composite was mixed for three 1-minute pulses in a
Waring
blender and the resulting slurry was distributed in approximately 25 mL
aliquots into
sterile 50 mL conical tubes. Herein, these samples are referred to as the
fecal
composite sample. The aliquots of composite sample were stored at -80 C_
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
49
For testing, aliquots of fecal samples were thawed and diluted in triplicate
by
serial 10-fold dilutions into sterile 0.1 % peptone. 0.1 mL samples of each
dilution
were then plated in duplicate onto the surface of Luria agar, Luria agar + 75
g/mL
nalidixic acid, VRBA, VRBA + 25 g/mL nalidixic acid. M17sNAR cells were
spiked
into the 10-1 dilution of two independent fecal composite aliquots. For the
spiking
experiment, a suspension of M 17sNAR cells was prepared by scraping a single
colony
of M 17sNAR cells from a culture that had been streaked onto Luria agar + 75
g/mL
nalidixic acid. The colony was resuspended in 5 ml of sterile 0.1 % peptone by
vortex
mixing for 30 seconds using a vortex mixer. The M 17sNAR cells present in the
lo*. M17sNAR suspension were enumerated by performing serial 10-fold dilutions
of the
suspension into sterile 0.1 % peptone and plating 0.1 mL portions of each
dilution
onto Luria agar, Luria agar + 75 g/mL nalidixic acid, VRBA, VRBA + 25 g/mL
nalidixic acid. The M17sNAR cell suspension was used to spike 10-1 dilutions
of the
fecal composite samples at two different concentrations by adding 0.1 mL of a
10-fold
15' or 1000-fold dilution of M17sNAR suspension into the 10-1 dilution of
independent
fecal composite aliquots. The spiked 10-1 dilutions were then diluted by
serial 10-fold
dilutions into 0.1% peptone. 0. i mL aliquots of each dilution were then
plated in
duplicate onto the surface of Luria agar, Luria agar + 75 g/mL nalidixic
acid,
VRBA, VRBA + 25 g/mL nalidixic acid.
20 . After the cells were spread onto the surface of the growth media, the
plates
were incubated for 36 hours at 37 C. The colonies were enumerated and averaged
for
each duplicate set of plates from the relevant dilutions. To confirm M 17sNAR,
10
colonies from each set of the VRBA + 25 g/mL nalidixic acid plates of the
relevant
dilutions were picked with toothpicks and inoculated into 100 L of Luria
broth in 96-
25 well culture plates. The plates were incubated for 16 hours at 37 C. From
each
culture, 50 L of cells was then removed to a 96-well PCR plate and mixed with
50
L of 20 mM Tris-0.2mM EDTA. The cells were then heated to 95 C for 10 minutes
in the thermocycler. From the heated cell suspensions, 2 L was removed and
distributed into a fresh 96-well PCR plate and 18 L of PCR mix was added. The
30 PCR mix consists of 1 X PCR buffer (Takara), 250 mM dNTPs (Takara), 1.4
units of
Taq DNA polymerase, luM of each primer (Contig 127 primers, above). The plate
was then covered with a 96-well lid and placed into the thermocycler.
Reactions were
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
heated to 95 C for 2.5 minutes followed by 40 cycles of 95 C for 30 seconds,
63 C
for 45 seconds, 72 C for 45 seconds. A final cycle of 72 C for 5 minutes was
then
conducted and the samples held at 4 C until ready for gel electrophoresis.
. To the completed PCR reactions, 2 L of loading dye (0.21% Bromphenol
5 Blue, 0.21% Xylene cyanol, 50% glycerol) was added. A total of 15 L of the
reactions was then loaded onto a 0.8% agarose gel prepared in IX TAE
containing I
ng/mL of ethidium bromide. The gel was then electrophoresed for 1.5 hours at
100
Volts/Cm. The electrophoresed PCR products were then visulalized by placing
the
gel onto a 302 nm UV lightbox and imaged with CCD camera.
Results
To measure the sensitivity and selectivity of the combined nalidixic acid
resistance selection and Contig 127 PCR confirmation, experiments were
performed
with human fecal samples. A composite fecal sample was prepared from 10-gram
samples of 100 human fecal samples. Samples of the composite were then mixed
with measured quantities of the M17SNAR cells and subjected to serial dilution
followed by plating of portions of each dilution onto VRBA + 25 gg/mL
nalidixic
acid as well as control media (VRBA, Luria agar, and Luria agar with 75 g/mL
nalidixic acid). After incubation, the number of colonies was averaged from
duplicate
plates of each dilution. As shown in Table 13, incorporation of 75 gg/mL
nalidixic
acid into Luria Agar was not selective for M17sNAR from fecal samples as this
medium yielded nearly as many colonies as the Luria Agar alone. Therefore,
nalidixic acid selection alone does not provide enough selectivity for
M17sN,ax
detection. In contrast to the Lura agar, the VRBA + naldixic acid was entirely
selective for M17sNAR, as the fecal composite sample alone (without added
M17sHAR)
yielded less than the detection limit of 10 CFU/ml lactose fermenting,
nalidixic acid
resistant colonies. Given that the fecal composite sample contained I X 104
lactose-
fermenting CFU/ml on VRBA, the results argue that less than 1 in 10,000
coliform
bacteria are capable of growth and lactose fermentation on VRBA + nalidixic
acid.
Samples in which M17sNAR cells had been introduced, however, did yield
nalidixic
acid-resistant, lactose-fermenting colonies in the VRBA + 25 gg/mi nalidixic
acid
media at the expected dilutions dilutions. Based on the number of input
M17sNAR
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
5t
cells, the VRBA + 25 g/mL nalidixic acid gave detection efficiencies of
between
23% (for the 1.3 X 105 input sample) and 42% (for the 1.3 X 103 input sample).
Therefore, the plating efficiency of the M17SNAR strain on VRBA + 25 g/mL
nalidixic acid is estimated at 32.5%. Combining the detection limit of< 10
CFU/mL
from an undiluted fecal sample with the 32.5% plating efficiency of the
M17sNAR on
VRBA + 25 g/mi nalidixic acid, a detection limit of <33 CFU/ml of M17SNAR in
a
fecal sample was determined. The results are summarized in Table 13 below.
To confirm that the colonies growing on the VRBA + nalidixic acid are only
M17sNAR, the Contig 127 PCR assay was performed on a total of 84 randomly
chosen
colonies from the VRBA + nalidixic acid plates derived from dilutions of
samples
containing M 17sNAR. To demonstrate the selectivity of the plating, 132
colonies from
VRBA plates without antibiotic were also chosen randomly and tested with the
Contig
127 PCR assay. Of the colonies chosen from VRBA plates, 48 were picked from
plates where no M 17sNAR had been added to the samples and 84 were chosen from
the
countable plates of dilutions from samples in which the M17SNAR had been
introduced. As shown in Table 13, below, no Contig 127 PCR positive colonies
were
obtained from those tested from the VRBA plates derived from unspiked samples,
as
would be expected. Moreover, as was anticipated, both Contig 127-positive and
Contig 127-negative colonies were detected on VRBA plates without antibiotics,
with
a higher ratio of positive to negative Contig 127 PCR positive colonies being
obtained
from the samples containing higher numbers of spiked M17sNAR. When the
colonies
from VRBA + 25 g/mL nalidixic acid were tested, only Contig 127-positive
colonies
were obtained, as would be expected. Therefore, the combination of selective
plating
on VRBA + nalidixic acid and Contig 127 PCR confinnation provides a highly
sensitive and highly selective method for enumerating M17SNAR from fecal
samples.
Table 13 - Enumeration o colonies rom uns iked and s fked ecal sam les.
Input M17SNAR CFU/ml fecal sample Contig 127 PCR
confirmation
LB 0 1.6 X 10
LB 1.3 X 101.1X10
LB 1.3 X 109.1X10
LB + 75 ILg/mi Nal 0 5.5 X 106
LB + 75 pg/mi Nal 1.3 X 10 1.2 X 10
LB + 75 g/ml Nal 1.3 X 10 1_7 X 10
VRBA 0 1 X 10 0/48
VRBA 1.3 X 10 1.1 X 10 40/48
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
52
Input M17SNAR CFU/ml fecal sample Contig 127 PCR
confirmation b
VRBA 1.3 X 10 2.0 X 10 23/36
VRBA + 25 ml Nal 0 > 10
VRBA + 25 ml Nal 1.3 X 10 3.0 X 10 48/48
VRBA + 25 g/ml Nal 1.3 X 10 5.5 X 10 36/36
No colonies present on the 10" dilution, the lowest dilution that was plated
Number of colonies positive/number of colonies tested
EXAMPLE 6
Detection of M17sNAR infecal samples from dogs prior to, during and following
administration of the probiotic
The overall objective of this study was to develop a tool for the
quantification
of E. coli M17SNAR in human fecal samples and a method which would measure the
degree and duration of shedding of the probiotic E. coli M17sNAR strain in
fecal
samples. Fecal samples collected from canines fed M17sNAR cultures during the
course of a 14-day toxicology study (conducted by Ricerca Biosciences LLC,
Concord, OH) were used to model this method. The approach used was to
enumerate
total coliforms and M17sNAR using selective plating on Violet Red Bile Agar
(VRBA)
and VRBA supplemented with 25 g/mL nalidixic acid (as shown for spiked human
fecal samples in Examples 5 above). Confirmation of M 17sNAR was conducted on
colonies growing on VRBA + 25 g/mL nalidixic acid using the M17sNAR-specific
Contig 127 PCR assay.
Experimental Procedures
Differential plating of fecal samples - Fecal samples were collected during
the course of a GLP dog toxicology study conducted by Ricerca Biosciences LLC,
Concord, OH. Ten grams of each sample was mixed with 10 mL of sterile saline +
15
% glycerol in a sterile 50 mL conical tube. The slurries were then frozen at -
80 C
and transported on dry ice. Each sample was logged into a master spreadsheet
and
subsequently stored at -80 C until processing. For processing, the samples
were
thawed at room temperature for 1 hour and mixed vigorously by shaking for 30
seconds with an additional 10 mL of sterile 0.1 % peptone. The resulting
slurry is
referred to as the undiluted sample.
A 0.5 mL portion of the undiluted sample was removed with a P-1000
micropipettor and dispensed into 4.5 mL of sterile 0.1% peptone. The diluted
sample
was then serially diluted to a final dilution of 10-6. For plating, 0.1 mL
portions of the
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
53
undiluted sample and the 10'' through 10-6 dilutions were plated in duplicate
onto
VRBA and VRBA + 25 g/mL nalidixic acid. The plates were incubated for 36
hours
at 37 C prior to enumerating colonies. Presumptive total coliforms were scored
as the
number of lactose-positive colonies on VRBA X reciprocal of the dilution.
Presumptive M 17sNAR were scored as the number of lactose-positive colonies on
VRBA + 25 g/mL nalidixic acid X reciprocal of the dilution.
PCR confirmation - To confirm presence of M17sNAR, colonies were picked
from VRBA or VRBA + 25 g/mL nalidixic acid and tested using the Contig 127
PCR assay. Colonies to be tested were picked using sterile toothpicks and
inoculated-
into 200 L cultures of Luria Broth in sterile 96-well assay plates. Controls,
including M17sNAR and DH5a, were also inoculated into the appropriate wells.
The
plates were then covered with a sterile plastic lid and incubated for 15 hours
at 37 C_
Following incubation, 50 L of cells from each well was then transferred to
the
corresponding wells of a 96-well PCR plate and mixed with 50 L of 20 mM Tris-
0.2mM EDTA. The cells were then heated to 95 C for 10 minutes in the
thermocycler. From the heated cell suspensions, 2 EtL was removed and
distributed
into a fresh 96-well PCR plate and 18 L of PCR mix was added. The PCR mix
consists of 1X PCR buffer (Takara), 250 mM dNTPs (Takara), 1.4 units of Taq
DNA
polymerase, 1 uM of each primer. The plate was then covered with a 96-well lid
and
placed into the thermocycler. Reactions were heated to 95 C for 2.5 minutes
followed by 40 cycles of 95 C for 30 seconds, 63 C for 45 seconds, 72 C for
45
seconds. A final cycle of 72 C for 5 minutes was then conducted and the
samples
held at 4 C until ready for gel electrophoresis.
To the completed PCR reactions, 2 L of loading dye (0.21 % Bromphenol
Blue, 0.21 % Xylene cyanol, 50 % glycerol) was added. A total of 15 L of the
reactions was then loaded onto a 0.8% agarose gel prepared in 1 X TAE
containing I
ng/mL of ethidium bromide. The gel was then electrophoresed for 1.5 hours at
100
Volts/Cm. The electrophoresed PCR products were then visualized by placing the
gel
onto a 302 nm UV lightbox and imaged with CCD camera.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
54
Results
Presumptive and confirmed detection of M17SNAR in canine fecal samples.
Individual animals were dosed with M17SNAR daily for 14 days by gastric
gavage.
The animals were fed within 2 hours after administration of the Ml7sNAR dose.
Fecal
samples were collected daily beginning on day 0 and continuing through day 14
or
day 28, depending on study group. Dosing was done at two different dose
levels, 5 X
109 and 1 X 1013 cfu per dose, per day. For certain animals in the high dose
group,
dosing was stopped after day 14 and fecal samples continued to be collected
for an
additional 14 days. For example enumeration of M 17sHAR in feces of selected
animals
from the high dose group, fecal samples from day 0 and days 1, 4, 7, 10, and
13 of the
dosing period and days 16, 18, 20, 22, 25, and 28 post administration period
were
tested by differential plating on VRBA and VRBA + 25 g/mL nalidixic acid.
Ten colonies from the highest dilutions of VRBA + 25 gg/mL nalidixic acid
plates yielding countable colonies (30-300 colonies) were then subjected to
Contig
127 PCR analysis to confirm the presence of M17sNAR. Ten colonies were also
tested
from VRBA plates when the sample failed to yield any nalidixic acid-resistant
colonies on even the undiluted sample. Table 14 shows the counts of
presumptive
total coliforms, presumptive M17sNAR, and the results of the Contig 127 PCR
assay.
In each instance, only Contig 127-positive colonies were recovered from VRBA +
nalidixic acid plates while no Contig 127-positive colonies were found among
samples which failed to yield colonies on VRBA + nalidixic acid. Thus, the
correlation between presumptive M17SNAR (growth of colonies on VRBA +
nalidixic
acid) was 1Ø
Table 14 - Presumptive total coliforms and M17SNARfrom fecal samples of
canines
dosed with M17sNAR.
VRBA +
Animal Day VRBA ~ai Contig 127 PCR (positives from
cfu Lo gio) 10 independent colonies)
3028-3M 0 4.204 1.477 0
Male 1 7.176 6.792 10
4 5.491 5.633 l0
7 6.380 6.204 10
10 5.839 5.491 10
13 6.968 6.544 10
16 4.826 1.491 0
18 5.643 1.491 0
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
VRBA +
Animal Day VRBA ~ai Contig 127 PCR (positives from
cfu Lo l0 10 independent colonies)
20 6.146 1.491 0
22 7.230 1.491 0
25 4.342 1.491 0
28 5.279 1.491 0
3029-3M 0 6.342 1.477 0
Male 1 6.176 4.863 10
4 5.079 4.301 10
7 6.903 6.079 10
10 6.342 4.898 10
13 7.255 6.477 10
16 4.623 1.477 0
18 6.505 1.477 0
20 6.079 1.477 0
22 6.041 1.477 0
25 6.279 1.477 0
28 6.771 1.477 0
3032-3F 0 4.869 1.477 0
Female 1 5.799 5.322 10
4 6.114 5.672 10
7 4.163 4.415 10
10 4.763 4.556 10
13 6.079 5.380 10
16 3.176 2.079 0
18 4.431 l .505 0
20 4.204 1.505 0
22 3.959 1.505 0
25 4.919 1.505 0
28 4.415 1.505 0
3033-3F 0 2.929 1.477 0
Female 1 5.462 5.398 10
.4 5.996 6.826 10
7 7.415 7.146 10
10 6.653 6.431 l0
13 5.940 6.633 10
16 4.624 2.176 10
18 5.959 1.518 0
20 6.204 1.518 0
22 7.415 1.518 0
25 6.518 1.518 0
28 6.613 1.518 0
Detectab[e shedding of M17srvAR. The total coliform and total M17sN,ax
counts for the four animals are plotted in Figures 3a-d. The total coliform
counts per
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
56
animal ranged between 104 and 107 CFU/g of feces. Shedding of M17SNAR was
detectable in all four animals through day 13. Two animals continued to shed
detectable levels of M17SNAR until day 16 (Figures 3c-d). Beyond day 16,
Ml7sN,aa
could no longer be detected in the fecal samples. Thus, after dosing was
stopped (day
14) the M17sNAR population was rapidly eliminated to levels below the
detection limit
of the.assay (101'48or 30 CFU/g).
During the dosing period, fluctuation was noted in both the total coliform
counts and the M17SNAR counts. Whether this reflects statistical sampling
error or
other factors is unknown. After the period in which shedding was detectable,
the total
coliform levels generally reached the pre-administration levels, with the
exception of
-animal 3033, in which the levels were approximately four-logs higher after
dosing.
This study has shown that M17sNAR can be specifically detected in the feces of
canines dosed with M17SNAR. The M17SNAR does not appear to stably colonize the
bowel as a member of the flora of these animals, and it is decreased to
undetectable
levels within 2-4 days after the dosing period. There was little effect of the
M17SNAR
on the 'total coliform population in terms of absolute numbers, although the
data
would not be able to measure any affects on diversity of the flora.
Nonetheless,
within 4-6 days after the dosing period, the total coliform levels are nearly
as high, or
higher than pre-administration levels.
Of note, there are some dose-response relationships that can be discerned
during the first few days of the dosing period. It is likely that at these
higher doses,
the niche within the bowel that can be occupied by M 17sNAR is quickly
saturated. The
assay method described in this study is sensitive and can detect appearance,
duration
and disappearance of M 17sNAR in feces. Hence, this is an effective assay
format that
25. can be used to monitor colonization and elimination of E. coli M17sNAR
during human
clinical trials.
EXAMPLE 7
Genomic sequencing of M17sNAR
A complete genome sequence of E.rcherichia coli M17sNAR was effected in
order to identify genomic sequences unique to E. coli M17sNAR. In order to
accomplish this, whole genome shotgun sequencing strategy was used in which
the
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
57
the genomic DNA is "peppered" with enough sequence 'reads' such that they
overlap,
and yield, when assembled, the complete sequence of the genome. An 8-fold
coverage of the Escherichia coli M17sNAR genome was performed to obtain a
comprehensive number of sequence 'reads' and a shotgun assembly was generated
from the same: To complete the work, the following steps were taken
sequentially,
1. Physical shearing of genomic DNA;
2. Construction of three separate libraries: one high titer small insert
library, one 10 kb insert library and one 40 kb insert library;
3. Random shotgun sequencing to obtain approximately 8-fold sequence
coverage of the genome; and
4. Assembly of the shotgun sequence data using highly specialized
genome sequence assembly computer programs.
Experimental Procedures
Physical shearing of DNA -
E.coli M l7sNAR genomic DNA was checked for molecular weight. Pulse field
gel electrophoresis (PFGE) was run with a high molecular weight marker to
determine
the molecular weight of the sample (BioRad ChefMapper, Hercules, CA). The high
molecular weight genomic DNA was then mechanically sheared via a HydroshearTM
device (Genemachines, San Carlos, CA) to the desired sizes of approximately
4.Okb,
10.Okb and 40.Okb. The HydroshearTM machine provides a controlled and
reproducible method available for generating random DNA fragments. This
software-
driven device (Hydroshear software v. 1Ø6a) uses hydrodynamic shearing
forces to
fragment DNA strands into designated sizes.
Library Construction
Experience. has deinonstrated the need for construction of several libraries
including both, small and large-sized DNA inserts. The small-insert library is
used to
obtain an appropriate coverage of the genome and the large-insert library is
used to
obtain a`scaffold' of the genome, which is used during the closure phase of
the
sequencing project. In other words, the "reads" from the small insert library
provides the `bulk' of the sequence information while the "reads" from the
large-
insert library help in assembling the sequence information in the correct
order.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
58
For the whole genome shotgun sequencing of E. colf M.17sNAR, three separate
libraries containing 4, 10 and 40 kb DNA inserts were constructed using the
sheared
Escherichia coli Ml7sNAR DNA (Figure 4). The 3-4kb and 10.0kb fragments were
cloned into the pAGEN vector system (Agencourt Bioscience Corp., Beverly, MA)
for isolation and sequencing. To improve and verify assembly, a large insert
fosmid
library was generated with the 40 kb fragments using the CopyControlTM pCC 1
FOSTM
vector system (Epicentre Technologies, Madison, WI). A fosmid is similar to a
plasmid (circular DNA) but is capable of containing much larger sizes of DNA
inserts, up to 50 kb, compared to about 10 kb in a plasmid. The large insert
size (40
kb) of Fosmid libraries make them particularly attractive, since Fosmid clones
can
close small physical gaps with fewer walking steps, in comparison to small
insert
libraries and can therefore reduce redundant sequencing.
While constructing libraries it is essential that each recombinant clone
contain
a single genomic DNA insert. The presence of multiple inserts in a single
clone
would give rise to artifacts during genome assembly. In order to ensure this
the
randomly sheared DNA was used in construction of plasmid libraries using an
adaptor
based cloning method. Herein, the cloning vector was cleaved at a symmetrical
pair
of BstXl sites to produce non-complementary 4-base overhangs as a result of
which
the vector fragment cannot recircularize. Mechanically sheared insert DNA was
end-
repaired and ligated (or `joined') to an adaptor with an overhang
complementary to
the vector ends, but not to itself. The prepared inserts were then ligated or
inserted
into the vector. The use of non-self-complementary adaptors reduced background
and
substantially lowered the incidence of clone siblings.
Prior to proceeding with high throughput sequencing, the integrity of the
transformed libraries was verified. A total of 768 clones were picked and
subjected to
bidirectional sequencing. A BLAST 2.2.10 (Basic Local Alignment Search Tool)
analysis was performed on the 1,536 sequencing "reads"
(www.ncbi.nlm.nih.gov/blast/). The BLAST program finds regions of local
similarity
between sequences. It compares nucleotide or protein sequences to sequence
databases and calculates the statistical significance of matches thereby
providing
valuable information about the possible identity and integrity of the 'query'
sequences.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
59
Random Shotgun Sequencing
Sequencing template preparation - The plasmids containing genomic DNA
were isolated from library cultures using Solid Phase Reversible
Immobilization
technology (SPRI ) [Hawkins, TL., K.J. McKernan, L.B. Jacotot, J.B. MacKenzie,
P.M. Richardson and E.S Lander. 1997. A'magnetic attraction to high-throughput
genomics. Science Vol. 276 (5320), 1887-1889]. High-copy plasmid templates (3-
4kb and 19kb insert plasmids) were purified using SprintPrepTM SPRI protocol
while
the - low-copy (40kb fosmid) templates were purified using a SPRI protocol
(Agencourt Bioscience Corp., Beverly, MA). The SPRI (Solid Phase Reversible
Immobilization) technology uses carboxylate-coated, iron-core, paramagnetic
particles to capture DNA of a desired fragment length based on tuned buffering
conditions. Once the desired DNA is captured on the particles, they can be
magnetically concentrated and separated so that contaminants can be washed
away.
This procedure harvests plasmid DNA directly from lysed bacterial cultures by
trapping both plasmid and genomic DNA to the functionalized bead particles and
selectively eluting only the plasmid DNA.
Shotgun Sequencing - The DNA templates were sequenced in 384-well
format using BigDye Version 3.1 reactions on AB13730 instruments (Applied
Biosystems, Foster City, CA). The BigDye Version 3.1 contains dye terminators
labeled with novel high sensitivity dyes. This BigDye terminator chemistry
involves
a fluorescein donor dye linked to a dRhodamine acceptor dye and is 2-3 times
brighter
than standard dye terminators and also has narrower emission spectra giving
less
background noise. This provides an overall improvement of 4-5 times in
sensitivity
of the capillary analytical procedure. During sample preparation for
sequencing, the
DNA fragments are chemically labeled with these fluorescent dyes, which
facilitate
the detection and identification of the DNA.
In this procedure, labeled DNA samples are prepared in 96- or 384-well plates
and placed on the AB13730 Genetic Analyzer machine in which capillary
electrophoresis is used in separating the mixture of DNA fragments according
to their
lengths, providing a profile of the separation and determining the order of
the four
deoxyribonucleotide bases. The DNA molecules from the samples are injected
into
thin, fuse-silica capillaries that have been filled with polymer. The DNA
fragments
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
migrate towards the other end of the capillaries, with the shorter fragments
moving
faster than the longer fragments. As the fragments enter a detection cell,
they move
through the path of a laser beam which causes the dye on the fragments to
fluoresce.
This fluorescence is captured by a charge-coupled device (CCD) camera. The CCD
5 camera coverts the fluorescence information into electronic information,
which is then
transferred to a computer workstation for processing by the 3700 data
collection
software to generate electropherograms which plot relative dye concentration
against
time for each of the dyes used to label the DNA fragments. The positions and
shapes
of the electropherogram are used to determine the base sequence of the DNA
10 fragment. Thermal cycling for the sequencing reactions was performed using
384-
well Thermocyclers (ABI, MJ Researcli, Hercules, CA). Sequencing reactions
were
purified using CleanSeq dye-terminator removal kit from Agencourt Bioscience
Assembly
Once the shotgun sequencing phase is complete, the sequencing `reads'
15 generated from random subclones are assembled into contigs (contiguous
sequences),
followed by a directed, or finishing phase in which the assembly is inspected
for
correctness and for various kinds of data anomalies (such as contaminant
`reads',
unremoved vector sequences, and chimeric or deleted `reads'), additional data
are
collected to close gaps and resolve low quality regions, and editing is
performed to
20 correct assembly or base-calling errors.
Validation of sequence 'reads': All 'reads' obtained from the high-
throughput sequencing were processed using Phred base calling software
(version
0.020425c) and constantly monitored against quality metrics using the Phred
Q20
(University of Washington). Phred is a base calling software developed at the
25 University of Washington Genome Center which reads DNA sequence
chromatogram
files, analyzes peaks to call bases and assigns quality scores to each
nucleotide (2).
Phred Q20 calls bases with a Phred quality value of 20 or greater. A Phred
score of
20 indicates the existence of one error in 100 bases. The quality scores for
each run
were monitored through Galaxy LIMS system, a state-of-the-art Oracle-based
30 Laboratory Information Management System (LIMS) (Agencourt Bioscience Corp,
Beverly, MA) with any substantial deviations from the normal range
investigated
immediately.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
61
Assembly step -The assembly of the vast amount of sequence data generated
into a few contigs (contiguous sequence) requires a complex computational
process
which is further complicated by three main considerations that need to be
addressed,
1. quality scores of each sequence,
2. use of the generated sequence itself or its complement and
3. presence of repeated sequences whose mis-assembly needs to be
avoided.
A range of computer software programs with complex algorithms, are now
available to accomplish assembling an entire genome. Clusters of overlapping
sequences are constructed and consensus sequences are deduced from these
clusters.
Paracel Genome AssemblerTM, version 2,6.2 (Paracel, Pasadena, CA), coupled
with
the LIMS system (Agencourt Bioscience Corp.; Beverly, MA) were used to
assemble
the sequence data for this project. Paracel's scaffold viewer and Consed
(version
13.0), a graphical tool for viewing and editing sequence assemblies
(University of
Washington) were used to finish the assembly [Gordon, D., C. Abajian and P.
Green.
1998. Consed: a graphical tool for sequence finishing. Genome Res Vol. 8 (3),
195-
202].
Results
Whole genome sequencing of E.coli M17sNõR was accomplished using the
shotgun sequencing method. A multi-library strategy was utilized which helped
to
ameliorate the presence of repeat elements and other artifacts during
assembly. Large
insert libraries to increase the clone coverage and scaffolding of the genome
assembly. In addition to a 3-4 kb-insert, high copy number plasmid library, a
10kb-
insert plasmid and a 40kb-insert fosmid libraries were also constructed.
Shotgun
sequencing of the three libraries was performed and a total of 36,265,538
Phred 20
bases were generated to obtain approximately an 8-fold coverage of the genome.
- The
sequence 'reads' were assembled into contiguous sequence blocks and subjected
to a
BLAST analysis for identification of se.quences unique to E.coli M17sNAR.
Pulse Field Gel Electrophoresis of E.coli M17sNAR genomic DNA
The whole-genome shotgun strategy involves randomly breaking DNA into
segments of various sizes and cloning these fragments into vectors for
sequencing.
The success of this strategy is highly dependent on the quality and integrity
of the
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
62
genomic DNA used as the starting material. A pulse field gel electrophoresis
was run
to check the quality of the genomic DNA and to determine if the DNA was high
molecular weight.
During continuous field electrophoresis, DNA above 30-50 kb migrates with
the same mobility regardless of size and is seen in a gel as a single large
diffuse band.
In the pulse field method the DNA is forced to change direction during
electrophoresis and different sized fragments within this diffuse band begin
to
separate from each other. With each reorientation of the electric field
relative to the
gel, smaller sized DNA begins to move in the new direction more quickly than
the
larger DNA. Thus, the larger DNA lags behind providing a separation from the
smaller DNA. Any low molecular weight or plasmid DNA can thus be identified.
High-throughput Sequencing
The high-throughput shotgun sequencing of E.coli M17SNAR resulted in 57,408
distinct high-quality 'reads' representing 36,265,538 bases with good quality
scores,
providing an approximately 8-fold coverage of the genome. The distribution of
these
sequences across the three different libraries constructed is shown in Table
15, below.
The high copy standard 3-4 kb genome library offered the most cost efficient
method
to produce paired-end sequence coverage of the genome, while the 10 kb and
Fosmid
libraries provided larger physical links from paired-end 'reads' which are
useful in
ordering and orienting contiguous sequence `blocks' in the assembly process.
Table 15 - Sequence 'reads'generated by the high-throughput sequencing of the
three libraries
Libraries
4kb insert 10kb insert Fosmid (40kb insert)
Total 'reads' 27,648 13,728 16,032
Pass rate* 91.54% 83.75% 85.03%
Average Phred20 bases**
per'read' 725 763 670
Total Phred20 bases 18,349,009 8,772,363 9,144,166
* Pass rate: defined as a`read' containing >100 cumulative Phred20 bases**
** Phred20 bases: Bases which receive a score of 20 or more when subjected to
Phred analysis, a
base-
calling program developed at the University of Washington Genome Center.
Assembly
In the assembly phase, sequence data was vector and quality screened based
on Phred quality score information. All the sequence 'reads' from the
libraries were
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
63
first compared to each other. Identities between the sequences of different-
'reads'
were noted, and then used to align the sequences into contiguous stretches of
sequence called contigs. The sequences of two different 'reads' of the same
segment
of DNA may not be identical because of the quality of the sequencing reaction
analysis. Thus for each base in the contig it is usual to require that it is
independently
confirmed from multiple overlapping 'reads' from both directions.
Contig building software designed to take into account the "quality" of each
base in a`read' (where quality is a measure of the confidence the Phred
software has
that the base has been called correctly) were used. Any gaps, discrepancies or
.'ambiguities in the sequence were also identified. Contigs were then ordered
and
linked together into larger supercontigs by using paired 'reads' lying in
different
contigs. A total of 464 contigs were assembled and the details are listed in
Table 16,
below. Whole genome assembly was thus performed using the Paracel Genome
AssemblerTM, version 2.6:2, coupled with the Agencourt's LIMS system while,
Paracel's scaffold viewer and Consed (version 13.0) were used to finish the
assembly.
Table 16 - Summa of the sequence assembly
Contigs Total # Total length
Su erconti s 71 4420860
Conti s(?2 kb) 313 4706396
Conti s(<2 kb) 80 na*
Total # of contigs 464 Na
= na, not applicable
Identification ojsequences unique to E.coli MI7sNAR
To identify potential unique sequences, a BLAST analysis was effected to help
determine sequences unique to E. coli M17sNAR. BLAST, which stands for `Basic
Local Alignment Search Tool' (www.ncbi.nlm.nih.gov/BLAST/) is a program that
finds regions of local similarity (alignment) between sequences. The program
compares nucleotide or protein sequences to sequence databases and calculates
the
statistical significance of matches: BLAST can be used to infer functional and
evolutionary relationships between sequences as well as help identify members
of
gene families. BLAST analysis allows for performing five distinct blast
comparisons.
For this study a blastn analysis was used which compares a given nucleotide
sequence
with other nucleotide sequences present in the database.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
64
When the BLAST program finds an alignment to the `query' sequence, it calls
it a`hit' and then scores the alignment based on the similarity between the
two
sequences using different statistical parameters. One of these is the Expect
value (E),
which is defined as a parameter that describes the number of hits one can
"expect" to
see just by chance when searching a database of a particular size. It
decreases
exponentially with the Score (S) that is assigned to a match between two
sequences.
Essentially, the E value describes the random background noise that exists for
matches between sequences. For example, an E value of 1 assigned to a hit can
be
interpreted as meaning that in a database of the current size one might expect
to see I
match with a similar score simply by chance. This means that the lower the E-
value,
or the closer it is to "0" the more "significant" the match is.
When no sequence similarities are found in a BLAST analysis of a`query'
sequence against a particular database, it is recorded as "no hits found".
This
indicates that the query sequence is not found anywhere in the database making
it a
unique sequence.
Strategy devised to identify unique sequences:
All 464 total contigs were provided electronically as *.txt files of the
individual contig sequences in FASTA format
(www.ncbi.nlm.nih.gov/blast/html/search.html). These files were used in a
pairwise
2o BLAST analysis of the entire contigs against the E. coli CFT073 genome
sequence
and subsequently to identify the non-aligning regions from the M17 contigs.
These
non-aligned sequences were then used in pairwise BLAST to identify any
sequence
homology against the E. coli MG1655 (K-12), E. coli EDL933 (0157:H7), and E.
coli
Sakai (0157:H7) genome sequences. Segments not showing significant alignment
(sequence homology) to either the E. coli CFT073, K-12, or 0157:H7 genomes
were
then used in a BLAST search - against the entire nr NCBI database
(www.ncbi.nlm.nih.gov/BLAST/).
In a parallel approach, BLAST analysis was effected with each of the 464
contigs first
split up into 200bp (base pair) fragments and then individually blasted
against two
specialized databases. The first database constructed was an `E. coli'
database, in
which four strains of E. coli (www.ncbi.nlm.nih.gov/genomes/lproks.cgi) were
included to create a database named NCBlrefseq_ecoli.dna (Escherichia coli
strains
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
included were CFT073, K12, 0157:H7 and 0157:H7 EDL933). For the second
database, all bacterial genomes present in the NCBI database on August 19,
2005
were consolidated to create a `Bacterial' database and named
NCBIrefseq_bacteria.dna. Next, each of the 200bp fragments was subjected to a
5, blastn analysis against both consolidated NCBI databases of both E. colf
and bacteria,
described above. Sequences with `no hits,' were identified to be unique
sequences.
There were nine unique 200bp sequence fragments thus identified. All nine
sequences had no hits against the `E. coli' database but `hits' were found,
although
mostly with poor scores against the `Bacteria' database.
10 Conclusion
Whole genome shotgun sequencing of E. coli M17sNAz was successfully
completed to approximately an 8-fold coverage of the genome. Sequences unique
to
the organism were identified using BLAST analysis. The documented locations of
the unique sequences found in the E. coli M17sNAR genome are listed in Table
17,
.15 below. For each of nine unique sequences, the following details are
provided in
Example 8,
The sequence, 200 base pairs in length.
BLAST 2.2.10 results
Against the E. coli database, NCBlrefseq_ecoli.dna: No hits were registered
for any
20 of the nine sequences.
Against the Bacterial database, NCBIrefseq_bacteria.dna: The top ten highest
scoring
hits are tabulated along with the respective `E values'.
Based on `blastn' analysis, none of the nine, 200 base pair long unique
sequence fragments showed any homology to the consolidated E. coli database.
25 There was homology found when these same sequence fragments were compared
to a
consolidated Bacterial database, even if the sequence homology was poor in
most
cases. For eight of the nine sequences, the sequence homology to bacteria
other than
E. coli varied from 7 to 14.5% base pair match (the percent homology for the
top
`blastn' hit for each sequence is shown in Table 17 below.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
66
Table 17- Unique E. coli M17SNAR Sequences Ident fed by Shotgun Sequencing
Approach
Appendix Page Non-E. coli E. colf
No. No, Sequence Identifer* Homology Homology
1 13 081205.asm.C13 39801 40000 9.5 0.0
2 14 081205.asm.C120 38601 38800 10.0 0.0
3 15 081205.asm.C 127 15201 15400 10.0 0.0
4 16 081205.asm.C 166 1001 1200 14.5 0.0
17 081205.asm.C228 1401 1600 10.0 0.0
6 18 081205.asm.C250 3001 3200 90.0 0.0
7 19 081205.asm.C251 601 800 11.5 0.0
8 20 081205.asm.C274 2401 2600 13.5 0.0
9 21 081205.asm.C435 601 800 9.0 0.0
* Sequence identifiers indicate the origin of the fiagments: Each of the 464
contigs assembled for this
project were
5 numbered C1 to C464. Once each contig was split into 200bp fragments for the
BLAST analysis, each
fragment was
denoted by the contig number followed by the numbers of the base pairs
included in the fragment.
For the unique sequence 081205.asm.C250 3001_3200, a 90% base pair
match to Salmonella enterica subspecies was found.
In conclusion, the whole genome sequencing of Escherichia coli M17SNAR was
completed and genomic sequences unique to E. coli M17sNAR have been
successfully
identified.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
67
EXAMPLE 8
Sequence information
Example 8.1
Unique sequences identified with using BLAST analysis:
1. Sequence name: 081205.asm.C13_39801_40000 SEQ ID NO: 1
T1TI ITATGACCGAGTAAACAACAGGCTACGTCGCTCTTGGGTCATCGGT
TGTGCGTTTAATACACTTACAAGAGAACCTACCGTGGTGATGGGAAGAAA
CGGATTATCTTCTATTCCGCGTAGATCGCGCCCACAACGAGCGGCAATAT
CTTCGACCAGCTCTTCTAACTCGTCTGCATCGTTTACTAAATCCAGATCA
Blast Results:
A. Against E.coli Database:
Query= 081205.asm.C13_39801_40000 (200 letters)
Database: NCBlrefseq_ecoli.dna
6 sequences; 20,994,025 total letters
Searching..done
***** No hits found ******
Database: NCBlrefseq_ecoli.dna
Posted date: Aug 20, 2005 6:10 AM
Number of letters in database: 20,994,025
Number of sequences in database: 6
3oB. Against Bacterial Database:
Table 18
Top 10 Sequences producing si nificant alignments: E Value
Bacillus subtilis subsp. subtilis str. 168 0.47
Thermoanaerobacter ten con ensis MB4 1.8
Caulobacter crescentus CBI S 1.8
Thermobi rda usca YX 7.3
Salmonella enterica subs . enterica serovar 7.3
Silicibacter omero i DSS-3 me a lasmid 7.3
Salmonella enterica subsp. enterica serovar 7.3
Rickettsia typhi sir. Wilmington 7.3
Rhodo seudomonas alustris CGA009 7.3
Wolinella succinogenes DSM 1740 7.3
Database: NCBlrefseq_bacteria.dna
Posted date: Aug 19, 2005 10:25 AM
Number of letters in database: 788,089,043
Number of sequences in database: 413
BLASTN 2.2.10 [Oct-19-2004]
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
68
Example 8.2
2.SequenceNarne:081205.asm.C120_38601_38800 SEQ ID NO 2:
CCACAACATCCGACCAACGAAATCGTCCTGACGAGTGCTGTCCTGCGGGC
GGGCCAGAGCATGTTTGACGACTATAGCCTCTTTGCCCTGTATACCATCT
.CGATAAGTATCTGCCCAAGCGTGCAACGTTTGATGCAGCACTGAATGATC
AGTGGAGCCCGCCGGTACGGTGTAAAGGATAGGAGTGACCCCTTTGGCCT
Blast Results:
A. Against E.coli Database
Query= 081205.asm.C120_38601_38800 nseq=468
(2001etters)
Database: NCBlrefseq_ecoli.dna
6 sequences; 20,994,025 total letters
Searching..done
***** No hits found ******
Database: NCBIrefseq_ecoli.dna
Posted date: Aug 20, 2005 6:10 AM
Number of letters in database: 20,994,025
Number of sequences in database: 6
B. Against Bacterial Database
Table 19
Top 10 Sequences producing significant alignments: E Value
Photobacterium profundum SS9 chromosome 1 0.12
Acinetobacter s . ADPI 0.47
Chromobacteriuin violaceum A TCC 12472 0.47
Gluconobacter oxydans 621H 1.8
Pseudomonas , rin ae v_ phaseolicola 1448A 1.8
Burkholderia seudomallei K96243 7.3
Burkhotderia mallei ATCC 23344 7.3
Yersinia seudotuberculosis IP 32953 7.3
Yersinia pestis blovar Medievalis str. 91001 7.3
Gloeobacter violaceus PCC 7421 7.3
Database: NCBlrefseq_bacteria.dna
Posted date: Aug 19, 2005 10:25 AM
Number of letters in database: 788,089,043
Number of sequences in database: 413
BLASTN 2.2.10 [Oct-19-2004]
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
69
Example 8.3
3. Sequence Name: 081205.asm.C127_15201_15400 SEQ ID NO: 3
ATTATGCAAGACCTTATATCAGCCTCCATCCGTACTGGACAAAATACCAT
TGTTCAAAAGTGGGGAAGATTCTATTCTCTTAGCATCGCTCGTTGGCTTG
CCACAGTATTAGCAGAACTGTCTGATATAGCTTCTCATAAATATGGAATA
ATTAGTTTTTATGGCCTTAGTGAACATTGTTGCAGTTATATAGTTGAAGA
Blast Results:
A. Against E. coli Database
Query= 081205.asm.C127_15201_15400 nseq=274
(200 letters)
Database: NCBIrefseq_ecoli.dna
l s 6 sequences; 20,994,025 total letters
Searching..done
***** No hits found ******
Database: NCBlrefseq_ecoli.dna
Posted date: Aug 20, 2005 6:10 AM
Number of letters in database: 20,994,025
Number of sequences in database: 6
B. Against Bacterial Database
Table 20
Top 10 Sequences producing si ni6cant alignments: E Value
Wi lesworthia glossinidia 0=12
Zymomonas mobilis subsp. mobilis ZM4 7.3
Photobacterium profundum SS9 7.3
Prochlorococcus marinus subs . pastoris str. 7.3
Chlorobium te idum TLS 7.3
Thermoto a maritima MSB8 7.3
Database: NCBIrefseq_bacteria.dna
30. Posted date: Aug 19, 2005 10:25 AM
Number of letters in database: 788,089,043
Number of sequences in database: 413
BLASTN 2.2.10 [Oct-19-2004]
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
Example 8.4
4.SequenceName:081205.asm.C166_1001_1200 SEQ ID NO:
4CACGTACTAAGCTCTCATGTTTAACGTACTAAGCTCTCATGTTTAACGAA
5 CTAAACCCTCATGGCTAACGTACTAAGCTCTCATGGCTAACGTACTAAGC
TCTCATGTTTCACGTACTAAGCTCTCATGTTTGAACAATAAAATTAATAT
AAATCAGCAACTTAAATAGCCTCTAAGGTTTTAAGTTTTATAAGAAAAAA
Blast Results:
10 A. Against E.coli Database
Query= 081205.asm.C166_1001_1200 nseq=3
(200 letters)
Database: NCBIrefseq_ecoli.dna
15 6 sequences; 20,994,025 total letters
Searching..done
***** No hits found ******
Database: NCBlrefseq_ecoli.dna
Posted date: Aug 20, 2005 6:10 AM
Number of letters in database: 20,994,025
Number of sequences in database: 6
.25
B. Against Bacterial Database
Table 21
Top 10 Sequences producing si nifcant alignments: E Value
Pseudomonas fluorescens Pf-5 0.008
Ehrlichia ruminantium str. Wel evonden 0.47
Ehrlichia ruminantium str. Gardel 0.47
Ehrlichia ruminantium sir. Welgevonden 0.47
Shewanella oneidensis MR-1 0.47
Rickettsia conorii str. Malish 0.47
Bacillus thuringiensis serovar konkukian str. 9 1.8
Pholorhabdus luminescens subs . laumondii 7T01 1.8
Bacteroides thetaiotaomicron VPI-5482 1.8
Stre tococcus agalactiae NEM316 1.8
Database: NCBIrefseq_bacteria.dna
Posted date: Aug 19, 2005 10:25 AM
Number of letters in database: 788,089,043
Number.of sequences in database: 413
BLASTN 2.2.10 [Oct-19-2004]
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
71
Example 8.S
5. Sequence Name: 081205.asm.C228_1401_1600 SEQ ID NO: 5
TTAGATAGTTTGTCTAAATAATTATGTTGCCATGCGAAGTATGCATGGCT
GCATGTCTGCCTTCCATTTAAAATGGGCTAAGACCTATAACCCTAAATAT
TATTCTTTATTATCTTCTTTACCACTTCGCACCATCCCGTTCGACTTGTT
GCGGTTGTACTTCGCCTGAAGCAGCTGGATTGGCGTCGGGCCATGCTCGG
Blast Results:
A. Against E.coli Database
Query= 081205.asm.C228_1401_1600 nseq=9
(2001etters)
Database: NCBIrefseq_ecoli.dna
6 sequences; 20,994,025 total letters
Searching..done
***** No hits found ******
Database: NCBIrefseq_ecoli.dna
Posted date: Aug 20, 2005 6:10 AM
Number of letters in database: 20,994,025
Number of sequences in database: 6
B. Against Bacterial Database
Table 22
Top 10 Sequences producing si nificant alignments: E Value
Lactobacillus acidophilus NCFM 0.12
Stre tococcus pneumoniae R6 0.12
Stre tococcus neumoniae TIGR4 0.12
M co plasma mycoides subs . mycoides SC str. PGI 0.47
Francisella tularensis subsp. lularensis Schu 4 1.8
Onion yellows phyloplasma OY-M 1.8
Gloeobacter violaceus PCC 7421 1.8
Erwinia carotovora subs . atrose tica SCRI1043 1.8
Sta h lococcus epidermidis RP62A 1.8
Pseudomonas aeruginosa PAOI 1.8
Database: NCBIrefseq_bacteria.dna
Posted date: Aug 19, 2005 10:25 AM
Number of letters in database: 788,089,043
Number of sequences in database: 413
B LASTN 2.2.10 [Oct-19-2004]
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
72
Example 8. 6
. 6. Sequence Name: 081205.asm.C250 3001_3200 SEQ ID NO: 6
AGCCGTCACGACCGCCGAAAGTGGCCGGGCGGCTGCGTACACGAAACTCT
CCTGGCTCAGGCATATCTTTCTGAGTGGACGGCAGCCCCAGCGTAAGCCT
GTTATCACGTAACTCCTTCAGTTGCCGCAGCGCTTCTTTGTGGTCATCCT
TCACCGTATCCGGGAGGTCACCTTCCGGGCGGCGGGCGTAGAGCCGGTAA .
Blast Results:
A. Against E.coli Database
Query= 081205.asm.C250_3001_3200 nseq=30
(200 letters)
Database: NCBIrefseq_ecoli.dna
6 sequences; 20,994,025 total letters
Searching..done
***** No hits found ******
Database: NCBIrefsecLecoli.dna
Posted date: Aug 20, 2005 6:10 AM
Number of letters in database: 20,994,025
Number of sequences in database: 6
B. Against Bacterial Database
Table 23
Top 10 Sequences producing significant alignments: E Value
Salmonella enterica subsp. enterica serovar 1e-93
Salmonella enterica subsp. enterica serovar 1 e-93
Brad rhizobium 'a onicum USDA 110 0.47
Mycobacterium leprae TN 0.47
Thermobi ida fusca YX 1.8
Geobacillus kausto hilus HTA426 1.8
Symbiobacterium thermo hilum IAM 14863 1.8
Pseudomonas s rin ae pv. phaseolicola 1448A 1.8
Rhodo seudomonas alustris CGA009 1.8
Pseudomonasfluorescens P -S 1.8
Database: NCBlrefsecLbacteria.dna
Posted date: Aug 19, 2005 10:25 AM
Number of letters in database: 788,089,043
Number of sequences in database: 413
BLASTN 2.2.10 [Oct-19-2004]
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
73
Example 8.7
7. Sequence Name: 081205.asm.C251_601_800 SEQ ID NO: 7
TGGATTGGTGGCAAACGCTGCCTTGCGATATTACATAAGACCACGAGACA
TATATTGCAGACCTATTCCTAGAGTCTGGCTAACCAGTGATCGCAACGCT
TCTTTCCCTTCAATTITTATAGAGTCAGATATTCTGGCCCCCAACGGTTT
TTCCAGACTTCCAGGCGTAGCGTTTAATACCTCAAGACCTTTAGCCGTTA
Blast Results:
A. Against E.coli Database
Query= 081205.asm.C251_601_800 nseq=29
(200 letters)
Database: NCBIrefsecLecoli.dna
6 sequences; 20,994,025 total letters
Searching..done
***** No hits found ******
Database: NCBlrefseq_ecoli.dna
Posted date: Aug 20, 2005 6:10 AM
Number of letters in database: 20,994,025
Number of sequences in database: 6
B. Against Bacterial Database
Table 24
Top 10 Sequences producing si niCcant alignments: E Value
Bacillus clausii KSM-K16 0.47
Erwinia carotovora subs . atrose tica SCRI1043 0.47
Gloeobacter violaceus PCC 7421 1.8
Methanocaldococcus 'annaschii DSM 2661 1.8
Z momonas mobilis subsp. mobilis ZM4 7.3
Bacillus cereus E33L 7.3
Parachlamydia s. UWE2S 7.3
Bdellovibrio bacteriovorus HDIOO 7.3
Lactobacillus 'ohnsonii NCC 533 7.3
Rhodopirellula baltica SH 1 7.3
Database: NCBIrefseq_bacteria.dna
Posted date: Aug 19, 2005 10:25 AM
Number of letters in database: 788,089,043
Number of sequences in database: 413
BLASTN 2.2.10 [Oct-19-2004]
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
74
Example 8.8
8. Sequence Name: 081205.asm.C274_2401_2600 SEQ ID NO: 8
TTGTTATCATCGATCCTGATCTATGTCCTGCACCAGGGGAGTTTGTTGTC
GCCAAAAACGACGGTCACGAAGCTACATTTAAAAAATACCGTCCATTAGG
AATCGGCATCGACGACTTTGAATTAATCCCCCTAAATCCTGATTACCCTA
TT'I"TTCGTAGTGCAGATATGAACTTACAGATCATAGGTGTAATGATCGAA
Blast Results:
to A. Against E. coli Database
Query= 081205.asm.C274_2401_2600 nseq=88
(200 letters)
Database: NCBlrefseq_ecoli.dna
6 sequences; 20,994,025 total letters
Searching..done
***** No hits found ******
Database: NCBIrefseq_ecoli.dna.
Posted date: Aug 20, 2005 6:10 AM
Number of letters in database: 20,994,025
Number of sequences in database: 6
.25
B. Against Bacterial Database
Table 25
Top 10 Sequences producing significant alignments: E Value
Thermoplasma acidophilum DSM 1728 0.47
Silicibacier pomeroyi DSS-3 1.8
Desul ovibrio vulgaris subsp. vulgaris str. 1.8
Azoarcus sp. EbNI 7.3
Le ionella pneumophila str. Paris 7.3
Propionibacterium acnes KPA 171202 7.3
Bartonella henselae sir. Houston-1 7.3
Gloeobacter violaceus PCC 7421 7.3
S nechococcus s. WH 8102 7.3
Bacillus cereus A TCC 14579 7.3
Database: NCBIrefscq_bacteria.dna
Posted date: Aug 19, 2005 10:25 AM
Number of letters in database: 788,089,043
Number of sequences in database: 413
BLASTN 2.2.10 [Oct-19-2004]
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
Example 8.9
9. Sequence Name: 081205.asm.C435_601_800 SEQ ID NO: 9
CGGCATTTAAAGCTGCCCTCACGAAGGTCTGTAATGGAATCTTCATTGTT
5 GAATCCCATGCCGACTATCCCCGAGGTTCCCGTAGTGTCCTGGTTATAAT
AATCCAGCATTG CTGTTCTTAACAGCGTTGCCCCTTGTGCGGACAGCAAC
TTACGTCCTGTATCAACTTTGCGCCCGTCGTCCCATCCACGGATAAACTC
Blast Results:
10 A. Against E. coli Database
Query= 081205.asm.C435_601_800 nseq=6
(200 letters)
Database: NCBIrefseq_ecoli.dna
15 6 sequences; 20,994,025 total letters
Searching..done
* * * * * No hits found *'` * * * *
20 Database: NCBIrefseq_ecoli.dna
Posted date: Aug 20, 2005 6:10AM
Number of letters in database: 20,994,025
Number of sequences in database: 6
B. Against Bacterial Database
Table 26
Top 10 Se uences producing significant alignments: E Value
Chlam do hila pneumonine 1.8
Methanosarcina acetivorans C2A 1.8
Chlam do hila neumoniaeJ138 1-8
Chlam do hila neumoniae AR39 1.8
Chlam do hila neumoniae CWL029 1.8
Photorhabdus luminescens subsp. laumondii 7701 7.3
Salmonella enterica 'subs . enterica serovar Typ 7.3
Salmonella enterica subsp. enterica serovar Typ 7.3
Database: NCBlrefseq_bacteria.dna
Posted date: Aug 19, 2005 10:25 AM
Number of letters in database: 788,089,043
Number of sequences in database: 413
BLASTN 2.2.10 [Oct-19-2004]
It is appreciated that certain features of the invention, which are, for
clarity,
described in the context of separate embodiments, may also be provided in
combination in a single embodiment. Conversely, various features of the
invention,
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
76
which are, for brevity, described in the context of a single embodiment, may
also be
provided separately or in any suitable subcombination.
Although the invention has been described in conjunction with specific
5. embodiments thereof, it is evident that many alternatives, modifications
and variations
will be apparent to those skilled in the art. Accordingly, it is intended to
embrace all
such alternatives, modifications and variations that fall within the spirit
and broad
scope of the appended claims. All publications, patents and patent
applications and
GenBank Accession numbers mentioned in this specification a're herein
incorporated
in their entirety by reference into the speeification, to the same extent as
if each
individual publication, patent or patent application or GenBank Accession
number
was specifically and individually indicated to be incorporated herein by
reference. In
-addition, citation or identification of any reference in this application
shall not be
construed as an admission that such reference is available as prior art to the
present
l5 invention.
CA 02652558 2008-11-17
WO 2007/136553 PCT/US2007/011200
77
REFERENCES
(other rejerences are cited in the document)
1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman.
1990. Basic local alignment search tool. J Mol Biol 215:403-10.
2. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W.
Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation
of protein database search programs. Nucleic Acids Res 25:3389-402.
3. Gellert, M., K. Mizuuchi, M.H. O'Dea, T. Itoh, and J.I. Tomizawa.
1977. Nalidixic acid resistance: a second genetic character involved in DNA
gyrase
activity. Proc. Natl. Acad. Sci. USA 74:4772-4776.
4. Horcajada, J. P., S. Soto, A. Gajewski, A. Smithson, M. T. Jimenez de
Anta, J. Mensa, J. Vila, and J. R. Johnson. 2005. Quinolone-Resistant
Uropathogenic
Escherichia coli Strains from Phylogenetic Group B2 Have Fewer Virulence
Factors
than Their Susceptible Counterparts. J. Clin. Microbiol. 43:2962-2964.
5. Maniatis, T., Fritsch, E.F., Sambrook, J. 1982. Molecular cloning: a
laboratory manual, I ed, vol. 1. Cold Spring Harbor Laboratory Press, Cold
Spring
Harbor, NY.
6. Ochman, H., and R. K. Selander. 1984. Standard reference strains of
Escherichia coli from natural populations. J Bacteriol 157:690-3.
7. Tatusova, T. A., and T. L. Madden. 1999. BLAST 2 Sequences, a new
tool for comparing protein and nucleotide sequences. FEMS Microbiol Lett
174:247-
50.
8. Vila, J., J. Ruiz, P. Goni, and M. T. De Anta. 1996. Detection of
mutations in parC in quinolone-resistant clinical isolates of Escherichia
coli.
Antimicrob Agents Chemother 40:491-3.
9. Vila, J., M. Vargas, J. Ruiz, M. Corachan, M. T. Jimenez de Anta, and
J. Gascon. 2000. Quinolone Resistance in Enterotoxigenic Escherichia coli
Causing
Diarrhea in Travelers to India in Comparison with Other Geographical Areas.
Antimicrob: Agents Chemother. 44:1731-1733.
