CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
DESCRIPTION
MIR-143 REGULATED GENES AND PATHWAYS AS TARGETS FOR
THERAPEUTIC INTERVENTION
BACKGROUND OF THE INVENTION
This application claims the benefit of priority to U.S. Provisional Patent
Application Serial No. 60/939,573 filed May 22, 2007 and U.S. Provisional
Patent
Application Serial No. 60/826,173 filed September 19, 2006, which are hereby
incorporated by reference in their entirety.
1. FIELD OF THE INVENTION
The present invention relates to the fields of molecular biology and medicine.
More specifically, the invention relates to methods and compositions for the
treatment
of diseases or conditions that are affected by miR-143 microRNAs, microRNA
expression, and genes and cellular pathways directly and indirectly modulated
by
such.
II. BACKGROUND
In 2001, several groups used a cloning method to isolate and identify a large
group of "microRNAs" (miRNAs) from C. elegans, Drosophila, and humans (Lagos-
Quintana et al., 2001; Lau et al., 2001; Lee and Ambros, 2001). Several
hundred
miRNAs have been identified in plants and animals-including humans-that do not
appear to have endogenous siRNAs. Thus, while similar to siRNAs, miRNAs are
distinct.
miRNAs thus far observed have been approximately 21-22 nucleotides in
length, and they arise from longer precursors transcribed from non-protein-
encoding
genes. See review of Carrington et al. (2003). The precursors form structures
that
fold back on themselves in self-complementary regions; they are then processed
by
the nuclease Dicer (in animals) or DCL1 (in plants) to generate the short
double-
stranded miRNA. One of the miRNA strands is incorporated into a complex of
proteins and miRNA called the RNA-induced silencing complex (RISC). The
miRNA guides the RISC complex to a target mRNA, which is then cleaved or
translationally silenced, depending on the degree of sequence complementarity
of the
miRNA to its target mRNA. Currently, it is believed that perfect or nearly
perfect
-1-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
complementarity leads to mRNA degradation, as is most commonly observed in
plants. In contrast, imperfect base pairing, as is primarily found in animals,
leads to
translational silencing. However, recent data suggest additional complexity
(Bagga et
al., 2005; Lim et al., 2005), and mechanisms of gene silencing by miRNAs
remain
under intense study.
Recent studies have shown that expression levels of numerous miRNAs are
associated with various cancers (reviewed in Esquela-Kerscher and Slack, 2006;
Calin
and Croce, 2006). miRNAs have also been implicated in regulating cell growth
and
cell and tissue differentiation - cellular processes that are associated with
the
development of cancer.
The inventors previously demonstrated that hsa-miR-143 is involved with the
regulation of numerous cell activities that represent intervention points for
cancer
therapy and for therapy of other diseases and disorders (U.S. Patent
Applications
serial number 11/141,707 filed May 31, 2005 and serial number 11/273,640 filed
November 14, 2005). Upon evaluation of 24 different human tissues, hsa-miR-143
was found to be preferentially expressed in human prostate and colon tissue
samples.
The inventors observed that hsa-miR-143 expression is lower in many human
cancer
tumor samples including lung, colon, breast, bladder, and thyroid tumors, than
in
normal cells from the same patients. Overexpression of hsa-miR-143 in human
leukemia cells (Jurkat) increased proliferation of those cells. The inventors
also
found hsa-miR-143 to be up-regulated in brain tissues of Alzheimer's patients.
Other
investigators have also observed that miR- 143 is down-regulated in colorectal
tumors
when compared with matched normal samples (Michael et al., 2003; Akao et al.,
2006) and that miR-143 may be involved in the differentiation of human
adipocytes
(fat storage cells) (Esau et al., 2004).
Bioinformatics analyses suggest that any given miRNA may bind to and alter
the expression of up to several hundred different genes. In addition, a single
gene
may be regulated by several miRNAs. Thus, each miRNA may regulate a complex
interaction among genes, gene pathways, and gene networks. Mis-regulation or
alteration of these regulatory pathways and networks, involving miRNAs, are
likely to
contribute to the development of disorders and diseases such as cancer.
Although
bioinformatics tools are helpful in predicting miRNA binding targets, all have
-2-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
limitations. Because of the imperfect complementarity with their target
binding sites,
it is difficult to accurately predict the mRNA targets of miRNAs with
bioinformatics
tools alone. Furthermore, the complicated interactive regulatory networks
among
miRNAs and target genes make it difficult to accurately predict which genes
will
actually be mis-regulated in response to a given miRNA.
Correcting gene expression errors by manipulating miRNA expression or by
repairing miRNA mis-regulation represent promising methods to repair genetic
disorders and cure diseases like cancer. A current, disabling limitation of
this
approach is that, as mentioned above, the details of the regulatory pathways
and
networks that are affected by any given miRNA, including miR-143, remain
largely
unknown. This represents a significant limitation for treatment of cancers in
which
miR-143 may play a role. A need exists to identify the genes, genetic
pathways, and
genetic networks that are regulated by or that may regulate hsa-miR-143
expression.
SUMMARY OF THE INVENTION
The present invention provides additional compositions and methods by
identifying genes that are direct targets for miR-143 regulation or that are
indirect or
downstream targets of regulation following the miR-143-mediated modification
of
another gene(s) expression. Furthermore, the invention describes gene,
disease,
and/or physiologic pathways and networks that are influenced by miR-143 and
its
family members. In certain aspects, compositions of the invention are
administered to
a subject having, suspected of having, or at risk of developing a metabolic,
an
immunologic, an infectious, a cardiovascular, a digestive, an endocrine, an
ocular, a
genitourinary, a blood, a musculoskeletal, a nervous system, a congenital, a
respiratory, a skin, or a cancerous disease or condition.
In particular aspects, a subject or patient may be selected for treatment
based
on expression and/or aberrant expression of one or more miRNA or mRNA. In a
farther aspect, a subject or patient may be selected for treatment based on
aberrations
in one or more biologic or physiologic pathway(s), including aberrant
expression of
one or more gene associated with a pathway, or the aberrant expression of one
or
more protein encoded by one or more gene associated with a pathway. In still a
further aspect, a subject or patient may be selected based on aberrations in
miRNA
expression, or biologic and/or physiologic pathway(s). A subject may be
assessed for
-3-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
sensitivity, resistance, and/or efficacy of a therapy or treatment
regime.based on the
evaluation and/or analysis of miRNA or mRNA expression or lack thereof. A
subject
may be evaluated for amenability to certain therapy prior to, during, or after
administration of one or therapy to a subject or patient. Typically,
evaluation or
assessment may be done by analysis of miRNA and/or mRNA, as well as
combination
of other assessment methods that include but are not limited to histology,
immunohistochemistry, blood work, etc.
In some embodiments, an infectious disease or condition includes a bacterial,
viral, parasite, or fungal infection. Many of these genes and pathways are
associated
with various cancers and other diseases. Cancerous conditions include, but are
not
limited to astrocytoma, acute myelogenous leukemia, breast carcinoma, bladder
carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma,
esophageal squamous cell carcinoma, glioma, glioblastoma, gastric carcinoma,
hepatocellular carcinoma, Hodgkin lymphoma, leukemia, lipoma, melanoma, mantle
cell lymphoma, myxofibrosarcoma, multiple myeloma, neuroblastoma, non-Hodgkin
lymphoma, lung carcinoma, non-small cell lung carcinoma, ovarian carcinoma,
esophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma,
squamous cell carcinoma of the head and neck, thyroid carcinoma, urothelial
carcinoma wherein the modulation of one or more gene is sufficient for a
therapeutic
response. Typically a cancerous condition is an aberrant hyperproliferative
condition
associated with the uncontrolled growth or inability to undergo cell death,
including
apoptosis.
The present invention provides methods and compositions for identifying
genes that are direct targets for miR-143 regulation or that are downstream
targets of
regulation following the miR-143-mediated modification of upstream gene
expression. Furthermore, the invention describes gene pathways and networks
that
are influenced by miR-143 expression in biological samples. Many of these
genes
and pathways are associated with various cancers and other diseases. The
altered
expression or function of miR-143 in cells would lead to changes in the
expression of
these key genes and contribute to the development of disease. Introducing miR-
143
(for diseases where the miRNA is down-regulated) or a miR-143 inhibitor (for
diseases where the miRNA is up-regulated) into disease cells or tissues would
result
-4-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
in a therapeutic response. The identities of key genes that are regulated
directly or
indirectly by miR-143 and the disease with which they are associated are
provided
herein. In certain aspects a cell may be an epithelial, stromal, or mucosal
cell. The
cell can be, but is not limited to brain, a neuronal, a blood, an esophageal,
a lung, a
cardiovascular, a liver, a breast, a bone, a thyroid, a glandular, an adrenal,
a
pancreatic, a stomach, a intestinal, a kidney, a bladder, a prostate, a
uterus, an ovarian,
a testicular, a splenic, a skin, a smooth muscle, a cardiac muscle, or a
striated muscle
cell. In certain aspects, the cell, tissue, or target may not be defective in
miRNA
expression yet may still respond therapeutically to expression or over
expression of a
miRNA. miR-143 could be used as a therapeutic target for any of these
diseases. In
certain embodiments miR-143 can be used to modulate the activity of miR-143 in
a
subject, organ, tissue, or cell.
A cell, tissue, or subject may be a cancer cell, a cancerous tissue, harbor
cancerous tissue, or be a subject or patient diagnosed or at risk of
developing a disease
or condition. In certain aspects a cancer cell is a neuronal, glial, lung,
liver, brain,
breast, bladder, blood, leukemic, colon, endometrial, stomach, skin, ovarian,
fat, bone,
cervical, esophageal, pancreatic, prostate, kidney, or thyroid cell. In still
a further
aspect cancer includes, but is not limited to astrocytoma, acute myelogenous
leukemia, breast carcinoma, bladder carcinoma, cervical carcinoma, colorectal
carcinoma, endometrial carcinoma, esophageal squamous cell carcinoma, glioma,
glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma,
leukemia, lipoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, multiple
myeloma, neuroblastoma, non-Hodgkin lymphoma, lung carcinoma, non-small cell
lung carcinoma, ovarian carcinoma, esophageal carcinoma, osteosarcoma,
pancreatic
carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck,
thyroid carcinoma, urothelial carcinoma.
Embodiments of the invention include methods of modulating gene
expression, or biologic or physiologic pathways in a cell, a tissue, or a
subject
comprising administering to the cell, tissue, or subject an amount of an
isolated
nucleic acid or mimetic thereof comprising a miR-143 nucleic acid, mimetic, or
inhibitor in an amount sufficient to modulate the expression of a gene
positively or
negatively modulated by a miR-143 miRNA. A "miR-143 nucleic acid sequence" or
-5-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
"miR-143 inhibitor" includes the full length precursor of miR-143, or
complement
thereof, as well as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23,
24, 25, 26, 27, 28, 29 or more nucleotides of a precursor miRNA or its
processed
sequence, or complement thereof, including all ranges and integers there
between. In
certain embodiments, the miR-143 nucleic acid sequence or miR-143 inhibitor
contains the full-length processed miRNA sequence or complement thereof and is
referred to as the "miR- 143 full-length processed nucleic acid sequence" or
"miR-143
full-length processed inhibitor sequence." In still further aspects, the miR-
143 nucleic
acid comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
20, 21, 22,
232, 24, 25, 50 nucleotide (including all ranges and integers there between)
segment
or complementary segment of miR-143 that is at least 75, 80, 85, 90, 95, 98,
99 or
100% identical to SEQ ID NO:1 to SEQ ID NO:13. The general term miR-143
includes all members of the miR-143 family that share at least part of a
mature miR-
143 sequence (UGAGAUGAAGCACUGUAGCUCA (SEQ ID NO:1)) or a
complement thereof.
A "miR-143 nucleic acid sequence" includes the full length precursor of miR-
143 and other family members that include lla-mir-143 (MI0002552)
GCGCAGCGCCCUGUC
UCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGA
GAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC (SEQ ID
NO:2); xtr-mir-143 (MI0004937)
UGUCUCCCAGCCCAAGGUGCAGUGCUGCAUCUCUGGUCAGUUGUGA
GUCUGAGAUGAAGCACUGUAGCUCGGGAAGGGGGAAU (SEQ ID NO:3);
dre-mir-143-2 (MI0002008)
GAUCUACAGUCGUCUGGCCCGCGGUGCAGUGCUGCAUCUCUG
GUCAACUGGGAGUCUGAGAUGAAGCACUGUAGCUCGGGAGGACAACAC
UGUCAGCUC (SEQ ID NO:4); rno-mir-143 (MI0000916) GCGGAGCGCCUG
UCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCU
GAGAUGAAGCACUGUAGCUCAGGAAGGGAGAAGAUGUUCUGCAGC (SEQ
ID NO:5); ptr-mir-143 (MI0002549)
GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUG
CAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAA
GAGAGAAGUUUUUCUGCAGC (SEQ ID NO:6); ppy-mir-143 (MI0002551)
-6-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
GCGCAGC
GCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGG
AGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCA
GC (SEQ ID NO:7); ggo-mir-143 (MI0002550)
GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCU
GCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGA
AGAGAGAAGUUGUUCUGCAGC (SEQ ID NO:8); dre-mir-143-1 (MI0002007)
GAUCUACAGUCGUCUGGCCCGCGGUGCAGUGCUGCAUCUCUGGUCAACU
GGGAGUCUGAGAUGAAGCACUGUAGCUCGGGAGGACAACACUGUCAGC
UC (SEQ ID NO:9); hsa-mir-143 (MI0000459)
GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUG
CUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAG
GAAGAGAGAAGUUGUUCUGCAGC (SEQ ID NO:10); ppa-mir-143
(MI0002553)
GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUC
AGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUU
UUCUGCAGC (SEQ ID NO:11); mdo-mir-143 (MI0005302)
CCCGAGGUGCAGUGCUGCAUCUCUGGUC
AGUUGUGAGUCUGAGAUGAAGCACUGUAGCUCGGG (SEQ ID NO:12);
mmu-mir-143 (MI0000257)
CCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGA
GAUGAAGCACUGUAGCUCAGG (SEQ ID NO:13). In certain aspects, a nucleic
acid or mimetic of the present invention will comprise 5, 6, 7, 8, 9, 10, 11,
12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or more nucleotides
of the
precursor miRNA or its processed sequence, including all ranges and integers
there
between. In certain embodiments, the miR-143 nucleic acid sequence contains
the
full-length processed miRNA sequence and is referred to as the "miR-143 full-
length
processed nucleic acid sequence." In still further aspects, a miR-143
comprises at
least one 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
23, 24, 25, 50
nucleotide (including all ranges and integers there between) segment of miR-
143 that
is at least 75, 80, 85, 90, 95, 98, 99 or 100% identical to SEQ ID NOs
provided
herein.
-7-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
In specific embodiments, a miR-143 or miR-143 inhibitor containing nucleic
acid is hsa-miR-143 or hsa-miR-143 inhibitor, or a variation thereof. In a
further
aspect, a miR-143 nucleic acid or miR-143 inhibitor can be administered with
1, 2, 3,
4, 5, 6, 7, 8, 9, 10 or more miRNAs or miRNA inhibitors. miRNA or its
complement
can be administer concurrently, in sequence or in an ordered progression. In
certain
aspects, a miR-143 or miR-143 inhibitor can be administered in combination
with one
or more of let-7, miR-15a, miR-16, miR-20, miR-21, miR-26a, miR-31, miR-34a,
miR-126, miR-145, miR-147, miR-188, miR-200b, miR-200c, miR-215, miR-216,
miR-292-3p, and/or miR-331. All or combinations of miRNAs or inhibotrs thereof
may be administered in a single formulation. Administration may be before,
during
or after a second therapy.
miR-143 nucleic acids or complement thereof may also include various
heterologous nucleic acid sequence, i.e., those sequences not typically found
operatively coupled with miR-143 in nature, such as promoters, enhancers, and
the
like. The miR-143 nucleic acid is a recombinant nucleic acid, and can be a
ribonucleic acid or a deoxyribonucleic acid. The recombinant nucleic acid may
comprise a miR-143 or miR-143 inhibitor expression cassette, i.e., a nucleic
acid
segment that expresses a nucleic acid when introduce into an environment
containing
components for nucleic acid synthesis. In a further aspect, the expression
cassette is
comprised in a viral, or plasmid DNA vector or other therapeutic nucleic acid
vector
or delivery vehicle, including liposomes and the like. In certain aspects,
viral vectors
can be administered at 1x102, Ix103, 1x104 1x105, lx106, 1x107, 1x10g, 1x109,
1x1010,
1x1011, 1x1012, 1x1013, 1x1014 pfu or viral particle (vp).
In a particular aspect, the miR-143 nucleic acid or miR-143 inhibitor is a
synthetic nucleic acid. Moreover, nucleic acids of the invention may be fully
or
partially synthetic. In still further aspects, a nucleic acid of the invention
or a DNA
encoding such can be administered at 0.001, 0.01, 0.1, 1, 10, 20, 30, 40, 50,
100, 200,
400, 600, 800, 1000, 2000, to 4000 g or mg, including all values and ranges
there
between. In yet a further aspect, nucleic acids of the invention, including
synthetic
nucleic acid, can be administered at 0.001, 0.01, 0.1, 1, 10, 20, 30, 40, 50,
100, to 200
g or mg per kilogram (kg) of body weight. Each of the amounts described herein
may be administered over a period of time, including 0.5, 1, 2, 3, 4, 5, 6, 7,
8, 9, 10,
-8-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
minutes, hours, days, weeks, months or years, including all values and ranges
there
between.
In certain embodiments, administration of the composition(s) can be enteral or
parenteral. In certain aspects, enteral administration is oral. In further
aspects,
parenteral administration is intralesional, intravascular, intracranial,
intrapleural,
intratumoral, intraperitoneal, intramuscular, intralymphatic, intraglandular,
subcutaneous, topical, intrabrortchial, intratracheal, intranasal, inhaled, or
instilled.
Compositions of the invention may be administered regionally or locally and
not
necessarily directly into a lesion.
In certain aspects, the gene or genes modulated comprises 1, 2, 3, 4, 5, 6, 7,
8,
9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200 or more
genes or
combinations of genes identified in Tables 1, 3, 4, and/or S. In still further
aspects,
the gene or genes modulated may exclude 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14,
15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 175 or more genes or combinations of
genes
identified in Tables 1, 3, 4, and/or 5. Modulation includes modulating
transcription,
mRNA levels, mRNA translation, and/or protein levels in a cell, tissue, or
organ. In
certain aspects the expression of a gene or level of a gene product, such as
mRNA or
encoded protein, is down-regulated or up-regulated. In a particular aspect the
gene
modulated comprises or is selected from (and may even exclude) 1, 2, 3, 4, 5,
6, 7, 8,
9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26. 27, 28,
or all of the
genes identified in Tables 1, 3, 4, and/or 5, or any combinations thereof. In
certain
embodiments a gene modulated or selected to be modulated is from Table 1. In
further embodiments a gene modulated or selected to be modulated is from Table
3.
In still further embodiments a gene modulated or selected to be modulated is
from
Table 4. In yet further embodiments a gene modulated or selected to be
modulated is
from Table 5. Embodiments of the invention may also include obtaining or
assessing
a gene expression profile or miRNA profile of a target cell prior to selecting
the mode
of treatment, e.g., administration of a miR-143 nucleic acid, inhibitor of miR-
143, or
mimetics thereof. The database content related to nucleic acids and genes
designated
by an accession number or a database submission are incorporated herein by
reference
as of the filing date of this application. In certain aspects of the invention
one or more
miRNA or miRNA inhibitor may modulate a single gene. In a further aspect, one
or
-9-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
more genes in one or more genetic, cellular, or physiologic pathways can be
modulated by one or more miRNAs or complements thereof, including miR-143
nucleic acids and miR-143 inhibitors in combination with other miRNAs.
miR-143 nucleic acids may also include various heterologous nucleic acid
sequence, i.e., those sequences not typically found operatively coupled with
miR-143
in nature, such as promoters, enhancers, and the like. The miR-143 nucleic
acid is a
recombinant nucleic acid, and can be a ribonucleic acid or a deoxyribonucleic
acid.
The recombinant nucleic acid may comprise a miR-143 expression cassette. In a
further aspect, the expression cassette is comprised in a viral, or plasmid
DNA vector
or other therapeutic nucleic acid vector or delivery vehicle, including
liposomes and
the like. In a particular aspect, the miR-143 nucleic acid is a synthetic
nucleic acid.
Moreover, nucleic acids of the invention may be fully or partially synthetic.
Table 1. Genes with increased (positive values) or decreased (negative values)
expression following transfection of human cancer cells with pre-miR hsa-miR-
143.
Gene RefSeq Transcript ID A log2
Symbol
AKAP12 NM 005 1 00 /// NM 144497 0.725245496
ANKRD46 NM 198401 0.791492237
ANXA6 NM 001 1 55 /// NM 004033 0.727214714
ARL2BP NM 012106 0.800772424
ASNAI NM 004317 -1.07942093
ATP6V1A NM 001690 -1.126127932
ATXN1 NM000332 0.850968582
AXL NM 001699 NM 021913 1.156039698
BCL2L1 NM 001191 NM 138578 -0.821265359
CCND1 NM053056 -0.938024465
CCNG1 NM 004060 NM 199246 0.862627632
CLIC4 NM 013943 0.825614765
CXCL1 NM 001511 0.938115811
CXCL2 NM002089 0.706326327
DAZAP2 NM 014764 -0.916764957
DCP2 NM 152624 0.797770229
DDAH1 NM 012137 0.765730627
DDX3Y NM 004660 0.848651105
DICERI NM 030621 NM 177438 0.929848609
DSC2 NM 004949 NM024422 0.902830281
FLJ13910 NM 022780 0.866839654
GALC NM 000153 -1.161432175
GATM NM 001482 -1.970548228
-10-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
GOLPH2 NM 016548 /// NM 177937 -1.126884613
GREB1 NM 014668 /// NM 033090 /// NM 148903 0.755673527
GREM1 NM 013372 1.051739161
HIPK2 NM022740 -0.904313564
HIPK3 NM 005734 0.826433357
IFIH1 NM 022168 0.706653845
IGFBP3 NM 000598 /// NM 001013398 -0.809607512
IL32 NM 001012631 /// NM_001012632 /// 0.757126883
NM001012633 /// NM 001012634
NM 001012635
IL6ST NM002184 /// NM 175767 0.751854493
IL8 NM 000584 1.104016175
INSIGI NM 005542 /// NM 198336 /// NM 198337 0.875027481
LEPR NM 001003679 /// NM 001003680 /// 0.797930372
NM 002303
LM04 NM 006769 -1.012706499
LOC137886 XM 059929 -0.752855433
MCLI NM 021960 /// NM 182763 0.761759353
MGC5618 --- 0.797855581
MTUS1 NM 001 001 924 /// NM 001001925 /// 0.70655
NM 001001927 /// NM 001001931
NM 020749
NIDI NM 002508 1.090976167
NT5E NM 002526 0.878049429
PDCD2 NM002598 /// NM 144781 -0.723484401
PDCD4 NM 014456 /// NM145341 0.728228239
PDK4 NM 002612 0.961974975
PELIl NM 020651 0.768582445
PMCH NM 002674 0.790936704
PROSC NM_007198 -1.645677869
PTPN12 NM 002835 0.769808986
RABIIFIP1 NM 001002233 /// NM 001002814 /// -0.83733308
NM 025151
RAB2 NM 002865 0.827382805
RBL1 NM002895 /// NM 183404 -1.302328709
RDX NM 002906 0.760806942
RECK NM 021111 1.103484746
RHEB NM005614 0.825468322
RHOB NM 004040 0.921813933
RHOBTBI NM 001032380 /// NM 014836 /// NM 198225 0.744478582
RP2 NM 006915 0.822851399
SERPINE1 NM 000602 -0.856846452
SLC11A2 NM000617 0.716682705
SLC30A1 NM 021194 -0.841163945
SLC35BI NM 005827 -1.07644709
TAF10 NM 006284 -1.695883532
TBC1D2 NM 018421 -0.746279363
TGFBR2 NM 001024847 /// NM 003242 0.854509353
-11-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
TMEM45A NM 018004 -0.748492283
TMF1 NM 007114 -0.939693594
TNC NM 002160 0.86901183
TNRC9 XM 049037 0.740367787
TRAI NM 003299 0.875188144
TTMP NM 024616 0.844059608
TXN NM003329 0.92541735
UGT1A8 NM 019076 NM 021027 -0.961897449
UGTIA9
WASPIP NM 003387 1.04160055
WDR50 NM016001 -1.049152791
WEE1 NM 003390 0.722369746
A further embodiment of the invention is directed to methods of modulating a
cellular pathway comprising administering to the cell an amount of an isolated
nucleic
acid comprising a miR-143 nucleic acid sequence or a miR-143 inhibitor. A
cell,
tissue, or subject may be a cancer cell, a cancerous tissue or harbor
cancerous tissue,
or a cancer patient. The database content related to all nucleic acids and
genes
designated by an accession number or a database submission are incorporated
herein
by reference as of the filing date of this application.
A further embodiment of the invention is directed to methods of modulating a
cellular pathway comprising administering to the cell an amount of an isolated
nucleic
acid comprising a miR-143 nucleic acid sequence in an amount sufficient to
modulate
the expression, function, status, or state of a cellular pathway, in
particular those
pathways described in Table 2 or the pathways known to include one or more
genes
from Table 1, 3, 4, and/or 5. Modulation of a cellular pathway includes, but
is not
limited to modulating the expression of one or more gene(s). Modulation of a
gene
can include inhibiting the function of an endogenous miRNA or providing a
functional miRNA to a cell, tissue, or subject. Modulation refers to the
expression
levels or activities of a gene or its related gene product (e.g., mRNA) or
protein, e.g.,
the mRNA levels may be modulated or the translation of an mRNA may be
modulated. Modulation may increase or up regulate a gene or gene product or it
may
decrease or down regulate a gene or gene product (e.g., protein levels or
activity).
Still a further embodiment includes methods of administering an miRNA or
mimic thereof, and/or treating a subject or patient having, suspected of
having, or at
risk of developing a pathological condition comprising one or more of step (a)
-12-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
administering to a patient or subject an amount of an isolated nucleic acid
comprising
a miR-143 nucleic acid sequence or a miR-143 inhibitor in an amount sufficient
to
modulate expression of a cellular pathway; and (b) administering a second
therapy,
wherein the modulation of the cellular pathway sensitizes the patient or
subject, or
increases the efficacy of a second therapy. An increase in efficacy can
include a
reduction in toxicity, a reduced dosage or duration of the second therapy, or
an
additive or synergistic effect. A cellular pathway may include, but is not
limited to
one or more pathway described in Table 2 below or a pathway that is know to
include
one or more genes of Tables 1, 3, 4, and/or 5. The second therapy may be
administered before, during, and/or after the isolated nucleic acid or miRNA
or
inhibitor is administered
A second therapy can include administration of a second miRNA or
therapeutic nucleic acid such as a siRNA or antisense oligonucleotide, or may
include
various standard therapies, such as pharmaceuticals, chemotherapy, radiation
therapy,
drug therapy, immunotherapy, and the like. Embodiments of the invention may
also
include the determination or assessment of gene expression or gene expression
profile
for the selection of an appropriate therapy. In a particular aspect, a second
therapy is
a chemotherapy. A chemotherapy can include, but is not limited to paclitaxel,
cisplatin, carboplatin, doxorubicin, oxaliplatin, larotaxel, taxol, lapatinib,
docetaxel,
methotrexate, capecitabine, vinorelbine, cyclophosphamide, gemcitabine,
amrubicin,
cytarabine, etoposide, camptothecin, dexamethasone, dasatinib, tipifarnib,
bevacizumab, sirolimus, temsirolimus, everolimus, lonafarnib, cetuximab,
erlotinib,
gefitinib, imatinib mesylate, rituximab, trastuzumab, nocodazole, sorafenib,
sunitinib,
bortezomib, alemtuzumab, gemtuzumab, tositumomab or ibritumomab.
Embodiments of the invention include methods of treating a subject with a
disease or condition comprising one or more of the steps of (a) determining an
expression profile of one or more genes selected from Table 1, 3, 4, and/or 5;
(b)
assessing the sensitivity of the subject to therapy based on the expression
profile; (c)
selecting a therapy based on the assessed sensitivity; and (d) treating the
subject using
a selected therapy. Typically, the disease or condition will have as a
component,
indicator, or resulting mis-regulation of one or more gene of Table 1, 3, 4,
and/or 5.
-13-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
In certain aspects, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more miRNA may be used in
sequence or in combination. For instance, any combination of miR-143 or a miR-
143
inhibitor with another miRNA Further embodiments include the identification
and
assessment of an expression profile indicative of miR-143 status in a cell or
tissue
comprising expression assessment of one or more gene from Table 1, 3, 4,
and/or 5,
or any combination thereof.
The term "miRNA" is used according to its ordinary and plain meaning and
refers to a microRNA molecule found in eukaryotes that is involved in RNA-
based
gene regulation. See, e.g., Carrington et al., 2003, which is hereby
incorporated by
reference. The term can be used to refer to the single-stranded RNA molecule
processed from a precursor or in certain instances the precursor itself.
In some embodiments, it may be useful to know whether a cell expresses a
particular miRNA endogenously or whether such expression is affected under
particular conditions or when it is in a particular disease state. Thus, in
some
embodiments of the invention, methods include assaying a cell or a sample
containing
a cell for the presence of one or more marker gene or mRNA or other analyte
indicative of the expression level of a gene of interest. Consequently, in
some
embodiments, methods include a step of generating an RNA profile for a sample.
The
term "RNA profile" or "gene expression profile" refers to a set of data
regarding the
expression pattern for one or more gene or genetic marker in the sample (e.g.,
a
plurality of nucleic acid probes that identify one or more markers from Tables
1, 3, 4,
and/or 5); it is contemplated that the nucleic acid profile can be obtained
using a set of
RNAs, using for example nucleic acid amplification or hybridization techniques
well
know to one of ordinary skill in the art. The difference in the expression
profile in the
sample from the patient and a reference expression profile, such as an
expression
profile from a normal or non-pathologic sample, is indicative of a pathologic,
disease,
or cancerous condition. A nucleic acid or probe set comprising or inhibitor
can be
selected based on observing two given miRNAs share a set of target genes or
pathways listed in Tables 1, 2, 4 and/or 5 that are altered in a particular
disease or
condition. These two miRNAs may result in an improved therapy (e.g., reduced
toxicity, greater efficacy, prolong remission, or other improvements in a
subjects
condition), result in an increased efficacy, an additive efficacy, or a
synergistic
-14-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
efficacy providing an additional or an improved therapeutic response. Without
being
bound by any particular theorty, synergy of two miRNA can be a consequence of
regulating the same genes or related genes (related by a common pathway or
biologic
end result) more effectively (e.g., due to distinct binding sites on the same
target or
related target(s)) and/or a consequence of regulating different genes, but all
of which
have been implicated in a disease or condition.
In certain aspects, miR-143 or a miR-143 inhibitor and let-7 can be
administered to patients with acute myeloid leukemia, breast carcinoma,
bladder
carcinoma, cervical carcinoma, colorectal carcinoma, endometrial carcinoma,
glioma,
glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin lymphoma,
leukemia, melanoma, myxofibrosarcoma, multiple myeloma, neuroblastoma, non-
Hodgkin lymphoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal
carcinoma, pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma
of the
head and neck, thyroid carcinoma, or urothelial carcinoma.
Further aspects include administering miR-143 or a miR-143 inhibitor and
miR-15 to patients with astrocytoma, acute myeloid leukemia, breast carcinoma,
bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial
carcinoma,
glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin
lymphoma, melanoma, mantle cell lymphoma, myxofibrosarcoma, multiple myeloma,
neuroblastoma, non-Hodgkin lymphoma, non-small cell lung carcinoma, ovarian
carcinoma, esophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate
carcinoma, squamous cell carcinoma of the head and neck, or thyroid carcinoma.
In still further aspects, miR-143 or a miR-143 inhibitor and miR-16 are
administered to patients with astrocytoma, breast carcinoma, bladder
carcinoma,
colorectal carcinoma, endometrial carcinoma, glioblastoma, gastric carcinoma,
hepatocellular carcinoma, Hodgkin lymphoma, melanoma, mantle cell lymphoma,
myxofibrosarcoma, multiple myeloma, non-small cell lung carcinoma, ovarian
carcinoma, esophageal carcinoma, pancreatic carcinoma, prostate carcinoma,
squamous cell carcinoma of the head and neck, or thyroid carcinoma.
Aspects of the invention include methods where miR-143 or a miR-143
inhibitor and miR-20 are administered to patients with astrocytoma, acute
myeloid
-15-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
leukemia, breast carcinoma, bladder carcinoma, colorectal carcinoma,
endometrial
carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma,
melanoma, mantle cell lymphoma, neuroblastoma, non-small cell lung carcinoma,
ovarian carcinoma, esophageal carcinoma, pancreatic carcinoma, prostate
carcinoma,
or squamous cell carcinoma of the head and neck.
In a further aspect, miR-143 or a miR-143 inhibitor and miR-21 are
administered to patients with astrocytoma, acute myeloid leukemia, breast
carcinoma,
bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial
carcinoma,
glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin
lymphoma, leukemia, melanoma, mantle cell lymphoma, multiple myeloma, non-
Hodgkin lymphoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal
carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous
cell
carcinoma of the head and neck, or thyroid carcinoma.
In still further aspects, miR-143 or a miR-143 inhibitor and miR-26a are
administered to patients with acute myeloid leukemia, breast carcinoma,
bladder
carcinoma, cervical carcinoma, colorectal carcinoma, glioma, glioblastoma,
gastric
carcinoma, hepatocellular carcinoma, leukemia, melanoma, multiple myeloma,
neuroblastoma, non-Hodgkin lymphoma, non-small cell lung carcinoma, ovarian
carcinoma, esophageal carcinoma, osteosarcoma, pancreatic carcinoma, or
prostate
carcinoma.
In yet further aspects, miR-143 or a miR-143 inhibitor and miR-34a are
administered to patients with astrocytoma, acute myeloid leukemia, breast
carcinoma,
bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial
carcinoma,
glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin
lymphoma, leukemia, melanoma, mantle cell lymphoma, multiple myeloma, non-
Hodgkin lymphoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal
carcinoma, osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous
cell
carcinoma of the head and neck, thyroid carcinoma, or urothelial carcinoma.
In certain aspects, miR-143 or a miR-143 inhibitor and miR-126 are
administered to patients with astrocytoma, acute myeloid leukemia, breast
carcinoma,
bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial
carcinoma,
-16-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, Hodgkin
lymphoma, leukemia, melanoma, mantle cell lymphoma, non-Hodgkin lymphoma,
non-small cell lung carcinoma, ovarian carcinoma, esophageal carcinoma,
osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous cell
carcinoma of
the head and neck, or thyroid carcinoma.
In still a further aspect, miR-143 or a miR-143 inhibitor and miR-147 are
administered to patients with astrocytoma, breast carcinoma, bladder
carcinoma,
cervical carcinoma, colorectal carcinoma, endometrial carcinoma, esophageal
squamous cell carcinoma, glioma, glioblastoma, gastric carcinoma,
hepatocellular
carcinoma, Hodgkin lymphoma, leukemia, lipoma, melanoma, mantle cell lymphoma,
myxofibrosarcoma, multiple myeloma, non-Hodgkin lymphoma, non-small cell lung
carcinoma, ovarian carcinoma, esophageal carcinoma, osteosarcoma, pancreatic
carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck,
or
thyroid carcinoma.
In yet another aspect, miR-143 or a miR-143 inhibitor and miR-188 are
administered to patients with astrocytoma, acute myeloid leukemia, breast
carcinoma,
bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial
carcinoma,
esophageal squamous cell carcinoma, glioma, glioblastoma, gastric carcinoma,
hepatocellular carcinoma, leukemia, melanoma, multiple myeloma, non-Hodgkin
lymphoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal
carcinoma,
pancreatic carcinoma, prostate carcinoma, squamous cell carcinoma of the head
and
neck, or thyroid carcinoma.
In other aspects, miR-143 or a miR-143 inhibitor and miR-215 are
administered to patients with astrocytoma, acute myeloid leukemia, breast
carcinoma,
bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial
carcinoma,
esophageal squamous cell carcinoma, glioma, glioblastoma, gastric carcinoma,
hepatocellular carcinoma, Hodgkin lymphoma, leukemia, lipoma, melanoma, mantle
cell lymphoma, myxofibrosarcoma, multiple myeloma, neuroblastoma, non-Hodgkin
lymphoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal
carcinoma,
osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous cell
carcinoma of
the head and neck, thyroid carcinoma, or urothelial carcinoma.
-17-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
In certain aspects, miR-143 or a miR-143 inhibitor and miR-216 are
administered to patients with astrocytoma, breast carcinoma, cervical
carcinoma,
colorectal carcinoma, endometrial carcinoma, glioma, glioblastoma, gastric
carcinoma, hepatocellular carcinoma, Hodgkin lymphoma, leukemia, non-Hodgkin
lymphoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal
carcinoma,
osteosarcoma, prostate carcinoma, or squamous cell carcinoma of the head and
neck.
In a further aspect, miR-143 or a miR-143 inhibitor and miR-292-3p are
administered to patients with astrocytoma, acute myeloid leukemia, breast
carcinoma,
bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial
carcinoma,
glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia,
lipoma,
melanoma, myxofibrosarcoma, multiple myeloma, neuroblastoma, non-Hodgkin
lymphoma, non-small cell lung carcinoma, ovarian carcinoma, esophageal
carcinoma,
osteosarcoma, pancreatic carcinoma, prostate carcinoma, squamous cell
carcinoma of
the head and neck, thyroid carcinoma, or urothelial carcinoma.
In still a further aspect, miR-143 or a miR-143 inhibitor and miR-331 are
administered to patients with astrocytoma, acute myeloid leukemia, breast
carcinoma,
bladder carcinoma, cervical carcinoma, colorectal carcinoma, endometrial
carcinoma,
glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma, leukemia,
melanoma, myxofibrosarcoma, multiple myeloma, neuroblastoma, non-Hodgkin
lymphoma, ovarian carcinoma, esophageal carcinoma, osteosarcoma, pancreatic
carcinoma, prostate carcinoma, squamous cell carcinoma of the head and neck,
or
thyroid carcinoma.
In yet a further aspect, miR-143 or a miR-143 inhibitor and miR-200b/c are
administered to patients with breast carcinoma, cervical carcinoma, colorectal
carcinoma, glioma, glioblastoma, gastric carcinoma, hepatocellular carcinoma,
leukemia, lipoma, multiple myeloma, non-small cell lung carcinoma, ovarian
carcinoma, esophageal carcinoma, osteosarcoma, pancreatic carcinoma, prostate
carcinoma, squamous cell carcinoma of the head and neck, or thyroid carcinoma.
It is contemplated that when miR-143 or a miR-143 inhibitor is given in
combination with one or more other miRNA molecules, the two different miRNAs
or
inhibitors may be given at the same time or sequentially. In some embodiments,
-18-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
therapy proceeds with one miRNA or inhibitor and that therapy is followed up
with
therapy with the other miRNA or inhibitor 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15,
20, 25, 30,
35, 40, 45, 50, 55 minutes, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18,
19, 20, 21, 22, 23, 24 hours, 1, 2, 3, 4, 5, 6, 7 days, 1, 2, 3, 4, 5 weeks,
or 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, or 12 months or any such combination later.
Further embodiments include the identification and assessment of an
expression profile indicative of miR-143 status in a cell or tissue comprising
expression assessment of one or more gene from Table 1, 3, 4, and/or 5, or any
combination thereof.
The term "miRNA" is used according to its ordinary and plain meaning and
refers to a microRNA molecule found in eukaryotes that is involved in RNA-
based
gene regulation. See, e.g., Carrington et al., 2003, which is hereby
incorporated by
reference. The term can be used to refer to the single-stranded RNA molecule
processed from a precursor or in certain instances the precursor itself or a
mimetic
thereof.
In some embodiments, it may be useful to know whether a cell expresses a
particular miRNA endogenously or whether such expression is affected under
particular conditions or when it is in a particular disease state. Thus, in
some
embodiments of the invention, methods include assaying a cell or a sample
containing
a cell for the presence of one or more miRNA marker gene or mRNA or other
analyte
indicative of the expression level of a gene of interest. Consequently, in
some
embodiments, methods include a step of generating an RNA profile for a sample.
The
term "RNA profile" or "gene expression profile" refers to a set of data
regarding the
expression pattern for one or more gene or genetic marker in the sample (e.g.,
a
plurality of nucleic acid probes that identify one or more markers or genes
from
Tables 1, 3, 4, and/or 5); it is contemplated that the nucleic acid profile
can be
obtained using a set of RNAs, using for example nucleic acid amplification or
hybridization techniques well know to one of ordinary skill in the art. The
difference
in the expression profile in the sample from a patient and a reference
expression
profile, such as an expression profile from a normal or non-pathologic sample,
or a
digitized reference, is indicative of a pathologic, disease, or cancerous
condition. In
certain aspects the expression profile is an indicator of a propensity to or
probability
-19-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
of (i.e., risk factor for a disease or condition) developing such a
condition(s). Such a
risk or propensity may indicate a treatment, increased monitoring,
prophylactic
measures, and the like. A nucleic acid or probe set may comprise or identify a
segment of a corresponding mRNA and may include all or part of 1, 2, 3, 4, 5,
6, 7, 8,
9, 10, 11, 12 ,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28,
29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50,
51, 52, 53, 54,
55, 56, 57, 58, 59, 60, 61, 62, 100, 200, 500, or more segments, including any
integer
or range derivable there between, of a gene or genetic marker, or a nucleic
acid,
mRNA or a probe representative thereof that is listed in Tables 1, 3, 4,
and/or 5 or
identified by the methods described herein.
Certain embodiments of the invention are directed to compositions and
methods for assessing, prognosing, or treating a pathological condition in a
patient
comprising measuring or determining an expression profile of one or more miRNA
or
marker(s) in a sample from the patient, wherein a difference in the expression
profile
in the sample from the patient and an expression profile of a normal sample or
reference expression profile is indicative of pathological condition and
particularly
cancer (e.g., In certain aspects of the invention, the miRNAs, cellular
pathway, gene,
or genetic marker is or is representative of one or more pathway or marker
described
in Table 1, 2, 3, 4, and/or 5, including any combination thereof.
Aspects of the invention include diagnosing, assessing, or treating a
pathologic
condition or preventing a pathologic condition from manifesting. For example,
the
methods can be used to screen for a pathological condition; assess prognosis
of a
pathological condition; stage a pathological condition; assess response of a
pathological condition to therapy; or to modulate the expression of a gene,
genes, or
related pathway as a first therapy or to render a subject sensitive or more
responsive
to a second therapy. In particular aspects, assessing the pathological
condition of the
patient can be assessing prognosis of the patient. Prognosis may include, but
is not
limited to an estimation of the time or expected time of survival, assessment
of
response to a therapy, and the like. In certain aspects, the altered
expression of one or
more gene or marker is prognostic for a patient having a pathologic condition,
wherein the marker is one or more of Table 1, 3, 4, and/or 5, including any
combination thereof.
-20-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
Table 2. Significantly affected functional cellular pathways following hsa-miR-
143
over-expression in human cancer cells.
Number
of Genes Pathwa Functions
Cellular Movement, Hematological System Development and
9 Function, Immune Response
Gene Expression, Cellular Growth and Proliferation, Developmental
2 Disorder
Table 3. Predicted target genes of hsa-miR-143 for Ref Seq ID reference -
Pruitt et
al., 2005.
Gene RefSeq
S mbol Transcript ID Descri tion
76P NM014444 gamma tubulin ring complex protein (76p gene)
AACS NM023928 acetoacetyl-CoA synthetase
AADACLI NM020792 arylacetamide deacetylase-like 1
AARSL NM_020745 alanyl-tRNA synthetase like
ABAT NM_000663 4-aminobutyrate aminotransferase precursor
ABCA1 NM005502 ATP-binding cassette, sub-family A member 1
ABCB 11 NM_003742 ATP-binding cassette, sub-family B(MDR/TAP),
ABCB9 NM_203445 ATP-binding cassette, sub-family B (MDR/TAP),
ABCC1 NM004996 ATP-binding cassette, sub-family C, member I
ABCC13 NM_172024 ATP-binding cassette protein C13 isoform b
ABCC3 NM020038 ATP-binding cassette, sub-family C, member 3
ABCC4 NM005845 ATP-binding cassette, sub-family C, member 4
ABCG4 NM022169 ATP-binding cassette, subfamily G, member 4
ABCG5 NM022436 sterolin 1
ABHD14A NM015407 abhydrolase domain containing 14A
ABHD14B N1VI032750 abhydrolase domain containing 14B
ABHD8 NM_024527 abhydrolase domain containing 8
ABLIMI NM001003407 actin-binding LIM protein 1 isoform b
ABR NM001092 active breakpoint cluster region-related
ABTB2 NM145804 ankyrin repeat and BTB (POZ) domain containing
ACACB NM001093 acetyl-Coenzyme A carboxylase beta
ACADSB NM001609 acyl-Coenzyme A dehydrogenase, short/branched
ACCN1 NM001094 amiloride-sensitive cation channel 1, neuronal
ACE NM 152831 angiotensin I converting enzyme isoform 3
ACE2 NM_021804 angiotensin I converting enzyme 2 precursor
ACIN1 NM014977 apoptotic chromatin condensation inducer 1
ACOXL NM018308 acyl-Coenzyme A oxidase-like
ACP 1 NM_004300 acid phosphatase I isoform c
ACSL6 NM001009185 acyl-CoA synthetase long-chain family member 6
ACTL8 NM030812 actin like protein
ACTN2 NM001103 actinin, alpha 2
ACTR8 NM022899 actin-related protein 8
ACVRIB NM004302 activin A type IB receptor isoform a precursor
ACY1L2 NM001010853 hypothetical protein LOC135293
ADAM10 NM_001110 ADAM metallopeptidase domain 10
ADA1VI12 NM003474 ADAM metallopeptidase domain 12 isoform 1
ADAM9 NM_001005845 ADAM metallopeptidase domain 9 isoform 2
ADAMTS1 NM 006988 ADAM metallopeptidase with thrombospondin type 1
-21-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
ADAMTS3 NM014243 ADAM metallopeptidase with thrombospondin type 1
ADAMTS4 NM005099 ADAM metallopeptidase with thrombospondin type 1
ADAMTSLI NM052866 ADAMTS-like 1 isoform 2
ADAR NM001025107 adenosine deaminase, RNA-specific isoform d
ADARBI NM001033049 RNA-specific adenosine deaminase B1 isoform 4
ADATl NM012091 adenosine deaminase, tRNA-specific I
ADCYl NM_021116 brain adenylate cyclase 1
ADCY2 NM 020546 adenylate cyclase 2
ADCY6 NM 015270 adenylate cyclase 6 isoform a
ADCY9 NM001116 adenylate cyclase 9
ADD2 NM001617 adducin 2 isoform a
ADD3 NM_001121 adducin 3 (gamma) isoform b
ADIl NM_018269 membrane-type 1 matrix metalloproteinase
ADIPOQ NM004797 adiponectin precursor
ADORA3 NM000677 adenosine A3 receptor isoform 2
ADRA2B NM000682 alpha-2B-adrenergic receptor
ADSSLl NM_152328 adenylosuccinate synthase-like I isoform 2
AFAP NM021638 actin filament associated protein
AFFI NM_005935 myeloid/lymphoid or mixed-lineage leukemia
AFF2 NM_002025 fragile X mental retardation 2
AFG3L2 NM_006796 AFG3 ATPase family gene 3-like 2
AGBL4 NM_032785 hypothetical protein LOC84871
AGMAT NM024758 agmatine ureohydrolase (agmatinase)
AGPATI NM006411 1 -acylglycerol-3 -phosphate 0-acyltransferase 1
AGPAT3 NM_020132 I -acylglycerol-3 -phosphate 0-acyltransferase 3
AGPAT4 NM001012733 1-acylglycerol-3-phosphate 0-acyltransferase 4
AGR2 NM006408 anterior gradient 2 homolog
AGRN NM_198576 agrin
AHCTFl NM_015446 transcription factor ELYS
AHCYLI NM_006621 S-adenosylhomocysteine hydrolase-like 1
AICDA NM020661 activation-induced cytidine deaminase
AIFl NM_004847 allograft inflammatory factor 1 isoform 2
AIG1 NM_016108 androgen-induced 1
AIPLl NM_001033054 aryl hydrocarbon receptor interacting
AIRE NM_000383 autoimmune regulator AIRE isoform 1
AKI NM_000476 adenylate kinase 1
AK3 NM016282 adenylate kinase 3
AKAPI I NM144490 A-kinase anchor protein I1 isoform 2
AKAP13 NM006738 A-kinase anchor protein 13 isoform 1
AKAP6 NM_004274 A-kinase anchor protein 6
AKTI NM001014431 v-akt murine thymoma viral oncogene homolog 1
ALB NM_000477 albumin precursor
ALDH3A2 NM000382 aldehyde dehydrogenase 3A2 isoform 2
ALDH5A1 NM001080 aldehyde dehydrogenase 5A1 precursor, isoform 2
ALKBH4 NM017621 hypothetical protein LOC54784
ALPL NM_000478 tissue non-specific alkaline phosphatase
ALS2 NM_020919 alsin
ALX3 NM006492 aristaless-like homeobox 3
AMDHD 1 NM_152435 hypothetical protein LOC 144193
AMFR NM_001144 autocrine motility factor receptor
AMICAI NM153206 adhesion molecule, interacts with CXADR antigen
AMMECRI NM_001025580 AMMECR1 protein isoform 2
AMOTLI NM_130847 angiomotin like 1
AMPD2 NM 004037 adenosine monophosphate deaminase 2(isoform L)
-22-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
AMT NM000481 aminomethyltransferase (glycine cleavage system
AMZ1 NM133463 archaemetzincin-1
ANGELl NM_015305 angel homolog I
ANGPTLI NM_004673 angiopoietin-like 1 precursor
ANGPTL2 NM_012098 angiopoietin-like 2 precursor
ANGPTL7 NM_021146 angiopoietin-like 7
ANKH NM054027 ankylosis, progressive homolog
ANKRD12 NM015208 ankyrin repeat domain 12
ANKRD13 NM_033121 ankyrin repeat domain 13
ANKRD20A3 NM_001o12419 hypothetical protein LOC441425
ANKRD25 NM_015493 ankyrin repeat domain 25
ANKRD28 NM015199 ankyrin repeat domain 28
ANKRD29 NM173505 ankyrin repeat domain 29
ANKRD41 NM_152363 ankyrin repeat domain 41
ANKRD50 NM_020337 ankyrin repeat domain 50
ANKS6 NM_173551 sterile alpha motif domain containing 6
ANXA3 NM005139 annexin A3
ANXA9 NM003568 annexin A9
AOC2 NM001158 amine oxidase, copper containing 2 isoform a
AP2B 1 NM001030006 adaptor-related protein complex 2, beta I
AP3D1 NM_003938 adaptor-related protein complex 3, delta 1
AP3M1 NM012095 adaptor-related protein complex 3, mu 1 subunit
APAFI NM_001160 apoptotic protease activating factor isoform b
APOAIBP NM_144772 apolipoprotein A-I binding protein precursor
APOA5 NM_052968 apolipoprotein AV
APOBEC3A NM145699 phorbolin 1
APOBEC3F NM_145298 apolipoprotein B mRNA editing enzyme, catalytic
APOBEC4 NM_203454 apolipoprotein B mRNA editing enzyme, catalytic
APOLl NM_003661 apolipoprotein Ll isoform a precursor
APOL6 NM_030641 apolipoprotein L6
APOLDl NM_030817 apolipoprotein L domain containing 1
APPL NM012096 adaptor protein containing pH domain, PTB domain
APTX NM_175069 aprataxin isoform b
AQP10 NM080429 aquaporin 10
AQP2 NM_000486 aquaporin 2
AQP3 NM_004925 aquaporin 3
ARCNl NM001655 archain
ARFGAP3 NM014570 ADP-ribosylation factor GTPase activating
ARFIP2 NM_012402 ADP-ribosylation factor interacting protein 2
ARHGAP18 NM033515 Rho GTPase activating protein 18
ARHGAP20 NM_020809 Rho GTPase activating protein 20
ARHGAP25 NM_001007231 Rho GTPase activating protein 25 isoform a
ARHGAP26 NM_015071 GTPase regulator associated with the focal
ARHGAP28 NM_091010000 Rho GTPase activating protein 28 isoform a
ARHGAP9 NM_032496 Rho GTPase activating protein 9
ARHGDIB NM001175 Rho GDP dissociation inhibitor (GDI) beta
ARHGEFl NM_004706 Rho guanine nucleotide exchange factor I isoform
ARHGEF7 NM_003899 Rho guanine nucleotide exchange factor 7 isoform
ARID3B NM006465 AT rich interactive domain 3B (BRIGHT- like)
ARID5B NM032199 AT rich interactive domain 5B (MRF1-like)
ARL15 NM019087 ADP-ribosylation factor related protein 2
ARL3 NM_004311 ADP-ribosylation factor-like 3
ARL6 NM032146 ADP-ribosylation factor-like 6
ARL6IP2 NM 022374 ADP-ribosylation factor-like 6 interacting
-23-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
ARMC5 NM_024742 armadillo repeat containing 5
ARMC8 NM_014154 armadillo repeat containing 8 isoform 1
ARNT NM001668 aryl hydrocarbon receptor nuclear translocator
ARRDC4 NM183376 arrestin domain containing 4
ARSD NM001669 arylsulfatase D isoform a precursor
ARTS-1 NM016442 type 1 tumor necrosis factor receptor shedding
ASAM NM024769 adipocyte-specific adhesion molecule
ASB4 NM_145872 ankyrin repeat and SOCS box-containing protein 4
ASB6 NM017873 ankyrin repeat and SOCS box-containing 6 isoform
ASCC3 NM_006828 activating signal cointegrator 1 complex subunit
ASL NM_000048 argininosuccinate lyase isoform 1
ASPH NM_004318 aspartate beta-hydroxylase isoform a
ASTN NM004319 astrotactin isoform 1
ASXLl NM015338 additional sex combs like 1
ASXL2 NM018263 additional sex combs like 2
ATCAY NM033064 caytaxin
ATF3 NM_001030287 activating transcription factor 3 isoforrn 1
ATG10 NM031482 APG10 autophagy 10-like
ATG12 NM_004707 APG12 autophagy 12-like
ATG9A NM_024085 APG9 autophagy 9-like 1
ATG9B NM_173681 nitric oxide synthase 3 antisense
ATHLI NM_025092 hypothetical protein LOC80162
ATM NM000051 ataxia telangiectasia mutated protein isoform 1
ATOH8 NM_032827 atonal homolog 8
ATP10A NM024490 ATPase, Class V, type LOA
ATP11B NM014616 ATPase, Class VI, type 11B
ATP11C NM001010986 ATPase, Class VI, type 11C isoformb
ATP 1A2 NM_000702 Na+/K+ -ATPase alpha 2 subunit proprotein
ATPIA3 NM_152296 Na+/K+-ATPase alpha 3 subunit
ATP2B2 NM_001001331 plasma membrane calcium ATPase 2 isoform a
ATP6AP 1 NM001183 ATPase, H+ transporting, lysosomal accessory
ATP6VOE NM003945 ATPase, H+ transporting, lysosomal, VO subunit
ATP6V 1A NM_001690 ATPase, H+ transporting, lysosomal 70kD, V 1
ATP6V 1C2 NM_144583 vacuolar H+ ATPase C2 isoform b
ATP6V 1F NM004231 ATPase, H+ transporting, lysosomal l4kD, V 1
ATP8A1 NM006095 ATPase, aminophospholipid transporter (APLT),
ATPBD4 NM_080650 ATP binding domain 4
ATPIFI NM_178191 ATPase inhibitory factor 1 isoform 3 precursor
ATXN1 NM000332 ataxin 1
AVPRIB NM_000707 arginine vasopressin receptor 1B
AZGP1 NM001185 alpha-2-glycoprotein 1, zinc
B3GNT6 NM138706 UDP-G1cNAc:betaGal
B4GALT1 NM001497 UDP-Gal:betaGlcNAc beta 1,4-
B4GALT5 NM004776 UDP-Gal:betaGlcNAc beta 1,4-
BAAT NM001701 bile acid Coenzyme A: amino acid
BACE1 NM012104 beta-site APP-cleaving enzyme 1 isoform A
BACHl NM001011545 BTB and CNC homology 1 isoform b
BACH2 NM021813 BTB and CNC homology 1, basic leucine zipper
BAG1 NM004323 BCL2-associated athanogene isoform 1L
BAG3 NM004281 BCL2-associated athanogene 3
BAG5 NM_001015048 BCL2-associated athanogene 5 isoform b
BAGE4 NM_181704 B melanoma antigen family, member 4
BARHL2 NM020063 BarH-like 2
BAT2D 1 NM 015172 HBxAg transactivated protein 2
-24-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
BATF2 NM138456 basic leucine zipper transcription factor,
BAZ2A NM_013449 bromodomain adjacent to zinc finger domain, 2A
BBC3 NM014417 BCL2 binding component 3
BBS1 NM024649 Bardet-Biedl syndrome 1
BBS5 NM_152384 Bardet-Biedl syndrome 5
BCAN NM 198427 brevican isoform 2
BCAP29 NM001008406 B-cell receptor-associated protein BAP29 isoform
BCAP31 NM005745 B-cell receptor-associated protein 31
BCL2 NM000633 B-cell lymphoma protein 2 alpha isoform
BCL3 NM_005178 B-cell CLL/lymphoma 3
BCORLI NM021946 BCL6 co-repressor-like 1
BCR NM004327 breakpoint cluster region isoform 1
BDH2 NM_020139 3-hydroxybutyrate dehydrogenase, type 2
BETIL NM016526 blocked early in transport 1 homolog (S.
BFAR NM016561 apoptosis regulator
BGN NM001711 biglycan preproprotein
BHLHB9 NM030639 basic helix-loop-helix domain containing, class
BHMT2 NM_017614 betaine-homocysteine methyltransferase 2
BICD1 NM001003398 bicaudal D homolog I isoform 2
BIRC1 NM004536 baculoviral IAP repeat-containing 1
BIRC2 NM001166 baculoviral IAP repeat-containing protein 2
BIRC4 NM_001167 baculoviral IAP repeat-containing protein 4
BIRC4BP NM017523 XIAP associated factor-1 isoform I
BIRC5 NM001012270 baculoviral IAP repeat-containing protein 5
BLMH NM_000386 bleomycin hydrolase
BLOCIS2 NM001001342 biogenesis of lysosome-related organelles
BLR1 NM001716 Burkitt lymphoma receptor 1 isoform 1
BLZF1 NM003666 basic leucine zipper nuclear factor 1
BMPRIA NM004329 bone morphogenetic protein receptor, type IA
BMPR2 NM001204 bone morphogenetic protein receptor type II
BOK NM032515 BCL2-related ovarian killer
BOLA2 NM001031833 BoIA-like protein 2 isoform b
BOLL NM033030 boule isoform 2
BPNT1 NM_006085 3'(2'), 5'-bisphosphate nucleotidase 1
BRCA1 NM_007306 breast cancer 1, early onset isoform
BRD2 NM_005104 bromodomain containing protein 2
BRD4 NM_014299 bromodomain-containing protein 4 isoform short
BSN NM003458 bassoon protein
BTBD14B NM052876 transcriptional repressor NAC 1
BTBD15 NM_014155 BTB (POZ) domain containing 15
BTBD4 NM_025224 BTB (POZ) domain containing 4
BTBD6 NM033271 BTB domain protein BDPL
BTF3L4 NM152265 transcription factor BTF3-like
BTG2 NM006763 B-cell translocation gene 2
BTN1A1 NM001732 butyrophilin, subfamily 1, member Al
BTN2A1 NM_007049 butyrophilin, subfamily 2, member Al isoform 1
BTN2A2 NM_006995 butyrophilin, subfamily 2, member A2 isoform a
BTN3A2 NM007047 butyrophilin, subfamily 3, member A2 precursor
BTNL8 NM_024850 butyrophilin-like 8 short form
BTRC NM_003939 beta-transducin repeat containing protein
BVES NM007073 blood vessel epicardial substance
C10orfl 0 NM007021 fasting induced gene
C10orfl04 NM_173473 hypothetical protein LOCI19504
C10orf111 NM 153244 hypothetical protein LOC221060
-25-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
C10orfl 14 NM001010911 hypothetical protein LOC399726
C10orf12 NM015652 hypothetical protein LOC26148
Cl0orfl29 NM_207321 hypothetical protein LOC142827
C10orf38 NM001010924 hypothetical protein LOC221061
C10orf39 NM194303 hypothetical protein LOC282973
ClOorf42 NM138357 hypothetical protein LOC90550
ClOorf46 NM153810 hypothetical protein LOC143384
C10orf53 NM182554 hypothetical protein LOC282966
C10orf54 NM_022153 hypothetical protein LOC64115
ClOorf56 NM_153367 hypothetical protein LOC219654
C 10orf65 NM 138413 hypothetical protein LOC 112 817
ClOorf83 NM_178832 hypothetical protein LOC118812
CIOor199 NM_207373 hypothetical protein LOC387695
C l lorfl NM_022761 hypothetical protein LOC64776
Cl lorfl7 NM_182901 chromosome 11 open reading &ame 17
Cl lorf45 NM145013 hypothetical protein LOC219833
Cl lorf46 NM_152316 hypothetical protein LOC120534
Cl lorf49 NM_001003676 hypothetical protein LOC79096 isoform 1
Cl lorf54 NM014039 hypothetical protein LOC28970
Cl lorf55 NM207428 hypothetical protein LOC399879
C 11 orf69 NM_152314 hypothetical protein LOC 120196
C12orf22 NM030809 TGF-beta induced apoptosis protein 12
C12orf29 NM_001009894 hypothetical protein LOC91298
C12orf31 NM032338 hypothetical protein LOC84298
C12orf41 NM017822 hypothetical protein LOC54934
Cl2orf5 NM_020375 chromosome 12 open reading frame 5
Cl2orf59 NM_153022 hypothetical protein LOC120939
C13orf3 NM_145061 hypothetical protein LOC221150
C14orf103 NM_018036 hypothetical protein LOC55102
C14orf11 NM_018453 hypothetical protein LOC55837
C14orf115 NM_018228 hypothetical protein LOC55237
C 14orf143 NM_145231 hypothetical protein LOC90141
C14orf150 NM_001008726 hypothetical protein LOC112840
Cl4orf162 NM_020181 chromosome 14 open reading frame 162
C14orf43 NM_194278 hypothetical protein LOC91748
C14orf58 NM_017791 hypothetical protein LOC55640
C14orf8 NM173846 chromosome 14 open reading frame 8
C15orf15 NM016304 ribosomal protein L24-like
Cl5orf2O NM_025049 DNA helicase homolog PIF1
C15orf27 NM_152335 hypothetical protein LOC123591
C15orf38 NM_182616 hypothetical protein LOC348110
C15orf39 NM_015492 hypothetical protein LOC56905
C15orf42 NM152259 leucine-rich repeat kinase 1
C16orf53 NM_024516 hypothetical protein LOC79447
Cl6orf54 NM_175900 hypothetical protein LOC283897
Cl6orf58 NM_022744 hypothetical protein LOC64755
C17orf28 NM_030630 hypothetical protein LOC283987
C 17orf42 NM_024683 hypothetical protein LOC79736
C 17orf45 NM_152350 hypothetical protein LOC 125144
C17orf53 NM_024032 hypothetical protein LOC78995
Cl7orf56 NM_144679 hypothetical protein LOC146705
C17orf59 NM_017622 hypothetical protein LOC54785
C17orf69 NM_152466 hypothetical protein LOC147081
C18orflNM 001003674 hypothetical protein LOC753 isoform gamma I
-26-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
C18orf24 NM_145060 hypothetical protein LOC220134
C18orf25 NM_001008239 chromosome 18 open reading frame 25 isoform b
C18orf45 NM032933 hypothetical protein LOC85019
C19orfl 0 NM019107 chromosome 19 open reading frame 10
C19orf23 NM152480 hypothetical protein LOC 148046
C19orf35 NM198532 hypothetical protein LOC374872
C19orf39 NM175871 hypothetical protein LOC126074
C19orf4 NM012109 brain-specific membrane-anchored protein
C1orf106 NM_018265 hypothetical protein LOC55765
C1orf107 NM_014388 hypothetical protein LOC27042
C 1 orf108 NM_024595 hypothetical protein LOC79647
Clorfl09 NM_017850 hypothetical protein LOC54955
Clorf115 NM_024709 hypothetical protein LOC79762
Clorfl 16 NM_023938 specifically androgen-regulated protein
C 1 orfl 17 NM182623 hypothetical protein LOC348487
Clorf119 NM_020141 hypothetical protein LOC56900
C1orfl30 NM_001010980 hypothetical protein LOC400746
Clorfl35 NM_024037 hypothetical protein LOC79000
C1orf140 NM_001010913 hypothetical protein LOC400804
Clorf144 NM_015609 putative MAPK activating protein PM20,PM21
Clorfl45 NM001025495 hypothetical protein LOC574407
C1orf149 NM_022756 hypothetical protein LOC64769
Clorf151 NM001032363 chromosome 1 open reading frame 151 protein
Clorfl57 NM_182579 hypothetical protein LOC284573
C l orf162 NM_174896 hypothetical protein LOC 128346
Clorf166 NM024544 hypothetical protein LOC79594
Clorfl72 NM_152365 hypothetical protein LOC126695
Clorfl73 NM_001002912 hypothetical protein LOC127254
Clorfl83 NM_019099 hypothetical protein LOC55924 isoform 1
ClorfI87 NM_198545 chromosome 1 open reading frame 187
Clorf2l NM_030806 chromosome 1 open reading frame 21
Clort36 NM_183059 chromosome I open reading frame 36
Clorf38 NM_004848 basement membrane-induced gene isoform 1
Clorf45 NM_001025231 hypothetical protein LOC448834
C l orf49 NM_032126 hypothetical protein LOC84066
C l orf52 NM_198077 hypothetical protein LOC148423
Clorf53 NM_001024594 hypothetical protein LOC388722
Clorf56 NM_017860 hypothetical protein LOC54964
Clorf6l NM006365 transcriptional activator of the c-fos promoter
Clorf66 NM_015997 hypothetical protein LOC51093
Clorf69 NM_001010867 hypothetical protein LOC200205
Clorf74 NM_152485 hypothetical protein LOC148304
Clorf76 NM_173509 hypothetical protein MGC 16664
C1orf80 NM_022831 hypothetical protein LOC64853
Clorf83 NM_153035 hypothetical protein LOC127428
C 1 orf95 NM_001003665 hypothetical protein LOC375057
Clorf96 NM_145257 hypothetical protein LOC126731
C 1 QTNF 1 NM_030968 C l q and tumor necrosis factor related protein 1
C1RL NM_G16546 complement component 1, r subcomponent-like
C20orf108 NM_080821 hypothetical protein LOC116151
C20orf11 NM017896 chromosome 20 open reading frame 11
C20orf111 NM016470 oxidative stress responsive 1
C20orf12 NM018152 hypothetical protein LOC55184
C20orf28 NM 015417 hypothetical protein LOC25876
-27-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
C20orf29 NM_018347 hypothetical protein LOC55317
C20orf4 NM015511 hypothetical protein LOC25980
C20orf42 NM_017671 chromosome 20 open reading frame 42
C20orf43 NM_016407 hypothetical protein LOC51507
C20otf44 NM018244 basic FGF-repressed Zic binding protein isoform
C20or198 NM_024958 hypothetical protein LOC80023
C21 orfl 14 NM001012707 hypothetical protein LOC378826
C21orf24 NM001001789 hypothetical protein LOC400866
C21orf29 NM144991 chromosome 21 open reading frame 29
C21 orf62 NM019596 hypothetical protein LOC56245
C21orf69 NM058189 chromosome 21 open reading frame 69
C21 orf93 NM_ 145179 hypothetical protein LOC246704
C22orfl 3 NM031444 chromosome 22 open reading frame 13
C22orf18 NM001002876 proliferation associated nuclear element 1
C22orf25 NM152906 hypothetical protein LOC128989
C22orf9 NM_001009880 hypothetical protein LOC23313 isoform b
C2orf11 NM_144629 hypothetical protein LOC130132
C2orf15 NM144706 hypothetical protein LOC150590
C2orfl7 NM024293 hypothetical protein LOC79137
C2orfl8 NM017877 hypothetical protein LOC54978
C2orf27 NM013310 hypothetical protein LOC29798
C2orf37 NM025000 hypothetical protein LOC80067
C3orf17 NM001025072 hypothetical protein LOC25871 isoform b
C3orf21 NM_152531 hypothetical protein LOC152002
C3orf23 NM001029839 hypothetical protein LOC285343 isoform 2
C3orf34 NM032898 hypothetical protein LOC84984
C4orf13 NM001030316 hypothetical protein LOC84068 isoform a
C5orf2l NM_032042 hypothetical protein LOC83989
C5orf24 NM152409 hypothetical protein LOC134553
C5orf4 NM016348 hypothetical protein LOC10826 isoform 1
C6orf130 NM_145063 hypothetical protein LOC221443
C6orf149 NM_020408 hypothetical protein LOC57128
C6orfl 5 NM014070 STG protein
C6orf155 NM024882 hypothetical protein LOC79940
C6orf157 NM_198920 hypothetical protein LOC90025
C6orf165 NM178823 hypothetical protein LOC 154313 isoform 2
C6ort201 NM_206834 hypothetical protein LOC404220
C6ort205 NM_001010909 hypothetical protein LOC394263
C6orf69 NM173562 hypothetical protein LOC222658
C6ort96 NM017909 hypothetical protein LOC55005
C6ort97 NM025059 hypothetical protein LOC80129
C7 NM_000587 complement component 7 precursor
C7orf34 NM178829 hypothetical protein LOC135927
C7orf38 NM145111 hypothetical protein LOC221786
C8orf1 NM004337 hypothetical protein LOC734
C8orfl7 NM020237 MOST-1 protein
C8orf44 NM_019607 hypothetical protein LOC56260
C8orf51 NM024035 hypothetical protein LOC78998
C9orf106 NM001012715 hypothetical protein LOC414318
C9orfl28 NM001012446 hypothetical protein LOC392307
C9orfl4O NM_178448 hypothetical protein LOC89958
C9orf152 NM_001012993 hypothetical protein LOC401546
C9orf163 NM_152571 hypothetical protein LOC158055
C9orf25 NM 147202 hypothetical protein LOC203259
-28-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
C9orf27 NM_021208 chromosome 9 open reading frame 27
C9orf42 NM_138333 hypothetical protein LOC116224
C9orf5 NM032012 hypothetical protein LOC23731
C9orf5O NM_199350 hypothetical protein LOC375759
C9orf58 NM001002260 chromosome 9 open reading frame 58 isoform 2
C9orf65 NM_138818 hypothetical protein LOC158471
C9orf89 NM_032310 chromosome 9 open reading frame 89
C9orf91 NM153045 hypothetical protein LOC203197
CA12 NM_001218 carbonic anhydrase XII isoform 1 precursor
CA2 NM_000067 carbonic anhydrase II
CABLES2 NM_031215 Cdk5 and Abl enzyme substrate 2
CACHD1 NM_020925 cache domain containing I
CACNAIE NM000721 calcium channel, voltage-dependent, alpha lE
CACNA2D2 NM001005505 calcium channel, voltage-dependent, alpha
CACNA2D3 NM_018398 calcium channel, voltage-dependent, alpha
CACNG4 NM_014405 voltage-dependent calcium channel gamma-4
CALCB NM000728 calcitonin-related polypeptide, beta
CALDl NM004342 caldesmon 1 isoform 2
CALM3 NM005184 calmodulin 3
CALML4 NM033429 calmodulin-like 4 isoform 2
CALNl NM001017440 calneuron 1
CALR NM004343 calreticulin precursor
CAMK2A NM_015981 calcium/calmodulin-dependent protein kinase IIA
CAMK2D NM172127 calcium/calmodulin-dependent protein kinase II
CAMK2G NM_001222 calcium/calmodulin-dependent protein kinase II
CAMKKl NM032294 calcium/calmodulin-dependent protein kinase 1
CAMKK2 NM_006549 calciunt/calmodulin-dependent protein kinase
CAMLG NM_001745 calcium modulating ligand
CAMSAPI NM_015447 calmodulin regulated spectrin-associated protein
CAND1 NM018448 TIP120 protein
CAPN11 NM007058 calpain 11
CAPN3 NM_212464 calpain 3 isoform g
CAPZB NM004930 F-actin capping protein beta subunit
CARKL NM_013276 carbohydrate kinase-like
CASC2 NM_178816 cancer susceptibility candidate 2 isoform 1
CASC3 NM_007359 cancer susceptibility candidate 3
CASKIN2 NM020753 cask-interacting protein 2
CASP2 NM_032982 caspase 2 isoform 1 preproprotein
CASP8 NM001228 caspase 8 isoform A
CASQ2 NM_001232 cardiac calsequestrin 2
CASTI NM015576 cytomatrix protein p110
CBFA2T2 NM_001032999 core-binding factor, runt domain, alpha subunit
CBFB NM_001755 core-binding factor, beta subunit isoform 2
CBL NM005188 Cas-Br-M (murine) ecotropic retroviral
CBLLl NM024814 Cas-Br-M (murine) ecotropic retroviral
CBX7 NM_175709 chromobox homolog 7
CC2DIB NM_032449 coiled-coil and C2 domain containing 1B
CCBLI NM004059 cytoplasmic cysteine conjugate-beta lyase
CCBP2 NM_001296 chemokine binding protein 2
CCDC102B NM_024781 hypothetical protein LOC79839
CCDC14 NM_022757 coiled-coil domain containing 14
CCDC21 NM022778 coiled-coil domain containing 21
CCDC25 NM_001031708 coiled-coil domain containing 25 isoform 1
CCDC33 NM 182791 hypothetical protein LOC80125
-29-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
CCDC49 NM017748 hypothetical protein LOC54883
CCDC58 NM001017928 hypothetical protein LOC 131076
CCDC68 NM_025214 CTCL tumor antigen se57-1
CCDC72 NM015933 hypothetical protein LOC51372
CCDC93 NM019044 hypothetical protein LOC54520
CCDC94 NM018074 hypothetical protein LOC55702
CCDC97 NM052848 hypothetical protein LOC90324
CCDC98 NM139076 coiled-coil domain containing 98
CCKAR NM_000730 cholecystokinin A receptor
CCL18 NM002988 small inducible cytokine A18 precursor
CCL22 NM 002990 small inducible cytokine A22 precursor
CCL4L1 NM_001001435 chemokine (C-C motif) ligand 4-like 1 precursor
CCL4L2 NM_207007 chemokine (C-C motif) ligand 4-like 2 precursor
CCL7 NM006273 chemokine (C-C motil) ligand 7 precursor
CCND1 NM053056 cyclinDl
CCND2 NM001759 cyclin D2
CCNT2 NM_001241 cyclin T2 isoform a
CCPG1 NM_004748 cell cycle progression 1 isoform 1
CCR1 NM001295 chemokine (C-C motifl receptor 1
CCR2 NM000647 chemokine (C-C motif) receptor 2 isoform A
CCR6 NM004367 chemokine (C-C motif) receptor 6
CCT5 NM012073 chaperonin containing TCP1, subunit 5(epsilon)
CD109 NM_133493 CD109
CD164L2 NM207397 CD164 sialomucin-like 2
CD22 NM_001771 CD22 antigen
CD244 NM016382 CD244 natural killer cell receptor 2B4
CD276 NM001024736 CD276 antigen isoform a
CD28 NM006139 CD28 antigen
CD300C NM006678 CD300C antigen
CD300LG NM_145273 triggering receptor expressed on myeloid cells
CD34 NM001025109 CD34 antigen isoform a
CD3D NM000732 CD3D antigen, delta polypeptide (TiT3 complex)
CD4 NM_000616 CD4 antigen precursor
CD40 NM_152854 CD40 antigen isoform 2 precursor
CD44 NM000610 CD44 antigen isoform 1 precursor
CD47 NM_001025079 CD47 molecule isoform 3 precursor
CD53 NM_000560 CD53 antigen
CD80 NM005191 CD80 antigen (CD28 antigen ligand 1, B7-1
CD82 NM_001024844 CD82 antigen isoform 2
CD84 NM_003874 CD84 antigen (leukocyte antigen)
CD8A NM_001768 CD8 antigen alpha polypeptide isoform 1
CD93 NM_012072 CD93 antigen precursor
CDAN1 NM_138477 codanin 1
CDC25A NM001789 cell division cycle 25A isoform a
CDC25B NM004358 cell division cycle 25B isoform 2
CDC42BPA NM_003607 CDC42-binding protein kinase alpha isoform B
CDC42SEI NM020239 CDC42 small effector 1
CDCA5 NM080668 cell division cycle associated 5
CDGAP NM020754 Cdc42 GTPase-activating protein
CDH1 NM_004360 cadherin 1, type 1 preproprotein
CDH17 NM004063 cadherin 17 precursor
CDH3 NM_001793 cadherin 3, type 1 preproprotein
CDH5 NM001795 cadherin 5, type 2 preproprotein
CDK2AP1 NM 004642 CDK2-associated protein 1
-30-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
CDK5R2 NM003936 cyclin-dependent kinase 5, regulatory subunit 2
CDK5RAP3 NM025197 CDK5 regulatory subunit associated protein 3
CDK6 NM_001259 cyclin-dependent kinase 6
CDKALI NM_017774 CDK5 regulatory subunit associated protein
CDON NM_016952 surface glycoprotein, Ig superfamily member
CDR2L NM014603 paraneoplastic antigen
CDRTI NM006382 CMT1A duplicated region transcript I
CDRT4 NM_173622 hypothetical protein LOC284040
CDX1 NM001804 caudal type homeo box transcription factor I
CEACAM5 NM_004363 carcinoembryonic antigen-related cell adhesion
CELSRl NM014246 oadherin EGF LAG seven-pass G-type receptor 1
CELSR2 NM001408 cadherin EGF LAG seven-pass G-type receptor 2
CELSR3 NM001407 cadherin EGF LAG seven-pass G-type receptor 3
CENTA2 NM_018404 centaurin-alpha 2 protein
CENTD 1 NM_015230 centaurin delta 1 isoform a
CENTGI NM014770 centaurin, gamma 1
CEP 135 NM025009 centrosome protein 4
CEP192 NM_018069 hypothetical protein LOC55125 isoform 2
CEP350 NM_014810 centrosome-associated protein 350
CFD NM_001928 complement factor D preproprotein
CG018 NM_052818 hypothetical protein LOC90634
CGN NM_020770 cingulin
CGNLl NM_032866 cingulin-like 1
CHD5 NM015557 chromodomain helicase DNA binding protein 5
CHD6 NM032221 chromodomain helicase DNA binding protein 6
CHKA NM001277 choline kinase alpha isoform a
CHKB NM152253 choline/ethanolamine kinase isoform b
CHML NM001821 choroideremia-like Rab escort protein 2
CHPF NM_024536 chondroitin polymerizing factor
CHRNB 1 NM000747 nicotinic acetylcholine receptor beta 1 subunit
CHRNB2 NM_000748 cholinergic receptor, nicotinic, beta
CHRNG NM005199 cholinergic receptor, nicotinic, gamma
CHST10 NM004854 HNK-1 sulfotransferase
CHST13 NM_152889 carbohydrate (chondroitin 4) sulfotransferase
CHST3 NM_004273 carbohydrate (chondroitin 6) sulfotransferase 3
CHST4 NM_005769 carbohydrate (N-acetylglucosamine 6-0)
CHURCI NM_145165 churchill domain containing 1
CIAPINI NM_020313 cytokine induced apoptosis inhibitor 1
CIASI NM004895 cryopyrin isoform a
CIDEA NM001279 cell death-inducing DFFA-like effector a isoform
CIR NM004882 CBFl interacting corepressor
CIT NM007174 citron
CITED4 NM_133467 Cbp/p300-interacting transactivator, with
CLASPI NM_015282 CLIP-associating protein 1
CLCN6 NM001286 chloride channel 6 isoform C1C-6a
CLECI2A NM_138337 myeloid inhibitory C-type lectin-like receptor
CLEC12B NM205852 macrophage antigen h
CLEC4E NM_014358 C-type lectin domain family 4, member E
CLEC4F NM_173535 C-type lectin, superfamily member 13
CLEC5A NM013252 C-type lectin, superfamily member 5
CLIC4 NM013943 chloride intracellular channel 4
CLN5 NM006493 ceroid-lipofuscinosis, neuronal 5
CLN6 NM017882 CLN6 protein
CLN8 NM 018941 CLN8 protein
-31-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
CLPS NM_001832 colipase preproprotein
CLYBL NM138280 citrate lyase beta like
CMYA5 NM_153610 cardiomyopathy associated 5
CNDP2 NM_018235 CNDP dipeptidase 2(metallopeptidase M20
CNGA2 NM005140 cyclic nucleotide gated channel alpha 2
CNGA3 NM001298 cyclic nucleotide gated channel alpha 3
CNGB1 NM001297 cyclic nucleotide gated channel beta 1
CNNM 1 NM020348 cyclin M 1
CNNM3 NM_017623 cyclin M3 isoform 1
CNOT4 NM013316 CCR4-NOT transcription complex, subunit 4
CNP NM_033133 2',3'-cyclic nucleotide 3' phosphodiesterase
CNTD1 NM 173478 hypothetical protein LOC124817
CNTD2 NM024877 hypothetical protein LOC79935
CNTNAP2 NM_014141 cell recognition molecule Caspr2 precursor
COG4 NM015386 component of oligomeric golgi complex 4
COG5 NM006348 component of oligomeric golgi complex 5 isoform
COL12A1 NM004370 collagen, type XII, alpha 1 long isoform
COL18A1 NM030582 alpha 1 type XVIII collagen isoform 1 precursor
COL1A1 NM_000088 alpha 1 type I collagen preproprotein
COL21A1 NM_030820 collagen, type XXI, alpha 1 precursor
COL24A1 NM_152890 collagen, type XXIV, alpha 1
COL4A4 NM_000092 alpha 4 type IV collagen precursor
COL4A5 NM000495 alpha 5 type IV collagen isoforrn 1, precursor
COL5A2 NM000393 alpha 2 type V collagen preproprotein
COL5A3 NM_015719 collagen, type V, alpha 3 preproprotein
COL9A1 NM_001851 alpha 1 type IX collagen isoform 1 precursor
COL9A2 NM001852 alpha 2 type IX collagen
COMMD2 NM_016094 COMM domain containing 2
COMMD5 NM014066 hypertension-related calcium-regulated gene
COMMD7 NM_053041 COMM domain containing 7
COPA NM_004371 coatomer protein complex, subunit alpha
COPZ1 NM_016057 coatomer protein complex, subunit zeta 1
COQ5 NM_032314 hypothetical protein LOC84274
COQ9 NM_020312 hypothetical protein LOC57017
CORIN NM006587 corin
COROIB NM_001018070 coronin, actin binding protein, 1B
CORO2B NM006091 coronin, actin binding protein, 2B
COTL1 NM021149 coactosin-like 1
COVA1 NM006375 cytosolic ovarian carcinoma antigen I isoform a
COX4NB NM_006067 neighbor of COX4
COX7A2L NM004718 cytochrome c oxidase subunit VIIa polypeptide 2
CP110 NM014711 CP110 protein
CPAMD8 NM015692 C3 and PZP-like, alpha-2-macroglobulin domain
CPB2 NM001872 plasma carboxypeptidase B2 isoform a
CPD NM_001304 carboxypeptidase D precursor
CPLX2 NM_001008220 complexin 2
CPM NM_001005502 carboxypeptidase M precursor
CPNE3 NM003909 copine III
CPOX NM_000097 coproporphyrinogen oxidase
CPSF2 NM_017437 cleavage and polyadenylation specific factor 2
CPSF3L NM032179 related to CPSF subunits 68 kDa isoform 2
CRAMPIL NM_020825 Crm, cramped-like
CREB 1 NM004379 cAMP responsive element binding protein 1
CREB3L2 NM 194071 cAMP responsive element binding protein 3-like
-32-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
CREB5 NM001011666 cAMP responsive element binding protein 5
CREBL2 NM001310 cAMP responsive element binding protein-like 2
CREG2 NM153836 cellular repressor of ElA-stimulated genes 2
CRELDI NM_001031717 cysteine-rich with EGF-like domains 1 isofonn 1
CRISPLD2 NM031476 cysteine-rich secretory protein LCCL domain
CRK NM005206 v-crk sarcoma virus CTI O oncogene homolog
CRLF3 NM015986 cytokine receptor-like factor 3
CRNKLI NM016652 crooked neck-like 1 protein
CRSP2 NM_004229 cofactor required for Sp 1 transcriptional
CRSP7 NM004831 cofactor required for Sp 1 transcriptional
CRTC3 NM022769 transducer of regulated CREB protein 3
CRX NM000554 cone-rod homeobox protein
CSDC2 NM_014460 RNA-binding protein pippin
CSFl NM_172212 colony stimulating factor I isoform a precursor
CSF2RA NM006140 colony stimulating factor 2 receptor alpha chain
CSMDI NM033225 CUB and Sushi multiple domains 1
CSNKIGI NM_001011664 casein kinase 1, gamma I isoform L
CSNKIG3 NM_001031812 casein kinase 1, gamma 3 isoform 2
CSNK2A1 NM001895 casein kinase II alpha 1 subunit isoform a
CSPG3 NM004386 chondroitin sulfate proteoglycan 3 (neurocan)
CSRP3 NM_003476 cysteine and glycine-rich protein 3
CSTB NM000100 cystatin B
CTAGEI NM172241 cutaneous T-cell lymphoma-associated antigen 1
CTDSP2 NM005730 nuclear LIM interactor-interacting factor 2
CTF1 NM_001330 cardiotrophin 1
CTGF NM_001901 connective tissue growth factor
CTH NM001902 cystathionase isofornm 1
CTLA4 NM005214 cytotoxic T-lymphocyte-associated protein 4
CTNNBIPI NM001012329 catenin, beta interacting protein 1
CTNNDI NM001331 catenin (cadherin-associated protein), delta 1
CTSB NM_001908 cathepsin B preproprotein
CTSC NM_148170 cathepsin C isoform b precursor
CTSD NM001909 cathepsin D preproprotein
CTSS NM004079 cathepsin S preproprotein
CTTN NM005231 cortactin isoform a
CTXNl NM206833 cortexin 1
CUBN NM001081 cubilin
CUGBP2 NM001025076 CUG triplet repeat, RNA binding protein 2
CUL3 NM003590 cullin 3
CUL5 NM_003478 Vasopressin-activated calcium-mobilizing
CWF19L1 NM018294 CWF19-like 1, cell cycle control
CX3CL1 NM_002996 chemokine (C-X3-C motif) ligand 1
CXCL12 NM_000609 chemokine (C-X-C motif) ligand 12 (stromal
CXCL14 NM004887 small inducible cytokine B14 precursor
CXCL9 NM002416 small inducible cytokine B9 precursor
CXorf2l NM025159 hypothetical protein LOC80231
CXorf23 NM198279 hypothetical protein LOC256643
CXorf34 NM024917 hypothetical protein LOC79979
CXorf38 NM144970 hypothetical protein LOC159013
CXorf53 NM001018055 BRCAIBRCA2-containing complex subunit 36
CXXC5 NM016463 CXXC finger 5
CXXC6 NM030625 CXXC finger 6
CYB561D1 NM182580 cytochrome b-561 domain containing 1
CYB5B NM 030579 cytochrome b5 outer mitochondrial membrane
-33-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
CYB5D1 NM 144607 hypothetical protein LOC124637
CYBRDI NM024843 cytochrome b reductase 1
CYCS NM018947 cytochrome c
CYFIP2 NM_014376 cytoplasmic FMR1 interacting protein 2
CYLC2 NM001340 cylicin 2
CYLD NM015247 ubiquitin carboxyl-terminal hydrolase CYLD
CYLN2 NM003388 cytoplasmic linker 2 isoform 1
CYP11B1 NM_000497 cytochrome P450, family 11, subfamily B,
CYP11B2 NM000498 cytochrome P450, subfamily XIB polypeptide 2
CYP1A2 NM000761 cytochrome P450, family 1, subfamily A,
CYP26B 1 NM_019885 cytochrome P450, family 26, subfamily b,
CYP2B6 NM000767 cytochrome P450, family 2, subfamily B,
CYP2C9 NM000771 cytochrome P450, family 2, subfamily C,
CYP8B1 NM004391 cytochrome P450, family 8, subfamily B,
D2HGDH NM152783 D-2-hydroxyglutarate dehydrogenase
DAB2 NM_001343 disabled homolog 2
DAPKI NM004938 death-associated protein kinase 1
DAPK2 NM_014326 death-associated protein kinase 2
DBF4 NM006716 activator of S phase kinase
DBT NM_001918 dihydrolipoamide branched chain transacylase
DCAKD NM_024819 dephospho-CoA kinase domain containing
DCAMKLI NM004734 doublecortin and CaM kinase-like 1
DCLREIC NM001033855 artemis protein isoform a
DCST2 NM144622 hypothetical protein LOC127579
DCTD NM001012732 dCMP deaminase isofonn a
DCTN4 NM016221 dynactin 4 (p62)
DCTN5 NM032486 dynactin 4
DCX NM000555 doublecortin isofonn a
DDAH1 NM_012137 dimethylarginine dimethylaminohydrolase I
DDEFLI NM_017707 development and differentiation enhancing
DDI I NM001001711 hypothetical protein LOC414301
DDI2 NM_032341 DNA-damage inducible protein 2
DDIT4L NM145244 DNA-damage-inducible transcript 4-like
DDRl NM_001954 discoidin domain receptor family, member I
DDXi l NM004399 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide I 1
DDX17 NM006386 DEAD box polypeptide 17 isoform p82
DDX23 NM_004818 DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
DEDD2 NM133328 death effector domain-containing DNA binding
DEFA3 NM_005217 defensin, alpha 3 preproprotein
DEFA6 NM001926 defensin, alpha 6 preproprotein
DEGS1 NM_003676 degenerative spennatocyte homolog 1, lipid
DENNDIC NM_024898 hypothetical protein LOC79958
DENND2C NM_198459 DENN/MADD domain containing 2C
DERA NM015954 2-deoxyribose-5-phosphate aldolase homolog
DERL3 NM001002862 derlin-3 protein isoform b
DFFA NM213566 DNA fragmentation factor, 45kDa, alpha
DFFB NM_001004285 DNA fragmentation factor, 40 kD, beta
DGKB NM_004080 diacylglycerol kinase, beta isoform 1
DGKQ NM_001347 diacylglycerol kinase, theta
DHCR24 NM_014762 24-dehydrocholesterol reductase precursor
DHDDS NM024887 dehydrodolichyl diphosphate synthase isoform a
DHFR NM_000791 dihydrofolate reductase
DHRS7B NM_015510 hypothetical protein LOC25979
DHRS9 NM 005771 NADP-dependent retinol dehydrogenase/reductase
-34-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
DHTKDI NM_018706 dehydrogenase E1 and transketolase domain
DHX30 NM138614 DEAH (Asp-Glu-Ala-His) box polypeptide 30
DHX37 NM032656 DEAH (Asp-Glu-Ala-His) box polypeptide 37
DIAPHI NM005219 diaphanous 1
DIDO1 NM033081 death inducer-obliterator I isoform c
DIP13B NM018171 DIP13 beta
DIP2B NM_173602 hypothetical protein LOC57609
DIP2C NM014974 hypothetical protein LOC22982
DIRASI NM_145173 small GTP-binding tumor suppressor 1
DIRAS2 NM017594 Di-Ras2
DIRC 1 NM_052952 hypothetical protein LOC 116093
DISC1 N001012957 disrupted in schizophrenia 1 isoform Lv
DIXDC 1 NM033425 DIX domain containing 1 isoform b
DJ12208.2 NM020466 hypothetical protein LOC57226
DKFZP434B0335 NM015395 hypothetical protein LOC25851
DKFZp434I1020 NM_194295 hypothetical protein LOC196968
DKFZp547H025 NM020161 hypothetical protein LOC56918
DKFZp564K142 NM_032121 implantation-associated protein
DKFZp686K16132 NM_001012987 hypothetical protein LOC388957
DKFZp686O24166 NM_001009913 hypothetical protein LOC374383
DKFZp761B107 NM_I73463 hypothetical protein LOC91050
DKFZp761E198 NM_138368 hypothetical protein LOC91056
DKFZp779B 1540 NM_001010903 hypothetical protein LOC389384
DLC I NM006094 deleted in liver cancer 1 isoform 2
DLEC 1 NM_007335 deleted in lung and esophageal cancer 1 isoform
DLG3 NM_021120 synapse-associated protein 102
DLGAP2 NM_004745 discs large-associated protein 2
DLX1 NM178120 distal-less homeobox 1 isoform I
DMBXl NM_147192 diencephalon/mesencephalon homeobox I isoform b
DMTF1 NM021145 cyclin D binding myb-like transcription factor
DNAH11 NM_003777 dynein, axonemal, heavy potypeptide 11
DNAJA4 NM_018602 DnaJ (Hsp40) homolog, subfamily A, member 4
DNAJC 11 NM018198 DnaJ (Hsp4O) homolog, subfamily C, member 11
DNAJC 14 NM_032364 dopamine receptor interacting protein
DNAJC18 NM152686 DnaJ (Hsp40) homolog, subfamily C, member 18
DNAIA NM005740 dynein light chain 4, axonemal
DNASEILI NM001009932 deoxyribonuclease I-like 1 precursor
DNASE2 NM001375 deoxyribonuclease II, lysosomal precursor
DNMT3A NM_022552 DNA cytosine methyltransferase 3 alpha isoform
DOC2B NM_003585 double C2-like domains, beta
DOCKl NM001380 dedicator of cytokinesis 1
DOCK2 NM004946 dedicator of cytokinesis 2
DOCK3 NM004947 dedicator of cytokinesis 3
DOCK9 NM015296 dedicator of cytokinesis 9
DPCRl NM_080870 diffuse panbronchiolitis critical region 1
DPF3 NM012074 D4, zinc and double PHD fingers, family 3
DPY19L2 NM_173812 hypothetical protein LOC283417
DPYSL3 NM001387 dihydropyrimidinase-like 3
DQX1 NM_133637 DEAQ box polypeptide 1(RNA-dependent ATPase)
DSCAM NM206887 Down syndrome cell adhesion molecule isoform
DTNA NM_001390 dystrobrevin alpha isoform 1
DTNB NM021907 dystrobrevin, beta isoform 1
DTWD2 NM173666 DTW domain containing 2
DTX1 NM 004416 dettex homolog 1
-35-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
DTX3L NM138287 deltex 3-like
DUSP 13 NM001007271 muscle-restricted dual specificity phosphatase
DUSP4 NM001394 dual specificity phosphatase 4 isoform 1
DUT NM_001025248 dUTP pyrophosphatase isoform 1 precursor
DUX1 NM_012146 double homeobox, 1
DUXA NM001012729 hypothetical protein LOC503835
DVL3 NM004423 dishevelled 3
DYNC2LI1 N1VI016008 dynein 2 light intermediate chain isoform 1
DYRKIB NM_004714 dual-specificity tyrosine-(Y)-phosphorylation
DZIP1 NM_014934 DAZ interacting protein 1 isoform 1
E2F2 NM004091 E2F transcription factor 2
E2F3 NM001949 E2F transcription factor 3
EAF1 NM033083 ELL associated factor 1
EARS2 NM133451 hypothetical protein LOC124454
EBI3 NM005755 Epstein-Barr virus induced gene 3 precursor
ECM2 NM001393 extracellular matrix protein 2 precursor
ECOP NM030796 EGFR-coamplified and overexpressed protein
EDA2R NM021783 X-linked ectodysplasin receptor
EDARADD NM080738 EDAR-associated death domain isoform B
EDEM 1 NM_014674 ER degradation enhancer, mannosidase alpha-like
EDG4 NM004720 endothelial differentiation, lysophosphatidic
EDN3 NM000114 endothelin 3 isoform 1 preproprotein
EEF2K NM_013302 elongation factor-2 kinase
EFCAB5 NM_001033562 EF-hand calcium binding domain 5 isoform 2
EFEMPI NM_004105 EGF-containing fibulin-like extracellular matrix
EFNAI NM_004428 ephrin Al isoform a precursor
EFNA3 NM004952 ephrin A3
EFNB3 NM_001406 ephrin-B3 precursor
EFS NM005864 embryonal Fyn-associated substrate isoform 1
EGFR NM201284 epidermal growth factor receptor isoform d
EGLN1 NM022051 egl nine homolog 1
EGRl NM_001964 early growth response 1
EHD2 NM_014601 EH-domain containing 2
EIF2AK2 NM_002759 eukaryotic translation initiation factor 2-alpha
EIF2AK3 NM_004836 eukaryotic translation initiation factor 2-alpha
EIF2AK4 NM001013703 eukaryotic translation initiation factor 2 alpha
EIF2C1 NM_012199 eukaryotic translation initiation factor 2C, 1
EIF4EBP2 NM004096 eukaryotic translation initiation factor 4E
EIF4ENIF1 NM_019843 eukaryotic translation initiation factor 4E
EIF5 NM001969 eukaryotic translation initiation factor 5
ELAC1 NM_018696 elaC homolog 1
ELF4 NM001421 E74-like factor 4(ets domain transcription
ELF5 NM001422 E74-like factor 5 ESE-2b
ELKI NM005229 ELKI protein
ELK4 NM021795 ELK4 protein isoform b
ELMO1 NM_014800 engulfment and cell motility 1 isoform 1
ELMO2 NM_133171 engulfment and cell motility 2
ELMODI NM_018712 ELMO domain containing 1
ELOF1 NM032377 elongation factor 1 homolog (ELF1, S.
ELOVL5 NM_021814 homolog of yeast long chain polyunsaturated
ELOVL6 NM_024090 ELOVL family member 6, elongation of long chain
EMEl NM_152463 essential meiotic endonuclease 1 homolog I
EMID1 NM_133455 EMI domain containing 1
EMP I NM 001423 epithelial membrane protein 1
-36-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
EMR2 NM013447 egf-like module containing, mucin-like, hormone
ENAH NM001008493 enabled homolog isoform a
ENAM NM031889 enamelin
ENOl NM_001428 enolase 1
ENPP1 NM006208 ectonucleotide pyrophosphatase/phosphodiesterase
ENPP5 NM_021572 ectonucleotide pyrophosphatase/phosphodiesterase
ENPP6 NM153343 ectonucleotide pyrophosphatase/phosphodiesterase
ENSA NM207043 endosulfine alpha isoform 2
ENTPD3 NM001248 ectonucleoside triphosphate diphosphohydrolase
EP400 NM015409 E1A binding protein p400
EPB41 NM004437 erythrocyte membrane protein band 4.1
EPB41 L5 NM020909 erythrocyte membrane protein band 4.1 like 5
EPHA2 NM_004431 ephrin receptor EphA2
EPHA3 NM_005233 ephrin receptor EphA3 isoform a precursor
EPHB4 NM_004444 ephrin receptor EphB4 precursor
EPM2AIP1 NM014805 EPM2A interacting protein 1
EPO NM000799 erythropoietin precursor
ERBB3 NM001982 erbB-3 isoform 1 precursor
ERGICI NM_020462 endoplasmic reticulum-golgi intermediate
ESAM NM138961 endothelial cell adhesion molecule
ESRRG NM001438 estrogen-related receptor gamma isoform 1
ET NM_024311 hypothetical protein LOC79157
ETV 1 NM_004956 ets variant gene 1
ETV3 NM_005240 ets variant gene 3
ETV6 NM001987 ets variant gene 6
EVC NM 153717 Ellis van Creveld syndrome protein
EXOC2 NM018303 Sec5 protein
EXOC4 NM021807 SEC8 protein isoform a
EXTL3 NM_001440 Reg receptor
EYA2 NM_005244 eyes absent 2 isoform a
EZH 1 NM001991 enhancer of zeste homolog 1
F11R NM_016946 F11 receptor isoform a precursor
F13A1 NM_000129 coagulation factor XIII Al subunit precursor
F2R NM_001992 coagulation factor II receptor precursor
F2RLI NM005242 coagulation factor II (thrombin) receptor-like 1
F2RL3 NM_003950 coagulation factor II (thrombin) receptor-like 3
FADS2 NM004265 fatty acid desaturase 2
FADS6 NM_178128 fatty acid desaturase domain family, member 6
FAIM2 NM_012306 Fas apoptotic inhibitory molecule 2
FAM100B NM_182565 hypothetical protein LOC283991
FAM102A NM203305 early estrogen-induced gene 1 protein isoform b
FAM102B NM001010883 hypothetical protein LOC284611
FAM104A NM032837 hypothetical protein LOC84923
FAM106A NM_024974 hypothetical protein LOC80039
FAM 107A NM_007177 downregulated in renal cell carcinoma
FAM107B NM_031453 hypothetical protein LOC83641
FAM111A NM_022074 hypothetical protein LOC63901
FAM117A NM_030802 C/EBP-induced protein
FAM11A NM_032508 family with sequence similarity 11, member A
FAM19A1 NM_213609 family with sequence similarity 19 (chemokine
FAM20B NM_014864 family with sequence similarity 20, member B
FAM36A NM198076 family with sequence similarity 36, member A
FAM3B NM_058186 family with sequence similarity 3, member B
FAM40A NM 033088 hypothetical protein LOC85369
-37-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
FAM43A NM_153690 hypothetical protein LOC131583
FAM53B NM014661 hypothetical protein LOC9679
FAM55C NM_145037 hypothetical protein LOC91775
FAM5B NM_021165 BMP/retinoic acid-inducible neural-specific
FAM60A NM_021238 family with sequence similarity 60, member A
FAM62C NM031913 family with sequence similarity 62 (C2 domain
FAM71C NM_153364 hypothetical protein LOC 196472
FAM81A NM152450 hypothetical protein LOC145773
FAM83E NM017708 hypothetical protein LOC54854
FAM83F NM138435 hypothetical protein LOC113828
FAM83H NM_198488 hypothetical protein LOC286077
FAM89B NM152832 Mouse Mammary Turmor Virus Receptor homolog 1
FAM98B NM_173611 hypothetical protein LOC283742
FANCC NM000136 Fanconi anemia, complementation group C
FANCD2 NM_033084 Fanconi anemia complementation group D2 isoform
FATEl NM033085 fetal and adult testis expressed transcript
FBSI NM022452 fibrosin I
FBXL11 NM012308 F-box and leucine-rich repeat protein I 1
FBXO16 NM_172366 F-box only protein 16
FBXO21 NM015002 F-box only protein 21 isoform 2
FBXO27 NM178820 F-box protein 27
FBXO31 NM024735 F-box protein 31
FBXO34 NM_017943 F-box only protein 34
FBXO44 NM001014765 F-box protein 44 isoform 1
FBX09 NM012347 F-box only protein 9 isoform 1
FBXW 1 I NM012300 F-box and WD-40 domain protein 1B isoform C
FBXW8 NM01,2174 F-box and WD-40 domain protein 8 isoform 2
FCER2 NM002002 Fc fragment of IgE, low affinity TI, receptor
FCGR3A NM_000569 Fe fragment of IgG, low affinity IIIa, receptor
FCGR3B NM000570 low affinity immunoglobulin gamma Fc region
FCHSDI NM_033449 FCH and double SH3 domains 1
FCMD NM006731 fukutin
FEMIC NM020177 feminization 1 homolog a
FGA NM021871 fibrinogen, alpha polypeptide isoform alpha
FGD6 NM018351 FYVE, RhoGEF and PH domain containing 6
FGFI NM000800 fibroblast growth factor 1(acidic) isoform 1
FGF19 NM005117 fibroblast growth factor 19 precursor
FGFR1 NM023107 fibroblast growth factor receptor I isoform 5
FHIT NM_002012 fragile histidine triad gene
FIS NM175616 hypothetical protein LOC202299
FKBP 10 NM021939 FK506 binding protein 10, 65 kDa
FKBPIA NM000801 FK506-binding protein IA
FKBP5 NM_004117 FK506 binding protein 5
FKBP9 NM_007270 FK506 binding protein 9
FKBP9L NM_182827 FK506 binding protein 9-like
FKRP NM024301 fukutin-related protein
FKSG44 NM_031904 FKSG44 protein
FLJ10159 NM018013 hypothetical protein LOC55084
FLJ10324 NM_018059 hypothetical protein LOC55698
FLJ10357 NM_018071 hypothetical protein LOC55701
FLJ10490 NM_018111 hypothetical protein LOC55150
FLJ10803 NM_018224 hypothetical protein LOC55744
FLJ10815 NM018231 amino acid transporter
FLJ11021 NM 023012 hypothetical protein LOC65117 isofonn a
-38-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
FLJ 11151 NM_018340 hypothetical protein LOC55313
FLJ11171 NM018348 hypothetical protein LOC55783
FLJ11259 NM_018370 hypothetical protein LOC55332
FLJ11292 NM_018382 hypothetical protein LOC55338
FLJ11806 NM024824 nuclear protein UKp68 isoform 1
FLJ12505 NM_024749 hypothetical protein LOC79805
FLJ12681 NM_022773 hypothetical protein LOC64788
FLJ12700 NM024910 hypothetical protein LOC79970
FLJ12949 NM_023008 hypothetical protein LOC65095 isoform 1
FLJ13197 NM_024614 hypothetical protein LOC79667
FLJ14001 NM024677 hypothetical protein LOC79730
FLJ14213 NM_024841 hypothetical protein LOC79899
FLJ14397 NM_032779 hypothetical protein LOC84865
FLJ14816 NM_032845 hypothetical protein LOC84931
FLJ14834 NM_032849 hypothetical protein LOC84935
FLJ20032 NM_017628 hypothetical protein LOC54790
FLJ20035 NM017631 hypothetical protein LOC55601
FLJ20160 NM017694 hypothetical protein LOC54842
FLJ20186 N207514 differentially expressed in FDCP 8 isoform 1
FLJ20297 NM_017751 hypothetical protein LOC55627 isoform I
FLJ20581 NM_017888 hypothetical protein LOC54988
FLJ20582 NM014106 hypothetical protein LOC54989
FLJ20628 NM017910 hypothetical protein LOC55006
FLJ20701 NM017933 hypothetical protein LOC55022
FLJ20758 NM_017952 hypothetical protein LOC55037
FLJ20972 NM_025030 hypothetical protein LOC80098
FLJ21865 NM_022759 endo-beta-N-acetylglucosaminidase
FLJ21963 NM024560 hypothetical protein LOC7961 I
FLJ22795 NM_025084 hypothetical protein LOC80154
FLJ23322 NM_024955 hypothetical protein LOC80020
FLJ23834 NM_152750 hypothetical protein LOC222256
FLJ25996 NM_001001699 hypothetical protein LOC401109
FLJ26175 NM_001001668 hypothetical protein LOC388566
FLJ27365 NM_207477 hypothetical protein LOC400931
FLJ31222 NM207388 hypothetical protein LOC388387
FLJ31568 NM_152509 hypothetical protein LOC150244
FLJ31875 NM_182531 hypothetical protein LOC197320
FLJ32011 NM182516 hypothetical protein LOC148930
FLJ32130 NM152458 hypothetical protein LOC146540
FLJ32312 NM_ 144709 hypothetical protein LOC 150962
FLJ32447 NM_153038 hypothetical protein LOC151278
FLJ32569 NM_152491 hypothetical protein LOC148811
FLJ32894 NM_144667 hypothetical protein LOC144360
FLJ32926 NM144577 hypothetical protein LOC93233
FLJ32955 NM_153041 hypothetical protein LOC 150596
FLJ33387 NM_182526 hypothetical protein LOC161145
FLJ33860 NM_173644 hypothetical protein LOC284756
FLJ34931 NM001029883 hypothetical protein LOC388939
FLJ35409 NM001001688 hypothetical protein LOC400765
FLJ35429 NM001003807 hypothetical protein LOC285830
FLJ35740 NM 147195 FLJ35740 protein
FLJ35773 NM_152599 hypothetical protein LOC162387
FLJ35880 NM_153264 hypothetical protein LOC256076
FLJ36268 NM 207511 hypothetical protein LOC401563
-39-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
FLJ36492 NM_182568 hypothetical protein LOC284047
FLJ36874 NM_152716 hypothetical protein LOC219988
FLJ37927 NM_152623 hypothetical protein LOC166979
FLJ38288 NM_173632 hypothetical protein LOC284309
FLJ38663 NM152269 hypothetical protein LOC91574
FLJ38973 NM_153689 hypothetical protein LOC205327
FLJ38991 NM001033760 mitochondrial COX18 isoform 5
FLJ39370 NM_152400 hypothetical protein LOC 132720
FLJ39531 NM_207445 hypothetical protein LOC400360
FLJ39743 NM182562 hypothetical protein LOC283777
FLJ40142 NM_207435 hypothetical protein LOC400073
FLJ40852 NM_173677 hypothetical protein LOC285962
FLJ41423 NM_001001679 hypothetical protein LOC399886
FLJ41733 NM_207473 hypothetical protein LOC400870
FLJ41841 NM_207499 hypothetical protein LOC401263
FLJ41993 NM_001001694 hypothetical protein LOC400935
FLJ42102 NM_001001680 hypothetical protein LOC399923
FLJ42418 NM_0o1001695 hypothetical protein LOC400941
FLJ42953 NM207474 hypothetical protein LOC400892
FLJ43339 NM207380 hypothetical protein LOC388115
FLJ43505 NM_207468 hypothetical protein LOC400823
FLJ43582 NM_207412 hypothetical protein LOC389649
FLJ43879 NM_001001698 hypothetical protein LOC401039
FLJ43980 NM001004299 hypothetical protein LOC124149
FLJ44691 NM198506 hypothetical protein LOC345193
FLJ45079 NM_001001685 hypothetical protein LOC400624
FLJ45121 NM_207451 hypothetical protein LOC400556
FLJ45139 NM_001001692 hypothetical protein LOC400867
FLJ45202 NM_207507 hypothetical protein LOC401508
FLJ45422 NM_001004349 hypothetical protein LOC441140
FLJ45645 NM_198557 hypothetical protein LOC375287
FLJ45684 NM207462 hypothetical protein LOC400666
FLJ45831 NM_001001684 hypothetical protein LOC400576
FLJ45850 NM_207395 hypothetical protein LOC388569
FLJ45909 NM_198445 hypothetical protein LOC126432
FLJ45910 NM_207390 hypothetical protein LOC388512
FLJ45964 NM_207483 hypothetical protein LOC401040
FLJ46010 NM 001001703 hypothetical protein LOC401191
FLJ46026 NM_207458 hypothetical protein LOC400627
FLJ46154 NM_198462 FLJ46154 protein
FLJ46230 NM_207463 hypothetical protein LOC400679
FLJ46257 NM_001001693 hypothetical protein LOC400932
FLJ46266 NM 207430 hypothetical protein LOC399949
FLJ46347 NM_001005303 hypothetical protein LOC389064
FLJ46363 NM_207434 hypothetical protein LOC400002
FLJ46365 NM_207504 hypothetical protein LOC401459
FLJ46481 NM_207405 hypothetical protein LOC389197
FLJ46688 NM_001004330 hypothetical protein LOC440107
FLJ46831 NM207426 forkhead box 12
FLJ46838 NM_001007546 hypothetical protein LOC440865
FLJ90757 NM_001004336 hypothetical protein LOC440465
FLOT1 NM005803 flotillin 1
FLOT2 NM004475 flotillin 2
FLTI NM 002019 fins-related tyrosine kinase 1 (vascular
-40-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
FLT4 NM182925 fms-related tyrosine kinase 4 isoform 1
FLYWCHI NM032296 FLYWCH-type zinc finger 1 isofonn a
FMNL3 NM175736 formin-like 3 isoform 1
FM04 NM002022 flavin containing monooxygenase 4
FMOD NM002023 fibromodulin precursor
FNl NM002026 fibronectin 1 isoform 3 preproprotein
FNDC1 NM_032532 fibronectin type III domain containing 1
FNDC5 NM153756 fibronectin type III domain containing 5
FNDC8 NM017559 hypothetical protein LOC54752
FNTB NM002028 farnesyltransferase, CAAX box, beta
FOSB NM_006732 FBJ murine osteosarcoma viral oncogene homolog
FOSL2 NM_005253 FOS-like antigen 2
FOXJ2 NM018416 forkhead box J2
FOXJ3 NM014947 forkhead box J3
FOXK2 NM181430 forkhead box K2 isoform 2
FOXOIA NM002015 forkhead box OlA
FOXP1 NM032682 forkhead box Pl isoform I
FRMD1 NM024919 FERM domain containing 1
FRMPD2 NM_001017929 FERM and PDZ domain containing 2 isoform 2
FSCN1 NM003088 fascin 1
FSD1L NM_207647 fibronectin type III and SPRY domain containing
FST NM006350 follistatin isoform FST317 precursor
FSTL4 NM015082 follistatin-like 4
FTSJ1 NM012280 FtsJ homolog 1 isoform a
FUNDC2 NM023934 FUN 14 domain containing 2
FUSIP 1 NM006625 FUS interacting protein (serine-arginine rich) 1
FUT2 NM000511 fucosyltransferase 2 (secretor status included)
FUT4 NM002033 fucosyltransferase 4
FUT6 NM000150 fucosyltransferase 6 (alpha (1,3)
FXYD3 NM005971 FXYD domain containing ion transport regulator 3
FYCO1 NM024513 FYVE and coiled-coil domain containing 1
FZDI NM003505 frizzled 1
GAB2 NM_012296 GRB2-associated binding protein 2 isoform b
GABARAPLI NM031412 GABA(A) receptor-associated protein like 1
GABBR1 NM001470 gamma-aminobutyric acid (GABA) B receptor 1
GABRA4 NM000809 gamma-aminobutyric acid A receptor, alpha 4
GABRB3 NM000814 gamma-aminobutyric acid (GABA) A receptor, beta
GABRE NM004961 gamma-aminobutyric acid (GABA) A receptor,
GABRG1 NM_173536 gamma-aminobutyric acid A receptor, gamma I
GABRG2 NM000816 gamma-aminobutyric acid A receptor, ganuna 2
GABRR2 NM002043 gamma-aminobutyric acid (GABA) receptor, rho 2
GALC NM_000153 galactosylceramidase isoform a precursor
GALM NM_138801 galactose mutarotase (aldose 1-epimerase)
GALNT13 NM_052917 UDP-N-acetyl-alpha-D-galactosamine:polypeptide
GALNT3 NM_004482 polypeptide N-acetylgalactosaminyltransferase 3
GALNT6 NM007210 polypeptide N-acetylgalactosaminyltransferase 6
GALNTL2 NM_054110 UDP-N-acetyl-alpha-D-galactosamine:polypeptide
GALT NM000155 galactose-l-phosphate uridylyltransferase
GAPVDI NM015635 GTPase activating protein and VPS9 domains 1
GARNLI NM014990 GTPase activating Rap/RanGAP domain-like 1
GARNL4 NM_015085 GTPase activating Rap/RanGAP domain-like 4
GAS2L1 NM_152237 growth arrest-specific 2 like 1 isoform b
GAS7 NM_003644 growth arrest-specific 7 isoform a
GATA4 NM 002052 GATA binding protein 4
-41-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
GATAD 1 NM_021167 GATA zinc finger domain containing 1
GATM NM_001482 glycine amidinotransferase (L-arginine:glycine
GATS NM178831 opposite strand transcription unit to STAG3
GCLM NM002061 glutamate-cysteine ligase regulatory protein
GCM 1 NM_003643 glial cells missing homolog a
GCNT1 NM001490 beta-l,3-galactosyl-O-glycosyl-glycoprotein
GCNT2 NM001491 glucosaminyl (N-acetyl) transferase 2,
Gcoml NM001018097 GRINLIA combined protein isoform 8
GDAP2 NM_017686 ganglioside induced differentiation associated
GDF10 NM_004962 growth differentiation factor 10 precursor
GDF6 NM_001001557 growth differentiation factor 6
GDPD4 NM_182833 glycerophosphodiester phosphodiesterase domain
Genesymbol hsa-miR-143 targets Gene_name
GFODI NM_018988 glucose-fructose oxidoreductase domain
GFOD2 NM_030819 hypothe6cal protein LOC81577
GFPTI NM_002056 glucosamine-fructose-6-phosphate
GFPT2 NM005110 glutamine-fiuctose-6-phosphate transaminase 2
GGA2 NM015044 ADP-ribosylation factor binding protein 2
GGT6 NM 153338 gamma-glutamyltransferase 6 homolog
GGTL3 NM178025 gamma-glutamyltransferase-like 3 isoform b
GHR NM_000163 growth hormone receptor precursor
GIF NM_005142 gastric intrinsic factor (vitamin B synthesis)
GIMAP6 NM_001007224 GTPase, IMAP family member 6 isoform 3
GIT2 NM_014776 G protein-coupled receptor kinase-interactor 2
GJC1 NM_152219 gap junctionprotein, chi 1, 31.9kDa (connexin
GLB1L NM024506 galactosidase, beta 1-like
GLDC NM_000170 glycine dehydrogenase (decarboxylating; glycine
GLI3 NM_000168 GLI-Kruppel family member GLI3
GLP 1R NM_002062 glucagon-like peptide 1 receptor
GLT25D2 NM_015101 glycosyltransferase 25 domain containing 2
GLYATL2 NM_145016 hypothetical protein LOC219970
GMEB2 NM_012384 glucocorticoid modulatory element binding
GMFB NM_004124 glia maturation factor, beta
GNA15 NM_002068 guanine nucleotide binding protein (G protein),
GNAI1 NM_002069 guanine nucleotide binding protein (G protein),
GNAL NM_002071 guanine nucleotide binding protein (G protein),
GNAS NM_016592 guanine nucleotide binding protein, alpha
GNB3 NM_002075 guanine nucleotide-binding protein, beta-3
GNB4 NM_021629 guanine nucleotide-binding protein, beta-4
GNB5 NM006578 guanine nucleotide-binding protein, beta-5
GNG12 NM_018841 G-protein gamma-12 subunit
GNG4 NM_004485 guanine nucleotide binding protein (G protein),
GNG7 NM052847 guanine nucleotide binding protein (G protein),
GNL3 NM_014366 guanine nucleotide binding protein-like 3
GNPNATI NM_198066 glucosamine-phosphate N-acetyltransferase 1
GNS NIvi_002076 glucosamine (N-acetyl)-6-sulfatase precursor
GOLGA NM_018652 golgin-like protein
GOLGAI NM_002077 golgin 97
GOLGA4 NM_002078 golgi autoantigen, golgin subfamily a, 4
GOLPH2 NM016548 golgi phosphoprotein 2
GORASP I NM_031899 Golgi reassembly stacking protein 1
GOSR1 NM001007024 golgi SNAP receptor complex member 1 isoform 3
GOT1 NM002079 aspartate aminotransferase 1
GOT2 NM 002080 aspartate aminotransferase 2 precursor
-42-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
GP5 NM004488 glycoprotein V (platelet)
GP6 NM_016363 glycoprotein VI (platelet)
GPA33 NM_005814 transmembrane glycoprotein A33 precursor
GPCI NM_002081 glypican 1 precursor
GPC2 NM 152742 glypican 2
GPIAPI NM005898 membrane component chromosome 11 surface marker
GPR109A NM_177551 G protein-coupled receptor 109A
GPR109B NM_006018 G protein-coupled receptor 109B
GPR135 NM022571 G protein-coupled receptor 135
GPR176 NM007223 putative G protein coupled receptor
GPR180 NM_180989 G protein-coupled receptor 180 precursor
GPR26 NM_153442 G protein-coupled receptor 26
GPR62 NM080865 G protein-coupled receptor 62
GPR83 NM016540 G protein-coupled receptor 83
GPRC5A NM003979 G protein-coupled receptor, family C, group 5,
GPRC5B NM016235 G protein-coupled receptor, family C, group 5,
GPSM3 NM_022107 G-protein signalling modulator 3 (AGS3-like, C.
GPX3 NM002084 plasma glutathione peroxidase 3 precursor
GRAMDIA NM020895 hypothetical protein LOC57655
GRAMD2 NM_001012642 hypothetical protein LOC 196996
GRHL2 NM024915 transcription factor CP2-like 3
GRIA2 NM000826 glutamate receptor, ionotropic, AMPA 2
GRIN2B NM000834 N-methyl-D-aspartate receptor subunit 2B
GRINLIA NM001018103 glutamate receptor, ionotropic, N-methyl
GRIPAP1 NM020137 GRIP1 associated protein I isoform I
GRK1 NM_002929 rhodopsin kinase
GSDMDCI NM024736 gasdermin domain containing 1
GSTA4 NM001512 glutathione S-transferase A4
GSTM4 NM_147149 glutathione S-transferase M4 isoform 3
GTF2I NM001518 general transcription factor II, i isoform 4
GTPBP1 NM004286 GTP binding protein 1
GTPBP3 NM032620 GTP binding protein 3 (mitochondrial) isoform V
GUSBL2 NM_206910 hypothetical protein LOC375513 isofonn 2
H2AFY2 NM018649 core histone macroH2A2.2
H2BFWT NM001002916 H2B histone family, member W, testis-specific
H6PD NM004285 hexose-6-phosphate dehydrogenase precursor
HABP2 NM004132 hyaluronan binding protein 2
HAGHL NM_207112 hydroxyacylglutathione hydrolase-like isoform 1
HAPLN4 NM023002 brain link protein 2
HAS3 NM005329 hyaluronan synthase 3 isoform a
HBSIL NM006620 HBS1-like
hCAP-H2 NM152299 kleisin beta isoform 2
HCCS NM_005333 holocytochrome c synthase (cytochrome c
HCG9 NM005844 hypothetical protein LOC10255
HCP 1 NM080669 heme carrier protein 1
HDAC4 NM006037 histone deacetylase 4
HDAC7A NM015401 histone deacetylase 7A isoform a
HECA NM016217 headcase
HECTDI NM_015382 HECT domain containing 1
HECW2 NM020760 HECT, C2 and WW domain containing E3 ubiquitin
HEMK1 NM_016173 HemK methyltransferase family member 1
HES2 NM_019089 hairy and enhancer of split homolog 2
HFE NM_000410 hemochromatosis protein isoform I precursor
HGF NM 001010934 hepatocyte growth factor isoform 5 precursor
- 43 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
HGS NM_004712 hepatocyte growth factor-regulated tyrosine
HHAT NM_018194 hedgehog acyltransferase
HHLA2 NM_007072 HERV-H LTR-associating 2
HIATLI NM032558 hypothetical protein LOC84641
HIG2 NM_013332 hypoxia-inducible protein 2
HIGD2A NM_138820 HIGI domain family, member 2A
HIPI NM_005338 huntingtin interacting protein 1
91PK1 NM181358 homeadomain-interacting protein kinase 1 isoform
HISTIH4E NM_003545 H4 histone family, member 7
HK2 NM000189 hexokinase 2
HKDC1 NM_025130 hexokinase domain containing 1
HKR2 NM_181846 GLI-Kruppel family member HKR2
HLA-A NM_002116 major histocompatibility complex, class I, A
HLA-B NM_005514 major histocompatibility complex, class I, B
HLA-C NM002117 major histocompatibility complex, class I, C
HLA-DOA NM_002119 major histocompatibility complex, class II, DO
HLA-DPAI NM033554 major histocompatibility complex, class II, DP
HLA-DPBI NM_002121 major histocompatibility complex, class II, DP
HLA-DQA2 NM_020056 major histocompatibility complex, class II, DQ
HLA-DQB 1 NM_002123 major histocompatibility complex, class II, DQ
HLA-E NM_005516 major histocompatibility complex, class I, E
HLF NM_002126 hepatic leukemia factor
HMBS NM_000190 hydroxymethylbilane synthase isoform 1
HMG2L1 NM_001003681 high-mobility group protein 2-like 1 isoform b
HMGA1 NM002131 high mobility group AT-hook 1 isoform b
HMGA2 NM_001015886 high mobility group AT-hook 2 isoform c
HMGB1 NM002128 high-mobility group box 1
HMGCS2 NM_005518 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2
HMMR NM_012484 hyaluronan-mediated motility receptor isoform a
HNI NM001002033 hematological and neurological expressed 1
HNF4A NM_000457 hepatocyte nuclear factor 4 alpha isoform b
HNMT NM001024074 histamine N-methyltransferase isoform 2
HNRPAO NM_006805 heterogeneous nuclear ribonucleoprotein AO
HOXA5 NM019102 homeobox A5
HOXB 13 NM006361 homeobox B 13
HOXB9 NM024017 homeobox B9
HOXC5 NM018953 homeobox C5
HPCAIA NM_016257 hippocalcin-like protein 4
HPS5 NM007216 Hermansky-Pudlak syndrome 5 isoform b
HPSE NM006665 heparanase
HR NM_005144 hairless protein isoform a
HRB NM_004504 HIV-1 Rev binding protein
HRH4 NM021624 histamine H4 receptor
HS2ST1 NM_012262 heparan sulfate 2-0-sulfotransferase 1
HS3ST2 NM006043 heparan sulfate D-glucosaminyl
HSBP 1 NM001537 heat shock factor binding protein 1
HSD17B1 NM_000413 hydroxysteroid (17-beta) dehydrogenase 1
HSDL2 NM032303 hydroxysteroid dehydrogenase like 2
HSH2D NM_032855 hematopoietic SH2 domain containing
HSPB7 NM_014424 heat shock 27kDa protein family, member 7
HSPBPI NM_012267 hsp70-interacting protein
HSPCO65 NM_014157 hypothetical protein LOC29070
HTR2C NM000868 5-hydroxytryptamine (serotonin) receptor 2C
HTR3A NM 000869 5-hydroxytryptamine (serotonin) receptor 3A
-44-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
HTR3B NM006028 5-hydroxytryptamine (serotonin) receptor 3B
HTR4 NM000870 serotonin 5-HT4 receptor isoform b
HTR6 NM000871 5-hydroxytryptamine (serotonin) receptor 6
HTR7 NM000872 5-hydroxytryptamine receptor 7 isoform a
HUNK NM014586 hormonally upregulated Neu-associated kinase
HYOUI NM006389 oxygen regulated protein precursor
HYPK NM016400 Huntingtin interacting protein K
IAPP NM_000415 slet amyloid polypeptide precursor
BRDCI NM_152553 BR domain containing 1
CAl NM_022308 slet cell autoantigen 1 isoform 3
D4 NM_001546 inhibitor of DNA binding 4, dominant negative
ER3 NM_003897 mmediate early response 3 isoform short
FIT3 NM001031683 interferon-induced protein with
FIT5 NM012420 interferon-induced protein with
IFNA14 NM002172 interferon, alpha 14
IFNA16 NM002173 interferon, alpha 16
IFNA7 NM021057 nterferon, alpha 7
IGFI NM000618 insulin-like growth factor 1(somatomedin C)
IGF2BP 1 NM006546 insulin-like growth factor 2 mRNA binding
IGF2R NM_000876 nsulin-like growth factor 2 receptor
IGFBP3 NM_000598 nsulin-like growth factor binding protein 3
IGFBP5 NM000599 nsulin-like growth factor binding protein 5
IGFL1 NM_198541 nsulin growth factor-like family member 1
IGSF4D NM153184 mmunoglobulin superfamily, member 4D
IHPKI NM001006115 nositol hexaphosphate kinase 1 isoform 2
IHPK2 NM_001005910 nositol hexaphosphate kinase 2 isoform b
HPK3 NM_054111 nositol hexaphosphate kinase 3
L10RA NM001558 nterleukin 10 receptor, alpha precursor
L10RB NM000628 nterleukin 10 receptor, beta precursor
L11RA NM147162 nterleukin 11 receptor, alpha isoform 2
L12RB 1 NM153701 interleukin 12 receptor, beta 1 isoform 2
L12RB2 NM001559 nterleukin 12 receptor, beta 2 precursor
L13RA1 NM001560 interleukin 13 receptor, alpha I precursor
L16 NM004513 nterleukin 16 isoform 1 precursor
IL17C NM013278 interleukin 17C
L17RD NM017563 interleukin 17 receptor D
L18 NM001562 interleukin 18 proprotein
L1F5 NM012275 interleukin 1 family, member 5
LIF9 NM019618 interleukin 1 family, member 9
LIRAP NM_002182 interleukin 1 receptor accessory protein isoform
L1RL1 NM003856 interleukin 1 receptor-like 1 isoform 2
L1RN NM000577 interleukin 1 receptor antagonist isoform 3
L22RA2 NM_052962 interleukin 22-binding protein isoform 1
L27RA NM004843 class I cytokine receptor
L28RA NM170743 interleukin 28 receptor, alpha isoform 1
L2RA NM000417 nterleukin 2 receptor, alpha chain precursor
L3 NM000588 nterleukin 3 precursor
L6R NM181359 nterleukin 6 receptor isoform 2 precursor
L8RA NM_000634 nterleukin 8 receptor alpha
INCAI NM_213726 nhibitor of CDK interacting with cyclin Al
ING5 NM032329 nhibitor of growth family, member 5
INOCl NM017553 IN080 complex homolog 1
INPPSE NM_019892 nositol polyphosphate-5-phosphatase E
INSL4 NM 002195 insulin-like 4 precursor
-45-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
INTS2 NM 020748 integrator complex subunit 2
IQCC NM_018134 IQ motif containing C
IQCE NM_152558 IQ motif containing E
IRAK1 NM_001025242 interleukin-1 receptor-associated kinase 1
IRF5 NM_002200 interferon regulatory factor 5 isoform a
IRF8 NM002163 nterferon regulatory factor 8
IRX6 NM024335 roquois homeobox protein 6
ITGA11 NM_001004439 ntegrin, alpha 11 precursor
ITGA3 NM_002204 ntegrin alpha 3 isoform a precursor
ITGA5 NM_002205 ntegrin alpha 5 precursor
ITGA6 NM_000210 ntegrin alpha chain, alpha 6
ITGAM NM000632 ntegrin alpha M precursor
TGAV NM002210 ntegrin alpha-V precursor
TM2B NM_021999 ntegral membrane protein 2B
TPRl NM_002222 nositol 1,4,5-triphosphate receptor, type 1
JAGl NM_000214 agged 1 precursor
JAGNl NM032492 agunal homolog 1
JMI l NM_033626 hypothetical protein LOC90060
JMJD2B NM_015015 umonji domain containing 2B
JMJD2C NM015061 umonji domain containing 2C
JOSD1 NM014876 Josephin domain containing 1
JOSD3 NM_024116 Josephin domain containing 3
JPHl NM_020647 unctophilin 1
JPH3 NM_020655 unctophilin 3
JRK NM_003724 erky homolog
K6IRS4 NM175053 keratin 6 irs4
KA36 NM182497 type I hair keratin KA36
KAL1 NM000216 Kallmann syndrome I protein
KATNALI NM001014380 katanin p60 subunit A-like 1
KBTBD3 NM152433 BTB and kelch domain containing 3
KBTBD6 NM_152903 kelch repeat and BTB (POZ) domain-containing 6
KBTBD8 NM032505 T-cell activation kelch repeat protein
KCNA7 NM031886 potassium voltage-gated channel, shaker-related
KCNB1 NM_004975 potassium voltage-gated channel, Shab-related
KCNDl NM_004979 potassium voltage-gated channel, Shal-related
KCND2 NM_012281 potassium voltage-gated channel, Shal-related
KCND3 NM004980 potassium voltage-gated channel, Shal-related
KCNEIL NM012282 potassium voltage-gated channel, Isk-related
KCNE3 NM005472 potassium voltage-gated channel, Isk-related
KCNH5 NM172375 potassium voltage-gated channel, subfamily H,
KCNH6 NM 173092 potassium voltage-gated channel, subfamily H,
KCNH7 NM033272 potassium voltage-gated channel, subfamily H,
KCNH8 NM_144633 potassium voltage-gated channel, subfamily H,
KCNIPl NM_014592 Kv channel interacting protein 1 isoform 2
KCNIP2 NM_014591 Kv channel interacting protein 2 isoform 1
KCNJ 10 NM002241 potassium inwardly-rectifying channel, subfamily
KCNJ13 NM002242 potassium inwardly-rectifying channel J13
KCNJ4 NM_004981 potassium inwardly-rectifying channel J4
KCNJ5 NM000890 potassium inwardly-rectifying channel J5
KCNJ8 NM004982 potassium inwardly-rectifying channel J8
KCNK2 NM001017424 potassium channel, subfamily K, member 2 isoform
KCNK3 NM_002246 potassium channel, subfamily K, member 3
KCNMAl NM001014797 large conductance calcium-activated potassium
KCNS2 NM 020697 potassium voltage-gated channel,
-46-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
KCTD10 NM031954 potassium channel tetramerisation domain
KDELC2 NM153705 KDEL (Lys-Asp-Glu-Leu) containing 2
KEAP 1 NM012289 kelch-like ECH-associated protein 1
KENAE NM176816 hypothetical protein LOC202243
KIAA0125 NM_014792 hypothetical protein LOC9834
KIAA0232 NM014743 hypothetical protein LOC9778
KIAA0256 NM_014701 hypothetical protein LOC9728
KIAA0265 NM_014997 hypothetical protein LOC23008
KIAA0286 NM_015257 hypothetical protein LOC23306
KIAA0319 NM014809 KIAA0319
KIAA0319L NM024874 polycystic kidney disease 1-like isoform a
KIAA0329 NM_014844 hypothetical protein LOC9895
KIAA0350 NIvI015226 hypothetical protein LOC23274
KIAA0355 NM014686 hypothetical protein LOC9710
KIAA0427 NM014772 hypothetical protein LOC9811
KIAA0446 NM_014655 hypothetical protein LOC9673
KIAA0467 NM015284 KIAA0467 protein
KIAA0494 NM_o 14774 hypothetical protein LOC9813
K1AA0495 NM_207306 K1AA0495
KIAA0513 NM_014732 hypothetical protein LOC9764
KIAA0514 NM014696 hypothetical protein LOC9721
KIAA0523 NM015253 hypothetical protein LOC23302
KIAA0553 NM001002909 hypothetical protein LOC23131
KIAA0644 NM_014817 hypothetical protein LOC9865
KIAA0652 NM014741 hypothetical protein LOC9776
KIAA0676 NM_015043 hypothetical protein LOC23061 isoform b
KIAA0701 NM001006947 hypothetical protein LOC23074 isoform b
KIAA0703 NM014861 calcium-transporting ATPase 2C2
KIAA0738 NM_014719 hypothetical protein LOC9747
KIAA0773 NM_001031690 hypothetical protein LOC9715
KIAA0789 NM_014653 hypothetical protein LOC9671
KIAA0804 NM_001009921 hypothetical protein LOC23355 isoform a
KIAA0831 NM_014924 hypothetical protein LOC22863
KIAA0889 NM_152257 hypothetical protein LOC25781
KIAA0892 NM_015329 hypothetical protein LOC23383
KIAA1008 NM014953 KIAA1008
KIAA1012 NM_014939 hypothetical protein LOC22878
KIAA1024 NM_015206 hypothetical protein LOC23251
KIAA1128 NM_018999 granule cell antiserum positive 14
KIAA1161 NM_020702 hypothetical protein LOC57462
KIAA1166 NM_018684 hepatocellular carcinoma-associated antigen 127
KIAA1189 NM001009959 hypothetical protein LOC57471 isoform a
KIAA1267 NM_015443 hypothetical protein LOC284058
KIAA1274 NM014431 KIAA1274
KIAA1328 NM_020776 hypothetical protein LOC57536
KIAA1333 NM017769 hypothetical protein LOC55632
KIAA1446 NM020836 likely ortholog of rat brain-enriched guanylate
KIAA1456 NM020844 hypothetical protein LOC57604
KIAA1467 NM_020853 hypothetical protein LOC57613
KIAA1522 NM_020888 hypothetical protein LOC57648
KIAA1576 NM_020927 hypothetical protein LOC57687
KIAA1604 NM_020943 hypothetical protein LOC57703
KIAA1622 NM020958 HEAT-like repeat-containing protein isoform 2
KIAA1641 NM 020970 hypothetical protein LOC57730
-47-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
KIAA1706 NM030636 hypothetical protein LOC80820
KIAA1715 NM030650 Lunapark
KIAA1727 NM033393 hypothetical protein LOC85462
KIAA1729 NM053042 hypothetical protein LOC85460
KIAA1737 NM033426 KIAA1737 protein
KIAA1853 NM 194286 KIAA1853 protein
KIAA1875 NM032529 KIAA1875 protein
KIAA1909 NM052909 hypothetical protein LOC153478
KIAA1914 NM_001001936 KIAA1914 protein isoform 1
KIAA1920 NM_052919 hypothetical protein LOC114817
KIAA2022 NM001008537 hypothetical protein LOC340533
KIF1B NM_015074 kinesin family member 1B isoform b
KIF3B NM004798 kinesin family member 3B
KIF3C NM002254 kinesin family member 3C
KIF4A NM_012310 kinesin family member 4
KIF9 NM_022342 kinesin family member 9 isoform 1
KIRREL NM018240 kin of IRRE like
KLC2 NM_022822 likely ortholog of kinesin light chain 2
KLC3 NM_177417 kinesin light chain 3
KLF12 NM007249 Kruppel-like factor 12 isofonn a
KLF13 NM015995 Kruppel-like factor 13
KLF17 NM_173484 zinc fmger protein 393
KLF5 NM001730 Kruppel-like factor 5
KLHDC6 NM 207335 hypothetical protein LOC166348
KLHL20 NM014458 kelch-like 20
KLHL21 NM014851 kelch-like 21
KLHL22 NM032775 kelch-like
KLHL24 NM017644 DREl protein
KLHL25 NM022480 BTB/POZ KELCH domain protein
KLHL26 NM018316 hypothetical protein LOC55295
KLHL6 NM130446 kelch-like 6
KLHL7 NM001031710 SBBI26 protein isoform 1
KLK13 NM_015596 kallikrein 13 precursor
KLK5 NM012427 kallikrein 5 preproprotein
KLRG1 NM005810 killer cell lectin-like receptor subfamily G,
KM-HN-1 NM152775 KM-HN-1 protein
KNDC1 NM152643 kinase non-catalytic C-lobe domain (KIND)
KPNA1 NM002264 karyopherin alpha 1
KPNA6 NIv1012316 karyopherin alpha 6
KRAS NM004985 c-K-ras2 protein isoform b
KREMEN2 NM_024507 kringle-containing transmembrane protein 2
KRITl NM001013406 krev interaction trapped 1 isoform 2
KRT25A NM181534 keratin 25A
KRT2A NM 000423 keratin 2a
KRT2B NM_015848 cytokeratin 2
KRT4 NM002272 keratin 4
KRTAPl-1 NM030967 keratin associated protein 1-1
KRTAP4-14 NM033059 keratin associated protein 4-14
KRTAP4-4 NM032524 keratin associated protein 4.4
KRTAP9-2 NM_031961 keratin associated protein 9.2
KRTAP9-3 NM031962 keratin associated protein 9.3
L3MBTIA NM_173464 hypothetical protein LOC91133
LACEl NM145315 lactation elevated 1
LAMB3 NM 000228 laminin subunit beta 3 precursor
-48-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
LAMC1 NM002293 laminin, gamma 1 precursor
LANCL2 NM018697 LanC lantibiotic synthetase component C-like 2
LARP 1 NM015315 la related protein isoform 1
LARP4 NM_052879 c-Mpl binding protein isoform a
LARP5 NM_015155 La ribonucleoprotein domain family, member 5
LASP1 NM006148 LIM and SH3 protein 1
LASS3 NM_178842 hypothetical protein LOC204219
LBH NM_030915 hypothetical protein DKFZp566JO91
LCT NM_002299 lactase-phlorizin hydrolase preproprotein
LDB3 NM_007078 LIM domain binding 3
LDLR NM000527 low density lipoprotein receptor precursor
LDLRAP 1 NM015627 low density lipoprotein receptor adaptor protein
LDOCIL NM_032287 hypothetical protein LOC84247
LECT2 NM_002302 leukocyte cell-derived chemotaxin 2 precursor
LENEP NM018655 lens epithelial protein
LEREP04 NM018471 erythropoietin 4 immediate early response
LETM1 NM_012318 leucine zipper-EF-hand containing transmembrane
LGALS8 NM_006499 galectin 8 isoform a
LHFPL2 NM005779 ipoma HMGIC fusion partner-like 2
LHFPL3 NM_199000 ipoma HMGIC fusion partner-like 3
LHFPL5 NM_182548 ipoma HMGIC fusion partner-like 5
LHX3 NM014564 LIM homeobox protein 3 isoform b
LHX4 NM033343 LIM homeobox protein 4
LIAS NM_006859 ipoic acid synthetase isoform 1 precursor
LIF NM002309 eukemia inhibitory factor (cholinergic
LIFR NM002310 eukemia inhibitory factor receptor precursor
LILRB 1 NM_006669 eukocyte immunoglobulin-like receptor,
LILRB4 NM006847 eukocyte immunoglobulin-like receptor,
LIMD1 NM_014240 LIM domains containing 1
LIMD2 NM_030576 LIM domain containing 2
LIMK1 NM002314 LIM domain kinase 1
LIMK2 NM005569 LIM domain kinase 2 isoform 2a
LIMS2 NM017980 LIM and senescent cell antigen-like domains 2
LIMS3 NM_033514 LIM and senescent cell antigen-like domains 3
LIN28 NM_024674 in-28 homolog
LIN9 NM173083 lin-9 homolog
LIX1 NM153234 limb expression I
LLGL1 NM_004140 lethal giant larvae homolog 1
LMNB2 NM032737 lanun B2
LM04 NM_006769 LIM domain only 4
LMO7 NM005358 LIM domain only 7
LMOD3 NM198271 leiomodin 3 (fetal)
LOC116236 NM_198147 hypothetical protein LOC116236
LOC124491 NM_145254 hypothetical protein LOC124491
LOC129138 NM_138797 hypothetical protein LOC 129138
LOC129607 NM_207315 thymidylate kinase family LPS-inducible member
LOC 130576 NM_177964 hypothetical protein LOC 130576
LOC133619 NM_130809 hypothetical protein LOC133619
LOC144501 NM_182507 hypothetical protein LOC144501
LOC 151194 NM_ 145280 hypothetical protein LOC 151194
LOC152485 NM_178835 hypothetical protein LOC152485
LOC153561 NM 207331 hypothetical protein LOC153561
LOC158318 NM_001024608 hypothetical protein LOC158318
LOC162427 NM 178126 hypothetical protein LOC162427
-49-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
LOC196463 NM173542 h}pothetical protein LOC196463
LOC 196752 NM001010864 hypothetical protein LOC 196752
LOC197322 NM 174917 hypothetical protein LOC.197322
LOC201164 NM_178836 hypothetical protein LOC201164
LOC203427 NM_145305 mitochondrial solute carrier protein
LOC221091 NM_203422 hypothetical protein LOC221091
LOC222967 NM173565 hypothetical protein LOC222967
LOC283219 NM_001029859 hypothetical protein LOC283219
LOC283537 NM_181785 hypothetical protein LOC283537
LOC283551 NM_001012706 hypothetical protein LOC283551
LOC284296 NM_175908 hypothetical protein LOC284296
LOC284434 NM001007525 hypothetical protein LOC284434
LOC284757 NM_001004305 hypothetical protein LOC284757
LOC286076 NM_001024610 hypothetical protein LOC286076
LOC339524 NM_207357 hypothetical protein LOC339524
LOC340156 NM001012418 hypothetical protein LOC340156
LOC342897 NM001001414 similar to F-box only protein 2
LOC345222 NM001012982 hypothetical protein LOC345222
LOC348262 NM_207368 hypothetical protein LOC348262
LOC387856 NM_0o1013635 hypothetical protein LOC387856
LOC388503 NM_001013640 hypothetical protein LOC388503
LOC389118 NM001007540 hypothetical protein LOC389118
LOC389199 NM_203423 hypothetical protein LOC389199
LOC389791 NM001013652 hypothetical protein LOC38979I
LOC389834 NM_001013655 hypothetical protein LOC389834
LOC392395 NM_001013664 hypothetical protein LOC392395
LOC399706 NM_001010910 hypothetical protein LOC399706
LOC399898 NM_001013666 hypothetical protein LOC399898
LOC400145 NM_001013669 hypothetical protein LOC400145
LOC400499 NM_001013671 hypothetical protein LOC400499
LOC400657 NM_001008234 hypothetical protein LOC400657
LOC400891 NM_001013675 hypothetical protein LOC400891
LOC400924 NM001013676 hypothetical protein LOC400924
LOC400965 NM001013677 hypothetical protein LOC400965
LOC401137 NM_214711 hypothetical protein LOC401137
LOC401398 NM001023566 hypothetical protein LOC401398
LOC401431 NM_001008745 hypothetical protein LOC401431
LOC401507 NM001012278 hypothetical protein LOC401507
LOC401589 NM_001013687 hypothetical protein LOC401589
LOC401620 NM_001013688 hypothetical protein LOC401620
LOC401720 NM_001013690 hypothetical protein LOC401720
LOC440313 NM_001013704 hypothetical protein LOC440313
LOC440337 NM_001013705 hypothetical protein LOC440337
LOC440570 NM_001013708 hypothetical protein LOC440570
LOC440742 NM001013710 hypothetical protein LOC440742
LOC440925 NM001013712 hypothetical protein LOC440925
LOC440944 NM001013713 hypothetical protein LOC440944
LOC441070 NM001013715 hypothetical protein LOC441070
LOC441136 NM_001013719 hypothetical protein LOC441136
LOC441268 NM_001013725 hypothetical protein LOC441268
LOC441459 NM001013728 hypothetical protein LOC441459
LOC442247 NM001013734 hypothetical protein LOC442247
LOC504188 NM_001013404 hypothetical protein LOC504188
LOC54103 NM 017439 hypothetical protein LOC54103
-50-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
LOC541473 NM_001013748 FKBP6-like
LOC554251 NM001024680 hypothetical protein LOC554251
LOC55908 NM_018687 hepatocellular carcinoma-associated gene TD26
LOC613206 NM_001033016 myeloproliferative disease associated tumor
LOC613266 NM_001033516 hypothetical protein LOC613266
LOC63928 NM_022097 hepatocellular carcinoma antigen gene 520
LOC90167 NM_194277 hypothetical protein LOC90167
LOC90639 NM001031617 hypothetical protein LOC90639
LOH12CR1 NM058169 LOH1CR12
LOXL4 NM032211 lysyl oxidase-like 4 precursor
LPIN3 NM022896 lipin 3
LPP NM_005578 LIM domain containing preferred translocation
LRAT NM004744 lecithin retinol acyltransferase
LRBA NM_006726 LPS-responsive vesicle trafficking, beach and
LRCH4 NM_002319 leucine-rich repeats and calponin homology (CH)
LRP 11 NM_032832 low density lipoprotein receptor-related protein
LRP 12 NM013437 suppression of tumorigenicity
LRP2BP NM018409 LRP2 binding protein
LRRC14 NM_014665 eucine rich repeat containing 14
LRRC2 NM_024512 eucine rich repeat containing 2
LRRC20 NM_018205 eucine rich repeat containing 20 isoform 3
LRRC27 NM_030626 eucine rich repeat containing 27
LRRC3B NM_052953 eucine rich repeat containing 3B
LRRC48 NM031294 eucine rich repeat containing 48
LRRC54 NM015516 tsukushi
LRRIQ2 NM_024548 eucine-rich repeats and IQ motif containing 2
LRRN5 NM006338 eucine rich repeat neuronal 5 precursor
LRRTM3 NM 178011 eucine rich repeat transmembrane neuronal3
LSM12 NM_152344 hypothetical protein LOC124801
LSM16 NM_025083 LSM16 homolog (EDC3, S. cerevisiae)
LTBP2 NM000428 atent transforming growth factor beta binding
LUZP1 NM033631 eucine zipper protein 1
LY6H NM002347 ymphocyte antigen 6 complex, locus H
LY86 NM004271 MD-1, RP 105-associated
LYCAT NM001002257 ysocardiolipin acyltransferase isoform 2
LYPLA3 NM012320 ysophospholipase 3 (lysosomal phospholipase
LYSMDI NM212551 LysM, putative peptidoglycan-binding, domain
LYSMD4 NM_152449 hypothetical protein LOC145748
LYZ NM000239 ysozyme precursor
LZTR2 NM033127 regucalcin gene promotor region related protein
LZTS 1 NM021020 eucine zipper, putative tumor suppressor 1
M6PR NM002355 cation-dependent mannose-6-phosphate receptor
M6PRBP1 NM_005817 mannose 6 phosphate receptor binding protein 1
MAB21L1 NM005584 mab-21 -like protein 1
MAF NM_001031804 v-mafmusculoaponeurotic fibrosarcoma oncogene
MAGEAB NM005364 melanoma antigen family A, 8
MAGEA9 NM_005365 melanoma antigen family A, 9
MAGEL2 NM_019066 MAGE-like protein 2
MAGI2 NM_012301 membrane associated guanylate kinase, WW and PDZ
MALL NM005434 mal, T-cell differentiation protein-like
MAN1C1 NM020379 mannosidase, alpha, class 1C, member 1
MANEA NM_024641 mannosidase, endo-alpha
MAP1B NM005909 microtubule-associated protein 1B isoform I
MAP3K3 NM 002401 mitogen-activated protein kinase kinase kinase 3
-51-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
MAP3K7 NM_003188 mitogen-activated protein kinase kinase kinase 7
MAP4K1 NM007181 mitogen-activated protein kinase kinase kinase
MAPK1 NM_002745 mitogen-activated protein kinase 1
MAPK14 NM001315 mitogen-activated protein kinase 14 isoform I
MAPK3 NM002746 mitogen-activated protein kinase 3 isoform 1
MAPK7 NM_002749 mitogen-activated protein kinase 7 isoform I
MAPKAPK2 NM004759 mitogen-activated protein kinase-activated
MAPKBP 1 NM_014994 mitogen-activated protein kinase binding protein
MAPT NM005910 microtubule-associated protein tau isoform 2
MARCH3 NM178450 membrane-associated ring finger (C3HC4) 3
MARCH5 NM017824 ring finger protein 153
MARCKS NM002356 myristoylated alanine-rich protein kinase C
MARK3 NM002376 MAP/microtubule affinity-regulating kinase 3
MARVELD 1 NM_031484 MARVEL domain containing I
MARVELD3 NM052858 MARVEL domain containing 3 isoform 2
MAS1 NM002377 MAS1 onoogene
MASP1 NM_001879 mannan-binding lectin serine protease 1 isoform
MAT1A NM000429 methionine adenosyltransferase I, alpha
MATN2 NM002380 matrilin 2 isoform a precursor
MBD3 NM003926 methyl-CpG binding domain protein 3
MBNL3 NM018388 muscleblind-like 3 isoform G
MCART6 NM001012755 hypothetical protein LOC401612
MCCC2 NM022132 methylcrotonoyl-Coenzyme A carboxylase 2 (beta)
MCF2 NM005369 MCF.2 cell line derived transforming sequence
MCFD2 NM139279 multiple coagulation factor deficiency 2
MCL1 NM_021960 myeloid cell leukemia sequence 1 isoform 1
MCM4 NM005914 minichromosome maintenance protein 4
MCM8 NM032485 minichromosome maintenance protein 8 isoform 1
MDFIC NM_199072 MyoD family inhibitor domain containing isoform
MDGAI NM_153487 MAM domain containing
MECP2 NM004992 methyl CpG binding protein 2
MED12L NM053002 mediator of RNA polymerase II transcription,
MEF2C NM002397 MADS box transcription enhancer factor 2,
MEF2D NM005920 MADS box transcription enhancer factor 2,
MEGF10 NM_032446 MEGF10 protein
MEP1A NM_005588 meprin A, alpha (PABA peptide hydrolase)
METT5D1 NM_152636 methyltransferase 5 domain containing 1
METTL5 NM014168 methyltransferase like 5
MFAP3 NM005927 microfibrillar-associated protein 3
MFI2 NM033316 melanoma-associated antigen p97 isoform 2,
MFN2 NM014874 mitofusin 2
MFSD4 NM_181644 hypothetical protein DKFZp761N1114
MGAM NM004668 maltase-glucoamylase
MGC 10334 NM_001029885 hypothetical protein LOC80772
MGC 11102 NM_032325 hypothetical protein LOC84285
MGC 13379 NM016499 hypothetical protein LOC51259
MGC15875 NM_032921 hypothetical protein LOC85007 isoform 1
MGC16028 NM_052873 hypothetical protein LOC112752
MGC 16703 NM_145042 hypothetical protein LOC 113691
MGC20470 NM_145053 hypothetical protein LOC143630
MGC23280 NM_144683 hypothetical protein LOC147015
MGC24039 NM_144973 hypothetical protein LOC160518
MGC26694 NM_178526 hypothetical protein LOC284439
MGC26718 NM 001029999 hypothetical protein LOC440482
-52-
.
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
MGC26733 NM144992 hypothetical protein LOC200403
MGC27121 NM001001343 hypothetical protein LOC408263
MGC2752 NM023939 hypothetical protein LOC65996
MGC29891 NM144618 GA repeat binding protein, beta 2
MGC29898 NM145048 hypothetical protein LOC 133015
MGC3207 NM001031727 hypothetical protein LOC84245 isoform 1
MGC33214 NM_153354 hypothetical protein LOC 153396
MGC33530 NM182546 hypothetical protein LOC222008
MGC34646 NM173519 hypothetical protein LOC157807
MGC35295 NM152717 hypothetical protein LOC219995
MGC39900 NM_194324 hypothetical protein LOC286527
MGC4562 NM_133375 hypothetical protein LOC 115752
MGC4655 NM033309 hypothetical protein LOC84752
MGC50273 NM214461 hypothetical protein LOC408029
MGC9712 NM_152689 hypothetical protein LOC202915
MGLL NM001003794 monoglyceride lipase isoform 2
MIB1 NM020774 mindbomb homolog 1
MICAL2 NM014632 microtubule associated monoxygenase, calponin
MICAL-Ll NM_033386 molecule interacting with Rab13
MIDIIPI NM_021242 MID1 interactingGl2-likeprotein
MIER3 NM152622 hypothetical protein LOC 166968
MIPOLl NM138731 mirror-image polydactyly I
MKLl NM020831 megakaryoblastic leukemia 1 protein
MKL2 NM_014048 megakaryoblastic leukemia 2 protein
MKLN1 NM013255 muskelin 1, intracellular mediator containing
MKRN3 NM005664 makorin, ring finger protein, 3
MLC 1 NM015166 megalencephalic leukoencephalopathy with
MLL4 NM014727 myeloid/lymphoid or mixed-lineage leukemia 4
MLLT3 NM_004529 myeloid/lymphoid or mixed-lineage leukemia
MLSTD2 NM032228 male sterility domain containing 2
MLX NM_170607 transcription factor-like protein 4 isoform
MLXIPL NM_032951 Williams Beuren syndrome chromosome region 14
MMD2 NM_198403 monocyte-to-macrophage differentiation factor 2
MMP14 NM004995 matrix metalloproteinase 14 preproprotein
MMP17 NM016155 matrix metalloproteinase 17 preproprotein
MMP19 NM_001032360 matrix metalloproteinase 19 isofon-n 2 precursor
MMP2 NM004530 matrix metalloproteinase 2 preproprotein
MMP8 NM002424 matrix metalloproteinase 8 preproprotein
MN1 NM002430 meningioma 1
MOBKL2A NM_130807 MOB-LAK
MOBKL2B NM_024761 MOB 1, Mps One Binder kinase activator-like 2B
MOCS 1 NM_005942 molybdenum cofactor synthesis-step 1 protein
MOCS2 NM176806 molybdopterin synthase small subunit MOCS2A
MOG NM001008228 myelin oligodendrocyte glycoprotein isoform
MON1B NM014940 MONl homolog B
MOSPDI NM_019556 motile sperm domain containing 1
MPP2 NM0o5374 palmitoylated membrane protein 2
MPPEDI NM001585 hypothetical protein LOC758
MPST NM001013436 3-mercaptopyruvate sulfurtransferase
MRAS NM_012219 muscle RAS oncogene homolog
MRO NM031939 maestro
MRP63 NM_024026 mitochondrial ribosomal protein 63
MRPL30 NM145212 mitochondrial ribosomal protein L30
MRPL41 NM 032477 mitochondrial ribosomal protein L41
-53-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
MRPL52 NM178336 mitochondrial ribosomal protein L52 isoform a
MRPS11 NM022839 mitochondrial ribosomal protein S11 isoform a
MRPS26 NM030811 mitochondrial ribosomal protein S26
MRPS33 NM016071 mitochondrial ribosomal protein S33
MS4A10 NM206893 membrane-spanning 4-domains, subfamily A, member
MS4A2 NM000139 membrane-spanning 4-domains, subfamily A, member
MS4A4A NM024021 membrane-spanning 4-domains, subfamily A, member
MS4A7 NM021201 membrane-spanning 4-domains, subfamily A, member
MSH3 NM002439 mutS homolog 3
MSI2 NM138962 musashi 2 isoform a
MSL3L1 NM078628 male-specific lethal 3-like 1 isoform d
MSRl NM_002445 macrophage scavenger receptor 1 isoform type 2
MSRB3 NM001031679 methionine sulfoxide reductase B3 isofonn 2
MTAC2D1 NM152332 membrane targeting (tandem) C2 domain containing
MTHFR NM005957 5,1 0-methylenetetrahydrofolate reductase
MTHFSD NM022764 hypothetical protein LOC64779
MTM1 NM000252 myotubularin
MTMR12 NM019061 myotubularin related protein 12
MTMR2 NM_016156 myotubularin-related protein 2 isoform 1
MTMR3 NM_021090 myotubularin-related protein 3 isoform c
MTMR9 NM_015458 myotubularin-related protein 9
MTPN NM_145808 myotrophin
MTRR NM002454 methionine synthase reductase isoform 1
MUCDHL NM031265 mu-protocadherin isoform 4
MUMILI NM_152423 melanoma associated antigen (mutated) 1-like 1
MUTED NM201280 muted
MX2 NM002463 myxovirus resistance protein 2
MXDI NM002357 MAX dimerization protein 1
MXD4 NM_006454 MAD4
MYADM NM001020818 myeloid-associated differentiation marker
MYBBPIA NM_014520 MYB binding protein la
MYBL2 NM002466 MYB-related protein B
MYCLI NM_001033081 1-myc-1 proto-oncogene isoform 1
MYD88 NM_002468 mycloid differentiation primary response gene
MYL2 NM000432 myosin light chain 2
MYL3 NM000258 myosin light chain 3
MYO18A NM078471 myosin 18A isoform a
MYO1B NM012223 myosin IB
MYO1E NM_004998 myosin IE
MYO3A NM_017433 myosin IIIA
MY05C NM018728 myosin VC
MYO6 NM004999 myosin VI
MY07A NM_000260 myosin VIIA
MYOM2 NM_003970 myomesin 2
MYST2 NM_007067 MYST histone acetyltransferase 2
MYST3 NM_006766 MYST histone acetyltransferase (monocytic
MYT1L NM_015025 myelin transcription factor 1-like
N4BPI NM_153029 Nedd4 binding protein 1
NAALADL2 NM207015 N-acetylated alpha-linked acidic dipeptidase 2
NAG6 NM_022742 hypothetical protein DKFZp434G156
NAG8 NM_014411 nasopharyngeal carcinoma associated gene
NALP 1 NM014922 death effector filament-forming Ced-4-like
NALP 12 NM144687 PYRIN-containing APAF1-like protein 7 isoform 2
NANOSI NM 199461 nanos homolog I isoform 1
-54-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
NANP NM152667 haloacid dehalogenase-like hydrolase domain
NAP1L4 NM005969 nucleosome assembly protein 1-like 4
NAPE-PLD NM198990 N-acyl-phosphatidylethanolamine-hydrolyzing
NARGI NM057175 NMDA receptor regulated 1
NARGIL NM024561 NMDA receptor regulated 1-like protein isoform
NARG2 NM001018089 NMDA receptor regulated 2 isoform b
NAT10 NM_024662 N-acetyltransferase-like protein
NAT12 NM001011713 hypothetical protein LOC122830
NAV3 NM014903 neuron navigator 3
NCAM1 NM181351 neural cell adbesion molecule I isoform 2
NCOA1 NM003743 nuclear receptor coactivator 1 isoform 1
NCOA6IP NM_024831 PRIP-interacting protein PIPMT
NCOA7 NM181782 nuclear receptor coactivator 7
NCRI NM004829 natural cytotoxicity triggering receptor 1
NCSTN NM_015331 nicastrin precursor
NDEI NM017668 nuclear distribution gene E homolog 1
NDEL1 NM001025579 nudE nuclear distribution gene E homolog like 1
NDFIPI NM030571 Nedd4 family interacting protein 1
NDRG4 NM020465 NDRG family member 4
NDST1 NM_001543 N-deacetylase/N-sulfotransferase (heparan
NEBL NM006393 nebulette sarcomeric isoform
NECAPI NM_015509 adaptin-ear-binding coat-associated protein 1
NECAP2 NM018090 adaptin-ear-binding coat-associated protein 2
NEDD4 NM006154 neural precursor cell expressed, developmentally
NEDD9 NM182966 neural precursor cell expressed, developmentally
NEIL2 NM145043 nei-like 2
NEK8 NM_178170 NIMA-related kinase 8
NES NM006617 nestin
NETO1 NM138999 neuropilin- and tolloid-like protein I isoform 1
NETO2 NM_018092 neuropilin- and tolloid-like protein 2
NEURL NM004210 neuralized-like
NEUROG2 NM_024019 neurogenin 2
NF2 NM000268 neurofibroniin 2 isoform 1
NFAMI NM_145912 NFAT activation molecule 1 precursor
NFASC NM015090 neurofascin precursor
NFAT5 NM006599 nuclear factor of activated T-cells 5 isoform c
NFATC 1 NM006162 nuclear factor of activated T-cells, cytosolic
NFIC NM_005597 nuclear factor I/C isoform 1
NFKBILI NM_005007 nuclear factor of kappa light polypeptide gene
NFXL1 NM_152995 nuclear transcription factor, X-box binding-like
NFYA NM_002505 nuclear transcription factor Y, alpha isoform I
NFYB NM_006166 nuclear transcription factor Y, beta
NGFR NM002507 nerve growth factor receptor precursor
NHLH1 NM_005598 nescient helix loop helix 1
NIPA1 NM_144599 non-imprinted in Prader-Willi/Angelman syndrome
NIPSNAPI NM_003634 nipsnap homolog 1
NKIRAS2 NM001001349 NFKB inhibitor interacting Ras-like 2
NKTR NM001012651 natural killer-tumor recognition sequence
NLGN2 NM_020795 neuroligin 2
NMNATI NM022787 nicotinamide nucleotide adenylyltransferase 1
NMT1 NM_021079 N-myristoyltransferase 1
NMT2 NM004808 glycylpeptide N-tetradecanoyltransferase 2
NNAT NM005386 neuronatin isoform alpha
NOB 1 NM 014062 nin one binding protein
-55-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
NOL11 NM_015462 nucleolar protein 11
NOL6 NM022917 nucleolar RNA-associated protein alpha isoform
NOMl NM138400 nucleolar protein with MIF4G domain 1
NOVAl NM_002515 neuro-oncological ventral antigen 1 isoform 1
NOX1 NM007052 NADPH oxidase 1 isoform long
NPAL3 NM_020448 NIPA-like domain containing 3
NPAS2 NM002518 neuronal PAS domain protein 2
NPC1 NM000271 Niemann-Pick disease, type Cl
NPHPI NM000272 nephrocystin isoform 1
NPLOC4 NM_017921 nuclear protein localization 4
NPR3 NM_000908 natriuretic peptide receptor C/guanylate cyclase
NPTX1 NM_002522 neuronal pentraxin I precursor
NPTXR NM014293 neuronal pentraxin receptor isoform 1
NQOI NM000903 NAD(P)H menadione oxidoreductase 1,
NR3C1 NM_000176 nuclear receptor subfamily 3, group C, member 1
NRGl NM013958 neuregulin 1 isoform HRG-beta3
NRIPI NM_003489 receptor interacting protein 140
NRIP2 NM_031474 nuclear receptor interacting protein 2
NRP2 NM003872 neuropilin 2 isoform 2 precursor
NSF NM006178 N-ethylmaleimide-sensitive factor
NT5C2 NM_012229 5'-nucleotidase, cytosolic II
NTRK2 NM_001007097 neurotrophic tyrosine kinase, receptor, type 2
NUAK2 NM030952 NUAK family, SNF1-like kinase, 2
NUCB 1 NM006184 nucleobindin 1
NUDTIO NM_153183 nudix-type motif 10
NUDT12 NM031438 nudix -type motif 12
NUDT15 NM018283 nudix-type motif 15
NUDT16 NM152395 nudix-type motif 16
NUDT16L1 NM_032349 syndesmos
NUDT18 NM024815 nudix (nucleoside diphosphate linked moiety
NUDT4 NM_019094 nudix-type motif 4 isoform alpha
NUMB NM001005743 numb homolog isoform 1
NUMBL NM004756 numb homolog (Drosophila)-like
NUP35 NM_001008544 nucleoporin 35kDa isoform b
NUP43 NM198887 nucleoporin 43kDa
NXFl NM006362 nuclear RNA export factor 1
NYD-SP18 NM032599 testes development-related NYD-SP 18
NY-REN-7 NM_173663 hypothetical protein LOC285596
OACT2 NM138799 0-acyltransferase (membrane bound) domain
OACT5 NM005768 gene rich cluster, C3f gene
OAF NM178507 hypothetical protein LOC220323
OAS3 NM_006187 2'-5'oligoadenylate synthetase 3
OAZ1 NM004152 omithine decarboxylase antizyme 1
OBFC2B NM024068 hypothetical protein LOC79035
OCRL NM_000276 phosphatidylinositol polyphosphate 5-phosphatase
OLIG1 NM_138983 oligodendrocyte transcription factor 1
OPCML NM_001012393 opioid binding protein/cell adhesion
OPRDI NM_000911 opioid receptor, delta I
OPTC NM014359 opticin precursor
OR2H1 NM_030883 olfactory receptor, family 2, subfamily H,
OR51E2 NM_030774 olfactory receptor, family 51, subfamily E,
OR7D2 NM175883 hypothetical protein LOC162998
ORAOV 1 NM_153451 oral cancer overexpressed I
ORC2L NM 006190 origin recognition complex, subunit 2
-56-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
OSBP2 NM_030758 oxysterol binding protein 2 isoform a
OSBPL2 NM_014835 oxysterol-binding protein-like protein 2 isofonn
OSBPL3 NM015550 oxysterol-binding protein-like protein 3 isoform
OSBPL7 NM_145798 oxysterol-binding protein-like protein 7
OSCAR NM 206817 osteoclast-associated receptor isoform 2
OTUD4 NM_199324 OTU domain containing 4 protein isoform 1
OTUD6B NM016023 OTU domain containing 6B
OXGRI NM_080818 oxoglutarate (alpha-ketoglutarate) receptor 1
P2RX2 NM_012226 purinergic receptor P2X2 isoform I
P2RX7 NM002562 purinergic receptor P2X7
P2RY13 NM_023914 purinergic receptor P2Y, G-protein coupled, 13
P2RY14 NM014879 purinergic receptor P2Y, G-protein coupled, 14
P2RY4 NM002565 pyrimidinergic receptor P2Y4
P2RY8 NM178129 G-protein coupled purinergic receptor P2Y8
P4HA1 NM_000917 prolyl 4-hydroxylase, alpha I subunit isoform 1
P4HA3 NM_182904 prolyl4-hydroxylase, alpha III subunit
P53AIP1 NM022112 p53-regulated apoptosis-inducing protein 1
PACRG NMI52410 PARK2 co-regulated
PACS1 NM018026 phosphofurin acidic cluster sorting protein I
PAFAHIB2 NM002572 platelet-activating factor acetylhydrolase,
PAG 1 NM018440 phosphoprotein associated with glycosphingolipid
PAICS NM_006452 phosphoribosylaminoimidazole carboxylase
PALMD NM_017734 palmdelphin
PAN3 NM_175854 PABPI-dependent poly A-specific ribonuclease
PAP2D NM_001010861 phosphatidic acid phosphatase type 2d isoform 2
PAPLN NM173462 papilin
PAPOLB NM020144 poly(A) polymerase beta (testis specific)
PAPPA NM_00258I pregnancy-associated plasma protein A
PAQR5 NM017705 membrane progestin receptor gamma
PAQR6 NM198406 progestin and adipoQ receptor family member VI
PARD6G NM032510 PAR-6 gamma protein
PARP6 NM020213 poly (ADP-ribose) polymerase family, member 6
PARVA NM018222 parvin, alpha
PATE NM_138294 expressed in prostate and testis
PAX5 NM_016734 paired box 5
PBK NM_018492 T-LAK cell-originated protein kinase
PC NM000920 pyruvate carboxylase precursor
PCDHI 1X NM_032967 protocadherin 11 X-linked isoform b precursor
PCDHI lY NM032971 protocadherin 11 Y-linked isoform a
PCDH21 NM_033100 protocadherin 21 precursor
PCDHA9 NM014005 protocadherin alpha 9 isoform 2 precursor
PCDHB 10 NM018930 protocadherin beta 10 precursor
PCGF3 NM006315 ring finger protein 3
PCGF6 NM001011663 polycomb group ring finger 6 isoform a
PCMTl NM_005389 protein-L-isoaspartate (D-aspartate)
PCNXL2 NM014801 pecanex-like 2
PCQAP NM001003891 positive cofactor 2, glutamine/Q-rich-associated
PCSK2 NM002594 proprotein convertase subtilisin/kexin type 2
PCSK6 NM138323 paired basic amino acid cleaving system 4
PCSK7 NM_004716 proprotein convertase subtilisin/kexin type 7
PCSK9 NM174936 proprotein convertase subtilisin/kexin type 9
PCYOXl NM016297 prenylcysteine oxidase 1
PDAP1 NM014891 PDGFA associated protein 1
PDCD6IP NM 013374 programmed cell death 6 interacting protein
-57-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
PDCL NM_005388 phosducin-like
PDDC1 NM182612 hypothetical protein LOC347862
PDE11A NM016953 phosphodiesterase 11A
PDE1B NM000924 phosphodiesterase 1B, calmodulin-dependent
PDE4DIP NM001002811 phosphodiesterase 4D interacting protein isoform
PDE5A NM001083 phosphodiesterase 5A isoform 1
PDE7A NM002604 phosphodiesterase 7A isoform b
PDE8B NM001029851 phosphodiesterase 8B isoform 3
PDGFB NM002608 platelet-derived growth factor beta isoform 1,
PDGFRA NM006206 platelet-derived growth factor receptor alpha
PDGFRB NM_002609 platelet-derived growth factor receptor beta
PDIA6 NM005742 protein disulfide isomerase-associated 6
PDK1 NM002610 pyruvate dehydrogenase kinase, isozyme 1
PDLIM2 NM176871 PDZ and LIM domain 2 isoform 1
PDLIM5 NM001011513 PDZ and LIM domain 5 isoform b
PDP2 NM_020786 pyruvate dehydrogenase phosphatase isoenzyme 2
PDPK1 NM002613 3-phosphoinositide dependent protein kinase-1
PDPR NM017990 pyruvate dehydrogenase phosphatase regulatory
PDXK NM_003681 pyridoxal kinase
PDYN NM_024411 beta-neoendorphin-dynorphin preproprotein
PDZD2 NM178140 PDZ domain containing 2
PDZD4 NM032512 PDZ domain containing 4
PEBPt NM_002567 prostatic binding protein
PECR NM018441 peroxisomal trans-2-enoyl-CoA reductase
PEG3 NM006210 paternally expressed 3
PER2 NM022817 period 2 isoform 1
PEXIO NM_002617 peroxisome biogenesis factor 10 isoform 2
PEX5 NM_000319 peroxisomal biogenesis factor 5
PFKFB2 NM001018053 6-phosphofructo-2-kinase/fructose-2,
PGAP1 NM024989 GPI deacylase
PGBD4 NM_152595 piggyBac transposable element derived 4
PGD NM_002631 phosphogluconate dehydrogenase
PGK1 NM_000291 phosphoglycerate kinase 1
PGK2 NM138733 phosphoglycerate kinase 2
PGLYRP2 NM_052890 peptidoglycan recognition protein L precursor
PGLYRP4 NM020393 peptidoglycan recognition protein-I-beta
PGM2L1 NM_173582 phosphoglucomutase 2-like 1
PGRMC2 NM_006320 progesterone membrane binding protein
PHC2 NM004427 polyhomeotic 2-like isoform b
PHFt 1 NM_016119 PHD finger protein 11
PHF13 NM_153812 PHD finger protein 13
PHF20 NM016436 PHD finger protein 20
PHF20L1 NM_016018 PHD finger protein 20-like 1 isoform 1
PHF6 NM_001015877 PHD finger protein 6 isoform 1
PHF8 NM_015107 PHD finger protein 8
PHGDHLI NM_177967 hypothetical protein LOC337867
PHLDB 1 NM015157 pleckstrin homology-like domain, family B,
PHTF2 NM_020432 putative homeodomain transcription factor 2
PI4KII NM_018425 phosphatidylinositol 4-kinase type II
PIAS3 NM_006099 protein inhibitor of activated STAT, 3
PIGQ NM_004204 phosphatidylinositol glycan, class Q isoform 2
PIGW NM_178517 phosphatidylinositol glycan, class W
PIK3CG NM_002649 phosphoinositide-3-kinase, catalytic, gamma
PIK3R1 NM 181504 phosphoinositide-3-kinase, regulatory subunit,
-58-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
PIK3R3 NM_003629 phosphoinositide-3-kinase, regulatory subunit 3
PILRA NM013439 paired immunoglobulin-like type 2 receptor alpha
PIP3-E NM015553 phosphoinositide-binding protein PIP3-E
PIP5KIC NM012398 phosphatidylinositol-4-phosphate 5-kinase, type
PIP5K2B NM_003559 phosphatidylinositol-4-phosphate 5-kinase type
PIP5KL1 Nlv1_173492 phosphatidylinositol-4-phosphate 5-kinase-like
PITPNA NM006224 phospliatidylinositol transfer protein, alpha
PITX1 NM002653 paired-like homeodomain transcription factor 1
PKD2 NM000297 polycystin 2
PKNOXI NM004571 PBX/knotted 1 homeobox 1 isoform 1
PKP1 NM000299 plakophilin 1 isoform lb
PLA2GIB NM_000928 phospholipase A2, group IB
PLA2G2D NM012400 phospholipase A2, group IID
PLA2G4D NM178034 phospholipase A2, group IVD
PLAGL2 NM002657 pleiomorphic adenoma gene-like 2
PLAU NM_002658 urokinase plasminogen activator preproprotein
PLAUR NM_001005376 plasminogen activator, urokinase receptor
PLCB4 NM_000933 phospholipase C beta 4 isoform a
PLCD3 NM133373 phospholipase C delta 3
PLCXD3 NM001005473 phosphatidylinositol-specific phospholipase C, X
PLD5 NM152666 phospholipase D family, member 5
PLEKHAI NM_001001974 pleckstrin homology domain containing, family A
PLEKHA6 NM_014935 phosphoinositol 3-phosphate-binding protein-3
PLEKHB2 NM017958 pleckstrin homology domain containing, family B
PLEKHQ1 NM025201 PH domain-containing protein
PLIN NM002666 perilipin
PLXNAI NM032242 plexin Al
PML NM_033238 promyelocytic leukemia protein isoform 1
PNKD NM_015488 myofibrillogenesis regulator 1 isoform 1
PNMA2 NM_007257 paraneoplastic antigen MA2
PNPLAI NM_173676 patatin-like phospholipase domain containing 1
PNPO NM_018129 pyridoxine 5'-phosphate oxidase
PNRC 1 NM006813 proline-rich nuclear receptor coactivator 1
PODXL NM001018111 podocalyxin-like precursor isoform 1
POFUTI NM_015352 protein 0-fucosyltransferase 1 isoform 1
POFUT2 NM_015227 protein 0-fucosyltransferase 2 isoform A
POGK NM017542 pogo transposable element with KRAB domain
POGZ NM_145796 pogo transposable element with ZNF domain
POLDIP2 NM015584 DNA polymerase delta interacting protein 2
POLDIP3 NM032311 DNA polymerase delta interacting protein 3
POLH NM006502 polymerase (DNA directed), eta
POLRIB NM019014 RNA polymerase I polypeptide B
POLRIE NM_022490 RNA polymerase I associated factor 53
POLR2L NM021128 DNA directed RNA polymerase II polypeptide L
POLR3E NM018119 polymerase (RNA) III (DNA directed) polypeptide
POLR3GL NM_032305 polymerase (RNA) III (DNA directed) polypeptide
POM121 NM_172020 nuclear pore membrane protein 121
POU2F2 NM002698 POU domain, class 2, transcription factor 2
POU2F3 NM014352 POU transcription factor
PPAPDC2 NM_203453 phosphatidic acid phosphatase type 2 domain
PPARA NM_001001928 peroxisome proliferative activated receptor,
PPCDC NM021823 phosphopantothenoylcysteine decarboxylase
PPEF2 NM_152933 serine/threonine protein phosphatase with
PPFIBP2 NM 003621 PTPRF interacting protein, binding protein 2
-59-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
PPIL2 NM_014337 peptidylprolyl isomerase-like 2 isoform a
PPIL4 NM_139126 peptidylprolyl isomerase-like 4
PPL NM_002705 periplakin
PPM1B NM177968 protein phosphatase 1B isoform 2
PPM1E NM_014906 protein phosphatase IE
PPM2C NM_018444 pyruvate dehydrogenase phosphatase precursor
PPPIR12B NM_002481 protein phosphatase 1, regulatory (inhibitor)
PPP 1R12C NM_017607 protein phosphatase 1, regulatory subunit 12C
PPP1R13L NM006663 protein phosphatase 1, regulatory (inhibitor)
PPP 1R15B NM032833 protein phosphatase 1, regulatory subunit 15B
PPP 1R16B NM_015568 protein phosphatase 1 regulatory inhibitor
PPP 1R3A NM_002711 protein phosphatase 1 glycogen-binding
PPPIR3B NM024607 protein phosphatase 1, regulatory (inhibitor)
PPP2CB NM_001009552 protein phosphatase 2, catalytic subunit, beta
PPP2RIB NM002716 beta isoform of regulatory subunit A, protein
PPP2R2A NM002717 alpha isoform of regulatory subunit B55, protein
PPP2R3A NM_002718 protein phosphatase 2, regulatory subunit B",
PPP2R4 NM_021131 protein phosphatase 2A, regulatory subunit B'
PPP2R5C NM002719 ganuna isoform of regulatory subunit B56, protein
PPP4R1 L NM018498 hypothetical protein LOC55370
PPT2 NM_005155 palmitoyl-protein thioesterase 2 isoform a
PRCI NM_003981 protein regulator of cytokinesis 1 isoform 1
PRDM12 NM021619 PR domain containing 12
PRDM16 NM_022114 PR domain containing 16 isoform 1
PRDM9 NM020227 PR domain containing 9
PREB NM013388 prolactin regulatory element binding protein
PRELP NM_002725 proline arginine-rich end leucine-rich repeat
PREPL NM006036 prolyl endopeptidase-like
PRICKLE2 NM_198859 prickle-like 2
PRKAA2 NM_006252 AMP-activated protein kinase alpha 2 catalytic
PRKCA NM_002737 protein kinase C, alpha
PRKCE NM_005400 protein kinase C, epsilon
PRKD2 NM016457 protein kinase D2
PRKRIPI NM024653 PRKR interacting protein 1(ILI1 inducible)
PRKRIR NM004705 protein-kinase, interferon-inducible double
PRKX NM005044 protein kinase, X-linked
PRKY NM002760 protein kinase, Y-linked
PRND NM_012409 prion-like protein doppel preproprotein
PROSC NM_007198 proline synthetaae co-transcribed homolog
PRPF19 NM_014502 PRP19/PSO4 pre-rnRNA processing factor 19
PRPF4 NM004697 PRP4 pre-mRNA processing factor 4 homolog
PRRG4 NM024081 proline rich Gla (G-carboxyglutamic acid) 4
PRRT2 NM_145239 hypothetical protein LOC 112476
PRRXl NM_006902 paired mesoderm homeobox 1 isoform pmx-la
PRSS23 NM007173 protease, serine, 23 precursor
PRX NM020956 periaxin isoform 1
PRY NM004676 PTPN13-like, Y-linked
PRY2 NM001002758 PTPN13-like, Y-linked 2
PSCD1 NM_004762 pleckstrin homology, Sec7 and coiled/coil
PSCD4 NM013385 pleckstrin homology, Sec7 and coiled/coil
PSD3 NM015310 ADP-ribosylation factor guanine nucleotide
PSG4 NM002780 pregnancy specific beta-l-glycoprotein 4 isoform
PSG7 NM_002783 pregnancy specific beta-l-glycoprotein 7
PSMD5 NM 005047 proteasome 26S non-ATPase subunit 5
-60-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
PSME4 NM014614 proteasome (prosome, macropain) activator
PTAFR NM_000952 platelet-activating factor receptor
PTCH NM000264 patched
PTD004 NM001011708 GTP-binding protein PTD004 isoform 2
PTDSS2 NM030783 phosphatidylserine synthase 2
PTGDR NM000953 prostaglandin D2 receptor
PTGER3 NM_198718 prostaglandin E receptor 3, subtype EP3 isoform
PTGES2 NM025072 prostaglandin E synthase 2 isoform 1
PTGES3 NM006601 unactive progesterone receptor, 23 kD
PTGIS NM000961 prostaglandin 12 (prostacyclin) synthase
PTHBI NM001033604 parathyroid hormone-responsive B1 isoform 3
PTK6 NM005975 PTK6 protein tyrosine kinase 6
PTK7 NM_002821 PTK7 protein tyrosine kinase 7 isoform a
PTK9L NM007284 twinfilin-like protein
PTPDC 1 NM152422 protein tyrosine phosphatase domain containing 1
PTPLB NM_198402 protein tyrosine phosphatase-like (proline
PTPN11 NM_002834 protein tyrosine phosphatase, non-receptor type
PTPN2 NM002828 protein tyrosine phosphatase, non-receptor type
PTPN23 NM015466 protein tyrosine phosphatase, non-receptor type
PTPN4 NM002830 protein tyrosine phosphatase, non-receptor type
PTPN7 NM002832 protein tyrosine phosphatase, non-receptor type
PTPRE NM006504 protein tyrosine phosphatase, receptor type, E
PTPRN NM_002846 protein tyrosine phosphatase, receptor type, N
PTPRT NM_007050 protein tyrosine phosphatase, receptor type, T
PTRF NM012232 polymerase I and transcript release factor
PTTGIIP NM004339 pituitary tumor-transforming gene 1
PXMP4 NM_183397 peroxisomal membrane protein 4 isoform b
PXT1 NM152990 peroxisomal, testis specific 1
PYCRL NM_023078 pyrroline-5-carboxylate reductase-like
QDPR NM000320 quinoid dihydropteridine reductase
QKI NM_006775 quaking homolog, KH domain RNA binding isoform
QPCTL NM_017659 glutaminyl-peptide cyclotransferase-like
QPRT NM014298 quinolinate phosphoribosyltransferase
QRSL1 NM018292 glutaminyl-tRNA synthase
QSCN6 NM002826 quiescin Q6 isoform a
QSCN6L1 NM_181701 quiescin Q6-like 1
RAB11A NM004663 Ras-related protein Rab-11A
RABI IFIP1 NM001002814 Rab coupling protein isoform 3
RABIIFIP4 NM032932 RABI 1 family interacting protein 4 (class II)
RAB15 NM198686 Ras-related protein Rab-15
RAB22A NM020673 RAS-related protein RAB-22A
RAB23 NM016277 Ras-related protein Rab-23
RAB27A NM004580 Ras-related protein Rab-27A
RAB28 NM001017979 RAB28, member RAS oncogene family isoform 1
RAB33B NM031296 RAB33B, member RAS oncogene family
RAB37 NM001006638 RAB37, member RAS oncogene family isoform 2
RAB40B NM006822 RAB40B, member RAS oncogene family
RAB40C NM021168 RAR (RAS like GTPASE) like
RAB41 NM001032726 RAB41, member RAS homolog family
RAB43 NM198490 RAB43 protein
RAB6B NM016577 RAB6B, member RAS oncogene family
RAB6IP2 NM_015064 RAB6-interacting protein 2 isoform alpha
RAB7 NM004637 RAB7, member RAS oncogene family
RAB7L1 NM 003929 RAB7, member RAS oncogene family-like 1
-61-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
RABEPI NM004703 rabaptin, RAB GTPase binding effector protein 1
RABIF NM002871 RAB-interacting factor
RABL5 NM022777 RAB, member RAS oncogene family-like 5
RAD1 NM002853 RADI homolog isoform I
RAD23B NM_002874 W excision repair protein RAD23 homolog B
RAD51 NM002875 RAD51 homolog protein isoform 1
RAD51L3 NM002878 RAD51-like 3 isoform 1
RAEl NM001015885 RAEl (RNA export 1, S.pombe) homolog
RAF1 NM002880 v-raf-1 murine leukemia viral oncogene homolog
RAI17 NM020338 retinoic acid induced 17
RALBP 1 NM006788 ralA binding protein 1
RALGPSI NM014636 Ral GEF with PH domain and SH3 binding motif 1
RANBP 10 NM_020850 RAN binding protein 10
RAP2B NM002886 RAP2B, member of RAS oncogene family
RAPGEFI NM_005312 guanine nucleotide-releasing factor 2 isoform a
RAPGEF6 NM016340 PDZ domain-containing guanine nucleotide
RARG NM000966 retinoic acid receptor, gamma
RARRES 1 NM_206963 retinoic acid receptor responder (tazarotene
RASD2 NM014310 RASD family, member 2
RASGEFIB NM152545 RasGEF domain family, member 1B
RASGRP 1 NM005739 RAS guanyl releasing protein I
RASGRP4 NM_052949 RAS guanyl releasing protein 4 isoform 3
RASLIOB NM033315 RAS-like, family 10, member B
RASSF2 NM014737 Ras association domain family 2
RASSF4 NM_032023 Ras association domain family 4 isoform a
RASSF5 NM031437 Ras association (RaIGDS/AF-6) domain family 5
RASSF6 NM_177532 Ras association (RaIGDS/AF-6) domain family 6
RASSF8 NM_007211 Ras association (RaIGDS/AF-6) domain family 8
RAVERI NM_133452 RAVERI
RAXLX NM001008494 hypothetical protein LOC91464
RB1 NM000321 retinoblastoma 1
RBBP9 NM006606 retinoblastoma binding protein 9
RBL1 NM002895 retinoblastoma-like protein 1 isoform a
RBM14 NM006328 RNA binding motif protein 14
RBM16 NM014892 RNA-binding motif protein 16
RBM17 NM_032905 RNA binding motif protein 17
RBM19 NM_016196 RNA binding motif protein 19
RBM24 NM_153020 hypothetical protein LOC221662
RBM3 NM_001017430 RNA binding motif protein 3 isoform b
RBM33 NM001008408 hypothetical protein LOC155435
RBM5 NM_005778 RNA binding motif protein 5
RCC2 NM_018715 RCC 1-like
RCD-8 NM014329 autoantigen RCD8
RCHY1 NM_001008925 ring finger and CHY zinc finger domain
RDBP NM002904 RD RNA-binding protein
RDH12 NM_152443 retinol dehydrogenase 12 (all-trans and 9-cis)
RECQL5 NM_001003715 RecQ protein-like 5 isoform 2
REEPl NM_022912 receptor expression enhancing protein I
REEP3 NM001001330 receptor expression enhancing protein 3
REG4 NM032044 regenerating islet-derived family, member 4
REPSI NM031922 RALBP1 associated Eps domain containing 1
RERL NM007033 RER1 retention in endoplasmic reticulum 1
RETNLB NM_032579 colon and small intestine-specific cysteine-rich
REXOILI NM 172239 exonuclease GOR
-62-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
REXO2 NM015523 small fragment nuclease
RFC3 NM_181558 replication factor C 3 isoform 2
RFK NM018339 riboflavin kinase
RFNG NM_002917 radical fringe homolog
RFWD3 NM_018124 ring finger and WD repeat domain 3
RFX2 NM000635 regulatory factor X2 isoform a
RG9MTD3 NM144964 RNA (guanine-9-) methyltransferase domain
RGAGl NM_020769 retrotransposon gag domain containing 1
RGL1 NM_015149 ral guanine nucleotide dissociation
RGMB NM001012761 RGM domain family, member B isoform 1 precursor
RGS11 NM003834 regulator of G-protein signalling 11 isoform 2
RGS12 NM198432 regulator of G-protein signalling 12 isoform 5
RGS18 NM130782 regulator of G-protein signalling 18
RGS3 NM017790 regulator of G-protein signalling 3 isoform 3
RGSLl NM181572 regulator of G-protein signalling like 1
RHBDDI NM032276 rhomboid domain containing 1
RHBDL3 NM138328 rhomboid, veinlet-like 3
RHCG NM016321 Rhesus blood group, C glycoprotein
RHOBTB 1 NM001032380 Rho-related BTB domain containing 1
RHOG NM001665 ras homolog gene family, member G
RHOJ NM020663 TC 10-like Rho GTPase
RHOU NM_021205 ras homolog gene family, member U
RICBA NM021932 resistance to inhibitors of cholinesterase 8
RICTOR NM152756 rapamycin-insensitive companion of mTOR
RIMBP2 NM015347 RIM-binding protein 2
RIMS3 NM_014747 regulating synaptic membrane exocytosis 3
RIN2 NM018993 RAB5 interacting protein 2
RIN3 NM024832 Ras and Rab interactor 3
RIPK5 NM015375 receptor interacting protein kinase 5 isoform 1
RKHD2 NM016626 ring finger and KH domain containing 2
RLN2 NM005059 relaxin 2 isoform 2
RMND5A NM_022780 hypothetical protein LOC64795
RNASE7 NM032572 ribonuclease 7
RND2 NM_005440 Rho family GTPase 2
RNF10 NM_014868 ring finger protein 10
RNF 11 NM014372 ring finger protein 11
RNF121 NM_018320 ring finger protein 121 isoform 1
RNF125 NM017831 ring finger protein 125
RNF135 NM_197939 ring finger protein 135 isoform 2
RNF138 NM016271 ring finger protein 138 isoform 1
RNF144 NM_014746 ring finger protein 144
RNF165 NM_152470 ring finger protein 165
RNF185 NM152267 ring finger protein 185
RNF2 NM_007212 ring finger protein 2
RNF24 NM007219 ring finger protein 24
RNF26 NM032015 ring finger protein 26
RNF4 Nlvl002938 ring finger protein 4
RNF40 NM014771 ring finger protein 40
RNF6 NM005977 ring finger protein 6 isoform 1
RNF8 NM_003958 ring finger protein 8 isoform 1
RNGTT NM_003800 RNA guanylyltransferase and 5'-phosphatase
RNMT NM_003799 RNA (guanine-7-) methyltransferase
RNPC2 NM_004902 RNA-binding region containing protein 2 isoform
ROBO4 NM 019055 roundabout homolog 4, magic roundabout
-63-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
ROD1 NM_005156 ROD1 regulator ofdifferentiation 1
RORC NM001001523 RAR-related orphan receptor C isoform b
RP11-19J3.3 NM_001012267 hypothetical protein LOC401541
RP11-311P8.3 NM_145052 hypothetical protein LOC139596
RP13-15M17.2 NM_001010866 hypothetical protein LOC199953
RPAl NM002945 replication protein Al, 70kDa
RPL28 NM000991 ribosomal protein L28
RPL32 NM000994 ribosomal protein L32
RPL34 NM000995 ribosomal protein L34
RPL37 NM000997 ribosomal protein L37
RPL7L1 NM198486 ribosomal protein L7-like 1
RPLP2 NM001004 ribosomal protein P2
RPP25 NM017793 ribonuclease P 25kDa subunit
RPS27 NM001030 ribosomal protein S27
RPS6KA3 NM004586 ribosomal protein S6 kinase, 90kDa, polypeptide
RRAS2 NM012250 related RAS viral (r-ras) oncogene homolog 2
RRH NM006583 peropsin
RRM2 NM001034 ribonucleotide reductase M2 polypeptide
RRM2B NM_015713 ribonucleotide reductase M2 B (TP53 inducible)
RRP22 NM_001007279 RAS-related on chromosome 22 isoform b
RSI NM000330 X-linked juvenile retinoschisis protein
RSAD 1 NM_018346 radical S-adenosyl methionine domain containing
RTELI NM032957 regulator of telomere elongation helicase 1
RTFI NM_015138 Pafl/RNA polymerase II complex component
RTN2 NM206902 reticulon 2 isoform D
RTN4RL1 NM178568 reticulon 4 receptor-like 1
RUNDCI NM 173079 RUN domain containing 1
RUNX3 NM001031680 runt-related transcription factor 3 isofonn 1
RWDD4A NM_152682 RWD domain containing 4A
S100A11 NM005620 S100 calcium binding protein Al l(calgizzarin)
S100A14 NM020672 S100 calcium binding protein A14
S 100A7L1 NM_176823 S 100 calcium binding protein A7-like 1
S 100PBP NM_022753 S 100P binding protein Riken isoform a
SALL4 NM020436 sal-like 4
SAMD 13 NM001010971 dnaj-like protein
SAP130 NM_024545 mSin3A-associated protein 130
SAP30BP NM_013260 transcriptional regulator protein
SARM1 NM_015077 sterile alpha and TIR motif containing 1
SARTI NM005146 squamous cell carcinoma antigen recognized by T
SASHI NM015278 SAM and SH3 domain containing 1
SATLl NM_001012980 spermidine/spermine Nl-acetyl transferase-like
SAV I NM_021818 WW45 protein
SC65 NM_006455 synaptonemal complex protein SC65
SCAMPI NM004866 secretory carrier membrane protein 1 isoform 1
SCAMP4 NM079834 secretory carrier membrane protein 4
SCAMP5 NM_138967 secretory carrier membrane protein 5
SCAND2 NM_022050 SCAN domain-containing protein 2 isoform 1
SCAP2 NM003930 src family associated phosphoprotein 2
SCC-112 NM015200 SCC-112 protein
SCG3 NM_013243 secretogranin III
SCMLl NM_006746 sex comb on midleg-like 1 isoform b
SCML4 NM_198081 sex comb on midleg-like 4
SCN11A NM014139 sodium channel, voltage-gated, type XI, alpha
SCN2B NM 004588 sodium channel, voltage-gated, type II, beta
-64-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
SCN4A NM_000334 voltage-gated sodium channel type 4 alpha
SCN4B NM174934 sodium channel, voltage-gated, type IV, beta
SCOC NM032547 short coiled-coil protein
SCRTl NM031309 scratch
SCYLl NM020680 SCY1-like 1
SDF4 NM_016176 calcium binding protein Cab45 precursor
SDS NM006843 serine dehydratase
SEC14L1 NM003003 SEC 14 (S. cerevisiae)-like I isoform a
SEC 14L4 NM_174977 SEC 14p-like protein TAP3
SELIL NM005065 sel-I suppressor of lin-12-like
SELI NM033505 selenoprotein I
SELL NM000655 selectin L
SELP NM003005 selectin P precursor
SELT NM_016275 selenoprotein T
SEMA3E NM_012431 semaphorin 3E
SEMA3G NM020163 semaphorin sem2
SEMA4F NM004263 semaphorin W
SEMA5A NM_003966 semaphorin 5A
SEMA7A NM_003612 semaphorin 7A
SEPTlO NM144710 septin 10 isoform 1
SEPTl l NM018243 septin 11
SEPT3 NM019106 septin 3 isoform B
SEPT4 NM080417 septin 4 isoform 4
SEPT6 NM145799 septin 6 isoform A
SEPT9 NM006640 septin 9
SEPXl NM016332 selenoprotein X, 1
SERFIA NM_021967 small EDRK-rich factor IA, telomeric
SERFIB NM022978 small EDRK-rich factor IB, centromeric
SERPINB13 NM012397 serine (or cysteine) proteinase inhibitor, clade
SERPINB8 NM_002640 serine (or cysteine) proteinase inhibitor, clade
SERPINCl NM_000488 serine (or cysteine) proteinase inhibitor, clade
SERPINEI NM000602 plasminogen activator inhibitor-1
SETDIA NM014712 SET domain containing 1A
SFI NM004630 splicing factor 1 isoform 1
SF3A1 NM001005409 splicing factor 3a, subunit 1, 120kDa isoform 2
SF3A3 NM_006802 splicing factor 3a, subunit 3
SF4 NM_182812 splicing factor 4 isoform c
SFMBTI NM001005158 Scm-like with four mbt domains 1
SFMBT2 NM001029880 Scm-like with four mbt domains 2
SFRP4 NM003014 secreted frizzled-related protein 4
SFRS I 1 NM_004768 splicing factor p54
SFRS14 NM_001017392 splicing factor, arginine/serine-rich 14
SFTPB NM_198843 surfactant, pulmonary-associated protein B
SFXNI NM022754 sideroflexin 1
SFXN5 NM144579 sideroflexin 5
SGCB NM_000232 sarcoglycan, beta (43kDa dystrophin-associated
SGEF NM_015595 Src homology 3 domain-containing guanine
SGK2 NM_016276 serum/glucocorticoid regulated kinase 2 isoform
SGK3 NM_001033578 serum/glucocorticoid regulated kinase 3 isoform
SH2BP1 NM014633 SH2 domain binding protein 1
SH2D3A NM005490 SH2 domain containing 3A
SH2D3C NM_170600 SH2 domain containing 3C isoform 2
8H2D4A NM_022071 SH2 domain containing 4A
SH2D4B NM 207372 SH2 domain containing 4B
-65-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
SH3BGRL2 NM 031469 SH3 domain binding glutamic acid-rich protein
SH3BP2 NM_003023 SH3-domain binding protein 2
SH3GL2 NM003026 SH3-domain GRB2-like 2
SH3PX3 NM_153271 SH3 and PX domain containing 3
SH3PXD2A NM014631 SH3 multiple domains 1
SH3PXD2B NM_001017995 SH3 and PX domains 2B
SHANK2 NM_012309 SH3 and multiple ankyrin repeat domains 2
SHE NM001010846 Src homology 2 domain containing E
SIDTI NM017699 SID1 transmembrane family, member 1
SIGLECII NM052884 sialic acid binding Ig-like lectin 11
SIGLEC6 NM198846 sialic acid binding Ig-like lectin 6 isoform 3
SIPAIL3 NM_015073 signal-induced proliferation-associated I like
SIRPA NM_080792 signal-regulatory protein alpha precursor
SIRPB 1 NM_006065 signal-regulatory protein beta 1 precursor
SIRPG NM_018556 signal-regulatory protein gamma isoform 1
SIRT2 NM012237 sirtuin 2 isoform I
SIRT5 NM031244 sirtuin 5 isoform 2
SITl NM_014450 SHP2-interacting transmembrane adaptor protein
SITPEC NM016581 evolutionarily conserved signaling intermediate
SIX4 NM017420 sine oculis homeobox homolog 4
SKIP NM016532 skeletal muscle and kidney enriched inositol
SLAMF7 NM021181 SLAM family member 7
SLC12A5 NM020708 solute carrier family 12 member 5
SLC13A5 NM_177550 solute carrier family 13 (sodium-dependent
SLC14A2 NM_007163 solute carrier family 14 (urea transporter),
SLC15A4 NM145648 solute carrier family 15, member 4
SLC16A12 NM213606 solute carrier family 16 (monocarboxylic acid
SLC16Al4 NM_152527 solute carrier family 16 (monocarboxylic acid
SLC I6A2 NM006517 solute carrier family 16, member 2
SLC17A5 NM012434 solute carrier family 17 (anion/sugar
SLC 17A6 NM020346 differentiation-associated Na-dependent
SLC17A7 NM020309 solute carrier family 17, member 7
SLCIAI NM_004170 solute carrier family 1, member 1
SLCIA2 NM_004171 solute carrier family 1, member 2
SLC1A3 NM004172 solute carrier family 1 (glial high affinity
SLC22A15 NM_018420 solute carrier family 22 (organic cation
SLC22A16 NM_033125 solute carrier family 22, member 16
SLC22A3 NM_021977 solute carrier family 22 member 3
SLC22A7 NM006672 solute carrier family 22 member 7 isoform a
SLC24A1 NM_004727 solute carrier family 24
SLC24A4 NM153646 solute carrier family 24 member 4 isoform 1
SLC25A13 NM014251 solute carrier family 25, member 13 (citrin)
SLC25A15 NM014252 solute carrier family 25 (mitochondrial carrier;
SLC25A23 NM_024103 solute carrier family 25 (mitochondrial carrier;
SLC25A25 NM001006641 solute carrier family 25, member 25 isoform b
SLC25A3 NM213612 solute carrier family 25 member 3 isoform c
SLC26A2 NM000112 solute carrier family 26 member 2
SLC26A4 NM000441 pendrin
SLC26A8 NM052961 solute carrier family 26, member 8 isoform a
SLC27A1 NM_198580 solute carrier family 27 (fatty acid
SLC27A4 NM_005094 solute carrier family 27 (fatty acid
SLC2A3 NM_006931 solute carrier family 2 (facilitated glucose
SLC2A5 NM_003039 solute carrier family 2 (facilitated
SLC30A3 NM 003459 solute carrier family 30 (zinc transporter),
-66-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
SLC30A8 NM_173851 solute carrier family 30 member 8
SLC30A9 NM006345 solute carrier family 30 (zinc transporter),
SLC31A1 NM_001859 solute carrier family 31 (copper transporters),
SLC31A2 NM001860 solute carrier family 31 (copper transporters),
SLC35A4 NM080670 solute carrier family 35, member A4
SLC35A5 NM_017945 solute carrier family 35, member A5
SLC35B 1 NM005827 solute carrier family 35, member B 1
SLC35B4 NM032826 solute carrier family 35, member B4
SLC35D2 NM_007001 solute carrier family 35, member D2
SLC35E1 NM024881 solute carrier family 35, member El
SLC35F1 NM_001029858 solute carrier family 35, member F1
SLC35F5 NM_025181 solute carrier family 35, member F5
SLC36A1 NM_078483 solute carrier family 36 member I
SLC37A2 NM198277 solute carrier family 37 (glycerol-3-phosphate
SLC38A2 NM018976 solute carrier family 38, member 2
SLC38A3 NM006841 solute carrier family 38, member 3
SLC39A10 NM020342 solute carrier family 39 (zinc transporter),
SLC39A11 NM_139177 solute carrier family 39 (metal ion
SLC39A3 NM 213568 solute carrier family 39 (zinc transporter),
SLC4IA1 NM173854 solute carrier family 41 member 1
SLC45A3 NM033102 prostein
SLC5A6 NM021095 solute carrier family 5 (sodium-dependent
SLC5A8 NM145913 solute carrier family 5 (iodide transporter),
SLC6A1 NM003042 solute carrier family 6(neurotransmitter
SLC6A20 NM_020208 solute carrier family 6, member 20 isoform 1
SLC6A6 NM_003043 solute carrier family 6 (neurotransmitter
SLC6A7 NM014228 solute carrier family 6, member 7
SLC7A5 NM_003486 solute carrier family 7(cationic amino acid
SLC7A6 NM003983 solute carrier family 7 (cationic amino acid
SLC8A2 NM015063 solute carrier family 8 member 2
SLC8A3 NM033262 solute carrier family 8 member 3 isoform A
SLC9A1 NM003047 solute carrier family 9, isoform Al
SLC9A5 NM_004594 solute carrier family 9(sodium/hydrogen
SLC9A8 NM015266 Na+/H+ exchanger isoform 8
SLCO2A1 NM005630 solute carrier organic anion transporter family,
SLCO2B 1 NM007256 solute carrier organic anion transporter family,
SLFN13 NM144682 schlafen family member 13
SLFN5 NM_144975 schlafen family member 5
SLFNLI NM144990 hypothetical protein LOC200172
SLITRK3 NM014926 slit and trk like 3 protein
SMA4 NM021652 SMA4
SMAD2 NM_001003652 Sma- and Mad-related protein 2
SMAD3 NM005902 MAD, mothers against decapentaplegic homolog 3
SMARCBI NM001007468 SWI/SNF related, matrix associated, actin
SMARCD2 NM003077 SWI/SNF-related matrix-associated
SMCILI NM006306 SMC1 structural maintenance of chromosomes
SMC2L1 NM006444 structural maintenance of chromosomes 2-like 1
SMCR7 NM139162 Smith-Magenis syndrome chromosome region,
SMG7 NM014837 SMG-7 homolog isoform 3
SMNDCI NM005871 survival motor neuron domain containing 1
SMO NM005631 smoothened
SMPD3 NM018667 sphingomyelin phosphodiesterase 3, neutral
SMURF1 NM020429 Smad ubiquitination regulatory factor 1 isoform
SMYD4 NM 052928 SET and MYND domain containing 4
-67-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
SNFILK2 NM015191 SNF1-like kinase 2
SNIP NM025248 SNAP25-interacting protein
SNPH NM_014723 syntaphilin
SNRPN NM003097 small nuclear ribonucleoprotein polypeptide N
SNTB2 NM_130845 basic beta 2 syntrophin isoform b
SNURF NM005678 SNRPN upstream reading frame protein
SNXl 1 NM013323 sorting nexin 11
SNX13 NM_015132 sorting nexin 13
SNX27 NM_030918 sorting nexin family member 27
SOHLH2 NM017826 hypothetical protein LOC54937
SON NM_003103 SON DNA-binding protein isoform G
SORBSI NM_015385 sorbin and SH3 domain containing 1 isoform 2
SORCSI NM_001013031 SORCS receptor 1 isoform b
SORCS2 NM020777 VPS10 domain receptor protein SORCS 2
SOST NM_025237 sclerostin precursor
SOXl NM_005986 SRY (sex determining region Y)-box 1
SOX13 NM005686 SRY-box 13
SOX8 NM014587 SRY (sex determining region Y)-box 8
SP1 NM138473 Spl transcription factor
SP4 NM_003112 Sp4 transcription factor
SP6 NM_199262 Sp6 transcription factor
SP7 NM152860 osterix
SPACA4 NM133498 sperm acrosomal membrane protein 14
SPAG 16 NM001025436 sperm associated antigen 16 isoform 2
SPANXAI NM_013453 sperm protein associated with the nucleus, X
SPANXA2 NM145662 sperm protein associated with the nucleus, X
SPANXC NM022661 sperm protein associated with the nucleus, X
SPANXD NM032417 sperm protein associated with the nucleus, X
SPANXE NM145665 sperm protein associated with the nucleus, X
SPATA12 NM181727 spermatogenesis associated 12
SPATA18 NM145263 spermatogenesis associated 18 homolog
SPATA2 NM006038 spermatogenesis associated 2
SPECCI NM_001033554 spectrin domain with coiled-coils I NSP5a3a
SPG21 NM016630 acid cluster protein 33
SPIB NM_003121 Spi-B transcription factor (Spi-1/PU.1 related)
SPINLW 1 NM020398 serine peptidase inhibitor-like, with Kunitz and
SPIREl NM020148 spire homolog I
SPN NM001030288 sialophorin
SPOCK1 NM_004598 sparc/osteoiiectin, cwcv and kazal-like domains
SPOCK2 NM014767 sparc/osteonectin, cwcv and kazal-like domains
SPRN NM001012508 shadow of prion protein
SPRY3 NM_005840 sprouty homolog 3
SPRYD3 NM_032840 hypothetical protein LOC84926
SPTB NM001024858 spectrin beta isoform a
SPTBN2 NM006946 spectrin, beta, non-erythrocytic 2
SPTLC2 NM_004863 serine palmitoyltransferase, long chain base
SPTY2D1 NM_194285 hypothetical protein LOC144108
SRD5A1 NM001047 steroid-5-alpha-reductase 1
SRD5A2L2 NM_001010874 steroid 5 alpha-reductase 2-like 2
SRGAP2 NM_015326 SLIT-ROBO Rho GTPase activating protein 2
SRM NM_003132 spermidine synthase
SRP72 NM_006947 signal recognition particle 72kDa
SS18L1 NM015558 SS18-like protein I
SSBP3 NM 001009955 single stranded DNA binding protein 3 isoform c
-68-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
SSH2 NM033389 slingshot 2
SSR3 NM007107 signal sequence receptor gamma subunit
SSTR1 NM001049 somatostatin receptor 1
SSX1 NM005635 synovial sarcoma, X breakpoint 1
SSX8 NM_174961 synovial sarcoma, X breakpoint 8
ST6GAL1 NM003032 sialyltransferase 1 isoform a
ST6GALNAC4 NM175040 sialyltransferase 7D isoform b
ST7L NM_017744 suppression of tumorigenicity 7-like isoform 1
ST8SIA2 NM_006011 ST8 alpha-N-acetyl-neuraminide
ST8SIA4 NM_005668 ST8 alpha-N-acetyl-neuraminide
STAB2 NM_017564 stabilin 2 precursor
STAC NM003149 SH3 and cysteine rich domain
STAR NM_000349 steroidogenic acute regulator isoform 1
STARD13 NM052851 START domain containing 13 isoform gamma
STARD4 NM_139164 START domain containing 4, sterol regulated
STARD5 NM030574 StAR-related lipid transfer protein 5 isoform 2
STAT5A NM_003152 signal transducer and activator of transcription
STAU2 NM014393 staufen homolog 2
STCH NM006948 stress 70 protein chaperone,
STEAP3 NM001008410 dudulin 2 isoform b
STIPI NM006819 stress-induced-phosphoprotein 1
STKtO NM005990 serine/threonine kinase 10
STK16 NM001008910 serine/threonine kinase 16
STK32B NM018401 serine/threonine kinase 32B
STK35 NM080836 serine/threonine kinase 35
STK4 NM006282 serine/threonine kinase 4
STMN3 NM015894 SCG10-like-protein
STON1 NM006873 stonin 1
STOX2 NM020225 storkhead box 2
STRN NM003162 striatin, calmodulin binding protein
STRN3 NM_014574 nuclear autoantigen
STS NM_000351 steryl-sulfatase precursor
STX17 NM017919 syntaxin 17
STXBP 1 NM001032221 syntaxin binding protein 1 isoform b
STXBP5 NM139244 tomosyn
SUFU NM016169 suppressor of fused
SUHW 1 NM080740 suppressor of hairy wing homolog 1
SULTIA3 NM001017387 sulfotransferase family, cytosolic, IA,
SULTIA4 NM_001017389 sulfotransferase family, cytosolic, 1A,
SULTIEI NM005420 sulfotransferase, estrogen-preferring
SULT2A1 NM003167 sulfotransferase family, cytosolic, 2A,
SUMO3 NM_006936 small ubiquitin-like modifier protein 3
SURB7 NM_004264 SRB7 suppressor of RNA polymerase B homolog
SURF4 NM033161 surfeit 4
SURF5 NM133640 surfeit 5 isoform b
SUSD2 NM019601 sushi domain containing 2
SUSD4 NM017982 sushi domain containing 4 isoform a
SUV420H 1 NM_016028 suppressor of variegation 4-20 homolog 1 isoform
SV2A NM_014849 synaptic vesicle glycoprotein 2
SV2B NM_014848 synaptic vesicle protein 2B homolog
SVOP NM018711 SV2 related protein
SWAP70 NM015055 SWAP-70 protein
SYBL1 NM_005638 synaptobrevin-like 1
SYN2 NM 003178 synapsin II isoform IIb
-69-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
SYN3 NM_133632 synapsin III isoform IIIb
SYNGRl NM004711 synaptogyrin 1 isoform la
SYNJ2 NM003898 synaptojanin 2
SYNJ2BP NM018373 synaptojanin 2 binding protein
SYT10 NM198992 synaptotagmin 10
SYT11 NM152280 synaptotagmin 12
SYT3 NM_032298 synaptotagmin 3
SYT6 NM_205848 synaptotagmin VI
SYT7 NM_004200 synaptotagmin VII
SYT9 NM175733 synaptotagmin IX
TACC1 NM006283 transforming, acidic coiled-coil containing
TACSTD2 NM_002353 tumor-associated calcium signal transducer 2
TADA3L NM133480 transcriptional adaptor 3-like isoform b
TAF12 NM005644 TAF12 RNA polymerase II, TATA box binding
TAFIL NM153809 TBP-associated factor RNA polymerase 1-like
TAOK2 NM004783 TAO kinase 2 isoform 1
TAPBP NM_003190 tapasin isoform 1 precursor
TARDBP NM_007375 TAR DNA binding protein
TATDN2 NM014760 TatD DNase domain containing 2
TAZ NM181314 tafazzin isoform 5
TBCLDI NM015173 TBC1 (tre-2/USP6, BUB2, cdc16) domain family,
TBCLDIOB NM015527 TBC1 domain family, member lOB
TBC1D14 NM020773 TBC1 domain family, member 14
TBC1D20 NM_144628 TBC1 domain family, member 20
TBC1D22A NM_014346 TBC1 domain family, member 22A
TBC1D22B NM_017772 TBC1 domain family, member 22B
TBCID2B NM015079 TBC1 domain family, member 2B
TBL1X NM005647 transducin beta-like 1X
TBX21 NM013351 T-box 21
TBX3 NM005996 T-box 3 protein isoform 1
TCEAL7 NM152278 hypothetical protein LOC56849
TCF15 NM004609 basic helix-loop-helix transcription factor 15
TCF20 NM005650 transcription factor 20 isoform 1
TCF21 NM198392 transcription factor 21
TCF7 NM003202 transcription factor 7(T-cell specific,
TCHHLI NM001008536 trichohyalin-like 1
TCHP NM032300 trichoplein
TCN2 NM000355 transcobalamin II precursor
TCPIO NM004610 t-complex 10
TCTA NM_022171 T-cell leukemia translocation altered gene
TEAD1 NM021961 TEA domain family member 1
TEAD3 NM_003214 TEA domain family member 3
TERT NM198253 telomerase reverse transcriptase isoform 3
TEX2 NM018469 testis expressed sequence 2
TEX261 NM_144582 testis expressed sequence 261
TFAP2B NM003221 transcription factor AP-2 beta (activating
TFF3 NM_003226 trefoil factor 3 precursor
TGIF2 NM021809 TGFB-induced factor 2
TGM2 NM_004613 transglutaminase 2 isoform a
THADA NM198554 thyroid adenoma associated isoform 2
THAP6 NM 144721 THAP domain containing 6
THBSI NM_003246 thrombospondin 1 precursor
THEDCI NM018324 thioesterase domain containing 1 isoform 1
THEM4 NM 053055 thioesterase superfamily member 4 isoform a
-70-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
THEM5 NM182578 thioesterase superfamily member 5
THY1 NM_006288 Thy-1 cell surface antigen
TIA1 NM022037 TIAl protein isoform 1
TIGD5 NM032862 tigger transposable element derived 5
TIMM17A NM006335 translocase of inner mitochondrial membrane 17
TK2 NM004614 thymidine kinase 2, mitochondrial
TKTL1 NM012253 transketolase-like 1
TKTL2 NM032136 transketolase-like 2
TLK2 NM006852 tousled-like kinase 2
TLN2 NM015059 talin 2
TLR10 NM_001017388 toll-like receptor 10 precursor
TLX2 NM016170 T-cell leukemia, homeobox 2
TM2D2 NM001024380 TM2 domain containing 2 isoform b
TM4SF I 1 NM_015993 plasmolipin
TM4SF20 NM024795 transmembrane 4 L six family member 20
TM7SF4 NM030788 dendritic cell-specific transmembrane protein
TMBIM 1 NM022152 transmembrane BAX inhibitor motif containing 1
TMC5 NM024780 transmembrane channel-like 5
TMCC3 NM020698 transmembrane and coiled-coil domains 3
TMED2 NM006815 coated vesicle membrane protein
TMEM1 NM001001723 transmembrane protein 1 isoform b
TMEM105 NM_178520 hypothetical protein LOC284186
TMEM106A NM_145041 hypothetical protein LOC113277
TMEM113 NM025222 hypothetical protein PR02730
TMEM116 NM_138341 hypothetical protein LOC89894
TMEM 119 NM181724 hypothetical protein LOC338773
TMEM12 NM152311 transmembrane protein 12
TMEM121 NM025268 hole protein
TMEM127 NM017849 hypothetical protein LOC55654
TMEM132D NM_133448 hypothetical protein LOC121256
TMEM 134 NM_025124 hypothetical protein LOC80194
TMEM140 NM_018295 hypothetical protein LOC55281
TMEM148 NM153238 hypothetical protein LOC197196
TMEM16B NM020373 transmembrane protein 16B
TMEM16F NM001025356 transmembrane protein 16F
TMEM 16G NM001001891 transmembrane protein 16G isoform NGEP long
TMEM19 NM018279 transmembrane protein 19
TMEM29 NM014138 hypothetical protein LOC29057
TMEM30B NM001017970 transmembrane protein 30B
TMEM33 NM018126 transmembrane protein 33
T'MEM40 NM018306 transmembrane protein 40
TMEM41B NM015012 transmembrane protein 41 B
TMEM43 NM024334 transmembrane protein 43
TMEM53 NM024587 transmembrane protein 53
TMEM56 NM_152487 transmembrane protein 56
TMEM58 NM_198149 transmembrane protein 58
TMEM60 NM032936 transmembrane protein 60
TMEM63A NM014698 transmembrane protein 63A
TMEM69 NM016486 transmembrane protein 69
TMEM80 NM 174940 hypothetical protein LOC283232
TMEM97 NM014573 hypothetical protein MAC30
TMLHE NM018196 trimethyllysine hydroxylase, epsilon
TMOD2 NM_014548 tropomodulin 2 (neuronal)
TMPRSSIIB NM 182502 transmembrane protease, serine 11B
-71-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
TMPRSS3 NM024022 transmembrane protease, serine 3 isoform 1
TMPRSS4 NM019894 transmembrane protease, serine 4 isoform 1
TNFAIPI NM021137 tumor necrosis factor, alpha-induced protein 1
TNFAIP8L1 NM152362 tumor necrosis factor, alpha-induced protein
TNFAIP8L3 NM207381 tumor necrosis factor, alpha-induced protein
TNFRSFIOB NM003842 tumor necrosis factor receptor superfamily,
TNFRSFIOC NM003841 tumor necrosis factor receptor superfamily,
TNFRSFIOD NM003840 tumor necrosis factor receptor superfamily,
TNFRSF19 NM148957 tumor necrosis factor receptor superfamily,
TNFRSF8 NM_001243 tumor necrosis factor receptor superfamily,
TNFSFIO NM003810 tumor necrosis factor (ligand) superfamily,
TNFSF4 NM_003326 tumor necrosis factor (ligand) superfamily,
TNFSF9 NM_003811 tumor necrosis factor (ligand) superfamily,
TNIP3 NM024873 hypothetical protein LOC79931
TNNIl NM003281 troponin I, skeletal, slow
TNP 1 NM003284 transition protein 1(during histone to
. TNPO2 NM013433 transportin 2 (importin 3, karyopherin beta 2b)
TNRC15 NM_015575 trinucleotide repeat containing 15
TNRC6B NM_001024843 trinucleotide repeat containing 6B isoform 2
TNS3 NM_022748 tensin-like SH2 domain containing I
TOB2 NM016272 transducer of ERBB2, 2
TOLLIP NM_019009 toll interacting protein
TOM1L2 NM_001033551 target of mybl-like 2 isoform 1
TOMM40L NM032174 translocase of outer mitochondrial membrane 40
TOP2A NM_001067 DNA topoisomerase II, alpha isozyme
TOR2A NM130459 torsin family 2, member A
TOR3A NM_022371 torsin family 3, member A
TP53 NM000546 tumor protein p53
TP53INP1 NM_033285 tumor protein p53 inducible nuclear protein 1
TP53RK NM_033550 p53-related protein kinase
TPD52L3 NM033516 protein kinase NYD-SP25 isoform 1
TPM3 NM153649 tropomyosin 3 isoform 2
TPM4 NM_003290 tropomyosin 4
TPP1 NM_000391 tripeptidyl-peptidase I precursor
TRAF7 NM032271 ring finger and WD repeat domain 1 isoform 1
TRAIP NM005879 TRAF interacting protein
TRAM2 NM012288 translocation-associated membrane protein 2
TRAPPC3 NM_014408 BET3 homolog
TRIAD3 NM207111 TRIAD3 protein isoform a
TRIB3 NM021158 tribbles 3
TRIM10 NM_006778 tripartite motif-containing 10 isoform 1
TRIM14 NM_033220 tripartitemotifproteinTRIM14isoformalpha
TRIM22 NM_006074 tripartite motif-containing 22
TRIM24 NM_003852 transcriptional intermediary factor 1 alpha
TRIM25 NM_005082 tripartite motif-containing 25
TRIM26 NM_003449 tripartite motif-containing 26
TRIM29 NM_012101 tripartite motif protein TRIM29 isoform alpha
TRIM35 NM_015066 tripartite motif-containing 35 isoform 1
TRIM37 NM_015294 tripartite motif-containing 37 protein
TRIM44 NM017583 DIPB protein
TRIM5 NM_033034 tripartite motif protein TRIM5 isoform alpha
TRIM52 NM_032765 hypothetical protein LOC84851
TRIM55 NM_033058 ring finger protein 29 isoform 2
TRIM56 NM 030961 tripartite motif-containing 56
-72-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
TRIM58 NM015431 tripartite motif-containing 58
TRIM62 NM_018207 tripartite motif-containing 62
TRIM65 NM173547 tripartite motif-containing 65
TRIM67 NM_001004342 hypothetical protein LOC440730
TRIM73 NM_198924 hypothetical protein LOC375593
TRIM74 NM198853 hypothetical protein LOC378108
TRIM9 NM052978 tripartite motif protein 9 isoform 2
TRIO NM_007118 triple functional domain (PTPRF interacting)
TRIT1 NM017646 tRNA isopentenyltransferase 1
TRMT5 NM020810 tRNA-(N1G37) methyltransferase
TRPC5 NM_012471 transient receptor potential cation channel,
TRPM1 NM002420 transient receptor potential cation channel,
TRPM2 NM001001188 transient receptor potential cation channel,
TRPS 1 NM014112 zinc finger transcription factor TRPS I
TRPV5 NM_019841 transient receptor potential cation channel,
TRPV6 NM018646 transient receptor potential cation channel,
TRUB2 NM015679 TruB pseudouridine (psi) synthase homolog 2
TSC1 NM000368 tuberous sclerosis 1 protein isoform 1
TSC22D3 NM001015881 TSC22 domain family, member 3 isoform 3
TSN NM004622 translin
TSNAX NM005999 translin-associated factor X
TSPAN13 NM014399 tetraspanNET-6
TSPAN15 NM012339 transmembrane 4 superfamily member 15
TSPAN2 NM005725 tetraspan 2
TSPAN9 NM006675 tetraspanin 9
TSPYL5 NM033512 TSPY-like 5
TTBK1 NM032538 tau tubulin kinase 1
TTBK2 NM173500 tau tubulin kinase 2
TTC12 NM017868 tetratricopeptide repeat domain 12
TTC19 NM017775 tetratricopeptide repeat domain 19
TTC21B NM024753 tetratricopeptide repeat domain 21B
TTF2 NM_003594 transcription termination factor, RNA polymerase
TTL NM153712 tubulin tyrosine ligase
TTLL2 NM031949 tubulin tyrosine ligase-like family, member 2
TTLL3 NM_001025930 tubulin tyrosine ligase-like family, member 3
TTLL6 NM173623 hypothetical protein LOC284076
TTLL9 NM001008409 tubulin tyrosine ligase-like family, member 9
TTYH2 NM032646 tweety 2 isoform 1
TTYH3 NM025250 tweety 3
TUB NM_003320 tubby isoform a
TUBB NM178014 tubulin, beta polypeptide
TUBB 1 NM030773 beta tubulin 1, class VI
TUBB4 NM006087 tubulin, beta 4
TUBG1 NM_001070 tubulin, gamma 1
TUBG2 NM016437 tubulin, gamma 2
TUBGCP6 NM001008658 tubulin, gamma complex associated protein 6
TUFT1 NM020127 tuftelin 1
TULP3 NM_003324 tubby like protein 3
TUSC5 NM172367 LOST1
TXLNA NM175852 taxilin
TXLNB NM153235 muscle-derived protein 77
TXNDC13 NM_021156 thioredoxin domain containing 13
TXNDC4 NM_015051 thioredoxin domain containing 4 (endoplasmic
TXNL4B NM 017853 thioredoxin-like 4B
-73-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
TXNRD 1 NM003330 thioredoxin reductase l
TYSNDl NM173555 trypsin domain containing 1 isoform a
UACA NM001008224 uveal autoantigen with coiled-coil domains and
UAPILI NM_207309 UDP-N-acteylglucosamine pyrophosphorylase 1-like
UBE2E1 NM003341 ubiquitin-conjugating enzyme E2E 1 isoform 1
UBE2E3 NM006357 ubiquitin-conjugating enzyme E2E 3
UBE2G1 NM003342 ubiquitin-conjugating enzyme E2G 1 isoform 1
UBE2I NM003345 ubiquitin-conjugating enzyme E21
UBE2J1 NM_016021 ubiquitin-conjugating enzyme E2, Jl
UBE2Q1 NM_017582 ubiquitin-conjugating enzyme E2Q
UBE2R2 NM_017811 ubiquitin-conjugating enzyme UBC3B
UBE3B NM_183414 ubiquitin protein ligase E3B isoform b
UBE3C NM_o14671 ubiquitin protein ligase E3C
UBL3 NM007106 ubiquitin-like 3
UBL7 NM032907 ubiquitin-like 7 (bone marrow stromal
UBNl NM016936 ubinuclein 1
UBOX5 NM_014948 U-box domain containing 5 isofonn a
UBXD2 NM_014607 UBX domain containing 2
UBXD8 NM_014613 UBX domain containing 8
UGDH NM_003359 UDP-glucose dehydrogenase
UGT1A1 NM_000463 UDP glycosyltransferase 1 family, polypeptide Al
UGT1A10 NM_019075 UDP glycosyltransferase 1 family, polypeptide
UGT1A3 NM_019093 UDP glycosyltransferase 1 family, polypeptide A3
UGT1A4 NM007120 UDP glycosyliransferase 1 family, polypeptide A4
UGT1A5 NM_o19078 UDP glycosyltransferase 1 family, polypeptide A5
UGT1A6 NM_001072 UDP glycosyltransferase 1 family, polypeptide A6
UGT1A7 NM_019077 UDP glycosyltransferase 1 family, polypeptide A7
UGT1A8 NM_019076 UDP glycosyltransferase 1 family, polypeptide A8
UGTlA9 NM_021027 UDP glycosyltransferase 1 family, polypeptide A9
ULBP1 NM_025218 UL16 binding protein 1
UMOD NM001008389 uromodulin precursor
UNC13D NM 199242 unc-13 homolog D
UNC45B NM_001033576 cardiomyopathy associated 4 isoform 2
UNC5A NM133369 netrin receptor Unc5hl
UNC5D NM080872 netrin receptor Unc5h4
UNC93A NM_018974 unc-93 homolog A
UPF 1 NM_002911 regulator of nonsense transcripts I
UPF2 NM015542 UPF2 regulator of nonsense transcripts homolog
USF1 NM_007122 upstream stimulatory factor 1 isoform 1
USP18 NM_017414 ubiquitin specific protease 18
USP2 NM_004205 ubiquitin specific protease 2 isoform a
USP37 NM_020935 ubiquitin specific protease 37
USP46 NM_022832 ubiquitin specific protease 46
USP47 NM017944 ubiquitin specific protease 47
USP49 NM018561 ubiquitin specific protease 49
UTP14C NM021645 UTP14, U3 small nucleolar ribonucleoprotein,
UTS2D NM198152 urotensin 2 domain containing
UVRAG NM003369 UV radiation resistance associated gene
VANGL2 NM020335 vang-like 2 (van gogh, Drosophila)
VAPB NM004738 VAMP-associated protein B/C
VASH1 NM014909 vasohibin 1
VAT1 NM_006373 vesicle amine transport protein 1
VAXI NM199131 ventral anterior homeobox 1
VBP 1 NM 003372 von Hippel-Lindau binding protein 1
-74-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
VCPIPI NM_025054 valosin containing protein (p97)/p47 complex
VDAC1 NM003374 voltage-dependent anion channel 1
VEGF NM001025366 vascular endothelial growth factor isoform a
VGLL3 NM016206 colon carcinoma related protein
VHL NM000551 von Hippel-Lindau tumor suppressor isoform I
VIPRl NM_004624 vasoactive intestinal peptide receptor 1
VISA NM_020746 virus-induced signaling adapter
VMD2L3 NM_152439 vitelliform macular dystrophy 2-like 3
VPREBl NM007128 immunoglobulin iota chain preproprotein
VPS13A NM_001018037 vacuolar protein sorting 13A isoform C
VPS13D NM015378 vacuolar protein sorting 13D isoform I
VPS16 NM_022575 vacuolar protein sorting 16 isoform 1
VPS26A NM004896 vacuolar protein sorting 26 homolog A isoform 1
VPS37A NM_152415 hepatocellular carcinoma related protein 1
VPS45A NM_007259 vacuolar protein sorting 45A
VPS4B NM004869 vacuolar protein sorting factor 4B
VPS52 NM022553 suppressor of actin mutations 2-like
VPS72 NM005997 transcription factor-like 1
VSIG4 NM_007268 V-set and immunoglobulin domain containing 4
VSIG9 NM_173799 hypothetical protein LOC201633
VTCN 1 NM024626 V-set domain containing T cell activation
WASF3 NM006646 WAS protein family, member 3
WASPIP NM003387 WASP-interacting protein
WBP2 NM012478 WW domain binding protein 2
WBP5 NM001006612 WW domain binding protein 5
WBSCR17 NM_022479 UDP-Ga1NAc:polypeptide
WDFY3 NM014991 WD repeat and FYVE domain containing 3 isoform
WDR17 NM170710 WD repeat domain 17 isoform 1
WDR22 NM003861 Breakpoint cluster region protein, uterine
WDR23 NM025230 WD repeat domain 23 isoform 1
WDR33 NM018383 WD repeat domain 33 isoform 1
WDR36 NM139281 WD repeat domain 36
WDR42B NM001017930 WD repeat domain 42B
WDR48 NM020839 WD repeat domain 48
WDR50 NM016001 WD repeat domain 50
WDR6 NM018031 WD repeat domain 6 protein
WDR64 NM_144625 hypothetical protein LOC128025
WDR68 NM005828 WD-repeat protein
WDR7 NM015285 rabconnectin-3 beta isoform 1
WDR81 NM_152348 alpha-2-plasmin inhibitor
WDTC1 NM_015023 WD and tetratricopeptide repeats 1
WFDC1 NM021197 WAP four-disulfide core domain I precursor
WFS1 NM006005 wolframin
WHSCl NM014919 Wolf-Hirschhorn syndrome candidate 1 protein
WIGl NM022470 p53 target zinc finger protein isoform 1
WIRE NM133264 WIRE protein
WNK4 NM032387 WNK lysine deficient protein kinase 4
WNT2 NM_003391 wingless-type MMTV integration site family
WNT5B NM030775 wingless-type MMTV integration site family,
WSB1 NM_015626 WD repeat and SOCS box-containing 1 isoform 1
WWC3 NM015691 hypothetical protein LOC55841
WWP2 NM007014 WW domain containing E3 ubiquitin protein ligase
XK NM021083 McLeod syndrome-associated, Kell blood group
XKR5 NM 207411 XK-related protein 5a
-75-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
XLKD1 NM_006691 extracellular link domain containing 1
XPO4 NM_022459 exportin 4
XPO5 NM020750 exportin 5
XRCC2 NM005431 X-ray repair cross complementing protein 2
XRNl NM019001 5'-3' exoribonuclease 1
XYLB NM005108 xylulokinase homolog
YAF2 NM001012424 YY 1 associated factor 2 isoform b
YARS NM003680 tyrosyl-tRNA synthetase
YEATS2 NM_018023 YEATS domain containing 2
YIF1B NM_033557 Yipl interacting factor homolog B isoform 2
YPELl NM013313 yippee-like 1
YPEL2 NM001005404 yippee-like 2
YPEL5 NM016061 yippee-like 5
YTHDC2 NM022828 YTH domain containing 2
YWHAB NM003404 tyrosine 3-monooxygenase/tryptophan
ZADH1 NM_152444 zinc binding alcohol dehydrogenase, domain
ZADH2 NM175907 zinc binding alcohol dehydrogenase, domain
ZAK NM016653 MLK-related kinase isoform 1
ZBTB40 NM_014870 zinc finger and BTB domain containing 40
ZBTB41 NM_194314 zinc fmger and BTB domain containing 41
ZBTB5 NM014872 zinc finger and BTB domain containing 5
ZBTB6 NM_006626 zinc fmger protein 482
ZC3H12A NM_025079 zinc finger CCCH-type containing 12A
ZCCHC14 NM015144 zinc finger, CCHC domain containing 14
ZDHHC11 NM024786 zinc fmger, DHHC domain containing 11
ZDHHC2 NM016353 rec
ZDHHC23 NM_173570 zinc finger, DHHC domain containing 23
ZDHHC4 NM_018106 zinc finger, DHHC domain containing 4
ZDHHC9 NM_001008222 zinc finger, DHHC domain containing 9
ZFAND2B NM138802 zinc finger, AN1-type domain 2B
ZFP30 NM014898 zinc finger protein 30 homolog
ZFP36L1 NM004926 butyrate response factor 1
ZFP41 NM 173832 zinc finger protein 41 homolog
ZFP91 NM053023 zinc finger protein 91 isoform 1
ZFP95 NM_014569 zinc finger protein 95 homolog
ZFYVE16 NM014733 endosome-associated FYVE-domain protein
ZFYVE27 NM001002261 zinc finger, FYVE domain containing 27 isoform
ZFYVE28 NM020972 zinc finger, FYVE domain containing 28
ZGPAT NM181484 zinc fmger, CCCH-type with G patch domain
ZHX3 NM015035 zinc fingers and homeoboxes 3
ZIC1 NM003412 zinc finger protein of the cerebellum 1
ZIC3 NM003413 zinc finger protein of the cerebellum 3
ZIC4 NM032153 zinc finger protein of the cerebellum 4
ZIM3 NM_052882 zinc fmger, imprinted 3
ZKSCANI NM_003439 zinc fmger protein 36
ZMYM3 NM005096 zinc finger protein 261
ZMYM4 NM005095 zinc finger protein 262
ZMYND11 NM006624 zinc finger, MYND domain containing 11 isoform
ZMYND19 NM138462 zinc finger, MYND domain containing 19
ZNF132 NM003433 zinc finger protein 132 (clone pHZ-12)
ZNF 136 NM_003437 zinc fmger protein 136 (clone pHZ-20)
ZNF137 NM_003438 zinc finger protein 137 (clone pHZ-30)
ZNF157 NM_003446 zinc finger protein 157
ZNF160 NM 033288 zinc finger protein 160
-76-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
ZNF 167 NM018651 zinc finger protein ZFP isoform 1
ZNF17 NM_006959 zinc finger protein 17
ZNF 182 NM_001007088 zinc finger protein 21 isofonn 2
ZNF187 NM_001023560 zinc fingerprotein 187
ZNF192 NM006298 zinc fingerprotein 192
ZNF200 NM003454 zinc finger protein 200 isoform 1
ZNF202 NM003455 zinc finger protein 202
ZNF217 NM_006526 zinc finger protein 217
ZNF226 NM_001032374 zinc finger protein 226 isoform b
ZNF236 NM_007345 zinc finger protein 236
ZNF264 NM_003417 zinc finger protein 264
ZNF265 NM_005455 zinc finger protein 265 isoform 2
ZNF272 NM_006635 zinc finger protein 272
ZNF276 NM_152287 zinc finger protein 276 homolog
ZNF294 NM015565 zinc finger protein 294
ZNF300 NM_052860 zinc finger protein 300
ZNF31 NM145238 zinc finger protein 31
ZNF313 NM_018683 zinc finger protein 313
ZNF317 NM_020933 zinc finger protein 317
ZNF318 NM_014345 zinc finger protein 318
ZNF320 NM_207333 zinc finger protein 320
ZNF322A NM024639 zinc finger protein 322A
ZNF322B NM_199005 zinc finger protein 322B
ZNF329 NM_024620 zinc finger protein 329
ZNF333 NM_032433 zinc finger protein 333
ZNF33A NM_006974 zinc finger protein 33A
ZNF33B NM_006955 zinc finger protein 33B
ZNF346 NM_012279 zinc finger protein 346
ZNF365 NM199451 zinc finger protein 365 isoform C
ZNF37A NM_001007094 zinc finger protein 37a
ZNF384 NM133476 nuclear matrix transcription factor 4 isoform a
ZNF385 NM_015481 zinc finger protein 385
ZNF394 NM_032164 zinc finger protein 99
ZNF397 NM032347 zinc finger protein 397
ZNF41 NM007130 zinc finger protein 41
ZNF425 NM001001661 zinc finger protein 425
ZNF426 NM024106 zinc finger protein 426
ZNF43 NM_003423 zinc finger protein 43 (HTF6)
ZNF430 NM_025189 zinc finger protein 430
ZNF445 NM_181489 zinc finger protein 445
ZNF471 NM_020813 zinc finger protein 471
ZNF480 NM_144684 zinc finger protein 480
ZNF483 NM001007169 zinc fmger protein 483 isoform b
ZNF485 NM145312 zinc finger protein 485
ZNF490 NM_020714 zinc finger protein 490
ZNF493 NM175910 zinc finger protein 493
ZNF497 NM_198458 zinc finger protein 497
ZNF498 NM_145115 zinc finger protein 498
ZNF500 NM_021646 zinc finger protein 500
ZNF514 NM_032788 zinc finger protein 514
ZNF526 NM_133444 zinc finger protein 526
ZNF529 NM_020951 zinc finger protein 529
ZNF543 NM_213598 zinc finger protein 543
ZNF545 NM 133466 zinc finger protein 545
-77-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
ZNF547 NM_173631 zinc finger protein 547
ZNF562 NM_017656 zinc finger protein 562
ZNF565 NM_152477 zinc finger protein 565
ZNF570 NM_144694 zinc finger protein 570
ZNF571 NM_016536 zinc finger protein 571
ZNF577 NM_032679 zinc finger protein 577
ZNF581 NM016535 zinc finger protein 581
ZNF583 NM152478 zinc finger protein 583
ZNF592 NM014630 zinc finger protein 592
ZNF599 NM001007247 zinc finger protein 599 isofonn b
ZNF600 NM_198457 zinc fmger protein 600
ZNF605 NM_183238 zinc finger protein 605
ZNF607 NM032689 zinc finger protein 607
ZNF621 NM198484 zinc finger protein 621
ZNF622 NM_033414 zinc finger protein 622
ZNF623 NM014789 zinc finger protein 623
ZNF650 NM172070 zinc finger protein 650
ZNF651 NM145166 zinc finger protein 651
ZNF652 NM014897 zinc finger protein 652
ZNF660 NM_173658 zinc fmger protein 660
ZNF662 NM_207404 zinc finger protein 662
ZNF677 NM_182609 zinc finger protein 677
ZNF694 NM_001012981 zinc finger protein 694
ZNF696 NM030895 zinc finger protein 696
ZNF702 NM_024924 zinc finger protein 702
ZNF705A NM001004328 hypothetical protein LOC440077
ZNF708 NM_021269 zinc finger protein 15-like 1(KOX 8)
ZNF81 NM_007137 zinc finger protein 81 (HFZ20)
ZNF93 NM001004126 zinc finger protein 93 isoform b
ZNRF2 NM_147128 zinc finger/RING finger 2
ZSCAN2 NM_181877 zinc finger protein 29 isoform 1
ZSWIM4 NM023072 zinc finger, SWIM domain containing 4
ZWILCH NM017975 Zwilch
ZWINT NM001005414 ZW 10 interactor isofonn c
ZYG 11 A NM_001004339 hypothetical protein LOC440590
ZYG11B NM 024646 hypothetical protein LOC79699
Table 4. hsa-miR-143 targets that exhibited altered mRNA expression levels in
human cancer cells after transfection with pre-miR hsa-miR-143. for Ref Seq ID
reference - Pruitt et al., 2005.
RefSeq
Gene Symbol Transcript ID Descri tion
ATP6VIA NM 001690 ATPase, H+ transporting, lysosoma170kD, VI
ATXN1 NM 000332 ataxin 1
CCND1 NM 053056 cyclin D 1
CLIC4 NM 013943 chloride intracellular channel 4
DDAHI NM 012137 dimethylarginine dimethylaminohydrolase 1
GALC NM 000153 galactosylceramidase isoform a precursor
GATM NM001482 glycine amidinotransferase (L-arginine:glycine
GOLPH2 NM 016548 golgi phosphoprotein 2
IGFBP3 NM 000598 insulin-like growth factor binding protein 3
LM04 NM 006769 LIM domain only 4
MCL1 NM 021960 myeloid cell leukemia sequence 1 isoform 1
-78-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
PROSC NM 007198 proline synthetase co-transcribed homolog
RAB11FIP1 NM001002814 Rab coupling protein isoform 3
RBL1 NM002895 retinoblastoma-like protein 1 isoform a
RHOBTB 1 NM 001032380 Rho-related BTB domain containing 1
SERPINE1 NM 000602 plasmino en activator inhibitor-1
SLC35B1 NM 005827 solute carrier family 35, member B1
WASPIP NM 003387 WASP-interacting protein
WDR50 NM 016001 WD repeat domain 50
The predicted gene targets of hsa-miR-143 whose mRNA expression levels
are affected by hsa-miR-143 represent particularly useful candidates for
cancer
therapy and therapy of other diseases through manipulation of their expression
levels.
Certain embodiments of the invention include determining expression of one
or more marker, gene, or nucleic acid segment representative of one or more
genes,
by using an amplification assay, a hybridization assay, or protein assay, a
variety of
which are well known to one of ordinary skill in the art. In certain aspects,
an
amplification assay can be a quantitative amplification assay, such as
quantitative RT-
PCR or the like. In still further aspects, a hybridization assay can include
array
hybridization assays or solution hybridization assays. The nucleic acids from
a
sample may be labeled from the sample and/or hybridizing the labeled nucleic
acid to
one or more nucleic acid probes. Nucleic acids, mRNA, and/or nucleic acid
probes
may be coupled to a support. Such supports are well known to those of ordinary
skill
in the art and include, but are not limited to glass, plastic, metal, or
latex. In particular
aspects of the invention, the support can be planar or in the form of a bead
or other
geometric shapes or configurations known in the art. Proteins are typically
assayed
by immunoblotting, chromatography, or mass spectrometry or other methods known
to those of ordinary skill in the art.
The present invention also concerns kits containing compositions of the
invention or compositions to implement methods of the invention. In some
embodiments, kits can be used to evaluate one or more marker molecules, and/or
express one or more miRNA or miRNA inhibitor. In certain embodiments, a kit
contains, contains at least or contains at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37,
38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,
57, 58, 59, 60,
61, 100, 150, 200 or more probes, recombinant nucleic acid, or synthetic
nucleic acid
molecules related to the markers to be assessed or an miRNA or miRNA inhibitor
to
-79-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
be expressed or modulated, and may include any range or combination derivable
therein. Kits may comprise components, which may be individually packaged or
placed in a container, such as a tube, bottle, vial, syringe, or other
suitable container
means. Individual components may also be provided in a kit in concentrated
amounts; in some embodiments, a component is provided individually in the same
concentration as it would be in a solution with other components.
Concentrations of
components may be provided as lx, 2x, 5x, lOx, or 20x or more. Kits for using
probes, synthetic nucleic acids, recombinant nucleic acids, or non-synthetic
nucleic
acids of the invention for therapeutic, prognostic, or diagnostic applications
are
included as part of the invention. Specifically contemplated are any such
molecules
corresponding to any miRNA reported to influence biological activity or
expression
of one or more marker gene or gene pathway described herein. In certain
aspects,
negative and/or positive controls are included in some kit embodiments. The
control
molecules can be used to verify transfection efficiency and/or control for
transfection-
induced changes in cells.
Certain embodiments are directed to a kit for assessment of a pathological
condition or the risk of developing a pathological condition in a patient by
nucleic
acid profiling of a sample comprising, in suitable container means, two or
more
nucleic acid hybridization or amplification reagents. The kit can comprise
reagents
for labeling nucleic acids in a sample and/or nucleic acid hybridization
reagents. The
hybridization reagents typically comprise hybridization probes. Amplification
reagents include, but are not limited to amplification primers, reagents, and
enzymes.
In some embodiments of the invention, an expression profile is generated by
steps that include: (a) labeling nucleic acid in the sample; (b) hybridizing
the nucleic
acid to a number of probes, or amplifying a number of nucleic acids, and (c)
detennining and/or quantitating nucleic acid hybridization to the probes or
detecting
and quantitating amplification products, wherein an expression profile is
generated.
See U.S. Provisional Patent Application 60/575,743 and the U.S. Provisional
Patent
Application 60/649,584, and U.S. Patent Application Serial No. 11/141,707 and
U.S.
Patent Application Serial No. 11/273,640, all of which are hereby incorporated
by
reference.
-80-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
Methods of the invention involve diagnosing and/or assessing the prognosis of
a patient based on a miRNA and/or a marker nucleic acid expression profile. In
certain embodiments, the elevation or reduction in the level of expression of
a
particular gene or genetic pathway or set of nucleic acids in a cell is
correlated with a
disease state or pathological condition compared to the expression level of
the same in
a normal or non-pathologic cell or tissue sample. This correlation allows for
diagnostic and/or prognostic methods to be carried out when the expression
level of
one or more nucleic acid is measured in a biological sample being assessed and
then
compared to the expression level of a normal or non-pathologic cell or tissue
sample.
It is specifically contemplated that expression profiles for patients,
particularly those
suspected of having or having a propensity for a particular disease or
condition such
as cancer, can be generated by evaluating any of or sets of the miRNAs and/or
nucleic
acids discussed in this application. The expression profile that is generated
from the
patient will be one that provides information regarding the particular disease
or
condition. In many embodiments, the profile is generated using nucleic acid
hybridization or amplification, (e.g., array hybridization or RT-PCR). In
certain
aspects, an expression profile can be used in conjunction with other
diagnostic and/or
prognostic tests, such as histology, protein profiles in the serum and/or
cytogenetic
assessment.
-81-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
oo
N U U}.~
'~j ["tl tO ~ p N
U cs ai apo m U v ~~~
r/~ O b9 O 80 0~ ~ iC N N Q~ Rf ,~
p P7 a, V)
O d M y ~ppp N N " o " p Cp q Q~y L1 p 7 CS oo y " ~ O 2 2 o R A ^ p,
wy roN ~, a~ Y m .~oUri.x au.-.UUU
cd a P.
x N
y '^p 0 id
s. . o
4~ N v q G] ~u m~ ^^' rn ~ C7 Q: Y o 0~ f~i ^ p, ~V
o o
1-4 o oN.w
N No P
x 5
=~ ... ?'' q cUa F
fl W d
aF o
U 0
7
04 OD U U o oNo
b U x fA U o~, vi m
C7 p o
G ' U U U a U U o
cd U Lj U 0 a U `~ o,~ 02
z UF 0 o j.
U~ U cUa F
V)
U ~
m a a a~ 0] a U cn U U a ~? o o ~~.~y
"~ ~ rUii U cU vi CJ U CJ U x U U CJ ~ A Cj x o a`tli
U zoo w w ca x c~ co w a z~~ a~i =. 0
y U
00
U a.~
u
a a a ~ w
1i:it1
~c ts 27 Y7 es <a o U m E
o d r, `~ a Ga . C7 `" a~ o o p U
v~ C7 0. 0 0~ ~-1 P. aa F s. .~ `~ o U
H o~C~7 =~vUi
q Q C7 P" v Q CQ ov Um cUi U~ a a a r~ F F ~v um c7 In
1III
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
The methods can further comprise one or more of the steps including: (a)
obtaining a
sample from the patient, (b) isolating nucleic acids from the sample, (c)
labeling the nucleic
acids isolated from the sample, and (d) hybridizing the labeled nucleic acids
to one or more
probes. Nucleic acids of the invention include one or more nucleic acid
comprising at least
one segment having a sequence or complementary sequence of to a nucleic acid
representative of one or more of genes or markers in Table 1, 3, 4, and/or 5.
It is contemplated that any method or composition described herein can be
implemented with respect to any other method or composition described herein
and that
different embodiments may be combined. It is specifically contemplated that
any methods
and compositions discussed herein with respect to miRNA molecules, miRNA,
genes, and
nucleic acids representative of genes may be implemented with respect to
synthetic nucleic
acids. In some embodiments the synthetic nucleic acid is exposed to the proper
conditions to
allow it to become a processed or mature nucleic acid, such as a miRNA under
physiological
circumstances. The claims originally filed are contemplated to cover claims
that are multiply
dependent on any filed claim or combination of filed claims.
Also, any embodiment of the invention involving specific genes (including
representative fragments there of), mRNA, or miRNAs by name is contemplated
also to
cover embodiments involving miRNAs whose sequences are at least 80, 81, 82,
83, 84, 85,
86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% identical to the
mature sequence of the
specified miRNA.
It will be further understood that shorthand notations are employed such that
a generic
description of a gene or marker thereof, or of an miRNA refers to any of its
gene family
members (distinguished by a number) or representative fragments thereof,
unless otherwise
indicated. It is understood by those of skill in the art that a "gene family"
refers to a group of
genes having the same coding sequence or miRNA coding sequence. Typically,
miRNA
members of a gene family are identified by a number following the initial
designation. For
example, miR-16-1 and miR-16-2 are members of the miR-16 gene family and "mir-
7" refers
to miR-7-1, miR-7-2 and miR-7-3. Moreover, unless otherwise indicated, a
shorthand
notation refers to related miRNAs (distinguished by a letter). Exceptions to
these shorthand
notations will be otherwise identified.
- 83 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
Other embodiments of the invention are discussed throughout this application.
Any
embodiment discussed with respect to one aspect of the invention applies to
other aspects of
the invention as well and vice versa. The embodiments in the Example and
Detailed
Description section are understood to be embodiments of the invention that are
applicable to
all aspects of the invention.
The terms "inhibiting," "reducing," or "prevention," or any variation of these
terms,
when used in the claims and/or the specification includes any measurable
decrease or
complete inhibition to achieve a desired result.
The use of the word "a" or "an" when used in conjunction with the term
"comprising"
in the claims and/or the specification may mean "one," but it is also
consistent with the
meaning of "one or more," "at least one," and "one or more than one."
Throughout this application, the term "about" is used to indicate that a value
includes
the standard deviation of error for the device or method being employed to
determine the
value.
The use of the term "or" in the claims is used to mean "and/or" unless
explicitly
indicated to refer to alternatives only or the alternatives are mutually
exclusive, although the
disclosure supports a definition that refers to only alternatives and
"and/or."
As used in this specification and claim(s), the words "comprising" (and any
form of
comprising, such as "comprise" and "comprises"), "having" (and any form of
having, such as
"have" and "has"), "including" (and any form of including, such as "includes"
and "include")
or "containing" (and any form of containing, such as "contains" and "contain")
are inclusive
or open-ended and do not exclude additional, unrecited elements or method
steps.
Other objects, features and advantages of the present invention will become
apparent
from the following detailed description. It should be understood, however,
that the detailed
description and the specific examples, while indicating specific embodiments
of the
invention, are given by way of illustration only, since various changes and
modifications
within the spirit and scope of the invention will become apparent to those
skilled in the art
from this detailed description.
-84-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
DETAILED DESCRIPTION OF THE INVENTION
The present invention is directed to compositions and methods relating to the
identification and characterization of genes and biological pathways related
to these genes as
represented by the expression of the identified genes, as well as use of
miRNAs related to
such, for therapeutic, prognostic, and diagnostic applications, particularly
those methods and
compositions related to assessing and/or identifying pathological conditions
directly or
indirectly related to miR-143 expression or the aberrant expression thereof.
In certain aspects, the invention is directed to methods for the assessment,
analysis,
and/or therapy of a cell or subject where certain genes have a reduced or
increased expression
(relative to normal) as a result of an increased or decreased expression of
any one or a
combination of miR-143 family members (including, but not limited to lla-mir-
143
MI0002552; xtr-mir-143 MI0004937; dre-mir-143-2 MI0002008; rno-mir-143
MI0000916;
ptr-mir-143 M10002549; ppy-mir-143 MI0002551; ggo-mir-143 M10002550; dre-mir-
143-1
MI0002007; hsa-mir-143 MI0000459; ppa-mir-143 MI0002553; mdo-mir-143
MI0005302;
and mmu-mir-143 M10000257) and/or genes with an increased expression (relative
to
normal) as a result of decreased expression thereof. The expression profile
and/or response
to miR-143 expression or lack of expression may be indicative of an individual
with a
pathological condition, e.g., cancer.
Prognostic assays featuring any one or combination of the miRNAs listed or the
markers listed (including nucleic acids representative thereof) could be used
in assessment of
a patient to determine what if any treatment regimen is justified. As with the
diagnostic
assays mentioned above, the absolute values that define low expression will
depend on the
platform used to measure the miRNA(s). The same methods described for the
diagnostic
assays could be used for prognostic assays.
I. THERAPEUTIC METHODS
Embodiments of the invention concern nucleic acids that perform the activities
of or
inhibit endogenous miRNAs when introduced into cells. In certain aspects,
nucleic acids are
synthetic or non-synthetic miRNA. Sequence-specific miRNA inhibitors can be
used to
inhibit sequentially or in combination the activities of one or more
endogenous miRNAs in
cells, as well those genes and associated pathways modulated by the endogenous
miRNA.
-85-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
The present invention concerns, in some embodiments, short nucleic acid
molecules
that function as miRNAs or as inhibitors of miRNA in a cell. The term "short"
refers to a
length of a single polynucleotide that is 15, 16, 17, 18, 19, 20, 21, 22, 23,
24, 25, 50, 100, or
150 nucleotides or fewer,, including all integers or ranges derivable there
between. The
nucleic acid molecules are typically synthetic. The term "synthetic" refers to
a nucleic acid
molecule that is not produced naturally in a cell. In certain aspects the
chemical structure
deviates from a naturally-occurring nucleic acid molecule, such as an
endogenous precursor
miRNA or miRNA molecule or complement thereof. While in some embodiments,
nucleic
acids of the invention do not have an entire sequence that is identical or
complementary to a
sequence of a naturally-occurring nucleic acid, such molecules may encompass
all or part of
a naturally-occurring sequence or a complement thereof. It is contemplated,
however, that a
synthetic nucleic acid administered to a cell may subsequently be modified or
altered in the
cell such that its structure or sequence is the same as non-synthetic or
naturally occurring
nucleic acid, such as a mature miRNA sequence. For example, a synthetic
nucleic acid may
have a sequence that differs from the sequence of a precursor miRNA, but that
sequence may
be altered once in a cell to be the same as an endogenous, processed miRNA or
an inhibitor
thereof. The term "isolated" means that the nucleic acid molecules of the
invention are
initially separated from different (in terms of sequence or structure) and
unwanted nucleic
acid molecules such that a population of isolated nucleic acids is at least
about 90%
homogenous, and may be at least about 95, 96, 97, 98, 99, or 100% homogenous
with respect
to other polynucleotide molecules. In many embodiments of the invention, a
nucleic acid is
isolated by virtue of it having been synthesized in vitro separate from
endogenous nucleic
acids in a cell. It will be understood, however, that isolated nucleic acids
may be
subsequently mixed or pooled together. In certain aspects, synthetic miRNA of
the invention
are RNA or RNA analogs. miRNA inhibitors may be DNA or RNA, or analogs thereo
miRNA and miRNA inhibitors of the invention are collectively referred to as
"synthetic
nucleic acids."
In some embodiments, there is a miRNA or a synthetic miRNA having a length of
between 17 and 130 residues. The present invention concerns miRNA or synthetic
miRNA
molecules that are, are at least, or are at most 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,
47, 48, 49, 50, 51, 52,
53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71,
72, 73, 74, 75, 76, 77,
78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,
97, 98, 99, 100, 101,
-86-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116,
117, 118, 119,
120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 140, 145, 150, 160,
170, 180, 190, 200
or more residues in length, including any integer or any range there between.
In certain embodiments, synthetic miRNA have (a) a "miRNA region" whose
sequence or binding region from 5' to 3' is identical or complementary to all
or a segment of
a mature miRNA sequence, and (b) a "complementary region" whose sequence from
5' to 3'
is between 60% and 100% complementary to the miRNA sequence in (a). In certain
embodiments, these synthetic miRNA are also isolated, as defined above. The
term "miRNA
region" refers to a region on the synthetic miRNA that is at least 75, 80, 85,
90, 95, or 100%
identical, including all integers there between, to the entire sequence of a
mature, naturally
occurring miRNA sequence or a complement thereof. In certain embodiments, the
miRNA
region is or is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2,
99.3, 99.4, 99.5, 99.6,
99.7, 99.8, 99.9 or 100% identical to the sequence of a naturally-occurring
miRNA or
complement thereof.
The term "complementary region" or "complement" refers to a region of a
nucleic
acid or mimetic that is or is at least 60% complementary to the mature,
naturally occurring
miRNA sequence. The complementary region is or is at least 60, 61, 62, 63, 64,
65, 66, 67,
68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86,
87, 88, 89, 90, 91, 92,
93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8,
99.9 or 100%
complementary, or any range derivable therein. With single polynucleotide
sequences, there
may be a hairpin loop structure as a result of chemical bonding between the
miRNA region
and the complementary region. In other embodiments, the complementary region
is on a
different nucleic acid molecule than the miRNA region, in which case the
complementary
region is on the complementary strand and the miRNA region is on the active
strand.
In other embodiments of the invention, there are synthetic nucleic acids that
are
miRNA inhibitors. A miRNA inhibitor is between about 17 to 25 nucleotides in
length and
comprises a 5' to 3' sequence that is at least 90% complementary to the 5' to
3' sequence of a
mature miRNA. In certain embodiments, a miRNA inhibitor molecule is 17, 18,
19, 20, 21,
22, 23, 24, or 25 nucleotides in length, or any range derivable therein.
Moreover, an miRNA
inhibitor may have a sequence (from 5' to 3') that is or is at least 70, 75,
80, 85, 90, 91, 92,
93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8,
99.9 or 100%
complementary, or any range derivable therein, to the 5' to 3' sequence of a
mature miRNA,
-87-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
particularly a mature, naturally occurring miRNA. One of skill in the art
could use a portion
of the miRNA sequence that is complementary to the sequence of a mature miRNA
as the
sequence for a miRNA inhibitor. Moreover, that portion of the nucleic acid
sequence can be
altered so that it is still comprises the appropriate percentage of
complementarity to the
sequence of a mature miRNA.
In some embodiments, of the invention, a synthetic miRNA or inhibitor contains
one
or more design element(s). These design elements include, but are not limited
to: (i) a
replacement group for the phosphate or hydroxyl of the nucleotide at the 5'
terminus of the
complementary region; (ii) one or more sugar modifications in the first or
last 1 to 6 residues
of the complementary region; or, (iii) noncomplementarity between one or more
nucleotides
in the last 1 to 5 residues at the 3' end of the complementary region and the
corresponding
nucleotides of the miRNA region. A variety of design modifications are known
in the art, see
below.
In certain embodiments, a synthetic miRNA has a nucleotide at its 5' end of
the
complementary region in which the phosphate and/or hydroxyl group has been
replaced with
another chemical group (referred to as the "replacement design"). In some
cases, the
phosphate group is replaced, while in others, the hydroxyl group has been
replaced. In
particular embodiments, the replacement group is biotin, an amine group, a
lower alkylamine
group, an acetyl group, 2'O-Me (2'oxygen-methyl), DMTO (4,4'-dimethoxytrityl
with
oxygen), fluoroscein, a thiol, or acridine, though other replacement groups
are well known to
those of skill in the art and can be used as well. This design element can
also be used with a
miRNA inhibitor. .
Additional embodiments concern a synthetic miRNA having one or more sugar
modifications in the first or last 1 to 6 residues of the complementary region
(referred to as
the "sugar replacement design"). In certain cases, there is one or more sugar
modifications in
the first 1, 2, 3, 4, 5, 6 or more residues of the complementary region, or
any range derivable
therein. In additional cases, there is one or more sugar modifications in the
last 1, 2, 3, 4, 5, 6
or more residues of the complementary region, or any range derivable therein,
have a sugar
modification. It will be understood that the terms "first" and "last" are with
respect to the
order of residues from the 5' end to the 3' end of the region. In particular
embodiments, the
sugar modification is a 2'O-Me modification. In further embodiments, there is
one or more
sugar modifications in the first or last 2 to 4 residues of the complementary
region or the first
-88-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
or last 4 to 6 residues of the complementary region. This design element can
also be used
with an miRNA inhibitor. Thus, an miRNA inhibitor can have this design element
and/or a
replacement group on the nucleotide at the 5' terminus, as discussed above.
In other embodiments of the invention, there is a synthetic miRNA or inhibitor
in
which one or more nucleotides in the last 1 to 5 residues at the 3' end of the
complementary
region are not complementary to the corresponding nucleotides of the miRNA
region
("noncomplementarity") (referred to as the "noncomplementarity design"). The
noncomplementarity may be in the last 1, 2, 3, 4, and/or 5 residues of the
complementary
miRNA. In certain embodiments, there is noncomplementarity with at least 2
nucleotides in
the complementary region.
It is contemplated that synthetic miRNA of the invention have one or more of
the
replacement, sugar modification, or noncomplementarity designs. In certain
cases, synthetic
RNA molecules have two of them, while in others these molecules have all three
designs in
place.
The miRNA region and the complementary region may be on the same or separate
polynucleotides. In cases in which they are contained on or in the same
polynucleotide, the
miRNA molecule will be considered a single polynucleotide. In embodiments in
which the
different regions are on separate polynucleotides, the synthetic miRNA will be
considered to
be comprised of two polynucleotides.
When the RNA molecule is a single polynucleotide, there can be a linker region
between the miRNA region and the complementary region. In some embodiments,
the single
polynucleotide is capable of forming a hairpin loop structure as a result of
bonding between
the miRNA region and the complementary region. The linker constitutes the
hairpin loop. It
is contemplated that in some embodiments, the linker region is, is at least,
or is at most 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 residues in length, or any range
derivable therein. In
certain embodiments, the linker is between 3 and 30 residues (inclusive) in
length.
In addition to having a miRNA or inhibitor region and a complementary region,
there
may be flanking sequences as well at either the 5' or 3' end of the region. In
some
embodiments, there is or is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides
or more, or any
range derivable therein, flanking one or both sides of these regions.
-89-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
Methods of the invention include reducing or eliminating activity of one or
more
miRNAs in a cell comprising introducing into a cell a miRNA inhibitor (which
may be
described generally herein as an miRNA, so that a description of miRNA, where
appropriate,
also will refer to a miRNA inhibitor); or supplying or enhancing the activity
of one or more
miRNAs in a cell. The present invention also concerns inducing certain
cellular
characteristics by providing to a cell a particular nucleic acid, such as a
specific synthetic
miRNA molecule or a synthetic miRNA inhibitor molecule. However, in methods of
the
invention, the miRNA molecule or miRNA inhibitor need not be synthetic. They
may have a
sequence that is identical to a naturally occurring miRNA or they may not have
any design
modifications. In certain embodiments, the miRNA molecule and/or the miRNA
inhibitor are
synthetic, as discussed above.
The particular nucleic acid molecule provided to the cell is understood to
correspond
to a particular miRNA in the cell, and thus, the miRNA in the cell is referred
to as the
"corresponding miRNA." In situations in which a named miRNA molecule is
introduced into
a cell, the corresponding miRNA will be understood to be the induced or
inhibited miRNA or
induced or inhibited miRNA function. It is contemplated, however, that the
miRNA
molecule introduced into a cell is not a mature miRNA but is capable of
becoming or
functioning as a mature miRNA under the appropriate physiological conditions.
In cases in
which a particular corresponding miRNA is being inhibited by a miRNA
inhibitor, the
particular miRNA will be referred to as the "targeted miRNA." It is
contemplated that
multiple corresponding miRNAs may be involved. In particular embodiments, more
than one
miRNA molecule is introduced into a cell. Moreover, in other embodiments, more
than one
miRNA inhibitor is introduced into a cell. Furthermore, a combination of miRNA
molecule(s) and miRNA inhibitor(s) may be introduced into a cell. The
inventors
contemplate that a combination of miRNA may act at one or more points in
cellular pathways
of cells with aberrant phenotypes and that such combination may have increased
efficacy on
the target cell while not adversely effecting normal cells. Thus, a
combination of miRNA
may have a minimal adverse effect on a subject or patient while supplying a
sufficient
therapeutic effect, such as amelioration of a condition, growth inhibition of
a cell, death of a
targeted cell, alteration of cell phenotype or physiology, slowing of cellular
growth,
sensitization to a second therapy, sensitization to a particular therapy, and
the like.
-90-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
Methods include identifying a cell or patient in need of inducing those
cellular
characteristics. Also, it will be understood that an amount of a synthetic
nucleic acid that is
provided to a cell or organism is an "effective amount," which refers to an
amount needed (or
a sufficient amount) to achieve a desired goal, such as inducing a particular
cellular
characteristic(s). Certain embodiments of the methods include providing or
introducing to a
cell a nucleic acid molecule corresponding to a mature miRNA in the cell in an
amount
effective to achieve a desired physiological result.
Moreover, methods can involve providing synthetic or nonsynthetic miRNA
molecules. It is contemplated that in these embodiments, that the methods may
or may not be
limited to providing only one or more synthetic miRNA molecules or only one or
more
nonsynthetic miRNA molecules. Thus, in certain embodiments, methods may
involve
providing both synthetic and nonsynthetic miRNA molecules. In this situation,
a cell or cells
are most likely provided a synthetic miRNA molecule corresponding to a
particular miRNA
and a nonsynthetic miRNA molecule corresponding to a different miRNA.
Furthermore, any
method articulated using a list of miRNAs using Markush group language may be
articulated
without the Markush group language and a disjunctive article (i.e., or)
instead, and vice versa.
Typically, an endogenous gene, miRNA or mRNA is modulated in the cell. In
particular embodiments, the nucleic acid sequence comprises at least one
segment that is at
least 70, 75, 80, 85, 90, 95, or 100% identical in nucleic acid sequence to
one or more
miRNA or gene sequence. Modulation of the expression or processing of an
endogenous
gene, miRNA, or mRNA can be through modulation of the processing of a mRNA,
such
processing including transcription, transportation and/or translation with in
a cell.
Modulation may also be effected by the inhibition or enhancement of miRNA
activity with a
cell, tissue, or organ. Such processing may affect the expression of an
encoded product or the
stability of the mRNA. In still other embodiments, a nucleic acid sequence can
comprise a
modified nucleic acid sequence. In certain aspects, one or more miRNA sequence
may
include or comprise a modified nucleobase or nucleic acid sequence.
It will be understood in methods of the invention that a cell or other
biological matter
such as an organism (including patients) can be provided a miRNA or miRNA
molecule
corresponding to a particular miRNA by administering to the cell or organism a
nucleic acid
molecule that functions as the corresponding miRNA once inside the cell. The
form of the
molecule provided to the cell may not be the form that acts a miRNA once
inside the cell.
-91-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
Thus, it is contemplated that in some embodiments, a synthetic miRNA or a
nonsynthetic
miRNA is provided such that it becomes processed into a mature and active
miRNA once it
has access to the cell's miRNA processing machinery. In certain embodiments,
it is
specifically contemplated that the miRNA molecule provided is not a mature
miRNA
molecule but a nucleic acid molecule that can be processed into the mature
miRNA once it is
accessible to miRNA processing machinery. The term "nonsynthetic" in the
context of
miRNA means that the miRNA is not "synthetic," as defined herein. Furthermore,
it is
contemplated that in embodiments of the invention that concem the use of
synthetic miRNAs,
the use of corresponding nonsynthetic miRNAs is also considered an aspect of
the invention,
and vice versa. It will be understand that the term "providing" an agent is
used to include
"administering" the agent to a patient.
In certain embodiments, methods also include targeting a miRNA to modulate in
a
cell or organism. The term "targeting a miRNA to modulate" means a nucleic
acid of the
invention will be employed so as to modulate the selected miRNA. In some
embodiments the
modulation is achieved with a synthetic or non-synthetic miRNA that
corresponds to the
targeted miRNA, which effectively provides the targeted miRNA to the cell or
organism
(positive modulation). In other embodiments, the modulation is achieved with a
miRNA
inhibitor, which effectively inhibits the targeted miRNA in the cell or
organism (negative
modulation).
In some embodiments, the miRNA targeted to be modulated is a miRNA that
affects a
disease, condition, or pathway. In certain embodiments, the miRNA is targeted
because a
treatment can be provided by negative modulation of the targeted miRNA. In
other
embodiments, the miRNA is targeted because a treatment can be provided by
positive
modulation of the targeted miRNA or its targets.
In certain methods of the invention, there is a further step of administering
the
selected miRNA modulator to a cell, tissue, organ, or organism (collectively
"biological
matter") in need of treatment related to modulation of the targeted miRNA or
in need of the
physiological or biological results discussed herein (such as with respect to
a particular
cellular pathway or result like decrease in cell viability). Consequently, in
some methods of
the invention there is a step of identifying a patient in need of treatment
that can be provided
by the miRNA modulator(s). It is contemplated that an effective amount of a
miRNA
modulator can be administered in some embodiments. In particular embodiments,
there is a
-92-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
therapeutic benefit conferred on the biological matter, where a "therapeutic
benefit" refers to
an improvement in the one or more conditions or symptoms associated with a
disease or
condition or an improvement in the prognosis, duration, or status with respect
to the disease.
It is contemplated that a therapeutic benefit includes, but is not limited to,
a decrease in pain,
a decrease in morbidity, a decrease in a symptom. For example, with respect to
cancer, it is
contemplated that a therapeutic benefit can be inhibition of tumor growth,
prevention of
metastasis, reduction in number of metastases, inhibition of cancer cell
proliferation,
induction of cell death in cancer cells, inhibition of angiogenesis near
cancer cells, induction
of apoptosis of cancer cells, reduction in pain, reduction in risk of
recurrence, induction of
chemo- or radiosensitivity in cancer cells, prolongation of life, and/or delay
of death directly
or indirectly related to cancer.
Furthermore, it is contemplated that the miRNA compositions may be provided as
part of a therapy to a patient, in conjunction with traditional therapies or
preventative agents.
Moreover, it is contemplated that any method discussed in the context of
therapy may be
applied preventatively, particularly in a patient identified to be potentially
in need of the
therapy or at risk of the condition or disease for which a therapy is needed.
In addition, methods of the invention concern employing one or more nucleic
acids
corresponding to a miRNA and a therapeutic drug. The nucleic acid can enhance
the effect
or efficacy of the drug, reduce any side effects or toxicity, modify its
bioavailability, and/or
decrease the dosage or frequency needed. In certain embodiments, the
therapeutic drug is a
cancer therapeutic. Consequently, in some embodiments, there is a method of
treating cancer
in a patient comprising administering to the patient the cancer therapeutic
and an effective
amount of at least one miRNA molecule that improves the efficacy of the cancer
therapeutic
or protects non-cancer cells. Cancer therapies also include a variety of
combination therapies
with both chemical and radiation based treatments. Combination chemotherapies
include but
are not limited to, for example, 5-fluorouracil, alemtuzumab, amrabicin,
bevacizumab,
bleomycin, bortezomib, busulfan, camptothecin, capecitabine, carboplatin,
cetuximab,
chlorambucil, cisplatin (CDDP), COX-2 inhibitors (e.g., celecoxib),
cyclophosphamide,
cytarabine, dactinomycin, dasatinib, daunorubicin, dexamethasone, docetaxel,
doxorubicin
(adriamycin), EGFR inhibitors (gefitinib and cetuximab), erlotinib, estrogen
receptor binding
agents, etoposide (VP16), everolimus, farnesyl-protein transferase inhibitors,
gefitinib,
gemcitabine, gemtuzumab, ibritumomab, ifosfamide, imatinib mesylate,
larotaxel, lapatinib,
-93-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
lonafarnib, mechlorethamine, melphalan, methotrexate, mitomycin, navelbine,
nitrosurea,
nocodazole, oxaliplatin, paclitaxel, plicomycin, procarbazine, raloxifene,
rituximab,
sirolimus, sorafenib, sunitinib, tamoxifen, taxol, taxotere, temsirolimus,
tipifamib,
tositumomab, transplatinum, trastuzumab, vinblastin, vincristin, or
vinorelbine or any analog
or derivative variant of the foregoing.
Generally, inhibitors of miRNAs can be given to decrease the activity of an
endogenous miRNA. For example, inhibitors of miRNA molecules that increase
cell
proliferation can be provided to cells to decrease cell proliferation. The
present invention
contemplates these embodiments in the context of the different physiological
effects observed
with the different miRNA molecules and miRNA inhibitors disclosed herein.
These include,
but are not limited to, the following physiological effects: increase and
decreasing cell
proliferation, increasing or decreasing apoptosis, increasing transformation,
increasing or
decreasing cell viability, activating or inhibiting a kinase (e.g., Erk),
activating/inducing or
inhibiting hTert, inhibit stimulation of growth promoting pathway (e.g., Stat
3 signaling),
reduce or increase viable cell number, and increase or decrease number of
cells at a particular
phase of the cell cycle. Methods of the invention are generally contemplated
to include
providing or introducing one or more different nucleic acid molecules
corresponding to one
or more different miRNA molecules. It is contemplated that the following, at
least the
following, or at most the following number of different nucleic acid or miRNA
molecules
may be provided or introduced: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19,
20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,
39, 40, 41, 42, 43, 44,
45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
64, 65, 66, 67, 68, 69,
70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88,
89, 90, 91, 92, 93, 94,
95, 96, 97, 98, 99, 100, or any range derivable therein. This also applies to
the number of
different miRNA molecules that can be provided or introduced into a cell.
H. PHARMACEUTICAL FORMULATIONS AND DELIVERY
Methods of the present invention include the delivery of an effective amount
of a
miRNA or an expression construct encoding the same. An "effective amount" of
the
pharmaceutical composition, generally, is defined as that amount sufficient to
detectably and
repeatedly to achieve the stated desired result, for example, to ameliorate,
reduce, minimize
or limit the extent of the disease or its symptoms. Other more rigorous
definitions may apply,
including elimination, eradication or cure of disease.
-94-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
A. Administration
In certain embodiments, it is desired to kill cells, inhibit cell growth,
inhibit
metastasis, decrease tumor or tissue size, and/or reverse or reduce the
malignant or disease
phenotype of cells. The routes of administration will vary, naturally, with
the location and
nature of the lesion or site to be targeted, and include, e.g., intradermal,
subcutaneous,
regional, parenteral, intravenous, intramuscular, intranasal, systemic, and
oral administration
and formulation. Direct injection, intratumoral injection, or injection into
tumor vasculature
is specifically contemplated for discrete, solid, accessible tumors, or other
accessible target
areas. Local, regional, or systemic administration also may be appropriate.
For tumors of >4
cm, the volume to be administered will be about 4-10 ml (preferably 10 ml),
while for tumors
of <4 cm, a volume of about 1-3 ml will be used (preferably 3 ml).
Multiple injections delivered as a single dose comprise about 0.1 to about 0.5
ml
volumes. Compositions of the invention may be administered in multiple
injections to a
tumor or a targeted site. In certain aspects, injections may be spaced at
approximately 1 cm
intervals.
In the case of surgical intervention, the present invention may be used
preoperatively,
to render an inoperable tumor subject to resection. Alternatively, the present
invention may
be used at the time of surgery, and/or thereafter, to treat residual or
metastatic disease. For
example, a resected tumor bed may be injected or perfused with a formulation
comprising a
miRNA or combinations thereof. Administration may be continued post-resection,
for
example, by leaving a catheter implanted at the site of the surgery. Periodic
post-surgical
treatment also is envisioned. Continuous perfusion of an expression construct
or a viral
construct also is contemplated.
Continuous administration also maybe applied where appropriate, for example,
where
a tumor or other undesired affected area is excised and the tumor bed or
targeted site is
treated to eliminate residual, microscopic disease. Delivery via syringe or
catherization is
contemplated. Such continuous perfusion may take place for a period from about
1-2 hours,
to about 2-6 hours, to about 6-12 hours, to about 12-24 hours, to about 1-2
days, to about 1-2
wk or longer following the initiation of treatment. Generally, the dose of the
therapeutic
composition via continuous perfusion will be equivalent to that given by a
single or multiple
injections, adjusted over a period of time during which the perfusion occurs.
-95-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
Treatment regimens may vary as well and often depend on tumor type, tumor
location, immune condition, target site, disease progression, and health and
age of the patient.
Certain tumor types will require more aggressive treatment. The clinician will
be best suited
to make such decisions based on the known efficacy and toxicity (if any) of
the therapeutic
formulations.
In certain embodiments, the tumor or affected area being treated may not, at
least
initially, be resectable. Treatments with compositions of the invention may
increase the
resectability of the tumor due to shrinkage at the margins or by elimination
of certain
particularly invasive portions. Following treatments, resection may be
possible. Additional
treatments subsequent to resection may serve to eliminate microscopic residual
disease at the
tumor or targeted site.
Treatments may include various "unit doses." A unit dose is defined as
containing a
predetermined quantity of a therapeutic composition(s). The quantity to be
administered, and
the particular route and formulation, are within the skill of those in the
clinical arts. A unit
dose need not be administered as a single injection but may comprise
continuous infusion
over a set period of time. With respect to a viral component of the present
invention, a unit
dose may conveniently be described in terms of g or mg of miRNA or miRNA
mimetic.
Alternatively, the amount specified may be the amount administered as the
average daily,
average weekly, or average monthly dose.
miRNA can be administered to the patient in a dose or doses of about or of at
least
about 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110,
120, 130, 140, 150,
160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300,
310, 320, 330,
340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480,
490, 500, 510,
520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660,
670, 680, 690,
700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840,
850, 860, 870,
880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000 g or mg, or
more, or any
range derivable therein. Alternatively, the amount specified may be the amount
administered
as the average daily, average weekly, or average monthly dose, or it may be
expressed in
terms of mg/kg, where kg refers to the weight of the patient and the mg is
specified above. In
other embodiments, the amount specified is any number discussed above but
expressed as
mg/mz (with respect to tumor size or patient surface area).
-96-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
B. Injectable Compositions and Formulations
In some embodiments, the method for the delivery of a miRNA or an expression
construct encoding such or combinations thereof is via systemic
administration. However,
the pharmaceutical compositions disclosed herein may also be administered
parenterally,
subcutaneously, directly, intratracheally, intravenously, intradermally,
intramuscularly, or
even intraperitoneally as described in U.S. Patents 5,543,158; 5,641,515 and
5,399,363 (each
specifically incorporated herein by reference in its entirety).
Injection of nucleic acids may be delivered by syringe or any other method
used for
injection of a solution, as long as the nucleic acid and any associated
components can pass
through the particular gauge of needle required for injection. A syringe
system has also been
described for use in gene therapy that permits multiple injections of
predetermined quantities
of a solution precisely at any depth (U.S. Patent 5,846,225).
Solutions of the active compounds as free base or pharmacologically acceptable
salts
may be prepared in water suitably mixed with a surfactant, such as
hydroxypropylcellulose.
Dispersions may also be prepared in glycerol, liquid polyethylene glycols,
mixtures thereof,
and in oils. Under ordinary conditions of storage and use, these preparations
contain a
preservative to prevent the growth of microorganisms. The pharmaceutical forms
suitable for
injectable use include sterile aqueous solutions or dispersions and sterile
powders for the
extemporaneous preparation of sterile injectable solutions or dispersions
(U.S. Patent
5,466,468, specifically incorporated herein by reference in its entirety). In
all cases the form
must be sterile and must be fluid to the extent that easy syringability
exists. It must be stable
under the conditions of manufacture and storage and must be preserved against
the
contaminating action of microorganisms, such as bacteria and fungi. The
carrier can be a
solvent or dispersion medium containing, for example, water, ethanol, polyol
(e.g., glycerol,
propylene glycol, and liquid polyethylene glycol, and the like), suitable
mixtures thereof,
and/or vegetable oils. Proper fluidity may be maintained, for example, by the
use of a
coating, such as lecithin, by the maintenance of the required particle size in
the case of
dispersion and by the use of surfactants. The prevention of the action of
microorganisms can
be brought about by various antibacterial and antifungal agents, for example,
parabens,
chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases,
it will be
preferable to include isotonic agents, for example, sugars or sodium chloride.
Prolonged
-97-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
absorption of the injectable compositions can be brought about by the use in
the compositions
of agents delaying absorption, for example, aluminum monostearate and gelatin.
In certain formulations, a water-based formulation is employed while in
others, it may
be lipid-based. In particular embodiments of the invention, a composition
comprising a
tumor suppressor protein or a nucleic acid encoding the same is in a water-
based formulation.
In other embodiments, the formulation is lipid based.
For parenteral administration in an aqueous solution, for example, the
solution should
be suitably buffered if necessary and the liquid diluent first rendered
isotonic with sufficient
saline or glucose. These particular aqueous solutions are especially suitable
for intravenous,
intramuscular, subcutaneous, intratumoral, intralesional, and intraperitoneal
administration.
In this connection, sterile aqueous media which can be employed will be known
to those of
skill in the art in light of the present disclosure. For example, one dosage
may be dissolved in
1 ml of isotonic NaCI solution and either added to 1000 ml of hypodermoclysis
fluid or
injected at the proposed site of infusion, (see for example, "Remington's
Pharmaceutical
Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in
dosage will
necessarily occur depending on the condition of the subject being treated. The
person
responsible for administration will, in any event, determine the appropriate
dose for the
individual subject. Moreover, for human administration, preparations should
meet sterility,
pyrogenicity, general safety and purity standards as required by FDA Office of
Biologics
standards.
As used herein, a"carrier" includes any and all solvents, dispersion media,
vehicles,
coatings, diluents, antibacterial and antifungal agents, isotonic and
absorption delaying
agents, buffers, carrier solutions, suspensions, colloids, and the like. The
use of such media
and agents for pharmaceutical active substances is well known in the art.
Except insofar as
any conventional media or agent is incompatible with the active ingredient,
its use in the
therapeutic compositions is contemplated. Supplementary active ingredients can
also be
incorporated into the compositions.
The phrase "pharmaceutically acceptable" refers to molecular entities and
compositions that do not produce an allergic or similar untoward reaction when
administered
to a human.
-98-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
The nucleic acid(s) are administered in a manner compatible with the dosage
formulation, and in such amount as will be therapeutically effective. The
quantity to be
administered depends on the subject to be treated, including, e.g., the
aggressiveness of the
disease or cancer, the size of any tumor(s) or lesions, the previous or other
courses of
treatment. Precise amounts of active ingredient required to be administered
depend on the
judgment of the practitioner. Suitable regimes for initial administration and
subsequent
administration are also variable, but are typified by an initial
administration followed by other
administrations. Such administration may be systemic, as a single dose,
continuous over a
period of time spanning 10, 20, 30, 40, 50, 60 minutes, and/or 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or more hours, and/or 1, 2,
3, 4, 5, 6, 7, days
or more. Moreover, administration may be through a time release or sustained
release
mechanism, implemented by formulation and/or mode of administration.
C. Combination Treatments
In certain embodiments, the compositions and methods of the present invention
involve a miRNA, or expression construct encoding such. These miRNA
composition can be
used in combination with a second therapy to enhance the effect of the miRNA
therapy, or
increase the therapeutic effect of another therapy being employed. These
compositions
would be provided in a combined amount effective to achieve the desired
effect, such as the
killing of a cancer cell and/or the inhibition of cellular hyperproliferation.
This process may
involve contacting the cells with the miRNA or second therapy at the same or
different time.
This may be achieved by contacting the cell with one or more compositions or
pharmacological formulation that includes or more of the agents, or by
contacting the cell
with two or more distinct compositions or formulations, wherein one
composition provides
(1) miRNA; and/or (2) a second therapy. A second composition or method may be
administered that includes a chemotherapy, radiotherapy, surgical therapy,
immunotherapy or
gene therapy.
It is contemplated that one may provide a patient with the miRNA therapy and
the
second therapy within about 12-24 h of each other and, more preferably, within
about 6-12 h
of each other. In some situations, it may be desirable to extend the time
period for treatment
significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several
weeks (1, 2, 3, 4, 5, 6,
7 or 8) lapse between the respective administrations.
-99-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
In certain embodiments, a course of treatment will last 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
31, 32, 33, 34, 35, 36,
37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55,
56, 57, 58, 59, 60, 61,
62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,
81, 82, 83, 84, 85, 86,
87, 88, 89, 90 days or more. It is contemplated that one agent may be given on
day 1, 2, 3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27, 28, 29, 30,
31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49,
50, 51, 52, 53, 54, 55,
56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, 80,
81, 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, any combination thereof, and
another agent is
given on day 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24,
25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43,
44, 45, 46, 47, 48, 49,
50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68,
69, 70, 71, 72, 73, 74,
75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, and/or 90, or any
combination
thereof. Within a single day (24-hour period), the patient may be given one or
multiple
administrations of the agent(s). Moreover, after a course of treatment, it is
contemplated that
there is a period of time at which no treatment is administered. This time
period may last 1,
2, 3, 4, 5, 6, 7 days, and/or 1, 2, 3, 4, 5 weeks, and/or 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12
months or more, depending on the condition of the patient, such as their
prognosis, strength,
health, etc.
Various combinations may be employed, for example miRNA therapy is "A" and a
second therapy is "B":
A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B
B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A
B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A
Administration of any compound or therapy of the present invention to a
patient will
follow general protocols for the administration of such compounds, taking into
account the
toxicity, if any, of the vector or any protein or other agent. Therefore, in
some embodiments
there is a step of monitoring toxicity that is attributable to combination
therapy. It is
expected that the treatment cycles would be repeated as necessary. It also is
contemplated
that various standard therapies, as well as surgical intervention, may be
applied in
combination with the described therapy.
-100-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
In specific aspects, it is contemplated that a second therapy, such as
chemotherapy,
radiotherapy, immunotherapy, surgical therapy or other gene therapy, is
employed in
combination with the miRNA therapy, as described herein.
1. Chemotherapy
A wide variety of chemotherapeutic agents may be used in accordance with the
present invention. The term "chemotherapy" refers to the use of drugs to treat
cancer. A
"chemotherapeutic agent" is used to connote a compound or composition that is
administered
in the treatment of cancer. These agents or drugs are categorized by their
mode of activity
within a cell, for example, whether and at what stage they affect the cell
cycle. Alternatively,
an agent may be characterized based on its ability to directly cross-link DNA,
to intercalate
into DNA, or to induce chromosomal and mitotic aberrations by affecting
nucleic acid
synthesis. Most chemotherapeutic agents fall into the following categories:
alkylating
agents, antimetabolites, antitumor antibiotics, mitotic inhibitors, and
nitrosoureas.
a. Alkylating agents
Alkylating agents are drugs that directly interact with genomic DNA to prevent
the
cancer cell from proliferating. This category of chemotherapeutic drugs
represents agents
that affect all phases of the cell cycle, that is, they are not phase-
specific. Alkylating agents
can be implemented to treat chronic leukemia, non-Hodgkin's lymphoma,
Hodgkin's disease,
multiple myeloma, and particular cancers of the breast, lung, and ovary. They
include:
busulfan, chlorambucil, cisplatin, cyclophosphamide (cytoxan), dacarbazine,
ifosfamide,
mechlorethamine (mustargen), and melphalan. Troglitazaone can be used to treat
cancer in
combination with any one or more of these alkylating agents.
b. Antimetabolites
Antimetabolites disrupt DNA and RNA synthesis. Unlike alkylating agents, they
specifically influence the cell cycle during S phase. They have been used to
combat chronic
leukemias in addition to tumors of breast, ovary and the gastrointestinal
tract.
Antimetabolites include 5-fluorouracil (5-FU), cytarabine (Ara-C),
fludarabine, gemcitabine,
and methotrexate.
5-Fluorouracil (5-FU) has the chemical name of 5-fluoro-2,4(1H,3H)-
pyrimidinedione. Its mechanism of action is thought to be by blocking the
methylation
-101-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
reaction of deoxyuridylic acid to thymidylic acid. Thus, 5-FU interferes with
the synthesis of
deoxyribonucleic acid (DNA) and to a lesser extent inhibits the formation of
ribonucleic acid
(RNA). Since DNA and RNA are essential for cell division and proliferation, it
is thought
that the effect of 5-FU is to create a thymidine deficiency leading to cell
death. Thus, the
effect of 5-FU is found in cells that rapidly divide, a characteristic of
metastatic cancers.
c. Antitumor Antibiotics
Antitumor antibiotics have both antimicrobial and cytotoxic activity. These
drugs also
interfere with DNA by chemically inhibiting enzymes and mitosis or altering
cellular
membranes. These agents are not phase specific so they work in all phases of
the cell cycle.
Thus, they are widely used for a variety of cancers. Examples of antitumor
antibiotics
include bleomycin, dactinomycin, daunorubicin, doxorabicin (Adriamycin), and
idarubicin,
some of which are discussed in more detail below. Widely used in clinical
setting for the
treatment of neoplasms, these compounds are administered through bolus
injections
intravenously at doses ranging from 25-75 mg/m2 at 21 day intervals for
adriamycin, to 35-
100 mg/m2 for etoposide intravenously or orally.
d. Mitotic Inhibitors
Mitotic inhibitors include plant alkaloids and other natural agents that can
inhibit
either protein synthesis required for cell division or mitosis. They operate
during a specific
phase during the cell cycle. Mitotic inhibitors comprise docetaxel, etoposide
(VP16),
paclitaxel, taxol, taxotere, vinblastine, vincristine, and vinorelbine.
e. Nitrosureas
Nitrosureas, like alkylating agents, inhibit DNA repair proteins. They are
used to
treat non-Hodgkin's lymphomas, multiple myeloma, malignant melanoma, in
addition to
brain tumors. Examples include carmustine and lomustine.
2. Radiotherapy
Radiotherapy, also called radiation therapy, is the treatment of cancer and
other
diseases with ionizing radiation. Ionizing radiation deposits energy that
injures or destroys
cells in the area being treated by damaging their genetic material, making it
impossible for
these cells to continue to grow. Although radiation damages both cancer cells
and normal
cells, the latter are able to repair themselves and funetion properly.
Radiotherapy may be
-102-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
used to treat localized solid tumors, such as cancers of the skin, tongue,
larynx, brain, breast,
or cervix. It can also be used to treat leukemia and lymphoma (cancers of the
blood-forming
cells and lymphatic system, respectively).
Radiation therapy used according to the present invention may include, but is
not
limited to, the use of y-rays, X-rays, and/or the directed delivery of
radioisotopes to tumor
cells. Other forms of DNA damaging factors are also contemplated such as
microwaves,
proton beam irradiation (U.S. Patents 5,760,395 and 4,870,287) and UV-
irradiation. It is
most likely that all of these factors effect a broad range of damage on DNA,
on the precursors
of DNA, on the replication and repair of DNA, and on the assembly and
maintenance of
chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200
roentgens for
prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000
roentgens. Dosage
ranges for radioisotopes vary widely, and depend on the half-life of the
isotope, the strength
and type of radiation emitted, and the uptake by the neoplastic cells.
Radiotherapy may
comprise the use of radiolabeled antibodies to deliver doses of radiation
directly to the cancer
site (radioimmunotherapy). Once injected into the body, the antibodies
actively seek out the
cancer cells, which are destroyed by the cell-killing (cytotoxic) action of
the radiation. This
approach can minimize the risk of radiation damage to healthy cells.
Stereotactic radio-surgery (gamma knife) for brain and other tumors does not
use a
knife, but very precisely targeted beams of gamma radiotherapy from hundreds
of different
angles. Only one session of radiotherapy, taking about four to five hours, is
needed. For this
treatment a specially made metal frame is attached to the head. Then, several
scans and x-
rays are carried out to find the precise area where the treatment is needed.
During the
radiotherapy for brain tumors, the patient lies with their head in a large
helmet, which has
hundreds of holes in it to allow the radiotherapy beams through. Related
approaches permit
positioning for the treatment of tumors in other areas of the body.
3. Immunotherapy
In the context of cancer treatment, immunotherapeutics, generally, rely on the
use of
immune effector cells and molecules to target and destroy cancer cells.
Trastuzumab
(HerceptinTM) is such an example. The immune effector may be, for example, an
antibody
specific for some marker on the surface of a tumor cell. The antibody alone
may serve as an
effector of therapy or it may recruit other cells to actually affect cell
killing. The antibody
-103-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide,
ricin A chain,
cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent.
Alternatively, the
effector may be a lymphocyte carrying a surface molecule that interacts,
either directly or
indirectly, with a tumor cell target. Various effector cells include cytotoxic
T cells and NK
cells. The combination of therapeutic modalities, i.e., direct cytotoxic
activity and inhibition
or reduction of ErbB2 would provide therapeutic benefit in the treatment of
ErbB2
overexpressing cancers.
In one aspect of immunotherapy, the tumor or disease cell must bear some
marker that
is amenable to targeting, i.e., is not present on the majority of other cells.
Many tumor
markers exist and any of these may be suitable for targeting in the context of
the present
invention. Common tumor markers include carcinoembryonic antigen, prostate
specific
antigen, urinary tumor associated antigen, fetal antigen, tyrosinase (p97),
gp68, TAG-72,
HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin
receptor, erb
B and p155. An alternative aspect of immunotherapy is to combine anticancer
effects with
immune stimulatory effects. Immune stimulating molecules also exist including:
cytokines
such as IL-2, IL-4, IL-12, GM-CSF, gamma-IFN, chemokines such as MIP-1, MCP-1,
IL-8
and growth factors such as FLT3 ligand. Combining immune stimulating
molecules, either
as proteins or using gene delivery in combination with a tumor suppressor such
as MDA-7
has been shown to enhance anti-tumor effects (Ju et al., 2000). Moreover,
antibodies against
any of these compounds can be used to target the anti-cancer agents discussed
herein.
Examples of immunotherapies currently under investigation or in use are immune
adjuvants e.g., Mycobacterium bovis, Plasmodium falciparum,
dinitrochlorobenzene and
aromatic compounds (U.S. Patents 5,801,005 and 5,739,169; Hui and Hashimoto,
1998;
Christodoulides et al., 1998), cytokine therapy e.g., interferons a, (3 and y;
IL-1, GM-CSF
and TNF (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al.,
1998) gene therapy
e.g., TNF, IL-1, IL-2, p53 (Qin et al., 1998; Austin-Ward and Villaseca, 1998;
U.S. Patents
5,830,880 and 5,846,945) and monoclonal antibodies e.g., anti-ganglioside GM2,
anti-HER-
2, anti-p185; Pietras et al., 1998; Hanibuchi et al., 1998; U.S. Patent
5,824,311). Herceptin
(trastuzumab) is a chimeric (mouse-human) monoclonal antibody that blocks the
HER2-neu
receptor. It possesses anti-tumor activity and has been approved for use in
the treatment of
malignant tumors (Dillman, 1999). Table 6 is a non-limiting list of several
known anti-
- 104 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
cancer immunotherapeutic agents and their targets. It is contemplated that one
or more of
these therapies may be employed with the miRNA therapies described herein.
A number of different approaches for passive immunotherapy of cancer exist.
They
may be broadly categorized into the following: injection of antibodies alone;
injection of
antibodies coupled to toxins or chemotherapeutic agents; injection of
antibodies coupled to
radioactive isotopes; injection of anti-idiotype antibodies; and finally,
purging of tumor cells
in bone marrow.
TABLE 6
Generic Name Target
Cetuximab EGFR
Panitumumab EGFR
Trastuzumab erbB2 receptor
Bevacizumab VEGF
Alemtuzumab CD52
Gemtuzumab ozogamicin CD33
Rituximab CD20
Tositumomab CD20
Matuzumab EGFR
Ibritumomab tiuxetan CD20
Tositumomab CD20
HuPAM4 MUC 1
MORAb-009 Mesothelin
G250 carbonic anhydrase IX
mAb 8H9 8H9 antigen
M195 CD33
Ipilimumab CTLA4
HuLuc63 Csl
Alemtuzumab CD53
Epratuzumab CD22
BC8 CD45
HuJ591 Prostate specific membrane antigen
hA20 CD20
Lexatumumab TRAIL receptor-2
Pertuzumab HER-2 receptor
Mik-beta-1 IL-2R
RAV12 RAAG12
SGN-30 CD30
AME-133v CD20
HeFi-I CD30
BMS-663513 CD137
Volociximab anti-a5 I integrin
GC1008 TGF
HCD 122 CD40
Si lizumab CD2
MORAb-003 Folate receptor alpha
CNTO 328 IL-6
MDX-060 CD30
Ofatumumab CD20
SGN-33 CD33
-105-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
4. Gene Therapy
In yet another embodiment, a combination treatment involves gene therapy in
which a
therapeutic polynucleotide is administered before, after, or at the same time
as one or more
therapeutic miRNA. Delivery of a therapeutic polypeptide or encoding nucleic
acid in
conjunction with a miRNA may have a combined therapeutic effect on target
tissues. A
variety of proteins are encompassed within the invention, some of which are
described below.
Various genes that may be targeted for gene therapy of some form in
combination with the
present invention include, but are not limited to inducers of cellular
proliferation, inhibitors
of cellular proliferation, regulators of programmed cell death, cytokines and
other therapeutic
nucleic acids or nucleic acid that encode therapeutic proteins.
The tumor suppressor oncogenes function to inhibit excessive cellular
proliferation.
The inactivation of these genes destroys their inhibitory activity, resulting
in unregulated
proliferation. The tumor suppressors (e.g., therapeutic polypeptides) p53,
FHIT, p16 and C-
CAM can be employed.
In addition to p53, another inhibitor of cellular proliferation is p16. The
major
transitions of the eukaryotic cell cycle are triggered by cyclin-dependent
kinases, or CDK's.
One CDK, cyclin-dependent kinase 4 (CDK4), regulates progression through the
GI. The
activity of this enzyme may be to phosphorylate Rb at late G1. The activity of
CDK4 is
controlled by an activating subunit, D-type cyclin, and by an inhibitory
subunit, the p16INK4
has been biochemically characterized as a protein that specifically binds to
and inhibits
CDK4, and thus may regulate Rb phosphorylation (Serrano et al., 1993; Serrano
et al., 1995).
Since the p16INK4 protein is a CDK4 inhibitor (Serrano, 1993), deletion of
this gene may
increase the activity of CDK4, resulting in hyperphosphorylation of the Rb
protein. p16 also
is known to regulate the function of CDK6.
p16INK4 belongs to a newly described class of CDK-inhibitory proteins that
also
includes pl6B, p19, p21WAF1, and p27KIPI. The p161NK4 gene maps to 9p2l, a
chromosome region frequently deleted in many tumor types. Homozygous deletions
and
mutations of the p161NK4 gene are frequent in human tumor cell lines. This
evidence
suggests that the p16INK4 gene is a tumor suppressor gene. This interpretation
has been
challenged, however, by the observation that the frequency of the p16INK4 gene
alterations
is much lower in primary uncultured tumors than in cultured cell lines (Caldas
et al., 1994;
Cheng et al., 1994; Hussussian et al., 1994; Kamb et al., 1994; Mori et al.,
1994; Okamoto et
- 106 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
al., 1994; Nobori et al., 1995; Orlow et al., 1994; Arap et al., 1995).
Restoration of wild-type
p 1 61NK4 function by transfection with a plasmid expression vector reduced
colony formation
by some human cancer cell lines (Okamoto, 1994; Arap, 1995).
Other genes that may be employed according to the present invention include
Rb,
APC, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, zacl, p73, VHL, MMACI / PTEN,
DBCCR-1, FCC, rsk-3, p27, p27/pl6 fusions, p2l/p27 fusions, anti-thrombotic
genes (e.g.,
COX-1, TFPI), PGS, Dp, E2F, ras, myc, neu, raf, erb, fms, trk, ret, gsp, hst,
abl, E1A, p300,
genes involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-1, GDAIF,
or their
receptors) and MCC.
5. Surgery
Approximately 60% of persons with cancer will undergo surgery of some type,
which
includes preventative, diagnostic or staging, curative and palliative surgery.
Curative surgery
is a cancer treatment that may be used in conjunction with other therapies,
such as the
treatment of the present invention, chemotherapy, radiotherapy, hormonal
therapy, gene
therapy, immunotherapy and/or alternative therapies.
Curative surgery includes resection in which all or part of cancerous tissue
is
physically removed, excised, and/or destroyed. Tumor resection refers to
physical removal
of at least part of a tumor. In addition to tumor resection, treatment by
surgery includes laser
surgery, cryosurgery, electrosurgery, and microscopically controlled surgery
(Mohs'
surgery). It is further contemplated that the present invention may be used in
conjunction
with removal of superficial cancers, precancers, or incidental amounts of
normal tissue.
Upon excision of part of all of cancerous cells, tissue, or tumor, a cavity
may be
formed in the body. Treatment may be accomplished by perfusion, direct
injection or local
application of the area with an additional anti-cancer therapy. Such treatment
may be
repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4,
and 5 weeks or
every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be
of varying
dosages as well.
6. Other Agents
It is contemplated that other agents may be used in combination with the
present
invention to improve the therapeutic efficacy of treatment. These additional
agents include
- 107 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
immunomodulatory agents, agents that affect the upregulation of cell surface
receptors and
GAP junctions, cytostatic and differentiation agents, inhibitors of cell
adhesion, agents that
increase the sensitivity of the hyperproliferative cells to apoptotic
inducers, or other
biological agents. Immunomodulatory agents include tumor necrosis factor;
interferon alpha,
beta, and gamma; IL-2 and other cytokines; F42K and other cytokine analogs; or
MIP-1,
MIP-lbeta, MCP-1, RANTES, and other chemokines. It is further contemplated
that the
upregulation of cell surface receptors or their ligands such as Fas / Fas
ligand, DR4 or DR5 /
TRAIL (Apo-2 ligand) would potentiate the apoptotic inducing abilities of the
present
invention by establishment of an autocrine or paracrine effect on
hyperproliferative cells.
Increases intercellular signaling by elevating the number of GAP junctions
would increase
the anti-hyperproliferative effects on the neighboring hyperproliferative cell
population. In
other embodiments, cytostatic or differentiation agents can be used in
combination with the
present invention to improve the anti-hyperproliferative efficacy of the
treatments. Inhibitors
of cell adhesion are contemplated to improve the efficacy of the present
invention. Examples
of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and
Lovastatin. It is
further contemplated that other agents that increase the sensitivity of a
hyperproliferative cell
to apoptosis, such as the antibody c225, could be used in combination with the
present
invention to improve the treatment efficacy.
Apo2 ligand (Apo2L, also called TRAIL) is a member of the tumor necrosis
factor
(TNF) cytokine family. TRAIL activates rapid apoptosis in many types of cancer
cells, yet is
not toxic to normal cells. TRAIL mRNA occurs in a wide variety of tissues.
Most normal
cells appear to be resistant to TRAIL's cytotoxic action, suggesting the
existence of
mechanisms that can protect against apoptosis induction by TRAIL. The first
receptor
described for TRAIL, called death receptor 4 (DR4), contains a cytoplasmic
"death domain";
DR4 transmits the apoptosis signal carried by TRAIL. Additional receptors have
been
identified that bind to TRAIL. One receptor, called DR5, contains a
cytoplasmic death
domain and signals apoptosis much like DR4. The DR4 and DR5 mRNAs are
expressed in
many normal tissues and tumor cell lines. Recently, decoy receptors such as
DcRI and DcR2
have been identified that prevent TRAIL from inducing apoptosis through DR4
and DR5.
These decoy receptors thus represent a novel mechanism for regulating
sensitivity to a pro-
apoptotic cytokine directly at the cell's surface. The preferential expression
of these inhibitory
receptors in normal tissues suggests that TRAIL may be useful as an anticancer
agent that
induces apoptosis in cancer cells while sparing normal cells. (Marsters et
al., 1999).
-108-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
There have been many advances in the therapy of cancer following the
introduction of
cytotoxic chemotherapeutic drugs. However, one of the consequences of
chemotherapy is the
development/acquisition of drug-resistant phenotypes and the development of
multiple drug
resistance. The development of drug resistance remains a major obstacle in the
treatment of
such tumors and therefore, there is an obvious need for alternative approaches
such as gene
therapy.
Another form of therapy for use in conjunction with chemotherapy, radiation
therapy
or biological therapy includes hyperthermia, which is a procedure in which a
patient's tissue
is exposed to high temperatures (up to 106 F). External or internal heating
devices may be
involved in the application of local, regional, or whole-body hyperthermia.
Local
hyperthermia involves the application of heat to a small area, such as a
tumor. Heat may be
generated externally with high-frequency waves targeting a tumor from a device
outside the
body. Internal heat may involve a sterile probe , including thin, heated wires
or hollow tubes
filled with warm water, implanted microwave antennae, or radiofrequency
electrodes.
A patient's organ or a limb is heated for regional therapy, which is
accomplished
using devices that produce high energy, such as magnets. Alternatively, some
of the patient's
blood may be removed and heated before being perfused into an area that will
be internally
heated. Whole-body heating may also be implemented in cases where cancer has
spread
throughout the body. Warm-water blankets, hot wax, inductive coils, and
thermal chambers
may be used for this purpose.
Hormonal therapy may also be used in conjunction with the present invention or
in
combination with any other cancer therapy previously described. The use of
hormones may
be employed in the treatment of certain cancers such as breast, prostate,
ovarian, or cervical
cancer to lower the level or block the effects of certain hormones such as
testosterone or
estrogen. This treatment is often used in combination with at least one other
cancer therapy
as a treatment option or to reduce the risk of metastases.
This application incorporates U.S. Application Serial No. 11/349,727 filed on
February 8, 2006 claiming priority to U.S. Provisional Application Serial No.
60/650,807
filed February 8, 2005 herein by references in its entirety.
- 109 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
III. MIRNA MOLECULES
MicroRNA molecules ("miRNAs") are generally 21 to 22 nucleotides in length,
though lengths of 19 and up to 23 nucleotides have been reported. The miRNAs
are each
processed from a longer precursor RNA molecule ("precursor miRNA"). Precursor
miRNAs
are transcribed from non-protein-encoding genes. The precursor miRNAs have two
regions
of complementarity that enables them to form a stem-loop- or fold-back-like
structure, which
is cleaved in animals by a ribonuclease III-like nuclease enzyme called Dicer.
The processed
miRNA is typically a portion of the stem.
The processed miRNA (also referred to as "mature miRNA") becomes part of a
large
complex to down-regulate a particular target gene or its gene product.
Examples of animal
miRNAs include those that imperfectly basepair with the target, which halts
translation
(Olsen et al., 1999; Seggerson et al., 2002). siRNA molecules also are
processed by Dicer,
but from a long, double-stranded RNA molecule. siRNAs are not naturally found
in animal
cells, but they can direct the sequence-specific cleavage of an mRNA target
through a RNA-
induced silencing complex (RISC) (Denli et al., 2003).
A. Array Preparation
Certain embodiments of the present invention concems the preparation and use
of
mRNA or nucleic acid arrays, miRNA or nucleic acid arrays, and/or miRNA or
nucleic acid
probe arrays, which are macroarrays or microarrays of nucleic acid molecules
(probes) that
are fully or nearly complementary (over the length of the prove) or identical
(over the length
of the prove) to a plurality of nucleic acid, mRNA or miRNA molecules,
precursor miRNA
molecules, or nucleic acids derived from the various genes and gene pathways
modulated by
miR-143 miRNAs and that are positioned on a support or support material in a
spatially
separated organization. Macroarrays are typically sheets of nitrocellulose or
nylon upon
which probes have been spotted. Microarrays position the nucleic acid probes
more densely
such that up to 10,000 nucleic acid molecules can be fit into a region
typically 1 to 4 square
centimeters. Microarrays can be fabricated by spotting nucleic acid molecules,
e.g., genes,
oligonucleotides, etc., onto substrates or fabricating oligonucleotide
sequences in situ on a
substrate. Spotted or fabricated nucleic acid molecules can be applied in a
high density
matrix pattern of up to about 30 non-identical nucleic acid molecules per
square centimeter or
higher, e.g. up to about 100 or even 1000 per square centimeter. Microarrays
typically use
coated glass as the solid support, in contrast to the nitrocellulose-based
material of filter
- 110 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
arrays. By having an ordered array of marker RNA and/or miRNA-complementing
nucleic
acid samples, the position of each sample can be tracked and linked to the
original sample.
A variety of different array devices in which a plurality of distinct nucleic
acid probes
are stably associated with the surface of a solid support are known to those
of skill in the art.
Useful substrates for arrays include nylon, glass, metal, plastic, latex, and
silicon. Such
arrays may vary in a number of different ways, including average probe length,
sequence or
types of probes, nature of bond between the probe and the array surface, e.g.
covalent or non-
covalent, and the like. The labeling and screening methods of the present
invention and the
arrays are not limited in its utility with respect to any parameter except
that the probes detect
miRNA, or genes or nucleic acid representative of genes; consequently, methods
and
compositions may be used with a variety of different types of nucleic acid
arrays.
Representative methods and apparatus for preparing a microarray have been
described, for example, in U.S. Patents 5,143,854; 5,202,231; 5,242,974;
5,288,644;
5,324,633; 5,384,261; 5,405,783; 5,412,087; 5,424,186; 5,429,807; 5,432,049;
5,436,327;
5,445,934; 5,468,613; 5,470,710; 5,472,672; 5,492,806; 5,525,464; 5,503,980;
5,510,270;
5,525,464; 5,527,681; 5,529,756; 5,532,128; 5,545,531; 5,547,839; 5,554,501;
5,556,752;
5,561,071; 5,571,639; 5,580,726; 5,580,732; 5,593,839; 5,599,695; 5,599,672;
5,610;287;
5,624,711; 5,631,134; 5,639,603; 5,654,413; 5,658,734; 5,661,028; 5,665,547;
5,667,972;
5,695,940; 5,700,637; 5,744,305; 5,800,992; 5,807,522; 5,830,645; 5,837,196;
5,871,928;
5,847,219; 5,876,932; 5,919,626; 6,004,755; 6,087,102; 6,368,799; 6,383,749;
6,617,112;
6,638,717; 6,720,138, as well as WO 93/17126; WO 95/11995; WO 95/21265; WO
95/21944; WO 95/35505; WO 96/31622; WO 97/10365; WO 97/27317; WO 99/35505; WO
09923256; WO 09936760; W00138580; WO 0168255; WO 03020898; WO 03040410; WO
03053586; WO 03087297; WO 03091426; W003100012; WO 04020085; WO 04027093;
EP 373 203; EP 785 280; EP 799 897 and UK 8 803 000; the disclosures of which
are all
herein incorporated by reference.
It is contemplated that the arrays can be high density arrays, such that they
contain 2,
20, 25, 50, 80, 100 or more different probes. It is contemplated that they may
contain 1000,
16,000, 65,000, 250,000 or 1,000,000 or more different probes. The probes can
be directed
to mRNA and/or miRNA targets in one or more different organisms or cell types.
The
oligonucleotide probes range from 5 to 50, 5 to 45, 10 to 40, 9 to 34, or 15
to 40 nucleotides
in length in some embodiments. In certain embodiments, the oligonucleotide
probes are 5,
-I11-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
10, 15, 20 to 20, 25, 30, 35, 40 nucleotides in length including all integers
and ranges there
between.
The location and sequence of each different probe sequence in the array are
generally
known. Moreover, the large nuinber of different probes can occupy a relatively
small area
providing a high density array having a probe density of generally greater
than about 60, 100,
600, 1000, 5,000, 10,000, 40,000, 100,000, or 400,000 different
oligonucleotide probes per
cm2. The surface area of the array can be about or less than about 1, 1.6, 2,
3, 4, 5, 6, 7, 8, 9,
or 10 cm2.
Moreover, a person of ordinary skill in the art could readily analyze data
generated
using an array. Such protocols are disclosed above, and include information
found in WO
9743450; WO 03023058; WO 03022421; WO 03029485; WO 03067217; WO 03066906;
WO 03076928; WO 03093810; WO 03100448A1, all of which are specifically
incorporated
by reference.
B. Sample Preparation
It is contemplated that the RNA and/or miRNA of a wide variety of samples can
be
analyzed using the arrays, index of probes, or array technology of the
invention. While
endogenous miRNA is contemplated for use with compositions and methods of the
invention,
recombinant miRNA - including riucleic acids that are complementary or
identical to
endogenous miRNA or precursor miRNA - can also be handled and analyzed as
described
herein. Samples may be biological samples, in which case, they can be from
biopsy, fine
needle aspirates, exfoliates, blood, tissue, organs, semen, saliva, tears,
other bodily fluid, hair
follicles, skin, or any sample containing or constituting biological cells,
particularly cancer or
hyperproliferative cells. In certain embodiments, samples may be, but are not
limited to,
biopsy, or cells purified or enriched to some extent from a biopsy or other
bodily fluids or
tissues. Alternatively, the sample may not be a biological sample, but be a
chemical mixture,
such as a cell-free reaction mixture (which may contain one or more biological
enzyines).
C. Hybridization
After an array or a set of probes is prepared and/or the nucleic acid in the
sample or
probe is labeled, the population of target nucleic acids is contacted with the
array or probes
under hybridization conditions, where such conditions can be adjusted, as
desired, to provide
for an optimum level of specificity in view of the particular assay being
performed. Suitable
- 112 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
hybridization conditions are well known to those of skill in the art and
reviewed in Sambrook
et al. (2001) and WO 95/21944. Of particular interest in many embodiments is
the use of
stringent conditions during hybridization. Stringent conditions are known to
those of skill in
the art.
It is specifically contemplated that a single array or set of probes may be
contacted
with multiple samples. The samples may be labeled with different labels to
distinguish the
samples. For example, a single array can be contacted with a tumor tissue
sample labeled
with Cy3, and normal tissue sample labeled with Cy5. Differences between the
samples for
particular miRNAs corresponding to probes on the array can be readily
ascertained and
quantified.
The small surface area of the array permits uniform hybridization conditions,
such as
temperature regulation and salt content. Moreover, because of the small area
occupied by the
high density arrays, hybridization may be carried out in extremely small fluid
volumes (e.g.,
about 250 l or less, including volumes of about or less than about 5, 10, 25,
50, 60, 70, 80,
90, 100 1, or any range derivable therein). In small volumes, hybridization
may proceed
very rapidly.
D. Differential Expression Analyses
Arrays of the invention can be used to detect differences between two samples.
Specifically contemplated applications include identifying and/or quantifying
differences
between miRNA or gene expression from a sample that is normal and from a
sample that is
not normal, between a disease or condition and a cell not exhibiting such a
disease or
condition, or between two differently treated samples. Also, miRNA or gene
expression may
be compared between a sample believed to be susceptible to a particular
disease or condition
and one believed to be not susceptible or resistant to that disease or
condition. A sample that
is not normal is one exhibiting phenotypic or genotypic trait(s) of a disease
or condition, or
one believed to be not normal with respect to that disease or condition. It
may be compared
to a cell that is normal with respect to that disease or condition. Phenotypic
traits include
symptoms of, or susceptibility to, a disease or condition of which a component
is or may or
may not be genetic, or caused by a hyperproliferative or neoplastic cell or
cells.
An array comprises a solid support with nucleic acid probes attached to the
support.
Arrays typically comprise a plurality of different nucleic acid probes that
are coupled to a
- 113 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
surface of a substrate in different, known locations. These arrays, also
described as
"microarrays" or colloquially "chips" have been generally described in the
art, for example,
U.S. Patents 5,143,854, 5,445,934, 5,744,305, 5,677,195, 6,040,193, 5,424,186
and Fodor et
al., (1991), each of which is incorporated by reference in its entirety for
all purposes.
Techniques for the synthesis of these arrays using mechanical synthesis
methods are
described in, e.g., U.S. Patent 5,384,261, incorporated herein by reference in
its entirety for
all purposes. Although a planar array surface is used in certain aspects, the
array may be
fabricated on a surface of virtually any shape or even a multiplicity of
surfaces. Arrays may
be nucleic acids on beads, gels, polymeric surfaces, fibers such as fiber
optics, glass or any
other appropriate substrate, see U.S. Patents 5,770,358, 5,789,162, 5,708,153,
6,040,193 and
5,800,992, which are hereby incorporated in their entirety for all purposes.
Arrays may be
packaged in such a manner as to allow for diagnostics or other manipulation of
an all
inclusive device, see for example, U.S. Patents 5,856,174 and 5,922,591
incorporated in their
entirety by reference for all purposes. See also U.S. patent application Ser.
No. 09/545,207,
filed April 7, 2000 for additional information concerning arrays, their
manufacture, and their
characteristics, which is incorporated by reference in its entirety for all
purposes.
Particularly, arrays can be used to evaluate samples with respect to
pathological
condition such as cancer and related conditions. It is specifically
contemplated that the
invention can be used to evaluate differences between stages or sub-
classifications of disease,
such as between benign, cancerous, and metastatic tissues or tumors.
Phenotypic traits to be assessed include characteristics such as longevity,
morbidity,
expected survival, susceptibility or receptivity to particular drugs or
therapeutic treatments
(drug efficacy), and risk of drug toxicity. Samples that differ in these
phenotypic traits may
also be evaluated using the compositions and methods described.
In certain embodiments, miRNA and/or expression profiles may be generated to
evaluate and correlate those profiles with pharmacokinetics or therapies. For
example, these
profiles may be created and evaluated for patient tumor and blood samples
prior to the
patient's being treated or during treatment to determine if there are miRNA or
genes whose
expression correlates with the outcome of the patient's treatment.
Identification of
differential miRNAs or genes can lead to a diagnostic assay for evaluation of
tumor and/or
blood samples to determine what drug regimen the patient should be provided.
In addition, it
can be used to identify or select patients suitable for a particular clinical
trial. If an
- 114 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
expression profile is determined to be correlated with drug efficacy or drug
toxicity that
profile is relevant to whether that patient is an appropriate patient for
receiving a drug, for
receiving a combination of drugs, or for a particular dosage of the drug.
In addition to the above prognostic assay, samples from patients with a
variety of
diseases can be evaluated to determine if different diseases can be identified
based on
miRNA and/or related gene expression levels. A diagnostic assay can be created
based on
the profiles that doctors can use to identify individuals with a disease or
who are at risk to
develop a disease. Altematively, treatments can be designed based on miRNA
profiling.
Examples of such methods and compositions are described in the U.S.
Provisional Patent
Application entitled "Methods and Compositions Involving miRNA and miRNA
Inhibitor
Molecules" filed on May 23, 2005, which is hereby incorporated by reference in
its entirety.
E. Other Assays
In addition to the use of arrays and microarrays, it is contemplated that a
number of
different assays could be employed to analyze miRNAs or related genes, their
activities, and
their effects. Such assays include, but are not limited to, nucleic acid
amplification,
polymerase chain reaction, quantitative PCR, RT-PCR, in situ hybridization,
Northem
hybridization, hybridization protection assay (HPA)(GenProbe), branched DNA
(bDNA)
assay (Chiron), rolling circle amplification (RCA), single molecule
hybridization detection
(US Genomics), Invader assay (ThirdWave Technologies), and/or Bridge
Litigation Assay
(Genaco).
IV. NUCLEIC ACIDS
The present invention concerns nucleic acids, modified or mimetic nucleic
acids,
miRNAs, mRNAs, genes, and representative fragments thereof that can be
labeled, used in
array analysis, or employed in diagnostic, therapeutic, or prognostic
applications, particularly
those related to pathological conditions such as cancer. The molecules may
have been
endogenously produced by a cell, or been synthesized or produced chemically or
recombinantly. They may be isolated and/or purified. Each of the miRNAs
described herein
and include the corresponding SEQ ID NO and accession numbers for these miRNA
sequences. The name of a miRNA is often abbreviated and referred to without
a"hsa-"
prefix and will be understood as such, depending on the context. Unless
otherwise indicated,
- 115 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
miRNAs referred to in the application are human sequences identified as miR-X
or let-X,
where X is a number and/or letter.
In certain aspects, a miRNA probe designated by a suffix "5P" or "3P" can be
used.
"5P" indicates that the mature miRNA derives from the 5' end of the precursor
and a
corresponding "3P" indicates that it derives from the 3' end of the precursor,
as described on
the world wide web at sanger.ac.uk. Moreover, in some embodiments, a miRNA
probe is
used that does not correspond to a known human miRNA. It is contemplated that
these non-
human miRNA probes may be used in embodiments of the invention or that there
may exist a
human miRNA that is homologous to the non-human miRNA. In other embodiments,
any
mammalian cell, biological sample, or preparation thereof may be employed.
In some embodiments of the invention, methods and compositions involving miRNA
may concern miRNA, markers (mRNAs), and/or other nucleic acids. Nucleic acids
may be,
be at least, or be at most 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22,
23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41,
42, 43, 44, 45, 46, 47,
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66,
67, 68, 69, 70, 71, 72,
73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91,
92, 93, 94, 95, 96, 97,
98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 120, 130, 140,
150, 160, 170,
180, 190, 200, 210, 220, 230, 240, 250, ~260, 270, 280, 290, 300, 310, 320,
330, 340, 350,
360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500,
510, 520, 530,
540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680,
690, 700, 710,
720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860,
870, 880, 890,
900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 nucleotides, or any
range derivable
therein, in length. Such lengths cover the lengths of processed miRNA, miRNA
probes,
precursor miRNA, miRNA containing vectors, mRNA, mRNA probes, control nucleic
acids,
and other probes and primers.
In many embodiments, miRNA are 19-24 nucleotides in length, while miRNA probes
are 19-35 nucleotides in length, depending on the length of the processed
miRNA and any
flanking regions added. miRNA precursors are generally between 62 and 110
nucleotides in
humans.
Nucleic acids of the invention may have regions of identity or complementarity
to
another nucleic acid. It is contemplated that the region of complementarity or
identity can be
-116-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
at least 5 contiguous residues, though it is specifically contemplated that
the region is, is at
least, or is at most 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,
46, 47, 48, 49, 50, 51,
52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70,
71, 72, 73, 74, 75, 76,
77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95,
96, 97, 98, 99, 100,
110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250,
260, 270, 280,
290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430,
440, 441, 450,
460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600,
610, 620, 630,
640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780,
790, 800, 810,
820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960,
970, 980, 990, or
1000 contiguous nucleotides. It is further understood that the length of
complementarity
within a precursor miRNA or other nucleic acid or between a miRNA probe and a
miRNA or
a miRNA gene are such lengths. Moreover, the complementarity may be expressed
as a
percentage, meaning that the complementarity between a probe and its target is
90% or
greater over the length of the probe. In some embodiments, complementarity is
or is at least
90%, 95% or 100%. In particular, such lengths may be applied to any nucleic
acid
comprising a nucleic acid sequence identified in any of SEQ ID NO:1-13,
accession number,
or any other sequence disclosed herein. Typically, the commonly used name of
the miRNA
is given (with its identifying source in the prefix, for example, "hsa" for
human sequences)
and the processed miRNA sequence. Unless otherwise indicated, a miRNA without
a prefix
will be understood to refer to a human miRNA. Moreover, a lowercase letter in
a miRNA
name may or may not be lowercase; for example, hsa-mir-130b can also be
referred to as
miR-130B. The term "miRNA probe" refers to a nucleic acid probe that can
identify a
particular miRNA or structurally related miRNAs.
It is understood that some nucleic acids are derived from genomic sequences or
a
gene. In this respect, the term "gene" is used for simplicity to refer to the
genomic sequence
encoding the precursor nucleic acid or miRNA for a given miRNA or gene.
However,
embodiments of the invention may involve genomic sequences of a miRNA that are
involved
in its expression, such as a promoter or other regulatory sequences.
The term "recombinant" may be used and this generally refers to a molecule
that has
been manipulated in vitro or that is a replicated or expressed product of such
a molecule.
- 117 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
The term "nucleic acid" is well known in the art. A "nucleic acid" as used
herein will
generally refer to a molecule (one or more strands) of DNA, RNA or a
derivative or analog
thereof, comprising a nucleobase. A nucleobase includes, for example, a
naturally occurring
purine or pyrimidine base found in DNA (e.g., an adenine "A," a guanine "G," a
thymine "T"
or a cytosine "C") or RNA (e.g., an A, a G, an uracil "U" or a C). The term
"nucleic acid"
encompasses the terms "oligonucleotide" and "polynucleotide," each as a
subgenus of the
term "nucleic acid."
The term "miRNA" generally refers to a single-stranded molecule, but in
specific
embodiments, molecules implemented in the invention will also encompass a
region or an
additional strand that is partially (between 10 and 50% complementary across
length of
strand), substantially (greater than 50% but less than 100% complementary
across length of
strand) or fully complementary to another region of the same single-stranded
molecule or to
another nucleic acid. Thus, miRNA may encompass a molecule that comprises one
or more
complementary or self-complementary strand(s) or "complement(s)" of a
particular sequence.
For example, precursor miRNA may have a self-complementary region, which is up
to 100%
complementary, miRNA probes or nucleic acids of the invention can include, can
be or can
be at least 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100%
complementary to their
target.
It is understood that a "synthetic nucleic acid" of the invention means that
the nucleic
acid does not have all or part of a chemical structure or sequence of a
naturally occurring
nucleic acid. Consequently, it will be understood that the term "synthetic
miRNA" refers to a
"synthetic nucleic acid" that functions in a cell or under physiological
conditions as a
naturally occurring miRNA.
While embodiments of the invention may involve synthetic miRNAs or synthetic
nucleic acids, in some embodiments of the invention, the nucleic acid
molecule(s) need not
be "synthetic." In certain embodiments, a non-synthetic nucleic acid or miRNA
employed in
methods and compositions of the invention may have the entire sequence and
structure of a
naturally occurring mRNA or miRNA precursor or the mature mRNA or miRNA. For
example, non-synthetic miRNAs used in methods and compositions of the
invention may not
have one or more modified nucleotides or nucleotide analogs. In these
embodiments, the
non-synthetic miRNA may or may not be recombinantly produced. In particular
embodiments, the nucleic acid in methods and/or compositions of the invention
is specifically
- 118 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
a synthetic miRNA and not a non-synthetic miRNA (that is, not an miRNA that
qualifies as
"synthetic"); though in other embodiments, the invention specifically involves
a non-
synthetic miRNA and not a synthetic miRNA. Any embodiments discussed with
respect to
the use of synthetic miRNAs can be applied with respect to non-synthetic
miRNAs, and vice
versa.
It will be understood that the term "naturally occurring" refers to something
found in
an organism without any intervention by a person; it could refer to a
naturally-occurring
wildtype or mutant molecule. In some embodiments a synthetic miRNA molecule
does not
have the sequence of a naturally occurring miRNA molecule. In other
embodiments, a
synthetic miRNA molecule may have the sequence of a naturally occurring miRNA
molecule, but the chemical structure of the molecule, particularly in the part
unrelated
specifically to the precise sequence (non-sequence chemical structure) differs
from chemical
structure of the naturally occurring miRNA molecule with that sequence. In
some cases, the
synthetic miRNA has both a sequence and non-sequence chemical structure that
are not
found in a naturally-occurring miRNA. Moreover, the sequence of the synthetic
molecules
will identify which miRNA is effectively being provided or inhibited; the
endogenous
miRNA will be referred to as the "corresponding miRNA." Corresponding miRNA
sequences that can be used in the context of the invention include, but are
not limited to, all
or a portion of those sequences in the SEQ IDs provided herein, as well as any
other miRNA
sequence, miRNA precursor sequence, or any sequence complementary thereof In
some
embodiments, the sequence is or is derived from or contains all or part of a
sequence
identified herein to target a particular miRNA (or set of miRNAs) that can be
used with that
sequence.
As used herein, "hybridization", "hybridizes" or "capable of hybridizing" is
understood to mean the forming of a double or triple stranded molecule or a
molecule with
partial double or triple stranded nature. The term "anneal" as used herein is
synonymous
with "hybridize." The term "hybridization", "hybridize(s)" or "capable of
hybridizing"
encompasses the terms "stringent condition(s)" or "high stringency" and the
terms "low
stringency" or "low stringency condition(s)."
As used herein "stringent condition(s)" or "high stringency" are those
conditions that
allow hybridization between or within one or more nucleic acid strand(s)
containing
complementary sequence(s), but preclude hybridization of random sequences.
Stringent
- 119 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
conditions tolerate little, if any, mismatch between a nucleic acid and a
target strand. Such
conditions are well known to those of ordinary skill in the art, and are
preferred for
applications requiring high selectivity. Non-limiting applications include
isolating a nucleic
acid, such as a gene or a nucleic acid segment thereof, or detecting at least
one specific
mRNA transcript or a nucleic acid segment thereof, and the like.
Stringent conditions may comprise low salt and/or high temperature conditions,
such
as provided by about 0.02 M to about 0.5 M NaCl at temperatures of about 42 C
to about
70 C. It is understood that the temperature and ionic strength of a desired
stringency are
determined in part by the length of the particular nucleic acid(s), the length
and nucleobase
content of the target sequence(s), the charge composition of the nucleic
acid(s), and to the
presence or concentration of formamide, tetramethylammonium chloride or other
solvent(s)
in a hybridization mixture.
It is also understood that these ranges, compositions and conditions for
hybridization
are mentioned by way of non-limiting examples only, and that the desired
stringency for a
particular hybridization reaction is often determined empirically by
comparison to one or
more positive or negative controls. Depending on the application envisioned it
is preferred to
employ varying conditions of hybridization to achieve varying degrees of
selectivity of a
nucleic acid towards a target sequence. In a non-limiting example,
identification of a related
target nucleic acid that does not hybridize to a nucleic acid under stringent
conditions may be
achieved by hybridization at low temperature and/or high ionic strength. Such
conditions are
termed "low stringency" or "low stringency conditions," and non-limiting
examples of low
stringency include hybridization performed at about 0.15 M to about 0.9 M NaCI
at a
temperature range of about 20 C to about 50 C. Of course, it is within the
skill of one in the
art to further modify the low or high stringency conditions to suite a
particular application.
A. Nucleobase, Nucleoside, Nucleotide, and Modified Nucleotides
As used herein a "nucleobase" refers to a heterocyclic base, such as for
example a
naturally occurring nucleobase (i.e., an A, T, G, C or U) found in at least
one naturally
occurring nucleic acid (i.e., DNA and RNA), and naturally or non-naturally
occurring
derivative(s) and analogs of such a nucleobase. A nucleobase generally can
form one or
more hydrogen bonds ("anneal" or "hybridize") with at least one naturally
occurring
nucleobase in a manner that may substitute for naturally occurring nucleobase
pairing (e.g.,
the hydrogen bonding between A and T, G and C, and A and U).
-120-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
"Purine" and/or "pyrimidine" nucleobase(s) encompass naturally occurring
purine
and/or pyrimidine nucleobases and also derivative(s) and analog(s) thereof,
including but not
limited to, those a purine or pyrimidine substituted by one or more of an
alkyl, caboxyalkyl,
amino, hydroxyl, halogen (i.e., fluoro, chloro, bromo, or iodo), thiol or
alkylthiol moiety.
Preferred alkyl (e.g., alkyl, caboxyalkyl, etc.) moieties comprise of from
about 1, about 2,
about 3, about 4, about 5, to about 6 carbon atoms. Other non-limiting
examples of a purine
or pyrimidine include a deazapurine, a 2,6-diaminopurine, a 5-fluorouracil, a
xanthine, a
hypoxanthine, a 8-bromoguanine, a 8-chloroguanine, a bromothymine, a 8-
aminoguanine, a
8-hydroxyguanine, a 8-methylguanine, a 8-thioguanine, an azaguanine, a 2-
aminopurine, a 5-
ethylcytosine, a 5-methylcyosine, a 5-bromouracil, a 5-ethyluracil, a 5-
iodouracil, a 5-
chlorouracil, a 5-propyluracil, a thiouracil, a 2-methyladenine, a
methylthioadenine, a N,N-
diemethyladenine, an azaadenines, a 8-bromoadenine, a 8-hydroxyadenine, a 6-
hydroxyaminopurine, a 6-thiopurine, a 4-(6-aminohexyl/cytosine), and the like.
Other
examples are well known to those of skill in the art.
As used herein, a "nucleoside" refers to an individual chemical unit
comprising a
nucleobase covalently attached to a nucleobase linker moiety. A non-limiting
example of a
"nucleobase linker moiety" is a sugar comprising 5-carbon atoms (i.e., a "5-
carbon sugar"),
including but not limited to a deoxyribose, a ribose, an arabinose, or a
derivative or an analog
of a 5-carbon sugar. Non-limiting examples of a derivative or an analog of a 5-
carbon sugar
include a 2'-fluoro-2'-deoxyribose or a carbocyclic sugar where a carbon is
substituted for an
oxygen atom in the sugar ring. Different types of covalent attachment(s) of a
nucleobase to a
nucleobase linker moiety are known in the art (Komberg and Baker, 1992).
As used herein, a "nucleotide" refers to a nucleoside further comprising a
"backbone
moiety". A backbone moiety generally covalently attaches a nucleotide to
another molecule
comprising a nucleotide, or to another nucleotide to form a nucleic acid. The
"backbone
moiety" in naturally occurring nucleotides typically comprises a phosphorus
moiety, which is
covalently attached to a 5-carbon sugar. The attachment of the backbone moiety
typically
occurs at either the 3'- or 5'-position of the 5-carbon sugar. However, other
types of
attachments are known in the art, particularly when a nucleotide comprises
derivatives or
analogs of a naturally occurring 5-carbon sugar or phosphorus moiety.
A nucleic acid may comprise, or be composed entirely of, a derivative or
analog of a
nucleobase, a nucleobase linker moiety and/or backbone moiety that may be
present in a
- 121 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
naturally occurring nucleic acid. RNA with nucleic acid analogs may also be
labeled
according to methods of the invention. As used herein a "derivative" refers to
a chemically
modified or altered form of a naturally occurring molecule, while the terms
"mimic" or
"analog" refer to a molecule that may or may not structurally resemble a
naturally occurring
molecule or moiety, but possesses similar functions. As used herein, a
"moiety" generally
refers to a smaller chemical or molecular component of a larger chemical or
molecular
structure. Nucleobase, nucleoside and nucleotide analogs or derivatives are
well known in
the art, and have been described (see for example, Scheit, 1980, incorporated
herein by
reference).
Additional non-limiting examples of nucleosides, nucleotides or nucleic acids
include
those in: U.S. Patents 5,681,947, 5,652,099 and 5,763,167, 5,614,617,
5,670,663, 5,872,232,
5,859,221, 5,446,137, 5,886,165, 5,714,606, 5,672,697, 5,466,786, 5,792,847,
5,223,618,
5,470,967, 5,378,825, 5,777,092, 5,623,070, 5,610,289, 5,602,240, 5,858,988,
5,214,136,
5,700,922, 5,708,154, 5,728,525, 5,637,683, 6,251,666, 5,480,980, and
5,728,525, each of
which is incorporated herein by reference in its entirety.
Labeling methods and kits of the invention specifically contemplate the use of
nucleotides that are both modified for attachment of a label and can be
incorporated into a
miRNA molecule. Such nucleotides include those that can be labeled with a dye,
including a
fluorescent dye, or with a molecule such as biotin. Labeled nucleotides are
readily available;
they can be acquired commercially or they can be synthesized by reactions
known to those of
skill in the art.
Modified nucleotides for use in the invention are not naturally occurring
nucleotides,
but instead, refer to prepared nucleotides that have a reactive moiety on
them. Specific
reactive functionalities of interest include: amino, sulfhydryl, sulfoxyl,
aminosulfhydryl,
azido, epoxide, isothiocyanate, isocyanate, anhydride, monochlorotriazine,
dichlorotriazine,
mono-or dihalogen substituted pyridine, mono- or disubstituted diazine,
maleimide, epoxide,
aziridine, sulfonyl halide, acid halide, alkyl halide, aryl halide,
alkylsulfonate, N-
hydroxysuccinimide ester, imido ester, hydrazine, azidonitrophenyl, azide, 3-
(2-pyridyl
dithio)-propionamide, glyoxal, aldehyde, iodoacetyl, cyanomethyl ester, p-
nitrophenyl ester,
o-nitrophenyl ester, hydroxypyridine ester, carbonyl imidazole, and the other
such chemical
groups. In some embodiments, the reactive functionality may be bonded directly
to a
nucleotide, or it may be bonded to the nucleotide through a linking group. The
functional
-122-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
moiety and any linker cannot substantially impair the ability of the
nucleotide to be added to
the miRNA or to be labeled. Representative linking groups include carbon
containing linking
groups, typically ranging from about 2 to 18, usually from about 2 to 8 carbon
atoms, where
the carbon containing linking groups may or may not include one or more
heteroatoms, e.g.
S, 0, N etc., and may or may not include one or more sites of unsaturation. Of
particular
interest in many embodiments are alkyl linking groups, typically lower alkyl
linking groups
of 1 to 16, usually 1 to 4 carbon atoms, where the linking groups may include
one or more
sites of unsaturation. The functionalized nucleotides (or primers) used in the
above methods
of functionalized target generation may be fabricated using known protocols or
purchased
from commercial vendors, e.g., Sigma, Roche, Ambion, Biosearch Technologies
and NEN.
Functional groups may be prepared according to ways known to those of skill in
the art,
including the representative information found in U.S. Patents 4,404,289;
4,405,711;
4,337,063 and 5,268,486, and U.K.. Patent 1,529,202, which are all
incorporated by
reference.
Amine-modified nucleotides are used in several embodiments of the invention.
The
amine-modified nucleotide is a nucleotide that has a reactive amine group for
attachment of
the label. It is contemplated that any ribonucleotide (G, A, U, or C) or
deoxyribonucleotide
(G, A, T, or C) can be modified for labeling. Examples include, but are not
limited to, the
following modified ribo- and deoxyribo-nucleotides: 5-(3-aminoallyl)-UTP; 8-
[(4-
amino)butyll-amino-ATP and 8-[(6-amino)butyl]-amino-ATP; N6-(4-amino)butyl-
ATP, N6-
(6-amino)butyl-ATP, N4-[2,2-oxy-bis-(ethylamine)]-CTP; N6-(6-Amino)hexyl-ATP;
8-[(6-
Amino)hexyl]-amino-ATP; 5-propargylamino-CTP, 5-propargylamino-UTP; 5-(3-
aminoallyl)-dUTP; 8-[(4-amino)butyl]-amino-dATP and 8-[(6-amino)butyl]-amino-
dATP;
N6-(4-amino)butyl-dATP, N6-(6-amino)butyl-dATP, N4-[2,2-oxy-bis-(ethylamine)]-
dCTP;
N6-(6-Amino)hexyl-dATP; 8-[(6-Amino)hexyl]-amino-dATP; 5-propargylamino-dCTP,
and
5-propargylamino-dUTP. Such nucleotides can be prepared according to methods
known to
those of skill in the art. Moreover, a person of ordinary skill in the art
could prepare other
nucleotide entities with the same amine-modification, such as a 5-(3-
aminoallyl)-CTP, GTP,
ATP, dCTP, dGTP, dTTP, or dUTP in place of a 5-(3-aminoallyl)-UTP.
B. Preparation of Nucleic Acids
A nucleic acid may be made by any technique known to one of ordinary skill in
the
art, such as for example, chemical synthesis, enzymatic production, or
biological production.
- 123 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
It is specifically contemplated that miRNA probes of the invention are
chemically
synthesized.
In some embodiments of the invention, miRNAs are recovered or isolated from a
biological sample. The miRNA may be recombinant or it may be natural or
endogenous to
the cell (produced from the cell's genome). It is contemplated that a
biological sample may
be treated in a way so as to enhance the recovery of small RNA molecules such
as miRNA.
U.S. Patent Application Serial No. 10/667,126 describes such methods and it is
specifically
incorporated by reference herein. Generally, methods involve lysing cells with
a solution
having guanidinium and a detergent.
Alternatively, nucleic acid synthesis is performed according to standard
methods.
See, for example, Itakura and Riggs (1980) and U.S. Patents 4,704,362,
5,221,619, and
5,583,013, each of which is incorporated herein by reference. Non-limiting
examples of a
synthetic nucleic acid (e.g., a synthetic oligonucleotide), include a nucleic
acid made by in
vitro chemically synthesis using phosphotriester, phosphite, or
phosphoramidite chemistry
and solid phase techniques such as described in EP 266,032, incorporated
herein by
reference, or via deoxynucleoside H-phosphonate intermediates as described by
Froehler et
al., 1986 and U.S. Patent 5,705,629, each incorporated herein by reference.
Various different
mechanisms of oligonucleotide synthesis have been disclosed in for example,
U.S. Patents
4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744,
5,574,146,
5,602,244, each of which is incorporated herein by reference.
A non-limiting example of an enzymatically produced nucleic acid include one
produced by enzymes in amplification reactions such as PCRTM (see for example,
U.S.
Patents 4,683,202 and 4,682,195, each incorporated herein by reference), or
the synthesis of
an oligonucleotide described in U.S. Patent 5,645,897, incorporated herein by
reference. See
also Sambrook et al., 2001, incorporated herein by reference).
Oligonucleotide synthesis is well known to those of skill in the art. Various
different
mechanisms of oligonucleotide synthesis have been disclosed in for example,
U.S. Patents
4,659,774, 4,816,571, 5,141,813, 5,264,566, 4,959,463, 5,428,148, 5,554,744,
5,574,146,
5,602,244, each of which is incorporated herein by reference.
Recombinant methods for producing nucleic acids in a cell are well known to
those of
skill in the art. These include the use of vectors (viral and non-viral),
plasmids, cosmids, and
- 124 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
other vehicles for delivering a nucleic acid to a cell, which may be the
target cell (e.g., a
cancer cell) or simply a host cell (to produce large quantities of the desired
RNA molecule).
Alternatively, such vehicles can be used in the context of a cell free system
so long as the
reagents for generating the RNA molecule are present. Such methods include
those described
in Sambrook, 2003, Sambrook, 2001 and Sambrook, 1989, which are hereby
incorporated by
reference.
C. Isolation of Nucleic Acids
Nucleic acids may be isolated using techniques well known to those of skill in
the art,
though in particular embodiments, methods for isolating small nucleic acid
molecules, and/or
isolating RNA molecules can be employed. Chromatography is a process often
used to
separate or isolate nucleic acids from protein or from other nucleic acids.
Such methods can
involve electrophoresis with a gel matrix, filter columns, alcohol
precipitation, and/or other
chromatography. If miRNA from cells is to be used or evaluated, methods
generally involve
lysing the cells with a chaotropic (e.g., guanidinium isothiocyanate) and/or
detergent (e.g., N-
lauroyl sarcosine) prior to implementing processes for isolating particular
populations of
RNA.
In particular methods for separating miRNA from other nucleic acids, a gel
matrix is
prepared using polyacrylamide, though agarose can also be used. The gels may
be graded by
concentration or they may be uniform. Plates or tubing can be used to hold the
gel matrix for
electrophoresis. Usually one-dimensional electrophoresis is employed for the
separation of
nucleic acids. Plates are used to prepare a slab gel, while the tubing (glass
or rubber,
typically) can be used to prepare a tube gel. The phrase "tube
electrophoresis" refers to the
use of a tube or tubing, instead of plates, to form the gel. Materials for
implementing tube
electrophoresis can be readily prepared by a person of skill in the art or
purchased, such as
from C.B.S. Scientific Co., Inc. or Scie-Plas.
Methods may involve the use of organic solvents and/or alcohol to isolate
nucleic
acids, particularly miRNA used in methods and compositions of the invention.
Some
embodiments are described in U.S. Patent Application Serial No. 10/667,126,
which is
hereby incorporated by reference. Generally, this disclosure provides methods
for efficiently
isolating small RNA molecules from cells comprising: adding an alcohol
solution to a cell
lysate and applying the alcohol/lysate mixture to a solid support before
eluting the RNA
molecules from the solid support. In some embodiments, the amount of alcohol
added to a
-125-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
cell lysate achieves an alcohol concentration of about 55% to 60%. While
different alcohols
can be employed, ethanol works well. A solid support may be any structure, and
it includes
beads, filters, and columns, which may include a mineral or polymer support
with
electronegative groups. A glass fiber filter or column has worked particularly
well for such
isolation procedures.
In specific embodiments, miRNA isolation processes include: a) lysing cells in
the
sample with a lysing solution comprising guanidinium, wherein a lysate with a
concentration
of at least about I M guanidinium is produced; b) extracting miRNA molecules
from the
lysate with an extraction solution comprising phenol; c) adding to the lysate
an alcohol
solution for forming a lysate/alcohol mixture, wherein the concentration of
alcohol in the
mixture is between about 35% to about 70%; d) applying the lysate/alcohol
mixture to a solid
support; e) eluting the miRNA molecules from the solid support with an ionic
solution; and,
f) capturing the miRNA molecules. Typically the sample is dried and
resuspended in a liquid
and volume appropriate for subsequent manipulation.
V. LABELS AND LABELING TECHNIQUES
In some embodiments, the present invention concems miRNA that are labeled. It
is
contemplated that miRNA may first be isolated and/or purified prior to
labeling. This may
achieve a reaction that more efficiently labels the miRNA, as opposed to other
RNA in a
sample in which the miRNA is not isolated or purified prior to labeling. In
many
embodiments of the invention, the label is non-radioactive. Generally, nucleic
acids may be
labeled by adding labeled nucleotides (one-step process) or adding nucleotides
and labeling
the added nucleotides (two-step process).
A. Labeling Techniques
In some embodiments, nucleic acids are labeled by catalytically adding to the
nucleic
acid an already labeled nucleotide or nucleotides. One or more labeled
nucleotides can be
added to miRNA molecules. See U.S. Patent 6,723,509, which is hereby
incorporated by
reference.
In other embodiments, an unlabeled nucleotide or nucleotides is catalytically
added to
a miRNA, and the unlabeled nucleotide is modified with a chemical moiety that
enables it to
be subsequently labeled. In embodiments of the invention, the chemical moiety
is a reactive
amine such that the nucleotide is an amine-modified nucleotide. Examples of
amine-
-126-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
modified nucleotides are well known to those of skill in the art, many being
commercially
available such as from Ambion, Sigma, Jena Bioscience, and TriLink.
In contrast to labeling of cDNA during its synthesis, the issue for labeling
miRNA is
how to label the already existing molecule. The present invention concerns the
use of an
enzyme capable of using a di- or tri-phosphate ribonucleotide or
deoxyribonucleotide as a
substrate for its addition to a miRNA. Moreover, in specific embodiments, it
involves using a
modified di- or tri-phosphate ribonucleotide, which is added to the 3' end of
a miRNA.
Enzymes capable of adding such nucleotides include, but are not limited to,
poly(A)
polymerase, terminal transferase, and polynucleotide phosphorylase. In
specific
embodiments of the invention, a ligase is contemplated as not being the enzyme
used to add
the label, and instead, a non-ligase enzyme is employed. Terminal transferase
catalyzes the
addition of nucleotides to the 3' terminus of a nucleic acid. Polynucleotide
phosphorylase can
polymerize nucleotide diphosphates without the need for a primer.
B. Labels
Labels on miRNA or miRNA probes may be colorimetric (includes visible and UV
spectrum, including fluorescent), luminescent, enzymatic, or positron emitting
(including
radioactive). The label may be detected directly or indirectly. Radioactive
labels include
1251 32P 33P, and 35S. Examples of enzymatic labels include alkaline
phosphatase, luciferase,
horseradish peroxidase, and (3-galactosidase. Labels can also be proteins with
luminescent
properties, e.g., green fluorescent protein and phicoerythrin.
The colorimetric and fluorescent labels contemplated for use as conjugates
include,
but are not limited to, Alexa Fluor dyes, BODIPY dyes, such as BODIPY FL;
Cascade Blue;
Cascade Yellow; coumarin and its derivatives, such as 7-amino-4-
methylcoumarin,
aminocoumarin and hydroxycoumarin; cyanine dyes, such as Cy3 and Cy5; eosins
and
erythrosins; fluorescein and its derivatives, such as fluorescein
isothiocyanate; macrocyclic
chelates of lanthanide ions, such as Quantum DyeTM; Marina Blue; Oregon Green;
rhodamine
dyes, such as rhodamine red, tetramethylrhodamine and rhodamine 6G; Texas Red;
,
fluorescent energy transfer dyes, such as thiazole orange-ethidium
heterodimer; and,
TOTAB.
Specific examples of dyes include, but are not limited to, those identified
above and
the following: Alexa Fluor 350, Alexa Fluor 405, Alexa Fluor 430, Alexa Fluor
488, Alexa
- 127 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
Fluor 500. Alexa Fluor 514, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 555,
Alexa Fluor
568, Alexa Fluor 594, Alexa Fluor 610, Alexa Fluor 633, Alexa Fluor 647, Alexa
Fluor 660,
Alexa Fluor 680, Alexa Fluor 700, and, Alexa Fluor 750; amine-reactive BODIPY
dyes, such
as BODIPY 493/503, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY
576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/655, BODIPY FL, BODIPY
R6G, BODIPY TMR, and, BODIPY-TR; Cy3, Cy5, 6-FAM, Fluorescein Isothiocyanate,
HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific
Blue, REG,
Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, 2',4',5',7'-
Tetrabromosulfonefluorescein, and TET.
Specific examples of fluorescently labeled ribonucleotides are available from
Molecular Probes, and these include, Alexa Fluor 488-5-UTP, Fluorescein-l2-
UTP, BODIPY
FL-14-UTP, BODIPY TMR-14-UTP, Tetramethylrhodamine-6-UTP, Alexa Fluor 546-14-
UTP, Texas Red-5-UTP, and BODIPY TR-14-UTP. Other fluorescent ribonucleotides
are
available from Amersham Biosciences, such as Cy3-UTP and Cy5-UTP.
Examples of fluorescently labeled deoxyribonucleotides include Dinitrophenyl
(DNP)-11-dUTP, Cascade Blue-7-dUTP, Alexa Fluor 488-5-dUTP, Fluorescein-l2-
dUTP,
Oregon Green 488-5-dUTP, BODIPY FL-14-dUTP, Rhodamine Green-5-dUTP, Alexa
Fluor
532-5-dUTP, BODIPY TMR-14-dUTP, Tetramethylrhodamine-6-dUTP, Alexa Fluor 546-
14-dUTP, Alexa Fluor 568-5-dUTP, Texas Red-12-dUTP, Texas Red-5-dUTP, BODIPY
TR-
14-dUTP, Alexa Fluor 594-5-dUTP, BODIPY 630/650-14-dUTP, BODIPY 650/665-14-
dUTP; Alexa Fluor 488-7-OBEA-dCTP, Alexa Fluor 546-16-OBEA-dCTP, Alexa Fluor
594-
7-OBEA-dCTP, Alexa Fluor 647-12-OBEA-dCTP.
It is contemplated that nucleic acids may be labeled with two different
labels.
Furthermore, fluorescence resonance energy transfer (FRET) may be employed in
methods of
the invention (e.g., Klostermeier et al., 2002; Emptage, 2001; Didenko, 2001,
each
incorporated by reference).
Alternatively, the label may not be detectable per se, but indirectly
detectable or
allowing for the isolation or separation of the targeted nucleic acid. For
example, the label
could be biotin, digoxigenin, polyvalent cations, chelator groups and the
other ligands,
include ligands for an antibody.
-128-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
C. Visualization Techniques
A number of techniques for visualizing or detecting labeled nucleic acids are
readily
available. Such techniques include, microscopy, arrays, Fluorometry, Light
cyclers or other
real time PCR machines, FACS analysis, scintillation counters, Phosphoimagers,
Geiger
counters, MRI, CAT, antibody-based detection methods (Westerns,
immunofluorescence,
immunohistochemistry), histochemical techniques, HPLC (Griffey et al., 1997),
spectroscopy, capillary gel electrophoresis (Cummins et al., 1996),
spectroscopy; mass
spectroscopy; radiological techniques; and mass balance techniques.
When two or more differentially colored labels are employed, fluorescent
resonance
energy transfer (FRET) techniques may be employed to characterize association
of one or
more nucleic acid. Furthermore, a person of ordinary skill in the art is well
aware of ways of
visualizing, identifying, and characterizing labeled nucleic acids, and
accordingly, such
protocols may be used as part of the invention. Examples of tools that may be
used also
include fluorescent microscopy, a BioAnalyzer, a plate reader, Storm
(Molecular Dynamics),
Array Scanner, FACS (fluorescent activated cell sorter), or any instrument
that has the ability
to excite and detect a fluorescent molecule.
VI. KITS
Any of the compositions described herein may be comprised in a kit. In a non-
limiting example, reagents for isolating miRNA, labeling miRNA, and/or
evaluating a
miRNA population using an array, nucleic acid amplification, and/or
hybridization can be
included in a kit, as well reagents for preparation of samples from blood
samples. The kit
may further include reagents for creating or synthesizing miRNA probes. The
kits will thus
comprise, in suitable container means, an enzyme for labeling the miRNA by
incorporating
labeled nucleotide or unlabeled nucleotides that are subsequently labeled. In
certain aspects,
the kit can include amplification reagents. In other aspects, the kit may
include various
supports, such as glass, nylon, polymeric beads, and the like, and/or reagents
for coupling any
probes and/or target nucleic acids. It may also include one or more buffers,
such as reaction
buffer, labeling buffer, washing buffer, or a hybridization buffer, compounds
for preparing
the miRNA probes, and components for isolating miRNA. Other kits of the
invention may
include components for making a nucleic acid array comprising miRNA, and thus,
may
include, for example, a solid support.
-129-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
Kits for implementing methods of the invention described herein are
specifically
contemplated. In some embodiments, there are kits for preparing miRNA for
multi-labeling
and kits for preparing miRNA probes and/or miRNA arrays. In these embodiments,
kit
comprise, in suitable container means, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12
or more of the
following: (1) poly(A) polymerase; (2) unmodified nucleotides (G, A, T, C,
and/or U); (3) a
modified nucleotide (labeled or unlabeled); (4) poly(A) polymerase buffer;
and, (5) at least
one microfilter; (6) label that can be attached to a nucleotide; (7) at least
one miRNA probe;
(8) reaction buffer; (9) a miRNA array or components for making such an array;
(10) acetic
acid; (11) alcohol; (12) solutions for preparing, isolating, enriching, and
purifying miRNAs
or miRNA probes or arrays. Other reagents include those generally used for
manipulating
RNA, such as formamide, loading dye, ribonuclease inhibitors, and DNase.
In specific embodiments, kits of the invention include an array containing
miRNA
probes, as described in the application. An array may have probes
corresponding to all
known miRNAs of an organism or a particular tissue or organ in particular
conditions, or to a
subset of such probes. The subset of probes on arrays of the invention may be
or include
those identified as relevant to a particular diagnostic, therapeutic, or
prognostic application.
For example, the array may contain one or more probes that is indicative or
suggestive of (1)
a disease or condition (acute myeloid leukemia), (2) susceptibility or
resistance to a particular
drug or treatment; (3) susceptibility to toxicity from a drug or substance;
(4) the stage of
development or severity of a disease or condition (prognosis); and (5) genetic
predisposition
to a disease or condition.
For any kit embodiment, including an array, there can be nucleic acid
molecules that
contain or can be used to amplify a sequence that is a variant of, identical
to or
complementary to all or part of any of SEQ IDs described herein. In certain
embodiments, a
kit or array of the invention can contain one or more probes for the miRNAs
identified by the
SEQ IDs described herein. Any nucleic acid discussed above may be implemented
as part of
a kit.
The components of the kits may be packaged either in aqueous media or in
lyophilized form. The container means of the kits will generally include at
least one vial, test
tube, flask, bottle, syringe or other container means, into which a component
may be placed,
and preferably, suitably aliquoted. Where there is more than one component in
the kit
(labeling reagent and label may be packaged together), the kit also will
generally contain a
- 130 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
second, third or other additional container into which the additional
components may be
separately placed. However, various combinations of components may be
comprised in a
vial. The kits of the present invention also will typically include a means
for containing the
nucleic acids, and any other reagent containers in close confinement for
commercial sale.
Such containers may include injection or blow molded plastic containers into
which the
desired vials are retained.
When the components of the kit are provided in one and/or more liquid
solutions, the
liquid solution is an aqueous solution, with a sterile aqueous solution being
particularly
preferred.
However, the components of the kit may be provided as dried powder(s). When
reagents and/or components are provided as a dry powder, the powder can be
reconstituted by
the addition of a suitable solvent. It is envisioned that the solvent may also
be provided in
another container means. In some embodiments, labeling dyes are provided as a
dried power.
It is contemplated that 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 120,
130, 140, 150, 160,
170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000 g or at least or
at most those
amounts of dried dye are provided in kits of the invention. The dye may then
be resuspended
in any suitable solvent, such as DMSO.
Such kits may also include components that facilitate isolation of the labeled
miRNA.
It may also include components that preserve or maintain the miRNA or that
protect against
its degradation. Such components may be RNAse-free or protect against RNAses.
Such kits
generally will comprise, in suitable means, distinct containers for each
individual reagent or
solution.
A kit will also include instructions for employing the kit components as well
the use
of any other reagent not included in the kit. Instructions may include
variations that can be
implemented.
Kits of the invention may also include one or more of the following: Control
RNA;
nuclease-free water; RNase-free containers, such as 1.5 ml tubes; RNase-free
elution tubes;
PEG or dextran; ethanol; acetic acid; sodium acetate; ammonium acetate;
guanidinium;
detergent; nucleic acid size marker; RNase-free tube tips; and RNase or DNase
inhibitors.
- 131 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
It is contemplated that such reagents are embodiments of kits of the
invention. Such
kits, however, are not limited to the particular items identified above and
may include any
reagent used for the manipulation or characterization of miRNA.
VII. EXAMPLES
The following examples are included to demonstrate preferred embodiments of
the
invention. It should be appreciated by those of skill in the art that the
techniques disclosed in
the examples which follow represent techniques discovered by the inventor to
function well
in the practice of the invention, and thus can be considered to constitute
preferred modes for
its practice. However, those of skill in the art should, in light of the
present disclosure,
appreciate that many changes can be made in the specific embodiments which are
disclosed
and still obtain a like or similar result without departing from the spirit
and scope of the
invention.
EXAMPLE 1:
GENE EXPRESSION ANALYSIS FOLLOWING TRANSFECTION
WITH HSA-MIR-143
miRNAs are believed to regulate gene expression by binding to target mRNA
transcripts and (1) initiating transcript degradation or (2) altering protein
translation from the
transcript. Translational regulation leading to an up or down change in
protein expression
may lead to changes in activity and expression of downstream gene products and
genes that
are in turn regulated by those proteins. These numerous regulatory effects may
be revealed
as changes in the global mRNA expression profile. Microarray gene expression
analyses
were performed to identify genes that are mis-regulated by hsa-miR- 143
expression.
Synthetic Pre-miR-143 (Ambion) or two negative control miRNAs (pre-miR-NCI,
Ambion cat. no. AM17110 and pre-miR-NC2, Ambion, cat. no. AM17111) were
reverse
transfected into quadruplicate samples of A549 cells for each of three time
points. Cells were
transfected using siPORT NeoFX (Ambion) according to the manufacturer's
recommendations using the following parameters: 200,000 cells per well in a 6
well plate, 5.0
l of NeoFX, 30 nM final concentration of miRNA in 2.5 ml. Cells were harvested
at 4 h, 24
h, and 72 h post transfection. Total RNA was extracted using RNAqueous-4PCR
(Ambion)
according to the manufacturer's recommended protocol.
-132-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
mRNA array analyses were performed by Asuragen Services (Austin, TX),
according
to the company's standard operating procedures. Using the MessageAmpTM 11-96
aRNA
Amplification Kit (Ambion, cat #1819) 2 g of total RNA were used for target
preparation
and labeling with biotin. cRNA yields were quantified using an Agilent
Bioanalyzer 2100
capillary electrophoresis protocol. Labeled target was hybridized to
Affymetrix mRNA
arrays (Human HG-U133A 2.0 arrays) using the manufacturer's recommendations
and the
following parameters. Hybridizations were carried out at 45 C for 16 hr in an
Affymetrix
Model 640 hybridization oven. Arrays were washed and stained on an Affymetrix
FS450
Fluidics station, running the wash script Midi_euk2v3 450. The arrays were
scanned on a
Affymetrix GeneChip Scanner 3000. Summaries of the image signal data, group
mean
values, p-values with significance flags, log ratios and gene annotations for
every gene on the
array were generated using the Affymetrix Statistical Algorithm MAS 5.0 (GCOS
v1.3).
Data were reported in a file (cabinet) containing the Affymetrix data and
result files and in
files (.cel) containing the primary image and processed cell intensities of
the arrays. Data
were normalized for the effect observed by the average of two negative control
microRNA
sequences and then were averaged together for presentation. A list of genes
whose
expression levels varied by at least 0.7 log2 from the average negative
control was assembled.
Results of the microarray gene expression analysis are shown in Table 1 above.
Manipulation of the expression levels of the genes listed in Table I
represents a
potentially useful therapy for cancer and other diseases in which increased or
reduced
expression of hsa-miR-143 has a role in the disease.
EXAMPLE 2:
CELLULAR PATHWAYS AFFECTED BY HSA-miR-143
The mis-regulation of gene expression by hsa-miR-143 (Table 1) affects many
cellular pathways that represent potential therapeutic targets for the control
of cancer and
other diseases and disorders. The inventors determined the identity and nature
of the cellular
genetic pathways affected by the regulatory cascade induced by hsa-miR-143
expression.
Cellular pathway analyses were performed using Ingenuity Pathways Analysis
(Version 4.0,
Ingenuity Systems, Redwood City, CA). Alteration of a given pathway was
determined by
Fisher's Exact test (Fisher, 1922). The most significantly affected pathways
following over-
expression of hsa-miR-143 in A549 cells are shown in Table 2.
-133-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
These data demonstrate that hsa-miR-143 directly or indirectly affects the
expression
of several, cellular proliferation-, development-, and cell growth-related
genes and thus
primarily affects functional pathways related to cellular growth, cellular
development, and
cell proliferation. Those cellular processes have integral roles in the
development and
progression of various cancers. Manipulation of the expression levels of genes
in the cellular
pathways shown in Table 2 represents a potentially useful therapy for cancer
and other
diseases in which increased or reduced expression of hsa-miR-143 has a role in
the disease.
EXAMPLE 3:
PREDICTED GENE TARGETS OF HSA-MIR-143
Gene targets for binding of and regulation by hsa-miR-143 were predicted using
the
proprietary algorithm miRNATargetTM (Asuragen), which is an implementation of
the
method proposed by Krek et al. (2005). Predicted target genes are shown in
Table 3.
The predicted gene targets that exhibited altered mRNA expression levels in
human
cancer cells, following transfection with pre-miR hsa-miR-143, are shown in
Table 4.
The predicted gene targets of hsa-miR-143 whose mRNA expression levels are
affected by hsa-miR-143 represent particularly useful candidates for cancer
therapy and
therapy of other diseases through manipulation of their expression levels.
EXAMPLE 4:
CANCER RELATED GENE EXPRESSION ALTERED BY HSA-MIR-143
Cell proliferation, survival, and growth pathways are commonly altered in
tumors
(Hanahan and Weinberg, 2000). The inventors have shown that hsa-miR-143
directly or
indirectly regulates the transcripts of proteins that are critical in the
regulation of these
pathways. Many of these targets have inherent oncogenic or tumor suppressor
activity. Hsa-
miR-143 targets that have prognostic and/or therapeutic value for the
treatment of various
malignancies are shown in Table 5.
Hsa-miR-143 targeted cancer genes are regulators of the cell cycle,
transcription,
intracellular signaling, apoptosis and the thioredoxin redox pathway. Hsa-miR-
143 regulates
cell cycle progression by altering the expression of Weel, the retinoblastoma-
like 1 protein
(RBLI) as well as the cyclins D1 and Gl. RBLI, also known as p107, is a member
of the
- 134 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
retinoblastoma tumor suppressor protein family that includes the pocket
proteins p107, p130
and pRb. Similar to the pRb prototype, RBL1 interacts with the E2F family of
transcription
factors and blocks cell cycle progression and DNA replication (Sherr and
McCormick, 2002).
A subset of cancers show deregulated expression of RBL1 (Takimoto et al.,
1998; Claudio et
al., 2002; Wu et al., 2002; Ito et al., 2003). Transient transfection of hsa-
miR-143 leads to a
decrease in RBL1 mRNA levels which may suggest a proliferative function for
hsa-miR-143.
In contrast, negative regulation of cyclin Dl and positive regulation of
cyclin Gl are
indicators of a growth-inhibitory role for hsa-miR-143. Cyclins are co-factors
of cyclin-
dependent kinases (CDKs) and function in the progression of the cell cycle.
Cyclin D1 is
required for the transition from Gl into S phase and is overexpressed in
numerous cancer
types (Donnellan and Chetty, 1998).(Donnellan and Chetty, 1998). Hsa-miR-143
negatively
regulates cyclin D1 expression and therefore might interfere with abnormal
cell growth that
depends on high levels of cyclin D1. In accordance, cyclin GI has growth
inhibitory activity
and is upregulated by hsa-miR-143 (Zhao et al., 2003). Weel is a tyrosine
kinase that
functions as a mitotic inhibitor by phosphorylating the CDK1(cdc2)/cyclinBl
complex
(Parker and Piwnica-Worms, 1992; McGowan and Russell, 1993). Lack of Weel
expression
in lung cancer is correlated with a higher proliferation index, a higher
relapse rate and poor
prognosis (Yoshida et al., 2004). Another hsa-miR-143 target is LMO-4 (LIM
domain only
4), a zinc finger protein regulating transcription. LMO-4 is inherently
oncogenic and
inactivates the BRCA-1 tumor suppressor protein (breast cancer 1) (Sum et al.,
2002; Sum et
al., 2005). LMO-4 is frequently overexpressed in multiple cancer types and
predicts poor
outcome in breast cancer (Visvader et al., 2001; Mizunuma et al., 2003; Sum et
al., 2005;
Taniwaki et al., 2006). Accordingly, RNAi directed against LMO-4 leads to
reduced breast
cancer cell growth and migration (Sum et al., 2005). Our data indicate that
hsa-miR-143
diminishes LMO-4 transcripts and therefore may intercept with the oncogenic
properties of
LMO-4.
Hsa-miR-143 also governs the expression of PDCD4, BCL2L1 and MCL1, all of
which are functionally linked to the apoptotic pathway. Pdcd-4 (programmed
cell death 4) is
a tumor suppressor that is induced in response to apoptosis in normal cells.
The growth
inhibitory properties of Pdcd-4 are due to Pdcd-4 mediated inhibition of the c-
Jun proto-
oncoprotein, inhibition of cap-dependent mRNA translation and activation of
the
p2lWafl/Cipl CDK inhibitor (Yang et al., 2003; Bitomsky ef al., 2004; Goke et
al., 2004).
Pdcd-4 frequently shows reduced or lost expression in various human
malignancies, such as
-135-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
gliomas, hepatocellular carcinomas, lung and renal cell carcinomas (Jansen et
al., 2004;
Zhang et al., 2006; Gao et al., 2007). Expression of Pdcd-4 interferes with
skin
carcinogenesis in a mouse model and suppresses growth of human colon carcinoma
cells
(Jansen et al., 2005; Yang et al., 2006). Loss of Pdcd-4 also correlates with
lung tumor
progression (Chen et al., 2003). Since hsa-miR-143 positively regulates Pdcd-4
expression, a
hsa-miR-143 based therapy may reconstitute Pdcd-4 function. BCL2L1 and MCLI
are
members of the anti-apoptotic BCL-2 (B cell lymphoma 2) gene family that give
rise to two
alternatively spliced gene products with opposing functions (Boise et al.,
1993; Bae et al.,
2000). The predominantly expressed protein encoded by BCL2L1 is Bcl-XL which -
next to
BCL-2 - is a major inhibtor of programmed cell death. Overexpression of Bcl-XL
is detected
in numerous cancer types and correlates with tumor progression as well as poor
survival
(Manion and Hockenbery, 2003). Increased levels of Bcl-XL are also associated
with
resistance to chemo- and radiotherapy (Fesik, 2005). Transient transfection of
hsa-miR-143
leads to a reduction of Bcl-XL transcripts and therefore might provide a
therapeutic benefit to
oncogenic cells with increased expression of Bcl-XL. Mcl-1 (myeloid leukemia
1) is
overexpressed in hepatocellular carcinoma, prostate cancer, testicular tumor,
multiple
myeloma and various leukemias [see refs in Table 5]. Similar to Bcl-XL, high
levels of Mcl-
1 is correlated with poor prognosis of patients with ovarian carcinoma and is
indicative for
leukemic relapse (Kaufinann et al., 1998; Shigemasa et al., 2002). RNA
interference against
Mcl-1 induces a therapeutic response in gastric and hepatocellular carcinoma
cells (Schulze-
Bergkamen et al., 2006; Zangemeister-Wittke and Huwiler, 2006).
Molecules regulated by hsa-miR-143 that function in intracellular signal
transduction
include the inflammatory interleukin 8 (IL-8), transforming growth factor beta
(TGF-(3)
receptor 2 (TGFBR2) and A-kinase anchor protein 12 (AKAP12). IL-8 is
frequently
upregulated in various cancers and correlates with tumor vascularization,
metastasis and poor
prognosis (Rosenkilde and Schwartz, 2004; Sparmann and Bar-Sagi, 2004). TGFBR-
2 forms
a functional complex with TGFBR-1 and is the primary receptor for TGF-(3
(Massague et al.,
2000). Central role of TGF-(3 is inhibition of cellular growth of numerous
cell types, such as
epithelial, endothelial, hematopoietic neural and mesenchymal cells. Many
mammary and
colorectal carcinomas with microsatellite instability harbor inactivating
mutations of
TGFBR-2, and therefore escape the growth-inhibitory function of TGF-(3
(Markowitz et al.,
1995; Lucke et al., 2001). AKAP12, also referred to as gravin or SSeCKS (Sre
suppressed C
kinase substrate), functions as a kinase scaffold protein that tethers the
enzyme-substrate
- 136 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
interaction (Nauert et al., 1997). Expression of AKAP12 interferes with
oncogenic cell
transformation induced by the Src or Jun oncoproteins in vitro and is lost or
reduced in
numerous cancers, such as leukemia and carcinomas of the rectum, lung and
stomach (Lin
and Gelman, 1997; Cohen et al., 2001; Xia et al., 2001; Wikman et al., 2002;
Boultwood et
al., 2004; Choi et al., 2004; Mori et al., 2006). An apparent anti-oncogenic
activity of
AKAP12 in prostate and gastric cancers marks this protein as a putative tumor
suppressor
(Xia et al., 2001; Choi et al., 2004).
Based on the functions for most of these targets and how they are regulated by
hsa-
miR-143, hsa-miR-143 appears to have tumor suppressor potential. This view is
supported
by our observation that most cancers show reduced expression of miR-143.
However, hsa-
miR-143 also regulates gene expression in a manner that suggests a role for
hsa-miR-143 in
the development or progression of disease. For instance, hsa-miR-143
stimulates the
expression of thioredoxin (TXN), a 12-kDa thiol reductase targeting various
proteins and
multiple pathways. Thioredoxin modulates the activity of transcription
factors, induces the
expression of angiogenic Hif-1a (hypoxia induced factor la) as well as VEGF
(vascular
endothelial growth factor) and can act as a proliferative and anti-apoptotic
agent (Marks,
2006). In accord, carcinomas of the lung, pancreas, cervix, and liver show
increased levels of
thioredoxin. Thioredoxin expression is also correlated with aggressive tumor
growth, poor
prognosis, and chemoresistance (Marks, 2006). Therefore, a hsa-miR-143
antagonist may
have therapeutic potential in cancers that show altered expression of
thioredoxin.
In summary and not intending to limit the invention by any particular theory,
hsa-
miR-143 governs the activity of proteins that are critical regulators of cell
proliferation and
survival. These targets are frequently deregulated in human cancer. Based on
this review of
the genes and related pathways that are regulated by miR-143, introduction of
hsa-miR-143
or an anti-hsa-miR-143 into a variety of cancer cell types would likely result
in a therapeutic
response.
- 137 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
REFERENCES
The following references, to the extent that they provide exemplary procedural
or
other details supplementary to those set forth herein, are specifically
incorporated.herein by
reference.
U.S. Patent 4,337,063
U.S. Patent 4,404,289
U.S. Patent 4,405,711
U.S. Patent 4,659,774
U.S. Patent 4,682,195
U.S. Patent 4,683,202
U.S. Patent 4,704,362
U.S. Patent 4,816,571
U.S. Patent 4,870,287
U.S. Patent 4,959,463
U.S. Patent 5,141,813
U.S. Patent 5,143,854
U.S. Patent 5,202,231
U.S. Patent 5,214,136
U.S. Patent 5,221,619
U.S. Patent 5,223,618
U.S. Patent 5,242,974
U.S. Patent 5,264,566
U.S. Patent 5,268,486
U.S. Patent 5,288,644
U.S. Patent 5,324,633
U.S. Patent 5,378,825
U.S. Patent 5,384,261
U.S. Patent 5,399,363
U.S. Patent 5,405,783
U.S. Patent 5,412,087
U.S. Patent 5,424,186
U.S. Patent 5,428,148
-138-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
U.S. Patent 5,429,807
U.S. Patent 5,432,049
U.S. Patent 5,436,327
U.S. Patent 5,445,934
U.S. Patent 5,446,137
U.S. Patent 5,466,468
U.S. Patent 5,466,786
U.S. Patent 5,468,613
U.S. Patent 5,470,710
U.S. Patent 5,470,967
U.S. Patent 5,472,672
U.S. Patent 5,480,980
U.S. Patent 5,492,806
U.S. Patent 5,503,980
U.S. Patent 5,510,270
U.S. Patent 5,525,464
U.S. Patent 5,527,681
U.S. Patent 5,529,756
U.S. Patent 5,532,128
U.S. Patent 5,543,158
U.S. Patent 5,545,531
U.S. Patent 5,574,146
U.S. Patent 5,580,726
U.S. Patent 5,580,732
U.S. Patent 5,583,013
U.S. Patent 5,593,839
U.S. Patent 5,599,672
U.S. Patent 5,599,695
U.S. Patent 5,602,240
U.S. Patent 5,602,244
U.S. Patent 5,610,287
U.S. Patent 5,610,289
U.S. Patent 5,614,617
U.S. Patent 5,623,070
- 139 -
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
U.S. Patent 5,624,711
U.S. Patent 5,631,134
U.S. Patent 5,637,683
U.S. Patent 5,639,603
U.S. Patent 5,641,515
U.S. Patent 5,645,897
U.S. Patent 5,652,099
U.S. Patent 5,654,413
U.S. Patent 5,658,734
U.S. Patent 5,661,028
U.S. Patent 5,665,547
U.S. Patent 5,667,972
U.S. Patent 5,670,663
U.S. Patent 5,672,697
U.S. Patent 5,677,195
U.S. Patent 5,681,947
U.S. Patent 5,695,940
U.S. Patent 5,700,637
U.S. Patent 5,700,922
U.S. Patent 5,705,629
U.S. Patent 5,708,153
U.S. Patent 5,708,154
U.S. Patent 5,714,606
U.S. Patent 5,728,525
U.S. Patent 5,728,525
U.S. Patent 5,739,169
U.S. Patent 5,744,305
U.S. Patent 5,744,305
U.S. Patent 5,760,395
U.S. Patent 5,763,167
U.S. Patent 5,770,358
U.S. Patent 5,777,092
U.S. Patent 5,789,162
U.S. Patent 5,792,847
-140-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
U.S. Patent 5,800,992
U.S. Patent 5,801,005
U.S. Patent 5,807,522
U.S. Patent 5,824,311
U.S. Patent 5,830,645
U.S. Patent 5,830,880
U.S. Patent 5,837,196
U.S. Patent 5,846,225
U.S. Patent 5,846,945
U.S. Patent 5,847,219
U.S. Patent 5,856,174
U.S. Patent 5,858,988
U.S. Patent 5,859,221
U.S. Patent 5,871,928
U.S. Patent 5,872,232
U.S. Patent 5,876,932
U.S. Patent 5,886,165
U.S. Patent 5,919,626
U.S. Patent 5,922,591
U.S. Patent 6,004,755
U.S. Patent 6,040,193
U.S. Patent 6,040,193
U.S. Patent 6,087,102
U.S. Patent 6,251,666
U.S. Patent 6,368,799
U.S. Patent 6,383,749
U.S. Patent 6,617,112
U.S. Patent 6,638,717
U.S. Patent 6,720,138
U.S. Patent 6,723,509
U.S. Patent Serial 09/545,207
U.S. Patent Serial 10/667,126
U.S. Patent Serial 11/141,707
U.S. Patent Serial 11/273,640
-141-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
U.S. Patent Serial 11/349,727
U.S. Patent Seria160/575,743
U.S. Patent Serial 60/649,584
U.S. Patent Serial 60/650,807
Akao et al., Oncol Reports, 16:845-850, 2006.
Akiba et al., Int J Oncol, 18(2):257-264, 2001.
Arap et al., Cancer Res., 55(6):1351-1354, 1995.
Austin-Ward and Villaseca, Revista Medica de Chile, 126(7):838-845, 1998.
Bae et al., JBiol Chem, 275(33):25255-25261, 2000.
Bagga et al., Cell, 122(4):553-563, 2005.
Biswas et al., Cancer Res, 64(14):4687-4692, 2004.
Bitomsky et al., Oncogene, 23(45):7484-7493, 2004.
Boise et al., Cell, 74(4):597-608, 1993.
Boultwood et al., Br JHaematol, 126(4):508-511, 2004.
Bukowski et al., Clinical Cancer Res., 4(10)_2337-2347, 1998.
Caldas et al., Cancer Res., 54:3568-3573, 1994.
Calin and Croce, Nat Rev Cancer, 6(11):857-866, 2006.
Carrington and Ambros, Science, 301(5631):336-338, 2003.
Chen et al., JPathol, 200(5):640-646, 2003.
Cheng et al., Cancer Res., 54(21):5547-5551, 1994.
Choi et al., Oncogene, 23(42):7095-7103, 2004.
Cho-Vega et al., Hum Pathol, 35(9):1095-1100, 2004.
Christodoulides et al., Microbiology, 144(Pt 11):3027-3037, 1998.
Claudio et al., Clin Cancer Res, 8(6):1808-1815, 2002.
Cohen et al., Oncogene, 20(2):141-146, 2001.
Cummins et al., In: IRT.= Nucleosides and nucleosides, La Jolla CA, 72, 1996.
Davidson et al., J. Immunother., 21(5):389-398, 1998.
Denli et al., Trends Biochem. Sci., 28:196, 2003.
Didenko, Biotechniques, 31(5):1106-1116, 1118, 1120-1121, 2001.
Dillman, Cancer Biother. Radiopharm., 14(1):5-10, 1999.
Donnellan and Chetty, Mol Pathol, 51(1):1-7, 1998.
Emptage et al., Neuron, 29(l):197-208, 2001.
EP 266,032
-142-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
EP 373 203
EP 785 280
EP 799 897
Esau et al., JBiol Chem, 279(50):52361-52365, 2004.
Esquela-Kerscher and Slack, Nat Rev Cancer, 6(4):259-269, 2006.
Fesik, Nat Rev Cancer, 5(11):876-885, 2005.
Firth and Baxter, Endocr Rev, 23(6):824-854, 2002.
Fisher, J Royal Statistical Soc 85(1):87-94, 1922.
Fleischer et al., Int J Oncol, 28(1):25-32, 2006.
Fodor et al., Biochemistry, 30(33):8102-8108, 1991.
Froehler et al., Nucleic Acids Res., 14(13):5399-5407, 1986.
Gao et al., Oncol Rep, 17(1):123-128, 2007.
Goke et al., Am JPhysiol Cell Physiol, 287(6):C1541-1546, 2004.
Griffey et al., J. Mass Spectrom, 32(3):305-13, 1997.
Hanahan and Weinberg, Cell, 100(1):57-70, 2000.
Hanibuchi et al., Int. J. Cancer, 78(4):480-485, 1998.
Hellstrand et al., Acta Oncologica, 37(4):347-353, 1998.
Hui and Hashimoto, Infection Immun., 66(11):5329-5336, 1998.
Hussussian et al., Nat. Genet., 8(1):15-21, 1994.
Itakura and Riggs, Science, 209:1401-1405, 1980.
Ito et al., Anticancer Res, 23(5A):3819-3824, 2003.
Jansen et al., Cancer Res, 65(14):6034-6041, 2005.
Jansen et al., Mol Cancer Ther, 3(2):103-110, 2004.
Ju et al., Gene Ther., 7(19):1672-1679, 2000.
Kamb et al., Nat. Genet., 8(1):23-26, 1994.
Kamb et al., Science, 2674:436-440, 1994.
Kaufinann et al., Blood, 91(3):991-1000, 1998.
Kitada et al., Blood, 91(9):3379-3389, 1998.
Klostermeier and Millar, Biopolymers, 61(3):159-79, 2001-2002.
Kornberg and Baker, In: DNA Replication, 2d Ed., Freeman, San Francisco, 1992.
Krajewska et al., Am JPathol, 148(5):1567-1576, 1996.
Krek et al., Nature Genet 37:495-500, 2005.
Lagos-Quintana et al., Science, 294(5543):853-858, 2001.
Lau et al., Science, 294(5543):858-862, 2001.
-143-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
Lee and Ambros, Science, 294(5543):862-864, 2001.
Lim et al., Nature, 433(7027):769-773, 2005.
Lin and Gelman, CancerRes, 57(11):2304-2312, 1997.
Lucke et al., Cancer Res, 61(2):482-485, 2001.
Manion and Hockenbery, Cancer Biol Ther, 2(4 Suppl 1):S105-114, 2003.
Markowitz, Biochim Biophys Acta, 1470(1):M13-20, 2000.
Marks, Semin Cancer Biol, 16(6):436-443, 2006.
Marsters et al., Recent Prog. Horm. Res., 54:225-234, 1999.
Massague et al., Cell, 103(2):295-309, 2000.
McGowan and Russell, Embo J, 12(1):75-85, 1993.
Michael et al., Mol Cancer Res, 1:882-891, 2003.
Mizunuma et al., Br J Cancer, 88(10):1543-1548, 2003.
Mori et al., Cancer Res., 54(13):3396-3397, 1994.
Mori et al., Gastroenterology, 131(3):797-808, 2006.
Nauert et al., Curr Biol, 7(1):52-62, 1997.
Nobori et al., Nature, 368(6473):753-756, 1994.
Okamoto et al., Proc. Natl. Acad. Sci. USA, 91(23):1 1 045-1 1 049, 1994.
Olsen et al., Dev. Biol., 216:671, 1999.
Orlow et al., Cancer Res, 54(11):2848-2851, 1994.
Orlow et al., Int. J. Oncol., 15(1):17-24, 1994.
Parker and Piwnica-Worms, Science, 257(5078):1955-1957, 1992.
PCT Appln. WO 0138580
PCT Appln. WO 0168255
PCT Appln. WO 03020898
PCT Appln. WO 03022421
PCT Appln. WO 03023058
PCT Appln. WO 03029485
PCT Appln. WO 03040410
PCT Appln. WO 03053586
PCT Appln. WO 03066906
PCT Appln. WO 03067217
PCT Appln. WO 03076928
PCT Appln. WO 03087297
PCT Appln. WO 03091426
-144-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
PCT Appln. WO 03093810
PCT Appln. WO 03100012
PCT Appln. WO 03100448A1
PCT Appln. WO 04020085
PCT Appln. WO 04027093
PCT Appln. WO 09923256
PCT Appln. WO 09936760
PCT Appln. WO 93/17126
PCT Appln. WO 95/11995
PCT Appln. WO 95/21265
PCT Appln. WO 95/21944
PCT Appln. WO 95/21944
PCT Appln. WO 95/35505
PCT Appln. WO 96/31622
PCT Appln. WO 97/10365
PCT Appln. WO 97/27317
PCT Appln. WO 9743450
PCT Appln. WO 99/35505
Pietras et al., Oncogene, 17(17):2235-2249, 1998.
Pruitt et al., Nucleic Acids Res, 33(1):D501-D504, 2005.
Qin et al., Proc. Natl. Acad. Sci. USA, 95(24):14411-14416, 1998.
Reimer et al., JBiol Chem, 274(16):1 1 022-1 1 029, 1999.
Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-
1580, 1990.
Rosenkilde and Schwartz, Apmis, 112(7-8):481-495, 2004.
Rust et al., J Clin Pathol, 58(5):520-524, 2005.
Sambrook and Russell, Molecular Cloning: A Laboratory Manual 3'd Ed., Cold
Spring
Harbor Laboratory Press, 2001.
Sambrook et al., In: DNA microaarays: a molecular cloning manual, Cold Spring
Harbor
Laboratory Press, Cold Spring Harbor, NY, 2003.
Sambrook et al., In: Molecular cloning: a laboratory manual, 2"d Ed., Cold
Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, 1989.
Sano et al., Histopathology, 46(5):532-539, 2005.
Scheit, In: Synthesis and Biological Function, Wiley-Interscience, New York,
171-172, 1980.
Schulze-Bergkamen et al., BMC Cancer, 6:232, 2006.
-145-
CA 02663812 2009-03-18
WO 2008/036718 PCT/US2007/078859
Seggerson et al., Dev. Biol., 243:215, 2002.
Serrano et al., Nature, 366:704-707, 1993.
Serrano et al., Science, 267(5195):249-252, 1995.
Sherr and McCormick, Cancer Cell, 2(2):103-112, 2002.
Shigemasa et al., Jpn J Cancer Res, 93(5):542-550, 2002.
Sieghart et al., JHepatol, 44(1):151-157, 2006.
Skotzko et al., Cancer Res, 55(23):5493-5498, 1995.
Sparmann and Bar-Sagi, Cancer Cell, 6(5):447-458, 2004.
Sum et al., JBiol Chem, 277(10):7849-7856, 2002.
Sum et al., Proc Natl Acad Sci US A, 102(21):7659-7664, 2005.
Takimoto et al., Biochem Biophys Res Commun, 251(1):264-268, 1998.
Taniwaki et al., Int J Oncol, 29(3):567-575, 2006.
U.K.. Patent 1,529,202
U.K.. Patent 8 803 000
Visvader et al., Proc Natl Acad Sci USA, 98(25):14452-14457, 2001.
Wikman et al., Oncogene, 21(37):5804-5813, 2002.
Wu et al., EurJCancer, 38(14):1838-1848, 2002.
Wuilleme-Toumi et al., Leukemia, 19(7):1248-1252, 2005.
Xia et al., Cancer Res, 61(14):5644-5651, 2001 a.
Xia et al., Cancer, 91(8):1429-1436, 2001b.
Yang et al., Cancer Cell, 9(6):445-457, 2006a.
Yang et al., Mol Cell Biol, 23(1):26-37, 2003.
Yang et al., Mol Cell Biol, 26(4):1297-1306, 2006b.
Yoshida et al., Ann Oncol, 15(2):252-256, 2004.
Zangemeister-Wittke and Huwiler, Cancer Biol Ther, 5(10):1355-1356, 2006.
Zhang et al., Oncogene, 25(45):6101-6112, 2006.
Zhao et al., Mol Cancer Res, 1(3):195-206, 2003.
-146-
