Note: Descriptions are shown in the official language in which they were submitted.
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
......- , . .. .. .. ; ~ . .T. .._. ... .. . _ . . ... ...
-- -r. . _ +.. . . t_. . . _ .~'~"'" . . ..
~~.rõ PCT1US20Q~1~~~~~I~'~'
~., . , ~F= ~ u ll.i ' ia : 9~Ia. ~~ ..~.~
AVI-0o0CIP5 PCT
AVIAN DERIVED ERYTHROPOIETIN
.
Related Application Information
This application claims the benefit of US provisional patent application Nos.
60/857,896, filed November 9, 2006; 60/877,601, filed December 28, 2006; and
60/918,504, filed March 16, 2007.
Field of the Invention
The present invention relates to the introduction of exogenous genetic
material
into avian cells and the expression of the exogenous genetic material in the
avian cells.
The invention particularly relates to transgenic avian species, including
chicken, quail
and turkey, and to avians which lay eggs containing exogenous proteins, for
example
pharmaceutical proteins.
Background
Numerous natural and synthetic proteins are used in diagnostic and therapeutic
applications; many others are in development or in clinical trials. Current
methods of
protein production include isolation from natural sources and recombinant
production
in bacterial and mammalian cells. Because of the complexity and high cost of
these
I
~O~ ~~}r'~'+?(1
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
methods of protein production, however, efforts are underway to develop
alternatives.
For example, methods for producing exogenous proteins in the milk of pigs,
sheep,
goats, and cows have been reported. These approaches have certain limitations,
including long generation times between founder and production transgenic
herds,
extensive husbandry and veterinary costs, and variable levels of expression
because of
position effects at the site of the transgene insertion in the genome.
Proteins are also
being produced using milling and malting processes from barley and rye.
However,
plant post-translational modifications differ from vertebrate post-
translational
modifications, which often has a critical effect on the function of the
exogenous
proteins such as pharmaceutical proteins.
Like tissue culture and mammary gland bioreactors, the avian oviduct can also
potentially serve as a bioreactor. Successful methods of modifying avian
genetic
material such that high levels of exogenous proteins are secreted in the
oviduct and
packaged into eggs would allow inexpensive production of large amounts of
protein.
Several advantages of such an approach would be: a) short generation times (24
weeks)
and rapid establishment of transgenic flocks via artificial insemination; b)
readily
scaled production by increasing flock sizes to meet production needs; c) post-
translational modification of expressed proteins; 4) automated feeding and egg
collection; d) naturally sterile egg-whites; and e) reduced processing costs
due to the
high concentration of protein in the egg white.
The avian reproductive system, including that of the chicken, is well
described.
The egg of the hen consists of several layers which are secreted upon the yolk
during
its passage through the oviduct. The production of an egg begins with
formation of the
large yolk in the ovary of the hen. The unfertilized oocyte is then positioned
on top of
the yolk sac. Upon ovulation or release of the yolk from the ovary, the oocyte
passes
into the infundibulum of the oviduct where it is fertilized if sperm are
present. It then
moves into the magnum of the oviduct which is lined with tubular gland cells.
These
cells secrete the egg-white proteins, including ovalbumin, lysozyme,
ovomucoid,
conalbumin, and ovomucin, into the lumen of the magnum where they are
deposited
onto the avian embryo and yolk.
2
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
The ovalbumin gene encodes a 45 kD protein that is specifically expressed in
the tubular gland cells of the magnum of the oviduct (Beato Cell 56:335-
344(1989)).
Ovalbumin is the most abundant egg white protein, comprising over 50 percent
of the
total protein produced by the tubular gland cells, or about 4 grams of protein
per large
Grade A egg (Gilbert, "Egg albumen and its formation" in Physiology and
Biochemistry of the Domestic Fowl, Bell and Freeman, eds., Academic Press,
London,
N.Y., pp. 1291-1329). The ovalbumin gene and over 20 kb of each flanking
region
have-been cloned and analyzed (Lai et al., Proc. Natl. Acad. Sci. USA 75:2205-
2209
(1978); Gannon et al., Nature 278:428-424 (1979); Roop et al., Cell 19:63-68
(1980);
and Royal et al., Nature 279:125-132 (1975)).
Much attention has been paid to the regulation of the ovalbumin gene. The
gene, responds to steroid hormones such as estrogen, glucocorticoids, and
progesterone,
which induce the accumulation of about 70,000 ovalbumin mRNA transcripts per
tubular gland cell in immature chicks and 100,000 ovalbumin mRNA transcripts
per
tubular gland cell in the mature laying hen (Palmiter, J. Biol. Chem. 248:8260-
8270
(1973); Palmiter, Cell 4:189-197 (1975)). DNAse hypersensitivity arialysis and
promoter-reporter gene assays in transfected tubular gland cells defined a 7.4
kb region
as containing sequences required for ovalbumin gene expression. This 5'
flanking
region contains four DNAse 1-hypersensitive sites centered at -0.25, -0.8, -
3.2, and -6.0
kb from the transcription start site. These sites are called 1-TS-I, -II, -
II1I, and -IV,
respectively. These regions reflect alterations in the chromatin structure and
are
specifically correlated with ovalbumin gene expression in oviduct cells (Kaye
et al.,
EMBO 3:1137-1144 (1984)). Hypersensitivity of HS-II and -III are estrogen-
induced,
supporting a role for these regions in hormone-induction of ovalbumin gene
expression.
HS-I and HS-II are both required for steroid induction of ovalbumin gene
transcription, and a 1.4 kb =portion of the 5' region that includes these
elements is
sufficient to drive steroid-dependent ovalbumin expression in explanted
tubular gland
cells (Sanders and McKnight, Biochemistry 27: 6550-6557 (1988)). HS-1 is
termed the
negative-response element ("NRE") because it contains several negative
regulatory
elements which repress ovalbumin expression in the absence of hormones
(Haekers et
3
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
al., Mol. Endo. 9:1113-1126 (1995)). Protein factors bind these elements,
including
some factors only found in oviduct nuclei suggesting a role in tissue-specific
expression. HS-II is termed the steroid-dependent response element ("SDRE")
because
it is required to promote steroid induction of transcription. It binds a
protein or protein
complex known as Chirp-I. Chirp-I is induced by estrogen and turns over
rapidly in the
presence of cyclohexamide (Dean et al., Mol. Cell. Biol. 16:2015-2024 (1996)).
Experiments using an explanted tubular gland cell culture system defined an
additional
set of factors that bind SDRE in a steroid-dependent manner, including an NFxB-
like
factor (Nordstrom et al., J. Biol. Chem. 268:1 3 1 93-1 3202 (1993); Schweers
and
Sanders, J. Biol. Chem. 266: 10490-10497 (1991)).
Less is known about the function of HS-III and -IV. HS-II1 contains a
functional estrogen response element, and confers estrogen inducibility to
either the
ovalbumin proximal promoter or a heterologous promoter when co-transfected
into
HeLa cells with an estrogen receptor eDNA. These data imply that HS-III may
play a
functional role in the overall regulation of the ovalbumin gene. Little is
known about
the function of HS-IV, except that it does not contain a functional estrogen-
response
element (Kato et al., Cell 68: 731-742 (1992)).
There has been much interest in modifying eukaryotic genomes by introducing
foreign genetic material and/or by disrupting specific genes. Certain
eukaryotic cells
may prove to be superior hosts for the production of exogenous eukaryotic
proteins.
The introduction of genes encoding certain proteins also allows for the
creation of new
phenotypes which could have increased economic value. In addition, some
genetically-caused disease states may be cured by the introduction of a
foreign gene
that allows the genetically defective cells to express the protein that they
can otherwise
not produce. Finally, modification of animal genomes by insertion or removal
of
genetic material permits basic studies of gene function, and ultimately may
permit the
introduction of genes that could be used to cure disease states, or result in
improved
animal phenotypes.
Transgenesis has been accomplished in mammals by several different methods.
First, in mammals including the mouse, pig, goat, sheep and cow, a transgene
is
microinjected into the pronucleus of a fertilized egg, which is then placed in
the uterus
4
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
of a foster mother where it gives rise to a founder animal carrying the
transgene in its
germline. The transgene is engineered to carry a promoter with specific
regulatory
sequences directing the expression of the foreign protein to a particular cell
type. Since
the transgene inserts randomly into the genome, position effects at the site
of the
transgene's insertion into the genome may variably cause decreased levels of
transgene
expression. This approach also requires characterization of the promoter such
that
sequences necessary to direct expression of the transgene in the desired cell
type are
defined and included in the transgene vector (Hogan et al. Manipulating the
Mouse
Embryo, Cold Spring Harbor Laboratory, NY (1988)).
A second method for effecting animal transgenesis is targeted gene disruption,
in which a targeting vector containing sequences of the target gene flanking a
selectable marker gene is introduced into embryonic stem ("ES") cells. By
homologous
recombination, the targeting vector replaces the target gene sequences at the
chromosomal locus or inserts into interior sequences preventing expression of
the
target gene product. Clones of ES cells having the appropriately disrupted
gene are
selected and then injected into early stage blastocysts generating chimeric
founder
animals, some of which have the transgene in the germ line. In the case where
the
transgene deletes the target locus, it replaces the target locus with foreign
DNA borne
in the transgene vector, which consists of DNA encoding a selectable marker
useful for
detecting transfected ES cells in culture and may additionally contain DNA
sequences
encoding a foreign protein which is then inserted in place of the deleted gene
such that
the target gene promoter drives expression of the foreign gene (U.S. Pat. Nos.
5,464,764 and 5,487,992 (M. P. Capecchi and K. R. Thomas)). This approach
suffers
from the limitation that ES cells are unavailable in many mammals, including
goats,
cows, sheep and pigs. Furthermore, this method is not useful when the deleted
gene is
required for survival or proper development of the organism or cell type.
Recent developments in avian transgenesis have allowed the modification of
avian genomes. Germ-line transgenic chickens may be produced by injecting
replication-defective retrovirus into the subgerininal cavity of chick
blastoderms in
freshly laid eggs (U.S. Pat. No. 5,162,215; Bosselman et al., Science 243:533-
534
(1989); Thoraval et al., Transgenic Research 4:369-36 (1995)). The retroviral
nucleic
5
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
acid carrying a foreign gene randomly inserts into a chromosome of the
embryonic
cells, generating transgenic animals, some of which have the transgene in
their germ
line. Use of insulator elements inserted at the 5' or 3' region of the fused
gene construct
to overcome position effects at the site of insertion has been described (Chim
et al.,
Cell 74:504-514 (1993)).
In another approach, a transgene has been microinjected into the germinal disc
of a fertilized egg to produce a stable transgenic founder avian that may pass
the gene
to the F1 generation (Love et al., Bio/Technology 12:60-63 (1994)). However,
this
method has several disadvantages. Hens must be sacrificed in order to collect
the
fertilized egg, the fraction of transgenic founders is low, and injected eggs
require labor
intensive in vitro culture in surrogate shells.
In another. approach, blastodermal cells containing presumptive primordial
germ cells ("PGCs") are excised from donor eggs, transfected with a transgene
and
introduced into the subgerminal cavity of recipient embryos. The transfected
donor
cells are incorporated into the recipient embryos generating transgenic
embryos, some
of which are expected to have the transgene in the germ line. The transgene
inserts in
random chromosomal sites by nonhomologous recombination. However, no
transgenic
founder avians have yet been generated by this method.
Lui, Poult. Sci. 68:999-1010 (1995), used a targeting vector containing
flanking
DNA sequences of the vitellogenin gene to delete part of the resident gene in
chicken
blastodermal cells in culture. However, it has not been demonstrated that
these cells
can contribute to the germ line and thus produce a transgenic embryo. In
addition, this
method is not useful when the deleted gene is required for survival or proper
development of the organism or cell type.
Thus, it can be seen that there is a need for a method of introducing foreign
DNA, operably linked to a suitable promoter, into the avian genome such that
efficient
expression of an exogenous gene can be achieved. Furthermore, there exists a
need to
create germ-line modified transgenic avians which express exogenous genes in
their
oviducts and secrete the expressed exogenous proteins into their eggs.
When interferon was discovered in 1957, it was hailed as a significant
antiviral
agent. In the late 1970s, interferon became associated with recombinant gene
6
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
technology. Today, interferon is a symbol of the complexity of the biological
processes of cancer and the value of endurance and persistence in tackling
this
complexity.
The abnormal genes that cause cancer comprise at least three types: firstly,
there are the oncogenes, which, when altered, encourage the abnormal growth
and
division that characterize cancer. Secondly, there are the tumor suppressor
genes,
which, when altered, fail to control this abnormal growth and division.
Thirdly, there
are the DNA repair genes, which, when altered, fail to repair mutations that
can lead to
cancer. Researchers speculate that there are about 30 to 40 tumor suppressor
genes in
the body, each of which produces a protein. These proteins may be controlled
by
"master" tumor suppressor proteins such as Rb (for retinoblastoma, with which
it was
first associated) and p53 (associated with many different tumors). Evidence
from the
laboratory suggests that returning just one of these tumor suppressor genes to
its
normal function can appreciably reduce the aggressiveness of the malignancy.
Scientists became intrigued by interferon when it was discovered that
interferon
can inhibit cell growth. Further, interferon was found to have certain
positive effects
on the immune system. It is now considered analogous to a tumor suppressor
protein:
it inhibits the growth of cells, particularly malignant celts; it blocks the
effects of many
oncogenes and growth factors; and unlike other biological agents, it inhibits
cell
motility which is critical to the process of metastasis.
Intercellular communication is dependent on the proper functioning of all the
structural components of the tissue through which the messages are conveyed:
the
matrix, the cell membrane, the cytoskeleton, and the cell itself. In cancer,
the
communication network between cells is disrupted. If the cytoskeleton is
disrupted,
the messages don't get through to the nucleus and the nucleus begins to
function
abnormally. Since the nucleus is the site where the oncogenes or tumor
suppressor
genes get switched on or off, this abnormal functioning can lead to
malignancy. When
this happens, the cells start growing irregularly and do not differentiate.
They may also
start to move and disrupt other cells. It is believed that interferon,
probably in concert
with other extracellular and cellular substances, restores the balance and
homeostasis,
making sure the messages get through properly. Interferon stops growth, stops
7
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
motility, and enhances the ability of the cell, through adhesion molecules, to
respond to
its environment. It also corrects defects and injuries in the cytoskeleton.
Interferon has
been found to block angiogenesis, the initial step in the formation of new
blood vessels
that is essential to the growth of malignancies. Moreover, it blocks fibrosis,
a response
to injury that stimulates many different kinds of cells and promotes cell
growth
(Kathryn L. Hale, Oncolog, Interferon: The Evolution of a Biological Therapy,
Taking
a New Look at Cytokine Biology).
Interferon is produced by animal cells when they are invaded by viruses and is
released into the bloodstream or intercellular fluid to induce healthy cells
to
manufacture an enzyme that counters the infection. For many years the supply
of
human interferon for research was limited by costly extraction techniques. In
1980,
however, the protein became available in greater quantities through genetic
engineering
(i.e., recombinant forms of the protein). Scientists also determined that the
body makes
three distinct types of interferon, referred to as a-(alpha), (3-(beta), and y-
(gamma)
interferon. Interferons were first thought to be highly species-specific, but
it is now
known that individual interferons may have different ranges of activity in
other species.
Alpha interferon (a-IFN) has been approved for therapeutic use against hairy-
cell
leukemia and hepatitis C. a-IFN has also been found effective against chronic
hepatitis
B, a major cause of liver cancer and cirrhosis, as well as for treatment of
genital warts
and some rarer cancers of blood and bone marrow. Nasal sprays containing a-IFN
provide some protection against colds caused by rhinoviruses. Human a-IFN
belongs
to a family of extra-cellular signaling proteins with antiviral,
antiproliferating and
immunomodulatory activities. IFN-a proteins are encoded by a multigene family
which includes 13 genes clustered on the human chromosome 9. Most of the IFN-
a
genes are expressed at the mRNA level in leukocytes induced by Sendai virus.
Further, it has been shown that at least nine different sub-types are also
produced at the
protein level. The biological significance of the expression of several
similar IFN- a
proteins is not known, however, it is believed that they have quantitatively
distinct
patterns of antiviral, growth inhibitory and killer-cell-stimulatory
activities. Currently,
two IFN- a variants, IFN- a 2a and IFN- a 2b, are mass produced in Escherichia
coli by
recombinant technology and marketed as drugs.
8
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Unlike natural IFN-a, these recombinant IFN-a products have been shown to be
immunogenic in some patients, which could be due to unnatural forms of IFN-a
proteins. Thus, for the development of IFN-a drugs it is necessary to not only
identify
the IFN-a subtypes and variants expressed in normal human leukocytes, but also
to
characterize their possible post-translational modifications (Nyman et al.
(1998) Eur. J.
Biochem. 25 3 :485-493 ).
Nyman et al. (supra) studied the glycosylation of natural human IFN-a. They
found that two out of nine of the subtypes produced by leukocytes after a
Sendai-virus
induction were found to be glycosylated, namely IFN-a 14c and IFN-a 2b, which
is
consistent with earlier studies. IFN-a 14 is the only IFN-a subtype with
potential N-
glycosylation sites, Asn2 and Asn72, but only Asn72 is actually glycosylated.
IFN-a 2
is 0-glycosylated at Threonine 106 (Thr106). Interestingly, no other IFN- a
subtype
contains Thr at this position. In this study, Nyman et al. liberated and
isolated the
oligosaccharide chains and analyzed their structures by mass spectrometry and
specific
glycosidase digestions. Both IFN- a 2b and IFN- a 14c resolved into three
peaks in
reversed-phase high performance liquid chromatography (RP-HPLC). Electrospray
ionization mass spectrometry (ESI-MS) analysis of IFN-a 2b fractions from RP-
HPLC
revealed differences in their molecular masses, suggesting that these
represent different
glycoforms. This was confirmed by masspectrometric analysis of the liberated 0-
glycans of each fraction. IFN-a 2b was estimated to contain about 20% of the
core
type-2 pentasaccharide, and about 50% of disialylated and 30% of
monosialylated core
type-1 glycans. Nyman 'et al.'s data agrees with previous partial
characterization of
IFN-a 2b glycosylation (Adolf et al. (1991) Biochem. J. 276:511-518). The role
of
glycosylation in IFN-a 14c and IFN-a 2b is not clearly established. According
to
Nyman et al. (supra), the carbohydrate chains are not essential for the
biological
activity, but glycosylation may have an effect on the pharmacokinetics and
stability of
the proteins.
There are at least 15 functional genes in the human genome that code for
proteins of the IFN-a family. The amino acid sequence similarities are
generally in the
region of about 90%, thus, these molecules are closely related in structure.
IFN-a
proteins contain 166 amino acids (with the exception of IFN-a 2, which has 165
amino
9
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
acids) and characteristically contain four conserved cysteine residues which
form two
disulfide bridges. IFN-a species are slightly acidic in character and lack a
recognition
site for asparagine-linked glycosylation (with the exception of IFN-a 14 which
does
contain a recognition site for asparagine-linked glycosylation). Three
variants of IFN-
a 2, differing in their amino acids at positions 23 and 34, are known: IFN-a
2a (Lys-23,
His-34); IFN-a 2b (Arg-23, His-34); and IFN-a 2c (Arg-23, Arg-34). It is
believed that
IFN-a 2a and IFN-a 2c are allelic variants of IFN-a 2b. See, Gewert et al
(1993) J.
Interferon Res. vol 13, p 227-231. The minor differences in amino acid content
of the
IFN-a 2 species is not expected to effect glycosylation of the interferons.
That is
glycosyation patterns are expected to be essentially the same for each of IFN-
a 2a, 2b
and 2c. Two other human IFN species, namely IFN-co 1 and IFN-(3 are N-
glycosylated
and are more distantly related to IFN-a. IFN-a, -(i and -w, collectively
referred to as
class I IFNs, bind to the same high affinity cell membrane receptor (Adolf et
al. (1991)
Biochem. J. 276:511-518).
Adolf et al. (supra) used the specificity of a monoclonal antibody for the
isolation of natural IFN-a 2 from human leukocyte IFN. They obtained a 95%
pure
protein through immunoaffinity chromatography which confirmed the expected
antiviral activity of IFN-a 2. Analysis of natural IFN-a 2 by reverse-phase
HPLC,
showed that the natural protein can be resolved into two components, both more
hydrophilic than E. coli-derived IFN-a 2. SDS/PAGE revealed that the protein
is also
heterogeneous in molecular mass, resulting in three bands, all of them with
lower
electrophoretic mobility than the equivalent E. coli-derived protein.
Adolf et al. (supra) also speculated that natural IFN-a 2 carries 0-linked
carbohydrate residues. Their hypothesis was confirmed by cleavage of the
putative
peptide-carbohydrate bond with alkali; the resulting protein was homogeneous
and
showed the same molecular mass as the recombinant protein. Further comparison
of
natural and recombinant proteins after proteolytic cleavage, followed by
separation and
analysis of the resulting fragments, allowed them to define a candidate
glycopeptide.
Sequence analysis of this peptide identified Thr-106 as the 0-glycosylation
site. A
comparison of the amino acid sequences of all published IFN-a 2 species
revealed that
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
this threonine residue is unique to IFN-a 2. Glycine, isoleucine or glutamic
acid are
present at the corresponding position (107) in all other proteins.
Preparations of IFN-a 2 produced in E. coli are devoid of 0-glycosylation and
have been registered as drugs in many countries. However, the immunogenicity
of
therapeutically applied E. coli-derived IFN-a 2 might be affected by the lack
of
glycosylation. Studies have shown that four out of sixteen patients receiving
recombinant human granulocyte-macrophage colony-stimulating factor produced in
yeast developed antibodies to this protein. Interestingly, these antibodies
were found to
react with epitopes that in the endogenous granulocyte-macrophage colony-
stimulating
factor are protected by 0-linked glycosylation, but which are exposed in the
recombinant factor (Adolf et al., supra).
Similarly, induction of antibodies to recombinant E. coli-derived IFN-a 2
after
prolonged treatment of patients has been described and it has been speculated
that
natural IFN-a 2 may be less immunogenic than the recombinant IFN-a 2 proteins
(Galton et al. (1989) Lancet 2:572-573).
What is needed are improved methods of producing therapeutic or
pharmaceutical proteins such as antibodies and cytokines including interferon,
G-CSF
and erythropoietin.
Summary of the Invention
This invention provides vectors and methods for the stable intioduction of
exogenous nucleic acid sequences into the genome of avians in order to express
the
exogenous sequences to alter the phenotype of the avians or to produce desired
proteins. In particular, transgenic avians are produced which express
exogenous
sequences in their oviducts and which deposit exogenous proteins, such as
pharmaceutical proteins, into their eggs. Avian eggs that contain such
exogenous
proteins are encompassed by this invention. The present invention further
provides
novel forms of therapeutic proteins (e.g., human cytokines) including
interferons, G-
CSF, G-MCSF and erythropoietin which are efficiently expressed in the oviduct
of
transgenic avians and deposited into avian eggs.
11
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
In one aspect, the invention is drawn to proteins (e.g., human proteins) such
as
cytokines produced in avians. In a particular aspect, the invention is drawn
to human
erythropoietin with a glycosylation pattern (e.g., poultry derived
erythropoietin)
wherein the erythropoietin is obtained from avian cells of a transgenic
chicken,
transgenic quail or transgenic turkey. Also included in the invention are
human
proteins including cytokines such as erythropoietin produced in avians in
isolated or
purified fon=n and present in pharmaceutical compositions. The isolation of
the
recombinant proteins of the invention including erythropoietin can be
accomplished by
methodologies readily apparent to a practitioner skilled in the art of protein
purification. The make-up of formulations useful for producing pharmaceutical
compositions are also well known in the art. In one embodiment, the proteins
of the
invention including erythropoietin have a glycosylation pattern that is
obtained from
poultry or avian oviduct cells, for example, tubular gland cells (e.g.,
tubular gland cells
of a chicken).
One aspect of the present invention provides methods for producing exogenous
proteins in specific tissues of avians. Exogenous proteins may be expressed in
the
oviduct, blood and/or other cells and tissues of the avian. In one embodiment,
transgenes are introduced into embryonic blastodermal cells, for example, near
stage X,
to produce a transgenic avian, such that the protein of interest is expressed
in the
tubular gland cells of the magnum of the oviduct, secreted into the lumen, and
deposited into the egg white of a hard shell egg. A transgenic avian so
produced can
carry the transgene in its germ line. The exogenous genes can therefore be
transmitted
to avians by both artificial introduction of the exogenous gene into avian
embryonic
cells, and by the transmission of the exogenous gene to the avian's offspring
stably in a
Mendelian fashion.
The present invention encompasses methods of producing exogenous protein in
an avian oviduct. The methods may include a first step of providing a vector
that
contains a coding sequence and a promoter operably linked to the coding
sequence, so
that the promoter can effect expression of the nucleic acid in the avian
oviduct. Next,
transgenic cells and/or tissues can be produced, wherein the vector is
introduced into
avian embryonic blastodermal cells, either freshly isolated, in culture, or in
an embryo,
12
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
so that the vector sequence is inserted, for example, randomly inserted into
the avian
genome. Finally, a mature transgenic avian which expresses the exogenous
protein in
its oviduct can be derived from the transgenic cells and/or tissue. This
method can also
be used to produce an avian egg which contains exogenous protein such as a
pharmaceutical protein (e.g., a cytokine) when the exogenous protein that is
expressed
in the oviduct is also secreted into the oviduct lumen and deposited into the
egg, for
example, in the egg white of a hard shell egg.
In one aspect, the production of a transgenic bird by chromosomal insertion of
a
vector into its avian genome may optionally involve DNA transfection of
embryonic
blastodermal cells which are then injected into the subgerminal cavity beneath
a
recipient blastoderm. The vector used in such a method may have a promoter
which is
fused to an exogenous coding sequence and directs expression of the coding
sequence
in the tubular gland cells of the oviduct.
In another aspect of the invention, a random chromosomal insertion and the
production of a transgenic avian is accomplished by transduction of embryonic
blastodermal cells with replication-defective or replication-competent
retroviral
particles carrying the transgene genetic code between the 5' and 3' LTRs of
the
retroviral rector. For instance, an avian leukosis virus (ALV) retroviral
vector or a
murine leukemia virus (MLV) retroviral vector may be used which comprises a
modified pNLB plasmid containing an exogenous gene that is inserted downstream
of
a segment of a promoter region. An RNA copy of the modified retroviral vector,
packaged into viral particles, can be used to infect embryonic blastoderms
which
develop into transgenic avians. Aiternatively, helper cells which produce the
retroviral
transducing particles are delivered to the embryonic blastoderm.
Another aspect of the invention provides a vector which includes a coding
sequence and a promoter in operational and positional relationship such that
the coding
sequence is expressed in an avian oviduct. Such vectors include, but are not
limited to,
an avian leukosis virus (ALV) retroviral vector, a murine leukemia virus (MLV)
retroviral vector, and a lentivirus vector. In addition, the vector may be a
nucleic acid
sequence which includes an LTR of an avian leukosis virus (ALV) retroviral
vector, a
murine leukemia virus (MLV) retroviral vector, or a lentivirus vector. The
promoter is
13
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
sufficient for effecting expression of the coding sequence in the avian
oviduct. The
coding sequence codes for an exogenous protein which is deposited into the egg
white
of a hard shell egg. As such, the coding sequence codes for exogenous proteins
such as
transgenic poultry derived proteins such as interferon-a 2b (TPD IFN-a 2b) and
transgenic poultry derived erythropoietin (TPD EPO) and transgenic poultry
derived
granulocyte colony stimulating factor (TPD G-CSF). In one embodiment, vectors
used
in the methods of the invention contain a promoter which is particularly
suited for
expression of exogenous proteins in avians and their eggs. As such, expression
of the
exogenous coding sequence may occur in the oviduct and blood of the transgenic
avian
and in the egg white of its avian egg. The promoters include, but are not
limited to, a
cytomegalovirus (CMV) promoter, a MDOT promoter, a rous-sarcoma virus (RSV)
promoter, a(3-actin promoter (e.g., a chicken P-actin promoter) a murine
leukemia
virus (MLV) promoter, a mouse mammary tumor virus (MMTV) promoter, an
ovalbumin promoter, a lysozyme promoter, a conalbumin promoter, an ovomucoid
promoter, an ovomucin promoter, and an ovotransferrin promoter. Optionally,
the
promoter may be a segment of at least one promoter region, such as a segment
of the
ovalbumin-, lysozyme-, conalbumin-, ovomucoid-, ovomucin-, and ovotransferrin
promoter region. In one embodiment, the promoter is a combination or a fusion
of one
or more promoters or a fusion of a portion of one or more promoters such as
ovalbumin-, lysozyme-, conalbumin-, ovomucoid-, ovomucin-, and ovotransferrin
promoters.
One aspect of the invention involves truncating the ovalbumin promoter and/or
condensing the critical regulatory elements of the ovalbumin promoter so that
it retains
sequences required for expression in the tubular gland cells of the magnum of
the
oviduct, while being small enough that it can be readily incorporated into
vectors. For
instance, a segment of the ovalbumin promoter region may be used. This segment
comprises the 5'-flanking region of the ovalbumin gene. The total length of
the
ovalbumin promoter segment may be from about 0.88 kb to about 7.4 kb in
length, and
is preferably from about 0.88 kb to about 1.4 kb in length. The segment
preferably
includes both the steroid-dependent regulatory element and the negative
regulatory
element of the ovalbumin gene. The segment optionally also includes residues
from
14
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
the 5'untranslated region (5'UTR) of the ovalbumin gene. Alternatively, the
promoter
may be a segment of the promoter region of the lysozyme-, conalbumin-,
ovomucin-,
ovomucoid- and ovotransferrin genes. An example of such a promoter is the
synthetic
MDOT promoter which is comprised of elements from the ovomucoid (MD) and
ovotransferrin (OT) promoter.
In another aspect of the invention, the vectors integrated into the avian
genome
contain constitutive promoters which are operably linked to the exogerious
coding
sequence (e.g., cytomegalovirus (CMV) promoter, rous-sarcoma virus (RSV)
promoter, and a murine leukemia virus (MLV) promoter. Alternatively, a non-
constitutive promoter such as a mouse mammary tumor virus (MMTV) promoter may
be used.
Other aspects of the invention provide for transgenic avians which carry a
transgene in the genetic material of their germ-line tissue. More
specifically, the
transgene includes an exogenous gene and a promoter in operational and
positional
relationship to express the exogenous gene. The exogenous gene may be
expressed in
the avian oviduct and in the blood of the transgenic avian. The exogenous gene
codes
for exogenous proteins such as pharmaceutical proteins including cytokines
such as
TPD IFN-a (e.g., IFN-a 2) and TPD EPO and TPD G-CSF. The exogenous protein is
deposited into the egg white of a hard shell egg.
Another aspect of the invention provides for an avian egg which contains
protein exogenous to the avian species. Use of the invention allows for
expression of
exogenous proteins in oviduct cells with secretion of the proteins into the
lumen of the
oviduct magnum and deposition into the egg white of the avian egg. Proteins
packaged
into eggs may be present in quantities of up to one gram or more per egg. The
exogenous protein includes, but is not limited to, TPD IFN-a 2 and TPD EPO and
TPD
G-CSF.
Still another aspect of the invention provides an isolated polynucleotide
sequence comprising the optimized coding sequence of human interferon-a 2b
(IFN-a
2b), i.e., recombinant transgenic poultry derived interferon-a 2b coding
sequence
which codes for transgenic poultry derived interferon-a 2b (TPD IFN-a 2b). The
invention also encompasses an isolated protein comprising the polypeptide
sequence of
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
TPD IFN-a 2b, wherein the protein is 0-glycosylated at Thr-106 with N-Acetyl-
Galactosamine, Galactose, N-Acetyl-Glucosamine, Sialic acid, and combinations
thereof.
The invention further contemplates a pharmaceutical composition comprising
the polypeptide sequence of TPD IFN-a 2b, wherein the protein is 0-
glycosylated at
Thr-106 with N-Acetyl-Galactosamine, Galactose, N-Acetyl-Glucosamine, Sialic
acid,
and combinations thereof.
One aspect of the invention provides for coding sequences for exogenous
proteins produced as disclosed herein wherein the coding sequence is codon
optimized
for expression in an avian, for example, in a chicken. Codon optimization may
be
determined from the codon usage of at least one, and preferably more than one,
protein
expressed in an avian cell (e.g., a chicken cell). For example, the codon
usage may be
determined from the nucleic acid sequences encoding the proteins ovalbumin,
lysozyme, ovomucin and ovotransferrin of chicken. For example, the DNA coding
sequence for the exogenous protein may be codon optimized using the
BACKTRANSLATE program of the Wisconsin Package, version 9.1 (Genetics
Computer Group, Inc., Madison, WI) with a codon usage table compiled from the
chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid, and ovotransferrin
proteins.
One aspect of the invention provides an isolated polynucleotide sequence
comprising the optimized coding sequence of human erythropoietin (EPO), i.e.,
recombinant transgenic poultry derived erythropoietin coding sequence which
codes
for transgenic poultry derived erythropoietin (TPD EPO).
Another aspect of the invention provides for a vector comprising a first and
second coding sequence and a promoter in operational and positional
relationship to
the first and second coding sequence to express the first and second coding
sequence in
an avian oviduct. In this aspect, the vector may include an internal ribosome
entry site
(IRES) element positioned between the first and second coding sequence,
wherein the
first coding sequence codes for protein X and the second coding sequence codes
for
protein Y, and wherein one or both of protein X and protein Y are deposited
into the
egg (e.g., egg white) of a hard shell egg.
16
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
For example, protein X may be a light chain (LC) of a monoclonal antibody and
protein Y may be a heavy chain (HC) of a monoclonal antibody. Alternatively,
the
protein encoded by the second coding sequence (e.g., enzyme) may be capable of
providing post-translational modification of the protein encoded by the first
coding
sequence. The vector optionally includes additional coding sequences and
additional
IRES elements, such that each coding sequence in the vector is separated from
another
coding sequence by an IRES element. Other examples of employing an IRES which
are contemplated for use in the present invention are disclosed in, for
example, US
Patent Application No. 11/047,184, filed January 31, 2005, the disclosure of
which is
incorporated in its entirety herein by reference.
The invention also contemplates methods of producing an avian egg which
contains proteins such as pharmaceutical proteins including monoclonal
antibodies,
enzymes and other proteins. Such methods may include providing a vector with a
promoter, coding sequences, and at least one IRES element; creating transgenic
cells or
tissue by introducing the vector into avian embryonic blastodermal cells,
wherein the
vector sequence is randomly inserted into the avian genome; and deriving a
mature
transgenic avian from the transgenic cells or tissue. The transgenic avian so
derived
may express the coding sequences in its oviduct, and the resulting protein
secreted into
the oviduct lumen, so that the protein is deposited into the egg white of a
hard shell
egg. In addition, the invention includes progeny of the transgenic avians
which
produce eggs containing the recombinant protein. Typically, the progeny will
either
contain the transgene in essentially all the cells of the bird or none of the
cells of the
progeny bird will contain the transgene.
One important aspect of the present invention relates to avian hard shell eggs
(e.g., chicken hard shell eggs) which contain an exogenous peptide or protein
including, but not limited to, a pharmaceutical protein. The exogenous peptide
or
protein may be encoded by a transgene of a transgenic avian. In one
embodiment, the
exogenous peptide or protein (e.g., pharmaceutical protein) is glycosylated.
The
protein may be present in any useful amount. In one embodiment, the protein is
present in an amount in a range of between about 0.01 g per hard-shell egg
and about
I gram per hard-shell egg. In another embodiment, the protein is present in an
amount
17
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
in a range of between about I g per hard-shell egg and about I gram per hard-
shell
egg. For example, the protein may be present in an amount in a range of
between
about 10 g per hard-shell egg and about I gram per hard-shell egg (e.g., a
range of
between about 10 g per hard-shell egg and about 400 milligrams per hard=shell
egg).
In one embodiment, the exogenous protein of the invention, for example, the
exogenous pharmaceutical protein, is present in the egg white of the egg. In
one
embodiment, the protein is present in an amount in a range of between about 1
ng per
milliliter of egg white and about 0.2 gram per milliliter of egg white. For
example, the
protein may be present in an amount in a range of between about 0.1 jig per
milliliter
of egg white and about 0.2 gram per milliliter of egg white (e.g., the protein
may be
present in an amount in a range of between about I g per milliliter of egg
white and
about 100 milligrams per milliliter of egg white. In one embodiment, the
protein is
present in an amount in a range of between about I g per milliliter of egg
white and
about 50 milligrams per milliliter of egg white. For example, the protein may
be
present in an amount in a range of about 1 g per milliliter of egg white and
about 10
milligrams per milliliter of egg white (e.g., the protein may be present in an
amount in
a range of between about 1 g per milliliter of egg white and about 1
milligrams per
milliliter of egg white). In one embodiment, the protein is present in an
amount of
more than 0.1 g per milliliter of egg white. In one embodiment, the protein
is present
in an amount of more than 0.5 g per milliliter of egg white. In one
embodiment, the
protein is present in an amount of more than I g per milliliter of egg white.
In one
embodiment, the protein is present in an amount of more than 1.5 g per
milliliter of
egg white.
The invention contemplates the production of hard shell eggs containing any
useful protein including one or more pharmaceutical proteins. Such proteins
include,
but are not limited to, hormones, immunoglobulins or portions of
immunoglobulins,
cytokines (e.g., GM-CSF, G-CSF, erythropoietin and interferon) and CTLA4. The
invention also includes the production of hard shell eggs containing fusion
proteins
including, but not limited to, imunoglobulins or portions of immunoglobulins
fused to
certain useful peptide sequences. In one embodiment, the invention provides
for the
18
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
production of hard shell eggs containing an antibody Fc fragment. For example,
the
eggs may contain an Fc-CTLA4 fusion protein in accordance with the invention.
The avians developed from the blastodermal cells into which the vector has
been introduced are the GO generation and can be referred to as "founders".
Founder
birds are typically chimeric for each inserted transgene. That is, only some
of the cells
of the GO transgenic bird contain the transgene(s). The GO generation
typically is also
hemizygous for the transgene(s). The GO generation may be bred to non-
transgenic
animals to give rise to G1 transgenic offspring which are also hemizygous for
the
transgene and contain the transgene(s) in essentially all of the bird's cells.
The G1
hemizygous offspring may be bred to non-transgenic animals giving rise to G2
hemizygous offspring or may be bred together to give rise to G2 offspring
homozygous
for the transgene. Substantially all of the cells of birds which are positive
for the
transgene that are derived from G I offspring will contain the transgene(s).
In one
embodiment, hemizygotic G2 offspring from the same line can be bred to produce
G3
offspring homozygous for the transgene. In one embodiment, hemizygous GO
animals
are bred together to give rise to homozygous GI offspring containing two
copies of the
transgene(s) in each cell of the animal. These are merely examples of certain
useful'
breeding methods and the present invention contemplates the employment of any
useful breeding method such as those known to individuals of ordinary skill in
the art.
One aspect of the invention is directed to compositions which contain proteins
produced in accordance with the invention that have a poultry derived
glycosylation
pattern, such as a chicken derived glycosylation pattern. One aspect of the
invention is
directed to compositions which contain proteins produced in accordance with
the
invention that have an avian derived glycosylation pattern, such as a chicken
derived
glycosylation pattern. For example, the invention includes pharmaceutical
proteins
having a poultry derived glycosylation pattern such as one or more of the
glycosylation
patterns disclosed herein. The invention also includes human proteins having a
poultry
derived glycosylation pattern such as one or more of the glycosylation
patterns
disclosed herein.
In one aspect, the invention includes G-CSF wherein the G-CSF has a poultry
derived glycosylation pattern, i.e., a transgenic poultry derived G-CSF or TPD
G-CSF.
19
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
In one aspect, the invention includes G-CSF wherein the G-CSF has a transgenic
avian
derived glycosylation pattern, i.e., a transgenic avian derived G-CSF. In one
embodiment, the glycosylation pattern is other than that of G-CSF produced in
a
human cell and/or in a CHO cell. That is, the compositions have a G-CSF
molecule
with a poultry or avian. derived carbohydrate chain (i.e., glycosylation
structure) and
that carbohydrate chain or glycosylation structure is not found on G-CSF
obtained
from human cells and/or CHO cells. However, the composition may also include G-
CSF molecules that have glycosylation structures that are the same as that
found on G-
CSF obtained from CHO cells and/or human cells. Glycosylation of human G-CSF
produced in CHO cells is disclosed in Holloway, C.J., European J. of Cancer
(1994)
vol 30A, pS2-S6, the disclosure of which is incorporated in its entirety
herein by
reference; in Oheda et al (1988) J. Biochem., v 103, p 544-546, the disclosure
of which
is incorporated in its entirety herein by reference and in Andersen et al
(1994)
Glycobiology, vol 4, p 459-467, the disclosure of which is incorporated in its
entirety
herein by reference. It appears that structures such as A and G shown in
Example 20
may be the same or similar to glycosylation structures reported for G-CSF
produced in
CHO cells. In one embodiment, the glycosylation pattern of the G-CSF produced
in
accordance with the invention is other than that of G-CSF produced in
mammalian cell.
In one embodiment, the invention provides for the G-CSF to be isolated. That
is, the G-CSF contained in the composition may be an isolated G-CSF. For
example,
the G-CSF may be isolated from egg white. The isolated G-CSF may be G-CSF
molecules having differing glycosylation structures among the G-CSF molecules
or the
isolated G-CSF may be an isolated individual species of G-CSF molecules having
only
one particular glycosylation structure among the species of G-CSF molecules.
In one embodiment, the G-CSF of a composition of the invention is present in a
hard shell egg. For example, the G-CSF may be present in the egg white of a
hard
shell egg laid by a transgenic avian of the invention. That is, in one
embodiment, the
invention is directed to avian (e.g., chicken) egg white containing G=CSF of
the
invention. In one embodiment, the G-CSF is present in the egg white in an
amount in
excess of about I microgram per ml of egg white. For example, the G-CSF can be
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
present in an amount greater that about 2 micrograms per ml of egg white
(e.g., present
in an amount of about 2 micrograms to about 200 micrograms per ml of egg
white).
In one particular aspect of the invention, the G-CSF is glycosylated in an
oviduct cell of the avian, e.g., glycosylated in an oviduct cell of a chicken.
For
example, the G-CSF can be produced and glycosylated in an oviduct cell. In one
embodiment, the G-CSF is glycosylated in a tubular gland cell (e.g., the G-CSF
is
produced and glycosylated in a tubular gland cell).
The G-CSF is believed to be glycosylated at threonine 133. However, the
invention is not limited to glycosylation at any particular site on a G-CSF
molecule.
Typically, the G-CSF of the invention is human G-CSF. In one embodiment,
the mature G-CSF has the amino acid sequence of FIG. 18 C.
. In one embodiment, compositions of the invention include G-CSF molecules
glycosylated with:
SA-Gal-NAcGal-, Gal-NAcGIu-NAcGaI-, Gal-NAcGlu-NAcGal-,
Gal Gal
I
SA
SA-Gal-NAcGIu-NAcGaI-, SA-Gal-NAcGIu-NAcGaI-, Gal-NAcGal-, and
Gal Gal
SA
SA-Gal-NAcGaI-.
SA
The invention is also specifically directed to compositions containing G-CSF
molecules that have one of these particular glycosyation structures. Such
compositions
may also include one or more G-CSF molecules having one or more other
glycosylation structures.
That is, in one embodiment, the invention is specifically directed to
compositions containing G-CSF molecules that have:
21
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Gal-NAcGIu-NAcGaI-;
I
Gal
and to compositions containing G-CSF molecules that have:
SA-Ga1-NAcGIu-NAcGal-;
1
Gal
and to compositions containing G-CSF molecules that have:
SA-Gal-NAcGIu-NAcGaI-;
Gal
SA
and to compositions containing G-CSF molecules that have:
SA-GaI-NAcGaI-;
and to compositions containing G-CSF molecules that have:
Gal-NAcGlu-NAcGaI-;
Gal
1
SA
and to compositions containing G-CSF molecules that have:
SA-Gal-NAcGaI-;
(
Gal
and to compositions containing G-CSF molecules that have:
Gal-NAcGaI-,
wherein Gal=Galactose,
NAcGa1=N-Acetyl-Galactosam i ne,
22
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
NAcG1u=N-Acetyl-Glucosamine, and
SA=Sialic Acid.
The invention is also directed to methods of increasing white blood cell count
in a patient which include administering to a patient a therapeutically
effective amount
of G-CSF produced in accordance with the invention. Typically, the
therapeutically
effective amount is an amount of G-CSF that increases the white blood cell
count in a
patient by a desired amount.
One aspect of the invention relates to compositions containing EPO, i.e., EPO
molecules produced in accordance with the invention. In a particularly useful
embodiment, the EPO is purified or isolated. For example, the EPO has been
removed
from the contents of a hard shell egg laid by a transgenic avian. In one
particularly
useful embodiment, the EPO is human EPO. In one embodiment, the EPO of the
invention has a glycosylation pattern resulting from the EPO being produced in
an
oviduct cell of an avian. Another aspect of the invention relates to
compositions
containing EPO that has a glycosylation pattern wherein the glycosylation
pattern is
other than that of EPO produced in a human cell or a CHO cell and the EPO is
produced in an oviduct cell of a chicken. In one aspect the invention provides
for
compositions that contain isolated EPO (e.g., human EPO) having an avian or
poultry
derived glycosylation pattern. For example, the compositions can contain a
mixture of
EPO molecules produced in avians, for example, chickens, in accordance with
the
invention and isolated from egg white. In one useful embodiment, the EPO
containing
compositions are pharmaceutical formulations.
In one embodiment, the oligosaccharides present on the EPO of the invention
do not contain fucose. In another embodiment, about 90% or more of the N-
linked
oligosaccharides present on the EPO of the invention do not contain fucose. In
another
embodiment, about 80% or more of the N-linked oligosaccharides present on the
EPO
of the invention do not contain fucose. In another embodiment, about 70% or
more of
the N-linked oligosaccharides present on the EPO of the invention do not
contain
fucose. In another embodiment, about 60% or more of the N-linked
oligosaccharides
present on the EPO of the invention do not contain fucose. In another
embodiment,
23
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
about 50% or more of the N-linked oligosaccharides present on the EPO of the
invention do not contain fucose.
In one embodiment, about 95% or more of the N-linked oligosaccharides
present on the EPO of the invention do not contain sialic acid. In another
embodiment,
about 90% or more of the N-linked oligosaccharides present on the EPO of the
invention do not contain sialic acid. In another embodiment, about 80% or more
of the
N-linked oligosaccharides present on the EPO of the invention do not contain
sialic
acid. In another embodiment, more than about 70% or more of the N-linked
oligosaccharides present on the EPO of the invention do not contain sialic
acid. In
another embodiment, about 60% or more of the N-linked oligosaccharides present
on
the EPO of the invention do not contain sialic acid. In another embodiment,
about 50%
or more of the N-linked oligosaccharides present on the EPO of the invention
do not
contain sialic acid.
In one embodiment, about 95% or more of the N-linked oligosaccharides
present on the EPO of the invention contain a terminal N-Acetyl Glucosamine.
In
another embodiment, about 90% or more of the N-linked oligosaccharides present
on
the EPO of the invention contain a terminal N-Acetyl Glucosamine. In another
embodiment, about 80% or more of the N-linked oligosaccharides present on the
EPO
of the invention contain a terminal N-Acetyl Glucosamine. In another
embodiment,
about 70% or more of the N-linked oligosaccharides present on the EPO of the
invention contain a terminal N-Acetyl Glucosamine. In another embodiment,
about
60% or more of the N-linked oligosaccharides present on the EPO of the
invention
contain a terminal N-Acetyl Glucosamine. In another embodiment, about 50% or
more
of the N-linked oligosaccharides present on the EPO of the invention contain a
terminal
N-Acetyl Glucosamine.
In one embodiment, essentially none of the N-linked oligosaccharides structure
types present on the EPO molecules of the invention contain fucose. In another
embodiment, about 90% or more of the N-linked oligosaccharides structure types
present on the EPO molecules of the invention do not contain fucose. For
example, if
there are 20 oligosaccharide structure types, then 18 or more of the structure
types will
not contain fucose. In another embodiment, about 80% or more of the N-linked
24
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
oligosaccharides structure types present on the EPO molecules of the invention
do not
contain fucose. In another embodiment, about 70% or more of the N-linked
oligosaccharides structure types present on the EPO molecules of the invention
do not
contain fucose. In another embodiment, about 60% or more of the N-linked
oligosaccharides structure types present on the EPO molecules of the invention
do not
contain fucose. In another embodiment, about 50% or more of the N-linked
oligosaccharides structure types present on the EPO molecules of the invention
do not
contain fucose.
In one embodiment, essentially none of the N-linked oligosaccharides structure
types present on the EPO molecules of the invention contain sialic acid. In
another
embodiment, about 90% or more of the N-linked oligosaccharides structure types
present on the EPO molecules of the invention do not contain sialic acid. For
example,
if there are 20 ologosaccharide structure types, then 18 or more of the
structure types
will not contain sialic acid. In another embodiment, about 80% or more of the
N-
linked oligosaccharides structure types present on the EPO molecules of the
invention
do not contain sialic acid. In another embodiment, about 70% or more of the N-
linked
oligosaccharides structure types present on the EPO molecules of the invention
do not
contain sialic acid. In another embodiment, about 60% or more of the N-linked
oligosaccharides structure types present on the EPO molecules of the invention
do not
contain sialic acid. In another embodiment, about 50% or more of the N-linked
oligosaccharides structure types present on the EPO molecules of the invention
do not
contain sialic acid.
In one embodiment, all of the N-linked oligosaccharides structure types
present
on the EPO molecules of the invention contain a terminal N-Acetyl Glucosamine.
In
another embodiment, about 90% or more of the N-linked oligosaccharides
structure
types present on the EPO molecules of the invention contain a terminal N-
Acetyl
Glucosamine. For example, if there are 20 oligosaccharide structure types,
then 18 or
more of the structure types will contain a terminal N-Acetyl Glucosamine. In
another
embodiment, about 80% or more of the N-linked oligosaccharides structure types
present on the EPO molecules of the invention contain a terminal N-Acetyl
Glucosamine. In another embodiment, about 70% or more of the N-linked
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
oligosaccharides structure types present on the EPO molecules of the invention
contain
a terminal N-Acetyl Glucosamine. In another embodiment, about 60% or more of
the
N-linked oligosaccharides structure types present on the EPO molecules of the
invention contain a terminal N-Acetyl Glucosamine. In another embodiment,
about
50% or more of the N-linked oligosaccharides structure types present on the
EPO
molecules of the invention contain a terminal N-Acetyl Glucosamine.
In one aspect, the invention is directed to EPO obtained from a transgenic
avian, for example, a transgenic chicken, which contains a transgene encoding
the
EPO. In one embodiment, the EPO is produced in an avian oviduct cell, for
example, a
tubular gland cell. In one embodiment, the EPO is contained in a hard shell
egg, for
example, a hard shell egg laid by an avian, e.g., a chicken. For example, the
EPO may
be present in the contents of an intact hard shell egg. In one particularly
useful
embodiment, the EPO of the invention is human EPO.
In one aspect, the invention is drawn to compositions containing isolated EPO
molecules, for example, human EPO molecules, wherein the EPO is produced in an
avian which contains a transgene encoding the EPO. In one embodiment, the EPO
is
produced in an oviduct cell (e.g., a tubular gland cell) of a transgenic avian
(e.g.,
transgenic chicken) and the EPO is isolated from egg white of the transgenic
avian. =In
one embodiment, the EPO of the invention has the amino acid sequence of FIG.
19A.
It is contemplated that the EPO is N-glycosylated and/or 0-glycosylated. In
one
embodiment, the EPO is glycosylated in the oviduct cell (e.g., tubular gland
cell) of the
bird, for example, a chicken.
In one aspect, the invention relates to a composition, for example, a
pharmaceutical formulation, containing isolated EPO, for example, human EPO,
having an avian derived glycosylation pattern. In one aspect, the invention
relates to a
composition, for example, a pharmaceutical formulation, containing isolated
EPO, for
example, human EPO, having a poultry derived glycosylation pattern. In one
aspect,
the invention relates to a composition, for example, a pharmaceutical
formulation,
containing isolated EPO, for example, human EPO, produced in accordance with
the
invention. In one embodiment, EPO in compositions of the invention contains a
glycosylation pattern other than that of EPO produced in a mammalian cell. In
one
26
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
embodiment, EPO in compositions of the invention contains a glycosylation
pattern
other than that of EPO produced in a CHO cell and a human cell. In one
embodiment,
EPO of the invention is attached to one or more N-linked oligosaccharide
structures
disclosed herein (e.g., those shown in FIG. 21). In one embodiment, EPO of the
invention is attached to one or more 0-linked oligosaccharide structures
disclosed
herein (e.g., those shown in FIG. 20).
One aspect of the invention is drawn to methods of treating a patient
comprising administering to a patient a therapeutically effective amount of
EPO
obtained from a transgenic avian. In one embodiment, the therapeutically
effective
amount is an amount that increases the red blood cell count in a patient by a
desired
amount. It is contemplated that EPO produced in accordance with the invention
can be
used to treat chronic kidney disease, for example, where tissues fail to
sustain
production of erythropoietin.
One aspect of the invention is drawn to compositions containing isolated
glycosylated human protein molecules produced in the oviduct of a transgenic
avian
wherein the transgenic avian (e.g., transgenic chicken) contains a transgene
encoding
the human protein and wherein the human protein contains a chicken derived
oligosaccharide which is not nonnally present on the human protein. In one
embodiment, the human protein is attached to one or more N-linked
oligosaccharide
structures disclosed herein (e.g., those shown in FIG. 21). In one embodiment,
the
human protein is attached to one or more 0-linked oligosaccharide structures
disclosed
herein (e.g., those shown in FIG. 20).
In one embodiment, the invention is directed to isolated protein molecules
produced in the oviduct of a transgenic chicken, for example, as disclosed
herein,
wherein the transgenic chicken contains a transgene encoding the protein
molecule and
wherein the protein molecule contains a chicken derived oligosaccharide. For
example, the protein molecule can be a glycosylated form of GM-CSF, interferon
(3,
fusion protein, CTLA4-Fc fusion protein, growth hormones, cytokines,
structural,
interferon, lysozyme, (3-casein, albumin, a-1 antitrypsin, antithrombin III,
collagen,
factors VIII, IX, X (and the like), fibrinogen, lactoferrin, protein C, tissue-
type
plasminogen activator (tPA), somatotropin, and chymotrypsin, immunoglobulins,
27
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
antibodies, immunotoxins, factor VIII, b-domain deleted factor VIII, factor
Vlia,
factor IX, anticoagulants; hirudin, alteplase, tpa, reteplase, tpa, tpa - 3 of
5 domains
deleted, insulin, insulin lispro, insulin aspart, insulin glargine, long-
acting insulin
analogs, glucagons, tsh, follitropin-beta, fsh, pdgh, inf-beta ib, ifn-beta
la, ifn-
gammalb, il-2, il-11, hbsag, ospa, dornase-alpha dnase, beta
glucocerebrosidase, tnf-
alpha, il-2-diptheria toxin fusion protein, tnfr-lgg fragment fusion protein
laronidase,
dnaases, alefacept, tositumomab, murine mab, alemtuzumab, rasburicase,
agalsidase
beta, teriparatide, parathyroid hormone derivatives, adalimumab (lggl),
anakinra,
biological modifier, nesiritide, human b-type natriuretic peptide (hbnp),
colony
stimulating factors, pegvisomant, human growth hormone receptor antagonist,
recombinant activated protein c, omalizumab, immunoglobulin e(lge) blocker,
Ibriturnomab tiuxetan, ACTH, glucagon, somatostatin, somatotropin, thymosin,
parathyroid hormone, pigmentary hormones, somatomedin, luteinizing hormone,
chorionic gonadotropin, hypothalmic releasing factors, etanercept,
antidiuretic
hormones, prolactin and thyroid stimulating hormone, an immunoglobulin
polypeptide,
immunoglobulin polypeptide D region, immunoglobulin polypeptide J region,
immunoglobulin polypeptide C region, immunoglobulin light chain,
immunoglobulin
heavy chain, an immunoglobulin heavy chain variable region, an immunoglobulin
light
chain variable region and a linker peptide. Proteins not normally glycosylated
can be
engineered to contain a glycosylation site which will be glycosylated in the
avian
system, as is understood by a practitioner of skill in the art. In one
embodiment, the
isolated protein has attached one or more N-linked oligosaccharide structures
disclosed
herein (e.g., those shown in FIG. 21). In one embodiment, the isolated protein
is
attached to one or more 0-linked oligosaccharide structures disclosed herein
(e.g.,
those shown in FIG. 20).
Features (e.g., compositions, glycosylation structures) specifically
contemplated for certain proteins disclosed herein such as EPO are also
contemplated
for other specific proteins disclosed herein, which can be produced in
accordance with
the invention.
The invention also includes, methods of making glycosylated proteins disclosed
herein such as erythropoietin comprising producing a transgenic avian which
contains a
28
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
transgene encoding protein (e.g., erythropoietin) wherein the protein is
packaged into a
hard shell egg laid by the avian. Also included are the eggs laid by the
avians which
contain the protein (e.g., erythropoietin).
The invention also provides for compositions which contain isolated mixtures
of an individual type of useful protein molecule, such as those proteins
disclosed
herein, where one or more of the protein molecules contained in the mixture
has a
specific oligosaccharide structure attached, in particular an oligosaccharide
structure
disclosed herein which may be produced by a transgenic avian. For example, the
invention provides for isolated mixtures of EPO molecules, for example, human
EPO
molecules (e.g., EPO of SEQ ID NO: 50) which contain an EPO molecule
glycosylated
with one or more of:
^-
l 5 a-
-5
and
^
&Q-EI-0
^~
and
30 and
29
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
and E]
El/
and
^
] 0 D--~
and
^
1. ~
^
^/
and
^- ^
and
^ '
^/
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
and
Gal 0 NAcGIu Siatic Acid 0 Mannose
and
XXX
Gal 0 NAcGIu Sialic Acid - NAcGal
and each of the other oligosaccharide structure shown in FIG. 20 and FIG. 21.
Any useful combination of features described herein is included within the
scope of the present invention provided that the features included in any such
combination are not mutually inconsistent as will be apparent from the
context, this
specification, and the knowledge of one of ordinary skill in the art.
Additional objects and aspects of the present invention will become more
apparent upon review of the detailed description set forth below when taken in
conjunction with the accompanying figures, which are briefly described as
follows.
31
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Brief Description of the Drawings
FIGS. IA and 1B illustrate ovalbumin promoter expression vectors comprising
ovalbumin promoter segments and a coding sequence, gene X, which encodes an
exogenous protein X. X represents any exogenous gene or exogenous protein of
interest.
FIGS. 2A, 2B, 2C and 2D illustrate retroviral vectors of the invention
comprising an ovalbumin promoter and a coding sequence, gene X, encoding an
exogenous protein X. X represents any exogenous gene or exogenous protein of
interest.
FIG. 2E illustrates a method of amplifying an exogenous gene for insertion
into
the vectors of 2A and 2B.
FIG. 2F illustrates a retroviral vector comprising an ovalbumin promoter
controlling expression of a coding sequence, gene X, and an internal ribosome
entry
site (IRES) element enabling expression of a second coding sequence, gene Y. X
and
Y represent any gene of interest.
FIGS. 3A and 3B show schematic representations of the ALV-derived vectors
pNLB and pNLB-CMV-BL, respectively. Because NLB has not been sequenced in its
entirety, measurements in bp (base pair) are estimated from published data
(Cosset et
al., 1991; Thoraval et al., 1995) and data discussed herein. The vectors are
both shown
as they would appear while integrated into the chicken genome.
FIGS. 4A and 4B show the amount of (3-lactamase (lactamase) in the blood
serum of chimeric and transgenic chickens. In FIG. 4A the concentration of
bioactive
lactamase in the serum of GO chickens transduced with the NLB-CMV-BL transgene
was measured at 8 month post-hatch. The generation, sex and wing band numbers
are
indicated. Lactamase serum concentrations were measured for GI transgenic
chickens
at 6 to 7 months post-hatch. Arrows indicate GI chickens bred from rooster
2395. In
FIG. 4B the lactamase serum concentration was measured for Gl and G2
transgenic
chickens. Arrows indicate G2s bred from hen 5657 or rooster 4133. Samples from
chickens 4133, 5308, and 5657 are the same as those in FIG. 4A. Samples from
G2
birds bred from 5657 were collected at 3 to 60 days post-hatch. Samples from
G2 birds
bred from 4133 were collected at 3 month post-hatch.
32
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
FIG. 5 shows the pedigree of chickens containing the transgenic loci harbored
by hen 5657 (FIG. 5A) or rooster 4133 (FIG. 5B). 2395 was a rooster that
carried
multiple transgenic loci. 2395 was bred to a non-transgenic hen, yielding 3
offspring
each carrying the transgene in a unique position of the chicken genome. For
simplicity, transgenic progeny for which expression data were not shovan as
well as
non-transgenic progeny were omitted from the pedigree. Band numbers are
indicated
by the following symbols: o hen; o rooster; = hen carrying the NLB-CMV-BL
transgene; ^ rooster carrying the NLB-CMV-BL transgene.
FIG. 6 shows P-lactamase (lactamase) in the egg white of hen 5657 and her
offspring. In FIG. 6A egg white from hen 5657 and her transgenic offspring
were
assayed for active lactamase. The control is from untreated hens and
clutchmate is a
non-transgenic G2 bred from hen 5657. Eggs were collected in March 2000.
Arrows
indicate 02s bred from hen 5657. In FIG. 6B egg white samples from G2
transgenic
hens carrying one copy of the transgene (hemizygous) were compared with that
of G3
hen 6978 which harbored two copies (homozygous). Eggs were collected in
February
2001. The generation and wing band numbers are indicated to the left.
FIG. 7 shows (3-lactamase (lactamase) in the eggs of G2 and G3 hens bred from
rooster 4133. In FIG. 7A egg whites from four representative hemizygous
transgenic
hens bred from rooster 4133 were assayed for active lactamase. Eggs were
collected in
October 1999, March 2000 and February 2001 and a minimum of 4 eggs per hen
were
assayed one month after each set was collected. The control represents egg
white from
untreated hens. Band numbers are indicated to the left. The average of the 4
hens for
each period is calculated. In FIG. 7B egg white from hemizygous G2 transgenic
hens
were compared with that of hemizygous and homozygous transgenic G3 hens. The
eggs were collected in February 2001. The generation and transgene copy number
are
displayed in the data bar for each hen. The average concentration for hens
carrying one
or two copies is at the bottom of the chart.
FIGS. 8A and 8B show the pNLB-CMV-IFN vector for expressing IFN-a 2b in
chickens; and the pNLB-MDOT-EPO vector used for expressing erythropoietin
(EPO)
in chickens, respectively.
33
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
FIG. 9 depicts the novel glycosylation pattern of transgenic poultry derived
interferon-a 2b (TPD IFN-a 2b), including all 6 bands.
FIG. 10 shows the comparison of human peripheral blood leukocyte derived
interferon-a 2b (PBL IFN-a 2b or natural hIFN) and transgenic poultry derived
interferon-a 2b (TPD IFN-a 2b or egg white hIFN).
FIG. IlA depicts the synthetic nucleic acid sequence (cDNA, residues 1-498)
of optimized human interferon-a 2b (IFN-a 2b), i.e., recombinant TPD IFN-a. 2b
(SEQ
ID NO: 1). FIG. 11B depicts the synthetic amino acid sequence (residues 1-165)
of
transgenic poultry derived interferon-a 2b (TPD IFN-a 2b) (SEQ ID NO: 2).
FIG. 12A depicts the synthetic nucleic acid sequence (cDNA, residues 1-579)
of optimized human erythropoietin (EPO) i.e., recombinant TPD EPO (SEQ ID NO:
3). FIG. 12B depicts the synthetic amino acid sequence (residues 1-193) of
transgenic
poultry derived erythropoietin (TPD EPO) (SEQ ID NO: 4). (For natural human
EPO
see also NCBI Accession Number NP 000790).
FIG. 13 shows the synthetic MDOT promoter linked to the IFN-MM CDS. The
MDOT promoter contains elements from the chicken ovomucoid gene (ovomucoid
promoter) ranging from -435 to -166 bp (see NCBI Accession Number J00894) and
the
chicken conalbumin gene (ovotransferrin promoter) ranging from -251 to +29 bp
(see
NCBI Accession Numbers Y00497, M11862 and X01205).
FIG. 14 provides a summary of the major egg white proteins.
FIGS. 15A and 15D show the pCMV-LC-emcvlRES-HC vector, wherein the
light chain (LC) and heavy chain (HC) of a human monoclonal antibody were
expressed from this single vector by placement of an I.RES from the
encephalomyocarditis virus (EMCV) in order to test for expression of
monoclonal
antibodies. In comparison, FIGS. 15B and 15C show the separate vectors pCMV-HC
and pCMV-LC, respectively, wherein these vectors were also used to test for
expression of monoclonal antibodies.
FIG. 16 shows a silver stained SDS PAGE of Neupogen (lane A) and TPD G-
CSF (lane B).
FIG. 17 depicts the increase in Absolute Neutrophil Count (ANC) of TPD G-
CSF compared to bacterial derived human G-CSF over a 14 day period.
34
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
FIG. 18A (SEQ ID NO: 39) shows the nucleotide sequence encoding the amino
acid sequence of FIG. 18B. FIG. 18 B (SEQ ID NO: 40), which corresponds to
NCBI
Accession NP 7577373, shows the amino acid sequence of G-CSF including the
natural signal sequence which is cleaved away to form the mature G-CSF during
cellular secretion. FIG. 18C (SEQ ID NO: 41) shows the amino acid sequence of
the
mature G-CSF protein produced in accordance with the present invention.
FIG. 19A shows the nucleotide coding sequence used to produce the 165 amino
acid form of human erythropoietin in transgenic avians. FIG. 19B shows the
amino
acid sequence of the 165 amino acid form of human erythropoietin produced in
transgenic avians.
FIG. 20 shows representative 0-linked glycosylation structures determined for
the erythropoietin produced in accordance with the invention.
FIG. 21A and FIG. 21B shows representative N-linked glycosylation structures
determined for the erythropoietin produced in accordance with the invention.
The
bracket in front of a group of sugar residues means that the indicated
sugar(s) can be
attached to any of the bracketed sugars. For example, in Structure E-n the
indicated
galactose molecule attached to a sialic acid can be attached to any one of the
five
terminal n-acetyl glucosamines. Postulated linkages are also shown for the
structures,
as is understood in the art. It is contemplated that for each of the
structures indicated
as C-n, E-n, F-n and H-n, the two terminal NAcG1u residues linked to a single
mannose
may be 2,6-linked to mannose instead of 2,4 linked to the mannose.
FIG. 22 shows the in vitro activity of the purified transgenic chicken derived
EPO. ED50 = 0.44 ng/ml.
Detailed Description
Certain definitions are set forth herein to illustrate and define the meaning
and
scope of the various terms used to describe the invention herein.
A "nucleic acid or polynucleotide sequence" includes, but is not limited to,
eukaryotic mRNA, cDNA, genomic DNA, and synthetic DNA and RNA sequences,
comprising the natural nucleoside bases adenine, guanine, cytosine, thymidine,
and
uracil. The -term also encompasses sequences having one or more modified
bases.
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
The term "avian" as used herein refers to any species, subspecies or race of
organism of the taxonomic class ava, such as, but not limited to chicken,
turkey, duck,
goose, quail, pheasants, parrots, finches, hawks, crows and ratites including
ostrich,
emu and cassowary. The term includes the various known strains of Gallus
gallus, or
chickens, (for example, White Leghorn, Brown Leghorn, Barred-Rock, Sussex, New
Hampshire, Rhode Island, Australorp, Minorca, Amrox, California Gray), as well
as
strains of turkeys, pheasants, quails, duck, ostriches and other poultry
commonly bred
in commercial quantities. It also includes an individual avian organism in all
stages of
development, including embryonic and fetal stages.
"Therapeutic proteins" or "pharmaceutical proteins" include an amino acid
sequence which in whole or in part makes up a drug.
A "coding sequence" or "open reading frame" refers to a polynucleotide or
nucleic acid sequence which can be transcribed and translated (in the case of
DNA) or
translated (in the case of mRNA) into a polypeptide in vitro or in vivo when
placed
under the control of appropriate regulatory sequences. The boundaries of the
coding
sequence are determined by a translation start codon at the 5' (amino)
terminus and a
translation stop codon at the 3' (carboxy) terminus. A transcription
termination
sequence will usually be located 3' to the coding sequence. A coding sequence
may be
flanked on the 5' and/or 3' ends by untranslated regions.
"Exon" refers to that part of a gene which, when transcribed into a nuclear
transcript, is "expressed" in the cytoplasmic mRNA after removal of the
introns or
intervening sequences by nuclear splicing.
Nucleic acid "control sequences" or "regulatory sequences" refer to promoter
sequences, translational start and stop codons, ribosome binding sites,
polyadenylation
signals, transcription termination sequences, upstream regulatory domains,
enhancers,
and the like, as necessary and sufficient for the transcription and
translation of a given
coding sequence in a defined host cell. Examples of control sequences suitable
for
eukaryotic cells are promoters, polyadenylation signals, and enhancers. All of
these
control sequences need not be present in a recombinant vector so long as those
necessary and sufficient for the transcription and translation of the desired
gene are
present.
36
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
"Operably or operatively linked" refers to the configuration of the coding and
control sequences so as to perform the desired function. Thus, control
sequences
operably linked to a coding sequence are capable of effecting the expression
of the
coding sequence. A coding sequence is operably linked to or under the control
of
transcriptional regulatory regions in a cell when DNA polymerase will bind the
promoter sequence and transcribe the coding sequence into mRNA that can be
translated into the encoded protein. The control sequences need not be
contiguous with
the coding sequence, so long as they function to direct the expression
thereof. Thus,
for example, intervening untranslated yet transcribed sequences can be present
between
a promoter sequence and the coding sequence and the promoter sequence can
still be
considered "operably linked" to the coding sequence.
The terms "heterologous" and "exogenous" as they relate to nucleic acid
sequences such as coding sequences and control sequences, denote sequences
that are
not normally associated with a region of a recombinant construct or with a
particular
chromosomal locus, and/or are not normally associated with a particular cell.
Thus, an
"exogenous" region of a nucleic acid construct is an identifiable segment of
nucleic
acid within or attached to another nucleic acid molecule that is not found in
association
with the other molecule in nature. For example, an exogenous region of a
construct
could include a coding sequence flanked by sequences not found in association
with
the coding sequence in nature_ Another example of an exogenous coding sequence
is a
construct where the coding sequence itself is not found in nature (e.g.,
synthetic
sequences having codons different from the native gene). Similarly, a host
cell
transformed with a construct or nucleic acid which is not normally present in
the host
cell would be considered exogenous for purposes of this invention.
As used herein the terms "oligosaccharide", "oligosaccharide structure",
"glycosylation pattern" and "glycosylation structure" have essentially the
same
meaning and each refer to one or more structures which are formed from sugar
residues
and are attached to glycosylated proteins.
"Exogenous protein" as used herein refers to a protein not naturally present
in a
particular tissue or cell, a protein that is the expression product of an
exogenous
expression construct or transgene, or a protein not naturally present in a
given quantity
37
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
in a particular tissue or cell. A protein that is exogenous to an egg is a
protein that is
not normally found in the egg. For example, a protein exogenous to an egg may
be a
protein that is present in the egg as a result of the expression of a coding
sequence
present in a transgene of the animal laying the egg.
"Endogenous gene" refers to a naturally occurring gene or fragment thereof
normally associated with a particular cell.
"EPO" means "erythropoietin" and the two terms are used interchangeably
throughout the specification.
The expression products described herein may consist of proteinaceous material
having a defined chemical structure. However, the precise structure depends on
a
number of factors, particularly chemical modifications common to proteins. For
example, since all proteins contain ionizable amino and carboxyl groups, the
protein
may be obtained in acidic or basic salt form, or in neutral form. The primary
amino
acid sequence may be derivatized using sugar molecules (glycosylation) or by
other
chemical derivatizations involving covalent or ionic attachment with, for
example,
lipids, phosphate, acetyl groups and the like, often occurring through
association with
saccharides. These modifications may occur in vitro or in vivo, the latter
being
performed by a host cell through post-translational processing systems. Such
modifications may increase or decrease the biological activity of the
molecule, and
such chemically modified molecules are also intended to come within the scope
of the
invention.
Alternative methods of cloning, amplification, expression, and purification
will
be apparent to the skilled artisan. Representative methods are disclosed in
Sambrook,
Fritsch, and Maniatis, Molecular Cloning, a Laboratory Manual, 2nd Ed., Cold
Spring
Harbor Laboratory (1989).
"Vector" means a polynucleotide comprised of single strand, double strand,
circular, or supercoiled DNA or RNA. A typical vector may be comprised of the
following elements operatively linked at appropriate distances for allowing
functional
gene expression: replication origin, promoter, enhancer, 5' mRNA leader
sequence,
ribosomal binding site, nucleic acid cassette, termination and polyadenylation
sites, and
selectable marker sequences. One or more of these elements may be omitted in
38
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
specific applications. The nucleic acid cassette can include a restriction
site for
insertion of the nucleic acid sequence to be expressed. In a functional vector
the
nucleic acid cassette contains the nucleic acid sequence to be expressed
including
translation initiation and termination sites. An intron optionally may be
included in the
construct, for example, 5' to the coding sequence. A vector is constructed so
that the
particular coding sequence is located in the vector with the appropriate
regulatory
sequences, the positioning and orientation of the coding sequence with respect
to the
control sequences being such that the coding sequence is transcribed under the
"control" of the control or regulatory sequences. Modification of the
sequences
encoding the particular protein of interest may be desirable to achieve this
end. For
example, in some cases it may be necessary to modify the sequence so that it
may be
attached to the control sequences with the appropriate orientation; or to
maintain the
reading*frarne. The control sequences and other regulatory sequences may be
ligated to
the coding sequence prior to insertion into a vector. Alternatively, the
coding sequence
can be cloned directly into an expression vector which already contains the
control
sequences and an appropriate restriction site which is in reading frame with
and under
regulatory control of the control sequences.
A "promoter" is a site on the DNA to which RNA polymerase binds to initiate
transcription of a gene. In some embodiments the promoter will be modified by
the
addition or deletion of sequences, or replaced with alternative sequences,
including
natural and synthetic sequences as well as sequences which may be a
combination of
synthetic and natural sequences. Many eukaryotic promoters contain two types
of
recognition sequences: the TATA box and the upstream promoter elements. The
former, located upstream of the transcription initiation site, is involved in
directing
RNA polymerase to initiate transcription at the correct site, while the latter
appears to
determine the rate of transcription and is upstream of the TATA box. Enhancer
elements can also stimulate transcription from linked promoters, but many
function
exclusively in a particular cell type. Many enhancer/promoter elements derived
from
viruses, e.g., the SV40 promoter, the cytomegalovirus (CMV) promoter, the rous-
sarcoma virus (RSV) promoter, and the murine leukemia virus (MLV) promoter are
all
active in a wide array of cell types, and are termed "ubiquitous".
Alternatively, non-
39
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
constitutive promoters such as the mouse mammary tumor virus (MMTV) promoter
may also be used in the present invention. The nucleic acid sequence inserted
in the
cloning site may have any open reading frame encoding a polypeptide of
interest, with
the proviso that where the coding sequence encodes a polypeptide of interest,
it should
lack cryptic splice sites which can block production of appropriate mRNA
molecules
and/or produce aberrantly spliced or abnormal mRNA molecules.
The term "poultry derived" refers to a composition or substance produced by or
obtained from poultry. "Poultry" refers to birds that can be kept as
livestock, including
but not limited to, chickens, duck, turkey, quail and ratites. For example,
"poultry
derived" may refer to chicken derived, turkey derived and/or quail derived.
A "marker gene" is a gene which encodes a protein that allows for
identification
and isolation of correctly transfected cells. Suitable marker sequences
include, but are
not limited to green, yellow, and blue fluorescent protein genes (GFP, YFP,
and BFP,
respectively). Other suitable markers include thymidine kinase (tk),
dihydrofolate
reductase (DHFR), and aminoglycoside phosphotransferase (APH) genes. The
latter
imparts resistance to the aminoglycoside antibiotics, such as kanamycin,
neomycin,
and geneticin. These, and other marker genes such as those encoding
chloramphenicol
acetyltransferase (CAT), (3-lactamase, 0-galactosidase (0-gal), may be
incorporated into
the primary nucleic acid cassette along with the gene expressing the desired
protein, or
the selection markers may be contained on separate vectors and cotransfected.
A "reporter gene" is a marker gene that "reports" its activity in a cell by
the
presence of the protein that it encodes.
A "retroviral particle", "transducing particle", or "transduction particle"
refers
to a replication-defective or replication-competent virus capable of
transducing non-
viral DNA or RNA into a cell.
The terms "transformation", "transduction" and "transfection" all denote the
introduction of a polynucleotide into an avian blastodermal cell. "Magnum" is
that part
of the oviduct between the infundibulum and the isthmus containing tubular
gland cells
that synthesize and secrete the egg white proteins of the egg.
A "MDOT promoter", as used herein, is a synthetic promoter which is active in
the tubular gland cells of the magnum of the oviduct amongst other tissues.
MDOT is
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
comprised of elements from the ovomucoid (MD) and ovotransferrin (TO)
promoters
(FIG. 13):
The term "optimized" is used in the context of "optimized coding sequence",
wherein the most frequently used codons for each particular amino acid found
in the
egg white proteins ovalbumin, lysozyme, ovomucoid, and ovotransferrin are used
in
the design of the optimized human interferon-a 2b (IFN-a 2b) polynucleotide
sequence
that is inserted into vectors of the present invention. More specifically, the
DNA
sequence for optimized human IFN-ct 2b is based on the hen oviduct optimized
codon
usage and is created using the BACKTRANSLATE program of the Wisconsin
Package, Version 9.1 (Genetics Computer Group Inc., Madison, Wis.) with a
codon
usage table compiled from the chicken (Gallus gallus) ovalbumin, lysozyme,
ovomucoid, and ovotransferrin proteins. For example, the percent usage for the
four
codons of the amino acid alanine in the four egg white proteins is 34% for
GCU, 31 10
for GCC, 26% for GCA, and 8% for GCG. Therefore, GCU is used as the codon for
the majority of alanines in the optimized human IFN-a 2b coding sequence. The
vectors containing the gene for optimized human IFN-a 2b are used to produce
transgenic .avians that express transgenic poultry derived IFN-a 2b (TPD IFN-a
2b) in
their tissues and eggs. Similarly, the above method is employed for the design
of other
coding sequences proteins such as human erythropoietin (EPO) or other proteins
which
may be produced in accordance with the invention.
By the methods of the present invention, transgenes can be introduced into
avian embryonic blastodermal cells to produce a transgenic chicken, transgenic
turkey,
transgenic quail and other avian species, that carry the transgene in the
genetic material
of its germ-line tissue. The blastodermal cells are typically stage VII-XII
cells, or the
equivalent thereof, and in one embodiment are near stage X. The cells useful
in the
present invention include embryonic germ (EG) cells, embryonic stem (ES) cells
&
primordial germ cells (PGCs). The embryonic blastodermal cells may be isolated
freshly, maintained in culture, or reside within an embryo.
The vectors useful in carrying out the methods of the present invention are
described herein. These vectors may be used for stable introduction of an
exogenous
coding sequence into the genome of an avian. Alternatively, the vectors may be
used
41
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
to produce exogenous proteins in specific tissues of an avian, for example, in
the
oviduct tissue of an avian. The vectors may also be used in methods to produce
avian
eggs which contain exogenous protein. In one embodiment, the coding sequence
and
the promoter are both positioned between 5' and 3' LTRs before introduction
into
blastodermal cells. In one embodiment, the vector is retroviral and the coding
sequence and the promoter are both positioned between the 5' and 3' LTRs of
the
retroviral vector. In one useful embodiment, the LTRs or retroviral vector is
derived
from the avian leukosis virus (ALV), murine leukemia virus (MLV), or
lentivirus.
In one embodiment, the vector includes a signal peptide coding sequence which
is operably linked to the coding sequence, so that upon translation in a cell,
the signal
peptide will direct secretion of the exogenous protein expressed by the vector
into the
egg white of a hard shell egg. The vector may include a marker gene, wherein
the
marker gene is operably linked to a promoter.
In some cases, introduction of a vector of the present invention into the
embryonic blastodermal cells is performed with embryonic blastodermal cells
that are
either freshly isolated or in culture. The transgenic cells are then typically
injected into
the subgerminal cavity beneath a recipient blastoderm in an egg. In some
cases,
however, the vector is delivered directly to the cells of a blastodermal
embryo.
In one embodiment of the invention, vectors used for transfecting blastodermal
cells and generating stable integration into the avian genome contain a coding
sequence
and a promoter in operational and positional relationship to express the
coding
sequence in the tubular gland cell of the magnum of the avian oviduct, wherein
the
coding sequence codes for an exogenous protein which is deposited in the egg
white of
a hard shell egg. The promoter may optionally be a segment of the ovalbumin
promoter region which is sufficiently large to direct expression of the coding
sequence
in the tubular gland cells. The invention involves truncating the ovalbumin
promoter
and/or condensing the critical regulatory elements of the ovalbumin promoter
so that it
retains sequences required for expression in the tubular gland cells of the
magnum of
the oviduct, while being small enough that it can be readily incorporated into
vectors.
In one embodiment, a segment of the ovalbumin promoter region may be used.
This
segment comprises the 5'-flanking region of the ovalbumin gene. The total
length of
42
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
the ovalbumin promoter segment may be from about 0.88 kb to about 7.4 kb in
length,
and is preferably from about 0.88 kb to about 1.4 kb in length. The segment
preferably
includes both the steroid-dependent regulatory element and the negative
regulatory
element of the ovalbumin gene. The segment optionally also includes residues
from
the 5' untranslated region (5' UTR) of the ovalbumin gene. Hence, the promoter
may
be derived from the promoter regions of the ovalbumin-, lysozyme-, conalbumin-
,
ovomucoid-, ovotransferrin- or ovomucin genes (FIG. 14). An example of such a
promoter is the synthetic MDOT promoter which is comprised of elements from
the
ovomucoid and ovotransferrin promoter (FIG. 13). The promoter may also be a
promoter that is largely, but not entirely, specific to the magnum, such as
the lysozyme
promoter. The promoter may also be a mouse mammary tumor virus (MMTV)
promoter. Alternatively, the promoter may be a constitutive promoter (e.g., a
cytomegalovirus (CMV) promoter, a rous-sarcoma virus (RSV) promoter, a murine
leukemia virus (MLV) promoter, etc.). In a preferred embodiment of the
invention, the
promoter is a cytomegalovirus (CMV) promoter, a MDOT promoter, a rous-sarcoma
virus (RSV) promoter, a murine leukemia virus (MLV) promoter, a mouse mammary
tumor virus (MMTV) promoter, an ovalbumin promoter, a lysozyme promoter, a
conalbumin promoter, an ovomucoid promoter, an ovomucin promoter, and an
ovotransferrin promoter. Optionally, the promoter may be at least one segment
of a
promoter region, such as a segment of the ovalbumin-, lysozyme-, conalbumin-,
ovomucoid-, ovomucin-, and ovotransferrin promoter region. In one embodiment,
the
promoter is a CMV promoter.
FIGS. IA and 1B illustrate examples of ovalbumin promoter expression
vectors. Gene X is a coding sequence which encodes an exogenous protein. Bent
arrows indicate the transcriptional start sites. In one example, the vector
contains 1.4
kb of the 5' flanking region of the ovalbumin gene (FIG. IA). The sequence of
the "-
1.4 kb promoter" of FIG. lA corresponds to the sequence starting from
approximately
1.4 kb upstream (1.4 kb) of the ovalbumin transcription start site and
extending
approximately 9 residues into the 5' untranslated region of the ovalbumin
gene. The
approximately 1.4 kb-long segment harbors two critical regulatory elements,
the
steroid-dependent regulatory element (SDRE) and the negative regulatory
element
43
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
(NRE). The NRE is so named because it contains several negative regulatory
elements
which block the gene's expression in the absence of hormones (e.g., estrogen).
A
shorter 0.88 kb segment also contains both elements. In another example, the
vector
contains approximately 7.4 kb of the 5' flanking region of the ovalbumin gene
and
harbors two additional elements (HS-III and HS-IV), one of which is known to
contain
a functional region enabling induction of the gene by estrogen (FIG. IB). A
shorter 6
kb segment also contains all four elements and could optionally be used in the
present
invention.
Each vector used for random integration according to the present invention
preferably comprises at least one 1.2 kb element from the chicken (3-globin
locus which
insulates the gene within from both activation and inactivation at the site of
insertion
into the genome. In one embodiment, two insulator elements are added to one
end of
the ovalbumin gene construct. In the 0-globin locus, the insulator elements
serve to
prevent the distal locus control region (LCR) from activating genes upstream
from the
globin gene domain, and have been shown to overcome position effects in
transgenic
flies, indicating that they can protect against both positive and negative
effects at the
insertion site. The insulator element(s) are only needed at either the 5' or
3' end of the
gene because the transgenes are integrated in multiple, tandem copies
effectively
creating a series of genes flanked by the insulator of the neighboring
transgene. In
another embodiment, the insulator element is not linked to the vector but is
cotransfected with the vector. In this case, the vector and the element are
joined in
tandem in the cell by the process of random integration into the genome.
Each vector may optionally also comprise a marker gene to allow identification
and enrichment of cell clones which have stably integrated the expression
vector. The
expression of the marker gene is driven by a ubiquitous promoter that drives
high
levels of expression in a variety*of cell types. In one embodiment of the
invention, the
marker gene is human interferon driven by a lysozyme promoter. In another
embodiment the green fluorescent protein (GFP) reporter gene (Zolotukhin et
al., J.
Virol 70:4646-4654 (1995)) is driven by the Xenopus elongation factor 1-a (ef-
1-a)
promoter (Johnson and Krieg, Gene 147:223-26 (1994)). The Xenopus ef-1-a
promoter
is a strong promoter expressed in a variety of cell types. The GFP contains
mutations
44
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
that enhance its fluorescence and is humanized, or modified such that the
codons match
the codon usage profile of human genes. Since avian codon usage is virtually
the same
as human codon usage, the humanized form of the gene is also highly expressed
in
avian blastodermal cells. In alternative embodiments, the marker gene is
operably
linked to one of the ubiquitous promoters of HSV tk, CMV, 0-actin, or RSV.
While human and avian codon usage is well matched, where a nonvertebrate
gene is used as the coding sequence in the transgene, the nonvertebrate gene
sequence
may be modified to change the appropriate codons such that codon usage is
similar to
that of humans and avians.
Transfection of the blastodermal cells may be mediated by any number of
methods known to those of ordinary skill in the art. The introduction of the
vector to
the cell may be aided by first mixing the nucleic acid with polylysine or
cationic lipids
which help facilitate passage across the cell membrane. However, introduction
of the
vector into a cell is preferably achieved through the use of a delivery
vehicle such as a
liposome or a virus. Viruses which may be used to introduce the vectors of the
present
invention into a blastodermal cell include, but are not limited to,
retroviruses,
adenoviruses, adeno-associated viruses, herpes simplex viruses, and vaccinia
viruses.
In one method of transfecting blastodermal cells, a packaged retroviral-based
vector is used to deliver the vector into embryonic blastodermal cells so that
the vector
is integrated into the avian genome.
As an alternative to delivering retroviral transduction particles to the
embryonic
blastodermal cells in an embryo, helper cells which produce the retrovirus can
be
delivered to the blastoderm.
Useful retrovirus for randomly introducing a transgene into the avian genome
is
the replication-deficient avian leucosis virus (ALV), the replication-
deficient murine
leukemia virus (MLV), or the lentivirus. In order to produce an appropriate
retroviral
vector, a pNLB vector is modified by inserting a region of the ovalbumin
promoter and
one or more exogenous genes between the 5' and 3' long terminal repeats (LTRs)
of the
retrovirus genome. The invention contemplates that any coding sequence placed
downstream of a promoter that is active in tubular gland cells will be
expressed in the
tubular gland cells. For example, the ovalbumin promoter will be expressed in
the
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
tubular gland cells of the oviduct magnum because the ovalbumin promoter
drives the
expression of the ovalbumin protein and is active in the oviduct tubular gland
cells.
While a 7.4 kb ovalbumin promoter has been found to produce the most active
construct when assayed in cultured oviduct tubular gland cells, the ovalbumin
promoter
is preferably shortened for use in the retroviral vector. In one embodiment,
the
retroviral vector comprises a 1.4 kb segment of the ovalbumin promoter; a.
0.88 kb
segment would also suffice.
Any of the vectors of the present invention may also optionally include a
coding sequence encoding a signal peptide that will direct secretion of the
protein
expressed by the vector's coding sequence from the tubular gland cells of the
oviduct.
This aspect of the invention effectively broadens the spectrum of exogenous
proteins
that may be deposited in avian eggs using the methods of the invention. Where
an
exogenous protein would not otherwise be secreted, the vector containing the
coding
sequence is modified to comprise a DNA sequence comprising about 60 bp
encoding a
signal peptide from the lysozyme gene. The DNA sequence encoding the signal
peptide is inserted in the vector such that it is located at the N-terminus of
the protein
encoded by the DNA.
FIGS. 2A-2D illustrate examples of suitable retroviral vector constructs. The
vector construct is inserted into the avian genome with 5' and 3' flanking
LTRs. Neo is
the neomycin phosphotransferase gene. Bent arrows indicate transcription start
sites.
FIGS. 2A and 2B illustrate LTR and oviduct transcripts with a sequence
encoding the
lysozyme signal peptide (LSP), whereas FIGS. 2C and 2D illustrate transcripts
without
such a sequence. There are two parts to the retroviral vector strategy. Any
protein that
contains a eukaryotic signal peptide may be cloned into the vectors depicted
in FIGS.
2B and 2D. Any protein that is not ordinarily secreted may be cloned into the
vectors
illustrated in FIGS. 2A and 2B to allow for its secretion from the tubular
gland cells.
FIG. 2E illustrates the strategy for cloning an exogenous gene into a lysozyme
signal peptide vector. The polymerase chain reaction is used to amplify a copy
of a
coding sequence, gene X, using a pair of oligonucleotide primers containing
restriction
enzyme sites that enable the insertion of the amplified gene into the plasmid
after
46
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
digestion with the two enzymes. The 5' and 3' oligonucleotides contain the
Bsu361 and
Xbal restriction sites, respectively.
Another aspect of the invention involves the use of internal ribosome entry
site
(IRES) elemerits in any of the vectors of the present invention to allow the
translation
of two or more proteins from a dicistronic or polycistronic mRNA (Example 15).
The
IRES units are fused to 5' ends of one or more additional coding sequences
which are
then inserted into the vectors at the end of the original coding sequence, so
that the
coding sequences are separated from one another by an IRES (FIGS. 2F, 15A and
15D). Pursuant to this aspect of the invention, post-translational
modification of the
product is facilitated because one coding sequence may encode an enzyme
capable of
modifying the other coding sequence product. For example, the first coding
sequence
may encode collagen which would be hydroxylated and made active by the enzyme
encoded by the second coding sequence. In the retroviral vector example of
FIG. 2F, an
internal ribosome entry site (IRES) element is positioned between two
exogenous
coding sequences (gene X and gene Y). The IRES allows both protein X and
protein Y
to be translated from the same transcript the transcription of which is
directed by a
promoter such as the ovalbumin promoter. Bent arrows indicate transcription
start
sites. The expression of the protein encoded by gene X is expected to be
highest in
tubular gland cells, where it is specifically expressed but not secreted. The
protein
encoded by gene Y is also expressed specifically in tubular gland cells but
because it is
efficiently secreted, protein Y is packaged into the eggs. In the retroviral
vector
example of FIGS. 15A and 15D, the light chain (LC) and heavy chain (HC) of a
human
monoclonal antibody are expressed from a single vector, pCMV-LC-emcvlRES-HC,
by placement of an IRES from the encephalomyocarditis virus (EMCV).
Transcription
is driven by a CMV promoter. (See also Murakami et al. (1997) "High-level
expression
of exogenous genes by repiication-competent retrovirus vectors with an
internal
ribosomal entry site" Gene 202:23-29; Chen et al. (1999) "Production and
design of
more effective avian replication-incompetent retroviral vectors" Dev. Biol.
214:370-
384; Noel et al. (2000) "Sustained systemic delivery of monoclonal antibodies
by
genetically modified skin fibroblasts" J. Invest. Dermatol. 115:740-745).
47
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
In another aspect of the invention, the coding sequences of vectors used in
any
of the methods of the present invention are provided with a 3' untranslated
region (3'
UTR) to confer stability to the RNA produced. When a 3' UTR is added to a
retroviral
vector, the orientation of the promoter, gene X and the 3' UTR must be
reversed in the
construct, so that the addition of the 3' UTR will not interfere with
transcription of the
full-length genomic RNA. In one embodiment, the 3' UTR may be that of the
ovalbumin or lysozyme genes, or any 3' UTR that is functional in a magnum
cell, i.e.,
the SV40 late iregion.
In an alternative embodiment of the invention, a constitutive promoter (e.g.,
CMV) is used to express the coding sequence of a transgene in the magnum of an
avian. In this case, expression is not limited to the magnum; expression also
occurs in
other tissues within the avian (e.g., blood). The use of such a transgene,
which
includes a constitutive promoter and a coding sequence, is particularly
suitable for
effecting or driving the expression of a protein in the oviduct and the
subsequent
secretion of the protein into the egg white (see FIG. 8A for an example of a
CMV
driven construct, such as the pNLB-CMV-IFN vector for expressing IFN-a 2b in
chickens).
FIG. 3A shows a schematic of the replication-deficient avian leukosis virus
(ALV)-based vector pNLB, a vector which is suitable for use in the invention.
In the
pNLB vector, most of the ALV genome is replaced by the neomycin resistance
gene
(Neo) and the lacZ gene, which encodes b-galactosidase. FIG. 3B shows the
vector
pNLB-CMV-BL, in which lacZ has been replaced by the CMV promoter and the P-
lactamase coding sequence (P-La or BL). Construction of the vector is reported
in the
specific examples (Example 1, vide infra). P-lactamase is expressed from the
CMV
promoter and utilizes a polyadenylation signal (pA) in the 3' long terminal
repeat
(LTR). The (3-Lactamase protein has a natural signal peptide; thus, it is
found in blood
and in egg white.
Avian embryos are transduced with the pNLB-CMV-BL vector (Example 2,
vide infra). The egg whites of eggs from the resulting stably transduced hens
contain
up to 60 micrograms ( g) of secreted, active (3-lactamase per egg (Examples 2
and 3,
vide infra).
48
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
FIGS. 8A and 8B illustrates the pNLB-CMV-IFN vector used for expressing
interferon-a 2b (IFN-a 2b) and the pNLB-MDOT-EPO vector used for expressing
erythropoietin (EPO), respectively. Both exogenous proteins (EPO, IFN) are
expressed
in avians, preferably chicken and turkey.
The pNLB-MDOT-EPO vector is created by substituting an EPO encoding
sequence for the BL encoding sequence (Example 10, vide infra). In one
embodiment,
a synthetic promoter called MDOT is employed to drive expression of EPO. MDOT
contains elements from both the ovomucoid and ovotransferrin promoter. The DNA
sequence for human EPO is based on hen oviduct optimized codon usage as
created
using the BACKTRANSLATE program of the Wisconsin Package, version 9.1
(Genetics Computer Group, Inc., Madison, Wis.) with a codon usage table
compiled
from the chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid, and
ovotransferrin
proteins. The EPO DNA sequence is synthesized and cloned into the vector and
the
resulting plasmid is pNLB-MDOT-EPO (a.k.a. pAVIJCR-A145.27.2.2). In one
embodiment, transducing particles (i.e., transduction particles) are produced
for the
vector, and these transducing particles are titered to determine the
appropriate
concentration that can be used to inject embryos. Eggs are then injected with
transducing particles after which they hatch about 21 days later.
The exogenous protein levels such as the EPO levels can then be measured by
an ELISA assay from serum samples collected from chicks one week after hatch.
Male
birds are selected for breeding, wherein birds are screened for GO roosters
which
contain the EPO transgene in their sperm. Preferably, roosters with the
highest levels
of the transgene in their sperm samples are bred to nontransgenic hens by
artificial
insemination. Blood DNA samples are screened for the presence of the
transgene. A
number of chicks are usually found to be transgenic (GI avians). Chick serum
is
tested for the presence of human EPO (e.g., ELISA assay). The egg white in
eggs
from G1 hens is also tested for the presence of human EPO. The EPO (i.e.,
derived
from the optimized coding sequence of human EPO) present in eggs of the
present
invention is biologically active (Example 11).
Similarly, the pNLB-CMV-IFN vector (FIG. 8A) is created by substituting an
IFN encoding sequence for the BL encoding sequence (Example 12, vide infra).
In one
49
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
embodiment, a constitutive cytomegalovirus (CMV) promoter is employed to drive
expression of IFN. More specifically, the IFN coding sequence is controlled by
the
cytomegalovirus (CMV) immediate early promoter/enhancer and SV40 polyA site.
FIG. 8A illustrates pNLB-CMV-IFN used for expressing IFN in avians, for
example,
chicken and turkey. An optimized coding sequence is created for human IFN-a
2b,
wherein the most frequently used codons for each particular amino acid found
in the
egg white proteins ovalbumin, lysozyme, ovomucoid, and ovotransferrin are used
in
the design of the human IFN-a 2b sequence that is inserted into vectors of the
present
invention. More specifically, the DNA sequence for the optimized human IFN-a
2b
(FIG. I 1 A) is based on the hen oviduct optimized codon usage and is created
using the
BACKTRANSLATE program (supra) with a codon usage table compiled from the
chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid, and ovotransferrin
proteins.
For example, the percent usage for the four codons of the amino acid alanine
in the
four egg white proteins is 34% for GCU, 31% for GCC, 26% for GCA, and 8% for
GCG. Therefore, GCU is used as the codon for the majority of alanines in the
optimized human IFN-a 2b sequence. The vectors containing the gene for the
optimized human IFN-a 2b sequence are used to create transgenic avians that
express
TPD IFN-a 2b in their tissues and eggs.
Transducing particles (i.e., transduction particles) are produced for the
vector
and titered to determine the appropriate concentration that can be used to
inject
embryos (Example 2, vide infra). Thus, chimeric avians are produced (see also
Example 13, vide infra). Avian eggs are windowed according to the Speksnijder
procedure (U.S. Pat. No. 5,897,998), and eggs are injected with transducing
particles
Eggs hatch about 21 days after injection. hIFN levels are measured (e.g.,
ELISA
assay) from serum samples collected from chicks one week after hatch. As with
EPO
(supra), male birds are selected for breeding. In order to screen for GO
roosters which
contain the IFN transgene in their sperm, DNA is extracted from rooster sperm
samples. The GO roosters with the highest levels of the transgene in their
sperm
samples are bred to nontransgenic hens by artificial insemination. Blood DNA
samples
are screened for the presence of the transgene. The serum of transgenic
roosters is
tested for the presence of hIFN (e.g., ELISA assay). If the exogenous protein
is
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
confirmed the sperm of the transgenic roosters is used for artificial
insemination of
nontransgenic hens. A certain percent of the offspring will then contain the
transgene
(e.g., more than 50%). When IFN (i.e., derived from the optimized coding
sequence of
human IFN) is present in eggs of the present invention, the IFN may be tested
for
biological activity. As with EPO, such eggs usually contain biologically
active IFN,
such as TPD IFN-a 2b (FIG. I IB).
The methods of the invention which provide for the production of exogenous
protein in the avian oviduct and the production of eggs which contain
exogenous
protein involve an additional step subsequent to providing a suitable vector
and
introducing the vector into embryonic blastodermal cells so that the vector is
integrated
into the avian genome. The subsequent step involves deriving a mature
transgenic
avian from the transgenic blastodermal cells produced in the previous steps.
Deriving
a mature transgenic avian from the blastodermal cells optionally involves
transferring
the transgenic blastodermal cells to an embryo and allowing that embryo to
develop
fully, so that the cells become incorporated into the avian as the embryo is
allowed to
develop. The resulting chick is then grown to maturity. In one embodiment, the
cells
of a blastodermal embryo are transfected or transduced with the vector
directly within
the embryo (Example 2). The resulting embryo is allowed to develop and the
chick
allowed to mature.
In either case, the transgenic avian so produced from the transgenic
blastodermal cells is known as a founder. Some founders will carry the
transgene in
the tubular gland cells in the magnum of their oviducts. These avians will
express the
exogenous protein encoded by the transgene in their oviducts. The exogenous
protein
may also be expressed in other tissues (e.g., blood) in addition to the
oviduct. If the
exogenous protein contains the appropriate signal sequence(s), it will be
secreted into
the lumen of the oviduct and into the egg white of the egg. Some founders are
germ-
line founders (Examples 8 and 9). A germ-line founder is a founder that
carries the
transgene in genetic material of its germ-line tissue, and may also carry the
transgene
in oviduct magnum tubular gland cells that express the exogenous protein.
Therefore,
in accordance with the invention, the transgenic avian will have tubular gland
cells
expressing the exogenous protein, and the offspring of the transgenic avian
will also
51
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
have oviduct magnum tubular gland cells that express the exogenous protein.
Alternatively, the offspring express a phenotype determined by expression of
the
exogenous gene in specific tissue(s) of the avian (Example 6, Table 2). In one
embodiment of the invention, the transgenic avian is a chicken or a turkey.
The invention can be used to express, in large yields and at low cost, desired
proteins including those used as human and animal pharmaceuticals,
diagnostics, and
livestock feed additives. For example, the invention includes transgenic
avians that
produce such proteins and eggs laid by the transgenic avians which contain the
protein,
for example, in the egg white. The present invention is contemplated for use
in the
production of any desired protein including pharmaceutical proteins with the
requisite
that the coding sequence of the protein can be introduced into an oviduct cell
in
accordance with the present invention. In fact, all proteins tested thus far
for
heterologous production in accordance with the present invention, including
interferon
a 2b, GM-CSF, interferon (3, erythropoietin, G-CSF, CTLA4-Fc fusion protein
and (3-
lactamase, have been produced successfully employing the methods disclosed
herein.
The production of human proteins as disclosed herein is of particular
interest.
The human form of each of the proteins disclosed herein for which there is a
human
form, is contemplated for production in accordance with the invention.
Proteins contemplated for production as disclosed herein include, but are not
limited to, fusion proteins, growth hormones, cytokines, structural proteins
and
enzymes including human growth hormone, interferon, lysozyme, and (3-casein,
albumin, a-1 antitrypsin, antithrombin III, coliagen, factors VIII, IX, X (and
the like),
fibrinogen, insulin, lactoferrin, protein C, erythropoietin (EPO), granulocyte
colony-
stimulating factor (G-CSF), granulocyte macrophage colony-stimulating factor
(GM-
CSF), tissue-type plasminogen activator (tPA), somatotropin, and chymotrypsin.
Modified immunoglobulins and antibodies, including immunotoxins which bind to
surface antigens on human tumor cells and destroy them, can also be produced
as
disclosed herein.
Other specific examples of therapeutic proteins which may be produced as
disclosed herein include, without limitation, factor VIII, b-domain deleted
factor VIII,
factor VIIa, factor IX, anticoagulants; hirudin, alteplase, tpa, reteplase,
tpa, tpa - 3 of
52
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
domains deleted, insulin, insulin lispro, insulin aspart, insulin glargine,
long-acting
insulin analogs, hgh, glucagons, tsh, follitropin-beta, fsh, gm-csf, pdgh, ifn
alpha2, ifn
alpha2a, ifn alpha2b, inf-apha, inf-beta lb, ifn-beta la, ifn-gammalb, il-2,
il-i 1,
hbsag, ospa, murine mab directed against t-lymphocyte antigen, murine mab
directed
5 against tag-72, tumor-associated glycoprotein, fab fragments derived from
chimeric
mab directed against platelet surface receptor gpll(b)/III(a), murine mab
fragment
directed against tumor-associated antigen ca125, murine mab fragment directed
against
human carcinoembryonic antigen, cea, murine mab fragment directed against
human
cardiac myosin, murine mab fragment directed against tumor surface antigen
psma,
murine mab fragments (fab/fab2 mix) directed against hmw-maa, murine mab
fragment
(fab) directed against carcinoma-associated antigen, mab fragments (fab)
directed
against nca 90, a surface granulocyte nonspecific cross reacting antigen,
chimeric mab
directed against cd20 antigen found on surface of b lymphocytes, humanized mab
directed against the alpha chain of the i12 receptor, chimeric mab directed
against the
alpha chain of the il2 receptor, chimeric mab directed against tnf-alpha,
humanized
mab directed against an epitope on the surface of respiratory synctial virus,
humanized
mab directed against her 2, human epidermal growth factor receptor 2, human
mab
directed against cytokeratin tumor-associated antigen anti-ctla4, chimeric mab
directed
against cd 20 surface antigen of b lymphocytes dornase-alpha dnase, beta
glucocerebrosidase, tnf-alpha, il-2-diptheria toxin fusion protein, tnfr-lgg
fragment
fusion protein laronidase, dnaases, alefacept, darbepoetin alfa (colony
stimulating
factor), tositumomab, murine mab, alemtuzumab, rasburicase, agalsidase beta,
teriparatide, parathyroid hormone derivatives, adalimumab (Iggl), anakinra,
biological
modifier, nesiritide, human b-type natriuretic peptide (hbnp), colony
stimulating
factors, pegvisomant, human growth hormone receptor antagonist, recombinant
activated protein c, omalizumab, immunoglobulin e (Ige) blocker, lbritumomab
tiuxetan, ACTH, glucagon, somatostatin, somatotropin, thymosin, parathyroid
hormone, pigmentary hormones, somatomedin, erythropoietin, luteinizing
hormone,
chorionic gonadotropin, hypothalmic releasing factors, etanercept,
antidiuretic
hormones, prolactin and thyroid stimulating hormone.
53
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
The invention includes methods for producing multimeric proteins including
immunoglobulins, such as antibodies, and antigen binding fragments thereof.
Thus, in
one embodiment of the present invention, the multimeric protein is an
immunoglobulin, wherein the first and second heterologous polypeptides are
immunoglobulin heavy and light chains respectively.
In certain embodiments, an immunoglobulin polypeptide encoded by the
transcriptional unit of at least one expression vector may be an
immunoglobulin heavy
chain polypeptide comprising a variable region or a variant thereof, and may
further
comprise a D region, a J region, a C region, or a combination thereof. An
immunoglobulin polypeptide encoded by an expression vector may also be' an
immunoglobulin light chain polypeptide comprising a variable region or a
variant
thereof, and may further comprise a J region and a C region. The present
invention
also contemplates multiple immunoglobulin regions that are derived from the
same
animal species, or a mixture of species including, but not only, human, mouse,
rat,
rabbit and chicken. In certain embodiments, the antibodies are human or
humanized.
In other embodiments, the immunoglobulin polypeptide encoded by at least one
expression vector comprises an immunoglobulin heavy chain variable region, an
immunoglobulin light chain variable region, and a linker peptide thereby
forming a
single-chain antibody capable of selectively binding an antigen.
Examples of therapeutic antibodies that may be produced in methods of the
invention include, but are not limited, to HERCEPTINTM (Trastuzumab)
(Genentech,
CA) which is a humanized anti-HER2 monoclonal antibody for the treatment of
patients with metastatic breast cancer; REOPROTM (abciximab) (Centocor) which
is an
anti-glycoprotein lIb/IIIa receptor on the platelets for the prevention of
clot formation;
ZENAPAXTM (daclizumab) (Roche Pharmaceuticals, Switzerland) which is an
immunosuppressive, humanized anti-CD25 monoclonal antibody for the prevention
of
acute renal allograft rejection; PANOREXTM which is a murine anti-l7-IA cell
surface
antigen IgG2a antibody (Glaxo Wellcome/Centocor); BEC2 which is a murine anti-
idiotype (GD3 epitope) IgG antibody (imClone System); IMC-C225 which is a
chimeric anti-EGFR IgG antibody (ImCione System); VITAXINTM which is a
humanized anti-aV¾3 integrin antibody (Applied Molecular Evolution/Medlmmune);
54
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Campath; Campath 1H/LDP-03 which is a humanized anti CD52 IgGl antibody
(Leukosite); Smart M195 which is a humanized anti-CD33 IgG antibody (Protein
Design Lab/Kanebo); RITUXANTM which is a chimeric anti-CD2O IgGI antibody
(IDEC Pharm/Genentech, Roche/Zettyaku); LYMPHOCIDET"' which is a humanized
anti-CD22 IgG antibody (Immunomedics); ICM3 is a humanized anti-ICAM3 antibody
(ICOS Pharm); IDEC-114 is a primate anti-CD80 antibody (IDEC
Pharm/Mitsubishi);
ZEVALINT"' is a radiolabelled murine anti-CD20 antibody (IDEC/Schering AG);
IDEC-131 is a humanized anti-CD40L antibody (IDEC/Eisai); IDEC-151 is a
primatized anti-CD4 antibody (IDEC); IDEC-152 is a primatized anti-CD23
antibody
1.0 (IDEC/Seikagaku); SMART anti-CD3 is a humanized anti-CD3 IgG (Protein
Design
Lab); 5G1.1 is a humanized anti-complement factor 5 (CS).antibody (Alexion
Pharm);
D2E7 is a humanized anti-TNF-a antibody (CATIBASF); CDP870 is a humanized
anti-TNF-a Fab fragment (Celltech); IDEC-151 is a primatized anti-CD4 IgGI
antibody (IDEC Pharm/SmithKiine Beecham); MDX-CD4 is a human anti-CD4 IgG
antibody (Medarex/Eisai/Genmab); CDP571 is a humanized anti-TNF-a IgG4
antibody
(Celltech); LDP-02 is a humanized anti-a4p7 antibody (LeukoSite/Genentech);
OrthoClone OKT4A is a humanized anti-CD4 IgG antibody (Ortho Biotech);
ANTOVATM is a humanized anti-CD40L IgG antibody (Biogen); ANTEGRENTM is a
humanized anti-VLA-4 IgG antibody (Elan); CAT-152, a human anti-TGF-(32
antibody
(Cambridge Ab Tech); Cetuximab (BMS) is a monoclonal anti-EGF receptor (EGFr)
antibody; Bevacizuma (Genentech) is an anti-VEGF human monoclonal antibody;
Infliximab (Centocore, JJ) is a chimeric (mouse and human) monoclonal antibody
used
to treat autoimmune disorders; Gemtuzumab ozogamicin (Wyeth) is a monoclonal
antibody used for chemotherapy; and Ranibizumab (Genentech) is a chimeric
(mouse
and human) monoclonal antibody used to treat macular degeneration.
In one aspect, the invention is drawn to G-CSF produced in poultry or avains.
In one aspect, the invention is drawn to G-CSF with a poultry derived
glycosylation
pattern (TPD G-CSF) wherein the G-CSF is obtained from avian cells, for
example,
avian cells of a chicken, quail or turkey. Also included in the invention are
the human
proteins including cytokines such as G-CSF produced in poultry in isolated or
purified
form and human proteins including cytokines such as G-CSF produced in poultry
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
present in pharmaceutical compositions. The isolation of the proteins
including G-CSF
can be accomplished by methodologies readily apparent to a practitioner
skilled in the
art of protein purification. The make-up of formulations useful for producing
pharmaceutical compositions are also well known in the art.
The present invention encompasses transgenic poultry derived therapeutic or
pharmaceutical proteins having a poultry derived glycoslyation pattern which
are
derived from avians. For example, the invention includes interferon-a 2 (TPD
IFN-a
2) derived from avians. TPD IFN-a 2 (e.g., species type b) exhibits a new
glycosylation
pattern and contains new glyco forms (bands 4 and 5 are a -Gal extended
disaccharides; see FIG. 9) not normally seen in human peripheral blood
leukocyte
derived interferon-a 2 (PBL IFN-a 2b). TPD IFN-a 2b also contains 0-linked
carbohydrate structures that are similar to human PBL IFN-a 2b and is more
efficiently
produced in chickens than the human form.
The present invention contemplates an isolated polynucleotide comprising the
optimized polynucleotide sequence of proteins produced as disclosed herein.
For
example, the invention includes avian optimized coding sequence for human IFN-
a 2b,
i.e., recombinant transgenic poultry derived interferon-a 2b (TPD IFN-a 2b)
(SEQ ID
NO: 1). The coding sequence for optimized human IFN-a 2b includes 498 nucleic
acids and 165 amino acids (see SEQ ID NO: I and FIG. 11A). Similarly, the
coding
sequence for natural human IFN-a 2b includes 498 nucleotides (NCBI Accession
Number AF405539 and 0I:15487989) and 165 amino acids (NCBI Accession Number
AAL01040 and GI:15487990). The most frequently used codons for each particular
amino acid found in the egg white proteins ovalbumin, lysozyme, ovomucoid, and
ovotransferrin are used in the design of the optimized human IFN-a 2b coding
sequence which is inserted into vectors of the present invention. More
specifically,
the DNA sequence for the optimized human IFN-a 2b is based on the hen oviduct
optimized codon usage and is created using the BACKTRANSLATE program of the
Wisconsin Package, Version 9.1 (Genetics Computer Group Inc., Madison, Wis.)
with
a codon usage table compiled from the chicken (Gallus gallus) ovalbumin,
lysozyme,
ovomucoid, and ovotransferrin proteins. For example, the percent usage for the
four
codons of the amino acid alanine in the four egg white proteins is 34% for
GCU, 31 %
56
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
for GCC, 26% for GCA, and 8% for GCG. Therefore, GCU is used as the codon for
the
majority of alanines in the optimized human IFN-a 2b coding sequence. The
vectors
containing the gene for optimized human IFN-a 2b are used to create transgenic
avians
that express TPD IFN-a 2b in their tissues and eggs.
, As discussed in Example 13 (vide infra), TPD IFN-a 2b is produced in
chicken.
However, TPD IFN-a 2b may also be produced in turkey and other avian species
such
as quail. In a preferred embodiment of the invention, TPD IFN-a 2b is
expressed in
chicken and turkey and their hard shell eggs. A carbohydrate analysis (Example
14,
vide infra), including a monosaccharide analysis and FACE analysis, reveals
the sugar
make-up or novel glycosylation pattern of the protein. As such, TPD IFN-a 2b
shows
the following monosaccharide residues: N-Acetyl-Galactosamine (NAcGal),
Galactose
(Gal), N-Acetyl-Glucosamine (NAcGlu), and Sialic acid (SA). However, there is
no
N-linked glycosylation in TPD IFN-a 2b. Instead, TPD IFN-a 2b is 0-
glycosylated at
Thr-106. This type of glycosylation is similar to human IFN-a 2, wherein the
Thr
residue at position 106 is unique to IFN-a 2. Similar to natural IFN-a, TPD
IFN-a 2b
does not have mannose residues. A FACE analysis reveals 6 bands (FIG. 9) that
represent various sugar residues, wherein bands 1, 2 and 3 are un-sialylated,
mono-
sialylated, and di-sialylated, respectively (FIG. 10). The sialic acid (SA)
linkage is
alpha 2-3 to Galactose (Gal) and alpha 2-6 to N-Acetyl-Galactosamine (NAcGal).
Band 6 represents an un-sialylated tetrasaccharide. Bands 4 and 5 are alpha-
Galactose
(alpha-Gal) extended disaccharides that are not seen in human PBL IFN-a 2b or
natural
human IFN (natural hIFN). FIG. 10 shows the comparison of TPD IFN-a 2b (egg
white hIFN) and human PBL IFN-a 2b (natural hIFN). Minor bands are present
between bands 3 and 4 and between bands 4 and 5 in TPD IFN-a 2b (vide infra).
The present invention contemplates an isolated polypeptide sequence (SEQ ID
NO: 2) of TPD IFN-a 2b (see also FIG. I1B) and a pharmaceutical composition
thereof, wherein the protein is 0-glycosylated at Thr-106 with one or more of
the
carbohydrate structures disclosed herein as follows:
(i) Gal-NAcGaI-
(ii) SA-Gal-NAcGaI-
57
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
(iii) SA-Gal-NAcGaI-
1
SA
(iv) Gal-NAcGIu-NAcGaI-
Gal
(v) Gal-Gal-NAcGaI-
(vi) Gal-Gal-NAcGaI-
SA
wherein Gal=Galactose,
NAcGa1=N-Acetyl-Galactosamine,
NAcG1u=N-Acetyl-Glucosamine, and
SA=Sialic Acid.
In a one embodiment of the present invention, the percentages are as follows:
(i) Gal-NAcGaI- is about 20%
(ii) SA-Gal-NAcGaI- is about 29%
(iii) SA-Gal-NAcGaI- is about 9%
1
SA
(iv) Gal-NAcGIu NAcGaI- is about 6%
1
Gal
(v) Gal-Gal-NAcGaI- is about 7%
(vi) Gal-Gal NAcGaI- is about 12%
1
SA
58
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
wherein Gal=Galactose,
NAcGa 1=N-Acetyl-Galacto samine,
NAcG1u=N-Acetyl-Glucosamine, and
SA=Sialic Acid.
Minor bands are present between bands 3 and 4 and between bands 4 and 5
which account for about 17% in TPD IFN-a 2b.
In one embodiment, the invention is directed to human proteins having a
poultry derived glycosylation pattern. In one embodiment, the poultry derived
glycosylation pattem is obtained from avian oviduct cells, for example,
tubular gland
cells. For example, glycosylation patterns are disclosed herein which have
been
demonstrated to be present on human proteins produced in oviduct cells of a
chicken in
accordance with the present invention.
In one embodiment, the invention is directed to human G-CSF produced in
avians (e.g., avian oviduct cells) such as chickens, turkey and quail hav,ing
a poultry
derived glycosylation pattern. The mature hG-CSF amino acid sequence is shown
in
FIG 18 C. Nucleotide sequence used herein to produce G-CSF is shown in FIG 18
A
and in NCBI Accession NM 172219. Nucleotide sequences optimized for avian
(e.g.,
chicken) codon usage are also contemplated for use to produce G-CSF and other
proteins such as human proteins produced in accordance with the invention.
The invention includes the eggs and the avians (e.g., chicken, turkey and
quail)
that lay the eggs containing G-CSF molecules of the invention comprising one
or more
of the glycosylation structures shown below:
A B C
SA-Gal-NAcGaI-; Gal NAcGIu NAcGaI-; Gal-NAcGIu-NAcGal-;
I I
Gal Gal
1
SA
59
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
D E F
SA-Gal-NAcGIu-NAcGaI-; SA-Gal-NAcGIu-NAcGal-; Gal-NAcGaI-;
I I
Gal Gal
1
SA
G
SA-Gal-NAcGaI-
SA
wherein Gal=Galactose,
NAcGa1=N-Acetyl-Galactosamine,
NAcG1u=N-Acetyl-Glucosamine, and
SA=Sialic Acid.
In one embodiment, the invention includes a mixture of G-CSF molecules
wherein the mixture contains G-CSF molecules having a glycosylation structure
selected from one or more of Structure A, Structure B, Structure C, Structure
D,
Structure E, Structure F and Structure G. The invention also includes a
mixture of G-
CSF molecules wherein the mixture contains G-CSF molecules having a
glycosylation
structure selected from one or more of Structure A, Structure B, Structure C,
Structure
D, Structure E, Structure F and Structure G wherein the mixture is isolated or
purified,
for example, purified from an egg or from egg white produced in accordance
with the
invention. Also included is a mixture of G-CSF molecules wherein the mixture
contains G-CSF molecules having two, three, four, five or six of the
structures:
Structure A, Structure B, Structure C, Structure D, Structure E, Structure F
and/or
Structure G. Also included is a mixture of G-CSF molecules wherein the mixture
contains G-CSF molecules having two, three, four, five or six of the
structures:
Structure A, Structure B, Structure C, Structure D, Structure E, Structure F
and/or
Structure G, that has been isolated or purified, for example, purified from an
egg or
from egg white produced in accordance with the invention.
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
The invention also includes an individual G-CSF molecule comprising a
Structure A. The invention also includes an individual G-CSF molecule
comprising a
Structure B_ The invention also includes an individual G-CSF molecule
comprising a
Structure C. The invention also includes an individual G-CSF molecule
comprising a
Structure D. The invention also includes an individual G-CSF molecule
comprising a
Structure E. The invention also includes an individual G-CSF molecule
comprising a
Structure F. The invention also includes an individual G-CSF molecule
comprising a
Structure G. In one embodiment, the individual G-CSF molecule is present in a
mixture of G-CSF molecules that may be an isolated or purified mixture of G-
CSF
-molecules, for example, the mixture being purified from an egg or from egg
white
produced in accordance with the invention. In one embodiment, the individual G-
CSF
molecule is isolated or purified, for example, purified as disclosed herein
(e.g., by
HPLC as disclosed in Example 20).
The embodiments of the invention as specified herein regarding G-CSF, for
example, mixtures of G-CSF molecules and individual G-CSF molecules (in the
preceding two paragraphs), are also applicable in general for each of the
other proteins
produced in accordance with the invention and their corresponding poultry
derived
glycosylation structures.
Transgenic chickens which lay eggs containing EPO were produced as
disclosed in Examples 22 and 23. In addition, a second line of EPO producing
chickens was produced essentially as described in examples 22 and 23 except
that a
different producer cell line was used, as described in US patent publication
No.
2007/0077650, published May 5, 2007, the disclosure of which is incorporated
in its
entirety herein by reference. This second line of EPO producing chickens
appeared to
have a deletion in the CMV promoter and in an LTR providing for an enhanced
level
of production of EPO in the egg white of the resulting transgenic chickens as
disclosed
in US patent application No. 11/880,838, filed July 24, 2007, the disclosure
of which is
incorporated in its entirety herein by reference. This higher EPO produc'ing
line was
used to obtain the EPO used for oligosaccharide analysis.
Proteins produced in transgenic avians in accordance with the invention can be
purified from egg white by any useful procedure such as those apparent to a
61
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
practitioner of ordinary skill in the art of protein purification. For
example, the EPO
produced in transgenic avians in accordance with the invention can be purified
from
egg white by methods apparent to practitioners of ordinary skill in the art of
protein
purification. An example of a purification protocol for EPO present in egg
white is
described in Example 24.
The human erythropoietin (hEPO) produced in chickens has been shown to
contain an 0-linked carbohydrate chain and three N-linked carbohydrate chains.
The
0-linked glycosylation has been shown to be at Ser-126 of the EPO and the N-
linked
glycosylations have been shown to be at Asn-24, Asn-38 and Asn-83. The mature
erythropoietin amino acid sequence produced in accordance with the invention
is
shown in FIG. 19B. The human nucleotide sequence encoding the EPO is shown in
FIG. 19A. Nucleotide sequences optimized for avian (e.g., chicken) codon usage
are
also contemplated for use to produce EPO and other proteins in accordance with
the
invention.
Representative glycosylation structures have been determined for the
erythropoietin of the invention and are shown in Example 25 and in FIGS. 20
and 21.
In particular, B-n, D-n, F-n, H-n, J-n, L-n, N-n, O-n, P-n, and Q-n have been
identified
as being present on the avian derived EPO. Also, evidence shows that one or
more of
oligosaccharide structures A-n, C-n, E-n, G-n, I-n, K-n and M-n may also be
present on
the EPO. In addition, data has indicated that there may be a second form of Q-
n in
which only four of the five terminal NAcGlu residues are present. This second
form of
Q-n may be a precursor form of Q-n.
The invention includes the eggs and egg white and the avians (e.g., chicken
turkey and quail) that lay the eggs and produce the egg white containing
erythropoietin
molecules of the invention comprising one or more of the glycosylation
structures
disclosed herein.
In one embodiment, the invention includes a mixture of erythropoietin
molecules wherein the mixture contains erythropoietin molecules (e.g., one or
more
erythropoietin molecules) having an 0-linked glycosylation structure selected
from
Structure A-o, Structure B-o and Structure C-o. Though 0-linked glycosylation
analysis to date have confirmed the presence of A-o, B-o and C-o; Structure D-
o,
62
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Structure E-o, Structure F-o and Structure G-o are also contemplated as being
present
on the poultry derived human EPO. It has been determined that the primary 0-
linked
oligosaccharide present on the avian derived EPO appears to be C-o.
The invention also includes EPO having N-linked glycosylation structures at
three sites wherein the structures at each of the three sites are selected
from one of A-n,
B-n, C-n, D-n, E-n, F-n, G-n, H-n, I-n, J-n, K-n, L-n, M-n, N-n, O-n, P-n and
Q-n.
The invention also includes a mixture of erythropoietin molecules (e.g., more
than one erythropoietin molecule) wherein some or all of the erythropoietin
molecules
have one or more glycosylation structures selected from Structure A-o,
Structure B-o,
Structure C-o, Structure A-n, Structure B-n, Structure C-n, Structure D-n,
Structure E-
n, Structure F-n, Structure G-n, Structure H-n, Structure I-n, Structure J-n,
Structure K-
n, Structure L-n, Structure M-n, Structure N-n, Structure O-n, Structure P-n,
Structure
Q-n. In one embodiment, the mixture of erythropoietin molecules is purified or
isolated, for example, isolated from an egg or purified or isolated from egg
white
produced in a transgenic avian.
The invention also includes an individual erythropoietin molecule comprising a
Structure A-o. The invention also includes an individual erythropoietin
molecule
comprising a Structure B-o. The invention also includes an individual
erythropoietin
molecule comprising a Structure C-o. The invention also includes an individual
erythropoietin molecule comprising a Structure A-n. The invention also
includes an
individual erythropoietin molecule comprising a Structure B-n. The invention
also
includes an individual erythropoietin molecule comprising a Structure C-n. The
invention also includes an individual erythropoietin molecule comprising a
Structure
D-n. The inverition also includes an individual erythropoietin molecule
comprising a
Structure E-n. The invention also includes an individual erythropoietin
molecule
comprising a Structure F-n. The invention also includes an individual
erythropoietin
molecule comprising a Structure G-n. The invention also includes an individual
erythropoietin molecule comprising a Structure H-n. The invention also
includes an
individual erythropoietin molecule comprising a Structure I-n. The . invention
also
includes an individual erythropoietin molecule comprising a Structure J-n. The
invention also includes an individual erythropoietin molecule comprising a-
Structure
63
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
K-n. The invention also includes an individual erythropoietin molecule
comprising a
Structure L-n. The invention also includes an individual erythropoietin
molecule
comprising a Structure M-n. The invention also includes an individual
erythropoietin
molecule comprising a Structure N-n. The invention also includes an individual
erythropoietin molecule comprising a Structure O-n. The invention also
includes an
individual erythropoietin molecule comprising a Structure P-n. The invention
also
includes an individual erythropoietin molecule comprising a Structure Q-n. In
one
embodiment, the individual erythropoietin molecule is present in a mixture of
erythropoietin molecules which has been produced in a transgenic avian, e.g.,
a
transgenic chicken. In one embodiment, the individual erythropoietin molecule
is
present in a mixture of erythropoietin molecules which has been isolated or
purified,
for example, the mixture is isolated or purified from an egg or from egg white
produced by a transgenic avian. In one embodiment, the individual
erythropoietin
molecule is isolated or purified.
The invention includes exemplary EPO molecules where each of the Asn-24,
Asn-38 and Asn-83 glycosylation sites are glycosylated with one of the A=n, B-
n, C-n,
D-n, E-n, F-n, G-n, H-n, 1-n, J-n, K-n, L-n, M-n, N-n, O-n, P-n and Q-n
Structures and
where and the Ser-126 is glycosylated with A-o, B-o or C-o.
MALDI-TOF-MS analysis of peptide products yielded from proteolytic digests
of the avian derived EPO of the invention have shown that essentially the same
oligosaccharide structures are present at each of the three N-linked
glycosylation sites.
That is, it appears that about the same ratio of each of the N-linked
oligosaccharides is
present at each of the three N-linked glycosylation sites on the EPO
molecules. This
indicates that other N-glycosylated exogenous proteins produced in accordance
with
the invention may have similar N-linked glycosylation patterns. In addition,
data has
shown that each of the three N-linked sites is extensively glycosylated, each
site being
glycosylated greater than 95% of the time and possibly greater than 98% of the
time,
for example, greater than 99% of the time. The erythropoietin analyzed was
produced
in a transgenic chicken which contained a transgene encoding the amino acid
sequence
of the human 165 amino acid protein, after cleavage of the signal peptide.
However, it
is expected that EPO produced in a transgenic chicken using a nucleotide
sequence
64
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
encoding the 166 amino acid form of EPO would result in the same complement of
oligosaccharides on the 166 amino acid protein as is found on the 165 amino
acid
protein.
N-linked oligosaccharides= attached to human EPO produced in transgenic
chickens have a paucity of terminal sialic acid moieties. That is, only minor
amounts
of the N-linked oligosaccharide structures are terminally sialylated. This is
in contrast
to EPO produced in human cells and human EPO produced in CHO cells where the N-
linked oligosaccharide structures are extensively terminally sialylated. In
addition,
terminal N-Acetyl Glucosamine (NAcGlu) is present extensively on the N-linked
oligosaccharide structures of the EPO produced in transgenic chickens which is
not the
case for EPO produced in human cells and human EPO produced in CHO cells.
Further, fucose is not present on the N-linked oligosaccharide structures of
the EPO
produced in transgenic chickens. However, fucose appears to be present on all
or most
N-linked oligosaccharide structures of EPO produced in human cells and human
EPO
produced in CHO cells.
Combinations of glycosylation structures are contemplated as being attached to
erythropoietin. For example, a human erythropoietin molecule may be
glycosylated
with, A-o, A-n, B-n and C-n, or A-o, B-n, C-n and D-n, or A-o, D-n, E-n and F-
n, or A-
o, E-n, F-n and G-n, or B-o, A-n, D-n and H-n, or B-o, E-n, F-n and G-n, or B-
o, A-n,
A-n and A-n, or C-o, D-n, D-n and C-n, or C-o, F-n, G-n and H-n,'or C-o, A-n,
B-n and
C-n, or C-o, A-n, B-n and H-n, or C-o, A-n, B-n and E-n, or C-o, A-n, B-n and
H-n or
other such combinations.
It is understood that though the reported method of making compositions of the
invention is in avians, the compositions are not limited thereto. For example,
certain of
the glycosylated protein molecules of the invention may be produced in other
organisms such as transgenic fish, transgenic mammals, for example, transgenic
goats
or in transgenic plants, such as tobacco and duck weed (Lemna minor).
It is also contemplated that the glycosylation structures demonstrated to be
present on one protein of the invention may be present on another protein of
the
invention. For example, glycosylation structures shown to be present on TPD G-
CSF
may also be present on TPD GM-CSF, TPD IFN and/or other TPD proteins. In
another
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
example, it is contemplated that the glycosylation structures determined to be
present
on TPD IFN a2 may be present on TPD G-CSF, TPD GM-CSF and/or other transgenic
poultry derived (TPD) proteins. The invention also specifically contemplates
human
proteins in general having one or more of the TPD glycosyaltion structures
disclosed
herein.
The invention also contemplates that pegylating proteins produced as disclosed
herein may be advantageous as discussed, for example, in US patent application
No.
11/584,832, filed October 23, 2006, the disclosure of which is incorporated it
its
entirety herein by reference.
While it is possible that, for use in therapy, therapeutic proteins produced
in
accordance with this invention may be administered in raw form, it is
preferable to
administer the therapeutic proteins as part of a pharmaceutical formulation.
The invention thus further provides pharmaceutical formulations comprising
poultry derived glycosylated therapeutic proteins or a pharmaceutically
acceptable
derivative thereof together with one or more pharmaceutically acceptable
carriers
thereof and, optionally, other therapeutic and/or prophylactic ingredients and
methods
of administering such pharmaceutical formulations. The carrier(s) must be
"acceptable"
in the sense of being compatible with the other ingredients of the formulation
and not
deleterious to the recipient thereof. Methods of treating a patient (e.g.,
quantity of
pharmaceutical protein administered, frequency of administration and duration
of
treatment period) using pharmaceutical compositions of the invention can be
determined using standard methodologies known to physicians of skill in the
art.
Pharmaceutical formulations include those suitable for oral, rectal, nasal,
topical (including buccal and sub-lingual), vaginal or parenteral. The
pharmaceutical
formulations include those suitable for administration by injection including
intramuscular, sub-cutaneous and intravenous administration. The
pharmaceutical
formulations also include those for administration by inhalation or
insufflation. The
formulations may, where appropriate, be conveniently presented in discrete
dosage
units and may be prepared by any of the methods well known in the art of
pharmacy.
The methods of producing the pharmaceutical formulations typically include the
step
of bringing the therapeutic proteins into association with liquid carriers or
finely
66
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
divided solid carriers or both and then, if necessary, shaping the product
into the
desired formulation.
Pharmaceutical formulations suitable for oral administration may conveniently
be presented as discrete units such as capsules, cachets or tablets each
containing a
predetermined amount of the active ingredient; as a powder or granules; as a
solution;
as a suspension; or as an emulsion. The active ingredient may also be
presented as a
bolus, electuary or paste. Tablets and capsules for oral administration may
contain
conventional excipients such as binding agents, fillers, lubricants,
disintegrants, or
wetting agents. The tablets may be coated according to methods well known in
the art.
Oral liquid preparations may be in the form of, for example, aqueous or oily
suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a
dry
product for constitution with water or other suitable vehicle before use. Such
liquid
preparations may contain conventional additives such as suspending agents,
emulsifying agents, non-aqueous vehicles (which may include edible oils) or
preservatives.
Therapeutic proteins of the invention may also be formulated for parenteral
administration (e.g., by injection, for example bolus injection or continuous
infusion)
and may be presented in unit dose form in ampoules, pre-filled syringes, small
volume
infusion or in multi-dose containers with an added preservative. The
therapeutic
proteins may be injected by, for example, subcutaneous injections,
intramuscular
injections, and intravenous infusions or injections.
The therapeutic proteins may take such forms as suspensions, solutions, or
emulsions in oily or aqueous vehicles, and may contain formulatory agents such
as
suspending, stabilizing and/or dispersing agents. It is also contemplated that
the
therapeutic proteins may be in powder form, obtained by aseptic isolation of
sterile
solid or by lyophilization from solution, for constitution with a suitable
vehicle, e.g.,
sterile, pyrogen-free water, before use.
For topical administration to the epidermis, the therapeutic proteins produced
according to the invention may be formulated as ointments, creams or lotions,
or as a
transdermal patch. Ointments and creams may, for example, be formulated with
an
aqueous or oily base with the addition of suitable thickening and/or gelling
agents.
67
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Lotions may be formulated with an aqueous or oily base and will in general
also
contain one or more emulsifying agents, stabilizing agents, dispersing agents,
suspending agents, thickening agents or coloring agents.
Formulations suitable for topical administration in the mouth include lozenges
comprising active ingredient in a flavored base, usually sucrose and acacia or
tragacanth; pastilles comprising the active ingredient in an inert base such
as gelatin
and glycerin or sucrose and acacia; and mouthwashes comprising the active
ingredient
in a suitable liquid carrier.
Pharmaceutical formulations suitable for rectal administration wherein the
carrier is a solid are most preferably represented as unit dose suppositories.
Suitable
carriers include cocoa butter and other materials commonly used in the art,
and the
suppositories may be conveniently formed by a mixture of the active compound
with
the softened or melted carrier(s) followed by chilling and shaping in molds.
Formulations suitable for vaginal administration may be presented as
pessaries,
tampons, creams, gels, pastes, foams or sprays containing in addition to the
active
ingredient, such carriers as are known in the art to be appropriate.
For intra-nasal administration the therapeutic proteins of the invention may
be
used as a liquid spray or dispersible powder or in the form of drops.
Drops may be formulated with an aqueous or non-aqueous base also comprising
one or more dispersing agents, solubilizing agents or suspending agents.
Liquid sprays
are conveniently delivered from pressurized packs.
For administration by inhalation, therapeutic proteins according to the
invention
may be conveniently delivered from an insufflator, nebulizer or a pressurized
pack or
other convenient means of delivering an aerosol spray. Pressurized packs may
comprise a suitable propellant such as dichlorodifluoromethane,
trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other
suitable gas.
In the case of a pressurized aerosol, the dosage unit may be determined by
providing a
valve to deliver a metered amount.
For administration by inhalation or insufflation, the therapeutic proteins
according to the invention may take the form of a dry powder composition, for
example a powder mix of the compound and a suitable powder base such as
lactose or
68
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
starch. The powder composition may be presented in unit dosage form in, for
example,
capsules or cartridges or, e.g., gelatin or blister packs from which the
powder may be
administered with the aid of an inhalator or insufflator.
When desired, the above described formulations adapted to give sustained
release of the active ingredient, may be employed.
The pharmaceutical compositions according to the invention may also contain
other active ingredients such as antimicrobial agents, or preservatives.
In a specific example, human EPO produced as disclosed herein, and which
may be pegylated, is employed in a pharmaceutical formulation wherein each I
mL
contains 0.05 mg polysorbate 80, and is formulated at pH 6.2 + 0.2 with 2.12
mg
sodium phosphate monobasic monohydrate, 0.66 mg sodium phosphate dibasic
anhydrous, and 8.18 mg sodium chloride in water for injection. In another
specific
example, human interferon alpha produced as disclosed herein is employed in a
pharmaceutical formulation containing 7.5 mg/ml sodium chloride, 1.8 mg/ml
sodium
phosphate dibasic, 1.3 rng/mi sodium phosphate monobasic, 0.1 mg/ml edetate
disodium dihydrate, 0.7 mg/ml Tween 80 and 1.5 mg/ml m-cresol. In another
specific example, human G-CSF produced as disclosed herein is employed in a
pharmaceutical formulation containing 0.82 mg/ml sodium acetate, 2.8 l/ml
glacial
acetic acid, 50 mg/ml mannitol and 0.04 mg/ml Tween 80.
In addition, it is contemplated that the therapeutic proteins of the invention
may
be used in combination with other therapeutic agents.
Compositions or compounds of the invention can be used to treat a variety of
conditions. For example, there are many conditions for which treatment
therapies are
known to practitioners of skill in the art in which therapeutic proteins
obtained from
cell culture (e.g., CHO cells) are employed. The present invention
contemplates that
the therapeutic proteins produced in an avian system containing a poultry
derived
glycosyation pattern can be employed to treat such conditions. That is, the
invention
contemplates the treatment of conditions known to be treatable by
conventionally
produced therapeutic proteins by using therapeutic proteins produced in
accordance
with the invention. For example, erythropoietin produced in accordance with
the
invention can be used to treat human conditions such as anemia and kidney
disease,
69
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
e.g., chronic renal failure (or other conditions which may be treatable by
administering
EPO of the invention) and G-CSF produced in accordance with the invention can
be
used to treat cancer patients, as understood in the art.
Generally, the dosage administered will vary depending upon known factors
such as age, health and weight of the recipient, type of concurrent treatment,
frequency
of treatment, and the like. Usually, a dosage of active ingredient can be
between about
0.0001 and about 10 milligrams per kilogram of body weight. Precise dosage,
frequency of administration and time span of treatment can be determined by a
physician skilled in the art of administration of the respective therapeutic
protein.
The following specific examples are intended to illustrate the invention and
should not be construed as limiting the scope of the claims.
Example 1
Vector Construction
The lacZ gene of pNLB, a replication-deficient avian leukosis virus (ALV)-
based vector (Cosset et al., 1991), was replaced with an expression cassette
consisting
of a cytomegalovirus (CMV) promoter and the reporter gene, (3-lactamase. The
pNLB
and pNLB-CMV-BL vector constructs are diagrammed in FIG. 3A and 3B,
respectively.
To efficiently replace the lacZ gene of pNLB with a transgene, an intermediate
adaptor plasmid was first created, pNLB-Adapter. pNLB-Adapter was created by
inserting the chewed back Apal/Apal fragment of pNLB (Cosset et al., J. Virol.
65:3388-94 (1991)) (in pNLB, the 5' Apal resides 289 bp upstream of lacZ and
the
3'Apal resides 3' of the 3' LTR and Gag segments) into the chewed-back
KpnI/Sacl
sites of pBluescriptKS(-). The filled-in Mlul/Xbal fragment of pCMV-BL (Moore
et
al., Anal. Biochem. 247: 203-9 (1997)) was inserted into the chewed-back
Kpnl/Ndel
sites of pNLB-Adapter, replacing lacZ with the CMV promoter and the BL gene
(in
pNLB, Kpnl resides 67 bp upstream of lacZ and Ndel resides 100 bp upstream of
the
lacZ stop codon), thereby creating pNLB-Adapter-CMV-BL. To create pNLB-CMV-
BL, the HindIII/B1pI insert of pNLB (containing IacZ) was replaced with the
HindIII/Blp1 insert of pNLB-Adapter-CMV-BL. This two step cloning was
necessary
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
because direct ligation of blunt-ended fragments into the HindIIl/BIpI sites
of pNLB
yielded mostly rearranged subclones, for unknown reasons.
Example 2
Creation of the pNLB-CMV-BL Founder Flock
Sentas and Isoldes were cultured in F10 (Gibco), 5% newborn calf serum
(Gibco), 1% chicken serum (Gibco), 50 g/ml phleomycin (Cayla Laboratories)
and 50
g/ml hygromycin (Sigma). Transduction particles were produced as described in
Cosset et al., 1993, herein incorporated by reference, with the following
exceptions.
Two days after. transfection of the retroviral vector pNLB-CMV-BL (from
Example 1,
above) into 9x105 Sentas, virus was harvested in fresh media for 6-16 hours
and
filtered. All of the media was used to transduce 3x106 Isoldes in 3 100 mm
plates with
polybrene added to a final concentration of 4 g/ml. The following day the
media was
replaced with media containing 50 g/ml phleomycin, 50 g/ml hygromycin and
200
g/ml G418 (Sigma). After 10-12 days, single G418 resistant colonies were
isolated
and transferred to 24-well plates. After 7-10 days, titers from each colony
were
determined by transduction of Sentas followed by G418 selection. Typically 2
out of
60 colonies gave titers at 1-3x105. Those colonies were expanded and virus
concentrated to 2-7x106 as described in Allioli et al., Dev. Biol. 165:30-7
(1994),
herein incorporated by reference. The integrity of the CMV-BL expression
cassette
was confirmed by assaying for P-lactamase in the media of cells transduced
with NLB-
CMV-BL transduction particles.
The transduction vector, pNLB-CMV-BL, was injected into the subgerminal
cavity of 546 unincubated SPF White Leghom embryos, of which 126 chicks
hatched
and were assayed for secretion of (3-lactamase (lactamase) into blood. In
order to
measure the concentration of active lactamase in unknown samples, a kinetic
colorimetric assay was employed in which PADAC, a purple substrate, is
converted to
a yellow compound specifically by lactamase. Lactamase activity was
quantitated by
monitoring the decrease in OD570 nm during a standard reaction time and
compared to
a standard curve with varying levels of purified lactamase (referred to as the
"lactamase
assay"). The presence or absence of lactamase in a sample could also be
determined by
71
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
visually scoring for the conversion of purple to yellow in a test sample
overnight or for
several days (the "overnight lactamase assay"). The latter method was suitable
for
detection of very low levels of lactamase or for screening a large number of
samples.
At one to four weeks of age, chick serum samples were tested for the presence
of
lactamase. Twenty-seven chicks had very low levels of lactamase in their serum
that
was detectable only after the overnight lactamase assay and, as these birds
matured,
lactamase was no longer detectable. As shown in Table I below and FIG. 4A, 9
additional birds (3 males and 6 females) had serum levels of lactamase that
ranged
from 11.9 to 173.4 ng/ml at six to seven months post-hatch.
Table 1: Expression of P-Lactamase in NLB-CMV-BL-Transduced Chickens
Average ng/ml of (3-Lactamase
Sex Band No. Serum: 8 Month Egg White: 8 Month Egg White: 14 Month
Birds Hens3 Hens3
NA' Controls2 0.0 f 7.4 0.0 13.6 0.0 :f: 8.0
Female 1522 36.7 f 1.6 56.3 dz 17.8 47.9 t 14.3
Female 1549 11.9 t 1.3 187.0 32.4 157.0 32.2
Female 1581 31.5 t 4.8 243.8 ::L 35.7 321.7 68.8
Female 1587 33.9 f 1.4 222.6 :h 27.7 291.0 t 27.0
Female 1790 31.0 t 0.5 136.6 t 20.2 136.3 t 11.0
Female 1793 122.8 t 3.6 250.0 +37.0 232.5 +28.6
Male 2395 16.0 f 2.3 NA NA
Male 2421 165.5 f 5.0 NA NA
Male 2428 173.4 f 5.9 NA NA
'NA: not applicable.
ZControls were obtained from untreated hens.
3Represents the average of 5 to 20 eggs.
72
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Example 3
P-Lactamase Expression in the Egg White of GO Hens
Fifty-seven pullets transduced with pNLB-CMV-BL retroviral vector were
raised to sexual maturity and egg white from each hen was tested for active 0-
lactamase (lactamase) at 8 months of age. Of the 57 birds, six had significant
levels of
lactamase that ranged from 56.3 to 250.0 ng/ml (Table 1, supra). No other hens
in this
group had detectable levels of lactamase in their egg white, even after
incubation of
PADAC with the sample for several days. Lactamase was not detectable in egg
white
from 24 hens that were mock injected and in 42 hens that were transduced with
a NLB
vector that did not carry the lactamase transgene. Stable lactamase expression
was still
detectable in the egg white of the six expressing hens six months following
the initial
assays (Table 1, supra).
Lactamase was detected in the egg white of all six hens by a western blot
assay
with an anti- (3-lactamase antibody. The egg white lactamase was the same size
as the
bacterially produced, purified lactamase that was used as a standard. The
amount
detected in egg white by Western analysis was consistent with that determined
by the
enzymatic assay, indicating that a significant proportion of the egg wh'ite
lactamase
was biologically active. Hen-produced lactamase in egg white stored at 4 C
lost no
activity and showed no change in molecular weight even after several months of
storage. This observation allowed storage of lactamase-containing eggs for
extended
periods prior to analysis.
Example 4
Germline Transmission and Serum Expression of the (3-Lactamase Transgene in G
1
and G2 Transgenic Chickens
DNA was extracted from sperm collected from 56 GO roosters and three of the
56 birds that harbored significant levels of the transgene in their sperm DNA
as
determined by quantitative PCR were selected for breeding. These roosters were
the
same three that had the highest levels of (3-lactamase (lactamase) in their
blood
(roosters 2395, 2421 and 2428). Rooster 2395 gave rise to three Gl transgenic
offspring (out of 422 progeny) whereas the other two yielded no transgenic
offspring
73
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
out of 630 total progeny. Southern analysis of blood DNA from each of the
three G I
transgenic chickens confirmed that the transgenes were intact and that they
were
integrated at unique random loci. The serum of the G1 transgenic chicks, 5308,
5657
and 4133, at 6 to 11 weeks post-hatch contained 0.03, 2.0 and 6.0 g/ml of
lactamase,
respectively. The levels of lactamase dropped to levels of 0.03, 1.1 and 5.0
g/ml
when the chickens were assayed again at 6 to 7 months of age (FIG. 4A).
Hen 5657 and rooster 4133 were bred to non-transgenic chickens to obtain
offspring hemizygous for the transgene. The pedigrees of transgenic chickens
bred
from rooster 4133 or hen 5657 and the subsequent generations are shown in FIG.
5.
Transgenic rooster 5308.was also bred but this bird's progeny exhibited
lactamase
concentrations that were either very low or not detectable in serum and egg
white.
Active lactamase concentrations in the serum of randomly selected 02
transgenic
chicks were measured at 3 to 90 days post-hatch. Of the five G2 transgenics
bred from
hen 5657, all had active lactamase at concentrations of 1.9 to 2.3 glml
(compared to
the parental expression of 1.1 g/ml, *FIG. 4B). All of the samples were
collected
during the same period of time, thus, the lactamase concentrations in the
serum of the
offspring were expected to be higher than that of the parent since the
concentration in
hen 5657 had dropped proportionately as she matured. Similarly, the five
randomly
selected transgenic chicks bred from rooster 4133 all had serum lactarriase
concentrations that were similar but higher than that of their parent (FIG.
4B).
Example 5
f3-Lactamase Expression in the Egg White of Transgenic Hens
Eggs from G1 hen 5657 contained 130 ng of active P-lactamase (lactamase) per
ml of egg white (FIG. 6A). Lactamase concentrations were higher in the first
few eggs
laid and then reached a plateau that was stable for at least nine months. Eggs
from
transgenic hens bred from hen 5657 and a non-transgenic rooster had -
lactamase
concentrations that were similar to their parent (FIG. 6A). Hen 6978 was bred
from G2
hen 8617 and sibling G2 rooster 8839 and was homozygous for the transgene as
determined by quantitative PCR and Southern analysis. As expected, the
concentration
-of lactamase in the eggs of bird 6978 was nearly two-fold higher than her
hemizygous
74
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
parent (FIG. 6B). No other G3 hens bred from hen 5657, were analyzed because
hen
6978 was the only female in her clutch. It is important to note that the eggs
from hens
8867, 8868 and 8869 were collected eleven months apart and had similar
concentrations of lactamase (FIGS. 6A and 6B), again indicating that the
expression
levels in the egg white were consistent throughout the lay period.
Rooster 4133 was bred to non-transgenic hens to obtain hemizygous G2 hens.
Of the 15 transgenic hens analyzed, all had lactamase in the egg white at
concentrations ranging from 0.47 to 1.34 g/ml. Four representative hens are
shown in
FIG. 7A. When assayed 6 months later, the average expression level had dropped
from
approximately 1.0 pg/ml to 0.8 gg/ml (FIG. 7A). Expression levels were high in
the
initial eggs and leveled out over several months. After that, the
concentrations of
lactamase in the eggs remained constant.
G2 hen 8150 and sibling G2 rooster 8191 were crossed to yield hemizygous and
homozygous G3 hens. All transgenic G3 hens expressed lactamase in the white of
their eggs at concentrations ranging from 0.52 to 1.65 g/ml (FIG. 7B). The
average
expression for the G3 hens that were homozygous was 47% higher than those G2
hens
and G3 hens that were hemizygous. The amount of lactamase in the eggs from G2
and
G3 hens bred. from rooster 4133 and his offspring varied significantly (FIGS.
7A and
7B), although the levels in the eggs from any given hen in that group were
relatively
constant. The average expression of lactamase was expected to double for the
homozygous genotype. Western blot analysis confirmed that the transgene was
faithfully producing intact lactamase in the eggs of G2 transgenics. The
lactamase
level detected on a Western blot also correlated closely with that determined
by the
enzyme activity assay, indicating that a significant portion of the egg white
lactamase
was bioactive. Thus, retroviral vectors were successfully employed to
implement stable and reliable expression of a transgene in chickens.
Deposition of lactamase in the yolk was detectable but lower than that of egg
white. Seven G2 or G3 hens of rooster 4133`s lineage were analyzed and the
concentration in the yolk ranged from 107 to 375 ng/ml or about 20% the
concentration
in the egg white. There was no correlation between the yolk and egg white
lactamase
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
levels of a given hen (Harvey et al., "Expression of exogenous protein in egg
white of
transgenic chickens" (Apri12002) Nat. Biotechnol. 20:396-399).
Example 6
Production of Founder Males
For pNLB-CMV-BL transduction, freshly laid fertilized White Leghorn eggs
were used. Seven to ten microliters of concentrated particles were, injected
into the
subgerminal cavity of windowed eggs and chicks hatched after sealing the
window.
546 eggs were injected. Blood DNA was extracted and analyzed for the presence
of
the transgene using a probe-primer set designed to detect the neo resistance
gene via
the Taqman assay. As can be seen in Table 2 below, approximately 25% of all
chicks
had detectable levels of transgene in their blood DNA.
TABLE 2: Summary of Transgenesis with the NLB-CMV-BL Vectors
Transgene NLB-CMV-BL
Number of injections 546
Number of birds hatched ( !o) 126 (23.1%)
Number of chicks with transgene in
b 36(28.6%)
their blood DNA (%)
4
8 Number of males 56
w
0
Number of males with transgene in
O 3(5.4/op )
~ their sperm DNA (%)
o =
Number of males that transmitted 1(1.8%)
transgene to progeny (%)
76
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
TABLE 2: Summary of Transgenesis with the NLB-CMV-BL Vectors Continued
4. Number of chicks bred from GO males 1026
O
r- x
O U
6 ~ Number of GI transgenics 3
Rate of germline transmission 0.29% 5
N Number of chicks bred from Gl
120
transgenics
o ~
Number of G2 transgenics 61
2 Rate of germline transmission 50.8%
ExamRIe 7
Germline Transmission of the Transgene
Taqman detection of the neo resistance gene in sperm DNA was used to
identify candidate GO males for breeding. Three GO males were identified,
wherein
each had the NLB-CMV-BL transgene in their sperm DNA at levels that were above
background. All GO males positive for the transgene in their sperm were bred
to non-
transgenic hens to identify fully transgenic G1 offspring.
For NLB-CMV-BL 1026 chicks were bred, respectively, and three G1 chicks
obtained for each transgene (Table 2, supra). All G1 progeny came from the
male with
the highest level of transgene in his sperm DNA, even though an equivalent
number of
chicks were bred from each male.
Example 8
Southern Analysis of Gls and G2s
In order to confirm integration and integrity of the inserted vector
sequences,
Southern blot analysis was performed on DNA from G1 and G2 transgenics. Blood
DNA was digested with HindIII and hybridized to a neo resistance probe to
detect
junction fragments created by the internal HindIIl site found in the pNLB-CMV-
BL
77
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
vector (FIG. 3B) and genomic sites flanking the site of integration. Each of
the 3 GI
birds carrying NLB-CMV-BL had a junction fragment of unique size, indicating
that
the transgene had integrated into three different genomic sites. G 1 s were
bred to non-
transgenic hens to obtain hemizygous G2s. As can be seen in Table 2 (supra),
50.8%
of offspring from GI roosters harboring NLB-CMV-BL were transgenic as expected
for Mendelian segregation of a single integrated transgene. Southern analysis
of
HindI1I-digested DNA from G2 offspring detected junction fragments similar in
size to
those originating from their transgenic parents, indicating that the transgene
was
transmitted intact.
Example 9
Screeniniz for G3 Progeny Homozygous for the Transgene
In order to obtain transgenic chickens homozygous for the transgene, G2
hemizygous birds having NLB-CMV-BL integrated at the same site (e.g., progeny
of
the same GI male) were crossbred. Two groups were bred: the first was a hen
and
rooster arising from the GI 4133 male and the second from the G1 5657 hen. The
Taqman assay was used to quantitatively detect the neo resistance transgene in
G3
progeny using a standard curve. The standard curve was constructed using known
amounts of genomic DNA from the GI transgenic 4133 male hemizygous for the
transgene as determined by Southern analysis. The standard curve ranged from
103 to
1.6x104 total copies of the transgene or 0.2 to 3.1 transgene copies per
diploid genome.
Because reaction components were not' limited during the exponential phase,
amplification was very efficient and gave reproducible values for a given copy
number.
There was a reproducible, one-cycle difference between each standard curve
differing
two-fold in copy number.
In order to determine the number of transgene alleles in the G3 offspring,
DNAs were amplified and compared to the standards. DNA from non-transgenics
did
not amplify. Birds homozygous for the transgenic allele gave rise to plots
initiating the
amplification one cycle earlier than those hemizygous for the allele. The
sequence
detection program was able to calculate the number of alleles in an unknown
DNA
78
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
sample based on the standard curve and the cycle threshold (Ct) at which a
sample's
amplification plot exhibited a significant rise. The data are shown in Table 3
below.
In order to confirm Taqman copy number analysis, DNA of selected birds was
analyzed by Southern blotting using Pstl-digested DNA and a probe
complementary to
the neo resistance gene to detect a 0.9 kb fragment. Detection of a small
fragment was
chosen since transfer of smaller DNAs from gel to membrane is more
quantitative.
The signal intensity of the 0.9 kb band corresponded well to the copy number
of G3
transgenic birds as determined by the Taqman assay. The copy numbers of an
additional eighteen G3 transgenic birds analyzed by Southern blotting were
also
consistent with that determined by Taqman. A total of 33 progeny were analyzed
for
the 4133 lineage, of which 9 (27.3%) were non-transgenic, 16 (48.5%) were
hemizygous and 8 (24.2%) were homozygous. A total of 10 progeny were analyzed
for the 5657 lineage, of which 5 (50.0%) were non-transgenic, 1 (10.0%) was
hemizygous and 4 (40.0%) were homozygous. The observed ratio of non-
transgenics,
hemizygotes and homozygotes for the 4133 lineage G3 progeny was not
statistically
different from the expected 1:2:1 ratio as determined by the x2 test (P is
less than or
equal to 0.05). Progeny of the 5657 lineage did not have the expected
distribution but
this could have been due to the low number of progeny tested (Harvey et al.,
"Consistent production of transgenic chickens using replication deficient
retroviral
vectors and high-throughput screening procedures" (February 2002) Poultry
Science
81:202-212).
79
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
TABLE 3: Determination of Transgene Copy Number in G3 Offspring
Bred from G2 Transgenics
G 1 Parent Band No. Ct2 Mean Total Standard Copies per
(Std. No. or Copy Number Deviation Diploid
NTC') Genome3
NA 4133 27.3 3,975 145.7 1
4133 6792 40.0 0 0.0 0
5657 6977 25.9 10,510 587.0 2
5657 6978 25.8 10,401 505.1 2
4133 7020 26.7 6,064 443.1 1
4133 7021 26.8 5,239 133.8 1
4133 7022 26.1 9,096 352.3 2
4133 7023 26.8 5,424 55.7 1
4133 7024 26.9 4,820 110.1 1
5657 7110 26.4 8,092 1037.5 2
5657 7111 30.4 403 46.3 0
5657 7112 33.2 60 6.1 0
4133 7142 26.5 6,023 367.6 1
4133 7143 25.9 9,474 569.8 2
4133 7144 25.7 12,420 807.7 2
4133 7338 27.2 4,246 201.7 1
5657 7407 37.7 1 1.0 0
NA (stdl) 29.1 1,000 0.0 0.2
NA (std2) 28.1 2,000 0.0 0.4
NA (std3) 27.1 4,000 0.0 0.8
NA (std4) 26.2 8,000 0.0 1.6
NA (std5) 25.3 16,000 0.0 3.1
NA (NTC) 39.8 -1 0.0 0.0
1Std. No.: standard number; NTC: no template control.
2Ct: cycle threshold; cycle at which a sample's fluorescence exhibited a
significant increase above background. '
'Copies per diploid genome were determined by dividing the mean by 5100
and rounding to the nearest first decimal place.
4NA: not applicable.
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Example 10
Vector Construction for pNLB-MDOT-EPO vector
Following the teachings of Example l(Vector Construction) of the
specification, an pNLB-MDOT-EPO vector was created, substituting an EPO
encoding
sequence for the BL encoding sequence (FIG. 8B). Instead of using the CMV
promoter, MDOT was used (FIG. 13). MDOT is a synthetic promoter which contains
elements from both the ovomucoid (MD) and ovotransferrin (TO) promoter. (pNLB-
MDOT-EPO vector, a.k.a. pAVIJCR-A145.27.2.2).
The DNA sequence for human EPO based on hen oviduct optimized codon
usage was created using the BACKTRANSLATE program of the Wisconsin Package,
version 9.1 (Genetics Computer Group, Inc., Madison, Wis.) with a codon usage
table
compiled from the chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid, and
ovotransferrin proteins. The DNA sequence was synthesized and cloned into the
3'
overhang T's of pCRII-TOPO (Invitrogen) by Integrated DNA Technologies,
Coralville, Iowa, on a contractual basis. The EPO coding sequence was then
removed
from pEpoMM with Hind III and Fse I, purified from a 0.8% agarose-TAE Gel, and
ligated to Hind III and Fse I digested, alkaline phosphatase-treated pCMV-
IFNMM.
The resulting plasmid was pAVIJCR-A137.43.2.2 which contained the EPO coding
sequence controlled by the cytomegalovirus immediate early promoter/enhancer
and
SV40 polyA site. The plasmid pAVIJCR-A137.43.2.2 was digested with Nco I and
Fse I and the appropriate fragment ligated to an Nco I and Fse I-digested
fragment of
pMDOTIFN to obtain pAVIJCR-A137.87.2.1 which contained EPO driven by the
MDOT promoter. In order to clone the EPO coding sequence controlled by the
MDOT
promoter into the NLB retroviral plasmid, the plasmids pALVMDOTIFN and
pAVIJCR-A137.87.2.1 were digested with Kpn I and Fse I. Appropriate DNA
fragments were purified on a 0.8% agarose-TAE gel, then ligated and
transformed into
DH5 a cells. The resulting plasmid was pNLB-MDOT-EPO (a.k.a. pAVIJCR-
A 145.27.2.2).
81
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Example 11
Production of Transgenic Chickens and Fully Transgenic G1 Chickens Expressing
EPO
Production of NLB-MDOT-EPO transduction particles were performed as
described for NLB-CMV-BL (see Example 2). Approximately 300 White Leghorn
eggs were windowed according to the Speksnijder procedure (U.S. Pat. No.
5,897,998),
then injected with about 7x104 transducing particles per egg. Eggs hatched 21
days
after injection, and human EPO levels were measured by EPO ELISA from serum
samples collected from chicks one week after hatch.
In order to screen for GO roosters which contained the EPO transgene in their
sperm, DNA was extracted from rooster sperm samples by Chelex-100 extraction
(Walsh et al., 1991). DNA samples were then subjected to Taqman analysis on a
7700 Sequence Detector (Perkin Elmer) using the "neo for-I" (5'-
TGGATTGCACGCAGGTTCT-3'; SEQ ID NO: 5) and "neo rev-1" (5'-
TGCCCAGTCATAGCCGAAT-3'; SEQ ID NO: 6) primers and FAM labeled NEO-
PROBEI (5'-CCTCTCCACCCAAGCGGCCG-3'; SEQ ID NO: 7) to detect the
transgene. Eight GO roosters with the highest levels of the transgene in their
sperm
samples were bred to nontransgenic SPAFAS (White Leghorn) hens by artificial
insemination. Blood DNA samples were screened for the presence of the
transgene by
Taqman analysis as described above.
Out of 1,054 offspring, 16 chicks were found to be transgenic (GI avians).
Chick serum was tested for the presence of human EPO by EPO ELISA, and EPO was
present at about 70 nanogram/mI (ng/ml). Egg white in eggs from Gl hens was
also
tested for the presence of human EPO by EPO ELISA and found to contain human
EPO at about 70 ng/ml. The EPO present in eggs (i.e., derived from the
optimized
coding sequence of human EPO) was found to be biologically active when tested
on a
human EPO responsive cell line (HCD57 murine erythroid cells) in a cell
culture assay.
82
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Example 12
Vector Construction for pNLB-CMV-IFN
Following the teachings of Example 1, a pNLB-CMV-IFN vector~was created
(FIG. 8A), substituting an IFN encoding sequence for the BL encoding sequence
of
Example 1.
An optimized coding sequence was created, wherein the most frequently used
codons for each particular amino acid found in the egg white proteins
ovalbumin,
lysozyme, ovomucoid, and ovotransferrin were used in the design of the
optimized
human IFN-a 2b coding sequence that was inserted into vectors of - the present
invention. More specifically, the DNA sequence for optimized human IFN-a 2b is
based on the hen oviduct optimized codon usage and was created using the
BACKTRANSLATE program of the Wisconsin Package, Version 9:1 (Genetics
Computer Group Inc., Madison, Wis.) with a codon usage table compiled from the
chicken (Gallus gallus) ovalbumin, lysozyme, ovomucoid, and ovotransferrin
proteins.
For example, the percent usage for the four codons of the amino acid alanine
in the
four egg white proteins is 34% for GCU, 31 o for GCC, 26% for GCA, and 8% for
GCG. Therefore, GCU was used as the codon for the majority of alanines in the
optimized human IFN-a 2b coding sequence. The vectors containing the gene for
optimized human IFN-a 2b were used to create transgenic avians that express
transgenic poultry derived interferon-a 2b (TPD IFN-a 2b) in their tissues and
eggs.
The template and primer oligonucleotides listed in Table 4 below were
amplified by PCR with Pfu polymerase (Stratagene, La Jolla, Calif.) using 20
cycles of
94 C for 1 min.; 50 C. for 30 sec.; and 72 C. for I min. and 10 sec. PCR
products were
purified from a 12% polyacrylamide-TBE gel by the "crush and soak" method
(Maniatis et al. 1982), then combined as templates in an amplification
reaction using
only IFN-1 and IFN-8 as primers (see Table 4). The resulting PCR product was
digested with Hind III and Xba I and gel purified from a 2% agarose-TAE gel,
then
ligated into Hind III and Xba I digested, alkaline phosphatase-treated
pBluescript KS
(Stratagene), resulting in the plasmid pB1uKSP-IFNMagMax. Both strands were
sequenced by cycle sequencing on an ABI PRISM 377 DNA Sequencer (Perkin-Elmer,
Foster City, Calif.) using universal T7 or T3 primers. Mutations in pBIuKSP-
IFN
83
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
derived from the original oligonucleotide templates were corrected by site-
directed
mutagenesis with the Transformer Site-Directed Mutagenesis Kit (Clontech, Palo
Alto,
Calif.). The IFN coding sequence was then removed from the corrected pB1uKSP-
IFN
with Hind III and Xba 1, purified from a 0.8% agarose-TAE Gel, and ligated to
Hind
III and Xba I digested, alkaline phosphatase-treated pCMV-BetaLa-3B-dH. The
resulting plasmid was pCMV-IFN which contained an IFN coding sequence
controlled
by the cytomegalovirus immediate early promoter/enhancer and SV40 polyA site.
In
order to clone the IFN coding sequence controlled by the CMV promoter/enhancer
into
the NLB retroviral plasmid, pCMV-IFN was first digested with CIaI and Xbal,
then
both ends were filled in with Kienow fragment of DNA polymerase (New England
BioLabs, Beverly, Mass.). pNLB-adapter was digested with Ndel and Kpnl, and
both
ends were made blunt by T4 DNA polymerase (New England BioLabs). Appropriate
DNA fragments were purified on a 0.8% agarose-TAE gel, then ligated and
transformed into DH5 a cells. The resulting plasmid was pNLB-adapter-CMV-IFN.
This plasmid was then digested with Miul and partially digested with BIpI and
the
appropriate fragment was gel purified. pNLB-CMV-EGFP was digested with M1uI
and
BipI, then alkaline-phosphatase treated and gel purified. The MIuI/Bipl
partial
fragment of pNLB-adapter-CMV-IFN was ligated to the large fragment derived
from
the MluI/B1pI digest of pNLB-CMV-EGFP creating pNLB-CMV-IFN.
25
84
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Table 4
Sequence
Templa Primer Primer of Primer
te Sequence af Tem late I Sequence of Primer 1 2 2
IFN-A 5'ATGGCTTTGACCT77GCC7TACTG IFN-1 5'CCCAAGCTT1 CACCATGG IFN-2 S'CTGTG
SEQ ID GTGGCTCTCCTGGTGCTGAGCTGCA SEQ ID CTTTGACCTITGCCTT3' SEQ ID GGTCTGA
NO:B AGAGCAGCTGCTCTGTGGGCTGCG NO: 9 NO: 10 GGCAGA
ATCTGCCTCA3' T3'
IFN-B 5'GACCCACAGCCTGGGCAGCAGGA IFN-2b 5'ATCTGCCTCAGACCCACA IFN-3b 5'AACTC
SEQID GGACCCTGATGCTGCTGGCTCAGAT SEQID G3' SEQID CTC7TGA
NO:II GAGGAGAATCAGCCTGTTTAGCTG NO: 12 NO: 13 GGAAAG
CCTGAAGGATAGGCACGATTTI'GG CCAAAAT
CTTT3' C3'
IFN-C 5'CTCAAGAGGAGTITGGCAACCAG IFN-3c 5'GATTTTGGCTT7CCTCAA IFN-4 5'ATCTGC
SEQ 1D TTTCAGAAGGCTGAGACCATCCCTG SEQ ID GAGGAGTT3' SEQ ID TGGATCA
NO: 14 TGCTGCACOAGATG3' NO: 15 NO: 16 TCTCGTG
C3'
IFN-D 5'ATCCAGCAGATCTTTAACCTGTTT IFN-4b 5'GCACGAGATGATCCAGC IFN-5 5'ATCGTT
SEQ ID AGCACCAAGGATAGCAGCGCTGCT SEQ ID AGAT3' SEQ ID CAGCTGC
NO: 14 TGGGATGAGACCCTGCTGGATAAG NO:18 NO: 19 TGGTACA
T'i'ITACACCGAGCTGTACCAGCA3' 3'
IFN-E 5'GCTGAACGATCTGGAGGCTTGCG IFN-5b 5'TGTACCAGCAGCTGAAC IFN-6 5'CCTCAC
SEQID TGATCCAGGGCGTGGGCGTGACCG SEQID GAT3' SEQID AGCCAG
NO: 20 AGACCCCTCTGATGAAGGAGGATA NO: 21 NO: 22 GATGCTA
GCATCCT3' T3'
IFN-F 5'GGCTGTGAGGAAGTACTTTCAGA IFN-6b 5'ATAGCATCCTGGCTGTGA IFN-7 5'ATGAT
SEQID GOATCACCCTGTACCTGAAGGAGA SEQID GG3' SEQID CTCAGCC
NO: 23 AGAAGTACAGCCCTTGCGCTTGGG NO:24 NO: 25 CTCACGA
AAGTCGTGAGGG3' C3'
!FN-G 5'CTGAGATCATGAGGAGCTTTAGC IFN-7b 5'GTCGTGAGGGCTGAGAT IFN-8 5'TGCTCT
SEQID CTGAGCACCAACCTGCAAGAGAGC SEQID CAT3' SEQID AGACTTT
NO: 26 TTGAGGTCTAAGGAGTAA3' NO: 27 NO: 28 rrACTCC
TTAGACC
TCAAGCT
CT3'
Example 13
Production of Transgenic Chickens and Fully Transgenic GI Chickens Expressing
IFN
Transduction particles of pNLB-CMV-IFN were produced following the
procedures of Example 2. Approximately 300 White Leghorn (strain Line 0) eggs
were windowed according to the Speksnijder procedure (U.S. Pat. No.
5,897,998), then
injected with about 7x104 transducing particles per egg. Eggs hatched 21 days
after
injection, and human IFN levels were measured by IFN ELISA from serum samples
collected from chicks one week after hatch.
In order to screen for GO roosters which contained the IFN transgene in their
sperm, DNA was extracted from rooster sperm samples by Chelex-100 extraction
(Walsh et al., 1991). DNA samples were then subjected to Taqman analysis on a
7700 Sequence Detector (Perkin Elmer) using the "neo for-1" (5'-
TGGATTGCACGCAGGTTCT-3'; SEQ ID NO: 5) and "neo rev-1 "(5'-
GTGCCCAGTCATAGCCGAAT-3'; SEQ ID NO: 6) primers and FAM labeled NEO-
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
PROBEI (5'-CCTCTCCACCCAAGCGGCCG-3'; SEQ ID NO: 7) to detect the
transgene. Three GO roosters with the highest levels of the transgene in their
sperm
samples were bred to nontransgenic SPAFAS (White Leghorn) hens by artificial
insemination.
Blood DNA samples were screened for the presence of the transgene by
Taqman analysis as described above. Out of 1,597 offspring, one rooster was
found
to be transgenic (a.k.a. "Alphie"). Alphie's serum was tested for the presence
of hIFN
by hIFN ELISA, and hIFN was present at 200 ng/ml.
Alphie's sperm was used for artificial insemination of nontransgenic SPAFAS
(White Leghorn) hens. 106 out of 202 (about 52%) offspring contained the
transgene
as detected by Taqman analysis. These breeding results followed a Mendelian
inheritance pattern and indicated that Alphie is transgenic.
Example 14
Carbohydrate Analysis of Transgenic Poultry Derived Interferon-a 2b (TPD IFN-a
2b)
Experimental evidence revealed a new glycosylation pattern in interferon-a 2b
derived from avians (i.e., TPD IFN-a 2b). TPD IFN-a 2b was found to contain
two
new glyco forms (bands 4 and 5 are a -Gal extended disaccharides; see FIG. 9)
not
normally seen in human peripheral blood leukocyte derived interferon-a 2b (PBL
IFN-
a 2b) or natural human interferon-a 2b (natural hIFN). TPD IFN-a 2b was also
found
to contain 0-linked carbohydrate structures that are similar to human PBL IFN-
a 2b
and was more efficiently produced in chickens then the human form.
The coding sequence for human IFN-a 2b was optimized (Example 12, supra)
resulting in a recombinant IFN-a 2b coding sequence. TPD IFN-a 2b was then
produced in chickens (Example 13, supra). A carbohydrate analysis, including a
monosaccharide analysis and FACE analysis, revealed the sugar make-up or novel
glycosylation pattern of the protein. As such, TPD IFN-a 2b showed the
following
monosaccharide residues: N-Acetyl-Galactosamine (NAcGal), Galactose (Gal), N-
Acetyl-Glucosamine (NAcGlu), and Sialic acid (SA). No N-linked glycosylation
was
found in TPD IFN-a 2b. Instead, TPD IFN-a 2b was found to be O-glycosyiated at
Thr-106. This type of glycosylation is similar to human IFN-a 2, wherein the
Thr
86
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
residue at position 106 is unique to IFN-a 2. In addition, TPD IFN-a 2b was
found to
have no mannose residues. A FACE analysis revealed 6 bands (FIG. 9) that
represent
various sugar residues, wherein bands 1, 2 and 3 are un-sialylated, mono-
sialylated,
and di-sialylated, respectively (FIG. 10). The sialic acid (SA) linkage is
alpha 2-3 to
Galactose (Gal) and alpha 2-6 to N-Acetyl-Galactosamine (NAcGaI). Band 6
represents an un-sialylated tetrasaccharide. Bands 4 and 5 were found to be
alpha-
Galactose (alpha-Gal) extended disaccharides that are not seen in human PBL
IFN-a
2b. FIG. 10 shows the comparison of TPD IFN-a 2b (egg white hIFN) and human
PBL IFN-a 2b (natural hIFN). Minor bands were present between bands 3 and 4
and
between bands 4 and 5 in TPD IFN-a 2b (vide infra).
The protein was found to be 0-glycosylated at Thr-106 with specific residues,
such as:
(i) Gal-NAcGal-
(ii) SA-Gal-NAcGaI-
(iii) SA-Gal-NAcGaI-
1
SA
(iv) GaI-NAcGIu-NAcGaI-
I
Gal
(v) Gal-Gal-NAcGa1-
(vi) Gal-Gal-NAcGal-
1
SA
wherein Gal=Galactose,
NAcGaI=N-Acetyl-Galactosamine,
NAcGlu=N-Acetyl-Glucosamine, and
SA=Sialic Acid.
87
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
The percentages were as follows:
(i) Gal-NAcGaI- is about 20%
(ii) SA-Gal-NAcGaI- is about 29%
(iii) SA-Gal-NAcGal- is about 9%
1
SA
(iv) Gal-NAcGIu-NAcGaI- is about 6%
Gal
(v) Gal-Gal-NAcGal- is about 7%
(vi) Gal-Gal-NAcGaI- is about 12%
1
SA
Minor bands were present between bands 3 and 4 and between bands 4 and 5
which account for about 17% in TPD IFN-a 2b.
Example 15
Expression of MAbs from Plasmid Transfection and Retroviral Transduction Using
the
EMCV IRES in Avian Cells
The light chain (LC) and heavy chain (HC) of a human monoclonal antibody
were expressed from a single vector, pCMV-LC-emcvlRES-HC, by placement of an
IRES from the encephalomyocarditis virus (EMCV) (see also Jang et al. (1988)
"A
segment of the 5' nontranslated region of encephalomyocarditis virus RNA
directs
internal entry of ribosomes during in vitro translation" J. Virol. 62:2636-
2643) between
the LC and HC coding sequences. Transcription was driven by the CMV promoter.
In order to test expression of monoclonal antibodies from two separate
vectors,
the LC or HC linked to the CMV promoter were cotransfected into LMH/2a cells,
an
estrogen-responsive, chicken hepatocyte cell line (see also Binder et al.
(1990)
"Expression of endogenous and transfected apolipoprotein II and vitellogenin
II genes
in an estrogen responsive chicken liver cell line" Mol. Endocrinol. 4:201-
208).
88
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Contransfection of pCMV-LC and pCMV-HC resulted in 392 ng/ml of MAbs
determined by a MAb ELISA whereas transfection of pCMV-LC-emcvlRES-HC
resulted in 185 nglml of MAb.
The CMV-LC-emcv-HC cassette was inserted in a retroviral vector based on
the Moloney murine leukemia virus (MLV), creating pL-CMV-LC-emcvlRES-HC-
RN-BG. LMH cells (see also Kawaguchi et at. (1987) "Establishment and
characterization of a chicken hepatocellular carcinoma cell line, LMH" Cancer
Res.
47:4460-4464), the parent line of LMH/2a, were used as target cells because
they are
not neomycin resistant. LMH cells were transduced with the L-CMV-LC-emcvlRES-
HC-RN-BG retroviral vector and selected with neomycin and passaged for several
weeks. LMH cells were separately transduced and neomycin selected with the
parent
MLV vector, LXRN. Media from LXRN cells were negative for MAb, whereas media
from the L-CMV-LC-emcvIRES-HC-RN-BG-transduced cells contained 22 ng/ml of
MAb.
Example 16
Production of Transgenic Chickens and Fully Transgenic G1 Chickens Expressing
MAbs
A pNLB-CMV-LC-emcv-HC vector is produced by substituting the CMV-LC-
emev-HC cassette of Example 15 for the CMV-BL cassette of pNLB-CMV-BL of
Example I.
Transduction particles of pNLB-CMV-LC-emcv-HC are produced following
the procedures 6f Example 2. Approximately 300 White Leghorn (strain Line 0)
eggs
are windowed according to the Speksnijder procedure (U.S. Pat. No. 5,897,998)
and
are then injected with about 7x104 transducing particles per egg. Eggs hatch
21 days
after injection, and human MAb levels are measured by ELISA from serum samples
collected from chicks one week after hatch.
GO roster which contain the transgene in their sperm are identified by Taqman
analysis. Three GO roosters with the highest levels of the transgene in their
sperm
samples are bred to nontransgenic SPAFAS (White Leghorn) hens by artificial
insemination.
89
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Over 1000 offspring are screened and more than 10 chicks are found to be
transgenic (GI avians). Chick serum is tested for the presence of the MAb by
ELISA.
The MAb is found to be present in an amount greater than 10 g/ml of serum.
Egg
white in eggs from G I hens is also tested for the presence of the MAb by
ELISA and is
found to be present in an amount greater than 10 g/ml of egg white.
Example 17
Construction of pNLB-CMV-hG-CSF
This vector construction effectively replaces the IFN coding region of the
pNLB-CMV-IFN vector of Example 12 with the coding sequence of G-CSF. The hG-
CSF ORF (human granulocyte colony stimulating factor open reading frame) was
amplified from pORF9-hG-CSFb (cat. no. porf-hgcsfb, Invivogen, San Diego,
CA)with
the primers 5'GCSF (ggggggaagctttcaccatggctggacctgcca; SEQ ID NO: 32) and
3'GCSF (actagacttttcagggctgggcaaggtggcg; SEQ ID NO: 33) to create a 642 base
pair
(bp) PCR product. In order to provide the pNLB-CMV-hG-CSF construct with a
sequence 3' of the G-CSF coding sequence identical to that found in pNLB-CMV-
IFN
alpha-2b, an 86 bp fragment of pNLB-CMV-IFN alpha-2b, which is present
adjacent to
the 3' end of the INF coding sequence, was amplified by PCR using the primers
5'GCSF-NLB (ccagccctgaaaagtctagtatggggattggtg; SEQ ID NO: 34) and 3'GCSF-NLB
(gggggggctcagctggaattccgcc; SEQ ID NO: 35). The two PCR products (642 bp and
86
bp) were mixed and fused by PCR amplification with primers 5'GCSF and 3'GCSF-
NLB. The PCR product was cloned into pCR 4Blunt-TOPO plasmid vector
(Invitrogen) according to the manufacturer's instructions and electroporated
into
DH5a-E cells, producing pFusion-hG-CSF-NLB. pFusion-hG-CSF-NLB was digested
with Hind III and Blp I and the 690 bp G-CSF fragment was gel purified. The
IFN
alpha-2b coding sequence was removed from pNLB-CMV-IFN alpha-2b by digesting
with Blp I. The vector was then religated and clones were selected which
lacked the
IFN coding insert, creating pNLB-CMV-delta hIFN alpha-2b. pNLB-CMV-delta IFN
alpha=2b was digested with Blp I and partially digested with Hind III and the
8732 bp
Blp I- Hind III vector fragment was gel purified. The 8732 bp fragment was
ligated to
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
the 690 bp Hind III /Blp I G-CSF fragment to create pNLB-CMV-G-CSF. The G-CSF
ORF was verified by sequencing.
Example 18
Production of Transgenic Chickens Expressing human pranulocyte colony
stimulating
factor (hG-CSF).
Production of NLB-CMV-hG-CSF transduction particles was performed as
described for NLB-CMV-BL in Example 2. The embryos of 277 stage X eggs were
injected with 7 l of NLB-CMV-hG-CSF transduction particles (titers were
2.1x107-
6.9x107). 86 chicks hatched and were raised to sexual maturity. 60 chicks
tested
positive for G-CSF which were evenly divided in sex; 30 male and 30 females.
Egg
white from 21 hens was assayed by ELISA for the presence of hG-CSF. Five hens
were found to have significant levels of hG-CSF protein in the egg white at
levels that
ranged from 0.05 ug/ml to 0.5 g/ml.
DNA was extracted from rooster sperm samples by Chelex-100 extraction
(Walsh et a]., 1991). DNA samples were then subjected to TaqmanTM analysis on
a
7700 Sequence Detector (Perkin Elmer) using the primers SJ-G-CSF for
(cagagcttcctgctcaagtgctta; SEQ ID NO: 36) and SJ-G-CSF rev
(ttgtaggtggcacacagcttct;
SEQ ID NO: 37) and the probe, SJ-G-CSF probe (agcaagtgaggaagatccagggcg; SEQ ID
NO: 38), to detect the transgene. The rooster with the highest levels of the
transgene in
his sperm samples was bred to nontransgenic SPAFAS (White Leghorn) hens by
artificial insemination.
Blood DNA samples were screened for the presence of the transgene by
TaqmanT" analysis as described above. Out of 2264 offspring, 13 GIs were found
to be
transgenic and each were serum positive for the presence of G-CSF with one hen
(XGF498) having approximately 136.5 ng/ml G-CSF in the serum and 5.6 g/ml G-
CSF in the egg white, each as measured by ELISA.
Two G1 roosters (QGF910 and DD9027) which were of the same line as
XGF498 (therefore having the identical transgene inserted into identical
position in the
genome) were crossed with nontransgenic hens, to produce female offspring that
lay
eggs containing poultry derived G-CSF. Milligram quantities of the G-CSF were
91
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
purified from egg white collected from eggs of QGF910 and DD9027 offspring.
Patterns of representative glycosylation structures of the poultry derived G-
CSF were
determined from the G-CSF obtained as disclosed in Example 20.
Example 19
Production of Transgenic Chickens Expressing human cytotoxic lymphoctye
antigen
four-Fc fusion protein (CTLA4-Fc)
pNLB-1.80M-CTLA4Fc and pNLB-3.90M-CTLA4Fc were constructed as
disclosed in US Patent Application No. 11/047,184, filed January 31, 2005, the
disclosure of which is incorporated in its entirety herein by reference.
Production of
pNLB-1.80M-CTLA4Fc and pNLB-3.90M-CTLA4Fc transduction particles were
performed as described for pNLB-CMV-BL in Example 2. 193 white leghorn eggs
were injected with 7 l of pNLB-l.80M-CTLA4Fc transduction particles (titers
were
- 4x 106) and 72 chicks hatched. 199 white leghorn eggs were injected with 7
l of
pNLB-3.90M-CTLA4Fc transduction particles (titers were - 4x106) and 20 chicks
hatched.
Egg white from 30 hens produced with the pNLB-1.80M-CTLA4Fc particles
were assayed by ELISA for the presence of CTLA4-Fc. One hen was found to have
significant levels of CTLA4-Fc protein in the egg white at an average level of
0.132
p.g/ml (5 eggs assayed).
Egg white from seven hens produced with the pNLB-3.90M-CTLA4Fc
particles were assayed by ELISA for the presence of CTLA4-Fc. Two hens were
found
to have significant levels of CTLA4-Fc protein in the egg white at an average
level of
0.164 g/ml (5 eggs assayed) for one hen and an average level of 0.123 g/ml
(5 eggs
assayed) for the second positive hen.
Example 20
Carbohydrate analysis of Transgenic Poultry Derived G-CSF
The TPD G-CSF oligosaccharide structures were determined by employing the
following analysis techniques as are well known to practitioners of skill in
the art.
MALDI-TOF-MS (Matrix assisted laser desorption ionization time-of-flight mass
92
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
spectrometry) analysis and ESI MS/MS (electrospray ionization tandem mass
spectrometry) were performed on the oligosaccharides after release from the
peptide
backbone. The 0-linked oligosaccharides were chemically released from the
protein
and were permethylated using the NaOH method involving reaction with methyl
iodide
under anhydrous DMSO and extracted into chloroform prior to analysis. Direct
mass
spectrometry was performed on the intact glycosylated G-CSF. Analyses were
also
performed on the polysaccharide structures using HPLC analysis. Briefly, after
release
from the protein backbone the structures were separated using HPLC. Samples of
the
individual polysaccharide species were digested with certain enzymes and the
digest
products were analyzed by HPLC providing for structure determination as is
understood in the art.
The structures as determined are shown below. Interestingly, Structure C and
Structure D may be precursor forms of Structure E shown below. It has been
estimated, the invention not being limited thereto, that structure A is
present on the
poultry derived glycosylated G-CSF about 20% to about 40% of the time and that
structure B is present on the poultry derived glycosylated G-CSF about 5% to
about
25% of the time and that structure. C is present on the poultry derived
glycosylated G-
CSF about 10% to about 20% of the time and that structure D is present on the
poultry
derived glycosylated G-CSF about 5% to about 15% of the time and that
structure E is
present on the poultry derived glycosylated G-CSF about 1% to about 5% of the
time
and that structure F is present on the poultry derived glycosylated G-CSF
about 10% to
about 25% of the time and that structure G is present on the poultry derived
glycosylated G-CSF about 20% to about 30% of the time.
A B c
SA-Gal-NAcGal-; Gal-NAcGlu-NAcGal-; Gal-NAcGIu-NAcGaI-;
( I
Gai Gal
1
SA
93
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
D E F
SA-Gal-NAcGlu-NAcGaI-; SA-Gal-NAcGIu-NAcGaI-; Gal-NAcGaI-;
I I
Gal Gal
1
SA
G
SA-Gal-NAcGaI-
I
SA
Monosaccharide analysis was performed by GC/MS (gas chromatography-
mass spectrometry) on poultry derived G-CSF that had been - spiked with
Arabitol
(internal standard), hydrolyzed, N-acetylated and TMS derivatized using
methods
readily available to those skilled in the art. The derivatized sample was
compared to a
standard mixture of sugars similarly derivatized. Sialic acid analysis of the
poultry
derived G-CSF was performed after spiking with ketodeoxynonulosonic acid,
lyophilized then hydrolyzed, desalted and re-lyophilized.. Analysis of the
sample was
performed on a Dionex BioLC system using appropriate standards. These analyses
showed the presence of galactose, glucose, N-acetylgalactosamine, N-
acetylglucosamine and sialic acid (N-acetylneuraminic acid) as seen in Table
5. The
data in Table 5 supersedes preliminary data generated by HPAEC-PAD analysis
which
determined a greater percentage of N-acetylglucosamine to be present.
Table 5
TPD G-CSF
Monosaccharide Nmoles Nmoles
detected Detected/mg
Galactose 4.5 34.5
N-Acet i alactosamine 2.9 22.2
N-Acet 1 lucosamine 0.95 7.3
Sialic Acid 6.0 46.0
Linkage analysis was performed on a permethylated glycan sample of the
poultry derived G-CSF that was hydrolyzed in TFA and reduced in sodium
borodeuteride. The borate was removed by three additions of methanol:glacial
acetic
94
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
acid (9:1) followed by lyophilization and then acetylation by acetic
anhydride. After
purification by extraction with chloroform, the sample was examined by GC/MS.
A
mixture of standards was also run under the same conditions. The linkages were
determined as follows:
i. The sialic acid linkage is 2-3 to galactose and 2-6 to N-
acetylgalactosamine
ii. The galactose linkage is 2-3 to N-acetylgalactosamine and 2-4 to N-
acetylglucosamine
iii. The N-acetylglucosamine linkage is 2-6 to N-acetylgalactosamine
Example 21
In vitro Cell Proliferation Activity of Poultry Derived G-CSF (TPD G-CSF)
The in vitro biological activity of TPD G-CSF was demonstrated using the NFS-
60 cell proliferation assay. Briefly, NFS-60 cells were maintained in growth
media
containing GM-CSF. Confluent cultures were harvested, washed and plated at a
cell
density of 105 cells per well with growth media alone. TPD G-CSF and bacterial
derived human G-CSF (i.e., Neupogen ) were serial diluted in growth media and
added to separate wells in triplicate. Cell proliferation was determined by
metabolic
reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide
(MTT) and
was quantified spectrophotometrically. The specific activity of the avian
derived G-
CSF was determined by comparing the ED50 of Neupogen with that of the
purified
avian derived G-CSF. The specific activity of TPD G-CSF over a 14 day period
was
determined to be well in excess of that of the bacterial derived G-CSF
Neupogen
(non-glycosylated G-CSF). See FIG. 17.
Example 22
Construction of vNLB-CMV-Des-Arg166-EPO
pNLB-CMV-IFN described in Example 12 was digested with Hind III and
EcoRl in order to replace the hIFN a2 coding sequence and signal peptide
coding
sequence with an EPO coding sequence plus signal peptide (SEQ ID NO: 42) shown
below. Because multiple EcoRI and Hind III sites exist in the vector, RecA-
assisted
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
restriction endonuclease (RARE) cleavage method was used to cut the desired
sites.
The following oligonucleotides were used in the RARE procedure:
pnlbEcoRI3805rare (5'-GAC TCC TGG AGC CCG TCA GTA TCG GCG GAA TTC
CAG CTG AGC GCC GGT CGC TAC CAT TAC-3') (SEQ ID NO: 43) and
pnlbHinD III3172rare (5'-TAA TAC GAC TCA CTA TAG GGA GAC CGG AAG
CTT TCA CCA TGG CTT TGA CCT TTG CCT TAC-3') (SEQ ID NO: 44).
A linearized vector of 8740 bp was obtained and was gel purified.
The EPO insert was prepared by overlap PCR as follows. The first PCR
product was produced by amplification of a synthetic EPO sequence cloned into
a
standard cloning vector with Pfu polymerase and the following primers:
5'pNLB/Epo
(5'-GGGGGGAAGCTTTCACCATGGGCGTGCACGAG-3') (SEQ ID NO: 45) and
pNLB/3'Epo (5'-TCCCCATACTAGACTTTTTACCTATCGCCGGTC-3') (SEQ II)
NO: 46). The second PCR product was produced by amplification of a region of
pNLB-CMV-hIFN alpha-2b with Pfu polymerase and the following primers:
3'Epo/pNLB* (5'-ACCGGCGATAGGTAAAAAGTCTAGTATGGG-3') (SEQ ID NO:
47) and pNLB/Sapl (5'-GGGGGGGCTCTTCTCAGCTGGAATTCCGCCGATAC-3')
(SEQ ID NO: 48). The two PCR products were mixed and reamplified with the
following primers: 5'pNLB/Epo (5'-
GGGGGGAAGCTTTCACCATGGGCGTGCACGAG-3') (SEQ ID NO: 45) and
pNLB/Sapl (5'-GGGGGGGCTCTTCTCAGCTGGAATTCCGCCGATAC-3') (SEQ
ID NO: 48).
The fusion PCR product was digested with Hind III and Eco RI and a 633 bp
fragment
gel purified. The 8740 bp and 633 bp fragments were ligated to create pNLB-CMV-
EPO.
EPO I - Synthetic EPO sequence (610 nt)
AAGCTTTCACCATGGGCGTGCACGAGTGCCCTGCTTGGCTGTGGCTGCTCTT
GAGCCTGCTCAGCCTGCCTCTGGGCCTGCCTGTGCTGGGCGCTCCTCCAAG
GCTGATCTGCGATAGCAGGGTGCTGGAGAGGTACCTGCTGGAGGCTAAGG
AGGCTGAGAACATCACCACCGGCTGCGCTGAGCACTGCAGCCTGAACGAG
AACATCACCGTGCCTGATACCAAGGTGAACTTTTACGCTTGGAAGAGGATG
GAGGTGGGCCAGCAGGCTGTGGAGGTGTGGCAGGGCCTGGCTCTGCTGAG
CGAGGCTGTGCTGAGGGGCCAGGCTCTGCTGGTGAACAGCTCTCAGCCTTG
96
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
GGAGCCTCTGCAGCTGCACGTGGATAAGGCTGTGAGCGGCCTGAGAAGCC
TGACCACCCTGCTGAGGGCTCTGAGGGCTCAGAAGGAGGCTATCAGCCCTC
CAGATGCTGCAAGCGCTGCCCCTCTGAGGACCATCACCGCTGATACCTTTA
GGAAGCTGTTTAGGGTGTACAGCAACTTTCTGAGGGGCAAGCTGAAGCTGT
ACACCGGCGAGGCTTGCAGGACCGGCGATAGGTAAAAAGGCCGGCCGAGC
TC (SEQ ID NO: 42)
An EPO coding sequence is produced which codes for a 165 amino acid form
of EPO with the terminal codon (coding for arginine at position 166) removed.
A 179
bp region of pNLB-CMV-EPO corresponding to the sequence that extends from an
Eco 47111 site that resides in the EPO coding sequence to an EcoRI site that
resides
downstream of the EPO stop codon in pNLB-CMV-EPO was synthesized with the
terminal arginine codon (position 166) eliminated so that aspartic acid (amino
acid
165) will be the terminal amino acid codon, resulting in a 176 bp Eco
47111/EcoR1
fragment. The fragment was synthesized by Integrated DNA Technologies
(Coralville,
Iowa 52241) and cloned into a pDRIVE vector (Qiagen, Inc), creating pDRIVE-des-
Arg166-EPO. The 176 bp Eco 47III/EcoRI fragment was subcloned into the
Eco471I1/EcoRI site of pNLB-CMV-EPO, creatingpNLB-CMV-Des-Arg166-EPO.
Transduction particles were prepared from the pNLB-CMV-Des-Argl66-EPO
essentially as described in Example 2.
Example 23
Production of Transgenic Chickens Expressing Human Erythopoietin
1234 White Leghorn chicken eggs were windowed and injected with the
transduction particles essentially as described in Example 2. 334 of the eggs
hatched.
DNA was extracted from rooster spenn samples by Chelex-100 extraction (Walsh
et
al., 1991). DNA samples were then subjected to TaqmanTM analysis on a 7700
Sequence Detector (Perkin Elmer) to detect the transgene. Seven of the hatched
GO
roosters tested positive for the NLB-CMV-EPO transgene. Three of the chimeric
germline transgenic roosters that tested positive for the NLB-CMV-EPO
transgene
were bred to non-transgenic females by artificial insemination to produce 1190
offspring, 14 of which were transgene positive germline transgenic Gl's. Egg
white of
97
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
eggs laid by the GI germline transgenic females or their descendents contained
about
0.4 to 1.9 g/ml of EPO, as determined by ELISA.
Example 24
Purification of Transizenic Poultry Derived EPO
Egg white from eggs of transgenic chickens which produce EPO in their
oviduct was diluted with three volumes of 50 mM sodium acetate, pH 4.6, mixed
and
then filtered and loaded on to a Sepharose cation exchange column. Following a
wash
of the column with 50 mM sodium acetate, pH 5.0, containing 100 mM NaCI, the
EPO
was eluted with the same acetate buffer containing 500 mM NaCl together with
0.05%
Tween 20. The EPO eluted from the Sepharose column was loaded on to a Phenyl
Sepharose hydrophobic interaction chromatography column. The column was
equilibrated with 2 M NaCI, 50 mM Tris-HCI, pH 7.2, 0.05% Tween 20. The same
buffer was used to wash the column after loading of the preparation. This is
followed
by a water wash. EPO was subsequently eluted with 30% IPA. The EPO preparation
was then applied to a reversed-phase HPLC column and the EPO eluted with an
increasing concentration of ethanol in 0.1% trifluoroacetic acid. The peak of
EPO
elution occurs at an ethanol concentration of about 53%. Diafiltration was
used to
concentrate the final EPO preparation and to replace the solvent with 0.1 M
sodium
phosphate buffer, pH 7Ø
Example 25
Carbohydrate analysis of Transgenic Poultry Derived Erythropoietin
The oligosaccharide structures were determined for avian derived human EPO
by employing the following analysis techniques as are well known to
practitioners of
ordinary skill in the art.
The 0-linked oligosaccharides were chemically released from the protein and
the N-linked oligosaccharides were enzymatically released from the protein.
After
release, the 0-linked and the N-linked oligosaccharides were permethylated
using the
NaOH method involving reaction with methyl iodide under anhydrous DMSO and
98
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
were then extracted into chloroform prior to analysis. The structures were
separated
using HPLC.
MALDI-TOF-MS (Matrix assisted laser desorption ionization time-of-flight
mass spectrometry) analysis and ESI MS/MS (electrospray ionization tandem mass
spectrometry) were performed on the oligosaccharides after release from the
peptide
backbone and purification as is understood in the art. Samples of the
individual
polysaccharide species were also digested with certain enzymes and the digest
products
were analyzed by HPLC as is understood in the art.
The O-tinked and N-linked oligosaccharide structures shown below were
identified. Linkage analysis of the structures revealed the linkages shown in
FIGS. 20
and 21.
N-linked EPO structures are shown below.
^_'
A-n
^~
25 ^
B-n
^
^
~ C-n
~
L._l
99
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
^-
D-n
^~
^
E-n
^
F-n
Da.
G-n
DD`~
^
H-n
El/"'
l00
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
I-n
J-n
^
.^ K-n
^
^~
i;`~.: - ^
L-n
^
^~ M-n
^/
101
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
NIEI~
^~ N-n
^--
^
^-^ 0-n
^
^'i
~^ P-n
~ :;' ;: _.. ^ ^-'^
Q-n
~p Gaf ^ NAcGIu = Sialic Acid 0 Mannose
102
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
0-linked EPO structures are shown below.
(i) SA-Gal-NAcGaI Structure A-o
(ii) Gal-NAcGlu-NAcGaI Structure B-o
I
Gal
(iii) Gal-NAcGIu-NAcGaI Structure C-o
Gal
1
SA
(iv) SA-GaI-NAcGIu-NAcGaI Structure D-o
1
Gal
(v) SA-Gal-NAcGIu-NAcGaI Structure E-o
1
Gal
I
SA
(vi) Gal-NAcGaI Structure F-o
(vii) SA-NAcGaI Structure G-o
1
Gal
(
SA
wherein Gal=Galactose,
NAcGa1=N-Acetyl-Galactosamine,
NAcGIu=N-Acetyl-Glucosamine, and
SA=Sialic Acid.
103
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
Example 26
Carbohydrate Analysis of Transgenic Poultry Derived EPO
Monosaccharide analysis of EPO obtained from a transgenic chicken was
performed by GC/MS (gas chromatography-mass spectrometry). The sample was
spiked with Arabitol (internal standard), hydrolyzed, N-acetylated and TMS
derivatized using methods readily available to those skilled in the art. The
derivatized
sample was compared to a standard mixture of sugars similarly derivatized.
Sialic
acid analysis of the EPO was performed after spiking with ketodeoxynonulosonic
acid,
lyophilizing then hydrolyzing, desalting and re-lyophilizing. Analysis of the
sample
was performed on a Dionex BioLC system using appropriate standards. Table 6
shows
the quantification of monosaccharides detected for the EPO. Trace amounts of
contaminating xylose, fucose and glucose were also detected in the
monosaccharide
analysis. The data in Table 6 supersedes preliminary data generated by HPAEC-
PAD
analysis.
TABLE 6
nmoles nmoles
Monosaccharide detected detected/rng
sample
Mannose 49 245
Galactose 16 80
N-Acetylgalactosamine 6.0 30
N-Acetylglucosamine 91 455
Sialic acid 4.7 24
Example 27
In vitro Cell Proliferation Activity of TPD Human EPO
The in vitro biological activity of the poultry derived human EPO was
demonstrated using the TF-1 cell proliferation ,assay. Two separate samples
representing two fractions (SP1 column: 130 mM NaCl and 250 mM NaCI) recovered
104
CA 02668487 2009-05-04
WO 2008/057161 PCT/US2007/021643
from an initial ion exchange purification step were tested. Each of the two
fractions
showed essentially the same cell proliferation activity and it was also
subsequently
shown that the glycosylated erythropoietin contained in the two fractions was
essentially the same. Briefly, TF-1 cells were maintained in growth media
containing
GM-CSF (2 ng/ml). Confluent cultures were harvested, washed and plated in
wells of
a standard 96 well plate (each well 0.32 cm2 ) at a cell density of 104 cells
per well in
growth media not containing GM-CSF. Avian derived EPO was serial diluted in
growth media and added to separate wells in triplicate. Cell proliferation.
after 5 days
was determined by metabolic reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide (MTT) and was quantified spectrophotometrically.
The
in vitro activity of the purified EPO is shown in FIG. 22.
All documents (e.g., U.S. patents, U.S. patent applications, publications)
cited
in the above specification are incorporated herein by reference. Various
modifications
and variations of the present invention will be apparent to those skilled in
the art
without departing from the scope and spirit of the invention. Although the
invention
has been described in connection with specific preferred embodiments, it
should be
understood that the invention as claimed should not be unduly limited to such
specific
embodiments. Indeed, various modifications of the described modes for carrying
out
the invention which are obvious to those skilled in the art are intended to be
within the
scope of the following claims.
105
