Note: Descriptions are shown in the official language in which they were submitted.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
1
MEGANUCLEASE VARIANTS CLEAVING A DNA TARGET SEQUENCE
FROM THE BETA-2-MICROGLOBULIN GENE AND USES THEREOF
The invention relates to a meganuclease variant cleaving a DNA
target sequence from the beta-2-microglobulin gene, to a vector encoding said
variant,
to a cell, an animal or a plant modified by said vector and to the use of said
meganuclease variant and derived products for genome therapy ex vivo (gene
cell
therapy), and genome engineering.
Proteins from the Major Histocompatibility Complex (MHC, also
called HLA for hu.mans) have a major role in allorecognition. These proteins
present
antigenic peptides to T cells. They can be classified in two different
complexes, MHC
class I and MHC class II. MHC class I complexes are ligands or specific T
cells and
NK cells immunoglobulin-like receptors. They involve highly polymorphic
proteins
and a small polypeptide, the (32-microglobulin, necessary for assembly of MHC
I
complexes at the cell surface (Zijlstra et al., Nature, 1990, 344, 742-746).
Since the
other components of the complex are encoded by multigenic families, knocking-
out
the (32-microglobulin gene (B2M in human) is the simplest way to suppress MHC
I
complexes (Koller et al., Proc. Nat. Acad. Sci. U. S. A., 1989, 86, 8932-8935
; Zijlstra
et al., Nature, 1990, 344, 742-746).
Because of their pivotal role in allorecognition, MHC proteins are
also major players in graft rejection. One could hypothesize that disruption
of MHC
class I proteins would at least partly alleviate graft rejection. However,
studies in mice
have provided a more mitigated picture. Whereas hematopoietic stem cells from
P2m
-/- mice are quickly rejected (Bix et al., Nature, 1991, 349, 329-331 ; Liao
et al.,
Science, 1991, 253, 199-202 ; Huang et al., J. Immunol., 2005, 175, 3753-3761;
Ruggeri et al., Immunol Rev, 2006, 214, 202-218), apparently as a consequence
of
NK cells activation, renal and pancreatic islets allograft from such KO
animals are
better tolerated (Markmann et al., Transplantation, 1992, 54, 1085-1089 ;
Coffinan et
al., J. Immunol., 1993, 151, 425-435). Thus, at least for certain tissues, the
inactivation of the human B2M gene could provide a solution for one of the
most
recurrent problems in transplantation. This could be used in many applications
in cell
therapy, for pancreatic, renal, and muscular tissues, including heart:
precursor cells
could be cultivated, treated ex vivo, and retransplanted into the patient.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
2
In adition, like immunoglobulins, prealbumin, and the beta protein
(APP) found in the amyloid of Alzheimer disease, beta-2-microglobulin has a
predominantly beta-pleated sheet structure that may adopt the fibrillar
conformation of
amyloid in certain pathologic states (Cunningham et al., Biochemistry, 1973,
12:
4811-4821). This includes Hemodialysis-Related Amyloidosis (HRA; Gorevic et
al.,
1986, Proc. Nat. Acad. Sci. 83: 7908-7912). Zingraff et al. (New Eng. J. Med.,
1990,
323: 1070-1071) described a patient with severe renal insufficiency who had
beta-2-
microglobulin amyloidosis despite the fact that dialysis had never been
performed.
The authors suggested also that some B2M variants are more amyloidogenic than
others. Thus, the inactivation of the human B2M gene could also provide a
solution
for treating pathologies associated with a fibrillar conformation of beta-2
microglobulin such as HRA.
Furthermore, the beta-2 microglobulin is highly expressed in the
majority of cells; insertion of an exogenous gene of interest at the beta-2
microglobulin locus has the advantage of reproducible expression levels of the
recombinant protein. Thus, gene targeting at the beta-2 microglobulin locus
allows the
engineering of transgenic animals or recombinant cell lines producing high
level of a
protein of interest.
Homologous gene targeting strategies have been used to knock out
endogenous genes (Capecchi, M.R., Science, 1989, 244, 1288-1292) including the
mouse B2M (or (32m) gene (Koller et al., Proc. Natl. Acad. Sci. U. S. A.,
1989, 86,
8932-8935), or knock-in exogenous sequences in the chromosome. Basically, a
DNA
sharing homology with the targeted sequence was introduced into the cell's
nucleus,
and the endogenous homologous recombination machinery provides for the next
steps
(figure la). Homologous recombination (HR), is a very conserved DNA
maintenance
pathway involved in the repair of DNA double-strand breaks (DSBs) and other
DNA
lesions (Rothstein, Methods Enzymol., 1983, 101, 202-211; Paques et al.,
Microbiol
Mol Biol Rev, 1999, 63, 349-404; Sung et al., Nat. Rev. Mol. Cell. Biol.,
2006, 7,
739-750) but it also underlies many biological phenomenon, such as the meiotic
reassortiment of alleles in meiosis (Roeder, Genes Dev., 1997, 11, 2600-2621),
mating
type interconversion in yeast (Haber, Annu. Rev. Genet., 1998, 32, 561-599),
and the
"homing" of class I introns and inteins to novel alleles. HR usually promotes
the
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
3
exchange of genetic information between endogenous sequences, but in gene
targeting
experiments, it is used to promote exchange between an endogenous chromosomal
sequence and an exogenous DNA construct. However, the process has a low
efficiency (10"6 to 10"9 of transfected cells).
This efficiency can be enhanced by a DNA double-strand break
(DSB) in the targeted locus. Such DSBs can be created by meganucleases, which
are
by definition sequence-specific endonucleases recognizing large sequences
(Thierry,
A. and B. Dujon, Nucleic Acids Res., 1992, 20, 5625-5631). These proteins can
cleave unique sites in living cells, thereby enhancing gene targeting by 1000-
fold or
more in the vicinity of the cleavage site (Puchta et al., Nucleic Acids Res.,
1993, 21,
5034-5040 ; Rouet et al., Mol. Cell. Biol., 1994, 14, 8096-8106 ; Choulika et
al., Mol.
Cell. Biol., 1995, 15, 1968-1973; Puchta et al., Proc. Natl. Acad. Sci.
U.S.A., 1996,
93, 5055-5060 ; Sargent et al., Mol. Cell. Biol., 1997, 17, 267-277; Cohen-
Tannoudji
et al., Mol. Cell. Biol., 1998, 18, 1444-1448 ; Donoho, et al., Mol. Cell.
Biol., 1998,
18, 4070-4078; Elliott et al., Mol. Cell. Biol., 1998, 18, 93-101), (figure 1
b).
However, although several hundreds of natural meganucleases, also referred to
as
"homing endonucleases" have been identified (Chevalier, B.S. and B.L.
Stoddard,
Nucleic Acids Res., 2001, 29, 3757-3774), the repertoire of cleavable
sequences is too
limited to address the complexity of the genomes, and there is usually no
cleavable
site in a chosen gene. Theoretically, the making of artificial sequence
specific
endonucleases with chosen specificities could alleviate this limit. Therefore,
the
making of meganucleases with tailored specificities is under intense
investigation.
Recently, fusion of Zinc-Finger Proteins with the catalytic domain
of the Fokl, a class IIS restriction endonuclease, were used to make
functional
sequence-specific endonucleases (Smith et al., Nucleic Acids Res., 1999, 27,
674-681;
Bibikova et al., Mol. Cell. Biol., 2001, 21, 289-297 ; Bibikova et al.,
Genetics, 2002,
161, 1169-1175 ; Bibikova et al., Science, 2003, 300, 764; Porteus, M.H. and
D.
Baltimore, Science, 2003, 300, 763-; Alwin et al., Mol. Ther., 2005, 12, 610-
617;
Umov et al., Nature, 2005, 435, 646-651; Porteus, M.H., Mol. Ther., 2006, 13,
438-
446). Such nucleases could recently be used for the engineering of the ILR2G
gene in
human cells from the lymphoid lineage (Urnov et al., Nature, 2005, 435, 646-
651).
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
4
The binding specificity of Cys2-His2 type Zinc-Finger Proteins
(ZFP), is easy to manipulate, probably because they represent a simple
(specificity
driven by essentially four residues per finger), and modular system (Pabo et
al., Annu.
Rev. Biochem., 2001, 70, 313-340 ; Jamieson et al., Nat. Rev. Drug Discov.,
2003, 2,
361-368. Studies from the Pabo (Rebar, E.J. and C.O. Pabo, Science, 1994, 263,
671-
673 ; Kim, J.S. and C.O. Pabo, Proc. Natl. Acad. Sci. U S A, 1998, 95, 2812-
2817),
Klug (Choo, Y. and A. Kiug, Proc. Natl. Acad. Sci. USA, 1994, 91, 11163-11167
;
Isalan M. and A. Klug, Nat. Biotechnol., 2001, 19, 656-660) and Barbas (Choo,
Y.
and A. Klug, Proc. Natl. Acad. Sci. USA, 1994, 91, 11163-11167 ; Isalan M. and
A.
Klug, Nat. Biotechnol., 2001, 19, 656-660) laboratories resulted in a large
repertoire
of novel artificial ZFPs, able to bind most G/ANNG/ANNG/ANN sequences.
Nevertheless, ZFPs might have their limitations, especially for
applications requiring a very high level of specificity, such as therapeutic
applications.
It was recently shown that FokI nuclease activity in fusion acts with either
one
recognition site or with two sites separated by varied distances via a DNA
loop
including in the presence of some DNA-binding defective mutants of FokI (Catto
et
al., Nucleic Acids Res., 2006, 34, 1711-1720). Thus, specificity might be very
degenerate, as illustrated by toxicity in mammalian cells and Drosophila
(Bibikova et
al., Genetics, 2002, 161, 1169-1175 ; Bibikova et al., Science, 2003, 300, 764-
.).
In the wild, meganucleases are essentially represented by homing
endonucleases. Homing Endonucleases (HEs) are a widespread family of natural
meganucleases including hundreds of proteins families (Chevalier, B.S. and
B.L.
Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774). These proteins are encoded
by
mobile genetic elements which propagate by a process called "homing": the
endonuclease cleaves a cognate allele from which the mobile element is absent,
thereby stimulating a homologous recombination event that duplicates the
mobile
DNA into the recipient locus. Given their exceptional cleavage properties in
terms of
efficacy and specificity, they could represent ideal scaffold to derive novel,
highly
specific endonucleases.
HEs belong to four major families. The LAGLIDADG family,
named after a conserved peptidic motif involved in the catalytic center, is
the most
widespread and the best characterized group. Seven structures are now
available.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
Whereas most proteins from this family are monomeric and display two
LAGLIDADG motifs, a few ones have only one motif, but dimerize to cleave
palindromic or pseudo-palindromic target sequences.
Although the LAGLIDADG peptide is the only conserved region
5 among members of the family, these proteins share a very similar
architecture (figure
2). The catalytic core is flanked by two DNA-binding domains with a perfect
two-fold
symmetry for homodimers such as I-CreI (Chevalier, et al., Nat. Struct. Biol.,
2001, 8,
312-316) and I-MsoI (Chevalier et al., J. Mol. Biol., 2003, 329, 253-269) and
with a
pseudo symmetry fo monomers such as I-SceI (Moure et al., J. Mol. Biol., 2003,
334,
685-69, I-DmoI (Silva et al., J. Mol. Biol., 1999, 286, 1123-1136) or I-AniI
(Bolduc et
al., Genes Dev., 2003, 17, 2875-2888). Both monomers, or both domains (for
monomeric proteins) contribute to the catalytic core, organized around
divalent
cations. Just above the catalytic core, the two LAGLIDADG peptides play also
an
essential role in the dimerization interface. DNA binding depends on two
typical
saddle-shaped (3oao(3 folds, sitting on the DNA major groove. Other domains
can be
found, for example in inteins such as PI-PfuI (Ichiyanagi et al., J. Mol.
Biol., 2000,
300, 889-901) and PI-Scel (Moure et al., Nat. Struct. Biol., 2002, 9, 764-
770), which
protein splicing domain is also involved in DNA binding.
The making of functional chimeric meganucleases, by fusing the N-
terminal I-DmoI domain with an I-CreI monomer (Chevalier et al., Mol. Cell.,
2002,
10, 895-905 ; Epinat et al., Nucleic Acids Res, 2003, 31, 2952-62;
International PCT
Applications WO 03/078619 and WO 2004/031346) have demonstrasted the
plasticity
of LAGLIDADG proteins.
Besides, different groups have have used a rational approach to
locally alter the specificity of the I-Crel (Seligman et al., Genetics, 1997,
147, 1653-
1664; Sussman et al., J. Mol. Biol., 2004, 342, 31-41; International PCT
Applications
WO 2006/097784 and WO 2006/097853; Arnould et al., J. Mol. Biol., 2006, 355,
443-458; Rosen et al., Nucleic Acids Res., 2006, 34, 4791-4800 ; Smith et al.,
Nucleic
Acids Res., 2006, 34, e149), I-Scel (Doyon et al., J. Am. Chem. Soc., 2006,
128,
2477-2484), PI-Scel (Gimble et al., J. Mol. Biol., 2003, 334, 993-1008 ) and I-
MsoI
(Ashworth et al., Nature, 2006, 441, 656-659).
,
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
6
In addition, hundreds of I-CreI derivatives with locally altered
specificity were engineered by combining the semi-rational approach and High
Throughput Screening:
- Residues Q44, R68 and R70 or Q44, R68, D75 and 177 of I-Crel
were mutagenized and a collection of variants with altered specificity in
positions 3
to 5 of the DNA target (5NNN DNA target) were identified by screening
(International PCT Applications WO 2006/097784 and WO 2006/097853; Arnould et
al., J. Mol. Biol., 2006, 355, 443-458; Smith et al., Nucleic Acids Res.,
2006, 34,
e 149).
- Residues K28, N30 and Q38, N30, Y33 and Q38 or K28, Y33, Q38
and S40 of I-CreI were mutagenized and a collection of variants with altered
speci-
ficity in positions 8 to 10 of the DNA target (IONNN DNA target) were
identified
by screening (Smith et al., Nucleic Acids Res., 2006, 34, e149).
Residues 28 to 40 and 44 to 77 of I-Crel were shown to form two
separable functional subdomains, able to bind distinct parts of a homing
endonuclease
half-site (Smith et al. Nucleic Acids Res., 2006, 34, e149).
The combination of mutations from the two subdomains of I-CreI
within the same monomer allowed the design of novel chimeric molecules
(homodimers) able to cleave a palindromic combined DNA target sequence
comprising the nucleotides in positions 3 to 5 and 8 to 10 which are bound
by
each subdomain (Smith et al., Nucleic Acids Res., 2006, 34, e149).
Two different variants were combined and assembled in a functional
heterodimeric endonuclease able to cleave a chimeric target resulting from the
fusion
of a different half of each variant DNA target sequence (Arnould et al.,
precited;
International PCT Application WO 2006/097854). Interestingly, the novel
proteins
had kept proper folding and stability, high activity, and a narrow specificity
The combination of the two former steps allows a larger
combinatorial approach, involving four different subdomains. The different
subdomains can be modified separately and combined to obtain an entirely
redesigned
meganuclease variant (heterodimer or single-chain molecule) with chosen
specificity,
as illustrated on figure 3. In a first step, couples of novel meganucleases
are combined
in new molecules ("half-meganucleases") cleaving palindromic targets derived
from
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
7
the target one wants to cleave. Then, the combination of such "half-
meganuclease"
can result in an heterodimeric species cleaving the target of interest. The
assembly of
four set of mutations into heterodimeric endonucleases cleaving a model target
sequence or a sequence from the human RAG I gene has been described in Smith
et al.
(Nucleic Acids Res., 2006, 34, e149).
These variants can be used to cleave genuine chromosomal
sequences and have paved the way for novel perspectives in several fields,
including
gene therapy.
The Inventors have identified a series of DNA targets in the beta-2
microglobulin gene that could be cleaved by I-CreI variants (figure 4). The
combinatorial approach described in figure 3 was used to entirely redesign the
DNA
binding domain of the I-CreI protein and thereby engineer novel meganucleases
with
fully engineered specificity, to cleave DNA targets from the human B2M gene.
The I-
CreI variants which are able to cleave a genomic DNA target from the human B2M
gene can be used for inactivating the human B2M gene (figure 6) ex vivo, for
the
purpose of preventing xenograft rejection in human. Other potential
applications
include genome therapy of pathologies associated with a fibrillar conformation
of
beta-2 microglobulin and genome engineering at the beta-2 microglobulin locus
(knock-out and knock in).
The invention relates to an I-CreI variant wherein at least one of the
two I-CreI monomers has at least two substitutions, one in each of the two
functional
subdomains of the LAGLIDADG core domain situated from positions 26 to 40 and
44
to 77 of I-Crel, and is able to cleave a DNA target sequence from the beta-2
microglobulin gene.
The cleavage activity of the variant according to the invention may
be measured by any well-known, in vitro or in vivo cleavage assay, such as
those
described in the International PCT Application WO 2004/067736; Epinat et al.,
Nucleic Acids Res., 2003, 31, 2952-2962; Chames et al., Nucleic Acids Res.,
2005,
33, e178 and Arnould et al., J. Mol. Biol., 2006, 355, 443-458. For example,
the
cleavage activity of the variant of the invention may be measured by a direct
repeat
recombination assay, in yeast or mammalian cells, using a reporter vector. The
reporter vector comprises two truncated, non-functional copies of a reporter
gene
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
8
(direct repeats) and the genomic DNA target sequence within the intervening
sequence, cloned in a yeast or a mammalian expression vector. Expression of
the
variant results in a functional endonuclease which is able to cleave the
genomic DNA
target sequence. This cleavage induces homologous recombination between the
direct
repeats, resulting in a functional reporter gene, whose expression can be
monitored by
appropriate assay.
Defnitions
- Amino acid residues in a polypeptide sequence are designated
herein according to the one-letter code, in which, for example, Q means Gln or
Glutamine residue, R means Arg or Arginine residue and D means Asp or Aspartic
acid residue.
- Nucleotides are designated as follows: one-letter code is used for
designating the base of a nucleoside: a is adenine, t is thymine, c is
cytosine, and g is
guanine. For the degenerated nucleotides, r represents g or a (purine
nucleotides), k
represents g or t, s represents g or c, w represents a or t, m represents a or
c, y repre-
sents t or c (pyrimidine nucleotides), d represents g, a or t, v represents g,
a or c, b
represents g, t or c, h represents a, t or c, and n represents g, a, t or c.
- by "me-ganuclease", is intended an endonuclease having a double-
stranded DNA target sequence of 12 to 45 bp. Said meganuclease is either a
dimeric
enzyme, wherein each domain is on a monomer or a monomeric enzyme comprising
the two domains on a single polypeptide.
- by "meganuclease domain" is intended the region which interacts
with one half of the DNA target of a meganuclease and is able to associate
with the
other domain of the same meganuclease which interacts with the other half of
the
DNA target to form a functional meganuclease able to cleave said DNA target.
- by "meganuclease variant" or "variant" is intented a meganuclease
obtained by replacement of at least one residue in the amino acid sequence of
the
wild-type meganuclease (natural meganuclease) with a different amino acid.
- by "functional variant" is intended a variant which is able to cleave
a DNA target sequence, preferably said target is a new target which is not
cleaved by
the parent meganuclease. For example, such variants have amino acid variation
at
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
9
positions contacting the DNA target sequence or interacting directly or
indirectly with
said DNA target.
- by "meganuclease variant with novel specificity" is intended a
variant having a pattern of cleaved targets different from that of the parent
meganuclease. The terms "novel specificity", "modified specificity", "novel
cleavage
specificity", "novel substrate specificity" which are equivalent and used
indifferently,
refer to the specificity of the variant towards the nucleotides of the DNA
target
sequence.
- by "I-CreI" is intended the wild-type I-Crel having the sequence
SWISSPROT P05725 or pdb accession code 1g9y, corresponding to the sequence
SEQ ID NO: 1 or SEQ ID NO: 107 in the sequence listing.
- by "domain" or "core domain" is intended the "LAGLIDADG
homing endonuclease core domain" which is the characteristic alPI(32a2(33(34a3
fold of
the homing endonucleases of the LAGLIDADG family, corresponding to a sequence
of about one hundred amino acid residues. Said domain comprises four beta-
strands
((31(32(33(34) folded in an antiparallel beta-sheet which interacts with one
half of the
DNA target. This domain is able to associate with another LAGLIDADG homing
endonuclease core domain which interacts with the other half of the DNA target
to
form a functional endonuclease able to cleave said DNA target. For example, in
the
case of the dimeric homing endonuclease I-Crel (163 amino acids), the
LAGLIDADG
homing endonuclease core domain corresponds to the residues 6 to 94.
- by "single-chain meganuclease" is intended a meganuclease
comprising two LAGLIDADG homing endonuclease domains or core domains linked
by a peptidic spacer. The single-chain meganuclease is able to cleave a
chimeric DNA
target sequence comprising one different half of each parent meganuclease
target
sequence.
- by "subdomain" is intended the region of a LAGLIDADG homing
endonuclease core domain which interacts with a distinct part of a homing endo-
nuclease DNA target half-site.
- by "beta-hairpin" is intended two consecutive beta-strands of the
antiparallel beta-sheet of a LAGLIDADG homing endonuclease core domain ((01(32
or,(33(3a) which are connected by a loop or a tum,
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
- by "I-Crel site" is intended a 22 to 24 bp double-stranded DNA
sequence which is cleaved by I-Crel. I-Crel sites include the wild-type
(natural) non-
palindromic I-Crel homing site and the derived palindromic sequences such as
the
sequence 5'- t-12C-11a-10a-9a-8a-7C-6g-5t-4C-3g-2t-
Ia+1C+2g+3a+4C+5g+6t+7t+8t+9t+10g+11a+12 also
5 called C 1221 (SEQ ID NO :2; figure 5).
- by "DNA target", "DNA target sequence", "target sequence",
"target-site", "target" , "site"; "site of interest"; "recognition site",
"recognition
sequence", "homing recognition site", "homing site", "cleavage site" is
intended a 20
to 24 bp double-stranded palindromic, partially palindromic (pseudo-
palindromic) or
10 non-palindromic polynucleotide sequence that is recognized and cleaved by a
LAGLIDADG homing endonuclease such as I-Crel, or a variant, or a single-chain
chimeric meganuclease derived from I-CreI. These terms refer to a distinct DNA
location, preferably a genomic location, at which a double stranded break
(cleavage) is
to be induced by the meganuclease. The DNA target is defined by the 5' to 3'
sequence of one strand of the double-stranded polynucleotide, as indicate
above for
C 1221. Cleavage of the DNA target occurs at the nucleotides in positions +2
and -2,
respectively for the sense and the antisense strand. Unless otherwiwe
indicated, the
position at which cleavage of the DNA target by an I-Cre I meganuclease
variant
occurs, corresponds to the cleavage site on the sense strand of the DNA
target.
- by "DNA target half-site", "half cleavage site" or half-site" is
intended the portion of the DNA target which is bound by each LAGLIDADG homing
endonuclease core domain.
- by "chimeric DNA target" or "hybrid DNA target" is intended the
fusion of a different half of two parent meganuclease target sequences. In
addition at
least one half of said target may comprise the combination of nucleotides
which are
bound by at least two separate subdomains (combined DNA target).
- by "beta-2-microglobulin gene" is intended the beta-2-
microglobulin gene of a mammal. For example, the human beta-2-microglobulin
gene
(B2M, 6673bp) is situated from positions 42790977 to 42797649 of the sequence
corresponding to accession number NC_000015. The B2M gene comprises four exons
(Exon 1: positions 1-127; Exon 2: positions 3937 to 4215; Exon 3: 4843 to
4870;
Exon 4: positions 6121 to 6673). The ORF which is from position 61 (Exon 1) to
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
11
positions 4856 (Exon 3), is flanked by a short and a long untranslated region,
respectively at its 5' and 3' ends (Figure 4).
- by "DNA target sequence from the beta-2-microglobulin gene",
"genomic DNA target sequence", " genomic DNA cleavage site", "genomic DNA
target" or "genomic target" is intended a 20 to 24 bp sequence of the beta-2-
microglobulin gene of a mammal which is recognized and cleaved by a
meganuclease
variant.
- by "vector" is intended a nucleic acid molecule capable of
transporting another nucleic acid to which it has been linked.
- by "homologous" is intended a sequence with enough identity to
another one to lead to a homologous recombination between sequences, more
particularly having at least 95 % identity, preferably 97 % identity and more
prefera-
bly 99 %.
- "identity" refers to sequence identity between two nucleic acid
molecules or polypeptides. Identity can be determined by comparing a position
in
each sequence which may be aligned for purposes of comparison. When a position
in
the compared sequence is occupied by the same base, then the molecules are
identical
at that position. A degree of similarity or identity between nucleic acid or
amino acid
sequences is a function of the number of identical or matching nucleotides at
positions
shared by the nucleic acid sequences. Various alignment algorithms and/or
programs
may be used to calculate the identity between two sequences, including FASTA,
or
BLAST which are available as a part of the GCG sequence analysis package
(University of Wisconsin, Madison, Wis.), and can be used with, e.g., default
settings.
- "individual" includes mammals, as well as other vertebrates (e.g.,
birds, fish and reptiles). The terms "mammal" and "mammalian", as used herein,
refer
to any vertebrate animal, including monotremes, marsupials and placental, that
suckle
their young and either give birth to living young (eutharian or placental
mammals) or
are egg-laying (metatharian or nonplacental mammals). Examples of mammalian
species include humans and other primates (e.g., monkeys, chimpanzees),
rodents
(e.g., rats, mice, guinea pigs) and others such as for example: cows, pigs and
horses.
- by mutation is intended the substitution, deletion, insertion of one
or more nucleotides/amino acids in a polynucleotide (cDNA, gene) or a
polypeptide
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
12
sequence. Said mutation can affect the coding sequence of a gene or its
regulatory
sequence. It may also affect the structure of the genomic sequence or the
structure/stability of the encoded mRNA.
The variant according to the invention may be an homodimer or an
heterodimer. Preferably, it is an heterodimer wherein both monomers are
mutated in
positions 26 to 40 and/or 44 to 77. More preferably, both monomers have
different
substitutions both in positions 26 to 40 and 44 to 77 of I-Crel.
In a preferred embodiment of said variant, said substitution(s) in the
subdomain situated from positions 44 to 77 of I-Crel are in positions 44, 68,
70, 75
and/or 77.
In another preferred embodiment of said variant, said substitution(s)
in the subdomain situated from positions 26 to 40 of I-CreI are in positions
26, 28, 30,
32, 33, 38 and/or 40.
In another preferred embodiment of said variant, it comprises one or
more mutations at positions of other amino acid residues which contact the DNA
target sequence or interact with the DNA backbone or with the nucleotide
bases,
directly or via a water molecule; these residues are well-known in the art
(Jurica et al.,
Molecular Cell., 1998, 2, 469-476; Chevalier et al., J. Mol. Biol., 2003, 329,
253-269).
In particular, additional substitutions may be introduced at positions
contacting the
phosphate backbone, for example in the final C-terminal loop (positions 137 to
143).
Preferably said residues are involved in binding and cleavage of said DNA
cleavage
site. More preferably, said residues are in positions 138, 139, 142 or 143 of
I-CreI.
Two residues may be mutated in one variant provided that each mutation is in a
different pair of residues chosen from the pair of residues in positions 138
and 139
and the pair of residues in positions 142 and 143. The mutations which are
introduced
modify the interaction(s) of said amino acid(s) of the final C-terminal loop
with the
phosphate backbone of the I-CreI site. Preferably, the residue in position 138
or 139 is
substituted by an hydrophobic amino acid to avoid the formation of hydrogen
bonds
with the phosphate backbone of the DNA cleavage site. For example, the residue
in
position 138 is substituted by an alanine or the residue in position 139 is
substituted
by a methionine. The residue in position 142 or 143 is advantageously
substituted by a
small amino acid, for example a glycine, to decrease the size of the side
chains of
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
13
these amino acid residues. More, preferably, said substitution in the final C-
terminal
loop modify the specificity of the variant towards the nucleotide in positions
1 to 2,
6 to 7 and/or 11 to 12 of the I-CreI site.
In another preferred embodiment of said variant, it comprises one or
more additional mutations that improve the binding and/or the cleavage
properties of
the variant towards the DNA target sequence from the beta-2 microglobulin
gene.
The additional residues which are mutated may be on the entire I-
Crel sequence, and in particular in the C-terminal half of I-CreI (positions
80 to 163).
For example, the variant comprises one or more additional substitutions in
positions:
2, 4, 19, 24, 31, 43, 49, 50, 53, 54, 56, 57, 59, 60, 64, 66, 69, 72, 73, 80,
81, 82, 83,
85, 87, 89, 92, 94, 96, 100, 103, 105, 107, 110, 111, 117, 120, 128, 129, 132,
135,
140, 142, 147, 153, 154, 155, 156, 157, 158, 159, 161, 163. Preferably said
substitutions are selected from the group consisting of: N21, N2Y, K4Q, G19S,
124F,
124V, Q31L, F43L, T49A, Q50R, W53R, F54L, D56E, D56G, K57N, V59A, D60E,
D60G, D60N, V64A, V64D, Y66C, D69G, D69E, S72F, S72P, S72T, V731, E80G,
181T, 181V, K82E, K82R, P83Q, P83A, H85R, F87L, T89A, T891, Q92L, Q92R,
F94L, F94Y, K96R, K100R, K100Q, N103T, N103S, V105A, K107R, E110D,
E110G, Q111L, E117G, D120G, W128R, V129A, 1132V, L135P, T140M, K142R,
T147A, T147N, D153G, D153V, S154G, L155Q, S156N, S156R, E157V, K158N,
K159Q, K159R, S 161 P, S 161 F, S162F, P163L and P163Q. More preferably, said
mutations are selected from the group consisting of: G19S, 124V, F54L, F87L
and
I132V.
The variant may also comprise one or two additional residues
inserted at the C-terminus of the I-CreI sequence (positions 164 and 165); for
example
a G can be inserted at position 164, a T or a P at position 165
In another preferred embodiment of said variant, said substitutions
are replacement of the initial amino acids with amino acids selected from the
group
consisting of: A, D, E, G, H, K, N, P, Q, R, S, T, Y, C, V, L and W.
The variant of the invention may be derived from the wild-type I-
Crel (SEQ ID NO: 1) or an I-Crel scaffold protein, such as the scaffold of SEQ
ID
NO: 106 (167 amino acids) having the insertion of an alanine in position 2,
the
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
14
substitution D75N, and the insertion of AAD at the C-terminus (positions 164
to 166)
of the I-CreI sequence.
In addition, the variants of the invention may include one or more
residues inserted at the NH2 terminus and/or COOH terminus of the sequence.
For
example, a tag (epitope or polyhistidine sequence) is introduced at the NH2
terminus
and/or COOH terminus; said tag is useful for the detection and/or the
purification of
said variant.
The variant according to the present invention may be an
homodimer which is able to cleave a palindromic or pseudo-palindromic DNA
target
sequence.
Alternatively, said variant is an heterodimer, resulting from the
association of a first and a second monomer having different substitutions in
positions
26 to 40 and 44 to 77 of I-CreI, said heterodimer being able to cleave a non-
palindromic DNA target sequence from the beta-2-microglobulin gene.
The DNA target sequence which is cleaved by said variant may be
in an exon or in an intron of the beta-2-microglobulin gene.
In another preferred embodiment of said variant, said DNA target
sequence is from the human beta-2-microglobulin gene (B2M gene). Preferably
said
DNA target sequence is selected from the group consisting of the sequences SEQ
ID
NO: 82 to 91 (24 bp; Figures 4 and 15) and the 20 to 22 bp derived sequences
lacking
one or two of the terminal base pairs from one or both ends of said 24 bp
sequence.
Since coding exons represent only a small fraction of the gene (Figure 4),
most
potential target sites are found in intronic sequences or untranslated exonic
sequences.
However, targets such as B2M18 and B2M20 (SEQ ID NO: 89 and 90) are found in
the B2M open reading frame.
More preferably, the monomers of the variant have at least the
following substitutions, respectively for the first and the second monomer:
- Y33R, Q38A, Q44D, R68A, R70S, D75K and 177R (first
monomer), and K28R, Y33A, Q38Y, S40Q, Q44A, R68Y, R70S, D75Y and 177K
(second monomer); this variant cleaves the B2M4 target which is located in the
first
intron (figures 4 and 15),
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
- S32T, Y33T, Q44T, R68Y, R70S, D75Y and 177V (first monomer),
and Y33R, Q38A, Q44N, R68Q, R70S, D75S and 177V (second monomer); this
variant cleaves the B2M 10 target which is located in the first intron
(figures 4 and 15),
-S32G, Y33H, Q44A, R68Y, R70S, D75Y and 177K or S32A, Y33H,
5 Q44A, R68Y, R70S, D75Y and 177K (first monomer) and N30Q, Y33G, Q38C,
R68N, R70S, D75N and 177R (second monomer); this variants cleave the B2M 11
target which is located in the first intron (figures 4 and 15),
- S32G, Y33H, Q44A, R68Y, R70S, D75Y and 177K (first
monomer), and S32T, Q38S, Q44K, R70S and 177A (second monomer); this variant
10 cleaves the B2M 13 target which is located in the first intron (figures 4
and 15),
- S32T, Y33T, Q44K, R68E, R70S and 177R (first monomer), and
N30A, Y33T, Q44N, R68K, R70S, D75H and 177F (second monomer); this variant
cleaves the B2M14 target which is located in the first intron (figures 4 and
15),
- S32R, Y33D, Q44A, R70S, D75E and 177R (first monomer), and
15 N30D, Y33R, Q44K, R68Y, R70S, D75N and 177Q (second monomer); this variant
cleaves the B2M 16 target which is located in the first intron (figures 4 and
15),
- S32T, Q38W, Q44A, R70S, D75R and 177Y (first monomer), and
Y33H, S40Q, Q44N, R70S, D75R and 177Y (second monomer); this variant cleaves
the B2M 17 target which is located in the first intron (figures 4 and 15),
- Y33H, Q38G, Q44N, R68Y, R70S, D75R and 177V (first
monomer), and a second monomer selected from the group consisiting of: N30A,
Y33T, Q44N, R68Y, R70S, D75R and 177V; N30H, Y33C, R68Y, R70S, D75R and
177Q; S32G, Y33C, R68Y, R70S, D75R and 177Q; S32R, Y33T, R68Y, R70S, D75R
and 177Q; S32G, Y33C, Q44N, R68Y, R70S, D75R and 177Q; S32A, Y33C, Q44N,
R68Y, R70S, D75R and 177Q; S32G, Y33S, Q44N, R68Y, R70S, D75R and 177Q;
N30H, Y33C, Q44N, R68Y, R70S, D75R and 177V; S32G, Y33C, Q44N, R68Y,
R70S, D75R and 177V; Y33C, S40Q, Q44N, R68Y, R70S, D75R and 177V; S32G,
Y33S, Q44N, R68Y, R70S, D75R and 177V; S32G, Y33C, Q44T, R68Y, R70S,
D75R and 177Q; S32A, Y33C, Q44T, R68Y, R70S, D75R and I77Q ; S32G, Y33C,
R68Y, R70S, D75R and 177V; S32G, Y33C, R68Y, R70S and D75R; S32G, Y33C,
Q44N, R68Y, R70S, D75R and 177Y; S32A, Y33C, Q44N, R68Y, R70S, D75R and
177Y; S32R, Y33T, R68Y, R70S, D75R, 177Q and D153G; N30H, Y33C, Q44R,
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
16
R68Y, R70S, D75R and 177Q; these variants cleave the B2M18 target which is
located in exon 2 (figures 4 and 15, Table VII),
- Y33T, S40N, Q44T, R68Y, R70S, D75R and 177V (first monomer),
and a second monomer selected from the group consisiting of: K28R, Y33A, Q38Y,
S40Q, Q44A, R68S, R74S, D75S and 177R; K28A, Y33S, S40R, R70S and D75N;
K28A, Y33T, S40R, R70S and D75N; K28R, Y33A, Q38Y, S40Q, R70S and D75N;
K28R, Y33N, Q38R, S40Q, R70S and D75N; K28R, Y33R, Q38Y, S40Q, R70S and
D75N; K28R, Y33S, Q38R, S40Q, R70S and D75N; K28R, Y33S, Q38Y, S40Q,
R70S and D75N; K28T, Y33T, S40D, R70S and D75; K28T, Y33T, S40R, R70S and
D75N; S32G, Y33C and D75N; Y33C and D75N; Y33S, S40R and D75N; Y33S and
S40R; N30A and Y33G; N30A and Y33T; N30C and Y33A; N30G and Y33C;
N30S, Y33S and Q38T; N30A and S32W; N30H and Y33K; N30R and Y33P; N30K
and Y33T; N30P and Y33W; S32G and Y33P; S32T and Y33A; Y33T and S40E;
these variants cleave the B2M20 target which is located at the intron 2- exon
3
junction (figures 4 and 15; Table VIII), and
- K28T, Y33R, S40R, Q44T, R70S and D75Y (first monomer), and
N30D, Y33R, Q44N, R68Y, R70S, D75Y and I77Q (second monomer); this variant
cleaves the B2M33 target which is located in exon 4 (figures 4 and 15).
More preferably, said variant consist of a first monomer having any
of the sequences SEQ ID NO: 24 to 28, 126 to 134 and a second monomer having
any
of the sequences SEQ ID NO: 37 to 77 and 135; this variant which derives from
the
monomers cleaving the B2M11 target, as defined above, has additional
substitutions
that increase the cleavage of the B2M11 target (figures 4 and 15; Table IV, V
and VI).
The heterodimeric variant is advantageously an obligate heterodimer
variant having at least one pair of mutations interesting corresponding
residues of the
first and the second monomers which make an intermolecular interaction between
the
two I-Crel monomers, wherein the first mutation of said pair(s) is in the
first
monomer and the second mutation of said pair(s) is in the second monomer and
said
pair(s) of mutations impairs the formation of functional homodimers from each
monomer without preventing the formation of a functional heterodimer, able to
cleave
the genomic DNA target from the beta-2 microglobulin gene.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
17
The monomers have advantageously at least one of the following
pairs of mutations, respectively for the first and the second monomer:
a) the substitution of the glutamic acid in position 8 with a basic
amino acid, preferably an arginine (first monomer) and the substitution of the
lysine in
position 7 with an acidic amino acid, preferably a glutamic acid (second
monomer);
the first monomer may further comprise the substitution of at least one of the
lysine
residues in positions 7 and 96, by an arginine.
b) the substitution of the glutamic acid in position 61 with a basic
amino acid, preferably an arginine (first monomer) and the substitution of the
lysine in
position 96 with an acidic amino acid, preferably a glutamic acid (second
monomer) ;
the first monomer may further comprise the substitution of at least one of the
lysine
residues in positions 7 and 96, by an arginine
c) the substitution of the leucine in position 97 with an aromatic
amino acid, preferably a phenylalanine (first monomer) and the substitution of
the
phenylalanine in position 54 with a small amino acid, preferably a glycine
(second
monomer) ; the first monomer may further comprise the substitution of the
phenylalanine in position 54 by a tryptophane and the second monomer may
further
comprise the substitution of the leucine in position 58 or lysine in position
57, by a
methionine, and
d) the substitution of the aspartic acid in position 137 with a basic
amino acid, preferably an arginine (first monomer) and the substitution of the
arginine
in position 51 with an acidic amino acid, preferably a glutamic acid (second
monomer).
For example, the first monomer may have the mutation D137R and
the second monomer, the mutation R51 D.
The obligate heterodimer meganuclease comprises advantageously, at
least two pairs of mutations as defined in a), b) c) or d), above; one of the
pairs of
mutation is advantageously as defined in c) or d). Preferably, one monomer
comprises
the substitution of the lysine residues at positions 7 and 96 by an acidic
amino acid
and the other monomer comprises the substitution of the glutamic acid residues
at
positions 8 and 61 by a basic amino acid. More preferably, the obligate
heterodimer
meganuclease, comprises three pairs of mutations as defined in a), b) and c),
above.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
18
The obligate heterodimer meganuclease consists advantageously of a first
monomer
(A) having at least the mutations selected from: (i) E8R, E8K or E8H, E61 R,
E61 K or
E61 H and L97F, L97W or L97Y; (ii) K7R, E8R, E61 R, K96R and L97F, or (iii)
K7R,
E8R, F54W, E61R, K96R and L97F and a second monomer (B) having at least the
mutations (iv) K7E or K7D, F54G or F54A and K96D or K96E; (v) K7E, F54G,
L58M and K96E, or (vi) K7E, F54G, K57M and K96E. For example, the first
monomer may have the mutations K7R, E8R, E61R, K96R and L97F or K7R, E8R,
F54W, E61 R, K96R and L97F and the second monomer, the mutations K7E, F54G,
L58M and K96E or K7E, F54G, K57M and K96E.
The subject-matter of the present invention is also a single-chain
chimeric meganuclease (fusion protein) derived from an I-CreI variant as
defined
above. The single-chain meganuclease may comprise two I-CreI monomers, two I-
Crel core domains (positions 6 to 94 of I-Crel) or a combination of both.
Preferably,
the two monomers /core domains or the combination of both, are connected by a
peptidic linker.
The subject-matter of the present invention is also a polynucleotide
fragment encoding a variant or a single-chain chimeric meganuclease as defined
above; said polynucleotide may encode one monomer of an homodimeric or
heterodimeric variant, or two domains/monomers of a single-chain chimeric
meganuclease.
The subject-matter of the present invention is also a recombinant
vector for the expression of a variant or a single-chain meganuclease
according to the
invention. The recombinant vector comprises at least one polynucleotide
fragment
encoding a variant or a single-chain meganuclease, as defined above. In a
preferred
embodiment, said vector comprises two different polynucleotide fragments, each
encoding one of the monomers of an heterodimeric variant.
A vector which can be used in the present invention includes, but is
not limited to, a viral vector, a plasmid, a RNA vector or a linear or
circular DNA or
RNA molecule which may consists of a chromosomal, non chromosomal, semi-
synthetic or synthetic nucleic acids. Preferred vectors are those capable of
autonomous
replication (episomal vector) and/or expression of nucleic acids to which they
are
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
19
linked (expression vectors). Large numbers of suitable vectors are known to
those of
skill in the art and commercially available.
Viral vectors include retrovirus, adenovirus, parvovirus (e. g. adeno-
associated viruses), coronavirus, negative strand RNA viruses such as
orthomyxovirus
(e. g., influenza virus), rhabdovirus (e. g., rabies and vesicular stomatitis
virus), para-
myxovirus (e. g. measles and Sendai), positive strand RNA viruses such as
picor-
navirus and alphavirus, and double-stranded DNA viruses including adenovirus,
herpesvirus (e. g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus,
cytomega-
lovirus), and poxvirus (e. g., vaccinia, fowlpox and canarypox). Other viruses
include
Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus,
and
hepatitis virus, for example. Examples of retroviruses include: avian leukosis-
sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group,
lentivirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their
replication,
In Fundamental Virology, Third Edition, B. N. Fields, et al., Eds., Lippincott-
Raven
Publishers, Philadelphia, 1996).
Preferred vectors include lentiviral vectors, and particularly self
inactivacting lentiviral vectors.
Vectors can comprise selectable markers, for example: neomycin
phosphotransferase, histidinol dehydrogenase, dihydrofolate reductase,
hygromycin
phosphotransferase, herpes simplex virus thymidine kinase, adenosine
deaminase,
glutamine synthetase, and hypoxanthine-guanine phosphoribosyl transferase for
eukaryotic cell culture; TRP 1 for S. cerevisiae; tetracycline, rifampicin or
ampicillin.
resistance in E. coli.
Preferably said vectors are expression vectors, wherein the
sequence(s) encoding the variant/single-chain meganuclease of the invention is
placed
under control of appropriate transcriptional and translational control
elements to
permit production or synthesis of said variant. Therefore, said polynucleotide
is
comprised in an expression cassette. More particularly, the vector comprises a
repli-
cation origin, a promoter operatively linked to said encoding polynucleotide,
a
ribosome-binding site, an RNA-splicing site (when genomic DNA is used), a
polyadenylation site and a transcription termination site. It also can
comprise an
enhancer. Selection of the promoter will depend upon the cell in which the
poly-
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
peptide is expressed. Preferably, when said variant is an heterodimer, the two
poly-
nucleotides encoding each of the monomers are included in one vector which is
able
to drive the expression of both polynucleotides, simultaneously. Suitable
promoters
include tissue specific and/or inducible promoters. Examples of inducible
promoters
5 are: eukaryotic metallothionine promoter which is induced by increased
levels of
heavy metals, prokaryotic lacZ promoter which is induced in response to
isopropyl- 0-
D-thiogalacto-pyranoside (IPTG) and eukaryotic heat shock promoter which is
induced by increased temperature. Examples of tissue specific promoters are
skeletal
muscle creatine kinase, prostate-specific antigen (PSA), a-antitrypsin
protease, human
10 surfactant (SP) A and B proteins, 0-casein and acidic whey protein genes.
According to another advantageous embodiment of said vector, it
includes a targeting construct comprising sequences sharing homologies with
the
region surrounding the genomic DNA cleavage site as defined above.
Alternatively, the vector coding for an I-CreI variant/single-chain
15 meganuclease and the vector comprising the targeting construct are
different vectors.
More preferably, the targeting DNA construct comprises:
a) sequences sharing homologies with the region surrounding the
genomic DNA cleavage site as defined above, and
b) a sequence to be introduced flanked by sequences as in a).
20 For genome therapy or the making of knock-out animals/cells, the
sequence to be introduced is a sequence which inactivates the beta-2
microglobulin
gene. Both homologous chromosomes have to be targeted in order to totally
inactivate
the function of the gene. In addition, said sequence may also delete the b2-
microglobulin gene or part thereof, and eventually introduce an exogenous gene
or
part thereof (knock-in/gene replacement). For making knock-in animals/cells
the DNA
which repairs the site of interest comprises the sequence of an exogenous gene
of
interest, and eventually a selection marker, such as the HPRT gene.
Alternatively, the
sequence to be introduced can be any other sequence used to alter the
chromosomal
DNA in some specific way including a sequence used to modify a specific
sequence,
to attenuate or activate the endogenous gene of interest or to introduce a
mutation into
a site of interest. Such chromosomal DNA alterations may be used for genome
engi-
neering (animal models and recombinant cell lines including human cell lines).
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
21
Inactivation of the beta-2 microglobulin gene may occur by insertion
of a transcription termination signal that will interrupt the transcription,
and result in a
truncated protein (Figure 6a). In this case, the sequence to be introduced
comprises, in
the 5' to 3' orientation: at least a transcription termination sequence (polyA
1),
preferably said sequence further comprises a marker cassette including a
promoter and
the marker open reading frame (ORF) and a second transcription termination
sequence
(polyA2; figure 6a). This strategy can be used with any meganuclease cleaving
a
target downstream of the B2M promoter and upsteam of the B2M stop codon, such
as
any of the targets B2M4, B2M10, B2M11, B2M13, B2M14, B2M16, B2M17, B2M18
and B2M20 (SEQ ID NO: 82 to 90; figures 4 and 15).
Inactivation of the beta-2 microglobulin gene may also occur by
insertion of a marker gene within the B2M open reading frame (ORF), that would
disrupt the coding sequence (figure 6b). The insertion can in addition be
associated
with deletions of ORF sequences flanking the cleavage site and eventually, the
insertion of an exogeneous gene of interest (gene replacement). This strategy
can be
used with a meganuclease cleaving an exonic sequence, such as for example, a
meganuclease cleaving B2M18 or B2M20 (SEQ ID NO: 90, 91).
In addition, inactivation of the beta-2 microglobulin gene may also
occur by insertion of a sequence that would destabilize the transcript. This
strategy
can be used with any meganuclease cleaving a target downstream of the B2M
promoter such as any of the targets (SEQ ID NO: 82 to 91) presented in figures
4 and
15.
Preferably, homologous sequences of at least 50 bp, preferably more
than 100 bp and more preferably more than 200 bp are used. Indeed, shared DNA
homologies are located in regions flanking upstream and downstream the site of
the
break and the DNA sequence to be introduced should be located between the two
arms.
Therefore, the targeting construct is preferably from 200 pb to 6000
pb, more preferably from 1000 pb to 2000 pb; it comprises: a beta-2
microglobulin
gene fragment which has at least 200 bp of homologous sequence flanking the
target
site for repairing the cleavage, and the sequence for inactivating the beta-2
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
22
microglobulin gene and eventually the sequence of an exogeneous gene of
interest for
replacing the beta-2 microglobulin gene, as defined above.
For the insertion of a sequence, DNA homologies are generally
located in regions directly upstream and downstream to the site of the break
(sequences immediately adjacent to the break; minimal repair matrix). However,
when
the insertion is associated with a deletion of ORF sequences flanking the
cleavage site,
shared DNA homologies are located in regions upstream and downstream the
region
of the deletion.
For example, the B2M target which is cleaved by each of the variant
as defined above and the minimal matrix for repairing the cleavage with each
variant
are indicated in figure 15.
The subject-matter of the present invention is also a composition
characterized in that it comprises at least one meganuclease as defined above
(variant
or single-chain derived chimeric meganuclease) and/or at least one expression
vector
encoding said meganuclease, as defined above.
In a preferred embodiment of said composition, it comprises a
targeting DNA construct comprising a sequence which inactivates the beta-2
microglobulin gene, flanked by sequences sharing homologies with the genomic
DNA
cleavage site of said variant, as defined above.
Preferably, said targeting DNA construct is either included in a
recombinant vector or it is included in an expression vector comprising the
polynucleotide(s) encoding the meganuclease according to the invention.
The subject-matter of the present invention is also the use of at least
one meganuclease and/or one expression vector, as defined above, for the
preparation
of a medicament for preventing, improving or curing xenograft rejection during
transplantation of cells from a donor into an individual (recipient) in need
thereof.
The subject-matter of the present invention is also the use of at least
one meganuclease and/or one expression vector, as defined above, for the
preparation
of a medicament for preventing, improving or curing a pathological condition
associated with a fibrillar conformation of beta-2 microglobulin in an
individual in
need thereof.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
23
The use of the meganuclease may comprise at least the step of (a)
inducing in somatic tissue(s) of the donor/ individual a double stranded
cleavage at a
site of interest of the beta-2 microglobulin gene comprising at least one
recognition
and cleavage site of said meganuclease by contacting said cleavage site with
said
meganuclease, and (b) introducing into said somatic tissue(s) a targeting DNA,
wherein said targeting DNA comprises (1) DNA sharing homologies to the region
surrounding the cleavage site and (2) DNA which inactivates the beta-2
microglobulin
gene upon recombination between the targeting DNA and the chromosomal DNA, as
defined above. The targeting DNA is introduced into the somatic tissues(s)
under
conditions appropriate for introduction of the targeting DNA into the site of
interest.
The targeting construct may comprise sequences for deleting the beta-2
microglobulin
gene and eventually the sequence of an exogenous gene of interest (gene
replacement).
Alternatively, the beta-2 microglobulin gene may be inactivated by
the mutagenesis of the open reading frame, by repair of the double-strands
break by
non-homologous end joining (Figure 6c). In the absence of a repair matrix, the
DNA
double-strand break in an exon will be repaired essentially by the error-prone
Non
Homologous End Joining pathway NHEJ, resulting in small deletions (a few
nucleotides), that will inactivate the cleavage site, and result in frameshift
mutation.
In this case the use of the meganuclease comprises at least the step
of : inducing in somatic tissue(s) of the donor/individual a double stranded
cleavage at
a site of interest of the beta-2 microglobulin gene comprising at least one
recognition
and cleavage site of said meganuclease by contacting said cleavage site with
said
meganuclease, and thereby induce mutagenesis of the beta-2 microglobulin gene
open
reading frame by repair of the double-strands break by non-homologous end
joining.
According to the present invention, said double-stranded cleavage
may be induced, ex vivo by introduction of said meganuclease into somatic
cells
(pancreas, kidney, heart, muscle) from the donor/individual and then
transplantation
of the modified cells into the recipient (xenotransplantation) or back into
the diseased
individual (pathology associated with a fibrillar conformation of beta-2
microglobulin) .
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
24
The subject-matter of the present invention is also a method for
preventing, improving or curing xenograft rejection during transplantation, in
an
individual in need thereof, said method comprising at least the step of
administering to
said individual a composition as defined above, by any means.
The subject-matter of the present invention is also a method for
preventing, improving or curing a pathological condition associated with a
fibrillar
conformation of beta-2 microglobulin, in an individual in need thereof, said
method
comprising at least the step of administering to said individual a composition
as
defined above, by any means.
The subject-matter of the present invention is further the use of a
meganuclease as defined above, one or two polynucleotide(s), preferably
included in
expression vector(s), for genome engineering at the beta-2 microglobulin gene
locus
(animal models and recombinant cells generation: knock-in or knock-out), for
non-
therapeutic purposes.
According to an advantageous embodiment of said use, it is for
inducing a double-strand break in a site of interest of the beta-2
microglobulin gene
comprising a genomic DNA target sequence, thereby inducing a DNA recombination
event, a DNA loss or cell death.
According to the invention, said double-strand break is for: repairing
a specific sequence in the beta-2 microglobulin gene, modifying a specific
sequence in
the beta-2 microglobulin gene, restoring a functional beta-2 microglobulin
gene in
place of a mutated one, attenuating or activating the endogenous beta-2
microglobulin
gene, introducing a mutation into a site of interest of the beta-2
microglobulin gene,
introducing an exogenous gene or a part thereof, inactivating or deleting the
endogenous beta-2 microglobulin gene or a part thereof, translocating a
chromosomal
arm, or leaving the DNA unrepaired and degraded.
According to another advantageous embodiment of said use, said
variant, polynucleotide(s), vector, are associated with a targeting DNA
construct as
defined above.
In a first embodiment of the use of the meganuclease according to
the present invention, it comprises at least the following steps: 1)
introducing a
double-strand break at a site of interest of the beta-2 microglobulin gene
comprising at
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
least one recognition and cleavage site of said meganuclease, by contacting
said
cleavage site with said meganuclease ; 2) providing a targeting DNA construct
comprising the sequence to be introduced flanked by sequences sharing
homologies to
the targeted locus. Said meganuclease can be provided directly to the cell or
through
5 an expression vector comprising the polynucleotide sequence encoding said
meganuclease and suitable for its expression in the used cell. This strategy
is used to
introduce a DNA sequence at the target site, for example to generate knock-in
or
knock-out animal models or cell lines that can be used for drug testing.
In a second embodiment of the use of the meganuclease according to
10 the present invention, it comprises at least the following steps: 1)
introducing a
double-strand break at a site of interest of the beta-2 microglobulin gene
comprising at
least one recognition and cleavage site of said meganuclease, by contacting
said
cleavage site with said meganuclease ; 2) maintaining said broken genomic
locus
under conditions appropriate for homologous recombination with chromosomal DNA
15 sharing homologies to regions surrounding the cleavage site.
In a third embodiment of the use of the meganuclease according to
the present invention, it comprises at least the following steps: 1)
introducing a
double-strand break at a site of interest of the beta-2 microglobulin gene
comprising at
least one recognition and cleavage site of said meganuclease, by contacting
said
20 cleavage site with said meganuclease ; 2) maintaining said broken genomic
locus
under conditions appropriate for repair of the double-strands break by non-
homologous end joining.
The subject-matter of the present invention is also a method for
making a beta-2 microglobulin knock-in or knock-out animal, comprising at
least the
25 step of:
(a) introducing into a pluripotent precursor cell or an embryo of an
animal, a meganuclease, as defined above, so as to into induce a double
stranded
cleavage at a site of interest of the beta-2 microglobulin gene comprising a
DNA
recognition and cleavage site of said meganuclease; simultaneously or
consecutively,
(b) introducing into the animal precursor cell or embryo of step (a) a
targeting DNA, wherein said targeting DNA comprises (1) DNA sharing homologies
to the region surrounding the cleavage site and (2) DNA which repairs the site
of
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
26
interest upon recombination between the targeting DNA and the chromosomal DNA,
so as to generate a genomically modified animal precursor cell or embryo
having
repaired the site of interest by homologous recombination,
(c) developping the genomically modified animal precursor cell or
embryo of step (b) into a chimeric animal, and
(d) deriving a transgenic animal from the chimeric animal of step
(c).
Preferably, step (c) comprises the introduction of the genomically
modified precursor cell generated in step (b) into blastocysts so as to
generate
chimeric animals.
The subject-matter of the present invention is also a method for
making a beta-2 microglobulin knock-in or knock-out cell, comprising at least
the step
of:
(a) introducing into a cell, a meganuclease, as defined above, so as
to into induce a double stranded cleavage at a site of interest of the beta-2
microglobulin gene comprising a DNA recognition and cleavage site for said
meganuclease, simultaneously or consecutively,
(b) introducing into the cell of step (a), a targeting DNA, wherein
said targeting DNA comprises (1) DNA sharing homologies to the region
surrounding
the cleavage site and (2) DNA which repairs the site of interest upon
recombination
between the targeting DNA and the chromosomal DNA, so as to generate a
recombinant cell having repaired the site of interest by homologous
recombination,
(c) isolating the recombinant cell of step (b), by any appropriate
mean.
The targeting DNA is introduced into the cell under conditions
appropriate for introduction of the targeting DNA into the site of interest.
In a preferred embodiment, said targeting DNA construct is inserted
in a vector.
Alternatively, the beta-2 microglobulin gene may be inactivated by
repair of the double-strands break by non-homologous end joining (Figure 6c).
The subject-matter of the present invention is also a method for
making a beta-2 microglobulin knock-out animal, comprising at least the step
of
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
27
(a) introducing into a pluripotent precursor cell or an embryo of an
animal, a meganuclease, as defined above, so as to induce a double stranded
cleavage
at a site of interest of the beta-2 microglobulin gene comprising a DNA
recognition
and cleavage site of said meganuclease, and thereby generate genomically
modified
precursor cell or embryo having repaired the double-strands break by non-
homologous
end joining,
(b) developping the genomically modified animal precursor cell or
embryo of step (a) into a chimeric animal, and
(c) deriving a transgenic animal from a chimeric animal of step (b).
Preferably, step (b) comprises the introduction of the genomically
modified precursor cell obtained in step (a), into blastocysts, so as to
generate
chimeric animals.
The subject-matter of the present invention is also a method for
making a beta-2 microglobulin-deficient cell, comprising at least the step of:
(a) introducing into a cell, a meganuclease, as defined above, so as
to induce a double stranded cleavage at a site of interest of the beta-2
microglobulin
gene comprising a DNA recognition and cleavage site of said meganuclease, and
thereby generate genomically modified HPRT deficient cell having repaired the
double-strands break, by non-homologous end joining, and
(b) isolating the genomically modified HPRT deficient cell of
step(a), by any appropriate mean.
The cell which is modified may be any cell of interest. For making
transgenic/knock-out animals, the cells are pluripotent precursor cells such
as embryo-
derived stem (ES) cells, which are well-kown in the art. For making
recombinant cell
lines, the cells may advantageously be human cells, for example PerC6 (Fallaux
et al.,
Hum. Gene Ther. 9, 1909-1917, 1998) or HEK293 (ATCC # CRL-1573) cells. Said
meganuclease can be provided directly to the cell or through an expression
vector
comprising the polynucleotide sequence encoding said meganuclease and suitable
for
its expression in the used cell.
For making transgenic animals/recombinant cell lines, including
human cell lines expressing an heterologous protein of interest, the targeting
DNA
comprises the sequence of the exogenous gene encoding the protein of interest,
and
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
28
eventually a marker gene, flanked by sequences upstream and downsteam the beta-
2
microglobulin gene, as defined above, so as to generate genomically modified
cells
(animal precursor cell or embryo/animal or human cell) having replaced the
beta-2
microglobulin gene by the exogenous gene of interest, by homologous
recombination.
The exogenous gene and the marker gene are inserted in an
appropriate expression cassette, as defined_ above, in order to allow
expression of the
heterologous protein/marker in the transgenic animal/recombinant cell line.
The meganuclease can be used either as a polypeptide or as a
polynucleotide construct encoding said polypeptide. It is introduced into
somatic cells
of an individual, by any convenient means well-known to those in the art,
which are
appropriate for the particular cell type, alone or in association with either
at least an
appropriate vehicle or carrier and/or with the targeting DNA.
According to an advantageous embodiment of the uses according to
the invention, the meganuclease (polypeptide) is associated with:
- liposomes, polyethyleneimine (PEI); in such a case said association
is administered and therefore introduced into somatic target cells.
- membrane translocating peptides (Bonetta, The Scientist, 2002, 16,
38; Ford et al., Gene Ther., 2001, 8, 1-4 ; Wadia and Dowdy, Curr. Opin.
Biotechnol.,
2002, 13, 52-56); in such a case, the sequence of the variant/single-chain
meganuclease is fused with the sequence of a membrane translocating peptide
(fusion
protein).
According to another advantageous embodiment of the uses
according to the invention, the meganuclease (polynucleotide encoding said
meganuclease) and/or the targeting DNA is inserted in a vector. Vectors
comprising
targeting DNA and/or nucleic acid encoding a meganuclease can be introduced
into a
cell by a variety of methods (e.g., injection, direct uptake, projectile
bombardment,
liposomes, electroporation). Meganucleases can be stably or transiently
expressed into
cells using expression vectors. Techniques of expression in eukaryotic cells
are well
known to those in the art. (See Current Protocols in Human Genetics: Chapter
12
"Vectors For Gene Therapy" & Chapter 13 "Delivery Systems for Gene Therapy").
Optionally, it may be preferable to incorporate a nuclear localization signal
into the
recombinant protein to be sure that it is expressed within the nucleus.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
29
Once in a cell, the meganuclease and if present, the vector
comprising targeting DNA and/or nucleic acid encoding a meganuclease are
imported
or translocated by the cell from the cytoplasm to the site of action in the
nucleus.
For purposes of therapy, the meganucleases and a pharmaceutically
acceptable excipient are administered in a therapeutically effective amount.
Such a
combination is said to be administered in a "therapeutically effective amount"
if the
amount administered is physiologically significant. An agent is
physiologically
significant if its presence results in a detectable change in the physiology
of the
recipient. In the present context, an agent is physiologically significant if
its presence
results in a decrease in the severity of one or more symptoms of the targeted
disease
and in a genome correction of the lesion or abnormality.
In one embodiment of the uses according to the present invention,
the meganuclease is substantially non-immunogenic, i.e., engender little or no
adverse
immunological response. A variety of methods for ameliorating or eliminating
delete-
rious immunological reactions of this sort cari be used in accordance with the
inven-
tion. In a preferred embodiment, the meganuclease is substantially free of N-
formyl
methionine. Another way to avoid unwanted immunological reactions is to
conjugate
meganucleases to polyethylene glycol ("PEG") or polypropylene glycol ("PPG")
(preferably of 500 to 20,000 daltons average molecular weight (MW)).
Conjugation
with PEG or PPG, as described by Davis et al. (US 4,179,337) for example, can
provide non-immunogenic, physiologically active, water soluble endonuclease
conju-
gates with anti-viral activity. Similar methods also using a polyethylene--
poly-
propylene glycol copolymer are described in Saifer et al. (US 5,006,333).
The invention also concerns a prokaryotic or eukaryotic host cell
which is modified by a polynucleotide or a vector as defined above, preferably
an
expression vector.
The invention also concerns a non-human transgenic animal or a
transgenic plant, characterized in that all or part of their cells are
modified by a
polynucleotide or a vector as defined above.
As used herein, a cell refers to a prokaryotic cell, such as a bacterial
cell, or an eukaryotic cell, such as an animal, plant or yeast cell.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
The subject-matter of the present invention is also the use of at least
one meganuclease variant, as defined above, as a scaffold for making other
meganucleases. For example a third round of mutagenesis and
selection/screening can
be performed on said variants, for the purpose of making novel, third
generation
5 meganucleases.
The different uses of the meganuclease and the methods of using
said meganuclease according to the present invention include the use of the I-
Crel
variant, the single-chain chimeric meganuclease derived from said variant, the
poly-
nucleotide(s), vector, cell, transgenic plant or non-human transgenic mammal
10 encoding said variant or single-chain chimeric meganuclease, as defined
above.
The I-CreI variant according to the invention may be obtained by a
method for engineering I-CreI variants able to cleave a genomic DNA target
sequence
from the beta-2 microglobulin gene, comprising at least the steps of:
(a) constructing a first series of I-CreI variants having at least one
15 substitution in a first functional subdomain of the LAGLIDADG core domain
situated
from positions 26 to 40 of I-Crel,
(b) constructing a second series of I-Crel variants having at least
one substitution in a second functional subdomain of the LAGLIDADG core domain
situated from positions 44 to 77 of I-Cre1,
20 (c) selecting and/or screening the variants from the first series of
step (a) which are able to cleave a mutant I-CreI site wherein (i) the
nucleotide triplet
in positions -10 to -8 of the I-CreI site has been replaced with the
nucleotide triplet
which is present in positions -10 to -8 of said genomic target and (ii) the
nucleotide
triplet in positions +8 to +10 has been replaced with the reverse
complementary
25 sequence of the nucleotide triplet which is present in positions -10 to -8
of said
genomic target,
(d) selecting and/or screening the variants from the second series of
step (b) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide triplet
in positions -5 to -3 of the I-Crel site has been replaced with the nucleotide
triplet
30 which is present in positions -5 to -3 of said genomic target and (ii) the
nucleotide
triplet in positions +3 to +5 has been replaced with the reverse complementary
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
31
sequence of the nucleotide triplet which is present in positions -5 to -3 of
said
genomic target,
(e) selecting and/or screening the variants from the first series of
step (a) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide triplet
in positions +8 to +10 of the I-Crel site has been replaced with the
nucleotide triplet
which is present in positions +8 to +10 of said genomic target and (ii) the
nucleotide
triplet in positions -10 to -8 has been replaced with the reverse
complementary
sequence of the nucleotide triplet which is present in positions +8 to +10 of
said
genomic target,
(f) selecting and/or screening the variants from the second series of
step (b) which are able to cleave a mutant I-Crel site wherein (i) the
nucleotide triplet
in positions +3 to +5 of the I-CreI site has been replaced with the nucleotide
triplet
which is present in positions +3 to +5 of said genomic target and (ii) the
nucleotide
triplet in positions -5 to -3 has been replaced with the reverse complementary
sequence of the nucleotide triplet which is present in positions +3 to +5 of
said
genomic target,
(g) combining in a single variant, the mutation(s) in positions 26 to
40 and 44 to 77 of two variants from step (c) and step (d), to obtain a novel
homodimeric I-CreI variant which cleaves a sequence wherein (i) the nucleotide
triplet in positions -10 to -8 is identical to the nucleotide triplet which is
present in
positions -10 to -8 of said genomic target, (ii) the nucleotide triplet in
positions +8 to
+10 is identical to the reverse complementary sequence of the nucleotide
triplet which
is present in positions -10 to -8 of said genomic target, (iii) the nucleotide
triplet in
positions -5 to -3 is identical to the nucleotide triplet which is present in
positions -5 to
-3 of said genomic target and (iv) the nucleotide triplet in positions +3 to
+5 is identi-
cal to the reverse complementary sequence of the nucleotide triplet which is
present in
positions -5 to -3 of said genomic target, and/or
(h) combining in a single variant, the mutation(s) in positions 26 to
40 and 44 to 77 of two variants from step (e) and step (f), to obtain a novel
homodimeric I-CreI variant which cleaves a sequence wherein (i) the nucleotide
triplet in positions +3 to +5 is identical to the nucleotide triplet which is
present in
positions +3 to +5 of said genomic target, (ii) the nucleotide triplet in
positions -5 to -
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
32
3 is identical to the reverse complementary sequence of the nucleotide triplet
which is
present in positions +3 to +5 of said genomic target, (iii) the nucleotide
triplet in posi-
tions +8 to +10 of the I-CreI site has been replaced with the nucleotide
triplet which is
present in positions +8 to +10 of said genomic target and (iv) the nucleotide
triplet in
positions -10 to -8 is identical to the reverse complementary sequence of the
nucleo-
tide triplet in positions +8 to +10 of said genomic target,
(i) combining the variants obtained in steps (g) and (h) to form
heterodimers, and
(j) selecting and/or screening the heterodimers from step (i) which
are able to cleave said genomic DNA target from the beta-2 microglobulin gene.
Steps (a), (b), (g), and (h) may comprise the introduction of
additional mutations in order to improve the binding and/or cleavage
properties of the
mutants, particularly at other positions contacting the DNA target sequence or
interacting directly or indirectly with said DNA target. This may be performed
by
generating a combinatorial library as described in the International PCT
Application
WO 2004/067736.
In addition, step (g) and/or (h) may further comprise the introduction
of random mutations on the whole variant or in a part of the variant, in
particular the
C-terminal half of the variant (positions 80 to 163). This may be performed by
generating random mutagenesis libraries on a pool of variants, according to
standard
mutagenesis methods which are well-known in the art and commercially
available.
The (intramolecular) combination of mutations in steps (g) and (h)
may be performed by amplifying overlapping fragments comprising each of the
two
subdomains, according to well-known overlapping PCR techniques.
The (intermolecular) combination of the variants in step (i) is
performed by co-expressing one variant from step (g) with one variant from
step (h),
so as to allow the formation of heterodimers. For example, host cells may be
modified
by one or two recombinant expression vector(s) encoding said variant(s). The
cells are
then cultured under conditions allowing the expression of the variant(s), so
that
heterodimers are formed in the host cells, as described previously in the
International
PCT Application WO 2006/097854 and Amould et al., J. Mol. Biol., 2006, 355,
443-
458.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
33
The selection and/or screening in steps (c), (d), (e), (f) and/or (j) may
be performed by using a cleavage assay in vitro or in vivo, as described in
the
International PCT Application WO 2004/067736, Arnould et al., J. Mol. Biol.,
2006,
355, 443-458, Epinat et al., Nucleic Acids Res., 2003, 31, 2952-2962 and
Chames et
al., Nucleic Acids Res., 2005, 33, e178.
According to another advantageous embodiment of said method,
steps (c), (d), (e), (f) and/or (j) are performed in vivo, under conditions
where the
double-strand break in the mutated DNA target sequence which is generated by
said
variant leads to the activation of a positive selection marker or a reporter
gene, or the
inactivation of a negative selection marker or a reporter gene, by
recombination-
mediated repair of said DNA double-strand break.
. The subject matter of the present invention is also an I-Crel variant
having mutations in positions 26 to 40 and/or 44 to 77 of I-CreI that is
useful for
engineering the variants able to cleave a DNA target from the beta-2
microglobulin
gene, according to the present invention. In particular, the invention
encompasses the
I-CreI variants as defined in step (c) to (f) of the method for engineering I-
CreI
variants, as defined above, including the variants of the sequence SEQ ID NO:
78, 79,
80, 81 and 105. The invention encompasses also the I-CreI variants as defined
in step
(g) and (h) of the method for engineering I-Crel variants, as defined above,
including
the variants of the sequence SEQ ID NO: 29 to 36.
Single-chain chimeric meganucleases able to cleave a DNA target
from the gene of interest are derived from the variants according to the
invention by
methods well-known in the art (Epinat et al., Nucleic Acids Res., 2003, 31,
2952-62;
Chevalier et al., Mol. Cell., 2002, 10, 895-905; Steuer et al., Chembiochem.,
2004, 5,
206-13; International PCT Applications WO 03/078619 and WO 2004/031346). Any
of such methods, may be applied for constructing single-chain chimeric
meganucleases derived from the variants as defined in the present invention.
The polynucleotide sequence(s) encoding the variant as defined in
the present invention may be prepared by any method known by the man skilled
in the
art. For example, they are amplified from a cDNA template, by polymerase chain
reaction with specific primers. Preferably the codons of said cDNA are chosen
to
favour the expression of said protein in the desired expression system.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
34
The recombinant vector comprising said polynucleotides may be
obtained and introduced in a host cell by the well-known recombinant DNA and
genetic engineering techniques.
The I-CreI variant or single-chain derivative as defined in the
present the invention are produced by expressing the polypeptide(s) as defined
above;
preferably said polypeptide(s) are expressed or co-expressed (in the case of
the variant
only) in a host cell or a transgenic animal/plant modified by one expression
vector or
two expression vectors (in the case of the variant only), under conditions
suitable for
the expression or co-expression of the polypeptide(s), and the variant or
single-chain
derivative is recovered from the host cell culture or from the transgenic
animal/plant.
The practice of the present invention will employ, unless otherwise
indicated, conventional techniques of cell biology, cell culture, molecular
biology,
transgenic biology, microbiology, recombinant DNA, and immunology, which are
within the skill of the art. Such techniques are explained fully in the
literature. See, for
example, Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000,
Wiley and son Inc, Library of Congress, USA); Molecular Cloning: A Laboratory
Manual, Third Edition, (Sambrook et al, 2001, Cold Spring Harbor, New York:
Cold
Spring Harbor Laboratory Press); Oligonucleotide Synthesis (M. J. Gait ed.,
1984);
Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D.
Harries & S.
J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J.
Higgins
eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R. Liss, Inc.,
1987);
Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide
To
Molecular Cloning (1984); the series, Methods In ENZYMOLOGY (J. Abelson and
M. Simon, eds.-in-chief, Academic Press, Inc., New York), specifically, Vols.
154 and
155 (Wu et al. eds.) and Vol. 185, "Gene Expression Technology" (D. Goeddel,
ed.);
Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds.,
1987,
Cold Spring Harbor Laboratory); Immunochemical Methods In Cell And Molecular
Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of
Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds.,
1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory
Press,
Cold Spring Harbor, N.Y., 1986).
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
In addition to the preceding features, the invention further comprises
other features which will emerge from the description which follows, which
refers to
examples illustrating the I-CreI meganuclease variants and their uses
according to the
invention, as well as to the appended drawings in which:
5 - figure 1 illustrates gene targeting strategies (a) A linear sequence
containing a marker surrounded by sequences homologous to the targeted locus
can be
introduced into the nucleus, and recombine with the homologous targeted locus.
This
experimental design is today the most widespread one for gene knock-in and
gene
knock-out. Note that the insertion of the marker can be associated with a
deletion
10 within the targeted locus, resulting in gene replacement. (b) meganuclease-
induced
gene targeting. In this case, the targeting sequence is often part of a
circular plasmid.
- figure 2 represents the tridimensional structure of the I-Crel
homing endonuclease bound to its DNA target. The catalytic core is surrounded
by
two a(3(3a(3(3a folds forming a saddle-shaped interaction interface above the
DNA
15 major groove.
- figure 3 illustrates the combinatorial approach for the making of
redesigned Homing Endonucleases. A large collection of I-Crel derivatives with
locally altered specificity is generated. Then, a two step combinatorial
approach is
used to assemble these mutants into homodimeric proteins (by combinations of
20 mutations within a same monomer), and then into heterodimers, resulting in
meganucleases with fully redesigned specificity.
- figure 4 represents the human B2M gene (accession number
NC_000015 ; 6673 pb). The Exons are boxed (Exon 1: positions 1-127; Exon 2:
positions 3937 to 4215; Exon 3: 4843 to 4870; Exon 4: positions 6121 to 6673).
The
25 ORF is from position 61 (Exon 1) to positions 4856 (Exon 3). Various
meganuclease
sites (B2Mn) are indicated.
- figure 5 represents the B2M series of target. B2M11.2 and
B2M11.3 are two palindromic sequences derived from the B2M target by mirror
duplication of one half of the target. These two targets can in turn be
considered as
30 combinations of the l OGAA_P and 5TAG_P (B2M 11.2) and the 10CTG_P and the
5TTT P targets (B2M11.3) found to be cleaved by I-Crel targets, if nucleotides
at
positions 11, 7 and 6 in the B2M 11.2 and B2M 11.3 targets are considered
as
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
36
having no impact on cleavage. All targets are aligned with the C1221 target, a
palindromic sequence cleaved by I-Crel.
- figure 6 represent three strategies for inactivation of a gene by
meganuclease-induced recombination. Note that in all three cases, both
homologous
chromosomes have to be targeted in order to totally inactivate the function of
the
gene. (a) inactivation by cleavage in the intron: a transcription termination
sequence
(polyA 1) and a marker cassette including a promoter, the marker ORF, and a
second
transcription termination sequence (polyA2). The transcription termination
sequences
will result in a truncated transcript, and therefore, a truncated protein. (b)
Inactivation
by cleavage in an exon, and knock-in of a marker cassette. Marker knock-in can
be
associated with deletion of exonic sequences (see Figure 1). (c) Inactivation
by
cleavage in an exon, and repair by the error-prone Non Homologous End Joining
pathway. In the absence of a repair matrix, the DNA double-strand break will
be
repaired essentially by NHEJ, resulting most of the time in perfect rejoining
of the 3'
cohesive ends resulting from meganuclease cleavage. In this case, the restored
cleavage site can be cleaved again by the meganuclease. However, this error
prone
repair pathway can also result in small deletions (a few nucleotides), that
will
inactivate the cleavage site, and result in frameshift mutation.
- figure 7 illustrates the cleavage of the B2M11.2 target by
combinatorial mutants. The figure displays an example of primary screening of
I-CreI
combinatorial mutants with the B2M 11.2 target. H12 is a positive control (C).
In the
first top filter, the sequence of positive mutant at position B3 (circle) is
KNAHQS/AYSYK (same nomenclature as for Table I). In the second filter, bottom
one's, the sequence of positive mutant at position F7 is KNGHQS/AYSYK.
- figure 8 illustrates cleavage of the of B2M11.2 target by optimized
mutants. A series of I-CreI N75 optimized mutants cutting B2M11.2 are obtained
from random mutagenesis of the mutants KNAHQS/AYSYK and KNGHQS/AYSYK.
Cleavage is tested with the B2M11.2 target. Mutants cleaving B2M 11.2 are
circled.
For example, the sequence of positive mutant at position B3 is corresponding
to
28K30N32A33H38Q40S44A68Y70S75Y77K/2Y53R66C (same nomenclature as for
Table II). H 12 is a positive control.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
37
- figure 9 illustrates cleavage of the B2M 11.3 target by
combinatorial mutants. The figure displays an example of primary screening of
I-Crel
combinatorial mutants with the B2M 11.3 target. H 10, H 11 and H 12 are
respectively
negative (C 1) and two positive controls (C2 and C3) of different strength. In
the filter,
the sequence of positive mutant at position G5 (circle) is KQSGCS/QNSNR (same
nomenclature as for Table III).
- figure 10 illustrates cleavage of B2M11 target by heterodimeric
combinatorial mutants. The figure displays primary screening of combinations
of I-
Crel mutants with the B2M 11 target. A column of positive heterodimeric
combinatorial mutants are circled. In the example filter, (1) and (2) are
yeast strain
with B2M 11 target and mutant respectively
28K30N32G33H38Q40S44A68Y70S75Y77K/2I96R105A (1) and
28K30N32A33H38Q40S44A68Y70S75Y77K/132V (2), matted with the yeast strain
with 28K30Q32S33G38C40S44Q68N70S75N77R (M1) (same nomenclature as for
Table IV).
- figure 11 illustrates cleavage of B2M11 target by optimized
heterodimeric combinatorial mutants. A series of I-CreI N75 optimized mutants
cutting B2M11.3 are coexpressed with mutants cutting B2M11.2. Cleavage is
tested
with the B2M11 target. Mutants cleaving B2M11 are circled (as example G9,
corresponding to an heterodimer of 28K30Q32S33G38C40S44Q68N70S75N77R vs
28K30N32A33H38Q40S44A68Y70S75Y77K/2Y53R66C. In the examples filter, the
yeast strain with B2M 11 target and mutant
28K30N32A33H38Q40S44A68Y70S75Y77K/2Y53R66C is matted with the yeast
strain with 28K30Q32S33G38C40S44Q68N70S75N77R (MI) (same nomenclature as
for Table V), or controls (Cl to C3) in diagonal. H 10, H 11 and H12 are also
respectively negative (C 1) and two positive controls (C2 and C3) of different
strength.
- figure 12 represents the pCLS 1055 vector map.
- figure 13 represents the pCLS0542 vector map.
- figure 14 represents the pCLS 1107 vector map.
- figure 15 represents meganuclease target sequences found in the
human B2M gene and the corresponding I-CreI variant which is able to cleave
said
DNA target. The exons closest to the target sequences, and the exons junctions
are
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
38
indicated (columns 2 and 3), the sequence of the DNA target is presented
(column 4),
with its position (column 5). The minimum repair matrix for repairing the
cleavage at
the target site is indicated by its first nucleotide (start, colunm 8) and
last nucleotide
(end, column 9). The sequence of each variant is defined by the mutated
residues at
the indicated positions. For example, the first heterodimeric variant of
figure 15
consists of a first monomer having K, N, S, R, A, S, D, A, S, K, R in
positions 28, 30,
32, 33, 38, 40, 44, 68, 70, 75 and 77, respectively and a second monomer
having R, N,
S, A, Y, Q, A, Y, S, Y and K in positions 28, 30, 32, 33, 38, 40, 44, 68, 70,
75 and 77,
respectively. The positions are indicated by reference to I-Crel sequence
SWISSPROT P05725 (SEQ ID NO: 1) ; I-Crel has K, N, S, Y, Q, S, Q, R, R, D and
I,
in positions 28, 30, 32, 33, 38, 40, 44, 68, 70, 75 and 77 respectively.
- figure 16 represents the pCLS 1069 vector map.
- figure 17 represents the pCLS 1058 vector map.
- figure 18 represents the B2M 18 series of target. B2M 18.3 and
B2M 18.4 are two palindromic sequences derived from the B2M 18 target by
mirror
duplication of one half of the target. These two targets can in turn be
considered as
combinations of IONNN and 5NNN targets found to be cleaved by I-CreI targets,
if
one considers that nucleotides at positions 11, 7 and 6 in the B2M18.3 and
B2M 18.4 targets have no impact on cleavage. All targets are aligned with the
C 1221
target, a palindromic sequence cleaved by I-CreI.
- figure 19 illustrates cleavage of the B2M18.4 target by
combinatorial mutants. The figure displays an example of primary screening of
I-Crel
combinatorial mutants with the B2M18.4 target. Right double dots (C) on each
quarter
are alternatively respectively negative (C 1) and two positive controls (C2
and C3) of
different strength. The left double dots (M) in the filter are combinatorial
clone tested.
The sequence of positive mutant at position B 10 (circle) is KNGCQS/QYSRQ
(same
nomenclature as for Table VII).
- figure 20 represents the B2M20 series of target. B2M20.3 and
B2M20.4 are two palindromic sequences derived from the B2M20 target by mirror
duplication of one half of the target. These two targets can in turn be
considered as
combinations of IONNN and 5NNN targets found to be cleaved by I-Crel targets,
if
one considers that nucleotides at positions f11, 7 and 6 in the B2M20.3 and
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
39
B2M20.4 targets have no impact on cleavage. All targets. are aligned with the
C 1221
target, a palindromic sequence cleaved by I-Crel.
- figure 21 illustrates cleavage of the B2M20.4 target by
combinatorial mutants. The figure displays an example of primary screening of
I-CreI
combinatorial mutants with the B2M20.4 target. Right double dots (C) on each
quarter
are alternatively respectively negative (Cl) and two positive controls (C2 and
C3) of
different strength. The left double dots (M) in the filter are combinatorial
clone tested.
The sequence of positive mutant at position F6 (circle) is KNSTQE/QRRDI (same
nomenclature as for Table VIII).
Example 1: Strategy for engineering novel meganucleases cleaving the human
B2M gene
The combinatorial approach described in Smith et al., Nucleic Acids
Res., 2006 and illustrated in figure 3, was used to engineer the DNA binding
domain
of I-Crel, and cleave one of the B2M targets, B2M 11 (figures 5 and 15), a 24
bp (non-
palindromic) target (figure 5) located at positions 2892 to 2915 of the human
B2M
gene (accession number NC_000015.8, positions 42790977 to 42797649). The
meganucleases cleaving B2M11 can be used to inactivate the B2M gene by
insertion
of a transcription termination signal that will interrupt the transcription,
and result in a
truncated protein (Figure 6a).
The B2M11 sequence is partly a patchwork of the IOGAA_P,
10CTG_P, 5TAG_P and 5TTT P targets (Figure 5), which are cleaved by previously
identified meganucleases, obtained as described in International PCT
Applications
WO 2006/097784, WO 2006/097853; Arnould et al., J. Mol. Biol., 2006, 355, 443-
458 and Smith et al., Nucleic Acids Res., 2006, 34, e149. Thus B2M11 could be
cleaved by meganucleases combining the mutations found in the I-CreI
derivatives
cleaving these four targets.
The 10GAA P, IOCTG P, 5TAG_P and 5TTT_P sequences are 24
bp derivatives of C1221, a palindromic sequence cleaved by I-CreI
(International PCT
Applications WO 2006/097784, WO 2006/097853; Arnould et al., J. Mol. Biol.,
2006,
355, 443-458 and Smith et al., Nucleic Acids Res., 2006, 34, e149).
However, the structure of I-CreI bound to its DNA target suggests
that the two external base pairs of these targets (positions -12 and 12) have
no impact
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
on binding and cleavage (Chevalier et al., Nat. Struct. Biol., 2001, 8, 312-
316;
Chevalier B.S. and Stoddard B.L., Nucleic Acids Res., 2001, 29, 3757-3754;
Chevalier et al., J. Mol. Biol., 2003, 329, 253-269), and in this study, only
positions -
11 to 11 were considered. Consequently, the B2M 11 series of targets were
defined as
5 22 bp sequences instead of 24 bp.
Two palindromic targets, B2M11.2 and B2M11.3 were derived from
B2M 11 (Figure 5). Since B2M 11.2 and B2M 11.3 are palindromic, they should be
cleaved by homodimeric proteins. Thus, proteins able to cleave the B2M11.2 and
B2M 11.3 sequences as homodimers, were first designed (examples 2 and 3),
followed
10 by an optimization of homodimers able to cleaved more efficiently B2M 11.2
target
(example 4), and then coexpression to obtain heterodimers cleaving B2M11.1
(example 5). Chosen mutant cleaving B2M11.3 were then refined; the chosen
mutants
were randomly mutagenized, and used to form novel heterodimers that were
screened
against the B2M11 target (example 6).
15 Example 2: Making of meganucleases cleaving B2M11.2
This example shows that I-CreI mutants can cut the B2M 11.2 DNA
target sequence derived from the left part of the B2M11 target in a
palindromic form
(figure 5).
Target sequences described in this example are 22 bp palindromic
20 sequences. Therefore, they will be described only by the first 11
nucleotides, followed
by the suffix _P. For example, target B2M11.2 will be noted also
tgaaattaggt_P; SEQ
ID NO: 96)).
B2M11.2 is similar to 5TAG_P in positions f1, 2, 3, 4, 5 and
7 and to l OGAA P in positions f 1, 2, 7, 8, 9 and f 10. It was
hypothesized that
25 positions 6 and 11 would have little effect on the binding and cleavage
activity.
Mutants able to cleave 5TAG P target (caaaactaggt_P; SEQ ID NO: 94) were
previously obtained by mutagenesis on I-CreI N75 at positions 44, 68, 70, 75
and 77,
as described in Arnould et al., J. Mol. Biol., 2006, 355, 443-458 and
International
PCT Applications WO 2006/097784, WO 2006/097853. Mutants able to cleave the
30 10GAA_P target (cgaaacgtcgt _P; SEQ ID NO:92 ) were obtained by mutagenesis
on
I-Crel N75 and D75 at positions 28, 30, 32, 33, 38, 40, as described
previously in
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
41
Smith et al, Nucleic Acids Res., 2006, 34, e149). Thus combining such pairs of
mutants would allow for the cleavage of the B2M 11.2 target.
Therefore, to check whether combined mutants could cleave the
B2M 11.2 target, mutations at positions 44, 68, 70, 75 and 77 from proteins
cleaving
5TAG P(caaaactaggt_P; SEQ ID NO: 94) were combined with the 28, 30, 32, 33, 38
and 40 mutations from proteins cleaving IOGAA_P (cgaaacgtcgt_P; SEQ ID NO:
92).
1) Material and Methods
The method for producing meganuclease variants and the assays
based on cleavage-induced recombination in mammal or yeast cells, which are
used
for screening variants with altered specificity are described in the
International PCT
Application WO 2004/067736; Epinat et al., Nucleic Acids Res., 2003, 31, 2952-
2962; Chames et al., Nucleic Acids Res., 2005, 33, e178, and Arnould et al.,
J. Mol.
Biol., 2006, 355, 443-458. These assays result in a functional LacZ reporter
gene
which can be monitored by standard methods.
a) Construction of target vector
The target was cloned as follow: oligonucleotide corresponding to the target
sequence
flanked by gateway cloning sequence was ordered from PROLIGO: 5'
tggcatacaagttttgttctcaggtacctgagaacaacaatcgtctgtca 3' (SEQ ID NO: 98). Double-
stranded target DNA, generated by PCR amplification of the single stranded
oligonucleotide, was cloned using the Gateway protocol (INVITROGEN) into yeast
reporter vector (pCLS 1055, Figure 12). Yeast reporter vector was transformed
into S.
cerevisiae strain FYBL2-7B (MAT a, ura3d851, trpld63, leu2dl, lys2d202).
b) Construction of combinatorial mutants
I-Crel mutants cleaving 10GAA_P or 5TAG_P were identified as
described previously in Smith et al, Nucleic Acids Res., 2006, 34, e149, and
Arnould
et al., J. Mol. Biol., 2006, 355, 443-458; International PCT Applications WO
2006/097784, WO 2006/097853, respectively for the 10GAA P or 5TAG P targets.
In order to generate I-Crel derived coding sequence containing mutations from
both
series, separate overlapping PCR reactions were carried out that amplify the
5' end (aa
positions 1-43) or the 3' end (positions 39-167) of the I-Crel coding
sequence. For
both the 5' and 3' end, PCR amplification is carried out using Ga110F (5'-
gcaactttagtgctgacacatacagg-3'; SEQ ID NO: 99) or GallOR (5'-
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
42
acaaccttgattggagacttgacc-3'; SEQ ID NO: 100) primers specific to the vector
(pCLS0542, Figure 13) and primers specific to the I-CreI coding sequence for
amino
acids 3 9-43 (assF 5'-ctannnttgaccttt-3'(SEQ ID NO:101 ) or assR 5'-
aaaggtcaannntag-
3'(SEQ ID NO: 102)) where nnn code for residue 40. The PCR fragments resulting
from the amplification reaction realized with the same primers and with the
same
coding sequence for residue 40 were pooled. Then, each pool of PCR fragments
resulting from the reaction with primers Ga110F and assR or assF and GallOR
was
mixed in an equimolar ratio. Finally, approximately 25 ng of each final pool
of the
two overlapping PCR fragments and 75 ng of vector DNA (pCLS0542) linearized by
digestion with NcoI and Eagl were used to transform the yeast Saccharomyces
cerevisiae strain strain FYC2-6A (MATa, trp l A63, leuAl, his3A200) using a
high
efficiency LiAc transformation protocol (Gietz and Woods, Methods Enzymol.,
2002,
350, 87-96). An intact coding sequence containing both groups of mutations is
generated by in vivo homologous recombination in yeast.
c) Mating of meganuclease expressing clones and screening in yeast:
Screening was performed as described previously (Arnould et al., J.
Mol. Biol., 2006, 355, 443-458). Mating was performed using a colony gridder
(QpixII, Genetix). Mutants were gridded on nylon filters covering YPD plates,
using a
low gridding density (about 4 spots/cm2). A second gridding process was
performed
on the same filters to spot a second layer consisting of different reporter-
harboring
yeast strains for each target. Membranes were placed on solid agar YPD rich
medium,
and incubated at 30 C for one night, to allow mating. Next, filters were
transferred to
synthetic medium, lacking leucine and tryptophan, with galactose (2 %) as a
carbon
source, and incubated for five days at 37 C, to select for diploids carrying
the
expression and target vectors. After 5 days, filters were placed on solid
agarose
medium with 0.02 % X-Gal in 0.5 M sodium phosphate buffer, pH 7.0, 0.1 % SDS,
6
% dimethyl formamide (DMF), 7mM (3-mercaptoethanol, 1% agarose, and incubated
at 37 C, to monitor P-galactosidase activity. Results were analyzed by
scanning and
quantification was performed using appropriate software.
d) Sequencing of mutants
To recover the mutant expressing plasmids, yeast DNA was extracted
using standard protocols and used to transform E. coli. Sequence of mutant ORF
were
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
43
then performed on the plasmids by MILLEGEN SA. Alternatively, ORFs were
amplified from yeast DNA by PCR (Akada et al., Biotechniques, 2000, 28, 668-
670),
and sequence was performed directly on PCR product by MILLEGEN SA.
2) Results
I-CreI combinatorial mutants were constructed by associating
mutations at positions 44, 68, 70, 75 and 77 with the 28, 30, 33, 38 and 40
mutations
on the I-Crel N75 or D75 scaffold, resulting in a library of a complexity of
2014.
Examples of combinations are displayed on Table 1. These libraries were
transformed
into yeast and 4464 clones (2.2 times the diversity) were screened for
cleavage against
B2M11.2 DNA target (tgaaattaggt _P; SEQ ID NO: 96). 2 positives clones were
found with a very low level of activity, which after sequencing and validation
by
secondary screening turned out to correspond to 2 different novel
endonucleases (see
Table I). Positives are shown in Figure 7.
Throughout the text and figures, combinatorial mutants sequences are
named with an eleven letter code, after residues at positions 28, 30, 32, 33,
38, 40, 44,
68 and 70, 75 and 77. For example, KNGHQS/AYSYK stands for I-Crel K28, N30,
G32, H33, Q38, S40, A44, Y68, S70, Y75 and K77 (I-CreI
28K30N32G33H38Q40S44A68Y70S75Y77K). Parental mutants are named with a six
letter code, after residues at positions 28, 30, 32, 33, 38 and 40 or a five
letter code,
after residues at positions 44, 68, 70, 75 and 77. For example, KNGHQS stands
for I-
CreI K28, N30, G32, H33, Q38 and S40, and AYSYK stands for I-CreI A44, Y68,
S70, Y75 and K77.
30
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
44
Table I: Cleavage of the B2M11. 2 target by the combinatorial variants
Amino acids
at positions Amino acids at positions 28, 30, 32, 33, 38 and 40
44, 68, 70, 75 (KNGHQS stands for K28, N30, G32, H33, Q38 and S40)
and 77
(AYSYK stands
for A44, Y68,
S70, Y75 and
K77)
KNGHQS KNAHQS KNSHQS KNAQQS KYSHQS KNPRQS KPSHQS KRSWQS
(SEQ ID (SEQ ID
NO: 79) NO: 80)
ARSYY
ANNNI
SRSYT
AYSYK + +
(SEQ ID No: 78)
AQNNI
ARSYV
NRSYN
ARNNI
ARTNI
AKSYI
NYSYV
ARSYQ
SRSYS
NQSSV
NRSYS
AKSYR
TRSYI
TNSYK
ARSYN
SRSYI
ARSYI
TYSYK
NRSNI
NRSYI
ATNNI
*Only 176 out of the 2014 combinations are displayed
+ indicates cleavage of the B2M 11.2 target by the combinatorial variant
Example 3: Making of meganucleases cleaving B2M11.2 with higher efficacy by
random mutagenesis of meganucleases cleaving B2M11.2.
I-CreI mutants able to cleave the palindromic B2M11.2 target have
been identified by assembly of mutants cleaving the palindromic IOGAA_P and
5TAG_P target (example 2). However, only 2 of these combinations were able to
cleave B2M11.2 and with a minimal efficiency.
Therefore the two protein combinations cleaving B2M11.2 were
mutagenized and variants cleaving B2M11.2 with better efficiency were
screened.
According to the structure of the I-CreI protein bound to its target, there is
no contact
between the residues used for the first combinatorial approach (28, 30, 32,
33, 38 and
40 vs 44, 68, 70, 75 and 77) in the I-Crel protein (Chevalier et al., Nat.
Struct. Biol.,
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
2001, 8, 312-316; Chevalier B.S. and Stoddard B.L., Nucleic Acids Res., 2001,
29,
3757-3754; Chevalier et al., J. Mol. Biol., 2003, 329, 253-269). Thus, it is
difficult to
rationally choose a set of positions to mutagenize, and mutagenesis was done
on the
C-terminal part of the protein (831ast amino acids) or on the whole protein.
5 1) Material and Methods
Random mutagenesis libraries were created on a pool of chosen
mutants, by PCR using Mn2+ or derivatives of dNTPs as 8-oxo-dGTP and dPTP in
two-step PCR process, as described in the protocol from JENA BIOSCIENCE GmbH
in JBS dNTP-Mutagenis kit. Primers used are preATGCreFor (5'-
10 gcataaattactatacttctatagacacgcaaacacaaatacacagcggccttgccacc-3'; SEQ ID NO:
103)
and ICrelpostRev (5'-ggctcgaggagctcgtctagaggatcgctcgagttatcagtcggccgc-3'; SEQ
ID
NO: 104). The new libraries were cloned in vivo in the yeast in the linearized
kanamycin vector harbouring a galactose inducible promoter, a KanR as
selectable
marker and a 2 micron origin of replication. Positives resulting clones were
verified
15 by sequencing (MILLEGEN).
Pools of mutants were amplified by PCR reaction using these primers
common for leucine vector (pCLS0542, Figure 13) and kanamycin vector (pCLS
1107,
Figure 14). Approximately 75ng of PCR fragment and 75ng of vector DNA
(pCLS0542) linearized by digestion with NcoI and EagI are used to transform
the
20 yeast Saccharomyces cerevisiae strain FYC2-6A (MATa, trp1063, leu2Al,
his30200)
using a high efficiency LiAc transformation protocol. A library of intact
coding
sequence for the I-CreI mutant is generated by in vivo homologous
recombination in
yeast.
Mating assays were done as described in example 2.
25 2) Results:
Two mutants cleaving B2M 11.2, I-Crel
28K30N32G33H38Q40S44A68Y70S75Y77K and I-CreI
28K30N32A3338Q40SH44A68Y70S75Y77K, also called KNGHQS/AYSYK and
KNAHQS/AYSYK according to nomenclature of Table I) were pooled, randomly
30 mutagenized and transformed into yeast (Figure 13). 4464 transformed clones
were
then mated with a yeast strain that contains the B2M 11.2 target in a reporter
plasmid.
Thirty-two clones were found to trigger cleavage of the B2M11.2 target when
mated
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
46
with such yeast strain, corresponding at least to 13 different novel
endonucleases (see
Table II). Example of positives is shown on Figure 8.
Table II: Optimized mutants towards the B2M11.2 target
Optimized Mutant B2M1 1.2* Target
(SEQ ID NO: 24 to 36) B2M1 1.2
1-Cre128K30N32A33H38Q40S44A68Y70S75Y77K/2Y53R +
1-Cre128K30N32A33H38Q40S44A68Y70S75Y77K/2Y53R66C
1-Cre128K30N32A33H 38Q40S44A68Y70S75Y77K/132V +
1-Cre128K30N32G33H38Q40S44A68Y70S75Y77K/2196R105A +
1-Cre128K30N32G33H38Q40S44A68Y70S75Y77K/120G +
1-Cre128K30N32A33H38Q40S44A68Y70S75Y77K/43L105A159R +
1-Cre128K30N32G33H38Q40S44A68Y70S75Y77K/50R
I-CreI28K30N32G33H38Q40S44A68Y70S75Y77K/49A50R +
1-Cre128K30N32G33H38Q40S44A68Y70S75Y77K/81V129A154G +
1-Cre128K30N32G33H38Q40S44A68Y70S75Y77K/129A161P +
1-Cre128K30N32G33H38Q40S44A68Y70S75Y77K/117G +
1-Cre128K30N32G33H38Q40S44A68Y70S75Y77K/81T +
1-Cre128K30N32G33H38Q40S44A68Y70S75Y77K/103T
+ B2M 11.2 target cleavage
* optimized mutations are in bold
Example 4: Making of meganucleases cleaving B2M11.3
This example, shows that I-CreI mutants can cleave the B2M11.3
DNA target sequence derived from the right part of the B2M11.1 target in a
palindromic form (Figure 5). All target sequences described in this example
are 22 bp
palindromic sequences. Therefore, they will be described only by the first 11
nucleotides, followed by the suffix _P, solely to indicate that (for example,
B2M11.3
will be called tctgactttgt_P; SEQ ID NO: 97).
B2M11.3 is similar to 5TTT_P in positions 1, 2, 3, 4, 5, 6
and 7 and to IOCTG P in positions 1, 2, 6, 7, 8, 9 and 10. It was
hypothesized that position 11 would have little effect on the binding and
cleavage
activity. Mutants able to cleave 5TTT_P target (caaaactttgt_P; SEQ ID NO: 95)
were
previously obtained by mutagenesis on I-CreI N75 at positions 44, 68, 70, 75
and 77,
as described in Arnould et al., J. Mol. Biol., 2006, 355, 443-458 and
International
PCT Applications WO 2006/097784, WO 2006/097853. Mutants able to cleave the
10CTG P target (cctgacgtcgt_P; SEQ ID NO: 93) were obtained by mutagenesis on
I-
Crel N75 and D75 at positions 28, 30, 32, 33, 38, 40 and 70, as described in
Smith et
al., Nucleic Acids Res., 2006, 34, e149). Thus combining such pairs of mutants
would
allow for the cleavage of the B2M 11.3 target.
Both sets of proteins are mutated at position 70. However, it was
previously demonstrated that two separable functional domains exist in I-Crel
(Smith
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
47
et al., Nucleic Acids Res., 2006, 34, e149). That implies that this position
has little
impact on the specificity in base 10 to 8 of the target. Therefore, to check
whether
combined mutants could cleave the B2M 11.3 target, mutations at positions 44,
68, 70,
75 and 77 from proteins cleaving 5TTT_P (caaaactttgt_P; SEQ ID NO: 95) were
combined with the 28, 30, 32, 33, 38, 40 mutations from proteins cleaving
IOCTG_P
(cctgacgtcgt_P; SEQ ID NO: 93).
1) Material and Methods
I-CreI mutants cleaving IOCTG_P or 5TTT P were identified as
described previously in Smith et al, Nucleic Acids Res., 2006, 34, e149, and
Arnould
et al., J. Mol. Biol., 2006, 355, 443-458; International PCT Applications WO
2006/097784, WO 2006/097853, respectively for the l OCTG_P and 5TTT_P targets.
In order to generate I-CreI derived coding sequence containing
mutations from both series, separate overlapping PCR reactions were carried
out that
amplify the 5' end (aa positions 1-43) or the 3' end (positions 39-167) of the
I-CreI
coding sequence. For both the 5' and 3' end, PCR amplification is carried out
using
GallOF (5'-gcaactttagtgctgacacatacagg-3': SEQ ID NO: 99) or Ga110R (5'-
acaaccttgattggagacttgacc-3': SEQ ID NO: 100) primers specific to the vector
(pCLS0542, Figure 13) and primers specific to the I-CreI coding sequence for
amino
acids 39-43 (assF 5'-ctannnttgaccttt-3'(SEQ ID NO: 101) or assR 5'-
aaaggtcaannntag-
3'(SEQ ID NO: 102)) where nnn code for residue 40. The PCR fragments resulting
from the amplification reaction realized with the same primers and with the
same
coding sequence for residue 40 were pooled. Then, each pool of PCR fragments
resulting from the reaction with primers Ga110F and assR or assF and Ga110R
was
mixed in an equimolar ratio. Finally, approximately 25ng.of each final pool of
the two
overlapping PCR fragments and 75ng of vector DNA, a kanamycin resistant yeast
expression vector (pCLS 1107, Figure 14), linearized by digestion with DraIII
and
NgoMIV were used to transform the yeast Saccharomyces cerevisiae strain strain
FYC2-6A (MATa, trp1063, leu201, his3A200) using a high efficiency LiAc
transformation protocol (Gietz and Woods, methods Enzymol., 2002, 350, 87-96).
An
intact coding sequence containing both groups of mutations is generated by in
vivo
homologous recombination in yeast.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
48
2) Results
I-Crel combinatorial mutants were constructed by associating mutations at
positions
44, 68, 70, 75 and 77 with the 28, 30, 33, 38 and 40 mutations on the I-CreI
N75 or
D75 scaffold, resulting in a library of complexity 1600. Examples of
combinatorial
mutants are displayed on Table III. This library was transformed into yeast
and 3348
clones (2.1 times the diversity) were screened for cleavage against B2M 11.3
DNA
target (tctgactttgt_P; SEQ ID NO: 97). One positive clone was found, which
after
sequencing and validation by secondary screening turned out to be correspond
to a
novel endonuclease (see Table III). Positive is shown in Figure 9.
Table III: Cleavage of the B2M11.3 target by the combinatorial mutants*
Amino
acids
at
positions Amino acids at positions 28, 30, 32, 33, 38 and 40
44, 68, 70, (KNSTQA stands for K28, N30, S32, T33, Q38 and A40)
75 and 77
(KNANI
stands for
K44, N68,
A70, N75 KQSGCS
and 177) KNSTQA (SEQ ID KNSGQA KNSSQP KDSRGS KSSNQS KNTTQS KNSGCS KQSTQS
KCSGQS
NO: 81)
KNANI'
KRDNI
QNSNR
QRDNI
KGSNI
NHNNI
THHNI
KNSNI
QRRNI
QRSDK
KASNT
QESNR
TRSYI
TSSKN
QRSNT
TYSYR
QASDR
KYSNI
KYSNQ
TTSYR
KQSNT
QNSNR +
(SEQ ID
NO: 105)
QSSNR
KYSDT
TYSYK
* Only 240 out of the 1600 combinations are displayed).
+ indicates cleavage of the B2M 11.3 target by the combinatorial mutant.
Example 5: Making of meganucleases cleaving B2M11 by coexpression of
meganucleases cleaving B2M11.2 assembly with proteins cleaving B2M11.3
I-CreI mutants able to cleave each of the palindromic B2M 11 derived
targets (B2M11.2 and B2M11.3) were identified in examples 2, 3 and 4. Pairs of
such
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
49
mutants (one cutting B2M 11.2 and one cutting B2M 11.3) were co-expressed in
yeast
Upon coexpression, there should be three active molecular species, two
homodimers,
and one heterodimer. It was assayed whether the heterodimers that should be
formed
cut the B2M 11 target.
1) Material and Methods
a) Cloning of optimized mutants in leucine vector, in B2M 11 target yeast
The yeast strain FYBL2-7B (MAT a, ura30851, trp1063, leu201,
lys2A202) containing the B2M 11 target into yeast reporter vector (pCLS 1055,
Figure
12) is transformed with optimised mutants cutting B2M 11.2 target that were
cloned in
leucine vector (pCLS0542, Figure 13), using a high efficiency LiAc
transformation
protocol. Mutant-target yeasts are used as target for mating assays as
described in
examples 2 and 4, against the mutant cutting B2M 11.3, in kanamycin vector
(pCLS 1107).
b) Mating of meganucleases coexpressing clones and screening in yeast
Mating was performed using a colony gridder (QpixlI, Genetix).
Mutants were gridded on nylon filters covering YPD plates, using a low
gridding
density (about 4 spots/cm2). A second gridding process was performed on the
same
filters to spot a second layer consisting of different reporter-harbouring
yeast strains
for each mutant-target. Membranes were placed on solid agar YPD rich medium,
and
incubated at 30 C for one night, to allow mating. Next, filters were
transferred to
synthetic medium, lacking leucine and tryptophan, adding G418, with galactose
(1 %)
as a carbon source, and incubated for five days at 37 C, to select for
diploids carrying
the expression and target vectors. After 5 days, filters were placed on solid
agarose
medium with 0.02 % X-Gal in 0.5 M sodium phosphate buffer, pH 7.0, 0.1 % SDS,
6
% dimethyl formamide (DMF), 7mM (3-mercaptoethanol, 1% agarose, and incubated
at 37 C, to monitor (3-galactosidase activity. Results were analyzed by
scanning and
quantification was performed using appropriate software
2) Results:
Coexpression of mutants cleaving the B2M11.2 and B2M11.3
resulted in the cleavage of the B2M11 target in most cases (Figure 10).
Functional
combinations are summarized in Table IV.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
Table IV: Combinations that resulted in cleavage of B2M11 target.
B2M11
Mutant B2M11.3 Optimized Mutant B2M11.2 target
cleavage
I-Cre128K30N32A33H38040S44A68Y70S75Y77K/2Y53R66C +
1-Cre128K30N32A33H38Q40S44A68Y70S75Y77K/2Y53R +
I-Crel 28K30N32A33H38040S 44A68Y70S75Y77K/132V +
I-Crel 28K30N32G33H38Q40S 44A68Y70S75Y77K/2196R105A +
I-Crel 28K30N32G33H38Q40S 44A68Y70S75Y77K/120G +
I-Crel I-Crel 28K30N32A33H38Q40S 44A68Y70S75Y77K/43L1 05A1 59R
K28Q30S32G33C38S40 I-Crel 28K30N32G33H38040S 44A68Y70S75Y77K/50R
Q44N68S70N75R77 I-Crel 28K30N32G33H38Q40S 44A68Y70S75Y77K/49A50R
(KQSGCS/QNSNR) I-Crel 28K30N32G33H38Q40S 44A68Y70S75Y77K/81V129A154G
I-Cre128K30N32G33H38Q40S 44A68Y70S75Y77K/129A161P
1-Cre128K30N32G33H38Q40S 44A68Y70S75Y77K/117G
I-Crel 28K30N32G33H38Q40S 44A68Y70S75Y77K/81T
1-Cre128K30N32G33H38Q40S 44A68Y70S75Y77K/103T
+ indicates that the heterodimeric mutant is cleaving the B2M 11 target
Example 6: Making of meganucleases cleaving B2M11 with higher efficacy by
random mutagenesis of meganuclease cleaving B2M11.3 and co-expression with
5 proteins cleaving B2M11.2
I-Crel mutants able to cleave the palindromic B2M11 target were
identified by co-expression of mutants cleaving the palindromic B2M11.2 and
B2M11.3 targets (Example 5). However, efficiency and number of positive
combinations able to cleave B2M11 were minimal.
10 Therefore, the protein cleaving B2M 11.3 was mutagenized and
variants cleaving B2M11 with better efficiency, when combined to optimized
mutants
for B2M 11.2, were screened. According to the structure of the I-CreI protein
bound to
its target, there is no contact between the residues used for the first
combinatorial
approach (28, 30, 32, 33, 38 and 40 vs 44, 68, 70, 75 and 77) in the I-Crel
protein
15 (Chevalier et al., Nat. Struct. Biol., 2001, 8, 312-316; Chevalier B.S. and
Stoddard
B.L., Nucleic Acids Res., 2001, 29, 3757-3754; Chevalier et al., J. Mol.
Biol., 2003,
329, 253-269). Thus, it is difficult to rationally choose a set of positions
to
mutagenize, and mutagenesis was done on the C-terminal part of the protein (83
last
amino acids) or on the whole protein.
20 1) Material and Methods
A random mutagenesis library was created on the chosen mutant, by
PCR using Mn2+ or derivatives of dNTPs as 8-oxo-dGTP and dPTP in two-step PCR
process as described in the protocol from JENA BIOSCIENCE GmbH in JBS dNTP-
Mutageneis kit. Primers used are: preATGCreFor (5'-
25 gcataaattactatacttctatagacacgcaaacacaaatacacagcggccttgccacc-3'; SEQ ID NO:
103) and
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
51
ICreIpostRev (5'-ggctcgaggagctcgtctagaggatcgctcgagttatcagtcggccgc-3'; SEQ ID
NO:
104). The new libraries were cloned in vivo in the yeast in the linearized
kanamycin
vector harbouring a galactose inducible promoter, a KanR as selectable marker
and a 2
micron origin of replication. Positives resulting clones were verified by
sequencing
(MILLEGEN).
Pools of mutants were amplified by PCR reaction using these primers
common for leucine vector (pCLS0542, Figure 13) and kanamycin vector (pCLS
1107,
Figure 14). Approximately 75ng of PCR fragment and 75ng of vector DNA
(pCLS 1107) linearized by digestion with Dralll and NgoMIV are used to
transform
the yeast Saccharomyces cerevisiae strain FYC2-6A (MATa, trp 1063, leu201,
his3A200) using a high efficiency LiAc transformation protocol. A library of
intact
coding sequence for the I-CreI mutant is generated by in vivo homologous
recombination in yeast.
Mutant-target yeasts are prepared and used as target for mating
assays as described in example 5.
2) Results:
The mutants cleaving B2M 11.3 (I-CreI
28K30Q32S33G38C40S44Q68N70S75N77R also called KQSGCS/QNSNR
according to nomenclature of Table III) was randomly mutagenized and
transformed
into yeast. 6696 transformed clones were then mated with a yeast strain that
(i)
contains the B2M 11 target in a reporter plasmid (ii) expresses a optimized
variant
cleaving the B2M11.2 target, chosen among those described in example 5. Four
such
strains were used, expressing either the I-Crel
28K30N32A33H38Q40S44A68Y70S75Y77K/132V mutant, the I-CreI
28K30N32G33H38Q40S44A68Y70S75Y77K/2196R105A mutant, the
28K30N32G33H38Q40S44A68Y70S75Y77K/120G mutant, or the
28K30N32A33H38Q40S44A68Y70S75Y77K/2Y53R66C mutant (see Table V). One
hundred and one clones were found to trigger cleavage of the B2M11 target when
mated with such yeast strain. In a control experiment, none of these clones
was found
to trigger cleavage of B2M11 without coexpression of the KQSGCS/QNSNR protein.
It was concluded that 101 positives were containing proteins able to cleave
B2M11
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
52
when forming heterodimers with KQSGCS/QNSNR. Examples of such heterodimeric
mutants are listed in Table V. Examples of positives are shown on Figure 11.
Table V: Combinations that resulted in cleavage of B2M11 target
Optimized Mutant Optimized Mutant B2M11.3* BZM'll
B2M11'2* (SEQ ID NO: 37 to 77) target
(SEQ ID NO: 25 to 28) cleavage
1-Cre128K30Q33G38C40S44Q68N70S77R/19S72F +
I-Cre128K30Q33G38C40S44Q68N70S77R/31L83Q87L +
1-Cre128K30Q33G38C40S44Q68N70S77R/43L1170 +
1-Cre128K30Q33G38C40S44Q68N70S77R/49A +
I-Crel 28K30Q33G38C40S44Q68N70S77R/50R107R +
I-Crel 28K30Q33G38C40S44Q68N70S77R/54L +
I-Crel 28K30Q33G38C40S44Q68N70S77R/56E +
I-Crel I-Crel 28K30Q33G38C40S44Q68N70S77R/57N +
32G33H44A68Y70S75Y77 1-Cre128K30033G38C40S44Q68N70S77R/59A60E163L +
K 1-Cre128K30Q33G38C40S44Q68N70S77R/60G100R155Q165T +
/2196R105A 1-Cre128K30Q33G38C40S44068N70S77R/60N +
1-Cre128K30Q33G38C40S44Q68N70S77R/64A +
Or 1-Cre128K30Q33G38C40S44Q68N70S77R/64D69G +
1-Cre128K30Q33G38C40S44Q68N70S77R/69E82E +
I-Crel I-Crel 28K30Q33G38C40S44Q68N70S77R/69G +
32A33H44A68Y70S75Y77 1-Cre128K30Q33G38C40S44Q68N70S77R/72P154G +
K I-Crel 28K30033G38C40S44Q68N70S77R/731 +
/132V 1-Cre128K30Q33G38C40S44Q68N70S77R/731156N +
I-Crel 28K30Q33G38C40S44Q68N70S77R/103S +
Or 1-Cre128K30Q33G38C40S44Q68N70S77R/103S147N +
I-Crel 28K30033G38C40S44Q68N70S77R/105A +
I-Crel I-Crel 28K30Q33G38C40S44Q68N70S77R/110D +
32A33H44A68Y70S75Y77 1-Cre128K30033G38C40S44Q68N70S77R/110G153V +
K I-Crel 28K30Q33G38C40S44Q68N70S77R/111 L +
/2Y53R66C 1-Cre128K30033G38C40S44Q68N70S77R/142R161P +
I-Crel 28K30033G38C40S44Q68N70S77R/1530 +
Or 1-Cre128K30Q33G38C40S44Q68N70S77R/153V +
1-Cre128K30033G38C40S44Q68N70S77R/156N +
I-Crel I-Crel 28K30Q33G38C40S44Q68N70S77R/156R +
32G33H44A68Y70S75Y77 1-Cre128K30Q33G38C40S44Q68N70S77R/157V +
K 1-Cre128K30Q33G38C40S44Q68N70S77R/158N +
/120G 1-Cre128K30Q33G38C40S44Q68N70S77R/80094Y +
1-Cre128K30Q33G38C40S44Q68N70S77R/81T83A117G +
I-Crel 28K30Q33G38C40S44Q68N70S77R/81 V159Q +
1-Cre128K30Q33G38C40S44Q68N70S77R/82E107R +
1-Cre128K30Q33G38C40S44Q68N70S77R/85R +
1-Cre128K30033G38C40S44Q68N70S77R/87L +
1-Cre128K30Q33G38C40S44Q68N70S77R/92L135P142R1640165P +
1-Cre128K30Q33G38C40S44Q68N70S77R/96R +
I-Crel 28K30033G38C40S44Q 68Y70S77R/72T140M +
1-Cre128K30Q33G38S40S44Q68N70S77R +
+: indicates that the heterodimeric variant is cleaving the B2M11 target.
Optimized mutations are in bold
Example 7: Making of meganucleases cleaving B2M11.2 in an extrachromosomic
model in CHO cells with high efficacy by random mutagenesis of meganucleases
cleaving B2M11.3 and co-expression with proteins cleaving B2M11.
I-Crel mutants able to cleave the palindromic B2M11 target with a
better efficiency have been identified in yeast by co-expression of mutants-
optimized
or not- cleaving palindromic B2M 11.2 and B2M 11.3 targets (Example 5).
However,
functional heterodimer in CHO cell are interesting and efficiency and number
of
positive combinations able to cleave B2M11 in mammalian cell cells using an
extrachromosomal assay could be different than in yeast cell.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
53
Therefore the best proteins cleaving B2M 11.2 were mutagenized as
in example 5, and variants cleaving with good efficiency B2M 11 when combined
to
optimized mutants for B2M 11.3 were screened. According to the structure of
the I-
Crel protein bound to its target, there is no contact between the residues
used for the
first combinatorial approach (28, 30, 32, 33, 38 and 40 vs 44, 68, 70, 75 and
77) in the
I-Crel protein (Chevalier et al., Nat. Struct. Biol., 2001, 8, 312-316;
Chevalier B.S.
and Stoddard B.L., Nucleic Acids Res., 2001, 29, 3757-3754; Chevalier et al.,
J. Mol.
Biol., 2003, 329, 253-269). Thus, it is difficult to rationally choose a set
of positions
to mutagenize, and mutagenesis was done on the C-terminal part of the protein
(83
last amino acids) or on the whole protein.
1) Material and Methods
a) Construction of libraries by random muta eg nesis
Random mutagenesis libraries on a pool of chosen mutants were
created by PCR using Mn2+ or derivatives of dNTPs as 8-oxo-dGTP and dPTP in
two-
step PCR process as described in the protocol from JENA BIOSCIENCE GmbH in
JBS dNTP-Mutageneis kit. Primers used are attBl-ICrelFor (5'-
ggggacaagtttgtacaaaaaagcaggcttcgaaggagatagaaccatggccaataccaaatataacaaagagttcc-
3':
(SEQ ID NO: 120) and attB2-ICreIRev (5'-
ggggaccactttgtacaagaaagctgggtttagtcggccgccggggaggatttcttcttctcgc-3': SEQ ID
NO:
121). PCR products obtained were cloned in vitro in CHO Gateway expression
vector
pCDNA6.2 from INVITROGEN (pCLS 1069, Figure 16). In parallel, chosen mutants
used for libraries were cloned in the same way in this vector. Cloned mutants
and
positives resulting clones of libraries were verified by sequencing
(MILLEGEN).
b) Construction of B2M11 target in a vector for screening in CHO cells
From yeast target vector (as example 1) the B2M 11 target was
amplified by two steps PCR using primers Mls (5'-aaaaagcaggctgattggcatacaagtt-
3':
SEQ ID NO: 122) and M2s (5'-agaaagctgggtgattgacagacgattg-3': SEQ ID NO: 123)
followed by attB 1 adapbis (5'-ggggacaagtttgtacaaaaaagca-3': SEQ ID NO: 124)
and
attB2adapbis (5'- ggggaccactttgtacaagaaagct-3': SEQ ID NO: 125). Primers are
from
PROLIGO. Final PCR was cloned using the Gateway protocol (INVITROGEN) into
CHO reporter vector (pCLS 1058, Figure 17). Cloned target was verified by
sequencing (MILLEGEN).
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
54
c) Extrachromosomal assay in mammalian cells
CHO cells were transfected with Polyfect transfection reagent
according to the supplier's protocol (QIAGEN). 72 hours after transfection,
culture
medium was removed and 150 l of lysis/revelation buffer added for 0-
galactosidase
liquid assay (typically, 1 liter of buffer contained 100 ml of lysis buffer
(Tris-HC1 10
mM pH7.5, NaC1 150 mM, Triton X 100 0.1%, BSA 0.1 mg/ml, protease inhibitors),
ml of Mg 100X buffer (MgC12 100 mM, (3-mercaptoethanol 35 %), 110ml ONPG 8
mg/ml and 780 ml of sodium phosphate 0.1 M pH7.5). After incubation at 37 C,
optical density (OD) was measured at 420 nm. The entire process was performed
on
10 an automated Velocityl l BioCel platform. Per assay, 150 ng of target
vector was
cotransfected with 12.5 ng of each one of both mutants (12.5 ng of mutant
cleaving
palindromic B2M 11.2 target and 12.5 ng of mutant cleaving palindromic B2M
11.3
target)
2) Results
The optimized mutants cleaving B2M11.2 (I-Crel
32G33H44A68Y70S75Y77K/120G, 32A33H44A68Y70S75Y77K/2Y53R66C,
32G33H44A68Y70S75Y77K/2I96R105A and 32A33H44A68Y70S75Y77K/132V as
described into Table V) were randomly mutagenized and transformed into Gateway
vector (Figure 16). DNA plasmid of 1920 transformed clones were purified and
then
cotransfected with the CHO B2M 11 target vector and an optimized variant
cleaving
the B2M11.3 target, chosen among those described in example 6. Cotransfection
of
the transformed clones with the CHO B2M 11 target vector and the initial
mutant
(30Q33G38C68N70S77R) cleaving B2M11.3 was included for comparison. Sixty
clones were found to trigger cleavage of the B2M 11 target when co-transfected
with
an optimized variant cleaving B2M11.3 target.
In a control experiment, none of these clones was found to trigger
cleavage of B2M 11 without cotransfection of a (optimized or not) variant
cleaving the
B2M11.3 target. It was thus concluded that 60 positives were containing
proteins able
to cleave B2M11 when forming heterodimers with optimized variant cleaving the
B2M 11.3 target. Examples of such heterodimeric mutants derived from two
optimized
variants cleaving the B2M11.3 target (30Q33G38C68N70S77R/43L115T117G and
30Q33G38C68N70S77R/110D) are listed in Table VI.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
Table VI: Combinations that resulted in cleavage* of the B2M11
target in CHO cells.
Initial (30Q33G38C68N70S77R) and
CHO Optimized Mutants B2M11.2 Optimized B2M11.3 mutants
Optimized Optimized Initial
43L115T117G 110D
32A33H44A68Y70S75Y77K/132V + +/-
32A33H44A68Y70S75Y77K/19S120G nd - -
32A33H44A68Y70S75Y77K/19S132V ++ + +
32A33H44A68Y70S75Y77K/19S43L + + +/-
32A33H44A68Y70S75Y77K/19S43L53R66C + +/- +/-
32A33H44A68Y70S75Y77K/24F117G + +/- +/-
32A33H44A68Y70S75Y77K/43L132V + +/- +/-
32G33H44A68Y70S75Y77K/ - +/- -
32G33H44A68Y70S75Y77K1105A + +/- +/-
32G33H44A68Y70S75Y77K/105A128R +/- - -
32G33H44A68Y70S75Y77KI105A162F +/- - -
32G33H44A68Y70S75Y77K/117G 154G +/- +/- -
32G33H44A68Y70S75Y77K/120G +/- +/- -
32G33H44A68Y70S75Y77KI120G162F +/- - -
32G33H44A68Y70S75Y77KI120G163Q +/- - -
32G33H44A68Y70S75Y77K/19S431-105A + +/- +/-
32G33H44A68Y70S75Y77K/19S96R105A nd - +/-
32G33H44A68Y70S75Y77K/24F89A117G162F165P + + +/-
32G33H44A68Y70S75Y77K/2196R105A - +/- -
32G33H44A68Y70S75Y77K/4Q96R105A +/- - -
32G33H44A68Y70S75Y77K/79G96R105A +l- - -
32G33H44A68Y70S75Y77K/89A +/- - -
32G33H44A68Y70S75Y77K/891120G +l- - -
32G33H44A68Y70S75Y77K/92R96R105A +/- - -
32G33H44A68Y70S75Y77K/94L105A +/- - -
32G33H44A68Y70S75Y77K/96R100Q105A161F +l- - -
32G33H44A68Y70S75Y77K/96R105A + +/- +/-
32G33H44A68Y70S75Y77K/96R105A117G +1- - -
*(-):< 0.25. ( ): 0.25 S< 0,5. (+) : 0,5 S<1,2. (++): 2: 1,2. Values
(absorbance unit)
5 correspond to average of experimental results of the extrachromosomal assay
in CHO cells
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
56
Example 8: Making of meganucleases cleaving B2M18.
Two news series of palindromic targets, B2M l 8.3 and B2M 18.4
were derived from B2M 18 and B2M20.3 and B2M20.4 from B2M20 (Figures 18 and
21). Since B2M18.3, B2M18.4, B2M20.3 and B2M20.4 are palindromic, they should
be cleaved by homodimeric proteins. First, proteins able to cleave the B2M18.4
sequence as homodimers were designed (example 8), and then proteins able to
cleave
the B2M20.4 sequences as homodimers were designed (example 9).
This example shows that I-CreI variants can cleave the B2M 18.4
DNA target sequence derived from the right part of the B2M18 target in a
palindromic
form (Figure 18). All target sequences described in this example are 22 bp
palindromic sequences. Therefore, they will be described only by the first 11
nucleotides, followed by the suffix P. For example, B2M18.4 will be called
TTAACTATCGT_P (SEQ ID NO: 113).
B2M18.4 is similar to 5ATC_P in positions 1, 2, 3, 4, 5, 8
and _9 and to l OTAA_P in positions 1, 2, 3, 4, 8, 9 and 10. It was
hypothesized that positions 6, 7 and 11 would have little effect on the
binding and
cleavage activity. Mutants able to cleave 5ATC_P target (CAAAACATCGT P) were
previously obtained by mutagenesis on I-Crel N75 at positions 44, 68, 70, 75
and 77,
as described in Arnould et al., J. Mol. Biol., 2006, 355, 443-458 and
International
PCT Applications WO 2006/097784, WO 2006/097853. Mutants able to cleave the
5ATC_P target (CTAAACGTCGT P) were obtained by mutagenesis on I-Crel N75
and D75 at positions 28, 30, 32, 33, 38, 40 and 70 as described in Smith et
al., Nucleic
Acids Res., 2006, 34, e149 . Thus combining such pairs of mutants would allow
for
the cleavage of the B2M18.4 target.
Both sets of proteins are mutated at position 70. However, the
existence of two separable functional subdomains was hypothesized. That
implies that
this position has little impact on the specificity in base 10 to 8 of the
target. Therefore,
mutations at positions 44, 68, 70, 75 and 77 from proteins cleaving 5ATC_P
(CAAAACATCGT P) were combined with the 28, 30, 32, 33, 38, 40 mutations from
proteins cleaving IOTAA OTAA-P (CTAAACP) to check whether combined
mutants could cleave the B2M 18.4 target.
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
57
1) Material and Methods
The experimental procedure is as described in example 2.
2) Results
I-Cre1 combinatorial mutants were constructed by associating
mutations at positions 44, 68, 70, 75 and 77 with the 28, 30, 33, 38 and 40
mutations
on the I-Crel N75 or D75 scaffold, resulting in a library of complexity 1600.
Examples of combinatorial mutants are displayed on Table VII. This library was
transformed into yeast and 3348 clones (2.1 times the diversity) were screened
for
cleavage against B2M 18.4 DNA target (TTAACTATCGT P). 59 positives clones
were found, which after sequencing and validation by secondary screening
turned out
to be correspond to 18 novel endonucleases (SEQ ID NO: 136 to 152 and 179; see
Table VII). Positives are shown in Figure 19. One positive clone presents an
additional
mutation in position 153. The sequence of this clone is KNRTQS/ QYSRQ - 153G.
Table VII : Cleavage of the B2M18.4 target by the combinatorial mutants*
Amino acids at Amino acids at positions 28, 30, 32, 33, 38 and 40 (ex: KHSCQS
stands for
positions 44, 68, K28, H30, S32, C33, Q38 and S40
70, 75 and 77
(ex:QYSRQ KHSCQS KNGCQS KNSCQQ KNACQS KNGSQS KNRTQS
stands for Q44, Y68,
S70, R75 and Q77
QYSRQ + + +
TYSRI
QNSNR
QASRI
QRSRI
NYSRQ + + +
NYSRV + + + +
TYSRS
TYSRV
NYSRH
QRSNK
TYSRQ + +
QRRNI
QQSAR
RYSYT
QYSRV +
RYSRQ +
QYSRI +
QQSNR
SYSRI
NYSRY + +
QQSRI
NTSRV
QRPNI
HASRY
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
58
* Only 138 out of the 1600 combinations theoretically present in the
combinatorial library
are displayed. + indicates that the combinatorial mutant was found among the
identified positives.
Example 9: Making of meganucleases cleaving B2M20
This example shows that I-Crel variants can cleave the B2M20.4
DNA target sequence derived from the right part of the B2M20.1 target in a
palindromic form (Figure 19). All target sequences described in this example
are 22
bp palindromic sequences. Therefore, they will be described only by the first
11
nucleotides, followed by the suffix _P. For example, B2M20.4 will be called
TTACATGTCGT_P: SEQ ID NO: 119).
B2M18.4 is similar to 5GTC P in positions f1, 2, 3, 4, 5 and 7
and to IOTAC P in positions 1, 2, 3, 4, 5, 7, 8, 9 and 10. It was
hypothesized that positions 6 and f 11 would have little effect on the
binding and
cleavage activity. Mutants able to cleave 5GTC_P target (CAAAACGTCGT P) were
previously obtained by directed mutagenesis on I-Crel at positions 70 and 75
as
described in Arnould et al., J. Mol. Biol., 2006, 355, 443-458 and
International PCT
Applications WO 2006/097784, WO 2006/097853. Mutants able to cleave the
10TAC_P target (CTACACGTCGT P) were obtained by mutagenesis on I-Crel N75
and D75 at positions 28, 30, 32, 33, 38, 40 and 70, as described in Smith et
al.,
Nucleic Acids Res., 2006, 34, e149. Thus combining such pairs of mutants would
allow for the cleavage of the B2M20.4 target.
Both sets of proteins are mutated at position 70. However, the
existence of two separable functional subdomains was hypothesized. That
implies that
this position has little impact on the specificity in base 10 to 8 of the
target. Therefore,
mutations at positions 70 and 75 from proteins cleaving 5GTC_P
(CAAAACGTCGT_P) were combined with the 28, 30, 32, 33, 38, 40 mutations from
proteins cleaving 1 0TAC P(CTACACGTCGT P) to check whether combined
mutants could cleave the B2M20.4 target.
1) Material and Methods
The experimental procedure is as described in example 2.
2) Results
I-CreI combinatorial mutants were constructed by associating
mutations at positions 70 and 75 with the 28, 30, 33, 38 and 40 mutations on
the I-
CreI N75 or D75 scaffold, resulting in a library of complexity 1536. Examples
of
CA 02678709 2009-08-19
WO 2008/102274 PCT/IB2008/001334
59
combinatorial mutants are displayed on Table VIII. This library was
transformed into
yeast and 6696 clones (4.4 times the diversity) were screened for cleavage
against
B2M20.4 DNA target (TTACATGTCGT P). 196 positives clones were found, which
after sequencing and validation by secondary screening turned out to be
correspond to
164 novel endonucleases (see Table VIII showing SEQ ID NO: 153 to 178).
Positive
is shown in Figure 21. 12 clones present additional mutations (56G, 82R, 147A
or
161 F), as in example 8.
Table VIII : Cleavage of the B2M20.4 target by the combinatorial mutants*
Amino acids Amino acids at positions 70 and 75
at positions ex : SN stands for S70 and N75
28, 30, 32, 33, 38 and 40
(ex: ANSSQR stands
for A28, N30, S32, S33, SN SY RN RA SA RY SE RE SD RD
Q38 and R40)
ANSSQR +
ANSTQR +
RNSAYQ +
RNSNRQ +
RNSRYQ +
RNSSRQ +
RNSSYQ +
TNSNQD +
TNSTQR +
KNGCQS +
KNSCQS +
KNSSQR + +
KASGQS +
KASTQS +
KCSAQS +
KCSCQS +
KSSSTS +
KTWYQS +
KHSKQS +
KRSPQS +
KKSTQS +
KPSWQS +
KNGPQS +
KNTAQS +
KNSTQE +
* Only 230 out of the 1536 combinations theoretically present in the
combinatorial library
are displayed. + indicates that the combinatorial mutant was found among the
identified
positives.
