Note: Descriptions are shown in the official language in which they were submitted.
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
METHODS AND KITS FOR AMPLIFYING DNA
CROSS-REFERENCE TO RELATED APPLICATIONS
This application is a continuation-in-part of U.S. Application Serial No.
11/213,519,
filed August 26,2005, now pending, which claims the benefit of U. S.
Provisional Application
No. 60/604,830, filed August 27, 2004, and U.S. Provisional Application No.
60/639,110,
filed December 23, 2004, the contents of each of which applications are hereby
incorporated
by reference herein.
FIELD OF THE INVENTION
This invention relates to methods, reaction mixtures, compositions and kits
for
producing multiple copies of a specific nucleic acid sequence or "target
sequence" which may
be present either alone or as a component, large or small, of a homogeneous or
heterogeneous
mixture of nucleic acids. The mixture of nucleic acids may be that found in a
sample taken
for diagnostic testing, for screening of blood products, for food, water,
industrial or
environmental testing, for research studies, for the preparation of reagents
or materials for
other processes such as cloning, or for other purposes.
The selective amplification of specific nucleic acid sequences is ofvalue in
increasing
the sensitivity of diagnostic and other detection assays while maintaining
specificity;
increasing the sensitivity, convenience, accuracy and reliability of a variety
of research
procedures; and providing ample supplies of specific oligonucleotides for
various purposes.
BACKGROUND OF THE INVENTION
The detection and/or quantitation of specific nucleic acid sequences is an
important
technique for identifying and classifying microorganisms, diagnosing
infectious diseases,
detecting and characterizing genetic abnormalities, identifying genetic
changes associated
with cancer, studying genetic susceptibility to disease, and measuring
response to various
types of treatment. Such procedures are also useful in detecting and
quantitating
microorganisms in foodstuffs, water, industrial and environmental samples,
seed stocks, and
other types of material where the presence of specific microorganisms may need
to be
monitored. Other applications are found in the forensic sciences,
anthropology, archaeology,
and biology where measurement of the relatedness of nucleic acid sequences has
been used
to identify criminal suspects, resolve paternity disputes, construct
genealogical and
phylogenetic trees, and aid in classifying a variety of life forms.
A number of methods to detect and/or quantitate nucleic acid sequences are
well
known in the art. These include hybridization to a labeled probe, and various
permutations
-1-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
of the polymerase chain reaction (PCR), coupled with hybridization to a
labeled probe. See,
e.g., Mullis et al., "Process for Amplifying, Detecting and/or Cloning Nucleic
Acid
Sequences," U.S. Patent No. 4,683,195; Mullis, "Process for Amplifying Nucleic
Acid
Sequences," U.S. Patent No. 4,683,202; Mullis et al., "Process for Amplifying,
Detecting
and/or Cloning Nucleic Acid Sequences," U.S. Patent No. 4,800,159; Mullis et
al. (1987)
Meth. Enzymol. 155,335-350; and Murakawa et al. (1988) DNA 7,287-295. The
requirement
of repeated cycling of reaction temperature between several different and
extreme
temperatures is a disadvantage of the PCR procedure. In order to make PCR
convenient,
expensive programmable thermal cycling instruments are required.
Additionally, Transcription-Mediated Amplification (TMA) methods may be used
to
synthesize multiple copies of a target nucleic acid sequence autocatalytically
under conditions
of substantially constant temperature, ionic strength, and pH in which
multiple RNA copies
of the target sequence autocatalytically generate additional copies. See,
e.g., Kacian et al.,
"Nucleic Acid Sequence Amplification Methods," U.S. Patent No. 5,399,491, and
Kacian et
al, "Nucleic Acid Sequence Amplification Methods," U.S. PatentNo. 5,824,518,
the contents
of each of which patents are hereby incorporated by reference herein. TMA is
useful for
generating copies of a nucleic acid target sequence for purposes which include
assays to
quantitate specific nucleic acid sequences in clinical, environmental,
forensic and sitnilar
samples, cloning and generating probes. TMA is a robust and highly sensitive
amplification
system with demonstrated efficacy. TMA overcomes many of the problems
associated with
PCR-based amplification systems. In particular, temperature cycling is not
required. Other
transcription-based amplifcation methods are disclosed by Malek et al.,
"Enhanced Nucleic
Acid Amplification Process," U.S. Patent No. 5,130,238; Davey et al., "Nucleic
Acid
Amplification Process," U.S. Patent No. 5,409,818; Davey et al., "Method for
the Synthesis
of Ribonucleic Acid (RNA)," U.S. Patent No. 5,466,586; Davey et al., "Nucleic
Acid
Amplification Process," U.S. Patent No. 5,554,517; Burg et al., "Selective
Amplification of
Target Polynucleotide Sequences," U.S. Patent No. 6,090,591; and Burg et al.,
"Selective
Amplification of Target Polynucleotide Sequences," U.S. Patent No. 6,410,276.
An inherent result of highly sensitive nucleic amplification systems is the
emergence
of side-products. Side-products include molecules which may, in some systems,
interfere with
the amplification reaction, thereby lowering specificity. This is because
limited amplification
resources, including primers and enzymes needed in the formation of primer
extension and
transcription products are diverted to the formation of side-products. In some
situations, the
appearance of side-products can also complicate the analysis of amplicon
production by
various molecular techniques.
-2-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Accordingly, there remains a need in the art for a robust nucleic acid
amplification
system to synthesize multiple copies of a target nucleic acid sequence
autocatalytically under
conditions of substantially constant temperature, ionic strength, and pH which
reduces the
appearance of side-products, thereby increasing specificity and improving
detection and
quantitation of amplification products.
SUMMARY OF THE INVENTION
The present invention is directed to novel methods of synthesizing multiple
copies of
a target sequence which are autocatalytic (i.e., able to cycle automatically
without the need
to modify reaction conditions such as temperature, pH, or ionic strength and
using the product
of one cycle in the next one). In particular, the present invention discloses
methods of nucleic
acid amplification which are robust and efficient, while reducing the
appearance of side-
products. The methods use a priming oligonucleotide, a promoter
oligonucleotide modified
to preventthe initiation ofDNA synthesis therefrom (e.g., includes a 3'-
blocking moiety) and,
optionally, a displacer oligonucleotide, a binding molecule and/or a 3'-
blocked extender
oligonucleotide, to amplify RNA or DNA molecules in vitro. Primers used in the
disclosed
methods target only one sense of a target nucleic acid. The methods of the
present invention
minimize or substantially eliminate the emergence of side-products, thus
providing a high
level of specificity. Furthermore, the appearance of side-products can
complicate the analysis
of the amplification reaction by various molecular detectiontechniques. The
present invention
minimizes or substantially eliminates this problem, thus providing an enhanced
level of
sensitivity.
In one embodiment, the present invention is drawn to a method of synthesizing
multiple copies of a target sequence comprising treating a target nucleic acid
which comprises
an RNA target sequence with a priming oligonucleotide and a binding molecule
(e.g.,
terminating oligonucleotide or digestion oligonucleotide), where the priming
oligonucleotide
hybridizes to the 3'-end of the target sequence such that a primer extension
reaction can be
initiated therefrom, and where the binding molecule binds to the target
nucleic acid adjacent
to or near the S'-end of the target sequence (by "adjacent to" is meant that
the binding
molecule binds to a base of the target nucleic acid next to the 5'-terminal
base of the target
sequence and fully 5' to the target sequence); extending the priming
oligonucleotide in a
primer extension reaction with a DNA polymerase, e.g., reverse transcriptase,
to give a DNA
primer extension product complementary to the target sequence, where the
primer extension
product has a 3'-end which is determined by the binding molecule, where the 3'-
end of the
primer extension product is complementary to the 5'-end of the target
sequence; separating
the primer extension product from the target sequence using an enzyme which
selectively
-3-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
degrades the target sequence, e.g., an enzyme with an RNAse H activity;
treating the primer
extension product with a promoter oligonucleotide comprising first and second
regions, where
the first region hybridizes to a 3'-region of the primer extension product to
form a promoter
oligonucleotide:primer extension product hybrid, where the second region
comprises a
promoter for an RNA polymerase and is situated 5' to the first region, and
where the promoter
oligonucleotide is modified to prevent the initiation of DNA synthesis
therefrom (e.g., a
blocking moiety is situated at the 3'-terminus ofthe promoter oligonucleotide
which prevents
polymerase extension); extending the 3'-end of the primer extension product in
the promoter
oligonucleotide:primer extension product hybrid to add a sequence
complementary to the
le second region of the promoter oiigonucleotide; and transcribing from the
promoter
oligonucleotide:primer extension product hybrid multiple RNA products
complementary to
the primer extension product using an RNA polymerase which recognizes the
promoter in the
promoter oligonucleotide and initiates transcription therefrom. According to
this embodiment,
the base sequences of the resulting RNA products are substantially identical
to the base
1 S sequence of the target sequence. In a preferred aspect of this embodiment,
the activity of the
DNA polymerase is substantially limited to the formation of primer extension
products
comprising the priming oligonucleotide. In yet another preferred aspect of
this embodiment,
the formation of side-products in the method is substantially less than if
said promoter
oligonucl8otide was not modified to prevent the initiation of DNA synthesis
therefrom.
20 According to yet another preferred aspect of this embodiment, if an
oligonucleotide used in
the amplification reaction comprises a promoter for an RNA polymerase, then
that
oligonucleotide further comprises a blocking moiety situated at its 3'-
terminus to prevent the
initiation of DNA synthesis therefrom.
A second embodiment of the present invention is drawn to a method of
synthesizing
25 multiple copies of a target sequence, where the method comprises treating a
target nucleic
acid comprising an RNA target sequence with a priming oligonucleotide which
hybridizes
to the 3'-end of the target sequence such that a primer extension reaction can
be initiated
therefrom; extending the priming oligonucleotide in a primer extension
reaction with a DNA
polymerase, e.g., reverse transcriptase, to give a first DNA primer extension
product having
30 an indeterminate 3'-end and comprising a base region complementary to the
target sequence;
separating the first primer extension product from the target nucleic acid
using an enzyme
which selectively degrades that portion of the target nucleic acid which is
complementary to
the first primer extension reaction, e.g., an enzyme with an RNAse H activity;
treating the
first primer extension product with a promoter oligonucleotide comprising
first and second
35 regions, where the first region hybridizes to a 3'-region of the first
primer extension product
to form a promoter oligonucleotide:first primer extension product hybrid,
where the second
-4-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
region comprises a promoter for an RNA polymerase and is situated 5' to the
first region, and
where the promoter oligonucleotide is modified to prevent the initiation of
DNA synthesis
therefrom (e.g., a blocking moiety is situated at the 3'-terminus of the
promoter
oligonucleotide which prevents polymerase extension); and transcribing from
the promoter
oligonucleotide:first primer extension product hybrid multiple first RNA
products
complementary to at least a portion of the first primer extension product
using an RNA
polymerase which recognizes the promoter and initiates transcription
therefrom, where the
base sequences of the resulting first RNA products are substantially identical
to the base
sequence of the target sequence. In a preferred aspect of this embodiment, the
activity of the
DNA polymerase in the method is substantially limited to the formation of
primer extension
products comprising the priming oligonucleotide. In yet another preferred
aspect of this
embodiment, the formation of side-products in the method is substantially less
than if the
promoter oligonucleotide was not modified to prevent the initiation of DNA
synthesis
therefrom. According to yet another preferred aspect of this embodiment, if an
oligonucleotide used in the amplification reaction comprises a promoter for an
RNA
polymerase, then that oligonucleotide further comprises a blocking moiety
situated at its 3'-
terminus to prevent the initiation of DNA synthesis therefrom.
This embodiment is preferably drawn to the further steps of treating a first
RNA
product transcribed from the promoter oligonucleotide:first primcr extension
product with the
priming oligonucleotide described above to form a priming oligonucleotide:f
rst RNA product
hybrid such that a primer extension reaction can be initiated from the priming
oligonucleotide; extending the priming oligonucleotide in a primer extension
reaction with
a DNA polymerase, e.g., reverse transcriptase, to give a second DNA primer
extension
product complementary to the first RNA product, where the second primer
extension product
has a 3'-end which is complementary to the S'-end of the first RNA product;
separating the
second primer extension product from the first RNA product using an enzyme
which
selectively degrades the first RNA product, e.g., an enzyme with an RNAse H
activity;
treating the second primer extension product with the promoter oligonucleotide
described
above to form a promoter oligonucleotide:sccond primer extension product
hybrid; extending
the 3'-end of the second primer extension product in the promoter
oligonucleotide:second
primer extension product hybrid to add a sequence complementary to the second
region of
the promoter oligonucleotide; and transcribing from the promoter
oligonucleotide:second
primer extension product hybrid multiple second RNA products complementary to
the second
primer extension product using an RNA polymerase, where the base sequences of
the second
RNA products are substantially identical to the base sequence of the target
sequence.
-5-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
A third embodiment of the present invention is drawn to a method of
synthesizing
multiple copies of a target sequence comprising treating a target nucleic acid
comprising a
DNA target sequence with a promoter oligonucleotide comprising first and
second regions,
where the first region hybridizes to the 3'-end of the target sequence to form
a promoter
oligonucleotidc:target nucleic acid hybrid, where the second region comprises
a promoter for
an RNA polymerase and is situated 5' to the first region, and where the
promoter
oligonucleotide is modified to prevent the initiation of DNA synthesis
therefrom (e.g., a
blocking moiety is situated at the 3'-terminus of the promoter
oligonucleotide); transcribing
from the promoter oligonucleotide:target nucleic acid hybrid multiple first
RNA products
comprising a base region complementary to the target sequence using an RNA
polymerase
which recognizes the promoter and initiates transcription therefrom; treating
the first RNA
products with a priming oligonucleotide which hybridizes to a 3'-region of the
first RNA
products such that a primer extension reaction may be initiated therefrom;
extending the
priming oligonucleotide in the primer extension reaction with a DNA
polymerase, e.g.,
reverse transcriptase, to give a DNA primer extension product complementary to
at least a
portion of the first RNA products, where the primer extension product has a 3'-
cnd which is
complementary to the 5'-end of the first RNA products; separating the primer
extension
product from the first RNA product using an enzyme which selectively degrades
the first
RNA product (e.g., an enzyme with an RNAse H activity); treating the primer
extension
product with the promoter oligonucleotide described above to form a promoter
oligonucleotide:primer extension product hybrid; and transcribing from the
promoter
oligonucleotide:primer extension product hybrid multiple second RNA products
complementary to the primer extension product using an RNA polymerase, wherein
the base
sequences of the second RNA products are substantially complementary to the
base sequence
of the target sequence. In a preferred aspect of this embodiment, the activity
of the DNA
polymerase in the method is substantially limited to the formation of primer
extension
products comprising the priming oligonucleotide. In yet another preferred
aspect of this
embodiment, the formation of side-products in the method is substantially less
than if the
promoter oligonucleotide was not modified to prevent the initiation of DNA
synthesis
therefrom. According to yet another preferred aspect of this embodiment, if an
oligonucleotide used in the amplification reaction comprises a promoter for an
RNA
polymerase, then that oligonucleotide further comprises a blocking moiety
situated at its 3'-
terminus to prevent the initiation of DNA synthesis therefrom. Furthermore,
any method of
this embodiment may include extending the 3'-end of the primer extension
product in the
promoter oligonucleotide:primer extension product hybrid described above to
add a sequence
complementary to the second region of the promoter oligonucleotide.
-6-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
A fourth embodiment of the present invention is drawn to a method of
synthesizing
multiple copies of a target sequence comprising treating a target nucleic acid
which comprises
a DNA target sequence with a priming oligonucleotide, where the priming
oligonucleotide
hybridizes to the 3'-end of the target sequence such that a primer extension
reaction can be
initiated therefrom; extending the priming oligonucleotide in a primer
extension reaction with
a DNA polymerase, e.g., reverse transcriptase, to give a first DNA primer
extension product,
where at least a portion of the first primer extension product is
complementary to the target
sequence; treating the primer extension product with a promoter
oligonucleotide comprising
first and second regions, where the first region comprises a base sequence
which corresponds
to a region at the 5'-end of the target sequence and which hybridizes to the
first primer
extension product to form a promoter oligonucleotide:first primer extension
product hybrid,
where the second region comprises a promoter for an RNA polymerase and is
situated 5' to
the first region, and where the promoter oligonucleotide is modified to
prevent the initiation
of DNA synthesis therefrom (e.g., a blocking moiety is situated at the 3'-
terminus of the
promoter oligonucleotide which prevents polymerase extension); and
transcribing from the
promoter oligonucleotide:first primer extension product hybrid multiple first
RNA products
complementary to at least a portion of the first primer extension product
using an RNA
polymerase which recognizes the promoter in the promoter oligonucleotide and
initiates
transcription therefrom. Provided that if the first primer extension product
has a defined 3'-
end, then the method further comprises treating the target nucleic acid with a
binding
molecule which binds to the target nucleic acid adjacent to or near the 5'-end
of the target
sequence. Further provided that the priming oligonucleotide does not include
an RNA region
which hybridizes to the target nucleic acid and which is selectively degraded
by an enzyme
activity when hybridized to the target nucleic acid. According to this
embodiment, the base
sequences of the resulting first RNA products are substantially identical to
the base sequence
of the target sequence. In a preferred aspect ofthis embodiment, the target
nucleic acid is part
of a double-stranded complex that is exposed to conditions sufficient to
denature the complex
(e.g., heat and/or chemical denaturants) prior to extending the priming
oligonucleotide in a
primer extension reaction. In another preferred aspect of this embodiment, the
activity of the
DNA polymerase is substantially limited to the formation of primer extension
products
comprising the priming oligonucleotide. In yet another preferred aspect of
this embodiment,
the formation of side-products in the method is substantially less than if
said promoter
oligonucleotide was not modified to prevent the initiation of DNA synthesis
therefrom. In
-7-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
yet a further preferred aspect of this embodiment, if an oligonucleotide used
in the
amplification reaction comprises a promoter for an RNA polymerase, then that
oligonucleotide further comprises a blocking moiety situated at its 3'-
terminus to prevent the
initiation of DNA synthesis therefrom.
The method of this embodiment is preferably drawn to the further steps of
treating the
first RNA products transcribed from the promoter oligonucleotide:first DNA
primer extension
product with the priming oligonucleotide described above to form a prithing
oligonucleotide:first RNA product hybrid such that a primer extension reaction
can be
initiated from the priming oligonucleotide; extending the priming
oligonucleotide in a primer
extension reaction with a DNA polymerase, e.g., reverse transcriptase, to give
a second DNA
primer extension product complementary to the first RNA product, where the
second primer
extension product has a 3'-end which is complementary to the 5'-end of the
first RNA product;
separating the second primer extension product from the first RNA product
using an enzyme
which selectively degrades the first RNA product, e.g., an enzyme with an
RNAse H activity;
treating the second primer extension product with the promoter oligonucleotide
described
above to form a promoter oligonucleotide:second primer extension product
hybrid; extending
the 3'-end of the second primer extension product in the promoter
oligonucleotide:second
primer extension product hybrid to add a sequence complementary to the second
region of
the promoter oligonucleotide; and transcribing from the promoter
oligonucleotide:second
primer extension product hybrid multiple second RNA products complementary to
the second
primer extension product using an RNA polymerase, where the base sequences of
the second
RNA products are substantially identical to the base sequence of the target
sequence.
Another aspect ofthe method of this embodiment comprises treating the target
nucleic
acid with a binding molecule (e.g., terminating oligonucleotide or digestion
oligonucleotide),
where the binding molecule binds to the target nucleic acid adjacent to or
near the 5'-end of
the target sequence (as indicated above, the phrase "adjacent to" means that
the binding
molecule binds to a base sequence of the target nucleic acid next to the 5'-
terminal base of the
target sequence and fully 5' to the target sequence). The target nucleic acid
is preferably
treated with the binding molecule prior to initiating extension of the priming
oligonucleotide
in a primer extension reaction with a DNA polymerase. In this aspect, the
first primer
extension product has a 3'-end which is determined by the binding molecule,
where the 3'-end
of the primer extension product is complementary to the 5'-end of the target
sequence. After
the promoter oligonucleotides hybridizes to the first primer extension
product, this aspect of
the method further comprises extending the 3'-end of the first DNA primer
extension product
in the promoter oligonucleotide:first primer extension product hybrid to add a
sequence
complementary to the second region of the promoter oligonucleotide.
-8-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Yet another aspect of the method of this embodiment comprises treating the
target
nucleic acid with a displacer oligonucleotide, where the displacer
oligonucleotide hybridizes
to the target nucleic acid upstream from the priming oligonucleotide such that
a primer
extension reaction can be initiated therefrom (in this context, the term
"upstream" means that
the 3'-terminal nucleotide of the displacer oligonucleotide is 5' to the 3'-
terminal nucleotide
of the priming oligonucleotide), and then extending the displacer
oligonucleotide in a primer
extension reaction with a DNA polymerase to give a second DNA primer extension
product
that displaces the first DNA primer extension product from the target nucleic
acid. In a
preferred aspect, the activity of the DNA polymerase is substantially limited
to the formation
of primer extension products comprising the displacer and priming
oligonucleotides.
Reagents and conditions suitable for practicing any of the embodiments
described
above are set forth in the Examples section.
The methods of the present invention may be used as a component of assays to
detect
and/or quantitate specific nucleic acid target sequences in clinical, food,
water, industrial,
] 5 environmental, forensic, and similar samples or to produce large numbers
of copies of DNA
and/or RNA of specific target sequences for a variety of uses. (As used
herein, the term
"copies" refers to amplification products having either the same or the
opposite sense of the
target sequence.) These methods may also be used to produce multiple copies of
a target
sequence for cloning or to generate probes or to produce RNA and DNA copies
for
sequencing.
The priming oligonucleotides of the embodiments described above optionally
have
a cap comprising a base region hybridized to a 3'-end thereof prior to
treating a target nucleic
acid or an RNA product with one of the priming oligonucleotides in order to
prevent the
initiation of DNA synthesis therefrom. (As used herein, the term "priming
oligonucleotide"
is inclusive of displacer oligonucleotides.) The 5'-terminal base (i.e., the
5'-most base) of a
cap hybridizes to the 3'-terminal base (i.e., the 3'-most base) of a priming
oligonucleotide.
However, the caps are designed to be preferentially displaced from priming
oligonucleotides
by a target nucleic acid, a primer extension product, or an RNA product. A cap
of the present
invention may take the form of a discrete capping oligonucleotide, or may be
attached to the
5'-end of a priming oligonucleotide via a linker. A preferred capping
oligonucleotide is
modified to prevent the initiation of DNA synthesis therefrom (e.g., comprises
a blocking
moiety at its 3'-terminus).
To increase the binding affinity of a priming oligonucleotide for a target
nucleic acid
or complement thereof, the 5'-end of a priming oligonuclcotide may include one
or more
modifications which improve the binding properties (e.g., hybridization or
base stacking) of
the priming oligonucleotide to the target nucleic acid or an RNA product,
provided the
_9..
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
modifications do not prevent the priming oligonucleotide from being extended
in a primer
extension reaction or substantially interfere with cleavage of an RNA template
to which the
priming oligonucleotide is hybridized. The modifications are preferably spaced
at least 15
bases from the 3'-terminus of a priming oligonucleotide, and most preferably
affect a region
limited to the three or four 5'-most nucleotides of the priming
oligonucleotide. Preferred
modifications include 2'-O-methyl ribonucleotides and "Locked Nucleic Acids"
or "Locked
Nucleoside Analogues" (LNAs). See Becker et al., "Method for Amplifying Target
Nucleic
Acids Using Modified Primers," U.S. Patent No. 6,13,038; Imanishi et al.,
"Bicyclonucleoside and Oligonucleotide Analogues," U.S. Patent No. 6,268,490;
and Wengel
et al., "Oligonucleotide Analogues," U. S. Patent No. 6,670,461. The contents
of each of the
foregoing references are hereby incorporated by reference herein.
The promoter oligonucleotide used in the methods described above may further
include an insertion sequence which is selected to enhance the rate at which
RNA products
are formed. The insertion sequence is preferably from 5 to 20 nucleotides in
length and is
positioned betweeri or adjacent to the first and second regions of the
promoter
oligonucleotide. Preferred insertion sequences of the present invention
include the base
sequences of SEQ ID NO:1 ccacaa and SEQ ID NO:2 acgtagcatcc.
The rate of amplification' may also be affected by the inclusion of an
extender
oligonucleotide in any of the above-described methods. An extender
oligonucleotide is
preferably from 10 to 50 nucleotides in length and is designcd to hybridize to
a DNA template
so that the 5'-end of the extender oligonucleotide is adjacent to or near the
3'-end of a
promoter oligonucleotide. The extender oligonucleotide is preferably modified
to prevent the
initiation of DNA synthesis therefrom (e.g., includes a 3'-terminal blocking
moicty).
In some applications of the methods described above, the binding molecule may
comprise an oligonucleotide having a 5'-cnd which overlaps the 5'-end of the
first region of
the promoter oligonucleotide. To limit hybridization of the binding molecule
to the promoter
oligonucleotide, the 5'-end of the first region of the promoter
oligonucleotide may be
synthesized to include a sufficient number of mismatches with the 5'-end of
the binding
molecule to prevent the promoter oligonucleotide from hybridizing to the
binding molecule.
While a single mismatch generally should be sufficient, the number of
destabilizing
mismatches needed in the first region of the promoter oligonucleotide will
depend upon the
length and base composition of the overlapping region.
In an adaptation of the above methods, the blocking moiety may be released
from the
promoter oligonucleotide prior to treating the primer extension product or the
first primer
extension product with the promoter oligonucleotide. To facilitate release of
the blocking
moiety, the promoter oligonucleotide is provided to a reaction mixture pre-
hybridized to an
-10-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
oligodeoxynucleotide. The oligodeoxynucleotide is hybridized to a 3'-region of
the first
region of the promoter oligonucleotide which includes a sufficient number of
contiguous
ribonucleotides such that the blocking moiety is released from the promoter
oligonucleotide
in the presence of an enzymatic activity capable of cleaving the
ribonucleotides of the 3'-
region. During cleavage of the ribonucleotides, the oligodeoxynucleotide is
also released
from the first region of the promoter oligonucleotide, and the remaining,
uncleaved portion
of the first region hybridizes to the primer extension product or the first
primer extension
product. The 3'-section of ribonucleotides preferably includes at least 6
contiguous
ribonucleotides, and the oligdeoxyonucleotide is preferably the same length as
and fully
complementary to the 3'-seotion of ribonucleotides. The oligodeoxynucleotide
may be a
separate molecule or it may be joined to the promoter oligonucleotide by means
of a linker.
The present invention further relates to reaction mixtures useful for carrying
out the
methods described above. The reaction mixtures of the present invention may
contain each
component, or some subcombination of components, necessary for carrying out
the methods
described above.
The materials and/or reagents used in the methods of the present invention may
be
incorporated as parts of kits, e.g., diagnostic kits for clinical or criminal
laboratories, or
nucleic amplification kits for general laboratory use. The present invention
thus includes kits
which include some or all of the components necessary to carry out the methods
ofthe present
invention, e.g., oligonucleotides, binding molecules, stock solutions,
enzymes, positive and
negative control target sequences, detection reagents, containers (e.g., test
tubes, cuvettes,
cassettes, plates, microfluidic devices and the like), and instructions
provided in written or
electronic form for performing the disclosed methods.
Certain embodiments of the present invention include one or more detection
probes
for determining the presence or amount ofthe RNA and/or DNA products in the
amplification
reaction mixture. Probes may be designed to detect RNA and/or DNA products
after the
amplification reaction (i.e., end-point detection) or, alternatively, during
the amplification
reaction (i.e., real-time detection involves periodically measuring the amount
of signal
associated with probe:amplicon complexes in the reaction mixture). Thus, the
probes may
be provided to the reaction mixture prior to, during or at the completion of
the amplification
reaction. For real-time detection of RNA products in the first two methods
described above,
it may be desirable to provide the probe to the reaction mixture after the
first primer extension
reaction has been initiated (i. e., addition of amplification enzymes) since
probe binding to the
target sequence, rather than RNA product, may slow the rate at which an RNA-
dependent
DNA polymerase (e.g., reverse transcriptase) can extend the priming
oligonucleotide.
Preferred probes have one or more associated labels to facilitate detection.
-11-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
The present invention is further drawn to various oligonucleotides, including
the
priming oligonucleotides, promoter oligonucleotides, terminating
oligonucleotides,displacer
oligonucleotides, capping oligonucleotides, extender oligonucleotides and
detection probes
described herein. It is to be understood that oligonucleotides of the present
invention may be
DNA or RNA (and analogs thereof), and in either case, the present invention
includes RNA
equivalents of DNA oligonucleotides and DNA equivalents ofRNA
oligonucleotides. Except
for the preferred priming oligonucleotides, displacer oligonucleotides and
detection probes
described below, the oligonucleotides described in the following paragraphs
are preferably
modified to prevent their participation in a synthesis reaction in the
presence of a DNA
polymerase (e.g., include a blocking moiety at their 3'-termini).
For certain amplification reactions in which the target nucleic acid contains
a hepatitis
C virus (HCV) 5' untranslated region, the present invention includes a
promoter
oligonuelcotide comprising a promoter sequence and a hybridizing sequence up
to 40 or 50
bases in length. The promoter sequence is recognized by an RNA polymerase,
such as a T7,
T3 or SP6 RNA polymerase, and preferably includes the T7 RNA polymerase
promoter
sequence of SEQ ID NO:3 aatttaatacgactcac tatagggaga. The hybridizing sequence
of the
preferred promoter oligonucleotide comprises, consists of, consists
essentially of, overlaps '
with, or is contained within and includes at least 10, 15, 20, 25, 30 or 32
contiguous bases
of a base sequence that is at least 80%, 90% or 100% identical to the base
sequence of SEQ
ID NO: 4 ctagccatggcgttagtatgagtgtcgtgcag or an equivalent sequence containing
uracil bases
substituted for thymine bases, and which hybridizes to the target nucleic acid
under
amplification conditions. The promoter oligonucleotide preferably does not
include a region
in addition to the hybridizing sequence that hybridizes to the target nucleic
acid under
amplification conditions. More preferably, the promoter oligonucleotide
comprises, consists
of, or consists essentially of a base sequence substantially corresponding to
the base sequence
of SEQ ID NO:5 aatttaatacgactcactatagggagactagccatggcgttagtatgagtgtcgtgcag or
an
equivalent sequence containing uracil bases substituted for thymine bases, and
which
hybridizes to the target nucleic acid under amplification conditions. The base
sequence of the
promoter oligonucleotide preferably consists of a promoter sequence and a
hybridizing
sequence consisting of or contained within and including at least 10, 15, 20,
25, 30 or 32
contiguous bases of the base sequence of SEQ ID NO:4 or an equivalent sequence
containing
uracil bases substituted for thymine bases, and which hybridizes to the target
nucleic acid
under amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
an HCV
5' untranslated region, the present invention includes a priming
oligonuclcotide up to 40 or
50 bases in length. A preferred priming oligonucleotide includes an
oligonucleotide
-12-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
comprising, consisting of, consisting essentially of, overlapping with, or
contained within and
including at least 10, 15, 20, 25, 30 or 31 contiguous bases of a base
sequence that is at least
80%, 90% or 100% identical to the base sequence of SEQ ID NO:6
aggcattgagcgggttgatccaagaaaggac or an equivalent sequence containing uracil
bases
substituted for thymine bases, and which hybridizes to the target nucleic acid
under
amplification conditions. More preferably, the priming oligonucleotide
comprises, consists
of, or consists essentially of a base sequence substantially corresponding to
the base sequence
of SEQ ID NO:6 or an equivalent sequence containing uracil bases substituted
for thymine
bases, and which hybridizes under amplification conditions to the target
nucleic acid. The
base sequence ofthe priming oligonucleotide preferably consists ofor is
contained witbin and
includes at least 10, 15, 20, 25, 30 or 31 contiguous bases of the base
sequence of SEQ ID
NO:6 or an equivalent sequence containing uracil bases substituted for thymine
bases, and
which hybridizes to the target nucleic acid under amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
an HCV
5' untranslated region, the present invention is further directed to a
detection probe up to 35,
50 or 100 bases in length. A preferred detection probe includes a target
binding region which
comprises, consists of, consists essentially of, overlaps with, or is
contained within and
includes at least 10, 13 or 15 contiguous bases of a base sequence that is at
least 80%, 90%
or 100% identical to the base sequence of SEQ ID NO:7 guacucaccgguucc, the
complement
thereof, or an equivalent sequence containing thymine bases substituted for
uracil bases, and
which preferentially hybridizes to the target nucleic acid or its complement
(e.g., not human
nucleic acid) under stringent hybridization conditions. The detection probe
preferably does
not include a region in addition to the target binding region that hybridizes
to the target
nucleic acid or its complement under stringent hybridization conditions. More
preferably, the
detection probe comprises, consists of, or consists essentially of abase
sequence substantially
corresponding to the base sequence of SEQ ID NO:7, the complement thereof, or
an
equivalent sequence containing thymine bases substituted for uracil bases, and
which
preferentially hybridizes to the target nucleic acid or its complement under
stringent
hybridization conditions. The base sequence of the detection probe preferably
consists of or
is contained within and includes at least 10, 13 or 15 contiguous bases of the
base sequence
of SEQ ID NO:7, the complement thereof, or an equivalent sequence containing
thymine
bases substituted for uracil bases, and which preferentially hybridizes to the
target nucleic
acid or its complement under stringent hybridization conditions. In certain
embodiments the
probe optionally includes one or more detectable labels, e.g., an AE
substituent.
For certain amplification reactions in which the target nucleic acid contains
an HCV
5' untranslated region, the present invention is further directed to a
detection probe up to 40
-13-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
or 50 bases in length. A preferred detection probe includes a target binding
region which
comprises, consists of, consists essentially of, overlaps with, or is
contained within and
includes at least 18, 20 or 22 contiguous bases of a base sequence that is at
least 80%, 90%
or 100% identical to the base sequence of SEQ ID NO:8 agaccacuauggcucucccggg,
the
complement thereof, or an equivalent sequence containing thymine bases
substituted for
uracil bases, and which preferentially hybridizes to the target nucleic acid
or its complement
(e.g., not human nucleic acid) under stringent hybridization conditions. The
detection probe
preferably does not include a region in addition to the target binding region
that hybridizes
to the target nucleic acid or its complement under stringent hybridization
conditions. More
preferably, the detection probe comprises, consists of, or consists
essentially of a base
sequence substantially corresponding to the base sequence of SEQ ID NO: 8, the
complement
thereof, or an equivalent sequence containing thymine bases substituted for
uracil bases, and
which preferentially hybridizes to the target nucleic acid or its complement
under stringent
hybridization conditions. The base sequence of the detection probe preferably
consists of or
is contained within and includes at least 18, 20 or 22 contiguous bases of the
base sequence
SEQ ID NO:8, the complement thereof, or an equivalent sequence containing
thymine bases
substituted for uracil bases, and which preferentially hybridizes to the
target nucleic acid or
its complement under stringent hybridization conditions. In certain
embodiments the probe
optionally includes one or more detectable labels, e.g., an AE substituent.
For certain amplification reactions in which the target nucleic acid contains
a human
immunodeficiency virus (HIV) pol gene, the present invention includes a
promoter
oligonucleotide comprising a promoter sequence and a hybridizing sequence up
to 40 or 50
bases in length. The promoter sequence is recognized by an RNA polymerase,
such as a T7,
T3 or SP6 RNA polymerase, and preferably includes the T7 RNA polymerase
promoter
sequence of SEQ ID NO:3. The hybridizing sequence of the preferred promoter
oligonucleotide comprises, consists of, consists essentially of, overlaps
with, or is contained
within and includes at least 10, 15, 20, 25, 30 or 31 contiguous bases of a
base sequence that
is at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:9
acaaatggcagtattcatccacaatttaaaa or an equivalent sequence containing uracil
bases substituted
for thymine bases, and which hybridizes to the target nucleic acid under
amplification
conditions. The promoter oligonucleotide preferably does not include a region
in addition to
the hybridizing sequence that hybridizes to the target nucleic acid under
amplification
conditions. More preferably, the promoter oligonucleotide comprises, consists
of, or consists
essentially of a base sequence substantially corresponding to the base
sequence of SEQ ID
NO:10 aatttaatacgactcactatagggagacta gccatggcgttagtatgagtgtcgtgcag or an
equivalent
sequence containing uracil bases substituted for thymine bases, and which
hybridizes to the
-14-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
target nucleic acid under amplification conditions. The base sequence of the
promoter
oligonucleotide preferably consists of a promoter sequence and a hybridizing
sequence
consisting of or contained within and including at least 10, 15, 20, 25, 30 or
31 contiguous
bases ofthe base sequence of SEQ ID NO:9 or an equivalent sequence containing
uracil bases
substituted for thymine bases, and which hybridizes to the target nucleic acid
under
amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
an HIV
pol gene, the present invention includes a priming oligonucleotide up to 40 or
50 bases in
length. A preferred priming oligonucleotide includes an oligonucleotide
comprising,
consisting of, consisting essentially of, overlapping with, or contained
within and including
at least 10, 15, 20, 25 or 27 contiguous bases of a base sequence that is at
least 80%, 90% or
100% identical to the base sequence of SEQ ID NO:11
gtttgtatgtctgttgctattatgtct or an
equivalent sequence containing uracil bases substituted for thymine bases, and
which
hybridizes to the target nucleic acid under amplification conditions. More
preferably, the
priming oligonucleotide comprises, consists of, or consists essentially of a
base sequence
substantially corresponding to the base sequence of SEQ ID NO:11 or an
equivalent sequence
containing uracil bases substituted for thymine bases, and which hybridizes to
the target
nucleic acid under amplification conditions. The base sequence of the priming
oligonucleotide preferably consists of or is contained within and includes at
least 10, 15, 20,
25 or 27 contiguous bases of the base sequence of SEQ ID NO:11 or an
equivalent sequence
containing uracil bases substituted for thymine bases, and which hybridizes to
the target
nucleic acid under amplification conditions.
For certain amplification reactions in which the target nuclcic acid contains
an HIV
pol gene, the present invention is further directed to a detection probe up to
35, 50 or 100
bases in length. A preferred detection probe includes a target binding region
which
comprises, consists of, consists essentially of, overlaps with, or is
contained within and
includes at least 13, 15 or 17 contiguous bases of a base sequence that is at
least 80%, 90%
or 100% identical to the base sequence of SEQ ID NO:12 acuguaccccccaaucc, the
complement thereof, or an equivalent sequence containing thymine bases
substituted for
uracil bases, and which preferentially hybridizes to the target nucleic acid
or its complement
(e.g., not human nucleic acid) under stringent hybridization conditions. The
detection probe
preferably does not include a region in addition to the target binding region
that hybridizes
to the target nucleic acid or its complement under stringent hybridization
conditions. More
preferably, the detection probe comprises, consists of, or consists
essentially of a base
sequence substantially corresponding to the base sequence of SEQ ID NO:12, the
complement
thereof, or an equivalent sequence containing thymine bases substituted for
uracil bases, and
-15-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
which preferentially hybridizes to the target nucleic acid or its complement
under stringent
hybridization conditians, The base sequence of the detection probe preferably
consists of or
is contained within and includes at least 13, 15 or 17 contiguous bases of the
base sequence
of SEQ ID NO: 12, the complement thereof, or an equivalent sequence containing
thymine
bases substituted for uracil bases, and which preferentially hybridizes under
stringent
hybridization conditions to the target nucleic acid or its complement. In
certain embodiments
the probe optionally includes one or more detectable labels, e.g., an AE
substituent.
For certain amplification reactions in which the target nucleic acid contains
a human
papilloma virus (HPV) E6 and E7 gene, the present invention includes a
promoter
oligonucleotide comprising a promoter sequence and a hybridizing sequence up
to 40 or 50
bases in length. The promoter sequence is recognized by an RNA polymerase,
such as a T7,
T3 or SP6 RNA polymerase, and preferably includes the T7 RNA polymerase
promoter
sequence of SEQ ID NO:3. The hybridizing sequence of the preferred promoter
oligonucleotide comprises, consists of, consists essentially of, overlaps
with, or is contained
within and includes at least 10, 15, 20, 25 or 27 contiguous bases of a base
sequence that is
at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:13
gaacagatggggcacacaattcctagt or an equivalent sequence containing uracil bases
substituted
for thymine bases, and which hybridizes to the target nucleic acid under
amplification
conditions. The promoter oligonucleotide preferably does not include a region
in addition to
the hybridizing sequence that hybridizes to the target nucleic acid under
amplification
conditions. More preferably, the promoter oligonucleotide comprises, consists
of, or consists
essentially of a, base sequence substantially corresponding to the base
sequence of SEQ ID
NO: 14 aatttaatacgactcactatagggagagaa cagatggggcacacaattcctagt or an
equivalent sequence
containing uracil bases substituted for thymine bases, and which hybridizes to
the target
nucleic acid under amplification conditions. The base sequence of the promoter
oligonucleotide preferably consists of a promoter sequence and a hybridizing
sequence
consisting of or contained within and including at least 10, 15, 20, 25 or 27
contiguous bases
of the base sequence of SEQ ID NO:13 or an equivalent sequence containing
uracil bases
substituted for thymine bases, and which hybridizes to the target nucleic acid
under
amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
an HI'V
E6 and E7 gene, the present invention includes a priming oligonucleotide up to
40 or 50 bases
in length. A preferred priming oligonucleotide includes an oligonucleotide
comprising,
consisting of, consisting essentially of, overlapping with, or contained
within and including
at least 10, 15 or 19 contiguous bases of a base sequence that is at least
80%, 90% or 100%
identical to the base sequence of SEQ ID NO: 15 gacagetcagaggaggagg or an
equivalent
-16-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
sequence containing uracil bases substituted for thymine bases, and which
hybridizes to the
target nucleic acid under amplification conditions. More preferably, the
priming
oligonucleotide comprises, consists of, or consists essentially of a base
sequence substantially
corresponding to the base sequence of SEQ ID NO: 15 or an equivalent sequence
containing
uracil bases substituted for thymine bases, and which hybridizes to the target
nucleic acid
under amplification conditions. The base sequence ofthe priming
oligonucleotide preferably
consists of or is contained within and includes at least 10, 15 or 19
contiguous bases of the
base sequence of SEQ ID NO: 15 or an equivalent sequenee containing uracil
bases
substituted for thymine bases, and which hybridizes to the target nucleic acid
under
amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
an HPV
E6 and E7 gene, the present invention is further directed to a detection probe
up to 35, 50 or
100 bases in length. A preferred detection probe includes a target binding
region which
comprises, consists of, consists essentially of, overlaps with, or is
contained within and
includes at least 15, 17 or 19 contiguous bases of a base sequence that is at
least 80%, 90%
or 100% identical to the base sequence of SEQ ID NO:16 ggacaagcagaaccggaca or
the
complement thereof, and which preferentially hybridizes to the target nucleic
acid or its
complement (e.g., not human nucleic acid) under stringent hybridization
conditions. The
detection probe preferably does not include a region in addition to the target
binding region
that hybridizes to the target nucleic acid or its complement under stringent
hybridization
conditions. More preferably, the detection probe comprises, consists of, or
consists essentially
of a base sequence substantially corresponding to the base sequence of SEQ ID
NO: 16 or the
complement thereof, and which preferentially hybridizes to the target nucleic
acid or its
complement under stringent hybridization conditions. The base sequence of the
detection
probe preferably consists of or is contained within and includes at least 15,
17 or 19
contiguous bases of the base sequence of SEQ ID NO:16 or the complement
thereof, and
which preferentially hybridizes to the target nucleic acid or its complement
under stringent
hybridization conditions. In certain embodiments the probe optionally includes
one or more
detectable labels, e.g., an AE substituent.
For certain amplification reactions in which the target nucleic acid contains
a West
Nile Virus (WN V) nonstructural protein 5 gene, the present invention includes
a promoter
oligonucleotide comprising a promoter sequence and a hybridizing sequence up
to 40 or 50
bases in length. The promoter sequence is recognized by an RNA polymerase,
such as a T7,
T3 or SP6 RNA polymerase, and preferably includes the T7 RNA polymerase
promoter
sequence of SEQ ID NO:3. The hybridizing sequence of the preferred promoter
oligonucleotide comprises, consists of, consists essentially of, overlaps
with, or is contained
-17-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
within and includes at least 10, 15, 20, 25 or 27 contiguous bases of a base
sequence that is
at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:17
gagtagacggtgctgcctgcgactcaa or an equivalent sequence containing uracil bases
substituted
for thymine bases, and which hybridizes to the target nucleic acid under
amplification
conditions. The promoter oligonucleotide preferably does not include a region
in addition to
the hybridizing sequence that hybridizes to the target nucleic acid under
amplification
conditions. More preferably, the promoter oligonucleotide comprises, consists
of, or consists
essentially of a base sequence substantially corresponding to the base
sequence of SEQ ID
NO:18 aatttaatacgactcactcactatagggagagagtagacggtgctgcctgcgactcaa or an
equivalent
sequence containing uracil bases substituted for thymine bases, and which
hybridizes to the
target nucleic acid under amplification conditions. The base sequence of the
promoter
oligonucleotide preferably consists of a promoter sequence and a hybridizing
sequence
consisting of or contained within and including at least 10, 15, 20, 25 or 27
contiguous bases
of the base sequence of SEQ ID NO: 17 or an equivalent sequence containing
uracil bases
substituted for thymine bases, and which hybridizes to the target nucleic acid
under
amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
a WNV
nonstructural protein 5 gene, the present invention includes a priming
oligonucleotide up to
40 or 50 bases in length. A preferred priming oligonucleotide includes an
oligonucleotide
comprising, consisting of, consisting essentially of, overlapping with, or
contained within and
including at least 10, 15, 20 or 23 contiguous bases of a base sequence that
is at least 80%,
90% or 100% identical to the base sequence of SEQ ID NO: 19
tccgagacggttctgagggctta or
an equivalent sequence containing uracil bases substituted for thyminc bases,
and which
hybridizes to the target nucleic acid under amplification conditions. More
preferably, the
priming oligonucleotide comprises, consists of, or consists essentially of a
base sequence
substantially corresponding to the base sequence of SEQ ID NO: 19 or an
equivalent sequence
containing uracil bases substituted for tbymine bases, and which hybridizes to
the target
nucleic acid under amplification conditions. The base sequence of the priming
oligonucleotide preferably consists of or is contained within and includes at
least 10, 15, 20
or 23 contiguous bases of the base sequence of SEQ ID NO: 19 or an equivalent
sequence
containing uracil bases substituted for thymine bases, and which hybridizes to
the target
nucleic acid under amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
a WNV
nonstructural protein 5 gene, the present invention is further directed to a
detection probe up
to 35, 50 or 100 bases in length. A preferred detection probe includes a
target binding region
which comprises, consists of, consists essentially of, overlaps with, or is
contained within and
-18-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
includes at least 14, 16 or 18 contiguous bases of a base sequence that is at
least 80%, 90%
or 100% identical to the base sequence of SEQ ID NO:20 gaucacuucgcggcuuug, the
complement thereof, or an equivalent sequence containing thymine bases
substituted for
uracil bases, and which preferentially hybridizes to the target nucleic acid
or its complement
(e.g., not human nucleic acid) under stringent hybridization conditions. The
detection probe
preferably does not include a region in addition to the target binding region
that hybridizes
to the target nucleic acid or its complement under stringent hybridization
conditions. More
preferably, the detection probe comprises, consists of, or consists
essentially of a base
sequence substantially corresponding to the base sequence of SEQ ID NO:20, the
complement
thereof, or an equivalent sequence containing thymine bases substituted for
uracil bases, and
which preferentially hybridizes to the target nucleic acid or its complement
under stringent
hybridization conditions. The base sequence of the detection probe preferably
consists of or
is contained within and includes at least 14, 16 or 18 contiguous bases of the
base sequence
of SEQ ID NO:20, the complement thereof, or an equivalent sequence containing
thymine
bases substituted for uracii bases, and which preferentially hybridizes to the
target nucleic
acid or its complement under stringent hybridization conditions. In certain
embodiments the
probe optionally includes one or more detectable labels, e.g., an AE
substituent.
For certain amplification reactions in which the target nucleic acid contains
a 23S
rRNA sequence of Chlamydia trachomatis, the present invention includes a
promoter
oligonucleotide comprising a promoter sequence and a hybridizing sequence up
to 40 or 50
bases in length. The promoter sequence is recognized by an RNA polymerase,
such as a T7,
T3 or SP6 RNA polymerase, and preferably includes the T7 RNA polymerase
promoter
sequence of SEQ ID NO:3. The hybridizing sequence of the preferred promoter
oligonucleotide comprises, consists of, consists essentially of, overlaps
with, or is contained
within and includes at least 10, 15, 20, 25 or 30 contiguous bases of a base
sequence that is
at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:21
cggagtaagttaagcacgcggacgattgga or an equivalent sequence containing uracil
bases substituted
for thymine bases, and which hybridizes to the target nucleic acid under
amplification
conditions. The promoter oligonucleotide preferably does not include a region
in addition to
the hybridizing sequence that hybridizes to the target nucleic acid under
amplification
conditions. More preferably, the promoter oligonucleotide comprises, consists
of, or consists
essentially of a base sequence substantially corresponding to the base
sequence of SEQ ID
NO:22 aatttaatacgactcactatagggagacgg agtaagttaagcacgcggacgattgga or an
equivalent
sequence containing uracil bases substituted for thymine bases, and which
hybridizes to the
target nucleic acid under amplification conditions. The base sequence of the
promoter
oligonucleotide preferably consists of a promoter sequence and a hybridizing
sequence
19
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
consisting of or contained within and including at least 10, 15, 20, 25 or 30
contiguous bases
of the base sequence of SEQ ID NO:21 or an equivalent sequence containing
uracil bases
substituted for thymine bases, and which hybridizes to the target nucleic acid
under
amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
a 23S
rRNA sequence of Chlansydia trachomatis, the present invention includes a
priming
oiigonucleotide up to 40 or 50 bases in length. A preferred priming
oligonucleotide includes
an oligonucleotide comprising, consisting of, consisting essentially of,
overlapping with, or
contained within and including at least 10, 15, 20, 25 or 29 contiguous bases
of a base
sequence that is at least 80%, 90% or 100% identical to the base sequence of
SEQ ID NO:23
cccgaagattccccttgatcgcgacctga or an equivalent sequence containing uracil
bases substituted
for thymine bases, and which hybridizes to the target nucleic acid under
amplification
conditions. More preferably, the priming oligonucleotide comprises, consists
of, or consists
essentially of a base sequence substantially corresponding to the base
sequence of SEQ ID
NO:23 or an equivalent sequence containing uracil bases substituted for
thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions.
The base sequence
of the priming oligonucleotide preferably consists of or is contained within
and includes at
least 10, 15, 20, 25 or 29 contiguous bases of the base sequence of SEQ ID
NO:23 or an
equivalent sequence containing uracil bases substituted for thymine bases, and
which
hybridizes to the target nucleic acid under amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
a 23S
rRNA sequence of Chlamydia trachomatis, the present invention is further
directed to a
detection probe up to 35, 50 or 100 bases in length. A preferred detection
probe includes a
target binding region which comprises, consists of, consists essentially of,
overlaps with, or
is contained within and includes at least 19, 22 or 24 contiguous bases of a
base sequence that
is at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:24
cguucucaucgcucuacggacucu, the complement thereof, or an equivalent sequence
containing
thymine bases substituted for uracil bases, and which preferentially
hybridizes to the target
nucleic acid or its complement (e.g., not Chlamydia psittaci nucleic acid)
under stringent
hybridization conditions. The detection probe preferably does not include a
region in addition
to the target binding region that hybridizes to the target nucleic acid or its
complement under
stringent hybridization conditions. More preferably, the detection probe
comprises, consists
of, or consists essentially of a base sequence substantially corresponding to
the base sequence
of SEQ ID NO:24, the complement thereof, or an equivalent sequence containing
thymine
bases substituted for uracil bases, and which preferentially hybridizes under
stringent
hybridization conditions to the target nucleic acid or its complement. The
base sequence of
-20-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
the detection probe preferably consists of or is contained within and includes
at least 19, 22
or 24 contiguous bases of the base sequence of SEQ ID NO:24, the complement
thereof, or
an equivalent sequence containing thymine bases substituted for uracil bases,
and which
preferentially hybridizes to the target nucleic acid or its complement under
stringent
hybridization conditions. In certain embodiments the probe optionally includes
one or more
detectable labels, e.g., an AE substituent.
For certain amplification reactions in which the target nucieic acid contains
a 16S
rRNA sequence of Mycobacterium tuberculosis, the present invention includes a
promoter
oligonucleotide comprising a promoter sequence and a hybridizing sequence up
to 40 or 50
bases in length. The promoter sequence is recognized by an RNA polymerase,
such as a T7,
T3 or SP6 RNA polymerase, and preferably includes the T7 RNA polymerase
promoter
sequence of SEQ ID NO:3. The hybridizing sequence of the preferred promoter
oligonucleotide comprises, consists of, consists essentially of, overlaps
with, or is contained
within and includes at least 10, 15, 20, 25, 30, 35 or 36 contiguous bases of
a base sequence
that is at least 80%, 90% or 100% identical to the base sequence of SEQ ID
NO:25
actgggtctaataceggataggaccacgggatgcat or an equivalent sequence containing
uracil bases
substituted for thymine bases, and which hybridizes to the target nucleic acid
under
amplification conditions. The promoter oligonucleotide preferably does not
include a region
in addition to the hybridizing sequence that hybridizes to the target nucleic
acid under
amplification conditions. More preferably, the promoter oligonucleotide
comprises, consists
of, or consists essentially of a base sequence substantially corresponding to
the base sequence
of SEQ ID NO:26
aattctaatacgactcactatagggagaactgggkctaataccggataggaccacgggatgcat or an
equivalent sequence containing uracil bases substituted for thymine bases, and
which
hybridizes to the target nucleic acid under amplification conditions. The base
sequence of the
promoter oligonucleotide preferably consists of a promoter sequence and a
hybridizing
sequence consisting of or contained within and including at least 10, 15, 20,
25, 30, 35 or 36
contiguous bases of the base sequence of SEQ ID NO:25 or an equivalent
sequence
containing uracil bases substituted for thymine bases, and which hybridizes to
the target
nucleic acid under amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
a 16S
rRNA sequence of Mycobacterium tuberculosis, the present invention includes a
promoter
oligonucleotide comprising a promoter sequence and a hybridizing sequence up
to 40 or 50
bases in length. The promoter sequence is recognized by an RNA polymerase,
such as a T7,
T3 or SP6 RNA polymerase, and preferably includes the T7 RNA polymerase
promoter
sequence of SEQ ID NO:3. The hybridizing sequence of the preferred promoter
oligonucleotide comprises, consists of, consists essentially of, overlaps
with, or is contained
-21-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
within and includes at least 10, 15, 20, 25, 30 or 31 contiguous bases of a
base sequence that
is at least 80%, 90% or 100% identical to the base sequence of SEQ ID NO:27
actgggtetaataccggataggaccacggga or an equivalent sequence containing uracil
bases
substituted for thymine bases, and which hybridizes to the target nucleic acid
under
amplification conditions. The promoter oligonucleotide preferably does not
include a region
in addition to the hybridizing sequence that hybridizes to the target nucleic
acid under
amplification conditions. More preferably, the promoter oligonucleotide
comprises, consists
of, or consists essentially of a base sequence substantially corresponding to
the base sequence
of SEQ ID NO:28 aattetaatacgactcactat agggagaactgggtctaataccggataggaccacggga
or an
equivalent sequence containing uracil bases substituted for thymine bases, and
which
hybridizes to the target nucleic acid under amplification conditions. The base
sequence ofthe
promoter oligonucleotide preferably consists of a promoter sequence and a
hybridizing
sequence consisting of or contained within and including at least 10, 15, 20,
25, 30 or 31
contiguous bases of the base sequence of SEQ ID NO:27 or an equivalent
sequence
containing uracil bases substituted for thymine bases, and which hybridizes to
the target
nucleic acid under amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
a 16S
rRNA sequence of Mycobacterium tuberculosis, the present invention includes a
priming
oligonucleotide up to 40 or 50 bases in length. A preferred priming
oligonucleotide includes
an oligonucl0otide comprising, consisting of, consisting essentially of,
overlapping with, or
contained within and including at least 10, 15, 20, 25 or 27 contiguous bases
of a base
sequence that is at least 80%, 90% or 100% identical to the base sequence of
SEQ ID NO:29
gccgtcaccccaccaacaagctgatag or an equivalent sequence containing uracil bases
substituted
for thymine bases, and which hybridizes to the target nucleic acid under
amplification
conditions. More preferably, the priming oligonucleotide comprises, consists
of, or consists
essentially of a base sequence substantially corresponding to the base
sequence of SEQ ID
NO:29 or an equivalent sequence containing uracil bases substituted for
thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions.
The base sequence
of the priming oligonucleotide preferably consists of or is contained within
and includes at
least 10, 15, 20, 25 or 27 contiguous bases of the base sequence of SEQ ID
NO:29 or an
equivalent sequence containing uracil bases substituted for thymine bases, and
which
hybridizes to the target nucleic acid under amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
a 16S
rRNA sequence of Mycobacterium tuberculosis, the present invention is further
directed to
a detection probe up to 35, 50 or 100 bases in length. A preferred detection
probe includes
a target binding region which comprises, consists of, consists essentially of,
overlaps with,
-22-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
or is contained within and includes at least 18, 20 or 22 contiguous bases of
a base sequence
that is at least 80%, 90% or 100% identical to the base sequence of SEQ ID
NO:30
gcucaucccacaccgcuaaagc, the complement thereof, or an equivalent sequence
containing
thymine bases substituted for uracil bases, and which preferentially
hybridizes to the target
nucleic acid or its complement (e.g., not nucleic acid from a Mycobacterium
avium complex
organism) under stringent hybridization conditions. The detection probe
preferably does not
include a region in addition to the target binding region that hybridizes to
the target nucleic
acid or its compiement under stringent hybridization conditions. More
preferably, the
detection probe comprises, consists of, or consists essentially of a base
sequence substantially
corresponding to the base sequence of SEQ ID NO:30, the complement thereof, or
an
equivalent sequence containing thymine bases substituted for uracil bases, and
which
preferentially hybridizes to the target nucleic acid or its complement under
stringent
hybridization conditions. The base sequence of the detection probe preferably
consists of or
is contained within and includes at least 18, 20 or 22 contiguous bases of the
base sequence
of SEQ ID NO:30, the complement thereof, or an equivalent sequence containing
thymine
bases substituted for uracil bases, and which preferentially hybridizes to the
target nucleic
acid or its complement under stringent hybridization conditions. In certain
embodiments the
probe optionally includes one or more detectable labels, e.g., an AE
substituent.
For certain amplification reactions in which the target nucleic acid contains
a 16S
rRNA sequence of Mycobacterium tuberculosis, the present invention is further
directed to
a detection probe up to 35, 50 or 100 bases in length. A preferred detection
probe includes
a target binding region which comprises, consists of, consists essentially of,
overlaps with,
or is contained within and includes at least 22, 25 or 28 contiguous bases of
a base sequence
that is at least 80%, 90% or 100% identical to the base sequence of SEQ ID
NO:31
ccgagaucccacaccgcuaaagccucgg, the complement thereof, or an equivalent
sequence
containing thymine bases substituted for uracil bases, and which
preferentially hybridizes to
the target nucleic acid or its complement (e.g., not nucleic acid from a
Mycobacterium avium
complex organism) under stringent hybridization conditions. The detection
probe preferably
does not include a region in addition to the target binding region that
hybridizes to the target
nucleic acid or its complement under stringent hybridization conditions. More
preferably, the
detection probe comprises, consists of, or consists essentially of a base
sequence substantially
corresponding to the base sequence of SEQ ID NO:31, the complement thereof, or
an
equivalent sequence containing thymine bases substituted for uracil bases, and
which
preferentially hybridizes to the target nucteic acid or its complement under
stringent
hybridization conditions. The base sequence of the detection probe preferably
consists of or
is contained within and includes at least 22, 25 or 28 contiguous bases of the
base sequence
- 23 -
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
of SEQ ID NO:3 1, the complement thereof, or an equivalent sequence containing
thymine
bases substituted for uracil bases, and which preferentially hybridizes to the
target nucleic
acid or its complement under stringent hybridization conditions. In certain
embodiments the
probe optionally includes one or more detectable labels, e.g., a
fluorophore/quencher dye pair.
For certain amplification reactions in which the target nucleic acid contains
a 16S
rRNA sequence of Mycobacterium tuberculosis, the present invention is further
directed to
a detection probe up to 35, 50 or 100 bases in length. A preferred detection
probe includes
a target binding region which comprises, consists of, consists essentially of,
overlaps with,
or is contained within and includes at least 18, 20 or 22 contiguous bases of
a base sequence
that is at least 80%, 90% or 100% identical to the base sequence of SEQ ID
NO:32
gctcatcccacaccgctaaagc, the complement thereof, or an equivalent sequence
containing uracil
bases substituted for thymine bases, and which preferentially hybridizes to
the target nucleic
acid or its complement (e.g., not nucleic acid from a Mycobacterium avium
complex
organism) under stringent hybridization conditions. The detection probe
preferably does not
include a region in addition to the target binding region that hybridizes to
the target nucleic
acid or its complement under stringent hybridization conditions. More
preferably, the
detection probe comprises, consists of, or consists essentially of a base
sequence substantially
corresponding to the base sequence of SEQ ID NO:32, the complement thereof, or
an
equivalent sequence containing uracil bases substituted for thymine bases, and
which
preferentially hybridizes to the target nucleic acid or its complement under
stringent
hybridization conditions. The base sequence of the detection probe preferably
consists of or
is contained within and includes at least 18, 20 or 22 contiguous bases of the
base sequence
of SEQ ID NO:32, the complement thereof, or an equivalent sequence containing
uracil bases
substituted for thymine bases, and which preferentially hybridizes to the
target nucleic acid
or its complement under stringent hybridization conditions. In certain
embodiments the probe
optionally includes one or more detectable labels, e.g., an AE substituent.
For certain amplification reactions in which the target nucleic acid contains
the orfX
gene of a Staphylococcus aureus (e.g. a methicillin-resistant strain), the
present invention
includes a promoter oligonucleotide comprising a promoter sequence and a
hybridizing
sequence up to 40 or 50 bases in length. The promoter sequence is recognized
by an RNA
polymerase, such as a T7, T3 or SP6 RNA polymerase, and preferably includes
the T7 RNA
polymerase promoter sequence of SEQ ID NO:3 aatttaatacgactcactatagggaga. The
hybridizing
sequence ofthe preferred promoter oligonucleotide comprises, consists of,
consists essentially
of, overlaps with, or is contained within and includes at least 10, 15, 20, 25
or 29 contiguous
bases of a base sequence that is at least 80%, 90% or 100% identical to the
base sequence of
SEQ ID NO:33 tgacccaagggcaaagcgactttg or an equivalent sequence containing
uracil bases
-24-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
substituted for thymine bases, and which hybridizes to the target nucleic acid
under
amplification conditions. The promoter oligonucleotide preferably does not
include a region
in addition to the hybridizing sequence that hybridizes to the target nucleic
acid under
amplification conditions. More preferably, the promoter oligonucleotide
comprises, consists
of, or consists essentially of a base sequence substantially corresponding to
the base sequence
of SEQ ID NO:34 aatttaatacgactcactatagggagatgacccaagggcaaagcgactttg or an
equivalent
sequence containing uracil bases substituted for thymine bases, and which
hybridizes to the
target nucleic acid under amplification conditions. The base sequence of the
promoter
oligonucleotide preferably consists of a promoter sequence, such as SEQ ID
NO:3, and a
hybridizing sequence consisting of or contained within and including at least
10, 15, 20, 25
or 29 contiguous bases of the base sequence of SEQ ID NO:33 or an equivalent
sequence
containing uracil bases substituted for thymine bases, and which hybridizes to
the target
nucleic acid under amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
the orfX
gene of a Staphylococcus aureus (e.g. a methicillin-resistant strain), the
present invention
includes a priming oligonucleotide up to 40 or 50 bases in length. A preferred
priming
oligonucleotide includes an oligonucleotide comprising, consisting of,
consisting essentially
of, overlapping with, or contained within and including at least 10, 15, 20,
25 or 26
contiguous bases of a base sequence that is at least 80%, 90% or 100%
identical to the base
sequence of SEQ ID NO:35 gtgcgtagttactgcgttgtaagacgtc or an equivalent
sequence
containing uracil bases substituted for thymine bases, and which hybridizes to
the target
nucleic acid under amplification conditions. More preferably, the priming
oligonucleotide
comprises, consists of, or consists essentially of a base sequence
substantially corresponding
to the base sequence of SEQ ID NO:35 or an equivalent sequence containing
uracil bases
substituted for thymine bases, and which hybridizes under amplification
conditions to the
target nucleic acid. The base sequence of the priming oligonucleotide
preferably consists of
or is contained within and includes at least 10, 15, 20, 25 or 26 contiguous
bases of the base
sequence of SEQ ID NO:35 or an equivalent sequence containing uracil bases
substituted for
thymine bases, and which hybridizes to the target nucleic acid under
amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
the orfX
gene of a Staphylococcus aureus (e.g. a methicillin-resistant strain), the
present invention
includes a priming oligonucleotide up to 40 or 50 bases in length. A preferred
priming
oligonucleotide includes an oligonucleotide comprising, consisting of,
consisting essentially
of, overlapping with, or contained within and including at least 10, 15, 20,
25 or 26
contiguous bases of a base sequence that is at least 80%, 90% or 100%
identical to the base
sequence of SEQ ID NO:36 ctgaatgatagtgcgtagttactgcg or an equivalent sequence
containing
-25-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
uracil bases substituted for thymine bases, and which hybridizes to the target
nucleic acid
under amplification conditions. More preferably, the priming oligonucleotide
comprises,
consists of, or consists essentially of a base sequence substantially
corresponding to the base
sequence of SEQ ID NO:36 or an equivalent sequence containing uracil bases
substituted for
thymine bases, and which hybridizes under amplification conditions to the
target nucleic acid.
The base sequence ofthe priming oligonucleotide preferably consists of or is
contained within
and includes at least 10, 15, 20, 25 or 26 contiguous bases of the base
sequence of SEQ ID
NO:36 or an equivalent sequence containing uracil bases substituted for
thymine bases, and
which hybridizes to the target nucleic acid under amplification conditions.
For certain amplification reactions in which the target nucleic acid contains
the orfX
gene of a Staphylococcus aureus (e.g. a methicillin-resistant strain), the
present invention is
further directed to a detection probe up to 35, 50 or 100 bases in length. A
preferred detection
probe includes a target binding region which comprises, consists of, consists
essentially of,
overlaps with, or is contained within and includes at least 10, 12, 15 or 17
contiguous bases
of a base sequence that is at least 80%, 90% or 100% identical to the base
sequence of SEQ
ID NO:37 ccgucauuggcggauca, the complement thereof, or an equivalent sequence
containing
thymine bases substituted for uracil bases, and which preferentially
hybridizes to the target
nucleic acid or its complement under stringent hybridization conditions. The
detection probe
preferably does not include a region in addition to the target binding region
that hybridizes
to the target nucleic acid or its complement under stringent hybridization
conditions. More
preferably, the base sequence of the target binding region of the detection
probe comprises,
consists of, or consists essentially of a base sequence substantially
corresponding to the base
sequence of SEQ ID NO:38, the complement thereof, or an equivalent sequence
containing
thymine bases substituted for uracil bases, and which preferentially
hybridizes to the target
nucleic acid or its complement under stringent hybridization conditions. The
detection probe
may be capable of forming a hairpin molecule through self-hybridization at its
end portions,
such as a "molecular beacon" or "molecular torch," as described infra, under
the stringent
hybridization conditions. In certain embodiments the probe optionally includes
one or more
detectable labels, e.g., a pair of interacting fluorescent labels.
For amplif cation reactions which do not form part ofthe present invention,
the above-
described promoter oligonucleotides may be modified to exclude the promoter
sequence
and/or the priming oligonucleotides may be modified to include a promoter
sequence.
Additionally, where the desired specificity for a target sequence can be
achieved, the
promoter oligonucleotides and/or the priming oligonucleotides described above
may be
modified and used as detection probes. Also, the above-described detection
probes may be
adapted for use as amplification oligonucleotides.
-26-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Other features and advantages of the invention will be apparent from the
following
description of the preferred embodiments thereof and from the claims.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1A-1D depict four general methods of the present invention.
Figures 2A-2D depict the general methods ofFigures 1 A-1 D with the further
inclusion
of an extender oligonucleotide hybridized to an extension product or target
sequence 3' to the
blocked promoter oligonucleotide.
FIG. 3 depicts a denaturing agarose gel showing the effect of using a promoter
oligonucleotide with a 3'-blocking moiety.
FIG. 4 shows the real-time accumulation of amplification products in a
Mycobacterium tuberculosis system, both in the presence (Figures 4A, 4C and
4E) and in the
absence (Figures 4B, 4D and 4F) of a terminating oligonucleotide modified to
fully contain
2'-O-methyl ribonucleotides. The input target nucleic acid for these reactions
was 0 copies
(Figures 4A and 4B), 100 copies (Figures 4C and 4D) and 1000 copies (Figures
4E and 4F).
FIG. 5 illustrates the formation of primer-dependent side-products.
Figures 6A and 6B illustrate the use of caps to limit side-product formation.
The cap
and priming oligonucleotide are separate molecules in FIG. 6A, and in FIG. 6B
they are
linked to each otber.
Figures 7A and 7B depict non-denaturing agarose gels showing the effect of a
capping
oligonucleotide on side-product formation. FIG. 7A depicts reactions without
added
template, and FIG. 7B depicts reactions with added template.
FIG. 8 shows the real-time accumulation of amplification products in a
Staphylococcus aureus system according to a method of the present invention.
The target
nucleic acid was double-stranded DNA, which was tested at four copy levels
against a
negative control.
FIG. 9 shows the real-time accumulation of amplification products in five
different
Staphylococcus aureus systems according to methods of the present invention.
The target
nucleic acid for each system was double-stranded DNA, and each was system was
tested at
10,000 copies of target against a negative control. The first system (FIG. 9A)
employed the
method of FIG. 1 D, and each of the remaining systems excluded a component of
this method.
The method of FIG. 9B excluded the terminating oligonucleotide; the method of
FIG. 9C
excluded the displacer oligonucleotide; the method of FIG. 9D excluded the
priming
oligonucleotide; and the method of FIG. 9E excluded a denaturation step.
-27-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
DETAILED DESCRIPTION OF THE INVENTION
In accordance with the present invention, novel methods, reaction mixtures,
compositions and kits are provided for the amplification of specific nucleic
acid target
sequences for use in assays for the detection and/or quantitation of such
nucleic acid target
sequences or for the production of large numbers of copies of DNA and/or RNA
of specific
target sequences for a variety of uses. In particular, the embodiments of the
present invention
provide for amplification of nucleic acid target sequences with enhanced
specificity and
sensitivity. Amplification methods of the present invention are preferably
carried out using
priming oligonucleotides that target only one sense of a target nucleic acid,
with all other
oligonucleotides used in the amplification methods preferably comprising a
blocking moiety
at their 3'-termini so that they cannot be extended by a nucleic acid
polymerase.
Definitions
The following terms have the following meanings unless expressly stated to the
contrary. It is to be noted that the term "a" or "an" entity refers to one or
more of that entity;
for example, "a nucleic acid," is understood to represent one or more nucleic
acids. As such,
the terms "a" (or "an"), "one or more," and "at least one" can be used
interchangeably herein.
1. Nucleic acid
The term "nucleic acid" is intended to encompass a singular "nucleic acid" as
well as
plural "nucleic acids," and refers to any chain of two or more nucleotides,
nucleosides, or
nucleobases (e.g., deoxyribonucleotides or ribonucleotides) covalently bonded
together.
Nucleic acids include, but are not limited to, virus genomes, or portions
thereof, either DNA
or RNA, bacterial genonnes, or portions thereof, fungal, plant or animal
genomes, or portions
thereof, messenger RNA (mRNA), ribosomal RNA (rRNA), transfer RNA (tRNA),
plasmid
DNA, mitochondrial DNA, or synthetic DNA or RNA. A nucleic acid may be
provided in a
linear (e.g., mRNA), circular (e.g., plasmid), or branched form, as well as a
double-stranded
or single-stranded form. Nucleic acids may include modified bases to alter the
function or
behavior of the nucleic acid, e.g., addition of a 3'-terminal
dideoxynuclaotide to block
additional nucleotides from being added to the nucleic acid. As used herein,
a"sequence' of
a nucleic acid refers to the sequence of bases which make up a nucleic acid.
The term
"polynucleotide" may be used herein to denote a nucleic acid chain. Throughout
this
application, nucleic acids are designated as having a 5-terminus and a 3'-
terminus. Standard
nucleic acids, e.g., DNA and RNA, are typically synthesized "S'-to-3'," i.e.,
by the addition
of nucleotides to the 3'-terminus of a growing nucleic acid.
-28-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
A "nucleotide" is a subunit of a nucleic acid consisting of a phosphate group,
a 5-
carbon sugar and a nitrogenous base. The 5-carbon sugar found in RNA is
ribose. In DNA,
the 5-carbon sugar is 2'-deoxyribose. The term also includes analogs of such
subunits, such
as a methoxy group at the 2' position of the ribose (2'-O-Me). As used herein,
methoxy
oligonucleotides containing "T" residues have a methoxy group at the 2'
position ofthe ribose
moiety, and a uracil at the base position of the nucleotide.
A "non-nucleotide unit" is a unit which does not significantly participate in
hybridization of a polymer. Such units must not, for example, participate in
any significant
hydrogen bonding with a nucleotide, and would exclude units having as a
component one of
the five nucleotide bases or analogs thereof.
2. Oligonucleotide
As used herein, the term "oligonucleotide" or "oligomer" is intended to
encompass
a singular "oligonucleotide" as well as plural "oligonucleotides," and refers
to any polymer
of two or more of nucleotides, nucleosides, nucleobases or related compounds
used as a
reagent in the amplification methods of the present invention, as well as
subsequent detection
methods. The oligonucleotide may be DNA and/or RNA and/or analogs thereof. The
term
oligonucleotide does not denote any particular function to the reagent,
rather, it is used
generically to cover all such reagents described herein. An oligonucleotide
may serve various
different functions, e.g., it may function as a primer if it is capable of
hybridizing to a
complementary strand and can further be extended in the presence of a nucleic
acid
polymerase, it may provide a promoter if it contains a sequence recognized by
an RNA
polymerase and allows for transcription, and it may function to prevent
hybridization or
impede primer extension if appropriately situated and/or modified. Specific
oligonucleotides
of the present invention are described in more detail below. As used herein,
an
oligonucleotide can be virtually any length, limited only by its specific
function in the
amplification reaction or in detecting an amplification product of the
amplification reaction.
Oligonucleotides of a defined sequence and chemical structure may be produced
by
techniques known to those of ordinary skill in the art, such as by chemical or
biochemical
synthesis, and by in vitro or in vivo expression from recombinant nucleic acid
molecules, e.g.,
bacterial or viral vectors. As intended by this disclosure, an oligonucleotide
does not consist
solely of wild-type chromosomal DNA or the in vivo transcription products
thereof.
Oligonucleotides may be modified in any way, as long as a given modification
is
compatible with the desired function of a given oligonucleotide. One of
ordinary skill in the
art can easily determine whether a given modification is suitable or desired
for any given
oligonucleotide of the present invention. Modifications include base
modifications, sugar
-29-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
modifications or backbone modifications. Base modifications include, but are
not limited to
the use of the following bases in addition to adenine, cytidine, guanosine,
thymine and uracil:
C-5 propyne, 2-amino adenine, 5-methyl cytidine, inosine, and dP and dK bases,
The sugar
groups of the nuclcoside subunits may be ribose, deoxyribose and analogs
thereof, including,
for example, ribonucleosides having a 2'-O-nnethyl substitution to the
ribofuranosyl moiety.
See Becker et al., U.S. Patent No. 6,130,038. Other sugar modifications
include, but are not
limited to 2'-amino, 2'-fluoro, (L)-alpha-threofuranosyl, and pentopuranosyl
modifications.
The nucleoside subunits may by joined by linkages such as phosphodiester
linkages, modified
linkages or by non-nucleotide moieties which do not prevent hybridization of
the
oligonucleotide to its complementary target nucleic acid sequence. Modified
linkages include
those linkages in which a standard phosphodiester linkage is replaced with a
different linkage,
such as a phosphorothioate linkage or a methylphosphonate linkage. The
nucleobase subunits
may be joined, for example, by replacing the natural deoxyribose phosphate
backbone of
DNA with a pseudo peptide backbone, such as a 2-aminoethylglycine backbone
which
couples the nucleobase subunits by means of a carboxymethyl linker to the
central secondary
amine. (DNA analogs having a pseudo peptide backbone are referred to as
"peptide nucleic
acids" or "PNA' and disclosed by Nielsen et al., "Peptide Nucleic Acids,"
U.S. Patent No.
5,539,082.) Other linkage modifications include, but are not limited to,
morpholino bonds.
Non-limiting examples af oligonucleotides or oligomers contemplated by the
present
invention include nucleic acid analogs containing bicyclic and tricyclic
nucleoside and
nucleotide analogs (LNAs). See Imanishi et al., U.S, Patent No. 6,268,490; and
Wengel et al.,
U.S. PatentNo. 6,670,461.) Any nucleic acid analog is contemplated by the
present invention
provided the modified oligonucleotide can perform its intended function, e.g.,
hybridize to
a target nucleic acid under stringent hybridization conditions or
amplification conditions, or
interact with a DNA or RNA polymerase, thereby initiating extension or
transcription. In the
case of detection probes, the modified oligonucleotides must also be capable
of preferentially
hybridizing to the target nucleic acid under stringent hybridization
conditions.
While design and sequence of oligonucleotides for the present invention depend
on
their function as described below, several variables must generally be taken
into account.
Among the most critical are: length, melting temperature (Tm), specificity,
complementarity
with other oligonucleotides in the system, G/C content, polypyrimidine (T, C)
or polypurine
(A, G) stretches, and the 3'-end sequence. Controlling for these and other
variables is a
standard and well known aspect of oligonucleotide design, and various computer
programs
are readily available to screen large numbers of potential oligonucleotides
for optimal ones.
The 3'-terminus of an oligonucleotide (or other nucleic acid) can be blocked
in a
variety of ways using a blocking moiety, as described below. A "blocked"
oligonucleotide
-30-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
cannot be extended by the addition of nucleotides to its 3'-terminus, by a DNA-
or RNA-
dependent DNA polymerase, to produce a complementary strand of DNA. As such, a
"blocked" oligonucleotide cannot be a "priming oligonucleotide."
As used in this disclosure, the phrase "an oligonucleotide having a nucleic
acid
sequence'comprising,"consisting of,' or'consisting essentially of a sequence
selected from"
a group of specific sequences means that the oligonucleotide, as a basic and
novel
characteristic, is capable of stably hybridizing to a nucleic acid having the
exact complement
of one of the listed nucleic acid sequences of the group under stringent
hybridization
conditions. An exact complement includes the corresponding DNA or RNA
sequence.
The phrase "an oligonucleotide substantially corresponding to a nucleic acid
sequence" means that the referred to oligonucleotide is sufficiently similar
to the reference
nucleic acid sequence such that the oligonucleotide has similar hybridization
propertics to the
reference nucleic acid sequence in that it would hybridize with the same
target nucleic acid
sequence under stringent hybridization conditions.
One skilled in the art will understand that "substantially corresponding"
oligonucleotides of the invention can vary from the referred to sequence and
still hybridize
to the same target nucleic acid sequence. This variation from the nucleic acid
may be stated
in terms of a percentage of identical bases within the sequence or the
percentage of perfectly
complementary bases between the probe or primer and its target sequence. Thus,
an
oligonucleotide of the present invention substantially corresponds to a
reference nucleic acid
sequence if these percentages of base identity or complementarity are from
100% to about
80%. In preferred embodiments, the percentage is from 100% to about 85%. In
more
preferred embodiments, this percentage can be from 100% to about 90%; in other
preferred
embodiments, this percentage is from 100% to about 95%. One skilled in the art
will
understand the various modifications to the hybridization conditions that
might be required
at various percentages of complementarity to allow hybridization to a specific
target sequence
without causing an unacceptable level of non-specific hybridization.
3. Blocking Moiety
As used herein, a "blocking moiety" is a substance used to "block" the 3'-
terminus of
an oligonucleotide or other nucleic acid so that it cannot be extended by a
nucleic acid
polymerase. A blocking moiety may be a small molecule, e.g., a phosphate or
ammonium
group, or it may be a modified nucleotide, e.g., a 3'2' dideoxynucleotide or
3' deoxyadenosine
5'-triphosphate (cordycepin), or other modified nucleotide. Additional
blocking moieties
include, for example, the use of a nucleotide or a short nucleotide sequence
having a 3'-to-5'
orientation, so that there is no free hydroxyl group at the 3'-terminus, the
use of a 3' alkyl
-31-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
group, a 3' non-nucleotide moiety (see, e.g., Arnold et al., "Non-Nucleotide
Linking
Reagents for Nucleotide Probes," U.S. Patent No. 6,031,091, the contents
ofwhich are hereby
incorporated by reference herein), phosphorothioate, alkane-diol residues,
peptide nucleic
acid (PNA), nucleotide residues lacking a 3' hydroxyl group at the 3'-
terminus, or a nucleic
acid binding protein. Preferably, the 3'-blocking moiety comprises a
nucleotide or a
nucleotide sequence having a 3'-to-5' orientation or a 3' non-nucleotide
moiety, and not a 37-
dideoxynucleotide or a 3' terminus having a free hydroxyl group. Additional
methods to
prepare 3'-blocking oligonucleotides are well known to those of ordinary skill
in the art.
4. Binding molecule
As used herein, a "binding molecule" is a substance which hybridizes to or
otherwise
binds to a target nucleic acid adjacent to or near the 5'-end of the desired
target sequence, so
as to limit a DNA primer extension product to a desired length, i.e., a primer
extension
product having a generally defined 3'-end. As used herein, the phrase "defined
3'-end" means
that the 3'-end of a primer extension product is not wholly indeterminate, as
would be the case
in a primer extension reaction which occurs in the absence of a binding
molecule, but rather
that the 3'-end of the primer extension product is generally known to within a
small range of
bases. In certain embodiments, a binding molecule comprises a base region. The
base region
may be DNA, RNA, a DNA:RNA chimeric molecule, or an analog thereof. Binding
molecules compr.ising a base region may be modified in one or more ways, as
described
herein. Exemplary base regions include terminating and digestion
oligonucleotides, as
described below. In other embodiments, a binding molecule may comprise, for
example, a
protein or drug capable of binding RNA with sufficient affinity and
specificity to limit a DNA
primer extension product to a pre-determined length.
5. Terminating Oligonucleotide
In the present invention, a "terminating oligonucleotide" is an
oligonucleotide
comprising a base sequence that is complementary to a region of the target
nucleic acid in the
vicinity ofthe 5'-end ofthe target sequence, so as to "terminate" primer
extension of a nascent
nucleic acid that includes a priming oligonucleotide, thereby providing a
defined 3'-end for
the nascent nucleic acid strand. A terminating oligonucleotide is designed to
hybridize to the
target nucleic acid at a position sufficient to achieve the desired 3'-end for
the nascent nucleic
acid strand. The positioning of the terminating oligonucleotide is flexible
depending upon
its design. A terminating oligonucleotide may be modified or unmodified. In
certain
embodiments, terminating oligonucleotides are synthesized with at least one or
more 2'-O-
methyl ribonucleotides. These modified nucleotides have demonstrated higher
thermal
.32-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
stability of complementary duplexes. The 2'-O-methyl ribonucleotides also
function to
increase the resistance of oligonucleotides to exonucleases, thereby
increasing the half-life
of the modified oligonucleotides. See, e.g., Majlessi et al. (1988) Nucleic
Acids Res. 26,
2224-9, the contents of which are hereby incorporated by reference herein.
Other
modifications as described elsewhere herein may be utilized in addition to or
in place of 2'-O-
methyl ribonucleotides. For example, a terminating oligonucleotide may
comprise PNA or
an LNA. See, e.g., Petersen et al. (2000) J. Mal. Recognit. 13, 44-53, the
contents of which
are hereby incorporated by reference herein. Although not required, a
terminating
oligonucleotide of the present invention preferably includes a blocking moiety
at its 3'-
terminus to prevent extension. A terminating oligonucleotide may also comprise
a protein
or peptide joined to the oligonucleotide so as to terminate further extension
of a nascent
nucleic acid chain by a polymerase. A terminating oligonucleotide of the
present invention
is typically at least 10 bases in length, and may extend up to 15, 20,25,
30,35, 40, 50 or more
nucleotides in length. Suitable and preferred terminating oligonucleotides are
described
is herein. It should be noted that while a terminating oligonucleotide
typically or necessarily
includes a 3'-blocking moiety, "Y-blocked" oligonucleotides are not
necessarily terminating
oligonucleotides. Other oligonucleotides of the present invention, e.g.,
promoter
oligonucleotides and capping oligonucleotides are typically or necessarily 3'-
blocked as well.
6. Modifying Oligonucleotide/Digestion Oligonucleotide
A modifying oligonucleotide provides a mechanism by which the 3'-terminus of
the
primer extension product is determined. A modifying oligonucleotide typically
comprises
a motif which hybridizes to one or more bases in the vicinity of the 5'-end of
a target
sequence, and which facilitates termination of primer extension by means of a
modifying
enzyme, e.g., a nuclease. Alternatively, a modifying oligonucleotide might
comprise a base
region which hybridizes in the vicinity of the 3'-end of a target sequence,
and is tethered to
a specific modifying enzyme or to a chemical which can then terminate primer
extension.
One specific modifying oligonucleotide is a digestion oligonucleotide. A
digestion
oligonucleotide is comprised of DNA, preferably a stretch of at least about 6
deoxyribonucleotides. The digestion oligonucleotide hybridizes to the RNA
template, and
the RNA of a RNA:DNA hybrid is digested by a selective RNAse as described
herein, e.g.,
by an enzyme having an RNAse H activity.
7. Promoter Oligonucleotide/Promoter Sequence
As is well known in the art, a "promoter" is a specific nucleic acid sequence
that is
recognized by a DNA-dependent RNA polymerase ("transcriptase") as a signal to
bind to the
-33-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
nucleic acid and begin the transcription of RNA at a specific site. For
binding, it was
generally thought that such transcriptases required DNA which had been
rendered double-
stranded in the region comprising the promoter sequence via an extension
reaction, however,
the present inventors have determined that efficient transcription of RNA can
take place even
under conditions where a double-strandcd promoter is not formed through an
extension
reaction with the template nucleic acid. The template nucleic acid (the
sequence to be
transcribed) need not be double-stranded. Individual DNA-dependent RNA
polymerases
recognize a variety of different promoter sequences which can vary markedly in
their
efficiency in promoting transcription. When an RNA polymerase binds to a
promotcr
sequence to initiate transcription, that promoter sequence is not part of the
sequence
transcribed. Thus, the RNA transcripts produced thereby will not include that
sequence.
According to the present invention, a "promoter oligonucleotide" refers to an
oligonucleotide comprising first and second regions, and which is modified to
prevent the
initiation of DNA synthesis from its 3'-terminus. The "first region" of a
promoter
oligonucleotide of the present invention comprises a base sequence which
hybridizes to a
DNA template, where the hybridizing sequence is situated 3', but not
necessarily adjacent to,
a promoter region. The hybridizing portion of a promoter oligonucleotide of
the present
invention is typically at least 10 nucleotides in length, and may extend up to
15, 20, 25, 30,
35, 40, 50 or more nucleotides in length. The "second region" comprises a
promoter for an
RNA polymerase. A promoter oligonucleotide of the present invention is
engineered so that
it is incapable of being extended by an RNA- or DNA-dependent DNA polymerase,
e.g.,
reverse transcriptase, preferably comprising a blocking moiety at its 3'-
terminus as described
above. Suitable and preferred promoter oligonucleotides are described herein.
Promoter oligonucleotides of the present invcntion may be provided to a
reaction
mixture with an oligodeoxynucleotide bound to a ribonucleotide-containing
section of the
first region. The ribonucleotide-containing section preferably comprises at
least 6 contiguous
ribonucleotides positioned at or near the 3'-end of the first region, and the
oligodeoxynucleotide is preferably the same length as and fully complementary
to the
ribonucleotide-containing section of the first region. Upon exposure to an
enzyme capable of
cleaving the RNA of an RNA:DNA duplex (e.g., an RNAse H activity), a blocking
moiety
at the 3'-end of the promoter oligonucleotide is released and the remainder of
the first region
is in a single-stranded form which is available for hybridization to a DNA
template. The
remaining, uncleaved portion of the first region is preferably 10 to 50
nucleotides in length,
as described above.
Promoter oligonucleotides of the present invention may be used in methods
disclosed
herein to distinguish between regions of variability in the target sequence or
between the
34
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
target sequence and non-target nucleic acid which may be present in a reaction
mixture (e.g.,
single nucleotide polymorphisms ("SNPs") or mismatches between closely related
organisms
or strains). When a primer extension product or nucleic acid sharing a high
degree of
sequence identity with a target nucleic acid contains one or more base
mismatches with the
target binding portion of a promoter oligonucleotide, the complements of these
mismatched
bases are integrated into the transcription products and the mismatched bases
are then
reproduced in initial and/or subsequent rounds of primer extension, thereby
affecting the
efficiency and sensitivity of the amplification reaction. Additionally,
mismatches between
the target binding portion of the promoter oligonucleotide and the primer
extension product
may interfere with the formation of a double-stranded promoter sequence in the
presence of
a reverse transcriptase, thereby further affecting the efficiency of the
amplification reaction.
These deleterious effects on an amplification reaction can be exploited to
distinguish between
nucleic acids exhibiting sequence variability in the region targeted by the
promoter
oligonucleotide.
8. Insertion Sequence
As used herein, an "insertion sequence" is a sequence positioned between the
first
region (i.e., template binding portion) and the second region of a promoter
oligonucleotide.
Insertion sequences are preferably 5 to 20 nucleotides in length, more
preferably 6 to 18
nucleotides in length, and most preferably 6 to 12 nucleotides in length. The
inclusion of
insertion sequences in promoter oligonucleotides increases the rate at which
RNA
amplification products are formed. Exemplary insertion sequences are described
herein.
9. Extender Oligonucleotide
An extender oligonucleotide is an oligonucleotide which hybridizes to a DNA
template adjacent to or near the 3'-end of the first region of a promoter
oligonucleotide. An
extender oligonucleotide preferably hybridizes to a DNA template such that the
5'-terminal
base of the extender oligonucleotide is within 3, 2 or 1 bases of the 3'-
terminal base of a
promoter oligonucleotide. Most preferably, the 5'-terminal base of an extender
oligonucleotide is adjacent to the 3'-terminal base of a promoter
oligonucleotide when the
extender oligonucleotide and the promoter oligonucleotide are hybridized to a
DNA template.
To prevent extension of an extender oligonucleotide, a 3'-terminal blocking
moiety is
typically included. An extender oligonucleotide is preferably 10 to 50
nucleotides in length,
more preferably 20 to 40 nucleotides in length, and most preferably 30 to 35
nucleotides in
length.
- 35 -
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
10. Priming Oligonucleotide
A priming oligonucleotide is an oligonucleotide, at least the 3'-end of which
is
complementary to a nucleic acid template, and which hybridizes to the template
to give a
priming oligonucleotide:template hybrid suitable for initiation of synthesis
by an RNA- or
DNA-dependent DNA polymerase. A priming oligonucleotide is extended by the
addition
of covalently bonded nucleotides to its 3'-terminus, which nucleotides are
complementary to
the template. The result is a primer extension product. A priming
oligonucleotide of the
present invention is typically at least 10 nucleotides in length, and may
extend up to 15, 20,
25, 30, 35, 40, 50 or more nucleotides in length. Suitable and preferred
priming
oligonucleotides are described herein. Virtually all DNA polymerases
(including reverse
transcriptases) that are known require hybridization ofan oligonucleotide to a
single-stranded
template ("priming") to initiate DNA synthesis, whereas RNA replication and
transcription
(copying of RNA from DNA) generally do not require a primer. Because of its
function, a
priming oligonucleotide cannot comprise a 3'-blocking moiety that prevents
extension in the
presence of a DNA polymerase. Priming oligonucleotides are preferably designed
to
preferentially hybridize to a target nucleic acid, and so that it cannot be
cleaved by a
ribonuclease when hybridized to the target nucleic acid.
11. Displacer Oligonucleotide
A "displacer oligonucleo#ide" is a priming oligonuclcotide which hybridizes to
a
template nucleic acid upstream from a neighboring priming oligonucleotide
hybridized to the
3'-end of a target sequence (referred to herein as the "forward priming
oligonucleotide"). By
"upstream" is meant that a 3'-end of the displacer oligonucleotide complexes
with the
template nucleic acid 5' to a 3'-end of the forward priming oligonucleotide.
When hybridized
to the template nucleic acid, the 3'-terminal base of the displacer
oligonuclcotide is preferably
adjacent to or spaced from the 5-terminal base of the forward priming
oligonucleotide. More
preferably, the 3'-terminal base of the displacer oligonucleotide is spaced
from 5 to 35 bases
from the 5'-terminal base of the forward priming oligonucleotide. The
displacer
oligonucleotide may be provided to a reaction mixture contemporaneously with
the forward
priming oligonucleotide or after the forward priming oligonucleotide has had
sufficient time
to hybridize to the template nucleic acid. Extension of the forward priming
oligonucleotide
can be initiated prior to or after the displacer oligonucleotide is provided
to a reaction
mixture. Under amplification conditions, the displacer oligonucleotide is
extended in a
template-dependent manner, thereby displacing a primer extension product
comprising the
forward priming oligonucleotide which is complexed with the template nucleic
acid, Once
displaced from the template nucleic acid, the primer extension product
comprising the
-36-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
forward priming oligonucleotide is available for complexing with a promoter
oligonucleotide.
The forward priming oligonucleotide and the displacer oligonucleotide both
preferentially
hybridize to the target nucleic acid.
12. Cap or Capping Oligonucleotide
As used herein, a "cap" comprises an oligonucteotide complementary to the 3'-
end of
a priming oligonucleotide, where the 5'-terminal base of the cap hybridizes to
the 3'-terminal
base of the priming oligonucleotide. A cap according to present invention is
designed to
preferentially hybridize to the 3'-end ofthe priming oligonucleotide, e.g.,
not with a promoter
oligonucleotide, but such that the cap will be displaced by hybridization of
the priming
oligonucleotide to the target nucleic acid. A cap may take the form of a
discrete capping
oligonucleotide or it may be joined to the 5'-end of the priming
oligonucleotide via a linker
region, thereby forming a stem-loop structure with the priming oligonucleotide
under
amplification conditions. Such a linker region can comprise conventional
nucleotides, abasic
nucleotides or otherwise modified nucleotides, or a non-nucleotide region. As
described in
more detail herein, a suitable cap is at least three bases in length, and is
no longer than about
14 bases in length. Typical caps are about 5 to 7 bases in length.
13. Probe
By "probe" or "detection probe" is meant a molecule comprising an
oligonucleotide
having a base sequence partly or completely complementa.ry to a region of an
amplification
product containing either sense of a target sequence sought to be detected, so
as to hybridize
thereto under stringent hybridization conditions. As would be understood by
someone having
ordinary skill in the art, a probe comprises an isolated nucleic acid
molecule, or an analog
thereof, in a form not found in nature without human intervention (e.g.,
recombined with
foreign nucleic acid, isolated, or purified to some extent).
The probes of this invention may have additional nucleotides outside of the
targeted
region so long as such nucleotides do not substantially affect hybridization
under stringent
hybridization conditions and, in the case of detection probes, do not prevent
preferential
hybridization to the target sequence. A non-complementary sequence may also be
included,
such as a target capture sequence (generally a homopolymer tract, such as a
poly-A, poly-T
-37-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
or poly-U tail), promoter sequcnce, a binding site for RNA transcription, a
restriction
andonuclease recognition site, or may contain sequences which will confer a
desired
secondary or tertiary structure, such as a catalytic active site or a hairpin
structure on the
probe, on the target nucleic acid, or both.
The probes preferably include at least one detectable label. The label may be
any
suitable labeling substance, including but not limited to a radioisotope, an
enzyme, an enzyme
cofactor, an enzyme substrate, a dye, a hapten, a chemiluminescent molecule, a
fluorescent
molecule, a phosphorescent molecule, an electrochemiluminescent molecule, a
chromophore,
a base sequence region that is unable to stably hybridize to the target
nucleic acid under the
stated conditions, and mixtures of these. In one particularly preferred
embodiment, the label
is an acridinium ester. Probes may also include interacting labels which emit
different
signals, depending on whether the probes have hybridized to target sequences.
Examples of
interacting labels include enzyme/substrates, enzyme/cofactor,
luminescent/quencher,
luminescent/adduct, dye dimers, and Fiirrester energy transfer pairs. Certain
probes of the
present invention do not include a label. For example, non-labeled "capture"
probes may be
used to enrich for target sequences or replicates thereof, which may then be
detected by a
second "detection" probe. See, e.g., Weisburg et al., "Two-Step Hybridization
and Capture
of a Polynucleotide," U.S. Patent No. 6,534,273, the contents of which are
hereby
incorporated by reference herein. While detection probes are typically
labeled, certain
detection technologies do not require that the probe be labeled for detection
of the
amplification product. See, e.g., Nygren et al., "Devices and Methods for
Optical Detection
of Nucleic Acid Hybridization, U.S. Patent No. 6,060,237.
By "stable" or "stable for detection" is meant that the temperature of a
reaction
mixture is at least 2 C below the melting temperature of a nucleic acid
duplex. The
temperature of the reaction mixture is more preferably at least 5 C below the
melting
temperature of the nucleic acid duplex, and even more preferably at least 10 C
below the
melting temperature of the nucleic acid duplex.
By "preferentially hybridize" is meant that under stringent hybridization
conditions,
probes of the prescnt invention hybridize to an amplification product
containing either sense
of the target sequence to form stable probe:target hybrids, while at the same
time formation
of stable probe:non-target hybrids is minimized. Thus, a probe hybridizes to a
target
sequence or replicate thereof to a sufficiently greater extent than to a non-
target sequence, to
enable one having ordinary skill in the art to accurately quantitate the RNA
replicates or
complementary DNA (cDNA) of the target sequence formed during the
amplification.
Probes of a defined sequence may be produced by techniques known to those of
ordinary skill in the art, such as by chemical synthesis, and by in vitro or
in vivo expression
-38-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
from recombinant nucleic acid molecules. Preferably probes are 10 to 100
nucleotides in
length, more preferably 12 to 50 bases in length, and even more preferably 18
to 35 bases in
length.
14. Hybridize/Hybridization
Nucleic acid hybridization is the process by which two nucleic acid strands
having
completely or partially complementary nucleotide sequences come together under
predetermined reaction conditions to form a stable, double-stranded hybrid.
Either nucleic
acid strand may be a deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA)
or analogs
thereof. Thus, hybridization can involve RNA:RNA hybrids, DNA:DNA hybrids,
RNA:DNA
hybrids, or analogs thereof. The two constituent strands of this double-
stranded structure,
sometimes called a hybrid, are held together by hydrogen bonds. Although these
hydrogen
bonds most commonly form between nucleotides containing the bases adenine and
thymine
or uracil (A and T or U) or cytosine and guanine (C and G) on single nucleic
acid strands,
base pairing can also form between bases which are not members of these
"canonical" pairs.
Non-canonical base pairing is well-known in the art. (See, e.g., ROGER L.P.
ADAMS ET AL.,
THE BIOCHEMISTRY OF THE NUCLEIC ACIDS (I 1' ed. 1992).)
"Stringent hybridization conditions" or "stringent conditions" refer to
conditions
wherein a specific detection probe is able to hybridize to an amplification
product containing
either sense of a target sequence over other nucleic acids present in a
reaction mixture. It will
be appreciated that these conditions may vary depending upon factors including
the GC
content and length of the probe, the hybridization temperature, the
composition of the
hybridization reagent or solution, and the degree of hybridization specificity
sought. Specific
stringent hybridization conditions are provided in the disclosure below.
By "nucleic acid hybrid" or "hybrid" or "duplex" is meant a nucleic acid
structure
containing a double-stranded, hydrogen-bonded region wherein each strand is
complementary
to the other, and wherein the region is sufficiently stable under stringent
hybridization
conditions to be detected by means including, but not limited to,
chemiluminescent or
fluorescent light detection, autoradiography, or gel electrophoresis. Such
hybrids may
comprise RNA:RNA, RNA:DNA, or DNA:DNA duplex molecules.
By "complementary" is meant that the nucleotide sequences of similar regions
of two
single-stranded nucleic acids, or to different regions of the same single-
stranded nucleic acid
have a nucleotide base composition that allow the single-stranded regions to
hybridize
together in a stable, double-stranded hydrogen-bonded region under stringent
hybridization
or amplification conditions. When a contiguous sequence of nucleotides of one
single-
stranded region is able to form a series of "canonical" hydrogen-bonded base
pairs with an
-39-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
analogous sequence of nucleotides of the other single-stranded region, such
that A is paired
with U or T and C is paired with G, the nucleotides sequences are "perfectly"
complementary.
By "preferentially hybridize" is meant that under stringent hybridization
conditions,
certain complementary nucleotide sequences hybridize to form a stable hybrid
preferentially
over other, less stable duplexes.
15. Nucleic Acid "Identity"
In certain embodiments, a nucleic acid of the present invention comprises a
contiguous base region that is at least 80%, 90%, or 100% identical to a
contiguous base
region of a reference nucleic acid. For short nucleic acids, e.g., certain
oligonucleotides of
the present invention, the degree of identity between a base region of a
"query" nucleic acid
and a base region of a reference nucleic acid can be determined by manual
alignment.
"Identity" is determined by comparing just the sequence of nitrogenous bases,
irrespective
of the sugar and backbone regions of the nucleic acids being compared. Thus,
the
query:rcference base sequence alignment may be DNA:DNA, RNA:RNA, DNA:RNA,
RNA:DNA, or any combinations or analogs thereof. Equivalent RNA and DNA base
sequences can be compared by replacing uridine residues (in RNA) with
thymidine residues
(in DNA).
16. Target Nucleic Acid/Target Sequence
A "target nucleic acid" is a nucleic acid comprising a "target sequence" to be
amplified. Target nucleic acids may be DNA or RNA as described herein, and may
be either
single-stranded or double-stranded. The target nucleic acid may include other
sequences
besides the target sequence which may not be amplified. Typical target nucleic
acids include
virus genomes, bacterial genomes, fungal genomes, plant genomes, animal
genomes, rRNA,
tRNA, or mRNA from viruses, bacteria or eukaryotic cells, mitochondrial DNA,
or
chromosomal DNA.
Target nucleic acids may be isolated from any number of sources based on the
purpose
of the amplification assay being carried out. Sources of target nucleic acids
include, but are
not limited to, clinical specimens, e.g., blood, urine, saliva, feces, semen,
or spinal fluid, from
criminal evidence, from environmental samples, e.g., water or soil samples,
from food, from
industrial samples, from cDNA libraries, or from total cellular RNA. By
"isolated" it is
meant that a sample containing a target nucleic acid is taken from its natural
milieu, but the
term does not connote any degree of purification. If necessary, target nucleic
acids of the
present invention are made available for interaction with the various
oligonucleotides of the
present invention. This may include, for example, cell lysis or cell
permeabilization to release
- 4Q
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
the target nucleic acid from cells, which then may be followed by one or more
purification
steps, such as a series of isolation and wash steps. See, e.g., Clark et al.,
"Method for
Extracting Nucleic Acids from a Wide Range of Organisms," U.S. Patent No.
5,786,208, the
contents of which are hereby incorporated by reference herein. This is
particularly important
where the sample may contain components that can interfere with the
amplification reaction,
such as, for example, heme present in a blood sample. See Ryder et al.,
"Amplification of
Nucleic Acids from Mononuclear Cells Using Iron Complexing and Other Agents,"
U.S.
Patent No. 5,639,599, the contents of which are hereby incorporated by
reference herein.
Methods to prepare target nucleic acids from various sources for amplification
are well
known to those of ordinary skill in the art. Target nucleic acids of the
present invention may
be purified to some degree prior to the amplification reactions described
herein, but in other
cases, the sample is added to the amplification reaction without any further
manipulations.
The term "target sequence" refers to the particular nucleotide sequence of the
target
nucleic acid which is to be amplified. The "target sequence" includes the
complexing
sequences to which oligonucleotides (e.g., priming oligonucleotides and/or
promoter
oligonucleotides) complex during the processes of the present invention. Where
the target
nucleic acid is originally single-stranded, the term "target sequence" will
also refer to the
sequence complementary to the "target sequence" as present in the target
nucleic acid. Where
the "target nucleic acid" is originally double-stranded, the term "target
sequence" refers to
both the sense (+) and antisense (-) strands. In choosing a target sequence,
the skilled artisan
will understand that a "unique" sequence should be chosen so as to distinguish
between
unrelated or closely related target nucleic acids. As will be understood by
those of ordinary
skill in the art, "unique" sequences are judged from the testing environment.
At least the
sequences recognized by the detection probe (as described in more detail
elsewhere herein)
should be unique in the environment being tested, but need not be unique
within the universe
of all possible sequences. Furthermore, even though the target sequence should
contain a
"unique" sequence for recognition by a detection probe, it is not always the
case that the
priming oligonucleotide and/or promoter oligonucleotide are recognizing
"unique" sequences.
In some embodiments, it may be desirable to choose a target sequence which is
common to
a family of related organisms, for example, a sequence which is common to all
HIV strains
that might be in a sample. In other situations, a very highly specific target
sequence, or a
target sequence having at least a highly specific region recognized by the
detection probe,
would be chosen so as to distinguish between closely related organisms, for
example, between
pathogenic and non-pathogenic E. coli. A target sequence of the present
invention may be
of any practical length. A minimal target sequence includes the region which
hybridizes to
the priming oligonucleotide (or the complement thereof), the region which
hybridizes to the
-41-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
hybridizing region of the promoter oligonucleotide (or the complement
thereof), and a region
used for detection, e.g., a region which hybridizes to a detection probe,
described in more
detail elsewhere herein. The region which hybridizes to the detection probe
may overlap with
or be contained within the region which hybridizes with the priming
oligonueleotide (or its
complement) or the hybridizing region of the promoter oligonucleotide (or its
complement).
In addition to the minimal requirements, the optimal length of a target
sequence depends on
a number of considerations, for example, the amount of secondary structure, or
self-
hybridizing regions in the sequence. Determining the optimal length is easily
accomplished
by those of ordinary skill in the art using routine optimization methods.
Typically, target
t0 sequences of the present invention range from about 100 nucleotides in
length to from about
150 to about 250 nucleotides in length. The optimal or preferred length may
vary under
different conditions, which can easily be tested by one of ordinary skill in
the art according
to the methods described herein. The term "amplicon" refers to a nucleic acid
molecule that
is generated during an amplification procedure and is substantially
complementary or
identical to a sequence contained within the target sequence.
17. Template
A "template" is a nucleic acid molecule that is being copied by a nucleic acid
polymerase. A template may be single-stranded, double-stranded or partially
double-stranded,
depending on the polymerase. The synthesized copy is complementary to the
template or to
at least one strand of a double-stranded or partially double-stranded
template. Both RNA and
DNA are typically synthesized in the 5'-to-3' direction and the two strands of
a nucleic acid
duplex are aligned so that the 5'-termini of the two strands are at opposite
ends of the duplex
(and, by necessity, so then are the 3'-termini). While according to the
present invention, a
"target sequence" is always a "template," templates can also include secondary
primer
extension products and amplification products.
18. DNA-dependent DNA Polymerase
A "DNA-dependent DNA polymerase" is an enzyme that synthesizes a
complementary DNA copy from a DNA template. Examples are DNA polymerase I from
E.
coli, bacteriophage T7 DNA polymerase, or DNA polymerases from bacteriophages
T4, Phi-
29, M2, or T5. DNA-dependent DNA polymerases of the present invention may be
the
naturally occurring enzymes isolated from bacteria or bacteriophages or
expressed
recombinantly, or may be modified or "evolved" forms which have been
engineered to
possess certain desirable characteristics, e.g., thermostability, or the
ability to recognize or
synthesize a DNA strand from various modified templates. All known DNA-
dependent DNA
-42-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
polymerases require a complementary primer to initiate synthesis. It is known
that under
suitable conditions a DNA-dependent DNA polymerase may synthesize a
complementary
DNA copy from an RNA template. RNA-dependent DNA polymerases (described below)
typically also have DNA-dependent DNA polymerase activity.
19. DNA-dependent RNA Polymerase (Transcriptase)
A "DNA-dependent RNA polymerase" or "transcriptase" is an enzyme that
synthesizes multiple RNA copies from a double-stranded or partially-double-
stranded DNA
molecule having a promoter sequence that is usually double-stranded. The RNA
molecules
("transcripts") are synthesized in the 5'-to-3' direction beginning at a
specific position just
downstream of the promoter. Examples of transcriptases are the DNA-dependent
RNA
polymerase from E. coli and bacteriophages T7, T3, and SP6.
20. RNA-dependent DNA polymerase (Reverse Transcriptase)
An "RNA-dependent DNA polymerase" or "reverse transcriptase" ("RT") is an
enzyme that synthesizes a complementary DNA copy from an RNA template. All
known
reverse transcriptases also have the ability to make a complementary DNA copy
from a DNA
template; thus, they are both RNA- and DNA-dependent DNA polymerases. RTs may
also
have an RNAse H activity. Preferred is reverse transcriptase derived from
Maloney murine
leukemia virus (MMLV-RT). A primer is required to initiate synthesis with both
RNA and
DNA templates.
21. Selective RNAses
As used herein, a "selective RNAse" is an enzyme that degrades the RNA portion
of
an RNA:DNA duplex but not single-stranded RNA, double-stranded RNA or DNA. An
exemplary selective RNAse is RNAse H. Enzymes other than RNAse H which possess
the
same or similar activity are also contemplated in the present invention.
Selective RNAses
may be endonucleases or exonucleases. Most reverse transcriptase enzymes
contain an
RNAse H activity in addition to their polymerase activities. However, other
sources of the
RNAse H are available without an associated polymerase activity. The
degradation may result
in separation of RNA from a RNA:DNA complex. Alternatively, a selective RNAse
may
simply cut the RNA at various locations such that portions of the RNA melt off
or permit
enzymes to unwind portions of the RNA. Other enzymes which selectively degrade
RNA
target sequences or RNA products of the present invention will be readily
apparent to those
of ordinary skill in the art.
- 43 -
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
22. Sense/Antisense Strand(s)
Discussions of nucleic acid synthesis are greatly simplified and clarified by
adopting
terms to name the two complementary strands of a nucleic acid duplex.
Traditionally, the
strand encoding the sequences used to produce proteins or structural RNAs are
designated as
the "sense (+)" strand and its complement the "antisense (-)" strand. It is
now known that in
many cases, both strands are functional, and the assignment of the designation
"sense" to one
and "antisense" to the other must then be arbitrary. Nevertheless, the terms
are very useful
for designating the sequence orientation of nucleic acids and will be employed
herein for that
purpose.
23. Specificity of the System
The term "specificity," in the context of an amplification system, is used
herein to
refer to the characteristic of an amplification system which describes its
ability to distinguish
between target and non-target sequences dependent on sequence and assay
conditions. In
terms of a nucleic acid amplification, specificity generally refers to the
ratio of the number
of specific amplicons produced to the number of side-products (a. e., the
signal-to-noise ratio),
described in more detail below.
24. Sensitivity
The term "sensitivity" is used herein to refer to the precision with which a
nucleic acid
amplification reaction can be detected or quantitated. The sensitivity of an
amplification
reaction is generally a measure of the smallest copy number of the target
nucleic acid that can
be reliably detected in the amplification system, and will depend, for
example, on the
detection assay being employed, and the specificity ofthe amplification
reaction, i. e., the ratio
of specific amplicons to side-products.
25. Amplification Conditions
By "amplification conditions" is meant conditions permitting nucleic acid
amplification according to the present invention. Amplification conditions
may, in some
embodiments, be less stringent than "stringent hybridization conditions" as
described herein.
Oligonucleotides used in the amplification reactions ofthe present invention
hybridize to their
intended targets under amplification conditions, but may or may not hybridize
under stringent
hybridization conditions. On the other hand, detection probes of the present
invention
hybridize under stringent hybridization conditions. While the Examples section
infra
provides preferred amplification conditions for amplifying target nucleic acid
sequences
according to the present invention, other acceptable conditions to carry out
nucleic acid
- 44
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
amplifications according to the present invention could be easily ascertained
by someone
having ordinary skill in the art depending on the particular method of
amplification employed.
* * ~: x*
The present invention provides an autocatalytic amplification method which
synthesizes large numbers of RNA copies of an RNA or DNA target sequence with
high
specificity and sensitivity. An important aspect of the present invention is
the minimal
production of side-products during the amplification. Examples of side-
products include
oligonucleotide dimers and self-replicating molecules. The target nucleic acid
contains the
target sequence to be amplified. The target sequence is that region of the
target nucleic acid
which is defined on either end by priming oligonucleotides, promoter
oligonucleotides, and,
optionally, a binding molecule, e.g., a terminating oligonucleotide or a
modifying
oligonucleotide (described in more detail below), and/or the natural target
nucleic acid
termini, and includes both the sense and antisense strands. Promoter
oligonucleotides of the
present invention are modified to prevent the synthesis of DNA therefrom.
Preferably, the
promoter oligonucleotides comprise a blocking moiety attached at their 3'-
termini to prevent
primer extension in the presence of a polymerase. Indeed, according to the
present invention,
at least about 80% of the oligonucleotides present in the amplification
reaction which
comprise a promoter further comprise a 3'-blocking moiety. In further
embodiments, at least
about 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the oligonucleotides
provided to
the amplification reaction which comprise a promoter are further modified to
comprise a 3'-
blocking moiety. In a specific embodiment, any oligonucleotide used in an
amplification
reaction ofthe present invention which comprises a promoter sequence must
further comprise
a 3'-terminus blocking moiety.
One embodiment of the present invention comprises amplification of a target
nucleic
acid comprising an RNA target sequence. See Figures lA and 1B. The target
nucleic acid
has indeterminate 3'- and 5'-ends relative to the desired RNA target sequence.
The target
nucleic acid is treated with a priming oligonucleotide which has a base region
sufficiently
complementary to a 3'-region of the RNA target sequence to hybridize
therewith. See Step
1 of Figures IA and 1B. Priming oligonucleotides are designed to hybridize to
a suitable
region of any desired target sequence, according to primer design methods well
known to
those of ordinary skill in the art. Suitable priming oligonucleotides are
described in more
detail herein. While a priming oligonuclcotide of the present invention can
optionally include
a non-hybridizing base region situated 5' to the region which hybridizes with
the target
sequence, according to the present invention the 5' region of a priming
oligonucleotide does
not include a promoter sequence recognized by an RNA polymerase. Additionally,
the 5'-end
-45-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
of the priming oligonucleotide may include one or modifications which improve
the binding
properties (e.g., hybridization or base stacking) of the priming
oligonucleotide to a target
sequence or RNA amplification product, as discussed more fully infra, provided
the
modifications do not substantially interfere with the priming function of the
priming
oligonucleotide or cleavage of a template RNA to which the priming
oligonucleotide is
hybridized. In the presence of nucleoside triphosphates and buffers, salts and
cofactors, the
3'-cnd of the priming oligonucleotide is extended by an appropriate DNA
polymerase, e.g.,
an RNA- dependentDNA polymerase ("reverse transcriptase") in an extension
reaction using
the RNA target sequence as a template to give a DNA primer extension product
which is
cornplementary to the RNA template. See Steps 2 and 3 of Figures 1 A and 1 B.
The DNA primer extension product is separated (at least partially) from the
RNA
template using an enzyme which degrades the RNA template. See Step 4 of
Figures 1 A and
1B. Suitable enzymes, i.e., "selective RNAses," are those which act on the RNA
strand of
an RNA:DNA complex, and include enzymes which comprise an RNAse H activity.
Some
reverse transcriptases include an RNAse H activity, including those derived
from Moloney
murine leukemia virus ("MMLV") and avian myeloblastosis virus ("AMV").
According to
this method, the selective RNAse may be provided as an RNAse H activity of a
reverse
transcriptase, or may be provided as a separate enzyme, e.g., as an E. coli
RNAse H or a T.
thermophilus RNAse H. Other enzymes which selectively degrade RNA present in
an
RNA:DNA duplex may also be used.
In certain specific embodiments, the method ofthe present invention further
comprises
treating the target nucleic acid as described above to limit the length of the
DNA primer
extension product to a certain desired length. Such length limitation is
typically carried out
through use of a "binding molecule" which hybridizes to or otherwise binds to
the RNA target
nucleic acid adjacent to or near the 5'-end of the desired target sequence.
See Step 1 of FIG.
lA. In certain embodiments, a binding molecule comprises a base region. The
base region
may be DNA, RNA, a DNA:RNA chimeric molecule, or an analog thereof. Binding
molecules comprising a base region may be modified in one or more ways, as
described
elsewhere herein. Suitable binding molecules include, but are not limited to,
a binding
molecule comprising a terminating oligonucleotide or a terminating protein
that binds RNA
and prevents primer extension past its binding region, or a binding molecule
comprising a
modifying molecule, for example, a modifying oligonucleotide such as a
"digestion"
oligonucleotide that directs hydrolysis of that portion of the RNA target
hybridized to the
digestion oligonucleotide, or a sequence-specific nuclease that cuts the RNA
target.
A terminating oligonucleotide ofthe present invention has a 5'-base region
sufficiently
complementary to the target nucleic acid at a region adjacent to, near to, or
overlapping with
-46-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
the 5'-end of the target sequence, to hybridize therewith. In certain
embodiments, a
terminating oligonucleotide is synthesized to include one or more modified
nucleotides. For
example, certain terminating oligonucleotides of the present invention
comprise one or more
2'-O-methyl ribonucleotides, or are synthesized entirely of2'-O-methyl
ribonucleotides. See,
e.g., Majlessi et al. (1998) Nuclefc Acids Res., 26, 2224-2229. A terminating
oligonucleotide
of the present invention typically also comprises a blocking moiety at its 3'-
end to prevent the
terminating oligonucleotide from functioning as a primer for a DNA polymerase.
In some
embodiments, the 5'-end of a terminating oligonucleotide of the present
invention overlaps
with and is complementary to at least about 2 nucleotides of the 5'-end of the
target sequence.
Typically, the 5'-end of a terminating oligonucleotide of the present
invention overlaps with
and is complementary to at least 3, 4, 5, 6, 7, or 8 nucleotides of the 5'-end
of the target
sequence, but no more than about 10 nucleotides of the 5'-end of the target
sequence. (As
used herein, the term "end" refers to a 5'- or 3'-region of an
oligonucleotide, nucleic acid or
nucleic acid region which includes, respectively, the 5'- or 3'-terminal base
of the
oligonucleotide, nucleic acid or nucleic acid region.) Suitable terminating
oligonucleotides
are described in more detail herein.
To the extent that a terminating oligonucleotide has a 5' base region which
overlaps
with the target sequence, it may be desirable to introduce one or more base
mismatches into
the 5'-end of the first region of a promoter oligonucleotide in order to
minimize or prevent
hybridization of the terminating oligonucleotide to the promoter
oligonucleotide, as the
formation of terminating oligonucleotide:promoter oligonucleotide hybrids may
negatively
affect the rate of an amplification reaction. While one base mismatch in the
region of overlap
generally should be sufficient, the exact number needed will depend upon
factors such as the
length and base composition of the overlapping region, as well as the
conditions of the
amplification reaction. Despite the possible benefits of a modified promoter
oligonucleotide,
it should be noted that mutations in the first region of the promoter
oligonucleotide could
render it a poorer template for amplification. Moreover, it is entirely
possible that in a given
amplification system the formation of terminating oligonucleotide:promoter
oligonucleotide
hybrids advantageously prevents or interferes with the formation of priming
oligonucleotide:promoter oligonucleotides hybrids with a 3'-end available for
primer
extension. See FIG. 5 (formation of primer-dependent side-products).
A modifying oligonucleotide provides a mechanism by which the 3'-terminus of
the
primer extension product is determined. A modifying oligonucleotide may
provide a motif
comprising one or more bases in the vicinity of the 5'-end of the RNA target
sequence which
facilitates termination of primer extension by means of a modifying enzyme,
e.g., a nuclease.
-47-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Alternatively, a modifying oligonucleotide might be tethered to a specific
modifying enzyme
or to a chemical which can then terminate primer extension.
One specific modifying oligonucleotide is a digestion oligonucleotide. A
digestion
oligonucleotide is comprised of DNA, preferably a stretch of at least about 6
deoxyribonucleotides. The digestion oligonucleotide hybridizes to the RNA
template and the
RNA of the RNA:DNA hybrid is digested by a selective RNAse as described
herein, e.g., by
an RNAse H activity.
The single-stranded DNA primer extension product, or "first" DNA primer
extension
product, which has either a defined 3'-end or an indeterminate 3'-end, is then
treated with a
promoter oligonucleotide which comprises a first region sufficiently
complementary to a 3'-
region of the DNA primer extension product to hybridize therewith, a second
region
comprising a promoter for an RNA polymerase, e.g., T7 polymerase, which is
situated 5' to
the first region, e.g., immediately 5' to or spaced from the first region, and
modified to prevent
the promoter oligonucleotide from functioning as a primer for a DNA polymerase
(e.g., the
promoter oligonucleotide includes a blocking moiety attached at its 3'-
terminus). See Step 5
of Figures IA and 113. Upon identifying a desired hybridizing "first region,"
suitable
promoter oligonucleotides can be constructed by one of ordinary skill in the
art using only
routine procedures. Those of ordinary skill in the art will readily understand
that a promoter
region has certain nucleotides which are required for recognition by a given
RNA polymerase.
In addition, certain nucleotide variations in a promoter sequence might
improve the
functioning of the promoter with a given enzyme, including the use of
insertion sequences.
Insertion sequences are positioned between the first and second regions of
promoter
oligonucleotides and function to increase amplification rates. The improved
amplification
rates may be attributable to several factors. First, because an insertion
sequence increases the
distance between the 3'-cnd and the promoter sequence of a promoter
oligonucleotide, it is
less likely that a polymerase, e.g., reverse transcriptase, bound at the 3'-
end of the promoter
oligonucleotide will interfere with binding ofthe RNA polymerase to the
promoter sequence,
thereby increasing the rate at which transcription can be initiated. Second,
the insertion
sequence selected may itself improve the transcription rate by functioning as
a better template
for transcription than the target sequence. Third, since the RNA polymerase
will initiate
transcription at the insertion sequence, the primer extension product
synthesized by the
priming oligonucleotide, using the RNA transcription product as a template,
will contain the
complement of the insertion sequence toward the 3'-end of the primer extension
product. By
providing a larger target binding region, i.e., one which includes the
complement of the
insertion sequence, the promoter oligonucleotide may bind to the primer
extension product
faster, thereby leading to the production of additional RNA transcription
products sooner.
-48-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Insertion sequences are preferably 5 to 20 nucleotides in length and should be
designed to
minimize intramolecular folding and intermolecular binding with other
oligonucleotides
present in the amplification reaction mixture. Programs which aid in
minimizing secondary
structure are well known in the art and include Michael Zucker's mfold
software for
predicting RNA and DNA secondary structure using nearest neighbor
thermodynamic rules.
The latest version of Michael Zucker's mfold software can be accessed on the
Web at
www.bioinfo.rpi.edu/applications/mfold using a hypertext transfer protocol
(http) in the URL.
Currently preferred insertion sequences include the nucleotide sequences of
SEQ ID Nos. I
and 2 in combination with the T7 RNA polymerase promoter sequence of SEQ ID
NO:3. See
Ikeda et at. (1992) J. Biol. Chem. 267, 2640-2649. Other useful insertion
sequences may be
identified using in vitro selection methods well known in the art.
Assaying promotcr oligonucleotides with variations in the promoter sequences
is
easily carried out by the skilled artisan using routine methods. Furthermore,
if it is desired to
utilize a different RNA polymerase, the promoter sequence in the promoter
oligonucleotide
is easily substituted by a different promoter. Substituting different promoter
sequences is well
within the understanding and capabilities of those of ordinary skill in the
art. It is important
to note that according to the present invention, promoter oligonucleotides
provided to the
amplification reaction mixture are modified to prevent the initiation of DNA
synthesis from
their 3'-termini, and preferably comprise a blocking moiety attached at their
3'-termini.
Furthermore, terminating oligonucleotides and capping oligonucleotides, and
even probes
used in the methods of the present invention also optionally comprise a
blocking moiety
attached at their 3'-termini.
Where a terminating oligonucleotide is used, the first region of the promoter
oligonucleotide is designed to hybridize with a desired 3'-end of the DNA
primer extension
product with substantial, but not necessarily exact, precision. Subsequently,
the second region
of the promoter oligonucleotide may act as a template, allowing the first DNA
primer
extension product to be further extended to add a base region complementary to
the second
region of the promoter oligonucleotide, i.e., the region comprising the
promoter sequence,
rendering the promoter double-stranded. See Steps 6 and 7 of FIG. 1 A. An RNA
polymerase
which recognizes the promoter binds to the promoter sequence, and initiates
transcription of
multiple RNA copies complementary to the DNA primer extension product, which
copies are
substantially identical to the target sequence. By "substantially identical"
it is meant that the
multiple RNA copies may have additional nucleotides either 5' or 3' relative
to the target
sequence, or may have fewer nucleotides either 5' or 3' relative to the target
sequence,
depending on, e.g., the boundaries of "the target sequence," the transcription
initiation point,
or whether the priming oligonuoleotide comprises additional nucleotides 5' of
the primer
-49-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
region (e.g., a linked "cap" as described herein). Where a target sequence is
DNA, the
sequence ofthe RNA copies is described herein as being "substantially
identical" to the target
sequence. It is to be understood, however, that an RNA sequence which has
uridine residues
in place of the thymidine residues of the DNA target sequence still has a
"substantially
identical" sequence, The RNA transcripts so produced may automatically recycle
in the
above system without further manipulation. Thus, this reaction is
autocatalytic. In those
embodiments where a binding molecule or other means for terminating a primer
extension
reaction is not used, the first region of the promoter oligonuclcotide is
designed to hybridize
with a selected region of the first DNA primer extension product which is
expected to be 5'
to the 3'-terminus of the first DNA primer extension product, but since the 3'-
terminus of the
first DNA primer extension product is indeterminate, the region where the
promoter
oligonucleotide hybridizes probably will not be at the actual3'-end of the
first DNA primer
extension product. According to this embodiment, it is generally the case that
at least the 3'-
terminal base of the first DNA primer extension product does not hybridize to
the promoter
oligonucleotide. See Step 5 of FIG. 1B. Thus, according to this embodiment the
first DNA
primer extension product will likely not be further extended to form a double-
stranded
promoter.
Surprisingly, the inventors discovered that the formation of a double-stranded
promoter sequence through extension of a template nucleic acid is not
necessary to permit
initiation of transcription of RNA complementary to the first DNA primer
extension product.
See Step 6 of FIG. 1B. The resulting "First" RNA products are substantially
identical to the
target sequence, having a 5'-end defined by the transcription initiation
point, and a 3'-end
defined by the 5'-end of the first DNA primer extension product. See Step 7 of
FIG. 1B. As
illustrated in FIG. 1 B, a sufficient number of first RNA products are
produced to
automatically recycle in the system without further manipulation. The priming
oligonucleotide hybridizes to the 3'-end of the first RNA products, and is
extended by a DNA
polymerase to form a second DNA primer extension product. Unlike the first DNA
primer
extension product formed without the use of a terminating oligonucleotide or
other binding
molecule, the second DNA primer extension product has a defined 3'-end which
is
complementary to the 5'-ends of the first RNA products. See Steps 8-10 of FIG.
1 B. The
second DNA primer extension product is separated (at least partially) from the
RNA template
using an enzyme which selectively degrades the RNA template. See Step 11 of
FIG. 1 B. The
single-stranded second DNA primer extension product is then treated with a
promoter
oligonucleotide as described above, and the second region of the promoter
oligonucleotide
acts as a template, allowing the second DNA primer extension product to be
further extended
to add a base region complementary to the second region ofthe promoter
oligonucleotide, i. e.,
-50-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
the region comprising the promoter sequence, rendering the promoter double-
stranded. See
Steps 12-14 of FIG. 1B. An RNA polymerase which recognizes the promoter binds
to the
promoter sequence, and initiates transcription of multiple "second" RNA
products
complementary to the second DNA primer extension product, and substantially
identical to
the target sequence. See Step 15 of FIG. 1B. The second RNA transcripts so
produced
automatically recycle in the above system without further manipulation. Thus,
this reaction
is autocatalytic. See Steps 7-15 of FIG. 1B.
In another embodiment, the present invention is drawn to a method of
synthesizing
multiple copies of a target sequence from a target nucleic acid comprising a
DNA target
sequence. This embodiment is diagramed in FIG. 1 C. The target nucleic acid
may be either
single-stranded, partially single-stranded, or double-stranded DNA. When the
DNA is
double-stranded, it is denatured, or partially denatured, prior to
amplification. The DNA
target nucleic acid need not have a defined 3'-end. The single-stranded,
partially single-
stranded, or denatured DNA target nucleic acid is treated with a promoter
oligonucleotide as
described above. The first region of the promoter oligonucleotide is designed
to hybridize
with a selected region ofthe target nucleic acid in the 3'-region ofthe
desired target sequence,
but since the 3'-end of the target nucleic acid need not be coterminal with
the 3'-end of the
target sequence, the region where the promoter oligonucleotide hybridizes will
likely not be
at or near the 3'-end of the target nucleic acid sequence. See Step 1 of FIG.
1 C. Thus, the
promoter region of the promoter oligonucleotide will likely remain single-
stranded.
As noted above, the inventors surprisingly discovered that it is not necessary
for the
single-stranded promoter sequence on the promoter oligonucleotide to form a
double-stranded
promoter through extension of a template nucleic acid in order for the
promoter sequence to
be recognized by the corresponding RNA polymerase and, in this case, initiate
transcription
of RNA complementary to the DNA target sequence. See Step 2 of FIG. 1 C. The
resulting
"first RNA products" have a 5'-end defined by the transcription initiation
point for the
promoter, however, the 3'-region will remain indeterminate. See Step 3 of FIG.
1 C. These
first RNA products are then treated with a priming oligonucleotide. The
priming
oligonucleotide hybridizes to a region of the first RNA products at a position
complementary
to a 5' region of the desired target sequence, and is extended by a DNA
polymerase to form
a DNA primer extension product. See Steps 4-6 of FIG. 1C. This DNA primer
extension
product has a 5'-end coinciding with the 5'-end of the priming
oligonucleotide, and a 3'-end
coinciding with the 5'-end of the first RNA products. See Step 6 of FIG. 1 C.
The DNA
primer extension product is separated (at least partially) from its RNA
template using an
enzyme which selectively degrades the RNA template, as described above. See
Step 7 of FIG.
1 C. The DNA primer extension product is then treated with the promoter
oligonucleotide, as
-51-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
described above, and the second region of the promoter oligonucleotide acts as
a template,
allowing the DNA primer extension product to be further extended to add a base
region
complementary to the second region of the promoter oligonucleotide, i.e., the
region
comprising the promoter, rendering the promoter double-stranded. See Steps 8-
10 of FIG. 1 C.
An RNA polymerase which recognizes the promoter binds to the promoter
sequence, and
initiates transcription of multiple RNA products complementary to the DNA
primer extension
product. See Step 11 of FIG, 1 C. The sequence of these "second RNA products"
is
substantially complementary to the desired target sequence. The RNA products
so produced
automatically recycle in the above system without further manipulation. Thus,
this reaction
is autocatalytic. See Steps 3-11 of FIG. 1 C.
In yet another embodiment, the present invention relates to a method of
synthesizing
multiple copies of a target sequence from a target nucleic acid comprising a
DNA target
sequence. One aspect of this embodiment is illustrated in FIG. 1D. Prior to
amplification,
the target nucleic acid in this embodiment may be single-stranded, partially
single-stranded,
or double-stranded. If a region of the target nucleic acid containing the
target sequence is
double-stranded, then the target nucleic acid may be denatured, or partially
denatured, prior
to initiating amplification to render the target sequence accessible to the
priming
oligonucleotide. See Step I of FIG. 1D. Denaturation may be effected by heat,
high pH,
and/or low ionic strength. (Useful chemical denaturants include imidazole,
dimethyI
sulfoxide, formamide, urea and/or sodium hydryoxide.) The accessible target
sequence is
treated with a priming oligonucleotide, as described infra, which hybridizes
to a 3'-end of the
target sequence. See Step 2 of FIG. 1 D. In the presence of nucleoside
triphosphates and
buffers, salts and cofactors, the 3'-end of the priming oligonucleotide is
extended by a DNA
polymerase in an extension reaction using the DNA target sequence as a
template to give a
first DNA primer extension product that is complementary to the template. See
Steps 3 and
4 of FIG. 1 D. In one aspect of this embodiment, a binding molecule is
included which limits
the length of the first DNA primer extension product by hybridizing or
otherwise binding to
the target nucleic acid adjacent to or near the 5'-end of the target sequence.
The binding
molecule may be any of the binding molecules described herein that is
appropriate for a target
nucleic acid containing a DNA target sequence, but is preferably a terminating
oligonucleotide. See Steps 2 to 4 of FIG. 1 D. One advantage of a terminating
oligonucleotide
is that it does not require the use of a restriction endonuclease to create a
defined 3'-end on
the first DNA primer extension product.
To separate the first DNA primer extension product from the template, the
target
nucleic acid can be treated with a displacer oligonucleotide in another aspect
of this
embodiment. See Step 5 of FIG. 1D. The displacer oligonucleotide has a priming
function
-52-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
and is designed to hybridize to the target nucleic acid upstream from the
priming
oligonucleotide (referred to as the "forward priming oligonucleotide" in this
embodiment),
By "upstream" is meant that a 3'-cnd of the displacer oligonucleotide
hybridizes to the target
nucleic acid upstream from a 3'-end of the forward priming oligonucleotide.
Thus, the
displacer oligonucleotide and the forward priming oligonucleotide may
hybridize to
overlapping or distinct regions of the target nucleic acid. In preferred
embodiments, the 3'-
terminus of the displacer oligonucleotide is adjacent to or spaced up to 5 to
35 bases from the
5'-terminus of the forward priming oligonucleotide relative to the target
nucleic acid (i.e., the
target nucleic acid has up to 5 to 35, contiguous unbound nucleotides situated
between the 3'-
terminal base of the displacer oligonucleotide and the 5'-terminal base of the
priming
oligonucleotide when both oligonucleotides are hybridized to the target
nucleic acid). The
displacer oligonucleotide is generally from 10 to 50 nucleotides in length and
may include one
or more modifications at the 5'-end which improve the binding properties
(e.g., hybridization
or base stacking) of the displacer oligonucleotide to the target nucleic acid,
provided that the
modifications do not substantially interfere with the priming function of the
displacer
oligonucleotide. The displacer oligonucleotide and the forward priming
oligonucleotide are
designed to hybridize to the target nucleic acid under the same conditions.
The target nucleic
acid is preferably treated with the displacer oligonucleotide after the
forward priming
oligonucleotide has had sufficient time to hybridize to the target nucleic
acid. Alternatively,
the target nucleic acid is treated with both the displacer oligonucleotide and
the forward
priming oligonucleotide before exposing the mixture to a polymerase suitable
for extending
the 3'-ends of the displacer oligonucleotide and the forward priming
oligonucleotide. In the
presence of the DNA polymerase, the 3'-end of the displacer oligonuclaotide is
extended in
a template-dependent manner to form a second DNA primer extension product
which
displaces the first DNA primer extension product from the target nucleic acid,
thereby making
it available for hybridization to a promoter oligonucleotide. See Steps 6 and
7 of FIG. 1 D. In
an alternative approach, conditions could be established whereby the promoter
oligonucleotide gains access the first DNA primer extension product through
stand invasion
facilitated by, for example, DNA breathing (e.g., AT rich regions), low salt
conditions, and/or
the use of DMSO and/or osmolytes, such as betaine. The promoter
oligonucleotide of this
embodiment is the same as that described above and, likewise, is modified to
prevent the
promoter oligonucleotide from functioning as a priming oligonucleotide for a
DNA
polymerase (e.g., the promoter oligonucteotide includes a blocking moiety at
its 3'-terminus).
Where a terminating oligonucleotide or other binding molecule capable of
determining
the 3'-end of the first DNA primer extension product is used, a first region
of the promoter
oligonucleotide is designed to hybridize to the 3'-end of the first DNA primer
extension
-53-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
product with sufficient precision that a second region of the promoter
oligonucleotide acts as
a template, allowing the first DNA primer extension product to be further
extended to add a
base region complementary to the second region of the promoter
oligonucleotide. See Steps
8-10 of FIG. 1 D. This extension reaction renders a region containing the
promoter sequence
double-stranded. An RNA polymerase which recognizes the promoter then binds to
the
promoter sequence and initiates transcription of multiple RNA copies
complementary to the
first DNA primer extcnsion product, where the RNA copies are substantially
identical to the
target sequence, as this term is defined hereinabove. See Steps 11 and 12 of
FIG. 1D. The
RNA transcripts so produced may automatically recycle in the method of this
embodiment
and, thus, the reaction is autocatalytic. See Steps 9-17 of FIG.1D. In the
subsequent rounds
of amplification, a third DNA primer extension product comprising the promoter
oligonucleotide and complementary to the RNA transcript is formed, and this
DNA primer
extension product is then separated from the RNA transcript (at least
partially) using an
enzyme which selectively degrades the RNA transcript (e.g., an enzyme having
an RNase H
activity, such as a reverse transcriptase derived from MMLV or AMV). See Steps
13-16 of
FIG. 1 D.
In those aspects of this embodiment where a binding molecule or other means
for
terminating a primer extension reaction are not used, the first region of the
promoter
oligonucleotide is designed to hybridize to a selected region ofthe first DNA
primer extension
product which is expected to be 5' to the 3'-terminus of the first DNA primer
extension
product. Since the 3'-terminus of the first DNA primer extension product is
indeterminate,
the region where the promoter oligonucleotide hybridizes probably will not be
at the actual
3'-end of the first DNA primer extension product. According to this
embodiment, it is
generally the case that at least the 3'-terminal base of the first DNA primer
extension product
does not hybridize to the promoter oligonucleotide. Thus, according to this
embodiment the
first DNA primer extension product will likely not be further extended to form
a double-
stranded promoter. As discussed above, the inventors surprisingly discovered
that the
formation of a double-stranded promoter sequence through extension of a
template nucleic
acid is not necessary to permit initiation of transcription of RNA
complementary to the first
DNA primer extension product. In subsequent rounds of amplification, however,
the RNA
transcripts will include a defined 3'-end and DNA primer extension products
complementary
to the RNA transcripts will hybridize to the promoter oligonucleotide and be
extended to add
a sequence complementary to a region of the promoter oligonucleotide
containing the
promoter sequence.
The inventors also discovered that the rate of amplification could be enhanced
by
providing an extender oligonuclcotide to a reaction mixture, as diagramed in
Figures 2A-2D.
54
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
(Step 5 of Figures 2A and 213, Step 4 of FIG. 2C, and Step 8 of FIG. 2D.) An
extender
oligonucleotide is generally 10 to 50 nucleotides in length and hybridizes to
a DNA template
(i. e., the DNA target sequence or any ofthe DNA primer extension products
described herein)
downstream from a promoter oligonucleotide. When included, the 5'-terminal
base of the
extender oligonucleotide is positioned near or adjacent to the 3'-terminal
base ofthe promoter
oligonucleotide when both oligonucleotides are hybridized to a DNA template.
(By "adjacent
to" is meant that the DNA template has no unbound bases situated between the
3'-terminal
base of the promoter oligonucleotide and the 5'-terminal base of the extender
oligonucleotide
when both oligonucleotides are hybridized to the DNA template.) Most
preferably, the
extender oligonucleotide hybridizes to a DNA template such that the 5'-
terminal base of the
extender oligonucleotide is spaced no more than tbree nucleotides from the 3'-
terminal base
of the promoter oligonucleotide relative to the DNA template (i. e., the DNA
template has a
maximum of three, contiguous unbound nucleotides situated between the 3'-
terminal base of
the promoter oligonucleotide and the 5'-terminal base of the extender
oligonucleotide when
both oligonucleotides are hybridized to the DNA template). To prevent the
extender
oligonucleotide from functioning as a priming oligonucleotide in a primer
extension reaction,
the extender oligonucleotide preferably includes a 3'-terminal blocking
moiety. While not
wishing to be bound by theory, it is believed that the phosphate at the 3'-end
of the extender
oligonucleotide functions to draw the DNA-dependent DNA polymerase (e.g.,
reverse
transcriptase) farther away from the promoter sequence of the promoter
oligonucleotide,
thereby minimizing interference with the binding and progress of the RNA
polymerase in
transcription. It is also possible that the extender oligonucleotide
facilitates faster trancription
reactions by limiting secondary structure within the target sequence.
In one aspect, the present invention relates to minimizing side-product
formation in
nucleic acid amplification reactions. One type of side-product is referred to
herein as an
"oligonucleotide dimer." This side-product occurs when a priming
oligonucleotide base-pairs
non-specifically with another nucleic acid in the amplification reaction,
e.g., the promoter
oligonucleotide. Since the priming oligonucleotide can be extended via a DNA
polymerase,
a double-stranded form of the promoter oligonucleotide can result, which can
be transcribed
into non-specific, amplifiable side-products. To prevent priming
oligonucleotides from
participating in the formation of oligonucleotide dimers, one option is to add
a short
complementary nucleotide "cap" to the 3'-end ofthe priming oligonucleotide.
See Figures 6A
and 6B. A cap is thought to reduce non-specific hybridization between the
priming
oligonucleotide and other nucleic acids in the reaction, e.g., the promoter
oligonucleotide,
thereby eliminating or substantially reducing the production
of"oligonucleotide-dimer" side-
products as compared to amplification reactions carried out under identical
conditions, but
-55-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
without the use of a cap, As used herein, a cap comprises a base region
complementary to a
region at the 3'-end of the priming oligonucleotide which is preferably pre-
hybridized to the
priming oligonucleotide prior to its introduction into an amplification
reaction mixture. A
suitable cap length will vary based on base content, stringency conditions,
etc., but will
typically hybridize to up to 3, 6, 9,12,15,18, or 20 contiguous or non-
contiguous nucleotides
at the'3-end of the priming oligonucleotide. Suitable caps preferably range
from 5 to 10 bases
in length. The length of the complementary cap region is dependent on several
variables, for
example, the melting temperature of the double-stranded hybrid formed with the
3'-end of the
priming oligonucleotide. In general, an efficient cap will specifically
hybridize to a region
lo at the 3'-end of the priming oligonucleotide more strongly than any non-
specific reactions
with other oligonucleotides present in the amplification reaction, but will be
readily displaced
in favor of specific hybridization of the priming oligonucleotide with the
desired template.
Exemplary caps comprise, or alternately consist essentially of, or alternately
consist of an
oligonucleotide from 5 to 7 bases in length which hybridizes to a region at
the 3'-end of the
priming oligonucleotide, such that the 5'-terminal base of the cap hybridizes
to the 3'-terminal
base of the priming oligonucleotide. Typically, a cap will hybridize to no
more than 8, 9, or
10 nucleotides of a region at the 3'-end of the priming oligonucleotide.
A cap may take the form of a capping oligonucleotide or a base region attached
to the
5'-end of the priming oligonucleotide, either directly or through a linker.
See Figures 6A and
6B. A capping oligonucleotide is synthesized as a separate oligonucleotide
from the priming
oligonucleotide, and normally comprises a blocking moiety at its 3'-terminus
to prevent
primer extension by a DNA polymerase, as illustrated in FIG. 6A.
Alternatively, the cap
comprises a base region complementary to a region at the 3'-end of the priming
oligonucleotide, which is connected to the 5'-end of the priming
oligonucleotide via a linking
region comprising, alternately consisting essentially of, or alternately
consisting of 3, 4, 5, 6,
7, 8, 9, or 10 nucleotides. See FIG. 6B. Typically, the nucleotides in the
linking region are
abasic nucleotides. By "abasic nucleotide" is meant a nucleotide comprising a
phosphate
group and a sugar group, but not a base group. Constructing a priming
oligonucleotide with
a cap attached to its 5'-end simplifies oligonucleotide synthesis by requiring
the synthesis of
only a single oligonucleotide comprising both the priming portion and the cap.
The caps described herein may also be used with other oligonucleotides
provided to
a reaction mixture, including displacer and extender oligonucleotides, which
have free 3'-
hydroxyls that are capable of participating in an extension reaction in the
presence of a DNA
polymerase. The importance of caps increases with the number of
oligonucleotides having
free 3'-hydroxyls.
-56-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
In any of the embodiments described above, once a desired region for the
target
sequence is identified, that region can be analyzed to determine where
selective RNAse
degradation will optimally cause cuts or removal of sections of RNA from the
RNA:DNA
duplex. Analyses can be conducted to determine the effect of the RNAse
degradation of the
target sequence by RNAse H activity present in AMV reverse transcriptase or
MMLV reverse
transcriptase, by an exogenously added selective enzyme with an RNAse
activity, e.g., E. coli
RNAse H, or selective enzymes with an RNAse activity from other sources, and
by
combinations thereof. Following such analyses, the priming oligonucleotide can
be selected
for so that it will hybridize to a section of RNA which is substantially
nondegraded by the
selective RNAse present in the reaction mixture, because substantial
degradation at the
binding site for the priming oligonucleotide could inhibit initiation of DNA
synthesis and
prevent optimal extension of the primer. In other words, a priming
oligonucleotide is typically
selected to hybridize to a region of an RNA target nucleic acid or the
complement of a DNA
target nucleic acid, located so that when the RNA is subjected to selective
RNAse
degradation, there is no substantial degradation which would prevent formation
of the primer
extension product.
Conversely, the site for hybridization of the promoter oligonucleotide may be
chosen
so that sufficient degradation of the RNA strand occurs to permit efficient
hybridization of
the promoter oligonucleotide to the DNA strand. Typically, only portions of
RNA are
removed from the RNA:DNA duplex through selective RNAse degradation and, thus,
some
parts of the RNA strand will remain in the duplex. Selective RNAse degradation
on the RNA
strand of an RNA:DNA hybrid results in the dissociation of small pieces of RNA
from the
hybrid. Positions at which RNA is selectively degraded may be determined
through standard
hybridization analyses. Thus, a promoter oligonucleotide may be selected which
will more
efficiently bind to the DNA after selective RNAse degradation, i. e., will
bind at areas where
RNA fragments are selectively removed.
Figures lA-1D and 2A-2D do not show the RNA portions which may remain after
selective RNAse degradation. It is to be understood, however, that even though
Figures 1 A-
1D and 2A-2D show complete removal of RNA from the DNA:RNA duplex, under
certain
conditions only partial removal actually occurs. Indeed, amplification as
depicted in Figures
lA-1D and 2A-2D may be inhibited if a substantial portion of the RNA strand of
an
RNA:DNA hybrid remains undegraded, thus preventing hybridization of the
promoter
oligonucleotide and/or the optional extender ofigonucleotide. However, based
upon principles
and methods disclosed in this application, as well as those disclosed by
Kacian et al, U.S.
Patent No. 5,339,491, routine modifications can be made by those skilled in
the art according
-57-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
to the teachings of this invention to provide an effective and efficient
procedure for
amplification of RNA.
In summary, the present invention provides methods for autocatalytically
synthesizing
multiple copies of a target sequence from a target nucleic acid without
repetitive manipulation
ofreaction conditions such as temperature, ionic strength and pH, which
comprises combining
into a reaction mixture a target nucleic acid which comprises either an RNA
target sequence,
or a single-stranded or partially single-stranded DNA target sequence or a
double-stranded
DNA sequence which has been rendered at least partially single-stranded; a
priming
oligonucleotide, a promoter oligonucleotide, and, optionally, a displacer
oligonucleotide, an
extender oligonucleotide and/or a binding molecule or other means for
terminating a primer
extension reaction, all as described above; a reverse transcriptase or an RNA-
dependent DNA
polymerase and a DNA-dependent DNA polymerase; an enzyme activity which
selectively
degrades the RNA strand of an RNA:DNA complex (such as an RNAse H activity);
and an
RNA polymerase which recognizes the promoter sequence in the promoter
oligonucleotide.
The reaction mixture also includes the necessary building blocks for nucleic
acid
amplification, e.g., nucleoside triphosphatcs, buffers, salts, and stabilizing
agents. The
components of the reaction mixture may be combined stepwise or at once. The
reaction
mixture is incubated under conditions whereby an oligonucleotide:target
nucleic acid is
formed, and DNA priming and nucleic acid synthesis can occur for a period of
time sufficient
to allow multiple copies ofthe target sequence or its complement to be
produced. The reaction
advantageously takes place under conditions suitable for maintaining the
stability of reaction
components, such as the enzymes, and without requiring modification or
manipulation of
reaction conditions during the course of the amplification reaction.
Accordingly, the reaction
of some embodiments may take place under conditions that are substantially
isothermal and
include substantially constant ionic strength and pH.
As such, the amplification methods of the present invention do not require
repeated
denaturation steps to separate the RNA:DNA complexes produced upon extension
of the
priming oligonucleotide. A denaturation step would require manipulation of
reaction
conditions, such as by substantially increasing the temperature of the
reaction mixture
(generally from ambient temperature to a temperature between about 80 C and
about 105 C),
reducing its ionic strength (generally by l OX or more) or changing pH
(usually increasing pH
to 10 or greater). Such manipulations of the reaction conditions often
deleteriously affect
enzyme activities, requiring addition of additional enzyme and also
necessitate further
manipulations of the reaction mixture to return itto conditions suitable for
further nucleic acid
synthesis. In those embodiments where the target nucleic acid is double-
stranded DNA, an
initial denaturation step is often required. Denaturation may be carried out
by altering
-58-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
temperature, ionic strength, and/or pH as described above, prior to adding the
remaining
components ofthe reaction mixture. Once the remaining components are added, no
additional
manipulations of the reaction mixture are needed.
The methods of the present invention are designed to decrease, diminish, or
substantially eliminate side-product formation in the amplification reactions.
For example,
side-products are decreased, diminished, or substantially eliminated through
the utilization
of promoter oligonucleotides modified to prevent primer extension by a DNA
polymerase,
generally by including a blocking moiety at the 3'-termini of the promoter
oligonucleotides.
Further embodiments decrease, diminish, or substantially eliminate side-
products through the
use of a cap which hybridizes to a region at the 3'-end of the priming
oligonucleotide, thereby
preventing oligonucleotide dimer formation. According to the present
invention, most, e.g.,
at least about 90%, of the oligonucleotides present in the amplification
reaction which
comprise a promoter further comprise a 3'-blocking moiety to prevent primer
extension. In
a specific embodiment, any oligonucleotide used in the amplification reaction
which
comprises a promoter, not just the promoter oligonucleotide, further comprises
a 3'-blocking
moiety. In certain preferred embodiments, most, e.g., at least about 80%, 90%,
95%, 96%,
97%, 98% or 99%, or all oligonucleotides required for the amplification
reaction, other than
the priming oligonucleotides (including displacer oligonucleotides, if used),
comprise a 3'-
blocking moiety. Thus, in certain embodiments, most if not all DNA polymerase
activity in
the amplification reactions is limited to the formation of DNA primer
extension products
which comprise the priming oligonucleotides.
Promoters or promoter sequences suitable for incorporation in promoter
oligonucleotides used in the methods of the present invention are nucleic acid
sequences
(either naturally occurring, produced synthetically or a product of a
restriction digest) that are
specifically recognized by an RNA polymerase that recognizes and binds to that
sequence and
initiates the process of transcription, whereby RNA transcripts are produced.
Typical, known
and useful promoters include those which are recognized by certain
bacteriophage
polymerases, such as those from bacteriophage T3, 77, and SP6, and a promoter
from E. coli.
The sequence may optionally include nucleotide bases extending beyond the
actual
recognition site for the RNA polymerase which may impart added stability or
susceptibility
to degradation processes or increased transcription efficiency. Promoter
sequences for which
there is a known and available polymerase that is capable of recognizing the
initiation
sequence are particularly suitable to be employed.
Suitable DNA polymerases include reverse transcriptases. Particularly suitable
DNA
polymerases include AMV reverse transcriptase and MMLV reverse transcriptase.
Some of
the reverse transcriptases suitable for use in the methods of the present
invention, such as
-59-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
AMV and MMLV reverse transcriptases, have an RNAse H activity. Indeed,
according to
certain embodiments of the present invention, the only selective RNAse
activity in the
amplification reaction is provided by the reverse transcriptase -- no
additional selective
RNAse is added. However, in some situations it may also be useful to add an
exogenous
selective RNAse, such as E. coli RNAse H. Although the addition of an
exogenous selective
RNAse is not required, under certain conditions, the RNAse H activity present
in, e.g., AMV
reverse transcriptase may be inhibited or inactivated by other components
present in the
reaction mixture. In such situations, addition of an exogenous selective RNAse
may be
desirable. For example, where relatively large amounts of heterologous DNA are
present in
the reaction mixture, the native RNAse H activity of the AMV reverse
transcriptase may be
somewhat inhibited and thus the number of copies of the target sequence
produced
accordingly reduced. In situations where the target nucleic acid comprises
only a small
portion of the nucleic acid present (e.g., where the sample contains
significant amounts of
heterologous DNA and/or RNA), it is particularly useful to add an exogenous
selective
RNAse. See, e.g., Kacian et al, U.S.1'atent No. 5,399,491, the contents of
which are hereby
incorporated by reference herein (see Example 8).
RNA amplification products produced by the methods described above may serve
as
templates to produce additional amplification products related to the target
sequence through
the above-described mechanisms. The system is autocatalytic and amplification
by the
methods of the present invention occurs without the need for repeatedly
modifying or
changing reaction conditions such as temperature, pH, ionic strength and the
like. These
methods do not require an expensive thermal cycling apparatus, nor do they
require several
additions of enzymes or other reagents during the course of an amplification
reaction.
The methods of the present invention are useful in assays for detecting and/or
quantitating specific nucleic acid target sequences in clinical,
environmental, forensic, and
similar samples or to produce large numbers of RNA amplification products from
a specific
target sequence for a variety of uses. For example, the present invention is
useful to screen
clinical samples (e.g., blood, urine, feces, saliva, semen, or spinal fluid),
food, water,
laboratory and/or industrial samples for the presence of specific nucleic
acids. The present
invention can be used to detect the presence of, for example, viruses,
bacteria, fungi, or
parasites. The present invention is also useful for the detection of human,
animal, or plant
nucleic acids for genetic screening, or in criminal investigations,
archeological or sociological
studies.
In a typical assay, a sample containing a target nucleic acid to be amplified
is mixed
with a buffer concentrate containing the buffer, salts, magnesium,
triphosphates,
oligonucleotides, e.g., apriming oligonucleotide, apromoter oligonucleotide,
and, optionally,
b0
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
a displacer oligonucleotide, an extender oligonucleotide and/or a binding
molecule, e.g., a
terminating oligonucleotide or a digestion oligonucleotide, and/or a capping
oligonucleotide,
and other reagents. The reaction may optionally be incubated at a temperature,
e.g., 60-100 C,
for a period of time sufficient to denature any secondary structures in the
target nuclcic acid
or to denature a double-stranded DNA target nucleic acid. After cooling,
reverse transcriptase,
an RNA polymerase, and, if desired, a separate selective RNAse, e.g., RNAse H,
are added
and the reaction is incubated for a specified amount of time, e.g., from about
10 minutes to
about 120 minutes, at an optimal temperature, e.g., from about 20 C to about
55 C, or more,
depending on the reagents and other reaction conditions. The displacer
oligonucleotide, if
used, may be provided with the enzymes to permit sufficient time for the
priming
oligonucleotide to hybridize to the target nucleic acid before initiating
amplification.
The amplification product can be detected by hybridization with an optionally
labeled
detection probe and measurement of the resulting hybrids can be performed in
any
conventional manner. Design criteria in selecting probes for detecting
particular target
sequences are well known in the art and are described in, for example, Hogan
et al., "Methods
for Making Oligonucleotide Probes for the Detection and/or Quantitation of Non-
Viral
Organisms," U.S. Patent No. 6,150,517, the contents of which are hereby
incorporated by
reference herein. Hogan teaches that probes should be designed to maximize
homology for
the target sequence(s) and minimize homology for possible non-target
sequences. To
minimize stability with non-target sequences, Hogan instructs that guanine and
cytosine rich
regions should be avoided, that the probe should span as many destabilizing
mismatches as
possible, and that the length of perfect complementarity to a non-target
sequence should be
minimized. Contrariwise, stability of the probe with the target sequence(s)
should be
maximized, adenine and thymine rich regions should be avoided, probe:target
hybrids are
preferably terminated with guanine and cytosine base pairs, extensive self-
complementarity
is generally to be avoided, and the melting temperature of probeaarget hybrids
should be
about 2-10 C higher than the assay temperature.
In particular, the amplification product can be assayed by the Hybridization
Protection
Assay ("HPA"), which involves hybridizing a chemiluminescent oligonucleotide
probe to the
target sequence, e.g., an acridinium ester-labeled ("AE") probe, selectively
hydrolyzing the
chemiluminescent label present on unhybridized probe, and measuring the
chemiluminescence
produced from the remaining probe in a luminometer. See, e.g., Arnold et al.,
"Homogenous
Protection Assay,"U.S. PatentNo. 5,283,174 and NORMAN C. NELSON ETAL.,
NONISOTOPIC
PRoBING, BLOTTING, AND SEQUENCING, ch. 17 (Larry J. Kricka ed., 2d ed. 1995),
each of
which is hereby incorporated by reference in its entirety. Particular methods
of carrying out
HPA using AE probes are disclosed in the Examples section hereinbelow.
-61-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
In further embodiments, the present invention provides quantitative evaluation
of the
amplification process in real-time by methods described herein. Evaluation of
an
amplification process in "real-time" generally involves making periodic
determinations ofthe
amount of signal associated with probe:amplicon complexes in the reaction
mixture during
the amplification reaction, and the determined values are used to calculate
the amount of
target sequence initially present in the sample. There are a variety of
methods for determining
the amount of initial target sequence present in a sample based on real-time
amplification.
These include those disclosed by Light et al., "Method for Determining the
Amount of an
Analyte in a Sample," U.S. Patent Application Publication No. US 2006-0276972
(paragraphs
505 to 549); Lee et al., "Methods for Quantitative Analysis of a Nucleic Acid
Amplification
Reaction," U.S. Patent Application Publication No. US 2006-0286587; Carrick et
al.,
"Method and Algorithm for Quantitating Polynucleotides," U.S. Patent
Application
Publication No. US 2006-0292619; Wittwer et al., "Method for Quantification of
an Analyte,"
U.S. Patent No. 6,303,305; and Yokoyama et al., "Method for Assaying Nucleic
Acid," U.S.
Patent No. 6,541,205. (Each of these references or the indicated portion is
hereby
incorporated by reference herein.) Another method for determining the quantity
of target
sequence initially present in a sample, but which is not based on a real-time
amplification, is
disclosed by Ryder et al., "Method for Determining Pre-Amplification Levels of
a Nucleic
Acid Target Sequence from Post-Amplification Levels of Product," U.S. Patent
No.
5,710,029, the contents of which are hereby incorporated by reference herein.
The present
invention is particularly suited to real-time evaluation, because the
production of side-
products is decreased, diminished, or substantially eliminated.
Amplification products may be detected in real-time through the use of various
self-
hybridizing probes, most of which have a stem-loop structure. Such self-
hybridizing probes
are labeled so that they emit differently detectable signals, depending on
whether the probes
arc in a self-hybridized state or an altered state through hybridization to a
target sequence.
By way of example, "molecular torches" are a type of self-hybridizing probe
which includes
distinct regions of self-complementarity (referred to as "the target binding
domain" and "the
target closing domain") which are connected by ajoining region (e.g., non-
nucleotide linker)
and which hybridize to each other under predetermined hybridization assay
conditions. In a
preferred embodiment, molecular torches contain single-stranded base regions
in the target
binding domains that are from 1 to about 10 bases in length and are accessible
for
hybridization to a target sequence present in an amplification product under
strand
displacement conditions. The single-stranded region may be, for example, a
terminal region
or an internal region, such as a loop region. Alternatively, the strand
displacement conditions
may cause "breathing" in a double-stranded terminal region of the molecular
torch, thereby
-62-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
resulting in a transient single-stranded region of the terminal region which
is accessible for
hybridization to the target sequence. Under strand displacement conditions,
hybridization of
the two complementary regions (which may be fully or partially complementary)
of the
molecular torch is favored, except in the presence of the target sequence,
which will bind to
the single-stranded region present in the target binding domain and displace
all or a portion
of the target closing domain. The target binding domain and the target closing
domain of a
molecular torch include a detectable label or a pair of interacting labels
(e.g.,
luminescentlquencher) positioned so that a different signal is produced when
the molecular
torch is self-hybridized than when the molecular torch is hybridized to the
target sequence,
thereby permitting detection of probe:target duplexes in a test sample in the
presence of
unhybridized molecular torches. Molecular torches and a variety of types of
interacting label
pairs are disclosed by Becker et al., "Molecular Torches," U.S. Patent No,
6,534,274, the
contents of which are hereby incorporated by reference herein.
Aiiother example of a detection probe exhibiting self-complementarity is
a"molecular
beacon." Molecular beacons include nucleic acid molecules having a target
complement
sequence, an affinity pair (or nucleic acid arms) holding the probe in a
closed conformation
in the absence of a target sequence present in an amplification product, and a
label pair that
interacts when the probe is in a closed conformation. Hybridization of the
target sequence
and the target complement sequence separates the members of the affinity pair,
thereby
shifting the probe to an open conformation. The shift to the open conformation
is detectable
due to reduced interaction of the label pair, which may be, for example, a
fluorophore and a
quencher (e.g., DABCYL and EDANS). Molecular beacons are disclosed by Tyagi et
al.,
"Detectably Labeled Dual Confirmation Oiigonucleotide Probes, Assays and
Kits," U.S.
Patent No. 5,925,517, and Tyagi et al., "Nucleic Acid Detection Probes Having
Non-FRET
Fluorescence Quenching and Kits and Assays Including Such Probes," U.S. Patent
No.
6,150,097, each of which is hereby incorporated by reference herein in its
entirety.
Other self-hybridizing probes for use in the present invention are well known
to those
of ordinary skill in the art. By way ofexample, probe binding pairs having
interacting labels,
such as those disclosed by Morrison, "Competitive Homogenous Assay," U.S.
Patent No.
5,928,862 (the contents of which are hereby incorporated by reference herein),
might be
adapted for use in the present invention. Probe systems used to detect single
nuclcotide
polymorphisms (snps) might also be utilized in the present invention.
Additional detection
systems include "molecular switches," as disclosed by Arnold et al.,
"Oligonucleotides
Comprising a Molecular Switch," U. S. Patent Application Publication No. US
2005-0042638,
the contents of which are hereby incorporated by reference herein. And other
probes, such as
those comprising intercalating dyes and/or fluorochromes, might be useful for
detection of
-63-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
amplification products in the present invention, See, e.g., Ishiguro et ad.,
"Method of
Detecting Specific Nucleic Acid Sequences," U.S. Patent No. 5,814,447, the
contents of
which are hereby incorporated by reference herein.
In those methods of the present invention where the initial target sequence
and the
RNA transcription product share the same sense, it may be desirable to
initiate amplification
before adding probe for real-time detec#ion. Adding probe prior to initiating
an amplification
reaction may slow the rate of amplification since probe which binds to the
initial target
sequence has to be displaced or otherwise remove during the primer extension
step to
complete a primer extension product having the complement of the target
sequence. The
initiation of amplification is judged by the addition of amplification enzymes
(e.g., a reverse
transcriptase and an RNA polymerase).
In addition to the methods described herein, the present invention is drawn to
kits
comprising one or more of the reagents required for carrying out the methods
of the present
invention, Kits comprising various components used in carrying out the present
invention
may be configured for use in any procedure requiring amplification of nucleic
acid target
molecules, and such kits can be customized for various different end-users.
Suitable kits may
be prepared, for example, for blood screening, disease diagnosis, infection
control,
environmental analysis, criminal investigations or other forensic analyses,
genetic analyses,
archeological or sociological analyses, or for general laboratory use. Kits of
the present
invention provide one or more of the components necessary to carry out nucleic
acid
amplifications according to the invention. Kits may include reagents suitable
for amplifying
nucleic acids from one particular target or may include reagents suitable for
amplifying
multiple targets. Kits of the present invention may further provide reagents
for real-time
detection of one or more nucleic acid targets in a single sample, for example,
one or more
self-hybridizing probes as described above. Kits may comprise a carrier that
may be
compartmentalized to receive in close confinement one or more containers such
as vials, test
tubes, wells, and the like. Preferably at least one of such containers
contains one or more
components or a mixture of components needed to perform the amplification
methods of the
present invention.
A kit according to the present invention can include, for example, in one or
more
containers, a priming oligonucleotide, a promoter oligonucleotide modified to
prevent primer
extension by a DNA polymerase (e.g., modified to include a 3'-blocking
moiety), a binding
molecule or other means for terminating a primer extension reaction, and,
optionally, a
displacer oligonucleotide, an extender oligonucleotide and/or a capping
oligonucleotide as
described herein, If real-time detection is used, the one or more containers
may include one
or more reagents for real-time detection of at least one nucleic acid target
sequence in a single
-64-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
sample, for example, one or more self-hybridizing probes as described above.
Another
container may contain an enzyme reagent, for example a mixture of a reverse
transcriptase
(either with or without RNAse H activity), an RNA polymerase, and optionally
an additional
selective RNAse enzyme. (If included, the displacer oligonucleotide may be
provided in the
container containing the enzyme reagent.) These enzymes may be provided in
concentrated
form or at working concentration, usually in a form which promotcs enzyme
stability. The
enzyme reagent may also be provided in a lyophilized form. See Shen et al.,
"Stabilized
Enzyme Compositions for Nucleic Acid Amplification," U.S. Patent No.
5,834,254, the
contents of which are hereby incorporated by reference herein. Another one or
more
containers may contain an amplification reagent in concentrated form, e.g.,
IOX, 50X, or
100X, or at working concentration. An amplification reagent will contain one
or more of the
components necessary to run the amplification reaction, e.g., a buffer, MgC12,
KCI, dNTPs,
rNTPs, EDTA, stabilizing agents, etc. Certain of the components, e.g., MgCIZ
and rNTPs,
may be provided separately from the remaining components, allowing the end
user to titrate
these reagents to achieve more optimized amplification reactions. Another one
or more
containers may include reagents for detection of amplification products,
including one or
more optionally labeled detection probes. In some embodiments, a kit ofthe
present invention
will also include one or more containers containing one or more positive and
negative control
target nucleic acids which can be utilized in amplification experiments in
order to validate the
test amplifications carried out by the end user. In some instances, one or
more of the reagents
listed above may be combined with an internal control. It is also possible to
combine one or
more of these reagents in a single tube or other containers.
Supports suitable for use with the invention (e.g., test tubes, multi-tube
units, multi-
well plates, cuvettes, flexible containers, microfluidic devices, including
analytical cards or
discs for use in centrifugal analyzers, etc.) may also be supplied with
reagents of the
invention. Finally, a kit of the present invention may include one or more
instruction manuals
provided in written or electronic form, including CD-ROMs, DVDs and video
tapes. Kits of
the invention may contain virtually any combination of the components set out
above or
described elsewhere herein. As one skilled in the art would recognize, the
components
supplied with kits of the invention will vary with the intended use for the
kits, and the
intended end user. Thus, kits may be specifically designed to perform various
functions set
out in this application and the components of such kits will vary accordingly.
The present invention is further drawn to various oligonucleotides, including
the
priming oligonucleotides, promoter oligonucleotides, terminating
oligonucleotides, displacer
oligonucleotides, extender oligonucleotides, capping oligonucleotides and
detection probes
described herein. It is to be understood that the oligonucleotides of the
present invention may
-65-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
be DNA, RNA, DNA:RNA chimerics and analogs thereof, and, in any case, the
present
invention includes RNA equivalents of DNA oligonucleotides and DNA equivalents
of RNA
oligonucleotides. Except for the preferred priming oligonuclaotides (including
displacer
oligonucleotides) and detection probes described supra, the oligonucleotides
described
hereinabove preferably comprise a blocking moiety at their 3'-termini.
Detection probes of the present invention may be labeled in a number of
alternative
ways, e.g., with radioactive isotopes, fluorescent labels, chemiluminescent
labels, nuclear
tags, bioluminescent labels, intercalating dyes, or enzyme labels. The
detection probes may
include groups of interacting labels which emit a detectable change in signal
when the probes
t 0 are hybridized to a target sequence or its complement. In various
embodiments, these labeled
probes optionally or preferably are synthesized to include at least one
modified nucleotide,
e.g., a 2'-O-methyl ribonucleotide; or these labeled oligonucleotide probes
optionally or
preferably are synthesized entirely of modified nucleotides, e.g., 2'-O-methyl
ribonuclcotides.
It will be understood by one of ordinary skill in the relevant arts that other
suitable
modifications and adaptations to the methods and compositions described herein
are readily
apparent from the description ofthe invention contained herein in view of
information known
to the ordinarily skilled artisan, and may be made without departing from the
scope of the
invention or any embodiment thereof. Having now described the present
invention in detail,
the same will be more clearly understood by reference to the following
examples, which are
included herewith for purposes of illustration only and are not intended to be
limiting of the
invention.
EXAMPLES
Examples are provided below illustrating different aspects and embodiments of
the
invention. It is believed that these examples accurately reflect the details
of experiments
actually performed, however, it is possible that some minor discrepancies may
exist between
the work actually performed and the experimental details set forth below which
do not affect
the conclusions of these experiments. Skilled artisans will appreciate that
these examples are
not intended to limit the invention to the specific embodiments described
therein.
Additionally, those skilled in the art, using the techniques, materials and
methods described
herein, could easily devise and optimize alternative amplification systems for
detecting and/or
quantifying any target sequence.
The practice of the present invention will employ, unless otherwise indicated,
conventional techniques of molecular biology, recombinant DNA, and chemistry,
which are
within the skill of the art. Such techniques are explained fully in the
literature. See, for
example, Molecular Cloning A Laboratory Manual, 2nd Ed., Sambrook et al., ed.,
Cold
-66-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Spring Harbor Laboratory Press: (1989); DNA Cloning, Volumes I and II (D. N.
Glover ed.,
1985); Oligonucleotide Synthesis (M. J. Gait ed.,1984); Mullis et al. U.S.
Pat. No: 4,683,195;
Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); B. Perbal,
A Practical
Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology
(Academic Press,
Inc., N.Y.); and in Ausubel et al., Current Protocols in Molecular Biology,
John Wiley and
Sons, Baltimore, Maryland (1989).
Unless otherwise indicated, oligonucleotides and modified oligonucleotides in
the
following examples were synthesized using standard phosphoramidite chemistry,
various
methods of which are well known in the art. See e.g., Carruthers, et al., 154
Methods in
Enzymology, 287 (1987), the contents of which are hereby incorporated by
reference herein.
Unless otherwise stated herein, modified nucleotides were 2'-0-methyl
ribonucleotides, which
were used in the synthesis as their phosphoramidite analogs. Applicant
prepared the
oligonucleotides using an ExpediteTM 8909 DNA Synthesizer (PerSeptive
Biosystems,
Framingham, Mass.).
Various reagents are identified in the examples below, which include an
amplification
reagent, an enzyme reagent, a hybridization reagent, a selection reagent, and
detection
reagents. Unless otherwise indicated, the formulations and pH values (where
relevant) of
these reagents were as follows.
Amplification Reaeent. The "Amplification Reagent" comprised 11.6 mM Trizma
base buffer, 15 mM Trizma hydrochloride buffer, 22.7 mM MgClz, 23.3 mM KCI,
3.33%
(v/v) glycerol, 0.05 mM zinc acetate, 0.665 mM dATP, 0.665 mM dCTP, 0.665 mM
dGTP,
0.665 mM dTTP, 0.02% (vlv) ProClin 300 Preservative (Supelco, Bellefonte, PA;
Cat. No.
48126), 5.32 mM ATP, 5.32 mM CTP, 5.32 mM GTP, 5.32 mM UTP, and 6 M HCl to pH
7.81 to 8.0 at 22 C.
Enzyme Reagent. The "Enzyme Reagent" comprised 70 mM N-acetyl-L-cysteine,
10% (v/v) TRITON X-102 detergent, 16 mM HEPES, 3 mM EDTA, 0.05% (w/v) sodium
azide, 20 mM Trizma base buffer, 50 mM KCI, 20% (v/v) glycero1,150 mM
trehalose, 4M
NaOH to pH 7, and containing 224 RTUI L Moloney murine leukemia virus ("MMLV")
reverse transcriptase and 140 U/ L T7 RNA polymerase, where one RTU of RT
activity
incorporates 1 nmol of dTMP into DE81 filter-bound product in 20 minutes at 37
C using
poly(rA)-p(dT)12_,$ as the substrate, and one U of T7 RNA polymerase activity
produces 5
fmol of RNA transcript in 20 minutes at 37 C.
-67-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Hybridization Reagent. The "Hybridization Reagent" comprised 100 mM succinic
acid, 2% (w/v) lithium lauryl sulfate, 230 mM LiOH, 15 mM aldrithiol-2,1.2 M
LiCl, 20 mM
EDTA, 20 mM EGTA, 3.0% (v/v) ethyl alcohol, and 2M LiOH to pH 4.7.
Selection Reagent. The "Selection Reagent" comprised 600 mM H3B03, 182 mM
NaOH, 1% (v/v) TRITON X-100 detergent, and 4 M NaOH to pH 8.5.
Detection ReaEent I. "Detection Reagent I" comprised 1 mM HNO3 and 30 mM
HZOZ.
Detection Rea ent II. "Detection Reagent II" comprised 1 M NaOH and 2% (w/v)
Zwittergent 3-14 detergent.
Oil Reagent: The "Oil Reagent" comprised a silicone oil (United Chemical
Technologies, Inc., Bristol, PA; Cat. No. PS038).
Example 1
Comparison of Blocked and Unblocked Promoter Oligonucleotides
This experiment was conducted to evaluate the specificity of an amplification
method
according to the present invention in which a region ("the target region") of
a cloned
transcript derived from the 5' untranslated region ofthe hepatitis C virus
("the transcript") was
targeted for amplification. For this experiment we prepared two sets of
priming and promoter
oligonucleotides having identical base sequences. The two sets of
oligonucleotides differed
by the presence or absence of a 3'-terminal blocking moiety on the promoter
oligonucleotide.
The promoter oligonucleotide in each set targeted the complement of a sequence
contained
within the 5'-end of the target region and had the base sequence of SEQ ID
NO:5
aatltaatacgactcactataeaaagactagccatg gcgttagtatgagtgtcgtgcag, where the
underlined portion
of the promoter oligonucleotide constitutes a T7 promoter sequence (SEQ ID
N0:3) and the
non-underlined portion represents a hybridizing sequence (SEQ ID NO:4). The
priming
oligonucleotide in each set targeted a sequence contained within the 3'-end
ofthe target region
and had the base sequence of SEQ ID NO:6. Also included in the amplification
method was
a terminating oligonucleotide made up of 2'-O-methyl ribonucleotides having
the base
sequence of SEQ ID NO:38 ggcuagacgcuuucugcgugaaga. The terminating
oligonucleotide
had a 3'-terminal blocking moiety and targeted a region of the transcript just
5' to the target
region. The 5'-ends of the terminating oligonucleotide and of the hybridizing
sequence of the
promoter oligonucleotide overlapped by six bases. The 3'-terminal blocking
moiety of both
-68-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
the promoter oligonucleotide and the terminating oligonucleotide consisted of
a 3'-to-3'
linkage prepared using 3'-dimethyltrityl-N-benzoyl-2'-deoxycytidine, 5'-
succinoyl-long chain
alkylamino-CPG (Glen Research Corporation, Sterling, VA; Cat. No. 20-0102-01).
For amplification, 75 L of the Amplification Reagent was added to each of
eight
reaction tubes. The Amplification Reagent was then combined with 30 pmol of a
promoter
oligonucleotide, 30 pmol of the priming oligonucleotide and 5 pmol of the
terminating
oligonucleotide. One set of four of the tubes was provided with 30 pmol of the
unblocked
promoter oligonucleotide (group I), and another set of four tubes was provided
with 30 pmol
ofthe blocked promoter oligonucleotide (group II). Next, l L of a 0.1 %(wlv)
lithium lauryl
sulfate ("LLS") buffer containing 1000 copiesl L of the transcript was added
to two of the
tubes in each group, while the remaining two tubes in each group served as
negative controls.
The reaction mixtures were overlaid with 200 L of the Oil Reagent, and the
tubes were then
sealed and hand-shaken horizontally for 5 to 10 seconds before the tubes were
incubated in
a 60 C water bath for 10 minutes. The tubes were then transferred to a 41.5 C
water bath and
incubated for 15 minutes before adding 25 L of the Enzyme Reagent to each
tube. After
adding the Enzyme Reagent, the tubes were sealed, removed from the water bath
and hand-
shaken horizontally for 5 to 10 seconds to fully mix the components of the
reaction mixtures.
The tubes were returned to the 41.5 C water bath and incubated for an
additional 60 minutes
to facilitate amplification of the target region in the presence of MMLV
reverse transcriptase
and T7 RNA polymerase. Following amplification, the tubes were removed from
the 41.5 C
water bath and allowed to cool at room temperature for 10 to 15 minutes.
A 5 L aliquot of each reaction mixture was taken from the tubes, diluted 1:1
with a
2X Novex TBE-Urea Sample Buffer (Invitrogen Corporation, Carlsbad, CA; Cat.
No.
LC6876), and loaded onto a Novex TBE-Urea Denaturing Gel (Invitrogen; Cat.
No.
EC6865BOX). The gel was held by an Xcell SurelockTM Mini-Cell (Invitrogen;
Cat. No.
EI0001) and run at 180 volts for 50 minutes using a 5X Novex TBE Running
Buffer
(Invitrogen; Cat. No. LC6675) diluted 1:4 with deionized water. Aflerwards,
the gel was
stained with 0.5 glmL of ethidium bromide in a 1X TBE (Tris-Borate-EDTA)
solution,
visualized on a FisherBiotech Ultraviolet Transilluminator (Fisher Scientific
International
Inc., Hampton, NH; Model No. FB-TIV-816A), and photographed with a handheld
camera
using Polaroid 667 film.
The results of this experiment are illustrated in the photographed gel of FIG.
3. Each
number above the pictured gel represents a distinct lane, where lane 1 is an
RNA ladder of
100, 200, 300, 400, 500, 750 and 1000 base oligonucleotides, and the remainder
of the lanes
correspond to the following reaction mixtures: (i) lanes 2 and 3 correspond to
the transcript-
containing replicates of group I(unblocked promoter oligonucleotide); (ii)
lanes 4 and 5
-69-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
correspond to the transcript-containing replicates of group II (blocked
promoter
oligonucleotide); (iii) lanes 6 and 7 correspond to the transcript-negative
replicates of group
I; and (iv) lanes 8 and 9 correspond to the transcript-negative replicates of
group II. The first
visible band in lanes 2-5 constitutes amplicon derived from amplification of
the target region.
The remainder of the bands in lanes 2, 3, 6 and 7 constitute non-specific
amplification
products. Thus, the results indicate that only amplification using the fully
blocked promoter
oligonucleotides was specific, as there was no visible side-product formation
in either the
transcript-containing or transcript negative reaction mixtures containing
blocked promoter
oligonucleotides, whereas visible side-products were formed in both the
transcript-containing
and transcript-negative reaction mixtures containing unblocked promoter
oligonucleotides.
Example 2
Reduction in the Formation of Replicating Molecules
This experiment was designed to evaluate whether the use of a blocked promoter
oligonucleotide in an amplification method of the present invention would lead
to a reduction
in the formation of replicating molecules over a standard transcription-based
amplification
procedure. Replicating molecules are generally believed to form when the 3'-
ond of a
promoter oligonucleotide forms a hairpin structure and is extended in the
presence of a
polymerase, thereby forming a double-stranded promoter sequence. Transcription
initiated
from the double-stranded promoter sequence results in the formation of
amplicon containing
an antisense version of the promoter sequence.
In this experiment, we compared the production of replicating molecules in
amplification reactions containing promoter oligonucleotides that were either
blocked or
unblocked at their 3'-terminal ends in the presence or absence of purified
rRNA from
Mycobacterium tuberculosis (ATCC No. 25177) using one of two detection probes
targeting
a region ("the target region") of the 16S rRNA of Mycobacterium tuberculosis
("the target
nucleic acid"). The blocked and unblocked promoter oligonucleotides targeted
sequences
contained within the complement of the 5'-end of the target region. The
blocked promoter
oligonucleotide had the base sequence of SEQ ID NO:26
aattctaatacgactcactatagggagaactgggtctaataccggataggaccacgggatgcat, and the
unblocked
promoter oligonucleotide had the base sequence of SEQ ID N0:28
aattctaatacgactcactataggaaaaactgggtetaat accggataggaccacggga, where the
underlined portion
of each promoter oligonucleotide constitutes a 17 promoter sequence (SEQ ID
NO:3) and the
non-underlined portion represents a hybridizing sequence (SEQ ID N0:25 and SEQ
ID
NO:27). The priming oligonucleotide targeted a sequence contained within the
3'-end of the
target region and had the base sequence of SEQ ID N0:29. Also included was a
terminating
-70-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
oligonucleotide made up of 2'-O-methyl ribonucleotides having the base
sequence of SEQ ID
NO:39 cccaguuucccaggcuuaucec. The terminating oligonucleotide targeted a
region of the
target nucleic acid just 5' to the target region and had a 3'-terminal
blocking moiety. The 5'-
ends of the terminating oligonucleotide and the hybridizing sequence of the
promoter
oligonucleotide overlapped by six bases. The 3'-terminal blocking moiety of
both the blocked
promoter oligonucleotide and the terminating oligonucleotide consisted ofthe
3'- to-3' linkage
described in Example 1. And for detection, two detection probes were
synthesized. The first
detection probe ("detection probe I") comprised 2'-0-methyl ribonucleotides
targeted a
sequence contained within the target region and had the base sequence of SEQ
ID N0:30
gcucauccca*caccgcuaaagc. The second detection probe ("detection probe II")
targeted the
antisense of a region contained within the T7 promoter sequence and had the
base sequence
of SEQ ID NO:40 atacgactc* actata. The asterisk in both detection probe
sequences indicates
the position of a 4-(2-succinimidyloxycarbonyl ethyl)-phenyl-10-
methylaoridinium-9-
carboxylate fluorosulfonate acridinium ester label ("standard AE") joined to
the probe by
means of a non-nucleotide linker, as described by Arnold et al., "Linking
Reagents for
Nucleotide Probes," U.S. I'atent No. 5,585,481, the contents of which are
hereby incorporated
by reference herein.
A total of eight different amplification reactions were performed in
replicates of five.
All of the reaction tubes used for the amplification reactions were provided
with 75 L of the
Amplification Reagent, followed by 5 pmol each of either the blocked or
unblocked promoter
oligonucleotide, the priming oligonucleotide, and the terminating
oligonucleotide. Two sets
of the tubes received 2 L each of a 0.2% (w/v) LLS buffer containing 250
copies/ L of the
target nucleic acid, and the other two sets of tubes received no target
nuclcic acid. The
reaction mixtures were overlaid with 200 L of the Oil Reagent, and the tubes
were then
sealed and hand-shaken horizontally for 5 to 10 seconds before being incubated
in a 60 C
water bath for 10 minutes. The tubes were then transferred to a 41.5 C water
bath and
incubated for 10 minutes before adding 25 L of the Enzyme Reagent to each
tube. After
adding the Enzyme Reagent, the tubes were sealed, removed from the water bath
and hand-
shaken horizontally for 5 to 10 seconds to fully mix the components of the
reaction mixtures.
The tubes were returned to the 41.5'C water bath and incubated for an
additional 60 minutes
to permit amplification of the target sequences. Following amplification, the
tubes were
removed from the 41.5 "C water bath and allowed to cool at room temperature
for 10 to 15
minutes.
The detection step was performed in accordance with the Hybridization
Protection
Assay disclosed by Arnold et al., "Homogenous Protection Assay," U.S. Patent
No.
5,283,174. In this step, 100 L of the Hybridization Reagent containing either
52 fmol of
71
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
detection probe I or 10.2 fmol of detection probe II was added to each tube.
After adding the
detection probes, the tubes were sealed, hand-shaken horizontally for 5 to 10
seconds, and
incubated in a 60'C water bath for 15 minutes to permit hybridization of the
detection probes
to their corresponding target sequences. Following hybridization, 250 L of
the Selection
Reagent was added to the tubes and the tubes were sealed and hand-shaken
horizontally for
5 to 10 seconds before being incubated in a 60 C water bath for 10 minutes to
hydrolyze
acridinium ester labels associated with unhybridized probe. The samples were
cooled at room
temperature for at least 10 minutes before being analyzed in a LEADER HC+
Luminometer
(Gen-Probe Incorporated, San Diego, CA; Cat. No. 4747) equipped with automatic
injection
of Detection Reagent I, followed by automatic injection of Detection Reagent
II. Signal
emitted from the tubes was measured in relative light units ("RLU"), which is
a measure of
chemiluminescence.
The results were averaged for each set of reaction conditions and are
presented in
Table 1 below. From these results, it can be seen that those amplification
reactions containing
the blocked promoter oligonucleotide performed as well as those amplification
reactions
containing the unblocked promoter oligonucleotide at amplifying a targeted
region of the
target nucleic acid. However, those amplification reactions containing the
blocked promoter
oligonucieotide produced substantially fewer replicating molecules than did
those
amplification reactions containing the unblocked promoter oligonucleotide,
both in the
presence and in the absence of the transcript.
Table 1
Effect of 3'-Blocking Promoter Oligonucleotides on the Formation of
Replicating
Molecules
Detection Probe I Detection Probe II
Target No Target Target No Target
Nucleic Nucleic Nucleic Nucleic
Acid Acid Acid Acid
Blocked Promoter 1,047,084 4,222 64,874 10,063
Oligonucleotide
Unblocked Promoter 976,156 98,067 526,657 456,130
Oligonucleotide
-72-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Example 3
Sensitivity of Amplification Assay Using Blocked Promoter Oligonucleotide and
Terminating Oligonucleotide
This experiment examined the sensitivity of an amplification system according
to the
present invention in which a region ("the target region") of purified 23S rRNA
from
Chlamydia trachomatis (ATCC No. VR-878) ("the target nucleic acid") was
targeted for
amplification. Included in this experiment was a promoter oligonucleotide
having a 3'-
terminal blocking moiety, a priming oligonucleotide, a terminating
oligonucleotide having a
3'-terminal blocking moiety, and a labeled detection probe. The promoter
oligonucleotide
targeted the complement of a sequence contained within the 5'-end of the
target region and
had tha basa sequence of SEQ ID N 0 : 2 2
aatltaatacgactcactatagg.aagacggagtaagttaagcacgcggac gattgga, where the
underlined portion
of the promoter oligonucleotide constitutes a T7 promoter sequence (SEQ ID
NO:3) and the
non-underlined portion represents a hybridizing sequence (SEQ ID NO:21). The
priming
oligonucleotide targeted a sequence contained within the 3'-end of the target
region and had
the base sequence of SEQ ID NO:23. The terminating oligonucleotide was made up
of 2'-0-
methyl ribonucleotides having the base sequence of SEQ ID NO:41
uccgucauuccuucgcuauagu
and targeted a region of the target nucleic acid just 5' to the target region.
The 5'-ends of the
terminating oligonucleotide and the hybridizing sequence of the promoter
oligonucleotide
overlapped by four bases. The 3'-terminal blocking moiety of both the promoter
ofigonucleotide and the terminating oligonucleotide consisted of the 3'-to-3'
linkage described
in Example 1. The detection probe targeted a sequence contained within the
target region and
was made up of 2'-O-methyl ribonucleotides having the base sequence of SEQ ID
NO:24
cguucucaucgcucu*acggacucu, where the asterisk indicates the position of a
standard AE label
joined to the probe by means of a non-nucleotide linker. See Arnold et al.,
U.S. Patent No.
5,585,481.
Amplification in this experiment was carried out essentially as described in
Example
1. Each amplification reaction was performed in replicates of 3, and the
target nucleic acid
was added to each reaction tube in each set of replicates in copy numbers of
10, 100, 1000 or
10,000 from a 0.1% (w/v) LLS buffer containing 10, 100, 1000 or 10,000 copies/
L,
respectively. The promoter and priming oligonucleotides were each added to the
tubes in 30
pmol/reaction amounts, and 5 pmol ofthe terminating oligonucleotide was added
to each tube.
Using the Chlamydia trachomatis probe of this experiment, detection was
carried out
essentially as described in Example 2. The results of this experiment are set
forth in Table
2 below and indicate 100 copy sensitivity for this amplification system, where
an average
RLU value of above 10,000 constituted a positive result.
-73-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Table 2
Sensitivity of Chlamyrlia trachomatis Amplification System
Copy Number Avg. RLU
10 8504
100 51,574
1000 1,578,416
10,000 6,092,697
l0
Example 4
Amplification of a Double-Stranded Target Sequence
This example examines an amplification system according to the present
invention in
which a region ("the target region") of a cloned, double-stranded transcript
derived from the
E6 and E7 genes of human papilloma virus type 16 ("HPV-16") ("the transcript")
was
targeted for amplification. See FIG. 1C. This experiment included a promoter
oligonucleotide having a 3'-terminal blocking moiety, a priming
oligonucleotide and a labeled
detection probe. The promoter oligonucleotide targeted the complement of a
sequence
contained within the 5'-end of the target region and had the base sequence of
SEQ ID N0:14
aatttaatacgactcactatagggagagaacagatggggcacacaattcctagt, where the underlined
portion ofthe
promoter oligonucleotide constitutes a T7 promoter sequence (SEQ ID NO:3) and
the non-
underlined portion represents a hybridizing sequence (SEQ ID NO: 13). The 3'-
terminal
blocking moiety of the promoter oligonucleotide consisted of the 3'-to-3'
linkage described
in Example 1. The priming oligonucleotide targeted a sequence contained within
the 3'-end
of the target region and had the base sequence of SEQ ID NO: 15. The detection
probe, which
was comprised of 2'-O-methyl ribonucleotides, had the base sequence of SEQ ID
NO: 16
ggacaa*gcagaaccggaca and targeted a sequence contained within the target
region, The
asterisk indicates the position of a standard AE label joined to the probe by
means of a non-
nucleotide linker. See Arnold et al., U.S. Patent No. 5,585,481.
The amplification reactions of this experiment were performed in replicates of
5, and
each tube included 75 pL of the Amplification Reagcnt containing 0, 50, 100,
500, 1000 or
5000 copies of the transcript. Each tube was also provided with 40 pinol of
the promoter
oligonucleotide and 15 pmol of the priming oligonucleotide. The reaction
mixtures were
overlaid with 200 pL of the Oil Reagent, and the tubes were then sealed and
hand-shaken
horizontally for 5 to 10 seconds. To separate the complementary strands of the
double-
-74-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
stranded transcript, the tubes were incubated in a heat block for 10 minutes
at 95 C. At the
end of this incubation, the tubes were removed from the heat block and rapidly
cooled on ice
for 5 minutes to promote association of the priming oligonucleotide and the
targeted region
of the transcript. The tubes were then incubated in a 41.5 C water bath for
10 minutes. To
initiate amplification, 25 p.L of the Enzyme Reagent was added to the tubes,
which were then
sealed and hand-shaken horizontally for 5 to 10 seconds to fully mix the
Amplification and
Enzyme Reagents. Amplification was then carried out by returning the tubes to
the 41.5 C
water bath for a I hour incubation.
Following amplification, detection of the amplification products was performed
in the
manner described in Example 2 using 100 fmol/reaction of the detaction probe.
The results
of this experiment are set forth in Table 3 below and indicate 500 copy
sensitivity for this
amplification system, where an RLU value of 10,000 or greater constituted a
positive result.
Table 3
Sensitivity of HPV-16 Amplification System
Copy Number Avg. RLU % Positive
Amplifications
0 5410 0
50 5647 0
100 6018 0
500 19,928 80
1000 200,072 80
5000 371,641 100
Example 5
Comparison of Blocked and Unblocked Promoter Oligonucleotides
The purpose of this experiment was to evaluate the benefit of including a
terminating
oligonucleotide in the HCV amplification system of Example 1. See FIG. lA. For
this
experiment, four different reaction mixtures were set up in replicates of 10
containing either
0 or 10 copies of the transcript of Example 1 in the presence or absence of a
terminating
oligonucleotide. The promoter, priming and terminating oligonucleotides were
identical to
those used in Example 1. Unlike Example 1, this experiment included two
detection probes,
both of which were made up of 2'-O-methyl ribonucleotides and targeted a
sequence
contained within the region of the transcript targeted for amplification. The
first detection
-75-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
probe had the base sequence of SEQ ID NO:7 guacu*caccggtrucc, and the second
detection
probe had the base sequence of SEQ ID NO:8 agaccacua*uggcucucccggg. Each
detection
probe had a "cold," or unlabeled version, and a "hot," or labeled version.
(Cold probes were
used in this experiment to prevent saturation of the hot probes in the
presence of a vast excess
of amplicon, thereby permitting the extent of amplification to be evaluated.)
The asterisks
indicate the positions of standard AE labels joined to the hot probes by means
of non-
nucleotide linkers. See Arnold et al., U.S. Patent No. 5,585,481.
The amplification reactions were essentially carried out in the manner
described in
Example 2 using 30 pmol/reaction of the promoter oligonucleotide and 15
pmol/reaction of
each of the priming and terminating oligonucleotides. Detection was performed
as described
in Example 2 using 100 fmol/reaction of each of the two hot probes and each of
the two cold
probes in amounts corresponding to the ratios indicated in Table 4 below. The
averaged
results are set forth in Table 4 in relative light units ("RLU") and
demonstrate that only those
reaction mixtures containing the terminating oligonucleotide had 10 copy level
sensitivity in
the HCV amplification system. The coefficient of variation values ("%CV")
appearing in
Table 4 for the different copy levels tested constitute the standard deviation
of the replicates
over the mean of the replicates as a percentage.
Table 4
Sensitivity of the HCV Amplification System in the Presence and Absence of a
Terminating Oligonucleotide
Copy Terminating Cold Prot/Hot Avg. RLU %CV
Number Oligonucleotide Probe Ratio
0 + 25:1 15,813 7.5
10 + 25:1 635,695 83.5
0 - 5:1 15,378 14.3
10 - 5:1 20,730 37.5
Example 6
Varying Length of Base Overlap Between Promoter Oligonucleotide and
Terminating Oligonucleotide
In this experiment, we studied the effect of varying the length of overlap
between a
blocked promoter oligonucleotide and a terminating oligonucleotide on
amplification
efficiency in the HCV amplification system of Example 1. The reaction mixtures
were set up
in replicates of four and each set was provided with 0 or 50 copies of the
transcript of
-76-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Example 1. The amount of overlap between the promoter oligonucleotide and the
terminating
oligonucleotide, if present, was 2, 4 or 6 bases for each set of reaction
mixtures. The
promoter oligonucleotide, the priming oligonucleotide, and the detection
probes were
identical to those used in Example 5. The cold probes and hot probes were used
at a ratio of
4:1. The three terminating oligonucleotides of this experiment were made up of
2'-O-methyl
ribonucleotides and had the following base sequences: (i) SEQ ID NO:42
agacgcuuucugcgugaagacagu (2 base overlap); (ii) SEQ ID NO:43
cuagacgcuuucugcgugaagaca
(4 base overlap); and (iii) SEQ ID NO:38 (6 base overlap).
The amplification reactions were carried out in reaction tubes in the manner
described
in Example 5 using 30 pmol/reaction of the promoter oligonucleotide and 15
pmol/reaction
each of the priming oligonucleotide and the terminating oligonucleotides.
Detection was
performed as described in Example 2 using 100 fmol/reaction of each of the two
hot probes
and 400 fmol/reaction of each of the two cold probes. The averaged results are
set forth in
Table 5 in relative light units ("RLU") and indicate that under the conditions
tested, six bases
15, of overlap between the promoter oligonucleotide and the terminating
oligonucleotide is
optimal for the HCV amplification system. The skilled artisan could apply this
method to any
amplification system to determine the optimal amount of overlap between a
promoter
oligonucleotide and a terminating oligonucleotide using nothing more than
routine
experimentation.
Table 5
Effect of Terminating Oligonucieotide/Promoter Oligonucleotide Base Overlap on
Amplification Efficiency
Copy Terminating Base Avg. RLU
Number Oligonucleotide Overlap
- N/A 29,593
0 + 2 25,430
+ 4 27,128
+ 6 27,732
- N/A 265,250
50 + 2 339,833
+ 4 253,577
+ 6 1,904,911
-77-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Example 7
Comparison of Real-Time Amplification Assays in the Presence or Absence of a
Terminating Oligonucleotide
This experiment was conducted to determine whether a terminating
oligonucleotide
improves amplification performance in a real-time amplification assay. For
this experiment,
we used the Mycobacterium tuberculosis amplification system of Example 2,
which included
the unblocked promoter oligonucleotide having the base sequence of SEQ ID
NO:28, the
priming oligonucleotide having the base sequence of SEQ ID NO:29, and the
blocked
terminating oligonucleotide having the base sequence of SEQ ID NO:39. Also
included was
a molecular beacon detection probe having the base sequence of SEQ ID NO:3 1.
The
detection probe was synthesized to include a BHQ-2 Black Hole QuencherTM Dye
joined to
its 3'-end using a BHQ-2 Glycolate CPG (Biosearch Technologies, Inc., Novato,
CA; Cat. No.
CG5-5042G-1) and a CyTM5 Dye joined to its 5'-end using a CyTM5-CE
phosphoramidite
(Glen Research; Cat. No. 105915-90). The reactions were run in the wells of a
Thermo
Labsystems White Cliniplate 96 (VWR International, Inc., West Chester, PA;
Cat. No. 28298-
610), and each reaction well contained 0, 100 or 1000 copies of the target
nucleic acid of
Example 2. For each copy number tested, there were four replicates which
included the
terminating oligonucleotide and four replicates which did not.
For amplification and detection, 75 L of the Amplification Reagent was added
to
each reaction well, followed by the addition of 2 L of a 0.1 % (w/v) LLS
buffer containing
50 copies/ L to each tube of one set of replicates and 2 L of a 0.1% (w/v)
LLS buffer
containing 500 copies/ L to each tube of another set of replicates. The
promoter
oligonucleotide, the priming oligonucleotide and, when included, the
terminating
oligonucleotide were each added to the tubes in 5 pmol/reaction amounts, and 2
pmol/reaction
of the detection probe was added to each tube. Target nucleic acid was
provided to the
reaction wells in the amounts indicated, and the reactions mixtures were
overlaid with 80 L
of the Oil Reagent. The plate was sealed with a ThermalSeal RTTM Film (Sigma-
Aldrich
Corporation, St. Louis, MO; Product No. Z369675) and the contents of the plate
were
subjected to a 60 C incubation for 15 minutes in a Solo HT Microplate
Incubator (Thermo
Electron Corporation, Waltham, MA; Model No. 5161580), followed by a 42'C
incubation
for 10 minutes in the Solo HT Microplate Incubator. Next, 25 L of the Enzyme
Reagent
(pre-heated to 42 C) was added to each well and the contents were mixed
several times using
a pipette. The contents of the plate were then incubated at 42 C for 120
minutes in a
BioluminTM 960 Micro Assay Reader (Molecular Dynamics Inc., Sunnyvale, CA) and
fluorescence from the CyTM5 Dye channel was monitored as a function of time in
one minute
intervals. The results of this monitoring, which are graphically presented in
Figures 4A-F,
-78-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
indicate that the terminating oligonucleotide dramatically enhanced
amplification ofthe target
sequence in the Mycobacteraum tuberculosis real-time amplification assay.
Example 8
Terminating Oligonucleotides Versus Digestion Oligonucleotides
This experiment compared levels of amplification in the Mycobacterium
tuberculosis
amplification system of Example 2 using either a terminating oligonucleotide
or a digestion
oligonucleotide in the presence of a blocked or unblocked promoter
oligonucleotide. The
t 0 terminating oligonucleotide of this experiment was designed to bind to the
targeted RNA and
physically block the activity of the reverse transcriptase enzyme, while the
digestion
oligonucleotide, which was composed of DNA, was designed to bind to the
targeted RNA and
direct digestion of the substrate RNA by an RNAse H activity. Use of the
terminating or
digestion oligonucleotide results in the formation of a template-complementary
strand, or
cDNA, having a defined 3'-end. The promoter oligonucleotide is designed so
that its
template-binding portion hybridizes to a 3'-terminal sequence present in the
template-
complementary strand, thereby facilitating the formation of a double-stranded
promoter
sequence in the presence of the reverse transcriptase enzyme.
As in Example 2, the promoter oligonucleotide of this experiment had the base
sequence of SEQ ID NO:28 and the priming oligonucleotide had the base sequence
of SEQ
ID NO:29. The terminating oligonucleotide was made up of 2'-O-methyl
ribonucleotides
having the base sequence of SEQ ID NO:44 caguuucccaggcuuauccc, and the
digestion
oligonucleotide had the base sequence of SEQ ID NO:45
gtattagacccagtttcccaggct. The 5'-
ends of the terminating oligonucleotide the hybridizing sequence of the
promoter
oligonucleotide identified in Example 2 overlapped by four bases, and the
first 14 bases
extending from the 5'-end of the digestion oligonucleotide overlapped with the
5'-most 14
bases of the hybridizing sequence of the promoter oligonucleotide. The blocked
promoter
oligonucleotide, the terminating oligonucleotide, and the digestion
oligonucleotide all
included a 3'-terminal blocking moiety consisting of the 3'-to-3' linkagc
described in Example
1. And the detection probe had the base sequence of SEQ ID NO:32
gctcatccca*caccgctaaagc, where the asterisk indicates the position of a
standard AE label
joincd to the probe by means of a non-nucleotide linker. See Arnold et al.,
U.S. Patent No.
5,585,481.
A total of six different reactions were performed in replicates of two, as set
forth in
Table 6 below. Template positive reactions were each provided with 1 L of a
0.1% (wlv)
LLS buffer containing 50 copies/l.tL of the Mycobacterium tuberculosis target
nucleic acid
of Example 2, and template negative reactions included no target nucleic acid.
Amplification
-79-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
and detection were essentially carried out as in Example 2 using 30
pmoVreaction each of the
promoter and priming oligonucleotides, 5 pmoVreaction of the terminating
oligonucleotide,
30 pmollreaction ofthe digestion oligonuclcotide, and 10 fmol/reaction of the
detection probe.
The results of these reactions, which were measured in relative light units
("RLU"), are
presented in Table 6 and indicate that amplification in this amplification
system was similar
in the presence of either the terminating or the digestion oligonucleotide,
although
performance was somewhat better using the digestion oligonucleotide.
Additionally, the
results indicate that the level of amplification in this amplification system
at this copy number
was enhanced in the presence of the digestion oligonucleotide.
Table 6
Amplicon Production Using Terminating or Digestion Oligonucleotide
Reaction Template Terminating (T) or Promoter RLU
Digestion (D) Oligonuclcotide
Oligonucleotide
1 T Blocked 319,449
2 T Blocked 254,181
3 T Unblocked 20,915
4 T Unblocked 3767
5 Positive D Blocked 472,786
6 D Blocked 422,818
7 D Unblocked 162,484
8 D Unblocked 136,134
9 None Blocked 10,007
10 None Blocked 5052
11 Negative D Blocked 27,594
12 D Blocked 5157
Example 9
Capped Priming Oligonucleotides
This experiment studied the effect of including a priming oligonucleotide cap
on side-
product formation using the Mycobacterium tuberculosis amplification system of
Example
2. A "cap" is a short oligonucleotide complementary to the 3'-terminal end of
a priming
-80-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
oligonucleotide and includes a 3'-terminal blocking moiety to prevent
extension from a
terminal 3'-OH group. The cap is included to prevent the priming
oligonucleotide from
forming an oligonucleotide dimer with the promoter oligonuclcotide, which
could result in
the formation of a functional double-stranded promoter sequence if the priming
oligonucleotide is extended in the presence of a reverse transcriptase enzyme.
As illustrated
in FIG. 5A, the formation of an oligonueleotide dimer having a functional
double-stranded
promoter sequence could lead to the production of unwanted side-products in
the presence of
an RNA polymerase. While the cap inhibits oligonucleotide dimer formation, the
cap can be
readily displaced from the priming oligonucleotide through specific
hybridization with the
template sequence. A diagram of cap usage is shown in FIG. 6A.
For this experiment, we tested three different reaction conditions in
replicates of two
in the presence or absence of the Mycobacterium tuberculosis target nucleic
acid of Example
2. The components of the three reaction conditions differed as follows: (i)
the first set of
reaction conditions included an unblocked promoter oligonucleotide, an
uncapped priming
oligonucleotide and a blocked terminating oligonucleotide; (ii) the second set
of reaction
conditions included a blocked promoter oligonucleotide, an uncapped priming
oligonucleotide, and a blocked terminating oligonucleotide; and (iii) the
third set of reaction
conditions included a blocked promoter oligonucleotide, a priming
oligonuclaotide hybridized
to a blocked cap at its 3'-terminal end, and a blocked terminating
oligonucleotide. As in
Example 2, the promoter oligonucleotide had the base sequence of SEQ ID NO:28
and the
priming oligonucleotide had the base sequence of SEQ ID NO:29. The cap had the
base
sequence of SEQ ID NO:46 ctatc. The terminating oligonucleotide was made up of
2'-0-
methyl ribonucleotides having the base sequence of SEQ ID N0:44
caguuucccaggcuuauccc.
And the terminating oligonucleotide, the promoter oligonucleotide, when
blocked, and the cap
all included a 3'-terminal blocking moiety consisting of the 3'-to-3' linkage
described in
Example 1.
Prior to initiating amplification, the priming oligonucleotide and the cap
were pre-
hybridized in a 10 mM NaCi solution containing the priming oligonucleotide and
the cap at
a 1:1 ratio. The facilitate hybridization, the reaction tubes containing the
solution were
incubated in a 95 C water bath for 10 minutes and then cooled at room
temperature for 2
hours. Following this pre-hybridization step, amplification was carried out as
in Example 2
using 30 pmoUreaction each of the promoter oligonucleotide and the capped
priming
oligonucleotide and 5 pmol/reaction of the terminating oligonucleotide, where
each reaction
mixture was also provided with 1 L of a 0.1 /u (w/v) LLS buffer containing
10,000 copies/ L
of the target nucleic acid. After amplification, a 5pL sample was taken from
each tube,
diluted 1:1 with a lOX Blue]uiceTM Gel Loading Buffer (Invitrogen; Cat. No.
10816-015)
-81-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
which was diluted to 2X with TBE (Tris-Borate-EDTA), and loaded onto an E-GeI
Single
Comb Gel (4% high resolution agarose) which was pre-stained with ethidium
bromide
(Invitrogen; Cat. No. G5018-04). The gels were run on an E-Gel Base
(Invitrogen; Cat. No.
G5100-01) at 80 volts for 30 minutes. The gels were then visualized on a
FisherBiotech
Ultraviolet Transilluminator and photographed with a handheld camera using
Polaroid 667
film .
The results of this experiment are illustrated in the photographed gels of
FIG. 7A
(template negative gel) and FIG. 7B (template positive gel). The numbers above
the pictured
gels indicate distinct lanes, where lane 7 is blank, lane 8 is a 100 base pair
RNA ladder, lane
t0 9 is a 20 base pair RNA ladder, and the remainder of the lanes contain
products from the
following reaction mixtures: (i) lanes 1 and 2 correspond to reaction mixtures
containing the
unblocked promoter oligonucIeotide, the uncapped priming oligonucleotide, and
the blocked
terminating oligonucleotide; (ii) lanes 3 and 4 correspond to reaction
mixtures containing the
blocked promoter oligonucleotide, the uncapped priming oligonucleotide, and
the terminating
oligonucleotide; and (iii) lanes 5 and 6 correspond to reaction mixtures
containing the blocked
promoter oligonucleotide, the capped priming oligonucleotide, and the
terminating
oligonucleotide. The results clearly show that capping the priming
oligonucleotide resulted
in a further reduction in side-product formation (the side-products, which are
oligonucleotide
dimers in these reactions, are in the 20-mer to 60-mer range, whereas the
amplicon would be
greater than 100 bases in length).
Example 10
Looped Priming Oligonucleotides
In this experiment, the effect of looped priming oligonucleotides on
amplification in
the Mycobacterium tuberculosis amplification system of Example 2 was examined.
Looped
priming oligonucleotides are a variety of the priming oligonucleotides and
caps evaluated in
Example 9. A looped priming oligonucleotide includes a cap which is joined at
its 3'-end to
the 5'-end of the priming oligonucleotide by means of a non-nucleotide linker
(e.g., abasic
nucleotides). One advantage of a looped priming oligonucleotide is that
reassociation of the
priming oligonucleotide and the cap, in the absence of the targeted template,
is faster when
the two oligonucleotides are maintained in close proximity to each other.
Another advantage
of a looped priming oligonucleotide is that the priming oligonucleotide and
the cap can be
generated in a single synthesis procedure, as opposed to the time intensive
syntheses of
separate priming and cap oligonucleotides.
Comparison was made between an uncapped priming oligonucleotide and looped
priming oligonucleotides having caps of varying lengths. The promoter, priming
and
-82-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
terminating oligonucleotides were the same as those used in Example 9, and the
detection
probe was the same as detection probe I used in Example 2. The detection probe
was provided
to the reaction mixtures in both "cold" and "hot" forms, for the reasons
described in Example
5, and the cold:hot probe ratio of each reaction mixture was 250:1. The looped
priming
oligonucleotides had the following sequences, where each "n" represents an
abasic nucleotide
(Glen Research; Cat. No. 10-1924-xx):
Looped Priming Oligonucleotide I (LPO I): SEQ ID NO:47
ctatttnngccgtcaccccaccaaca agctgatag;
Looped Priming Oligonucleotide II (LPO II): SEQ IDNO:48 ctatcnnnnngccgtcacccca
ccaacaagctgatag;
Looped Priming Oligonucleotide III (LPO III): SEQ ID NO:49
ctatnnnnngccgtcacccca ccaacaagetgatag;
Looped Priming Oligonucleotide IV (LPO IV): SEQ ID NO:50
ctatcannnnngccgtcaccc caccaacaagctgatag;
Looped Priming Oligonucleotide V (LPO V): SEQ ID NO:51 ctatcnnnngccgtcaccccac
caacaagctgatag;
Looped Priming Oligonucleotide VI (LPO VI): SEQ ID NO:52
ctatcannnngccgtcacccc accaacaagctgatag; and
Looped Priming Oligonucleotide VII (LPO VII): SEQ ID NO:53
ctatcagcttgttggnnnnn gccgtcaccccaccaacaagctgatag.
A different reaction mixture was prepared for each priming oligonucleotide,
and the
reaction mixtures were tested in replicates of three using 1000 copies of the
Mycobacterium
tuberculosis target nucleic acid of Example 2 obtained from 0.1 %(w/v) LLS
buffer
containing 1000 copies/ L of the target nucleic acid. The amplification and
detection steps
were carried out as in Example 2 using 30 pmol/reaction each of the promoter
and priming
oligonucleotides, 5 pmol/reaction of the terminating oligonucleotide, 10
fmol/reaction of the
hot probe, and 2.5 pmol/reaction of the cold probe. Signal from the tubes was
measured in
relative light units ("RLU") and the average RLU values are presented in Table
7 below. The
results indicate that the template can be amplified using a looped priming
oligonucleotide, and
that a looped priming oligonucleotide having four abasic groups and a five
base cap is optimal
for the Mycobacterium tuberculosis amplification system.
-83-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Table 7
Effect of Looped Priming Oligonucleotides on Amplification
Priming Oligonucleotide Avg. RLU
Uncapped 430,060
LPO I 292,541
LPO Iv 260,559
LPO 111 281,304
LPO IV 136,398
LPO V 372,119
LPO VI 171,382
LPO VII 20,045
Example 11
Comparison of Looped Priming Oligonucleotides and Caps
This experiment evaluated the ability of looped priming oligonucleotides to
inhibit
primer-dependent side-product formation. For this experiment, looped priming
oligonucleotides LPO V and LPO VII of Example 10 were compared with an
uncapped
priming oligonucleotide and a priming oligonucleotide having a 14 base cap.
The uncapped
and capped priming oligonucleotides were the same as the uncapped priming
oligonucleotide
used in Example 10, and the cap had the base sequence of SEQ ID NO:54
ctatcagcttgttg (the
cap and the priming oligonucleotide were pre-hybridized as in Example 9). The
terminating
oligonucleotide was the same as the terminating oligonucleotide used in
Example 10, and the
detection probe targeted the complement of the priming oligonucleotide and had
the base
sequence of SEQ ID NO:29 gccgtcacccc*accaacaagctgatag, where the asterisk
indicates the
position of a standard AE label joined to the probe by means of a non-
nucleotide linker. See
Arnold et at., U.S. Patent No. 5,585,481. The detection probe was provided to
the reaction
mixtures in both "cold" and "hot" forms, for the reasons described in Example
5, and the
cold:hot probe ratio of each reaction mixture was 4000:1. As with the promoter
and
terminating oligonucleotides, the cap had a 3'-terminal blocking moiety
consisting of the 3'
to 3' linkage described in Example 1.
The reaction mixtures were all template-free and tested in replicates of
three, with a
different set of reaction mixtures being prepared for each priming
oligonucleotide. The
amplification and detection steps were carried out as in Example 2 using 30
pmol/reaction
-84-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
each of the promoter and priming oligonucleotides, 5 pmol/reaction of the
terminating
oligonuclcotide, 20 fmol/reaction of the hot probe, and 80 pmoUreaction of the
cold probe.
Signal from the tubes was measured in relative light units ("RLU") and the
averages of those
RLU values are set forth in Table 9 below. The results indicate that the
capped priming
oligonucleotide inhibited primer-dependent side-product formation to a greater
extent than
did the looped priming oligonucleotides, although use of the looped priming
oiigonucleotides
resulted in less primer-dependent side-product formation than when the
uncapped priming
oligonucleotide was used in this amplification system.
Table S
Inhibition of Primer-Dependent Side-product Formation Using Looped Priming
Oligonucleotides and Caps
Priming Oligonucleotide Avg. RLU
Uncapped 2,246,565
LPO V 1,497,699
LPO VII 1,040,960
Capped 106,134
Example 12
Comparison of RNA Transcript Production in the Presence
and Absence of Extender Oligonucleotides
This experiment examined the effect of extender oligonucleotides on amplicon
production in amplification reaction mixtures containing a blocked promoter
oligonucleotide.
The extender oligonucleotides of this experiment were either blocked or
unblocked and had
the base sequence of SEQ ID NO:55 cctccaggaccccecctcccgggagagecata. A 3'-end
blocked
terminating oligonucleotide was included that was made up of 2'-O-methyl
ribonucleotides
having the base sequence of SEQ ID N0:56 auggcuagacgcuuucugcgugaaga. The
target
nucleic acid ("target"), priming oligonucleotide and promoter oligonucleotide
were the same
as those used in Example 1. The blocking moiety of each blocked
oligonucleotide used in this
experiment was a 3'-terminal blocking moiety consisting of the 3'-to-3'
linkage described in
Example 1. Cold and hot probes were used for detection of transcription
products and had
the sequence of SEQ ID N0:7. The hot probe of this experiment was identical to
the first
detection probe used in Example 5.
Six groups of amplification reaction mixtures were tested in replicates of
four as
follows: (i) no extender oligonucleotide and no target (group I); (ii) no
extender
-85-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
oligonucleotide and 100 copies oftarget (group II); (iii) blocked extender
oligonucleotide and
no target (group III); (iv) blocked extender oligonucleotide and 100 copies of
target (group
IV); (v) unblocked extender oligonucleotide and no target (group V); (iv)
unblocked extender
oligonucleotide and 100 copies of target (group VI). Reaction tubes from the
six groups were
set-up with 30 L Amplification Reagent containing 6 pmol of the priming
oligonucleotide,
4 pmol of the promoter oligonucleotide and 0.8 pmol ofthe terminating
oligonucleotide. The
reaction tubes of groups III and N contained 4 pmol of the blocked extender
oligonucleotide,
and the reaction tubes of groups V and VI contained 4 pmol of the unblocked
extender
oligonucleotide. As indicated above, the reaction tubes of groups II, IV and
VI further
lo contained 100 copies of target, while those of groups I, III and V
contained no target. The
reaction mixtures were overlaid with 200 L Oil Reagent, and the tubes were
then sealed and
vortexed for 10 seconds before being incubated in a 60 C water bath for 10
minutes. The
tubes were then transferred to a 41.5 C water bath and incubated for 15
minutes before adding
p.L Enzyme Reagent. After adding Enzyme Reagent, the tubes were again sealed
and
hand-shaken horizontally for 5 to 10 seconds to fully mix the components of
the reaction
mixtures. The tubes were returned to the 41.5'C water bath and incubated for
an additional
60 minutes to permit ampliEcation of the target sequence. Following
amplification, the tubes
were removed from the 41.5 C water bath and placed in an ice water bath for
two minutes.
Detection of RNA transcription products was performed essentially as described
in
Example 2 (reaction tubes were vortexed rather than hand-shaken) using 100
fmoi/reaction
of the hot probe and 300 pmoVreaction of the cold probe. The averaged results
are set forth
in Table 9 in relative light units ("RLU") and demonstrate that the extender
oligonucleotides
of this experiment contributed to faster rates of amplification. The
coefficient of variation
values ("%CV") appearing in Table 9 for the different reaction conditions
tested constitute
the standard deviation of the replicates over the mean of the replicates as a
percentage.
- 86 -
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
Table 9
Effect of Extender Oligonucleotides on Amplicon Production
Copy Extender Avg. RLU %CV
Number Oligonucleotide
0 None 4239 13
100 None 70,100 28
0 Blocked 4721 30
100 Blocked 337,964 12
0 Unblocked 13,324 76
100 Unblocked 869,861 12
Example 13
Amplification of a DNA Target Sequence
This experiment was conducted to determine the sensitivity of an amplification
system
according to the present invention for a target region contained within double-
stranded DNA
("dsDNA"). The exemplary dsDNA used in this experiment was a cloned transcript
derived
from the orfX gene of a methicillin-resistant strain of Staphylococcus aureus.
Included for
amplification were a priming oligonucleotide, a displacer oligonucleotide, a
terminating
oligonucleotide and a promoter oligonucleotide. The priming oligonucleotide
targeted a
sequence contained within the 3'-end of the target region and had the base
sequence of SEQ
ID NO:35; the displacer oligonucleotide targeted a sequence present in a
target nucleic acid
containing the target region 5' to the target region and had the base sequence
of SEQ ID
NO:57 cuugctcaattaacacaacccgcatc, where the underlined bases were LNAs; the
terminating
oligonuclaotide targeted a sequence present in the target nucleic acid 3' to
the target region
and had the base sequence of SEQ ID NO:58 " ttggttcaauuc, where the underlined
bases
were LNAs (the terminating oligonucleotide was not fully comprised of LNAs to
limit
folding); and the promoter oligonucleotide had the base sequence of SEQ ID
NO:34
aatttaatacgactcactataggga~aacgcatgacccaagggcaaagcgactttg, where the underlined
portion was
a T7 promoter sequence (SEQ ID NO:3) and the remainder was a hybridizing
sequence (SEQ
ID NO:33) that targeted the complement of a sequence contained within the 5'-
end of the
target region. The promoter oligonucleotide and the terminating
oligonucleotide both included
a 3'-terminal blocking moiety consisting of the 3'-to-3' linkage described in
Example 1.
Detection was carried out in real-time with a molecular torch detection probe
having the base
-87-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
sequence of SEQ ID NO:59 ccgucauuggcggaucagacgg. The base sequence of this
probe was
comprised of 2'-O-methylribonucleotides and nucleotides 17 and 18, reading 5'-
to-3', were
joined to each other by a 9-carbon linker. The detection probe was synthesized
to include
interacting DABCYL and FAM labels using 3'-DABCYL CPG (Prime Synthesis, Inc.,
Aston,
PA; Cat. No. N-9756-10) and a 6-FAM phosphoramidi#e joined to the 5'-end
(BioGenex Inc.,
San Ramon, CA; Cat. No. BGX-3008-01). The probe was also synthesized to
include a 9-
carbon linker positioned between nucleotides 17 and 18 reading 5'-to-3' (Glen
Research
Corporation, Sterling, VA; Cat. No. 10-1909-90). The synthesized probe was
purified by
polyacrylamide gel electrophoresis and reverse phase HPLC. The target binding
portion of
the probe consisted of SEQ ID NO:37.
The amplification reactions ofthis experiment were performed in replicates of
six for
each copy number and, for this, each of twelve test wells of a microtiter
plate was provided
with 30 L of an amplification reagent comprising 44.1 mM HEPES, 2.82% (w/v)
trehalose,
30.6 mM MgClz, 33 mM KCI, 0.3 % (v/v) ethanol, 0.1% (w/v) methyl paraben,
0.02% (w/v)
propyl paraben, 9.41 mM rATP, 1.8 mM rCTP, 11.8 rGTP, 1.8 mM UTP, 0.47 mM
dATP,
0.47 mM dCTP, 0.47 mM dGTP, 0.47 mM dTTP, 15 pmol priming oligonucleotide, 8
pmol
displacer oligonucleotide, and 0.5 pmol terminating oligonucleotide at pH 7.7.
Each well also
contained 0, 10, 100, 1000 or 10,000 copies of the transcript. The plate was
covered with a
scaling card and incubated for 10 minutes at 95 C in the equivalent of a DNA
Engine
Opticon 2 Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA;
Cat. No.
CFD3220) to denature the double-stranded transcript, and then for 5 minutes at
42 C to
promote hybridization of the priming oligonucleotide, the displacer
oligonucleotide and the
terminating oligonucleotide to the target nucleic acid. After incubating, the
plate was
removed from the detection system and 10 L of an enzyme reagent was added to
each test
well to initiate amplification. The enzyme reagent comprised 58 mM HEPES,
3.03% (w/v)
trehalose, 50 mM N-acetyl-L-cysteine,1.04 mM EDTA, 120 mM KC1,10% (w/v) TRITON
X-100, 20% (v/v) glycerol, 15 pmol promoter oligonucleotide, 8 pmol detection
probe, 360
RTU/ L MMLV reverse transcriptase ("RT"), and 80 U/ L T7 RNA polymerase at pH
7.0,
where one RTU of RT activity incorporates 1 nmol of dT into a substrate in 20
minutes at
37 C and one U of T7 RNA polymerase activity produces 5 fmol of RNA transcript
in 20
minutes at 37 C. Following enzyme addition, the plate was placed on a
Thermomixer R
(Eppendorf North America, Inc., Westbury, NY; Cat. No. 5355 29716) pre-warmed
to 44 C,
covered with a sealing card, and agitated for 30 seconds at 1400 rpm. The
plate was returned
to the 42 C detection system, where an amplification reaction monitored in
real-time was
-88-
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
carried out for 100 minutes, with fluorescent readings being taken every 24
seconds.
Detection depended upon conformational changes in the probes hybridized to
amplification
products, thereby resulting in the emission of detectable, fluorescent
signals.
The results of this experiment are illustrated graphically in Figure 8, where
time in
minutes is plotted on the x-axis and relative fluorescent signal is plotted on
the y-axis. The
data show that this amplification system had a sensitivity of at least 1000
copies of transcript.
None of the control samples (0 transcript) exhibited detectable amplification.
Example 14
Comparison of Systems for Amplifying a DNA Target Sequence
A set of experiments was conducted to compare the sensitivities of various
related
amplification systems of the present invention for a target region contained
within double-
stranded DNA. Like Example 13, the exemplary target nucleic acid used in this
experiment
was a cloned transcript derived from the orfX gene of a methicillin-resistant
strain of
Staphylococcus aureus. The priming oligonucleotide used in these experiments
had the base
sequence of SEQ ID NO:36. The remainder of the oligonucleotides were the same
as those
of Example 13. Except for the first experiment, each of the experiments
excluded one of the
following components of Example 13: (i) a terminating oligonucleotide; (ii) a
displacer
oligonucleotide; (iii) a priming oligonucleotide; and (iv) heat to denature
the double-stranded
target. The experiments were run in replicates of twelve following the general
protocol of
Example 13. The sets of replicates contained either 0 or 1000 copies of the
transcript.
The results of this experiment are illustrated graphically in Figures 9A-E,
where,
again, time in minutes is plotted on the x-axis and relative fluorescent
signal is plotted on the
y-axis.
The results of these experiments show the following: (i) all replicates
containing the target
were positive when the amplification system was not modified (see Figure 9A);
(ii) all
replicates containing target were positive when the terminating
oligonucleotide was excluded
from the reaction mixture (see Figure 9B); (iii) 6 out of 12 replicates
containing the target
were positive when the displacer oligonucleotide was excluded from the
reaction mixture (see
Figure 9C); (iv) 3 out of 12 replicates containing the target were positive
when the priming
oligonucleotide was excluded from the reaction mixture (see Figure 9D); and
(v) 4 out of 12
replicates containing the target were positive when the double-stranded target
was not
exposed to heat-denaturing conditions (i.e., 95 C heat step) prior to enzyme
addition (see
Figure 9E). None of the control samples (0 transcript) exhibited detectable
amplification.
* * * * ~
- 89 -
CA 02678799 2009-08-20
WO 2008/108843 PCT/US2007/063103
While the present invention has been described and shown in considerable
detail
with reference to certain preferred embodiments, those skilled in the art will
readily appreciate
other embodiments of the present invention. Accordingly, the present invention
is deemed
to include all modifications and variations encompassed within the spirit and
scope of the
following appended claims.
-90-
