Note: Descriptions are shown in the official language in which they were submitted.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
1
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims benefit to U.S. Provisional Application No.
60/893,318,
filed March 6, 2007, which is incorporated by reference in its entirety.
GOVERNMENT RIGHTS
This invention was made with government support under 1R21A1058003,
awarded by NIH/NIAID and under RG 2978-A-201 awarded by National Multiple
Sclerosis Society. The U.S. Government may have certain rights in the
invention.
BACKGROUND
The present invention relates generally to the field of immunology.
Induction of immunity to pathogens, toxins, and peptides expressed by tumor
cells, requires the coordinated participation of the innate and adaptive
immune systems.
An early step is Ag internalization by APCs of the innate immune system,
notably by
dendritic cells (DCs), the most potent APC type, and the one best able to
present Ag to
naive T cells (Trombetta and Mellman, 2005). Internalized Ag is processed
through the
endosomal/lysosomal path. Processed peptides, bound to MHC molecules, are then
delivered to the cell surface. Those T cells with appropriate receptors
respond to such
peptides provided co-stimulatory molecules are expressed by the DC. A second
signal is
often required to drive DC maturation and efficient co-stimulatory molecule
expression.
Ag activates B cells bearing appropriate surface immunoglobulin directly to
produce
IgM. CD4+ T cells, having responded to processed Ag, induce immunoglobulin
class-
switching from IgM to IgG.
Limited uptake of soluble antigenic peptide by DCs constrains subsequent Ag
processing and presentation. Immune responses increase when Ag uptake is
facilitated.
IgG-immune complexes (ICs) bind to FcyRs expressed on DCs and this is followed
by
internalization of ICs with their captured Ags. Thus, stronger Ab responses
may occur
when soluble Ag is complexed to IgG, than when Ag alone is administered
(Wernersson
et al., 1999). ICs in antibody excess can be more effective at Ag presentation
than ICs at
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
2
equivalence or in Ag excess (Manca et al., 1991). IC driven, FcyR-mediated, Ag
internalization favors DC maturation and hence expression by them of
costimulatory
molecules (Regnault et al., 1999). Other means to target Ag to Fcy receptors
on APCs
have been employed in order to elicit strong immune responses against
otherwise weak
immunogens. Early studies, that documented the potential of this approach,
employed
Ag-containing anti-FcyR monoclonal antibodies as a means to facilitate
delivery of Ag to
APCs and hence increase Ag-specific T cell responses and Ag-specific humoral
responses (Snider et al., 1990; Heijnen et al., 1996; Gosselin et al., 1992;
Keler et al.,
2000). Modification of Ig by introduction of epitopes within the CDR region
(i.e.,
antigenized Ig) may also enhance immune responses compared to Ag alone
(Zaghouani et
al., 1993, Brummeanu et al., 1996).
Immune complexes (IC) exhibit diverse biological activities; some that
contribute
to disease whereas others ameliorate disease. Deposition of IgG containing IC
on tissue
surfaces, as for example in glomeruli, can contribute to the pathogenesis of
antibody-
mediated autoimmune diseases. On the other hand, IC can favorably modulate T-
and B-
cell activation pathways via binding to Fc receptors expressed on immunocytes.
Aggregated IgG (AIG) shares some features and biological activities with IC.
Both
modulate T-cell suppressor function (Antel et al., 1981; Durandy et al.,
1981), cytokine
synthesis, IgG secretion, and lymphocyte proliferation (Berger et al., 1997;
Wiesenhutter
et al., 1984; Ptak et al., 2000).
Monomeric IgG, or the Fc fragment thereof, can ameliorate disease progression
in
animal models of autoimmune disease (Miyagi et al., 1997; Gomez-Guerrero et
al.,
2000). Monomeric IgG can be used therapeutically, usually in massive doses, to
treat
antibody-mediated diseases in man. The protective effect in antibody-mediated
diseases
may be achieved in part through blockade of FcyRs such that binding of IC to
them is
impeded (Clynes et al., 1998). IgG administration also favorably affects the
course of T-
cell mediated autoimmune diseases such as multiple sclerosis (Fazekas et al.
1997;
Sorensen et al., 1998; Achiron et al., 1998). Here the basis for benefit is
poorly
understood though it is postulated to involve the increased production of anti-
inflammatory cytokines initiated by binding of IV IgG, or complexes derived
therefrom,
to FcyR. In both antibody and T-cell mediated processes the mechanisms and
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
3
consequences of FcyR engagement are fundamental to the understanding and
treatment of
autoimmune diseases.
Aggregated IgG has been proposed as a treatment for autoimmune diseases of
humans. The use of aggregated IgG has been studied as a treatment for multiple
sclerosis
and other autoimmune diseases. However, aggregated IgG has major limitations.
IgG is
commonly aggregated by exposure to heat; the resultant aggregates are bound
together in
a random fashion limiting reproducibility from one preparation to the next.
Preparations
contain a heterogeneous collection of aggregates of varying size in diverse
conformations.
U.S. Patents 5,714,147 and 5,455,165 disclose some hybrid immunoglobulin
molecules and the expression vectors encoding them. These chimeric molecules
can
improve the circulating plasma half-life of ligand binding molecules, and can
comprise a
lymphocyte homing receptor fused to an immunoglobulin constant region. Homo or
hetero-dimers or tetramer hybrid immunoglobulins containing predominantly the
heavy
and light constant regions of immunoglobulin have been used. U.S. Patent
6,046,310
discloses FAS ligand fusion proteins comprising a polypeptide capable of
specifically
binding an antigen or cell surface marker for use in treatment of autoimmune
disorders.
The fusion protein preferably comprises IgG2 or IgG4 isotype, and may comprise
antibodies with one or more domains, such as the CH2, CH1 or hinge deleted.
Majeau et
al. (1994) discusses Ig fusion proteins used for the inhibition of T cell
responses. These
fusion proteins comprise IgGI and LFA-3. Eilat et al. (1992) disclose a
soluble chimeric
Ig heterodimer produced by fusing TCR chains to the hinge region, CH2, and CH3
domains of human IgG1.
Immunoglobulin fusion proteins can be employed to express proteins in
mammalian and insect cells (Ashkenazi, et al., 1997). Fusion protein platforms
can
permit the introduction of additional functions, for example, inclusion of the
amino-
terminal CD8a domain may result in the co-ligation of FcR on lymphocytes to
MHC I on
antigen presenting cells (Alcover, et al., 1993; Meyerson, et al., 1996).
Other Ig proteins and variants have also been studied for their therapeutic
effect
on autoimmune diseases, including a recombinant polymeric IgG that mimics the
complement activity of IgM (Smith and Morrison, 1994) where the polymeric IgG
is
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
4
formed by the polymerization of H2L2 subunits. Greenwood et al. (1993)
discusses
therapeutic potency relative to the structural motifs involving the human IgG
antibodies,
IgGI, IgG3, and IgG4. U.S. Patent 5,998,166 discloses human FcyR -III
variants, which
can be used in the therapy or diagnosis of autoimmune diseases. U.S. Patent
5,830,731
discloses novel expression vectors in which cell surface antigens cloned
according to that
invention appear to have diagnostic and therapeutic utility in immune-mediated
infections. Cell surface antigens that are used to regulate lymphocyte
activation, appear
to achieve antigen aggregation in vitro by incubating lymphocytes with
immobilized
ligands or antibodies or their fragments (W09942077). However, the aggregated
IgG
and Fc aggregates have limited reproducibility, containing a random and
heterogeneous
mixture of protein thereby limiting their effectiveness as therapeutic agents.
Other
problems include a lack of an ability to target a number of cell types with a
single agent
and size limitations.
SUMMARY OF THE INVENTION
In some embodiments, the inventive polypeptide has an immunoglobulin
framework and consists of an Fc region linked to two arms. The Fc region
consists of
two Fc amino acid chains and each Fc amino acid chain is linked to one of the
two arms.
Each arm consists of an HCH2 polymer linked to an antigen portion, the HCH2
polymer
consists of two to six linear copies of an HCH2 monomer, and the HCH2 monomer
consists of at least a fragment of an HCH2 region. At least a fragment of an
HCH2
region includes a hinge region; and at least one hinge region cysteine of the
HCH2
monomer is mutated to serine.
In exemplary embodiments, the inventive polypeptide can consist of two amino
acid chains where each amino acid chain consists of (a) an Fc portion which
includes the
C-terminus of the amino acid chain; (b) a polymer portion consisting of two to
six linear
copies of an HCH2 monomer; and (c) an antigen portion which includes the N-
terminus
of the amino acid chain. The N-terminus of the Fc portion is linked to the C-
terminus of
the polymer portion, and the N-terminus of the polymer portion is linked to
the C-
terminus of the antigen portion. The two amino acid chains are linked using
one or more
disulfide bonds located in the Fc portion of each amino acid chain. The HCH2
monomer
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
can consist of at least a fragment of an HCH2 region, wherein the at least a
fragment of
an HCH2 region includes a hinge region.
In some embodiments, the inventive polypeptide has Fc amino acid chains
selected from the group consisting of: an amino acid chain of the IgGI Fc
region, an
5 amino acid chain of the IgG3 Fc region, an amino acid chain of the IgG2a Fc
region,
SEQ ID NO: 47, SEQ ID NO: 48, and fragments thereof.
In some embodiments, the inventive polypeptide is capable of binding to FcyR
or
of targeting cells expressing FcyR.
In some embodiments, the inventive polypeptide has the HCH2 region selected
from the group consisting of: a human IgGI HCH2 region, a human IgG2 HCH2
region,
a human IgG3 HCH2 region, a human IgG4 HCH2 region, a mouse IgG2a, SEQ ID NO:
9, SEQ ID NO: 10, SEQ ID NO: 50, SEQ ID NO: 51, and fragments thereof.
In some embodiments, the inventive polypeptide has three hinge region
cysteines
of the HCH2 monomer mutated to serine.
In some embodiments, the antigen portion is an antigen or an epitope, which
can
be a protein or protein fragment, a Botulinum neurotoxin protein or fragment
thereof,
BoNT/A Hc, BoNT/A HcN, BoNT/A HcC, HSA1, CD8a, FABP7, PLP, MBP, PLP-
MBP, PLP-PLP, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29,
SEQ ID NO: 34, SEQ ID NO: 40, SEQ ID NO: 43, or fragments thereof.
In some embodiments, a composition or vaccine comprises the inventive
polypeptide.
In other embodiments, the inventive polypeptide is provided to a subject, used
in
a vaccine, or used to induce immunity.
Other embodiments include methods for making the inventive polypeptides or the
nucleic acids used to encode the inventive polypeptides.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included
to
further demonstrate certain aspects of the present invention. The invention
may be better
understood by reference to one or more of these drawings in combination with
the
detailed description of specific embodiments presented herein.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
6
FIG. 1. Design Rationale. Schematic depicts the design rationale utilized in
the
construction of the HCH2 polymer, a feature of which is the iterative
regeneration of
cloning sites in the extension step. The OHCH2 shown in the schematic
represents an
HCH2 monomer in which the hinge cysteines have been changed to serines.
FIG. 2. Schematic illustrating the structures of IgG, Fc fusion protein,
HCH2 polymers, R2, R3, and R4. Drawing on the left represents IgGI
polypeptide.
The element labeled Fc represents the IgGi framework composed of the hinge,
CH2 and
CH3 domains of human IgGI with one light chain missing to reveal heavy chain
structure.
The small chain extending from the CH2 region represents N-linked carbohydrate
at
Asn297. The second drawing depicts an Fc fusion protein wherein an antigen
portion
(represented as a hexagon in the drawing and labeled as antigen) has been
fused to the Fc
region. The third drawing shows an HCH2 polymer. The darkened ovals represent
4
repeated hinge region and CH2 domain units. To prevent inter-chain disulfide
bond
formation between repeat units, hinge region cysteines were mutated to
serines. The
mutations leave intact those hinge residues known to interact with FcyRs. The
final three
drawings show HCH2 polymers with 2, 3, and 4 HCH2 monomers per polymer
integrated into Fc fusion protein structure.
FIGS. 3A, and 3B. Western Blot analyses of Fc, R2, R3 and R4. FIG. 3A.
Recombinant proteins were separated on 7% SDS-PAGE gels and stained with
Coomassie brilliant blue dye to reveal protein. FIG. 3B. Recombinant proteins
were
transferred to nitrocellulose membrane and stained with antibodies directed
against
human Fc. Note that the human IgG control and the fusion proteins are
recognized by
anti-Fc antibody.
FIG. 4. Western blot Analysis. HSA1R4 and MSA1mR4 (75 ng) were
electrophoresed on 7% SDS-polyacrylamide gels (SDS-PAGE). Gels were either
stained
with Coomassie Blue to reveal total protein(Panel A) or transferred to
nitrocellulose
membranes for Western Blot analysis (Panels B and C). Panel A. MSA1mR4 (Lane
M)
and HSA1R4 (Lane H) were resolved on SDS-PAGE gels and stained to reveal total
protein. As expected, the panel shows that MSA1mR4 and HSA1R4 have similar
molecular weights. Panel B. MSA1mR4 and HSA1R4 were run on SDS-PAGE gels and
transferred to a nitrocellulose membrane. The membrane was probed with goat
anti-
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
7
mouse IgG2a-HRPO (Caltag) to reveal the presence of proteins with mouse IgG2A
sequences. Only MSA1mR4 bound the antibody indicating that MSA1mR4 and
HSA1R4 are antigenically distinct. Panel C. The membrane from Panel B. was
stripped
of detecting antibody and reprobed with goat anti-human Fc-HRPO (Bethyl Labs)
to
reveal human Fc sequences. Only HSA1R4 bound the detecting antibody again
indicating
that HSA1R4 and MSA1mR4 are distinct.
FIG. 5. Binding of Clq to HSA1R4 measured by ELISA. HSA1R4, HSA1Fc,
and monomeric human IgG (Sigma Corp.) were immobilized onto ELISA plates at 2
to
g/ml. Clq was added to ELISA plates at 4 g/ml. Bound Clq was detected using
10 HRP conjugated goat anti-Clq IgG followed by OPD addition. Data are
expressed as
O.D. Approximately equal amounts of Clq bind HSA1R4, HSA1Fc, and monomeric
IgG at all concentrations of ligand tested. Data shown are representative of
three separate
experiments.
FIG. 6. R4 ligand binds far more efficiently to FcyR than monomeric Ig or
Ig fusion proteins. Panels A-E display binding results for five different Fc
receptors.
Low-affinity FcyR were coated onto 96 well plates at 4 g/mL, FcyRI was at 2
g/mL.
Plates were washed, blocked, and overlain with the FcyR ligands at the
indicated
concentrations. Plates were washed and bound ligand was detect using HRPO-
Protein G
which binds all ligands at a single site. Results shown are from a
representative assay of
four performed.
FIG. 7A, 7B, 7C. HSA1R4 binds to FcyRs expressed on the surface of living
cells. Flow cytometric analysis of HSAIR4 binding detected with FITC anti-HSA
goat
Ig is shown in black; background fluorescence of cells stained with HSAIR4 and
FITC
goat Ig in white. FIG. 7A. Pre-incubation with antibody to FcyRI (clone 10.1)
partially
blocks binding of HSAIR4 to U937 cells (gray). FIG. 7B. Preincubation with
antibody
to FcyRII (clone FLI8.26) partially blocks binding of HSAIR4 to U937 cells
(gray). Fig.
7C. Preincubation with antibody to both FcyRI and FcyRII completely blocks
binding of
HSA1R4 to U937 cells (gray).
FIG 8. HSA1R4 induces greater proliferative responses in PBMC than does
HSAIR3, HSA1R2, or HSA1Fc. PBMC activation with HCH2 polymer proteins
correlates directly with the number of HCH2 region repeats indicating a high
level of
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
8
sensitivity of Fcy receptors to HCH2 number in the HCH2 polymer proteins. 2 x
105
freshly isolated PBMC were plated into 96 well plates in the presence of
medium alone,
or with IL-2 (1 ng/mL) and varying concentrations of HSA1R4, HSA1R3, HSA1R2,
or
HSA1Fc for 72 hr. During the last 5 hr the cells were pulsed with 1 Ci of
[methyl-3H]
thymidine. The graph compares the proliferative response of PBMC to varying
dilutions
of each HCH2 polymer protein used. CPM is shown on the y-axis and
micrograms/ml of
HCH2 polymer protein used is shown on the x-axis. The dose response curves
show that
as the number of HCH2 repeats increases in each ligand so does the efficiency
with
which it induces PBMC proliferation. HSA1R4 induces significantly greater
proliferation by PBMC than does HSA1R3, HSA1R2, and HSA1Fc at the
concentrations
indicated on the figure. *Fc = p<.05 for HSA1Fc vs HSA1R4; *R2 = p<.05 for
HSA1R2
vs HSA1R4; *R3 = p<.05 for HSA1R3 vs HSA1R4, students' paired TTest. cpm of
PBMC in medium = 787 447; with IL-2 = 1957 1117; with HSA1Fc (20 g/ml) _
778 132; with HSA1R2 (20 g/ml) = 898 229; with HSA1R3 (20 g/ml) = 964
250; with HSA1R4 (20 g/ml) = 1131 270. Data represent the average from four
individuals SEM.
FIG. 9. I.V. injection of HSA1R4 increases HSAl-specific IgG antibody
responses in SJL mice. HSA 1 R4 increases HSA 1-specific IgG antibody
responses in
SJL mice following i.v. injection of 50 g of HSA1R4, HSA1Fc, or HSA1. Titers
of
HSA-reactive IgG at two wk post-immunization (four mice per group) are shown
as a
mean SEM. Also shown are IgGI and IgG2c titers of the same sera. HSA-
specific
antibody titers are significantly higher in mice receiving HSA1R4 than in mice
receiving
HSA1 (p<0.001) or HSA1Fc (p<0.05). ND = not done.
FIG. 10A, lOB. HSA1R4 in Ribi adjuvant enhances antigen specific antibody
responses in SJL mice. FIG. 10A. Mice were immunized with 50 ug of HSA1R4 (n =
6), HSA1Fc (n = 4), or HSA1 (n = 5) subcutaneously. Sera were obtained two wk
later.
Titers of total IgG reactive with HSA are shown as a mean SEM as are IgGi
and IgGZc
HSA-specific titers. HSA-specific Ab titers are higher in mice receiving
HSA1R4 than in
mice receiving HSA1Fc (p=0.01) or HSA1 (p <0.001). FIG. 10B. Mice were
immunized
with 250 ng of HSA1R4 (n = 8) or HSA1Fc (n = 7) subcutaneously in Ribi
adjuvant.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
9
Anti-HSA Ab titers are higher in mice given HSA1R4 than in mice receiving
HSA1Fc
(p<0.001).
FIG. 11. HSA1R4 increases HSA1-specific Ab responses in C57BL/6 mice.
Mice were immunized with 50 g of HSA1R4, HSA1Fc, and HSAI subcutaneously in
Ribi adjuvant. Sera were obtained two weeks later (7 mice per group). Titers
of HSA-
reactive IgG are shown as mean SEM. HSA-specific Ab titers are 10 fold
higher in
mice given HSA1R4 than in mice given HSA1Fc (p<0.05) and 50 fold higher than
in
mice given HSA1 (p<0.005).
FIG. 12A, 12B. FIG. 12A. HSA1-induced T cell proliferation is higher in
splenocytes from mice immunized with HSA1R4 than in splenocytes from mice
immunized with HSA1Fc (p<0.004). Shown are proliferative responses of cells
from
mice immunized 2 wk previously with HSA1R4 or HSA1Fc in Ribi adjuvant, and
challenged in vitro with HSA1. Data shown are the mean SEM of four
experiments.
FIG. 12B. HSA1R4 augments presentation of HSA1 to HSA-reactive T cells. Shown
are
proliferative responses of cells isolated from spleens of mice immunized 14
days
previously with HSA in CFA following in vitro challenge with HSA1R4, HSA1Fc,
or
HSA 1(1.6 x 10"9 M for each). HSA 1 R4 leads to greater T cell reactivity
(p<0.008 vs
HSA1Fc; p<0.001 vs HSA1). Data shown are the mean SEM of four experiments.
FIG 13. Schematic of BoNT/A toxin organization. BoNT is expressed as a
single chain 150 kD polypeptide which following proteolytic cleavage results
in a light
chain (-50 kD) linked by disulphide bonds to a heavy chain (-100 kD). BoNT
activities
map to discrete regions within the polypeptide chains: Endoprotease activity
resides
within the light chain. The heavy chain is responsible for receptor binding
and
translocation. The heavy chain can be further subdivided both functionally and
proteolytically into an amino-terminal fragment (HN), involved in ion-channel
formation
and light chain translocation, and a carboxyl-terminal fragment (Hc) involved
in receptor
binding. The Hc fragment is composed of two -200 amino acid sub-domains that
are
structurally distinct; the amino-terminal portion, HcN (residues 871 to 1078
of the
holotoxin) and the carboxyl-terminal portion, HcC (residues 1090 to 1296 of
the
holotoxin).
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
FIG. 14. HcR4 antigens bind efficiently to FcyR. Panels A-E display binding
results for five different Fc receptors. The binding of the HcR4 ligand to
FcyR was
determined using the receptor binding assay described in Example 6. HcR4 was
incubated with immobilized receptors at the indicated concentrations. Plates
were
5 washed and bound ligand was detected as described. Results shown are from a
representative assay of three performed.
FIG 15. HcR4 and HcmR4 increased Hc-specific antibody responses in high
responder SJL mice. SJL mice were immunized with a single 1.0 ug or 0.5 ug
dose of
Hc, HcR4, or HcmR4. Serum was collected 14 days after immunization and the Hc-
10 specific antibody titers were determined. HcmR4 and HcR4 induced higher
antibody
responses than Hc alone at both the 1.0 ug and 0.5 ug doses.
FIG 16. HcR4 increased Hc-specific antibody responses in low responder
C57BL/6 mice. A. Mice were immunized with 5 g of Hc or HcR4 SC in Ribi
adjuvant
(10 mice per group). Sera were obtained 14 days later and anti-Hc titers were
determined
using ELISA. Shown are the results from a 1:250 dilution of sera. The means
are
marked by a line. The difference between the means is significant (p<0.03). B.
Mice
were immunized with 10 g of Hc or HcR4 SC as described and Hc-specific titers
were
determined 14 days later. The means are marked by a line.
FIG 17. HcR4 leads to greater induction of secondary T cell responses to
recall antigens. LN cells were isolated from SJL mice 14 days post
immunization with
Hc. LN cells were challenged in vitro with Hc, HcR4, or HcmR4 as indicated. A.
HcR4
leads to greater T cell reactivity at 3.6 x 10-$ M vs Hc (p<0.03). B. Priming
at the lower
1.2 x 10-8 M dose produces a similar trend. Mean SEM of results from 4 mice.
FIG 18. Intranasal delivery of HcR4 results in large and rapid Hc-specific
antibody responses: SJL mice (n = 5) received 25 g of HcR4 in 10 L PBS
instilled
into each nostril on days 0, 7, and 14. Serum was obtained at days 21 and 28
and Hc
specific IgG titers were determined.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
11
DETAILED DESCRIPTION
The present invention concerns inventive polypeptides. The present invention
also concerns compositions and vaccines comprising the inventive polypeptides.
This
invention describes vaccines and methods of inducing immunity against an
antigen using
inventive polypeptides described herein. The present invention provides for
improved
vaccine efficacy by targeting Ag to Fcy receptors using multiple copies of
HCH2 of a
human IgG. The vaccines of the present invention can be applied, for example,
in the
induction of immunity to pathogens, toxins, and peptides expressed by tumor
cells. In
other embodiments of the invention, the inventive polypeptides are provided to
a subject.
Still other embodiments include methods for making the inventive polypeptides
and
nucleic acids used to encode the inventive polypeptides.
A. Antibody structure
Antibodies comprise a large family of glycoproteins with common structural
features. An antibody is comprised of four polypeptides that form a three
dimensional
structure which resembles the letter Y. Typically, an antibody is comprised of
two
different polypeptides, termed the heavy chain and the light chain.
An antibody molecule typically consists of three functional regions: the Fc,
Fab,
and antigen-binding site. The Fc region is located at the base of the Y. The
arms of the
Y comprise the Fab region. The antigen-binding site is located at the end of
each arm of
the Y. The area at the fulcrum of the arms of the Y is the hinge region.
There are five different types of heavy chain polypeptides designated as a, S,
E, y,
and . There are two different types of light chain polypeptides designated x
and X. An
antibody typically contains only one type of heavy chain and only one type of
light chain,
although any light chain can associate with any heavy chain.
Antibody molecules are categorized into five classes, IgG, IgM, IgA, IgE, and
IgD. The IgG class is further divided into subclasses including IgGl, IgG2,
IgG3, and
IgG4 for human IgG. An antibody molecule is comprised of one or more Y-units,
each Y
comprising two heavy chains and two light chains. For example IgG consists of
a single
Y-unit. IgM is comprised of 5 Y-like units.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
12
Amino acids toward the carboxyl terminal of each heavy chain polypeptide make
up a constant region. Amino acids toward the amino terminal of each heavy and
light
chain polypeptide make up a variable (V) region. Within the variable region
are
hypervariable regions known as complementarity determining regions (CDRs). One
heavy chain and one light chain associate to form an antigen-binding site.
Each heavy
chain and each light chain includes three CDRs. The six CDRs of an antigen-
binding site
define the amino acid residues that form the actual binding site for the
antigen. CDR
variability accounts for the diversity of antigen recognition.
The mature human IgGI heavy (H) chain can span 447 amino acid residues. The
Fc region of the H chain is essentially the same for all IgGI heavy chain
molecules. The
Fc region is the portion of the IgGI polypeptide that interacts with Fc
receptors. The Fc
region can be further subdivided into three consecutive parts, the hinge
region, the CH2
domain, and the CH3 domain. For human IgGl, the binding site for Fc receptors
is found
within the hinge and CH2 (HCH2) region. The HCH2 region encompasses amino acid
residues 216 to 340 of the human IgGl H chain.(Eu numbering). The hinge region
spans
residues 216 to 237 whereas the CH2 domain encompasses residues 238 to 340.
B. Some exemplary embodiments of inventive polypeptides and exemplary
methods of making
Capon, et al., 1989, Traunecker, et al., 1989, Chamow, et al., 1996, and
Ashkenazi, et al., 1997 disclose some examples of fusion proteins related to
immunology.
A recombinant immunoglobulin fusion protein can have an amino-terminus
composed of
a ligand-binding domain fused to a carboxyl-terminus composed of the hinge,
CH2, and
CH3 regions of Ig. The Ig class sometimes used is IgGI. The hinge, CH2, and
CH3
regions of IgG are collectively referred to as the Fc region of IgG. The hinge
region can
provide a flexible linker between the Fc region and the ligand binding domain.
It also is
the site of inter-chain disulphide bond formation, i.e., the covalent linking
of one
antibody amino acid chain to another to make the familiar dimeric structure.
The hinge
region (e.g., the part nearest to the CH2 domain, known as the hinge proximal
region) is
associated with molecular recognition and binding to Fcy receptors and
complement
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
13
components. Thus, some recombinant immunoglobulin fusion proteins are similar
to Ig
but lack the variable regions and the CH1 domain, which have been replaced by
the
ligand-binding domain. Sometimes, the recombinant molecule is generated at the
cDNA
level using recombinant DNA techniques and expressed in cell culture. In some
instances, the recombinant immunoglobulin fusion protein is a disulfide-linked
homodimer. There have been some variations on the above described fusion
proteins.
For example, in addition to ligand- binding domains, other fusion partners
have been
placed at the amino-terminus, such as ligands, enzymes, and peptide epitopes.
The term "amino acid chain" includes a linear chain of amino acids. The amino
acid chain can be chemically or biochemically modified (such as, but not
limited to,
glycosylation or phosphorylation) or derivatized amino acids, and can have a
modified
peptide backbone.
The term "polypeptide" refers to a polymeric form of amino acids of any
length,
and includes chemically or biochemically modified or derivatized amino acids,
as well as
amino acid chains having modified peptide backbones. The term includes amino
acid
chains that are linked, for example, by one or more disulfide bonds, proteins,
amino acid
chains, saccharides, or polysaccharides.
A "fragment" of a polypeptide or protein refers to a polypeptide that is
shorter
than the reference polypeptide or protein, but that can retain a biological
function or
activity that is recognized to be the same as the reference polypeptide or
protein. Such an
activity may include, for example, the ability to stimulate an immune
response. A
fragment may retain at least one epitope of the reference polypeptide or
protein. The
shorter polypeptide may retain all or part of a modification (e.g., by
glycosylation or
phosphorylation) of the reference polypeptide or protein.
"Immunological framework" refers to a molecule that comprises two arms
attached to an Fc region. The Fc region has the primary structural components
of an
antibody Fc region, but the arms can be comprised of any molecule and thus are
not
limited to the Fab-antigen structures of an antibody.
In exemplary embodiments, the inventive polypeptide can consist of two amino
acid chains where each amino acid chain consists of (a) an Fc portion which
includes the
C-terminus of the amino acid chain; (b) a polymer portion consisting of two to
six linear
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
14
copies of an HCH2 monomer; and (c) an antigen portion which includes the N-
terminus
of the amino acid chain. The N-terminus of the Fc portion is linked to the C-
terminus of
the polymer portion, and the N-terminus of the polymer portion is linked to
the C-
terminus of the antigen portion. The two amino acid chains are linked using
one or more
disulfide bonds located in the Fc portion of each amino acid chain. The HCH2
monomer
can consist of at least a fragment of an HCH2 region, wherein the at least
fragment of an
HCH2 region includes a hinge region. In some embodiments, at least one hinge
region
cysteine of the HCH2 monomer is mutated to serine. The Fc portion can
comprise, for
example, SEQ ID NO: 47 or SEQ ID NO: 48.
In other exemplary embodiments, the inventive polypeptide has an
immunoglobulin framework consisting of an Fc region consisting of two amino
acid
chains wherein each amino acid chain is linked to an arm. Each arm can consist
of an
HCH2 polymer linked to an antigen portion. The HCH2 polymer can consist of two
to
six linear copies of an HCH2 monomer, which consists of at least a fragment of
an HCH2
region. In some embodiments at least one hinge region cysteine of the HCH2
monomer
is mutated to serine, or another non-cysteine amino acid. Sometimes all the
hinge region
cysteines are mutated. In some embodiments, the Fc region comprises the linked
Fc
portions.
The inventive polypeptide can, for example, bind to FcyR, target cells
expressing
FcyR, or complement components.
The Fc region can be selected or derived from any animal, mammalian, mouse, or
human antibody. For example, the Fc region can combine polypeptides of Fc
regions
from IgG1, IgG2, IgG3, IgG4, IgA, IgD, IgM, IgE, IgG2a, or fragments thereof.
In some
embodiments, the combined polypeptides are identical. Some embodiments of the
fragments include fragments comprising a hinge region, a CH2 domain, and a CH3
domain. Exemplary embodiments of sequences that can be used to form the amino
acid
chain of the Fc region can include, but are not limited to SEQ ID NO: 47 and
SEQ ID
NO: 48.
Linkers can include, but are not limited to, amino acid chains, disulfide
bonds,
saccharides, polysaccarides, or any known linkers. For example, amino acid
chains up to
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 18, or 20 amino acids can be used as
linkers.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
In some embodiments, the HCH2 monomer can be selected or derived from an Fc
region of any animal, mammalian, mouse, or human antibody. It can be a
polypeptide
from the Fc regions of, for example, but not limited to, IgGI, IgG2, IgG3,
IgG4, IgA,
IgD, IgM, IgE, IgG2a, or fragments thereof. For example, the HCH2 region can
be
5 selected from the group consisting of: a human IgGI HCH2 region, a human
IgG2 HCH2
region, a human IgG3 HCH2 region, a human IgG4 HCH2 region, a mouse IgG2a
region,
and fragments thereof. Exemplary embodiments of sequences that can be used in
an
HCH2 monomer include,. but are not limited to, SEQ ID NO: 9, SEQ ID NO: 10,
SEQ ID
NO: 51, and SEQ ID NO: 52.
10 The HCH2 polymer can be made from, for example, 1, 2, 3, 4, 5, 6, 7, or 8
linear
copies of an HCH2 monomer.
The antigen portion includes, but is not limited to, antigens, polypeptides,
proteins
protein fragments, or any combination thereof. For example, the antigen
portion can
include proteins or protein fragments linked together in a serial fashion,
such as PLP
15 linked to PLP, a fragment of PLP linked to PLP, a fragment of PLP linked to
another
fragment of PLP, a fragment of PLP linked to a fragment of MBP, MBP linked to
a
fragment of PLP. In some embodiments, the antigen portion is a Botulinum
neurotoxin
protein, including for example, BoNT/A, BoNT/B, BoNT/C, BoNT/D, BoNT/E,
BoNT/F, BoNT/G, BoNT/A Hc, BoNT/A HcN, BoNT/A HcC, or portions, fragments, or
variants thereof. In some embodiments, the antigen portion can contain at
least one
antigenic domain or epitope of an infectious agent, microorganism, tumor
antigen, or self
protein, including for example, cancer antigens (such as, sarcoma, lymphoma,
leukemia,
melanoma, carcinoma of the breast, colon carcinoma, carcinoma of the lung,
glioblastoma, astrocytoma, carcinoma of the cervix, uterine carcinoma,
carcinoma of the
prostate, ovarian carcinoma, or portions, fragments, or variants thereof),
antigenic
domains of infectious agents, antigenic domains of viruses (such as, papilloma
virus,
Epstein Barr virus, herpes virus, retrovirus, hepatitis virus, influenza
virus, herpes zoster
virus, herpes simplex virus, human immunodeficiency virus 1, human
immunodeficiency
virus 2, adenovirus, cytomegalovirus, respiratory syncytial virus, rhinovirus,
or portions
or variants thereof), antigenic domains of a bacteria (from bacteria such as,
Salmonella,
Staphylococcus, Streptococcus, Enterococcus, Clostridium, Escherichia,
Klebsiella,
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
16
Vibrio, Mycobacterium, Mycoplasma pneumoniae, or portions or variants
thereof), toxin
polypeptides (such as, abrin, a conotoxin, diacetoxyscirpenol, ricin,
saxitoxin, a Shiga-
like ribosome inactivating protein, flexal, guanarito, junin, machupo, sabia,
tetrodotoxin,
a Botulinum neurotoxin, Clostridium perfringens epsilon toxin, a Shigatoxin,
Staphylococcal enterotoxin, T-2 toxin, Bovine spongiform encephalopathy agent,
epsilon
toxin, ricin toxin, Staphylococcal enterotoxin B, influenza virus
hemagglutinin, toxoids,
or portions, fragments, or variants thereof), tumor antigens (such as, KS 1/4
pan-
carcinoma antigen, ovarian carcinoma antigen (CA125), prostatic acid
phosphate,
prostate specific antigen, melanoma-associated antigen p97, melanoma antigen
gp75,
high molecular weight melanoma antigen (HMW-MAA), prostate specific membrane
antigen, carcinoembryonic antigen (CEA), polymorphic epithelial mucin antigen,
human
milk fat globule antigen, colorectal tumor-associated antigens such as: CEA,
TAG-72,
C017-1A; GICA 19-9, CTA-1 and LEA, Burkitt's lymphoma antigen-38.13, CD19,
human B-lymphoma antigen-CD20, CD33, melanoma specific antigens such as
ganglioside GD2, ganglioside GD3, ganglioside GM2, ganglioside GM3, tumor-
specific
transplantation type of cell-surface antigen (TSTA), bladder tumor oncofetal
antigen,
differentiation antigen such as human lung carcinoma antigen L6, L20, an
antigen of
fibrosarcoma, human leukemia T cell antigen-Gp37, neoglycoprotein, a
sphingolipid,
EGFR, EGFRvIII, FABP7, doublecortin, brevican, HER2 antigen, polymorphic
epithelial
mucin (PEM), malignant human lymphocyte antigen-APO-1, an I antigen, M18, M39,
SSEA-1, VEP8, VEP9, Myl, VIM-D5, D156_22, TRA-1-85, C14, F3, AH6, Y hapten,
Ley,
TL5, EGF receptor, FC10.2, gastric adenocarcinoma antigen, CO-514, NS-10, CO-
43,
G49, MH2, a gastric cancer mucin, T5A7, R24, 4.2, Gp3, D1.1, OFA-1, GM2, OFA-
2, GD2,
M1:22:25:8, SSEA-3, SSEA-4, or portions, fragment, or variants thereof),
autoantigens
from a mammal (such as, myelin basic protein (MBP), proteolipid protein (PLP),
myelin-
associated glycoprotein (MAG), myelin oligodendrocyte glycoprotein (MOG),
collagens,
insulin, proinsulin, glutamic acid decarboxylase 65 (GAD65), an islet cell
antigen,
portions, fragments, or variants thereof). Other examples of antigen portions
include, for
example, HSA, HSA1 (HSA domain 1), HSA2 (HSA domain 2), HSA3 (HSA domain 3),
Fatty Acid Binding Proteins (FABP) such as FABP1, FABP2, FABP3, FABP4, FABP5,
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
17
FABP6, FABP7, FABP8, FABP9 including FABP5-like 1-7; other examples of antigen
portions can be found throughout the application.
While not being by any particular theory, the immunoglobulin Fc region appears
to provide some features of the IgG fusion proteins such as stability,
covalent
dimerization, single-step purification, and ease of detection. The intervening
HCH2
polymer appears to confer increased effector function, including, for example,
targeting
to subsets of cells expressing FcyR, increased capacity to ligate FcyR, and to
bind
complement components. The amino-terminal domain can deliver a second signal.
Thus, multiple molecular signals can be integrated into a single molecule with
the
potential for synergistic interaction between the domains.
The inventive polypeptide comprises multiple HCH2 regions. The polymers were
developed using a cloning system that can result in the rapid addition of HCH2
units into
a human IgG, Fc region expression vector. Each HCH2 region can be composed of
the
hinge and CH2 domain from an Ig such as IgGI, which encompasses the region
that can
bind FcyR and complement. In some embodiments, to prevent inter-chain
disulfide bond
formation between the HCH2 region of the polymer, hinge region cysteines of
the HCH2
monomer unit were mutated to serines. These mutations can leave intact those
hinge
residues that interact with FcR and complement. The hinge within the Fc vector
was not
mutated thus retaining the dimeric structure of IgG. Several unique
restriction sites on
the 5' end can allow for the directional cloning of amino-terminal domains
into the
polymer expression constructs.
In some embodiments of the invention, it is not necessary for the entirety of
the
HCH2 region to be employed in making the HCH2 monomer. As described above, the
entire human IgGI HCH2 encompasses amino acid residues 216 to 340 of the human
IgGI H chain (Eu numbering), with the hinge region spaning residues 216 to 237
and the
CH2 domain encompassing residues 238 to 340. The interactions between IgG and
Fc
receptors have been analyzed in biochemical and structural studies using wild
type and
mutated Fc. One consensus indicates that some regions for binding to Fc
receptors are
located in the part of the hinge region closest to the CH2 domain and in the
amino-
terminus of the CH2 domain that is adjacent to the hinge, including for
example residues
233-239 (Glu-Leu-Leu-Gly-Gly-Pro-Ser). Mutations within this region can result
in
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
18
altered binding to Fc receptors. This region appears to be responsible for
some of the
direct interactions with Fc receptors. Further into the CH2 domain, and away
from the
hinge, are other residues that may, at least in some contexts, contribute to
Fc receptor
binding, including for example, Pro-329 which appears involved in direct
contact with
the Fc receptor and Asn-297 which appears to be the sole site for N-linked
glycosylation
within the Fc region. The presence of carbohydrate at this residue may
contribute to the
binding to Fc receptors. Peptides spanning residues 233-239 of IgGI Fc may
bind to
FcyRI1I poorly.
In the examples presented below the HCH2 polymers were constructed using the
human IgGI HCH2 region that encompasses amino acid residues 216 to 340 of the
human IgGI H chain. This region contains the sequences that may contribute to
Fc
receptor binding as well as additional flanking residues. The flanking
residues provide
structural stability and spacing between the HCH2 regions. In some embodiments
it can
be advantageous to construct HCH2 polymers comprised of fragments within the
HCH2
region instead of the entire HCH2 region. This may be done for example to
reduce the
size of the HCH2 monomer and hence the HCH2 polymer. One way that this could
be
achieved is through the deletion of flanking residues on either side of the
region that has
been identified with Fc receptor binding. For instance the hinge could be
truncated to
span residues 233 to 237 instead of residues 216 to 237 as used in the
examples presented
herein. Similar considerations apply to the CH2 region that spans residues 238-
340 and
to the hinge and CH2 regions of other Ig's including IgA, IgD, IgG2, IgG3,
IgG4, and
IgE. Other embodiments include different configurations of portions of HCH2
regions.
The HCH2 polymers can bind to low affinity FcR. In some instances the HCH2
polymers can bind the high affinity FcR receptors, for instance the FcyRI
receptor. This
is a natural consequence of the high binding affinity of the high affinity FcR
receptors for
the HCH2 region.
In some instances it can be advantageous to construct HCH2 polymers that bind
all forms of the low affinity FcyR receptors such as, for example, FcyRIIa,
FcyRIIb,
FcyRIIc, FcyRIIIa, and FcyRIIIb. In other embodiments the number and spacing
of
HCH2 monomers comprising the polymer are varied to increase the binding to one
type
of FcR receptor or conversely to decrease binding to another type of FcR
receptor. In yet
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
19
other embodiments alterations to the HCH2 monomer can be made to increase
specificity
of the polymer for one type of FcyR receptor or to decrease specific binding
to another
type of FcyR receptor. Such alterations are achieved by mutating certain amino
acid
residues within the HCH2 sequence to other amino acid residues. The choice of
residues
to mutate within the HCH2 unit can be informed by choice of target receptor
specificity.
In other embodiments the specific binding of the HCH2 polymers to different
FcyR
receptors can be enhanced by the presence of and type of glycosylation of the
HCH2
polymer. Choice of expression system in which to produce the HCH2 polymers in
part
determines the extent and type of glycosylation.
In the examples presented herein the HCH2 polymers were constructed using
DNA sequences from human IgGI. In some instances it can be advantageous to
construct HCH2 polymers comprised solely of human sequences to use as
immunotherapeuticagents in humans. However in some embodiments the polymers
are
assembled from sequences of other Ig's including IgA, IgD, IgG, IgM, and IgE.
In other
embodiments the HCH2 polymers are assembled from sequences of more than one
type
of Ig, for example a polymer containing HCH2 monomers derived from IgG
sequences
are linked to HCH2 monomers derived from IgE sequences. In other embodiments
the
HCH2 polymers are comprised of non-human sequences. The choice of sequences
can
be determined by the target receptor and host identity (human or non-human).
In yet
other embodiments the hinge region cysteines are mutated to amino acid
residues other
than serine. In some embodiments the HCH2 monomer may be altered or mutated to
bind complement components and not to bind to FcR. In other embodiments the
HCH2
monomer may be altered or mutated to bind FcR and to not bind complement.
In some examples presented herein the HCH2 polymers were constructed using
DNA sequences from human IgGI. The expressed proteins have been evaluated for
their
interactions with low affinity FcyR receptors. However in some embodiments the
HCH2
polymers are assembled from sequences of other Ig's including IgA, IgD, IgG,
IgM, and
IgE and these polymers may bind to and interact with the FcR for other Ig's
including
FcaR, FcsR, Fc R, FcSR, and FcRn. In other embodiments the polymers are
assembled
from sequences of more than one type of Ig, for example a polymer protein
containing
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
HCH2 units derived from IgG sequences and IgE sequences will interact and bind
with
the FcR for more than one type of Ig.
In the examples presented herein the HCH2 polymers are constructed from HCH2
monomers consisting of full length HCH2 regions. In some embodiments it may be
5 advantageous to construct HCH2 polymers that contain HCH2 monomers that are
smaller
than full length HCH2 regions. HCH2 polymers derived from a smaller HCH2
monomer
would have a smaller size and mass and yet still retain the ability to
effectively bind to
and activate FcR or complement. The reduction in the size of the HCH2 monomer
is
achieved by the removal of sequences that have diminished involvement in the
binding to
10 FcR or complement. In some embodiments, the identities of these sequences
are known,
as are the methods for their removal from the HCH2 monomer unit. The removal
of
these sequences could maintain the desired binding but yield a polymer of
smaller mass.
Recombinant HCH2 polymer constructs can mimic the biological activity and
functions of immune complexes (ICs), of aggregated IgG (AIG), and of
aggregated Fc.
15 The use of recombinant HCH2 polymer construct can offer several advantages
over AIG
or Fc aggregates. The number and construction of HCH2 monomers can be altered
to
hone interaction with FcR's. Aggregates are by nature heterogeneous with
considerable
variation between batches whereas inventive polypeptides are precisely
defined.
The receptors can be specifically activated with constructs containing
different
20 numbers of HCH2 monomers. As shown herein, the number of repeating HCH2
monomers available to bind receptor can influence cell function. Cell function
can be
changed with insertion of additional HCH2 monomers. The constructs of the
present
invention allow for the measurement of change in receptor function based on IC
size.
The number of repeating HCH2 monomers included within the polymer construct is
variable and can be selected to optimize biological activity. In one
embodiment the
HCH2 polymers are assembled as disulfide-linked homodimers. In some
embodiments
the HCH2 polymers are assembled as monomers (e.g., a single chain polypeptide
of
HCH2 monomers), or hetero- or homo-multimers, and particularly as dimers,
tetramers,
and pentamers.
A nonlimiting list of proteins or protein fragments are found throughout the
application and include, for example, ligand-binding domains, extracellular
domains of
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
21
receptors, enzymes, adhesion molecules, cytokines, peptide hormones,
immunoglobulin
fragments (Fab'), ligands, antigens, and fragments thereof. The site of the
fusion of the
protein or protein fragment connecting it to the linker or HCH2 polymer may be
selected
to optimize biological activity, stability, secretion, avidity, and binding
specificity.
HCH2 polymers using IgGl were designed using sequence data from the human
IgGI constant region gene as a guide (accession # Z17370). Several amino
terminal
domains have been expressed fused to the HCH2 polymers: the extracellular
domain of
human CD8a (accession # M12824), domain I of human serum albumin (accession #
V00494), murine fatty acid binding protein 7 (accession # BC057090), human
fatty acid
binding protein (accession # BC012299), the Hc, HcN, HcC fragments of
Botulinum
neurotoxin subtype A as well as antigen portions and combinations of PLP and
MBP.
For some uses it may be advantageous to construct HCH2 polymers composed of
the
HCH2 polymer region unfused to additional protein domains or Fc or framework
sequences.
In certain embodiments, the inventive polypeptides are produced by the
insertion
of the HCH2 polymeric region into an existing antibody sequence or the
sequence of a
recombinant protein. This process can be advantageous because of its
simplicity. The
HCH2 polymeric region is a discrete, modular DNA element designed for easy
transfer
from one cDNA construct to another. A modular DNA element is sometimes
referred to
as a`cloning cassette.' The HCH2 polymeric region can be used as a cloning
cassette
and simply spliced into the existing cDNA for any protein, thus removing
several steps
from the formation process. In certain circumstances the precise site of
insertion within a
protein sequence can be determined by experimentation. Using the approach
presented in
this application, existing monoclonal antibodies and recombinant
immunoglobulin fusion
proteins can be modified through the addition of the HCH2 polymer region.
Of course, any of the mentioned polypeptides (e.g., those specifically or
generally
described herein) that are used to construct the inventive polypeptide or
parts or portions
thereof, can be made from polypeptides that are substantially similar (as
defined herein)
to the mentioned polypeptides.
The inventive polypeptide may be an ingredient or component of a composition,
including, for example, a vaccine, emulsion, solution, pill, or any other
liquid or solid
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
22
composition that may be administered to any organism including, for example,
plant,
animal, mammal, mouse or human. The inventive polypeptide may be glycosylated
or
free from glycosylation.
In some embodiments the invention includes methods for producing an inventive
polypeptide comprising (1) preparing a vector comprising the nucleic acid
sequence
encoding the polypeptide; (2) transfecting a host cell with the vector; (3)
culturing the
host cell to provide expression; and (4) recovering the polypeptide.
The vector can be prepared by any known method, including but not limited to
cDNA obtained from reverse transcription, de novo gene synthesis, or obtaining
a cDNA
template from government or commercial sources.
For example, one can isolate RNA from a cell that expresses the immunoglobulin
heavy chain. The RNA can then be used to produce a cDNA using reverse
transcription.
An example of an expressing cell would be a cell line expressing an antibody
of the Ig
class of interest. Many monoclonal antibodies are expressed in SPO mouse
myeloma
cells. Another example is a myeloma cell line of any species that has aberrant
expression
of Ig heavy chains. ARH-77 (ATCC #: CRL-162) is an example of a human myeloma
cell line that produces IgG 1 heavy chains.
In de novo gene synthesis, cDNA sequences can be built up from smaller DNA
sequences, such as oligonucleotides. The advantage of de novo synthesis is
that it can
provide complete control over the design of the sequences employed to
construct the
cDNA. This strategy can permit the removal of unwanted restriction sites while
introducing others that are more desirable. The codons used in the wild-type
gene can be
altered to remove a codon bias and thereby improve yields of the expressed
protein from
the cell of choice.
A government source of cDNA template includes obtaining a cDNA clone for the
proper Ig type from the IMAGE clone consortium ( http://image.llnl.gov/ ). The
IMAGE consortium or Integrated Molecular Analysis of Genomes and their
Expression
Consortium, serves as a repository for mammalian cDNAs for expressed genes.
The
IMAGE consortium has a full-length cDNA clone for nearly every human and mouse
gene. In addition to these government sources, commercial sources such as
OpenBiosystems are available.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
23
Once the vector is prepared, it can be amplified by any known method
including,
for example, PCR.
Suitable cells for transfecting and culturing include, but are not limited to
insect
cells (such as, SF9 cells), mammalian cells (such as, human embryonic kidney
cells,
HEK 293 cells).
There are numerous resources that provide details and alternative means for
the
procedures that can be incorporated or used to make the inventive polypeptide.
These
include, for example (1) Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989)
Molecular
Cloning: A Laboratory Manual, Vol. 3, p. 16.66, Cold Spring Harbor Laboratory,
Cold
Spring Harbor, NY; (2) Methods in Enzymology, Vol 216, pp 3-689, 1992,
Recombinant
DNA Part G; (3) Methods in Enzymology, Vol 218, pp 3-806, 1993, Recombinant
DNA
Part I; and (4) Current Protocols in Molecular Biology found at
http://mrw.interscience.wiley.com/emrw/0471-142727/home/archive.htm#Core
C. Antigens and Vaccines
Certain embodiments of the present invention involve the use of polypeptides
disclosed herein to immunize subjects or as vaccines. As used herein,
"immunization" or
"vaccination" means increasing or activating an immune response against an
antigen. It
does not require elimination or eradication of a condition but rather
contemplates the
clinically favorable enhancement of an immune response toward an antigen. The
vaccine
may be a prophylactic vaccine or a therapeutic vaccine. A prophylactic vaccine
comprises one or more epitopes associated. with a disorder for which the
individual may
be at risk (e.g., Botulinum Neurotoxin antigens as a vaccine for prevention of
Botulinum
intoxication). Therapeutic vaccines comprise one or more epitopes associated
with a
particular disorder affecting the individual, such as tumor associated
antigens in cancer
patients.
As used herein, "vaccine" means an organism or material that contains an
antigen
in an innocuous form. The vaccine is designed to trigger an immunoprotective
response.
The vaccine may be recombinant or non-recombinant. When inoculated into a non-
immune host, the vaccine will provoke active immunity to the organism or
material, but
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
24
will not cause disease. Vaccines may take the form, for example, of a toxoid,
which is
defined as a toxin that has been detoxified but that still retains its major
immunogenic
determinants; or a killed organism, such as typhoid, cholera and
poliomyelitis; or
attenuated organisms, that are the live, but non-virulent, forms of pathogens,
or it may be
antigen encoded by such organism, or it may be a live tumor cell or an antigen
present on
a tumor cell.
"Epitope" refers to an antigenic determinant of a peptide, polypeptide, or
protein;
an epitope comprises three or more amino acids in a spatial conformation
unique to the
epitope. Generally, an epitope consists of at least 5 such amino acids and
more usually
consists of at least 8 to 10 amino acids. Methods of determining spatial
conformation of
amino acids include, for example, x-ray crystallography and 2-dimensional
nuclear
magnetic resonance. Antibodies that recognize the same epitope can be
identified in a
simple immunoassay showing the ability of one antibody to block the binding of
another
antibody to a target antigen.
Certain embodiments of the present invention pertain to methods of inducing an
immune response to an antigen in a subject. The term "antigen" means a
substance that is
recognized and bound specifically by an antibody or by a T cell antigen
receptor.
Antigens can include polypeptides, peptides, proteins, glycoproteins,
polysaccharides,
complex carbohydrates, sugars, gangliosides, lipids and phospholipids,
fragments thereof,
portions thereof and combinations thereof. The antigens can be those found in
nature or
can be synthetic. Antigens can elicit an antibody response specific for the
antigen.
Haptens are included within the scope of "antigen." A hapten is a low
molecular weight
compound that is not immunogenic by itself but is rendered immunogenic when
conjugated with an immunogenic molecule containing antigenic determinants.
Small
molecules may need to be haptenized in order to be rendered antigenic. In some
embodiments, antigens of the present invention include peptides and
polypeptides. In
this regard, the immunogenic polypeptides set forth herein include an antigen
polypeptide. Antigen polypeptides that may be used in the immunogenic
polypeptides of
the present methods include antigens from an animal, a plant, a bacteria, a
protozoan, a
parasite, a virus, fragments thereof or a combination thereof.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
An antigen polypeptide is an amino acid sequence that under appropriate
conditions results in an immune response in a subject. The immune response may
be an
antibody response. For example, the antibody response can be measured as an
increase in
antibody production, as measured by any number of techniques (e.g., ELISA).
The
5 immune response may also be a T cell response, such as increased antigen
presentation to
T cells, or increased proliferation of T cells.
The antigen polypeptide may be any polypeptide derived from a virus. For
example, the polypeptide may be derived from adenoviridiae (e.g.,
mastadenovirus and
aviadenovirus), herpesviridae (e.g., herpes simplex virus 1, herpes simplex
virus 2,
10 Epstein-Barr virus, herpes simplex virus 5, and herpes simplex virus 6),
leviviridae (e.g.,
levivirus, enterobacteria phase MS2, allolevirus), poxyiridae (e.g.,
chordopoxyirinae,
parapoxvirus, avipoxvirus, capripoxvirus, leporipoxvirus, suipoxvirus,
molluscipoxvirus,
and entomopoxyirinae), papovaviridae (e.g., polyomavirus and papillomavirus),
paramyxoviridae (e.g., paramyxovirus, parainfluenza virus 1, mobillivirus
(e.g., measles
15 virus), rubulavirus (e.g., mumps virus), pneumonoviridae (e.g.,
pneumovirus, human
respiratory syncytial virus), and metapneumovirus (e.g., avian pneumovirus and
human
metapneumovirus), picornaviridae (e.g., enterovirus, rhinovirus, hepatovirus
(e.g., human
hepatitis A virus), cardiovirus, and apthovirus, reoviridae (e.g.,
orthoreovirus, orbivirus,
rotavirus, cypovirus, fijivirus, phytoreovirus, and oryzavirus), retroviridae
(e.g.,
20 mammalian type B retroviruses, mammalian type C retroviruses, avian type C
retroviruses, type D retrovirus group, BLV-HTLV retroviruses, lentivirus (e.g.
human
immunodeficiency virus 1 and human immunodeficiency virus 2), spumavirus),
flaviviridae (e.g., hepatitis C virus), hepadnaviridae (e.g., hepatitis B
virus), togaviridae
(e.g., alphavirus, e.g., sindbis virus) and rubivirus (e.g., rubella virus),
rhabdoviridae
25 (e.g., vesiculovirus, lyssavirus, ephemerovirus, cytorhabdovirus, and
necleorhabdovirus),
arenaviridae (e.g., arenavirus, lymphocytic choriomeningitis virus, Ippy
virus, lassa
virus), coronaviridae (e.g., coronavirus and torovirus), influenza virus
hemagglutinin
(Genbank Accession No. J02132), human respiratory syncytial virus G
glycoprotein
(Genbank Accession No. Z33429), core protein, matrix protein or any other
protein of
Dengue virus (Genbank Accession No. M19197), measles virus hemagglutinin
(Genbank
Accession No. M81899), herpes simplex virus type 2 glycoprotein gB (Genbank
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
26
Accession No. M14923), poliovirus I VPI, envelope glycoproteins of HIV I,
hepatitis B
surface antigen, diptheria toxin, streptococcus 24M epitope, gonococcal pilin,
pseudorabies virus g50 (gpD), pseudorabies virus II (gpB), pseudorabies virus
gIII (gpC),
pseudorabies virus glycoprotein H, pseudorabies virus glycoprotein E,
transmissible
gastroenteritis glycoprotein 195, transmissible gastroenteritis matrix
protein, swine
rotavirus glycoprotein 38, swine parvovirus capsid protein, Serpulina
hydodysenteriae
protective antigen, bovine viral diarrhea glycoprotein 55, Newcastle disease
virus
hemagglutinin-neuraminidase, swine flu hemagglutinin, swine flu neuraminidase,
foot
and mouth disease virus, hog cholera virus, swine influenza virus, African
swine fever
virus, Mycoplasma hyopneumoniae, infectious bovine rhinotracheitis virus
(e.g.,
infectious bovine rhinotracheitis virus glycoprotein E or glycoprotein G),
infectious
laryngotracheitis virus (e.g., infectious laryngotracheitis virus glycoprotein
G or
glycoprotein I), a glycoprotein of La Crosse virus, neonatal calf diarrhea
virus,
Venezuelan equine encephalomyelitis virus, punta toro virus, murine leukemia
virus,
mouse mammary tumor virus, hepatitis B virus core protein or hepatitis B virus
surface
antigen or a fragment or derivative thereof, antigen of equine influenza virus
or equine
herpesvirus (e.g., equine influenza virus type A/Alaska 91 neuraminidase,
equine
influenza virus type A/Miami 63 neuraminidase, equine influenza virus type
A/Kentucky
81 neuraminidase equine herpesvirus type 1 glycoprotein B, and equine
herpesvirus type
1 glycoprotein D, antigen of bovine respiratory syncytial virus or bovine
parainfluenza
virus (e.g., bovine respiratory syncytial virus attachment protein (BRSV G),
bovine
respiratory syncytial virus fusion protein (BRSV F), bovine respiratory
syncytial virus
nucleocapsid protein (BRSV N), bovine parainfluenza virus type 3 fusion
protein, and the
bovine parainfluenza virus type 3 hemagglutinin neuraminidase), bovine viral
diarrhea
virus glycoprotein 48 or glycoprotein 53, Cercopithecine herpesvirus (Herpes B
virus),
Coccidioides posadasii, Crimean-Congo haemorrhagic fever virus, Ebola Viruses,
Lassa
fever virus, Marburg virus, Monkeypox virus, a reconstructed replication
competent
forms of the 1918 pandemic influenza virus containing any portion of the
coding regions
of all eight gene segments (Reconstructed 1918 Influenza virus), Rickettsia
prowazekii,
Rickettsia rickettsii, a South American haemorrhagic fever virus, tick-borne
encephalitis
complex (flavi) viruses, Central European tick-borne encephalitis, Far Eastern
tick-borne
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
27
encephalitis, Variola major virus (Smallpox virus), Variola minor virus
(Alastrim),
Yersinia pestis, Bacilius anthracis, a Botulinum neurotoxin producing species
of
Clostridium, Brucella abortus, Brucella melitensis, Brucella suis,
Burkholderia mallei
(formerly Pseudomonas mallei), Burkholderia mallei (formerly Pseudomonas
mallei),
Burkholderia pseudomallei (formerly Pseudomonas pseudomallei), Coccidiodes
immitis,
Coxiella burnetii, Eastern Equine Encephalitis virus, Francisella tularensis,
Hendra virus,
Nipah Virus, Rift Valley fever virus, Venezuelan Equine Encephalitis virus,
African
horse sickness virus, African swine fever virus, Akabane virus, Avian
influenza virus,
Bluetongue virus, Camel pox virus, Classical swine fever virus, Foot-and-mouth
disease
virus, Goat pox virus, Japanese encephalitis virus, Lumpy skin disease virus,
Malignant
catarrhal fever virus, Menangle virus, Mycoplasma capricolum, Mycoplasma
mycoides,
Newcastle disease virus, Peste des petits ruminants virus, Rinderpest virus,
Sheep pox
virus, Swine vesicular disease virus, Vesicular stomatitis virus, bacillus
anthracis,
arenavirus, Brucella sp., Burkholderia mallei, Burkholeria pseuomalei,
chlamydia
psittaci, vibrio cholerae, Coxiella burnetii, ebola virus, E. coli,
clostridium perfringens,
Salmonella sp., Shigella sp., or a variant thereof.
Antigen polypeptides useful in the present invention may also be a cancer
antigen
or a tumor antigen. Any cancer or tumor antigen may be used in accordance with
the
immunogenic compositions of the invention including, but not limited to, KS
1/4 pan-
carcinoma antigen, ovarian carcinoma antigen (CA125), prostatic acid
phosphate,
prostate specific antigen, melanoma-associated antigen p97, melanoma antigen
gp75,
high molecular weight melanoma antigen (HMW-MAA), prostate specific membrane
antigen, carcinoembryonic antigen (CEA), polymorphic epithelial mucin antigen,
human
milk fat globule antigen, colorectal tumor-associated antigens such as: CEA,
TAG-72,
C017-1A; GICA 19-9, CTA-1 and LEA, Burkitt's lymphoma antigen-38.13, CD19,
human B-lymphoma antigen-CD20, CD33, melanoma specific antigens such as
ganglioside GD2, ganglioside GD3, ganglioside GM2, ganglioside GM3, tumor-
specific
transplantation type of cell-surface antigen (TSTA) such as virally-induced
tumor
antigens including T-antigen DNA tumor viruses and Envelope antigens of RNA
tumor
viruses, oncofetal antigen-alpha-fetoprotein such as CEA of colon, bladder
tumor
oncofetal antigen, differentiation antigen such as human lung carcinoma
antigen L6, L20,
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
28
antigens of fibrosarcoma, human leukemia T cell antigen-Gp37, neoglycoprotein,
sphingolipids, breast cancer antigen such as EGFR, EGFRvIII, FABP7,
doublecortin,
brevican, HER2 antigen, polymorphic epithelial mucin (PEM), malignant human
lymphocyte antigen-APO- 1, differentiation antigen such as I antigen found in
fetal
erythrocytes, primary endoderm, I antigen found in adult erythrocytes,
preimplantation
embryos, I (Ma) found in gastric adenocarcinomas, M18, M39 found in breast
epithelium, SSEA-1 found in myeloid cells, VEP8, VEP9, Myl, VIM-D5, D156_22
found in
colorectal cancer, TRA-1-85 (blood group H), C14 found in colonic
adenocarcinoma, F3
found in lung adenocarcinoma, AH6 found in gastric cancer, Y hapten, Ley found
in
embryonal carcinoma cells, TL5 (blood group A), EGF receptor found in A431
cells, Ei
series (blood group B) found in pancreatic cancer, FC10.2 found in embryonal
carcinoma
cells, gastric adenocarcinoma antigen, CO-514 found in Adenocarcinoma, NS-10
found
in adenocarcinomas, CO-43, G49 found in EGF receptor of A431 cells, MH2 found
in
colonic adenocarcinoma, 19.9 found in colon cancer, gastric cancer mucins,
T5A7 found in
myeloid cells, R24 found in melanoma, 4.2, GD3, D1.1, OFA-1, GM2, OFA-2, GD2,
and
M1:22:25:8 found in embryonal carcinoma cells, SSEA-3 and SSEA-4 found in 4 to
8-
cell stage embryos, a T cell receptor derived peptide from a Cutaneous T cell
Lymphoma,
and variants thereof.
Antigen polypeptides useful in the present invention may also be an
autoantigen.
Autoantigens known to be associated with autoimmune disease have been
described.
Included are myelin proteins associated with demyelinating diseases, e.g.
multiple
sclerosis and experimental autoimmune encephalomyelitis; collagens and
rheumatoid
arthritis; acetylcholine receptor with myasthenia gravis; insulin, proinsulin,
glutamic acid
decarboxylase 65 (GAD65), islet cell antigen (ICA512; ICA12) with insulin
dependent
diabetes. Disease associated myelin proteins include myelin basic protein
(MBP),
proteolipid protein (PLP), myelin-associated glycoprotein (MAG) and myelin
oligodendrocyte glycoprotein (MOG).
In some embodiments, the antigen polypeptide can be, but is not limited to,
abrin,
a conotoxin, diacetoxyscirpenol, ricin, saxitoxin, a Shiga-like ribosome
inactivating
protein, flexal, guanarito, junin, machupo, sabia, tetrodotoxin, a Botulinum
neurotoxin,
Clostridium perfringens epsilon toxin, a Shigatoxin, Staphylococcal
enterotoxin, T-2
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
29
toxin, Bovine spongiform encephalopathy agent, epsilon toxin, ricin toxin,
Staphylococcal enterotoxin B, or a variant thereof.
In some embodiments, the antigen polypeptide is administered with the intent
of
inducing an immune response. Depending on the intended mode of administration,
the
compounds of the present invention can be in various pharmaceutical
compositions. The
compositions will include a unit dose of the selected polypeptide in
combination with a
pharmaceutically acceptable carrier and, in addition, can include other
medicinal agents,
pharmaceutical agents, carriers, adjuvants, diluents, and excipients.
"Pharmaceutically
acceptable" means a material that is not biologically or otherwise
undesirable, i.e., the
material can be administered to an individual along with the fusion protein or
other
composition without causing any undesirable biological effects or interacting
in a
deleterious manner with any of the other components of the pharmaceutical
composition
in which it is contained.
Any method of preparation of vaccines and immunizing agents can be used, as
exemplified by U.S. Pat. Nos. 4,608,251; 4,601,903; 4,599,231; 4,599,230;
4,596,792;
and 4,578,770. Typically, such vaccines are prepared as injectables either as
liquid
solutions or suspensions; solid forms suitable for solution in, or suspension
in, liquid
prior to injection may also be prepared. The preparation may also be
emulsified. In
addition, if desired, the vaccine may contain minor amounts of auxiliary
substances such
as wetting or emulsifying agents, pH buffering agents, or adjuvants that
enhance the
effectiveness of the vaccines.
Examples of physiologically acceptable carriers include saline solutions such
as
normal saline, Ringer's solution, PBS (phosphate-buffered saline), and
generally mixtures
of various salts including potassium and phosphate salts with or without sugar
additives
such as glucose. The active immunogenic ingredient is often mixed with
excipients that
are pharmaceutically acceptable and compatible with the active ingredient.
Suitable
excipients are, for example, water, saline, dextrose, glycerol, ethanol, or
the like, and
combinations thereof. Nontoxic auxiliary substances, such as wetting agents,
buffers, or
emulsifiers may also be added to the composition. Oral formulations include
such
normally employed excipients as, for example, pharmaceutical grades of
mannitol,
lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium
carbonate,
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
and the like. In one embodiment of the invention, adjuvants are not required
for
immunization.
Parenteral administration, if used, is generally characterized by injection.
Sterile
injectables can be prepared in conventional forms, either as liquid solutions
or
5 suspensions, solid forms suitable for solution or suspension in liquid prior
to injection, or
as emulsions.
The vaccine compositions set forth herein may comprise an adjuvant or a
carrier.
Adjuvants are any substance whose admixture into the vaccine composition
increases or
otherwise modifies the immune response to an antigen.
10 Adjuvants can include but are not limited to A1K(SO4)2, A1Na(SO4)Z,
A1NH(SO4)4, silica, alum, AI(OH)3, Ca3(PO4)2i kaolin, carbon, aluminum
hydroxide,
muramyl dipeptides, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-DMP), N-
acetyl-
nornuramyl-L-alanyl-D-isoglutamine (CGP 11687, also referred to as nor-MDP), N-
acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'2'-dipalmitoyl-s- n-
glycero-3-
15 hydroxphosphoryloxy)-ethylamine (CGP 19835A, also referred to as MTP-PE),
RIBI
(MPL+TDM+CWS) in a 2% squalene/Tween-80® emulsion, lipopolysaccharides
and its various derivatives, including lipid A, Freund's Complete Adjuvant
(FCA),
Freund's Incomplete Adjuvants, Merck Adjuvant 65, polynucleotides (for
example, poly
IC and poly AU acids), wax D from Mycobacterium, tuberculosis, substances
found in
20 Corynebacterium parvum, Bordetella pertussis, and members of the genus
Brucella,
liposomes or other lipid emulsions, Titermax, ISCOMS, Quil A, ALUN (see U.S.
Pat.
Nos. 58,767 and 5,554,372), Lipid A derivatives, choleratoxin derivatives, HSP
derivatives, LPS derivatives, synthetic peptide matrixes or GMDP, Interleukin
1,
Interleukin 2, Montanide ISA-51 and QS-21.
25 Additional adjuvants or compounds that may be used to modify or stimulate
the
immune response include ligands for Toll-like receptors (TLRs). In mammals,
TLRs are
a family of receptors expressed on DCs that recognize and respond to molecular
patterns
associated with microbial pathogens. Several TLR ligands have been intensively
investigated as vaccine adjuvants. Bacterial lipopolysaccharide (LPS) is the
TLR4 ligand
30 and its detoxified variant mono-phosphoryl lipid A (MPL) is an approved
adjuvant for
use in humans. TLR5 is expressed on monocytes and DCs and responds to
flagellin
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
31
whereas TLR9 recognizes bacterial DNA containing CpG motifs. Oligonucleotides
(OLGs) containing CpG motifs are potent ligands for, and agonists of, TLR9 and
have
been intensively investigated for their adjuvant properties.
Other agents that stimulate the immune response can also be administered to
the
subject. For example, other cytokines are also useful in vaccination protocols
as a result
of their lymphocyte regulatory properties. Many other cytokines useful for
such purposes
are known, including interleukin-12 (IL-12) that has been shown to enhance the
protective effects of vaccines, GM-CSF and IL-18. Thus cytokines can be
administered
in conjunction with antigens and adjuvants to increase the immune response to
the
antigens.
A vaccine composition according to the present invention may comprise more
than one different adjuvant. Furthermore, the invention encompasses a
therapeutic
composition further comprising any adjuvant substance including any of the
above or
combinations thereof. It is also contemplated that ML-IAP, or one or more
fragments
thereof, and the adjuvant can be administered separately in any appropriate
sequence.
In certain embodiments, the vaccine composition includes a carrier. The
carrier
may be any suitable carrier, for example a protein or an antigen presenting
cell.
Examples include serum proteins such as transferrin, bovine serum albumin,
human
serum albumin, thyroglobulin or ovalbumin, immunoglobulins, or hormones, such
as
insulin or palmitic acid. For immunization of humans, the carrier should be a
physiologically acceptable carrier acceptable to humans and safe. Tetanus
toxoid or
diptheria toxoid are suitable carriers in one embodiment of the invention.
Alternatively,
the carrier may be dextrans for example sepharose.
The timing of administration of the vaccine and the number of doses required
for
immunization can be determined from standard vaccine administration protocols.
In
some instances, a vaccine composition will be administered in two doses. The
first dose
will be administered at the elected date and a second dose will follow at one
month from
the first dose. A third dose may be administered if necessary, and desired
time intervals
for delivery of multiple doses of a particular antigen containing HCH2 polymer
can be
determined. In another embodiment, the antigen containing HCH2 polymer may be
given as a single dose.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
32
For each recipient, the total vaccine amount necessary can be deduced from
protocols for immunization with other vaccines. The exact amount of antigen-
HCH2
polymer required can vary from subject to subject, depending on the species,
age, weight
and general condition of the subject, the particular fusion protein used, its
mode of
administration, and the like. Generally, dosage will approximate that which is
typical for
the administration of other vaccines, and may be in the range of about 10
ng/kg to 1
mg/kg.
Any known methods for the preparation of mixtures or emulsions of polypeptides
disclosed herein and adjuvant can be used (see, e.g. Plotkin and Orenstein,
eds, Vaccines,
4th Ed., 2004).
Immunizations against toxins and viral infection can be tested using in vitro
assays and standard animal models. For example a mouse can be immunized with a
viral
antigen polypeptide expressed as a fusion protein with HCH2 polymers and
delivered by
the methods detailed herein. After the appropriate period of time to allow
immunity to
develop against the antigen, for example two weeks, a blood sample is tested
to
determine the level of antibodies, termed the antibody titer, using ELISA. In
some
instances the mouse is immunized and, after the appropriate period of time,
challenged
with the virus to determine if protective immunity against the virus has been
achieved.
Using these techniques the proper combination of antigen, adjuvant, and other
vaccine
components can be optimized to boost the immune response. Testing in humans
can be
contemplated after efficacy is demonstrated in animal models. Any known
methods for
immunization, including formulation of a vaccine composition and selection of
doses,
route of administration and the schedule of administration (e.g. primary and
one or more
booster doses) can be used (e.g. see Vaccines: From concept to clinic,
Paoletti and
McInnes, eds, CRC Press, 1999).
Generally accepted animal models can be used for testing of immunization
against cancer using a tumor and cancer antigen polypeptides. For example,
cancer cells
(human or murine) can be introduced into a mouse to create a tumor, and one or
more
cancer associated antigens can be delivered by the methods described herein.
The effect
on the cancer cells (e.g., reduction of tumor size) can be assessed as a
measure of the
effectiveness of the immunization. Of course, immunization can include one or
more
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
33
adjuvants or cytokines to boost the immune response. The tests also can be
performed in
humans, where the end point is to test for the presence of enhanced levels of
circulating
cytotoxic T lymphocytes against cells bearing the antigen, to test for levels
of circulating
antibodies against the antigen, to test for the presence of cells expressing
the antigen and
so forth.
In some embodiments, the vaccine composition includes antigen presenting
cells.
The antigen presenting cell can be a dendritic cell (DC). DC may be cultivated
ex vivo or
derived in culture from peripheral blood progenitor cells (PBPC) and
peripheral blood
stem cells (PBSC). The dendritic cells may be prepared and used in therapeutic
procedures according to any suitable protocol. Different protocols may be
adopted to use
with patients with different HLA types and different diseases. Incubation of
cultured
dendritic cells with HCH2 polymers of the invention is envisaged as one means
of
loading dendritic cells with antigen for subsequent transfer into hosts.
For any of the ex vivo methods of the invention, peripheral blood progenitor
cells
(PBPC) and peripheral blood stem cells (PBSC) are collected using apheresis
procedures
known. Briefly, PBPC and PBSC can be collected using conventional devices, for
example, a Haemonetics® Model V50 apheresis device (Haemonetics,
Braintree,
Mass.). Four-hour collections can be performed typically no more than five
times weekly
until, for example, approximately 6.5x 108 mononuclear cells (MNC)/kg patient
are
collected. The cells are suspended in standard media and then centrifuged to
remove red
blood cells and neutrophils. Cells located at the interface between the two
phases (also
known in the art as the buffy coat) are withdrawn and resuspended in HBSS. The
suspended cells are predominantly mononuclear and a substantial portion of the
cell
mixture are early stem cells. The stem cells obtained in this manner can be
frozen, then
stored in the vapor phase of liquid nitrogen. Ten percent dimethylsulfoxide
can be used
as a cryoprotectant. After all collections from the donor have been made, the
stem cells
are thawed and pooled. Aliquots containing stem cells, growth medium, such as
McCoy's 5A medium, 0.3% agar, and expansion factors (e.g. GM-CSF, IL-3, IL-4,
flt3-
ligand), are cultured and expanded at 37 C. in 5% COZ in fully humidified air
for 14
days.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
34
D. The Fc Receptors
There are three classes of Fc receptor (Gessner et al., 1998; Raghavan et al.,
1996). FcyRI (CD64) binds monomeric IgG with high affinity whereas AIG and IC
bind
preferentially to FcyRII (CD32) and FcyRIII (CD16), the low affinity receptors
for Fc.
FcyRII and FcyRIII are closely related in the structure of their ligand-
binding domains.
In humans three separate genes, FcyRIIA, FcyRIIB, and FcyRIIC, two of which
give rise
to alternatively spliced variants, code for FcyRII. FcyRI1a delivers
activating signals
whereas FcyRIIb delivers inhibitory signals. The functional basis for the
divergent
signals arises from signaling motifs located within the cytoplasmic tails of
the receptors.
An immunoreceptor tyrosine-based inhibitor motif (ITIM) located in the
cytoplasmic tail
of the FcyRIlb is involved in negative receptor signaling. The ITIM motif is a
unique
feature of the FcyRIIb receptor as it is not apparently present in any other
Fcy receptor
class. In contrast, an activatory immunoreceptor tyrosine-based activation
motif or
ITAM is located in the cytoplasmic tail of FcyRIIa. ITAM motifs transduce
activating
signals. They are also found in the FcR y-chains, which are identical to the y-
chains of
the high affinity IgE receptor (FcERI). While FcyRIIa and FcyRIIb are widely
expressed
on myeloid cells and some T-cell subsets they are notably absent from NK
cells.
Human FcyRIII is also present in multiple isoforms derived from two distinct
genes (FcyRIIIA and FcyRIIIB). FcyRIIIb is unique in its attachment to the
cell
membrane via a glycosylphosphatidyl anchor. FcyRIllb expression is restricted
to
neutrophils while FcyRIIIa is expressed by macrophages, and NK cells. FcyRIIIa
is also
expressed by some y8 T-cell subsets and certain monocytes. FcyRIlla requires
the
presence of the FcR y-chain or the CD3 ~-chain for cell surface expression and
signal
transduction. The FcR y-chain and the CD3 ~-chain are dimeric and possess ITAM
motifs. FcyRI1Ia forms a multimeric complex with these subunits and signaling
is
transduced through them. Thus, there is considerable FcyR receptor
heterogeneity and
diverse expression profiles.
AIG and IC have been used to target FcyRIIIa on immune cells, but as noted
earlier production of defined AIG and IC was seen to be problematic. Assembly
of
complexes by physical or chemical methods is difficult to control with
precision resulting
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
in heterogeneity within complexes of similar molecular weight in addition to
variations
between preparations and changes in composition upon storage. Molecular
cloning has
been used in the present invention to create molecules that can mimic or
approximate
AIG and IC function with respect to their interactions with FcyR and which
allow for the
5 inclusion and targeting of a second protein domain to cells expressing FcyR.
The binding sites for FcyRII and FcyRIII map to the hinge and proximal region
of
the CH2 domain of IgG, the same region originally identified for FcyRI (Duncan
et al.,
1988; Morgan et al., 1995; Lund et al., 1991). White et al. (2001) describe
the cloning
and expression of linear polymers of the hinge and CH2 (HCH2) fused to the Fc
region of
10 IgGI and demonstrate their biological activity. Legge et al. (2000) have
recently shown
that an aggregated PLP1 immunoadhesin, unlike the monomeric form, moderates
disease
severity in experimental autoimmune encephalomyelitis, the rodent model for
multiple
sclerosis. This change is due to the dual functionality of the aggregated Fc
and PLP
moieties within the complex.
15 In the later phase of a primary immune response or in chronic responses,
large
ICS form. These complexes signal through the low affinity IgG receptors that
recognize
ICS or IgG aggregates preferentially. The low affinity receptors are of two
classes
FcyRII (CD32) and FcyRIII (CD16). FcyRIlb provides an inhibitory signal for
secretion
of cytokines that augment immunoglobulin secretion including IgG secretion.
FcRII1a
20 (found on NK cells, monocytes and yyS T cells) preferentially recognizes
IgGI. One
thrust of this invention is directed towards activation of FcyRIIIa.
The ability of FcyR to bind IgG and transmit a signal into the cell depends
upon
the FcyRs alleles expressed, upon glycosylation, and how the receptor is
associated with
the signaling subunit. In addition, glycosylation patterns differ between cell
types and
25 this too can affect ligand binding to FcyRIIIa. FcyRIlla on NK cells is
glycosylated with
high mannose oligosaccharides, whereas monocyte/macrophage FcyRIIIa is not.
Perhaps
this imparts lower receptor affinity to monocyte/macrophage FcyRII1a relative
to NK cell
FcyRIIIa, adding yet another level of modification to receptor function (Galon
et al.,
1997; Edberg et al., 1997). Thus, FcyR function is regulated at several
levels, which can
30 have an impact on ligand binding and receptor signaling.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
36
Recently, the inventors have initiated studies into the potential
immunomodulatory role of immune co'mplexes (IC) in human autoimmune syndromes.
Central to these studies are the interactions between IC and FcR. The
inventors have
used molecular cloning to create molecules that can mimic or approximate IC
function
with respect to their interactions with FcR and which allow for the inclusion
and targeting
of a second protein domain to cells expressing FcR. The strategy pursued is to
express
multiple linear copies of the region of the IgG framework that binds FcR.
Expressing
only those determinants necessary for FcR engagement and presenting them in a
particularly favorable configuration results in novel proteins that are
considerably more
potent than IC. Thus recombinant IC mimetic proteins described herein will
provide both
a valuable tool for the examination of IC deposition and in the therapeutic
targeting of
FcR in autoimmune disorders.
E. Antigen presentation to Antigen Presenting Cells (APC).
In another embodiment of the invention, the polypeptides include linked
antigens.
In one embodiment, the polypeptides of the invention are used to target an
antigen to the
cell to enhance the process of internalization and presentation of the antigen
by these
cells, and ultimately to stimulate an immune response. In another embodiment,
the
polypeptides of the invention specifically bind the antigen directly or bind
to epitopes
attached to the antigen, e.g., a cloned Fab' fragment covalently attached to
the polymer by
genetic or chemical means which recognizes the antigen or epitopes attached to
the
antigen, and targets the bound antigen to antigen presenting cells (APC) for
internalization, processing, and presentation. In another embodiment, the
antigen is
linked to the polymers of the invention and at the same time binds a surface
receptor of
an antigen-presenting cell. In another embodiment the antigen is covalently
attached to
the polymers of the invention by genetic or chemical means.
More broadly, the polypeptides of this invention can be linked to a cell
surface
marker. A cell surface marker is a protein, carbohydrate, glycolipid, etc. but
most
commonly comprises a protein localized to the plasma membrane of a cell having
a
portion exposed to the extracellular region (e.g. an integral membrane protein
or a
transmembrane glycoprotein), such that the extracellular portion can be
specifically
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
37
bound by an antibody or other ligand. The term cell surface marker also refers
to a
polynucleotide sequence encoding such a cell surface protein. Numerous cell
surface
proteins can be used as cell surface markers, such as, for example, a CD
(cluster of
differentiation) antigen present on cells of hematopoietic lineage (CD2, CD4,
CD8,
CD21), Gamma-glutamyltranspeptidase, an adhesion protein (ICAM-1, ICAM-2, ELAM-
1, VCAM-1), a hormone, a growth factor, a cytokine receptor, ion channels, and
the
membrane-bound form of an immunoglobulin chain.
1. Polypeptides that contain HCH2 polymers for use in vaccines.
Traditional vaccines consist of killed or attenuated pathogenic organisms or
their
products administered to develop an immune response. Drawbacks to the
traditional
approach include unwanted harmful immune responses, inoculation with
potentially
infectious pathogens, and poor immune responses. Typically these vaccines
require co-
administration of potent adjuvants to elicit effective antibody responses.
Vaccines can be
made more effective by delivering those antigenic determinants that are most
likely to
confer protective immunity. Early attempts to develop peptide based vaccines
resulted in
poor immune responses due in part to an inefficient presentation of antigen by
APCs.
APCs capture, internalize and present antigen. In addition they provide
important
costimulatory signals to T-cells. T-cells, thus activated, are capable of
stimulating the
production of antibody-forming B cells. Monocytes, especially macrophages and
dendritic cells, function as APC. Macrophages express all three classes of
FcyR
constitutively whereas dendritic cells express FcyRI and FcyRII.
Dendritic cells (DCs) are highly specialized and are potent APCs for T-cells.
As a
result of this capacity DCs are often referred to as `professional APCs.' DCs
present
antigen efficiently on both MHC I and MHC II resulting in the initiation of
CD8+ and
CD4+ responses respectively. DCs can prime naive T-cells. Subsequent to
activation by
DCs, T-cells can interact with other APC. DCs have a proliferative immature
stage
followed by terminal differentiation into a non-proliferative mature stage.
Immature DCs
express FcyRI and FcyRII, are capable of internalizing and presenting antigen,
and
synthesize large amounts of MHC II. In contrast mature DCs no longer express
FcyRs,
become fully active APCs, activate T-cells, and secrete large amounts of IL-12
(which
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
38
spurs differentiation of T-cells). DCs are a more potent APC than macrophages
though
much less numerous.
There has been great interest in the enhancement of antigen presentation by
targeting antigen to FcyR expressed on APCs. Some peptide vaccines have
antigenic
determinants grafted into the variable region of IgG. These `antigenized-
antibodies'
increased the half-life of antigen and facilitated uptake of antigen by APCs
via the FcyRI
receptor (Zaghouani et al., 1993; Zanetti et al., 1992). Use of antigenized-
antibodies
have been shown to be more effective at priming antigen specific T-cell
responses than
peptide alone. Antigenized-antibodies have several limiting features: Since
they are
directed towards FcyRI alone, they can be effectively competed against by
monomeric
serum IgG. Secondly, the design of the molecule limits the size of the
antigenizing
determinant to a small peptide fragment.
More recently antigen has been expressed as a fusion protein with or
chemically
conjugated to monoclonal antibodies and Fab fragments directed against FcyRI
and
FcyR11(Liu et al., 1996b; Guyre et al., 1997). Using tetanus toxoid epitopes
conjugated
to anti-Fc*I monoclonal antibody, one group reported that peptides directed to
FcyRI
were 100 to 1000 fold more efficient than peptide alone in T-cell stimulation
(Liu et al.,
1996a). However, use of anti-FcyRI Fab' required chemical cross-linking to
achieve
maximal responses to antigen, thus implicating the low affinity IgG receptors
(Keler et
al., 2000). Disadvantages of this approach include the promiscuous binding of
antigen-
linked monoclonal antibody to FcyRI expressed on non-APCs. Monoclonal
antibodies
trigger effector functions poorly. Fab' fragments have the additional
disadvantage of a
short half-life in the circulation.
Attachment of antigen to the HCH2 polymers in the inventive polypeptides
described herein for the purpose of targeting APCs has distinct advantages
over existing
strategies. The inventive polypeptides present antigen to low affinity
receptors (FcyRII
and FcyRIII), thus bypassing competition from monomeric serum IgG for binding
to
FcyRI. Additionally there is no need for chemical cross-linking as is
necessary when
using anti-FcyRI Fab'. The inventive polypeptides imitate immune complexes.
Antigen
presented in the context of an immune complex may be a particularly
appropriate
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
39
substrate for APCs. Antigen-linked HCH2 polymers efficiently trigger effector
functions
that augment the immune response.
2. The inventive polypeptide in tolerance induction.
Immunologic tolerance can be characterized by the selective lack of an immune
response, including lack of a pathogenic immune response to a specific antigen
even
while leaving other responses of the immune system intact. Induction and
maintenance
of T cell unresponsiveness to a specific antigen may be achieved by several
mechanisms
that can be broadly summarized as: 1) clonal deletion; 2) anergy; and 3)
suppression.
Clonal deletion is a process of negative selection whereby T cells with high
affinity for
self-antigens are deleted in the thymus. Deletion is achieved by programmed
cell death
(apoptosis). This process of negative selection in the thymus is known as
`central
tolerance.' Anergy represents a state of immune inactivation characterized by
abolished
proliferative and cytokine responses. It is induced in cells that previously
responded to a
given antigen and results in an unresponsive state upon re-stimulation with
antigen.
Since this mechanism acts upon mature T cells that have exited the thymus and
reside in
the peripheral compartments, this form of tolerance is termed `peripheral
tolerance.'
Anergy is induced by any of a number of molecular events and need not be
permanent: it
can be reversed by certain cytokines. Three common anergy-inducive mechanisms
are T
cell receptor (TCR) stimulation without co-stimulatory signals, sub-optimal
TCR
stimulation even in the presence of co-stimulation, and the autocrine
inhibitory actions of
IL-10. Suppression of T cell function is a third mechanism by which T cell
tolerance can
be achieved. Suppression ensues when regulatory T cells are induced to exert
"non-
specific" suppressive effects on antigen-specific T cells in their vicinity.
This
microenvironmental effect is also referred to as `bystander suppression.'
B cell tolerance involves concepts and mechanisms similar but not identical to
those encountered in T cell tolerance. In mature B cells tolerance can be
induced through
a block in Ig-receptor signaling which results in impaired expression of the
B7
costimulatory molecules.
Induction of tolerance to either self- or foreign-antigens provides an
important
therapeutic approach to the treatment of allergies, autoimmune disease and
host vs. graft
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
disease (transplant rejection). In addition, the therapeutic potential of many
foreign
biologically active agents is limited by their immunogenicity. Tolerance
induction
represents one approach for the control of immune responses directed against
biologically
active foreign agents, thus improving their therapeutic potential. In some
instances the
5 antigen to be tolerized is presented orally, intradermally, or
intravenously. The source of
antigen can be in the form of a peptide, a protein, or nucleic acid which can
express a
peptide or protein. The antigen is then internalized by antigen presenting
cells (APC) and
presented on the surface of the cell, most typically as a MHC I-antigen
complex or as a
MHC II -antigen complex.
10 The inventive polypeptides, which comprise the HCH2 polymers, have several
advantageous aspects for use as vehicles for tolerance induction. Antigen(s)
linked to the
HCH2 polymers by chemical or genetic means are targeted to Fc receptors
expressed on
APC such as macrophages, B cells, and dendritic cells (DC). Fc-receptor-
mediated
internalization results in processing and presentation of antigen at the cell
surface - the
15 key first step in tolerance induction.
Macrophages and DC express Fc receptors for both IgG and IgE. HCH2
polymers are expressible which bind both classes of Fc receptor simultaneously
-
coaggregation of different Fc receptor classes may have advantages over
targeting a
single class of receptor. Ligation of FcRs induces secretion of IL10 from
certain immune
20 cells and, as already noted, IL10 induces anergy in T cells. As is observed
for immune
complexes, binding of inventive polypeptides to FcRs may induce a pattem of
cytokine
secretion that deviates T cell immune responses from a TH1 type response to a
TH2 type
response. TH2 type T cells favor the establishment and maintenance of immune
tolerance. Therefore, antigens linked to the HCH2 polymers can promote
tolerance
25 induction by both the efficient presentation of antigen to APC and the
simultaneous
induction of mechanisms that favor establishment of immune tolerance.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
41
F. Use of the Inventive Polypeptides as in vivo and in vitro immunological
agents
a. Inventive Polypeptide Example - Modification of recombinant monoclonal
antibodies by the introduction of an HCH2 polymer
It is an embodiment of the current invention that recombinant monoclonal
antibodies (mAb) can be modified by the introduction of one or more HCH2 units
into
the Fc region to create an HCH2 polymer of appropriate length within a
monoclonal
antibody. Monoclonal antibodies modified in this manner will retain their
target
specificity while acquiring improved or more selective effector function. HCH2
polymers greatly enhance Fc - FcR receptor interactions. More specifically
HCH2
polymers of the current invention have greatly improved binding to and
enhanced
activation of FcyRI1Ia receptors over that seen with the Fc portion of mAb in
current
therapeutic use. As enhanced interaction of mAB with FcyRIIIa has been
documented to
have therapeutic benefit in the treatment of malignancies. The inventors
envisage
modifying existing mAb with the introduction of an HCH2 polymer into the Fc
region of
the mAb. Monoclonal antibodies with this modification will have enhanced
interaction
with FcyRIIIa receptors.
Functional IgG genes, those that direct expression of a mAb, are composed of
heavy and light chain genes segments. Light chain (L) genes consist of three
exons,
containing the hydrophobic leader sequence, the variable regions and the L
constant
region (CL). Separating the exons are the intervening sequences or introns.
Similarly, the
variable region of a functional Ig heavy chain (H) gene has a separate exon
for each of
the leader sequence, the variable region, and H chain constant region (CH 1).
The H gene
also contains the Fc region that is composed of separate exons for the hinge,
the CH2
region and CH3 regions. Once again the exons are separated by introns. The
expression
of mAb in mammalian cells typically involves cloning both the H and L gene
segments
from functional Ig genes into either a single expression vector or separate
expression
vectors (one for L, one for H genes) that posses the Ig promoter region. Once
subcloned
the expression vectors possessing the L and H genes are transfected into an
appropriate
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
42
cell line for expression. The use of gene segments insures the presence of
intronic
sequences, which contain enhancer and other elements that collectively allow
for high
levels of Ig expression in B cells and myeloma cells. Ig expression systems
utilizing the
Ig promoter and intronic genetic elements limit protein expression to cells of
lymphoid
derivation however.
More recently, Ig expression systems have been developed that use viral
promoters and enhancer combinations, such as CMV. The use of viral
promoter/enhancer combinations permits strong expression in both lymphoid and
non-
lymphoid cells lines such as CHO and COS (Norderhaug, et al., 1997). Inclusion
of the
intronic enhancer from the Ig H gene also directs high level expression in
lymphoid cells.
Additionally, H and L gene segments are no longer necessary for efficient
expression and
can be replaced by their corresponding cDNA's (McLean, et al., 2000).
The introduction of HCH2 polymers into mAb can be achieved by any of several
approaches. In one method, using known molecular cloning techniques, H chain
gene
segments within expression vectors are modified by the insertion of the HCH2
polymer
cloning cassette into the 5' end of the hinge exon. The modified hinge exon
now consists
of the HCH2 polymer fused in frame to the hinge sequences. The vector
containing the
modified H gene is introduced in conjunction with an L gene into an
appropriate cell line
for mAb expression. Another method is to replace the Fc gene segment with a
cDNA
segment comprising a splice acceptor signal, the HCH2 polymer fused to an Ig
Fc cDNA
and a polyA signal. The modified H gene is then transferred into an Ig
expression vector
capable of directing Ig expression without Ig gene intronic sequences. The
vector
containing the modified H gene is introduced in conjunction with an L gene
into an
appropriate cell line for expression.
The insertion of HCH2 polymers into mAb expressed from cloned cDNA within
expression vectors can also be achieved using similar techniques. For
instance, the
cDNA encoding the Fc region can be removed from the H chain cDNA and replaced
with
a DNA segment encoding the HCH2 polymer fused to an Fc cDNA. Conversely, the
cDNA encoding the H chain leader, variable and CH1 region can be excised and
transferred to vectors containing the HCH2 polymer region genetically fused to
an Fc
cDNA. Alternatively, the HCH2 polymer cassette can be introduced into the H
chain
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
43
cDNA at the appropriate site. This site would sometimes be the junction
between the
CH1 region and the hinge. Subsequently, the modified H chain cDNA is then
transferred
into an Ig expression vector capable of directing Ig expression without Ig
gene intronic
sequences. The vector containing the modified H chain cDNA is introduced in
conjunction with an L chain expression vector into an appropriate cell line
for expression.
While interaction with FcyRIIIa receptors is important for the efficacy of
several
mAb in clinical use, the methods of modification described above are general.
In other
embodiments of the inventive polypeptides, HCH2 polymers can be introduced
into mAb
to enhance specificity for other individual FcR receptors, classes of FcR
receptors, as
blocking reagents for FcR receptors, or for binding to complement factors.
G. Autoimmune Diseases
Autoimmune diseases are processes in which the immune system mounts an
attack against body tissue components. This attack may be mediated by anti-
tissue
component antibodies produced by B lymphocytes or by cell-mediated tissue
destructive
processes mediated by T cells, by NK cells, and by monocytes/macrophages. In
some
autoimmune diseases several tissue damaging mechanisms may operate either
concurrently or sequentially. The inventive polypeptides of the current
invention can be
used in the treatment of autoimmune diseases. They can be used to alter
immunity and to
deliver therapeutic agents to a delivery site in a patient where the
therapeutic agent is
effective.
The number of autoimmune diseases is considerable and some persons may have
more than one autoimmune disease. Similarly, signs and symptoms may cover a
wide
spectrum and severity may also vary widely between afflicted individuals and
over time.
The reasons why some persons develop autoimmunity while others do not are
imperfectly
understood but certain recurring themes can be signaled. In many autoimmune
processes
there is a genetically determined propensity to develop disease. Among the
genes that
have been linked to propensity to develop autoimmunity are those of the major
histocompatibility complex. In addition, environmental factors are thought to
play a role.
During embryonic development many of those immune system cells that are
capable of
reacting against self-components are eliminated but some remain so that
essentially
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
44
everyone is at least theoretically capable of mounting an autoimmune response.
This
observation implies that under normal circumstances potentially auto-
aggressive cells are
held in check by physiologic restraint mechanisms and that a contributor to
the
pathogenesis of autoimmunity is a failure of normal restraint mechanisms.
Examples of commonly encountered autoimmune disorders include but are not
limited to: systemic lupus erythematosus, rheumatoid arthritis, type 1
diabetes, Guillain-
Barre syndrome, other immune mediated neuropathies including chronic
inflammatory
demyelinating polyneuropathy, multiple sclerosis and other immune-mediated
central
nervous system demyelinating diseases, rheumatoid arthritis, Crohn's disease,
ulcerative
colitis, myasthenia gravis, scleroderma/systemic sclerosis, and
dermatomyositis/polymyositis to name some of the more commonly encountered
entities.
Additional autoimmune diseases include acute glomerulonephritis, nephrotic
syndrome,
and idiopathic IgA nephropathy among autoimmune processes that affect the
kidneys.
Examples of autoimmune processes that affect the formed elements of the blood
are autoimmune aplastic anemia, autoimmune hemolytic anemia, and idiopathic
thrombocytopenic purpura.
Autoimmune diseases that affect the endocrine organs include Addison's
disease,
idiopathic hypoparathyroidism, Grave's disease, Hashimoto's thyroiditis,
lymphocytic
hypophysitis, autoimmune oophoritis, and immunologic infertility in the male.
The liver may also be the target of autoimmune processes. Examples include
autoimmune hepatitis, hepatitis C virus-associated autoimmunity,
immunoallergic
reaction drug-induced hepatitis, primary biliary cirrhosis, and primary
sclerosing
cholangitis.
Autoimmune processes of the intestinal tract include pernicious anemia,
autoimmune gastritis, celiac disease, Crohn's disease, and ulcerative colitis.
Cutaneous autoimmune diseases include dermatitis herpetiformis, epidermolysis
bullosa acquisita, alopecia totalis, alopecia areata, vitiligo, linear IgA
dermatosis,
pemphigus, pemphigoid, psoriasis, herpes gestationis, and cutaneous lupus
including
neonatal lupus erythematosus.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
Additional autoimmune diseases with rheumatological features include CREST
syndrome, ankylosing spondylitis, Behret's disease, juvenile rheumatoid
arthritis,
Sjogren's syndrome, and eosinophilia-myalgia syndrome.
Autoimmune diseases can affect the heart. Examples include myocarditis and
5 idiopathic dilated cardiomyopathy, rheumatic fever, Chaga's disease and
possibly some
components of atherosclerosis.
There can be an autoimmune component to inflammatory diseases of the blood
vessels. Examples include giant cell arteritis, Kawasaki's disease, Henoch-
Schonlein
purpura, polyarteritis nodosa, Goodpasture's syndrome, immune complex
vasculitis,
10 Wegener's granulomatosis, Churg-Strauss syndrome, Takayasu arteritis,
necrotizing
vasculitis, and anti-phospholipid antibody syndrome.
Autoimmune diseases of the central and peripheral nervous systems can occur as
a remote effect of malignant tumors. Rarely these same entities occur in the
absence of a
tumor. Examples include the Lambert-Eaton syndrome, paraneoplastic myelopathy,
15 paraneoplastic cerebellar degeneration, limbic encephalitis, opsoclonus
myoclonus, stiff
man syndrome, paraneoplastic sensory neuropathy, the POEMS syndrome, dorsal
root
ganglionitis, and acute panautonomic neuropathy.
Autoimmune diseases may affect the visual system. Examples include Mooren's
ulcer, uveitis, and Vogt-Koyanagi-Harada syndrome.
20 Other autoimmune processes, or ones in which autoimmunity may contribute to
disability, include interstitial cystitis, diabetes insipidus, relapsing
polychondritis,
urticaria, reflex sympathetic dystrophy, and cochleolabyrinthitis.
The list of autoimmune processes given above, while extensive, is not intended
to
be exhaustive. Rather it is intended to document that autoimmunity is a wide-
ranging
25 clinical phenomenon.
1. Multiple Sclerosis
This disease is characterized by destruction of CNS myelin and of the axons
which myelin ensheathes. The illness can begin with focal attacks of tissue
destruction in
the white matter of the CNS which cause loss of neuronal function and as one
attack
30 follows another progressively accumulating disability. After a time most
multiple
sclerosis patients experience a decline in the frequency of their attacks but
this decline is
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
46
accompanied by a shift in the natural history of the illness to a slow but
inexorable
worsening of their neurological disabilities. The switch from a relapsing-
remitting course
to a progressive one ultimately occurs in better than 80% of multiple
sclerosis victims.
Multiple sclerosis is an inflammatory disease. Lymphocytes and macrophages
move from the blood into the CNS and attack and destroy myelin and ultimately
the
myelin forming cells known as oligodendrocytes. The process is one of
autoimmunity
but the precise target within the CNS against which the immune response is
directed
remains unknown. There is a genetically determined predisposition to develop
multiple
sclerosis but there is compelling evidence that environmental factors have a
role as well,
though the nature of the environmental factors in cause remains unknown.
There have been advances in the treatment of multiple sclerosis in recent
years.
Five agents are approved for the treatment of MS. These are interferon betala,
interferon
betalb, glatiramer acetate, natalizumab, and novantrone. All five modulate
immune
responses in a manner that favorably alters the hitherto bleak natural history
of MS.
Unfortunately all five are only modestly effective and each has side effects
that are often
troublesome. The present invention offers the prospect of a more efficient and
effective
therapy for MS.
Experimental autoimmune encephalomyelitis (EAE) is a widely used animal
model for MS and serves as a useful model for the study of autoimmune
diseases. EAE
is a disease of the central nervous system and may be induced in susceptible
animals by
immunization with neuroantigens. EAE may also be adoptively transferred from
one
animal to the next by the serial transfer of T cells reactive against
encephalitogenic
determinants of myelin proteins or by the injection of T cell clones reactive
against
encephalitogenic determinants of myelin proteins. Myelin proteins that may be
targets of
the autoreactive response include proteolipid apoprotein (PLP), myelin basic
protein
(MBP), and myelin oligodendrocyte protein (MOG). Depending on the type and
strain of
animal used, the mode of induction, and the neuroantigen administered, the
disease may
be acute and monophasic in nature, or alternatively chronic, or relapsing-
remitting.
Affected animals develop flaccid tails, paralysis of the hindlimbs, and
incontinence. In severe disease, movement of the forelimbs may also become
impaired
and animals may become moribund. Histological analysis of the CNS reveals an
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
47
inflammatory cell infiltrate during the acute stages of disease that may be
accompanied
by demyelination of the neurons during chronic phases of the disease. EAE is
widely
used for the study of autoimmune disease and serves as a model for testing
potential
efficacy of experimental drugs for the treatment of MS and for the treatment
of
autoimmune diseases in general.
The proteins of the current invention were tested for their effect on disease
activity in a mouse model of EAE to gain insight into their potential use as
therapeutics
for the treatment of MS and other autoimmune diseases. Products of the current
invention inhibited EAE in the SJL/J mouse. Administration of construct HSA1Fc
and in
particular of HSA1R4 decreased clinical disease activity during the early
acute stages of
disease and decreased the frequency of and severity of relapses at later time
points as
compared to saline-treated controls. Decreased inflammatory cell infiltrates
were
observed in the CNS of construct-treated animals compared to saline treated-
controls.
H. Biological Functional Equivalents
As modifications or changes may be made in the structure of the
polynucleotides
and or proteins of the present invention, while obtaining molecules having
similar or
improved characteristics, such biologically functional equivalents are also
encompassed
within the present invention.
1. Modified Polynucleotides and Polypeptides
The biological functional equivalent may comprise a polynucleotide that has
been
engineered to contain distinct sequences while at the same time retaining the
capacity to
encode the "wild-type" or standard protein. This can be accomplished owing to
the
degeneracy of the genetic code, i.e., the presence of multiple codons, which
encode for
the same amino acids. In one example, one of skill in the art may wish to
introduce a
restriction enzyme recognition sequence into a polynucleotide while not
disturbing the
ability of that polynucleotide to encode a protein.
In another example, a polynucleotide can be engineered to contain certain
sequences that result in (and encode) a biological functional equivalent with
more
significant changes. Certain amino acids may be substituted for other amino
acids in a
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
48
protein structure without appreciable loss of interactive binding capacity
with structures
such as, for example, antigen-binding regions of antibodies, binding sites on
substrate
molecules, receptors, and such like. So-called "conservative" changes do not
disrupt the
biological activity of the protein, as the structural change is not one that
impinges on the
protein's ability to carry out its designated function. It is thus
contemplated by the
inventors that various changes may be made in the sequence of genes and
proteins
disclosed herein, while still fulfilling the goals of the present invention.
In terms of functional equivalents, it is well understood by the skilled
artisan that,
inherent in the definition of a "biologically functional equivalent" protein
or
polynucleotide, is the concept that there is a limit to the number of changes
that may be
made within a defined portion of the molecule while retaining a molecule with
an
acceptable level of equivalent biological activity, such as binding to FcyRs.
Biologically
functional equivalents are thus defined herein as those proteins (and
polynucleotides) in
which selected amino acids (or codons) may be substituted.
In general, the shorter the length of the molecule, the fewer the changes that
can
be made within the molecule while retaining function. Longer domains may have
an
intermediate number of changes. The full-length protein will have the most
tolerance for
a larger number of changes. However, it must be appreciated that certain
molecules or
domains that are highly dependent upon their structure may tolerate little or
no
modification.
Amino acid substitutions are generally based on the relative similarity of the
amino acid side-chain substituents, for example, their hydrophobicity,
hydrophilicity,
charge, size, or the like. An analysis of the size, shape or type of the amino
acid side-
chain substituents reveals that arginine, lysine or histidine are all
positively charged
residues; that alanine, glycine or serine are all of similar size; or that
phenylalanine,
tryptophan or tyrosine all have a generally similar shape. Therefore, based
upon these
considerations, arginine, lysine or histidine; alanine, glycine or serine; or
phenylalanine,
tryptophan or tyrosine; are defined herein as biologically functional
equivalents.
To effect more quantitative changes, the hydropathic index of amino acids may
be
considered. Each amino acid has been assigned a hydropathic index on the basis
of their
hydrophobicity or charge characteristics, these are: isoleucine (+4.5); valine
(+4.2);
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
49
Leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine
(+1.9); alanine
(+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9);
tyrosine (-1.3);
proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5);
aspartate (-3.5);
asparagine (-3.5); lysine (-3.9); or arginine (-4.5).
Hydropathic amino acid index can be used to confer interactive biological
function on a protein (Kyte & Doolittle, 1982). In some instances, certain
amino acids
may be substituted for other amino acids having a similar hydropathic index or
score or
still retain a similar biological activity. In making changes based upon the
hydropathic
index, the substitution of amino acids with hydropathic indices can be within
2 or within
1, or within 0.5.
The substitution of like amino acids can be made effectively on the basis of
hydrophilicity, particularly where the biological functional equivalent
protein or peptide
thereby created is intended for use in immunological embodiments, as in
certain
embodiments of the present invention. U.S. Patent 4,554,101 states that the
greatest local
average hydrophilicity of a protein, as governed by the hydrophilicity of its
adjacent
amino acids, correlates with its immunogenicity or antigenicity, i.e., with a
biological
property of the protein.
As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have
been assigned to amino acid residues: arginine (+3.0); lysine (+3.0);
aspartate (+3.0 1);
glutamate (+3.0 1); serine (+0.3); asparagine (+0.2); glutamine (+0.2);
glycine (0);
threonine (-0.4); proline (-0.5 1); alanine (-0.5); histidine (-0.5);
cysteine (-1.0);
methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine
(-2.3);
phenylalanine (-2.5); tryptophan (-3.4). In making changes based upon similar
hydrophilicity values, the substitution of amino acids with hydrophilicity
values can be
within 2, or within 1, or within 0.5.
The term "substantially similar" means a variant amino acid sequence that is
at
least 80% identical to a native amino acid sequence, or at least 90%
identical. The
percent identity may be determined, for example, by comparing sequence
information
using the GAP computer program, version 6.0 described by Devereux et al.
(Nucl. Acids
Res. 12:387, 1984) and available from the University of Wisconsin Genetics
Computer
Group (UWGCG). The GAP program utilizes the alignment method of Needleman and
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
Wunsch (J. Mol. Biol. 48:443, 1970), as revised by Smith and Waterman (Adv.
Appl.
Math 2:482, 1981). Some default parameters for the GAP program can include:
(1) a
unary comparison matrix (containing a value of 1 for identities and 0 for non-
identities)
for nucleotides, and the weighted comparison matrix of Gribskov and Burgess,
Nucl.
5 Acids Res. 14:6745, 1986, as described by Schwartz and Dayhoff, eds., Atlas
of Protein
Sequence and Structure, National Biomedical Research Foundation, pp. 353 358,
1979;
(2) a penalty of 3.0 for each gap and an additiona10.10 penalty for each
symbol in each
gap; and (3) no penalty for end gaps. Variants may comprise conservatively
substituted
sequences, meaning that a given amino acid residue is replaced by a residue
having
10 similar physiochemical characteristics. Examples of conservative
substitutions include
substitution of one aliphatic residue for another, such as Ile, Val, Leu, or
Ala for one
another, or substitutions of one polar residue for another, such as between
Lys and Arg;
Glu and Asp; or Gln and Asn. Other such conservative substitutions, for
example,
substitutions of entire regions having similar hydrophobicity characteristics,
are known.
15 Naturally occurring variants are also encompassed by the invention.
Examples of such
variants are proteins that result from alternate mRNA splicing events or from
proteolytic
cleavage of the native protein, wherein the native biological property is
retained.
2. Codons
While discussion has focused on functionally equivalent polypeptides arising
20 from amino acid changes, it will be appreciated that these changes may be
effected by
alteration of the encoding DNA; taking into consideration also that the
genetic code is
degenerate and that two or more codons may code for the same amino acid. A
table of
amino acids and their codons is presented below for use in such embodiments,
as well as
for other uses, such as in the design of probes and primers and the like.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
51
TABLES 1 AND 2. AMINO ACID DESIGNATIONS AND CODON TABLE
Table 1 - Amino Acid Desi ations Table 2- Codons for Amino Acids
Alanine Ala A GCA GCC GCG GCU
Cysteine Cys C UGC UGU
Aspartic acid Asp D GAC GAU
Glutamic acid Glu E GAA GAG
Phenylalanine Phe F UUC UUU
Glycine Gly G GGA GGC GGG GGU
Histidine His H CAC CAU
Isoleucine Ile I AUA AUC AUU
Lysine Lys K AAA AAG
Leucine Leu L UUA UUG CUA CUC CUG CUU
Methionine Met M AUG
Asparagine Asn N AAC AAU
Proline Pro P CCA CCC CCG CCU
Glutamine Gln Q CAA CAG
Arginine Arg R AGA AGG CGA CGC CGG CGU
Serine Ser S AGC AGU UCA UCC UCG UCU
Threonine Thr T ACA ACC ACG ACU
Valine Val V GUA GUC GUG GUU
Tryptophan Trp W UGG
Tyrosine Tyr Y UAC UAU
The term "functionally equivalent codon" is used herein to refer to codons
that
encode the same amino acid, such as the six codons for arginine or serine, and
also refers
to codons that encode biologically equivalent amino acids (see Codon Table,
above).
It will also be understood that amino acid and nucleic acid sequences may
include
additional residues, such as additional N- or C-terminal amino acids or 5' or
3' sequences,
and yet still be essentially as set forth in one of the sequences disclosed
herein, so long as
the sequence meets the criteria set forth above, including the maintenance of
biological
protein activity where protein expression is concerned. The addition of
terminal
sequences particularly applies to nucleic acid sequences that may, for
example, include
various non-coding sequences flanking either of the 5' or 3' portions of the
coding region
or may include various internal sequences, i.e., introns, which are known to
occur within
genes.
3. Altered Amino Acids
The present invention, in many aspects, relies on the synthesis of peptides
and
polypeptides in cyto, via transcription and translation of appropriate
polynucleotides.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
52
These peptides and polypeptides will include the twenty "natural" amino acids,
and post-
translational modifications thereof. However, in vitro peptide synthesis
permits the use
of modified or unusual amino acids. A table of exemplary, but not limiting,
modified or
unusual amino acids is provided herein below.
Table 3 - Modified or Unusual Amino Acids
Abbr. Amino Acid Abbr. Amino Acid
Aad 2-Aminoadipic acid EtAsn N-Eth las ara ine
BAad 3- Aminoadipic acid Hyl H drox 1 sine
BAIa beta-alanine, beta-Amino- ro ionic acid AHyl allo-H drox 1 sine
Abu 2-Aminobutyric acid 3Hyp 3-H drox roline
4Abu 4- Aminobutyric acid, piperidinic acid 4Hyp 4-H drox roline
Acp 6-Aminocaproic acid Ide Isodesmosine
Ahe 2-Aminoheptanoic acid Aile allo-Isoleucine
Aib 2-Aminoisobutyric acid MeGly N-Methylglycine,
sarcosine
BAib 3-Aminoisobutyric acid MeIle N-Methylisoleucine
Apm 2-Aminopimelic acid MeLys 6-N-Meth 11 sine
Dbu 2,4-Diaminobutyric acid MeVal N-Methylvaline
Des Desmosine Nva Norvaline
Dpm 2,2'-Diaminopimelic acid Nle Norleucine
Dpr 2,3-Diamino ro ionic acid Orn Ornithine
EtGly N-Eth 1 1 cine
4. Mimetics
In addition to the biological functional equivalents discussed above, the
present
inventors also contemplate that structurally similar compounds may be
formulated to
mimic the key portions of peptide or polypeptides of the present invention.
Such
compounds, which may be termed peptidomimetics, may be used in the same manner
as
the peptides of the invention and, hence, also are functional equivalents.
Certain mimetics that mimic elements of protein secondary and tertiary
structure
are described in Johnson et al. (1993). The underlying rationale behind the
use of peptide
mimetics is that the peptide backbone of proteins exists chiefly to orient
amino acid side
chains in such a way as to facilitate molecular interactions, such as those of
antibody or
antigen. A peptide mimetic is thus designed to permit molecular interactions
similar to
the natural molecule.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
53
Some successful applications of the peptide mimetic concept have focused on
mimetics of (3-turns within proteins, which are known to be highly antigenic.
Likely
(3-turn structure within a polypeptide can be predicted by computer-based
algorithms.
Once the component amino acids of the turn are determined, mimetics can be
constructed
to achieve a similar spatial orientation of the essential elements of the
amino acid side
chains.
Other approaches have focused on the use of small, multidisulfide-containing
proteins as attractive structural templates for producing biologically active
conformations
that mimic the binding sites of large proteins (Vita et a1.,1998). A
structural motif that
appears to be evolutionarily conserved in certain toxins is small (30-40 amino
acids),
stable, and highly permissive for. mutation. This motif is composed of a beta
sheet and an
alpha helix bridged in the interior core by three disulfides.
Beta II turns have been mimicked successfully using cyclic L-pentapeptides and
those with D-amino acids. (Weisshoff et al.,1999). Also, Johannesson et al.
(1999)
report on bicyclic tripeptides with reverse turn-inducing properties.
Methods for generating specific structures have been disclosed in the art. For
example, alpha-helix mimetics are disclosed in U.S. Patents 5,446,128;
5,710,245;
5,840,833; and 5,859,184. Theses structures render the peptide or protein more
thermally
stable, also increase resistance to proteolytic degradation. Six, seven,
eleven, twelve,
thirteen and fourteen membered ring structures are disclosed.
Methods for generating conformationally restricted beta turns and beta bulges
are
described, for example, in U.S. Patents 5,440,013; 5,618,914; and 5,670,155.
Beta-turns
permit changed side substituents without having changes in corresponding
backbone
conformation, and have appropriate termini for incorporation into peptides by
standard
synthesis procedures. Other types of mimetic turns include reverse and gamma
turns.
Reverse turn mimetics are disclosed in U.S. Patents 5,475,085 and 5,929,237,
and gamma
turn mimetics are described in U.S. Patents 5,672,681 and 5,674,976.
1. Proteinaceous compositions
In certain embodiments, the present invention concerns novel compositions
comprising at least one proteinaceous molecule, such as a polypeptide with
multiple
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
54
HCH2 regions. As used herein, a "proteinaceous molecule", "proteinaceous
composition", "proteinaceous compound", "proteinaceous chain" or
"proteinaceous
material" generally refers to, but is not limited to, a protein of greater
than about 200
amino acids or the full length endogenous sequence translated from a gene; a
polypeptide
of greater than about 100 amino acids; or a peptide of from about 3 to about
100 amino
acids. All the "proteinaceous" terms described above may be used
interchangeably
herein.
In certain embodiments the size of at least one proteinaceous molecule may
comprise, but is not limited to, about 1, about 2, about 3, about 4, about 5,
about 6, about
7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about
15, about 16,
about 17, about 18, about 19, about 20, about 21, about 22, about 23, about
24, about 25,
about 26, about 27, about 28, about 29, about 30, about 31, about 32, about
33, about 34,
about 35, about 36, about 37, about 38, about 39, about 40, about 41, about
42, about 43,
about 44, about 45, about 46, about 47, about 48, about 49, about 50, about
51, about 52,
about 53, about 54, about 55, about 56, about 57, about 58, about 59, about
60, about 61,
about 62, about 63, about 64, about 65, about 66, about 67, about 68, about
69, about 70,
about 71, about 72, about 73, about 74, about 75, about 76, about 77, about
78, about 79,
about 80, about 81, about 82, about 83, about 84, about 85, about 86, about
87, about 88,
about 89, about 90, about 91, about 92, about 93, about 94, about 95, about
96, about 97,
about 98, about 99, about 100, about 110, about 120, about 130, about 140,
about 150,
about 160, about 170, about 180, about 190, about 200, about 210, about 220,
about 230,
about 240, about 250, about 275, about 300, about 325, about 350, about 375,
about 400,
about 425, about 450, about 475, about 500, about 525, about 550, about 575,
about 600,
about 625, about 650, about 675, about 700, about 725, about 750, about 775,
about 800,
about 825, about 850, about 875, about 900, about 925, about 950, about 975,
about
1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 1750,
about
2000, about 2250, about 2500 or greater amino molecule residues, and any range
derivable therein.
As used herein, an "amino molecule" refers to any amino acid, amino acid
derivative, or amino acid mimic as would be known to one of ordinary skill in
the art. In
certain embodiments, the residues of the proteinaceous molecule are
sequential, without
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
any non-amino molecule interrupting the sequence of amino molecule residues.
In other
embodiments, the sequence may comprise one or more non-amino molecule
moieties. In
particular embodiments, the sequence of residues of the proteinaceous molecule
may be
interrupted by one or more non-amino molecule moieties.
5 Accordingly, the term "proteinaceous composition" encompasses amino molecule
sequences comprising at least one of the 20 common amino acids in naturally
synthesized
proteins, or at least one modified or unusual amino acid, including but not
limited to
those shown in Table 3.
In certain embodiments the proteinaceous composition comprises at least one
10 protein, polypeptide or peptide. In further embodiments the proteinaceous
composition
comprises a biocompatible protein, polypeptide or peptide. As used herein, the
term
"biocompatible" refers to a substance that produces no significant untoward
effects when
applied to, or administered to, a given organism according to the methods and
amounts
described herein. Organisms include, but are not limited to, a bovine, a
reptilian, an
15 amphibian, a piscine, a rodent, an avian, a canine, a feline, a fungus, a
plant, an
archebacteria, or a prokaryotic organism, with a selected animal or human
subject being
sometimes preferred. Such untoward or undesirable effects are those such as
significant
toxicity or adverse immunological reactions. In some embodiments,
biocompatible
protein, polypeptide or peptide containing compositions will generally be
mammalian
20 proteins or peptides, or synthetic proteins or peptides, each essentially
free from toxins,
pathogens and harmful immunogens.
Proteinaceous compositions may be made by any technique known, including the
expression of proteins, polypeptides or peptides through standard molecular
biological
techniques, the isolation of proteinaceous compounds from natural sources, or
the
25 chemical synthesis of proteinaceous materials. The nucleotide and protein,
polypeptide
and peptide sequences for various genes have been previously disclosed, and
may be
found at computerized databases known to those of ordinary skill in the art.
One such
database is the National Center for Biotechnology Information's Genbank and
GenPept
databases (http://www.ncbi.nlm.nih.gov/). The coding regions for these known
genes
30 may be amplified or expressed using the techniques disclosed herein or
otherwise known.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
56
Alternatively, various commercial preparations of proteins, polypeptides and
peptides are
known.
In certain embodiments a proteinaceous compound may be purified. Generally,
"purified" will refer to a specific protein, polypeptide, or peptide
composition that has
been subjected to fractionation to remove various other proteins,
polypeptides, or
peptides, and which composition substantially retains its activity, as may be
assessed, for
example, by the protein assays, that may be known for the specific or desired
protein,
polypeptide or peptide.
In certain embodiments, the proteinaceous composition may comprise at least
one
antibody. As used herein, the term "antibody" is intended to refer broadly to
any
immunologic binding agent such as IgG, IgM, IgA, IgD, and IgE. Generally, IgG
or IgM
may be preferred because they are the most common antibodies in the
physiological
situation and because they are most easily made in a laboratory setting.
Polypeptide regions of proteinaceous compounds may be linked via a linker
group. A linker group is able to join the compound of interest via a
biologically-
releasable bond, such as a selectively-cleavable linker or amino acid
sequence.
The term "antibody" is used to refer to any antibody-like molecule that has an
antigen binding region, and includes antibody fragments such as Fab', Fab,
F(ab')2, single
domain antibodies (DABs), Fv, scFv (single chain Fv), and the like. The
techniques for
preparing and using various antibody-based constructs and fragments are well
known.
Means for preparing and characterizing antibodies are also known (See, e.g.,
Antibodies:
A Laboratory Manual, Cold Spring Harbor Laboratory, 1988).
It is contemplated that virtually any protein, polypeptide, or peptide
containing
component may be used in the compositions and methods disclosed herein.
However, the
proteinaceous material may be biocompatible. Proteins and peptides suitable
for use in
this invention may be autologous proteins or peptides, although the invention
is clearly
not limited to the use of such autologous proteins. As used herein, the term
"autologous
protein, polypeptide or peptide" refers to a protein, polypeptide or peptide
that is derived
from or obtained from an organism. Organisms that may be used include, but are
not
limited to, a bovine, a reptilian, an amphibian, a piscine, a rodent, an
avian, a canine, a
feline, a fungus, a plant, or a prokaryotic organism, with a selected animal
or human
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
57
subject being sometimes being preferred. The "autologous protein, polypeptide
or
peptide" may then be used as a component of a composition intended for
application to
the selected animal or human subject. It can be biocompatible (i.e. from
mammalian
origin for mammals, from human origin for humans, from canine origin for
canines, etc.;
it is autologous; it is non-allergenic, or it is non-immunogenic).
J. Mechanisms of action and applications
Autoimmune disease often involves both T-cell and B-cell mediated components
that may act dependently or independently of one another, simultaneously or
sequentially, resulting in a host-damaging disease often characterized by
tissue or cell
compromise and a loss of one or more bodily functions. Fc receptors and
proteins of the
complement cascade are often intimately associated with the generation of the
autoimmune response, the regulation of the ongoing immune response, and the
effector
phase of the immune response (i.e. those mechanisms that lead to tissue or
cell
destruction or damage). The inventive polypeptides, through their ability to
bind Fc
receptors or complement, may influence disease outcome by their impact upon
one or
more of these areas.
The inventive polypeptides may favorably alter disease activity by multiple
pathways depending on the fusion protein design and type of disease treated.
Inventive
polypeptides may be designed to contain; multiple units of HCH2 regions, or
portions
thereof, able to bind Fc receptors, multiple units of HCH2 regions able to
bind
complement components, or both. It is contemplated that the inventive
polypeptide
design can be modified to maximize potential benefits achieved from its use in
treating a
specific disease and its composition may vary from one disease to the next.
For example,
for the treatment of some diseases it may be preferable to retain the Fc
receptor binding
ability of the fusion proteins but exclude or diminish binding of components
of the
complement cascade. The obverse may be preferred for the treatment of other
diseases.
The effect of the inventive polypeptides on disease outcome will depend not
only
on whether they contain multiple units able to bind Fc receptors, multiple
units able to
bind complement components, or both, but also on other protein domains that
may be
coexpressed in the inventive polypeptides to give them an additional function,
binding
capability, or other added feature. An additional modification to the
inventive
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
58
polypeptides includes the binding of additional proteins, protein domains, or
peptides to
the inventive polypeptides that give them an additional function, binding
capacity, or
other added feature. The flexibility in the fusion protein design enables the
inventors to,
depending on disease type, modify the inventive polypeptides to maximize their
therapeutic potential. It is an embodiment of the current invention that in
addition to the
treatment of autoimmunity, modifications of the inventive polypeptides as
described
above are applicable to their use in the treatment of neoplasms, the treatment
of
infections by viruses or other pathogens, the treatment of warts, and the
purposeful
induction of an immune response directed against a particular antigen or
antigens, as for
example in a vaccine.
Inventive polypeptides able to bind Fc receptors may influence disease outcome
through multiple mechanisms including but not limited to blocking Fc receptor
accessibility to endogenously produced Ig and immune complexes. Such blockade
would
be expected to limit self-antigen presentation by antigen presenting cells and
to, as a
consequence, diminish autoimmune responses. Blockade of Fc receptors may also
limit
or diminish tissue and cell destruction. Tissue and cell destruction in
autoimmune
disease can be mediated by Fc receptor-expressing effector cells (monocytes,
neutrophils,
macrophages, microglia, NK cells, as well as other cell types) that bind self-
antigen
reactive Ig bound to tissue or cells. For example, in ATP, the inventive
polypeptides
could limit platelet destruction and clearance by the body by decreasing their
uptake by
Kupffer cells in the liver and spleen via Fc receptor-mediated mechanisms.
Similarly
inventive polypeptides might limit demyelination in the CNS in multiple
sclerosis or
acetylcholine receptor destruction of motor neural endplates in myasthenia
gravis by
decreasing macrophage accessibility to Ig bound to self Ag in target tissues.
The
inventive polypeptides may favorably alter numerous autoimmune diseases via
similar
mechanisms.
The inventive polypeptides may modify autoimmune disease by activating cells
through Fc receptors and thereby altering the secretion of immunomodulators,
the
expression of specific cell surface markers, or the type or magnitude of
specific cell
functions. Modulation of protein secretion might include the decreased or
increased
production of interleukins including but not limited to IL-2, IL-4, IL-10, IL-
12, IL-18;
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
59
cytokines including but not limited to TGF(3, TNFa, TNFO; interferons y, 0,
and a;
growth factors, and products of the arachidonate cascade. Cellular functions
that may be
altered include cellular cytotoxicity, cell division, and activation state.
The inventive polypeptides may also be used to suppress or amplify immunity to
a specific antigen. Autoimmune disease may be treated by inducing tolerance to
a
specific antigen or by deviating the autoimmune response to a specific antigen
from a
harmful pathogenic one to a less harmful type. For example, in multiple
sclerosis the
elaboration of type 1 cytokines (IL-12, IL-2) in response to autoantigen is
generally
thought to be deleterious to the host while induction of a type 2 response (IL-
4, IL-10) is
thought to be protective. The purposeful deviation of the immune response from
a Thl
type to a Th2 type would likely be beneficial in the treatment of multiple
sclerosis. In
contrast, a Th2 type response is thought to be harmful in other autoimmune
diseases such
as lupus erythematosus, and consequently the purposeful deviation of the
response to
autoantigen in this disease from a Th2 type response to a Thl type response
would likely
be beneficial. Thus, modification of the inventive polypeptides would vary
depending on
the disease type and the mechanisms involved.
It is an embodiment of the current invention to coexpress one or more protein
domains of a specific antigen or bind one or more specific antigens or
antigenic
determinants to the inventive polypeptides that would induce a protective
immune
response, deviate a harmful immune response to a less harmful one, or induce a
state of
nonresponsiveness to antigen (Lasalle et al., 1994). For example, the
inventors
contemplate, in the treatment of multiple sclerosis, to coexpress a
neuroantigen peptide in
the fusion protein that induces a protective Th2 type response or an
unresponsive state. A
nonlimiting list of potential neuroantigens that might be used for the
treatment of
multiple sclerosis include proteolipid protein, myelin basic protein and
myelin
oligodendrocyte glycoprotein. Similarly, a T cell receptor or Ig domain may be
expressed in the fusion protein that would induce a protective anti-T cell
receptor or anti-
idiotype response. The inventors contemplate that varying the protein
coexpressed based
upon disease type should allow the inventive polypeptides to be used for the
treatment of
numerous autoimmune diseases.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
As mentioned earlier, the adaptive immune system is often referred to as
having
two components, cellular immunity (or Thl type response) and humoral immunity
(or
Th2 type response). Response to an antigen evokes one or both of these
components.
Immunomodulators such as lymphokines and monokines that promote one component
5 often inhibit the other. Thus a strong cellular response will often occur in
the presence of
a blunted humoral response and vice versa. Factors important to the
development of one
or the other response include the presence or absence of cytokines,
costimulatory factors,
as well as other factors that are known to those familiar in the art (Lasalle
et al., 1994).
For example the presence of IL-4 has been shown to enhance a Th2 type response
while
10 the presence of interferon gamma induces a Thl type response (Swain et al,.
1988). In
the treatment of autoimmune disease, neoplasms, or viral infections, or in the
induction of
immunity to pathogens by vaccine based therapies, selective modulation of one
or both of
these components may be used. The coadministration of cytokines, steroids, or
other
immunomodulators may be used in the treatment of varying diseases or when
attempting
15 to induce immunity to an antigen or antigens based upon the type of
response desired.
1. Neoplastic Cell Targets
Many so-called "tumor antigens" have been described, any one of which could be
employed as a target in connection with the combined aspects of the present
invention. A
large number of exemplary solid tumor-associated antigens are listed herein
below. The
20 preparation and use of antibodies against such antigens is known, and
exemplary
antibodies include from gynecological tumor sites: OC 125; OC 133; OMI; Mo vl;
Mo
v2; 3C2; 4C7; ID3; DU-PAN-2; F 36/22; 4F7/7A10; OV-TL3; B72.3; DF3; 2C8/2F7;
MF
116; Mov18; CEA 11-H5; CA 19-9 (1116NS 19-9); H17-E2; 791T/36; NDOG2; H317;
4D5, 3H4, 7C2, 6E9, 2C4, 7F3, 2H11, 3E8, 5B8, 7D3, SB8; HMFG2; 3.14.A3; from
25 breast tumor sites: DF3; NCRC-11; 3C6F9; MBE6; CLNH5; MAC 40/43; EMA;
HMFG1 HFMG2; 3.15.C3; M3, M8, M24; M18; 67-D-11; D547Sp, D75P3, H222; Anti-
EGF; LR-3; TA1; H59; 10-3D-2; HmAB1,2; MBR 1,2,3; 24=17=1; 24=17=2 (3E1=2);
F36/22.M7/105; C11, G3, H7; B6.2; B1=1; Cam 17=1; SM3; SM4; C-Mul (566); 4D5
3H4, 7C2, 6E9, 2C4, 7F3, 2H11, 3E8, 5B8, 7D3, 5B8; OC 125; MO v2; DU-PAN-2;
30 4F7/7A10; DF3; B72=3; cccccCEA 11; H17-E2; 3=14=A3; F023C5; from colorectal
tumor
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
61
sites: B72=3; (17-1A) 1083-17-1A; C017-1A; ZCE-025; AB2; HT-29-15; 250-30.6;
44X14; A7; GA73=3; 791T/36; 28A32; 28.19.8; X MMCO-791; DU-PAN-2; ID3; CEA
11-H5; 2C$/2F7; CA-19-9 (1116NS 19-9); PR5C5; PR4D2; PR4D1; from melanoma
sites
4=1; 8.2 M ; 96=5; 118=1, 133=2, (113=2); Li, LIa, R1 o(R19); 112; K5;6=1;
R24; 5=1; 225.28S;
465.12S; 9=2=27; Fl1; 376.96S; 465.12S; 15=75; 15=95; Mel-14; Mel-12; Me3-TB7;
225.28SD; 763.24TS; 705F6; 436910; M148; from gastrointestinal tumors: ID3; DU-
PAN-2; OV-TL3; B72-3; CEA 11-H5; 3=14=A3; C COLI; CA-19-9 (1116NS 19-9) and
CA50; OC125; from lung tumors: 4D5 3H4, 7C2, 6E9, 2C4, 7F3, 2H11, 3E8, 5B8,
7D3,
SB8; MO v2; B72=3; DU-PAN-2; CEA 11-H5; MUC 8-22; MUC 2-63; MUC 2-39;
MUC 7-39; and from miscellaneous tumors: PAb 240; PAb 246; PAb 1801; ERIC=1;
M148; FMH25; 6.1; CA1; 3F8; 4F7/7Alo;2Cg/2F7; CEA 11-H5.
Another means of defining a targetable tumor is in terms of the
characteristics of a
tumor cell itself, rather than describing the biochemical properties of an
antigen
expressed by the cell. Accordingly, the ATCC catalogue exemplifies human tumor
cell
lines that are publicly available (from ATCC Catalogue). Exemplary cell lines
include
J82; RT4; ScaBER; T24; TCCSUP; 5637; SK-N-MC; SK-N-SH; SW 1088; SW 1783; U-
87 MG; U-118 MG; U-138 MG; U-373 MG; Y79; BT-20; BT-474; MCF7; MDA-MB-
134-VI; MDA-MD-157; MDA-MB-175-VII; MDA-MB-361; SK-BR-3; C-33 A; HT-3;
ME-180; MS751; SiHa; JEG-3; Caco-2; HT-29; SK-CO-1; HuTu 80; A-253; FaDu; A-
498; A-704; Caki-1; Caki-2; SK-NEP-1; SW 839; SK-HEP-1; A-427; Calu-1; Calu-3;
Calu-6; SK-LU-1; SK-MES-1; SW 900; EB1; EB2; P3HR-1; HT-144; Malme-3M;
RPMI-7951; SK-MEL-1; SK-MEL-2; SK-MEL-3; SK-MEL-5; SK-MEL-24; SK-MEL-
28; SK-MEL-31; Caov-3; Caov-4; SK-OV-3; SW 626; Capan-1; Capan-2; DU 145; A-
204; Saos-2; SK-ES-1; SK-LMS-1; SW 684; SW 872; SW 982; SW 1353; U-2 OS;
Malme-3; KATO III; Cate-1B; Tera-1; Tera-2; SW579; AN3 CA; HEC-1-A; HEC-1-B;
SK-UT-1; SK-UT-1B; SW 954; SW 962; NCI-H69; NCI-H128; BT-483; BT-549;
DU4475; HBL-100; Hs 578Bst; Hs 578T; MDA-MB-330; MDA-MB-415; MDA-MB-
435S; MDA-MB-436; MDA-MB-453; MDA-MB-468; T-47D; Hs 766T; Hs 746T; Hs
695T; Hs 683; Hs 294T; Hs 602; JAR; Hs 445; Hs 700T; H4; Hs 696; Hs 913T; Hs
729;
FHs 738Lu; FHs 173We; FHs 738B1; NIH:OVCAR-3; Hs 67; RD-ES; ChaGo K-1;
WERI-Rb-1; NCI-H446; NCI-H209; NCI-H146; NCI-H441; NCI-H82; H9; NCI-H460;
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
62
NCI-H596; NCI-H676B; NCI-H345; NCI-H820; NCI-H520; NCI-H661; NCI-H510A;
D283 Med; Daoy; D341 Med; AML-193 and MV4-1 1.
One may consult the ATCC Catalogue of any subsequent year to identify other
appropriate cell lines. Also, if a particular cell type is desired, the means
for obtaining
such cells, or their instantly available source, are known. An analysis of the
scientific
literature will thus readily reveal an appropriate choice of cell for any
tumor cell type
desired to be targeted.
Recent technological advances allow rapid and efficient comparisons of gene
expression in neoplastic tissue to that of normal tissue. These technological
advances
include but are not limited to differential gene analysis using gene chip
arrays and protein
arrays. Using these technologies one is able to compare mRNA species and
proteins
expressed in neoplastic tissue to that found in normal tissue. Those mRNA
species or
proteins that are differentially expressed in neoplastic tissue compared to
normal tissue
may be readily discerned. Proteins found to be preferentially expressed in
neoplastic
tissue or in neoplastic cells using these screening technologies serve as
likely candidates
for the further development of cancer or tumor specific therapies. It is an
embodiment of
the current invention that tumor associated proteins or tumor specific
proteins discovered
using these technologies may be employed as targets in connection with the
combined
aspects of the present invention.
K. Combined Treatment
Combination of the inventive polypeptides with other therapeutic agents is
contemplated for use in the clinical treatment of various diseases that
involve altering
immunity, inflammation or neoplasms.
Naturally, before wide-spread use, animal studies and clinical trials will be
conducted. The various elements of conducting a clinical trial, including
patient
treatment and monitoring, are known, especially in light of the present
disclosure.
The present invention contemplates that the inventive polypeptides may be used
in combination with other therapies. Therapies for autoimmune diseases include
but are
not limited to interferon-P, interferon-a, i.v. immunoglobulins, monoclonal
antibodies
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
63
such as h5G1.1-mAb, polyclonal antibodies such as anti-RhoD (WinRho SDF),
retinoic
acid and other immunomodulatory agents such as glatiramer acetate.
Therapies for diseases that involve inflammation include, but are not limited
to
non-steroidal inflammatory drugs (NSAIDs) such as cyclo-oxygenase 2 (COX-2)
inhibitors.
The present invention contemplates that the inventive polypeptides may be used
as an adjuvant in combination with vaccines. Vaccines include, for example,
mAb
105AD7 anti-idiotype vaccine, mAb 11D10 anti-idiotype vaccine, mAb 3H1 anti-
idiotype vaccine, GM2, GM2-KLH, and MUC-1 antigen among many others.
Cancer therapies include a variety of combination therapies that are
contemplated
with the inventive polypeptides including immunological, chemical and
radiation based
treatments. Combination immunotherapies include, for example, interleukin-2,
monoclonal or bispecific antibodies such as Rituximab, Herceptin
(Trastuzumab), mAb
Lym-1, mAb m170, mAb BC8, mAb Anti-B1 (tositumomab), Campath-1H, anti-CEA
mAb MN-14, mAb HuGI-M195, mAb HuM291, mAb 3F8, mAb C225 (cetuximab),
anti-Tac mAb (daclizumab), and mAb hLL2 (epratuzumab).
Combination immunotherapies also include monoclonal antibodies (mAb) linked
to toxins or other agents. Examples include mAb gemtuzumab ozogamicin
(mylotarg),
mAb Mono-dgA-RFB4, mAb ibritumomab tiuxetan (IDEC-Y2B8), and Anti-Tac(Fv)-
PE38. Combination chemotherapies include, for example, cisplatin (CDDP),
carboplatin,
procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide,
melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin, daunorubicin,
doxorubicin,
bleomycin, plicomycin, mitomycin, etoposide (VP16), tamoxifen, taxol,
transplatinum, 5-
fluorouracil, vincristin, vinblastin and methotrexate or any analog or
derivative variant
thereof.
For precancerous conditions such as benign prostatic hyperplasia, a second
therapeutic agent selected from an a-1 adrenergic receptor blocker such as
terazosin,
doxazosin, prazosin, bunazosin, indoramin, tamsulosin, prazicin or alfuzosin;
a 5-a-
reductase enzyme blocker such as finasteride or an azasteroid derivative; a
combination
of an a-1 adrenergic receptor blocker, and a 5-a-reductase enzyme blocker, a
potassium
channel opener such as minoxidil, and a retinoic acid derivative.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
64
Various combinations may be employed, for instance where the inventive
polypeptide is "A" and the radio-, chemotherapeutic or other therapeutic agent
is "B":
A/B/A B/A/B BB/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B
B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A
B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A
The terms "contacted" and "exposed," when applied to a cell, are used herein
to describe
the process by which a therapeutic composition and a chemotherapeutic or
radiotherapeutic agent are delivered to a target cell or are placed in direct
juxtaposition
with the target cell. To achieve cell killing or stasis, both agents are
delivered to a cell in
a combined amount effective to kill the cell or prevent it from dividing.
The therapy including inventive polypeptides may precede or follow the other
agent treatment by intervals ranging from minutes to weeks. In embodiments
where the
other agent and inventive polypeptide are applied separately to the cell, one
would
generally ensure that a significant period of time did not expire between the
time of each
delivery, such that the agent and the fusion protein would still be able to
exert an
advantageously combined effect on the cell. In such instances, it is
contemplated that one
would contact the cell with both modalities within about 12-24 h of each other
or within
about 6-12 h of each other, with a delay time of only about 12 h being also
possible. In
some situations, it may be desirable to extend the time period for treatment
significantly,
however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4,
5, 6, 7 or 8)
elapse between the respective administrations.
L. Pharmaceutical Compositions
Pharmaceutical compositions of the present invention comprise an effective
amount of one or more inventive polypeptides, therapeutic agents or additional
agent
dissolved or dispersed in a pharmaceutically acceptable carrier. Aqueous
compositions
of the present invention comprise an effective amount of the inventive
polypeptides,
dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous
medium. The
phrases "pharmaceutically or pharmacologically acceptable" refer to molecular
entities
and compositions that do not produce an adverse, allergic or other untoward
reaction
when administered to an animal, or a human, as appropriate.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
As used herein, "pharmaceutically acceptable carrier" includes any and all
solvents, dispersion media, coatings, surfactants, antioxidants, preservatives
(e.g.,
antibacterial agents, antifungal agents), isotonic agents, absorption delaying
agents, salts,
preservatives, drugs, drug stabilizers, gels, binders, excipients,
disintegration agents,
5 lubricants, sweetening agents, flavoring agents, dyes, such like materials
and
combinations thereof (see, for example, Remington's Pharmaceutical Sciences,
18th Ed.
Mack Printing Company, 1990, pp. 1289-1329). The use of such media and agents
for
pharmaceutical active substances is known. Except insofar as any conventional
media or
agent is incompatible with the active ingredient, its use in the therapeutic
compositions is
10 contemplated. Supplementary active ingredients can also be incorporated
into the
compositions. For human administration, preparations should meet sterility,
pyrogenicity, general safety and purity standards as required by FDA Office of
Biologic
Standards.
The biological material should be dialyzed to remove undesired small molecular
15 weight molecules or lyophilized for more ready formulation into a desired
vehicle, where
appropriate. The active compounds will then generally be formulated for
parenteral
administration, e.g., formulated for injection via the intravenous,
intramuscular, sub-
cutaneous, intranasal, intralesional, or even intraperitoneal routes.
Typically, such
compositions can be prepared as injectables, either as liquid solutions or
suspensions;
20 solid forms suitable for using to prepare solutions or suspensions upon the
addition of a
liquid prior to injection can also be prepared; and the preparations can also
be emulsified.
The pharmaceutical forms suitable for injectable use include sterile aqueous
solutions or dispersions; formulations including sesame oil, peanut oil or
aqueous
propylene glycol; and sterile powders for the extemporaneous preparation of
sterile
25 injectable solutions or dispersions. In all cases the form must be sterile
and must be fluid
to the extent that easy syringability exists. It must be stable under the
conditions of
manufacture and storage and must be preserved against the contaminating action
of
microorganisms, such as bacteria and fungi.
Solutions of the active compounds as free base or pharmacologically acceptable
30 salts can be prepared in water suitably mixed with a surfactant, such as
hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
66
polyethylene glycols, and mixtures thereof and in oils. Under ordinary
conditions of
storage and use, these preparations contain a preservative to prevent the
growth of
microorganisms.
The inventive polypeptides can be formulated into a composition in a free
base, in
a neutral or salt form. Pharmaceutically acceptable salts, include the acid
addition salts
(formed with the free amino groups of the protein) and which are formed with
inorganic
acids such as, for example, hydrochloric or phosphoric acids, or such organic
acids as
acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free
carboxyl groups
can also be derived from inorganic bases such as, for example, sodium,
potassium,
ammonium, calcium, or ferric hydroxides, and such organic bases as
isopropylamine,
trimethylamine, histidine, procaine and the like.
The carrier can also be a solvent or dispersion medium containing, for
example,
water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid
polyethylene
glycol, and the like), suitable mixtures thereof, and vegetable oils. The
proper fluidity
can be maintained, for example, by the use of a coating, such as lecithin, by
the
maintenance of the required particle size in the case of dispersion and by the
use of
surfactants. The prevention of the action of microorganisms can be brought
about by
various antibacterial and antifungal agents, for example, parabens,
chlorobutanol, phenol,
sorbic acid, thimerosal, and the like. In many cases, isotonic agents, for
example, sugars
or sodium chloride can be included. Prolonged absorption of the injectable
compositions
can be brought about by the use in the compositions of agents delaying
absorption, for
example, aluminum monostearate and gelatin.
Sterile injectable solutions are prepared by incorporating the active
compounds in
the required amount in the appropriate solvent with various of the other
ingredients
enumerated above, as required, followed by filtered sterilization. Generally,
dispersions
are prepared by incorporating the various sterilized active ingredients into a
sterile
vehicle which contains the basic dispersion medium and the required other
ingredients
from those enumerated above. In the case of sterile powders for the
preparation of sterile
injectable solutions, some methods of preparation are vacuum-drying and freeze-
drying
techniques which yield a powder of the active ingredient plus any additional
desired
ingredient from a previously sterile-filtered solution thereof. The
preparation of more, or
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
67
highly, concentrated solutions for direct injection is also contemplated,
where the use of
DMSO as solvent is envisioned to result in extremely rapid penetration,
delivering high
concentrations of the active agents to a small area.
Upon formulation, solutions will be administered in a manner compatible with
the
dosage formulation and in such amount as is therapeutically effective. The
formulations
are easily administered in a variety of dosage forms, such as the type of
injectable
solutions described above, but drug release capsules and the like can also be
employed.
For parenteral administration in an aqueous solution, for example, the
solution
should be suitably buffered if necessary and the liquid diluent first rendered
isotonic with
sufficient saline or glucose. These particular aqueous solutions are
especially suitable for
intravenous, intramuscular, subcutaneous, intranasal, and intraperitoneal
administration.
In this connection, sterile aqueous media that can be employed will be known
to those of
skill in the art in light of the present disclosure. For example, one dosage
could be
dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of
hypodermoclysis fluid or injected at the proposed site of infusion, (see for
example,
"Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-
1580).
Some variation in dosage will necessarily occur depending on the condition of
the subject
being treated. The person responsible for administration will, in any event,
determine the
appropriate dose for the individual subject.
In addition to the compounds formulated for parenteral administration, such as
intravenous or intramuscular injection, other pharmaceutically acceptable
forms include,
e.g., tablets or other solids for oral administration; liposomal formulations;
time release
capsules; and any other form currently used, including cremes.
In certain embodiments, the use of liposomes or nanoparticles is contemplated
for
the formulation and administration of the fusion proteins or analogs thereof.
The
formation and use of liposomes is generally known and is also described below.
Nanocapsules can generally entrap compounds in a stable and reproducible way.
To avoid side effects due to intracellular polymeric overloading, such
ultrafine particles
(sized around 0.1 m) should be designed using polymers able to be degraded in
vivo.
Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these
requirements are
contemplated for use in the present invention, and such particles are easily
made.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
68
Liposomes are formed from phospholipids that are dispersed in an aqueous
medium and spontaneously form multilamellar concentric bilayer vesicles (also
termed
multilamellar vesicles (MLVs). MLVs generally have diameters of from 25 nm to
4 m.
Sonication of MLVs results in the formation of small unilamellar vesicles
(SUVs) with
diameters in the range of 200 to 500 A, containing an aqueous solution in the
core.
The following information may also be utilized in generating liposomal
formulations. Phospholipids can form a variety of structures other than
liposomes when
dispersed in water, depending on the molar ratio of lipid to water. At low
ratios the
liposome is the preferred structure. The physical characteristics of liposomes
depend on
pH, ionic strength and the presence of divalent cations. Liposomes can show
low
permeability to ionic and polar substances, but at elevated temperatures
undergo a phase
transition which markedly alters their permeability. The phase transition
involves a
change from a closely packed, ordered structure, known as the gel state, to a
loosely
packed, less-ordered structure, known as the fluid state. This occurs at a
characteristic 15 phase-transition temperature and results in an increase in
permeability to ions, sugars and
drugs.
Liposomes interact with cells via four different mechanisms: Endocytosis by
phagocytic cells of the reticuloendothelial system such as macrophages and
neutrophils;
adsorption to the cell surface, either by nonspecific weak hydrophobic or
electrostatic
forces, or by specific interactions with cell-surface components; fusion with
the plasma
cell membrane by insertion of the lipid bilayer of the liposome into the
plasma
membrane, with simultaneous release of liposomal contents into the cytoplasm;
and by
transfer of liposomal lipids to cellular or subcellular membranes, or vice
versa, without
any association of the liposome contents. Varying the liposome formulation can
alter
which mechanism is operative, although more than one may operate at the same
time.
The therapeutic agent may comprise different types of carriers depending on
whether it is to be administered in solid, liquid or aerosol form, and whether
it needs to
be sterile for such routes of administration as injection. The present
invention can be
administered intravenously, intradermally, intraarteri ally,
intraperitoneally,
intralesionally, intracranially, intraarticularly, intraprostaticaly,
intrapleurally,
intratracheally, intranasally, intravitreally, intravaginally, intrarectally,
topically,
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
69
intratumorally, intramuscularly, intraperitoneally, subcutaneously,
subconjunctival,
intravesicularlly, mucosally, intrapericardially, intraumbilically,
intraocularally, orally,
topically, locally, by inhalation (e.g.. aerosol inhalation), by injection, by
infusion, by
continuous infusion, localized perfusion bathing target cells directly, via a
catheter, via a
lavage, in cremes, in lipid compositions (e.g., liposomes), or by other
methods or any
combination of the foregoing (see, for example, Remington's Pharmaceutical
Sciences,
18th Ed. Mack Printing Company, 1990).
The actual dosage amount of a composition of the present invention
administered
to an animal patient can be determined by physical and physiological factors
such as
body weight, severity of condition, the type of disease being treated,
previous or
concurrent therapeutic interventions, idiopathy of the patient and the route
of
administration. The practitioner responsible for administration will, in any
event,
determine the concentration of active ingredient(s) in a composition and
appropriate
dose(s) for the individual subject.
In certain embodiments, pharmaceutical compositions may comprise, for
example, at least about 0.1% of an active compound. In other embodiments, an
active
compound may comprise between about 2% to about 75% of the weight of the unit,
or
between about 25% to about 60%, for example, and any range derivable therein.
In other
non-limiting examples, a dose may also comprise from about 1 microgram/kg/body
weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight,
about
50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200
microgram/kg/body weight, about 350 microgram/kg/body weight, about 500
microgram/kg/body weight, about 1 milligram/kg/body weight, about 5
milligram/kg/body weight, about 10 milligram/kg/body weight, about 50
milligram/kg/body weight, about 100 milligram/kg/body weight, about 200
milligram/kg/body weight, about 350 milligram/kg/body weight, about 500
milligram/kg/body weight, to about 1000 mg/kg/body weight or more per
administration,
and any range derivable therein. In non-limiting examples of a derivable range
from the
numbers listed herein, a range of about 5 mg/kg/body weight to about 100
mg/kg/body
weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body
weight, etc.,
can be administered, based on the numbers described above.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
In any case, the composition may comprise various antioxidants to retard
oxidation of one or more component.
In embodiments where the composition is in a liquid form, a carrier can be a
solvent or dispersion medium comprising but not limited to, water, ethanol,
polyol (e.g.,
5 glycerol, propylene glycol, liquid polyethylene glycol, etc), lipids (e.g.,
triglycerides,
vegetable oils, liposomes) and combinations thereof. The proper fluidity can
be
maintained, for example, by the use of a coating, such as lecithin; by the
maintenance of
the required particle size by dispersion in carriers such as, for example
liquid polyol or
lipids; by the use of surfactants such as, for example hydroxypropylcellulose;
or
10 combinations thereof. In some cases, it will be preferable to include
isotonic agents, such
as, for example, sugars, sodium chloride or combinations thereof.
In other embodiments, one may use eye drops, nasal solutions or sprays,
aerosols or
inhalants in the present invention. Such compositions are generally designed
to be
compatible with the target tissue type. In a non-limiting example, nasal
solutions are usually
15 aqueous solutions designed to be administered to the nasal passages in
drops or sprays.
Nasal solutions are prepared so that they are similar in many respects to
nasal secretions, so
that normal ciliary action is maintained. Thus, in some embodiments the
aqueous nasal
solutions usually are isotonic or slightly buffered to maintain a pH of about
5.5 to about 6.5.
In addition, antimicrobial preservatives, similar to those used in ophthalmic
preparations,
20 drugs, or appropriate drug stabilizers, if required, may be included in the
formulation. For
example, various commercial nasal preparations are known and include drugs
such as
antibiotics or antihistamines.
In certain embodiments the inventive polypeptides are prepared for
administration
by such routes as oral ingestion. In these embodiments, the solid composition
may
25 comprise, for example, solutions, suspensions, emulsions, tablets, pills,
capsules (e.g.,
hard or soft shelled gelatin capsules), sustained release formulations, buccal
compositions, troches, elixirs, suspensions, syrups, wafers, or combinations
thereof. Oral
compositions may be incorporated directly with the food of the diet. Some
carriers for
oral administration comprise inert diluents, assimilable edible carriers or
combinations
30 thereof. In other aspects of the invention, the oral composition may be
prepared as a
syrup or elixir. A syrup or elixir, may comprise, for example, at least one
active agent, a
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
71
sweetening agent, a preservative, a flavoring agent, a dye, a preservative, or
combinations
thereof.
In certain embodiments an oral composition may comprise one or more binders,
excipients, disintegration agents, lubricants, flavoring agents, and
combinations thereof.
In certain embodiments, a composition may comprise one or more of the
following: a
binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin or
combinations
thereof; an excipient, such as, for example, dicalcium phosphate, mannitol,
lactose,
starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate
or
combinations thereof; a disintegrating agent, such as, for example, corn
starch, potato
starch, alginic acid or combinations thereof; a lubricant, such as, for
example, magnesium
stearate; a sweetening agent, such as, for example, sucrose, lactose,
saccharin or
combinations thereof; a flavoring agent, such as, for example peppermint, oil
of
wintergreen, cherry flavoring, orange flavoring, etc.; or combinations of the
foregoing.
When the dosage unit form is a capsule, it may contain, in addition to
materials of the
above type, carriers such as a liquid carrier. Various other materials may be
present as
coatings or to otherwise modify the physical form of the dosage unit. For
instance,
tablets, pills, or capsules may be coated with shellac, sugar or both.
Additional formulations which are suitable for other modes of administration
include
suppositories. Suppositories are solid dosage forms of various weights and
shapes, usually
medicated, for insertion into the rectum, vagina or urethra. After insertion,
suppositories
soften, melt or dissolve in the cavity fluids. In general, for suppositories,
traditional carriers
may include, for example, polyalkylene glycols, triglycerides or combinations
thereof. In
certain embodiments, suppositories may be formed from mixtures containing, for
example,
the active ingredient in the range of about 0.5% to about 10%, or about 1% to
about 2%.
The composition must be stable under the conditions of manufacture and
storage,
and preserved against the contaminating action of microorganisms, such as
bacteria and
fungi. It will be appreciated that endotoxin contamination should be kept
minimally at a
safe level, for example, less that 0.5 ng/mg protein.
In particular embodiments, prolonged absorption of an injectable composition
can
be brought about by the use in the compositions of agents delaying absorption,
such as,
for example, aluminum monostearate, gelatin or combinations thereof.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
72
The invention also provides for the use of adjuvants as components in an
immunogenic composition compatible with the purified proteins to boost the
immune
response resulting from vaccination. One or more adjuvants can be selected
from the
group comprising saponins (e.g, GP-0100), or derivatives thereof, emulsions
alone or in
combination with carbohydrates or saponins, and aluminum-based adjuvants
(collectively, "alum" or "alum-based adjuvants") such as aluminum hydroxide,
aluminum
phosphate, or a mixture thereof. Aluminum hydroxide (commercially available as
"Alhydrogel") was used as alum in the Examples. A saponin is any plant
glycoside with
soapy action that can be digested to yield a sugar and a sapogenin aglycone.
Sapogenin is
the nonsugar portion of a saponin. It is usually obtained by hydrolysis, and
it has either a
complex terpenoid or a steroid structure that forms a practicable starting
point in the
synthesis of steroid hormones. The saponins of the invention can be any
saponin as
described above or saponin-like derivative with hydrophobic regions,
especially the
strongly polar saponins, primarily the polar triterpensaponins such as the
polar acidic
bisdesmosides, e.g. saponin extract from Quillsjabark Araloside A,
Chikosetsusaponin
IV, Calendula-Glycoside C, chikosetsusaponin V, Achyranthes-Saponin B,
Calendula-
Glycoside A, Araloside B, Araloside C, Putranjia-Saponin III,
Bersamasaponiside,
Putrajia-Saponin IV, Trichoside A, Trichoside B, Saponaside A, Trichoside C,
Gypsoside, Nutanoside, Dianthoside C, Saponaside D, aescine from Aesculus
hippocastanum or sapoalbin from Gyposophilla struthium, saponin extract
Quillaja
saponaria Molina and Quil A. In addition, saponin may include glycosylated
triterpenoid
saponins derived from Quillaja Saponaria Molina of Beta Amytin type with 8-11
carbohydrate moieties as described in U.S. Pat. No. 5,679,354. Saponins as
defined
herein include saponins that may be combined with other materials, such as in
an immune
stimulating complex ("ISCOM")-like structure as described in U.S. Pat. No.
5,679,354.
Saponins also include saponin-like molecules derived from any of the above
structures,
such as GPI-0100, such as described in U.S. Pat. No. 6,262,029. The saponins
of the
invention can be amphiphilic natural products derived from the bark of the
tree, Quillaja
saponaria. They can consist of mixtures of triterpene glycosides with an
average
molecular weight (Mw) of 2000. In another embodiment of the invention a
purified
fraction of this mixture is used.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
73
M. Kits
Any of the compositions described herein may be comprised in a kit. In a non-
limiting example, an inventive polypeptide, a nucleic acid coding for an
inventive
polypeptide or additional agent, may be comprised in a kit. The kits will thus
comprise,
in suitable container means, an inventive polypeptide, a nucleic acid coding
for an
inventive polypeptide or an additional agent of the present invention. The
inventors
envisage other components that may be included in a kit. These include but are
not
limited to immunodetection agents such as peroxidase and alkaline phosphatase
linked
monoclonal and polyclonal antibodies, immunoprecipitation reagents such as
protein A-
or protein G- linked beads, immune cell purification reagents such as magnetic
beads,
cloning reagents for the purpose of manipulating an expression vector, protein
expression
reagents including prokaryotic and eukaryotic cell lines for the purpose of
protein
expression.
The kits may comprise a suitably aliquoted inventive polypeptide or additional
agent compositions of the present invention, whether labeled or unlabeled, as
may be
used to prepare a standard curve for a detection assay. The components of the
kits may
be packaged either in aqueous media or in lyophilized form. The container
means of the
kits will generally include at least one vial, test tube, flask, bottle,
syringe or other
container means, into which a component may be placed, or suitably aliquoted.
Where
there is more than one component in the kit, the kit also will generally
contain a second,
third or other additional container into which the additional components may
be
separately placed. However, various combinations of components may be
comprised in a
vial. The kits of the present invention also will typically include a means
for containing
the inventive polypeptide, lipid, additional agent, and any other reagent
containers in
close confinement for commercial sale. Such containers may include injection
or
blow-molded plastic containers into which the desired vials are retained.
Therapeutic kits of the present invention comprise an inventive polypeptide,
other
polypeptide, peptide, inhibitor, gene, vector or other effectors. Such kits
will generally
contain, in suitable container means, a pharmaceutically acceptable
formulation of an
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
74
inventive polypeptide in a pharmaceutically acceptable formulation. The kit
may have a
single container means, or it may have distinct container means for each
compound.
When the components of the kit are provided in one or more liquid solutions,
the
liquid solution is an aqueous solution, with a sterile aqueous solution being
sometimes
preferred. The inventive polypeptide composition may also be formulated into a
syringeable composition, in which case, the container means may itself be a
syringe,
pipette, or other such like apparatus, from which the formulation may be
applied to an
infected area of the body, injected into an animal, or even applied to or
mixed with the
other components of the kit.
However, the components of the kit may be provided as dried powder(s). When
reagents or components are provided as a dry powder, the powder can be
reconstituted by
the addition of a suitable solvent. It is envisioned that the solvent may also
be provided
in another container means.
The container means will generally include at least one vial, test tube,
flask,
bottle, syringe or other container means, into which the immunoglobulin fusion
protein
formulation is placed, preferably, suitably allocated. The kits may also
comprise a
second container means for containing a sterile, pharmaceutically acceptable
buffer or
other diluent.
The kits of the present invention will also typically include a means for
containing
the vials in close confinement for commercial sale, such as, e.g., injection
or blow-
molded plastic containers into which the desired vials are retained.
Irrespective of the number or type of containers, the kits of the invention
may also
comprise, or be packaged with, an instrument for assisting with the
injection/administration or placement of the ultimate inventive polypeptide
within the
body of an animal. Such an instrument may be a syringe, pipette, forceps, or
any such
medically approved delivery vehicle.
As used herein the specification, "a" or "an" may mean one or more. As used
herein in the claim(s), when used in conjunction with the word "comprising",
the words
"a" or "an" may mean one or more than one. As used herein "another" may mean
at least
a second or more. As used herein, "or" takes on its usual meaning in that it
also includes
the conjunctive sense of and.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
Some of the abbreviations used in this application can be found in Table 4.
Table 4
AIG Aggregated Igg
IC Immune Complex
FcyR Fc Gamma Receptor
SLE Systemic Lupus Erythematosus
MS Multiple Sclerosis
CDCC Complement-Dependent Cellular Cytotoxicity
ADCC Antibody-Dependent Cell-Mediated Cytotoxicity
CDC Complement-Dependent Cytotoxicity
EAE Experimental Autoimmune Encephalomyelitis
NK cells Natural Killer Cells
PBMC Peripheral Blood Mononuclear Cells
5
N. Examples
The following examples are included to demonstrate some embodiments of the
invention. It will be appreciated that many changes can be made in the
specific
embodiments that are disclosed and still obtain a like or similar result
without departing
10 from the spirit and scope of the invention.
Examples 1, 2, and 3 describe the cloning and construction of the Fc framework
region and HCH2 polymer region of the ligands described in this application.
This
sequence in the mature polypeptide referred to as R4 is 742 amino acids long
and is SEQ
ID NO: 13.
Example 1- Cloning of the cDNA for the Fc region of Human IgG1
The Fc region of human IgG, corresponds to the constant region domains that
include the hinge region and CH2 and CH3 domains, (H-CH2-CH3). The cDNA for
the
Fc region was isolated to serve as template for HCH2 polymer construction. In
addition
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
76
the HCH2 polymers wer expressed as fusion to the Fc region. While the Fc
region was
derived from human IgGI cDNA one could equally use the H-CH2-CH3 domains from
human IgG3 for this same purpose. To obtain the H-CH2-CH3 sequence for human
IgGI, total RNA was isolated from the cell line ARH-77 (ATCC #: CRL-162) using
the
method of Chomczynski and Sacchi (Chomczynski, 1986). cDNA was produced from
the
total RNA using reverse transcription. First strand cDNA synthesis was primed
with 100
pmol random hexamers using 200 U SuperScript II reverse transcriptase
(Invitrogen) and
5 gg of total RNA in a 20 L reaction mixture that was 500 M in dNTPs
(Pharmacia), 1
U RNasin / L (Promega), 10 M in DTT, and 1 x in first strand buffer.
Reaction
proceeded at 42 C for 50 min.
The fragment containing the H-CH2-CH3 region (corresponding to amino acid
residues 226-457) was subcloned using RT-PCR, the primer, FRM-5p-H3, which
introduced a HindIIl site immediately 5' of the hinge region and a second
primer, FRM-
3p-Sal, which introduced a SaII site immediately 3' of the stop codon (Table
5). PCR
reactions were carried out in a volume of 50 L and consisted of 1xPCR buffer
(10 mM
Tris pH 8.3 and 50 mM KCL), 1.5 mM MgC12, 150 M of dNTPs, 15 pmol each of
forward and reverse primers, 5 L of reverse transcription products and 1.25 U
TAQ
polymerase. Cycling parameters consisted of 30s denaturation at 94 C, 1 min
annealing
at 60 C and 1 min extension at 72 C and reactions proceeded for 30 cycles.
The contents
of 4 identical PCR reactions were pooled and extracted once with 1:1:0.05
mixture of
phenol:CHC13:isoamyl alcohol (PCIA) and subsequently extracted lx with CHC13.
DNA
was recovered by precipitation with sodium acetate, pH5.4, and ethanol. DNA
pellets
were washed lx with 75% ethanol, and air dried. Amplified cDNAs were dually
digested
for two hours in a 120 L digestion buffer containing 150 U of HindI1l and 150
U SaII.
The digest was extracted lx with PCIA and lx with CHC13 and DNA was recovered
by
ethanol precipitation. DNA pellets were washed 1 x with 75% ethanol, air dried
and
resuspended in 15 L of TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0). The HindIII
and
SaII digested PCR products were ligated into like-digested pBSKS+ vector
(Stratagene).
The ligation reaction contained 50-100 ng of vector, 20-400 ng of insert, 2 L
of
lOx reaction buffer (660 mM Tris-HCI, pH &.5, 50 mM MgCIZ, 50 mM DTT, 10 mM
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
77
ATP), 1 L of 5 mM ATP, and 5 U T4 DNA ligase in a final volume of 20 L. The
ligation reaction proceeded overnight at 16 C.
L of ligation product was used to transform DH5a cells (subcloning-
efficiency, Invitrogen). Transformed bacteria were plated onto LB-Amp plates.
10
5 colonies from each transformation were grown up over-night in LB-Amp medium
and
mini-prep DNA was isolated and analyzed by HindIII and SaII digestion.
Plasmid preparation: To produce larger quantities of plasmid, single colonies
were used to inoculate 75 mL of LB medium supplemented with the appropriate
antibiotic and the cultures were grown over-night. Plasmid DNA was isolated
from
10 bacteria using the Qiagen plasmid midi purification kit following the
manufacturers
protocol (Qiagen). Plasmid DNA was resuspended in TE buffer and UV absorbance
at
260/280 nm is used to determine concentration and purity. Plasmid
concentration and
purity was confirmed by electrophoresis on agarose gels and visualization of
DNA by
ethidium bromide staining. Two positive clones were analyzed by DNA sequencing
to
verify sequence integrity. The resulting clone pFRM-HS was used for further
expression
construct assembly as describe in the following examples. Primers for this and
subsequent steps involving IgGI cloning were designed using sequence data from
the
human IgGI constant region gene as a guide (accession # Z17370).
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
78
TABLE 5
Sequence of Primers used for human IgGl HCH2 polymer PCR Amplification
Name Sequence
FRM-5P-H3 GgccgctaAAGCTTGAGCCCAAATCTTGTGACAAAACTC (SEQ ID NO:1)
FRM-3P-Sal GgccgctaGTCGACTCATTTACCCGGAGACAGGGAGAG (SEQ ID NO:2)
Hingel CccgtaGAATTCGAGCCCAAATCTTCTGACAAAACTCACACATCCCCA
CCGTCCCCA (SEQ ID NO:3)
CH2NH3 GgccgcatAAGCTTggagccTCGCGATTTGGCTTTGGAGATGGTTTTCTC
(SEQ ID NO:4)
SMA-DELH GgccgcatCCCGGGGAGCCCAAATCTTCTGACAAAACT (SEQ ID NO:5)
CH2H3 GgccgcatAAGCTTTTTGGCTTTGGAGATGGTTTTCTC (SEQ ID NO:6)
The small letters indicate bases used as clamps or spacers. Boldface letters
denote the
location of restriction sites.
Example 2- Hinge Mutagenesis and CH2 subcloning
This example describes the isolation and construction of a cDNA coding for the
hinge and CH2 region (HCH2) used for the construction of the HCH2 polymer. The
region of Fc that binds to FcyRI, FcyRII, and FcyRIII is found within the HCH2
region.
The HCH2 region (corresponding to amino acid residues 226-350 of IgG 1) was
isolated
as a separate monomer unit using PCR. The hinge region within the HCH2 monomer
unit was modified using PCR mutagenesis to change the three cysteines that
form inter-
chain disulfide bridges between Fc units to serines. Since the mature
polypeptide will
contain from 2 to 6 HCH2 units in each polypeptide chain, we mutated the three
cysteines
in each hinge region (H) so that aberrant disulfide bonds do not form during
the
translation of the mRNA to a polypeptide. The polymer was constructed using
three
differing constructs, referred to as ENH, SNH, and SH3. These units differ one
from
another only at their 5' or 3' ends in that they have different flanking
restriction sites as
detailed below. These units allow for the construction of the HCH2 polymers as
detailed
in Example 3.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
79
The first unit produced, composed of 5' EcoRI-AHCH2-NruI -HindIII 3', is
termed "ENH" to denote the sequence of restriction sites and the `delta' is
included in
front of the hinge, H, to denote that the hinge region was mutagenised. The
ENH
construct served as the starting unit for polymer construction. This was
accomplished by
amplifying the HCH2 region (corresponding to amino acid residues 226-350 of
IgGI)
using a 5' primer, Hingel (Table 5) which introduced single nucleotide changes
in each
of the three hinge cysteine codons resulting in their alteration to serine
residues. The 5'
primer also introduced an EcoRI site immediately 5' of the hinge region. The
3' primer,
CH2NH3 (Table 5), directed the amplification of the CH2 domain and introduced
an in-
frame 3' NruI site separated by a 6 nucleotide spacer from a HindIII site.
Clone pFRM-
HS was the template for the PCR reactions. PCR reactions conditions were
identical to
those described in Example 1. PCR reactions were pooled, extracted with
phenol:
Chloroform to remove the Taq polymerase and the amplified DNA was recovered
with
sodium acetate precipitation as described for Example 1. Amplified cDNA was
dually
digested for two hours in a 120 L digestion buffer containing 150 U of EcoRI
and 150 U
HindI1I. The digest was extracted and DNA was recovered by ethanol
precipitation as
described for Example 1. The EcoRI and HindlIl digested PCR products were
ligated into
like-digested pBSKS+ vector (Stratagene). Ligation reaction conditions were
the same as
described for Example 1. 10 L of ligation product was used to transform DH5a
cells
(subcloning-efficiency, Invitrogen). Transformed bacteria were plated onto LB-
Amp
plates. 10 colonies from each transformation were grown up over-night in LB-
Amp
medium and mini-prep DNA was isolated and analyzed by EcoRI and HindIIl
digestion.
Two clones identified as positive by restriction analysis were used to
inoculate 75
mL cultures to produce larger quantities of plasmid using Qiagen midi columns
as
described for Example 1. The clones were analyzed by DNA sequencing to verify
sequence integrity. Clone pENH18 was used in subsequent cloning steps.
Two additional constructs, an extension unit designated pSNH, and a capping
unit
designated pSH3, were generated. These varied from pENH18 only in their
flanking
restriction sites. pSNH has 5' SmaI-HCH2-NruI -HindIII 3' and was amplified
using
pENH18 as template and primers that introduced the flanking restriction sites
(Table 5).
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
The second construct, pSH3, contains 5' Smal-HCH2-HindIII 3' and was amplified
from
pENH18 template using a 5' primer, SMA-DELH, and a 3' primer, CH2H3 (Table 5),
which introduced a single HindIII site that flanks the 3' end of the CH2
domain. In both
instances, the techniques and conditions for the PCR reactions, restriction
digest, ligation
5 and plasmid preparation are identical to those described for Example 1. For
polymer
construction, both pSNH and pSH3 plasmids were digested with Smal and HindIII.
The
digestion released the 5' SmaI-HCH2-Nrul -HindIII 3' and 5' SmaI-HCH2-HindIII
3'
inserts from the vector. The restriction digests were extracted once with
1:1:0.05 mixture
of phenol:CHC13: isoamyl alcohol (PCIA) and subsequently extracted Ix with
CHC13.
10 DNA was recovered by precipitation with sodium acetate, pH5.4, and ethanol.
DNA
pellets were washed Ix with 75% ethanol, and air dried. The pelleted digests
were
resuspended in 20 L of TE, mixed with 6x loading dye (0.025% xylene cyanol,
0.025 %
bromphenol blue, and 50% sucrose in Tris-EDTA buffer) and loaded onto 1% low-
melt
agarose gels in TAE running buffer. The inserts were visualized on a UV gel
box, and
15 the inserts were excised from the gel and transferred to microfuge tubes.
The DNA
inserts were purified from the gel using the QIAEX II Gel Extraction kit
(Qiagen)
following manufacturers instructions. The inserts were eluted in 50 L of TE
and stored
for use in polymer construction (Example 3).
Example 3 - Polymer Construction
20 Polymers composed of HCH2 units were built using the scheme presented in
FIG.
1. The HCH2 polymers were constructed by the sequential addition of a single
starting
unit (ENH), multiple extension units (SNH), and ended by addition of a single
capping
unit (SH3).
Clone pENH18 was digested with NruI and HindI1I resulting in a 5' blunt end
and
25 a 3' sticky end. Next a 5' SmaI-HCH2-Nrul -HindIII 3' insert, isolated as
described in
Example 2, was ligated into the linearized vector resulting in the in-frame
insertion of a
HCH2 repeat unit at the 3' end of the pENH18 starting unit. The insertion also
regenerated the original sequence of restriction sites (NruI - spacer-HindIIl)
that were
used in the next round of extension. Conditions for the ligation reaction were
identical to
30 those described for Example 1. The ligation mixture is transformed into
DH5a cells.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
81
Transformed bacteria were plated onto LB-Amp plates and 10 colonies from the
transformation were grown up over-night in LB-Amp medium and min-prep DNA was
isolated and analyzed by EcoRI and HindIII digestion to confirm the insertion.
Two
colonies were expanded into 75 mL of LB-Amp broth and grown overnight. Plasmid
DNA was isolated using the Qiagen midi columns as described in Example 1.
Sequence
integrity was confirmed with DNA sequencing. The extension process continued
with
Nrul and HindIII digestion of the nascent polymer vector followed by ligation
with the
next SNH insert as described above. This cycle of digestion, ligation,
transformation,
and plasmid isolation was repeated twice more to generate the HCH2 polymer
sequence
for R4. In the final round of polymer construction a`capping' unit (SH3
insert) is ligated
into the polymer instead of the SNH insert. This resulted in the loss of the
internal
cloning site but importantly it results in an identical junction between all
the inserted
HCH2 units of the polymer. The result was the stepwise insertion of HCH2 units
into the
framework expression vector. Directionality of HCH2 insertion was maintained
by the
use of non-compatible flanking restriction sites but HCH2 insertion was
confirmed with
DNA sequencing at each step.
The junction between the HCH2 units was composed of the fusion of the 5' NruI
half-site to the 3' SmaI half-site, resulting in an in-frame Gly-Ser spacer
between the
protein domains. Choice of restriction sites determines the amino acid
composition of the
spacer. Guiding the choice of restriction sites was the desire to introduce
spacers
between the HCH2 units that were composed of small, hydrophilic amino acids
such as
glycine and serine. The completed polymer constructs were liberated from the
pBSKS+
cloning vector by digestion with EcoRl and HindIIl and the inserts were
purified from
low-melt agarose gels as described in Example 2. The polymer inserts were
ligated into
EcoRl and Hind III digested pFRM-HS resulting in the in-frame joining of the
HCH2
polymers to the IgGI framework region (FIG 2.).
Examples 1, 2, and 3, provide a step by step process that one can use to
produce a
set of constructs that contain the framework region of human IgGI with 2, 3 or
4 HCH2
units. The steps given here use specific sequences from human IgGI. However,
this
procedure can be readily modified to create polypeptides that contain up to 6
HCH2
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
82
repeat units by increasing the number of cycles of SNH insertion used to
create the linear
polymers.
Example 4 - Cloning and expression of an antigen in mice, Human Serum Albumin
(HSA) Domain I, fused to the HCH2 polymer, R4.
This example describes the preparation of fusion proteins formed between the
antigen, HSA1, and the polypeptide, R4, for its use in vaccines.
Background. HSA1 was selected as an antigen since it is poorly antigenic in
the
mouse. For this reason, we chose to use it to show the utility of using the R4
polypeptide
to increase immune responses to a weak antigen in a vaccine formulation.
Although
HSA1 is used as the antigen in this specific example, these same steps can be
used to link
other polypeptide antigens to the R4 polypeptide for use in vaccines. HSA1,
which spans
residues 1-197 of the mature HSA polypeptide (Minghetti et al., 1986), is 67%
identical
and 82% similar to its murine homolog. HSA1, although weakly antigenic for
mice,
contains both T and B cell epitopes, and accordingly, provides a useful study
of
techniques to facilitate T cell-dependent Ab responses against weak Ags
(Kenney et al.,
1989; Marusic-Galesic et al., 1991; Marusic-Galesic et al., 1992). HSA can be
converted
into a stronger Ag when presented to APCs in an IC, and is widely employed as
a carrier
for haptens (Marusic-Galesic et al., 1991; Marusic-Galesic et al., 1992). HSA1
was
expressed in a construct with R4 (HSA1R4). HSA1 was also expressed as an Fc
fusion
protein (HSA1Fc), or with a 6X Histidine tag (HSA1) to be used as comparators
in these
examples. HSA1Fc is an IgG fusion protein where HSA1 has been fused to the
framework region of IgG as described in Example 1. The experiments described
below
also serve to demonstrate the general utility of the expression system
Method. HSA1, HSA1Fc, and HSA1R4 cloning. Total RNA was isolated from
cell line Hep G2 (ATCC HB-8065) using the method of Chomczynski and Sacchi
(1987).
First strand cDNA synthesis was primed with 100 pmol random hexamers using 200
U
SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA) and 5 g of
total RNA in
a 20 L reaction mixture that was 500 M in dNTPs (Pharmacia, Piscataway, NJ),
1 U
RNasin/ L (Promega Corp., Madison, WI), 10 M in DTT, and lx in first strand
buffer.
Reaction proceeded at 42 C for 50 min. Domain 1 of mature HSA (HSA1) was
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
83
amplified from Hep G2 cDNA using PCR, the forward primer poml-F (5'-
GGCCGCATCTCGAGATGAAGTGGGTAACCTTTATTTCC-3'; SEQ ID NO:11), and
the reverse primer Doml-R (5'-
CCGCATGAATTCTCTCTGTTTGGCAGACGAAGCCTT-3'; SEQ ID NO:12). The
leader sequence and the first 197 amino acid residues of mature HSA (i.e.,
HSA1)
(Minghetti et al., 1986) were amplified, and flanking 5' Xho I and 3' Eco RI
sites were
introduced. The PCR product was digested with Xho I and Eco RI and ligated
into like-
digested pBSKS+ cloning vector (Stratagene, La Jolla, CA) to produce clone
pHSA-BS.
The HSA1 fragment was subcloned into the (White et al., 2001) Fc and HCH2
polymer expression vectors described in Examples 1 and 3 to yield pHSA 1 Fc,
pHSA 1 R2,
pHSA1R3 and pHSA1R4 respectively. To express HSA1 with a 6X HIS-tag, a short
linker that introduces a His tag and a 3' stop codon was ligated into the Eco
RI and Sal I
sites of pHSA-BS. Fusion protein cDNAs were transferred into the baculovirus
expression vector, pFastBacl (Invitrogen), by digestion with Bam HI and Sal I
and
subsequent ligation of the isolated cDNA fragments into the same sites on
pFastBacl to
produce pHSAI-FB, pHSA1Fc-FB and pHSA1R4FB. The pFastBacl vector places
fusion protein constructs under the control of a strong baculovirus-specific
promoter for
expression in insect cells. The vector is also used to generate virus that
express the
recombinant proteins. The pFastBacl expression constructs were transformed
into
DH10Bac competent cells (Invitrogen) following manufacturer's instructions and
correctly recombined virus was identified using PCR.
Example S- Baculovirus mediated protein expression and purification.
Cell line SF9 (ATCC CRL-1171) was maintained in ExCe11420 serum free
.25 medium (JRH Biosciences, Lenexa, KS) supplemented with 100 u/ml penicillin
and 100
gg/mi streptomycin. For bacmid transfection, 1 x 106 cells were plated into
each well of
a 6 well cluster and allowed to grow overnight. Transfection medium was
replaced with
2 ml fresh ExCe11420 without antibiotics. Two hours later, Bacmid DNA (6 g)
was
transfected into SF9 cells using Cellfectin reagent (Invitrogen). After 9
hours, the
medium was replaced with fresh medium containing antibiotics. Forty-eight
hours later,
medium containing virus was harvested and used in a second round of viral
amplification.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
84
For protein expression, 100 ml of medium supplemented with 1% Pluronic F-68
(Invitrogen) in shaker flasks was seeded with 4 x 105 SF9 cells/ml and shaken
at 110
RPM at 27 C for 24 hours at which time virus was introduced. Conditioned
medium was
harvested 72 hours later, and the protease inhibitor PMSF (Research Organics,
Cleveland,
Ohio) plus pepstatin A (Peptides International, Louisville, KY) were added to
a final
concentration of 1 mM and 1 M respectively. HSA1Fc and HSA1R4 were purified
using protein G-Sepharose (Pharmacia) as described previously (White et al.,
2001).
The 6xHis tagged HSA1 protein was purified using a Niz+ immobilized resin (Ni-
NTA, Qaigen, Valencia, CA). Prior to application to the column, interfering
ions and
peptides were removed by dialyzing the conditioned medium (12,000 - 14,000
MWCO
Spectrapor tubing) against 20 mM Tris, pH 7.9 and 0.5 M NaCl (TN) with 5 mM
imadazole for 36 h (1 buffer change). Dialyzed conditioned medium was loaded
onto a
2.5 mL bed column at a rate of 1 ml/min. The column was washed with buffer TN
with
30 mM imadazole, and HSA1 was eluted from the column with 0.5 M imidazole in
buffer
TN. Eluted proteins were dialyzed extensively against endotoxin free PBS pH
7.0, tested
for endotoxin content using the Kinetic-QCL limulus amebocyte assay
(BioWhittaker,
Walkersville, MD), aliquoted, and stored at -70 C for future use.
Results: The expressed polymers are stable, secreted, and soluble and are
readily
concentrated to useful levels. The proteins are glycosylated, as documented by
the
difference in predicted and observed molecular weights. Yields correlate
inversely with
protein size and fall in the range of 0.8 to 2.0 pg/mL of conditioned medium.
Example 6. Expression of HSA1R4 in human embryonic kidney (HEK) 293 cells
To express HSA1R4 in HEK293 cells, the coding region was transferred from the
pFastBac vector into the pCDNA3.0 mammalian expression vector (Invitrogen).
The
pcDNA3.0 vector uses the strong CMV viral promoter to drive gene expression in
a wide
variety of mammalian cells. The vector also expressed the geneticin/G418
resistance
gene permitting the selection of stably expressing cell lines. The HSA1R4
coding
regions were liberated from pFastBac vector by digestion with Bam HI and Sal I
and the
excised DNA fragment was purified from agarose gels using techniques described
in
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
Example 2. The fragment was ligated into Bam HI and Xho I digested pcDNA3.0
expression vector. The ligation conditions were identical to those described
in Example
1. The HSA1R4-pcDNA3.0 expression construct was transfected into HEK293 cells
using lipofectamine (Invitrogen). Two days post-transfection, cells were
subjected to
5 selection with culture medium supplemented with 500 ug/mL of geneticin
(G418). Cells
were passaged for 1 month in G418 selection medium at which time they were
seeded
into 100 mLs of growth medium in 500 mL Erlenmeyer flasks and grown with
gentle
shaking (100 rpm) for two weeks. Conditioned medium was harvested after two
weeks
and HSA1R4 was isolated from the conditioned medium using protein G affinity
10 chromatography as described in Example 4.
Results: HSA1R4 is well expressed in HEK293 cells. The expressed protein has
comparable polyacrylanzide gel migration as HSA1R4 produced in SF9 insect
cells.
TABLE 6
15 Sequence of Primers used for mouse IgG2a HCH2 polymer PCR Amplification
Name Sequence (5' to 3')
MU_Hinge_F CCGCTAGAATTCGAGCCCAGAGGGCCCACAATCAAGCCCTCTCCTCCATCCAAATCCCCA
(SEQ ID
NO: 15)
MU_CH2NH3 GGCCGCATAAGCTTGGAGCCTCGCGATTTGGGTTTTGAGATGGTTCTCTC
(SEQ ID
NO: 16)
MU_XS_DELH CCGCATTCTAGACCCGGGGAGCCCAGAGGGCCCACAATCAAG
(SEQ ID
NO: 17)
MU_CH2H3 GGCCGCATAAGCTTTTTGGGTTTTGAGATGGTTCTCTC
(SEQ ID
NO: 18)
Mu_FRM5P-H3 GGCCGCTAAAGCTTGAGCCCAGAGGGCCCACAATCAAG
(SEQ ID
NO: 19)
Mu_FRM3P-S GGCCGCTAGTCGACTCATTTACCCGGAGTCCGGGAGAAG
(SEQ ID
NO: 20)
The underlined letters indicate bases used as clamps or spacers. Boldface
letters denote
the location of restriction sites.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
86
Example 7- Murine HCH2 polymers derived from mouse IgG2a sequences.
For studies in mice, HCH2 polymers were produced that are composed of murine
IgG2a sequences. Murine IgG2a is syntenic with human IgGI.
Murine HCH2 fragment subcloning and hinge mutagenesis: Examples 1, 2 and 3
describe the procedure for assembling linear HCH2 polymers from small cDNA .
fragments containing the HCH2 region. The techniques and reaction conditions
used
were the same as those described in Examples 1, 2,and 3. This procedure was
applied to
produce HCH2 polymers from mouse IgG2A HCH2 cDNA. To obtain the template
sequence for mouse IgG2a, total RNA was isolated from the murine cell line F50-
8A5.5
and the fragment containing the H-CH2-CH3 region was subcloned using RT-PCR,
the
primer, Mu_FRM5p-H3, which introduced a HindIII site immediately 5' of the
hinge
region and a second primer, Mu_FRM3p-S, which introduced a SaII site
immediately 3'
of the stop codon (Table 6). The resulting clone Mu_FRM-HS was characterized
by
DNA sequencing and used as a sequence template for further rounds of PCR.
Prior to
murine HCH2 polymer construction, PCR mutagenesis was used to change the three
cysteines that form inter-chain disulfide bridges between Fc units to serines.
As detailed
in Example 2, the hinge cysteines were mutated to serines, the HCH2 region
amplified
and a 5' flanking EcoRI site and 3' flanking Nrul and HindIII site were
introduced using
primers Mu_Hinge-F, Mu_CH2NH3 in a PCR amplification wherein the IgG2A
framework clone, Mu_FRM-HS, served as template. The HCH2-ENH region was
subcloned and served as template for the production of two additional HCH2
region
fragments that differ from HCH2_ENH only by 5'- or 3'- flanking restriction
sites:
Fragment HCH2-SNH, which differs from HCH2-ENH only by the presence of a 5'
flanking Sma I site was produced using primers Mu_XS_DELH and Mu_CH2NH3
(Table 6) in a PCR amplification wherein HCH2-ENH served as template. Fragment
HCH2-SH differs from HCH2-SNH only by the removal of the NruI site from the 3'
flanking sequences, leaving Hind III site intact. HCH2-SH was produced using
primers
Mu_XS_DELH and Mu_CH2H3 in a PCR amplification wherein HCH2-SNH served as
template. Three HCH2 region fragments result; HCH2-ENH, HCH2-SNH, and HCH2-
SH. All possess mutations that alter hinge region cysteines to serines.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
87
Murine HCH2 polymer construction: Polymers composed of murine HCH2 units
were built using the scheme presented in FIG. 1. As a first step, clone HCH2-
ENH was
opened at the 3' flanking Nru I sites and Hind III sites using restriction
endonucleases.
Clone HCH2-SNH was digested with Sma I and Hind III and the insert thus
liberated was
gel purified and ligated into compatible sites in the HCH2-ENH clone. The
result of the
ligation was the tandem addition of one HCH2 fragment to another. The
insertion also
regenerated the original sequence of restriction sites (NruI - spacer-HindIIl)
which were
used in the next round of extension. Repeating this process of digestion and
ligation adds
HCH2 units in a stepwise manner. In the last round of polymer construction an
insert
derived from Sma I and Hind III digestion of HCH2-SH was used resulting in an
HCH2
polymer with a flanking 3' Hind III site. The completed murine R4 polymer was
digested with EcoRI and Hindlll to release the polymer inserts from the
cloning vector
and ligated into like-digested Mu_FRM-HS resulting in the in-frame joining of
the HCH2
polymers to the murine IgG2a framework region. HCH2 polymer and framework
region
were liberated by digestion with Eco RI and Sal I and ligated into like
digested pFactBac
expression vector (FIG 2).
Domain I of murine serum albumin (MSA1): Total RNA was isolated from
mouse liver using the method of Chomczynski and Sacchi (1987). First strand
cDNA
synthesis was primed with 100 pmol random hexamers using 200 U SuperScript II
reverse transcriptase (Invitrogen, Carlsbad, CA) and 5 g of total RNA in a 20
L
reaction mixture that was 500 M in dNTPs (Pharmacia, Piscataway, NJ), 1 U
RNasin/ L (Promega Corp., Madison, WI), 10 M in DTT, and lx in first strand
buffer.
Reaction proceeded at 42 C for 50 min. MSA1 was amplified from murine liver
cDNA
using PCR, the forward primer MSA_Doml_F (SEQ ID NO: 21) (5'
GGCCGCATGGATCCAAAATGAAGTGGGTAACCTTTCTC 3'), and the reverse
primer MSA_DomI_R (SEQ ID NO: 22) (5'
CCGCATGAATTCTCTCTGACGGACAGATGAGACC 3'). The resulting cDNA
spans the first 221 amino acid residues, including the leader sequence, of
mouse serum
albumin (i.e., MSA1) and flanking 5' Bam HI and 3' Eco RI sites were
introduced. The
amplified cDNA was digested with Bam HI and Eco RI and ligated into like-
digested
pFastBac expression vector into which the mR4 polymer and associated framework
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
88
region had already been transferred. The resulting expression construct
directs
expression of an amino-terminal MSA1 fused to a polymer of 4 HCH2 regions in
tandem
followed by an IgG2a framework region on the carboxyl end (MSAImR4). MSA1mR4
was expressed in SF9 cells and purified as described in Example 5 (FIG 4).
TABLE 7
Number of HCH2 units, potential N-linked glycosylation sites, predicted
molecular weights, and contribution of N-linked glycosylation to apparent
molecular
weight of HSAI-HCH2 polymers fused to the IgGI- Fc framework.
Construct Number of Number of Number of N-Linked Predicted Apparent
CH2 units HCH2 units HCH2 units glycosylation MW (KD) MW (KD)
irtserted in single in mature sites
chain polypeptide
HSA1Fc 0 1 2 2 48.8 52.5
HSA1R2 2 3 6 4 77.5 86.0
HSA1R3 3 4 8 5 91.6 117.2
HSA1R4 4 5 10 6 105.7 140.5
Example 8 - Structural Integrity
To examine the structural integrity and antigenic content, the recombinant
proteins were resolved on SDS-PAGE gels and analyzed by Western blot. Proteins
were
electrophoresed on 7% SDS-PAGE gels (Laemmli et al., 1970) and transferred to
nitrocellulose membranes (MSI). Membranes were blocked overnight in 5% non-fat
milk
in Tris-buffered saline, pH 7.4 (TBS). For analysis of Fc domains, a total of
50 ng of
recombinant protein or 0.5 g of control proteins (human IgG and BSA) were
loaded
onto the gels. The membrane was incubated for two hours with horse radish
peroxidase
(HRP)-labeled goat anti-human Fc polyclonal antibody (Caltag) used at 1:10000
dilution
in a binding buffer consisting of 0.1% non-fat milk and 0.1% normal goat serum
in TBS.
The blot was washed with TBS-tween and detection performed using the ECL-plus
chemoluminescent reagent following manufacturers instructions (Amersham). For
direct
visualization of proteins, gels were stained with Coomassie brilliant blue.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
89
Results: As shown in FIG. 3A the HCH2 polymers are expressed, stable, and
secreted. The observed molecular weight is larger than predicted for the
peptide
backbone alone, which indicates that the proteins are glycosylated (see Table
7). A
Western blot probed with antibodies directed against human Fc revealed binding
to the
HCH2 polymers in a fashion similar to the IgG control (FIG. 3B).
Example 9- HCH2 polymers can be expressed to minimize interaction with
complement factor Clq
Insect cells are known to express proteins that can have altered carbohydrate
moieties. These alterations may weaken binding of complement factor Clq to
these
proteins. For this reason the binding of Clq to HCH2 polymers expressed in
insect cell
line SF9 was investigated. An assay examining the binding of Clq to human IgG
or to
HCH2 polymers expressed in insect cells was undertaken. Various concentrations
of
human Clq were allowed to bind to monomeric human IgG, to HSA1Fc, or to HSA1R4
previously immobilized onto wells of a 96 well ELISA plate. The extent of Clq
binding
was detected using a goat anti-human Clq polyclonal antibody.
Clq Binding Assay. Binding of human Clq to monomeric human IgG, HSA1Fc,
and HSA1R4 was determined using modifications of a previously described ELISA
protocol (Hinton et al., 2006). Ligands (2-10 ug/ml) were diluted in PBS and
coated onto
Costar high-binding ELISA assay plates overnight at 4 C. Plates were washed
with
0.05% Tween-20 in PBS (PBS-T) and overlain with 4 g/ml of Clq (Calbiochem)
prepared in PBS-T with 0.1% gelatin (PTG) for four hours at room temperature.
Plates
were washed with PBS-T and incubated for 1 hour with goat anti-human Clq
(Calbiochem, La Jolla, CA) diluted 1:1000 in PTG. Plates were washed with PBS-
T and
incubated for 1 hour with rabbit anti-goat IgG conjugated to horse radish
peroxidase
diluted 1:10,000 in PTG. The rabbit anti-goat IgG detecting antibody was
preincubated
with 2.5 ng/mL of human IgG to eliminate residual cross-reactivity to human
Igs.
Finally, plates were washed with PBS-T and developed with 0.5 mg/mL o-
phenylenediamine (Sigma) peroxidase substrate. Absorbance was measured at 450
nm
using a ThermoMax plate reader (Molecular Devices).
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
The results, shown graphically in FIG. 5, demonstrate that HCH2 polymers
isolated from an insect cell expression system engage Clq more weakly than
native IgG.
Example 10 - Fc Receptor Binding Assay
5 The receptor binding assay measures the binding of HCH2 polymers, Fc fusion
proteins or IgG to recombinant ligand-binding domains of FcyRI, FcyRI1a,
FcyRIIb,
FcyRIIIa-158F and FcyRIIIa-158V. FcyRI has high affinity for the Fc region of
IgG and
binds avidly to HCH2 polymers, Fc fusion proteins, or monomeric IgG. The low
affinity
Fc receptors, FcyRIIa, FcyRIIb, FcyRIIIa-158F and FcyRIIIa-158V bind the Fc
regions of
10 IgG with low affinity.
Recombinant Fc receptor ligand binding domains: PCR was used to amplify
ligand binding domains (LBD) and to add the 6xHis Tag for easy purification.
The
templates for PCR were the full-length cDNAs IMAGE clones for each receptor
that
were acquired from OpenBiosystems. The PCR products were digested with Hind
III and
15 Eco RI and ligated into like digested expression plasmid vector pcDNA3.1
(Invitrogen).
Fc receptor expression vectors were transfected into HEK293 cells using
lipofectamine
(Invitrogen) mediated transfection. The histidine tagged Fc receptors were
purified by
immobilized metal affinity chromatography using a Ni2+ immobilized resin (Ni-
Sepharose 6 Fast Flow, GE Biosciences). His tagged Fc receptors were
extensively
20 dialyzed against endotoxin fee PBS pH 7Ø
Fc Receptor binding assay: The recombinant FcyRI, FcyRIIa, FcyRIIb, FcyRIIIa-
158F and FcyRIlfa-158V receptors were coated onto 96-well ELISA plates at 4
g/mL in
DPBS, pH 7.6. FcyRI was coated onto plates at 2 g/mL. Receptors were
incubated
overnight at 4 C. Wells were washed once with DPBS + 0.5% Tween-20 (PBST) and
25 blocked by the addition of 200 L of 1% Sanalac (Conagra, Irvine, Ca) in
DPBS to
prevent non-specific binding. Blocking proceeded over night at 4 C. Plates
were
washed 4x with PBST to remove non-adherent receptors and blocking buffer.
Human
IgG, HSAIFc, or HSAIR4 were diluted in 1% Sanalac in DPBS at the indicated
concentrations and 0.1 mL was added to duplicate wells and incubated for 3
hours to
30 allow receptor binding to occur. The plates were washed 4x with PBST to
remove
unbound ligands. Ligands were detected by the addition of Protein-G conjugated
to
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
91
horseradish peroxidase (HRPO). Protein-G binds the CH3-CH2 interface on IgG
and
thus binds to a single site on each ligand. Detection was achieved by
incubating with the
OPD substrate at 1 mg/mL (o-phenylenediamine, Sigma P-1526) in citrate buffer,
pH 5.4.
Data was acquired on the ThermoMax plate reader using the dual wavelength
endpoint
(450 nm - 650 nm) method and expressed as OD 450 after correction for blank
absorbance.
Results and Discussion: HCH2 polymers bind better to all of the human low-
affinity FcyRs tested, at all concentrations tested, than native human IgG, or
the Fc fusion
protein control protein (FIG 6). It should be noted that the highest
concentration tested,
20 ug/mL, represents the amount of circulating immune complexes present in
normal
human blood. Thus the concentration range used in this study parallels
physiologically
relevant concentrations of FcyR ligands.
HCH2 polymers bind avidly to low affinity Fc receptors. This property
distinguishes HCH2 polymers from Fc fusion proteins or IgG that do not have
significant
binding to the low-affinity Fc receptors. Fc fusion proteins alone or IgG
alone do not
bind to the low affinity Fc receptors. In order for them to bind they must
first be
modified by incorporation into an immune complex. HCH2 polymers alone are
sufficient
to bind low affinity Fc receptors. The ability of HCH2 polymers to bind
directly to low
affinity Fc receptors distinguishes HCH2 polymers from Fc fusion proteins or
IgG.
Example 11 - Fc - HCH2 interactions assessed using FACS
This example shows that the HCH2 polymers bind to more than one FcyR type
expressed on the surface of living cells and that they bind to the ligand
binding site of the
receptors.
Method. Binding of HSAIR4 to FcyRs was determined by flow cytometry using
the human monocytic cell line, U937. U937 cells constitutively express FcyRI
and
FcyRII (Liao et al., 1992). U937 cells (ATCC#: CRL-1 593.2, Rockville, MD)
were
maintained in RPMI 1640 supplemented with 10% FBS and 2 mM L-Glutamax. Cells
were suspended in wash buffer (1% OVA in DPBS) at 1 x 107 cells / ml. To
detect
binding, 5 g of HSA1R4 was added to a 0.05 ml suspension of cells. The cells
were
incubated at 4 C for 20 min, washed, and resuspended in 0.05 ml of wash buffer
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
92
containing affinity purified anti-HSA FITC conjugated goat IgG (1:100
dilution, Bethyl
Labs, Montgomery, TX). To show specificity of binding, U937 cells were
preincubated
at 4 C for 20 min with 5 g of monoclonal antibodies to FcyRI (CD64; clone
10.1; BD
Biosciences) and to FcyRII (CD32; clone FLI8.26; BD Biosciences) to block the
ability
of HSA1R4 to bind to FcyRs. Cells were analyzed using a FACScan II (BD
Biosciences,
San Jose, CA).
Results and Discussion. Increased fluorescence is uniformly observed when
U937 cells are incubated with HSAIR4 followed by FITC conjugated goat anti-HSA
polyclonal IgG to detect surface bound HSA 1 R4 (FIG. 7A). To detect binding
to specific
FcyRs, U937 cells were pre-incubated with blocking monoclonal antibodies
(mAbs) to
FcyRI, to FcyRII, or to both. Decreased fluorescence is observed following pre-
incubation with either mAb while pre-incubation with both reduces fluorescence
to
background levels (FIG. 7A, 7B, 7C). Thus, HSA 1 R4 appears to bind
exclusively to
FcyRI and FcyRII receptors on U937 cells. These data show that the HCH2
polymers
bind to both FcyRI and FcyRII on the surface of U937 cells. In addition, the
data indicate
that the HCH2 polymers bind to the ligand binding site on both FcyRI and
FcyRII.
Example 12 - Assessment of HCH2 polymer - FcyRIII Interactions
To assess potential HCH2 polymer - FcyRI11 interactions, the HCH2-polymers,
HSA1R2, HSA1R3, and HSA1R4 were assayed for their ability to activate NK cells
within PBMC isolates and compared to responses achieved using the Ig-fusion
protein,
HSA1Fc. NK cells express both the low affinity IL-2 receptor, and FcyRIII
(CD16)
(Nagler et al., 1990). When primed with high levels of IL-2 (1 ng/mL), NK
cells mount a
proliferative response to CD161igation. This triggered response was used as a
test of the
fitness of the recombinant molecules to engage FcyR.
Methods
PBMC Purification and Proliferative Assays.
Peripheral blood mononuclear cells (PBMC) from four healthy donors were
isolated from heparinized blood on a Ficoll-Paque gradient (Pharmacia Biotech
Inc) and
suspended in AIM V defined serum free medium (Gibco BRL). Recombinant protein
stocks were initially prepared in RPMI 1640 (concentration 1 mg/ml).
Recombinant
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
93
protein stocks were diluted in AIM V medium (Fisher Scientific) to achieve the
desired
final concentrations as indicated in the drawings. PBMC were plated at a final
concentration of 2 x 106 cells/ml in 96 well flat bottom plates (0.200 ml/well
final
volume). Cells were incubated for 72 hours in a humidified incubator at 37 C
in 5%
atmospheric CO2. During the last 5 hours of culture, wells were pulsed with 1
Ci of
[methyl-3H] thymidine (Amersham Corp). Cells were harvested using a PhD cell
harvester (Cambridge Technologies). Radioactivity was determined using a
Beckman
Scintillation Counter LS 5000TD (Beckman Instruments).
Results. The HCH2 polymer constructs, expressing domain one of human serum
albumin were tested for their ability to induce proliferative responses in
PBMC. Use of
these ligands allows us to determine the impact of decreasing HCH2 repeat
number on
FcyRIII triggered cell activation. PBMC were incubated with decreasing
concentrations
of HSA1R4, HSA1R3, and HSA1R2, in the presence of IL-2 and proliferative
responses
were measured as above. PBMC were also incubated with decreasing doses of
HSA1Fc
plus IL-2 to allow comparison with the HCH2 polymers. As shown in FIG 8, PBMC
proliferative responses triggered by the HCH2 polymers correlated with the
number of
HCH2 repeats present within the ligand. As the number of HCH2 units increased
within
each polymer so did its ability to induce proliferation by PBMC. HSA1R4 was
the most
effective ligand for inducing proliferative responses of PBMC; greater
proliferative
responses were observed in PBMC in response to all doses of HSA1R4 tested than
in
response to HSA1R3, HSA1R2 or HSA1Fc (FIG 8).
Example 13 - Method of using R4 in a vaccine formulation to increase
antibody titers to HSA1.
The purpose of this example is to demonstrate the feasibility of using R4 as
an
antigen delivery vehicle to increase antigen specific antibody responses. In
this example
we have used domain one of human serum albumin (HSA1) as an antigen fused to
the
amino terminus of R4 to generate the polypeptide we term, HSA1R4. In Example 4
we
showed how the construct, HSA1R4, was produced. In Example 5 we showed how
HSA1R4 could be expressed and purified. We have used the HSA1R4 polypeptide to
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
94
immunize mice and compared the responses achieved to those obtained using the
antigen
alone, HSA1.
Though we have used HSA1 in this example there are numerous other antigenic
epitopes that could be expressed at the amino terminus of R4 to generate a
hybrid
molecule. The polypeptide containing the antigenic epitope(s) could be linked
to the
amino terminus of R4, as is shown in this example where HSA1 is used as an
antigen, or
alternatively the antigenic epitopes could be linked to the carboxyl end of
R4. Numerous
antigens of choice may be used as detailed in this patent application. In some
instances,
the polypeptide sequence would be less than 500 amino acids long and soluble
in aqueous
solutions.
Methods
Mice. SJUJ mice and C57BL6 mice, 5 to 6 wk old, from Jackson Laboratories
(Bar Harbor, Maine) or from Taconic (Germantown, NY), were maintained in a
Barrier
facility and acclimated for one to two wks before study. Animal care and
experiments
were performed according to NIH guidelines, as approved by the animal use
committee
of the University of Chicago.
Immunization. HSA1, HSAIFc, or HSA1R4, dissolved in 0.15 ml saline, was
injected into a tail vein. For s.c. injections, HSA1, HSA1Fc, HSA1R4, or
ovalbumin
(OVA; Sigma Corp., St. Louis, MO) were suspended in Ribi adjuvant (Sigma
Corp.)
according to manufacturer's instructions. Ribi adjuvant contains MPL and
synthetic
TDM incorporated into a mix of squalene and Tween-80, and serves as an
immunostimulant with little toxicity. Proteins were dissolved in 2 ml of
saline at 0.25
mg/ml, transferred into vials containing 0.5 mg of MPL and 0.5 mg of TDM and
vortexed
for 4 min to create an oil-in-water emulsion. Mice were immunized
subcutaneously at
two sites, one on each flank. A total volume of 0.1 ml containing from 0.125
g to 25 g
of protein was injected at each site. Mice were bled retro-orbitally.
ELISA. ELISA plates (Corning Inc., Corning, NY) were overlain with 0.1
ml/well of carbonate buffer (0.1M, pH 8.4) containing 5 g of HSA or OVA and
incubated at room temperature for 5 hours. Wells were treated by the addition
of 0.1
mUwell of 0.25% Sanalac in DPBS to prevent non-specific binding (Conagra,
Irvine, Ca).
After 2 hours at room temperature, wells were washed with 0.5% Tween-20 in
DPBS
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
(wash buffer) and 1:200, 1:250, 1:500, 1:2,500, 1:12,500, 1:62,500, 1:125,000,
1:250,000, 1:500,000, 1:1,000,000, and 1:2,000,000 dilutions of serum samples
in 0.25%
Sanalac were added to duplicate wells. Sera from naive mice were diluted 1:200
and
added to duplicate wells to provide background O.D. values. Plates were left
overnight at
5 4 C, then washed, and overlain with a cocktail of biotinylated rat mAbs
(each at 0.5
g/ml) specific for murine Ig (mAbs clones: anti-IgGi A85-1; anti-IgG2b R12-3;
anti-
IgG3 R40-82; all from Invitrogen: and anti-IgG2c 5.7 from BD Biosciences).
IgG2, was
measured since SJL and C57BL6 mice express IgG2c rather than IgG2a (Martin et
al.,
1998). To quantitate levels of HSA1-reactive IgGI or IgG2c, wells were
overlain with
10 biotinylated Abs specific for those isotypes. Following incubation with
biotinylated Abs,
wells were washed, and overlain with 0.1 ml of affinity purified peroxidase-
conjugated
goat anti-biotin Ab (1:500 dilution: Zymed, South San Francisco, CA) for 45
min. Wells
were washed, and 0.2 ml of ortho-phenylenediamine (1 mg/ml) and H202 (1 l/ml)
in
citrate buffer (0.1 M, pH 4.5) was added to each well. Absorbance was measured
15 min
15 later using a ThermoMax Microplate Reader (Molecular Devices Corp.,
Sunnyvale, CA).
Serum dilutions were considered positive when their O.D. values exceeded twice
the
mean O.D. values obtained from wells containing non-immune sera. As a control,
absorbance values were measured from wells not coated with HSA or OVA but
overlain
with immune sera. Absorbance values of control wells always approximated those
found
20 in blanks.
Statistics. Ab titers were compared using Student's unpaired T test.
Results and Discussion
In this example we tested HSAIR4 in the high responder mouse strain SJL and in
the low responder mouse strain C57BL6. SJL mice respond to vaccination with
high
25 antibody titers to antigen while C57BL6 mice respond to vaccination with
lower antibody
titers. SJL mice were injected intravenously with 50 g of HSA1, HSA1Fc, or
HSA1R4,
and serum was obtained 14 days later, and Ab responses were assayed by ELISA.
Anti-
HSA Ab titers were not detected in mice given HSAI alone at the minimum 1:200
serum
dilution used as a cutoff (FIG. 9). Mice given HSA1R4 or HSA1Fc developed
30 substantial Ab responses to HSA (FIG. 9). HSA specific titers were fourfold
higher in
mice injected with HSAIR4 than in mice injected with HSAIFc (p<0.05). Equal
mass
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
96
weights of the proteins were injected so that the amount of HSA1 in HSA1Fc was
2.5
times that in HSA1R4 (FIG. 9). Anti-HSA IgGI and IgGZ,, were increased in
response to
both immunizations indicating activation of both Thl and Th2 type T cells
(FIG. 10).
These data show that SJL mice injected with HSA 1 covalently linked to R4
generate
greater antibody responses to HSA 1 than in mice injected with HSA 1 alone or
to
HSAIFc. When Ag/Ab complexes are injected intravenously in mice, greater Ab
responses are observed than with Ag alone (Wernersson et al., 1999; Wernersson
et al.,
2000; Getahun et al., 2004).
Vaccines are typically injected subcutaneously. Accordingly, the efficacy of
HSA1R4 as an Ag delivery agent was assessed. HSA1R4 was emulsified in Ribi
adjuvant. Ribi adjuvant contains monophosphoryl lipid A (MPL) which signals
through
Toll-like receptor 4 (TLR4) to activate APC maturation and to increase co-
stimulatory
molecule expression (Ismaili et al., 2002; Martin et al., 2003). Mice were
immunized
with HSA1 alone, HSA1Fc, or HSA1R4 (50 jig/mouse), and anti-HSA Ab titers
determined in sera obtained 14 days later. In mice immunized with HSAI alone,
anti-
HSA Ab titers were only detectable in sera from 2 of 5 mice at the 1:200
cutoff threshold
employed (FIG. 10A, lOB). Ab titers of mice given HSA1R4 averaged 1100 times
those
of mice given HSAI (p<0.001), and were seven-fold those of mice given HSA1Fc
(p=0.01). Isotype analysis revealed that both IgGiand IgG2c Ab titers rose
following
immunization with HSA1R4.
A 200 fold lower dosage of immunogens (250 ng) was next tested, again in Ribi
adjuvant, with Ab measured in sera obtained 14 days post-immunization. Mice
given
HSA1R4 developed 130 times as much HSA1 specific Ab as mice inununized with
HSA1Fc (p<0.001; FIG. lOB).
Since SJL mice can produce abnormally high levels of IgG (Jiang et al., 2000),
we next determined responses in C57BL6 mice that have lower antibody responses
to
vaccination. C57BL6 mice were immunized with HSA1R4, HSA1Fc, and HSA1 all in
Ribi adjuvant. Sera were collected 14 days later and assayed for HSA-specific
Ab titers.
C57BL6 mice developed Ab titers that were substantially lower than those
observed in
SJL mice. Nonetheless, anti-HSA Ab titers in C57BL6 mice receiving HSA1R4 were
10
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
97
fold those receiving HSA1Fc (p<0.05) and 50 fold higher than those receiving
HSA1
(p<0.005) (FIG. 11).
Example 14 - Method of using R4 in a vaccine formulation to increase T cell
responses to HSA1.
This example shows that in mice immunized with an antigen linked to R4, the
primary T cell response to that antigen is augmented. In this example the
antigen is
HSA1, and the mice are immunized with HSA1R4 in Ribi adjuvant and also with
HSA1Fc in Ribi adjuvant as a comparator.
Method
Mice. SJL/J mice were purchased and maintained as in Example 13.
Immunization. Mice were immunized with HSA1Fc and HSA1R4 as in Example
14. To generate HSA1-reactive T cells for in vitro use, mice were injected
with 0.1 ml of
an emulsion consisting of 0.05 ml saline containing 100 g of HSA (Sigma) and
0.05 ml
of CFA distributed intradermally with 0.025 ml given in each flank and over
each
scapula.
Proliferative Responses. LNs and spleens were harvested from mice immunized
14 days earlier with: 1) HSA in CFA or with; 2) HSA1R4 or HSA1Fc in Ribi
adjuvant.
LN and spleen fragments were placed in saline, and disrupted mechanically
using a tissue
homogenizer to obtain a single cell suspension. RBCs were removed by
centrifugation
on ficoll-hypaque gradients. Buffy layers were harvested from the gradients,
cells were
washed with HBSS, and resuspended in HL-1 Ventrex medium (Fisher Scientific,
Pittsburgh, PA) supplemented with 2 mM L-Glutamax, 50 m 2-mercaptoethanol, 1
x
MEM amino acids, and 10 g/ml gentamicin (Invitrogen). Cells were plated in 96
well
flat bottom plates at 6 x 105 splenocytes/well or 4 x 105 LN-derived
cells/well and
HSA1Fc or HSA1R4 added as indicated in the results section. As a source of
APCs,
splenocytes from native mice, processed as described above, were incubated at
37 C in
RPMI containing 75 g/ml of mitomycin C (Sigma) for 20 min, washed five times
in
saline, and added (3 x 105 cells/well) to wells containing LN-derived cells.
Cells were
incubated at 37 C for 72 h and pulsed for an additional 8 h with 1 Ci/well of
3H-
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
98
Thymidine. Cells were harvested using a Cambridge Phd cell harvester and
radioactivity
determined by liquid scintillography.
Statistics. Proliferative responses of HSA-reactive LN cells, were compared
using Student's unpaired T test. Proliferative responses of splenocytes were
compared
using Chi-square analysis of values above or below a SI of 3.
Results and Discussion. These data show that HSA1R4 is a potent Ag delivery
vehicle for induction of T cell responses. Mice were immunized with 50 ug of
HSA1R4
or HSA1Fc in Ribi adjuvant. HSAI-specific splenic T cell proliferative
responses were
measured 14 days later. Taking a stimulation index (SI) of 3 as indicative of
response, T
cells from mice given HSA1R4 responded to a 20 fold lower concentration of
HSA1 than
T cells from mice given HSA1Fc (FIG. 12A). T cells from mice given HSA1R4
responded better to a116 concentrations of HSA1 tested than T cells from mice
given
HSA1Fc (p<0.004) (FIG. 12A). The potency of HSA1R4 may be understated in our
assay as mice given HSA1Fc received 2.5 times as much HSA1 as those given
HSA1R4.
HSA1R4 presents Ag to T cells more efficiently than HSA1Fc (FIG 12B).
Targeting of Ag to FcyRs increases Ag uptake by APCs, Ag processing by them,
and Ag
presentation to T cells (Zaghouani et al., 1993; Brumeanu et al., 1993).
Accordingly,
studies were conducted to determine whether HSA 1 R4 could increase Ag
presentation to
T cells. Cells isolated from draining LNs of mice immunized with HSA in CFA 14
days
earlier were used as a source of HSA-reactive T cells. Mitomycin C treated
splenocytes
from naive mice served as a source of APCs. HSA-reactive T cells respond more
briskly
to HSA1R4 than to HSA1Fc (p<0.008) or to HSA1 (p<0.001) at molar equivalents
(1.6 x
10 M) (FIG. 12B).
These results demonstrate that robust Ab responses to HSA1, a weakly antigenic
peptide, can be obtained by coupling it to the HCH2 polymer R4. HSA 1 R4 has
10
potential FcyR binding regions and 2 copies of HSA 1. ICs in Ab excess, known
facilitators of Ab responses to weak Ags, bind to FcyRs expressed by APCs
(Marusic-
Galesci et al., 1991; Marusic-Galesci et al., 1992). Binding of ICs to FcyRs
triggers IC
internalization so that more Ag enters the.APC than when Ag alone is given.
Augmented
Ag processing, and increased presentation of processed Ag to T cells, ensue.
In
HSA1R4, these properties of ICs have been integrated into a single defined
molecule.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
99
Additionally, placement of Ag at the amino terminus of the HSA1R4 molecule
renders
the Ag fully accessible to processing enzymes. Thus, any antigenic peptide, of
any size,
or more than one when the goal is to develop a polyvalent vaccine, can be
linked to R4
for Ag delivery.
Example 15 - Design and construction of HCH2 polymers for delivery of
Botulinum
neurotoxin subtype A antigens (BoNTIA).
BoNT/A activities map to discrete regions within the polypeptide chains:
Endoprotease activity resides within the light chain. The heavy chain is
responsible for
receptor binding and translocation. The heavy chain can be further subdivided
both
functionally and proteolytically into an amino-terminal fragment (HN),
involved in ion-
channel formation and light chain translocation, and a carboxyl-terminal
fragment (Hj
involved in receptor binding The H, fragment is composed of two -200 amino
acid sub-
domains that are structurally distinct. The amino-terminal portion, HcN
(residues 871 to
1078 of the holotoxin) forms a lectin-like sub-domain. The carboxyl-terminal
portion,
HcC (residues 1090 to 1296 of the holotoxin) adopts a(3-trefoil structure. The
respective
roles of H,N and HcC in receptor recognition and binding to neurons are not
fully
understood (FIG 13).
Expression of Hc antigens in heterologous systems has previously proven
problematic due to the codon bias in the C. Botulinum gene. To circumvent this
limitation a synthetic gene approach was pursued. Designing the gene segments
de novo
permitted the introduction of restriction sites to facilitate the subcloning
of the Hc
fragments into expression vectors. The strategy was to synthesize the H,N and
HcC gene
segments separately and to combine segments to produce the Hc gene segment.
The C.
Botulinum Hc codon usage was optimized for expression in the spodoptera
frugiperda
(SF) cell lines using the UPGENE codon optimization algorithm
(<<http://www.vectorcore.pitt.edu/upgene/upgene.html>>). The codon usage data
set
was derived from highly expressed genes in SF cells
(<<http://www.kazusa.or.jp/codon/>>). The optimization scheme resulted in the
resolution of two types of codon bias: First was to reduce or eliminate the
use of rare
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
100
codons, as seen for example in the almost exclusive use of the TTA codon (LEU)
in C.
Botulinum. The second was the balanced use of codons when multiple codons were
available, as exemplified by the AAT codon (ASN).
The HcN and HcC gene segments were either subcloned individually or combined
at internal restriction sites to produce the Hc gene. The three gene segments
(SEQ ID
NO: 22 for Hc; SEQ ID NO: 24 for HcN; SEQ ID NO: 26 for HcC) were subcloned
into
the pFastBac expression vector. The leader sequence from human IgGI was cloned
upstream and in-frame to the synthetic genes to direct their secretion from
the cell into
the medium. The HcN, HcC, and Hc genes were followed in frame either by a
short
sequence coding for a 6xhistidine tag or by the R4 ligand coding sequences.
The R4
ligands are based on human IgGI sequences as described in Example 3. We have
also
developed identical ligands, mR4, based on murine IgG2a sequences (Example 7)
for use
in mice. The murine Ig2a sequences are syntenic to human IgGI. Accordingly we
subcloned the Hc gene segments in-frame with the mR4 sequences.
Recombinant virus was derived and used to infect SF9 cells as we have
described
in Example 5 and Jensen et al., 2007). Conditioned media containing the 6xHis
tagged
recombinant antigens, HcNHis, HcCHis, and HcHis control antigens were purified
in a
single step by passage of the conditioned medium over a Nickel affinity
column. The Hc
antigens fused to the R4 ligand, H,NR4, H,CR4, and HcR4, were purified in a
single step
from conditioned medium by affinity chromatography using protein-G Sepharose
columns. Table 8 lists the number of amino acids in each of the recombinant Hc
antigens
as well as their apparent molecular weights as estimated from SDS-PAGE. Sizes
and
weights for HcNR4, HcCR4, and HcR4 reflect the dimerization that is a feature
of the R4
ligands. Also listed in Table 8 are the antigen percentages in each of the
HcR4 ligands.
Antigen percentage is used to calculate the antigen load for vaccination, for
example an
immunization with 5 ug of HcR4 represents a load of 1.65 ug of Hc antigen.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
101
Table 8. Hc Antigens
ID AA Daltons wt% Ag
HcN 238 28260 (predicted) 100%
(SEQ ID NO: 25)
HcC 231 26781 (predicted) 100%
(SEQ ID NO: 27)
Hc 440 55976 100%
(SEQ ID NO: 23)
HcNR4 1970 271542 20%
HcCR4 1956 283766 20%
HcR4 2374 313810 33% 771
Example 16 - HCH2 polymers that deliver Botulinum neurotoxin subtype A(BoNT/A)
antigens bind to Fc receptors avidly.
In this study we determined if HcR4 ligand can target Hc antigens to FcyR. We
used the receptor binding assay introduced in Example 10. HcR4 was incubated
with the
immobilized receptors, plates were washed and residual ligand binding was
determined.
Hc antigen served as a control in these studies. Results: HcR4 binds
exceptionally well
to both low-affinity and high-affinity FcyRs (Fig 14). Hc antigens alone fail
to engage
the Fc receptors. Antigens delivered as HCH2 polymers engage Fc receptors
directly and
do not need to be incorporated into immune complexes.
HCH2 polymers that deliver Hc region from Botulinum neurotoxin subtype A
worked as well as HCH2 polymers that delivered domain I of human serum
albumin.
Thus it is the HCH2 polymer that confers enhanced binding to the low affinity
Fc
receptors. HCH2 polymers also avidly bind FcyRI, the high affinity receptor
for the Fc
region of IgG
Example 17 - HcR4 efficiently targets HC antigen to APCs resulting in
heightened
antigen specific B cell responses in vivo.
The goal of this study was to determine if the Hc, HcR4, and HcmR4 antigens
could direct antigen-specific responses. The SJL strain has been identified as
a high
responder to Hc immunizations whereas the C57BL/6 strain is a poor/non-
responder to
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
102
Hc antigens. Thus we examined responses in the SJL mice to single dose SC
immunizations with Hc and HcR4 at the 0.5 g and 1 g doses. The immunization
protocol was identical to that described in Example 14 above; antigens were
administered
as an emulsion in Ribi adjuvant. Mice were immunized in their flanks and bled
14 days
later. To detect antigen specific responses we developed an ELISA employing
recombinant Hc as capture antigen. Hc-based ELISA has been validated as being
predictive for the presence of neutralizing antibodies and correlates with an
in vivo lethal
challenge toxin model. Rabbit anti-sera produced against native BoNT/A binds
avidly to
the immobilized recombinant Hc and serves as a positive control.
Results for SJL: Immunization with 0.5 ug HcmR4 produced robust antigen-
specific responses by day 14. In contrast, immunization with Hc alone resulted
in poor
antigen-specific responses at 14 days. To further characterize the antibody
responses,
antigen specific antibody titers were determined using the ELISA described
above.
Immunization with a single 0.5 g of HcR4, or its murine analog, HcmR4 results
in large
Hc-specific antibody titers whereas immunization with a similar dose of Hc
results in
poor antibody titers (Figure 15A.). Similar trends are observed at the 1 ug
dose (Figure
15B.).
Results for C57BL/6: The C57BL/6 strain is a poor/non-responder to He
antigens. To determine the responses of the C57BL/6 strain to Hc and HcR4,
mice
received single dose SC immunizations of either 5 g or 10 g of HcR4 and Hc.
Responses were determined 14 days later. C57BL/6 mice responded poorly to
immunization with 5 g of Hc with only a single mouse of ten immunized having
shown
responses whereas 6 of 10 mice immunized with 5 g HcR4 had meaningful
responses
(Fig 16). The superior results with HcR4 were achieved using 5 g of HcR4 that
delivers
a dose of 1.67 g of Hc antigen (See Table 8). A similar trend was observed
when the
immunization dose is increased to 10 ug.
Conclusions: Immunization with either HcR4 or HcmR4 results in larger anti-Hc
antibody titers than can be achieved by immunization with Hc alone. The data
indicate
that the murine ligand, HcmR4, induces higher Hc-specific antibody responses
in mice
than its human R4 counterpart. These results might be expected as the murine
ligand is
likely better at engaging murine Fc receptors than the human ligand.
Nevertheless, the
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
103
results validate the use of the human ligand, HcR4, as an immunogen to achieve
large
and rapid responses to Hc in mice. It is also likely that the human HcR4 will
work even
better in humans than seen here with mice, just as the murine ligand, HcmR4,
results in
higher antibody titers in mice. The use of equal mass dosing in these
experiments
actually understates the efficacy of HcR4 and HcmR4 in comparison to Hc as 1
g of
HcR4 (or HcmR4) delivers an Hc antigen load of 0.33 g (Table 8). Taken
together
these results indicate that Hc delivered as a R4 ligand directs better antigen-
specific
responses especially at lower antigen doses.
Example 18 - The HCH2 polymers are potent antigen delivery vehicles for the
induction of Botulinum neurotoxin subtype A(BoNT/A) Hc-specific T cell
responses.
In this study we establish that BoNT/A antigens delivered using polypeptides
that
include HCH2 polymers are better at. inducing antigen-specific T cell
responses than
antigen alone.
Methods: To establish that use of HcR4 and HcmR4 leads to more efficient
presentation of Hc antigens on APCs, we used the in vitro T cell assay
introduced in
Example 15. Mice were immunized with recombinant Hc and 14 days later T cells
were
isolated from draining lymph nodes as a source of Hc-reactive T cells. APCs
were
loaded with equal concentrations of Hc, HcR4 and HcmR4 ligands in the presence
of Hc-
reactive T cells to serve as a read out for the assay.
Results: Hc-reactive T cells respond more strongly to Hc antigens when APCs
are primed with 3.6 x 10-$ M of HcR4 than when APCs are primed with 3.6 x 10-$
M of
Hc alone (Fig 17A). Similar trends are observed at low dose (1.2 x 10"8 M)
(Fig 17B).
The data in Fig 17B support a trend seen in antibody titer data indicating
that HcmR4
performs better in mice than HcR4, due to a more favorable interaction between
the
murine ligand and murine Fcy receptors.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
104
Example 19 - R4 administered nasally induces robust antibody responses to
antigen.
Mucosal administration of HcR4 ligands results in large and rapid Botulinum
neurotoxin subtype A(BoNT/A) Hc-specific antibody responses: the second route
for
delivery of antigens using'HCH2 polymers for the induction of immune responses
to
delivered antigens.
In this study we sought to determine if HCH2 polymers can deliver antigen when
administered mucosally. Induction of mucosal immune responses has the
advantage of
inducing both serum IgG and IgA as well as increased protection at the mucosal
surfaces
due primarily to locally expressed antigen-specific IgA. Mucosal immunity
might prove
to be critical in those circumstances where there is a potential for exposure
to aerosolized
BoNT/A, such as in a biothreat scenario. Mucosal vaccination has the
additional
advantage of needle-free administration. The R4 ligands may target APCs in the
mucosal
epithelium by several routes; FcyR-bearing DCs can directly sample mucosal ICs
through
mucosal epithelial barriers or in collaboration with M cells within the nasal-
associated
lymphoid tissues. A second mechanism may involve the transport of the R4
polymer
across the mucosal epithelia by FcRn. The FcRn binding site encompasses parts
of both
the CH2 and CH3 domains of IgGl. These sequences are present in the Fc region
at the
carboxyl end of the R4 polypeptide but absent from the HCH2 polymer. Antigen
transcytosed by vesicular transport or FcRn could then be captured by
macrophages and
DCs and transported to draining lymph nodes. Hc itself binds to epithelial
cells and is
transcytosed by them. The Hc contained in HcR4 could contribute to
transcytosis.
Mucosal administration of Hc results in systemic IgG and IgA titers as well as
induction
of antigen specific mucosal IgA responses. As is the case for Hc administered
in
adjuvant SC, immune responses to mucosally administered Hc are modest.
Methods: To determine if linking Hc to the R4 ligand can improve mucosal
immune response, HcR4 was instilled nasally into SJL mice at a dose of 25
gg/nostril on
days 0, 7, and 14. Serum was obtained on days 21 and 28 and assessed for Hc
specific
IgG titers.
Results: Intranasal (IN) administration of HcR4 resulted in large and rapid
induction of systemic antigen specific antibody titers (FIG 18). The magnitude
of the
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
105
response is 20-30 fold larger, achieved with fewer IN immunizations and two
weeks
earlier than in a published reports employing Hc alone. The rapidity and
magnitude of
the response suggest a synergism between the FcyR targeting capacity of the R4
ligand
and the intrinsic binding capacity of the Hc domain.
Example 20 Cloning and expression of Fatty Acid Binding Protein 7fused to the
HCH2 polymer R4
Fatty acid binding proteins (FABPs) are a family of small generally cytosolic
proteins with high affinity for long chain fatty acids and their CoA
derivatives. Fatty acid
binding proteins are involved in the uptake and transport of fatty acids and
as such impact
fatty acid metabolism and lipid biosynthesis. FABPs are also involved in the
modulation
of other cellular functions including gene expression, differentiation and
signal
transduction.
The brain form of fatty acid binding protein, FABP7, is mainly expressed early
in
the development of the CNS but sparsely in the adult brain. FABP7 is expressed
in a
subset of adult glial tumors or gliomas, FABP7 expression enhances glioma cell
migration and may therefore contribute to tumor spreading. In addition to
cancers of the
brain, FABP7 is frequently over expressed in melanoma where it also
contributes to
extracellular matrix invasion. FABP7 has characteristics favorable for
targeted
immunotherapy: it is expressed in the cancer cells but not in normal adult
tissue and its
expression in the cancer cells contributes to the malignant properties of the
cancer.
As a first step in the evaluation of an FABP7 therapeutic vaccine, FABP7 was
expressed as a fusion to the R4 HCH2 polymer. We have expressed murine FABP7
fused to the murine IgG2a R4, mR4, for use in mouse cancer models. We have
expressed
human FABP7 fused to human IgGI based R4 for evaluation in humans.
Murine FABP7: The full-length cDNA for murine FABP7 is present in IMAGE
clone 5700428, Genbank Accession # BC057090, and was used as template for PCR
reactions. The coding sequences were amplified from the full-length cDNA using
PCR
and the oligonucleotides primers Mu_FABP7-F1,
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
106
(5' GGCCGCATCTCGAGGTAGATGCTTTCTGCGCAACCTG 3')(SEQ ID
NO: 36), and Mu_FABP7-R1, (5'
GGCCGCATGAATTCTGCCTTTTCATAACAGCGAACAGC 3')(SEQ ID NO: 37).
The primers direct amplification of the coding region of murine FABP7 absent
the
initiation ATG and stop codon and introduce a 5' flanking Xho I site and a 3'
flanking
Eco RI site. The PCR products were digested with Eco RI and Xho I and ligated
into like
digested mR4pFastBac expression vector.
Human FABP7: The full-length cDNA for human FABP7 is present in IMAGE
clone IMAGE:4707233, Genbank Accession # BC012299, and was used as template
for
PCR reactions. The coding sequences were amplified from the full-length cDNA
using
PCR and the oligonucleotides primers Hu_FABP7-Fl,
(5' GGCCGCATCTCGAGGTGGAGGCTTTCTGTGCTACCTGG 3') (SEQ ID
NO: 31), and Hu_FABP7-R1, (5'
GGCCGCATGAATTCTGCCTTCTCATAGTGGCGAACAGC 3')(SEQ ID NO: 32).
The primers direct amplification of the coding region of human FABP7 absent
the
initiation ATG or the stop codon and introduce a 5' flanking Xho I site and a
3' flanking
Eco RI site. The PCR products were digested with Eco RI and Xho I and ligated
into like
digested human IgG1 R4pFastBac expression vector.
The recombinant FABP7-R4 fusion proteins were directed into the secretory
pathway by proceeding the FABP7 coding region with the leader sequence from
human
IgGI (MEFGLSWVFLVAILKGVQC)(SEQ ID NO: 45). When the IgGI leader
sequence precedes the FABP7-R4 coding region, it directs secretion of the
expressed
proteins from the cell into the medium. The recombinant proteins are purified
from the
conditioned medium.
Example 21 Cloning and expression of PLP and MBP peptides either single or in
tandem fused to the HCH2 polymer R4
Proteolipid protein (PLP) and myelin basic protein (MBP) are components of the
myelin sheath that surrounds the axons of nerve cells. PLP and MBP are targets
for
autoimmune reactions in multiple sclerosis in humans and in experimental
autoimmune
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
107
encephalomyelitis (EAE), the mouse model of the disease. Specific peptide
antigens
have been identified within PLP and MBP that are encephalitogenic T cell
epitopes
capable of inducing EAE in mice.
The PLP and MBP peptides were expressed as fusions to the human IgGI R4
HCH2 polymers either as single peptides or in tandem. The PLP peptide,
HSLGKWLGHPDKF (SEQ ID NO: 49), spans 13 amino acids. The cysteine present in
the wild-type sequence was changed to serine to prevent unwanted disulphide
bond
formation. Complementary oligonucleotides coding for the peptide and that
introduce a
flanking 5' Xho I half-site and a flanking 3' EcoR I half-site were prepared.
Most
restriction enzymes, (e.g., Eco RI and Xho I) result in recessed 3' ends (5'
overhangs) but
blunt end restriction sites result in evenly matched ends (e.g., Sma I) and
some
restriction enzymes result in recessed 5' ends (e.g., Sac I and Kpn I). By
designing
complementary oligonucleotides with appropriate 5' or three 3' overhangs, the
hybridized double-stranded oligonucleotides can be ligated directly into
restriction
digested expression vectors. Accordingly, the complementary oligonucleotides
coding
for the peptide were treated with poly-nucleotide kinase (New England Biolabs)
to
phosphorylate the oligonucleotides. Oligonucleotides were purified and
hybridized to
form double stranded DNA from the complementary oligonucleotides. The
phosphorylated, hybridized oligonucleotides were ligated directly into the
R4pFastBac
expression vector that had been previously prepared by digestion with Eco RI
and Xho I.
The MBP peptide, VHFFKNIVTPRTP (SEQ ID NO: 40), spans 13 amino acids and was
introduced into the R4pFastBac expression vector using a strategy identical to
that
pursued for the PLP peptide.
PLP-PLP peptides expressed in tandem: two copies of the PLP peptide were
expressed separated by a 2 amino acid linker
(HSLGKWLGHPDKFGTHSLGKWLGHPDKF)(SEQ ID NO: 43). To express two PLP
peptides in tandem, complementary oligonucleotides were synthesized as
described
above that code for a single peptide but also introduce a Kpn I site proximal
to the Eco RI
half-site. Kpn I was chosen as it codes for gly-thr (GT) when expressed in
frame. The
oligonucleotides were phosphorylated, hybridized and ligated into the
R4pFastBac
expression vector. The result was the introduction of as single PLP peptide
with an in
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
108
frame 3' unique Kpn I site between the peptide sequences and the Eco RI site.
The
resultant expression construct was termed PLPR4-KE to denote the addition of
the
intemal Kpn I site in frame with the Eco RI site. To introduce the second
peptide
sequence, complementary oligonucleotides were once again synthesized that
coded for
the peptide but that introduce a flanking 5' Kpn I half-site and a flanking 3'
EcoR I half-
site. These oligonucleotides were phosphorylated, hybridized to make them into
double-
stranded DNA and ligated into the PLPR4-KE construct that had been digested
with Kpn
I and Eco RI. This resulted in the PLP-PLPR4pFastBac expression vector.
Combined PLP-MBP peptides expressed in tandem: A similar strategy was
pursued to make the PLP-MBP tandem peptides
(HSLGKWLGHPDKFGTVHFFKNIVTPRTP)(SEQ ID NO: 50). Complementary
oligonucleotides were synthesized that coded for the MBP peptide but that
introduce a
flanking 5' Kpn I half-site and a flanking 3' EcoR I half-site. These
oligonucleotides
were phosphorylated, hybridized to make them into double-stranded DNA and
ligated
into the PLPR4-KE construct that had been digested with Kpn I and Eco RI. This
resulted in the production of PLP-MBPR4pFastBac expression construct.
The recombinant PLPR4, MBPR4, PLP-PLPR4 and PLP-MBPR4 fusion proteins
were directed into the secretory pathway by preceding the peptide coding
regions with
the leader sequence from human IgGl (MEFGLSWVFLVAILKGVQC)(SEQ ID NO:
45). When the IgG1 leader sequence precedes the coding regions, it directs
secretion of
the expressed proteins from the cell into the medium. The recombinant proteins
are
purified from the conditioned medium.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
109
o 0
o .ti ,~
~ C7 ~on 0 C7 0~ r ~i o
Q= o=~
`~ v~ ~ az A Q N
a " can mv) U U
o o ~. o 1-4
a o
o w~ ~~ ~ 0 w w w bw
w" ^
w ~ '~ ~~ ~ =~ ~ -~s~
r. ci
a d p o C c.1 c.4 a a.o u
=o .~ a~ ~ =o ,~ o. x a v~ a x .b >,
U o ~ E o o ~
C ~, U ' " x
~ ~M
x >
w`- 4 ~c7 ~o o~;c7 A 0 0 - a` ¾C7
cri p c~ G w ~G 4p [- :3 oo :5 r" o~ to
~ ~ N ~
p o N ~ A ~ ~
~~ a i=~aoiooxr ~a~ioxa "ixAa~'ia ri
C.4) cn x cn UU)UU) UU) UU)
z ¾
U
u
U
~ F"
fsr 0
O D U
U U o
u C)
¾
v~ U c~7 a
U U U U C7
F ~
z ¾ E" C7 V
¾ Q u U
U ¾ U E u U
U Q Q 0 C~j
=~~ ¾ ~ < ~ ~
~
U H 0
V ~
a~ ¾ H C7 ¾ 0
¾ E=¾
U U V E U E~-u ~ ~ u C7
Q U U m 0
C7 F-4 0 to C7 < U
U ~ C7 C7 U
u u
~ U N r ~ ~U~ U~ oo
OE-4 O O ¾O UO 0 HO O O
14oz ~z ¾z Uz Uz oz U)z
~ ~Q Q ~ ~ ~ vQ a
to a ~ a ~a ~a ~a ~ ~'a ua Oa
w ~W W ~oW ~oW 0 ~oW QW
C7U)C7ri) UUO C7U) C7~ C7~- C7~ C7~ w~
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
110
~ 0
o ~~--
~
o $ ~o M
d 0 ~ o
..,
~ ~= ¾ Cn M ~
p u rA >N~_p
~ -T 4" w" N r==~ ~ O f14 N
y~n
4" ~ ' yy '~", =~.' 4p
C ,y N ~ y `+~ >,
O M vi v~ -. O C!~ f1~i p
O y Q. p rn N N p~ p y~ ...
r zl N =u ?+ ~ O 3 -0 'O N o0
r- N 'd
U~~?Ww c~. 0U)x~~~~a3
a `*" 0
N a~
0 rfi, M~t ' ~ ' OpõQU ~
c 2
x ~a. E ~`" ~ ~x
~ ~ .. 2; a~ a~ --~
v~ ~ v~ U A v~ pU., A~Oe4U ~' `M`' ~an
xx.~ tor- z~0-~
>
w H
a a
> a w> F-+ x> x r..~
xa raaxHw>r=C(7acnCnu) 44
U)~ U a a > x w H a , c a ' Z ~ H a,~n
> HxwwwE+aua>aX ~w(D
> aw> Hrz> w~H aaxao
Q ~ W ~ C7 a~ m W~ E-i >+ H m w
aHacaF:4cnzcaH>4 ca 0
> HaU) > a HwzxM > a
a> 04>4 a a a x x M a z a> x ~
H~ cncna3FCE+>+H~> X >+a4 a4
C7
~
zx r~ H x w x a a a a
a H cn X F+ Gu 2 x u] L1 w U w w fZ H M ~
cD U a o4 ac x cn w 2M ra x w w a F+ a
U t-+>+E=> > x>+mw>+arzaxm
fy a caHxwxa(Di xxwr34 acD >-I a
xCnCaaUawaCnx> xa4zU)
azCncaxwww> 0 EnH zx
Q
U xa~~nwa~ax~cazax wa
U a0 xxwc34 au)4 0 X4 u) aH
awwcnx> xx 30 zHoa>+
aH E~ Q r-4 w w > U cnH >caaxH2
14 a U ~ 14 a0 cazaxu aa> xzz
u~H ac wwwvax
a~ U w a ~n ~ U > x x~9: (D z H> a a> H w
44 cnH c) a x Hw> 4 tD a 3 4
axUaa> xaHaA~Cww
~W cD ~cnHxwwHa~> a~x
c9 zH> a >Hx>a>4 a
xHw>cD a m m a H
a vFi ~ U a a> x a H a o< > c~ z~ o U)
(D z H 0
w w w H a U ) > a> Hwz0c~
aa C7 a> HZ > aa~aarzxxcnacn
9 0 acnu) a3H>+H~> >4 w
aa ¾ E-~ aca~C u) z raHa4wa4r~>
cn>aHwzxcncaaU c72
4 a O C7 a>4 aaxxxtnazC) caxx0
E-~ a 3 F+~+H x>+v~w~+> a
~H E-' U cnzxQ Hxwxwaxacwa(Di
a x H H c=+ z xU) ca a U a w a u) a4 c) 3
IOL4 Uz O U xu) azv~caxwww> c~Hx
F" > > x~H tnw>4 axaQzacn
C7 U xwxaaxxwwax acnx
U^ oaU awacnx> xx 3> ra
^ c n ca x w w > C 7 c n H Q a> cn
~ V~_ ?i a 0 0 z a`N4 U a E-+ --
u Qx E,, a xxwr-4 acn a(D 4U)t-4 xxa
~> O O a~nx> xx ~0 zH> aHxp
Q C7 w> c~ v~ H ca a xHw> X u~
~~Z UZ F-~z wozwxu aa>xwHw>+z
wzH2 0 2 Q2 w>ac7~cnHxwwwHawa~
U u
a Ua a
1O `O `O w C~7r~ w U ~ o LO o LO oLn oLn oLn oLn o
N N M ~ ~,/ ~ U r-I Ln r'1 N N M('r) C' C' 1f') N\O \O [-
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
111
>+ r. co
~~ C7
x "ro
o cl
O ~ U to ~
V cn O
cV
~pq +O' ^ .O,
0-4
04 C,~ cf)
o a
o x f~"~ x L C,, ~ ci~
a Z
Af N
U.~
~ ~4" xl UI U a.
v~O~ A oE~- 0
U
W 0 H a x0 x x w a a w U ca x x 0
aAZOwaM aM xa[*awwcnw>+>a
cn 4 0 >xxw>0 Harxaxxwaa ~
P4 3 u] ~n H H a A 2 Ll Ga W`N4 a U] x U 3
a A x w x x cn a cn > x x w> 0 H rx
mUaa0 ¾cnrz~3cn0 HHacazava 4==,
aHacw0 zHa caxaxxU acnx ¾ 0
04 >aa4 xHcnU0 a0 FCCM rz 3>ca U C7 N
aw>cna>xaHxw0 zHa caa> U
H w H rz w w w a> a a a x H U U a z H ¾ H
QHaaa>Haw>M a>xaHacxa U U
004 >M¾0 aHaHxwwwa>aHx U F-4 C7
~n~nmHaor.CAHaaa>Haw cn F-~ Q U ¾ `~
xH xcn>acnrz>cn¾0 aHaHw~H U Q Q
aHx~+a~nm~nHara¾caHawa U C7 U U U
waxHa3 a4r+ xva>wUx>xr~
a H Gu C] U] .Y. aX H fZ >+ a c!) cn U) (A Gu F., Q E~ E-
oH0 04 wzwaaHa3 xH acn U U
xcnaaacna,H[W oM x aX 04 0
z a a ~n ra H0 a [=4 zwa a o
a a U u
V
Cnxa+HHwxaxM aaaM aHwHcn ~7 ~ C7 O Q
aaaxAaU aazaa U QH>4 ca ¾ O 0 U
wawav) caxcnx~H HHwxxxva>a H U
awwwcnw~+aaaxcaaU aazaX x U U
Harz0 xxwwawaM caxUx~H 04 a0 H v Q
0 44 acnacnxawwwM w>+aaoawaa
M >xxw Ha13~ 0 xxwaawxHcn ¾U ~ Q O
U) c n H H a zca a c n 04 c n x a r J 4 aHa O
U
xaxxm amxxw>u Ha~aazcn <
a c7 rC u] CL $ m v) H H a r~ z 0 G i w 0 >+ a U < U ~
aaazcH~t>ioaw~~uxia ~uvic>nHHzx U 0 0
cna>xaHxw0 zHaQxaxxwa ~ U Q C7 U
rzwwwa>aa,axHCnc~aac~¾znaH ~ 0
C7 O U
a a> H a w> 0 a> x a H ac w 0 z H a w ¾ F U
¾c7aHn,Hxwwwa>aaaxHCD x V O O
H a ra ~C ca H a a a> H a w> U a> x cn z ~
cn>acnx>cn¾0 aHaHxwwwcnx < C7 Q
Ha4>+a0 M cnHao¾oHaaa>Hwa U
Ha3FCxH>xcn>ainx>U ¾0 04 3~C V ~ V
Q~nxxa>Hx~H aMv~~nHacalgCww v c~ U U
0 ac~zwaxHa3 xH acc w>x ¾ (~ Q
^
a a a cn a H c.a C] M p4 ax H rz ~H a ry V~, t" ,1 ('~ ~, 0 , 0
aa>>0 caHC7awzwarxHa3 v UtnV~od~¾
HHw x x x cn a w a ~n a H w oU x ~cav~~E-oo
xraaU a4 az04 a>>cncaH0 a44 2cnU E"' F.,
a c n L ] x m x > + H H w x a x U ) aaaU) acn0 OaOUO O O
w w x c n ac w a4 a a a x ca w c~ a a z a a > > ~ w Z Z z F-~ z V z V Z
w a a w a ~ n r a x c n x ~+HHwx w H
waU) xwwwwU) w>4 aaaxoaUU zv22 02 0 2
v (ZY U U
~,~,~a~a~a aUa Ua
~ oLn o o o o oLn o o oLn oo oLn o uO U
r-I u') -1 =--1 N N M m .q' ~w Il') lf) l0 \O [- l- a0 00 Ol 01 U C~ ...i U
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
112
;-:
-~
N Q
O O
~ ~ H
O ~ O
=~ ~ ~ ~ ~ ~ -~
~ b 42 .~ (U
o
o o y G
cd
O =~ O ~ ~I =~ ~
.~ ~
cl ~
' o o
~q N ~ o
U o
., =ao~, =a, ~ =~a., ~ ,~ ,~ 'ao
i~=~Q=~= Q~
Hw~H e~H ~xc~ x
w H z x a W. a z
zmHc~a~-4 Ht.. '+=
> zx x >+axa 0
x n
c N ~ z 0 v~i > Gx, ~
a x ci~ [-, ~-7 94
on
U Hz C-zxH ~~ 03
E-, xH~Haz p.
¾ H 4wacza0HHZa
a+m xacn 4 0 a
U a H H z z a z w
cn cn w cn wmfY z o
C7 V oz azawa~
H w 0 x^ a x a^
U
x~ ~Qaxzz >
[-4 ~z3aa ^4a~+ ~H
a H w 2^wwG 0 ~ EZ-~ 3
U Q zz~~zH>wci
x z H a 0 a a 0
a a w> ^^ a
V M H U7 w x Z Z Z H
Q z w~ 2 ~ a vxi vi
F" H x~ a z~ H x a
U F,y zM M z w>+ z~ w
xv~zz~x^ H
U HwzHxzx a
U U w z~ H 3 A CZ7 w~ z
H k+ U> H>+ a>+
C7 E='' U wazwa azz
H a H H CL z >+ 0 Z
FU-~o C7~ ^ mHH3xax>M
N N N 4 2 N Z ^ N rx i W~ N
E-o axwHa>~ HHa
Z
F"Z ¾ C7 z z o ~ x x a~z
U U z [- ^ a a M ^^ H r=C H
U Q U Q V@ > ^ m H a>+ C7 cn z P1
~ `- '-I ~ f- '-I U ' ~ ~ ~ ~ ~ Ad
'q C) LO C) LO C) LO 0
U r-I ln -1 -I N N M M C= ~..i
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
113
~ 0
O
cl
U 00
O W N
cl
Q
cn 0-4
"Cy C7"
z
0
Qx
0 =~'~,
~ O =~
U U RC H U C7 t~ C7 U C7 C7 U U C7 C7 C7 U U C~ ~ H U
F r=C H r=C 0 0 ( D H H U H H H H U H C7
H rC H H H U RC U F U rC U t7 C7 0 U H U
U(7 C~ C7 F F H C7 H H U U C7 U rC H U U U H C7
H C7 FC H H C7 H C7 C7 F~~ H r=C U H H r.~ r.~ r=C C'J r=C
a~ r=C U C7 H C~ r.~ ~ C7 FC ~ F H r=C U C7 RC U U t7
U U F U U H C7 U U H U U H U H H rC H U~ FC
U H rC C7 rC F U rC C7 C7 C7 U U H ( ~
H H r=C C7 H H H C7 r.C U U FC H C7 C7
C7 C7 C7 U C7 F U U C7 U U H H U H U H U C7
F U r~ FC H H FC 40 4 4 H H 0 H 0 Ge Z CL
U C7 FC U r=C 4 U H U 0 H4 4 C~ 4 H ~ V1 H[:,
U H H U H U U U UC7UFCH C7C7~C7F UC7U 2x x HFCr.CrCUrCURC4 c~UHH 4 0 H40
xc=.,ol H
RC U' U' RC U FC FC H H FC U RC U C7 (7 C7 RC U 0 (n >+ u) Z .--
U U U U U U U H U U U C7 U U U C7 H C7 H U H 0 a4 N Z
rC F F H rC r~ r~ H U H 4 r.~ C7 rC H< H C7 FC H W x u)
H4 r~ C.7 C7C7 r=C C7 r=C C7 RC 0 H U U F-H U C7 Zi H LV K4
C7 U U C7 0 4 0 H 0 U U H U U U< U H U U H pL ~ 5C cz
F4 HUHC7HFCURC40 R4 4 HH0 4 URCt74C4 a4H a4
0 U U U r=C U Hc4 U E+ H 00 ~4 0 (7 C7 0 1:4 C7 u) fx 2
r=C U U U U 0 U H H 4 0 H U U H H H U H 0 FC G+ 0 C7
r=C r=C H H 0 H H U H H H 4 U (7 F FC H c/) p4 a tn
FC U 0 FC FC H U r=C H r=C 6 U H H < < H C7 fY H H Z Z
H H U 0 0 H 0 U U U H 0 Ur H r=C C7 (7 C7 U C7 U ~ c/) W c/) u]
U(7U U C~
4 7 HH HU C7 t7 C7 U C'J UUU H U H W C] `NG C]
U U RC FC H H 0 H~ 0 0 H H U r4 H F U rC ~ H a a a a a4
r=C H RC C7 HK4 H r=C C7 U U 0 FC H 0 4 H RC FC x a L] a
F C7 C7 U H H H C7 U C7 U U U U C~ U ~ U U Z V1 H H A
C7 4 H H U H H H H H r=C H r=C r=C H H (7 C7 H u) Z 3 a a4
r=C C7 C7 H r.4 g ~ U H U4 H C7 C7 C~ < H W>+ H p, H
C7 U t7 U U U(7 F U H 0 H H U U 0 C.7 U U C7 >+ > H C7 W
H< U U H< C7 U4 FC H H< H U r=C 04 W Z~4
U H < r=C FC U U < 0 t7 t7 C7 C7 < 0 C9 a rC C7 H W
U U U U U U C7 U U U U1r=C U U H U4C7 U U C7 Z z>+ >+ Z
H 0 0 0 U< < 0 U< 0 < 0 H H H H H 0 A4 Z a
H 0 U U H < U U H H 0 oC7 H H U< rC U U U c/) H c/) u] p4
0 H 0 0 H RC 0 r = C H C7 4 C7 rC 0 H < 0 H r . C F 0 H > z
U U 0 H 0 0 H < RC 0 H FC 0 < H 0 0 0 U RC 2 W x z Ga
C7 U U H U U Cr~7 U U U U H Hr~ U U C7 U C~ C7 H H H~ a a
U 4 C7 ~ H FC U H H RC U H ( . 7 U 0 U ~ H 2 V) v ] Z H C7 U C~ C7 U U U U C7
U C7 U H F C7 F C7 C7 H H p4 tn Z Z>+
H~ H~~ FC H H rC C7 H rC U U~ C7 H U t~ H W Z H x
U H 0 RC H RC C7 U C7 U U U U U CD C7 >+ a W H H
H U U H H C7 U t7 C7 H U U U U H U H H U U W 2x H 3
rC H F rC r=C H H H U FC < FC C7 U FC U U4F H E H L 4 U> H
C7 < r=C H U U 0 U 0 0 4 0 0 RC 0 H F4 4 U E L*+ a Z G.4 N
H H ^
F 0 p4
H U H H U U H H< H H 4 0 U F H U ~ H H 3 5C
0 F F U H F 0 0 0 U U H0 U H<~ U~ ~
U H U( D U U H H U C7 U F 0 C7 C7 F U C7 U~ C7 N a C~ H a H a 2? Z Gl N
U U H U H H 0 H H H H H C7 r~ C7 F pL p4 W H O4
FC H U H FC 0 U F< C7 U U~~C 00 z>+ U O
U CD RC H~ U< U H H C7 F+ F FC 4C7 H H H U r 1 > 0~~ a r'1
,~ ,~ ~ ,~ ,~ ,~ ~a7 7
r-1 r-1 r-I r-I -1 -1 1--I '-i r-1 -I -1 r-1 -I r-I r-1 N 00 C' O l0 N r-I r-1
-1 W
--1 N 00 C' O l0 N OO C O l0 N a0 C' O%O O O r-1 N N M cn 1-1 O Lf) O
r-1 l0 r-I r-I N!"1 C) C C' LO l0 0 [- l- 00 Ol 01 .-1 r-1 r-1 .-i r-1 -I u e-
1 lf) r-1 r-1 N
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
114
=~
c~ p Q c~ p
~ C N ~ Q
y N ~ y N
~ v~ U "~ = n
"C7 ~ y 'C G
0
= .~.i
C u~ N C~~ y
a~ on o a a~ ~o 0
a a
s~. =
U
Ar
cti o
z o b U
x~ w Wu
cl w
U U FC H U C7 C7 C7 U C7 t7 H C7 F F U C7 U C7 C7 U U C7
H~ F~ FC ( 7 C7 C7 H H U FC FC H H r~ ~
r.~ H r=C H FC H F U 4 H H 0 0 0 0 RC C7 R FC C7UC47
U C7 t7 ( ~ H H H C7 H F U U U U H U FC C7 U U C7
F C7 rC H H C7 H C7 C7 H C7 RC C7 F F H H F C7
FC ~ U C7 H C7 FC C7 C7 H~ RC RC t ~ C7 C7 H
U U H U U H C7 U U H U U C7 (7 H H U~~ U U U
U a4 CD 4 F C7 0 0 H 0 rC H 4 F 0
H~ 1- H< 0 H RC C7 F 0 4 H 0 0 0 U4
C7 C7 C7 U C7 F U U(D U H F U U 0 U 0 aC 0 H
H U RC H H < 1:4 z N C7 z H 0 H H U H4 0 w
rC U C7 U4 r=C H U 14 ~4 > U) H U H C7 C7 (D U H 0
U H H U H U U U U (D U ~ aG C] RC C7 U F F C7 F rC C~ C7 F H
H r=C 4 U U4 r=C 0 N H W F RC U U 0 4 H U 0 < C9 CD Ug H H4 >+ f -i H r7 U C7
U U U U U U C7 C7
U U U U 0 U U H U H U W G.4 W A4 U U U U H U F F U U --
FC H H F FC 4 4 F U H FC x x4 RC 4 0 U FC U U~ F F E
F4 4 ( ~ FC ( ~ 0 a H 4 ~-+ 0 C7C7 4 0 H H 4 U E+ pA
C7 U U C7 0 0 C~ RC (7 F C~ H >4 u t/) z OU H C7 H U H C7 C7 H U
~HUFC7HU4 L74 axaz H4 4 c~4 UFH~U~ ~
A4
~~~~~~cH.~HF~~ ~a~a ~HCHn~0H0cHi~4
U FC r=C H H 0 H H U F E H C] cn W 5C F H H(7 C7 H
RC U 0 4 4 H U4 H4 ~ F C7 ~> G+ C7 U U FC RC H
F F U C7 C7 H t7 U U U U 3 z C7 C7 U U U U U C7 U F U U U U
H F H 0 4 U FC RC C++ .7 FC H H 0 9 rC 0 U 0 0 F U U
H F(D H FC 4 RC RC F C7 Ll Y a G. H (7 F H 4 4 0 H H F U
FC U OU U C7 F F H U i-+ U) C7 C7 U U C7 C7 C7 U U C7 ~ F U
U U rC F F 0 H C7 C7 ] z4 H H U H H F F U H U 0
< F C7 HFCC H H H O U C7 U H H z L] ~4 U F U FC U 0 C7 u U H U
H C7 C7 U H H H C7 U C7 U U 0 H H z W U U C7 U44H U U U F C7
P c/] FC C7 Lt: H r=C U F F RC 40 4
r.4 C7 C7 FKC r=C 04 U H U z a z W
r=C F H RC U 0 U U 0
C7 U (7 U U U 0 F U F u) V) 04 z C7 U U H U H F r=C H U FC r=C
F4 U U F4 C7 U
r~ a CD >+ W 3 H U 4 C7 C7 C7 U U H (D
U F 4 r.4 r=C U U r=C RC C7 z LL' W a C'J H F H C7 4 U U r=C F 0 C7
U U U U U U 0 U U U U t7 O W x~l O U 0 U U H H U F U F U 0
F 0 C7 C7 UF:4 K4 C7 U0~4 >+ 0 z z C] FC FC 4 0 4 4 H H 0 F 0
U U FC FC F H C7 FC H C7 4 aG xz > F U H U U H rC PIC 0 r=C F
H C7 U U H rC U U H H C'J 0 C] .-a > `.4 W C7 U < H C7 CD RC C7 F U t7 U
C7 F CD (D F FC C7 r=C 4 H C7 KC ~4 >-+ ~ U H FC 4 U F F FC < 0 H,:4 C7
U U( 7 H C7 C7 F RC FC ltC 0 HX ~4 Ga FC RC Ufe U C7 C7 C7 9 U C7
C7 U U F U U C7 U U U U W>+ Z z W U U 0 U U U 0 H 0 F U F
4 rC H .14 ~ U U 0 ~4 C7 H F 3 H 4 C7 4 FC F~ H(7 4
U FC ~ C7 FC F U F W fx N H t~ 4 C7 RC 0 F FC U U H U 0
H t7 U t7 C7 U U U U C7 U C7 Z H> C7 U C7 U U H U U U r=C U F U U
F H r = C H H C7 H a C7 a a (7 0 RC RC H F cD U4 ~ <
U H(7 RC H C7 U W> C] Q4 H H CD C7 < C7 C7 0 C7 0
F U U F F C7 U C7 C7 F C7 x z z z H A,' 0 H U U F F F U F U
r=C F H r=C FC H F H U FC 4 RC 0 z z~G 0: E Fg rC r.~ U C7 r=C FFCC H
(D F:4 O:C RC H U U(7 U C7 C7 k. > PL v) u] ~ U F FC 4 H 4 RC RC 4 F C7
H U C7 U CD U U U U U C7 4 0 > aL u) F C7 U H 4 C7 C7 t7 U C7 U
^4 4 4 U U H H~ C7 U
H U 1- F U U F H4 F ^ z> H~ fx ~
C7 F H F H(7 C~ C7 U ~ G+ >+ z W H C7 U C7 C7 H C7 F U
C7 H U C7 U U H F U C7 H U ~+ `~4 L] H N C7 C7 C7 C7 ~ U C7 U U U F U
0.' U U H U H F 0 H H~~ E a4 z aG a F H 04 H F U F
C7 RC H U H 40 U H FC 0 [H 0 i-+ a z a a U 0 4 H tD F 4 ~
U F H F H (.7 rC H U U Z 3 A C7 mz z U U U U U' U U U z
U C 7 U FU~ U U [F- H >+ m 7 >+ E H ~ 4 H H C7 C7 H
G7 a .CZ3 UFCHC94 0 0 4 H
a a a
-1 ,--4 -4 r-+ -1 -1 --4 -1 ~+ -4 -4 -4 ,~ --I --i -I --i W
-i N OO C' O l0 N m C' (D ~O NV) --I 0 tf) O~ .-1 N 00 V' C) l0 N 00 C O l0
r-I ~O -I r-1 N M M cP CLn l0 l0 [- _,, r-1 LO r-I 1 N~..i r-I ~O r-I ri N M M
C CLO l0 "O ~=,i
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
115
a~
>, o o b b
~ ~
,~ w c, oo a,o .ti 0 0
^O ~n ^ Q C a) w 0. 0
O Q ct Q ~
r' wx00 wx00
CIS N
~ 'O U "O Q b~ N y O M
~ M
c~
E ~ O V ~ O w w
N O N y.~. CO
bA
O-~i ~" W N_ fJ
~+ p ~r G' O O --I
y N~ Q ~L4 N LL 9 3 y n a vi
bo r- U ai O ti 4
paq cj M ~~"q paq a cn.. f?. Fa. OG
'r'~Q v Qb Q~~' a~~~ a~~
C.4 ow
o c~ p, .o
¾ ^ O a U Q .~i O w ='~" O w
o A on on
cqs ~~ Q x a u
4 U U U C7 H
H o H
c7 C7 ~~~CCC H H
K4
U Ur~ 4 0 r.C
`G A y H~ C7 H
W O~ [-U+URCH< U
ax H 4 FC4FC
U 0 U FC C7 C7 0
H. l H C7 UK4 H
7 U H U H 4 H --~
H A U U RC < C7
H~l C7 0 U U4 H
','Z ~ U C7 ( rC H~ rC
~j H C7 RC H FC
a U u t7 U H H U
U< HF4 H C7 U
C47 CD U H Urr~~ H U
Gi A x U 0 F FC C7
C7 A fx c7 H C7 C7 U c7 c7 U U
] H~ (~ U C7 C~7 ~ H F<
~
H C7 ~ C7 H H C7 C7
C=4 U
7
4 H C C7 0 ~ U H C7 H
>+ W Cs+ H E U C O O CD 0 ~4 U
Q a(-i C7 0 C7 U U U U H
aa H~ ~ v~~~ ~ H
Z ~ H C.7 H H H U ~ H
~
W H C7 U H C7 H C7
a H A U
HCC H H H H H
U
U H U' C7 H H
3`~ H C7 H U H H C7 U
U a> N 4 CU7 ~~ HU " c~7 O U r c H ,,
C7 C7 H 0 0 H
zO H l< 4 OE"O O
W fx H z C7 C7 c~ H~ H'f H z F, 4 4 ~
>x~ H H ~ H ~ 2
~ ~
U U
~--I O r-I N 00 V' O l0 ~ CD W ( ~ ~
r-I lf) r-1 ~..i r--I l0 r-1 ri N M M~..i (D ~..i 0~
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
116
o
co 0 M a)
cd y
Z N y 0 .~. .b
x c~ A U V (~. ir ^p ...
iG v~ ~ Q N ~ T~ cl
Q7 00 p+ 'C :-: -7 c~ O
00
WW Q U M
O cqs ci'
r
cqs
a QO
~~a .ro m.~ cab co t~~ a ~
' ~ W bp"A -
ci w `-OU' w ~ oip Q
aow ~D.~vtr) rA ~ Q O~ C7 V 0 0 z o ar
2 A 2
U H U U U H
U U.7 H
C7 ~ r~ FC CKc7 r.t
U H U 4 (D c7 H
U C~7 3 H 0 PIC U~(D 0 0
~ w Oa ~ C H 7 [ U -~ ~ U 0H
~
U a> (D U~UC7U .~
~ > D4 C7 C7 U U~ H ~
Kr x Cl RC H C7 ~ H0,ryC FC
H > LL' FCUUUUUr=C
[F ~~ c ~ 7 C7 t47 ~ 0 H 4 wr V
U C' U x U ~ 0 H~ 0 RC H 4
(D H z w 0 E. 0 0 UCD~ v v
H
U G4 - A U ~ FC H00 C4U
7 ~ C
FC > > C7 U~ ~(.~7 H RC rl) U
H 7 H~ U H H U.14 [U-4 ~ H U ~
H x Cw*- 0 ~ U EU-, 0 CU7 ~ U U ~
0 C7 ~l U t~ U 0 0 U H H U
FC r.,aH u H~4 cD UH U H
C7 Z Ol H 0 C7 U UF:4 C7 (D
H
E~ O G-i ~ U U CD U H H H ~ F
~ u) zx H C7 RC H H C7 U
~ Q[-w+ ~ U H 0 ~[-U~ H(H-~ ~ U
~ H
H H f J 4 W^ ~ U H H U u H^~!V~ ^ E
M U U H M r=C U[~-~ C.7 C7 H M V M E M
t~0 QaH~ w~~~H`"~OvO c~0
A4 ~ FC FC 0 9 H rC C7 ~ ~ Q
Cu ~ ~ ~ ~ ~ ,-1 ~ U d U ~
7
U 1-1 O~ r-I N 00 c' OIO
U ~ .-1 LIy r-1 r-I -I N en !`')
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
117
o c ^ a
2 0 .d o .n o
on b_ b
_0~
a
`d
o 3 a m " r
.T.
a -
03
q A 0 E to
a a) 'O = A ,~ y "" xi .`.' C cl
o~ v y a b 0
U .~
'4 4 F
"o
cq3 z
~ ~
A+^LT~ ~ ~ ^~+ a Aa+'~ ^A-d p'~+
0 cl C',
b ~b E
H ~ my 0
~
C7 U
H H
H C7
H H
FC ' ~
00
U H H @UE H
U cd
H
H H
u F
U Cr~7 ~ ~ C9
H FC ~ ~ EH-~
~ V U .7 U C) C U
H ~ U E=E U H
H H H H
H U U~ U H
FC U C~7 H ~ C7
H CF:47 H U cH7 CU7
C7 ~ H f=+ U
C7 U H 0 < a4 H
FC U U 0 U
a LD
U ~ x U
7 C
( 7
H U cH7 ~ H 0 ~
U
U [U-~ _
U H H H C7 C7
M U M H 0 'It a' ~4
z > 4H z HZ xz
H LD
~ d V d d U C7 d E d a d d
U U U) .i ~ .~... 0 .~.1 x .i
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
118
u o u~. U) a
3,~.ti ~a ~vWi
4J
0 0 r o
tp 0
H =.1 N
pq ti' .pv vi JJ 'T
a ai =~- ' a' 4 ¾ a s4 r
.c (1) C7 Q, o Z d ~ ~, r,
F'' ,-4
~ .. --~ U U Ln
p O~ [~" =~ ~ 4-~ m
W
O (D p
4-)
'A~ -..i U) U)
~ U b+ -~ a)
=o `~' S i
p
U
~ c p~, a~ ci a ~~ v a
--4~~.c~~,x w~r+
C7 aA=a c~~~
bo 4) r x Q
u
U FLi > Q~ 44
H U] U] f/) [z4
a U)
FC H ~+ H co
wza>x o
H >-+ a a 0 H wwaHm
F aaoax uai
~ w a 0 >+ a p.,
~ ~Hzx
H wxwa
H ~7 4 Cn a H
H za>-'
CH~ a x H 0 x
H W W W t!) x
H a> H w a
H a Q~ w
H >a>x
a 3 a
H u zocn
~ HwzCnU
~ H~~~w
H x W x w>
~ ca a uc7 z
~ U Ll x x (7
v) w>4 >a
x x w a a
W H > C7 H R:
a ~ acanx
aa
>
~azH
> a H x~
> 0 E U aW, E~-l W N ~
w z z HaWaz
~ n C7 H r1 n
w a a ~~~~~a
-i LO oLO o
Ul Ul ~.otor
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
119
t"...
U) a
cl c.)
44 o ~,fl Q~ o
M ,~ ~ N y
b' O C) Z y.,
4. 0 Gq
~ ~4 Ori ~4 . M .~ .^
~ O I N N (7 ...
E a rn bA ~ (7N ~
00 00 _
~ r24
~ N U U `l oN
O O z 0~
o4-).~ Q Q p o0 U
=rl U) cA .0 .0
ZP = H N 'A w
N 14 y 0
~d N U U y N U ^
rl . CL 04 C> U ~. O
U Cl, cr a y Q Q ~
w ro~ o.~~
G x A o o U U c~
FC N H A, `,2 w x' f~ o cz
a U A x x C7
wEn w~H > a
xxwaa
a cn x U
w > C7 H (Z ~
LL A z a Ul `~ x w
Uw'~3~o w~~ '-'
a A Z 4=^'
U U a z [~-~ ~ 0
W H x x a
W' a H d4 pU, (U- a O
aw> E U) a> a
a H w~
c
H a w a H a H a
U ~ > (4 44 A H ~l
C!] U) UO CO Ga U f~.' ~
Ha~ U"U) U)
w a x a A a~~
0.a H 44 H cA w a a
U A H>+ A U A H
axcn>a
U x N a a~ U x N
aaoawaa aaa
a a w C~ H cn w a w
ar~waHa
HaxazLI) Haa
A Gu a (7 ~H a A[~ a
U> x x zU) U) w H N
v) u) H H z x
a~~aa w~~c~n
w(D zHar~4 w0 zH
aaxHCD x aawH
Ua> a4cnz Ua>
xwwwcnx xwww
a a> H w a a a>
U~CC7a3 ~ Hao~
p ac
HaAo:Cww U > a
H a N a> x a % 3 ar~
H L1+ 3 H~ U x aG
=~ aaoa vzi
a 0.ai Oa uZi 0.~i vUa ~~ W O H [= a+ w~'P1
a a ~ > >4 w
x A aw, U c~.7 z ZZ Z w m w~ Z
~ M
a,~a ,a
rnoLnouO ou~ ~ ~r~r~ ~p~ crn1-1 crn~
l0 [- [- 00 00 Ol Ol ~..~ W..i M a.i N N M fh
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
120
REFERENCES
The following may be relevant to the instant application.
U.S. Patent 5,455,165
U.S. Patent 4,196,265
U.S. Patent 4,340,535
U.S. Patent 4,554,101
U.S. Patent 4,559,231
U.S. Patent 4,559,230
U.S. Patent 4,578,770
U.S. Patent 4,596,792
U.S. Patent 4,601,903
U.S. Patent 4,608,251
U.S. Patent 4,658,019
U.S. Patent 5,440,013
U.S. Patent 5,446,128
U.S. Patent 5,475,085
U.S. Patent 5,618,914
U.S. Patent 5,670,155
U.S. Patent 5,672,681
U.S. Patent 5,674,976
U.S. Patent 5,679,354
U.S. Patent 5,710,245
U.S. Patent 5,714,147
U.S. Patent 5,830,731
U.S. Patent 5,840,833
U.S. Patent 5,859,184
U.S. Patent 5,922,845
U.S. Patent 5,929,237
U.S. Patent 5,998,166
U.S. Patent 6,046,310
U.S. Patent 6,262,029
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
121
Achiron et al., Neurology, 50:398-402, 1998.
Alcover et al., Mol. Immunol., 30:55-67, 1993.
Anegon et al., J. Exp. Med., 167:452-72, 1998.
Antel et al., Clin. Exp. Immunol., 43:351-6, 1981.
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988.
Asghar, In: Pharmacological Manipulation of the complement system in human
diseases,
Front. Bioscience (On Line) 1, e15-26, 1996.
Ashkenazi and Chamow, Curr. Opin. Immunol., 9:195-200, 1997.
Berger et al., Eur. J. Immunol., 27:2994-3000, 1997.
Bolhuis et al., Int. J. Cancer Suppl., 7:78-81, 1992.
Brittenden et al., Cancer, 77:1226-1243, 1996.
Brumeanu et al., Immunotechnology, 2:85-95, 1996.
Brumeanu et al., J. Exp. Med., 178:1795-1799, 1993.
Capon et al., Nature, 337:525-31, 1989.
Cartron et al., Blood, 99:754-758, 2002.
Chamow and Ashkenazi, Trends Biotechnol., 14:52-60, 1996.
Chomczynski and Sacchi, Anal. Biochem., 162:156-159, 1987.
Clark et al., Int. J. Cancer Suppl., 2:15-7, 1988.
Clarkson et al. N. Engl. J. Med., 314(19):1236-9, 1986.
Clynes et al., Nat. Med., 6:443-446, 2000.
Clynes et al., Science, 279:1052-4, 1998.
Curnow, Cancer Immunol Immunother., 45(3-4):210-5, 1997.
Daeron, Annu. Rev. Immunol., 15:203-234, 1997.
Davis et al., Science, 213:1385-8, 1981.
Devereux et al., Nucl. Acids Res., 12:387-395, 1984.
Dillman et al., Cancer Res., 48:6097-102, 1988.
Dong et al., J. Immunol., 163:5427-5434, 1999.
Duncan et al., Nature, 332:563-4, 1988.
Durandy et al., J. Clin. Invest., 67:867-77, 1981.
Dwyer, New Engl. J. Med., 326:107-16, 1992.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
122
Edberg and Kimberly, J. Immunol., 159:3849-57, 1997.
Edberg et al., Exp. Clin. Immunogenet., 14:183-95, 1997.
Edwards et al., Ann. Rheum. Dis., 46:773-6, 1987.
Eilat et al., Proc. Natl. Acad. Sci. USA, 89:6871-5, 1992.
EP 44167
Fanger et al., Crit. Rev. Immunol., 12:101-24, 1992.
Fazekas et al., Lancet, 349:589-93, 1997.
Ferreri et al., J. Immunol., 136:4188-93, 1986.
Fortis et al., Eur. J. Immunol., 29:3654-3662, 1999.
Galfre et al., Methods Enzymol., 73:3-46, 1981.
Galon et al., Eur. J. Immunol., 27:1928-32, 1997.
Geha and Rosen, In: Therapeutic Immunology (Eds. Austen et al.) Blackwell
Science,
Cambridge, Mass., 280-296, 1996.
Gessner et al., Ann. Hematol., 76:231-48, 1998.
Getahun et al., J. Immunol., 172:5269-5276, 2004.
Ghose et al., Cancer Immunol. Immunother., 13:185-9, 1982.
Ghose et al., Crit. Rev. Ther. Drug Carrier Syst., 3:263-359, 1987.
Glennie et al., J. Immunol., 139:2367-75, 1987.
Goldstein, Transplant Proc., 19:1-6, 1987.
Gomez-Guerrero et al., J. Immunol., 164:2092-101, 2000.
Gosselin et al., J. Immunol., 149:3477-3481, 1992.
Gray et al., J. Exp. Med., 180:1937-42, 1994.
Gribskov et al., Nucl. Acids Res., 14:6745-6763,1986.
Greenwood et al. Eur. J. Immunol., 23(5):1098-104, 1993.
Guyre et al., Cancer Immunol. Immunother., 45:146-8, 1997.
Harjunpaa et al., Scand. J. Immunol., 51(6):634-41, 2000.
Harris et al., J. Immunol., 143:2401-6, 1989
Hayes et al., Crit. Rev. Oncology/Hematology, 39:31-42, 2001.
Heijnen et al., J. Clin. Invest., 97:331-338, 1996.
Hinton et al., J. Immunol., 176: 346-356, 2006.
Hulett and Hogarth, Adv. in Immunol., 57:1-127, 1994.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
123
Ismaili et al., J. Immunol., 168:926-932, 2002.
Jarvis et al., Protein Exp. Purif., 8:191-203, 1996.
Johannesson et al., J. Med. Chem., 42:601-608, 1999.
Johnson and Glennie, Brit. J Cancer, 85:1619-1623, 2001.
Johnson et al., In: Biotechnology and Pharmacy, Pezzuto et al., eds., Chapman
and Hall,
New York, 1993.
Keler et al., J Immunol., 165:6738-42, 2000.
Keler et al., J. Immunol., 165:6738-6742, 2000.
Kenney et al., J. Immunol. Methods, 121:157-166, 1989.
Kimberly, Rheum. Dis. Clin. North Am., 14(1):203-21, 1988.
Kimura et al., Jpn J. Clin. Oncol., 13(2):425-33, 1983.
Kroesen et al., Cancer Immunol. Immunother., 45:203-6, 1997.
Kurosaki et al., Proc. Natl. Acad. Sci. USA, 88:3837-41, 1991.
Kyte and Doolittle, J. Mol. Biol., 157(1):105-132, 1982.
Laemmli, Nature, 227:680-5, 1970.
Lanier et al., J. Immunol., 146:4421-6, 1991.
Lanier et al., Nature, 342:803-5, 1989.
LaSalle et al., Faseb J., 8:601-8, 1994.
Legge et al., J. Exp. Med., 191:2039-52, 2000.
Liao et al., Proc. Natl. Acad. Sci. USA, 89:3659-3663, 1992.
Lieberman, Rheum. Dis. Clin. North. Am., 14:223-243, 1988.
Liu et al., Cell Immunol., 167:188-94, 1996.
Liu et al., J. Clin. Invest., 98:2001-7, 1996.
Lord et al., Biochem. Soc. Trans., 20:734-8, 1992.
Lord et al., Targeted Diagn. Ther., 7:183-90, 1992.
Lubbe et al., Lancet, 1361-1363, 1983.
Lund et al., J. Immunol., 147:2657-62, 1991.
Majeau et al., J. Immunol., 152:2753-67, 1994.
Manabe et al., J. Lab. Clin. Med., 104:445-54, 1984.
Manca et al., J. Exp. Med., 173:37-48, 1991.
Marks et al., J. Mol. Biol., 222:581-97, 1991.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
124
Martin et al., Infect. Immun., 71:2498-2507, 2003.
Martin et al., J. Immunol Methods, 212: 187-192, 1998.
Marusic-Galesic et al., Immunology, 72:526-531, 1991.
Marusic-Galesic et al., Immunology, 75:325-329, 1992.
McCarroll and King, Curr. Opin. Biotechnol., 8:590-4, 1997.
McLean et al., Mol. Immunol., 37:837-845, 2000.
Menard et al., Int. J. Biol. Markers, 4:131-4, 1989.
Meyerson et al., J. Immunol., 156:574-84, 1996.
Miller, Curr.. Opin. Rheum., 4:693-699, 1992.
Minghetti et al., J. Biol. Chem., 261:6747-6757, 1986.
Miyagi et al., J. Neuroimmunol., 78:127-31, 1997.
Moingeon et al., Proc. Natl. Acad. Sci. USA, 89:1492-6, 1992.
Morgan et al., Immunology, 86:319-24, 1995.
Nagler et al., J. Exp. Med. 171:1527-33, 1990.
Needleman, J. Mol. Biol., 48:443-453,1970.
Nelson, Cancer Cells, 3:163-72, 1991.
Nitta et al., J. Neurosurg., 72:476-81, 190.
Nolan et al., Biochim. Biophys. Acta, 1040:1-11, 1990.
Norderhaug et al., J. Immun. Meth., 204:77-87, 1997.
Ohtsuka et al., J. Immunol., 160:2539-45, 1998.
Oi and Morrison, Mt Sinai J Med., 53(3):175-80, 1986.
Paoletti and McInnes, In: Vaccines: From concept to clinic, CRC Press, 1999.
Passwell et al., J. Immunol., 123:115-20, 1979.
PCT Appln. WO 9942077
Perez et al., J. Immunol., 137:2069-72, 1986.
Perez et al., Nature, 316:354-6, 1985.
Pfeifer, Curr. Opin. Biotechnol., 9:518-21, 1998.
Pietersz et al., Cancer Res., 48:926-31, 1988.
Pietersz et al., Immunol. Cell Biol., 66:43-9, 1988.
Plotkin and Orenstein, In: Vaccines, 4`h Ed., Saunders press, 2004.
Ptak et al., Scand. J. Immunol., 51:479-84, 2000.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
125
Raghavan and Bjorkman, Ann. Rev. Cell. Dev. Biol., 12:181-220, 1996.
Regnault et al., J. Exp. Med., 189:371-380, 1999.
Remington's Pharmaceutical Sciences, 15`h ed., pages 1035-1038 and 1570-1580,
Mack
Publishing Company, Easton, PA, 1980.
Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990.
Rosenstein et al., Cancer Res., 44:1949-1953, 1984.
Schwartz and Dayhoff, In: Atlas of Protein Sequence and Structure, National
Biomedical
Research Foundation, 353 358, 1979.
Segal et al., Immunobiology, 185(2-4):390-402, 1992.
Semple et al. Blood, 78(10):2619-2625, 1991.
Shields et al., J. Biol. Chem., 276:6591-6604, 2001.
Silman et al., Ann. Rheum. Dis., 47:988-92, 1988.
Smith and Morrison, Biotechnology (N Y). 12(7):683-8, 1994.
Snider et al., J. Exp. Med., 171:1957-1963, 1990.
Sondermann et al., Nature, 406:267-273, 2000.
Sorensen et al., Neurology, 50:1273-81, 1998.
Staerz et al., Nature, 314:628-31, 1985.
Steinberg and Steinber, Arthritis. Rheum., 34:945-950, 1991.
Stevenson et al., Infect Immun., 58(10):3225-32, 1990.
Swain et al., Immunol. Rev., 102:77-105, 1988.
Ting et al., J. Immunol., 141:741-8, 1988.
Traunecker et al., Nature, 339:68-70, 1989.
Trombetta and Mellman, Annu. Rev. Immunol., 23:975-1028, 2005.
Vaickus et al., Cancer Invest., 9:195-209, 1991.
Venables, British Medical J., 307:663-666, 1993.
Vita et al., Biopolymers, 47:93-100, 1998.
Vivier et al., Eur. J. Immunol., 21:1077-80, 1991.
Vyse and Walport, Br. F Hosp. Med., 50:121-132, 1993.
Wallace et al., Lupus 2 Suppl 1, S 13-5, 1993.
Weisshoff et al., Eur. J. Biochem., 259:776-788, 1999.
Wernersson et al., J. Immunol., 163:618-622, 1999.
CA 02679743 2009-08-31
WO 2008/109757 PCT/US2008/056066
126
Wernersson et al., Scand. J. Immunol., 52:563-569, 2000.
White et al., Protein Expression and Purification, 21:446-455, 2001.
Wiesenhutter et al., J. Clin. Immunol., 4:124-33, 1984.
Wilke et al., Clin. Exp. Rheumatol., 9:581-587,.1991.
Winter et al., Nature, 349:293-9, 1991.
Wu et al., J. Clin. Invest., 100:1059-70, 1997.
Wunderlich et al., Int. J. Clin. Lab. Res., 22:17-20, 1992.
Young, et al., Genes Develop., 8:1043-1057, 1994.
Zaghouani et al., Science, 259:224-227, 1993.
Zaghouani et al., Science, 259:224-7, 1993.
Zanetti et al., Immunol. Rev., 130:125-50, 1992.
