Note: Descriptions are shown in the official language in which they were submitted.
CA 02692909 2009-12-29
1
DESCRIPTION
MARKE:R GENE FOR DETECTION OF TUMOR PROMOTER, AND
METHOD FOR DETECTION OF TUMOR PROMOTER
TECHNICAL FIELD
[0001]
The present invention relates to a marker gene for
detection of a tumor promoter, and a method of detecting a tumor
promoter. The present invention particularly relates to a marker
gene that can be used in a method of detecting a tumor promoter
by using the expression level of a specific gene in a cultured
cell as an index, instead of the observation of focus formation,
in a transformation assay for predicting carcinogenicity as a
tumor promoter using a cultured cell, and to a method of
detecting a tumor promoter using the marker gene expression level
as an index.
BACKGROUND ART
[0002]
Foods, as well as various substances present in the
environment, may have carcinogenicity. Therefore, a method that
can quickly predict the carcinogenicity of such substances has
been desired.
[0003]
Various genotoxicity tests are used as simple test
methods for detecting carcinogenicity (oncogenicity). However,
there are carciziogens (non-mutagenic carcinogenic substances)
that cannot be detected by genotoxicity tests. Most of such
substances are called tumor promoters.
[0004]
It has been confirmed that the carcinogenic mechanism
principally involves a two-stage process. The first stage is
called "tumor initiation", in which DNA is damaged by a genotoxic
(mutagenic) substance. The second stage is called "carcinogenetic
promotion", which is known as a process in which a tumor promoter
CA 02692909 2009-12-29
2
(a substance having tumor-promoting activity) enhances the growth
of DNA-damaged cells and promotes tumor formation; however, the
mechanism of this promotion may vary.
[0005]
Exantples of substances known as tumor promoters include
endogenous hormones produced in the body, as well as various
organic and inorganic compounds. Tumor promoters are not always
genotoxic. Accordingly, and problematically, tumor promoters
cannot be always detected by genotoxicity tests.
[0006]
The action mechanisms of the compounds known as tumor
promoters are not identical. Examples of the action mechanisms
include cell growth promotion, cytotoxicity, promotion of enzymes
such as protein kinase C, and inhibition of enzymes. The detailed
molecular mechanism of tumor promotion has yet to be elucidated.
[0007]
A method generally used for detecting a tumor promoter
is a two-stage carcinogenicity test using rodents as a test
animal. However, this method necessitates animal breeding
facilities, and requires a long test period, such as 8 to 24
weeks or longerõ Furthermore, evaluations require autopsies etc.,
thus requiring a high level of skill and expertise. Accordingly,
an in vitro test that enables many samples to be tested in a
simpler manner has been desired.
[0008]
On the other hand, examples of in vitro test systems
currently known include a transformation assay using BALB/c 3T3
cells as cultured cells (Non-Patent Document 1), and a
transformation assay using Bhas cells produced by introducing a
v-Ha-Ras gene into BALB/c 3T3 cells (Non-Patent Document 2).
These tests are simpler in operation than animal tests, and are
excellent tumor promoter detection methods.
[0009]
Although these tests are simpler in operation than
animal tests, a long test period is required. More specifically,
CA 02692909 2009-12-29
3
it takes 25 days to complete the BALB/c 3T3 cell transformation
assay, and 21 days to complete the Bhas cell transformation assay.
Even if the period of cell preparation is excluded from the test
period, it takes a long period of about 20 days from the addition
of a test substance to the obtaining of results. Furthermore, the
evaluation reqizires microscopic observation of the focus
formation ability of cultured cells, thus requiring a high level
of skill and expertise.
[0010]
Other methods currently used for detecting tumor
promoters include, for example, metabolic cooperation assays, and
tests using EB virus. However, these methods have problematic
detection ability and complicated procedures, and are less
reliable than the above-mentioned tests.
[0011]
Alonq with recent technical developments regarding
genomic information, hazard assessments of chemical substances,
such as assessments of carcinogenicity, have been performed at
the genetic level. In general, carcinogenicity tests using
animals require a test period of two years. Even with the use of
an animal that is prone to develop cancer, it takes several
months to complete the test, and the evaluation requires
expertise, such as autopsy expertise. In contrast, evaluation
based on gene expression can detect carcinogenicity within
several days after the administration of a carcinogen, and can
predict carcinogenesis by reading numeric data. Accordingly, this
method is advantageous in terms of the shortening of the test
period, ease of operation, and the low level of skill required.
[0012]
There are various levels of gene expression analysis.
Global gene expression analysis of tens of thousands of genes
using DNA microarrays (Patent Documents 1 and 2) used in, for
example, carcinogenicity tests using animals, is an excellent
method having the following advantages: thousands to tens of
thousands of expressed genes can be analyzed; the expression
CA 02692909 2009-12-29
4
pattern of the entire gene can be analyzed and compared to detect
a phenomenon whose mechanism is unknown, such as carcinogenesis;
and unknown genes can also be analyzed. However, using global
gene expression analysis to evaluate many samples is difficult,
because global gene expression analysis has disadvantages such as
the inclusion in the analysis of many genes unnecessary for the
evaluation, and the high cost of the test equipment, reagent, and
analysis.
[0013]
Another known method uses marker genes that can predict
the onset of a specific disease by global gene analysis or from a
known mechanism, and evaluating the expression levels of the
specific marker genes by quantitative RT-PCR or like methods
(Patent Documents 3 and 4). This method is simple and relatively
low in cost, and suitable for screening, i.e., testing many
samples.
Non-Patent Document 1: "Short-term two-stage transformation assay
using BALB/c 3T:3 cells to predict the carcinogenicity of chemical
substances", TR Z 0023, Japanese Standards Association, 2002
Non-Patent Docurnent 2: Mutat. Res., vol. 557, 191-202, 2004
Patent Document 1: Japanese Unexamined Patent Publication No.
2007-54022
Patent Document 2: W02005/024020
Patent Document 3: Japanese Unexamined Patent Publication No.
2006-162446
Patent Document 4: Japanese Unexamined Patent Publication No.
2004-248575
DISCLOSURE OF THE INVENTION
PROBLEM TO BE SOLVED BY THE INVENTION
[0014]
An object of the present invention is to find gene(s)
that can be used as a marker for detecting tumor promoters in a
transformation assay using a cultured cell, which is an in vitro
test system for predicting carcinogenicity as a tumor promoter.
Another object of the present invention is to establish a method
CA 02692909 2009-12-29
for detecting tumor promoters at the genetic level using the
marker gene(s). A further object of the present invention is to
provide an in vitro test system for determining whether a
substance is a tumor promoter in a simple manner and within a
5 short period of time, by applying the tumor promoter detection
method to a transformation assay using a cultured cell.
MEANS FOR SOLVING THE PROBLEM
[0015]
To achieve the above object, the present inventors
first performed DNA microarray assay to find genes that could be
used for evaluating tumor-promoting activity in a transformation
assay. Since the mechanism of tumor promotion is complex and for
the most part has yet to be elucidated, 9 types of various tumor
promoters with different properties and different structures were
used to select marker genes.
[0016]
Marker genes were selected considering the following
points:
(1) increased expression of the gene is highly commonly observed
with the use of any tumor promoter;
(2) actual increase of the gene expression level upon
carcinogenesis can be confirmed in the literature, etc.;
(3) the gene is considered to be closely associated with tumor
promotion, such as cell proliferation, oncogene, apoptosis
inhibition, and cytoskeletal change;
(4) the gene has a high tumor promoter detection ability,
although its function is unknown; and
(5) the expression level of the gene is less than 1.5 times that
of the negative control, when a test substance is not a tumor
promoter.
As a result, 27 types of genes were selected.
[0017]
Further, the present inventors performed a
transformation assay using a cultured cell, and established a
method for detecting a tumor promoter in a simple manner and
CA 02692909 2009-12-29
6
within a short period of time, without the necessity of actual
observation of focus formation in a transformation assay using a
cultured cell, the method comprising exposing the cultured cell
to a test substance, i.e., a potential tumor promoter, extracting
the total RNA including m-RNA from the cultured cell after a
certain amount of time has elapsed, and determining the
expression level(s) of selected marker gene(s) in the total RNA.
[0018]
The present invention provides the following:
[0019]
1. A marker-gene for use as a marker in a method of
detecting a tumor promoter using a cultured cell, the marker-gene
comprising one or more genes selected from the following genetic
group A:
genetic group A
(Gene Symbol) (GenBank Accession)
Qrm 1 NM008768
Scarbi NM016741
CA 02692909 2009-12-29
7
Stmnl NM 019641
Rad2l NM 009009
Nup54 NM_183392
Jun NM 010591
Dmpl NM_016779
Abil NM 001077190 ; NM_001077192;
NM_001077193 ; NM 007380 ; NM_145994
6530403A03Rik NM_026382
Slc2al NM 011400
Plf ; Plf2 ; Mrppl13 NM 011118 ; NM 011954 ; NM_031191
Fos11 NM_010235
Chekl NM 007691
Pik3r5 NM_177320
Junb NM_008416
Vegfa NM001025250 ; NM 001025257 ;NM_009505
Rifl ; LOC671598 NM_175238 ; XR_003484
Illr11 NM 001025602 ; NM010743
Phex NM 011077
Tfrc NM011638
Zfhx l b NM_015753
Rad5lapl NM_009013
Hells NM_008234
Mcm3 NM008563
Orm2 NM 011016
Car13 NM 024495
Ccnbl NM_172301
In Item 1, the marker-gene may be a set of 3 genes, 7 genes, or
11 genes selectE:d from genetic group A.
[0020]
2. The marker-gene according to Item 1, which comprises
at least 3 genes in the following genetic group A-1:
genetic group A-1
(Gene Symbol) (GenBank Accession)
Fosll NM_010235
Hells NM 008234
Ccnbl NM_172301
[0021]
CA 02692909 2009-12-29
8
3. The marker-gene according to Item 1, which comprises
at least 7 genes in the following genetic group A-2:
genetic group A-2
(Gene Symbol) (GenBank Accession)
Orm 1 NM 008768
Jun NM_010591
Plf ; P1f2 ; Mrpplf3 NM_011118 ; NM_011954 ; NM_031191
Fosll NM 010235
Illrll NM_001025602 ; NM_010743
Hells NM 008234
Ccnbl NM 172301
[0022]
3-1. The marker-gene according to Item 1, which
comprises at least 11 genes in the following genetic group A-2':
genetic group A-2'
(Gene Symbol) (GenBank Accession)
rml NA~ 008768
Jun NM_010591
Plf ; P1f'2 ; Mrpplt3 NM_011118 ; NM_011954 ; N1Vl 031191
Fosl1 NM_010235
lllrll NM_001025602 ; NM_01 Q743
Hells NM_008234
Ccnbl NM_172301
SIc2a1 NM_011400
Phex NM_011077
Sca.rbl N1Vt 016741
Vegfa NM0410252050 ; NM 0a 1025257 ; NM 009505
[0023]
4. The marker-gene according to Item 1, which comprises
at least 22 genes in the following genetic group A-3:
genetic group A-3
CA 02692909 2009-12-29
9
(Gene Symbol) (GenBank Accession)
Orm1 NM 008768
Scarb 1 NM 016741
Stmnl NM 019641
Nup54 NM_183392
Jun NM_010591
Abil NM001077190 ; NM 001077192;
NM_001077193 ; NM_007380 ; NM_145994
Slc2al NM 011400
Plf ; Plf'Z ; Mrpplf3 NM_011118 ; NM_011954 ; NM031191
Fosll NM 010235
Chekl NM_007691
Pik3r5 NM 177320
Vegfa NM_001025250 ; NM_001025257 ; NM 009505
Rifl ; LOC671598 NM_175238 ; XR003484
Illrll NM 001025602 ; NM010743
Phex NM011077
Tfrc NM_011638
Rad5lapl NM_009013
Hells NM008234
Mcm3 NM008563
Orm2 NM-011016
Carl3 NM_024495
Ccnbl NM_172301
[0024]
5. The marker-gene according to Item 1, which is Orml.
[0025]
6. A method of detecting a tumor promoter, comprising
the steps of:
bringing a cultured cell into contact with a test substance;
determining the expression level of a marker-gene in the cell
brought into contact with the test substance;
comparing the determined expression level with the expression
level of a control brought into contact with a test substance-
free solvent; and
evaluating the test substance as having tumor-promoting activity,
when the comparison shows that (i) the sum of marker-gene
expression levels or (ii) the number of genes of the marker-gene
expressed at high levels in the test substance-contacted cells is
CA 02692909 2009-12-29
greater than that of the control,
the marker-gene being the marker-gene defined in one of Items 1
to 5.
[0026]
5 In particular, a method of detecting a tumor promoter
comprising the steps of:
bringing a cu.ltured cell into contact with a tumor initiator;
bringing the tumor initiator-contacted cultured cell into
contact with a test substance;
10 determining the expression level of a marker-gene in the cell
brought into contact with the test substance;
comparing the determined expression level with the expression
level of a control brought into contact with a test substance-
free solvent; and
evaluating the test substance as having tumor-promoting activity,
when the comparison shows that (i) the sum of marker-gene
expression levels or (ii) the number of genes of the marker-gene
expressed at high levels in the test substance-contacted cells is
greater than that of the control,
the marker-gene being the marker-gene defined in one of Items 1
to 5.
[0027]
7. The method according to Item 6, wherein the cultured
cell is BALB/c 3T3.
[0028]
8. A kit for use in a method of detecting a tumor
promoter using a. cultured cell, the kit comprising a reagent for
determining the marker-gene of any one of Items 1 to 5.
In particular, a kit for use in the method of Item 6 or
7, the kit comprising a reagent for determining the marker-gene
of any one of Items 1 to 5.
[0029]
9. Use of the marker-gene according to any one of Items
1 to 5 as a marker in a method of detecting a tumor promoter
using a cultured cell.
CA 02692909 2009-12-29
11
In particular, the use of the marker-gene according to
any one of Items 1 to 5 as a marker in the method of Item 6 or 7.
Further, the present invention includes the following
Items 10 to 19.
[0030]
10. A marker-gene for use in a tumor promoter detection
method comprising measuring the change in the expression level of
a specific gene in a cultured cell, instead of the observation of
focus formatiori, in a transformation assay for predicting
carcinogenicity as a tumor promoter using a cultured cell,
the marker-gene comprising at least one gene selected from the
following genes:
CA 02692909 2009-12-29
12
(Gene Symbol) (GenBank Accession)
Orm1 NM_008768
Scarb 1 NM 016741
Stmn1 NM 019641
Rad2l NM 009009
Nup54 NM-183392
Jun NM 010591
Dmpl NM_016779
Abil NM_001077190 ; NM 001077192;
NM 001077193 ; NM 007380 ; NM_145994
6530403A03Rik NM 026382
Slc2al NM 011400
Plf ; Plf2 ; Mrpplf3 NM011118 ; NM_011954 ; NM031191
Fosll NM 010235
Chekl NM 007691
Pik3r5 NM 177320
Junb NM_008416
Vegfa NM 001025250 ; NM001025257 ; NM009505
Rifl ; L0C673_598 NM175238 ; XR_003484
Illrll NM_001025602 ; NM 010743
Phex NM 011077
Tfrc NM 011638
Zfhx 1 b NM015753
Rad5lapl NM_009013
Hells NM_008234
Mcm3 NM 008563
Orm2 NM 011016
Car13 NM024495
Ccnbl NM_172301
[0031]
11. A method of detecting a tumor promoter in a
transformation assay for predicting carcinogenicity as a tumor
promoter using a. cultured cell, which uses the expression level
of one of the genes of the marker-genes of Item 10 as an index.
[0032]
12. A method of detecting a tumor promoter in a
transformation assay for predicting carcinogenicity as a tumor
promoter using a cultured cell, which uses the expression level
of Orm1 (NM 008768) of Item 10 as an index.
[0033]
13. A. method of detecting a tumor promoter using as an
CA 02692909 2009-12-29
13
index the sum of the expression levels of two or more genes
selected from the marker-genes of Item 10, the genes including at
least one of Scarb1 (NM 016741), Stmnl (NM 019641), Plf; Plf2;
Mrpplf3 (NM 011118; NM 011954; NM 031191), Fos11 (NM_010235), and
111r11 (NM 001025602; and NM 010743) of Item 10.
[0034]
14. A method of detecting a tumor promoter in a
transformation assay for predicting carcinogenicity as a tumor
promoter using a cultured cell, which uses the expression levels
of all the genes of Item 10 as an index.
[0035]
15. 'I'he method of detecting a tumor promoter according
to any one of Items 11 to 14, wherein the cultured cell is BALB/c
3T3.
[0036]
16. A transformation assay for predicting
carcinogenicity as a tumor promoter using a cultured cell, which
uses the tumor promoter detection method of Item 10 or 15.
[0037]
17. The method according to Item 11, which uses as the
index the expression levels of all the following 3 genes selected
from the genes of Item 10:
(Gene Symbol) (GenBank Accession)
Fosll NM010235
Hells NM_008234
Ccnbl NM_172301
[0038]
18. The method according to Item 11, which uses as the
index the expression levels of all the following 7 genes selected
from the genes of Item 10:
CA 02692909 2009-12-29
14,
(Gene Symbol) (GenBank Accession)
Orm1 NM 008768
Jun NM_410591
Plf ; Plt2 ; Mrpplf3 NM_011118 ; NM_011954 ; NM031191
Fosl1 NM 010235
Illrll NM001025602 ; NM010743
Hells NM 008234
Ccnbl NM 172301
[0039]
19. 'The method according to Item 11, which uses as the
index the expression levels of all the following 22 genes
selected from the genes of Item 10:
(Gene Symbol) (GenBank Accession)
Orml NM_008768
Scarb 1 NM_016741
Stmnl NM019641
Nup54 NM_183392
Jun NM 010591
Abil NM_001077190 ; NM001077192;
NM_001077193 ; NM_007380 ; NM_145994
Slc2a1 NM_011400
Plf ; Plf2 ; Mrpplf3 NM_011118 ; NM_011954 ; NM_031191
Fosll NM010235
Chek1 NM007691
Pik3r5 NM 177320
Vegfa NM_001025250 ; NM_001025257 ; NM_00950'r
Rifl ; LOC671598 NM_175238 ; XR003484
1l1rl1 NM001025602 ; NM010743
Phex NM011077
Tfrc NM011638
Rad5lapl NM009013
Hells NM 008234
Mcm3 NM 008563
Orm2 NM011016
Car13 NM_024495
Ccnbl NM_172301
[0040]
The present invention is described in detail below.
[0041]
CA 02692909 2009-12-29
15,
In the present specification, the "tumor promoter"
refers to a substance having tumor-promoting activity.
[0042]
"tumor-promoting activity" refers to the action of
promoting the proliferation of initiated potential tumor cells
(DNA-damaged cells) and malignant transformation of the cells.
Most of the nori-genotoxic carcinogens are tumor promoters.
[0043]
Most of the tumor promoters were found in two-stage
carcinogenicity tests in rodents or other animal tests. The
intensity of the activity of the promoters can be estimated from
the lowness of the tumor promoter concentration, as well as from
the number of tumors and precancerous lesions. For example, when
a test substance can cause a specific lesion at a lower
concentration, the test substance is evaluated as having a higher
tumor-promoting activity. When test substances are used at the
same concentration, a test substance is evaluated as having a
higher tumor-promoting activity when the number of tumors and
precancerous lesions developed is greater.
[0044]
More specifically, a test substance is evaluated as
having tumor-promoting activity when a large number of focus
formation and/or a low concentration is the result of a
transformation assay using BALB/c 3T3 cells, as shown in the
Examples below.
[0045]
1. Marker-gene
The marker-gene of the present invention, i.e., a gene
that can be used in a test using a cultured cell, comprises at
least one gene selected from the genes described below.
[0046]
In this specification, the gene refers to a source from
which a genetic trait is expressed. Examples of the gene include
isolated DNA molecules, RNA molecules, and DNA transcripts.
[0047]
CA 02692909 2009-12-29
16
In this specification, the marker-gene refers to a
single gene or a set of genes used as a marker, and can be
paraphrased as a marker gene or a set of marker genes.
[0048]
The base sequences of the genes shown below can be
identified by their Accession Nos. in a known database (NCBI).
Orml NM 008768
Scarbl NM016741
Stmnl NM-019641
Rad2l NM-009009
Nup54 NM_183392
Jun NM 010591
Dmpl NM016779
Abil NM_001077190 ; NM_001077192;
NM 001077193 ; NM_007380 ; NM_145994
6530403A03Rik NM_026382
Slc2al NM 011400
Plf ; Plf2 ; Mrpplf,'; NM011118 ; NM011954 ; NM 031191
Fosll NM010235
Chek1 NM_007691
Pik3r5 NM_177320
Junb NM 008416
Vegfa NM001025250 ; NM 001025257 ; NM_009505
Rifl ; LOC671598 NM_175238 ; XR-003484
Illrll NM001025602 ; NM 010743
Phex NM 011077
Tfrc NM 011638
Zfhxlb NM 015753
Rad5lapl NM 009013
Hells NM 008234
Mcm3 NM 008563
Orm2 NM011016
Car13 NM 024495
Ccnbl NM_172301
[0049]
All the NM 001077190, NM 001077192, NM 001077193,
NM 007380, and NM 145994 are transcript variants of Abil. Both
the DNA microarray assay and the RT-PCR probe assay regard these
five genes as identical.
CA 02692909 2009-12-29
17
[0050]
More specifically, Abil refers to a gene that can be
represented by the sequence of NM 001077190, NM001077192,
NM 001077193, NM 007380, or NM 145994.
[0051]
NM 011118, NM 011954, and NM 031191 represent three
genes, Plf2, Mrpplf3, and Plf. These genes have recently become
known as members of prolactin family 2, subfamily c(pr12c) under
the names of prl2c3, prl2c4, and prl2c2; and have nearly
identical sequences. Both the DNA microarray assay and the RT-PCR
probe assay regard these three genes as identical.
[0052]
More specifically, Plf2, Mrpplf3, and Plf refer to
genes that can be represented by the sequence of NM 011118,
NM 011954, or NM 031191.
[0053]
NM 001025250, NM 001025257, and NM 009505 are
transcript variants of Vegfa. Both the DNA microarray assay and
the RT-PCR probe assay regard these three genes as identical.
[0054]
More specifically, Vegfa refers to a gene that can be
represented by the sequence of NM 001025250, NM 001025257, or
NM 009505.
[0055]
NM175238 and XR003484 represent two genes, Rifl and
L0C671598. L0C671598 is a homologue of Rifl. These genes have
nearly identical sequences. Both the DNA microarray assay and the
RT-PCR probe assay regard these genes as identical.
[0056]
More specifically, Rifl and L0C671598 refer to genes
that can be represented by the sequence of NM 175238 or XR003484.
[0057]
NM_001025602 and NM010743 are transcript variants of
Illrll. Both the DNA microarray assay and the RT-PCR probe assay
regard these two genes as identical.
CA 02692909 2009-12-29
18
[0058]
More specifically, Illrll refers to a gene that can be
represented by the sequence of NM 001025602 or NM 010743.
[0059]
These marker-gene was found by a method comprising
adding substances known as tumor promoters to initiated cells,
and performing global gene expression analysis by DNA microarray
assay using the total RNA extracted from the cells after a
certain amount of time has elapsed, in a transformation assay
using BALB/c 3T3 cells.
[0060]
In particular, to find the marker-gene that can detect
all the tumor promoters, and considering the fact that the
mechanism of tu:nor promotion has yet to be elucidated, 9 types of
tumor promoters having different properties were selected to
perform DNA microarray analysis.
[0061]
More specifically, the following compounds were
selectively used as tumor promoters that are able to form foci in
transformed cells, and that have no genetic toxicity:
(i) TPA, which is a typical tumor promoter and is a phorbol ester
capable of activating protein kinase C;
(ii) okadaic acid, which has protein phosphatase 1,2A-inhibitory
activity;
(iii) phenobarbital sodium, which activates various drug-
metabolizing enzymes;
(iv) saccharin sodium, which causes bladder cancers at high
concentrations;
(v) sodium orthovanadate, which is a vanadic acid salt having
protein tyrosine phosphatase-inhibitory activity;
(vi) lithocholic acid, which is a secondary bile acid derived
from an organism; and
(vii) insulin, wzich promotes cell growth.
As tunlor promoters having genetic toxicity, the
following substances were selectively used:
CA 02692909 2009-12-29
19
(viii) zinc chloride, which increases metallothionein; and
(ix) sodium arsenite, which varies in toxicity induced by the
inhibition of oxidative phosphorylation.
[0062]
The 9 types of tumor promoters having different
properties and different structures were individually added to
test systems. RNA was extracted from the cells, and comprehensive
analysis of the expressed genes was performed using DNA
microarrays.
[0063]
The I;NA extraction time was set to 48 hours after the
addition of the test substance, in order to exclude the influence
of the expression of drug-metabolizing enzyme genes that have
little to do with test substance-specific carcinogenicity
promotion. The mechanism of tumor promotion is complex, and for
the most part has yet to be elucidated. Therefore, the marker-
gene was selected from about 40,000 types of genes on a DNA
microarray according to the following rules.
[0064]
As genes whose expression levels are highly reliable
according to a fixed method, and whose expression is increased
with the use of one of the tumor promoters, about 6,700 types of
genes were first selected. More specifically, as genes (1) whose
expression levels were up-regulated by more than 1.5-fold
compared to the negative control in at least one of the test
systems containing a tumor promoter, about 6,700 types of genes
were selected.
[0065]
Subsequently, as genes whose increased expression is
highly commonly observed in all the tumor promoters, 325 types of
genes were selected. More specifically, as genes (2) whose
expression levels are up-regulated by more than 1.5-fold compared
to the negative control in at least five of the test systems
containing a tumor promoter, 325 types of genes were selected.
[0066]
CA 02692909 2009-12-29
Further screening was performed to select the following
genes: (a) genes whose actual increase in the expression level
upon carcinogenesis can be confirmed in the literature, etc.; (b)
genes that are considered to be closely associated with the
5 properties of tumor promotion, such as cell proliferation,
oncogene, apoptosis inhibition, and cytoskeletal change; (c)
genes that have high tumor promoter detection ability, although
their functions are unknown; and (d) genes whose expression
levels are less than 1.5 times that of the negative control, when
10 a test substance is not a tumor promoter.
[0067]
More specifically, as genes (3) whose expression levels
are not more than 1.25 times that of the negative control in a
tumor promoter-free test system, 98 genes were selected from the
15 genes (2). Further, as genes (4)(i) whose expression levels are
sufficiently high, and as genes (4)(ii) that are considered to be
closely associated with the properties of carcinogenesis or tumor
promotion, such as cell proliferation, oncogene, apoptosis
inhibition, and cytoskeletal change, 27 types of genes were
20 selected from the genes (3).
[0068]
As a result, 27 types of genes were selected. Table 1
shows principal functions of the genes.
[0069J
[Table 1]
CA 02692909 2009-12-29
21
Reference Sequence Gene Symbol Gene functions
NM_008768 Orm1 Acute phase reactive protein
NM_016741 Scarbt
Cell adhesion
NM_019641 Stmnl Mi
NM_009009 crotubule depolymerization
Rad21 DNA repair
NM_183392 Nup54
NM 010591 `hansportation
Jun Oncogene
NM_016779 Dmp 1 Cell surface modification
NM_001077190 NM_001077192: Abil Oncogene-related
NM-001077193 : NM_007380 : NM_145994
NM_026382 6530403A03Rik Unknown gene
NM 011400 Slc2al Sugartransport
NM_011118 ; NM_011954 : NM031191 Pif : PIf2 : Mrpplf3
Cell division
NM_010235 Fosit
NM 007691 Chek1 Oncogene-related
DNA damage
NM_177320 Pik3r5 P13 kinase
NM 008416 Junb Oncogene-related
NM_001025250 NM_001025257 NM_009505 Vegfa Neovascularization
NM175238 : XR_003484 R i f 1 : L0C671598 Telomere maintenance
NM001025602 NM_010743 I I 1 r I 1 DNA methylation
NM_011077 Phex Pbosphorylation-related
NM_011638 Tfrc Transferrin uptake
NM_015753 Zfhxlb Zincfinger
NM_009013 Rad5lapl DNArepair
NM 008234 He I I s Apoptosis inhibition
NM 008563 Mom3 ~ DNA replication
NM_011016 Orm2 Acute phase reactive protein
NM 024495 Car13 Carbon metabolism
NM 172301 Ccnbl Cell cvcle
[0070]
The marker-gene of the present invention refers to
genes shown in Table 1, i.e., one or more genes or a set of genes
selected from genetic group A shown below.
[0071]
More specifically, the marker-gene of the present
invention may be a full set of 27 types of genes belonging to
genetic group A, a set of several genes selected from genetic
group A, or one gene selected from genetic group A.
Genetic group A:
CA 02692909 2009-12-29
22
(Gene Symbol) (GenBank Accession)
Orml NM 008768
Scarbl NM 016741
Stmnl NM 019641
Rad2l NM 009009
Nup54 NM_183392
Jun NM010591
Dmpl NM016779
Abil NM_001077190 ; NM 001077192;
NM_001077193 ; NM007380 ; NM_145994
6530403A03Ri.k NM026382
Slc2al NM011400
Pif ; Plf2 ; Mrpplf3 NM 011118 ; NM 011954 ; NM-031191
Fosll NM 010235
Chekl NM007691
Pik3r5 NM_177320
Junb NM 008416
Vegfa NM001025250 ; NM_001025257 ; NM 009505
Rifl ; LOC671598 NM_175238 ; XR 003484
Illrll NM001025602 ; NM010743
Phex NM011077
Tfrc NM 011638
Zthxlb NM 015753
Rad5lapl NM 009013
Hells NM_008234
Mcm3 NM 008563
Orm2 NM 011016
Carl3 NM024495
Ccnbl NM_172301
One example of the marker-gene of the present invention
is a gene set A-1 comprising at least all the 3 genes in the
following genetic group A-1:
(Gene Symbol) (GenBank Accession)
Fosll NM 010235
Hells NM_008234
Ccnbl NM_172301
The gene set A-1 may consist of the above three genes,
or may further include one or more genes selected from genetic
group A.
CA 02692909 2009-12-29
23
[0072]
For example, a gene set may consist of Fosl1, Ccnbl,
Hells, and Rad5lapl.
[0073]
Another example of the marker-gene of the present
invention is a gene set A-2 comprising at least all the 7 genes
in the following genetic group A-2:
(Gene Symbol) (GenBank Accession)
Orml NM008768
Jun NM_010591
Plf ; Plf2 ; Mrpplf3 NM 011118 ; NM_011954 ; NM031191
Fosll NM 010235
Illrll NM001025602 ; NM_010743
Hells NM008234
Ccnbl NM_172301
Gene set A-2 may consist of the above 7 genes, or may
further include one or more genes selected from genetic group A.
[0074]
A further example of the marker-gene of the present
invention is a gene set A-2' comprising at least all the 11 genes
in the following genetic group A-2':
(Gene Symbol) (GenBank Accession)
Orml NM_008768
Jun NM010591
Pif ; Plf2 ; Mrpplf3 NM011118 ; NM_011954 ; NM_031191
Fosll NM_010235
Illrll NM001025602 ; NM010743
Hells NM_008234
Ccnbl NM_172301
Slc2al NM_011400
Phex NM_011077
Scarbl NM016741
Vegfa NM_001025250 ; NM_001025257 ; NM_009505
Gene set A-2' may consist of the above 11 genes, or may
further include one or more genes selected from genetic group A.
[0075]
CA 02692909 2009-12-29
24
Another example of the marker-gene of the present
invention is a. gene set A-3 comprising at least all the 22 genes
in the following genetic group A-3:
(Gene Symbol) (GenBank Accession)
Orml NM008768
Scarbl NM016741
Stmnl NM_019641
Nup54 NM_183392
Jun NM010591
Abil NM001077190 ; NM 001077192;
NM_001077193 ; NM_007380 ; NM_145994
Slc2al NM_011400
Plf ; Plf2 ; Mrpplf3 NM_011118 ; NM_011954 ; NM 031191
Fosll NM010235
Chekl NM_007691
Pik3r5 NM_177320
Vegfa NM_001025250 ; NM 001025257 ; NM 009505
Rifl ; LOC671598 NM_175238 ; XR003484
Illrll NM_001025602 ; NM 010743
Phex NM011077
Tfrc NM011638
Rad5lapl NM009013
Hells NM008234
Mcm3 NM008563
Orm2 NM_011016
Car13 NM 024495
Ccnbl NM_172301
The gene set A-3 may consist of the above 22 genes, or
may further include one or more genes selected from genetic group
A.
[0076]
Further, a further example of the marker-gene of the
present invention may be Orml.
[0077]
The marker genes mentioned above are for illustrative
purposes only, and are not intended to limit the scope of the
present invention.
[0078]
CA 02692909 2009-12-29
25,
The marker-gene of the present invention can be used as
a marker in a tumor promoter detection method using a cultured
cell.
[0079]
An example of the tumor promoter detection method using
a cultured cell is described below in Section 2 ("Tumor promoter
detection method").
[0080]
More specifically, the marker-gene of the present
invention can be used, as described later, in a method comprising
exposing a cultured cell to a test substance (a tumor promoter),
extracting the total RNA from the cultured cell after a certain
elapsed time, and measuring the expression level of m-RNA
contained in the total RNA.
[0081]
Further, the marker-gene of the present invention can
be used in a method of quantitatively determining the expression
level of a marker gene-encoded protein in a cultured cell using
an antibody specific for the protein encoded by the marker gene.
For example, various enzyme immunoassays, radioimmunoassays,
solid phase enzyme immunoassays, etc. can be used. The antibody
may be a polyclonal or monoclonal antibody.
[0082]
2. Tumor promoter detection method
The present invention provides a method of detecting a
tumor promoter from the gene expression level using the marker-
gene mentioned above.
[0083]
The detection method of the present invention comprises
the steps of:
bringing a cultured cell into contact with a test substance;
determining the expression level of a marker-gene in the cell
brought into contact with the test substance;
comparing the determined expression level with that of a control
brought into contact with a test substance-free solvent; and
CA 02692909 2009-12-29
26,
evaluating the test substance as having tumor-promoting activity,
when the comparison shows that (i) the sum of the marker-gene
expression levels or (ii) the number of genes of the marker-gene
expressed at high levels in the test substance-contacted cells is
greater than that of the control.
[0084]
(1) Cell to be used
Various types of cultured cells used in general
transformation assays can be used as the cultured cell.
[0085]
Since mouse genes were used in the DNA microarray assay
for selecting the marker-gene in the present invention, the cell
is preferably a mouse-cultured cell, i.e., a mouse-derived cell.
[0086]
Specific examples of the cell include BALB/c 3T3 cells,
i.e., a BALB/c mouse embryonic fibroblast cell line, clonal
strains thereof, and transformants thereof, such as Bhas cells
obtained by introducing a v-Ha-Ras gene into BALB/c 3T3 cells.
Examples of usable cells other than such BALB/c 3T3 mouse cells
include C3H10T1,/2 cells.
[0087]
(2) Test substances
The kind of test substance is not particularly limited.
The test substarice may be a low molecular or high molecular
compound, or may be a mixture of different kinds of substances,
such as foods, processed foods, wastes, and incinerated waste.
[0088]
As the positive control, for example, TPA (phorbol 12-
myristate 13-acetate), i.e., a potent tumor promoter, can be used.
[0089]
As the negative control, a solvent alone is typically
used. In the present specification, the "negative control" refers
to a control cell sample brought into contact with a test
substance-free solvent, unless otherwise specified.
[0090]
CA 02692909 2009-12-29
27
(3) Determination of the expression level
Examples of the method of determining the expression
level include, but are not limited to, a method comprising
amplifying cDNA obtained by reverse transcription of mRNA and
performing quantitative RT-PCR using marker gene(s) as the
target; a northern blotting method comprising directly
determining the mRNA level using a probe; and a method of
analyzing the expression level of mRNA using a DNA microarray
carrying marker gene(s). Any of such methods can be used. The
quantitative RT-PCR methods are particularly preferable in view
of their low operational costs and their ability to obtain test
results in several hours.
[0091]
The mRNA can be extracted according to a known method.
For example, each test substance is added and allowed to stand
for a certain period, typically 36 to 72 hours, after which the
medium of each test substance-added group was extracted. After
washing with PBS, the total RNA is extracted and the expression
level of m-RNA of the marker-gene contained in the total RNA is
determined. For the extraction of the total RNA, a DNase
treatment is preferably performed.
[0092]
(4) Comparison of the expression level
The marker-gene expression levels determined in (3) is
compared with that of the control cell brought into contact with
a test substance-free solvent, i.e., the negative control. For
the comparison, an appropriate standard curve may be prepared
according to a usual method, and the expression level may be
normalized using an internal standard gene. The expression level
of a positive control may also be determined, whereby a
comparison to the negative control can be combined with a
comparison to the positive control.
[0093]
For example, a standard curve is prepared using a
dilution series of cDNA of the negative or positive control, and
CA 02692909 2009-12-29
28
the expressiori level relative to the standard curve is calculated.
The calculated expression level is normalized by the expression
level of P-actin used as an internal standard gene. The
normalized expression level is divided by that of the negative
control group. The expression level of each gene is calculated as
an expression level relative to that of the negative control
group, thus obtaining the expression level of each marker gene. A
comparison of the obtained expression level(s) of the marker
gene(s) with that of the negative control provides comparative
results of the expression level(s) of the marker gene(s) in test
substance-added systems.
[0094]
(5) Evaluation of tumor promoters
Based on the comparative results obtained in (4), the
test substance is evaluated on whether the test substance has
tumor-promoting activity, i.e., whether the test substance is a
tumor promoter. More specifically, when (i) the sum of marker-
gene expression levels or (ii) the number of genes of the marker-
gene expressed at high levels in the cells brought into contact
with a test substance is greater than that of the control, the
test substance is evaluated as having tumor-promoting activity.
[0095]
The criteria by which the test substance is evaluated
as a tumor promoter can be appropriately selected according to
various methods for analyzing the expression level of the marker-
gene for detection of tumor promoters.
[0096]
To analyze the expression of the marker-gene for
detection of the tumor promoters, for example, (1) analysis of
the number of genes of the marker-gene up-regulated by more than
1.5-fold compared to the negative control, (2) analysis of the
sum of the marker-gene expression levels, (3) cluster analysis,
etc. can be used. Methods involving the multiplication of other
coefficients are also usable.
[0097]
CA 02692909 2009-12-29
29
More specifically, when the sum of marker-gene
expression levels in cells brought into contact with a test
substance is greater than that of the negative control, i.e.,
greater than the sum of marker-gene expression levels in control
cells brought into contact with a test substance-free solvent,
the test substance can be evaluated as having tumor-promoting
activity.
[0098]
Further, the expression level of each of the marker
gene(s) in the cell brought into contact with a test substance is
compared with that of the negative control cell. When there are a
great number of genes of the marker-gene whose expression levels
in test substance-contacted cells are up-regulated by more than
1.5-fold compared to the negative control, the test substance is
evaluated as having tumor-promoting activity.
[0099]
The intensity of the tumor promoters can also be
evaluated from the above results. More specifically, the greater
the sum of the marker-gene expression levels in the test
substance-contacted cells, compared to that of the negative
control, the more the test substance can be evaluated as having
potent tumor promoter activity.
[0100]
The greater the number of genes of the marker-gene
whose expression levels in the test substance-contacted cells are
up-regulated by more than 1.5-fold compared to the negative
control, the more the test substance can be evaluated as having
potent tumor promoter activity.
[0101]
The method of the present invention may further include
other steps, if necessary. For example, the method may comprise
the step of bringing cultured cells into contact with a tumor
initiator.
[0102]
More specifically, in a transformation assay using a
CA 02692909 2009-12-29
cultured cell, two or more substances known as tumor promoters
are added to a.n initiated cell, RNA is extracted from the cell
after a certain period of time has elapsed, and the expression
level of each marker gene is determined.
5 [0103]
The type of marker gene can be selected according to
the type and structure of the test substance (tumor promoter), as
well as the type of the cultured cell.
[0104]
10 For example, a tumor promoter can be detected by
determining the expression level of one of the marker genes and
using the detezmined expression level as an index.
[0105]
Particularly when BALB/c 3T3 cells is used, tumor
15 promoters can be detected by using the expression level of Orml
gene (NM008768) as an index, irrespective of the type and
structure of the test substance. However, since the Orm1 gene is
expressed at low levels in Bhas cells, this gene cannot be used
in Bhas cells.
20 [0106]
When using BALB/c 3T3 cells, the marker-gene preferably
comprises at least Orml gene (NM_008768), particularly preferably
comprises a gene belonging to genetic group A-2, and more
preferably a gene belonging to genetic group A-3. When using Bhas
25 cells, the marker-gene preferably comprises at least Fosll
(NM 010235), Hells (NM 008234), and Ccnbl (NM_172301), more
preferably a gene belonging to generic group A-2, and even more
preferably genes belonging to generic group A-3.
[0107]
30 The expression levels of two or more genes can also be
used as an index to detect the tumor-promoting activity.
[0108]
For example, when the sum of the expression levels of
two or more marker genes is used as an index, a method of using
at least one of :3carbl (NM 016741), Stmnl (NM 019641), Plf; Plf2;
CA 02692909 2009-12-29
31
Mrpplf3 (NM 01.1118; NM 011954; NM 031191), Fosl1 (NM 010235), and
Illrll (NM 001.025602; NM 010743) as the marker-gene is preferable.
[0109]
A more preferable method is using as an index the
expression levels of all the 27 types of genes shown in genetic
group A to detect tumor promoters.
[0110]
The number of marker genes to be used may vary
depending on the type and structure of the test substance used.
In general, to assess the intensity of tumor-promoting activity
as a tumor pronloter, all the marker genes, or as many marker
genes as possible when using some of the marker genes as an index
are preferably used.
[0111]
If necessary, the evaluation can be made in combination
with other results, such as analysis results of the expression
levels of genes other than the marker genes of the present
invention, and analysis results of other physical properties of
test substances.
[0112]
(6) Use in the transformation assay using cultured cells for
predicting carcinogenicity as a tumor promoter
The detection method using the marker-gene according to
the present invention can be used as a method of detecting a
tumor promoter by determining changes in the expression levels of
a gene in cultured cells, instead of observation of focus
formation in a conventional transformation assay for predicting
carcinogenicity as a tumor promoter.
[0113]
The "transformation assay for predicting
carcinogenicity as a tumor promoter" as referred to herein is,
for example, a method described in "Short-term two-stage
transformation assay using BALB/c 3T3 cells to predict the
carcinogenicity of chemical substances", TR Z 0023, published by
Japanese Standards Association, 2002. More specifically, the
CA 02692909 2009-12-29
32
method comprises exposing cultured cells to a tumor initiator,
and culturing the cells for a specific period; exposing the cells
to a test substance whose tumor-promoting activity is to be
examined, and culturing the cells for about 20 days; and staining
the cells, and observing and counting the foci (cell clumps)
formed in culture dishes to calculate the transformation
frequency, and thereby predict the tumor-promoting activity.
[0114]
The transformation assay generally comprises the
following steps. After cells are seeded into 60 mm cell culture
dishes or plates and subjected to tumor initiation, the cells are
cultured for several days. When cells not necessarily requiring
tumor initiation are used, the cells are seeded and cultured for
several days. Subsequently, the medium is replaced with a medium
containing a test substance, and the cells are cultured typically
for about 20 days and then stained. Foci (cell clumps) formed in
culture dishes are observed and counted to calculate the
transformation frequency.
[0115]
According to the present invention, the focus formation
in the above method is replaced by the following steps. After
cells are cultured for a certain period and exposed to a test
substance whose tumor-promoting activity is to be examined, the
cells are cultured for about 36 to about 72 hours, after which
RNA is extracted from the cells. Using a marker-gene as the
target gene, the expression level of the marker-gene is
determined and used as an index to detect a tumor promoter.
[0116]
More specifically, instead of the following steps in a
conventional transformation method using cultured cells for
predicting carcinogenicity as a tumor promoter:
culturing cells for a specific period; exposing the cultured
cells to a test substance whose tumor-promoting activity is to be
examined; culturing the cells for about 20 days, and then
staining the cells; and observing and counting the foci (cell
CA 02692909 2009-12-29
33
clusters) formed in culture dishes,
the method of the present invention comprises the following
steps:
culturing cells for a specific period; exposing the cultured
cells to a test substance whose tumor-promoting activity is to be
examined; culturing the cells for about 36 to about 72 hours, and
then extracting RNA from the cells; and determining the
expression level of a marker-gene as the target,
whereby the:method of the present invention can detect tumor
promoters at the gene expression levels.
[0117]
(7) Test for predicting carcinogenicity as a tumor promoter
The conventional transformation assay using cultured
cells requires about 20 days of culturing to form foci after
exposing initiated cells to a test substance (a tumor promoter).
[0118]
In contrast, when using the tumor promoter detection
method of the present invention, a tumor promoter can be detected
within about 3-:o 4 days after exposure to a test substance (a
tumor promoter) . Thus, a test for predicting carcinogenicity as a
tumor promoter can be performed within a short period of time.
[0119]
The following method can be mentioned as an example of
the method of the present invention:
a test method for predicting the carcinogenicity of a test
substance as a tumor promoter, the method comprising the steps of
1) bringing cultured BALB/c 3T3 cells into contact with a tumor
initiator;
2) bringing the tumor initiator-contacted cells into contact with
a test substance;
3) culturing the test substance-contacted cells for a specific
period, and then extracting RNA;
4) subjecting the RNA extracted in step (3) to PCR using a primer
or a set of primers as shown in Table 2, and determining the
marker-gene expression levels in the test substance-contacted
CA 02692909 2009-12-29
34
cells;
5) comparing the determined expression levels with the expression
levels in control cells brought into contact with a test
substance-free solvent; and
6) evaluating the test substance as a tumor promoter when (i) the
sum of the marker-gene expression levels or (ii) the number of
genes of the marker-gene expressed at high levels in the test
substance-contacted cells is greater than that of the control,
the marker-gene being a marker-gene of the present invention
described above.
[0120]
Although any known tumor initiator can be used as the
tumor initiator, MCA (3-methylcholanthrene) is typically used.
[0121]
Although the cell-culturing period in step 3 can be
suitably selected, the period is typically about 36 to about 72
hours.
[0122]
The PCR primer used for detecting the marker-gene in
step 4 is not limited to those of the sequences shown in Table 2.
Any other appropriately designed primer may also be used.
[0123]
More specifically, the following procedures can be
mentioned as an example of the steps of the method; however, the
examples should not be construed as limitative of the present
invention.
[0124]
1) Cell seeding (Day 0)
BALB/c 3T3 cells in the logarithmic growth phase are
seeded into a predetermined number of culture dishes in an amount
of 1.0 x 104 cel'_s per culture dish using MEM medium containing
10% FBS (hereinafter referred to as a test medium).
[0125]
2) MCA treatment (Day 1)
After culturing in a carbon dioxide incubator for 24
CA 02692909 2009-12-29
hours, MCA is added as a tumor initiator.
[0126]
3) Medium replacement (Day 4)
72 hours after the addition of MCA, the medium is
5 aspirated from each culture dish, and replaced with 5 ml each of
normal medium or DME/F12 medium containing ITES and 2% FBS
(hereinafter referred to as a test medium).
[0127]
4) Test substance treatment (the first time) (Day 7)
10 The medium is aspirated from the culture dishes of each
group. 5 ml of a medium containing a predetermined amount of a
test substance is added to each test substance-added group,
whereas 5 ml of medium containing TPA is added to a TPA-added
group, and 5 ml of medium containing a solvent is added to a
15 solvent-added group.
[0128]
5) RNA extraction
After the test substance treated cells in the culture
dishes are cultured in a carbon dioxide incubator for 36 to 72
20 hours, RNA is extracted. A commercially available extraction kit
can be used to extract the RNA.
[0129]
6) Quantitative RT-PCR analysis of marker-gene expression
To examine the expression of a marker-gene using the
25 total RNA obtairied in the above step 5), a quantitative RT-PCR is
performed using primers for the marker-gene for detection of
tumor promoters shown in Table 2 below and using a Real-Time PCR
System. The PCR primers used for detecting the genes shown in
Table 1 are not limited to those of the sequences shown in Table
30 2. Any other appropriately designed primer may be used.
[0130]
To perform the quantitative RT-PCR, RNA extracted from
each test substa::ice-added group is first subjected to a reverse
transcription reaction to obtain cDNA.
35 [0131]
CA 02692909 2009-12-29
36
Subsequently, real-time PCR is performed using primers
for the marker-gene for detection of tumor promoters shown in
Table 2, and dissociation curve analysis is performed. A standard
curve is prepared using a dilution series of cDNA of a negative
or positive control. The expression level relative to the
standard curve is calculated. The calculated expression level is
normalized by the expression level of R-actin as an internal
standard gene. The normalized expression level is divided by the
expression level of the negative control group, whereby the
expression level of each gene can be obtained as an expression
level relative to the negative control group. The expression
levels of the qenes shown in Table 1 can be obtained from the
thus-obtained expression levels. The marker-gene expression
levels can be examined by comparison of the thus-obtained
expression levels with that of the negative control.
[0132]
7) Evaluation of carcinogenicity as a tumor promoter
Based on the comparative results of the gene expression
levels, the test substance is evaluated as having tumor-promoting
activity when the sum of marker-gene expression levels in test
substance-contacted cells is greater than that of the negative
control. Further, based on a comparison of the expression level
of each gene, the test substance is evaluated as having tumor-
promoting activity when the number of genes of the marker-gene
whose expressiori levels in test substance-contacted cells is up-
regulated by more than 1.5-fold compared to the negative control
is great, compared to the negative control.
[0133]
The tumor-promoting activity of the test substance can
also be evaluated by using other test results in combination,
such as a transformation assay using focus formation.
[0134]
The above test can also be used as a test for
predicting focus formation in a transformation assay using
cultured cells.
CA 02692909 2009-12-29
37
[0135]
5. Tumor promoter detection kit
The kit of the present invention includes a reagent for
measuring the expression level of a marker-gene.
[0136]
Examples of the reagent for measuring the expression
levels by PCR include a primer or a set of primers. More
specifically, the reagent may be a sense or antisense primer for
each marker gerle shown in Table 2, or one or more sets of sense
and antisense primers.
[0137]
Examples of the reagent for northern blotting assay
include probes for the marker genes.
[0138]
Examples of the reagent for DNA microarray assay
include arrays carrying probes for the marker genes.
[0139]
Examples of the reagent for immunoassay include
antibodies to transcripts of the marker genes, microplates on
which the antibodies are immobilized, etc.
[0140]
The kit of the present invention may include other
reagents or components than the reagent for measuring the
expression levels of the marker genes, as long as they do not
impair the object of the present invention. For example, the kit
may include a set of primers or probes for an internal standard
gene, such as R-actin, GAPDH, or 18srRNA, or antibodies thereto.
Further,.the kit may include TPA as a positive control, enzymes,
buffers, fluorescent reagents used for detection, etc.
EFFECT OF THE INVENTION
[0141]
The present invention provides a method or a test
system for detecting a tumor promoter in a simple manner within a
short period of time and at low cost, the method using a marker-
gene and thus obviating the need for long-term culturing and
CA 02692909 2009-12-29
38
observation of focus formation in a conventional method, i.e., an
in vitro test system using cultured cells.
[0142]
The present invention provides a marker-gene that can
be utilized in a method of detecting a tumor promoter by
determining changes in the expression level of a specific gene in
cultured cells, instead of observing focus formation in a
transformation assay for predicting carcinogenicity as a tumor
promoter using cultured cells.
[0143]
The tumor promoter can be detected by examining the
expression level of the marker-gene of the present invention.
[0144]
When the tumor promoter detection method of the present
invention is applied to a conventional transformation assay using
cultured cells, the test can be performed in a simple manner
without the need for an expensive measuring apparatus,
microscopic observation, autopsy, i.e., without requiring experts
having skill and expertise in pathological examination.
Furthermore, the number of days required for the test, which is
about 20 days after addition of the test substance in the
conventional method, can be greatly reduced to about 3 to about 4
days.
BRIEF DESCRIPTION OF THE DRAWINGS
[0145]
The abbreviations in the Figures stand for the
following:
control or cont: negative control, VitCNa: sodium ascorbate,
TBHQ: t-butylhydroquinone, As: sodium arsenite, Ins: insulin, LA:
lithocholic acid, PB: phenobarbital sodium, NaVO: sodium
orthovanadate, ZnCl or Zn: zinc chloride, TPA: phorbol
12-myristate 13-acetate, SS: saccharin sodium, OK: okadaic acid,
Per: perylene, BA: benz[a]anthracene, Chr: chrysene, 1-NN:
1-nitronaphthalene, Nap: naphthalene, MNNG: N-methyl-N'-nitro- N-
nitrosoguanidine, Mannit: D-mannitol, Menth: DL-menthol, Pro:
CA 02692909 2009-12-29
39
progesterone, TGFP1: transforming growth factor, SDM:
sulfadimethoxi,ne, KA: kojic acid, BHA: butylhydroxyanisol, Atz:
atrazine, VitE: DL-a-tocopherol, 1NP: 1-nitropyrene, Phorb:
phorbol, Eug: eugenol, PG: propyl gallate, Cys: L-cysteine
hydrochloride, and Phen: phenacetin.
[0146]
[Fig. 1]
Fig. 1 shows a relationship between the number of foci
formed in a BALB/c 3T3 transformation assay, and the number of
genes, among the marker genes shown in generic group A, whose
expression levels are up-regulated by more than 1.5-fold compared
to the negative control, as determined by DNA microarray assay.
When two or more of the genes are expressed at levels up-
regulated by more than 1.5-fold compared to the negative control,
the number of foci increases, and the test substance is evaluated
as having tumor-promoting activity.
[0147]
[FIG. 2]
Fig. 2 shows a relationship between the number of foci
formed in a BALB/c 3T3 transformation assay, and the sum of the
expression leve:ls of the marker genes shown in generic group A
relative to the negative control, as determined by DNA microarray
assay. When the sum of the expression levels relative to the
negative control is 38 or more, the number of foci increases, and
the test substarice is evaluated as having tumor-promoting
activity.
[0148]
[Fig. 3]
Fig. :3 shows the results of cluster analysis using the
marker genes of generic group A. Whether the test substance is a
tumor promoter (shown by a bold line) can be determined from the
genealogical tree shown at the top of Fig. 3.
[0149]
[Fig. 4]
Fig. 4 shows a relationship between the number of foci
CA 02692909 2009-12-29
formed in a BALB/c 3T3 transformation assay, and the number of
genes, among the marker genes shown in generic group A, whose
expression levels are up-regulated by more than 1.5-fold compared
to the negative control, as determined by quantitative RT-PCR.
5 When two or more of the genes are expressed at levels up-
regulated by more than 1.5-fold compared to the negative control,
the number of foci increases, and the test substance is evaluated
as having tumor-promoting activity.
[0150]
10 [Fig. 5]
Fig. 5 shows a relationship between the number of foci
formed in a BALB/c 3T3 transformation assay, and the sum of the
expression levels of the marker genes shown in generic group A
relative to the negative control, as determined by quantitative
15 RT-PCR. When the sum of the expression levels relative to the
negative control is 40 or more, the number of foci increases, and
the test substance is evaluated as having tumor-promoting
activity.
[0151]
20 [Fig. 6]
Fig. 6 shows a relationship between the number of foci
formed in a Bhas transformation assay, and the number of genes,
among the 4 mar}:er genes shown in generic group A, whose
expression levels are up-regulated by more than 1.5-fold compared
25 to the negative control, as determined by quantitative RT-PCR.
When one or more of the genes are expressed at levels up-
regulated by more than 1.5-fold compared to the negative control,
the number of foci increases, and the test substance is evaluated
as having tumor-promoting activity.
30 [0152]
[Fig. 7]
Fig 7 shows the relationship between the RNA extraction
time in a BALB/c 3T3 transformation assay using TPA or zinc
chloride, and the expression levels of three of the marker genes
35 for detection of tumor promoters shown in generic group A
CA 02692909 2009-12-29
41
relative to the negative control, as determined by quantitative
RT-PCR. 36 to 72 hours after the addition of TPA or zinc chloride,
all three marker genes were expressed at levels up-regulated by
more than 1.5-fold compared to the negative control.
[0153]
[Fig. 8]
Fig. 8 shows a relationship between the focus formation
ability in a BALB/c 3T3 transformation assay, and the number of
genes, among the marker genes shown in generic group A-3, whose
expression levels are up-regulated by more than 1.5-fold compared
to the negative control, as determined by quantitative RT-PCR.
When two or more of the marker genes are expressed at levels up-
regulated by more than 1.5-fold compared to the negative control,
the focus formation ability increases, and the test substance is
evaluated as having tumor-promoting activity.
[0154]
[Fig. 9]
Fig. 9 is a diagram of the arrangement of primers for
the genes, and samples (cDNA produced by a reverse transcription
reaction of RNA obtained 48 hours after the addition of each test
substance) in a 96-well plate used in quantitative RT-PCR. Using
one 96-well plate, the detection of tumor promoters from 12
samples can be performed using marker genes for detection of
tumor promoters.
[0155]
[Fig. 10]
Fig. 10 shows a relationship between the focus
formation ability in a BALB/c 3T3 transformation assay, and the
number of genes, among 7 marker genes shown in generic group A-2,
whose expression levels are up-regulated by more than 1.5-fold
compared to the negative control, as determined by quantitative
RT-PCR. When two or more of the marker genes are expressed at
levels up-regulated by more than 1.5-fold compared to the
negative control, the focus formation ability increases, and the
test substance is evaluated as having tumor-promoting activity
CA 02692909 2009-12-29
42
(+) .
[0156]
[Fig. 11]
Fig,. 11 shows a relationship between the focus
formation ability in a BALB/c 3T3 transformation assay, and the
number of genes, among 11 marker genes shown in generic group A-
2', whose expression levels are up-regulated by more than 1.5-
fold compared to the negative control, as determined by
quantitative RT-PCR. When two or more of the marker genes are
expressed at levels up-regulated by more than 1.5-fold compared
to the negative control, the focus formation ability increases,
and the test substance is evaluated as having tumor-promoting
activity.
BEST MODE FOR CARRYING OUT THE INVENTION
[0157]
The present invention will be described below in more
detail with reference to Examples. However, the scope of the
present invention is not limited to these Examples.
Example 1
[0158]
Transformation assay using BALB/c 3T3 cells, and total RNA
extraction
BALB/c 3T3 A31-1-1 cells (obtained from Japan Health
Sciences Foundation) were seeded into 60 mm cell culture dishes
(a product of Corning Incorporated) at a concentration of 10,000
cells/dish using MEM medium (manufactured by Nissui
Pharmaceutical Co., Ltd.) containing 10% fetal bovine serum (FBS)
(normal medium). Each test substance was added to twelve of the
prepared 60 mm cell culture dishes in an amount of 5 mL/dish (day
0 after the start of test), and the cells were cultured at 37 C
overnight. On the first day after the start of test, 3-
methylcholanthlene, which is a tumor initiator, was added to the
cells to a final concentration of 0.2 pg/mL, and the cells were
cultured for 3 days. On the fourth day after the start of test,
the cells were washed, the medium was replaced with normal medium,
CA 02692909 2009-12-29
43
and the cells were further cultured for 3 days. On the seventh
day after the start of the test, the medium was removed, and
replaced with test substance-containing D-MEM/F-12 medium (GIBCO;
a product of Invitrogen Corp.) containing 2% FBS and 0.2% ITS-X
(GIBCO) (test medium). The following test substances were used as
tumor promoters that were able to form foci in the BALB/c 3T3
cell transformation assay: 0.1 pg /mL of TPA, 7.5 pg/mL of zinc
chloride, 1pg/inL of sodium orthovanadate, 5000 pg/mL of saccharin
sodium, 0.0075 ug/mL of okadaic acid, 0.15 pg/mL of sodium
arsenite, 30 pg/mL of insulin, 500 }zg/mL of phenobarbital sodium,
and 7.5 pgof lithocholic acid. As substances unable to form foci
in the BALB/c 3T3 cell transformation assay, 100ug/mL of sodium
ascorbate and 2 pg/mL of TBHQ (tert-butylhydroquinone) were used.
As a negative control, a solvent alone was used. 48 hours after
addition of each test substance, the medium was removed from one
of the 12 dishes in each test substance-added group. After
washing with PBS, the total RNA was extracted using an RNeasy
Mini kit (manufactured by Qiagen Inc.) including a DNase step. 96
hours after add.ition of the test substance, the medium was
removed from one of the remaining dishes, and the cells were
stained with Crystal violet to determine the cytotoxicity. The
remaining 10 dishes were used to perform a regular transformation
assay using BALB/c 3T3 cells. On the twenty-fifth day after the
start of test, the number of foci in the transformed cells was
determined. When the number of foci formed in the test substance-
added group was significantly increased compared to the negative
control group (P<0.05, Wilcoxon (Mann-Whitney) test), the test
substance was evaluated as having tumor-promoting activity.
(0159]
DNA microarray expression analysis of marker-gene
Using the total RNA obtained above, DNA microarray gene
expression analysis was performed. In the DNA microarray
experiment, GeneChip, Mouse Genome 430 2.0 Array available from
Affymetrix, Inc., was used. For data analysis, GeneSpring GX
ver.7.3.2 availa:ole from Agilent Technologies, Inc. was used.
CA 02692909 2009-12-29
44
After normalization of DNA microarray data of each test
substance-added group, the expression level of each of
approximately 40,000 types of genes contained in the DNA
microarray was divided by that of the negative control (a group
that received only a solvent in the transformation assay using
BALB/c 3T3 cells) to calculate the expression level relative to
the negative control. From these approximately 40,000 genes, 27
types of marker genes for detection of tumor promoters shown in
generic group A were selected according to the marker gene
selection rules described above.
[0160]
Among the 27 types of marker genes for detection of
tumor promoters, the number of genes whose expression levels were
up-regulated by more than 1.5-fold compared to the negative
control was determined, and compared with the number of foci
formed in the BALB/c 3T3 cell transformation assay (Fig. 1). Fig.
1 shows that the number of foci increases in proportion to the
increase in the number of marker genes expressed up-regulated by
more than 1.5-fold compared to the negative control. Accordingly,
the results show that tumor promoters can be detected, and the
intensity of the tumor-promoting activity can also be determined.
[0161]
The sum of the relative expression levels of 27 marker
genes obtained by DNA microarray analysis was compared with the
number of foci in the BALB/c 3T3 cell transformation assay (Fig.
2). Fig. 2 shows that the number of foci increases in proportion
to the increase in the sum of the relative expression levels of
the marker genes. Accordingly, the results show that tumor
promoters can be detected, and the intensity of the tumor-
promoting activity can also be determined.
[0162]
Fig. 3 shows the results of cluster analysis of 27
types of marker genes for detection of tumor promoters. Using
GeneSpring GX ver.7.3.2 available from Agilent Technologies, Inc.,
the cluster analysis was performed under the following
CA 02692909 2009-12-29
conditions: similarity measure; distance, clustering algorism;
and average linkage. The genealogical tree in the upper portion
of Fig. 3 shows that test substances having tumor promotion
activity, which induced significant focus formation in the BALB/c
5 3T3 cell transformation assay, and test substances not having
promoter activity, which did not induce focus formation, belong
to different groups. Accordingly, whether the test substance is a
tumor promoter can be determined from the genealogical tree.
Example 2
10 [0163]
A BALB/c 3T3 cell transformation assay was performed
using the following compounds. The compounds used as tumor
promoters that were able to form foci in the BALB/c 3T3 cell
transformation assay were: 0.lug/mL of TPA, 0.1ug/mL of mezerein,
15 7.5 }ig/mL of zinc chloride, 1pg/mL of sodium orthovanadate, 5000
pg/mL of saccharin sodium, 0.0075 pg/mL of okadaic acid, 7.5
pg/mL of lithocholic acid, 500 g/mL of phenobarbital sodium, 2
}ig/mL of progesterone, 0.15 pg/mL of sodium arsenite, and 30
pg/mL of insulin. The compounds used as substances that were
20 unable to form foci in the BALB/c 3T3 cell transformation assay
were 2}ag/mL of TBHQ, 100 pg/mL of sodium ascorbate, 1pg/mL of
perylene, 5}ig/mL of benzo[a]anthracene, 1 pg/mL of chrysene,
10ug/mL of 1-nit:ronaphthalene, 3 ug/mL of naphthalene, 1 pg/mL of
MNNG (N-methyl-N'-nitro-N-nitrosoguanidine), 300 }ig/mL of D-
25 mannitol, and 100 pg/mL of DL-menthol. As a negative control, a
solvent alone was used. 48 hours after addition of each test
substance, the medium was sampled from one of 12 dishes of each
test substance-added group. After washing with PBS, the total RNA
was extracted using a RNeasy Mini kit (manufactured by Qiagen
30 Inc.) including a DNase step. One of the remaining dishes was
used to determine the cytotoxicity, and the remaining ten dishes
were used to determine the number of foci. When the number of
foci formed in the test substance-added group was significantly
increased compared to the negative control group (P<0.05,
35 Wilcoxon (Mann-Whitney) test), the test substance was evaluated
CA 02692909 2009-12-29
46
as having tumor-promoting activity.
[0164]
Quantitative RT-PCR expression analysis of marker-gene
Usirig the total RNA obtained in the above test,
quantitative RT-PCR was performed using primers for marker genes
for detection of tumor promoters shown in Table 2, and using a
7500 Real-Time PCR System available from Applied Biosystems. The
PCR primers for detecting the marker genes are not limited to
those of the sequences shown in Table 2. Any appropriately
designed primer or commercially available primer can be used, as
long as the primer can detect the expression of at least one of
the marker genes. As a first step of quantitative RT-PCR, 100 ng
of the total RNA obtained from each test substance-added group
was subjected to a reverse transcription reaction using a High
Capacity cDNA Reverse Transcription Kit available from Applied
Biosystems, Inc. to produce cDNA. To each well of a PCR 96-well
plate were added 1 uL of cDNA, 1.3 pL of 5 uM primers for one of
the marker genes for detection of tumor promoters shown in Table
2, 10 pL of a Power SYBR Green PCR Master Mix available from
Applied Biosystems, Inc., and 7.7 uL of ultrapure water. After
incubation at 50 C for 2 minutes and at 95 C for 10 minutes, 35
to 40 cycles of PCR were performed using a 7500 Real-Time PCR
System of Applied Biosystems, Inc., each cycle comprising 95 C
for 15 seconds, and 60 C for 60 seconds. A dissociation curve
analysis was then performed. A standard curve was prepared using
a dilution series of cDNA of a negative or positive control, and
the expression levels relative to the standard curve were
calculated. The calculated expression levels were normalized by
the expression levels of R-actin used as an internal standard
gene. The normalized levels were divided by that of the negative
control group. The expression level of each gene was obtained as
an expression level relative to the negative control.
[0165]
[Table 2]
CA 02692909 2009-12-29
47
Reference Gene symbol SEQ Primer name Primer sequence
sequence ID NO
NM 008768 Orm1 1 Orm1 primer sense ACTCCACCOATCTAGGATTCCA
2 Orm1 primer antisense GCAAAGGTTTCTACTCCTCCTTCA
NM 016741 Scarbl 3 Scarbl primer sense GCCAAGCTATAGGGTCCTGAAG
4 Scarbl primer antisense GACTGGGTGGCTGGTCTGA
NM 019641 Stmnl 5 Stmn1 primer sense CCCACAAAATGGAGGCTAACA
6 Stmnl primer antisense TCCACGTGCTTGTCCTTCTCT
NM009009 Rad21 7 Rad2l primer sense GGTCTTCAGCGAGCTCTTGCTA
8 Rad2l primer antisense CGACACAGCTCAAGCAAACTG
NM 183392 Nup54 9 Nup54 primer sense AGATGCAGACCTGTTACGAGAAATC
Nup54 primer antisense TCAAGTGGCTAAGGCCTTCCT
NM 010591 Jun 11 Jun primer sense ATTGCTTGTGTAGTGOTCCTTAACAC
12 Jun primer antisense TGCAGTCTAGCCTGGCACTTAC
NM 016779 Dmpl 13 Dmpl primer sense CCAGAGGGACAGGCAAATAGTG
14 Dmp1 primer antisense GCCCAGOTOCTOTCOAGATT
NM 001077190 ; Abil 15 Abil primer sense AAAATTCTCTGACCTTTAATCCTATGGT
NM 001077192;
NM 001077193 ; 16 Abil primer antisense TGCCCACATGTAAAGCCATTAC
NM 007380 ;
NM_145994
NM026382 6530403A03 17 6530403A03 primer sense ATTGAAAATGACAGTGACCTGTTTG
Rik
18 6530403A03 primer antisense GGACTTTTTCGGCTATTATGTTGATT
NM 011400 SIc2a1 19 SIc2a1 primer sense TCCAACTGGACCTCAAACTTCA
Slc2al primer antisense CCGCACAGTTGGTCCACATA
NM 011118 ; Pif ; Pli'2 ; 21 Mrpplf3primer sense GCCACAGACATAAAGAAAAAGATCAAC
NM 011954 ; Mrpplf3
NM 031191 22 Mrpplf3primer antisense TCTTCTTTTCTTCATCTCCATTCTGA
NM010235 Foslt 23 Fosll primer sense CCGAAGAAAGGAGCTGACAGA
24 Fosll primer antisense CGATTTCTCATCCTCCAATTTGT
NM007691 Chekl 25 Chekl primer sense CCGACTTTCTAAGGGTGATGGA
26 Chekl primer antisense CGCTGAGCTTCCCTTTAATCTTC
NM177320 Pik3r5 27 Pik3r5 primer sense GCAGAGTGTGGTCAGGTGTGA
28 Pik3r5 primer antisense GGTGGCAAGCTGCTCTTCTC
NM 008416 Junb 29 Junb primer sense GCCCTGGCAGCCTGTCT
Junb primer antisense GCGCCAAGGTGGGTTTC
NM001025250 ; Vegfa 31 Vegfa primer sense TGCACCCACGACAGAAGGA
NM_001025257 ;
NM 009505 32 Vegfa primer antisense TCGCTGGTAGACATCCATGAAC
NM_175238 ; Rifi ; 33 Rif1 primer sense CAGGACTGTCTCCACGGATGA
XR 003484 LOC671598 34 Rif1 primer antisense GGGTATCTAGGGTCACAGGTTCA
NM 001025602 ; II1r11 35 It1ri1 primer sense CTGCAGGAAAAGAGAATCCAAAC
NM 010743 36 II1ri1 primer antisense GGAAGGCATTGTGGAATCAAG
NM_011077 Phex 37 Phex primer sense GCCAAGAGAAATGGGAAAGCT
38 Phex primer antisense AGCACAAAACCTGTCCTTCCA
NM_011638 Tfrc 39 Tfrc primer sense TTGAGGCAGACCTTGCACTCT
Tfrc primer antisense AAAGCCAGGTGTGTATGGATCA
NM_015753 Zfhxlb 41 Zfhxlb primer sense GTGACAAGACATTCCAGAAAAGCA
42 Zfhxlb primer antisense TGGTGTGGTCTCTTTCCTGTGT
NM 009013 Rad5lap'I 43 Rad51ap1 primer sense TGAAAGCAAGAGGCCCAAGT
44 Rad51ap1 primer antisense AATGCATTGCTGCTAGAGTTCCT
NM008234 Hells 45 Hells primer sense TCTAGAATTACTGTTGGATCGAAGTGA
46 Hells primer antisense TCCCTGTCTTCCCTTTAATTGG
NM 008563 Mcm3 47 Mcm3 primer sense CCCAGGACTCCCAGAAAGTG
48 Mcm3 primer antisense GAGGGCCGCCTTAAAAGC
NM_011016 Orm2 49 Orm2 primer sense ACCTTACCCCCAACTTGATAAATG
Orm2 primer antisense ACAGTGGTOATCTATGGTGTGATACTC
NM024495 Car13 51 Car13 primer sense TTGAGAGTGTCACGTGGATTGTT
52 Car13 primer antisense CACAAGAGGCTTCGGAATCTG
NM_172301 Ccnbl 53 Ccnb1 primer sense GCAGOACCTGGCTAAGAATGT
54 Ccnbl primer antisense TTCTTGACAGTCATGTGCTTTGTG
CA 02692909 2009-12-29
48
[0166]
The number of marker genes whose expression levels are
up-regulated by more than 1.5-fold compared to the negative
control was determined, and compared with the number of foci
formed in a BALB/c 3T3 cell transformation assay (Fig. 4). Fig. 4
shows that the number of foci increases in proportion to an
increase in the number of marker genes up-regulated by more than
1.5-fold compared to the negative control. Accordingly, the tumor
promoters can be detected, and the intensity of the tumor-
promoting activity can also be determined therefrom.
[0167]
The sum of the relative expression levels of marker
genes obtained by quantitative RT-PCR was compared with the
number of foci formed in a BALB/c 3T3 cell transformation assay
(Fig. 5). Fig. 5 shows that the number of foci increases in
proportion to an increase in the sum of the relative expression
levels of the marker genes. Accordingly, the results show that
tumor promoters can be detected and the intensity of the tumor-
promoting activity can also be determined.
Example 3
[0168]
Quantitative RT-PCR was performed using the RNA
obtained in Exarlple 2 to determine the expression level of the
Orml gene. The conditions for the quantitative RT-PCR were the
same as in Example 2. As shown in Table 3 below, when the
expression level. of Orml is up-regulated by more than 1.5-fold
compared to the negative control, significant focus formation in
the transformed cells can be predicted. When the number of foci
formed in the test substance-added group was significantly
increased compared to the negative control (P<0.05, Wilcoxon
(Mann-Whitney) test), the test substance was evaluated as
inducing significant focus formation (having tumor-promoting
activity).
[0169]
CA 02692909 2009-12-29
49
[Table 3]
Test substance Expression level of Orml Focus fomla.tion in the BALB/c
(rates relative to the negative 3T3 cell transformation assay *
control)
TBHQ 0.9 -
Sodium ascorbate itCNa 0.6 -
Perylene (Per) 0.6 -
Benz[a anfllracen (BA) 1.1 -
Chrysene (Chr) 1.4 -
1 -nitronahthalene 1 ]vN) 1.0 -
Na hthalene (Na h 1.3 -
MNNG 1.3 -
D-mannitol (Mannit) 0.9 -
dl-menthol(Menth) 0.9 -
TPA 2.3 +
Mezerein (Mez) 2.6 +
Zinc chloride (ZnCI) 3.4 +
Sodium orthovanadate iNaVO 1.5 +
Saccharin sodium (SS) 3.2 +
Okadaic acid (OK) 8.0 +
Lithocholic acid (LA) 5.8 +
Phenobarbital sodium 'B 7.2 +
Pro esterone (Prog) 18.7 +
Sodium arsenite (As) 1.7 +
Insulin (Ins) 2.0 +
-: no significant focus formation induced;
+: significant focus formation induced
Example 4
[0170]
Tumor promoter detection in a transformation assay using Bhas
cells
Bhas cells (obtained from Japan Health Sciences
Foundation) were seeded into 6-well cell culture plates (#3910,
manufactured by Corning Incorporated) to a concentration of
20,000 cells/mL using D-MEM/F-12 medium containing 5% FBS. Each
test substance was added to 7 wells in an amount of 2 mL/well (on
day 0 after the start of the test), and cultured at 37 C for 3
days. On the third day after the start of the test, the medium
was replaced with test substance-containing D-MEM/F-12 medium
containing 2% FBS. With respect to the test substances, the
CA 02692909 2009-12-29
50,
following compounds were used as tumor promoters that were able
to form foci in the Bhas cellular transformation assay: 0.05
pg/mL of TPA, 0.001 pg/mL of mezerein, 10 pg/mL zinc chloride, 1
pg/mL of perylene, 50 pg/mL of insulin, 10 pg/mL of progesterone,
5 pg/mL of TBHQ, 1pg/mL of chrysene, and 5 pg/mL of lithocholic
acid. As non-tumor-promoting substances that were unable to form
foci in the Bhas cellular transformation assay, 0.1 pg/mL of MNNG
and 10 pg/mL of naphthalene were used. As a negative control, a
solvent alone was used. 48 hours after addition of the test
substance, the medium was removed from one of the wells of each
test substance-added group. After washing with PBS, the total RNA
was extracted using an RNeasy Mini kit (manufactured by Qiagen,
Inc.) including a DNase step. Six wells each of the remaining
wells were used to perform a regular transformation assay using
Bhas cells. On the twenty-first day after the start of the test,
the number of foci of the transformed cells was determined.
[0171]
For expression analysis of the marker genes for
detection of tumor promoters, the total RNA obtained in the
transformation assay using Bhas cells was subjected to
quantitative RT-.PCR using 4 promoters, Ccnbl, Hells, Rad5lapl,
and Fosll selected from the marker genes for detection of tumor
promoters shown in Table 2, and using a 7500 Real-Time PCR System
manufactured by Applied Biosystems, Inc. The expression levels of
the marker genes for detection of tumor promoters were normalized
by the expression level of R-actin used as an internal standard
gene. The normalized expression levels were divided by the
expression level of the negative control group. The expression
level of each of the 4 genes was obtained as a expression level
relative to that of the negative control group. The conditions
for the quantitative RT-PCR were the same as in Example 2. Among
the 4 genes, the number of marker genes whose expression levels
were up-regulated by more than 1.5-fold compared to the negative
control was detezmined, and compared with the number of foci
formed in the Bhas cellular transformation assay (Fig. 6). Fig. 6
CA 02692909 2009-12-29
51
shows that the number of foci increases in proportion to the
increase in the number of marker genes. Accordingly, the results
show that tumor promoters can be detected, and the intensity of
the tumor-promoting activity can also be determined.
Example 5
[0172]
Analysis of RNA extraction time
A BALB/c 3T3 cell transformation assay was performed in
the same manner as in Example 1 using 0.1 ug/mL of TPA or 7.5
pg/mL of zinc chloride as a test substance. 36, 48, 60, 72, and
80 hours after addition of the test substance, the medium was
removed from one of the 15 dishes of each test substance-added
group. After washing with PBS, the total RNA was extracted using
an RNeasy Mini kit (manufactured by Qiagen, Inc.) including a
DNase step. One of the remaining dishes was used to determine the
cytotoxicity. Ten of the remaining dishes were used to perform a
transformation assay using BALB/c 3T3 cells. On the twenty-fifth
day after the start of the test, the number of foci of the
transformed cells was determined. Significant focus formation was
observed both in the TPA-added group and in the zinc chloride-
added group.
[0173]
For expression analysis of the marker genes for
detection of tunlor promoters, the total RNA obtained in the above
test was subjected to quantitative RT-PCR using 3 primers, Ccnbl,
Hells, and Fosll, among the marker genes for detection of marker
promoters shown in Table 2, and using a 7500 Real-Time PCR System
manufactured by Applied Biosystems, Inc. The expression level of
each of the marker genes for detection of tumor promoters was
normalized by the expression level of R-actin used as an internal
standard gene. 5,he normalized expression level was divided by the
expression level of the negative control group. The expression
level of each of the 3 genes was obtained as a relative
expression level to that of the negative control group. The
conditions for the quantitative RT-PCR were the same as in
CA 02692909 2009-12-29
52
Example 2.
[0174]
Fig. 7 shows the relationship between the expression
levels of the 3 genes, and the RNA extraction time after addition
of the test substance. The results show that the expression
levels of these marker genes in RNA extracted 36 hours to 72
hours after addition of the test substance are up-regulated by
more than 1.5-fold compared to the negative control, and tumor
promoters can be detected.
Example 6
[0175]
Quantitative RT-PCR expression analysis using 22 types of marker
genes
A BALB/c 3T3 cell transformation assay was performed in
the same manner as in Example 1 using the following 33 substances
as test compounds: 0.1 pg/mL of TPA, 0.1 pg/mL of mezerein, 7.5
pg/mL of zinc chloride, 1 pg/mL of sodium orthovanadate, 5000
pg/mL of saccharin sodium, 0.0075 pg/mL of okadaic acid, 7.5
pg/mL of lithocholic acid, 500 pg/mL of phenobarbital sodium, 2
pg/mL of progesterone, 0.15 pg/mL of sodium arsenite, 30 pg/mL of
insulin, 0.003 pg/mL of a transforming growth factor, 100 ug/mL
of sulfadimethoxine, 100 pg/mL of Kojic acid, 30 pg/mL of
butylhydroxyanisol, 30 pg/mL of atrazine, 3 pg/mL of DL-a-
tocopherol, 3pg/mL of phenacetin, 2 pg/mL of TBHQ, 100 pg/mL of
sodium ascorbate, 5pg/mL of benzo[a]anthracene, 1pg/mL of
chrysene, 10 pg/mL of 1-nitronaphthalene, 3}ig/mL of naphthalene,
1 pg/mL of MNNG (N-methyl-N'-nitro-N-nitrosoguanidine), 300 pg/mL
of D-mannitol, 100 }.ig/mL of DL-menthol, 1pg/mL of 1-nitropyrene,
1 pg/mL of phorbol, 3pg/mL of eugenol, 1pg/mL of propyl gallate,
1 pg/mL of perylene, and 100 pg/mL of L-cysteine hydrochloride.
48 hours after addition of the test substance, the medium was
removed from one of the 12 dishes of each test substance-added
group. After washing with PBS, the total RNA was extracted using
an RNeasy Mini kit (manufactured by Qiagen, Inc.). One of the
remaining dishes was used to determine the cytotoxicity. Ten of
CA 02692909 2009-12-29
53
the remaining dishes were used to perform a transformation assay
using BALB/c 3T3 cells. On the twenty-fifth day after the start
of the test, the number of foci of the transformed cells was
determined. Test substances were simply classified into 3 groups
using the focus formation ability (intensity of the tumor-
promoting activity) as an index.
When the number of foci was significantly increased compared to
the negative control (P<0.05, Wilcoxon (Mann-Whitney) test) and
was at least 50% that of the positive control TPA, a group of
such test substances were evaluated as having potent tumor-
promoting activity (+++). The test substances evaluated as +++
were TPA, mezerein, zinc chloride, sodium orthovanadate, okadaic
acid, and transforming growth factors. When the number of foci
was significantly increased compared to the negative control
(P<0.05, Wilcoxon (Mann-Whitney) test) and was less than 50% that
of the positive control TPA, a group of such test substances were
evaluated as having tumor-promoting activity (++). The test
substances evaluated as "++" were lithocholic acid, phenobarbital
sodium, sodium arsenite, saccharin sodium, sulfadimethoxine,
kojic acid, insulin, butylhydroxyanisol, and phenacetin. When the
number of foci was increased at least 2-fold compared to the
negative control_ (P<0.05, Wilcoxon (Mann-Whitney) test) but the
difference is not significant (P<0.05), a group of such test
substances were evaluated as having weak tumor-promoting activity
(+). The test substances evaluated as "+" were progesterone,
atrazine, and DL-a-tocopherol. All the other test substances were
evaluated as having no tumor promoting activity (-), because the
number of foci did not increase 2-fold or more compared to that
of the negative control, and no significant changes were observed
in the number of foci.
[01761
For expression analysis of the marker genes for
detection of tumor promoters, the total RNA obtained in the above
test was subjected to quantitative RT-PCR using primers shown in
Table 2 corresporiding to the 22 marker genes for detection of
CA 02692909 2009-12-29
54
tumor promoter=s shown in generic group A-3, and using a 7500
Real-Time PCR System of Applied Biosystems, Inc. The expression
level of each of the marker genes for detection of tumor
promoters was normalized by the expression level of P-actin used
as an internal standard gene. The normalized expression level was
divided by the expression level of the negative control group.
The expression level of each of the 22 genes was obtained as an
expression level relative to that of the negative control group.
The conditions for the quantitative RT-PCR were the same as in
Example 2.
[0177}
The number of marker genes whose expression levels were
up-regulated by more than 1.5-fold compared to the negative
control was determined, and compared with focus formation ability
in the BALB/c 3T3 cell transformation assay (Fig. 8). Fig. 8
shows that the focus formation ability increases in proportion to
the increase in the number of marker genes whose expression
levels were up-regulated by more than 1.5-fold compared to the
negative control. Accordingly, the results show that tumor
promoters can be detected, and the intensity of the tumor-
promoting activity can also be easily determined from the number
of marker genes whose expression levels are up-regulated by more
than 1.5-fold compared to the negative control.
Example 7
[0178]
Quantitative RT-PCR expression analysis using 7 types of marker
genes
The RNA obtained in Example 6 was subjected to
quantitative RT-PCR to determine the expression levels of 7
marker genes for detection of tumor promoters (Orml; NM008768,
Jun; NM010591 arid Plf; Plf2; Mrpplf3; NM 011118; NM011954;
NM 031191, Fosll; NM 010235, Illrll; NM 001025602;
NM 010743,Hells; NM 008234, Ccnbl; NM 172301). More specifically,
primers for the 7 genes were respectively added to rows A, B, C,
D, E, F, and G of a PCR 96-well plate, and primers for (3-actin
CA 02692909 2009-12-29
55,
used as an internal standard gene were added to row H. Then cDNA
obtained from each sample was added to columns 1 to 12 of the 96-
well plate in an amount of 1 uL/well (12 samples can be tested
per 96-well plate) (Fig. 9) . The conditions for the quantitative
RT-PCR were this same as in Example 2.
[0179]
The number of marker genes whose expression levels were
up-regulated by more than 1.5-fold compared to the negative
control was determined, and compared with the focus formation
ability in the BALB/c 3T3 cell transformation assay (Fig. 10).
Fig. 10 shows that the focus formation ability increases in
proportion to the increase in the number of marker genes up-
regulated by more than 1.5-fold compared to the negative control.
Accordingly, the results show that tumor promoters can be
detected, and the intensity of the tumor-promoting activity can
also be determined from the number of marker genes up-regulated
by more than 1.5-fold compared to the negative control.
Example 8
[0180]
Quantitative RT-.PCR expression analysis using 11 types of marker
genes
Quant:itative RT-PCR was performed using RNA obtained in
Example 6 to determine the expression levels of 11 types of
marker genes for detection of tumor promoters (Orml; NM 008768,
Jun; NM 010591, Plf; Plf2; Mrpplf3; NM_011118; NM011954;
NM031191, Fosll; NM010235, Illr11; NM001025602; NM010743,
Hells; NM_008234, Ccnbl; NM172301, Slc2al; NM 011400, Phex;
NM011077, Scarbl; NM016741, Vegfa; NM001025250; NM001025257;
NM009505). More specifically, primers for the 11 genes were
respectively added to column 1 to 11 of a PCR 96-well plate, and
primers for (3-act:in used as an internal standard gene were added
to column 12. cDNA obtained from each sample was added to rows A
to H of the 96-well plate in an amount of 1pL/well (8 samples
can be tested per 96-well plate). The conditions for the
quantitative RT-PCR were the same as in Example 2.
CA 02692909 2009-12-29
5E
The number of marker agents whose expression levels
were up-regulated by more than 1.5-fold compared to the negative
control was determined, and compared with the focus formation
ability in the BALB/c 3T3 cell transformation assay (Fig. 11).
Fig. 11 shows that the focus formation ability increases in
proportion to the increase in the number of marker genes up-
regulated by more than 1.5-fold compared to the negative control.
Accordingly, the results show that tumor promoters can be
detected, and the intensity of the tumor-promoting activity can
also be determi_ned from the number of marker genes up-regulated
by more than 1.5-fold compared to the negative control.
