Note: Descriptions are shown in the official language in which they were submitted.
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
P80453PC00
Title: New molecular markers for detection of squamous cell carcinomas
and adenocarcinomas and high-grade precursor lesions thereof
FIELD OF THE INVENTION
The invention is in the field of diagnostics, especially in the
diagnostics of cancer, more specifically in the diagnostics of squamous cell
carcinomas and adenocarcinomas and high-grade precursor lesions thereof.
BACKGROUND OF THE INVENTION
The development of squamous cell and adenocarcinomas is
characterized by a sequence of premalignant lesions, which are graded as mild
dysplasia, m.oderate dysplasia and severe dysplasia/carcinoma in situ.
Squamous cell and adenocarcinomas can develop from the mucosal linings of
several organs, such as the uterine cervix, vagina, anus, head and neck, and
lung.
Over the past decade it has been well established that a subset of
squamous cell carcinomas and even adenocarcinomas can be initiated by an
infection with high-risk human papillomavirus (hrHPV). This causal
relationship becomes evident from epidemiological and functional studies
involving cervical cancer (zur Hausen, Nat Rev Cancer 2002; 2:342-350; Bosch
et al., J Clin Pathol. 2002; 55: 244-265). HrHPV DNA has been detected in up
to 99.7% of cervical squamous cell carcinomas (SCCs) (Walboomers et al., J.
Pathol. 1999: 189: 12-19) and at least 94% of cervical adeno- and
adenosquamous carcinomas (Zielinski et al., J Pathol 2003: 201: 535-543).
Expression of the viral oncogenes E6 and E7, which disturb the p53 and Rb
tumor suppressor pathways, respectively, has been shown to be essential for
both the onset of oncogenesis and the maintenance of a malignant phenotype.
However, consistent with a multistep process of carcinogenesis, additional
alterations in the host cell genome are required for progression of an hr-HPV
infected cell to an invasive carcinoma.
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
2
In squamous cell carcinomas that are not associated with HPV these
pathways are disturbed by other means, such as gene mutations and/or
deletions, which have been recognized as early events in the pathogenesis of
these tumors. As is the case for hrHPV-induced lesions additional alterations
in the cellular genome are also required for progression of lesions with
disturbed p53 and Rb pathways to premalignant lesions and carcinomas.
These additive alterations may be equal in lesions caused by HPV and those
that have the p53 and Rb pathways disturbed by other means, for example as
a consequence of exposure to carcinogens in tobacco smoke. An example is
inactivation of the tumour suppressor gene TSLCl/ CADM1, which plays a role
in both a subset of hrHPV-induced cervical cancers (Steenbergen et al., J Natl
Cancer Inst 2004: 96: 294-305) and lung cancers (Kuramochi et al., Nature
Genetics 2001: 27: 427-430), the latter generally developing in an hrHPV
independent manner.
In line with multiple events underlying carcinogenesis is the
observation that only a small proportion of patients harbouring epithelial
cells
with evidence of disturbed p53 and Rb pathways, including those infected with
hrHPV, will develop premalignant lesions or cancer.
At present there is a lack of markers that with high specificity
predict high-grade premalignant lesions and squamous cell carcinomas and
adenocarcinomas amongst risk populations, such as women with cervical
hrHPV infections. Such markers are of utmost importance for cost-effective
early detection programmes. However, the heterogeneity of events that can
drive malignant transformation of cells with disturbed p53 and Rb pathways
indicates that a single marker lacks sufficient sensitivity for malignant
disease. We therefore reasoned that a panel composed of several markers is
necessary to cover all carcinomas and high-grade precursor stages thereof that
may emerge from cells with disturbed p53 and/or Rb pathways.
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
3
SUMMARY OF THE INVENTION
By using three datasets obtained by genomic and expression
profiling of cervical squamous cell carcinomas, cervical adenocarcinomas and
cell lineages of an in vitro model system of HPV-immortalized epithelial cells
combined with innovative statistical methods the inventors now have
discovered that overexpression and/or downregulation of a number of genes is
highly correlated with human cervical squamous cell carcinomas and
adenocarcinomas and high-grade precursor lesions thereof. As is shown in the
examples, a marker panel of 3 of the genes was sufficient to detect all
cervical
squamous cell carcinomas and adenocarcinomas that have been analysed so
far.
Thus the invention comprises a method for the detection of a squamous cell
carcinomas or adenocarcinoma or a high-grade precursor lesion thereof by
assessing cells in a clinical sample for overexpression of one or more of the
genes listed in Table 1 and/or for downregulation of one or more of the genes
of
Table 2. Preferably said method comprises the detection of a cervical
carcinoma or a premalignant cervical lesion, more preferably wherein said
squamous cell carcinoma or adenocarcinoma or high-grade precursor lesion
thereof is a hrHPV-infected invasive cancer or high-grade precursor lesion
thereof. In another embodiment the method comprises the detection of a lung
squamous cell carcinoma or high-grade precursor lesion thereof.
The assessment of overexpression or downregulation is preferably
performed by nucleic acid assays or by assessing the concentration of gene
products, preferably by immunoassay.
In another embodiment, the invention comprises one or more
nucleic acid assays targeting at least 1 of the genes of Table 1 or 2, more
preferably at least 2 of the genes, more preferably at least 3 of the genes,
more
preferably at least 4 of the genes, more preferably at least 5 of the genes,
more
preferably at least 6 of the genes, and most preferably at least 7 of the
genes .
Preferably said assay targets 3 to 6 of the genes listed in Table 1 and 2. It
is
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
4
also possible that a larger number of the genes of Table 1 or 2 are assessed
in
the assay of the invention. Further, the assay additionally targets control
genes.
Also provided in the invention is a kit for the detection of
squamous cell carcinoma or adenocarcinoma and high-grade precursor lesions
thereof comprising means for taking a sample from a subject, optionally means
for storage of said sample, and means for detection of overexpression or
downregulation of one or more of the genes listed in Table 1 and 2.
In yet another embodiment the invention comprises a method for the
treatment of squamous cell carcinoma or adenocarcinoma and high-grade
precursor lesions thereof by antigen-specific immunotherapy based on
polypeptide, peptide or gene sequences of genes listed in Table 1 serving as a
tumor-associated antigen that is capable of being recognized by and/or
inducing cytotoxic T lymphocytes (CTL). The (poly)peptide sequence may also
comprise an amino acid sequence in which one or several amino acids of the
specific amino acid sequence are subjected to substitution, deletion,
insertion
or addition and further having immune induction activity is provided.
LEGENDS TO THE FIGURES
Figure 1. Real-time RT-PCR results. A. The expression of the ITGAV gene in
samples taken from control patients (both normal ecto- and endocervix) and
squamous cell carcinoma (SSC) and adenocarcinoma (AdCA) relative to cell
line RNA used for standard curve by real-time RT-PCR. On Y-axis expression
levels (2log) relative to the standard curve, based on tumor cell line RNA,
are
given B. Similar for SYCP2 C. Similar for DTX3L.
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
Figure 2. Real time RT-PCR for AQP3 on A. HPV-immortalized cells and
controls and B. normal cervical epithelium and cervical carcinomas
Figure 3. Fold changes (FC) compared to normal cervical epithelium as
5 determined by microarray analysis are shown for the 7 genes identified by
integration of microarray CGH and expression analysis.
Figure 4. Sequences of the genes of Table 1 and 2.
DETAILED DESCRIPTION OF THE INVENTION
The invention is based on an innovative approach in which three data sets
obtained from a unique series of cervical tissue specimens and HPV-
immortalized keratinocyte cell lines are combined.
The first data set is based on mRNA expression profiling of cervical squamous
cell carcinomas, cervical adenocarcinomas and normal epithelial controls and
comprises genes, which are differentially expressed in cervical carcinomas
compared with the normal controls. The second data set is based on
integration of expression and genomic profiling, using comparative genomic
hybridization arrays (CGH-arrays), of the same set of cervical squamous cell
carcinomas and cervical adenocarcinomas as used for expression profiling
(Wilting et al. J Pathol 2006: 209: 220-230). The third dataset is based on
mRNA expression profiling of a well-defined in vitro model system of HPV-
immortalized keratinocytes ( Steenbergen et al. J Natl Cancer Inst 2001: 93:
865-872). Since all cell lines within this model system have the same genetic
and epigenetic background, differentially expressed genes identified within
this model system represent marker genes, which are specifically associated
with immortalization, a key feature of cancer cells, rather than being a
result
of differences in (epi)genetic background.
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
6
Comparison of these data sets revealed that DNA copy number alterations do
not necessarily reflect altered expression levels of genes located at the
altered
chromosomal regions. This indicates that expression markers cannot simply be
deduced from DNA profiles alone. Vice versa, altered expression of genes at a
given chromosomal region is not always reflected by DNA copy number
alterations of that region. These findings stress the value of combining the
various data sets for selection of the most comprehensive panel of candidate
marker genes.
By combining the three datasets 64 marker genes were identified, which are
differentially expressed in subsets of cervical carcinomas and HPV-
immortalized cells compared with normal epithelial cells. Of these, 30 genes,
listed in Table 1, revealed over expression in cervical carcinomas/HPV-
immortalized cells compared with normal epithelial controls. The other 34
genes, listed in Table 2, were found to be down regulated in cervical
carcinomas/HPV-immortalized cells compared with normal epithelial controls.
The genes listed in Table 1 and Table 2 and the gene products
thereof provide a valuable source of molecular markers from which marker
panels can be composed to diagnose carcinomas and their high-grade precursor
lesions with invasive potential. Secondly, the (poly)peptide sequences of
genes
listed in Table 1 provide a valuable source of tumor-antigens for the
treatment
of carcinomas and their high-grade precursor lesion by immunotherapy.
"Expression" refers to the transcription of a gene into structural
RNA (rRNA, tRNA) or messenger RNA (mRNA) and, if applicable, subsequent
translation into a protein.
The term "invasive cancer" refers to a carcinoma invading
surrounding tissue.
The term "HPV-induced invasive cancer" refers to a carcinoma
induced by high-risk HPV, which invades surrounding tissue. The term
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
7
"invasive cervical cancer" refers to a cervical carcinoma invading surrounding
tissue.
The term "invasive lung cancer" refers to a lung carcinoma invading
surrounding tissue. The terms "high-grade premalignant lesion" and " high-
grade precursor lesion" refer to a stage in the multistep cellular evolution
to
cancer with a strongly increased chance to progress to a carcinoma. With
classical morphology the pathologist is unable to predict in the individual
patient which premalignant lesion will progress or regress. The current patent
application refers to a method, which can predict the progression to invasive
cancer.
The term "invasive potential" refers to the potential to invade
surrounding tissue and consequently to become malignant.
The term "high-grade premalignant cervical lesion" or "high-grade
cervical precursor lesion" refers to a stage in the multistep cellular
evolution to
cervical cancer with a strongly increased chance to progress to a cervical
carcinoma. With classical morphology the pathologist is unable to predict in
the individual patient which cervical premalignant lesion will progress or
regress.
The term "capable of specifically hybridizing to" refers to a nucleic
acid sequence capable of specific base-pairing with a complementary nucleic
acid sequence and binding thereto to form a nucleic acid duplex.
A"compiement" or "complementary sequence" is a sequence of
nucleotides which forms a hydrogen-bonded duplex with another sequence of
nucleotides according to Watson-Crick base-paring rules. For example, the
complementary base sequence for 5'-AAGGCT-3' is 3'-TTCCGA-5'.
The term "stringent hybridization conditions" refers to hybridization
conditions that affect the stability of hybrids, e.g., temperature, salt
concentration, pH, formamide concentration and the like. These conditions are
empirically optimised to maximize specific binding and minimize non-specific
binding of the primer or the probe to its target nucleic acid sequence. The
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
8
terms as used include reference to conditions under which a probe or primer
will hybridise to its target sequence, to a detectably greater degree than
other
sequences (e.g. at least 2-fold over background). Stringent conditions are
sequence dependent and will be different in different circumstances. Longer
sequences hybridise specifically at higher temperatures. Generally, stringent
conditions are selected to be about 5 C lower than the thermal melting point
(Tm) for the specific sequence at a defined ionic strength and pH. The Tm is
the
temperature (under defined ionic strength and pH) at which 50% of a
complementary target sequence hybridises to a perfectly matched probe or
primer. Typically, stringent conditions will be those in which the salt
concentration is less than about 1.0 M Na ion, typically about 0.01 to 1.0 M
Na
ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at
least about 30 C for short probes or primers (e.g. 10 to 50 nucleotides) and
at
least about 60 C for long probes or primers (e.g. greater than 50
nucleotides).
Stringent conditions may also be achieved with the addition of destabilizing
agents such as formamide. Exemplary low stringent conditions or "conditions
of reduced stringency" include hybridization with a buffer solution of 30%
formamide, 1 M NaCl, 1% SDS at 37 C and a wash in 2x SSC at 40 C.
Exemplary high stringency conditions include hybridization in 50%
formamide, 1 M NaCI, 1% SDS at 37 C, and a wash in 0.1x SSC at 60 C.
Hybridization procedures are well known in the art and are described in e.g.
Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons Inc.,
1994.
The term "oligonucleotide" refers to a short sequence of nucleotide
monomers (usually 6 to 100 nucleotides) joined by phosphorous linkages (e.g.,
phosphodiester, alkyl and aryl-phosphate, phosphorothioate), or non-
phosphorous linkages (e.g., peptide, sulfamate and others). An oligonucleotide
may contain modified nucleotides having modified bases (e.g., 5-methyl
cytosine) and modified sugar groups (e.g., 2'-O-methyl ribosyl, 2'-0-
methoxyethyl ribosyl, 2'-fluoro ribosyl, 2'-amino ribosyl, and the like).
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
9
Oligonucleotides may be naturally-occurring or synthetic molecules of double-
and single-stranded DNA and double- and single-stranded RNA with circular,
branched or linear shapes and optionally including domains capable of forming
stable secondary structures (e.g., stem-and-loop and loop-stem-loop
structures).
The term "primer" as used herein refers to an oligonucleotide which is
capable of annealing to the amplification target allowing a DNA polymerase to
attach thereby serving as a point of initiation of DNA synthesis when placed
under conditions in which synthesis of primer extension product which is
complementary to a nucleic acid strand is induced, i.e., in the presence of
nucleotides and an agent for polymerization such as DNA polymerase, and at a
suitable temperature and pH. The (amplification) primer is preferably single
stranded for maximum efficiency in amplification. Preferably, the primer is an
oligodeoxy ribonucleotide. The primer must be sufficiently long to prime the
synthesis of extension products in the presence of the agent for
polymerization.
The exact lengths of the primers will depend on many factors, including
temperature and source of primer. A'"pair of bi-directional primers" as used
herein refers to one forward and one reverse primer as commonly used in the
art of DNA amplification such as in PCR amplification.
The term "probe" refers to a single-stranded oligonucleotide sequence
that will recognize and form a hydrogen-bonded duplex with a complementary
sequence in a target nucleic acid sequence analyte or its cDNA derivative.
"Expression" refers to the transcription of a gene into structural
RNA (rRNA, tRNA) or messenger RNA (mRNA) and, if applicable, subsequent
translation into a protein.
Polynucleotides are "heterologous" to one another if they do not
naturally occur together in the same organism. A polynucleotide is
heterologous to an organism if it does not naturally occur in its particular
form
and arrangement in that organism.
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
Polynucleotides have "homologous" sequences if the sequence of
nucleotides in the two sequences is the same when aligned for maximum
correspondence as described herein. Sequence comparison between two or
more polynucleotides is generally performed by comparing portions of the two
5 sequences over a comparison window to identify and compare local regions of
sequence similarity. The comparison window is generally from about 20 to 200
contiguous nucleotides. The "percentage of sequence homology" for
polynucleotides, such as 50, 60, 70, 80, 90, 95, 98, 99 or 100 percent
sequence
homology may be determined by comparing two optimally aligned sequences
10 over a comparison window, wherein the portion of the polynucleotide
sequence
in the comparison window may include additions or deletions (i.e. gaps) as
compared to the reference sequence (which does not comprise additions or
deletions) for optimal alignment of the two sequences. The percentage is
calculated by: (a) determining the number of positions at which the identical
nucleic acid base occurs in both sequences to yield the number of matched
positions; (b) dividing the number of matched positions by the total number of
positions in the window of comparison; and (c) multiplying the result by 100
to
yield the percentage of sequence homology. Optimal alignment of sequences for
comparison may be conducted by computerized implementations of known
algorithms, or by inspection. Readily available sequence comparison and
multiple sequence alignment algorithms are, respectively, the Basic Local
Alignment Search Tool (BLAST) (Altschul, S.F. et al. 1990. J.1VIol. Biol.
215:403; Altschul, S.F. et al. 1997. Nucleic Acid Res. 25:3389-3402) and
ClustalW programs both available on the internet. Other suitable programs
include GAP, BESTFIT and FASTA in the Wisconsin Genetics Software
Package (Genetics Computer Group (GCG), Madison, WI, USA).
As used herein, "substantially complementary" means that two
nucleic acid sequences have at least about 65%, preferably about 70%, more
preferably about 80%, even more preferably 90%, and most preferably about
98%, sequence complementarity to each other. This means that the primers
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
11
and probes must exhibit sufficient complementarity to their template and
target nucleic acid, respectively, to hybridise under stringent conditions.
Therefore, the primer sequences as disclosed in this specification need not
reflect the exact sequence of the binding region on the template and
degenerate primers can be used. A substantially complementary primer
sequence is one that has sufficient sequence complementarity to the
amplification template to result in primer binding and second-strand
synthesis.
The term "hybrid" refers to a double-stranded nucleic acid molecule,
or duplex, formed by hydrogen bonding between complementary nucleotides.
The terms "hybridise" or "anneal" refer to the process by which single strands
of nucleic acid sequences form double-helical segments through hydrogen
bonding between complementary nucleotides.
"Overexpression" or "upregulation" of a gene in a particular cell or
sample means that more mRNA is transcribed from the gene in a particular
cell or sample than in control cells or samples. Alternatively, said increase
in
expression can be measured from the concentration of the gene product
(protein) in a cell. The increase in expression should amount to at least 1.5
times the expression in controls, preferably at least 2 times, more preferably
at
least 3 times or more. This increase in expression can be measured against the
expression of that gene in a control sample, or, within the same sample
against
the expression of a control gene.
"Underexpression" or "downregulation" of a gene in a particular cell
or sample means that less mRNA is transcribed from the gene in a particular
cell or sample than in control cells or samples. Alternatively, said decrease
in
expression can be measured from the concentration of the gene product
(protein) in a cell. The decrease in expression should amount to at least 0.5
times the expression in controls, preferably at least 0.25 times, more
preferably at least 0.1 times or less. This decrease in expression can be
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
12
measured against the expression of that gene in a control sample, or, within
the same sample against the expression of a control gene.
Table 1. Genes showing increased expression in squamous cell
carcinomas and in vitro immortalized cells. The sequences of these
genes are given in Fig. 4
Genbank ID Gene
AK024944 FLJ21291
AK025135 DTX3L
AL122079 CCDC14
NM_018155 SLC25A36
AL049229 DKFZp56401016
K024639 TP13A3
08991 PIK3R4
NM 018950 HLA-F
NM002210 ITGAV
NM_000090 COL3A1
NM 014382 TP2C1
N1VI_022154 SLC39A8
N1VI_002310 LIFR
NM_002101 GYPC
NM_004467 FGL1
AF086432 GPR87
NM_003536 H3FK
NM_003722 TP73L
NM_002546 TNFRSFIIB
NM 003617 ]RGS5
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
13
N1VI_001622 H SG
NM_006851 RTVP1
M97168 XIST
137382 DKFZp434L1226
N1VI_014210 EVI2A
NN!_006546 IGF2BP 1/IMP 1
N1VI_000483 APOC2
NM_025227 BPIL1
NM_003881 WISP2
IVM 014258 SYCP2
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
14
Table 2. Genes showing decreased expression in squamous cell
carcinomas and in vitro immortalized cells. The sequences of these
genes are given in Fig. 4.
Genbank ID Gene
NM.014704 KIAA0562
N1VI_002885 RAPIGAP
NNI004425 ECM1
AB045292 M83
J00129 FGB
.001007 FLJ10145
K023814 FLJ13752
NM_016230 LOC51167
NM_001540 HSPB1
NM005232 EPHAl
NM_004063 CDH17
AL137555 C9orf88
K022845 C9orf58
NM_004925 QP3
NM_020428 CTL2
NM_017918 FLJ20647
AL122071 SLC16A9
NM_053005 HCCA2
NM000543 SMPD 1
M62402 IGFBP6
NM004050 BCL2L2
NM_138452 DHRS1
NM 016039 CLE7
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
NM_017434 DUOX1
NM_002435 MPI
N1VI_001520 GTF3C1
NM_017839 AYTL1
NM_006373 VAT1
NM_002476 MYL4
NM_014921 LPHN1
NM_001928 DF
NM_006087 TUBB4
NM_006297 XRCC1
NM 006307 SRPX
The expression of the genes of Table 1 and 2 may be detected by
measuring gene transcripts. As such, the coding regions for the proteins in
5 these genes provide marker sequences for detection of transcripts of the
genes.
In yet another alternative, the expression of the genes may be detected by
measuring the proteins produced by the genes directly.
The cell component used for the assay can thus be nucleic acid, such
as RNA, preferably mRNA, or protein. When a cell component is protein, the
10 reagent is typically an antibody against the protein produced by the gene.
When the component is nucleic acid, the reagent is typically a nucleic acid
(DNA or RNA) probe or (PCR) primer. By using such probes or primers, gene
expression products, such as mRNA may for example be detected.
The test cell component may be detected directly in situ or it may be
15 isolated from other cell components by common methods known to those of
skill in the art before contacting with the reagent (see for example, "Current
Protocols in Molecular Biology", Ausubel et al. 1995. 4th edition, John Wiley
and Sons; "A Laboratory Guide to RNA: Isolation, analysis, and synthesis",
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
16
Krieg (ed.), 1996, Wiley-Liss; "Molecular Cloning: A laboratory manual", J.
Sambrook, E.F. Fritsch. 1989. 3 Vols, 2nd edition, Cold Spring Harbor
Laboratory Press)
Detection methods include such analyses as Northern blot analysis,
RNase protection, immunoassays, in situ hybridization, PCR (Mullis 1987,
U.S. Pat. No. 4,683,195, 4,683,202, en 4,800,159), LCR (Barany 1991, Proc.
Natl. Acad. Sci. USA 88:189-193; EP Application No., 320,308), 3SR (Guatelli
et al., 1990, Proc. Natl. Acad. Sci. USA 87:1874-1878), SDA (U.S. Pat. Nos.
5,270,184, en 5,455,166), TAS (Kwoh et al., Proc. Natl. Acad. Sci. USA 86:1173-
1177), Q-Beta Replicase (Lizardi et al., 1988, Bio/Technology 6:1197), Rolling
Circle Amplication (RCA) or other methods for the amplification of
cDNA/DNA. In an alternative method RNA may be detected by such methods
as NASBA (L. Malek et al., 1994, Meth. Molec. Biol. 28, Ch. 36, Isaac PG, ed.,
Humana Press, Inc., Totowa, N.J.) or TMA. These include PCR analyses on
microfluid array platforms, allowing simultaneous detection of multiple
targets in one sample using limited amounts of input material. Nucleic acid
probes, primers and antibodies can be detectably labeled, for instance, with a
radioisotope, a fluorescent compound, a bioluminescent compound, a
chemiluminescent compound, a metal chelator, an enzyme or a biologically
relevant binding structure such as biotin or digoxygenin. Those of ordinary
skill in the art will know of other suitable labels for binding to the
reagents or
will be able to ascertain such, using routine experimentation.
Other methods for detection include such analyses as can be
performed with nucleic acid arrays (See i.a. Chee et al., 1996, Science
274(5287):610-614).. Such arrays comprise oligonucleotides with sequences
capable of hybridizing under stringent conditions to the nucleic acid cell
component of which the level is to be detected in a method of the present
invention.
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
17
The invention now provides a nucleic acid assay or immuno assay for
the detection of squamous cell carcinomas and adenocarcinomas and targeting
at least 1 of the genes of Table 1 or 2, more preferably 2 of the genes, more
preferably 3 of the genes, more preferably 4 of the genes, more preferably 5
of
the genes, more preferably 6 of the genes, and most preferably at least 7 of
the
genes.
Another embodiment of the invention is a method to predict the
presence or risk of occurrence of squamous cell carcinoma and
adenocarcinoma or the occurrence or risk of high-grade premalignant lesions
comprising:
a. taking a tissue sample, e.g. a cervical smear or lung specimen,
from the patient;
b. isolating the nucleic acid and/or protein from the sample;
cl. analyse the gene expression profile of said nucleic acid by
assaying it with a nucleic acid assay according to the invention; or
c2. analyse gene expression of said protein lysate by assaying it with
an immuno assay according to the invention; and
d. identifying the expression of one or more of the genes listed in
Table 1 and 2; and
e. assessing the risk on basis of the expression found in step d.
Preferably, the samples in the above methods are fresh samples.
Gene expression analysis is preferably done using a nucleic acid
assay or immuno assay.
To investigate gene expression the assay should target
polynucleotide molecules or proteins from a clinically relevant source, in
this
case e.g. a sample from a patient suspected of squamous cell or
adenocarcinoma or high-grade precursor lesions thereof. Therefore, preferably
a fresh (within 2 days from sampling) sample or a sample collected in
preservation fluid that ensures preservation of RNA and/or protein needs to be
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
18
available. Said target polynucleotide molecules should be expressed RNA or a
nucleic acid derived therefrom (e.g., eDNA or amplified RNA derived from
cDNA that incorporates an RNA polymerase promoter). If the target molecules
consist of RNA, it may be total cellular RNA, poly(A)+ messenger RNA
(mRNA) or fraction thereof, cytoplasmic mRNA, or RNA transcribed from
cDNA (cRNA). Methods for preparing total and poly(A)+ messenger RNA are
well known in the art, and are described e.g. in Sambrook et al., (1989)
Molecular Cloning- A Laboratory Manual (2nd Ed.) Vols. 1-3, Cold Spring
Harbor, New York. In one embodiment, RNA is extracted from cells using
guanidinium thiocyanate lysis followed by CsCl centrifugation (Chrigwin et
al.,
(1979) Biochem. 18:5294-5299). In another embodiment, total RNA is extracted
using a silica-gel based column, commercially available examples of which
include RNeasy (Qiagen, Valencia, CA, USA) and StrataPrep (Stratagene, La
Jolla, CA, USA). In another embodiment, total RNA is extracted using
commercially available RNA isolation reagents examples of which include
Trizol (Life Technologies, Breda, The Netherlands) and RNAbee (Tel-Test Inc.,
Friendswood, Texas, USA). In another embodiment, total RNA is extracted
using automated nucleic acid extraction platforms an example of which is the
Nuclisens EasyMAG (BioMerieux, Durham, NC, USA). Poly(A)+ messenger
RNA can be selected, e.g. by selection with oligo-dT cellulose or,
alternatively,
by oligo-dT or hexamer primed reverse transcription of total cellular RNA. In
another embodiment, the polynucleotide molecules analyzed by the invention
comprise cDNA, or PCR products of amplified RNA or cDNA.
When desiring to predict or determine the presence of squamous cell
carcinoma or adenocarcinoma in a subject, the practitioner should take a
sample from that subject, and after isolation of the RNA the expression of at
least 1, but preferably 3 to 6 of the genes of Table 1 or 2 should be
determined.
To normalize these expression data it is possible to correct the data for
variations with the help of expression data of a control gene or element which
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
19
is not affected by the tumour state (such as a housekeeping gene), which is
present in the nucleic acid assay that has been used to determine the
expression profile of the subject to be assessed. Instead of one control gene,
also the mean value of a pool of control genes can be taken. This correction
can, for instance, be done by dividing the expression level of each of the
tested
genes by the expression level of the control gene(s)/element(s).
For purposes of the invention, an antibody specific for a gene
product from Table 1 or 2 may be used to detect and quantify the presenceof
the polypeptide produced by the gene in biological fluids or tissue samples.
For purposes of the invention, probes specific for polynucleotides of
genes from Table 1 or 2 may be used to detect and quantify the polynucleotide
of the gene in biological fluids or tissue samples.
Any specimen containing a detectable amount of polynucleotide or
encoded polypeptide of the genes of Tables 1 and 2 can be used. Nucleic acid
can also be analyzed by RNA in situ methods that are known to those of skill
in the art such as by in situ hybridization. Preferred samples for testing
according to methods of the invention include such specimens as (cervical)
smears and/or (cervical) biopsies and the like. Preferably, cytological
(cervical)
scrapes, self sampled cervico/vaginal specimens, sputa and/or cervical
biopsies
are used as samples for testing. Although the subject can be any mammal,
preferably the subject is human.
The invention methods can utilize antibodies immunoreactive with
polypeptide encoded by the genes listed in Tables 1 and 2, the predicted amino
acid sequences of which are available from the GenBank Accession Nos. listed
in said Tables, or immunoreactive fragments thereof. An antibody preparation
that consists essentially of pooled monoclonal antibodies with different
epitopic
specificities, as well as distinct monoclonal antibody preparations can be
used.
Monoclonal antibodies are made against antigen containing fragments of the
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
protein by methods well known to those skilled in the art (Kohler, et al.,
Nature, 256: 495,1975).
The term antibody as used in this invention is meant to include
intact molecules as well as fragments thereof, such as Fab and F(ab')2, which
5 are capable of binding an epitopic determinant on genes listed in Tables 1
(and
2). Antibody as used herein shall also refer to other protein or non-protein
molecules with antigen binding specificity such as miniantibodies,
peptidomimetics, anticalins etc.
Monoclonal antibodies can be used in the diagnostic methods of the
10 invention, for example, in immunoassays in which they can be utilized in
liquid phase or bound to a solid phase carrier. In addition, the monoclonal
antibodies in these immunoassays can be detectably labelled in various ways.
Examples of types of immunoassays that can utilize monoclonal antibodies of
the invention are competitive and non-competitive immunoassays in either a
15 direct or indirect format. Examples of such immunoassays are the
radioimmunoassay (RIA) and the sandwich (immunometric) assay. Detection
of the antigens using the monoclonal antibodies of the invention can be done
utilizing immunoassays that are run in either the forward, reverse, or
simultaneous modes, including immunohistochemical or immunocytochemical
20 assays on physiological samples. Those of skill in the art will know, or
can
readily discern, other immunoassay formats without undue experimentation.
Monoclonal antibodies can be bound to many different carriers to be
used to detect the presence of the gene products of the genes of Table 1 and
2.
Examples of well-known carriers include glass, polystyrene, polypropylene,
polyethylene, dextran, nylon, amylases, natural and modified celluloses,
polyacrylamides, agaroses and magnetite. The nature of the carrier can be
either soluble or insoluble for purposes of the invention. Those skilled in
the
art will know of other suitable carriers for binding monoclonal antibodies, or
will be able to ascertain such using routine experimentation.
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
21
In performing the assays it may be desirable to include certain
"blockers" in the incubation medium (usually added with the labeled soluble
antibody). The "blockers" are added to assure that non-specific proteins,
proteases, or antiheterophilic immunoglobulins to the immunoglobulins
present in the experimental sample do not cross-link or destroy the antibodies
on the solid phase support, or the radiolabelled indicator antibody, to yield
false positive or false negative results. The selection of "blockers"
therefore
may add substantially to the specificity of the assays described in the
present
invention. A number of nonrelevant (i. e., nonspecific) antibodies of the same
class or subclass (isotype) as those used in the assays (e. g., IgGl, IgG2a,
IgM,
etc.) can be used as "blockers". The concentration of the "blockers" (normally
1-
100 g/ L) may be important, in order to maintain the proper sensitivity yet
to
inhibit any unwanted interference by mutually occurring cross-reactive
proteins in the specimen.
Other diagnostic methods for the detection of production of gene
products or gene expression of the genes listed in Tables 1 and 2, include
methods wherein a sample for testing is provided, which sample comprises a
cell preparation from cervical or other tissue. Preferably such samples are
provided as (cervical) scrapes, self sampled cervico/vaginal specimens, or
sputa. In order to provide for efficient testing schemes, hrHPV positive
specimens are used as cervical samples for testing.
A cell or tissue sample obtained from a human, is suitably
pretreated to allow contact between a target cellular component of a test cell
comprised in said sample with a reagent that detects the gene product of one
or more of the genes listed in Tables 1 and 2 and detecting an increase or a
reduction therein as compared to that of a comparable normal cell. Samples
may be mounted on a suitable support to allow observation of individual cells.
Examples of well-known support materials include glass, polystyrene,
polypropylene, polyethylene, polycarbonate, polyurethane, optionally provided
with layers to improve cell adhesion and immobilization of the sample, such as
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
22
layers of poly-L-lysine or silane. Cervical smears or biopsies may for
instance
be prepared as for the Papanicolaou (Pap) test or any suitable modification
thereof as known by the skilled person, and may be fixed by procedures that
allow proper access of the reagent to the target component. In certain
embodiments of the invention the cytological specimens are provided as
conventional smear samples, thin layer preparations of cervical cells, self-
sampled cervico/vaginal specimens or any other kind of preparation known to
those of skill in the art. If storage is required, routine procedures use
buffered
formalin for fixation followed by paraffin embedding, which provides for a
well-
preserved tissue infrastructure. In order to allow for immunohistochemical or
immunofluorescent staining, the antigenicity of the sample material must be
retrieved or unmasked. One method of retrieving the antigenicity of
formaldehyde cross-linked proteins involves the treatment of the sample with
proteolytic enzymes. This method results in a(partiai) digest of the material
and mere fragments of the original proteins can be accessed by antibodies.
Another method for retrieving the immunore activity of
formaldehyde cross-linked antigens involves the thermal processing using heat
or high energy treatment of the samples. Such a method is described in e.g.
U.S. Pat. No. 5,244,787. Yet another method for retrieving antigens from
formaldehyde-f"ixed tissues is the use of a pressure cooker (e.g. 2100-
Retriever),
either in combination with a microwave or in the form of an autoclave, such as
described in e.g. Norton, 1994. J. Pathol. 173(4):371-9 and Taylor et al.
1996.
Biotech Histochem 71(5):263-70.
Several alternatives to formaldehyde may be used, such as ethanol,
methanol, methacarn or glyoxal, citrated acetone, or fixatives may be used in
combination. Alternatively, the sample may be air-dried before further
processing.
In order to allow for a detection with nucleic acid probes, the sample
material must be retrieved or unmasked in case of formalin fixed and paraffin
embedded material. One method involves the treatmentwith proteolytic
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
23
enzymes and a postfixation with paraformaldehyde. Proteolytic digestion may
be preceded by a denaturation step in HCl. This method results in a (partial)
digest of the material allowing the entry of probes to the target. No specific
unmasking procedures are required in case of non-formalin fixed material, e.g.
frozen material. Prior to hybridisation samples can be acetylated by treatment
with triethanolamine buffer.
The present invention also provides a kit of parts for use in a
method of detecting squamous cell carcinomas and adenocarcinomas and their
high-grade precursor lesions in test cells of a subject. Such a kit may
suitably
comprise means for taking and storing a sample, such as a brush or spatula to
take a scrape of the suspected mucosal tissue, e.g. a cervical scrape or lung
brush together with a container filled with collection medium to collect test
cells. Alternatively, a sampling device consisting of an irrigation syringe, a
disposable female urine catheter and a container with irrigation fluid will be
included to collect cervical cells by cervico-vaginal lavage.
A kit according to the present invention may comprise primers and
probes for the detection of mRNA expression of the genes listed in Table 1 and
2. In another embodiment, a kit according to the invention may comprise
antibodies and reagents for the detection of protein expression of proteins
expressed by the genes of Table 1 and 2 in cervical scrapes or other tissue
specimens.
The present invention will now be illustrated by way of the
following, non limiting examples.
EXAMPLES
1. Differentially expressed genes in tissues and cell lines
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
24
To confirm differential expression of genes listed in Tables 1 and 2 we
measured mRNA expression of the following genes: ITGAV, SYCP2, DTX3L,
SEMP1, DEK, ATP2C1, SLC25A36 and PIK3R4 by real time RT-PCR
analysis. For this purpose RNA was extracted from 22 cervical squamous cell
carcinomas, 8 cervical adenocarcinomas, 15 high-grade cervical intraepithelial
neoplasia (CIN) lesions and 24 normal epithelial controls (normal ectocervix
n=13 and normal endocervix n=11). ITGAV, SYCP2, DTX3L SEMP1, DEK,
ATP2C1, PIK3R4 and SLC25A36 showed significant overexpression in
squamous cell carcinomas compared with normal ectocervix (see examples
Figure 1). DTX3L in addition showed significant overexpression in
adenocarcinomas compared with normal endocervix (Figure 1).
Analysis of RNA isolated from 15 high-grade CIN lesions, enriched for
dysplastic cells by laser capture microdissection, demonstrated increased
expression of ITGAV in 60% (9/15) of cases, ATP2C1 in 40% (6/15) of cases,
DEK in 80% (12/15) of cases, SLC25A36 in 73% (11/15) of cases and PIK3R4 in
67% (7/15) of cases.
For another gene, AQP3 reduced expression in both HPV-
immortalized cells (n=8) compared with control cells (n=4) and cervical
carcinomas (n=8) compared with normal cervical epithelium (n=1) was
confirmed by real-time RT-PCR (Figure 2)
Based on a more than 2-fold overexpression as detected by micro
array analysis a marker panel of 3 of the genes (i.e. a combination of DTX3L
and FLJ21291 and CCDC14 or ITGAV) enabled the detection of 100% of
cervical squamous cell carcinomas and 100% of cervical adenocarcinomas
(Figure 3).
In addition, real time RT-PCR analysis for ITGAV, DTX3L, DEK,
ATP2C1, SLC25A36 and PIK3R4 mRNA expression was performed on 20 lung
squamous cell carcinomas and 20 normal lung samples (adjacent to
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
carcinomas). ITGAV, DTX3L, ATP2C1, SLC25A36 and PIK3R4 mRNA
expression was significantly increased in carcinomas compared with normal
control samples.
5
The primers used for RT-PCR are summarized in Table 3.
Table 3. Real-time RT-PCR primer sequences.
Gene Primers
UG9_t7 O9
DEK F: AGAGAGGTTGACAATGCAAGTCT
R:TCTGCCCCTTTCCTTGTG
SEMP1 F:GATGAGGATGGCTGTCATTG
R:TACCATGCTGTGGCAACTAAA
ITGAV F: TTGTTGCTACTGGCTGTTTTG
R:TCCCTTTCTTGTTCTTCTTGAG
SYCP2 F: ACAGAAAACTGAAGACTACCTTTGTTA
R:TCATCAGCTCCATTCAAATTAAA
ATP2C1 F:GGATGTTCAGCAGCTTTCACAA
R: TCTGTAGCGACTTAATAATTTTCATCTTG
SLC25A36 F:CCAGTGTCAACCGAGTAGTGTCT
R: AGGAACGAGGCCCTTCTTTT
PIK3R4 F:GACTGCTACAAAAACCCCATGTT
R:CGGCACCATAACGTATCCATAA
DTX3L F:CAGTGAAAGGGCAGCTAAGG
R:GCACAGGTTTTTCGTCAACA
AQP3 F:CCCATCGTGTCCCCACTC
R:GCCGATCATCAGCTGGTACA
F.= Forward primer; R: Reverse primer; ITGAV primer sequences were retrieved
from Rogojina et al (Rogojina et al., 2003)
Immunohistochemical analysis of PIK3R4 and DTX3L on 25 high-grade CIN
lesions and 8 cervical squamous cell carcinomas confirmed increased
expression of both proteins. 100% (PIK3R4) and 85% (DTX3L) of cervical
squamous cell carcinomas and 65% (PIK3R4) and 41% (DTX3L) of high-grade
CIN lesions revealed protein over expression.
A pilot experiment on 2 lung squamous cell carcinomas also revealed increased
PIK3R4 protein expression in these tumours.
CA 02697668 2010-02-22
WO 2009/025551 PCT/NL2008/050556
26
2. Marker gene analysis of cervical scrapes
Using a nested case-control design of women participating in the
POBASCAM trial we studied cervical scrapes of 50 hrHPV positive case
women in which >CIN 2 (including 1 carcinoma) was diagnosed within 18
months of follow-up versus 100 hrHPV positive control women with CIN 1 or
better within an 18 months follow-up period. Baseline cervical scrapes of
these
women were collected in universal collection medium and subjected to DTX3L,
and PIK3R4 mRNA expression analysis by real time PCR. For the latter, a
pool of cervical scrapes of hrHPV negative women with no signs of disease
during 5 years of follow-up served as normal reference. Samples were scored
positive for differential expression in case the mean ratio [DTX3L or PIK3R4
gene mRNA copies : housekeeping gene mRNA copies case sample]/ [DTX3L or
PIK3R4 gene mRNA copies : housekeeping gene mRNA copies normal
reference sample]of duplicate experiments was >1.5. Increased expression
ratios of DTX3L and PIK3R4 relative to a housekeeping gene were found in 21
and 28, respectively, of cases versus none of the controls. A total of 36
cases
revealed increased ratios for one or more of these genes.
