Note: Descriptions are shown in the official language in which they were submitted.
CA 02718802 2012-05-23
TITLE OF THE INVENTION
RECOMBINANT NUCLEIC ACIDS COMPRISING REGIONS OF Ad6
BACKGROUND OF THE INVENTION
The references cited in the present application are not admitted to be
prior art to the claimed invention.
About 3% of the world's population are infected with the Hepatitis C
virus (HCV). (Wasley et al., &min. Liver Dis. 20, 1-16, 2000.) Exposure to HCV
results in an overt acute disease in a small percentage of cases, while in
most
instances the virus establishes a chronic infection causing liver inflammation
and
slowly progresses into liver failure and cirrhosis. (Iwarson, FEMS Microbial.
Rev. 14,
201-204, 1994.) In addition, epidemiological surveys indicate an important
role of
HCV in the pathogenesis of hepatocellular carcinoma. (Kew, FEMS Microbial.
Rev.
14, 211-220, 1994, Alter, Blood 85, 1681-1695, 1995.)
Prior to the implementation of routine blood screening for HCV in
1992, most infections were contracted by inadvertent exposure to contaminated
blood,
blood products or transplanted organs. In those areas where blood screening of
HCV
is carried out, HCV is primarily contracted through direct percutaneous
exposure to
infected blood, i.e., intravenous drug use. Less frequent methods of
transmission
include perinatal exposure, hemodialysis, and sexual contact with an HCV
infected
person. (Alter et al., N. Engl. J. Med. 341(8), 556-562, 1999, Alter, J.
Hepatol. 31
Suppl. 88-91, 1999. Senzin. Liver. Dis. 201, 1-16, 2000.)
The HCV genome consists of a single strand RNA about 9.5 kb
encoding ft precursor polyprotein of about 3000 amino acids. (Choo et al.,
Science
244, 362-364, 1989, Choo et al., Science 244, 359-362, 1989, Takamizawa et
al.., J.
Viral. 65, 1105-1113, 1991.) The HCV polyprotein contains the viral proteins
in the
order: C-El-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B.
Individual viral proteins are produced by proteolysis of the HCV
polyprotein. Host cell proteases release the putative structural proteins C,
El, E2, and
1
CA 02718802 2011-02-16
p7, and create the N-terminus of NS2 at amino acid 810. (Mizushima et al., J.
Virol.
68,2731-2734, 1994, Hijikata et al., P.N.A.S. USA 90, 10773-10777, 1993.)
The non-structural proteins NS3, NS4A, NS4B, NS5A and NS5B
presumably form the virus replication machinery and are released from the
polyprotein. A zinc-dependent protease associated with NS2 and the N-terminus
of
NS3 is responsible for cleavage between NS2 and NS3. (Grakoui et al., J.
Virol. 67,
1385-1395, 1993, Hijikata et al., P.N.A.S. USA 90,10773-10777 , 1993.) A
distinct
serine protease located in the N-terminal domain of NS3 is responsible for
proteolytic
cleavages at the NS3/NS4A, NS4A/NS4B, NS4B/NS5A and NS5A/NS5B junctions.
(Bartenschlager et al., J. Virol. 67, 3835-3844, 1993, Grakoui et al., Proc.
Natl. Acad.
Sci. USA 90, 10583-10587, 1993, Tomei et al., J. Virol. 67, 4017-4026, 1993.)
NS4A provides a cofactor for NS3 activity. (Failla et al., J. Virol. 68, 3753-
3760,
1994, De Francesco et al., U.S. Patent No. 5,739,002.)
NS5A is a highly phosphorylated protein conferring interferon
resistance. (De Francesco et al., Semin. Liver Dis., 20(1), 69-83, 2000,
Pawlotsky,
Viral Hepat. Suppl. 1,47-48, 1999.)
NS5B provides an RNA-dependent RNA polymerase. (De Francesco
et al., International Publication Number WO 96/37619, Behrens et al., EMBO 15,
12-
22, 1996, Lohmann et al., Virology 249, 108-118, 1998.)
SUMMARY OF THE INVENTION
The present invention features Ad6 vectors and a nucleic acid encoding
a Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide containing an inactive NS5B
RNA-dependent RNA polymerase region. The nucleic acid is particularly useful
as a
component of an adenovector or DNA plasmid vaccine providing a broad range of
antigens for generating an HCV specific cell mediated immune (CMI) response
against HCV.
A HCV specific CMI response refers to the production of cytotoxic T
lymphocytes and T helper cells that recognize an HCV antigen. The CMI response
may also include non-HCV specific immune effects.
Preferred nucleic acids encode a Met-NS3-NS4A-NS4B-NS5A-NS5B
polypeptide that is substantially similar to SEQ. ID. NO. 1 and has sufficient
protease
activity to process itself to produce at least a polypeptide substantially
similar to the
NS5B region present in SEQ. ID. NO. 1. The produced polypeptide corresponding
to
NS5B is enzymatically inactive. More preferably, the HCV polypeptide has
sufficient
2
CA 02718802 2011-02-16
protease activity to produce polypeptides substantially similar to the NS3,
NS4A,
NS4B, NS5A, and NS5B regions present in SEQ. 1D. NO. 1.
Reference to a "substantially similar sequence" indicates an identity of at
least about 65% to a reference sequence. Thus, for example, polypeptides
having an amino
acid sequence substantially similar to SEQ. ID. NO. 1 have an overall amino
acid identity
of at least about 65% to SEQ. ID. NO. 1.
Polypeptides corresponding to NS3, NS4A, NS4B, NS5A, and NS5B
have an amino acid sequence identity of at least about 65% to the
corresponding
region in SEQ. ID. NO. 1. Such corresponding polypeptides are also referred to
herein as NS3, NS4A, NS4B, NS5A, and NS5B polypeptides.
Thus, a first aspect of the present invention describes a nucleic acid
comprising a nucleotide sequence encoding a Met-NS3-NS4A-NS4B-NS5A-NS5B
polypeptide substantially similar to SEQ. ID. NO. 1. The encoded polypeptide
has
sufficient protease activity to process itself to produce an NS5B polypeptide
that is
enzymatically inactive.
In a preferred embodiment, the nucleic acid is an expression vector
capable of expressing the Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide in a
desired human cell. Expression inside a human cell has therapeutic
applications for
actively treating an HCV infection and for prophylactically treating against
an HCV
infection.
An expression vector contains a nucleotide sequence encoding a
polypeptide along with regulatory elements for proper transcription and
processing.
The regulatory elements that may be present include those naturally associated
with
the nucleotide sequence encoding the polypeptide and exogenous regulatory
elements
not naturally associated with the nucleotide sequence. Exogenous regulatory
elements
such as an exogenous promoter can be useful for expression in a particular
host, such
as in a human cell. Examples of regulatory elements useful for functional
expression
include a promoter, a terminator, a ribosome binding site, and a
polyadenylation
signal.
Another aspect of the present invention describes a nucleic acid
comprising a gene expression cassette able to express in a human cell a Met-
NS3-
NS4A-NS4B-NS5A-NS5B polypeptide substantially similar to SEQ. ID. NO. 1. The
polypeptide can process itself to produce an enzymatically inactive NS5B
protein. The
gene expression cassette contains at least the following:
3
CA 02718802 2011-02-16
a) a promoter transcriptionally coupled to a nucleotide sequence
encoding a polypeptide;
b) a 5' ribosome binding site functionally coupled to the nucleotide
sequence,
5 c) a terminator joined to the 3' end of the nucleotide
sequence, and
d) a 3' polyadenylation signal functionally coupled to the nucleotide
sequence.
Reference to "transcriptionally coupled" indicates that the promoter is
positioned such that transcription of the nucleotide sequence can be brought
about by
10 RNA polymerase binding at the promoter. Transcriptionally coupled does
not require
that the sequence being transcribed is adjacent to the promoter.
Reference to "functionally coupled" indicates the ability to mediate an
effect on the nucleotide sequence. Functionally coupled does not require that
the
coupled sequences be adjacent to each other. A 3' polyadenylation signal
functionally
15 coupled to the nucleotide sequence facilitates cleavage and
polyadenylation of the
transcribed RNA. A 5' ribosome binding site functionally coupled to the
nucleotide
sequence facilitates ribosome binding.
In preferred embodiments the nucleic acid is a DNA plasmid vector or
an adenovector suitable for either therapeutic application in treating HCV or
as an
20 intermediate in the production of a therapeutic vector. Treating HCV
includes
actively treating an HCV infection and prophylactically treating against an
HCV
infection.
Another aspect of the present invention describes an adenovector
comprising a Met-NS3-NS4A-NS4B-NS5A-NS5B expression cassette able to express
= 25 a polypeptide substantially similar to SEQ. ID. NO. 1
that is produced by a process
involving (a) homologous recombination and (b) adenovector rescue. The
= homologous recombinant step produces an adenovirus genome plasmid. The
adenovector rescue step produces the adenovector from the adenogenome plasmid.
Adenovirus genome plasmids described herein contain a recombinant
30 adenovirus genome having a deletion in the El region and optionally in
the E3 region
and a gene expression cassette inserted into one of the deleted regions. The
recombinant adenovirus genome is made of regions substantially similar to one
or
more adenovirus serotypes.
Another aspect of the present invention describes an adenovector
35 consisting of the nucleic acid sequence of SEQ. ID. NO. 4 or a
derivative thereof,
4
CA 02718802 2011-02-16
wherein said derivative thereof has the HCV polyprotein encoding sequence
present
in SEQ. ID. NO. 4 replaced with the HCV polyprotein encoding sequence of
either
SEQ. ID. NO. 3, SEQ. lD. NO. 10 or SEQ. ID. NO. 11.
Another aspect of the present invention describes a cultured
recombinant cell comprising a nucleic acid containing a sequence encoding a
Met-
NS3-NS4A-NS4B-NS5A-NS5B polypeptide substantially similar to SEQ. ID. NO. 1.
The recombinant cell has a variety of uses such as being used to replicate
nucleic acid
encoding the polypeptide in vector construction methods.
Another aspect of the present invention describes a method of making
an adenovector comprising a Met-NS3-NS4A-NS4B-NS5A-NS5B expression cassette
able to express a polypeptide substantially similar to SEQ. ID. NO. 1. The
method
involves the steps of (a) producing an adenovirus genome plasrnid containing a
recombinant adenovirus genome with deletions in the El and E3 regions and a
gene
expression cassette inserted into one of the deleted regions and (b) rescuing
the
adenovector from the adenovirus genome plasmid.
Another aspect of the present invention describes a pharmaceutical
composition comprising a vector for expressing a Met-NS3-NS4A-NS4B-NS5A-
NS5B polypeptide substantially similar to SEQ. ID. NO. 1 and a
pharmaceutically
acceptable carrier. The vector is suitable for administration and polypeptide
expression in a patient.
A "patient" refers to a mammal capable of being infected with HCV.
A patient may or may not be infected with HCV. Examples of patients are humans
and chimpanzees.
Another aspect of the present invention describes a method of treating
a patient comprising the step of administering to the patient an effective
amount of a
vector expressing a Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide substantially
similar to SEQ. ID. NO. 1. The vector is suitable for administration and
polypeptide
expression in the patient.
The patient undergoing treatment may or may not be infected with
HCV. For a patient infected with HCV, an effective amount is sufficient to
achieve
one or more of the following effects: reduce the ability of HCV to replicate,
reduce
HCV load, increase viral clearance, and increase one or more HCV specific CMI
responses. For a patient not infected with HCV, an effective amount is
sufficient to
achieve one or more of the following: an increased ability to produce one or
more
components of a HCV specific CMI response to a HCV infection, a reduced
5
CA 02718802 2011-02-16
susceptibility to HCV infection, and a reduced ability of the infecting virus
to
establish persistent infection for chronic disease.
Another aspect of the present invention features a recombinant nucleic
acid comprising an Ad6 region and a region not present in Ad6. Reference to
"recombinant" nucleic acid indicates the presence of two or more nucleic acid
regions
not naturally associated with each other. Preferably, the Ad6 recombinant
nucleic
acid contains Ad6 regions and a gene expression cassette coding for a
polypeptide
heterologous to Ad6.
Other features and advantages of the present invention are apparent
from the additional descriptions provided herein including the different
examples.
The provided examples illustrate different components and methodology useful
in
practicing the present invention. The examples do not limit the claimed
invention.
Based on the present disclosure the skilled artisan can identify and employ
other
components and methodology useful for practicing the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures IA and 1B illustrate SEQ. ID. NO. 1.
Figures 2A, 2B, 2C, and 2D illustrate SEQ. ID. NO. 2. SEQ. ID. NO.
2 provides a nucleotide sequence coding for SEQ. ID. NO. 1 along with an
optimized
internal ribosome entry site and TAAA termination. Nucleotides 1-6 provides an
optimized internal ribosome entry site. Nucleotides 7-5961 code for a HCV Met-
NS3-NS4A-NS4B-NS5A-NS5B polypeptide with nucleotides in positions 5137 to
5145 providing a AlaAlaGly sequence in amino acid positions 1711 to 1713 that
renders NS5B inactive. Nucleotides 5962-5965 provide a TAAA termination.
Figures 3A, 3B, 3C, and 3D illustrate SEQ. ID. NO. 3. SEQ. ID. NO.
3 is a codon optimized version of SEQ. ID. NO. 2. Nucleotides 7-5961 encode a
HCV Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide.
Figures 4A-4M illustrate MRKAd6-NSmut (SEQ. lD. NO. 4). SEQ.
ID. NO. 4 is an adenovector containing an expression cassette where the
polypeptide
of SEQ. ID. NO. 1 is encoded by SEQ. ID. NO. 2. Base pairs 1-450 correspond to
the
Ad5 bp 1 to 450; base pairs 462 to 1252 correspond to the human CMV promoter;
base pairs 1258 to 1267 correspond to the Kozak sequence; base pairs 1264 to
7222
correspond to the NS genes; base pairs 7231 to 7451 correspond to the BGH
polyadenylation signal; base pairs 7469 to 9506 correspond to Ad5 base pairs
3511 to
5548; base pairs 9507 to 32121 correspond to Ad6 base pairs 5542 to 28156;
base
6
CA 02718802 2011-02-16
pairs 32122 to 35117 correspond to Ad6 base pairs 30789 to 33784; and base
pairs
35118 to 37089 correspond to Ad5 base pairs 33967 to 35935.
Figures 5A-50 illustrate SEQ. ID. NOs. 5 and 6. SEQ. ID. NO. 5
encodes a HCV Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide with an active
RNA dependent RNA polymerase. SEQ. ID. NO. 6 provides the amino acid sequence
for the polypeptide.
Figures 6A-6C provide the nucleic acid sequence for pVlJnsA (SEQ.
ID. NO. 7).
Figures 7A-7N provide the nucleic acid sequence for the Ad6 genome
(SEQ. ID. NO. 8).
Figures 8A-8K provide the nucleic acid sequence for the Ad5 genome
(SEQ. ID. NO. 9).
Figure 9 illustrates different regions of the Ad6 genome. The linear
(35759 bp) ds DNA genome is indicated by two parallel lines and is divided
into 100
map units. Transcription units are shown relative to their position and
orientation in
the genome. Early genes (E1A, E1B, E2A/B, E3 and E4 are indicated by gray
arrows.
Late genes (L1 to L5) , indicated by black arrows, are produced by alternative
splicing
of a transcript produced from the major late promoter (MLP) and all contain
the
tripartite leader (1, 2, 3) at their 5' ends. The El region is located from
approximately
1.0 to 11.5 map units, the E2 region from 75.0 to 11.5 map units, E3 from 76.1
to 86.7
map units, and E4 from 99.5 to 91.2 map units. The major late transcription
unit is
located between 16.0 and 91.2 map units.
Figure 10 illustrates homologous recombination to recover pAdEl-E3+
containing Ad6 and Ad5 regions.
Figure 11 illustrates homologous recombinant to recover a pAdEl-E3+
containing Ad6 regions.
Figure 12 illustrates a western blot on whole-cell extracts from 293
cells transfected with plasmid DNA expressing different HCV NS cassettes.
Mature
NS3 and NS5A products were detected with specific antibodies. "pVlJns-NS"
refers
to a pVlJnsA plasmid where a Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide is
encoded by SEQ. ID. NO. 5, and SEQ. ID. NO. 5 is inserted between bases 1881
and
1912 of SEQ. ID. NO. 7. "pVlJns-NSmut" refers to a pVlJnsA plasmid where SEQ.
ID. NO. 2 is inserted between bases 1882 and 1925 of SEQ. ID. NO. 7. "pVlJns-
NSOPTmut" refers to a pVlJnsA plasmid where SEQ. ID. NO. 3 is inserted between
bases 1881 and 1905 of SEQ. ID. NO. 7.
7
CA 02718802 2011-02-16
Figures 13A and 13B illustrate T cell responses by IFNy ELIspot
induced in C57black6 mice (A) and BalbC mice (B) by two injections of 25p.g
and
50 g, respectively, of plasmid DNA encoding the different HCV NS cassettes
with
Gene Electro-Transfer (GET). IFNy ELIspot on splenocytes from C57black6 mice
immunized with two injections of 25 g DNA/dose with GET of plasmid vectors
expressing the different HCV NS cassettes. (A) Data are expressed as SFC/106
PBMC. (B) IFNy ELIspot on splenocytes from BalbC mice immunized with two
injections of 501.1g DNA/dose with GET of plasmid vectors expressing the
different
HCV NS cassettes. Data are expressed as SFC/106 PBMC.
Figure 14 illustrates protein expression from different adenovectors
upon infection of HeLa cells. MRKAd5-NSmut is an adenovector based on an Ad5
sequence (SEQ. ID. NO. 9), where the Ad5 genome has an El deletion of base
pairs
451 to 3510, an E3 deletion of base pairs 28134 to 30817, and has the NS3-NS4A-
NS4B-NS5A-NS5B expression cassette as provided in base pairs 451 to 7468 of
SEQ.
ID. NO. 4 inserted between positions 450 and 3511. Ad5-NS is an adenovector
based
on an Ad5 backbone with an El deletion of base pairs 342 to 3523, and E3
deletion of
base pairs 28134 to 30817 and containing an expression cassette encoding a NS3-
NS4A-NS4B-NS5A-NS5B from SEQ. ID. NO. 5. "MRKAd6-NSOPTmut" refers to
an adenovector having a modified SEQ. ID. NO. 4 sequence, wherein base pairs
1258
to 7222 of SEQ. ID. NO. 4 is replaced with SEQ. ID. NO. 3.
Figure 15 illustrates T cell responses by IFNy ELIspot induced in
C57black6 mice by two injections of 109 vp of adenovectors containing
different
HCV non-structural gene cassettes. Data are expressed as SFC/106 PBMC.
Figures 16A-16D illustrate T cell responses by IFNy ELIspot induced
in Rhesus monkeys by one or two injections of 1010 vp (A) or 1011 vp (B) of
adenovectors containing different HCV non-structural gene cassettes. Data are
expressed as SFC/106 PBMC.
Figures 17A and 17B illustrates CD8+ T cell responses by IFNy ICS
induced in Rhesus monkeys by two injections of 1010 vp (A) or 10" vp (B) of
8
CA 02718802 2011-02-16
adenovectors encoding the different HCV non-structural gene cassettes. Data
are
expressed as number of positive IFNy/CD3/CD8 per 106 lymphocytes.
Figures 18A-18F illustrate T cell responses by bulk CTL assay induced
in Rhesus monkeys by two injections of 1011 vp of Ad5-NS (A+B), MRKAd5-NSmut
(C+D), or MRKAd6-NSmut (E+F).
Figure 19 illustrates the plasmid pE2.
Figures 20A-D illustrates the partial codon optimized sequence
NSsuboptmut (SEQ. ID. NO. 10). Coding sequence for the Met-NS3-NS4A-NS4B-
NS5A-NS5B polypeptide is from base 7 to 5961.
8a
CA 02718802 2011-02-16
DETAILED DESCRIPTION OF THE INVENTION
The present invention features Ad6 vectors and nucleic acid encoding a
Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide that contains an inactive NS5B
region. Providing an inactive NS5B region supplies NS5B antigens while
reducing the
possibility of adverse side effects due to an active viral RNA polymerase.
Uses of the
featured nucleic acid include use as a vaccine component to introduce into a
cell an
HCV polypeptide that provides a broad range of antigens for generating a CMI
response against HCV, and as an intermediate for producing such a vaccine
component.
The adaptive cellular immune response can function to recognize viral
antigens in HCV infected cells throughout the body due to the ubiquitous
distribution
of major histocompatibility complex (MBC) class I and IT expression, to induce
immunological memory, and to maintain immunological memory. These functions
are attributed to antigen-specific CD4+ T helper (Th) and CD8+ cytotoxic T
cells
(CTL).
Upon activation via their specific T cell receptors, HCV specific Th
cells fulfill a variety of immunoregulatory functions, most of them mediated
by Thl
and Th2 cytokines. HCV specific Th cells assist in the activation and
differentiation
of B cells and induction and stimulation of virus-specific cytotoxic T cells.
Together
with CTL, Th cells may also secrete 1FN-y and TNF-a that inhibit replication
and
gene expression of several viruses. Additionally, Th cells and CTL, the main
effector
cells, can induce apoptosis and lysis of virus infected cells.
HCV specific CTL are generated from antigens processed by
professional antigen presenting cells (pAPCs). Antigens can be either
synthesized
within or introduced into pAPCs. Antigen synthesis in a pAPC can be brought
about
by introducing into the cell an expression cassette encoding the antigen.
A preferred route of nucleic acid vaccine administration is an
intramuscular route. Intramuscular administration appears to result in the
introduction
and expression of nucleic acid into somatic cells and pAPCs. HCV antigens
produced
in the somatic cells can be transferred to pAPCs for presentation in the
context of
MHC class I molecules. (Donnelly et al., Annu. Rev. Immunol. /5:617-648,
1997.)
pAPCs process longer length antigens into smaller peptide antigens in
the proteasome complex. The antigen is translocated into the endoplasmic
reticuluin/Golgi complex secretory pathway for association with MHC class I
9
CA 02718802 2011-02-16
proteins. CD8+ T lymphocytes recognize antigen associated with class 1 MEC via
the
T cell receptor (TCR) and the CD8 cell surface protein.
Using a nucleic acid encoding a Met-NS3-NS4A-NS4B-NS5A-NS5B
polypeptide as a vaccine component allows for production of a broad range of
antigens capable of generating CMI responses from a single vector. The
polypeptide
should be able to process itself sufficiently to produce at least a region
corresponding
to NS5B. Preferred nucleic acids encode an amino acid sequence substantially
similar
to SEQ. ID. NO. 1 that has sufficient protease activity to process itself to
produce
individual HCV polypeptides substantially similar to the NS3, NS4A, NS4B,
NS5A,
and NS5B regions present in SEQ. ID. NO. 1.
A polypeptide substantially similar to SEQ. ID. NO. 1 with sufficient
protease activity to process itself in a cell provides the cell with T cell
epitopes that
are present in several different HCV strains. Protease activity is provided by
NS3 and
NS3/NS4A proteins digesting the Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide at
the appropriate cleavage sites to release polypeptides corresponding to NS3,
NS4A,
NS4B, NS5A, and NS5B. Self- processing of the Met-NS3-NS4A-NS4B-NS5A-
NS5B generates polypeptides that approximate naturally occurring HCV
polypeptides.
Based on the guidance provided herein a sufficiently strong immune
response can be generated to achieve beneficial effects in a patient. The
provided
guidance includes information concerning HCV sequence selection, vector
selection,
vector production, combination treatment, and administration.
I. HCV SEQUENCES
A variety of different nucleic acid sequences can be used as a vaccine
component to supply a HCV Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide to a
cell or as an intermediate to produce vaccine components. The starting point
for
obtaining suitable nucleic acid sequences are preferably naturally occurring
NS3-
NS4A-NS4B-NS5A-NS5B polypeptide sequences modified to produce an inactive
NS5B.
The use of a HCV nucleic acid sequence providing HCV non-structural
antigens to generate a CMI response is mentioned by Cho et al., Vaccine
17:1136-
1144, 1999, Paliard et al., International Publication Number WO 01/30812 (not
admitted to be prior art to the claimed invention), and Coit et al.,
International
Publication Number WO 01/38360 (not admitted to be prior art to the claimed
invention). Such references fail to describe, for example, a polypeptide that
processes
CA 02718802 2011-02-16
itself to produce an inactive NS5B, and the particular combinations of HCV
sequences and delivery vehicles employed herein.
Modifications to a HCV Met-NS3-NS4A-NS4B-NS5A-NS5B
polypeptide sequence can be produced by altering the encoding nucleic acid.
Alterations can be performed to create deletions, insertions and
substitutions.
Small modifications can be made in NS5B to produce an inactive
polymerase by targeting motifs essentially for replication. Examples of motifs
critical
for NS5B activity and modifications that can be made to produce an inactive
NS5B
are described by Lohmann etal., Journal of Virology 71:8416-8426, 1997, and
Kolykhalov et al., Journal of Virology 74:2046-2051, 2000.
Additional factors to take into account when producing modifications
to a HCV Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide include maintaining the
ability to self-process and maintaining T cell antigens. The ability of the
HCV
polypeptide to process itself is determined to a large extent by a functional
NS3
protease. Modifications that maintain NS3 activity protease activity can be
obtained
by taking into account the NS3 protein, NS4A which serves as a cofactor for
NS3, and
NS3 protease recognition sites present within the NS3-NS4A-NS4B-NS5A-NS5B
polypeptide.
Different modifications can be made to naturally occurring NS3-
NS4A-NS4B-NS5A-NS5B polypeptide sequences to produce polypeptides able to
elicit a broad range of T cell responses. Factors influencing the ability of a
polypeptide to elicit a broad T cell response include the preservation or
introduction
of HCV specific T cell antigen regions and prevalence of different T cell
antigen
regions in different HCV isolates.
Numerous examples of naturally occurring HCV isolates are well
known in the art. HCV isolates can be classified into the following six major
genotypes comprising one or more subtypes: HCV-1/(1a,lb,1c), HCV-2/(2a,2b,2c),
HCV-3/(3a,3b,10a), HCV-4/(4a), HCV-5/(5a) and HCV-6/(6a,6b,7b,8b,9a,11a).
(Simmonds, J. Gen. Virol., 693-712, 2001.) Examples of particular HCV
sequences
such as HCV-BK, HCV-J, HCV-N, HCV-H, have been deposited in GenBank and
described in various publications. (See, for example, Chamberlain et al., J.
Gen.
Virol., 1341-1347, 1997.)
HCV T cell antigens can be identified by, for example, empirical
experimentation. One way of identifying T cell antigens involves generating a
series
of overlapping short peptides from a longer length polypeptide and then
screening the
11
CA 02718802 2011-02-16
T-cell populations from infected patients for positive clones. Positive clones
are
activated/primed by a particular peptide. Techniques such as IFNy-ELISPOT,
IFNy-
Intracellular staining and bulk CTL assays can be used to measure peptide
activity.
Peptides thus identified can be considered to represent T-cell epitopes of the
respective pathogen.
HCV T cell antigen regions from different HCV isolates can be
introduced into a single sequence by, for example, producing a hybrid NS3-NS4A-
NS4B-NS5A-NS5B polypeptide containing regions from two or more naturally
occurring sequences. Such a hybrid can contain additional modifications, which
preferably do not reduce the ability of the polypeptide to produce an HCV CMI
response.
The ability of a modified Met-NS3-NS4A-NS4B-NS5A-NS5B
polypeptide to process itself and produce a CMI response can be determined
using
techniques described herein or well known in the art. Such techniques include
the use
of IFNy-ELISPOT, IFNy-Intracellular staining and bulk CTL assays to measure a
HCV specific CMI response.
A. Met-NS3-NS4A-NS4B-NS5A-NS5B Sequences
SEQ. ID. NO. 1 provides a preferred Met-NS3-NS4A-NS4B-NS5A-
NS5B sequence. SEQ. ID. NO. 1 contains a large number of HCV specific T cell
antigens that are present in several different HCV isolates. SEQ. ID. NO. 1 is
similar
to the NS3-NS4A-NS4B-NS5A-NS5B portion of the HCV BK strain nucleotide
sequence (GenBank accession number M58335).
In SEQ. ID. NO. 1 anchor positions important for recognition by MEC
class I molecules are conserved or represent conservative substitutions for 18
out of
20 known T-cell epitopes in the NS3-NS4A-NS4B-NS5A-NS5B portion of HCV
polyproteins. With respect to the remaining two known T-cell epitopes, one has
a
non-conservative anchor substitution in SEQ. ID. NO. 1 that may still be
recognized
by a different HLA supertype and one epitope has one anchor residue not
conserved.
HCV T-cell epitopes are described in Chisari et al., Curr. Top. Microbiol
Immunol.,
242:299-325, 2000, and Lechner et al. J. Exp. Med. 9:1499-1512, 2000.
Differences between the HCV-BK NS3-NS4A-NS4B-NS5A-NS5B
nucleotide sequence and SEQ. ID. NO. 1 include the introduction of a
methionine at
the 5' end and the presence of modified NS5B active site residues in SEQ. ID.
NO. 1.
12
CA 02718802 2011-02-16
The modification replaces GlyAspAsp with AlaAlaGly (residues 1711-1713) to
inactivate NS5B.
The encoded HCV Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide
preferably has an amino acid sequence substantially similar to SEQ. ID. NO. 1.
In
different embodiments, the encoded HCV Met-NS3-NS4A-NS4B-NS5A-NS5B
polypeptide has an amino acid identify to SEQ. ID. NO. 1 of at least 65%, at
least
75%, at least 85%, at least 95%, at least 99% or 100%; or differs from SEQ.
ID. NO.
1 by 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, 1-
15, 1-16, 1-
17, 1-18, 1-19, or 1-20 amino acids.
Amino acid differences between a Met-NS3-NS4A-NS4B-NS5A-
NS5B polypeptide and SEQ. ID. NO. 1 are calculated by determining the minimum
number of amino acid modifications in which the two sequences differ. Amino
acid
modifications can be deletions, additions, substitutions or any combination
thereof.
Amino acid sequence identity is determined by methods well known in
the art that compare the amino acid sequence of one polypeptide to the amino
acid
sequence of a second polypeptide and generate a sequence alignment. Amino acid
identity is calculated from the alignment by counting the number of aligned
residue
pairs that have identical amino acids.
Methods for determining sequence identity include those described by
Schuler, G.D. in Bioinformatics: A Practical Guide to the Analysis of Genes
and
Proteins, Baxevanis, A.D. and Ouelette, B.F.F., eds., John Wiley & Sons, Inc,
2001;
Yona, et al., in Bioinformatics: Sequence, structure and databanks, Higgins,
D. and
Taylor, W. eds, Oxford University Press, 2000; and Bioinfonnatics: Sequence
and
Genome Analysis, Mount, D.W., ed., Cold Spring Harbor Laboratory Press, 2001).
Methods to determine amino acid sequence identity are codified in publicly
available
computer programs such as GAP (Wisconsin Package Version 10.2, Genetics
Computer Group (GCG), Madison, Wisc.), BLAST (Altschul et al., J. MoL Biol.
215(3):403-10, 1990), and FASTA (Pearson, Methods in Enzymology 183:63-98,
1990, R.F. Doolittle, ed.).
In an embodiment of the present invention sequence identity between
two polypeptides is determined using the GAP program (Wisconsin Package
Version
10.2, Genetics Computer Group (GCG), Madison, Wisc.). GAP uses the alignment
method of Needleman and Wunsch. (Needleman, et al., J. Mol. Biol. 48:443-453,
1970.) GAP considers all possible alignments and gap positions between two
sequences and creates a global alignment that maximizes the number of matched
13
CA 02718802 2011-02-16
residues and minimizes the number and size of gaps. A scoring matrix is used
to
assign values for symbol matches. In addition, a gap creation penalty and a
gap
extension penalty are required to limit the insertion of gaps into the
alignment.
Default program parameters for polypeptide comparisons using GAP are the
BLOSUM62 (Henikoff etal., Proc. Natl. Acad. Sci. USA, 89:10915-10919, 1992)
amino acid scoring matrix (MATrix=blosum62.cmp), a gap creation parameter
(GAPweight=8) and a gap extension pararameter (LENgthweight=2).
More preferred HCV Met-NS3-NS4A-NS4B-NS5A-NS5B
polypeptides in addition to being substantially similar to SEQ. lD. NO. 1
across their
entire length produce individual NS3, NS4A, NS4B, NS5A and NS5B regions that
are
substantially similar to the corresponding regions present in SEQ. ID. NO. 1.
The
corresponding regions in SEQ. ID. NO. 1 are provided as follows: Met-NS3 amino
acids 1-632; NS4A amino acids 633-686; NS4B amino acids 687-947; NS5A amino
acids 948-1394; and NS5B amino acids 1395-1985.
In different embodiments a NS3, NS4A, NS4B, NS5A and/or NS5B
region has an amino acid identity to the corresponding region in SEQ. ID. NO.
1 of at
least 65%, at least 75%, at least 85%, at least 95%, at least 99%, or 100%; or
an
amino acid difference of 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-
12, 1-13,
1-14, 1-15, 1-16,1-17, 1-18, 1-19, or 1-20 amino acids.
Amino acid modifications to SEQ. ID. NO. 1 preferably maintain all or
most of the T-cell antigen regions. Differences in naturally occurring amino
acids are
due to different amino acid side chains (R groups). An R group affects
different
properties of the amino acid such as physical size, charge, and
hydrophobicity.
Amino acids can be divided into different groups as follows: neutral and
hydrophobic
(alanine, valine, leucine, isoleucine, proline, tyrptophan, phenylalanine, and
methionine); neutral and polar (glycine, serine, threonine, tryosine,
cysteine,
asparagine, and glutamine); basic (lysine, arginine, and histidine); and
acidic (aspartic
acid and glutamic acid).
Generally, in substituting different amino acids it is preferable to
exchange amino acids having similar properties. Substituting different amino
acids
within a particular group, such as substituting valine for leucine, arginine
for lysine,
and asparagine for glutamine are good candidates for not causing a change in
polypeptide tertiary structure.
Starting with a particular amino acid sequence and the known
degeneracy of the genetic code, a large number of different encoding nucleic
acid
14
CA 02718802 2011-02-16
sequences can be obtained. The degeneracy of the genetic code arises because
almost
all amino acids are encoded by different combinations of nucleotide triplets
or
"codons". The translation of a particular codon into a particular amino acid
is well
known in the art (see, e.g., Lewin GENES IV, p. 119, Oxford University Press,
1990).
Amino acids are encoded by codons as follows:
A=Ala=Alanine: codons GCA, GCC, GCG, GCU
C=Cys=Cysteine: codons UGC, UGU
D=Asp=Aspartic acid: codons GAC, GAU
E=G1u=Glutamic acid: codons GAA, GAG
F=Phe=Phenylalanine: codons UUC, LTUU
G=Gly=Glycine: codons GGA, GGC, GGG, GGU
H=His=Histidine: codons CAC, CAU
I=Ile=Isoleucine: codons AUA, AUC, AUU
K=Lys=Lysine: codons AAA, AAG
L=Leu=Leucine: codons UUA, ULIG, CUA, CUC, CUG, CUU
M=Met=Methionine: codon AUG
N=Asn=Asparagine: codons AAC, AAU
P=Pro=Proline: codons CCA, CCC, CCG, CCU
Q=GIn=Glutamine: codons CAA, CAG
R=Arg=Arginine: codons AGA, AGG, CGA, CGC, COG, CGU
S=Set=Serine: codons AGC, AGU, UCA, UCC, UCG, UCU
T=Thr=Threonine: codons ACA, ACC, ACG, ACU
V=Val=Valine: codons GUA, GUC, GUG, GUU
W=Trp=Tryptophan: codon UGG
Y=Tyr=Tyrosine: codons UAC, UAU.
Nucleic acid sequences can be optimized in an effort to enhance
expression in a host. Factors to be considered include C:G content, preferred
codons,
and the avoidance of inhibitory secondary structure. These factors can be
combined
in different ways in an attempt to obtain nucleic acid sequences having
enhanced
expression in a particular host. (See, for example, Donnelly et al.,
International
Publication Number WO 97/47358.)
The ability of a particular sequence to have enhanced expression in a
particular host involves some empirical experimentation. Such experimentation
involves measuring expression of a prospective nucleic acid sequence and, if
needed,
altering the sequence.
CA 02718802 2011-02-16
B. Encoding Nucleotide Sequences
SEQ. ID. NOs. 2 and 3 provide two examples of nucleotide sequences
encoding a Met-NS3-NS4A-NS4B-NS5A-NS5B sequence. The coding sequence of
SEQ. ID. NO. 2 is similar (99.4% nucleotide sequence identity) to the NS3-NS4A-
NS4B-NS5A-NS5B region of the naturally occurring HCV-BK sequence (GenBank
accession number M58335). SEQ. ID. NO. 3 is a codon-optimized version of SEQ.
ID. NO. 2. SEQ. ID. NOs. 2 and 3 have a nucleotide sequence identity of 78.3%.
Differences between the HCV-BK NS3-NS4A-NS4B-NS5A-NS5B
nucleotide (GenBank accession number M58335) and SEQ. ID. NO. 2, include SEQ.
ID. NO. 2 having a ribosome binding site, an ATG methionine codon, a region
coding
for a modified NS5B catalytic domain, a TAAA stop signal and an additional 30
nucleotide differences. The modified catalytic domain codes for a AlaAlaGly
(residues 1711-1713) instead of GlyAspAsp to inactivate NS5B.
A nucleotide sequence encoding a HCV Met-NS3-NS4A-NS4B-
NS5A-NS5B polypeptide is preferably substantially similar to the SEQ. ID. NO.
2
coding region. In different embodiments, the nucleotide sequence encoding a
HCV
Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide has a nucleotide sequence identify
to the SEQ. ID. NO. 2 coding region of at least 65%, at least 75%, at least
85%, at
least 95%, at least 99%, or 100%; or differs from SEQ. ID. NO. 2 by 1-2, 1-3,
1-4, 1-
5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, 1-15, 1-16, 1-17, 1-18, 1-
19, 1-20,
1-25, 1-30, 1-35, 1-40, 1-45, or 1-50 nucleotides.
Nucleotide differences between a sequence coding Met-NS3-NS4A-
NS4B-NS5A-NS5B and the SEQ. ID. NO. 2 coding region are calculated by
determining the minimum number of nucleotide modifications in which the two
sequences differ. Nucleotide modifications can be deletions, additions,
substitutions
or any combination thereof.
Nucleotide sequence identity is determined by methods well known in
the art that compare the nucleotide sequence of one sequence to the nucleotide
sequence of a second sequence and generate a sequence alignment. Sequence
identity
is determined from the alignment by counting the number of aligned positions
having
identical nucleotides.
Methods for determining nucleotide sequence identity between two
polynucleotides include those described by Schuler, in Bioinformatics: A
Practical
Guide to the Analysis of Genes and Proteins, Baxevanis, A.D. and Ouelette,
B.F.F.,
16
CA 02718802 2011-02-16
eds., John Wiley & Sons, Inc, 2001; Yona et al.,. in Bioinformatics: Sequence,
structure and databanks, Higgins, D. and Taylor, W. eds, Oxford University
Press,
2000; and Bioinfonnatics: Sequence and Genome Analysis, Mount, D.W., ed., Cold
Spring Harbor Laboratory Press, 2001). Methods to determine nucleotide
sequence
identity are codified in publicly available computer programs such as GAP
(Wisconsin Package Version 10.2, Genetics Computer Group (GCG), Madison,
Wisc.), BLAST (Altschul et al., J. Mot. Biol. 21.5(3):403-10, 1990), and FASTA
(Pearson, W.R., Methods in Enzymology /83:63-98, 1990, R.F. Doolittle, ed.).
In an embodiment of the present ivnention, sequence identity between
two polynucleotides is determined by application of GAP (Wisconsin Package
Version 10.2, Genetics Computer Group (GCG), Madison, Wisc.). GAP uses the
alignment method of Needleman and Wunsch. (Needleman et al., J. Mol. Biol.
48:443-453, 1970.) GAP considers all possible alignments and gap positions
between
two sequences and creates a global alignment that maximizes the number of
matched
residues and minimizes the number and size of gaps. A scoring matrix is used
to
assign values for symbol matches. In addition, a gap creation penalty and a
gap
extension penalty are required to limit the insertion of gaps into the
alignment.
Default program parameters for polynucleotide comparisons using GAP are the
nwsgapdna.cmp scoring matrix (MATrix=nwsgapdna.cmp), a gap creation parameter
(GAPweight=50) and a gap extension pararameter (LENgthweight=3).
More preferred HCV Met-NS3-NS4A-NS4B-NS5A-NS5B nucleotide
sequences in addition to being substantially similar across its entire length,
produce
individual NS3, NS4A, NS4B, NS5A and NS5B regions that are substantially
similar
to the corresponding regions present in SEQ. ID. NO. 2. The corresponding
coding
regions in SEQ. ID. NO. 2 are provided as follows: Met-NS3, nucleotides 7-
1902;
NS4A nucleotides 1903-2064; NS4B nucleotides 2065-2847; NS5A nucleotides
2848-4188: NS5B nucleotides 4189-5661.
In different embodiments a NS3, NS4A, NS4B, NS5A and/or NS5B
encoding region has a nucleotide sequence identity to the corresponding region
in
SEQ. ID. NO. 2 of at least 65%, at least 75%, at least 85%, at least 95%, at
least 99%
or 100%; or a nucleotide difference to SEQ. ID. NO. 2 of 1-2, 1-3, 1-4, 1-5, 1-
6, 1-7,
1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, 1-15, 1-16, 1-17, 1-18, 1-19, 1-20, 1-
25, 1-30,
1-35, 1-40, 1-45, or 1-50 nucleotides.
17
CA 02718802 2011-02-16
C. Gene Expression Cassettes
A gene expression cassette contains elements needed for polypeptide
expression. Reference to "polypeptide" does not provide a size limitation and
includes protein. Regulatory elements present in a gene expression cassette
generally
include: (a) a promoter transcriptionally coupled to a nucleotide sequence
encoding
the polypeptide, (b) a 5' ribosome binding site functionally coupled to the
nucleotide
sequence, (c) a terminator joined to the 3' end of the nucleotide sequence,
and (d) a 3'
polyadenylation signal functionally coupled to the nucleotide sequence.
Additional
regulatory elements useful for enhancing or regulating gene expression or
polypeptide
processing may also be present.
Promoters are genetic elements that are recognized by an RNA
polymerase and mediate transcription of downstream regions. Preferred
promoters
are strong promoters that provide for increased levels of transcription.
Examples of
strong promoters are the immediate early human cytomegalovirus promoter (CMV),
and CMV with intron A. (Chapman eta!, Nucl. Acids Res. 19:3979-3986, 1991.)
Additional examples of promoters include naturally occurring promoters such as
the
EF1 alpha promoter, the murine CMV promoter, Rous sarcoma virus promoter, and
SV40 early/late promoters and the 13-actin promoter; and artificial promoters
such as a
synthetic muscle specific promoter and a chimeric muscle-specific/CMV promoter
(Li
et al., Nat. Biotechnol. /7:241-245, 1999, Hagstrom etal., Blood 95:2536-2542,
2000).
The ribosome binding site is located at or near the initiation codon.
Examples of preferred ribosome binding sites include CCACCAUGG,
CCGCCAUGG, and ACCAUGG, where AUG is the initiation codon. (Kozak, Cell
44:283-292, 1986). Another example of a ribosome binding site is GCCACCAUGG
(SEQ. ID. NO. 12).
The polyadenylation signal is responsible for cleaving the transcribed
RNA and the addition of a poly (A) tail to the RNA. The polyadenylation signal
in
higher eukaryotes contains an AAUAAA sequence about 11-30 nucleotides from the
polyadenylation addition site. The AAUAAA sequence is involved in signaling
RNA
cleavage. (Lewin, Genes IV, Oxford University Press, NY, 1990.) The poly (A)
tail
is important for the mRNA processing.
Polyadenylation signals that can be used as part of a gene expression
cassette include the minimal rabbit 13 -globin polyadenylation signal and the
bovine
growth hormone polyadenylation (BGH). (Xu et al., Gene 272:149-156, 2001, Post
et
18
CA 02718802 2011-02-16
al., U.S. Patent U. S. 5,122,458.) Additional examples include the Synthetic
Polyadenylation Signal (SPA) and SV40 polyadenylation signal. The SPA sequence
is as follows: AAUAAAAGAUCUUUAUUUUCAUUAGAUCUGUGUG
UUGGUUUUUUGUGUG (SEQ. ID. NO. 13).
Examples of additional regulatory elements useful for enhancing or
regulating gene expression or polypeptide processing that may be present
include an
enhancer, a leader sequence and an operator. An enhancer region increases
transcription. Examples of enhancer regions include the CMV enhancer and the
SV40 enhancer. (Hitt et al., Methods in Molecular Genetics 7:13-30, 1995, Xu,
etal.,
.. Gene 272:149-156, 2001.) An enhancer region can be associated with a
promoter.
A leader sequence is an amino acid region on a polypeptide that directs
the polypeptide into the proteasome. Nucleic acid encoding the leader sequence
is 5'
of a structural gene and is transcribed along the structural gene. An example
of a
leader sequences is tPA.
An operator sequence can be used to regulate gene expression. For
example, the Tet operator sequence can be used to repress gene expression.
IEL THERAPEUTIC VECTORS
Nucleic acid encoding a Met-NS3-NS4A-NS4B-NS5A-NS5B
polypeptide can be introduced into a patient using vectors suitable for
therapeutic
administration. Suitable vectors can deliver nucleic acid into a target cell
without
causing an unacceptable side effect.
Cellular expression is achieved using a gene expression cassette
encoding a Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide. The gene expression
.. cassette contains regulatory elements for producing and processing a
sufficient
amount of nucleic acid inside a target cell to achieve a beneficial effect.
Examples of vectors that can be used for therapeutic applications
include first and second generation adenovectors, helper dependent
adenovectors,
adeno-associated viral vectors, retroviral vectors, alpha virus vectors,
Venezuelan
.. Equine Encephalitis virus vector, and plasmid vectors. (Hitt, et al.,
Advances in
Pharmacology 40:137-206, 1997, Johnston et al., U.S. Patent No. 6,156,588, and
Johnston et al., International Publication Number WO 95/32733) Preferred
vectors
for introducing a Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide into a subject are
first generation adenoviral vectors and plasmid DNA vectors.
19
CA 02718802 2011-02-16
=
A. First Generation Adenovectors
First generation adenovector for expressing a gene expression cassette
contain the expression cassette in an El and optionally E3 deleted recombinant
adenovirus genome. The deletion in the El region is sufficiently large to
remove
= 5 elements needed for adenoviral replication.
First generation adenovectors for expressing a Met-NS3-NS4A-NS4B-
NS5A-NS5B polypeptide contain a El and E3 deleted recombinant adenovirus
genome. The deletion in the El region is sufficiently large to remove elements
needed for adenoviral replication. The combinations of deletions of the El and
E3
regions are sufficiently large to accommodate a gene expression cassette
encoding a
Met-NS3-NS4A-NS4B-NS5A-NS5B polypeptide.
The adenovirus has a double-stranded linear genome with inverted
terminal repeats at both ends. During viral replication, the genome is
packaged inside
a viral capsid to form a virion. The virus enters its target cell through
viral attachment
followed by internalization. (Hitt et al., Advances in Pharmacology 40:137-
206,
1997.)
Adenovectors can be based on different adenovirus serotypes such as
those found in humans or animals. Examples of animal adenoviruses include
bovine,
porcine, chimp, murine, canine, and avian (CELO). Preferred adenovectors are
based
on human serotypes, more preferably Group B, C, or D serotypes. Examples of
human adenovirus Group B, C, D, or E serotypes include types 2 ("Ad2"), 4
("Ad4"),
5 ("Ad5"), 6 ("Ad6"), 24 ("Ad24"), 26 ("Ad26"), 34 ("Ad34") and 35 ("Ad35").
Adenovectors can contain regions from a single adenovirus or from two or more
adenovirus.
In different embodiments adenovectors are based on Ad5, Ad6, or a
combination thereof. Ad5 is described by Chroboczek, et al., J. Virology
186:280-
285, 1992. Ad6 is described in Figures 7A-7N. An Ad6 based vector containing
Ad5 regions is described in the Example section provided below.
Adenovectors do not need to have their El and E3 regions completely
removed. Rather, a sufficient amount the El region is removed to render the
vector
replication incompetent in the absence of the El proteins being supplied in
trans; and
the El deletion or the combination of the El and E3 deletions are sufficiently
large
enough to accommodate a gene expression cassette.
El deletions can be obtained starting at about base pair 342 going up to
about base pair 3523 of Ad5, or a corresponding region from other
adenoviruses.
CA 02718802 2011-02-16
Preferably, the deleted region involves removing a region from about base pair
450 to
about base pair 3511 of Ad5, or a corresponding region from other
adenoviruses.
Larger El region deletions starting at about base pair 341 removes elements
that
facilitate virus packaging.
E3 deletions can be obtained starting at about base pair 27865 to about
base pair 30995 of Ad5, or the corresponding region of other adenovectors.
Preferably the deletion region involves removing a region from about base pair
28134
up to about base pair 30817 of Ad5, or the corresponding region of other
adenovectors.
The combination of deletions to the El region and optionally the E3
region should be sufficiently large so that the overall size of the
recombinant genome
containing the gene expression cassette does not exceed about 105% of the wild
type
adenovirus genome. For example, as recombinant adenovirus Ad5 genomes increase
size above about 105% the genome becomes unstable. (Bett et al., Journal of
Virology 67:5911-5921, 1993.)
Preferably, the size of the recombinant adenovirus genome containing
the gene expression cassette is about 85% to about 105% the size of the wild
type
adenovirus genome. In different embodiments, the size of the recombinant
adenovirus genome containing the expression cassette is about 100% to about
105.2%, or about 100%, the size of the wild type genome.
Approximately 7,500 kb can be inserted into an adenovirus genome
with a El and E3 deletion. Without any deletion, the Ad5 genome is 35,935 base
pairs and the Ad6 genome is 35,759 base pairs.
Replication of first generation adenovectors can be performed by
supplying the El gene products in trans. The El gene product can be supplied
in
trans, for example, by using cell lines that have been transformed with the
adenovirus
El region. Examples of cells and cells lines transformed with the adenovirus
El
region are HEK 293 cells, 911 cells, PERC.6Tm cells, and transfected primary
human
aminocytes cells. (Graham etal., Journal of Virology 36:59-72, 1977, Schiedner
et
al., Human Gene Therapy //:2105-2116, 2000, Fallaux et al., Human Gene Therapy
9:1909-1917, 1998, Bout et al., U.S. Patent No. 6,033,908.)
A Met-NS3-NS4A-NS4B-NS5A-NS5B expression cassette should be
inserted into a recombinant adenovirus genome in the region corresponding to
the
deleted El region or the deleted E3 region. The expression cassette can have a
parallel or anti-parallel orientation. In a parallel orientation the
transcription direction
21
CA 02718802 2011-02-16
of the inserted gene is the same direction as the deleted El or E3 gene. In an
anti-
parallel orientation transcription the opposite strand serves as a template
and the
transcription direction is in the opposite direction.
In an embodiment of the present invention the adenovector has a gene
expression cassette inserted in the El deleted region. The vector contains:
a) a first adenovirus region from about base pair 1 to about base
pair 450 corresponding to either Ad5 or Ad6;
b) a gene expression cassette in a El parallel or El anti-parallel
orientation joined to the first region;
c) a second adenovirus region from about base pair 3511 to about
base pair 5548 corresponding to Ad5 or from about base pair 3508 to about base
pair
5541 corresponding to Ad6, joined to the expression cassette;
d) a third adenovirus region from about base pair 5549 to about
base pair 28133 corresponding to Ad5 or from about base pair 5542 to about
base pair
28156 corresponding to Ad6, joined to the second region;
e) a fourth adenovirus region from about base pair 30818 to about
base pair 33966 corresponding to Ad5 or from about base pair 30789 to about
base
pair 33784 corresponding to Ad6, joined to the third region; and
a fifth adenovirus region from about base pair 33967 to about
base pair 35935 corresponding to Ad5 or from about base pair 33785 to about
base
pair 35759 corresponding to Ad6 joined to the fourth region.
In another embodiment of the present invention the adenovector has an
expression cassette inserted in the E3 deleted region. The vector contains:
a) a first adenovirus region from about base pair 1 to about base
pair 450 corresponding to either Ad5 or Ad6;
b) a second adenovirus region from about base pair 3511 to about
base pair 5548 corresponding to Ad5 or from about base pair 3508 to about base
pair
5541 corresponding to Ad6, joined to the first region;
c) a third adenovirus region from about base pair 5549 to about
base pair 28133 corresponding to Ad5 or from about base pair 5542 to about
base pair
28156 corresponding to Ad6, joined to the second region;
d) a gene expression cassette in a E3 parallel or E3 anti-parallel
orientation joined to the third region;
22
CA 02718802 2011-02-16
e) a fourth adenovirus region from about base pair 30818 to
about
base pair 33966 corresponding to Ad5 or from about base pair 30789 to about
base
pair 33784 corresponding to Ad6, joined to the gene expression cassette; and
0 a fifth adenovirus region from about base pair 33967 to
about
base pair 35935 corresponding to Ad5 or from about base pair 33785 to about
base
pair 35759 corresponding to Ad6, joined to the fourth region.
In preferred different embodiments concerning adenovirus regions that
are present: (1) the first, second, third, fourth, and fifth region
corresponds to Ad5; (2)
the first, second, third, fourth, and fifth region corresponds to Ad6; and (3)
the first
region corresponds to Ad5, the second region corresponds to Ad5, the third
region
corresponds to Ad6, the fourth region corresponds to Ad6, and the fifth region
corresponds to Ad5.
B. DNA Plasmid Vectors
DNA vaccine plasmid vectors contain a gene expression cassette along
with elements facilitating replication and preferably vector selection.
Preferred
elements provide for replication in non-mammalian cells and a selectable
marker.
The vectors should not contain elements providing for replication in human
cells or
for integration into human nucleic acid.
The selectable marker facilitates selection of nucleic acids containing
the marker. Preferred selectable markers are those that confer antibiotic
resistance.
Examples of antibiotic selection genes include nucleic acid encoding
resistance to
ampicillin, neomycin, and kanamycin.
Suitable DNA vaccine vectors can be produced starting with a plasmid
containing a bacterial origin of replication and a selectable marker. Examples
of
bacterial origins of replication providing for higher yields include the ColE1
plasmid-
derived bacterial origin of replication. (Donnelly et al., Annu. Rev. Immunol.
15:617 -
648, 1997.)
The presence of the bacterial origin of replication and selectable
marker allows for the production of the DNA vector in a bacterial strain such
as E.
coll. The selectable marker is used to eliminate bacteria not containing the
DNA
vector.
23
CA 02718802 2011-02-16
AD6 RECOMBINANT NUCLEIC ACID
Ad6 recombinant nucleic acid comprises an Ad6 region substantially
similar to an Ad6 region found in SEQ. ID. NO. 8, and a region not present in
Ad6
nucleic acid. Recombinant nucleic acid comprising Ad6 regions have different
uses
such as in producing different Ad6 regions, as intermediates in the production
of Ad6
based vectors, and as a vector for delivering a recombinant gene.
As depicted in Figure 9, the genomic organization of Ad6 is very
similar to the genomic organization of Ad5. The homology between Ad5 and Ad6
is
approximately 98%.
In different embodiments, the Ad6 recombinant nucleic acid comprises
a nucleotide region substantially similar to ElA, ElB, E2B, E2A, E3, E4, Ll,
L2, L3,
or L4, or any combination thereof. A substantially similar nucleic acid region
to an
Ad6 region has a nucleotide sequence identity of at least 65%, at least 75%,
at least
85%, at least 95%, at least 99% or 100%; or a nucleotide difference of 1-2, 1-
3, 1-4,
1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, 1-15, 1-16, 1-17, 1-18,
1-19, 1-20,
1-25, 1-30, 1-35, 1-40, 1-45, or 1-50 nucleotides. Techniques and embodiments
for
determining substantially similar nucleic acid sequences are described in
Section I.B.
supra.
Preferably, the recombinant Ad6 nucleic acid contains an expression
cassette coding for a polypeptide not found in Ad6. Examples of expression
cassettes
include those coding for HCV regions and those coding for other types of
polypepti des.
Different types of adenoviral vectors can be produced incorporating
different amounts of Ad6, such as first and second generation adenovectors. As
noted
in Section H.A. supra. first generation adenovectors are defective in El and
can
replicate when El is supplied in trans.
Second generation adenovectors contain less adenoviral genome than
first generation vectors and can be used in conjugation with complementing
cell lines
and/or helper vectors supplying adenoviral proteins. Second generation
adenovectors
are described in different references such as Russell, Journal of General
Virology
8/:2573-2604, 2000; Hitt et al., 1997, Human Ad vectors for Gene Transfer,
Advances in Pharmacology, Vol 40 Academic Press.
In an embodiment of the present invention, the Ad6 recombinant
nucleic acid is an adenovirus vector defective in El that is able to replicate
when El is
24
CA 02718802 2011-02-16
supplied in trans. Expression cassettes can be inserted into a deleted El
region and/or
a deleted E3 region.
An example of an Ad6 based adenoviral vector with an expression
cassette provided in a deleted El region comprises or consists of:
a) a first adenovirus region from about base pair 1 to about base
pair 450 corresponding to either Ad5 or Ad6;
b) a gene expression cassette in a El parallel or El anti-parallel
orientation joined to the first region;
c) a second adenovirus region from about base pair 3511 to about
base pair 5548 corresponding to Ad5 or from about base pair 3508 to about base
pair
5541 corresponding to Ad6, joined to the expression cassette;
d) a third adenovirus region from about base pair 5549 to about
base pair 28133 corresponding to Ad5 or from about base pair 5542 to about
base pair
28156 corresponding to Ad6, joined to the second region;
e) an optionally present fourth region from about base pair 28134
to about base pair 30817 corresponding to Ad5, or from about base pair 28157
to
about base pair 30788 corresponding to Ad6, joined to the third region;
0 a fifth adenovirus region from about base pair 30818 to
about
base pair 33966 corresponding to Ad5 or from about base pair 30789 to about
base
pair 33784 corresponding to Ad6, wherein the fifth region is joined to the
fourth
region if the fourth region is present, or the fifth is joined to the third
region if the
fourth region is not present; and
a sixth adenovirus region from about base pair 33967 to about
base pair 35935 corresponding to Ad5 or from about base pair 33785 to about
base
pair 35759 corresponding to Ad6, joined to the fifth region;
wherein at least one Ad6 region is present.
In different embodiments of the invention, all of the regions are from
Ad6; all of the regions expect for the first and second are from Ad6; and 1,
2, 3, or 4
regions selected from the second, third, fourth, and fifth regions are from
Ad6.
An example of an Ad6 based adenoviral vector with an expression
cassette provided in a deleted E3 region comprises or consists of:
a) a first adenovirus region from about base pair 1 to
about base
pair 450 corresponding to either Ad5 or Ad6;
CA 02718802 2011-02-16
b) a second adenovirus region from about base pair 3511 to about
base pair 5548 corresponding to Ad5 or from about base pair 3508 to about base
pair
5541 corresponding to Ad6, joined to the first region;
c) a third adenovirus region from about base pair 5549 to about
base pair 28133 corresponding to Ad5 or from about base pair 5542 to about
base pair
28156 corresponding to Ad6, joined to the second region;
d) a gene expression cassette in a E3 parallel or E3 anti-parallel
orientation joined to the third region;
e) a fourth adenovirus region from about base pair 30818 to about
base pair 33966 corresponding to Ad5 or from about base pair 30789 to about
base
pair 33784 corresponding to Ad6, joined to the gene expression cassette; and
0 a fifth adenovirus region from about base pair 33967 to
about
base pair 35935 corresponding to Ad5 or from about base pair 33785 to about
base
pair 35759 corresponding to Ad6, joined to the fourth region;
wherein at least one Ad6 region is present.
In different embodiment of the invention, all of the regions are from
Ad6; all of the regions expect for the first and second are from Ad6; and 1,
2, 3, or 4
regions selected from the second, third, fourth and fifth regions are from
Ad6.
IV. VECTOR PRODUCTION
Vectors can be produced using recombinant nucleic acid techniques
such as those involving the use of restriction enzymes, nucleic acid ligation,
and
homologous recombination. Recombinant nucleic acid techniques are well known
in
the art. (Ausubel, Current Protocols in Molecular Biology, John Wiley, 1987-
1998,
and Sambrook et al., Molecular Cloning, A Laboratory Manual, 2" Edition, Cold
Spring Harbor Laboratory Press, 1989.)
Intermediate vectors are used to derive a therapeutic vector or to
transfer an expression cassette or portion thereof from one vector to another
vector.
Examples of intermediate vectors include adenovirus genome plasmids and
shuttle
vectors.
Useful elements in an intermediate vector include an origin of
replication, a selectable marker, homologous recombination regions, and
convenient
restriction sites. Convenient restriction sites can be used to facilitate
cloning or release
of a nucleic acid sequence.
26
CA 02718802 2011-02-16
Homologous recombination regions provide nucleic acid sequence
regions that are homologous to a target region in another nucleic acid
molecule. The
homologous regions flank the nucleic acid sequence that is being inserted into
the
target region. In different embodiments homologous regions are preferably
about 150
to 600 nucleotides in length, or about 100 to 500 nucleotides in length.
An embodiment of the present invention describes a shuttle vector
containing a Met-NS3-NS4A-NS4B-NS5A-NS5B expression cassette, a selectable
marker, a bacterial origin of replication, a first adenovirus homology region
and a
second adenovirus homologous region that target the expression cassette to
insert in
or replace an El region. The first and second homology regions flank the
expression
cassette. The first homology region contains at least about 100 base pairs
substantially homologous to at least the right end (3' end) of a wild-type
adenovirus
region from about base pairs 4-450. The second homology contains at least
about 100
base pairs substantially homologous to at least the left end (5' end) of Ad5
from about
base pairs 3511-5792, or the corresponding region from another adenovirus.
Reference to "substantially homologous" indicates a sufficient degree
of homology to specifically recombine with a target region. In different
embodiments
substantially homologous refers to at least 85%, at least 95%, or 100%
sequence
identity. Sequence identity can be calculated as described in Section I.B.
supra.
One method of producing adenovectors is through the creation of an
adenovirus genome plasmid containing an expression cassette. The pre-
Adenovirus
plasmid contains all the adenovirus sequences needed for replication in the
desired
complimenting cell line. The pre-Adenovirus plasmid is then digested with a
restriction enzyme to release the viral ITR's and transfected into the
complementing
cell line for virus rescue. The ITR's must be released from plasmid sequences
to
allow replication to occur. Adenovector rescue results in the production on an
adenovector containing the expression cassette.
A. Adenovirus Genome Plasmids
Adenovirus genome plasmids contain an adenovector sequence inside
a longer-length plasmid (which may be a cosmid). The longer-length plasmid may
contain additional elements such as those facilitating growth and selection in
eukaryotic or bacterial cells depending upon the procedures employed to
produce and
maintain the plasmid. Techniques for producing adenovirus genome plasmids
include
those involving the use of shuttle vectors and homologous recombination, and
those
27
CA 02718802 2011-02-16
involving the insertion of a gene expression cassette into an adenovirus
cosmid. (Hitt
et al., Methods in Molecular Genetics 7:13-30, 1995, Danthinne et al., Gene
Therapy
7:1707-1714, 2000.)
Adenovirus genome plasmids preferably have a gene expression
cassette inserted into a El or E3 deleted region. In an embodiment of the
present
invention, the adenovirus genome plasrnid contains a gene expression cassette
inserted in the El deleted region, an origin of replication, a selectable
marker, and the
recombinant adenovirus region is made up of:
a) a first adenovirus region from about base pair 1 to about base
450 corresponding to either Ad5 or Ad6;
b) a gene expression cassette in a El parallel or El anti-parallel
orientation joined to the first region;
c) a second adenovirus region from about base pair 3511 to about
base pair 5548 corresponding to Ad5 or from about base pair 3508 to about base
pair
5541 corresponding to Ad6, joined to the expression cassette;
d) a third adenovirus region from about base pair 5549 to about
base pair 28133 corresponding to Ad5 or from about base pair 5542 to about
base pair
28156 corresponding to Ad6, joined to the second region;
e) a fourth adenovirus region from about base pair 30818 to about
base pair 33966 corresponding to Ad5 or from about base pair 30789 to about
base
pair 33784 corresponding to Ad6, joined to the third region;
0 a fifth adenovirus region from about base pair 33967 to
about
base pair 35935 corresponding to Ad5 or from about base pair 33785 to about
base
pair 35759 corresponding to Ad6, joined to the fourth region, and
an optionally present E3 region corresponding to all or part of
the E3 region present in Ad5 or Ad6, which may be present for smaller inserts
taking
into account the overall size of the desired adenovector.
In another embodiment of the present invention the recombinant
adenovirus genome plasmid has the gene expression cassette inserted in the E3
deleted region. The vector contains an origin of replication, a selectable
marker, and
the following:
a) a first adenovirus region from about base pair 1 to
about base
pair 450 corresponding to either Ad5 or Ad6;
28
CA 02718802 2011-02-16
b) a second adenovirus region from about base pair 3511 to about
base pair 5548 corresponding to Ad5 or from about base pair 3508 to about base
pair
5541 corresponding to Ad6, joined to the expression cassette;
c) a third adenovirus region from about base pair 5549 to about
base pair 28133 corresponding to Ad5 or from about base pair 5542 to about
base pair
28156 corresponding to Ad6, joined to the second region;
d) the gene expression cassette in a E3 parallel or E3 anti-parallel
orientation joined to the third region;
e) a fourth adenovirus region from about base pair 30818 to about
base pair 33966 corresponding to Ad5 or from about base pair 30789 to about
base
pair 33784 corresponding to Ad6, joined to the gene expression cassette; and
a fifth adenovirus region from about base pair 33967 to about
base pair 35935 corresponding to Ad5 or from about base pair 33785 to about
base
pair 35759 corresponding to Ad6, joined to the fourth region.
In different embodiments concerning adenovirus regions that are
present: (1) the first, second, third, fourth, and fifth region corresponds to
Ad5; (2) the
first, second, third, fourth, and fifth region corresponds to Ad6; and (3) the
first region
corresponds to Ad5, the second region corresponds to Ad5, the third region
corresponds to Ad6, the fourth region corresponds to Ad6, and the fifth region
corresponds to Ad5.
An embodiment of the present invention describes a method of making
an adenovector involving a homologous recombination step to produce a
adenovirus
genome plasmid and an adenovirus rescue step. The homologous recombination
step
involves the use of a shuttle vector containing a Met-NS3-NS4A-NS4B-NS5A-NS5B
expression cassette flanked by adenovirus homology regions. The adenovirus
homology regions target the expression cassette into either the El or E3
deleted
region.
In an embodiment of the present invention concerning the production
of an adenovirus genome plasmid, the gene expression cassette is inserted into
a
vector comprising: a first adenovirus region from about base pair 1 to about
base pair
450 corresponding to either Ad5 or Ad6; a second adenovirus region from about
base
pair 3511 to about base pair 5548 corresponding to Ad5 or from about base pair
3508
to about base pair 5541 corresponding to Ad6, joined to the second region; a
third
adenovirus region from about base pair 5549 to about base pair 28133
corresponding
to Ad5 or from about base pair 5542 to about base pair 28156 corresponding to
Ad6,
29
CA 02718802 2011-02-16
joined to the second region; a fourth adenovirus region from about base pair
30818 to
about base pair 33966 corresponding to Ad5 or from about base pair 30789 to
about
base pair 33784 corresponding to Ad6, joined to the third region; and a fifth
adenovirus region from about 33967 to about 35935 corresponding to Ad5 or from
about base pair 33785 to about base pair 35759 corresponding to Ad6, joined to
the
fourth region. The adenovirus genome plasmid should contain an origin of
replication
and a selectable marker, and may contain all or part of the Ad5 or Ad6 E3
region.
In different embodiments concerning adenovirus regions that are
present: (1) the first, second, third, fourth, and fifth region corresponds to
Ad5; (2) the
first, second, third, fourth, and fifth region corresponds to Ad6; and (3) the
first region
corresponds to Ad5, the second region corresponds to Ad5, the third region
corresponds to Ad6, the fourth region corresponds to Ad6, and the fifth region
corresponds to Ad5.
B. Adenovector Rescue
An adenovector can be rescued from a recombinant adenovirus
genome plasmid using techniques known in the art or described herein. Examples
of
techniques for adenovirus rescue well known in the art are provided by Hitt et
al.,
Methods in Molecular Genetics 7:13-30, 1995, and Danthinne et al., Gene
Therapy
7:1707-1714, 2000.
A preferred method of rescuing an adenovector described herein
involves boosting adenoviral replication. Boosting adenoviral replication can
be
performed, for example, by supplying adenoviral functions such as E2 proteins
(polymerase, pre-terminal protein and DNA binding protein) as well as E4 orf6
on a
separate plasmid. Example 10 infra. illustrates the boosting of adenoviral
replication
to rescue an adenovector containing a codon optimized Met-NS3-NS4A-NS4B-
NS5A-NS5B expression cassette.
V. PARTIAL-OPITIMIZED HCV ENCODING SEO'UENCES
Partial optimization of HCV polyprotein encoding nucleic acid
provides for a lesser amount of codons optimized for expression in a human
than
complete optimization. The overall objective is to provide the benefits of
increased
expression due to codon optimization, while facilitating the production of an
adenovector containing HCV polyprotein encoding nucleic acid having optimized
codons.
CA 02718802 2011-02-16
Complete optimization of an HCV polyprotein encoding sequence
provides the most frequently observed human codon for each amino acid.
Complete
optimization can be performed using codon frequency tables well known in the
art
and using programs such as the BACKTRANSLATE program (Wisconsin Package
version 10, Genetics Computer Group, GCG, Madison, Wisc.).
Partial optimization can be preformed on an entire HCV polyprotein
encoding sequence that is present (e.g., NS3-NS5B), or one or more local
regions that are
present. In different embodiments the GC content for the entire HCV encoded
polyprotein
that is present is no greater than at least about 65%; and the GC content for
one or more
local regions is no greater than about 70%.
Local regions are regions present in HCV encoding nucleic acid, and can
vary in size. For example, local regions can be about 60, about 70, about 80,
about 90 or
about 100 nucleotides in length.
Partial optimization can be achieved by initially constructing an HCV
encoding polyprotein sequence to be partially optimized based on a naturally
ocurring
sequence. Alternatively, an optimized HCV encoding sequence can be used as
basis of
comparison to produce a partial optimized sequence.
VI. HCV COMBINATION TREATMENT
The HCV Met-NS3-NS4A-NS4B-NS5A-NS5B vaccine can be used by
itself to treat a patient, can be used in conjunction with other HCV
therapeutics, and
can be used with agents targeting other types of diseases. Additional
therapeutics
include additional therapeutic agents to treat HCV and diseases having a high
prevalence in HCV infected persons. Agents targeting other types of disease
include
vaccines directed against HIV and HBV.
Additional therapeutics for treating HCV include vaccines and non-
vaccine agents. (Zein, Expert Opin. Investig. Drugs 10:1457-1469, 2001.)
Examples
of additional HCV vaccines include vaccines designed to elicit an immune
response
against an HCV core antigen and the HCV El, E2 or p7 region. Vaccine
components
can be naturally occurring HCV polypeptides, HCV mimotope polypeptides or
nucleic
acid encoding such polypeptides.
HCV mimotope polypeptides contain HCV epitopes, but have a
different sequence than a naturally occurring HCV antigen. A HCV mimotope can
be
fused to a naturally occurring HCV antigen. References describing techniques
for
producing mimotopes in general and-describing-different HCV mimotopes are
31
CA 02718802 2011-02-16
provided in Felici et al. U.S. Patent No. 5,994,083 and Nicosia et al.,
International
Application Number WO 99/60132.
VII. PHARMACEUTICAL ADMINISTRATION
HCV vaccines can be formulated and administered to a patient using
the guidance provided herein along with techniques well known in the art.
Guidelines
for pharmaceutical administration in general are provided in, for example,
Modern
Vaccinology, Ed. Kurstak, Plenum Med. Co. 1994; Remington's Pharmaceutical
Sciences 18" Edition, Ed. Gennaro, Mack Publishing, 1990; and Modern
Pharmaceutics 2nd Edition, Eds. Banker and Rhodes, Marcel Dekker, Inc., 1990.
HCV vaccines can be administered by different routes such
intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal,
impression
through the skin, or nasal. A preferred route is intramuscular.
Intramuscular administration can be preformed using different
techniques such as by injection with or without one or more electric pulses.
Electric
mediated transfer can assist genetic immunization by stimulating both humoral
and
cellular immune responses.
Vaccine injection can be performed using different techniques, such as
by employing a needle or a needless injection system. An example of a needless
injection system is a jet injection device. (Donnelly et al., International
Publication
Number WO 99/52463.)
A. Electrically Mediated Transfer
Electrically mediated transfer or Gene Electro-Transfer (GET) can be
performed by delivering suitable electric pulses after nucleic acid injection.
(See
Mathiesen, International Publication Number WO 98/43702). Plasmid injection
and
electroporation can be performed using stainless needles. Needles can be used
in
couples, triplets or more complex patterns. In one configuration the needles
are
soldered on a printed circuit board that is a mechanical support and connects
the
needles to the electrical field generator by means of suitable cables.
The electrical stimulus is given in the form of electrical pulses. Pulses
can be of different forms (square, sinusoidal, triangular, exponential decay)
and
different polarity (monopolar of positive or negative polarity, bipolar).
Pulses can be
delivered either at constant voltage or constant current modality.
32
CA 02718802 2011-02-16
Different patterns of electric treatment can be used to introduce nucleic
acid vaccines including HCV and other nucleic acid vaccines into a patient.
Possible
patterns of electric treatment include the following:
Treatment 1: 10 trains of 1000 square bipolar pulses delivered every
other second, pulse length 0.2 msec/phase, frequency 1000 Hz, constant voltage
mode, 45 Volts/phase, floating current.
Treatment 2: 2 trains of 100 square bipolar pulses delivered every other
second, pulse length 2 msec/phase, frequency 100 Hz, constant current mode,
100
mAJphase, floating voltage.
Treatment 3: 2 trains of bipolar pulses at a pulse length of about 2
msec/phase, for a total length of about 3 seconds, where the actual current
going
through the tissue is fixed at about 50 mA.
Electric pulses are delivered through an electric field generator. A
suitable generator can be composed of three independent hardware elements
assembled in a common chassis and driven by a portable PC which runs the
driving
program. The software manages both basic and accessory functions. The elements
of
the device are: (1) signal generator driven by a microprocessor, (2) power
amplifier
and (3) digital oscilloscope.
The signal generator delivers signals having arbitrary frequency and
shape in a given range under software control. The same software has an
interactive
editor for the waveform to be delivered. The generator features a digitally
controlled
current limiting device (a safety feature to control the maximal current
output). The
power amplifier can amplify the signal generated up to +/- 150 V. The
oscilloscope is
digital and is able to sample both the voltage and the current being delivered
by the
amplifier.
B. Pharmaceutical Carriers
Pharmaceutically acceptable carriers facilitate storage and
administration of a vaccine to a subject. Examples of pharmaceutically
acceptable
carriers are described herein. Additional pharmaceutical acceptable carriers
are well
known in the art.
Pharmaceutically acceptable carriers may contain different components
such a buffer, normal saline or phosphate buffered saline, sucrose, salts and
polysorbate. An example of a pharmaceutically acceptable carrier is follows:
2.5-10
mM TRIS buffer, preferably about 5 mM TRIS buffer; 25-100 mM NaCI, preferably
33
CA 02718802 2011-02-16
=
about 75 mM NaCl; 2.5-10% sucrose, preferably about 5% sucrose; 0.01 -2 mM
MgC12; and 0.001%-0.01% polysorbate 80 (plant derived). The pH is preferably
from
about 7.0-9.0, more preferably about 8Ø A specific example of a carrier
contains 5
mM TRIS, 75 mM NaC1, 5% sucrose, 1 mM MgC12, 0.005% polysorbate 80 at pH
8Ø
C. Dosing Regimes
Suitable dosing regimens can be determined taking into account the
efficacy of a particular vaccine and factors such as age, weight, sex and
medical
condition of a patient; the route of administration; the desired effect; and
the number
of doses. The efficacy of a particular vaccine depends on different factors
such as the
ability of a particular vaccine to produce polypeptide that is expressed and
processed
in a cell and presented in the context of MHC class I and II complexes.
HCV encoding nucleic acid administered to a patient can be part of
different types of vectors including viral vectors such as adenovector, and
DNA
plasmid vaccines. In different embodiments concerning administration of a DNA
plasmid, about 0.1 to 10 mg of plasmid is administered to a patient, and about
1 to 5
mg of plasmid is administered to a patient. In different embodiments
concerning
administration of a viral vector, preferably an adenoviral vector, about 105
to 1011
viral particles are administered to a patient, and about 107 to 1010 viral
particles are
administered to a patient.
Viral vector vaccines and DNA plasmid vaccines may be administered
alone, or may be part of a prime and boost administration regimen. A mixed
modality
priming and booster inoculation involves either priming with a DNA vaccine and
boosting with viral vector vaccine, or priming with a viral vector vaccine and
boosting
with a DNA vaccine.
Multiple priming, for example, about to 2-4 or more may be used. The
length of time between priming and boost may typically vary from about four
months
to a year, but other time frames may be used. The use of a priming regimen
with a
DNA vaccine may be preferred in situations where a person has a pre-existing
anti-
adenovirus immune response.
In an embodiment of the present invention, 1x107 to lx1012 particles
and preferably about lx101 to lx1011 particles of adenovector is administered
directly
into muscle tissue. Following initial vaccination a boost is performed with an
adenovector or DNA vaccine.
34
CA 02718802 2011-02-16
In another embodiment of the present invention initial vaccination is
performed with a DNA vaccine directly into muscle tissue. Following initial
vaccination a boost is performed with an adenovector or DNA vaccine.
Agents such as interleukin-12, GM-CSF, 87-1, B7-2, 11)10, Mig-1 can
be coadministered to boost the immune response. The agents can be
coadministered
as proteins or through use of nucleic acid vectors.
D. Heterologous Prime-Boost
Heterologous prime-boost is a mixed modality involving the use of one
type of viral vector for priming and another type of viral vector for
boosting. The
heterologous prime-boost can involve related vectors such as vectors based on
different adenovirus serotypes and more distantly related viruses such
adenovirus and
poxvirus. The use of poxvirus and adenovirus vectors to protect mice against
malaria
is illustrated by Gilbert et al., Vaccine 20:1039-1045, 2002.
Different embodiments concerning priming and boosting involve the
following types of vectors expressing desired antigens such as Met-NS3-NS4A-
NS4B-NS5A-NS5B: Ad5 vector followed by Ad6 vector; Ad6 vector followed by
Ad5 vector; Ad5 vector followed by poxvirus vector; poxvirus vector followed
by
Ad5 vector; Ad6 vector followed by poxvirus vector; and poxvirus vector
followed by
Ad6 vector.
The length of time between priming and boosting typically varies from
about four months to a year, but other time frames may be used. The minimum
time
frame should be sufficient to allow for an immunological rest. In an
embodiment, this
rest is for a period of at least 6 months. Priming may involve multiple
priming with
one type of vector, such as 2-4 primings.
Expression cassettes present in a poxvirus vector should contain a
promoter either native to, or derived from, the poxvirus of interest or
another poxvirus
member. Different strategies for constructing and employing different types of
poxvirus based vectors including those based on vaccinia virus, modified
vaccinia
virus, avipoxvirus, raccoon poxvirus, modified vaccinia virus Ankara,
canarypoxviruses (such as ALVAC), fowlpoxviruses, cowpoxviruses, and NYVAC
are well known in the art. (Moss, Current Topics in Microbiology and
Immunology
/58:25-38, 1982; Earl et al., In Current Protocols in Molecular Biology,
Ausube) et
al. eds., New York: Greene Publishing Associates & Wiley Interscience;
1991:16.16.1-16.16.7, Child et al., Virology 174(2):625-9, 1990; Tartaglia et
al.,
CA 02718802 2011-02-16
Virology 188:217-232, 1992; U.S. Patent Nos., 4,603,112,4,722,848, 4,769,330,
5,110,587, 5,174,993, 5,185,146, 5,266,513, 5,505,941, 5,863,542, and
5,942,235.
E. Adjuvants
HCV vaccines can be formulated with an adjuvant. Adjuvants are
particularly useful for DNA plasmid vaccines. Examples of adjuvants are alum,
A1PO4, alhydrogel, Lipid-A and derivatives or variants thereof, Freund's
incomplete
adjuvant, neutral liposomes, liposomes containing the vaccine and cytokines,
non-
ionic block copolymers, and chemokines.
Non-ionic block polymers containing polyoxyethylene (POE) and
polyxylpropylene (POP), such as POE-POP-POE block copolymers may be used as an
adjuvant. (Newman et al., Critical Reviews in Therapeutic Drug Carrier Systems
/5:89-142, 1998.) The immune response of a nucleic acid can be enhanced using
a
non-ionic block copolymer combined with an anionic surfactant.
A specific example of an adjuvant formulation is one containing CRL-
1005 (CytRx Research Laboratories), DNA, and benzylalkonium chloride (BAK).
The formulation can be prepared by adding pure polymer to a cold (<5 C)
solution of
plasmid DNA in PBS using a positive displacement pipette. The solution is then
vortexed to solubilize the polymer. After complete solubilization of the
polymer a
clear solution is obtained at temperatures below the cloud point of the
polymer (-6-
7 C). Approximately 4 mM BAK is then added to the DNA/CRL-1005 solution in
PBS, by slow addition of a dilute solution of BAK dissolved in PBS. The
initial DNA
concentration is approximately 6 mg/rnL before the addition of polymer and
BAK,
and the final DNA concentration is about 5 mg/mL. After BAK addition the
formulation is vortexed extensively, while the temperature is allowed to
increase from
- 2 C to above the cloud point. The formulation is then placed on ice to
decrease the
temperature below the cloud point. Then, the formulation is vortexed while the
temperature is allowed to increase from -2 C to above the cloud point. Cooling
and
mixing while the temperature is allowed to increase from -2 C to above the
cloud
point is repeated several times, until the particle size of the formulation is
about 200-
500 nm, as measured by dynamic light scattering. The formulation is then
stored on
ice until the solution is clear, then placed in storage at -70 C. Before use,
the
formulation is allowed to thaw at room temperature.
36
CA 02718802 2011-02-16
F. Vaccine Storage
Adenovector and DNA vaccines can be stored using different types of
buffers. For example, buffer A105 described in Example 9 infra. can be used to
for
vector storage.
Storage of DNA can be enhanced by removal or chelation of trace
metal ions. Reagents such as succinic or malic acid, and chelators can be used
to
enhance DNA vaccine stability. Examples of chelators include multiple
phosphate
ligands and EDTA. The inclusion of non-reducing free radical scavengers, such
as
ethanol or glycerol, can also be useful to prevent damage of DNA plastnid from
free
radical production. Furthermore, the buffer type, pH, salt concentration,
light
exposure, as well as the type of sterilization process used to prepare the
vials, may be
controlled in the formulation to optimize the stability of the DNA vaccine.
VII. EXAMPLES
Examples are provided below to further illustrate different features of
the present invention. The examples also illustrate useful methodology for
practicing
the invention. These examples do not limit the claimed invention.
Example 1: Met-NS3-NS4A-NS4B-NS5A-NS5B Expression Cassettes
Different gene expression cassettes encoding HCV NS3-NS4A-NS4B-
NS5A-NS5B were constructed based on a lb subtype HCV BK strain. The encoded
sequences had either (1) an active NS5B sequence ("NS"), (2) an inactive NS5B
sequence ("NSmut"), (3) a codon optimized sequence with an inactive NS5B
sequence ("NSOPTmut"). The expression cassettes also contained a CMV
promoter/enhancer and the BGH polyadenylation signal.
The NS nucleotide sequence (SEQ. ID. NO. 5) differs from HCV BK
strain GenBank accession number M58335 by 30 out of 5952 nucleotides. The NS
amino acid sequence (SEQ. ID. NO. 6) differs from the corresponding lb
genotype
HCV BK strain by 7 out of 1984 amino acids. To allow for initiation of
translation an
ATG codon is present at the 5' end of the NS sequence. A TGA termination
sequence
is present at the 3' end of the NS sequence.
The NSmut nucleotide sequence (SEQ. ID. NO. 2, Figure 2), is similar
to the NS sequence. The differences between NSmut and NS include NSmut having
an altered NS5B catalytic site; an optimal ribosome binding site at the 5'
end; and a
TAAA termination sequence at the 3' end. The alterations in NS5B comprise
bases
37
CA 02718802 2011-02-16
5138 to 5146, which encode amino acids 1711 to 1713. The alterations result in
a
change of amino acids GlyAspAsp into AlaAlaGly and creates an inactive form of
the
NS5B RNA-dependent RNA-polymerase NS5B.
The NSOPTmut sequence (SEQ. lD. NO. 3, Figure 3) was designed
based on the amino acid sequence encoded by NSmut. The NSmut amino acid
sequence was back translated into a nucleotide sequence with the GCG
(Wisconsin
Package version 10, Genetics Computer Group, GCG, Madison, Wisc.)
BACKTRANSLATE program. To generate a NSOPTmut nucleotide sequence where
each amino acid is coded for by the corresponding most frequently observed
human
codon, the program was run choosing as parameter the generation of the most
probable nucleotide sequence and specifying the codon frequency table of
highly
expressed human genes (human_high.cod) available within the GCG Package as
translation scheme.
Example 2: Generation pVIJns plasmid with NS, NSmut or NSOPTmut Sequences
pV1Jns plasmids containing either the NS sequence, NSmut sequence
or NSOPTmut sequences were generated and characterised as follows:
pVIJns Plasmid with the NS Sequence
The coding region Met-NS3-NS4A-NS4B-NS5A and the coding
region Met-NS3-NS4A-NS4B-NS5A-NS5B from a HCV BK type strain (Tomei et
al., J. Virol. 67:4017-4026, 1993) were cloned into pcDNA3 plasmid
(Invitrogen),
generating pcD3-5a and pcD3-5b vectors, respectively. PcD3-5A was digested
with
Hind III, blunt-ended with Klenow fill-in and subsequently digested with Xba
I, to
generate a fragment corresponding to the coding region of Met-NS3-NS4A-NS4B-
NS5A. The fragment was cloned into pVlJns-poly, digested with Bgl II blunt-
ended
with Klenow fill-in and subsequently digested with Xba I, generating pV1JnsNS3-
5A.
pVlJns-poly is a derivative of pVlJnsA plasmid (Montgomery et al.,
DNA and Cell Biol. /2:777-783, 1993), modified by insertion of a polylinker
containing recognition sites for XbaI, PmeI, Pad into the unique Bglil and
NotI
restriction sites. The pVlJns plasmid with the NS sequence (pV1JnsNS3-5B) was
obtained by homologous recombination into the bacterial strain BJ5183, co-
transforming pV1INS3-5A linearized with XbaI and NotI digestion and a PCR
fragment containing approximately 200 bp of NS5A, NS5B coding sequence and
38
CA 02718802 2011-02-16
approximately 60 bp of the BGH polyadenylation signal. The resulting plasmid
represents pVlJns-NS.
pVlJns-NS can be summarized as follows:
Bases 1 to 1881 of pVlinsA
an additional AGCTT
then the Met-NS3-NS5B sequence (SEQ. ID. NO. 5)
then the wt TGA stop
an additional TCTAGAGCGTTTAAACCCTTAATTAAGG (SEQ. ID.
NO. 14)
Bases 1912 to 4909 of pVlinsA
pVlJns Plasmid with the NSmut Sequence
The V1JnsNS3-5A plasmid was modified at the 5' of the NS3 coding
sequence by addition of a full Kozak sequence. The plasmid (V1JNS3-5Akozak)
was
obtained by homologous recombination into the bacterial strain BJ5183, co-
transforming VIINS3-5A linearized by NM digestion and a PCR fragment
containing
the proximal part of Intron A, the restriction site BglII, a full Kozak
translation
initiation sequence and part of the NS3 coding sequence.
The resulting plasmid (V UNS3-5Akozak) was linearized with Xba I
digestion and co-transformed into the bacterial strain BJ5183 with a PCR
fragment,
containing approximately 200 bp of NS5A, the NS5B mutated sequence, the strong
translation termination TAAA and approximately 60 bp of the BGH
polyadenylation
signal. The PCR fragment was obtained by assembling two 22bp-overlapping
fragments where mutations were introduced by the oligonucleotides used for
their
amplification. The resulting plasmid represents pVlJns-NSmut.
pVlJns-NSmut can be summarized as follows:
Bases 1 to 1882 of pVIJnsA
then the kozak Met-NS3-NS5B(mut) TAAA sequence (SEQ. ID. NO. 2)
an additional TCTAGA
Bases 1925 to 4909 of pVlJnsA
pVlins Plasmid with the NSOPTmut Sequence
The human codon-optimized synthetic gene (NSOPTmut) with
mutated NS5B to abrogate enzymatic activity, full Kozak translation initiation
sequence and a strong translation termination was digested with BamIll and
Sall
39
CA 02718802 2011-02-16
restriction sites present at the 5' and 3' end of the gene. The gene was then
cloned
into the BglII and Sail restriction sites present in the polylinker of pVlJnsA
plasmid,
generating pVlJns-NSOPTmut.
pVlJns-NSOPTmut can be summarized as follows:
Bases 1 to 1881 of pVlJnsA
an additional C
then kozak Met-NS3-NS5B(optmut) TAAA sequence (SEQ. D. NO. 3)
an additional TITAAATG _______ AAAC (SEQ. BD. NO. 15)
Bases 1905 to 4909 of pVlJnsA
Plasmids Characterization
Expression of HCV NS proteins was tested by transfection of HEIC
293 cells, grown in 10% FCS/DMEM supplemented by L-glutamine (final 4 mM).
Twenty-four hours before transfection, cells were plated in 6-well 35 mm
diameter, to
reach 90-95% confluence on the day of transfection. Forty nanograms of plasmid
DNA (previously assessed as a non-saturating DNA amount) were co-transfected
with
100 ng of pRSV-Luc plasmid containing the luciferase reporter gene under the
control
of Rous sarcoma virus promoter, using the LIPOFECTAIVEINE 2000 reagent. Cells
were kept in a CO2 incubator for 48 hours at 37 C.
Cell extracts were prepared in 1% Triton/TEN buffer. The extracts
were normalized for Luciferase activity, and run in serial dilution on 10% SDS-
acrylamide gel. Proteins were transferred on nitrocellulose and assayed with
antibodies directed against NS3, NS5A and NS5B to assess strength of
expression and
correct proteolytic cleavage. Mock-transfected cells were used as a negative
control.
Results from representative experiments testing pVlJnsNS, pVlJnsNSmut and
pVlJnsNSOPTmut are shown in Figure 12.
Example 3: Mice Immunization with Plasmid DNA Vectors
The DNA plasrnids pVlJns-NS, pVlJns-NSmut and pVlins-
NSOPTmut were injected in different mice strains to evaluate their potential
to elicit
anti-HCV immune responses. Two different strains (Balb/C and C57Black6, N=9-
10)
were injected intramuscularly with 25 or 50 lig of DNA followed by electrical
pluses.
Each animal received two doses at three weeks interval.
Humoral immune response elicited in C57Black6 mice against the NS3
protein was measured in post dose two sera by ELISA on bacterially expressed
NS3
CA 02718802 2011-02-16
protease domain. Antibodies specific for the tested antigen were detected in
animals
immunized with all three vectors with geometric mean titers (GMT) ranging from
94000 to 133000 (Tables 1-3).
Table 1: pVljns-NS
GMT
_
Mice 1 2 3 4 5 6 7 8 9
n.
Titer 105466 891980 78799 39496 543542 182139 32351 95028 67800 94553
Table 2: pVljns-NSmut
__________________________________________________________________
GMT
Mice 11 12 13 14 15 16 17 18 19 20
n.
Titer 202981 55670 130786 49748 17672 174958 , 44304
37337 78182 193695 75083
Table 3: pVljns-NSOPTmut
GMT
Mice 21 22 23 24 25 26 27 28 29 30
n.
Titer 310349 43645 63496 82174 630778 297259 66861 146735 173506 77732 133165
A T cell response was measured in C57Black6 mice immunized with
two intramuscular injections at three weeks interval with 25 pg of plasrnid
DNA.
Quantitative ELIspot assay was performed to determine the number of IFNy
secreting
T cells in response to five pools of 20mer peptides overlapping by ten
residues
encompassing the NS3-NS5B sequence. Specific CD8+ response was analyzed by the
same assay using a Darner peptide encompassing a CD8+ epitope for C57Black6
mice
(pep1480).
Cells secreting 1FNy in an antigen specific-manner were detected using
a standard ELIspot assay. T cell response in C57Black6 mice immunized with two
intramuscular injections at three weeks interval with 50 lig of plasmid DNA,
was
41
CA 02718802 2011-02-16
analyzed by the same ELIspot assay measuring the number of 1FNy secreting T
cells
in response to five pools of 20mer peptides overlapping by ten residues
encompassing
the NS3-NS5B sequence.
Spleen cells were prepared from immunized mice and re-suspended in
R10 medium (RPIVII 1640 supplemented with 10% FCS, 2 mM L-Glutamine, 50
U/m1-50 g/m1Penicillin/Streptomycin, 10 mM Hepes, 50 gM 2-mercapto-ethanol).
Multiscreen 96-well Filtration Plates (Millipore, Cat. No. MAIPS4510,
Millipore
Corporation, 80 Ashby Road Bedford, MA) were coated with purified rat anti-
mouse
INFy antibody (PharMingen, Cat. No. 18181D, PharmiMingen, 10975 Torreyana
Road, San Diego, California 92121-1111 USA). After overnight incubation,
plates
were washed with PBS 1X/0.005% Tween and blocked with 250 l/well of R10
medi urn.
Splenocytes from immunized mice were prepared and incubated for
twenty-four hours in the presence or absence of 10 AM peptide at a density of
2.5 X
105/well or 5 X 105/well. After extensive washing (PBS 1X/0.005% Tween),
biotinylated rat anti-mouse IFNy antibody (PharMingen, Cat. No. 18112D,
PharMingen, 10975 Torreyana Road, San Diego, California 92121-1111 USA) was
added and incubated overnight at 4 C. For development, streptavidin-AKP
(PharMingen, Cat. No. 13043E, PharMingen, 10975 Torreyana Road, San Diego,
California 92121-1111 USA) and 1-Step"m NBT-BCIP development solution (Pierce,
Cat. No. 34042, Pierce, P.O. Box 117, Rockford, IL 61105 USA) were added.
Pools of 20mer overlapping peptides encompassing the entire sequence
of the HCV BK strain NS3 to NS5B were used to reveal HCV-specific IFNy-
secreting
T cells. Similarly a single 20mer peptide encompassing a CD8+ epitope for
C57Black6 mice was used to detect CD8 response. Representative data from
groups
of C57Black6 and Balb/C mice (N=9-10) immunized with two injections of 25 or
50
Rg of plasmid vectors pVlJns-NS, pVlJns-NSmut and pV1.Ins-NSOPTmut are shown
in Figures 13A and 13B.
Example 4: Immunization of Rhesus Macaques
Rhesus macaques (N=3) were immunized by intramuscular injection
with 5mg of plasmid pVlJns-NSOPTmut in 7.5mg/m1CRL1005, Benzalkonium
chloride 0.6 mM. Each animal received two doses in the deltoid muscle at 0,
and 4
weeks.
42
CA 02718802 2011-02-16
=
CM1 was measured at different time points by IFN-y ELISPOT. This
assay measures HCV antigen-specific CD8+ and CD4+ T lymphocyte responses, and
can be used for a variety of mammals, such as humans, rhesus monkeys, mice,
and
rats.
The use of a specific peptide or a pool of peptides can simplify antigen
presentation in CTL cytotoxicity assays, interferon-gamma RISPOT assays and
interferon-gamma intracellular staining assays. Peptides based on the amino
acid
sequence of various HCV proteins (core, E2, NS3, NS4A, NS4B, NS5A, NS5B) were
prepared for use in these assays to measure immune responses in HCV DNA and
adenovirus vector vaccinated rhesus monkeys, as well as in HCV-infected
humans.
The individual peptides are overlapping 20-mers, offset by 10 amino acids.
Large
pools of peptides can be used to detect an overall response to HCV proteins
while
smaller pools and individual peptides may be used to define the epitope
specificity of
a response.
IFNyELISPOT
The IFNy-ELISPOT assay provides a quantitative determination of
HCV-specific T lymphocyte responses. PBMC are serially diluted and placed in
microplate wells coated with anti-rhesus IFN-y antibody (MD-1 U-Cytech). They
are
cultured with a HCV peptide pool for 20 hours, resulting in the restimulation
of the
precursor cells and secretion of IFN-y. The cells are washed away, leaving the
secreted IFN bound to the antibody-coated wells in concentrated areas where
the cells
were sitting. The captured IFN is detected with biotinylated anti-rhesus IFN
antibody
(detector Ab U-Cytech) followed by alkaline phosphatase-conjugated
streptavidin
(Pharmingen 13043E). The addition of insoluble alkaline phosphatase substrate
results in dark spots in the wells at the sites where the cells were located,
leaving one
spot for each T cell that secreted IFN-y.
The number of spots per well is directly related to the precursor
frequency of antigen-specific T cells. Gamma interferon was selected as the
cytokine
visualized in this assay (using species specific anti-gamma interferon
monoclonal
antibodies) because it is the most common, and one of the most abundant
cytokines
synthesized and secreted by activated T lymphocytes. For this assay, the
number of
spot forming cells (SFC) per million PBMCs is determined for samples in the
43
CA 02718802 2011-02-16
presence and absence (media control) of peptide antigens. Data from Rhesus
macaques on PBMC from post dose two material are shown in Table 4.
Table 4
PV1J-NSOPTmut
Pep pools 21G 99C161 99C166
F (NS3p) 8 10 170
G (NS3h) 7 592 229
H (NS4) 3 14 16
I (NS5a) 5 71 36
L (NS5b) 14 23 11
M (NS5b) 3 35 8
DMSO 2 4 5
INFTELISPOT on PBMC from Rhesus monkeys immunized with two injections of 5
Example 5: Construction of Ad6 Pre-Adenovirus Plasmids
Ad6 pre-adenovirus plasmids were obtained as follows:
Construction of pAd6 E1-E3+ Pre-adenovirus Plasmid
An Ad6 based pre-adenovirus plasmid which can be used to generate
first generation Ad6 vectors was constructed either taking advantage of the
extensive
sequence identity (approx. 98%) between Ad5 and Ad6 or containing only Ad6
regions. Homologous recombination was used to clone wtAd6 sequences into a
bacterial plasmid.
A general strategy used to recover pAd6E1-E3+ as a bacterial plasmid
containing Ad5 and Ad6 regions is illustrated in Figure 10. Cotransformation
of BJ
5183 bacteria with purified wt Ad6 viral DNA and a second DNA fragment termed
the Ad5 ITR cassette resulted in the circularization of the viral genome by
homologous recombination. The ITR cassette contains sequences from the right
(bp
33798 to 35935) and left (bp Ito 341 and bp 3525 to 5767) end of the Ad5
genome
separated by plasmid sequences containing a bacterial origin of replication
and an
ampicillin resistance gene. The ITR cassette contains a deletion of El
sequences from
44
CA 02718802 2011-02-16
Ad5 342 to 3524. The Ad5 sequences in the ITR cassette provide regions of
homology with the purified Ad6 viral DNA in which recombination can occur.
Potential clones were screened by restriction analysis and one clone
was selected as pAd6E1-E3+. This clone was then sequenced in it entirety.
pAd6E1-
E3+ contains Ad5 sequences from bp 1 to 341 and from bp 3525 to 5548, Ad6 bp
5542 to 33784, and Ad5 bp 33967 to 35935 (bp numbers refer to the wt sequence
for
both Ad5 and Ad6). pAd6E1-E3+ contains the coding sequences for all Ad6 virion
structural proteins which constitute its serotype specificity.
A general strategy used to recover pAd6E1-E3+ as a bacterial plasmid
containing Ad6 regions is illustrated in Figure 11. Cotransformation of BJ
5183
bacteria with purified wt Ad6 viral DNA and a second DNA fragment termed the
Ad6
1TR cassette resulted in the circularization of the viral genome by homologous
recombination. The ITR cassette contains sequences from the right (bp 35460 to
35759) and left (bp 1 to 450 and bp 3508 to 3807) end of the Ad6 genome
separated
by plasmid sequences containing a bacterial origin of replication and an
ampicillin
resistance gene. These three segments were generated by PCR and cloned
sequentially into pNEB193, generating pNEBAd6-3 (the ITR cassette). The 1TR
cassette contains a deletion of El sequences from Ad5 451 to 3507. The Ad6
sequences in the 1TR cassette provide regions of homology with the purified
Ad6 viral
DNA in which recombination can occur.
Construction of pAd6 E1-E3- pre-adenovirus plasmids
Ad6 based vectors containing A5 regions and deleted in the E3 region
were constructed starting with pAd6E1-E3+ containing Ad5 regions. A 5322 bp
subfragment of pAd6E1-E3+ containing the E3 region (Ad6 bp 25871 to 31192) was
subcloned into pABS.3 generating pABSAd6E3. Three E3 deletions were then made
in this plasmid generating three new plasmids pABSAd6E3(1.8Kb) (deleted for
Ad6
bp 28602 to 30440), pABSAd6E3(2.3Kb) (deleted for Ad6 bp 28157 to 30437) and
pABSAd6E3(2.6Kb) (deleted for Ad6 bp 28157 to 30788). Bacterial recombination
was then used to substitute the three E3 deletions back into pAd6E1-E3+
generating
the Ad6 genome plasmids pAd6E1-E3-1.8Kb, pAd6E1-E3-2.3Kb and pAd6E1-E3-
2.6Kb.
=
CA 02718802 2011-02-16
=
Example 6: Generation of Ad5 Genome Plasmid with the NS Sequence
A pcDNA3 plasmid (Invitrogen) containing the coding region NS3-NS4A-
NS4B-NS5A was digested with XmnI and Nrul restriction sites and the DNA
fragment
containing the CMV promoter, the NS3-NS4A-NS4B-NS5A coding sequence and the
Bovine Growth Hormone (BGH) polyadenylation signal was cloned into the unique
EcorV
restriction site of the shuttle vector pDelE1Spa, generating the Sva3-5A
vector.
A pcDNA3 plasmid containing the coding region NS3-NS4A-NS4B-
NS5A-NS5B was digested with XmnI and EcorI (partial digestion), and the DNA
fragment containing part of NS5A, NS5B gene and the BGH polyadenylation signal
was cloned into the Sva3-5A vector, digested EcorI and B glIT blunted with
Klenow,
generating the Sva3-5B vector.
The Sva3-5B vector was finally digested Sspl and Bst1107I restriction
sites and the DNA fragment containing the expression cassette (CMV promoter,
NS3-
NS4A-NS4B-NS5A-NS5B coding sequence and the BGH polyadenylation signal)
flanked by adenovirus sequences was co-transformed with pAd5HVO (E1-,E3-) ClaI
linearized genome plasmid into the bacterial strain B35183, to generate
pAd5HVONS.
pAd5HVO contains Ad5 bp 1 to 341, bp 3525 to 28133 and bp 30818 to 35935.
Example 7: Generation of Adenovirus Genome Plasmids with the NSmut Sequence
Adenovirus genome plasrnids containing an NS-mut sequence were
generated in an Ad5 or Ad6 background. The Ad6 background contained Ad5
regions
at bases 1 to 450, 3511 to 5548 and 33967 to 35935.
pV1JNS3-5Akozak was digested with B gill and XbaI restriction
enzymes and the DNA fragment containing the Kozak sequence and the sequence
coding NS3-NS4A-NS4B-NS5A was cloned into a BglII and XbaI digested
polypMRKpdelE1 shuttle vector. The resulting vector was designated shNS3-
5Akozak.
PolypMRKpdelE1 is a derivative of RKpdelEl(Pac/pIXJpack450) +
CMVinin+BGHpA(str.) modified by the insertion of a polylinker containing
recognition sites for BglII, PmeI, SwaI, XbaI, Sall, into the unique Bg111
restriction
site present downstream the CMV promoter. MRKpdelE1(Pac/pIX/pack450) +
CMVmin + BGHpA(str.) contains Ad5 sequences from bp 1 to 5792 with a deletion
of El sequences from bp 451 to 3510. The human CMV promoter and BGH
polyadenylation signal were inserted into the El deletion in an El parallel
orientation
with a unique Bglil site separating them.
46
CA 02718802 2011-02-16
The NS5B fragment, mutated to abrogate enzymatic activity and with a
strong translation termination at the 3' end, was obtained by assembly PCR and
inserted into the shNS3-5Akozalc vector via homologous recombination,
generating
polypIvIRKpdelEINSmut. In polypMRKpdelE1NSmut the NS-mut coding sequence
is under the control of CMV promoter and the BGH polyadenylation signal is
present
downstream.
The gene expression cassette and the flanking regions which contain
adenovirus sequences allowing homologous recombination were excised by
digestion
with Pad and Bst11071 restriction enzymes and co-transformed with either
pAd5HVO (E1-,E3-) or pAd6E1-E3-2.6Kb Clal linearized genome plasmids into the
bacterial strain BJ5183, to generate pAd5HVONSmut and pAd6E1-,E3-NSmut,
respectively.
pAd6E1-E3-2.6Kb contains Ad5 bp I to 341 and from bp 3525 to
5548, Ad6 bp 5542 to 28157 and from bp 30788 to 33784, and Ad5 bp 33967 to
35935 (bp numbers refer to the wt sequence for both Ad5 and Ad6). In both
plasmids
the viral ITR's are joined by plasmid sequences that contain the bacterial
origin of
replication and an ampicillin resistance gene.
Example 8: Generation of Adenovirus Genome Plasmids with the NSOPTmut
The human codon-optimized synthetic gene (NSOPTmut) provided by
SEQ. ID. NO. 3 cloned into a pCRBlunt vector (Invitrogen) was digested with
BamH1
and Sall restriction enzymes and cloned into Bel and Sall restriction sites
present in
the shuttle vector polypMRKpdelEl. The resulting clone
(polypMRKpdelE1NSOPTmut) was digested with Pad and Bst1107I restriction
enzymes and co-transformed with either pAd5HVO (E1-,E3-) or pAd6E1-E3-2.6Kb
Clal linearized genome plasmids, into the bacterial strain BJ5183, to generate
pAd5HVONSOPTmut and pAd6E1-,E3-NSOPTmut, respectively.
Example 9: Rescue and Amplification of Adenovirus Vectors
Adenovectors were rescued in Per.6 cells. Per.C6 were grown in 10%
FCS / DMEM supplemented by L-glutamine (final 4mM), penicillin/streptomycin
(final 100 TO/m1) and 10 mM MgC12. After infection, cells were kept in the
same
medium supplemented by 5% horse serum (HS). For viral rescue, 2.5 X 106 Per.C6
were plated in 6 cm 0 Petri dishes.
47
CA 02718802 2011-02-16
Twenty-four hours after plating, cells were transfected by calcium
phosphate method with 10 lig of the Pac I linearized adenoviral DNA. The DNA
precipitate was left on the cells for 4 hours. The medium was removed and 5%
HS/DMEM was added.
Cells were kept in a CO2 incubator until a cytopathic effect was visible
(1 week). Cells and supernatant were recovered and subjected to 3X
freeze/thawing
cycles (liquid nitrogen / water bath at 37 C). The lysate was centrifuged at
3000 rpm
at - 4 C for 20 minutes and the recovered supernatant (corresponding to a cell
lysate
containing virus passed on cells only once; P1) was used, in the amount of 1
ml/ dish,
to infect 80-90% confluent Per.C6 in 10 cm 0 Petri dishes. The infected cells
were
incubated until a cytopathic effect was visible, cells and supernatant
recovered and the
lysate prepared as described above (P2).
P2 lysate (4 ml) were used to infect 2 X 15 cm 0 Petri dishes. The
lysate recovered from this infection (P3) was kept in aliquots at ¨80 C as a
stock of
virus to be used as starting point for big viral preparations. In this case, 1
ml of the
stock was enough to infect 2 X 15 cm 0 Petri dishes and resulting lysate (P4)
was used
for the infection of the Petri dishes devoted to the large scale infection.
Further amplification was obtained from the P4 lysate which was
diluted in medium without FCS and used to infect 30 X 15 cm 0 Petri dishes
(with
Per.C6 80%-90% confluent) in the amount of 10 ml/dish. Cells were incubated 1
hour in the CO2 incubator, mixing gently every 20 minutes. 12 ml! dish of 5%
HS /
DMEM was added and cells were incubated until a cytopathic effect was visible
(about 48 hours).
Cells and supernatant were collected and centrifuged at 2K rpm for 20
minutes at 4 C. The pellet was resuspended in 15 ml of 0.1 M Tris pH=8Ø
Cells
were lysed by 3X freeze/thawing cycles (liquid nitrogen / water bath at 37 C).
150 id
of 2 M MgCl2 and 75 Al of DNAse (10 mg of bovine pancreatic deoxyribonuclease
I
in 10 ml of 20 mM Tris-HCI pH= 7.4, 50 mM NaCI, 1 mM dithiothreitol, 0.1 mg/ml
bovine serum albumin, 50% glycerol) were added. After a 1 hour incubation at
37 C
in a water bath (vortex every 15 minutes) the lysate was centrifuged at 4K rpm
for 15
minutes at 4 C. The recovered supernatant was ready to be applied on CsC1
gradient.
The CsC1 gradients were prepared in SW40 ultra-clear tubes as
follows:
0.5 ml of 1.5d CsC1
3 ml of 1.35d CsC1
48
CA 02718802 2011-02-16
3 ml of 1.25d CsC1
5-ml/ tube of viral supernatant was applied.
If necessary, the tubes were topped up with 0.1 M tris-CI pH=8Ø
Tubes were centrifuged at 35K rpm for 1 hour at -10 C with rotor SW40. The
viral
bands (located at the 1.25/1.35 interface) were collected using a syringe.
. The virus was transferred into a new SW40 ultraclear tube and
1.35d
CsC1 was added to top the tube up. After centrifugation at 35K rpm for 24
hours at
C in the rotor SW40, the virus was collected in the smallest possible volume
and
dialyzed extensively against buffer A105 (5 mM Tris, 5% sucrose, 75 mM NaCI, 1
10 mM MgCl, 0.005% polysorbate 80 pH=8.0). After dialysis, glycerol was
added to
final 10% and the virus was stored in aliquots at ¨ 80 C.
Example 10: Enhanced Adenovector Rescue
First generation Ad5 and Ad6 vectors carrying HCV NSOPTmut
transgene were found to be difficult to rescue. A possible block in the rescue
process
might be attributed to an inefficient replication of plasmid DNA that is a sub-
optimal
template for the replication machinery of adenovirus. The absence of the
terminal
protein linked to the 5'ends of the DNA (normally present in the viral DNA),
associated with the very high G-C content of the transgene inserted in the El
region of
the vector, may be causing a substantial reduction in replication rate of the
plasmid-
derived adenovirus.
To set up a more efficient and reproducible procedure for rescuing Ad
vectors, an expression vector (pE2; Figure 19) containing all E2 proteins
(polymerase,
pre-terminal protein and DNA binding protein) as well as E4 orf6 under the
control of
tet-inducible promoter was employed. The transfection of pE2 in combination
with a
normal preadeno plasmid in PerC6 and in 293 leads to a strong increase of Ad
DNA
replication and to a more efficient production of complete infectious
adenovirus
particles.
Plasmid Construction
pE2 is based on the cloning vector pBI (CLONTECH) with the
addition of two elements to allow episomal replication and selection in cell
culture:
(1) the EBV-OriP (EBV [nt] 7421-8042) region permitting plasmid replication in
synchrony with the cell cycle when EBNA-1 is expressed and (2) the hygromycin-
B
phosphotransferase (HPH)-resistance gene allowing a positive selection of
49
CA 02718802 2011-02-16
transformed cells. The two transcriptional units for the adenoviral genes E2 a
and b
and E4-Orf6 were constructed and assembled in pE2 as described below.
The Ad5-Polymerase Clal/SphI fragment and the Ad5-pTP
Acc65/EcoRV fragment were obtained from pVac-Pol and pVac-pTP (Stunnemberg et
al. NAR /6:2431-2444, 1988). Both fragments were filled with Klenow and cloned
into the Sall (filled) and EcoRV sites of pBI, respectively obtaining pBI-
Pol/pTP.
EBV-OriP element from pCEP4 (Invitrogen) was first inserted within
two chicken 13-globin insulator dimers by cloning it into BamHI site of pJC13-
1
(Chung et al., Cell 74(3):505-14, 1993). HS4-OriP fragment from pJC13-OriP was
then cloned inside pSA lmv (a plasmid containing tk-Hygro-B resistance gene
expression cassette as well as Ad5 replication origin), the ITR's arranged as
head-to-
tail junction, obtained by PCR from pFG140 (Graham, EMBO J. 3:2917-2922, 1984)
using the following primers: 5'-TCGAATCGATACGCGAACCTACGC-3' (SEQ.
ID. NO. 16) and 5'-TCGACGTGTCGACTTCGAAGCGCACACCAAAAACGTC-3'
(SEQ. ID. NO. 17), thus generating pMVHS4Orip. A DNA fragment from
pMVHS4Orip, containing the insulated OriP, Ad5 1TR junction and tk-HygroB
cassette, was then inserted into pBI-Pol/pTP vector restricted AseI/AatIl
generating
pBI-Pol/pTPHS4 .
To construct the second transcriptional unit expressing Ad5-Orf6 as
well as Ad5-DBP, E4orf6 (Ad 5 [nt] 33193-34077) obtained by PCR was first
inserted into pBI vector, generating pBI-Orf6. Subsequently, DBP coding DNA
sequence (Ad 5 [nt] 22443-24032) was inserted into pBI-Orf6 obtaining the
second
bi-directional Tet-regulated expression vector (pBI-DBP/E4orf6). The original
polyA
signals present in pBI were substituted with BGH and 5V40 polyA.
pBI-DBP/E4orf6 was then modified by inserting a DNA fragment
containing the Adeno5-ITRs arranged in head-to-tail junction plus the
hygromicin B
resistance gene obtained from plasmid pSA-lmv. The new plasmid pBI-
DBP/E4orf6shuttle was then used as donor plasmid to insert the second tet-
regulated
transcriptional unit into pBI-Pol/pTPHS4 by homologous recombination using E.
coli
strain BJ5183 obtaining pE2.
Cell lines, Transfections and Virus Amplification
PerC6 cells were cultured in Dulbecco's modified Eagle's Medium
(DMEM) plus 10% fetal bovine serum (1-11S), 10 rnM MgCl2, penicillin (100
U/ml),
streptomycin (100 ilg/m1) and 2 mM glutamine.
CA 02718802 2011-02-16
All transient transfections were performed using Lipofectamine2000
(Invitrogen) as described by the manufacturer. 90% confluent PERC.6TM planted
in
6-cm plates were transfected with 3.5 1..tg of Ad5/6NSOPTmut pre-adeno
plasmids,
digested with Pad, alone or in combination with 5 tg pE2 plus 1 1.1g pUHD52.1.
pUHD52.1 is the expression vector for the reverse tet transactivator 2 (rtTA2)
(Urlinger et al., Proc. Natl. Acad. Sci. U.S.A. 97(14):7963-7968, 2000). Upon
transfection, cells were cultivated in the presence of 1 itg/m1 of doxycycline
to
activate pE2 expression. 7 days post-transfection cells were harvested and
cell lysate
was obtained by three cycles of freeze-thaw. Two ml of cell lysate were used
to infect
a second 6-cm dish of PerC6. Infected cells were cultivated until a full CPE
was
observed then harvested. The virus was serially passaged five times as
described
above, then purified on CsC1 gradient. The DNA structure of the purified virus
was
controlled by endonuclease digestion and agarose gel electrophoresis analysis
and
compared to the original pre-adeno plasmid restriction pattern.
Example 11: Partial Optimizeation of HCV Polyprotein Encoding Nucleic acid
Partial optimization of HCV polyprotein encoding nucleic acid was
performed to facilitate the production of adenovectors containing codons
optimized
for expression in a human host. The overall objective was to provide for
increased
expression due to codon optimization, while facilitating the production of an
adenovector encoding HCV polyprotein.
Several difficulties were encountered in producing an adenovector
encoding HCV polyprotein with codons optimized for expression in a human host.
An
adenovector containing an optimized sequence (SEQ. 1D. NO. 3) was found to be
more difficult to synthesize and rescue than an adenovector containing a non-
optimized sequence (SEQ. ID. NO. 2).
The difficulties in producing an adenovector containing SEQ. ID. NO.
3 were attributed to a high GC content. A particularly problemetic region was
the
region at about position 3900 of NSOPTmut (SEQ. ID. NO. 3).
Alternative versions of optimized HCV encoding nucleic acid
sequence were designed to facilitate its use in an adenovector. The
alternative
versions, compared taNSOPTmut, were designed to have a lower overall GC
content,
to reduce/avoid the presence of potentially problematic motifis of consecutive
G's or
C's, while maintaining a high level of codon optimization to allow improved
expression of the encoded polyprotein and the individual cleavage products.
51
CA 02718802 2011-02-16
A starting point for the generation of a suboptimally codon-optimized
sequence is the coding region of the NSOPTmut nucleotide sequence (bases 7 to
5961
of SEQ. ID. NO. 3). Values for codon usage frequencies (normalized to a total
of 1.0
for each amino acid) were taken from the file human_high.cod available in the
Wisconsin Package Version 10.3 (Accelrys Inc., a wholly owned subsidiary of
Pharmacopeia, Inc).
To reduce the local and overall GC content a table defining preferred
codon substitutions for each amino acid was manually generated. For each amino
acid
the codon having 1) a lower GC content as compared to the most frequent codon
and
2) a relativly high observed codon usage frequency (as defined in
human_high.cod)
was choosen as the replacement codon. For example for Arg the codon with the
highest frequency is CGC. Out of the other five alternative codons encoding
Arg
(CGG, AGG, AGA, CGT, CGA) three (AGG, CGT, CGA) reduce the GC content by
1 base, one (AGA) by two bases and one (COG) by 0 bases. Since the AGA codon
is
listed in human_high.cod as having a relatively low usage frequency (0.1), the
codon
substituting CGC was therefore choosen to be AGG with a relative frequency of
0.18.
Similar criteria were applied in order to establish codon replacements for the
other
amino acids resulting in the list shown in Table 5. Parameters applied in the
following
optimization procedure were determined empirically such that the resulting
sequence
maintained a considerably improved codon usage (for each amino acid) and the
GC
content (overall and in form of local stretches of consecutive G's and/or C's)
was
decreased.
Two examples of partial optimized HCV encoding sequences are
provided by SEQ. D. NO. 10 and SEQ., ID. NO. 11. SEQ. ID. NO. 10 provides a
HCV encoding sequence that is partially optimized throughout. SEQ. B:). NO. 11
provides an HCV encoding sequence fully optimized for codon usage with the
exception of a region that was partially optimized.
Codon optimization was performed using the following procedure:
Step 1) The coding region of the input fully optimized NSOPTmut
sequence was analyzed using a sliding window of 3 codons (9 bases) shifting
the
window by one codon after each cycle. Whenever a stretch containing 5 or more
consecutive C's and/or G's was detected in the window the following
replacement rule
was applied: Let N indicate the number of codon replacements previously
performed.
If N is odd replace the middle codon in the window with the codon specified in
Table
5, if N is even replace the third terminal codon in the window with the codon
52
CA 02718802 2011-02-16
specified in a codon optimization table such as human_high.cod. If Leu or Val
is
present at the second or third codon do not apply any replacement in order not
to
introduce Leu or Val codons with very low relative codon usage frequency (see,
for
example, human_high.cod). In the following cycle analysis of the shifted
window was
then applied to a sequence containing the replacements of the previous cycle.
The alternating replacement of the middle and terminal codon in the 3
codon window was found empirically to give a more satisfying overall
maintenance of
optimized codon usage while also reducing GC content (as judged from the final
sequence after the Procedure). In general, however, the precise replacement
strategy
depends on the amino acid sequence encoded by the nucelotide sequence under
analysis and will have to be determined empirically.
Step 2) The sequence containing all the codon replacements performed
during step 1) was then subjected to an additional analysis using a sliding
window of
21 codons (63 bases) in length: according to an adjustable parameter the
overall GC
content in the window was determined. If the GC content in the window was
higher
than 70% the following codon replacement strategy was applied: In the window
replace the codons for the amino acids Asn, Asp, Cys, Glu, His, Ile, Lys, Phe,
Tyr by
the codons given in Table 5. Restriction of the replacement to this set of
amino acids
was motivated by the fact that a) the replacement codon still has an accetably
high
frequency of usage in human_high.cod and b) the average overall human codon
usage
in CUTG for the replacement codon is nearly as high as the most frequent
codon. In
the following cycle analysis of the shifted window is then applied to a
sequence
containing the replacements of the previous cycle.
The threshold 70% was determined empirically by compromising
between an overall reduction in GC content and maintenance of a high codon
optimization for the individual amino acids. As in step 1) the precise
replacement
strategy (choice of amino acids and GC content threshold value) will again
depend on
the amino acid sequence encoded by the nucleotide sequence under analysis and
will
have to be determined empirically.
Step 3) The sequence generated by steps 1) and 2) was then manually
edited and additional codons were changed according to the following criteria:
Regions still having a GC content higher than 70% over a window of 21 codons
were
examined manually and a few codons were replaced again following the scheme
given
in Table 5.
53
CA 02718802 2011-02-16
Subsequent steps were performed to provide for useful restriction sites,
remove possible open reading frames on the complementary strand, to add
homologous recombinant regions, to add a Kozac signal, and to add a
terminator.
These steps are numbered 4-7
Step 4) The sequence generated in step 3 was examined for the absence
of certain restriction sites (Bg111, PmeI and XbaI) and presence of only 1
StuI site to
allow a subsequent cloning strategy using a subset of restriction enzymes. Two
sites
(one for Bglil and one for StuI) were removed from the sequence by replacing
codons
that were part of the respective recognition sites.
Step 5) The sequence generated by steps 1) through 4) was then
modified according to allow subsequent generation of a modified NSOPTmut
sequence (by homologous recombination). In the sequence obtained from steps 1)
through 4) the segment comprising base 3556 to 3755 and the segment comprising
base 4456 to 4656 were replaced by the corresponding segments from NSOPTmut.
The segment comprising bases 3556 to 4656 of SEQ. lD. NO. 10 can be used to
replace the problematic region in NSOPTmut (around position 3900) by
homologous
recombination thus creating the variant of NSOPTmut having the sequence of
SEQ.
ID. NO. 11.
Step 6) Analysis of the sequence generated through steps 1) to 5)
revealed a potential open reading frame spanning nearly the complete fragment
on the
complementary strand. Removal of all codons CTA and TTA (Leu) and TCA (Ser)
from the sense strand effectively removed all stop codons in one of the
reading frames
on the complementary strand. Although the likelyhood for transcription of this
complementary strand open reading frame and subsequent translation into
protein is
very small, in order to exclude a potential interference with the
transcription and
subsequent translation of the sequence encoded on the sense strand, TCA codons
for
Ser were introduced on the sense approximately every 500 bases. No changes
were
introduced in the segments introduced during step 5) to allow homologous
recombination. The TCA codon for Ser was preferred over the CTA and T'TA
codons
for Leu because of the higher relative frequency for TCA (0.05) as compared to
CTA
(0.02) and TTA (0.03) in human_high.cod. In addition, the average human codon
usage from CUTG favored TCA (0.14 against 0.07 for CTA and TTA).
Step 7) In a final step GCCACC was added at the 5' end of the
sequence to generate an optimized internal ribosome entry site (Kozak signal)
and a
TAAA stop sgnal was added at the 3'. To maintain the initiation of translation
54
CA 02718802 2011-02-16
properties of NSsuboptmut the first 8 codons of the coding region were kept
identical
to the NSOPTmut sequence. The resulting sequence was again checked for the
absence of Bg111, PmeI and Xbal recognition sites and the presence of only 1
StuI site.
The NSsuboptmut sequence (SEQ. 1D. NO. 10) has an overall reduced
GC content (63.5%) as compared to NSOPTmut (70.3%) and maintains a well
optimized level of codon usage optimization. Nucleotide sequence identity of
NSsuboptmut is 77.2% with respect to NSmut.
Table 5: Definition of codon replacements performed during steps 1) and 2).
________________________________________________________________
Amino Acid Most frequent Relative Reduction in
Replacement Relative
= codon frequency GC content codon
frequency
(bases)
Amino Acids where the replacement codon reduces the codon GC-content by 1 base
Ala
GCC 0.51 1 OCT 0.17
Arg
CGC 0.37 1 AGG 0.18
Asn 0.22
AAC 0.78 1 AAT
Asp
GAC 0.75 1 GAT 0.25
Cys
TGC 0.68 1 TGT 0.32
Glu
GAG 0.75 , 1 GAA 0.25
Gln
CAG 0.88 1 CAA 0.12 ,
Gly
GOC 0.50 1 GGA 0.14
His
_ CAC 0.79 1 CAT 0.21 ,
Ile
ATC 0.77 1 AU 0.18
Lys
AAG 0.82 1 AAA 0.18
Phe
TTC 0.80 1 TTT 0.20
Pro
CCC 0.48 1 CCT 0.19
Set
AGC , 0.34 1 TCT 0.13
Thr
ACC 0.51 1 ACA 0.14
Tyr
TAC 0.74 1 TAT 0.26
Amino Acids with no alternative codon .
Met
ATG 1.00 0 ATG 1.00
Trp
TOG 1.00 0 TGG 1.00
.,
CA 02718802 2011-02-16
Amino Acids where the replacement codon has a very low relative frequency.
These amino acids were
excluded from the replacement procedure
Leu
CTG 0.58 1 TTG 0.06
Val
GTG 0.64 1 OTT 0.07
Example 12: Virus Characterization
Adenovectors were characterized by: (a) measuring the physical
particles/ml; (b) running a TaqMan PCR assay; and (c) checking protein
expression
after infection of HeLa cells.
a) Physical Particles Determination
CsC1 purified virus was diluted 1/10 and 1/100 in 0.1% SDS PBS. As
a control, buffer A105 was used. These dilutions were incubated 10 minutes at
55 C.
After spinning the tubes briefly, O.D. at 260 nm was measured. The amount of
viral
particles was calculated as follows: 1 OD 260 nm = 1.1 X 1012 physical
particles/ml.
The results were typically between 5 X 10" and 1 X 1012 physical particles
/ml.
b) TaqMan PCR Assay
TaqMan PCR assay was used for adenovectors genome quantification
(Q-PCR particles/ml). TaqMan PCR assay was performed using the ABI Prism 7700-
sequence detector. The reaction was performed in a final 50 I volume in the
presence of oligonucleotides (at final 200 nM) and probe (at final 200 M)
specific
for the adenoviral backbone. The virus was diluted 1/10 in 0.1% SDS PBS and
incubated 10 minutes at 55 C. After spinning the tube briefly, serial 1/10
dilutions (in
water) were prepared. 10 Al the iO3, 10-5 and 104 dilutions were used as
templates in
the PCR assay.
The amount of particles present in each sample was calculated on the
basis of a standard curve run in the same experiment. Typically results were
between
1 X 1012 and 3 X 1012 Q-PCR particles /ml.
c) Expression of HCV Non-Structural Proteins
Expression of HCV NS proteins was tested by infection of HeLa cells.
Cells were plated the day before the infection at 1.5 X 106 cells/dish (10 cm
0 Petri
dishes). Different amounts of CsC1 purified virus corresponding to m.o.i. of
50, 250
56
CA 02718802 2011-02-16
and 1250 pp/cell were diluted in medium (FCS free) up to a final volume of 5
ml. The
diluted virus was added on the cells and incubated for 1 hour at 37 C in a CO2
incubator (gently mixing every 20 minutes). 5 ml of 5% HS-DMEM was added and
the cells were incubated at 37 C for 48 hours.
Cell extracts were prepared in 1% Triton/TEN buffer. The extracts
were run on 10% SDS-acrylamide gel, blotted on nitrocellulose and assayed with
antibodies directed against NS3, NS5a and NS5b in order to check the correct
polyprotein cleavage. Mock-infected cells were used as a negative control.
Results
from representative experiments testing the Ad5-NS, MRKAd5-NSmut, 1VIRKAd6-
NSmut and MRKAd6-NSOPTmut are shown in Figure 14.
Example 13: Mice Immunization with Adenovectors Encoding Different NS
Cassettes
The adenovectors Ad5-NS,IVIRKAd5-NSmut, MRKAd6-NSmut and
MRKAd6-NSOPTmut were injected in C57Black6 mice strains to evaluate their
potential to elicit anti-HCV immune responses. Groups of animals (N=9-10) were
injected intramuscularly with 109 pp of CsC1 purified virus. Each animal
received two
doses at three weeks interval.
Humoral immune response against the NS3 protein was measured in
post dose two sera from C57Black6 immunized mice by ELISA on bacterially
expressed NS3 protease domain. Antibodies specific for the tested antigen were
detected with geometric mean titers (GMT) ranging from 100 to 46000 (Tables 6,
7, 8
and 9).
Table 6: Ad5-NS
GMT
Mice n. 1 2 3 4 5 6 7 8 9 10
Titer 50 253 50 50 50 2257 504 50 50 50 108
57
CA 02718802 2011-02-16
=
Table 7: Ad5-NSmut
, GMT
Mice 11 12 13 14 15 16 17 18 19 20
n.
Titer 3162 78850 87241 6796 12134 3340 18473 13093 76167 49593 23645
=
Table 8: MRKAd6-NSmut
GMT
Mice 21 22 23 24 25 26 27 28 29 30
n.
Titer 125626 39751 40187 65834 60619 69933 21555 49348 29290 26859 46461
Table 9: MRKAd6-NSOPTmut
GMT
Mice n. 31 32 33 34 35 36 37
Titer 25430 3657 893 175 10442 49540 173 2785
T cell response in C57Black6 mice was analyzed by the quantitative
ELISPOT assay measuring the number of IFNy secreting T cells in response to
five
pools (named from F to L+M) of 20mer peptides overlapping by ten residues
encompassing the NS3-NS5B sequence. Specific CD8+ response induced in
C57Black6 mice was analyzed by the same assay using a 20mer peptide
encompassing a CD8+ epitope for C57Black6 mice (pep1480). Cells secreting IFNy
in an antigen specific-manner were detected using a standard ELIspot assay.
Spleen cells, splenocytes and peptides were produced and treated as
described in Example 3, supra. Representative data from groups of C57Black6
mice
(N=9-10) immunized with two injections of 109 viral particles of vectors Ad5-
NS,
MRKAd5-NSmut and MRKAd6-NSmut are shown in Figure 15.
Example 14: Immunization of Rhesus macaques with Adenovectors
Rhesus macaques (N=3-4) were immunized by intramuscular injection
of Csa purified Ad5-NS, MRKAd5-NSmut, MRKAd6-NSmut or MRKAd6-
58
CA 02718802 2011-02-16
NSOPTmut virus. Each animal received two doses of 10" or 101 vp in the
deltoid
muscle at 0, and 4 weeks.
CMI was measured at different time points by a) IFN-y ELISPOT (see
Example 3, supra), b) IFN-y ICS and c) bulk cm assays. These assays measure
HCV
antigen-specific CD8+ and CD4+ T lymphocyte responses, and can be used for a
variety of mammals, such as humans, rhesus monkeys, mice, and rats.
The use of a specific peptide or a pool of peptides can simplify antigen
presentation in CTL cytotoxicity assays, interferon-gamma ELISPOT assays and
interferon-gamma intracellular staining assays. Peptides based on the amino
acid
sequence of various HCV proteins (core, E2, NS3, NS4A, NS4B, NS5a, NS5b) were
prepared for use in these assays to measure immune responses in HCV DNA and
adenovirus vector vaccinated rhesus monkeys, as well as in HCV-infected
humans.
The individual peptides are overlapping 20-mers, offset by 10 amino acids.
Large
pools of peptides can be used to detect an overall response to HCV proteins
while
smaller pools and individual peptides may be used to define the epitope
specificity of
a response.
IFN-y/CS
For 1FN-y ICS, 2 x 106 PBMC in 1 ml R10 (RPM1 medium,
supplemented with 10% FCS) were stimulated with peptide pool antigens. Final
concentration of each peptide was 2 g/ml. Cells were incubated for 1 hour in
a CO2
incubator at 37 C and then Brefeldin A was added to a final concentration of
10 mg
/m1 to inhibit the secretion of soluble cytolcines. Cells were incubated for
additional
14-16 hours at 37 C.
Stimulation was done in the presence of co-stimulatory antibodies:
CD28 and CD49d (anti-humanCD28 BD340975 and anti-humanCD49d BD340976).
After incubation, cells were stained with fluorochrome-conjugated antibodies
for
surface antigens: anti-CD3, anti-CD4, anti-CD8 (CD3-APC Biosource APS0301,
CD4-PE BD345769, CD8-PerCP BD345774).
To detect intracellular cytolcines, cells were treated with FACS
permeabilization buffer 2 (BD340973), 2x final concentration. Once fixed and
permeabilized, cells were incubated with an antibody against human IFN-y, IFN-
yFTTC (Biosource AHC4338).
Cells were resuspended in 1% formaldehyde in PBS and analyzed at
FACS within 24 hours. Four color FACS analysis was performed on a FACSCalibur
59
CA 02718802 2011-02-16
instrument (Becton Dickinson) equipped with two lasers. Acquisition was done
gating on the lymphocyte population in the Forward versus Side Scatter plot
coupled
with the CD3, CD8 positive populations. At least 30,000 events of the gate
were
taken. The positive cells are expressed as number of IFN-y expressing cells
over 106
lymphocytes.
IFN-y ELISPOT and IFN-y ICS data from immunized monkeys after
one or two injections of 1010 or 1011 vp of the different adenovectors are
reported in
Figures 16A-16D, 17A, and 17B.
Bulk CTL Assays
A distinguishing effector function of T lymphocytes is the ability of
subsets of this cell population to directly lyse cells exhibiting appropriate
MHC-
associated antigenic peptides. This cytotoxic activity is most often
associated with
CD8+ T lymphocytes.
. PBMC samples were infected with recombinant vaccine viruses
expressing HCV antigens in vitro for approximately 14 days to provide antigen
restimulation and expansion of memory T cells. Cytotoxicity against autologous
B
cell lines treated with peptide antigen pools was tested.
The lytic function of the culture is measured as a percentage of specific
lysis resulted from chromium released from target cells during 4 hours
incubation
with CTL effector cells. Specific cytotoxicity is measured and compared to
irrelevant
antigen or excipient-treated B cell lines. This assay is semi-quantitative and
is the
preferred means for determining whether CTL responses were elicited by the
vaccine.
=
Data after two injections from monkeys immunized with 1011 vp/dose with
adenovectors Ad5-NS, MRKAd5-NSmut and MRKAd6-NSmut are reported in
Figures 18A-18F.
Other embodiments are within the following claims. While several
embodiments have been shown and described, various modifications may be made
without departing from the spirit and scope of the present invention.
