Note: Descriptions are shown in the official language in which they were submitted.
CA 02736087 2011-03-31
Description
Background
Chagas disease is a tropical parasitic disease caused by the flagellate
protozoan
Trypanosoma cruzi. T. cruzi is commonly transmitted to humans and other
mammals by an
insect vector, the blood-sucking assassin bugs of the subfamily Triatominae
(family
Reduviidae) most commonly species belonging to the Triatoma, Rhodnius, and
Panstrongylus
genera. The disease may also be spread through blood transfusion and organ
transplantation,
ingestion of food contaminated with parasites, and from a mother to her fetus.
Chagas disease passes through two successive stages, the acute and the chronic
phase.
After the acute clinical manifestations disappear, the infection rests with a
long period of
clinical latency, called the indeterminate form period, which may last
throughout life or evolve
to a chronic phase with cardiac or gastrointestinal involvement. The chronic
phase is
characterised by high specific IgG antibody production and low, intermittent
parasitaemia,
which results in the low sensitivity of the classic parasitological
techniques. Diagnosis in this
stage mainly relies on serological techniques, despite their lack of
specificity when crude T.
cruzi antigens are used (Luquetti and Rassi, 2000). Also false-negative
serological results
have been reported, which may be related to the antigen used, the parasite
strain involved in
the infection, or poor immune response of the patient (Luquetti and Rassi,
2000). In addition,
serology is not accurate enough in the evaluation of treatment efficacy, as it
remains positive
from 6 months to some years after successful treatment, particularly in
adults, and has low
positive predictive value in the diagnosis of congenital Chagas disease in the
first months of
life due to transfer of antibodies from mother to child. Molecular-based
assays, in particular
amplification by the polymerase chain reaction (PCR), provide a more sensitive
alternative to
traditional parasitological techniques. Some PCR protocols have been
described, leading to
unequal results, probably due to differences in the volume of blood processed,
the DNA
extraction procedure, or the DNA region of T. cruzi amplified (Junqueira et
al., 1996; Virreira et
al., 2003). NestedPCR(N-PCR) provides higher sensitivity than single-run PCR
assay and has
already been reported for supplementary diagnosis of Chagas disease (Marcon et
al., 2002).
This technique is highly sensitive, but time consuming and entails a high risk
of false positive
results due to contaminating amplicons.
In contrast, real-time PCR technology uses fluorescent labels for continuous
monitoring of
amplification throughout the reaction. The main advantages are the rapid
throughput of results
(amplification and detection in one step) and reduced risk of carry-over
contamination (minimal
manipulation of samples and use of UNG). Real-timePCR can be optimised both as
a
qualitative and quantitative assay. The present invetion provides probe for
the detection of T.
cruzi in biological samples. The probe generally hybridezed to a strand of an
amplication
product (or amplicon) to form an amplification prodect/probe hybrid, which can
be detected
Summary of the invention
a genomic DNA sequence which had been previously described as specific for all
T. cruzi
CA 02736087 2011-03-31
lineages (Moser et al., 1989; Virreira et al., 2003). GenBank accession no.
AY520036
As will be appreciated by one skilled in the art, any of the ologonucleotide
sequences (or active
fragements thereof) disclosed herein for amplification, detection or
quantification of T. cruzi
may be employed as detection probe or amplification primer, depending on the
intended use
and /or assay format.
Methods for labeling nucleic acid molecules are well-known in the art. For a
review of labeling
protocols, label detection techniques, and recent developments in the field,
see, for example,
L.J. Jricka, Ann. Clin. Biochem. 2002, 39: 114-129; R.P. van Gijlswijk et al.,
Expert Rev. Mol.
Diagn. 2001. Any of a wide variety of detectable aganents can be used in the
practice of the
present invention. Suitable detectable agents, various ligands, radionuclides,
fluorescent dyes,
chemiluminescent agents.
In certain embodiments, the inventive detection probe are fluorescently
labeled. Numberous
known fluorescent labeling moieties of a wide variety of chemical structures
and physical
characteristics are suitable for use in the practice of this invention.
Suitable fluorescent dyes
include, but are not limited to, fluorescein and fluorescein dyes (e.g.,
fluorescein,
6-carboxyfluorescein or FAM), Carbocyanine, merocyanine, styryl dyes, oxonol
dyes,
phycoerythrin, erythrosin, eosin, rhodamine dyes (e.g.,
carboxytetramethyirhodamine or
TAMRA, carboxyrhodamine 6G, carboxy-X-rhodamine (ROX), lissamine rhodamine B,
rhodamine 6G, rhodamine Green, rhodamine Red, tetramethylrhodamine or TMR),
cournarin
and coumarin dyes (e.g., methoxycoumarin, dialkylaminocoumarin,
hyfroxycoumarin and
aminomethylcoumarin or AMCA), Orgegon Green Dyes (e.g., Oregon Green 488,
Oregon
Green 500, Oregon Green 514), Texas Red, Texas Red-X, Spectrum Red, Spectrum
Green,
cyanine dyes, Alexa Fluor dyes, Bodipy dyes, IRDyes, and the like. For more
example of
suitable fluorescent dyes and methods for linking or incorporating fluorescent
dyes to nucleic
acid molecules see, for example, "The Handbook of Fluorescent Probes and
Research
Products", 9 Ed, Molecular Probes, Inc., Eugene, OR. Fluorescent dyes as well
as labeling kits
are commercially available from, for example, Molecular Probes In.
The use of physically linked fluorescent reporter/quencher molecule pairs is
also within the
scope of the invention. The use of such systems in TaqMan TM assay (as
described, for
example, in U.S. Pat. Nos. 5,210,015; 5,804,375;5487,792 and 6214,979) or as
Molecular
Beacons (as described, for example in, S. Tyagi and F.R.Kramer, Nature
Biotechnol. 1996, 14:
303-308) is well-known in the art. With the TaqMan TM assay format, products
of the
amplification reaction can be detected as they are formed in a so-called "real-
time" manner. As
a result, amplification product/probe hybrides are formed and detected while
the reaction
mixture is under amplification conditions.
Test samples will often be obtained or isolated from patients suspected of
being infected with T.
cruzi . As already mentioned, test sample may be used without further
treatment after isolation
or, alternativively, it may be processed before analysis. For example, test
sample may be
CA 02736087 2011-03-31
treated so as to release T. cruziB nucleic acids from cells that contain them.
Mothods of nucleic
acid extraction are well-known in the airt and include chemical methods,
temperature methods,
and mechanical methods (see, for example, J. Sambrook et al., "Molecular
Cloning: A
laboratory Manual", 1989, 2en Ed., Cold Spring Harbour Laboratory Press: New
York, NY).
There are also numerous different and versatile kits that can be used to
extract nucleic from
biological samples that are commercially available from, for example, Qiagen
Inc.(Valencia,
CA).
As already mentioned, probe of the present invention are specific for T.
cruzi, Accordingly, the
present invention also provides methods for simultaneously detectiong the
presence of T. cruzi
and another organism in a test sample using a combination of at least two
primer sets or
primer/probe sets.
Accordingly, the present invetion provides probe for the detection of T. cruzi
in biological
samples. The probe generally hybridezed to a strand of an amplication product
(or amplicon)
to form an amplification prodect/probe hybrid, which can be detected.
In another aspect, the present invention provides kits comprising materials
useful for the
detection of T. cruzi infection according to methods described herin. The
inventive kits may be
used by diagnostic laboratories, experimental laboratories, or practitioners.
Basic material and reagents required for the detection of T. cruzi according
the the present
invention may be assembled together in a kit. In certain embodiements, kits
comprise at least
one inventive primer set or primer/probe set, and optionally, amplification
reaction reagents.
Each kit preferably comprises the reagents which render the procedure
specific. Thus, a kit
adapted for use with NASBA preferably contains primers with a RNA ploymersase
promoter
linked to the target binding sequence, while a kit adapted for use with SDA
preferalby contains
primers including a restriction endonuclease recognition site 5' to the target
binding sequence.
Similarly, when the kit is adapted for use in a 5' nuclease assay, such as the
TaqMan assay,
the detection probes preferably contain at least one fluorescent reporter
moiety and at least
one quencher moiety.
Examples
The following examples describes some of the preferred modes of making and
practicing the
present invention. However, it should be understood that this example is for
illustrative
purposes only and is not meant to limit the scope of the invention.
Table 3 shows the results of a TaqMan PCR assay using primers and the
inventive specific
oligonucleotide. The set of primers and the probe was found to be efficient at
detecting T. cruzi.
i
CA 02736087 2011-03-31
.. . w .. :... .
4A OW
A"
.! T f. .p _
. _, _, ...aim ~...M..+.. ...,
Brief Description of The Drawing
Table 1 shows oligonudeotide sequence of the 195-bp satellite DNA in
Trypanosoma cruzi (the
GenBank accession no. AY520036).
Table 2 shows inventive specific oligonudeotide sequence derived from the 195-
bp satellite DNA
in Tiypanosoma cruzi (the GenBank accession no. AY520036).
Table 3 shows the results of a TaqMan PCR assay using primers and the
inventive specific
oligonucleotide. The set of primers and the probe was found to be efficient at
detecting T. cruzi.
Definitions
The terms "probe" and "detection probe" are used herein interchangeably and
refer to an
oligonucleotide capable of selectively hybridizing to at least a portion of a
target sequence
under appropriate conditions (e.g., a portion of a target sequence that has
been amplified). In
certain embodiments, a detection probe is labeled with a detectable moiey.
The terms "fluorophore", "fluorescent moiety", and " fluorescent dye" are used
herein
interchchangeably. They refer to a molecule that absobs a quantum of
electromagnetic
radiation at one wavelength, and emits one or more photons at a different,
typically longer,
wavelength in response. Numerous fluorescent dyes of a wide variety of
structures and
characteristics are suitable for use in the practive of the invention. Methods
and materials are
known for fluorescently labeling nucleic acid molecules. Prefeably, a
fluorescent moiety
absorbs and emits light with high efficiency, and is photostable. Rather than
being directly
detactable themselves, some fluorescent duyes transfer energy to another
fluorescent dye in a
CA 02736087 2011-03-31
process called fluorescent resonance energy transfer(FRET), and the second dye
produces
the detected signal. Such FRET fluorescent dye pairs are also encompassed by
the term
"fluorescent moiety". The use of physically linked fluorescent
reporter/quencher moeety is also
within the scope of the present invention. In these embodiments, when the
fluorescent reporter
and quencher moiety are held in close promimity, such as at the ends of a
nucleic acid probe,
the quencher moiety prevents detction of a luorescent signal from the reporter
moiety. When
the two moieties are physically separated, such as, for example, after
cleavage by a DNA
polymerase, the fluorescent signal form the erporter moiety becomes
detectable.
The term 'TagMan" assay, also known as fluorogenic 5' nuclease assay, is a
powerful and
versatile PCR-based detection system for nucleic acid targets. Analysis is
performed in
conjunction with thermal cycling by monitoring the generation of fluorescence
signals. The
assay system has the capability of generating quantitative data allowing the
determination of
target copy numbers. For example, standard curves can be generated using
serial dilutions of
previously quantified suspensions of Trypanosoma cruzi , against which unknown
samples can be
caompared. The TaqMan assay is conveniently performed using, for example,
AmpliTaq Gold DNA
polymerrase, which has endogenous 5' nuclease activity, to digest an
oligonucleotide probe labeled with
both a fluorescent reporter dye and a quencher moiety, as described above.
Assay results are obtained
by measuring changes in fluorescence that occur during the amplification cycle
as the probe is digested,
uncouping the flurorescent and quencher moieties and causing an increase in
the flurorescence signal
that is proportional to the amplification of the target sequence.
The term "isolated" when referring to an oligonudeotide means an
oligonucleotide, which by virtue of its
origin or manipulation, is esparated from at least some of the components with
which it is naturally
associated or with which it is associated when initially obtained or prepared.
By "isolated", it is
alternatively or additionally meant that the oligonucleotide of interest is
produced or synthesized by the
hand of man.
The Drawing
Table 1 shows oligonudeotide sequence of the 195-bp satellite DNA In
Trypanosome cruzi (the
GenBank accession no. AY520036).
GAGCTCTTGCCCACACGGGTGCTGCACTCGGCTGATCGTTTTCGAGCGGCTGCTGCATC
ACACGTTGTGGTCCAAATTTTTGTTTCCGATTGTGAATGGTGGGAGTCAGAGGCACTCTC
TGTCAATATCTGTTTGCGTGTTCACACACTGGACACCAAACAACCCTGAACTATCCGCTG
C TTGGAGGAATTTCGC
Table 2 shows inventive specific oligonucleotide sequence derived from the 195-
bp satellite
DNA in Trypanosoma cruzi (the GenBank accession no. AY520036).
CGTGTTCACACACTGGACACCAAAC
Table 3 shows the results of a TaqMan PCR assay using primers and the
inventive specific
CA 02736087 2011-03-31
oligonucleotide. The set of primers and the probe was found to be efficient at
detecting T. cruzi.
)WW
