Note: Descriptions are shown in the official language in which they were submitted.
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
1
MYOMETRIAL-DERIVED MESENCHYMAL STEM CELLS
FIELD OF THE INVENTION
The invention relates to methods of isolating adult stem cells, to the cells
thus
isolated and to applications thereof. More specifically, the invention relates
to isolated
adult stem cells which are derived from the myometrium, which can be
differentiated
and give rise to a series of cell lineages and which present specific markers,
such as cell
surface antigens. The cells provided by the present invention can be used, for
example,
in cell therapy and in the search for and development of novel medicaments.
BACKGROUND OF THE INVENTION
Currently, technological development in the field of stem cell research has
led
them to be considered a promising source of organs and tissues for those types
of
pathologies requiring organ or tissue transplants. Indeed, stem cell therapy
holds
tremendous promise for repair and/or regeneration of aging and damaged tissue.
Theoretically, the stem cells can undergo cellular division for self-
maintenance
during an unlimited period of time to originate phenotypically and
genotypically
identical cells. Furthermore, they have the capacity to differentiate between
one or
several cell types in the presence of certain signals or stimuli.
The generation of organs and cells from the stem cells of the patient or from
immunocompatible heterologous cells, so that the immune system of the
recipient does
not recognise them as foreign, offers a series of associated advantages that
solve the
problems brought on by the scarcity of donors and the risk of rejection. The
use of stem
cells for organ and tissue regeneration constitutes a promising alternative
therapy for
diverse human pathologies including: chondral, bone and muscular lesions,
neurodegenerative diseases, immunological rejection, cardiac disease and skin
disorders.
In addition to cellular therapy applications, stem cells have many other
potential
applications related to biomedical technologies that can help to facilitate
biopharmaceutical research and development activities. One of these
applications lies in
the development of cellular models of human and animal diseases that can help
to
substantially improve the celerity and efficacy of the process of searching
for and
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
2
developing new drugs. At this time, the methods most commonly used to measure
the
biological activity of a new compound before it goes into clinical trials
consist of
incomplete biochemical techniques or costly and inadequate animal models. Stem
cells
could be a potential source of virtually unlimited quantities of cells, both
undifferentiated and differentiated, for conducting in vitro tests to search
for and
develop new therapeutic compounds and to determine their activity, metabolism
and
toxicity. The development of such tests, particularly high-throughput
screening (HTS),
would reduce the time and money needed to develop compounds with therapeutic
activity, eliminate, to a large extent, the need to use animals for
experimentation and
would also reduce the exposure of patients to the adverse effects of the
compounds
during clinical trials. In addition, the availability of different types of
cells from various
individuals would provide a better understanding of the effects of a
potentially
therapeutic compound on a specific individual, leading to the full development
of the
pharmacogenomic field, where the activity of a compound would be correlated
with the
individual's genetic structure. The stem cells and their differentiated
progeny are also
very valuable in the process of searching for and characterising new genes
involved in a
wide variety of biological processes including development, cellular
differentiation and
neoplastic processes.
Depending on the origin of the stem cells, we can differentiate between
embryonic stem cells (ES cells) and adult stem cells. The ES cells come from
the
internal cellular mass of the blastocyte and their most relevant feature is
the fact that
they are pluripotential, which means that they can give rise to any adult
tissue derived
from the three embryonic layers. Adult stem cells are partially compromised
cells
present in adult tissue which can remain in the human body for decades
although they
become scarcer with the passage of time.
Despite the high pluripotentiality of ES stem cells, therapies based on the
use of
adult stem cells offer a series of advantages over those based on ES cells.
First of all, it
is complicated to control the culturing conditions of ES cells without
inducing their
differentiation, which raises the economic cost and the work required to use
these types
of cells. Furthermore, ES cells must go through several intermediate stages
before they
become the specific cell type needed to treat a particular pathology, a
process that is
controlled by chemically complex compounds. There are also problems related to
the
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
3
safety of the therapeutic use of ES cells due to the high probabilities that
the
undifferentiated stem cells from embryonic tissue will produce a type of
tumour known
as teratocarcinoma. Finally, the cells derived from ES cells are usually
rejected by the
immunological system due to the fact that the immunological profile of such
cells
differs from that of the recipient. Although this problem could be addressed
by using a
process known as "therapeutic cloning", in which autologous ES cells can be
obtained
by transferring the nucleus of a somatic cell from a patient to the ovocyte of
a female
donor, this technique has not yet been developed in humans and poses serious
ethical
and legal problems. Another solution could be the generation of "universal"
cellular
lines with generalised immune compatibility, but there is no technology at
this time that
allows obtaining such cells.
On the contrary, adult stem cells are not rejected by the immune system if
obtained by autologous transplant. Furthermore, the fact that they are
partially
compromised reduces the number of differentiation stages necessary to generate
specialised cells. In addition, the use of this type of cells is not
associated with any type
of legal or ethical controversy. Moreover, although these types of cells have
less
differentiation potentiality than ES cells, most of them are really
multipotent which
means that they can be differentiated to more than one type of tissue. What
this suggests
is that if an adequate source of adult stem cells is obtained, we could
provide different
cell types capable or covering multiple therapeutic applications.
A new type of mammal stem cell called "Multipotent Adult Progenitor Cell"
(MAPC) was recently isolated from bone marrow and other tissues. This type of
stem
cells appears to be the progenitor of the so-called mesenchymal stem cells and
shows a
great deal of multipotentiality. However, the process of isolating and
cultivating them is
long and costly, and it includes the use of large quantities of diverse growth
factors. In
the last several years many different types of mesoderm stem cells have been
isolated
from both mouse and human tissues and characterized to different extent. These
include
endothelial progenitor cells (EPC), multipotent adult progenitor cells (MAPC),
side
population cells (SP), mesoangioblasts, stem/progenitor cells from muscle
endothelium,
sinovia, dermis, and adipose tissue. Different experimental procedures,
different sources
and partial characterization still prevent a complete understanding of the
heterogeneity
of these cells; even less is known on their origin and possible lineage
relationships.
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
4
Whatever the case, many of these cells, such as MDSC or MA-PC have been shown
to
differentiate into skeletal muscle in vitro. Some of these cells grow
extensively in vitro
but others such as EPC and SP do not; on the other hand EPC and SP can
circulate
whereas systemic delivery has not been tested for most of the other cell
types. For
example, it was recently shown that cells isolated from adipose tissue can be
grown in
vitro extensively, differentiate into several tissues including skeletal
muscle and give
rise to human dystrophin expressing fibers. But few of these cells can
differentiate
efficiently to other cells types or be obtained and grow easily.
There is, therefore, a need to obtain an easily available source of
multipotent
stem cells. In particular, cells that can be easily isolated from a live
subject without
involving significant risk or pain, without high isolation and culturing costs
and with
minimal contamination from other cell types and not possessing the fear of
karyotypic
abnormalities during culture and possibility of oncogenesis.
Document EP1876233 describes the isolation of a cell population which
originate in an endometrial tissue or from an endometrial tissue isolated from
a
menstrual blood, a cord blood or an appendage of a fetus. These cells can
differentiate
into cardiac muscle cells. Masanori O. et at (PNAS, 2007. vol. 104, 47: 18700-
18705)
have described the isolation of a side population in human uterine myometrium
with
phenotypic and functional characteristics of stem cells. Said cells are
positive for the
surface markers CD90, CD73, CD105, CD34 and STRO-1 and negative for CD44. Said
cells were able to differentiate into adipocyte, osteocyte and smooth muscle
cells. The
isolation of said cell population is carried out by means of hysterectomy,
i.e. by surgical
removal of the uterus.
SUMMARY OF THE INVENTION
The authors of the present invention have isolated a new cell population from
the
mouse adult uterine wall, in particular, from the myometrial tissue, by means
of using a
simple and non-invasive approach. These cells are able to differentiate into
many
different mesoderm tissues types, including smooth muscle, adipocytes,
osteoblasts,
skeletal muscle and neural tissue thus, making them suitable for regenerative
medicine.
Hence, in a first aspect, the present invention refers to an isolated,
myometrial-
derived mesenchymal stem cell population characterized in that the cells of
said cell
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
population are positive for CD3 1, CD34, CD44, CD 117, SSEA-4, HLA-DR and WGA-
lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-
60
and TRAl-81 surface markers.
In another aspect, the invention refers to said isolated stem cell population
of the
5 invention for use as a medicament.
In a further aspect, the invention relates to the isolated stem cell
population of the
invention for the treatment of a tissue degenerative condition.
In another aspect, the invention refers to a pharmaceutical composition
comprising an isolated stem cell population according to the invention and an
acceptable pharmaceutical vehicle.
According to a further aspect, the invention refers to a method for isolating
a stem
cell population from myometrial tissue, wherein the cells of said cell
population are
characterized in that are positive for CD3 1, CD34, CD44, CD 117, SSEA-4 and
WGA-
lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-
60
and TRAl-81 surface markers, said method comprising the steps o
i) incubating a myometrial tissue sample in a suitable cell culture medium on
a
solid surface under conditions allowing cells of said sample to adhere to said
solid surface;
ii) recovering the cells from said cell culture which do not adhere to said
solid
surface or which present low adherence capacity; and
iii) confirm that the selected cell population presents the phenotype of
interest.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. Surface markers expression analyzed by flow cytometry. FACS analysis
using
a panel of antibodies: CD13, CD31, CD34, CD44, CD45, CD80, CD90, CD117,
CD133, CD146, PAL, HLA-DR, TRAl-60, TRAl-81, SSEA-4, WGA and TMRM.
Figure 2. Expression of MAMps markers analyzed by PCR. RNA extracted from the
different clones cells was analyzed for the presence of markers genes like
Sox2,
hTERT, MEF2a/2c and Tbx2/5 by PCR.
Figure 3. Staining for alkaline phosphatase revealing expression at varying
levels in
100% of the cell population.
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
6
Figure 4: EMSCs immunostaining for nestin after one week in culture in neural
stem
cell proliferation medium. Phase contrast (left panel), Nestin (middle panel),
nuclei
(right panel). (Microphotographs taken with a Nikon camera in a Nikon
Fluorescence
Inverted Microscope with a 20x objective).
DETAILED DESCRIPTION OF THE INVENTION
The present invention refers to a new mesenchymal stem cell population which
has been isolated from myometrial tissue, said stem cell population showing
capability
to differentiate into multiple cell types in vitro.
Thus, in a first aspect, the present invention refers to an isolated,
myometrial-
derived mesenchymal stem cell population, hereinafter referred to as "cell
population of
the invention", characterized in that the cells of said cell population are
positive for
CD31, CD34, CD44, CD 117, SSEA-4 (Stage-specific embryonic antigen-4), HLA-DR
and WGA-lectin (wheat germ agglutinin-lectin) surface markers and negative for
CD 13,
CD45, CD80, CD133, CD146, TRA1-60 and TRA1-81 (Tumor Rejection Antigen 1)
surface markers.
As used herein, the term "MHC" (major histocompatibility complex) refers to a
subset of genes that encodes cell-surface antigen-presenting proteins. In
humans, these
genes are referred to as human leukocyte antigen (HLA) genes. Herein, the
abbreviations MHC or HLA are used interchangeably.
As used herein, the term "isolated" applied to a cell population refers to a
cell
population, isolated from the human or animal body, which is substantially
free of one
or more cell populations that are associated with said cell population in vivo
or in vitro.
The cells of the cell population of the invention, hereinafter referred to as
the
"cells of the invention", derive from the myometrial tissue. The term
"myometrial
tissue" refers to tissue derived from the middle layer of the uterine wall.
The term
"uterus" as used herein, encompasses the cervical canal and uterine cavity.
Hence, it is
noted that throughout the specification and claims, the term "uterine tissue"
refers to
any material in the cervical canal and uterine cavity.
The cells of the invention can be obtained from any suitable source of
myometrial tissue from any suitable animal, including humans. In general, said
cells are
obtained from non-pathological post-natal mammalian myometrial tissue. In a
particular
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
7
embodiment, the cells of the cell population of the invention are from a
mammal, e.g, a
rodent, primate, etc, preferably, from a human.
As mentioned above, the cells of the invention are characterized in that are
positive for CD3 1, CD34, CD44, CD 117, SSEA-4, HLA-DR and WGA-lectin surface
markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl-81
surface markers.
As used herein, "negative" with respect to cell surface markers means that, in
a
cell population comprising the cells of the invention, less than 10%,
preferably 9%, 8%,
7%, 6%, 5%, 4%, 3%, 2%, 1 % or none of the cells show a signal for a specific
cell
surface marker in flow cytometry above the background signal, using
conventional
methods and apparatus (for example a Calibur (Becton Dickinson) FACS system
used
with commercially available antibodies and standard protocols known in the
art).
In a particular embodiment, the cells of the invention are characterised in
that
they express the following cell surface markers CD3 1, CD34, CD44, CD 117,
SSEA-4,
HLA-DR and WGA-lectin, i.e., the cells of the invention are positive for said
cell
surface markers. Preferably, the cells of the invention are characterised in
that they have
significant expression levels of said cell surface markers. As used herein,
the expression
"significant expression" means that, in a cell population comprising the cells
of the
invention, more than 10%, preferably 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or
all of the cells show a signal for a specific cell surface marker by flow
cytometry above
the background signal using conventional methods and apparatus (for example a
Calibur
(Becton Dickinson) FACS system used with commercially available antibodies and
standard protocols known in the art). The background signal is defined as the
signal
intensity given by a non-specific antibody of the same isotype as the specific
antibody
used to detect each surface marker in conventional FACS analysis Thus for a
marker to
be considered positive the specific signal observed is stronger than 10%,
preferably
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 500%, 1000%, 5000%, 10000% or
above, than the background signal intensity using conventional methods and
apparatus
(for example a Calibur (Becton Dickinson) FACS system used with commercially
available antibodies and standard protocols known in the art).
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
8
Commercially available and known monoclonal antibodies against said cell-
surface markers (e.g., cellular receptors and transmembrane proteins) can be
used to
identify the cells of the invention.
In a particular embodiment of the invention, the cells of the cell population
of the
invention are characterized in that they express at least one of the following
genes:
Mef2c (myocyte enhancer factor 2C), Sox2 (SRY (sex determining region Y)-box
2),
Tbx5 (T-box 5) and hTERT (telomerase reverse transcriptase catalytic subunit).
In a
more particular embodiment, said cells do not express Mef2a (myocyte enhancer
factor
2A) and Tbx2 (T-box 5) genes.
The term "gene" as used herein, may be a gene comprising transcriptional
and/or
translational regulatory sequences and/or a coding region and/or non-
translated
sequences (e.g., introns, 5'- and 3 '-untranslated sequences). The coding
region of a gene
may be a nucleotide sequence coding for an amino acid sequence or a functional
RNA,
such as tRNA, rRNA, catalytic RNA, siRNA, miRNA or antisense RNA. A gene, may
also be an mRNA or cDNA corresponding to the coding regions (e.g., exons and
miRNA) optionally comprising 5'- or 3 '-untranslated sequences linked thereto.
A gene
may also be an amplified nucleic acid molecule produced in vitro comprising
all or a
part of the coding region and/or 5'- or 3 '-untranslated sequences linked
thereto.
The term "gene expression" refers to a process that involves transcription of
the
DNA code into mRNA, translocation of mRNA to ribosomes, and translation of the
RNA message into proteins. The determination of the expression levels of said
genes
can be carried out by any standard method known in the state of the art. As an
illustrative, non limitative, example, said methods include measuring the
expression
levels of the mRNA encoded by the above mentioned genes. For this purpose, a
biological sample comprising the cells of the invention may be treated to
physically or
mechanically disrupt cell structure, to release intracellular components into
an aqueous
or organic solution to prepare nucleic acids for further analysis. The nucleic
acids are
extracted from the sample by procedures known to the skilled person and
commercially
available. RNA is then extracted by any of the methods typical in the art, for
example,
Sambrook, Fischer and Maniatis, Molecular Cloning, a laboratory manual, (2nd
ed.),
Cold Spring Harbor Laboratory Press, New York, (1989). Preferably, care is
taken to
avoid degradation of the RNA during the extraction process.
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
9
While all techniques of gene expression profiling are suitable for use in
performing the foregoing aspects of the invention, the gene mRNA expression
levels are
often determined by reverse transcription polymerase chain reaction (RT-PCR).
In order to normalize the values of mRNA expression among the different
samples, it is possible to compare the expression levels of the mRNA of
interest in the
test samples with the expression of a control RNA. Preferably, the control RNA
is
mRNA derived from housekeeping genes and which code for proteins which are
constitutively expressed and carry out essential cellular functions. Preferred
housekeeping genes for use in the present invention include 0-2-microglobulin,
ubiquitin, 18-S ribosomal protein, cyclophilin, GAPDH and actin.
Preferably, in the various embodiments of the invention, the detection method
provides an output (i.e., readout or signal) with information concerning the
presence,
absence of the marker(s) in a sample. According to the present invention, the
output
may be qualitative (e.g., "positive" or "negative"). In this sense, "positive
gene
expression" is considered when an amplification product of said gene using any
standard amplification reaction is obtained. Means for evaluating or detecting
said
amplification product are well known in the state of the art. In an
illustrative way, said
methods include, for example, visualisation of a band in an agarose gel as
shown in the
Example 1 accompanying the present invention. In order to carry out said
amplification
reaction, specific amplification oligonucleotides for said genes are used.
The terms "oligonucleotide primers" or "amplification oligonucleotides" are
herein used indistinguishably and refer to a polymeric nucleic acid having
generally less
than 1,000 residues, including those in a size range having a lower limit of
about 2 to 5
residues and an upper limit of about 500 to 900 residues. In preferred
embodiments,
oligonucleotide primers are in a size range having a lower limit of about 5 to
about 15
residues and an upper limit of about 100 to 200 residues. More preferably,
oligonucleotide primers of the present invention are in a size range having a
lower limit
of about 10 to about 15 residues and an upper limit of about 17 to 100
residues.
Although oligonucleotide primers may be purified from naturally occurring
nucleic
acids, they are generally synthesized using any of a variety of well known
enzymatic or
chemical methods. The term "amplification oligonucleotide" refers to an
oligonucleotide that hybridizes to a target nucleic acid, or its complement,
and
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
participates in a nucleic acid amplification reaction. Amplification
oligonucleotides
include primers and promoter primers in which the 3' end of the
oligonucleotide is
extended enzymatically using another nucleic acid strand as the template. In
some
embodiments, an amplification oligonucleotide contains at least about 10
contiguous
5 bases, and more preferably about 12 contiguous bases, that are complementary
to a
region of the target sequence (or its complementary strand). Target-binding
bases are
preferably at least about 80%, and more preferably about 90% to 100%
complementary
to the sequence to which it binds. An amplification oligonucleotide is
preferably about
10 to about 60 bases long and may include modified nucleotides or base
analogues.
10 Illustrative, non limitative, amplification oligonucleotides for use
according to the
present invention, include the ones disclosed in the Example 1 accompanying
the
present invention.
In another particular embodiment of the invention, the cells of the invention
express alkaline phosphatase protein.
Alkaline phosphatase (ALP) is a hydrolase enzyme responsible for removing
phosphate groups from many types of molecules, including nucleotides,
proteins, and
alkaloids. Alkaline phosphatase is a stem cell membrane marker and elevated
expression of this enzyme is associated with undifferentiated pluripotent stem
cell. All
primate pluripotent stem cells, like Embryonic stem (ES), embryonic germ (EG)
and
embryonal carcinoma (EC) cells, express alkaline phosphatase activity.
There are different methods known in the state of the art for the detection of
ALP
such as methods based on enzymatic reaction followed by colorimetric or fast
red violet
dye, fluorescent detection and immunostaining.
According to the present invention, any standard technique of protein
expression
profiling is suitable for use in performing the foregoing aspects of the
invention. In
particular, alkaline phosphatase protein expression may be detected by means
of flow
cytometry technique using conventional methods and apparatus (for example a
Calibur
(Becton Dickinson) FACS system used with commercially available antibodies and
standard protocols known in the art). Alternatively, alkaline phosphatase
protein
expression can be determined by means standard protein expression assays in
which
specific antibodies against said protein are used. Such assays include
radioimmunoassays, enzyme immunoassay (e.g., ELISA), immunofluorescence,
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
11
immunoprecipitation, latex agglutination, hemagglutination, and histochemical
tests. As
an illustrative, non limitative, example alkaline phosphatase protein
expression is
determined as described in the Example 1 accompanying the present invention.
The mitochondrial membrane potential (A`Pm) is a key indicator of
mitochondrial function and the characterization of A`Pm in situ allows for an
accurate
determination of mitochondrial bioenergetics and cellular metabolism. Methods
for
measuring A`Pm include using monovalent cationic fluorescent dyes such as
tetramethylrhodamine methyl ester (TMRM) due to their non-invasive nature. The
fluorescent membrane-permeant cationic probe TMRM has become one of the more
readily used probes in the analysis of A`Pm in intact cells. The ability to
measure A`Pm
paralleled to cellular and mitochondrial physiology, protein localization and
real time
enzymatic kinetics enables the characterization of the progression of necrotic
and
apoptotic cell death as well as cell survival following the addition of
stimuli and drugs.
In a particular embodiment, the cells of said cell population present a low
mitochondrial membrane potential. According to the present invention, the term
"low
mitochondrial membrane potential" means that, in a cell population comprising
the cells
of the invention, less than 10%, preferably 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1
% or
none of the cells show a signal for a specific mitochondrial membrane marker
in flow
cytometry above the background signal, using conventional methods and
apparatus (for
example a Calibur (Becton Dickinson) FACS system).
Advantageously, the cells of the invention lack in vivo tumorigenic activity.
Thus, in another particular embodiment of the invention, the cell population
of the
invention does not present tumorigenic activity. The expression "tumorigenic
activity"
as used here in refers to an altered behaviour or proliferative phenotype
which gives rise
to a tumour cell.
The tumorigenic activity of the cells of the invention can be tested by
performing
animal studies using immunodeficient mice strains. In these experiments,
several
million cells are implanted subcutaneously in the recipient animals, which are
maintained for several weeks and analyzed for tumour formation. A particular
assay is
disclosed in Example 1 accompanying the present invention.
The cells of the invention present the capacity to proliferate and be
differentiated
into several cell lineages. In a preferred embodiment, the cells of the
invention present
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
12
capacity to be differentiated into at least two, more preferably three, four,
five, six,
seven or more cell lineages. In this sense, the cells of the invention can
proliferate and
differentiate into cells of other lineages by conventional methods.
In a particular embodiment of the invention, the cells of the cell population
of the
invention present capacity to be differentiated into smooth muscle cells. In
another
particular embodiment, the cells of said population present capacity to be
differentiated
into adipocytes. In a further embodiment, the cells of said population present
capacity to
be differentiated into osteoblasts. In another particular embodiment, the
cells of said
population present capacity to be differentiated into neural cells.
Methods for identifying and subsequently isolating differentiated cells from
their
undifferentiated counterparts can be also earned out by methods well known in
the art.
The cells of the invention are also capable of being expanded ex vivo. That
is,
after isolation, the cells of the invention can be maintained and allowed to
proliferate ex
vivo in culture medium. Such medium is composed of, for example, Dulbecco's
Modified Eagle's Medium (DMEM), with antibiotics (for example, 100units/ml
Penicillin and 100 g/ml Streptomycin) or without antibiotics, and 5 mM
glutamine, and
supplemented with 2-20% fetal bovine serum (FBS). It is within the skill of
one in the
art to modify or modulate concentrations of media and/or media supplements as
necessary for the cells used. Sera often contain cellular and non-cellular
factors and
components that are necessary for viability and expansion. Examples of sera
include
FBS, bovine serum (BS), calf serum (CS), fetal calf serum (FCS), newborn calf
serum
(NCS), goat serum (GS), horse serum (HS), porcine serum, sheep serum, rabbit
serum,
rat serum (RS), etc. Also contemplated is, if the cells of the invention are
of human
origin, supplementation of cell culture medium with a human serum, preferably
of
autologous origin. It is understood that sera can be heat- inactivated at 55-
65 C if
deemed necessary to inactivate components of the complement cascade.
Modulation of
serum concentrations, withdrawal of serum from the culture medium can also be
used to
promote survival of one or more desired cell types. Preferably, cells of the
invention
will benefit from FBS concentrations of about 2% to about 25%. In another
embodiment, the cells of the invention can be expanded in a culture medium of
definite
composition, in which the serum is replaced by a combination of serum albumin,
serum
transferrin, selenium, and recombinant proteins including but not limited to
insulin,
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
13
platelet-derived growth factor (PDGF), and basic fibroblast growth factor
(bFGF) as
known in the art.
Many cell culture media already contain amino acids, however some require
supplementation prior to culturing cells. Such amino acids include, but are
not limited
to, L-alanine, L- arginine, L-aspartic acid, L-asparagine, L cysteine, L-
cystine, L-
glutamic acid, L-glutamine, L-glycine, and the like.
Antimicrobial agents are also typically used in cell culture to mitigate
bacterial,
mycoplasmal, and fungal contamination. Typically, antibiotics or anti-mycotic
compounds used are mixtures of penicillin/streptomycin, but can also include,
but are
not limited to amphotericin (Fungizone(R)), ampicillin, gentamicin, bleomycin,
hygromacin, kanamycin, mitomycin, etc.
Hormones can also be advantageously used in cell culture and include, but are
not limited to, D-aldosterone, diethylstilbestrol (DES), dexamethasone, b-
estradiol,
hydrocortisone, insulin, prolactin, progesterone, somatostatin/human growth
hormone
(HGH), etc.
The maintenance conditions of the cells of the invention can also contain
cellular
factors that allow cells to remain in an undifferentiated form. It is apparent
to those
skilled in the art that prior to differentiation, supplements that inhibit
cell differentiation
must be removed from the culture medium. It is also apparent that not all
cells will
require these factors. In fact, these factors may elicit unwanted effects,
depending on the
cell type.
In another particular embodiment of the invention, said cells present a
limited
proliferation rate. Indeed, the data herewith presented demonstrate that the
cells of the
invention can be grown extensively but not indefinitely in vitro. These cells
undergo
senescence after approximately 30 passages in vitro.
The cells of the invention can be transfected or genetically engineered to
express,
at least, one polypeptide of interest. Thus, in another particular embodiment,
the cells of
the invention are genetically modified.
A cell is said to be "genetically modified", "transfected", or "genetically
transformed" when a polynucleotide has been transferred into the cell by any
suitable
means of artificial manipulation, or where the cell is a progeny of the
originally altered
cell that has inherited the polynucleotide. The polynucleotide will often
comprise a
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
14
transcribable sequence encoding a protein of interest, which enables the cell
to express
the protein at an elevated level. The genetic alteration is said to be
"inheritable" if
progeny of the altered cell have the same alteration. "Transformed cell" means
a cell
into which (or into predecessor or an ancestor of which) a nucleic acid
molecule
encoding a polypeptide of the invention has been introduced, by means of, for
example,
recombinant DNA techniques or viruses. "Nucleic acid" or "nucleic acid
molecule"
refer to a deoxyribonucleotide or ribonucleotide polymer in either single- or
double-
stranded form, and unless otherwise limited, can encompass known analogs of
natural
nucleotides that can function in a similar manner as naturally occurring
nucleotides. The
terms "polypeptide", "peptide" and "protein" are used interchangeably herein
to refer to
a polymer of amino acid residues. The terms apply to amino acid polymers in
which one
or more amino acid residue is an artificial chemical mimetic of a
corresponding
naturally occurring amino acid, as well as to naturally occurring amino acid
polymers
and non-naturally occurring amino acid polymer. Amino acid mimetics refers to
chemical compounds that have a structure that is different from the general
chemical
structure of an amino acid, but which functions in a manner similar to a
naturally
occurring amino acid.
In recent years, MSC have been increasingly given a role in tissue repair and
regeneration. In different models of tissue damage, MSC improve the recovery
of
injured tissues.
The cells of the invention express some of the proteins that leukocytes use to
adhere to and cross the endothelium (CD44) and thus can diffuse into the
interstitium of
the skeletal muscle, inside the osteogenic tissue and between the adypocytes,
when
delivered intra-arterially. On the other hand, the data presented herein
demonstrate that
the cells of the invention can be grown extensively but not indefinitely in
vitro, which is
of vital importance considering that an additional concern for future cell
therapy
protocols is the risk that extensive expansion in vitro may compromise
differentiation
and/or self-renewal ability or even lead to malignant transformation. Indeed,
as
mentioned above, said cells undergo senescence after approximately 30 passages
in
vitro. Additionally, these cells maintain a diploid karyotype and are not
tumorigenic in
immune deficient mice.
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
The term "karyotype" as used herein, refers to the chromosome characteristics
of
an individual cell or cell line of a given species, as defined by both the
number and
morphology of the chromosomes. Typically, the karyotype is presented as a
systematized array of prophase or metaphase (or otherwise condensed)
chromosomes
5 from a photomicrograph or computer-generated image. Alternatively,
interphase
chromosomes may be examined as histone-depleted DNA fibres released from
interphase cell nuclei. It is considered a normal karyotype when the number of
chromosomes is not altered compared to the number of chromosomes of the
specie.
Therefore, in a further aspect, the present invention refers to the isolated
stem cell
10 population of the invention for use as a medicament. In a particular
embodiment, the
cell population of the invention is used as a medicament for the treatment of
a tissue
degenerative condition. The term "tissue degenerative condition" as used
herein, refers
to tissue which exhibits a pathological condition. Thus, according to the
present
invention, said cell population or composition of the invention can be used as
a
15 medicament for tissue repair and/or regeneration. In this sense, the cell
population of the
invention can be used for enhancing the proliferation, regeneration and/or
engrafting of
stem cells in said tissue, i.e. for the repair and/or regeneration of aging
and/or damaged
tissue.
In a more particular embodiment, said tissue degenerative condition is
skeletal
muscle degeneration, cardiac tissue degeneration, bone tissue degeneration,
neural
tissue degeneration, lung degeneration, liver degeneration, kidney
degeneration or more
than one of said tissue degenerative conditions simultaneously.
As used herein, the terms "treat", "treatment" and "treating" refer to the
amelioration of one or more symptoms associated with a disorder that results
from the
administration of the cell population of the invention or a pharmaceutical
composition
comprising same, to a subject in need of said treatment. Thus, "treatment" as
used
herein covers any treatment of a disorder, disease or condition of a mammal,
particularly a human, and includes: (a) preventing the disease or condition
from
occurring in a subject which may be predisposed to the disease or condition
but has not
yet been diagnosed as having it; (b) inhibiting the disease or condition,
i.e., arresting its
development; or (c) relieving the disease or condition, i.e., causing
regression of the
disease or condition or amelioration of one or more symptoms of the disease or
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
16
condition. The population of subjects treated by the method includes a subject
suffering
from the undesirable condition or disease, as well as subjects at risk for
development of
the condition or disease. As used herein, the terms "disorder" and "disease"
are used
interchangeably to refer to an abnormal or pathological condition in a subject
that
impairs bodily functions and can be deadly.
The term "subject" refers to an animal, preferably a mammal including a non-
primate (e.g. a cow, pig, horse, cat, dog, rat, or mouse) and a primate (e.g.
a monkey or
a human). In a preferred embodiment, the subject is a human.
While it is possible for the active agent, i.e. the cell population of the
invention, to
be administered alone, it is preferable to present it as part of a
pharmaceutical
formulation or composition, comprising as active ingredient an effective
amount of a
cell population according to the invention. The pharmaceutical formulation or
composition in the context of the invention is intended to mean a combination
of the
active agent(s), together or separately, with a pharmaceutically acceptable
carrier as
well as other additives. Thus, in another aspect, the present invention refers
to a
pharmaceutical composition comprising an isolated stem cell population of the
invention and an acceptable pharmaceutical vehicle or carrier.
In a specific embodiment, the term "pharmaceutically acceptable" means
approved by a regulatory agency of the Federal or a state government or listed
in the US
Pharmacopeia, or European Pharmacopeia, or other generally recognized
pharmacopeia
for use in animals and, more particularly, in humans.
The term "carrier" in the context of the present invention denotes any one of
inert, non-toxic materials, which do not react with the cell population of the
invention
and which can be added to formulations as diluents, adjuvants, excipients, or
vehicle or
to give form or consistency to the formulation. The carrier may at times have
the effect
of the improving the delivery or penetration of the active ingredient to the
target tissue,
for reducing undesired side effects etc. The carrier may also be a substance
that
stabilizes the formulation (e.g. a preservative), for providing the
formulation with an
edible flavor, etc. For examples of carriers, stabilizers and adjuvants, see
E. W. Martin,
REMINGTON'S PHARMACEUTICAL SCIENCES, MacK Pub Co (June, 1990). The
composition, if desired, can also contain minor amounts of pH buffering
agents.
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
17
Such compositions will contain a prophylactic or therapeutically effective
amount of a prophylactic or therapeutic agent preferably in purified form,
together with
a suitable amount of earner so as to provide the form for proper
administration to the
subject. The formulation should suit the mode of administration. In a
preferred
embodiment, the pharmaceutical compositions are sterile and in suitable form
for
administration to a subject, preferably an animal subject, more preferably a
mammalian
subject, and most preferably a human subject.
The pharmaceutical composition of the invention may be in a variety of forms.
These include, for example, solid, semi-solid, and liquid dosage forms, such
as
lyophilized preparations, liquids solutions or suspensions, injectable and
infusible
solutions, etc. The preferred form depends on the intended mode of
administration and
therapeutic application.
The administration of the cell population of the invention, or the
pharmaceutical
composition comprising same, to the subject in need thereof can be earned out
by
conventional means. In a particular embodiment, said cell population is
administered to
the subject by a method which involves transferring the cells to the desired
tissue, either
in vitro (e.g., as a graft prior to implantation or engrafting) or in vivo, to
the animal
tissue directly. The cells can be transferred to the desired tissue by any
appropriate
method, which generally will vary according to the tissue type. For example,
cells can
be transferred to graft by bathing the graft (or infusing it) with culture
medium
containing the cells. Alternatively, the cells can be seeded onto the desired
site within
the tissue to establish a population. Cells can be transferred to sites in
vivo using devices
such as catheters, trocars, cannulae, stents (which can be seeded with the
cells), etc.
In addition, the active materials can also be mixed with other active
materials
that do not impair the desired action, or with materials that supplement the
desired
action, or have another action. The compounds, i.e. the cell population of the
invention,
may be formulated as the sole pharmaceutically active ingredient in the
composition or
may be combined with other active ingredients, such as, for example other
agents useful
in the treatment of a tissue degenerative condition. Hence, the cell
population and
composition of the invention may be administered in a combination therapy. The
term
"combination therapy" refers to the use of the cell populations of the present
invention
with other active agents or treatment modalities, in the manner of the present
invention
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
18
for the amelioration of one or more symptoms associated with a disorder. These
other
agents or treatments may include known drugs and therapies for the treatment
of such
disorders. The combined use of the agents of the present invention with other
therapies
or treatment modalities may be concurrent, or given sequentially, that is, the
two
treatments may be divided up such that a cell population or a pharmaceutical
composition comprising same of the present invention may be given prior to or
after the
other therapy or treatment modality. The attending physician may decide on the
appropriate sequence of administering the cell population, or a pharmaceutical
composition comprising same, in combination with other agents, therapy or
treatment
modality.
In other aspect, the present invention relates to the use of the cells of the
invention for the preparation of a medicament for preventing, treating or
ameliorating
one or more symptoms associated with a tissue degenerative condition
including, but
not limited to, skeletal muscle degeneration, cardiac tissue degeneration,
bone tissue
degeneration, neural tissue degeneration, lung degeneration, liver
degeneration, kidney
degeneration or more than one of said tissue degenerative conditions
simultaneously.
In another aspect, the present invention refers to a method, hereinafter
referred to
as the "method of the invention", for isolating a stem cell population from
myometrial
tissue, wherein the cells of said cell population are characterized in that
are positive for
CD31, CD34, CD44, CD117, SSEA-4 and WGA-lectin surface markers and negative
for CD13, CD45, CD80, CD133, CD146, TRAl-60 and TRAl-81 surface markers, said
method comprising the steps o
i) incubating a myometrial tissue sample in a suitable cell culture medium on
a
solid surface under conditions allowing cells of said sample to adhere to said
solid surface;
ii) recovering the cells from said cell culture which do not adhere to said
solid
surface or which present low adherence capacity; and
iii) confirm that the selected cell population presents the phenotype of
interest.
As used herein, the term "solid surface" refers to any material that allows
cells to
adhere. In a particular embodiment said material is gelatin. As shown in the
Example 1
accompanying the present invention, myometrial tissue samples were transferred
to a
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
19
Petri dish coated with gelatin 1% as previously described for other cell types
(Minasi,
M.G., et at cited supra; Sampaolesi M, et al. 2003. Science. 301:487-492).
These
samples were cultured for 15 days and after the initial outgrowth of
fibroblast-like cells,
small round and refractile cells appeared. . Those cells, which adhered poorly
to the
substratum and floated, were easily collected by gently pipetting from the
original
culture. Said floating cells were either grown as a polyclonal population or,
in some
cases, cloned by limited dilution. Thus, according to step ii) of the method
of the
invention, the expression "low adherence capacity" as used herein, refers to
cells which,
under standard conditions allowing cells (such as, for example, fibroblast)
adhere to
said solid surface, either do not adhere to said solid surface and thus, float
in the culture
medium, or can easily be collected from said culture medium by means, for
example, of
gently pipetting.
The cells of the invention can be obtained by conventional means from any
suitable source of myometrial tissue from any suitable animal, including
humans. In a
particular case, myometrial tissue samples are obtained from the lower uterine
segment
of the corpus uteri by uterine exfolation. Sampling involves collecting
exfoliated cells
from the endocervical uterine canal with an appropiate tool as explained in
the Example
1 accompanying the present invention. In general, said cells are obtained from
non-
pathological post-natal mammalian myometrial tissue. In a particular
embodiment, the
cells of the cell population of the invention are from a mammal, e.g, a
rodent, primate,
etc, preferably, from a human. The animal can be alive or dead, so long as
myometrial
tissue cells within the animal are viable. Typically, human myometrial cells
are
obtained from living donors, using well-recognized protocols as explained
above.
The sample of miometrial tissue is, preferably, washed before being processed
to
separate the cells of the invention from the remainder of the material. The
remaining
cells generally will be present in clumps of various sizes, and the protocol
can proceed
using steps gauged to degrade the gross structure while minimizing damage to
the cells
themselves. The lumps of cells can be degraded using treatments, such as
mechanical
agitation, sonic energy, thermal energy, etc.
Following the final isolation, the cells can be cultured and, if desired,
assayed
for number and viability to assess the yield. Desirably, the cells will be
cultured without
differentiation, on a solid surface, using a suitable cell culture media, at
the appropriate
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
cell densities and culture conditions. Thus, in a particular embodiment, cells
are
cultured without differentiation on a solid surface, usually made of gelatin
in the
presence of a suitable cell culture medium [e g , DMEM, typically supplemented
with
5-15% (e g, 10%) of a suitable serum, such as fetal bovine serum or human
serum], and
5 incubated under conditions which allow cells to adhere to the solid surface
and
proliferate.
The cells are maintained in culture in the same medium and under the same
conditions until they reach the adequate confluence, typically, about 80% cell
confluence, with replacement of the cell culture medium when necessary. After
10 reaching the desired cell confluence, the cells can be expanded by means of
consecutive
passages using a detachment agent such as trypsin and seeding onto a bigger
cell culture
surface at the appropriate cell density (usually 2,000- 10,000 cells/cm) Thus,
cells are
then passaged at least twice in such medium without differentiating, while
still retaining
their developmental phenotype, and more preferably, the cells can be passaged
at least
15 10 times (e g , at least 15 times or even at least 20 times) without losing
developmental
phenotype Typically, the cells are plated at a desired density such as between
about 100
cells/cm2 to about 100,000 cells/cm2 (such as about 500 cells/cm2 to about
50,000
cells/cm2, or, more particularly, between about 1,000 cells/cm2 to about
20,000
cells/cm) If plated at lower densities (e g , about 300 cells/cm ), the cells
can be more
20 easily clonally isolated. For example, after a few days, cells plated at
such densities will
proliferate into an homogeneous population In a particular embodiment, the
cell density
is between 2,000-10,000 cells/cm2. As a result of the above method, a
homogeneous
cell population having the phenotype of interest is obtained. Example 1
describes in a
detailed manner the isolation of the cells of the invention from mouse
myometrial
tissue.
Confirmation of the phenotype of interest can be carried out by using
conventional means. Cell-surface markers can be identified by any suitable
conventional technique, usually based on a positive/negative selection, for
example,
monoclonal antibodies against cell-surface markers, whose presence/absence in
the cells
has to be confirmed, can be used, although other techniques can also be used.
Thus, in a
particular embodiment, monoclonal antibodies against one, two, three, four,
five, six,
seven of or preferably all of CD13, CD45, CD80, CD133, CD146, TRAl-60 and
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
21
TRA1-81 surface markers are used in order to confirm the absence of said
markers in
the selected cells, and monoclonal antibodies against one, two, three, four,
of or
preferably all of CD31, CD34, CD44, CD117, SSEA-4, HLA-DR and WGA-lectin are
used in order to confirm the presence thereof or detectable expression levels
of, at least
one of and preferably all of, said markers. Said monoclonal antibodies are
known,
commercially available or can be obtained by a skilled person in the art by
conventional
methods.
The cells and cell populations provided by the instant invention can be
clonally
expanded, if desired, using a suitable method for cloning cell populations.
For example,
a proliferated population of cells can be physically picked and seeded into a
separate
plate (or the well of a multi-well plate). Alternatively, the cells can be
subcloned onto a
multi- well plate at a statistical ratio for facilitating placing a single
cell into each well
(e.g., from about 0,1 to about 1 cell/well or even about 0,25 to about 0,5
cells/well, such
as 0,5 cells/well). Of course, the cells can be cloned by plating them at low
density (e.g.,
in a Petri dish or other suitable substrate) and isolating them from other
cells using
devices such as a cloning rings. The production of a clonal population can be
expanded
in any suitable culture medium. In any event, the isolated cells can be
cultured to a
suitable point when their developmental phenotype can be assessed.
Any of the steps and procedures for isolating the cells of the cell population
of the
invention can be performed manually, if desired. Alternatively, the process of
isolating
such cells can be facilitated and/or automated through one or more suitable
devices,
examples of which are known in the art.
In another aspect, the invention refers to a kit comprising a cell population
containing the cells of the invention.
In other aspect, the present invention refers to the use of a cell population
containing cells of the invention for preventing, treating, or ameliorating
one or more
symptoms associated with a tissue degenerative condition in a subject
suffering from
said disorders or diseases.
In other aspect, the present invention provides methods of preventing,
treating,
or ameliorating one or more symptoms associated with a tissue degenerative
condition,
in a subject suffering from said disorders or diseases, which comprises
administering to
said subject in need of such treatment of a prophylactically or
therapeutically effective
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
22
amount of a cell population containing cells of the invention. In a particular
embodiment, said tissue degenerative condition is skeletal muscle
degeneration, cardiac
tissue degeneration, bone tissue degeneration, neural tissue degeneration,
lung
degeneration, liver degeneration, kidney degeneration or more than one of said
tissue
degenerative conditions simultaneously.
The invention will now be described in more detail, by way of examples which
in no way are meant to limit the scope of the invention, but, rather, these
examples will
serve to illustrate the invention with reference to the accompanying figures.
EXAMPLE
Isolation, in vitro expansion and differentiation of mouse adult myometrial
precursors (MAMps) from the uterine tissue
I. Materials and Methods
Uterine and myometrial explants
Myometrial explants were taken from the lower uterine segment of the corpus
uteri by uterine exfolation. Sampling involves collecting exfoliated cells
from the
endocervical uterine canal with an appropiate tool. All explants were trimmed
of
endometrial, serosal, fat and fibrous tissue prior to use. Technique would be
similar to a
cervical cytology.
Myometrial tissue can be maintained for up to 24 hours post-obtention in
oxygenated
(95% 02, 5% C02) physiological salt solution (PBS) at room temperature.
Samples
were transferred to a Petri dish coated with gelatin 1% in presence of 10% FBS-
DMEM
plus 5 mM glutamine and antibiotics. These samples were cultured for 15 days
and after
the initial outgrowth of fibroblast-like cells, small round and refractile
cells appeared.
This cell population was easily collected by gently pipeting of the original
culture,
counted and cloned by limited dilution on gelatin I% coated p96-well dishes.
Myometrial precursors were also obtained from uterine explants. Myometrial
tissue pieces (10-30mg) obtained from 4 months C57 mice were kept in DMEM w/o
FCS (fetal calf serum), with antibiotics. Each piece was then rinsed in PBS
with Ca/Mg
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
23
and sharply dissected into 1-2 mm diameter pieces with a scalpel. Fragments
containing
small vessels were transferred to a Petri dish coated with gelatin 1% in
presence of 10%
FBS-DMEM plus 5 mM glutamine and antibiotics. These fragments were cultured
for
15 days and after the initial outgrowth of fibroblast-like cells, small round
and refractile
cells appeared. This cell population was easily collected by gently pipeting
of the
original culture, counted and cloned by limited dilution on gelatin 1% coated
p96well
dishes.
Different valid clones were selected by phase contrast morphology and then
characterized by surface markers expression.
Differentiation assays
Differentiation into different cell types was induced following already well-
known
published protocols.
Cultures were shifted to differentiation medium (DMEM supplemented with 2%
horse serum). Differentiation into smooth muscle cells and osteoblasts was
induced by
treatment with TGF(31 and BMP2 respectively, as previously described (Minasi,
M.G.,
et al. 2002. Development 129, 2773-2783). Differentiation into skeletal muscle
cells
was induced by co-culturing MAMps with C2C12 mouse myoblasts. Differentiation
into cardiac cells was analyzed after treatment with 10 microM 5-azacytidine
for 48
hours. After 5 days cultures were fixed and stained with colour solutions or
with
antibodies against striated myosin (MF20).
Differentiation into neural cells consist on changing the culture medium to a
neural stem cell proliferation medium: DMEM:Fl2 medium (Sigma) supplemented
with
D-Glucose (Sigma) to a final concentration of 4.5 mg/ml, N2 Supplement (Gibco-
Invitrogen), B27 Supplement (Gibco-Invitrogen), 20 g/ml insulin (Sigma), 2
g/ml
heparin (Sigma), 20 ng/ml (3FGF (Sigma), 10 ng/ml EGF (Sigma). The neural stem
cell
proliferation medium was changed twice and after one week in culture, the
cells were
processed for immunocytochemistry. Further, cells were grown for another week
in
neural stem cell differentiation medium (DMEM:F12 (Sigma), supplemented with D-
Glucose (Sigma) to a final concentration of 4,5 mg/ml, N2 Supplement (Gibco-
Invitrogen), B27 Supplement (Gibco-Invitrogen), 2 g/ml heparin (Sigma) and 1%
FBS
(Sigma)) and for another week in specific medium for neuronal culture
(Neurobasal-A
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
24
(Gibco-Invitrogen), B27 (Gibco-Invitrogen), Glutamax-I (Gibco-Invitrogen), P/S
(Sigma)) and oligodendrocyte differentiation (DMEM (Sigma), 4.5 mg/mL D-
glucose,
100 g/mL BSA (Sigma), 100 U/mL penicillin, 100 g/mL streptomycin (Sigma), 2
mM L-glutamine (Sigma), 60 g/mL N-acetyl-L-cysteine (Sigma), N2 Supplement
(Gibco-Invitrogen), 20 ng/mL bFGF (PeproTech) and 10 ng/mL PDGF-AA
(PeproTech). After this time, the cells were processed for
inmunocytochemistry.
Identification of human nuclei was confirmed by Hoechst. Percentage of
differentiation
was calculated by counting the number of differentiated MAMps.
Analysis of cell proli erarion
Cells were plated at a density of 3 x 103 cells/cm in different media and
passed
on average every three days. At each passage, the number of cells was counted
in
triplicate in a hemocytometer. For the growing curve of the clones, cells were
plated
initially at 1 x 104 cells/cm2 in complete DMEM or embryonic media and passed
every
five days. At each passage, the number of cells was counted in triplicate in
the
hemocytometer.
Kar yotype analysis
Cells, plated at 1/3 confluence 72 hours before analysis, were processed with
the
Karyomax kit (Invitrogen) according to the manufacturer's instructions. For
each of the
karyotypes analyzed, 5 different metaphase spreads were examined.
Tumorigenicity
To test for possible tumor formation, 5 nude mice were injected subcutaneously
with 107 MAMps. After 4 months, the mice were sacrificed and analyzed for the
presence of macroscopically detectable tumors.
Immunofluorescence
Cells were grown on gelatin coated glass coverslips, washed with PBS and fixed
with 4% paraformaldehyde for 10 minutes. Samples were frozen in liquid
nitrogen
cooled isopentane and serial 8 m thick sections were cut with a Leyca
cryostat. Cells
were permeabilized with 0.2% Triton X-100, 1% BSA in PBS for 30 minutes at RT,
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
while tissue sections were incubated without detergent. Cells and tissue
sections were
incubated with 10% donkey serum for 30 minutes a RT, and incubated overnight
at 4 C
with primary antibodies at the appropriate dilution. After incubation, samples
were
washed twice with the permeabilization buffer and then incubated with the
appropriate
5 FITC or TRiTC conjugated anti-mouse or anti-rabbit IgG and Hoechst for 45
minutes at
RT. After three final washes, the cover slips were mounted on glass slides
using mowiol
in PBS and analyzed under a fluorescent microscope (Nikon). Other tissue
sections or
cells were stained with X-Gal as described (Sampaolesi M, et al. 2003.
Science.
301:487-492).
Antibodies
The following antibodies were used: anti-laminin monoclonal or polyclonal
antibodies (Sigma) at 1:100 dilution; MF20 antibody at 1: 5 dilution, anti
Smooth Alpha
actin 1:300 dilution from Sigma, polyclonal anti-nestin antibody (Abeam), beta-
III-
tubulin (anti- TUJ1 antibody, Abeam), doublecortin (anti- Dcx antibody,
Abeam), and
MAP2 (Sigma) as neuronal marker, GFAP (Sigma) as astrocyte marker and RIP
(Developmental Studies Hybridoma Bank) as oligodendrocyte marker. Nuclei were
stained with bisbenzimide (Sigma).
For FACS analysis (FACS Calibur (Becton Dickinson)) the following antibodies
were
used CD44, CD34, CD45, CD117, CD133 from BD Biosciences, CD31, CD13, from ID
labs Inc, CD146 from Biocytes, CD80, CD90, SSEA-4, WGA from Abeam, TRAl-60
and TRAl-81 from Biotech, TMRM from Molecular Probes.
Gene expression analysis
RNA was extracted from the different MAMps clones cells while growing. RT-
PCR was performed for analyzing the expression of different genes involved in
development or differentiation previously described by other groups (Mef2c,
Sox2,
TbxS, hTERT, Mef2a and Tbx2).
The conditions for the PCR were general for all primers: 94 C for 4 minutes.
30
cycles of 94 C, 45 s; 55 C, 45 s; 72 C, 45 s. And a final step of 72 C for
10 minutes.
List of used primers:
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
26
Mef2a primer forward: TTGAGGCTCTGAACAAGAAGG
Mef2a primer reverse: GCATTGCCAGTACTTGGTGG
Mef2c primer forward: AACACGGGGACTATGGGGAGAAA
Mef2c primer reverse: TATGGCTGGACACTGGGATGGTA
Tbx2 primer forward: GGTGCAGACAGACAGTGCGT
Tbx2 primer reverse: AGGCCAGTAGGTGACCCATG
Tbx5 primer forward: CCAGCTCGGCGAAGGGATGTTT
Tbx5 primer reverse: CCGACGCCGTGTACCGAGTGAT
Sox2 primer forward: GGCAGCTACAGCATGATGCAGGAGC
Sox2 primer reverse: CTGGTCATGGAGTTGTACTGCAGG
mTERT: human/mouse TERT primer pair (R&D systems)
Alkaline Phospatase (AP) reaction
MAMps were cultured for five days on plates prior to analyzing AP activity, at
high density.
On the fifth day, media was aspirated and cells fixed with 4% paraformaldehyde
in PBS for 3 min. Then, fixative was aspirated and rinsed with PBS Ix.
Stain solution was added (mix fast red violet with naphthol, phosphatase
solution and water in a 2:1:1 ratio. Detection kit, (Millipore) covering each
well and
incubated for 15 min at room temperature in dark. Aspirate solution, rinse
plates with
PBS lx and count and analyze under microscope the number of violet cells.
Results
Isolation and in vitro expansion of cellse from primary mouse uterine biopsies
As mentioned above, uterus biopsies were dissected under the microscope;
fragments of vessels and surrounding mesenchymal tissue were dissected and
plated on
gelatin coated dish as previously described for other cell types (Minasi,
M.G., et al cited
supra; Sampaolesi M, et al. 2003. cited supra). After the initial outgrowth of
fibroblast-
like cells, small round and refractile cells appeared. Those cells adhered
poorly to the
substratum and were thus collected by gently pipetting. Floating cells were
either grown
as a polyclonal population or, in some cases, cloned by limited dilution. The
large
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
27
majority of the cells in the population acquired a triangular, refractile
morphology and
maintained a high proliferation rate for approximately 30 passages with a
doubling time
of approximately 36 hours. Proliferation rate was largely independent from the
age of
the mice (ranging from 4 to 8 months). This proliferation rate leads to a
final number of
approximately 3 x109 cells, starting from 10.000 cells outgrown. This number
of cells
would be suitable for injections. After 30 passages (approximately 60 PD),
large flat
cells appeared at increasing frequency that did not divide any more and after
few more
passages the whole population underwent senescence. At both early and late
passages,
cells were maintained a normal diploid karyotype. To test for tumorigenicity,
107
MAMps were injected subcutaneously SCID/beige mice. 10 injected mice were
maintained up to 6 months after the injection and none of them developed any
visible
tumor that could be detected macroscopically at autopsy (data not shown).
Phenotype of mouse myometrial precursors
MAMps were further characterized by flow cytometry and PCR gene expression
and their ability to differentiate to different cell types was analyzed.
Characterization of surface markers and gene expression
MAMps clones were analyzed by flow cytometry for the expression at the cell
surface of the following stem cells markers: CD31, CD34, CD44, CD 117,
alkaline
phosphatase (PAL), HLA-DR, SSEA-1, HLA-DR, WGA, CD13, CD45, CD80, CD90,
CD133, CD146, TRAl-60/81 and Tetramethyl Rhodamine Methyl Ester (TMRM). All
clones were positive for CD31, CD34, CD44, CD117, SSEA-4, HLA-DR and WGA-
lectin surface markers and negative for CD13, CD45, CD80, CD133, CD146, TRAl-
60
and TRAl-81 surface markers. See Table 1 below for percentage and Figure 1 for
FACS profiles.
Table 1: Percentage of expression of markers at the surface of MAMps.
...............................................................................
............
...............................................................................
...........
...............................................................................
............
...............................................................................
...........
...............................................................................
............
...............................................................................
...........
...............................................................................
............
...............................................................................
...........
...............................................................................
............
...............................................................................
...........
...............................................................................
............
...............................................................................
...........
...............................................................................
............
...............................................................................
...........
CD13 <1
CD31 99,7
CD34 99,12
CD44 95,32
CD45 <1
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
28
CD8O 2,88
CD9O 11,76
CD117 68,5
CD133 <1
CD146 <1
PAL 36,22
HLA-DR 28,91
TRA1-60 <1
TRA1-81 < 1
SEA-4 58,59
WGA 95,17
TMRM 8,9
RNA was extracted from the different MAMps clones cells while growing. RT-
PCR was performed for analyzing the expression of different genes involved in
development or differentiation previously described by other groups. MAMps
were
positive for Mef2c, Sox2, Tbx5 and hTERT, while negative for Mef2a and Tbx2
(see
Figure 2).
Differentiation potency of MAMps.
To complete the in vitro characterization of MAMps, their ability to undergo
terminal differentiation into different mesoderm cell types was tested. MAMps
readily
differentiate into smooth muscle, adipocytes or osteoblasts, when treated with
transforming growth factor beta (TGF(3), insulin-dexamethazone or bone
morphogenetic
protein 2 (BMP2). When cardiac muscle differentiation was induced by adding 5
M 5-
azacytidine each 48 hours, less than 1% of the MAMps expressed sarcomeric
myosin
(data not shown), showing that these cells have a modest ability to undergo
cardiomyogenesis. When skeletal muscle differentiation was induced by co-
culturing
MAMps with mouse myogenic cells, a very high percentage (more than 50%) fused
into
hybrid myotubes (Figure 6C). MAMps were also able to differentiate into neural
tissue
after changing to neural stem cells proliferation medium (see methods). After
one day in
the neural stem cell proliferation medium, and during one week, the cells
slowed down
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
29
the proliferation rate and started changing their shape. Some cells presented
long and
thin processes and others formed rosettes than resembled neurospheres. Most
cells were
positive for Nestin (Figure 4). Further, the cells showed positive staining
for the three
neuronal markers (Tuj-1, Dcx and MAP2), for the astrocyte marker GFAP as well
as for
the oligodendrocyte marker, RIP. Furthermore, the morphology of the Tuj-1
positive
cells was very similar to that of neuroblasts. Additionally, MAMps were
naturally
positive for the fostatase alkaline reaction (Figure 3).
DISCUSSION
The present invention shows the isolation of myometrial precursors from mouse
adult uterine tissue. Said precursors can grow until 30 passages and express
stem cells
surface markers and genes. Besides, these precursors are able to differentiate
into
different mesoderm tissues types which could make them suitable for
regenerative
medicine.
Myometrial precursors can be easily isolated from the very biopsy that is used
for
diagnosis, with no need of additional surgical intervention. The source of
cells is
important not only for practical reasons. Multipotent mesoderm progenitors,
receive
some sort of local commitment that favours recruitment into the cell types of
the tissue
where they reside. So, it is interesting to have a source of mesoderm
progenitors that
still remain with the multipotency property.
A comparison with other stem cells of the mesoderm
In the last several years many different types of mesoderm stem cells have
been
isolated from both mouse and human tissues and characterized to different
extent. These
include endothelial progenitor cells (EPC), multipotent adult progenitor cells
(MAPC),
side population cells (SP), mesoangioblasts, stem/progenitor cells from muscle
endothelium, sinovia, dermis, and adipose tissue. Different experimental
procedures,
different sources and partial characterization still prevent a complete
understanding of
the heterogeneity of these cells; even less is known on their origin and
possible lineage
relationships. Whatever the case, many of these cells, such as MDSC or MAPC
have
been shown to differentiate into skeletal muscle in vitro. Some of these cells
grow
extensively in vitro but others such as EPC and SP do not; on the other hand
EPC and
CA 02744423 2011-05-20
WO 2010/057965 PCT/EP2009/065523
SP can circulate whereas systemic delivery has not been tested for most of the
other cell
types. For example, it was recently shown that cells isolated from adipose
tissue can be
grown in vitro extensively, differentiate into several tissues including
skeletal muscle
and give rise to human dystrophin expressing fibers. But few of these cells
can
5 differentiate efficiently to other cells types or be obtained and grow
easily.
Perspectives for a clinical trial
In future clinical protocols, systemic delivery appears as an obligate choice.
The
myometrial precursors of the invention express some of the proteins that
leukocytes use
10 to adhere to and cross the endothelium and thus can diffuse into the
interstitium of the
skeletal muscle, inside the osteogenic tissue and between the adypocytes, when
delivered intra-arterially.
An additional concern for future cell therapy protocols is the risk that
extensive
expansion in vitro may compromise differentiation and/or self-renewal ability
or even
15 lead to malignant transformation. The data presented here demonstrate that
the cells of
the invention can be grown extensively but not indefinitely in vitro. These
cells
maintain a diploid karyotype, are not tumorigenic in immune deficient mice and
undergo senescence after approximately 30 passages in vitro.
Finally, two protocols appear now as alternative choices for cell therapy:
20 autologous cells after gene correction in vitro or normal donor cells in
the presence of
immune suppression or, hopefully induced adoptive tolerance. Donor cell
transplantation would overcome these problems but faces the need for a life
long
immune suppression that would also start early in life.
