Note: Descriptions are shown in the official language in which they were submitted.
CA 02763795 2012-01-10
AFFINITY-CONJUGATED NUCLEOPROTEIN-PAPAYA MOSAIC
VIRUS-LIKE PARTICLES AND USES THEREOF
FIELD OF THE INVENTION
[001] The present invention relates to the field of vaccine formulations and
adjuvants and,
in particular to influenza vaccines based on plant virus particles that elicit
an immune
response to the influenza nucleoprotein.
BACKGROUND OF THE INVENTION
[002] Influenza remains a major cause of morbidity and mortality. Annual
epidemics are
thought to result in between three to five million cases of severe illness and
between 250,000
and 500,000 deaths every year around the world (see "Fact Sheet on Influenza"
provided on
website maintained by the World Health Organization, at www.who.int). Despite
significant
success in controlling the emergence of this disease via vaccination, well-
known deficiencies
in current existing vaccines has long made their improvement a crucial
research and public
health priority. [ Ilyinskii et al. Int Rev Immunol 2008;27(6):392-426].
Inactivated influenza
vaccines have been available for more than 50 years and since 2003 a live
attenuated
influenza vaccine has also been available in the USA [Nichol et al. Vaccine
2008 Sep 12;26
Supp] 4:D17-22]. The principal disadvantage of existing influenza vaccines is
their failure to
provide protection to the strains other than those used to make the vaccine.
In fact, persistent
(drift) and dramatic (shift) antigenic changes on the major surface proteins
necessitate annual
repeated immunizations against seasonal viral stains. The efficacy and
effectiveness of
traditional vaccines in a given year will depend on many factors, but mainly
on the degree of
vaccine circulating match. This can be explained by the fact that neutralizing
antibody titers
against highly variable external glycoproteins of virus, namely hemagglutinin
(HA) and
neuraminidase (NA) are considered to be the gold standard correlate of vaccine-
induced
protection [ Palladino et al. J Virol 1995 Apr;69(4):2075-81, Rimmelzwaan et
al. Vaccine
2008 Sep 12;26 Suppl 4:D41-4]. Because of the accumulation of mutations in HA
and NA
genes, influenza vaccine must be reformulated each year to include the HA and
NA proteins
predicted to dominate in the following influenza season. Also, since they only
protect against
1
CA 02763795 2012-01-10
viral serotypes that express the same HA and NA proteins contained in the
vaccine, these
vaccines are less effective against the appearance of new HA and NA proteins
in naive
populations causing the potential risk of a pandemic disease with high
mortality like the
striking 1918 "Spanish Flu".
[0031 By contrast, vaccinations with a more conserved protein, like the
nucleoprotein (NP)
stimulate immunity against multiple serotypes [Schulman et at. J Bacteriol
1965 Jan;89:170-
4; Liang et al. J Immunol 1994 Feb 15;152(4):1653-61]. Such immunity has long
been
studied in animals and there is growing evidence that it may exist in humans.
[Epstein et al.
Expert Rev Anti Infect Ther 2003 Dec;l(4):627-38]. This form of immunity does
not
generally prevent all infection by heterosubtypic virus but it leads to more
rapid viral
clearance and to reduction in morbidity and mortality [ Epstein et al. Expert
Rev Anti Infect
Ther 2003 Dec; 1 (4):627-38]. The antigenic changes of NP are rare and only
occur to a minor
extent. The protein NP exhibits more than 90% protein sequence identity among
influenza A
isolates [ Altmuller et al. J Gen Virol 1989 Aug;70 ( Pt 8):2l 11-9; Gorman et
al. J Virol 1990
Apr;64(4):1487-97; Scholtissek et al. Arch Virol 1993;131(3-4):237-50; Shu et
al. J Virol
1993 May;67(5):2723-9.] and also contains dominant CTL target epitopes
[Townsend et al. J
Exp Med 1984 Aug 1;160(2):552-63; Yewdell et at. Proc Natl Acad Sci U S A 1985
Mar;82(6):1785-9; McMichael et al. J Gen Virol 1986 Apr;67 ( Pt 4):719-26;
Chen et al.
Immunity 2000 Jan;] 2(l):83-93] that are directed against different variants
of NP [Haanen et
al. J Exp Med 1999 Nov 1;190(9):1319-28]. NP vaccination was formerly thought
to confer
protection primarily via CD8 effectors mechanisms [ Taylor et al. Immunology
1986
Jul;58(3):417-20; Gschoesser et al. Vaccine 2002 Nov 1;20(31-32):3731-8]
because
restimulated T cells can transfer protection to naive mice [ Yap et al. Scand
J Immunol
1978;8(5):413-20; Wells et al. J Immunol 1981 Mar;126(3):1042-6; Lukacher et
al. J Exp
Med 1984 Sep 1;160(3):814-26] and because T cell depletion in the vaccinated
mice can
abrogate protection [ Liang et al. J Immunol 1994 Feb 15;152(4):1653-61,
Epstein et al. J
Immunol 1997 Feb 1 ;158(3):1222-30]. Many studies have also established that
both CD4+ T
cells secreting THI-type cytokines and CD8+ CTL play important roles in
protection obtained
with NP protein [ Ulmer et al. J Virol 1998 Jul;72(7):5648-53.]. In fact, mice
immunized with
influenza NP (as soluble protein or using DNA vector) have higher frequencies
of NP-
specific CD8 T cells before infection and have a better control of viral titer
after challenge
2
CA 02763795 2012-01-10
with H3N2 and H IN I strains of influenza virus. In these studies, the
involvement of
antibodies in protection has largely been underestimated. On the other hand,
recent studies
[Carragher et al. J Immunol 2008 Sep 15;181(6):4168-76] suggest that soluble
NP
immunization may promote both antibodies and T-cell protective response to
this conserved
internal protein. Immunization with soluble recombinant NP protein is
efficient but
necessitates the uses of adjuvant in all the studies [Carragher et al. J
Immunol 2008 Sep
15;18](6):4168-76; Tite et al. Immunology 1990 Oct;71(2):202-7; Tamura et al.
J Immunol
1996 May 15;156(10):3892-900; Guo et al. Arch Virol 2010 Jul 221.
[0041 The adjuvant capacity of PapMV VLPs to carry selected B-cell and CTL
epitopes has
been previously shown [Denis et al. Virology 2007 Jun 20;363(1):59-68; Leclerc
et al. J Virol
2007 Feb;81(3):1319-26; Lacasse et al. J Virol 2008 Jan;82(2):785-94]. PapMV
VLPs, like
many other VLP carriers, are restricted in the size and the nature of epitopes
that can be
inserted into their C-terminal region [Tremblay et al. Febs J 2006 Jan;
273(1):14-25].
Nevertheless, PapMV VLPs increase the immunogenicity of peptides carried on
heterologous
PapMV VLPs [ Denis et al Vaccine 2008 Jun 25;26(27-28):3395-403], as well as
some
components of the whole influenza inactivated vaccine (Savard et al.(201 1);
Plus One
6(6):e21522). The multimerisation of peptides selected by phage display has
been shown to
be an efficient method to improve the avidity of the peptide for its target
(Terskikh et al. Proc
Natl Acad Sci USA. 1997 Mar 4;94(5):1663-8).
10051 PapMV VLPs have been used as a platform for the fusion of affinity
peptides and
high avidity VLPs (HAV) have been generated directed to the resting spores of
the fungus
Plasmodiophora brassicae (Morin et al. J Biotechnol 2007 Feb 1;128(2):423-
34.).
1006] This background information is provided for the purpose of making known
information believed by the applicant to be of possible relevance to the
present invention. No
admission is necessarily intended, nor should be construed, that any of the
preceding
information constitutes prior art against the present invention.
3
CA 02763795 2012-01-10
SUMMARY OF THE INVENTION
[007] An object of the present invention is to provide an affinity-conjugated
nucleoprotein-
papaya mosaic virus-like particles and uses thereof. In accordance with an
aspect of the
invention, there is provided an affinity-conjugated nucleoprotein-PapMV virus-
like particle
system comprising an influenza nucleoprotein (NP) and a virus-like particle
(VLP) derived
from PapMV coat protein, said PapMV coat protein modified by the addition of
one or more
peptides capable of specifically binding to influenza NP, wherein said system
is capable of
inducing an immune response in an animal.
[008] In accordance with another aspect of the invention, there is provided an
immunogenic
composition comprising the affinity-conjugated nucleoprotein-PapMV virus-like
particle
system according to the invention, and a pharmaceutically acceptable carrier.
[009] In accordance with another aspect of the invention, there is provided a
method of
inducing an immune response to influenza nucleoprotein in an animal comprising
administering to said animal an effective amount of the affinity-conjugated
nucleoprotein-
PapMV virus-like particle system according to the invention.
[010] In accordance with another aspect of the invention, there is provided a
method of
preventing or treating influenza in an animal, said method comprising
administering to said
animal an effective amount of the affinity-conjugated nucleoprotein-PapMV
virus-like
particle system according to the invention.
[011] In accordance with another aspect of the invention, there is provided a
use of an
effective amount of the affinity-conjugated nucleoprotein-PapMV virus-like
particle system
according to the invention, to induce an immune response to influenza
nucleoprotein in an
animal in need thereof.
[012] In accordance with another aspect of the invention, there is provided a
use of an
effective amount of the affinity-conjugated nucleoprotein-PapMV virus-like
particle system
according to the invention, to prevent or treat influenza in an animal in need
thereof.
4
CA 02763795 2012-01-10
10131 In accordance with another aspect of the invention, there is provided a
use of the
affinity-conjugated nucleoprotein-PapMV virus-like particle system of the
invention, in the
manufacture of a medicament.
[014] In accordance with another aspect of the invention, there is provided a
method of
preparing an immunogenic composition comprising admixing influenza
nucleoprotein with a
papaya mosaic virus (PapMV) virus-like particle (VLP) derived from PapMV coat
protein,
said PapMV VLP comprising one or more peptides attached to coat proteins of
said PapMV
VLP, said peptides capable of specifically binding to influenza nucleoprotein.
[015] In accordance with another aspect of the invention, there is provided an
immunogenic
composition prepared by the method according to the invention.
[016] In accordance with another aspect of the invention, there is provided a
fusion protein
comprising a papaya mosaic virus (PapMV) coat protein fused to one or more
peptides
capable of specifically binding to influenza nucleoprotein.
[017] In accordance with another aspect of the invention, there is provided an
isolated
polynucleotide encoding the fusion protein according to the invention.
[018] In accordance with another aspect of the invention, there is provided a
use of the
fusion protein according to the invention, or a polynucleotide according to
the invention, to
prepare a virus-like particle.
BRIEF DESCRIPTION OF THE DRAWINGS
10191 These and other features of the invention will become more apparent in
the following
detailed description in which reference is made to the appended drawings.
1020] Figure 1 presents data relating to the selection of affinity peptides
against NP protein.
A) SDS-Page evaluation of influenza A/WSN/33 (HINT) NP protein. Lane I: broad
range
protein marker. Lane 2: Bacterial lysate before induction. Lane 3: Bacterial
lysate after
induction. Lane 4: Purified protein. B) Selected peptides against target NP
protein by phage
display after 5 rounds of panning.
CA 02763795 2012-01-10
[021] Figure 2 presents data relating to the characterization of the coat
proteins fused to
affinity peptides. A) SDS-Page evaluation of adjuvant protein PapMV and high
avidity
PapMV (PapMV HAV-ANPI and PapMV HAV-ANP2). Lane I: broad range protein
marker. Lane 2: Bacterial lysate after induction. Lane 3: Purified protein
after elution. B)
Morphologic evaluation of VLPs by Electron microscopy.
[022] Figure 3 presents measurement of the affinity of PapMV VLPs against the
target NP.
A) ELISA technique. Numbers are expressed as the ratio between the absorbance
at 450nm
ofNP coated plated versus control plate. B) Silicone nano-porous biosensor
analysis.
[023] Figure 4 presents data showing the immune response generated against NP
protein.
Mice, 10 per groups, were vaccinated three times with 10 g of purified
recombinant NP
(NP) with or without 30 g of recombinant PapMV VLPs or high avidity PapMV
HAV(PapMV HAV-ANPI and PapMV HAV-ANP2). Serum titer, 2 weeks after the last
injection (Data are representative of three experiments). A) IgGI serum titer
against NP. B)
lgG2a serum titer against NP. ** P < 0.01 vs NP and NP+PapMV HAV-ANPI, number
represent the time increase versus the NP alone. C) IgGl/IgG2a ratio serum
titer against NP.
* P < 0.05 vs. all groups. D) Mice, 5 per groups, were vaccinated three times
as described
above. 2 weeks after the last injection, the spleen was removed to obtain a
cell suspension
and 2.5x105 cells were reactivated with rNP protein. INF-g secreting cells
following
reactivation were revealed by ELISPOT assay. Background Spots obtained by
reactivation
with medium alone were removed from data obtained by reactivation with NP
protein. * P <
0.05 vs. all groups (data are representative of two experiments), number
represent the time
increase versus the NP alone.
[024] Figure 5 presents the effect of adjuvants on mouse influenza challenge
with
homologous strains A(H 1 N 1)/WSN/33. Mice, 10 per groups, were vaccinated
three times
with 10 g of purified NP (NP) with or without 30 pg of PapMV VLPs or PapMV
HAVs
(PapMV HAV-ANP2. Mice were challenged with 2LD50 of A(HINI)/WSN/33 influenza
virus, 2 weeks after the last boost and were sacrificed at day 7. A) Measure
of the body
weight losses of mice at day 7 B) Symptoms observed on each infected mice were
scored at
day 7 after the challenge. 1. Lightly spiked fur, lightly curved back. 2.
Spiked fur, curved
back. 3 Spiked fur, curved back, difficulty to move and light dehydratation.
4. Spiked fur,
6
CA 02763795 2012-01-10
curved back, difficulty to move and severe dehydratation, closed eyes and
ocular secretion.
** P < 0.05 vs all groups. C) In vitro influenza virus titration of infected
mouse homogenized
lungs in MDCK cells. Data are expressed as Log10 of plaque forming units
(PFU). D) 10
mice per groups were immunized as above and were challenged with 2LD50 of
A(H IN 1)/W SN/33 influenza virus, 2 weeks after the last boost. Body weight
of each mouse
was monitored for a 14 days period. Mice that lost more than 20% of their
initial weight were
sacrificed. Survival curve of infected mice express as percentage of mice who
losses less than
20% of their initial weight.
10251 Figure 6 presents the immune response generated against NP protein.
Mice, 15 per
groups (5 were not challenged), were vaccinated three times with 10 g of
purified NP (NP)
with or without 30 g of PapMV VLPs (PapMV VLP) or high avidity PapMV HAVs
PapMV HAV-ANP2). Serum titer, 2 weeks after the last injection) A) IgG 1 serum
titer
against NP. B) IgG2a serum titer against NP. * P < 0.05 vs NP, *** P < 0.001
vs NP.
Numbers represent the time increase versus the NP alone. C) Total IgG serum
titer against
PapMV. Both adjuvanted groups, P < 0.001 vs NP, ** P < 0.01 vs NP + PapMV HAV-
ANP2. D) Curve of IgG2a serum titer against NP protein in time following
immunization.
Arrows represent each injection.
[026] Figure 7 presents the biochemical characterization of the PapMV VLPs. A)
SDS-
PAGE showing the expression and purification profile of the PapMV CP. Lane 1:
broad
range protein marker. Lane 2: Bacterial lysate before induction. Lane 3:
Bacterial lysate after
induction. Lane 4: Purified protein after elution. B) Morphologic evaluation
of the adjuvant
PapMV VLPs by Electron microscopy, bar is 0.2 m and C) dynamic light
scattering of the
PapMV VLPs showing the average length the different populations of the VLPs
found in
solution.
[027] Figure 8 presents PapMV VLPs stimulate the secretion of THi-TH2
cytokines. A) In
vivo imaging of fluorescently labeled PapMV VLPs. The data are presented as
pseudocolor
images indicating fluorescence (Alexa@680) intensity, with a graduation from
red (more
intense) to yellow, which were superimposed over gray-scale reference
photographs of left
inferior member of the treated mouse. Imaging was taken at 24, 48 and 72h post-
injection. B)
7
CA 02763795 2012-01-10
Cytokine/chemokine profile of reactivated splenocytes with PapMV VLPs (100 g
/ml)
isolated after one subcutaneous injection. C) after 2 subcutaneous
immunizations.
[028] Figure 9 presents (A) the amino acid sequence for the papaya mosaic
virus (PapMV)
coat protein (GenBank Accession No. NP_044334. I ; SEQ ID NO: H), ), (B) the
nucleotide
sequence encoding the PapMV coat protein (GenBank Accession No. NC_001748
(nucleotides 5889-6536); SEQ ID NO:12), (C) the amino acid sequence of the
modified
PapMV coat protein CPAN5 (SEQ ID NO:13) and the amino acid sequence of the
modified
PapMV coat protein PapMV CPsm [SEQ ID NO:] 4.
[029J Figure 10 presents (A) the nucleotide sequence encoding the NP protein
from
influenza virus strain A/WSN/33 [SEQ ID NO:] 51, and (B) the amino acid
sequence of the
NP protein [SEQ ID NO:16] encoded by the sequence provided in (A).
DETAILED DESCRIPTION OF THE INVENTION
[030] An affinity-conjugated nucleoprotein-PapMV virus-like particle (ANP)
system is
provided. The ANP system comprises a virus-like particle (VLP) derived from
the coat
protein of PapMV which has been modified by the addition of one or more
"affinity
peptides." The affinity peptides are short peptide sequences capable of
specifically binding to
influenza nucleoprotein (NP). The ANP system further comprises influenza NP
conjugated
via the one or more affinity peptides to the VLP. By "derived from" it is
meant that the VLP
comprises coat proteins that have an amino acid sequence substantially
identical to the
sequence of the wild-type coat protein. The one or more affinity peptides are
attached, for
example by chemical or genetic means, to the coat protein of the PapMV to form
a PapMV
High Affinity VLP (PapMV HAV). In accordance with one embodiment of the
present
invention, the ANP system is capable of inducing a humoral immune response, a
cellular
immune response, or both, to the NP protein in an animal. The ANP system is
thus suitable
for use as a vaccine, which may require an active participation of one or both
of these two
branches of the immune system.
8
CA 02763795 2012-01-10
Definitions
[031] Unless defined otherwise, all technical and scientific terms used herein
have the same
meaning as commonly understood by one of ordinary skill in the art to which
this invention
belongs.
[032] As used herein, the term "about" refers to approximately a +/-10%
variation from a
given value. It is to be understood that such a variation is always included
in any given value
provided herein, whether or not it is specifically referred to.
[033] The term "adjuvant," as used herein, refers to an agent that augments,
stimulates,
actuates, potentiates and/or modulates an immune response in an animal. An
adjuvant may or
may not have an effect on the immune response in itself.
[034] The term "immune response," as used herein, refers to an alteration in
the reactivity of
the immune system of an animal in response to an antigen or antigenic material
and may
involve antibody production, induction of cell-mediated immunity, complement
activation,
development of immunological tolerance, or a combination thereof.
[035] The terms "effective immunoprotective response," "effective immune
response," and
"immunoprotection," as used herein, mean an immune response that is directed
against one or
more antigen so as to protect partially or completely against disease and/or
infection by a
pathogen in a vaccinated animal. For purposes of the present invention,
protection against
disease and/or infection by a pathogen thus includes not only the absolute
prevention of the
disease or infection, but also any detectable reduction in the degree or rate
of disease or
infection, or any detectable reduction in the severity of the disease or any
symptom or
condition resulting from infection by the pathogen in the vaccinated animal as
compared to
an unvaccinated infected or diseased animal. An effective immune response can
be induced
in animals that were not previously suffering from the disease, have not
previously been
infected with the pathogen and/or do not have the disease or infection at the
time of
vaccination. An effective immune response can also be induced in an animal
already
suffering from the disease or infected with the pathogen at the time of
vaccination.
Immunoprotection can be the result of one or more mechanisms, including
humoral and/or
cellular immunity.
9
CA 02763795 2012-01-10
[036] The terms "Immune stimulation" and "immunostimulation" as used
interchangeably
herein, refer to the ability of a molecule, such as a PapMV or PapMV VLP, that
is unrelated
to an animal pathogen or disease to provide protection to against infection by
the pathogen or
against the disease by stimulating the immune system and/or improving the
capacity of the
immune system to respond to the infection or disease. Immunostimulation may
have a
prophylactic effect, a therapeutic effect, or a combination thereof.
[037] A "recombinant virus" is one in which the genetic material of a
naturally-occurring
virus has combined with other genetic material.
[038] "Naturally-occurring," as used herein, as applied to an object, refers
to the fact that an
object can be found in nature. For example, an organism (including a virus),
or a polypeptide
or polynucleotide sequence that is present in an organism that can be isolated
from a source
in nature and which has not been intentionally modified by man in the
laboratory is naturally-
occurring.
[039] The terms "polypeptide" or "peptide" as used herein is intended to mean
a molecule
in which there is at least four amino acids linked by peptide bonds.
[040] The expression "viral nucleic acid," as used herein, may be the genome
(or a majority
thereof) of a virus, or a nucleic acid molecule complementary in base sequence
to that
genome. A DNA molecule that is complementary to viral RNA is also considered
viral
nucleic acid, as is a RNA molecule that is complementary in base sequence to
viral DNA.
[041] The term "virus-like particle" (VLP), as used herein, refers to a self-
assembling
particle which has a similar physical appearance to a virus particle. The VLP
may or may not
comprise viral nucleic acids. VLPs are generally incapable of replication.
[042] The term "pseudovirus," as used herein, refers to a VLP that comprises
nucleic acid
sequences, such as DNA or RNA, including nucleic acids in plasmid form.
Pseudoviruses are
generally incapable of replication.
[043] The term "vaccine," as used herein, refers to a material capable of
producing an
effective immune response.
CA 02763795 2012-01-10
[044] The terms "immumogen" and "`antigen" as used herein refer to a molecule,
molecules,
a portion or portions of a molecule, or a combination of molecules, up to and
including whole
cells and tissues, which are capable of inducing an immune response in a
subject alone or in
combination with an adjuvant. The immunogen/antigen may comprise a single
epitope or
may comprise a plurality of epitopes. The term thus encompasses peptides,
carbohydrates,
proteins, nucleic acids, and various microorganisms, in whole or in part,
including viruses,
bacteria and parasites. Haptens are also considered to be encompassed by the
terms
"immunogen" and "antigen" as used herein.
[045] The terms "immunization" and "vaccination" are used interchangeably
herein to refer
to the administration of a vaccine to a subject for the purposes of raising an
effective immune
response and can have a prophylactic effect, a therapeutic effect, or a
combination thereof.
Immunization can be accomplished using various methods depending on the
subject to be
treated including, but not limited to, intraperitoneal injection (i.p.),
intravenous injection
(i.v.), intramuscular injection (i.m.), oral administration, intranasal
administration, spray
administration and immersion.
[046] As used herein, the terms "treat," "treated," or "treating" when used
with respect to a
disease or pathogen refers to a treatment which increases the resistance of a
subject to the
disease or to infection with a pathogen (i.e. decreases the likelihood that
the subject will
contract the disease or become infected with the pathogen) as well as a
treatment after the
subject has contracted the disease or become infected in order to fight a
disease or infection
(for example, reduce, eliminate, ameliorate or stabilise a disease or
infection).
[047] The term "prime" and grammatical variations thereof, as used herein,
means to
stimulate and/or actuate an immune response against an antigen in an animal
prior to
administering a booster vaccination with the antigen.
1048] The term "subject" or "patient" as used herein refers to an animal in
need of
treatment.
[049] The term "animal," as used herein, refers to both human and non-human
animals,
including, but not limited to, mammals, birds and fish, and encompasses
domestic, farm, zoo,
laboratory and wild animals, such as, for example, cows, pigs, horses, goats,
sheep or other
11
CA 02763795 2012-01-10
hoofed animals, dogs, cats, chickens, ducks, non-human primates, guinea pigs,
rabbits,
ferrets, rats, hamsters and mice.
10501 The term "substantially identical," as used herein in relation to a
nucleic acid or
amino acid sequence indicates that, when optimally aligned, for example using
the methods
described below, the nucleic acid or amino acid sequence shares at least 70%,
at least 75%, at
least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least
97%, at least 98% or
at least 99% sequence identity with a defined second nucleic acid or amino
acid sequence (or
"reference sequence"). "Substantial identity" may be used to refer to various
types and
lengths of sequence, such as full-length sequence, functional domains, coding
and/or
regulatory sequences, promoters, and genomic sequences. Percent identity
between two
amino acid or nucleic acid sequences can be determined in various ways that
are within the
skill of a worker in the art, for example, using publicly available computer
software such as
Smith Waterman Alignment (Smith, T. F. and M. S. Waterman (1981) JMo1 Biol
147:195-
7); "BestFit" (Smith and Waterman, Advances in Applied Mathematics, 482-489
(1981)) as
incorporated into GeneMatcher PIusTM, Schwarz and Dayhof (1979) Atlas of
Protein
Sequence and Structure, Dayhof, M. 0., Ed pp 353-358; BLAST program (Basic
Local
Alignment Search Too] (Altschul, S. F., W. Gish, et al. (1990) J Mol Biol 215:
403-10), and
variations thereof including BLAST-2, BLAST-P, BLAST-N, BLAST-X, WU-BLAST-2,
ALIGN, ALIGN-2, CLUSTAL, and Megalign (DNASTAR) software. In addition, those
skilled in the art can determine appropriate parameters for measuring
alignment, including
algorithms needed to achieve maximal alignment over the length of the
sequences being
compared. In general, for amino acid sequences, the length of comparison
sequences will be
at least 10 amino acids. One skilled in the art will understand that the
actual length will
depend on the overall length of the sequences being compared and may be at
least 20, at least
30, at least 40, at least 50, at least 60, at least 70, at least 80, at least
90, at least 100, at least
110, at least 120, at least 130, at least 140, at least 150, or at least 200
amino acids, or it may
be the full-length of the amino acid sequence. For nucleic acids, the length
of comparison
sequences will generally be at least 25 nucleotides, but may be at least 50,
at least 100, at
least 125, at least 150, at least 200, at least 250, at least 300, at least
350, at least 400, at least
450, at least 500, at least 550, or at least 600 nucleotides, or it may be the
full-length of the
nucleic acid sequence.
12
CA 02763795 2012-01-10
10511 The terms "corresponding to" or "corresponds to" indicate that a nucleic
acid
sequence is identical to all or a portion of a reference nucleic acid
sequence. In
contradistinction, the term "complementary to" is used herein to indicate that
the nucleic acid
sequence is identical to all or a portion of the complementary strand of a
reference nucleic
acid sequence. For illustration, the nucleic acid sequence "TATAC" corresponds
to a
reference sequence "TATAC" and is complementary to a reference sequence
"GTATA."
AFFINITY-CONJUGATED NUCLEOPROTEIN-PAPMV VLP (ANP) SYSTEM
[052] As indicated above, the ANP system comprises a virus-like particle (VLP)
derived
from the coat protein of PapMV which has been modified by the addition of one
or more
"affinity peptides." The affinity peptides are short peptide sequences capable
of specifically
binding to influenza nucleoprotein (NP). The ANP system further comprises
influenza NP
conjugated via the one or more affinity peptides to the VLP.
PAPMV VLPs
[053] The ANP system of the present invention comprises PapMV VLPs formed from
recombinant PapMV coat proteins that have multimerised and self-assembled to
form a VLP.
When assembled, each VLP comprises a long helical array of coat protein
subunits. The wild-
type virus comprises over 1200 coat protein subunits and is about 500nm in
length. PapMV
VLPs that are either shorter or longer than the wild-type virus can still,
however, be effective.
In one embodiment of the present invention, the VLP comprises at least 40 coat
protein
subunits. In another embodiment, the VLP comprises between about 40 and about
1600 coat
protein subunits. In an alternative embodiment, the VLP is at least 40nm in
length. In another
embodiment, the VLP is between about 40nm and about 600nm in length.
[054] The VLPs of the present invention can be prepared from a plurality of
recombinant
coat proteins having identical amino acid sequences, such that the final VLP
when assembled
comprises identical coat protein subunits, or the VLP can be prepared from a
plurality of
recombinant coat proteins having different amino acid sequences, such that the
final VLP
when assembled comprises variations in its coat protein subunits.
13
CA 02763795 2012-01-10
1055] The coat protein used to form the VLP can be the entire PapMV coat
protein, or part
thereof, or it can be a genetically modified version of the PapMV coat
protein, for example,
comprising one or more amino acid deletions, insertions, replacements and the
like, provided
that the coat protein retains the ability to multimerise and assemble into a
VLP. The amino
acid sequence of the wild-type PapMV coat (or capsid) protein is known in the
art (see, Sit, et
at., 1989, J. Gen. Virol., 70:2325-2331, and GenBank Accession No. NP044334.1)
and is
provided herein as SEQ ID NO:I I (see Figure 9A). The nucleotide sequence of
the PapMV
coat protein is also known in the art (see, Sit, et al., ibid., and GenBank
Accession No.
NC 001748 (nucleotides 5889-6536)) and is provided herein as SEQ ID NO:12 (see
Figure
9B).
[056] As noted above, the amino acid sequence of the recombinant PapMV coat
protein
comprised by the VLP need not correspond precisely to the parental (wild-type)
sequence, i.e.
it may be a "variant sequence." For example, the recombinant protein may be
mutagenized by
substitution, insertion or deletion of one or more amino acid residues so that
the residue at
that site does not correspond to either the parental (reference) sequence. One
skilled in the art
will appreciate, however, that such mutations will not be extensive and will
not dramatically
affect the ability of the recombinant coat protein to multimerise and assemble
into a VLP.
The ability of a variant version of the PapMV coat protein to assemble into
multimers and
VLPs can be assessed, for example, by electron microscopy following standard
techniques,
such as the exemplary methods set out in the Examples provided herein.
1057] Recombinant coat proteins that are fragments of the wild-type protein
that retain the
ability to multimerise and assemble into a VLP (i.e. are "functional"
fragments) are,
therefore, also contemplated by the present invention. For example, a fragment
may comprise
a deletion of one or more amino acids from the N-terminus, the C-terminus, or
the interior of
the protein, or a combination thereof. In general, functional fragments are at
least 100 amino
acids in length. In one embodiment of the present invention, functional
fragments are at least
150 amino acids, at least 160 amino acids, at least 170 amino acids, at least
180 amino acids,
and at least 190 amino acids in length. Deletions made at the N-terminus of
the protein
should generally delete fewer than 25 amino acids in order to retain the
ability of the protein
to multimerise.
14
CA 02763795 2012-01-10
10581 In accordance with the present invention, when a recombinant coat
protein comprises
a variant sequence, the variant sequence is at least about 70% identical to
the reference
sequence. In one embodiment, the variant sequence is at least about 75%
identical to the
reference sequence. In other embodiments, the variant sequence is at least
about 80%, at least
about 85%, at least about 90%, at least about 95%, and at least about 97%
identical to the
reference sequence. In a specific embodiment, the reference amino acid
sequence is SEQ ID
NO:11.
1059] In one embodiment of the present invention, the VLP comprises a
genetically
modified (i.e. variant) version of the PapMV coat protein. In another
embodiment, the
PapMV coat protein has been genetically modified to delete amino acids from
the N- or C-
terminus of the protein and/or to include one or more amino acid
substitutions. In a further
embodiment, the PapMV coat protein has been genetically modified to delete
between about
1 and about 10 amino acids from the N- or C-terminus of the protein.
[060] In a specific embodiment, the PapMV coat protein has been genetically
modified to
remove one of the two methionine codons that occur proximal to the N-terminus
of the
protein (i.e. at positions I and 6 of SEQ ID NO: 11) and can initiate
translation. Removal of
one of the translation initiation codons allows a homogeneous population of
proteins to be
produced. The selected methionine codon can be removed, for example, by
substituting one
or more of the nucleotides that make up the codon such that the codon codes
for an amino
acid other than methionine, or becomes a nonsense codon. Alternatively all or
part of the
codon, or the 5' region of the nucleic acid encoding the protein that includes
the selected
codon, can be deleted. In a specific embodiment of the present invention, the
PapMV coat
protein has been genetically modified to delete between I and 5 amino acids
from the N-
terminus of the protein. In a further embodiment, the genetically modified
PapMV coat
protein has an amino acid sequence substantially identical to SEQ ID NO:13. In
a further
embodiment, the PapMV coat protein that has been genetically modified to
include additional
amino acids (for example between about I and about 8 amino acids) at the C-
terminus that
result from the inclusion of one or more specific restriction enzyme sites
into the encoding
nucleotide sequence. In a specific embodiment, the PapMV coat protein has an
amino acid
sequence substantially identical to SEQ ID NO:14.
CA 02763795 2012-01-10
10611 When the recombinant coat protein comprises a variant sequence that
contains one or
more amino acid substitutions, these can be "conservative" substitutions or
"non-
conservative" substitutions. A conservative substitution involves the
replacement of one
amino acid residue by another residue having similar side chain properties. As
is known in
the art, the twenty naturally occurring amino acids can be grouped according
to the
physicochemical properties of their side chains. Suitable groupings include
alanine, valine,
leucine, isoleucine, proline, methionine, phenylalanine and tryptophan
(hydrophobic side
chains); glycine, serine, threonine, cysteine, tyrosine, asparagine, and
glutamine (polar,
uncharged side chains); aspartic acid and glutamic acid (acidic side chains)
and lysine,
arginine and histidine (basic side chains). Another grouping of amino acids is
phenylalanine,
tryptophan, and tyrosine (aromatic side chains). A conservative substitution
involves the
substitution of an amino acid with another amino acid from the same group. A
non-
conservative substitution involves the replacement of one amino acid residue
by another
residue having different side chain properties, for example, replacement of an
acidic residue
with a neutral or basic residue, replacement of a neutral residue with an
acidic or basic
residue, replacement of a hydrophobic residue with a hydrophilic residue, and
the like.
[0621 In one embodiment of the present invention, the variant sequence
comprises one or
more non-conservative substitutions. Replacement of one amino acid with
another having
different properties may improve the properties of the coat protein. For
example, as described
herein, mutation of residue 128 of the coat protein improves assembly of the
protein into
VLPs. In one embodiment of the present invention, therefore, the coat protein
comprises a
mutation at residue 128 of the coat protein in which the glutamic residue at
this position is
substituted with a neutral residue. In a further embodiment, the glutamic
residue at position
128 is substituted with an alanine residue.
1063] Likewise, the nucleic acid sequence encoding the recombinant coat
protein need not
correspond precisely to the parental reference sequence but may vary by virtue
of the
degeneracy of the genetic code and/or such that it encodes a variant amino
acid sequence as
described above. In one embodiment of the present invention, therefore, the
nucleic acid
sequence encoding a the recombinant coat protein is at least about 70%
identical to the
reference sequence. In another embodiment, the nucleic acid sequence encoding
the
recombinant coat protein is at least about 75% identical to the reference
sequence. In other
16
CA 02763795 2012-01-10
embodiments, the nucleic acid sequence encoding the recombinant coat protein
is at least
about 80%, at least about 85% or at least about 90% identical to the reference
sequence. In a
specific embodiment, the reference nucleic acid sequence is SEQ ID NO: 12.
AFFINITY PEPTIDES FOR NUCLEOPROTEIN
[064] The PapMV VLP coat protein is attached, for example, genetically fused
to one or
more affinity peptides that have a high avidity for the NP protein, to form a
PapMV High
Affinity VLP (PapMV HAV) as described in more detail below.
[065] The affinity peptides selected for use in the ANP system of the present
invention are
preferably capable of specifically binding to the NP protein and of being
attached, for
example by chemical or genetic means, to a PapMV coat protein. Exemplary
peptides are
described in the Examples provided herein. Other affinity peptides that bind
influenza NP can
be identified using methods such as those described below or are known in the
art.
[066] Suitable affinity peptides can be selected by art-known techniques, such
as phage or
yeast display techniques. The peptides can be naturally occurring,
recombinant, synthetic, or
a combination of these. For example, the peptide can be a fragment of a
naturally occurring
protein or polypeptide. The term peptide as used herein also encompasses
peptide analogues,
peptide derivatives and peptidomimetic compounds. Such compounds are well
known in the
art and may have advantages over naturally occurring peptides, including, for
example,
greater chemical stability, increased resistance to proteolytic degradation,
enhanced
pharmacological properties (such as, half-life, absorption, potency and
efficacy) and/or
reduced antigenicity.
[067] Suitable peptides can range from about 3 amino acids in length to about
50 amino
acids in length. In accordance with one embodiment of the invention, an
affinity peptide
suitable for use in the ANP system is at least 5 amino acids in length. In
accordance with
another embodiment of the invention, an affinity peptide suitable for use in
the ANP system
is at least 7 amino acids in length. In accordance with another embodiment of
the invention,
an affinity peptide suitable for use in the ANP system is between about 5 and
about 50 amino
acids in length. In accordance with another embodiment of the invention, an
affinity peptide
suitable for use in the ANP system is between about 7 and about 50 amino acids
in length. In
17
CA 02763795 2012-01-10
other embodiments of the present invention, an affinity peptide suitable for
use in the ANP
system between about 5 and about 45 amino acids in length, between about 5 and
about 40
amino acids in length, between about 5 and about 35 amino acids in length and
between
about 5 and about 30 amino acids in length. In accordance with a specific
embodiment of the
invention, an affinity peptide suitable for use in the ANP system is 3, 4, 5,
6, 7, 8, 9, 10, 11,
12, 13, 14 or 15 amino acids in length. As would be understood by a worker
skilled in the art,
when the peptide is to be genetically fused to the PapMV coat protein, the
length of the
peptide selected should not interfere with the ability of the coat protein to
self-assemble into
VLPs.
[068] The affinity peptide comprised by the PapMV or VLP can be a single
peptide or it can
comprise a tandem or multiple arrangement of peptides.
10691 In one embodiment, the affinity peptide can be attached by chemical or
genetic means
to the C-terminus of the PapMV coat protein. In another embodiment, the
affinity peptide is
attached to the N-terminus of the PapMV coat protein. In yet another
embodiment, the
affinity peptide is attached to an internal loop of the PapMV coat protein
that is exposed on
the surface of the coat protein.
[0701 A spacer can be included between the affinity peptide and the coat
protein if desired
in order to facilitate the binding of the NP protein. Suitable spacers include
short stretches of
neutral amino acids, such as glycine, for example, a stretch of between about
3 and about 10
neutral amino acids. In one embodiment, a stretch of between about 3 and about
10 amino
acids is inserted between the PapMV coat protein and the affinity peptide.
[071] As noted above, phage display can be used to select specific peptides
that bind to an
antigenic protein of interest using standard techniques (see, for example,
Current Protocols in
Immunology, ed. Coligan et al., J. Wiley & Sons, New York, NY) and/or
commercially
available phage display kits (for example, the Ph.D. series of kits available
from New
England Biolabs, and the T7-Select9 kit available from Novagen). An example of
selection
of peptides by phage display is also provided in Example 2, below.
[072] Representative peptides that bind NP that were identified by phage
display include:
FHEFWPT [SEQ ID NO:4], FHENWPT [SEQ ID NO:5], KVWQIPH [SEQ ID NO:6] and
18
CA 02763795 2012-01-10
LPTPPWQ [SEQ ID NO:7]. One skilled in the art will appreciate that these
peptides are
examples only and that other peptides having an affinity for NP can be readily
identified
using art-known techniques. Truncated versions, for example comprising at
least 4
consecutive amino acids, of the SEQ ID NOs:4 to 7 are also contemplated. In
accordance
with one embodiment of the present invention, there is provided an ANP system
comprising a
PapMV VLP that includes one or more affinity peptides comprising all or a part
of the
sequence set forth in SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7.
INFLUENZA NUCLEOPROTEIN
[073] As indicated above, the ANP system of the present invention comprises an
NP protein
derived from an influenza virus. The ANP system may comprise polypeptide
fragments of
the NP protein and/or antigenic regions or fragments of the NP protein. The NP
protein can
be purified from the influenza virus, or expressed recombinantly.
[074] In the ANP system, the NP protein is combined with the PapMV VLP. In
certain
embodiments, it is contemplated that the NP protein may be conjugated to the
affinity peptide
added to the coat protein of the PapMV VLP. Conjugation can be, for example,
binding via
covalent or non-covalent means.
[075] In one embodiment, the NP protein of the ANP system is derived from an
influenza A
strain. Generally, influenza A strains are capable of infecting a large number
of vertebrates
including humans, domestic and farm animals, marine mammals, and various
birds. In
another embodiment, the NP protein of the ANP system is derived from an
Influenza B
strain. Typically, influenza B strains are capable of infecting humans and
pigs. In another
embodiment, the NP protein of the ANP system is derived from an influenza C
strain. The
influenza C strain has been observed to infect humans and seals.
10761 In one embodiment, the NP protein of the ANP system may be derived from
an
influenza A strain that infects humans, pigs, poultry. Humans are infected by
a variety of
influenza A strains, the most common strains being HIM, H IN2 and 1-13N2. In
pigs, strains
H I N I, H I N2 and H3N2 are prevalent, whereas in horses, strains H7N7 and
H3N8 are
prevalent. Poultry are also affected by a wide variety of strains including
HIN7, H2N2,
H3N8, H4N2, H4N8, H5NI, H5N2, H5N9, H6N5, H7N2, H7N3, H9N2, HION7, HI lN6,
19
CA 02763795 2012-01-10
H 12N5, 1-11 3N6 and H 14N5, many of which have also been reported in humans.
In one
embodiment, the NP protein of the ANP system may be derived from an influenza
A strain
that is a zoonotic, potential pandemic strain. Strains H5N I, H9N2 and H7N7
are considered
to be zoonotic, potential pandemic strains and are capable of affecting a
variety of
vertebrates. H5N I has been reported to infect domestic cats and FI3N8 has
been reported in
dogs. In one embodiment, the NP protein of the ANP system is derived from one
of the
following influenza A strains: HIN1, HIN2 and H3N2.
[077] The sequences of the influenza virus NP protein from various influenza
strains are
known in the art and are readily accessible from GenBank database maintained
by the
National Center for Biotechnology Information (NCBI). For example, the amino
acid
sequence of the NP protein from the influenza A strain A/WSN/33 is provided in
Fig. 10
[SEQ ID NO:16]. Suitable NP proteins for inclusion in the ANP system can,
therefore, be
readily selected by the skilled worker based on the knowledge in the art of
antigenic regions
of the influenza proteins and taking into consideration the animal in which an
immune
response is to be raised with the final ANP system.
[078] Various antigenic regions of the NP protein have been identified and are
suitable for
use in the ANP of the present invention. As indicated above, the NP protein
comprised by the
ANP of the present invention can be full-length proteins, fragments thereof,
or antigenic
fragments thereof. Examples include truncated versions of the NP protein, such
as N-terminal
or C-terminal truncations, as well as known antigenic fragments. Modified
version of the NP
protein, for example, NP protein that has been modified to facilitate
expression or
purification, are also contemplated.
[079] For humans, antigenic fragments of NP proteins include, but are not
limited to, the
nucleoprotein epitopes: NP 206-229 (Brett, 1991, J. Immunol. 147:984-991),
NP335-350 and
NP380-393 (Dyer and Middleton, 1993, In: Histoconipatibility testing, a
practical approach
(Ed.: Rickwood, D. and Haines, B. D.) IRL Press, Oxford, p. 292; Gulukota and
DeLisi,
1996, Genetic Analysis. Biornolecular Engineering, 13:81), NP 305-313
(DiBrino, 1993,
PNAS 90:1508-12); NP 384-394 (Kvist, 1991, Nature 348:446-448); NP 89-101
(Cerundolo,
1991, Proc. R. Soc. Lon. 244:169-7); NP 91-99 (Silver et al, 1993, Nature 360:
367-369); NP
CA 02763795 2012-01-10
380-388 (Suhrbier, 1993, J. Immunol. 79:171-173): NP 44-52 and NP 265-273
(DiBrino,
1993, ibid.).
[080] In one embodiment of the present invention, the ANP system comprises a
full-length
NP protein. In another embodiment, the ANP system comprises a C-terminally or
N-
terminally truncated NP protein, or a fragment of NP that comprises a
plurality of epitopes. In
a further embodiment, the ANP system comprises a fragment of NP that comprises
a plurality
of the epitopes listed above.
PREPARATION OF THE ANP SYSTEM
[081] The present invention provides an ANP system that comprises PapMV VLPs
derived
from a recombinant PapMV coat protein that has been modified by the addition
of one or
more affinity peptides for the NP protein, and an NP protein. The recombinant
coat proteins
are capable of multimerisation and assembly into VLPs. Methods of genetically
fusing the
affinity peptides for linking to NP, to the coat protein are known in the art
and some are
described below and in the Examples. Methods of chemically cross-linking
various molecules
to proteins are well known in the art and can be employed.
PapMV VLPs
[082] The recombinant coat proteins for use to prepare the VLPs of the present
invention
can be readily prepared by standard genetic engineering techniques by the
skilled worker
provided with the sequence of the wild-type protein. Methods of genetically
engineering
proteins are well known in the art (see, for example, Ausubel et al. (1994 &
updates) Current
Protocols in Molecular Biology, John Wiley & Sons, New York), as is the
sequence of the
wild-type PapMV coat protein (see SEQ ID NOs: I I and 12).
[083] Isolation and cloning of the nucleic acid sequence encoding the wild-
type protein can
be achieved using standard techniques (see, for example, Ausubel et al.,
ibid.). For example,
the nucleic acid sequence can be obtained directly from the PapMV by
extracting RNA by
standard techniques and then synthesizing eDNA from the RNA template (for
example, by
RT-PCR). PapMV can be purified from infected plant leaves that show mosaic
symptoms by
standard techniques.
21
CA 02763795 2012-01-10
1084] The nucleic acid sequence encoding the coat protein is then inserted
directly or after
one or more subcloning steps into a suitable expression vector. One skilled in
the art will
appreciate that the precise vector used is not critical to the instant
invention. Examples of
suitable vectors include, but are not limited to, plasmids, phagernids,
cosmids, bacteriophage,
baculoviruses, retroviruses or DNA viruses. The coat protein can then be
expressed and
purified as described in more detail below.
[085] Alternatively, the nucleic acid sequence encoding the coat protein can
be further
engineered to introduce one or more mutations, such as those described above,
by standard in
vitro site-directed mutagenesis techniques well-known in the art. Mutations
can be introduced
by deletion, insertion, substitution, inversion, or a combination thereof, of
one or more of the
appropriate nucleotides making up the coding sequence. This can be achieved,
for example,
by PCR based techniques for which primers are designed that incorporate one or
more
nucleotide mismatches, insertions or deletions. The presence of the mutation
can be verified
by a number of standard techniques, for example by restriction analysis or by
DNA
sequencing.
[086] As noted above, the coat proteins can also be engineered to produce
fusion proteins
comprising one or more affinity peptides fused to the coat protein. Methods
for making
fusion proteins are well known to those skilled in the art. DNA sequences
encoding a fusion
protein can be inserted into a suitable expression vector as noted above.
[087] One of ordinary skill in the art will appreciate that the DNA encoding
the coat protein
or fusion protein can be altered in various ways without affecting the
activity of the encoded
protein. For example, variations in DNA sequence may be used to optimize for
codon
preference in a host cell used to express the protein, or may contain other
sequence changes
that facilitate expression.
[088] One skilled in the art will understand that the expression vector may
further include
regulatory elements, such as transcriptional elements, required for efficient
transcription of
the DNA sequence encoding the coat or fusion protein. Examples of regulatory
elements that
can be incorporated into the vector include, but are not limited to,
promoters, enhancers,
terminators, and polyadenylation signals. The present invention, therefore,
provides vectors
comprising a regulatory element operatively linked to a nucleic acid sequence
encoding a
22
CA 02763795 2012-01-10
genetically engineered coat protein. One skilled in the art will appreciate
that selection of
suitable regulatory elements is dependent on the host cell chosen for
expression of the
genetically engineered coat protein and that such regulatory elements may be
derived from a
variety of sources, including bacterial, fungal, viral, mammalian or insect
genes.
[089] In the context of the present invention, the expression vector may
additionally contain
heterologous nucleic acid sequences that facilitate the purification of the
expressed protein.
Examples of such heterologous nucleic acid sequences include, but are not
limited to, affinity
tags such as metal-affinity tags, histidine tags, avidin / streptavidin
encoding sequences,
glutathione-S-transferase (GST) encoding sequences and biotin encoding
sequences. The
amino acids corresponding to expression of the nucleic acids can be removed
from the
expressed coat protein prior to use according to methods known in the art.
Alternatively, the
amino acids corresponding to expression of heterologous nucleic acid sequences
can be
retained on the coat protein if they do not interfere with its subsequent
assembly into VLPs.
[090] In one embodiment of the present invention, the coat protein is
expressed as a
histidine tagged protein. The histidine tag can be located at the carboxyl
terminus or the
amino terminus of the coat protein.
[091] The expression vector can be introduced into a suitable host cell or
tissue by one of a
variety of methods known in the art. Such methods can be found generally
described in
Ausubel et al. (ibid.) and include, for example, stable or transient
transfection, lipofection,
electroporation, and infection with recombinant viral vectors. One skilled in
the art will
understand that selection of the appropriate host cell for expression of the
coat protein will be
dependent upon the vector chosen. Examples of host cells include, but are not
limited to,
bacterial, yeast, insect, plant and mammalian cells. The precise host cell
used is not critical
to the invention. The coat proteins can be produced in a prokaryotic host
(e.g., E. coli, A.
salmonicida or B. subtilis) or in a eukaryotic host (e.g., Saccharomyces or
Pichia;
mammalian cells, e.g., COS, NIH 3T3, CHO, BHK, 293, or HeLa cells; or insect
cells). In
one embodiment, the coat proteins are expressed in prokaryotic cells.
[092] If desired, the coat proteins can be purified from the host cells by
standard techniques
known in the art (see, for example, in Current Protocols in Protein Science,
ed. Coligan, J.E.,
et al., Wiley & Sons, New York, NY) and sequenced by standard peptide
sequencing
23
CA 02763795 2012-01-10
techniques using either the intact protein or proteolytic fragments thereof to
confirm the
identity of the protein.
[093] The recombinant coat proteins of the present invention comprising the
affinity
peptides are capable of multimerisation and assembly into VLPs. In general,
assembly takes
place in the host cell expressing the coat protein. The VLPs can be isolated
from the host
cells by standard techniques, such as those described in Denis et al. 2007,
2008, and
Tremblay et al., 2006. In general, the isolate obtained from the host cells
contains a mixture
of VLPs, discs, less organised forms of the coat protein (for example,
monomers and dimers).
The VLPs can be separated from the other coat protein components by, for
example,
ultracentrifugation or gel filtration chromatography (for example, using
Superdex G-200) to
provide a substantially pure VLP preparation. In this context, by
"substantially pure" it is
meant that the preparation contains 70% or greater of VLPs. Alternatively, a
mixture of the
various forms of coat protein can be used in the final vaccine compositions.
When such a
mixture us employed, the VLP content should be 40% or greater. In one
embodiment,
preparations containing 50% or more of VLPs are used in the final vaccine
compositions. In
another embodiment, preparations containing 60% or more of VLPs are used in
the final
vaccine compositions. In a further embodiment, preparations containing 70% or
more of
VLPs are used in the final vaccine compositions. In another embodiment,
preparations
containing 80% or more of VLPs are used in the final vaccine compositions.
[094] The VLPs can be further purified by standard techniques, such as
chromatography, to
remove contaminating host cell proteins or other compounds, such as LPS. In
one
embodiment of the present invention, the VLPs are purified to remove LPS.
[095] In one embodiment of the present invention, the coat proteins assemble
to provide a
recombinant virus in the host cell and can be used to produce infective virus
particles which
comprise nucleic acid and fusion protein. This can enable the infection of
adjacent cells by
the infective virus particle and expression of the fusion protein therein. In
this embodiment,
the host cell used to replicate the virus can be a plant cell, insect cell,
mammalian cell or
bacterial cell that will allow the virus to replicate. The cell may be a
natural host cell for the
virus from which the virus-like particle is derived, but this is not
necessary. The host cell can
be infected initially with virus in particle form (i.e. in assembled rods
comprising nucleic acid
24
CA 02763795 2012-01-10
and a protein) or alternatively in nucleic acid form (i.e. RNA such as viral
RNA; eDNA or
run-off transcripts prepared from cDNA) provided that the virus nucleic acid
used for initial
infection can replicate and cause production of whole virus particles having
the chimeric
protein.
Characteristics of Recombinant Coat Proteins
[096] The recombinant coat proteins can be analyzed for their ability to
multimerize and
self-assemble into a VLP by standard techniques. For example, by visualising
the purified
recombinant protein by electron microscopy (see, for example, Example 4). VLP
formation
may also be determined by ultracentrifugation, and circular dichroism (CD)
spectrophotometry may be used to compare the secondary structure of the
recombinant
proteins with the WT virus.
[097] Stability of the VLPs can be determined if desired by techniques known
in the art, for
example, by SDS-PAGE and proteinase K degradation analyses. According to one
embodiment of the present invention, the PapMV VLPs of the invention are
stable at elevated
temperatures and can be stored easily at room temperature.
Combination of the PapMV VLPs with NP
[098] The NP protein can be combined with the PapMV VLPs in the ANP system by
bringing the NP protein into contact with the PapMV VLP. In certain
embodiments,
conjugation can occur between the affinity peptides on the PapMV VLPs and the
NP protein,
for example, via the formation of at least one non-covalent chemical bond, for
example, a
hydrogen bond, an ionic bond, a hydrophobic interaction or van der Waals
interaction.
Covalent attachment of the NP protein to the affinity peptide attached to the
PapMV coat
protein is also contemplated.
The PapMV VLPs and NP protein can be combined to provide the ANP system, for
example,
by simple mixing of the NP protein and the PapMV VLPs in solution with or
without
agitation.
If covalent attachment of the NP protein to the affinity peptide is to be
carried out, an
appropriate chemical agent, as is known in the art, can be added to the PapMV
VLPs-NP
CA 02763795 2012-01-10
protein mixture to induce formation of covalent bounds between the PapMV VLPs
and the
NP protein, and thereby improve the strength of attachment between the PapMV
VLP and the
NP protein. After conjugation any unconjugated NP protein and/or PapMV VLP
and/or cross
linking agent(s) can optionally be removed using standard techniques, for
example,
chromatography gel filtration technique that will separate the larger
conjugated proteins from
the unconjugated partners. Ultracentrifugation can also be used to separate
the NP protein
from the PapMV VLPs and the conjugated complex.
Optimal ratios of NP protein:PapMV VLP for inclusion in the ANP system can be
readily
determined by the skilled worker. For example, ratios of NP protein:PapMV VLP
of between
about 10:1 and 1:10 on a weight:weight basis may be useful. In one embodiment,
ratios of NP
protein:PapMV VLP of between about 9:1 and 1:9 on a weight:weight basis are
used to form
the ANP system. In another embodiment, ratios of NP protein:PapMV VLP of
between about
8:1 and 1:8 on a weight:weight basis are used to form the ANP system. In other
embodiments, ratios of NP protein:PapMV VLP of between about 7:1 and 1:7, of
about 6:1
to 1:6, and of about 5:1 and 1:5 on a weight:weight basis are used to form the
ANP system.
EVALUATION OF EFFICACY
10991 In order to evaluate the efficacy of the ANP system of the present
invention as a
vaccine, challenge studies can be conducted. Such studies involve the
inoculation of groups
of test animals (such as mice) with an ANP system of the present invention by
standard
techniques. Control groups comprising non-inoculated animals and/or animals
inoculated
with a commercially available vaccine, or other positive control, are set up
in parallel. After
an appropriate period of time post-vaccination, the animals are challenged
with an influenza
virus. Blood samples collected from the animals pre- and post-inoculation, as
well as post-
challenge are then analyzed for an antibody response to the virus. Suitable
tests for the
antibody response include, but are not limited to, Western blot analysis and
Enzyme-Linked
Immunosorbent Assay (ELISA). The animals can also be monitored for development
of other
conditions associated with infection with influenza virus including, for
example, body
temperature, weight. and the like. For certain strains of influenza, survival
is also a suitable
marker.
26
CA 02763795 2012-01-10
[0100] Cellular immune responses can also be assessed by techniques known in
the art,
including those described in the Examples presented herein. For example,
through processing
and cross-presentation of an epitope expressed on a PapMV VLP to specific T
lymphocytes
by dendritic cells in vitro and in vivo. Other useful techniques for assessing
induction of
cellular immunity (T lymphocyte) include monitoring T cell expansion and IFN-y
secretion
release, for example, by ELISA to monitor induction of cytokines (see Example
10).
[0101] The extent of infection can also be assessed by measurement of lung
viral titer using
standard techniques after sacrifice of the animal.
Production of stock PapMV or VLP
[0102] Stocks of recombinant PapMV or VLP can be prepared by standard
techniques. For
example, a recombinant virus can be propagated in an appropriate host, such as
Carica
papaya or Antirrhinum majus, such that sufficient recombinant virus can be
harvested.
[0103] Stocks of PapMV VLPs can be prepared from an appropriate host cell,
such as E. coli
transformed or transfected with an expression vector encoding the recombinant
coat protein
that makes up the VLP. The host cells are then cultured under conditions that
favor the
expression of the encoded protein, as is known in the art. The expressed coat
protein will
multimerise and assemble into VLPs in the host cell and can be isolated from
the cells by
standard techniques, for example, by rupturing the cells and submitting the
cell lysate to one
or more chromatographic purification step.
[0104] PapMV VLPs are stable structures and stocks of the VLPs can, therefore,
be stored
easily at room temperature or in a refrigerator.
VACCINE COMPOSITIONS
[0105] The present invention provides for compositions suitable for use as
influenza vaccines
comprising the ANP system of the invention together with one or more non-toxic
pharmaceutically acceptable carriers, diluents and/or excipients. If desired,
other active
ingredients, adjuvants and/or immunopotentiators may be included in the
compositions.
10106] The compositions can be formulated for administration by a variety of
routes. For
example, the compositions can be formulated for oral, topical, rectal, nasal
or parenteral
27
CA 02763795 2012-01-10
administration or for administration by inhalation or spray. The term
parenteral as used herein
includes subcutaneous injections, intravenous, intramuscular, intrathecal,
intrasternal
injection or infusion techniques. Intranasal administration to the subject
includes
administering the pharmaceutical composition to the mucous membranes of the
nasal passage
or nasal cavity of the subject. In one embodiment of the present invention,
the compositions
are formulated for topical, rectal or parenteral administration or for
administration by
inhalation or spray, for example by an intranasal route. In another
embodiment, the
compositions are formulated for parenteral administration.
10107] The compositions preferably comprise an effective amount of one or more
ANP
systems of the invention. The term "effective amount" as used herein refers to
an amount of
the ANP system required to induce a detectable immune response. The effective
amount of
ANP system for a given indication can be estimated initially, for example,
either in cell
culture assays or in animal models, usually in rodents, rabbits, dogs, pigs or
primates. The
animal model may also be used to determine the appropriate concentration range
and route of
administration. Such information can then be used to determine useful doses
and routes for
administration in the animal to be treated, including humans. In one
embodiment of the
present invention, the unit dose comprises between about I0 g to about 10mg of
protein. In
another embodiment, the unit dose comprises between about 10 g to about 5mg of
protein. In
a further embodiment, the unit dose comprises between about 40 g to about 2 mg
of protein.
One or more doses may be used to immunise the animal, and these may be
administered on
the same day or over the course of several days or weeks. In one embodiment of
the
invention, two or more doses of the composition are administered to the animal
to be treated.
In another embodiment, three or more doses of the composition are administered
to the
animal to be treated.
101081 Compositions for oral use can be formulated, for example, as tablets,
troches,
lozenges, aqueous or oily suspensions, dispersible powders or granules,
emulsion hard or soft
capsules, or syrups or elixirs. Such compositions can be prepared according to
standard
methods known to the art for the manufacture of pharmaceutical compositions
and may
contain one or more agents selected from the group of sweetening agents,
flavoring agents,
coloring agents and preserving agents in order to provide pharmaceutically
elegant and
palatable preparations. Tablets contain the ANP in admixture with suitable non-
toxic
28
CA 02763795 2012-01-10
pharmaceutically acceptable excipients including, for example, inert diluents,
such as calcium
carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate;
granulating
and disintegrating agents, such as corn starch, or alginic acid; binding
agents, such as starch,
gelatine or acacia, and lubricating agents, such as magnesium stearate,
stearic acid or talc.
The tablets can be uncoated, or they may be coated by known techniques in
order to delay
disintegration and absorption in the gastrointestinal tract and thereby
provide a sustained
action over a longer period. For example, a time delay material such as
glyceryl monosterate
or glyceryl distearate may be employed.
[0109 Compositions for oral use can also be presented as hard gelatine
capsules wherein the
ANP system is mixed with an inert solid diluent, for example, calcium
carbonate, calcium
phosphate or kaolin, or as soft gelatine capsules wherein the active
ingredient is mixed with
water or an oil medium such as peanut oil, liquid paraffin or olive oil.
[01101 Compositions for nasal administration can include, for example, nasal
spray, nasal
drops, suspensions, solutions, gels, ointments, creams, and powders. The
compositions can be
formulated for administration through a suitable commercially available nasal
spray device,
such as AccusprayTM (Becton Dickinson). Other methods of nasal administration
are known
in the art.
[0111] Compositions formulated as aqueous suspensions contain the ANP in
admixture with
one or more suitable excipients, for example, with suspending agents, such as
sodium
carboxymethylcellulose, methyl cellulose, hydropropylmethylcellulose, sodium
alginate,
polyvinylpyrrolidone, hydroxypropyl-(3-cyclodextrin, gum tragacanth and gum
acacia;
dispersing or wetting agents such as a naturally-occurring phosphatide, for
example, lecithin,
or condensation products of an alkylene oxide with fatty acids, for example,
polyoxyethyene
stearate, or condensation products of ethylene oxide with long chain aliphatic
alcohols, for
example, hepta-decaethyleneoxycetanol, or condensation products of ethylene
oxide with
partial esters derived from fatty acids and a hexitol for example,
polyoxyethylene sorbitol
monooleate, or condensation products of ethylene oxide with partial esters
derived from fatty
acids and hexitol anhydrides, for example, polyethylene sorbitan monooleate.
The aqueous
suspensions may also contain one or more preservatives, for example ethyl, or
n-propyl p-
29
CA 02763795 2012-01-10
hydroxy-benzoate, one or more colouring agents, one or more flavouring agents
or one or
more sweetening agents, such as sucrose or saccharin.
101121 Compositions can be formulated as oily suspensions by suspending the
ANP in a
vegetable oil, for example, arachis oil, olive oil, sesame oil or coconut oil,
or in a mineral oil
such as liquid paraffin. The oily suspensions may contain a thickening agent,
for example,
beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set
forth above,
and/or flavouring agents may optionally be added to provide palatable oral
preparations.
These compositions can be preserved by the addition of an anti-oxidant such as
ascorbic acid.
101131 The compositions can be formulated as a dispersible powder or granules,
which can
subsequently be used to prepare an aqueous suspension by the addition of
water. Such
dispersible powders or granules provide the ANP in admixture with one or more
dispersing or
wetting agents, suspending agents and/or preservatives. Suitable dispersing or
wetting agents
and suspending agents are exemplified by those already mentioned above.
Additional
excipients, for example, sweetening, flavouring and colouring agents, can also
be included in
these compositions.
[01141 Compositions of the invention can also be formulated as oil-in-water
emulsions. The
oil phase can be a vegetable oil, for example, olive oil or arachis oil, or a
mineral oil, for
example, liquid paraffin, or it may be a mixture of these oils. Suitable
emulsifying agents for
inclusion in these compositions include naturally-occurring gums, for example,
gum acacia or
gum tragacanth; naturally-occurring phosphatides, for example, soy bean,
lecithin; or esters
or partial esters derived from fatty acids and hexitol, anhydrides, for
example, sorbitan
monoleate, and condensation products of the said partial esters with ethylene
oxide, for
example, polyoxyethylene sorbitan monoleate. The emulsions can also optionally
contain
sweetening and flavouring agents.
[01151 Compositions can be formulated as a syrup or elixir by combining the
ANP with one
or more sweetening agents, for example glycerol, propylene glycol, sorbitol or
sucrose. Such
formulations can also optionally contain one or more demulcents,
preservatives, flavouring
agents and/or colouring agents.
CA 02763795 2012-01-10
10116] The compositions can be formulated as a sterile injectable aqueous or
oleaginous
suspension according to methods known in the art and using suitable one or
more dispersing
or wetting agents and/or suspending agents, such as those mentioned above. The
sterile
injectable preparation can be a sterile injectable solution or suspension in a
non-toxic
parentally acceptable diluent or solvent, for example, as a solution in 1,3-
butanediol.
Acceptable vehicles and solvents that can be employed include, but are not
limited to, water,
Ringer's solution, lactated Ringer's solution and isotonic sodium chloride
solution. Other
examples include, sterile, fixed oils, which are conventionally employed as a
solvent or
suspending medium, and a variety of bland fixed oils including, for example,
synthetic mono-
or diglycerides. Fatty acids such as oleic acid can also be used in the
preparation of
injectables.
[0117] Optionally the composition of the present invention may contain
preservatives such as
antimicrobial agents, anti-oxidants, chelating agents, and inert gases, and/or
stabilizers such
as a carbohydrate (e.g. sorbitol, mannitol, starch, sucrose, glucose, or
dextran), a protein (e.g.
albumin or casein), or a protein-containing agent (e.g. bovine serum or
skimmed milk)
together with a suitable buffer (e.g. phosphate buffer). The pH and exact
concentration of the
various components of the composition may be adjusted according to well-known
parameters.
[0118] Further, one or more compounds having adjuvant activity may be
optionally added to
the vaccine composition. Suitable adjuvants include, for example, alum
adjuvants (such as
aluminium hydroxide, phosphate or oxide); oil-emulsions (e.g. of Bayol F or
Marco152 );
saponins, or vitamin-E solubilisate. Virosomes are also known to have adjuvant
properties
(Adjuvant and Antigen Delivery Properties of Virosomes, Gluck, R., et al.,
2005, Current
Drug Delivery, 2:395-400) and can be used in conjunction with an ANP of the
invention.
[0119] As previously demonstrated, PapMV and PapMV VLPs have adjuvant
properties.
Accordingly, in one embodiment of the invention, the vaccine compositions
comprise
additional PapMV or PapMV VLPs as an adjuvant. In some embodiments, use of
PapMV or
PapMV VLPs may provide advantages over commercially available adjuvants in
that it has
been observed that PapMV or PapMV VLPs do not cause obvious local toxicity
when
31
CA 02763795 2012-01-10
administered by injection (see, for example, International Patent Publication
No.
W02008/058396).
[0120] Also encompassed by the present invention are vaccine compositions
comprising an
ANP system of the present invention in combination with a commercially
available influenza
vaccine.
[0121] Other pharmaceutical compositions and methods of preparing
pharmaceutical
compositions are known in the art and are described, for example, in
"Remington: The
Science and Practice of Pharmacy" (formerly "Remingtons Pharmaceutical
Sciences");
Gennaro, A., Lippincott, Williams & Wilkins, Philadelphia, PA (2000).
APPLICATIONS & USES
[0122] The present invention provides for a number of applications and uses of
the ANP
system described herein. In one embodiment, the ANP system can be used as a
vaccine
against influenza. In another embodiment, the ANP system can be used to induce
an immune
response against the NP protein. In the latter embodiment, the VLP acts to
potentiate the
immune response to the NP protein. The present invention thus also provides
methods for
potentiating and/or inducing an immune response to the NP protein in an
animal. As well, the
use of the ANP system of the invention for the preparation of medicaments,
including
vaccines, and/or pharmaceutical compositions is within the scope of the
present invention.
[0123] The ANP system of the present invention can be used to induce an immune
response
to one or more than one strain of influenza virus. The ANP system is suitable
for use in
humans as well as non-human animals, including domestic and farm animals. The
administration regime for the ANP system need not differ from any other
generally accepted
vaccination programs. A single administration of the ANP system in an amount
sufficient to
elicit an effective immune response may be used or, alternatively, other
regimes of initial
administration of the ANP system followed by boosting, once or more than once,
with NP
alone or with the ANP system may be used. Similarly, boosting with either the
ANP system
or NP may occur at times that take place well after the initial administration
if antibody titers
fall below acceptable levels. In one embodiment of the invention, the
administration regime
for the ANP system comprises an initial dose of the ANP system plus a booster
dose of the
32
CA 02763795 2012-01-10
ANP system. In another embodiment, the administration regime for the ANP
system
comprises an initial dose of the ANP system plus two or more booster doses of
the ANP
system. In a further embodiment, the administration regime for the ANP system
comprises an
initial dose of the ANP system plus three or more booster doses of the ANP.
Appropriate
dosing regimens can be readily determined by the skilled practitioner.
[0124] When the ANP system comprises non-covalently linked NP protein, the
PapMV VLP
component of the ANP system can be administered concomitantly with the NP
protein, or it
can be administered prior or subsequent to the administration of the NP
protein, depending on
the needs of the human or non-human animal in which an immune response is
desired.
[0125] Another embodiment provides for the use of a vaccine comprising the ANP
system in
conjunction with conventional influenza vaccines. In accordance with this
embodiment, the
ANP system vaccine may be administered concomitantly with the conventional
vaccine (for
example, by combining the two compositions), it can be administered prior or
subsequent to
the administration of the conventional vaccine.
[0126] One embodiment of the present invention provides for the use of the ANP
system as
an influenza vaccine for humans. Another embodiment of the present invention
provides for
the use of an ANP system comprising NP protein from the H I N I and/or H3N2
strains of
influenza as an influenza vaccine for humans. In a specific embodiment of the
present
invention, there is provided an ANP system for use as a human influenza
vaccine wherein the
PapMV VLP is modified by the addition of at least one or more affinity
peptides for NP
protein.
[0127] An alternative embodiment of the present invention provides for the use
of the ANP
system as an influenza vaccine for non-humans. Another embodiment provides for
the use of
an ANP system comprising NP protein from the H3N8, H7N7, H9N2 and/or H5NI
strains of
influenza as an influenza vaccine for non-humans. A further embodiment
provides for the use
of the ANP system as an influenza vaccine for non-human mammals. Another
embodiment
provides for the use of the ANP system as an influenza vaccine for birds.
KITS
33
CA 02763795 2012-01-10
[0128] The present invention additionally provides for kits comprising one or
more ANP
system for use as an influenza vaccine. Individual components of the kit would
be packaged
in separate containers and, associated with such containers, can be a notice
in the form
prescribed by a governmental agency regulating the manufacture, use or sale of
pharmaceuticals or biological products, which notice reflects approval by the
agency of
manufacture, use or sale. The kit may optionally contain instructions or
directions outlining
the method of use or administration regimen for the vaccine.
[0129] When one or more components of the kit are provided as solutions, for
example an
aqueous solution, or a sterile aqueous solution, the container means may
itself be an inhalant,
syringe, pipette, eye dropper, or other such like apparatus, from which the
solution may be
administered to a subject or applied to and mixed with the other components of
the kit.
[0130] The components of the kit may also be provided in dried or lyophilised
form and the
kit can additionally contain a suitable solvent for reconstitution of the
lyophilised
components. Irrespective of the number or type of containers, the kits of the
invention also
may comprise an instrument for assisting with the administration of the
composition to a
patient. Such an instrument may be an inhalant, nasal spray device, syringe,
pipette, forceps,
measured spoon, eye dropper or similar medically approved delivery vehicle.
[0131] To gain a better understanding of the invention described herein, the
following
examples are set forth. It will be understood that these examples are intended
to describe
illustrative embodiments of the invention and are not intended to limit the
scope of the
invention in any way.
EXAMPLES
EXAMPLE 1: EXPRESSION AND PURIFICATION OF RECOMBINANT NP
PROTEINS FROM E. COLI
[0132] Recombinant NP was prepared as follows. DNA encoding the influenza
A/WSN/33
(HINT) NP gene was amplified from a cDNA clone of this NP gene (provided by
Dr. Guy
Boivin of the Infectious Disease Research Centre, Quebec City, Canada) by PCR
with the
34
CA 02763795 2012-01-10
following primers 5'-GAC-TCC-ATG-GCG-ACC-AAA-GGC-ACC-AAA-CGA-3' [SEQ ID
NO:1 ] and 5'GAT-CCT-CGA-GTT-AGT-GGT-GGT-GGT-GGT-GGT-GAT-TGT-CGT-
ACT-CCT-C-3' [SEQ ID NO:2]. The resulting PCR product was digested with NCO]
and
XHO1 enzymes, and ligated into aNCOI/XHOI linearized Pet24d vector.
[0133] Briefly, the E. coli expression strain BL21(DE3) RIL was transformed
with the
plasmid pET-24d containing A/WSN/33 (HINI) NP protein constructs, and
maintained in
2xYT medium containing Kanarnycin (30 g-mL-1). Bacterial cells were grown at
37 C to
an optical density of 0.6 f 0.1 at 600 nm and protein expression was induced
with 1 mm
isopropyl-[3-d-thiogalactopyranoside (IPTG). Induction was continued for 16 h
at 22 C.
Bacteria were harvested by centrifugation for 15 min at 8,983g. The pellet was
resuspended
in ice-cold lysis buffer (50mM NaH2PO4 (pH 8.0), 300mM NaCl, 5mM imidazole, 20
M
phenylmethanesulfonyl fluoride) and bacteria were lysed by one passage through
a French
press at 750 PSIG. The lysate was centrifuged twice for 30 min at 20442xg to
eliminate
cellular debris. The supernatant was incubated overnight with 2 mL Ni-NTA
beads (Qiagen,
Mississauga, On, Canada) under gentle agitation at 4 C. Lysates were loaded
onto a column
and the beads were washed with 2 x 20 mL washing buffer (50mM NaH2PO4 (pH
8.0),
500mM NaCl, 5mM imidazole). At the end of this washing procedure, an
additional washing
step was performed with 40m1 of buffer containing IOmM imidazole. A washing
step to
remove lipopolysaccharide contaminants from our preparations was then
performed with 20
ml of (50mM NaH2PO4 (pH8.0), 500mM NaCl, l0mM imidazole and 0.5% Triton X-
100).
At the end of these steps, the beads were washed with 40 mL of working buffer
(50mM
NaH2PO4 (pH 8.0), 500mM NaCl, 20mM imidazole). Proteins were eluted in working
buffer
containing 0.5M imidazole. The eluted proteins were subjected to a step by
step dialysis
procedure with phosphate-buffered saline (PBS) containing decreasing
concentration of
imidazole (500, 250, 100, 0 mM) for a minimum of 2 hours with 8,000 kda
cutoff. The
resultant protein solution was filtered with a 0.45- m filter. The purity of
the proteins was
determined by SDS/PAGE and protein concentrations were evaluated by use of a
bicinchoninic acid protein kit (Pierce, Rockford, IL). The lipopolysaccharide
(LPS) content in
the purified proteins was evaluated with the Limulus test according to the
manufacturer's
instructions (Cambrex, Walkersville, MD) and was below 5 endotoxin units/mg of
protein.
[0134] Results:
CA 02763795 2012-01-10
[0135] The recombinant NP protein, fused to a 6xH tag at its C-terminus, was
expressed in E.
coli and purified by affinity chromatography using a nickel column, as shown
in (Fig IA).
EXAMPLE 2: SELECTION OF AFFINITY PEPTIDES FOR NP
[01361 The Ph.D.-7TM Phage display peptide library kit (New England Biolabs,
Berverly,
MA, USA) was used for the selection of peptides having an affinity for NP.
Target protein
(NP) was coated at 100 g/ml in O.1M NaHCO3 pH 8.6 on MaxiSorpTM plates (Nunc,
Roskilde, Denmark), overnight at 4 C. Coating solution was poured off and the
plates were
blocked with 0.5% BSA in 0,1 M NaHCO3 pH 8,6 supplemented with 0.02% NaN3 for
1 hour
at 4 C. After blocking, the plates were washed three times with TBS (50mM Tris
(pH 7.5),
150 mM NaCI) supplemented with 0.1% of Tween-20 (TBS-T 0.1%). 10 Lof the
original
phage library (corresponding to 2x1011 different phages) were added to each
well and the
plates were incubated for 1 hour at room temperature with gentle agitation.
The phage
solutions were then discarded and the plates were washed three time with (TBS-
T 0.1%). The
stringency of selection was increased by using 0.5% Tween-20 in TBS for the
three last
rounds of panning to reduce the frequency of non-specific phage binding. The
remaining
phages bound to the plates were eluted with 0.2M Glycine-HCI (pH 2,2)
supplemented with
lmg/ml BSA.
[0137] For phage titration, a single colony of ER2738 was inoculated in IOmL
of LB and
incubated with shaking until mid-log phase (OD600 0.5). A 10-fold serial
dilution of eluted
phages were prepared in LB, in a range of 108-1011 for amplified phages or 10'-
104 for crude
panning eluate. 10 1 of each dilution were added to 200 l of mid-log phase
bacteria and
incubated at room temperature for 5 min. Infected cells were transferred to a
culture tube
containing pre-warmed agarose top (45 C), vortexed quickly, and poured onto a
pre-warmed
LB/IPTG /Xgal plate. Plates were incubated overnight at 37 C and plates
containing
approximately 100 lysis plaques were counted for titration. For amplification
of the selected
phages, an overnight culture of ER2738 was diluted 1:100 in LB and inoculated
with blue
plaques from plates having 10 to - 100 plaques. Inoculated tubes were
incubated at 37 C
with shaking for 4-5 hours. After incubation, cultures were centrifuged 30
seconds and
supernatants were transferred to a fresh tube and centrifuged again. Using a
pipet, the upper
36
CA 02763795 2012-01-10
80% of supernatants were transferred to clean tubes and amplified phages were
stored at 4 C
until next processing. For phages sequencing, the QlAprep spin M13 DNA
extraction kit
(Qiagen, Mississauga,On.,Canada) was used according to themanufacturer's
instructions. 10
clones of the third and the last panning procedures (5 consecutive rounds of
panning were
carried out) were DNA sequenced using the following primer
5'TGTATGGGATTTTGTAATACATCA 3' [SEQ ID NO:3].
Results:
[0138] NP was used as the bait for the selection of high affinity peptides by
phage display.
After five rounds of panning of the phages toward NP, 10 clones were
sequenced. The
peptide FHEFWPT [SEQ ID NO:4] was found in half of the clones sequenced, the
peptide
FHENWPT [SEQ ID NO:5] was found 3 times out of 10 sequenced clones, and
finally, the
peptides KVWQIPH [SEQ ID NO:6] and LPTPPWQ [SEQ ID NO:7] were found in one out
of 10 sequenced clones (Fig I B). The peptides FHEFWPT [ANPI, SEQ ID NO:4] and
KVWQIPH [ANP2, SEQ ID NO:6] were selected for cloning at the surface of the
PapMV
VLP.
EXAMPLE 3: PREPARATION OF HIGH AVIDITY PAPMV VLP (PAPMV HAV
ANP)
Cloning, and engineering of PapMV HAV.
[0139] The PapMV-CP (coat protein) clone was generated as described previously
[28]. The
nucleotide and amino acid sequences of this coat protein are shown in Figure
9. To prepare
the PapMV HAV-ANP constructs containing the PapMV coat protein attached to the
high
affinity peptides, oligonucleotides containing sequences corresponding to
selected peptides
for PapMV-ANPI (5'-CTA-GTT-FTC-ATG-AAT-TCT-GGC-CGA-CCA-3' [SEQ ID
NO:17] and 5'-CGC-GTG-GTC-GGC-CAG-AAT-TCA-TGA-AAA-3' [SEQ ID NO:8]) and
for PapMV-ANP2 (5'-CTA-GTA-AAG-TGT- GGC-AGA-TTC-CGC-ATA-3' [SEQ ID
NO:9] and 5'-CGC-GTA-TGC-GGA-ATC-TGC-CAC-ACT-TTA-3' [SEQ ID NO:10]) were
annealed together, digested with Spel and Mlul enzymes and ligated into the
Spel/Mlul site
located at the C-terminus of PapMV-CP cloned in an Escherichia coli expression
vector
37
CA 02763795 2012-01-10
pET3D (Novagen). The integrity of the PapMV HAV-ANP clones was confirmed by
DNA
sequencing.
Expression and purification of PapMV HAV-ANP recombinant proteins from E. coli
101401 Expression in E. coli and purification of PapMV-CP were performed as
described
previously [31], with some minor modifications. Briefly, the E. coli
expression strain
BL21(DE3) RIL was transformed with the plasmid pET-3d containing PapMV-CP
constructs, and maintained in 2xYT medium containing ampicillin (50 g=mL-1).
Bacterial
cells were grown at 37 C to an optical density of 0.6 f 0.1 at 600 nm and
protein expression
was induced with 1 mM isopropyl-(3-d-thiogalactopyranoside (IPTG). Induction
was
continued for 16 h at 22 C. Bacteria were harvested by centrifugation for 15
min at 8,983g.
The pellet was resuspended in ice-cold lysis buffer (50mm NaH2PO4 (pH 8.0),
300mM NaCl,
10mM imidazol, 20 pM phenylmethanesulfonyl fluoride, 1 mg=mL-1 lysozyme) and
the
bacteria were lysed by one passage through a French press at 750 PSIG. The
lysate was
submitted to DNase (10 000U/ml) treatment with 60mM MgC12 for 15 min. at room
temperature and was centrifuged twice for 30 min at 20442g to eliminate
cellular debris. The
supernatant was incubated overnight with 2 mL Ni-NTA under gentle agitation at
4 C.
Lysates were loaded onto a column and the beads were washed with 2 x 30 mL
washing
buffer (50mM NaH2PO4 (pH 8.0), 300mM NaCI) containing increasing
concentrations of
imidazole (20mm and 50mm).Two washing steps to remove lipopolysaccharide
contaminants
from the preparations were included: the first one with 15 ml of (10mM Tris-
HCI (pH 8),
50mM imidazole and 0.5% Triton X-100), and the second one with 5mL of (10mM
Tris-HCI
(pH 8), 50mM imidazole and I% Zwittergent) with a 30 min. incubation period at
4 C. At the
end of each of these two additional washing steps, the beads were washed with
40 mL
working buffer (10mM Tris-HCI (pH 8) and 50mM imidazole). Proteins were eluted
in a
working buffer containing IM imidazole. The eluted proteins were subjected to
high-speed
ultracentrifugation (100,000 x g) for 45 min in a Beckman 50.2 Ti rotor. VLP
pellets were
resuspended in endotoxin-free phosphate-buffered saline (PBS) and finally, the
protein
solutions were filtered with 0.45- m filters. The purity, concentration and
LPS content in the
protein samples were evaluated as described in Example 1, and only samples
containing
below 5 endotoxin units/mg of protein was used.
38
CA 02763795 2012-01-10
EXAMPLE 4: MORHPOLOGICAL EVALUATION OF PAPMV HAV-ANPs
[0141] The morphology of PapMV HAV-ANPI and PapMV HAV-ANP2, prepared in
Example 3, was evaluated by electron microscopy. For morphological evaluation
by electron
microscopy, PapMV-ANP HAV proteins were diluted in water to a concentration of
20
n-/ L for PapMV VLPs and 40 ng/ml for NP protein, and mixed at 1:1 ratio with
3% uranyl
acetate solution and incubated in darkness for 7 min. Following uranyl acetate
staining, the
VLPs were absorbed for 5 min on carbon-coated formvar grids and then observed
on a JEOL
-1010 (Tokyo, Japan) transmission electron microscope. Images were acquired
with a
Bioscan Camera from Gatan (Warrendale, PA, USA) and analysed with the Gatan
Digital
Micrograph acquisition software. The length of the VLPs was measured with
Metamorph
software version 6.2r2 (Molecular Devices, Synnyvale, CA, USA) as described in
the
instruction manual from the manufacturers.
Results
[0142] In order to increase the protein-protein interaction between the
adjuvant (PapMV
VLP) and the antigen (NP), the two affinity peptide candidates identified as
described in
Example 2 were fused to the surface of the PapMV VLP. It has been previously
demonstrated
that the fusion of a low affinity peptide at the surface of an highly ordered
structure like the
PapMV VLPs can generate a VLP that shows a high avidity to its target that is
comparable to
the binding of an antibody [37]. The fusion of the affinity peptides FHEFWPT
(ANPI) and
KVWQIPH (ANP2) to the C-terminus of the PapMV CP was shown to be tolerated and
expressed at high levels and generated newly engineered PapMV VLPs that
harboured the
affinity peptide at their surface. These newly engineered PapMV VLPs are
referred to
respectively as high avidity PapMV HAV-ANP1 and PapMV HAV-ANP2 (Fig 2A).
Morphologic evaluation by electron microscopy revealed that the engineered
PapMV VLPs
are similar in length (average of 60nm), shape and in structure to the WT
PapMV VLP (Fig
2B).
EXAMPLE 5: MEASUREMENT OF AVIDITY OF PAPMV HAV-ANP1 AND
PAPMV HAV-ANP2 TO NP BY ELISA
39
CA 02763795 2012-01-10
101431 NP protein at 1 g/ml, was diluted in 0.1 M NaHCO3 buffer (pH 9.6) and
100 L/well
of diluted antigens were coated overnight at 4 C. Plates coated with buffer
only were used as
controls. Plates were blocked with PBS/0.1% Tween-20/2% BSA (150 L/well) for I
h at
37 C. After washing three times with PBS/0.1% Tween-20, PapMV, PapMV HAV-ANPI
and PapMV HAV-ANP2 proteins were added in 2-fold serial dilutions starting
from I g/ml.
The plates were incubated for I h. at room temperature, washed six times and
then incubated
for 1 hour with 100 L of rabbit polyclonal antibodies generated against
purified PapMV
virus (Tremblay et al. 2006) at a dilution of 1:5000 in PBS/0.1% Tween-20/2%
BSA. Plates
were then washed four times and incubated for lh. with 100 L peroxidase-
conjugated goat
anti-rabbit IgG (Jackson Immunoresearch, Baltimore, PA), at a dilution of
1:10,000 in
PBS/0.1% Tween-20/2% BSA for I h at 37 C. After four washes, the presence of
IgG was
detected with 100 l of TMB-S (Ultra-TMB-S, Research Diagnostics, Flanders, NJ)
according
to the manufacturer's instructions. The reaction was stopped by adding 100 L
of 0.18M
H2SO4. The OD was read at 450 rim. Results are expressed as a ratio of NP
coated/Buffer
coated OD at 450 rim.
Measurement of avidity by silicon nano-porous biosensor analysis.
[0144] A Ski Pro system from Silicon kinetics was used to measure the avidity
of PapMV
HAV-ANP proteins to NP protein (Latterich and Corbeil 2008; Proteome Sci
2008;6:31). The
analysis was performed with a porous carboxy chip PEG 2000. First, COOH groups
were
modified to sulfo-succinimide esters with activation buffer (200mM EDC(1-ethyl-
3-(3-
dimethylaminopropyl)carbodim idehydrochloride); 50 mm sulfo-NHS(N-
Hydroxysulfosuccinimide); 100 mM MES; 150 mM NaCl at pH 6.0). The chip was
activated
for 600 sec in this solution. Next, NP protein was immobilized on the chips
for 1200 sec with
immobilization buffer (20 mM NaAc, 1 mM EDTA, pH 4.5) at a 5 M final
concentration.
Then, free succinimide was deactivated with blocking buffer (I M Ethanolamine-
HCI pH 5.0)
for 300 sec. The chips were equilibrated 30 min with binding buffer (HBS-EP
from Biacore;
0,01 M HEPES pH 7.4, 0.15 M NaCl, 3 mM EDTA, 0.005% Surfactant P20) before
binding.
For the binding step: PapMV, PapMV HAV-ANPI and PapMV HAV-ANP2 were diluted in
binding buffer at 5 M final concentration and bound on the chip for 200 sec.
and then
washed with binding buffer for 400 sec. OPD was monitored at each binding
step, and
depicted as a graph of OPD, nm vs.Time, in seconds.
CA 02763795 2012-01-10
Results
[01451 Measurement of the avidity of the PapMV HAV-ANPs for their antigen
[01461 To evaluate the level of avidity of the PapMV HAV-ANPs to the antigen
NP, a
modified ELISA assay was first performed. In brief, the antigen NP was bound
to the ELISA
plate as usual, but instead of using an antibody for binding NP, the
respective PapMV HAV-
ANPs were used and PapMV VLPs were used as a negative control. The amount of
PapMV
HAV-ANP bound to NP was then revealed using an rabbit antibody directed to
PapMV CP
followed by a secondary goat anti rabbit antibody conjugated to peroxidase to
reveal the
complex. The assay showed a significant increase of the avidity of PapMV HAV-
ANP2 over
PapMV HAV-ANPI and PapMV VLPs as revealed by the five fold increase of the
signal
(Fig. 3A). To confirm this result, a biosensor platform was used for
monitoring direct protein-
protein interaction based on the combination of a defined nano-porous silicon
surface coupled
to light interferometry [33]. Consistent with the ELISA analysis, the
biosensor revealed a
significant increase of the avidity (again by a factor of approximately 5
times) of HAV-ANP2
over HAV-ANPI and PapMV VLPs as seen with the increase of OPD (mn) for the
PapMV
HAV-ANP2 (Fig.3B).
EXAMPLE 6: IMMUNIZATION OF MICE WITH PAPMV HAV-ANP1 AND
PAPMV HAV-ANP2
101471 The following experiment was performed to determine whether the avidity
of the
PapMV HAV-ANPI and PapMV HAV-ANP2 affected the immune response to NP. Briefly,
mice were immunized with recombinant NP protein (NP) with or without 30 g of
the
PapMV, PapMV HAV-ANPI or PapMV HAV-ANP2 as described below. Serum from these
animals was harvested two weeks after each immunization and ELISA was
performed to
measure IgG, IgGI and IgG2a levels in order to measure the humoral response to
the NP
antigen.
Immunization.
101481 We immunized ten 6-8-week-old BALB/c mice (Charles River, Wilmington,
MA)
subcutaneously with 10 g of recombinant NP protein (NP) with or without 30 g
of the
41
CA 02763795 2012-01-10
PapMV, PapMV HAV-ANPI or PapMV HAV-ANP2. Primary immunization was followed
by two booster doses given at 2 weeks interval. Blood samples were obtained 14
days after
each shot and stored at -20 C until analysis.
Antibody titration by ELISA.
Expression and purification of recombinant NP-GST proteins from E. coli for
ELISA
[0149] The influenza NP protein was cloned as a GST fusion protein in the
expression vector
pGEX-2T to generate pGEX-NP. E. coli expression strain BL21(DE3) RIL was
transformed
with pGEX-NP and maintained in 2xYT medium containing ampicillin (50 g=mL-1).
Bacterial cells were grown, induced and harvested as described in Example 3
for the
preparation of PapMV-CP. The bacterial cell pellet was resuspended in ice-cold
lysis buffer
(PBS I X) and stored at -80 C for at least one day. Frozen pellets were thawed
at 4 C on ice
and the cells lysed by one passage through a French press at 750 PSIG. The
lysate was
centrifuged for 45 min at 20442g to eliminate cellular debris and was loaded
on glutathione
separose beads from the bulk GST purification module (GE Healthcare, Little
Chalfont, UK).
The beads were washed three times with lOX bed of PBSIX. GST-Proteins were
eluted in
50mM Tris-HCI (pH 8.0) buffer containing 10mM reduced glutathione.
Antibody titration by ELISA
[0150] NP-GST at 1 g/m], was diluted in O.IM NaHCO3 buffer (pH 9.6) and 100
I/well of
diluted antigen was used to coat ELISA plates overnight at 4 C. Plates were
blocked with
PBS/0.1% Tween-20/2% BSA (I50 L/well) for 1 h at 37 C. After washing three
times with
PBS/0.1% Tween-20, sera were added in 2-fold serial dilutions starting from
1:50. The plates
were incubated for 90 min at 37 C, washed four times and then incubated with
100 L of
peroxidase-conjugated goat anti-mouse IgG, IgGI, IgG2a, (all from Jackson
Immunoresearch, Baltimore, PA), at a dilution of 1/10,000 in PBS/0.1 % Tween-
20/2% BSA
for I h at 37 C. After four washes, the presence of IgG was detected with 100
L of TMB-S
(Ultra-TMB-S, Research Diagnostics, Flanders, NJ) according to the
manufacturer's
instructions. The reaction was stopped by adding I OO L of 0.18M H2SO4 . The
OD was read
at 450 nm. Results are expressed as an antibody endpoint titer, determined
when the OD
42
CA 02763795 2012-01-10
value is 3-fold greater than the background value obtained with a same
dilution of serum
from pre-immune mice.
ELISPOT.
[01511 The day before splenocyte isolation, 70% ethanol-treated MultiScreen-IP
opaque 96-
well plates (High Protein Binding Immobilon-P membrane, Millipore, Bedford,
MA) were
coated overnight at 4 C with 100 L/well of capture IFN-y antibody, diluted in
DPBS as
suggested in the murine interferon-gamma ELISPOT kit (Abeam, Cambridge, MA,
USA).
After the overnight incubation, the plates were washed three times with 200 L
PBS/well and
blocked with 100 L/well of 2% skimmed dry milk in PBS for 2 h at 37 C, 5%
CO2. Two
weeks after the last boost, the mice were sacrificed and their spleens were
removed
aseptically. Spleens were minced in culture medium and homogenates were passed
through a
100- m cell strainer. The cells were centrifuged and red blood cells were
removed by
incubation for 5 min. at room temperature in ammonium chloride-potassium lysis
buffer
(150mM NH4CI, 10mM KHCO3, 0.1mM Na2EDTA (pH 7.2-7.4)). Isolated red blood
depleted spleen cells were washed twice in PBS and dilute in culture media
(RPMI 1640
supplemented with 25 mM Hepes, 2mM L-glutamine, 1mM sodium pyruvate, 50 M 2-
Mercaptoethanol, 10% heat inactivated fetal bovine serum, 100 U/ml penicillin
and 100
g /ml streptomycin (Invitrogen, Canada). Duplicate samples at 2.5 x 105
cells/well were
reactivated with either culture medium alone or with 50 g/ml of rNP and were
cultured for
36h. at 37 C, 5% CO2. At the end of incubation, the plates were washed
manually, 3 times
with 200 L/well of PBS/0.1% Tween 20. 100 L/well of biotinylated anti-mouse
IFN-
gamma detection antibody in PBS/I%BSA was added and the plates were incubated
for
1 h.30min. at 37 C, 5% CO2. Plates were manually washed 3 times with PBS and
100 L/well
of streptavidine-alkaline phosphatase conjugated secondary antibody diluted in
PBS/1% BSA
was added for 1 h. At 37 C, 5% CO2. The plates were washed a final 3 times
with PBS/0.I %
Tween 20. Spots were visualized by adding 100 L of ready-to-use BCIP/NBT
buffer in each
well for 2-15 mnin. Plates were scanned and counted using the lmmunoSpot
analyzer
(Cellular Technology Ltd., Shaker Heights, OH, USA) to determine the number of
spots/well.
The images were acquired by the Image Acquisition program (version 4.5) and
analysed with
the ImmunoSpot program (version 3). The precursor frequency of specific T
cells was
43
CA 02763795 2012-01-10
determined by subtracting the background spots in media alone from the number
of spots
seen in wells reactivated with NP.
Results
Improvement of the adjuvant property of the PapMV VLPs through an increase in
avidity to
the antigen.
[0152] The structural characterisation of the PapMV VLPs, PapMV HAV-ANPI and
PapMV
HAV-ANP2 suggest that they are all comparable in size and in structure.
However, their
avidity for the antigen NP differs. Through immunization of mice with the
different
conjugates, the ability of the avidity of the adjuvant for the antigen to
influence the immune
response to the antigen was evaluated. Balb/C mice, 10 per groups, were
immunized three
times by the subcutaneous route at 2 week intervals. Two weeks after each
immunization,
serum was harvested and ELISA was performed to measure the hurnoral response
to the NP
antigen.
[0153] The IgGl titers appeared to be similar and comparable with each
immunization
regime and the VLP did not increase the amount of antibody isotype
significantly (Fig. 4A).
However, the PapMV HAV-ANP2 appeared to significantly improve, by 5 fold, the
amount
of IgG2a directed to the NP antigen as compared to the other treatments,
suggesting that the
closer contact of the adjuvant to the antigen demonstrated a benefit (Fig.
4B). Therefore, the
ratio between the IgGl/IgG2a (T112/T111) is significantly lower with the PapMV
HAV-
ANP2+NP treatment and shows a strong bias toward a TH1 response that is
indicative of a
higher quality of the humoral immune response and indicative of the trigger of
a CTL
response. To further support this data, an INF-y ELISPOT against NP protein
was performed
two weeks after the last boost. Consistent with humoral response, as shown in
Fig. 4D, only
immunization with the PapMV HAV-ANP2-NP conjugate significantly increased (by
almost
8 fold) the number of NP-specific T-cells secreting INF-y, as compare to NP
alone.
EXAMPLE 7: ABILITY OF PAPMV HAV-ANP2 TO PROTECT MICE AGAINST
CHALLENGE WITH INFLUENZA VIRUS
44
CA 02763795 2012-01-10
[0154] The following experiment was performed to determine the ability of
PapMV HAV-
ANP2 to protect mice against a challenge with influenza virus. In this
experiment, mice were
immunized as described in Example 6, with recombinant NP protein (NP) with or
without
30 g of the PapMV, or PapMV HAV-ANP2.
Influenza A strain.
[0155] The influenza virus A strain used in this study was A/WSN/33 (H1NI),
which was
derived from a mouse lung-adapted clinical isolate, A/WSN/33, obtained by
serial passage in
neonatal mice and brains of adult mice [Stuart-Harris Lancet 1939;1:497-9].
The LD50
(Lethal Dose inducing 50% mortality) of this strain was previously evaluated
as being
approximately 103 plaque-forming units (pfu) [Abed Antivir Ther 2006;11(8):971-
6]. Under
the experimental conditions described here, the LD50 was estimated to
approximately
2.5x102 plaque-forming units (pfu) as determined in a pilot challenge
experiment (data not
shown).
Infection with influenza in mice.
[0156] Balb/C mice were infected intranasally with 50 L containing 5 x 102 pfu
(ILD50) of
influenza A/WSN/33. Mice were monitored daily for clinical symptoms (loss of
body weight,
abnormal behaviour and ruffled fur). Deaths were recorded over a period of 14
days. Mice
were sacrificed when the total body weight loss reached more than 20% of
initial weight. For
the virus titration, animals were sacrificed at day 7 and lungs were removed
aseptically and
stored at -80 C in 1 ml of sterile PBS.
Viral titration.
[0157] Lungs were homogenized and centrifuged at 2500 rpm/4 C for 10 min and
supernatants were titrated in MDBK cells using a standard plaque assay as
described
previously [ Abed et al. Antimicrob Agents Chemother 2005 Feb;49(2):556-9].
CD8+ T-cell depletion.
CA 02763795 2012-01-10
101581 For T-cell depletion experiments, mice were injected with 0.1 mg i.p.
of monoclonal
antibodies directed to CD84 in vaccinated or immunized mice at day 33 and 35.
After
depletion, which was validated by FACS, mice were challenged as before on day
36.
Statistical analysis.
[0159] Data were analysed with parametric (or non parametric when the variance
were
significantly different) ANOVA test. Student's or Tukey's post tests were used
to compare
differences (antibody titers, ELISPOT, Weight losses, symptoms and viral
titers) among
groups of mice. Differences among survival curves were analysed by Kaplan-
Meier survival
analysis. Values of *p < 0.05, **p < 0.01, ***p < 0.001 were considered
statistically
significant. Statistical analyses were performed with GraphPad PRISM 5.01.
Results:
Protective effect of the generated immune response
10160] The improvement of the Till response to NP using the PapMV HAV-ANP2 was
convincing and was expected to provide protection to an influenza challenge.
To confirm this
hypothesis, Balb/C mice were immunized with NP alone, NP + PapMV VLPs and NP +
PapMV HAV-ANP2 using a protocol similar to that described in Example 6, and
the capacity
of the vaccinated animals to be protected to a challenge with the influenza
mouse adapted
strain A/WSN/33 HIN1 was tested. The increased immunity generated by the PapMV
HAV-
ANP2 adjuvant was translated in a decreased weight losses and a significant
improvement of
the symptoms observed on the animals vaccinated with the conjugated vaccine
NP+ PapMV
HAV-ANP 2 (Fig. 5A and B) seven days after the challenge. Mice were sacrificed
at day 7
and the titers of WSN/33 strain were evaluated to measure the clearance of the
virus in the
animals. As expected and consistent with previous observations, the animals
vaccinated with
the NP+ PapMV HAV-ANP2 showed a significant reduction in the viral load as
compared to
the other treatments since more than half of the animals treated with this
vaccination regimen
had almost completely cleared the virus from their lungs (Fig. 5C). To confirm
this result this
experiment was repeated and the survival of the animals (10 per group)
followed 14 days
after challenge. Consistent with previous results, the IgGI titers to NP were
similar with all
46
CA 02763795 2012-01-10
the treatments (Fig 6A), but the IgG2a titers was significantly improved in
the group
immunized with the PapMV HAV-ANP2+NP as compared to NP alone (Fig 6B). As
expected, antibodies directed to PapMV CP were comparable in mice receiving
the
adjuvanted vaccines (Fig 6C). Interestingly, the IgG2a titers against NP were
found to be
always higher in the animals vaccinated with the PapMV HAV-ANP2+NP vaccine
(Fig 6D).
[0161] PapMV HAV-ANP2+NP was the best treatment of those tested and provided
40%
survival as compared to non-vaccinated mice or mice immunized with NP alone
that did not
survive the challenge. The addition of WT PapMV VLP to NP was less efficient
than the
treatment PapMV HAV-ANP2+NP and showed only 20% survival (Fig. 5D). Finally,
in
order to evaluate the contribution of the CD8+ mediated immune response to the
observed
protection, CD8+ cells were depleted using a monoclonal antibody directed to
CD8 in mice
that were previously immunized three times with the PapMV HAV-ANP2+NP regimen.
As
expected, the depletion of CD8+ cells erased the benefits of the vaccination
with PapMV
HAV-ANP2+NP suggesting that the protection that observed was caused by the
CD8+
mediated immune response.
Discussion
[0162] The data shown in Examples 1 to 7 demonstrate the ability of the native
PapMV VLP
and an engineered form harbouring a high avidity peptide to NP to its surface
(high avidity
VLP; HAV) to improve the immune response directed to the influenza NP protein.
Multimerisation of the affinity peptides for NP at the surface of HAV improves
its affinity for
the NP antigen which increases the efficacy of protection against an influenza
challenge.
[0163] The recent circulation of the highly pathogenic H5N 1 influenza virus
in some human
populations and the appearance of a new highly contagious H IN I of swine
origin triggered a
surge of interest in the development of new vaccine strategies that are not
based on protective
antibodies directed to HA and NA proteins that are highly variable. The
structural protein NP
is one of the most attractive targets for the development of a so-called
universal vaccine
because the amino acid sequence of this protein is highly conserved through
all the strains of
influenza. The antigen NP in DNA form alone [Ulner et al. Science 1993 Mar
19;259(5102):1745-9; Macklin et al. J Virol 1998 Feb;72(2):1491-6; Epstein et
al. Emerg
Infect Dis 2002 Aug;8(8):796-801; Luo et al. J Virol Methods 2008 Dec;] 54(1-
2):121-71, in
47
CA 02763795 2012-01-10
viral vectors [Andrew et al. Scand J hnmunol 1987 .lan;25(l):21-8; Webster et
al. Vaccine
1991 May;9(5):303-8; Wesley et at. Vaccine 2004 Sep 3;22(25-26):3427-34;
Epstein et
al.Vaccine 2005 Nov 16;23(46-47):5404-10; Altstein et al. Arch Virol 2006
May;151(5):921-
31; Roy et al. Vaccine 2007 Sep 28;25(39-40):6845-51; Barefoot et al. Clin
Vaccine
Immunol 2009 Apr;16(4):488-98] or as a soluble protein [Carragher et al. J
Immunol 2008
Sep 15;181(6):4168-76; Tite et al. Immunology 1990 Oct;71(2):202-7; Tamura et
al. J
Immunol 1996 May 15;156(10):3892-900; Guo et at. Arch Virol 2010 Jul 22,
Wraith et al. J
Gen Virol 1987 Feb;68 ( Pt 2):433-40] was shown previously to confer
protection in
homologous and heterologous challenges. All of the studies that used soluble
protein as
source of NP required an adjuvant to some extent to stimulate higher immunity
and confer
protection. Many of these potent adjuvants, particularly LPS, cause
considerable side effects
such as toxicity or inflammation and are not allowed for human use [Aguilar et
al. Vaccine
2007 May 10;25(19):3752-62]. Here, a new form of adjuvant derived from PapMV
VLPs
conjugated to soluble recombinant NP free of LPS contamination was tested. It
is well known
that VLPs like PapMV, are capable of inducing strong cellular and humoral
immune response
[Grgacic Methods 2006 Sep;40(1):60-5]. Effectively, B cells are efficiently
activated by
repetitive structures like PapMV VLPs which lead to cross-linking of B cell
receptors on the
cell surface [ Denis et al. Virology 2007 Jun 20;363(1):59-68, Bachmann et al.
Science 1993
Nov 26;262(5138):1448-51]. Thus, it is possible to render weak target antigens
more
immunogenic for B cells by presenting them in a more organised and repetitive
fashion.
PapMV VLPs are also known to be cross-presented on MHC-I through TAP-
independent
pathway [29]. Thus, it is also possible to trigger cellular response by more
efficient antigen
presentation. However, insertion of large epitopes into immunodominant region
of VLPs
often interferes with their correct conformation and interferes with formation
of the VLP.
Previous studies have circumvented this problem by introducing linker
sequences which
allows covalent linkage of large antigen to VLP carrier by using chemical
cross-linkers
[Jegerlehner et al. Vaccine 2002 Aug 19;20(25-26):3104-12]. Others use the
high specific
interaction of biotin/streptavidin protein to increase the avidity of VLP to
target antigen
[Chackerian et al. J Clin Invest 2001 Aug;108(3):415-23]. The approach
described in
Examples I to 7 was to improve the avidity of the PapMV VLP adjuvant through
the fusion
of an affinity peptide to the NP antigen to the surface of the VLP. The
resulting molecule
48
CA 02763795 2012-01-10
showed an improved avidity for NP which. consequently, improved the immune
response
directed to the antigen.
[0164] The HAV-ANP2 was more efficient than the PapMV VLP in increasing the
IgG2a
and the cellular response to the NP antigen. IgG2a is a more effective class
of antibody in
preventing intracellular virus replication since it is more efficient in
complement activation
and antibody-dependant cellular immunity [Coutelier et al. J Exp Med 1987 Jan
1;165(1):64-
9; Hocart et al. J Gen Virol 1989 Sep;70 ( Pt 9):2439-48]. Some authors have
reported that
non-neutralizing antibodies against NP might have a role in protection against
influenza virus
[Carragher et al. J Immunol 2008 Sep 15;181(6):4168-76; Zheng et al. J Immunol
2007 Nov
1;179(9):6153-9]. Here, with the CD8+ depletion experiment described in
Example 7, it was
confirmed as some previous reports [Epstein et al. J Immunol 1997 Feb
1;158(3):1222-30,
Stitz et al. J Gen Virol 1990 May;71 ( Pt 5):1169-79; Epstein et al. J Lnmunol
1998 Jan
1;160(1):322-7] have demonstrated before, that serum antibodies to NP do not
significantly
contribute to protective effect but rather the cellular response was important
to the observed
protection induced by the PapMV HAV-ANP2+NP vaccine.
[0165] The NP protein is an important target antigen for influenza A virus
cross-reactive
CTL [ Townsend et al. J Exp Med 1984 Aug 1;160(2):552-63; Yewdell et al. Proc
Natl Acad
Sci U S A 1985 Mar;82(6):1785-9; McMichael et al. J Gen Virol 1986 Apr;67 ( Pt
4):719-26;
Chen et al. Immunity 2000 Jan;12(1):83-93]. The protective effect of the HAV
adjuvanted
NP vaccine described herein is characterized by a more rapid, reduction in
viral titers, viral
clearance and reduction in morbidity and mortality, all features
characteristic of
heterosubtypic immunity [ Epstein et al. Expert Rev Anti Infect Ther 2003
Dec;1(4):627-38].
Moreover, the mechanism of immune protection generated by the PapMV HAV-
ANP2+NP
vaccine can be explained by the proliferation of CTLs specific to NP
[McMichael Curr Top
Microbiol Immunol 1994;189:75-91]. Engineered PapMV VLPs fused to CTL epitopes
were
previously showed to be efficient in improving the loading of the MHC class I
with the CTL
epitope (Leclerc et al. J Virol 2007 Feb;81(3):1319-26). It is likely that the
attachment of the
HAV to NP also triggers, as for the fusion directly on the PapMV CP, a similar
mechanism of
cross presentation.
49
CA 02763795 2012-01-10
[0166] It has been recently shown that intranasal administration of soluble NP
protein in
combination with cholera toxin B subunit adjuvant can confer protection to
homologous and
heterologous viruses by inducing mucosal and cell-mediated immunity [Guo et
al. Arch Virol
2010 Jul 22]. Because NP is an highly conserved target through all the strains
of influenza, it
is likely that the PapMV HAV-ANP2+NP vaccine could also provide a benefit in
protecting
against heterosubtypic strains of the virus.
EXAMPLE 8: PREPARATION AND ANALYSIS OF PAPMV VLPS
Expression and purification ofrecombinant proteins
PapMV-CP
[0167] Expression and purification of PapMV-CP in E. coli were performed as
described
previously (Denis et al Vaccine 2008 Jun 25;26(27-28):3395-403). The
lipopolysaccharide
(LPS) levels in the purified proteins was evaluated with the Limulus test
according to the
manufacturer's instructions (Cambrex, Walkersville, MD). In all cases, the LPS
contamination was less than 5 endotoxin (EU) units/mg of protein.
Morphological evaluation of 'PapMV VLPs.
[0168] Morphological evaluation of VLPs was carried out by electron microscopy
as
previously described (Tremblay et al. Febs J 2006 Jan; 273(l):14-25). VLPs
were observed
on a JEOL -1010 (Tokyo, Japan) transmission electron microscope. Images were
acquired
with a Bioscan Camera from Gatan (Warrendale, PA, USA) and analysed with the
Gatan
Digital Micrograph acquisition software. VLP content of preparations was
evaluated by gel
filtration chromatography using Superdex 200 10/300 (GE Healthcare, Baie
d'Urfe, Canada)
as previously described (Denis et al Vaccine 2008 Jun 25;26(27-28):3395-403).
The dynamic
light scattering (DLS), was also used to evaluate the homogeneity of the VLP
population and
its size. VLPs were diluted at 250 g/ml in PBS and size measurements were
performed with
a Zetasizer Nano ZS (Malvern. Worcestershire, UK). Particle size distributions
were
evaluated from intensity measurements.
Results
CA 02763795 2012-01-10
101691 PapMV VLPs were produced using the bacterial expression vector pET-3D
(Novagen) as described previously (Tremblay et al. Febs J 2006 Jan; 273(1):14-
25,; Denis et
al. Virology 2007 Jun 20;363(1):59-68; Denis et al Vaccine 2008 Jun 25;26(27-
28):3395-
403). The purification profile is shown in (Fig. 7). The PapMV VLP preparation
was
homogenous as demonstrated by SDS-PAGE showing only one protein of 30kDa (Fig.
7A)
that was able to self assemble as PapMV VLPs (Fig. 7B) that show an average
length of
70nm as measured by dynamic light scattering (DLS) (Fig. 7C).
EXAMPLE 9: ABILITY OF PAPMV VLPs TO BE TRANSPORTED TO
SECONDARY LYMPHOID ORGANS
In Vivo fluorescent Imaging
[0170] For in vivo fluorescent imaging, 25 g of Alexa@680 (Invitrogen,
Burlington, On,
Canada) stained VLPs (0.34 M. of Alexa@680 by M. of PapMV VLPs) were injected
in the
footpad of 3 anesthetized mice. Three other mice were injected with an
equivalent quantity of
Alexa@680 staining as negative control. The images were gathered with an IVIS
200
imaging system (Xenogen, Alameda, CA, USA) at 24, 48 and 72 hours. The data
are
represented as pseudocolor images indicating fluorescence intensity (red and
yellow, most
intense), which were superimposed over gray-scale reference photographs.
[0171] It has been previously reported that PapMV VLPs alone or fused to a
peptide antigen
are immunogenic (Denis et al. Virology 2007 Jun 20;363(1):59-68; Denis et al
Vaccine 2008
Jun 25;26(27-28):3395-403) and taken up by dendritic cells (Lacasse et al., J
Virol. 2008
Jan;82(2):785-94. Epub 2007 Nov 7). To illustrate the speed of capture of the
PapMV VLPs
by the immune cells, labelled VLPs were injected in the foot pad of mice. It
was observed
that the proximal propliteal lymph node became fluorescent 24 hours after
injection (Fig.
8A). The signal progressively declined 48 and 72 hours suggesting that the
PapMV VLPs
were rapidly degraded.
EXAMPLE 10: ABILITY OF PAPMV VLPS TO INDUCE VARIOUS CYTOKINES
AND CHEMOKINES
51
CA 02763795 2012-01-10
Evaluation of cvtokine and chernokine profile.
[0172] To evaluate the cytokines and chemokines profile generated following
PapMV VLPs
immunization, 2 groups of 5 BALB/c mouse were injected with 30 g of PapMV VLPs
once
or twice at 2 week intervals. Two weeks after the last boost (both groups were
synchronized),
the mice were sacrificed and the spleens were removed aseptically.
Splenocytes, 2.5 x 105
cells/well were reactivated with either culture medium alone or with 100 g/ml
of PapMV
VLPs were cultured for 36h at 37 C. The concentration of cytokines and
chemokines were
evaluated with MILLIPLEX MAP Mouse Cytokine/Chemokine - Premixed 22 Plex
(Millipore, Billerica, MA, USA) for Luminex xMAPOO platform. Measurements
were
performed with a Luminex I OOIS liquichip workstation (Qiagen, Canada).
[0173] To characterise the type of immune response induced by immunization
with PapMV
VLPs, the cytokine/chemokine profile secreted by spleen cells was evaluated
following one
or two subcutaneous injections in the back neck of the animals. Reactivation
of spleen cells
of mice immunized only once led to the secretion of MIP-la and KC (Fig. 8B).
Lower but
still significant amounts of IL-6, G-CSF, TNF-a, IL-2, RANTES, MCP-I, IL-la,
11-5, INF-y
and IL-17 were also measured. Two immunizations led to an increase of MIP-la,
KC levels
followed by an abundant secretion of IL-2, 5 and 6 secretion (Fig. 8C). Lower
but significant
levels of IL-13, G-CSF, GM-CSF, INF-y, 11-10, IL-la, RANTES, MCP-1, IL-17, TNF-
a and
11-4 were also detected. This result suggests that PapMV VLPs are efficiently
perceived by
the immune system and trigger a balanced TH1 and THZ cytokine profile. This
result also
indicates that PapMV VLP can be considered a pathogen associated molecular
pattern
(PAMP) that is recognized by the immune system as a danger signal. Therefore,
PapMV
VLPs show excellent potential as an adjuvant for improvement of the flu
vaccines.
[0174] The data shown in Examples 9 and 10 demonstrate that PapMV VLPs can be
used as
an efficient adjuvant that is readily recognised by the immune cells that
transport the
molecule rapidly to secondary lymphoid organs, where it is degraded. It has
been previously
shown that antigen-presenting cells (APCs) are able to uptake PapMV VLPs in
vivo and
which leads to their maturation (Denis et al. Virology 2007 Jun 20;363(1):59-
68, Lacasse et
al., J Virol. 2008 Jan;82(2):785-94. Epub 2007 Nov 7). It has also been shown
that PapMV
VLPs induce an active secretion of MIP-la and KC after one or two
immunizations of
52
CA 02763795 2012-01-10
PapMV VLPs. MIP-la (CCL3) is a chemotactic and pro-inflammatory chemokine that
is
produced by macrophages, dendritic cells and lymphocytes (Maurer and Von
Stebut Int J
Biochern Cell Biol. 2004 Oct;36(10):1882-6). This chemokine family is crucial
for T-cell
chemotaxis from the circulation to inflamed tissue and plays an important role
in the
regulation of transendothelial migration of monocytes, DCs and NK cells
(Maurer and Von
Stebut Int J Biochem Cell Biol. 2004 Oct;36(10):1882-6). In addition, CCL3 and
its receptor
CCR5 promote Tull skewing cytokine profiles (Andres et al. J Immunol. 2000 Jun
15;164(12):6303-12, Luther and Cyster Nat lmmunol. 2001 Feb;2(2):102-7). PapMV
VLPs
reactivated splenocytes also induced the secretion of KC (for keratinocyte
chemoattractant,
also designated N51 in the murine system), a rodent a-chemokine related to the
human
chemokine interleukin-8 (Tani et al. J Clin Invest. 1996 Jul 15;98(2):529-39,
Bozic et al. J
Immunol. 1995 Jun 1;154(11):6048-57). KC stimulates chemotaxis specifically of
neutrophils, which exit rapidly from the circulation to provide the first line
of cellular defense
against invading pathogens. The cytokine/chemokine profile shown here,
stimulated after
only one injection of PapMV VLPs, suggests that immune cells, presumably APCs,
could
induce the recruitment of lymphocytes following secretion of MIP-la and KC. It
has also
been suggested that following this recruitment, APCs are able to cross-present
CTL epitopes
and induce proliferation of specific CD8+ (Leclerc et al. J Virol 2007
Feb;81(3):1319-26).
After the second immunization of PapMV VLPs, an increase in secretion of 11-6
and IL-5
(TH2-like cyokine) and IL-2 (TH1-like cytokine) was observed, indicating an
activation of a
TH]/T! 2 mixed specific T-cell response. IL-6 augments immunoglobulin
production by B-
cells and enhances B-cell growth and differentiation (Van Damme Eur J Biochem.
1987 Nov
2;168(3):543-50) and synergizes with IL-I in augmenting antigen presentation
(Kupper et al.
1988). IL-5 is an interleukin produced by THZ cells and mast cells. Its acts
as a growth and
differentiation factor for both B cells and eosinophils (Adachi and Alam, Am J
Physiol. 1998
Sep;275(3 Pt 1):C623-33). IL-5 is known to enhance several functions of murine
B cells,
including immunoglobulin production, growth, and differentiation (Takatsu et
al. Adv
Immunol. 1994;57:145-90). This cytokine is also the main regulator of
eosinopoiesis,
eosinophil maturation and activation (Takatsu et al. Adv Immunol. 2009;101:191-
236).
Finally, IL-2 is an interleukin secreted by THi cells (Mosmann et al J
Immunol. 1986 Apr
1;136(7):2348-57). Its functions are to stimulates the growth, differentiation
and survival of
antigen-selected cytotoxic T cells via the activation of the expression of
specific genes
53
CA 02763795 2012-01-10
(Malek 2008) and is necessary for the development of T cell immunologic
memory.
Therefore, PapMV VLPs are powerful inducers of the immune response and are
recognized
by the immune system as a pathogen associated molecular pattern (PAMP) as
previously
suggested (Lacasse et al., J Virol. 2008 Ian;82(2):785-94. Epub 2007 Nov 7,
Acosta Ramirez
et al., Immunology. 2008 Jun;124(2):186-97. Epub 2007 Dec 7).
References:
[1] Ilyinskii PO, Thoidis G, Shneider AM. Development of a vaccine against
pandemic
influenza viruses: current status and perspectives. Int Rev Immunol
2008;27(6):392-426.
[2] Nichol KL. Efficacy and effectiveness of influenza vaccination. Vaccine
2008 Sep
12;26 Suppl 4:D17-22.
[3] Palladino G, Mozdzanowska K, Washko G, Gerhard W. Virus-neutralizing
antibodies
of immunoglobulin G (IgG) but not of IgM or IgA isotypes can cure influenza
virus
pneumonia in SCID mice. J Virol 1995 Apr;69(4):2075-81.
[4] Rimmelzwaan GF, McElhaney JE. Correlates of protection: novel generations
of
influenza vaccines. Vaccine 2008 Sep 12;26 Suppl 4:D41-4.
[5] Schulman JL, Kilbourne ED. Induction of Partial Specific Heterotypic
Immunity in
Mice by a Single Infection with Influenza a Virus. J Bacteriol 1965 Jan;89:170-
4.
[6] Liang S, Mozdzanowska K, Palladino G, Gerhard W. Heterosubtypic immunity
to
influenza type A virus in mice. Effector mechanisms and their longevity. J
Immunol 1994
Feb 15;152(4):1653-61.
[7] Epstein SL. Control of influenza virus infection by immunity to conserved
viral
features. Expert Rev Anti Infect Ther 2003 Dec;] (4):627-38.
[8] Altmuller A, Fitch WM, Scholtissek C. Biological and genetic evolution of
the
nucleoprotein gene of human influenza A viruses. J Gen Virol 1989 Aug;70 ( Pt
8):2111-9.
[9] Gorman OT, Bean WJ, Kawaoka Y, Webster RG. Evolution of the nucleoprotein
gene
of influenza A virus. J Virol 1990 Apr;64(4):1487-97.
54
CA 02763795 2012-01-10
[10] Scholtissek C. Ludwig S, Fitch WM. Analysis of influenza A virus
nucleoproteins for
the assessment of molecular genetic mechanisms leading to new phylogenetic
virus lineages.
Arch Virol 1993;131(3-4):237-50.
[11] Shu LL, Bean WJ, Webster RG. Analysis of the evolution and variation of
the human
influenza A virus nucleoprotein gene from 1933 to 1990. J Virol 1993
May;67(5):2723-9.
[12] Townsend AR, Skehel JJ. The influenza A virus nucleoprotein gene controls
the
induction of both subtype specific and cross-reactive cytotoxic T cells. J Exp
Med 1984 Aug
1;160(2):552-63.
[13] Yewdell JW, Bennink JR, Smith GL, Moss B. Influenza A virus nucleoprotein
is a
major target antigen for cross-reactive anti-influenza A virus cytotoxic T
lymphocytes. Proc
Nat] Acad Sci USA 1985 Mar;82(6):1785-9.
[14] McMichael AJ, Michie CA, Gotch FM, Smith GL, Moss B. Recognition of
influenza
A virus nucleoprotein by human cytotoxic T lymphocytes. J Gen Virol 1986
Apr;67 ( Pt
4):719-26.
[15] Chen W, Anton LC, Bennink JR, Yewdell JW. Dissecting the multifactorial
causes of
immunodominance in class I-restricted T cell responses to viruses. Immunity
2000
Jan; 12(l):83-93.
[16] Haanen JB, Wolkers MC, Kruisbeek AM, Schumacher TN. Selective expansion
of
cross-reactive CD8(+) memory T cells by viral variants. J Exp Med 1999 Nov
1;190(9):1319-
28.
[17] Taylor PM, Askonas BA. Influenza nucleoprotein-specific cytotoxic T-cell
clones are
protective in vivo. immunology 1986 Jul;58(3):417-20.
[18] Gschoesser C, Alrnanzar G, Hainz U, Ortin J, Schonitzer D, Schild H, et
al. CD4+ and
CD8+ mediated cellular immune response to recombinant influenza nucleoprotein.
Vaccine
2002 Nov 1;20(31-32):3731-8.
CA 02763795 2012-01-10
[19] Yap KL, Ada GL. The recovery of mice from influenza A virus infection:
adoptive
transfer of immunity with influenza virus-specific cytotoxic T lymphocytes
recognizing a
common virion antigen. Scand J Immunol 1978;8(5):413-20.
[20] Wells MA, Ennis FA, Albrecht P. Recovery from a viral respiratory
infection. 11.
Passive transfer of immune spleen cells to mice with influenza pneumonia. J
Immunol 1981
Mar; 126(3): 1042-6.
[21] Lukacher AE, Braciale VL, Braciale TJ. In vivo effector function of
influenza virus-
specific cytotoxic T lymphocyte clones is highly specific. J Exp Med 1984 Sep
1;160(3):814-
26.
[22] Epstein SL, Lo CY, Misplon JA, Lawson CM, Hendrickson BA, Max EE, et al.
Mechanisms of heterosubtypic immunity to lethal influenza A virus infection in
fully
immunocompetent, T cell-depleted, beta2-microglobulin-deficient, and J chain-
deficient
mice. J Immunol 1997 Feb 1;158(3):1222-30.
[23] Ulmer JB, Fu TM, Deck RR, Friedman A, Guan L, DeWitt C, et al. Protective
CD4+
and CD8+ T cells against influenza virus induced by vaccination with
nucleoprotein DNA. J
Virol 1998 Jul;72(7):5648-53.
[24] Carragher DM, Kaminski DA, Moquin A, Hartson L, Randall TD. A novel role
for
non-neutralizing antibodies against nucleoprotein in facilitating resistance
to influenza virus.
J Immunol 2008 Sep 15;181(6):4168-76.
[25] Tite JP, Hughes-Jenkins C, O'Callaghan D, Dougan G, Russell SM, Gao XM,
et al.
Anti-viral immunity induced by recombinant nucleoprotein of influenza A virus.
11.
Protection from influenza infection and mechanism of protection. Immunology
1990
Oct;71(2):202-7.
[26] Tamura S, Miyata K, Matsuo K, Asanuma H, Takahashi H, Nakajima K, et al.
Acceleration of influenza virus clearance by Thl cells in the nasal site of
mice immunized
intranasally with adjuvant-combined recombinant nucleoprotein. J Immunol 1996
May
15;156(10):3892-900.
56
CA 02763795 2012-01-10
[27] Guo L, Zheng M, Ding Y, Li D, Yang Z, Wang H, et al. Protection against
multiple
influenza A virus subtypes by intranasal administration of recombinant
nucleoprotein. Arch
Virol 2010 Jul 22.
[28] Denis J, Majeau N, Acosta-Ramirez E, Savard C, Bedard MC, Simard S, et
al.
Immunogenicity of papaya mosaic virus-like particles fused to a hepatitis C
virus epitope:
evidence for the critical function of multimerization. Virology 2007 Jun
20;363(1):59-68.
[29] Leclerc D, Beauseigle D, Denis J, Morin H, Pare C, Lamarre A, et al.
Proteasome-
independent major histocompatibility complex class I cross-presentation
mediated by papaya
mosaic virus-like particles leads to expansion of specific human T cells. J
Virol 2007
Feb;81(3):1319-26.
[30] Lacasse P, Denis J, Lapointe R, Leclerc D, Lamarre A. Novel plant virus-
based
vaccine induces protective cytotoxic T-lymphocyte-mediated antiviral immunity
through
dendritic cell maturation. J Virol 2008 Jan;82(2):785-94.
[31] Tremblay MH, Majeau N, Gagne ME, Lecours K, Morin H, Duvignaud JB, et al.
Effect of mutations K97A and E128A on RNA binding and self assembly of papaya
mosaic
potexvirus coat protein. Febs J 2006 Jan;273(1):14-25.
[32] Denis J, Acosta-Ramirez E, Zhao Y, Hamelin ME, Koukavica 1, Baz M, et al.
Development of a universal influenza A vaccine based on the M2e peptide fused
to the
papaya mosaic virus (PapMV) vaccine platform. Vaccine 2008 Jun 25;26(27-
28):3395-403.
[33] Latterich M, Corbeil J. Label-free detection of biomolecular interactions
in real time
with a nano-porous silicon-based detection method. Proteome Sci 2008;6:31.
[34] Stuart-Harris C. A neurotropic strain of human influenza virus. Lancet
1939; 1:497-9.
[35] Abed Y. Baz M, Boivin G. Impact of neuraminidase mutations conferring
influenza
resistance to neuraminidase inhibitors in the N I and N2 genetic backgrounds.
Antivir Ther
2006:1](8):971-6.
57
CA 02763795 2012-01-10
[36] Abed Y, Goyette N, Boivin G. Generation and characterization of
recombinant
influenza A (H I N I) viruses harboring amantadine resistance mutations.
Antimicrob Agents
Chemother 2005 Feb;49(2):556-9.
[37] Morin H, Tremblay MH, Plante E, Pare C, Majeau N, Hogue R, et al. High
avidity
binding of engineered papaya mosaic virus virus-like particles to resting
spores of
Plasmodiophora brassicae. J Biotechnol 2007 Feb 1;128(2):423-34.
[38] Ulmer JB, Donnelly JJ, Parker SE, Rhodes GH, Feigner PL, Dwarki VJ, et
al.
Heterologous protection against influenza by injection of DNA encoding a viral
protein.
Science 1993 Mar 19;259(5102):1745-9.
[39] Macklin MD, McCabe D, McGregor MW, Neumann V, Meyer T, Callan R, et al.
Immunization of pigs with a particle-mediated DNA vaccine to influenza A virus
protects
against challenge with homologous virus. J Virol 1998 Feb;72(2):1491-6.
[40] Epstein SL, Tumpey TM, Misplon JA, Lo CY, Cooper LA, Subbarao K, et al.
DNA
vaccine expressing conserved influenza virus proteins protective against H5NI
challenge
infection in mice. Emerg Infect Dis 2002 Aug;8(8):796-801.
[41] Luo M, Tao P, Li J, Zhou S, Guo D, Pan Z. Immunization with plasmid DNA
encoding influenza A virus nucleoprotein fused to a tissue plasminogen
activator signal
sequence elicits strong immune responses and protection against H5N1 challenge
in mice. J
Virol Methods 2008 Dec;154(1-2):121-7.
[42] Andrew ME, Coupar BE, Boyle DB, Ada GL. The roles of influenza virus
haemagglutinin and nucleoprotein in protection: analysis using vaccinia virus
recombinants.
Scand J ImmLmol 1987 Jan;25(l ):21-8.
[43] Webster RG, Kawaoka Y, Taylor J, Weinberg R, Paoletti E. Efficacy of
nucleoprotein
and haemagglutinin antigens expressed in fowipox virus as vaccine for
influenza in chickens.
Vaccine 1991 May;9(5):303-8.
58
CA 02763795 2012-01-10
[44] Wesley RD, Tang M, Lager KM. Protection of weaned pigs by vaccination
with
human adenovirus 5 recombinant viruses expressing the hemag-glutinin and the
nucleoprotein
of H3N2 swine influenza virus. Vaccine 2004 Sep 3;22(25-26):3427-34.
[45] Epstein SL, Kong WP, Misplon JA, Lo CY, Tumpey TM, Xu L, et al.
Protection
against multiple influenza A subtypes by vaccination with highly conserved
nucleoprotein.
Vaccine 2005 Nov 16;23(46-47):5404-10.
[46] Altstein AD, Gitelman AK, Smirnov YA, Piskareva LM, Zakharova LG,
Pashvykina
GV, et al. Immunization with influenza A NP-expressing vaccinia virus
recombinant protects
mice against experimental infection with human and avian influenza viruses.
Arch Virol 2006
May; 15](5):921-3 1.
[47] Roy S, Kobinger GP, Lin J, Figueredo J, Calcedo R, Kobasa D, et al.
Partial
protection against H5N1 influenza in mice with a single dose of a chimpanzee
adenovirus
vector expressing nucleoprotein. Vaccine 2007 Sep 28;25(39-40):6845-5 1.
[48] Barefoot BE, Sample CJ, Ramsburg EA. Recombinant vesicular stomatitis
virus
expressing influenza nucleoprotein induces CD8 T-cell responses that enhance
antibody-
mediated protection after lethal challenge with influenza virus. Clin Vaccine
Immunol 2009
Apr; 16(4):488-98.
[49] Wraith DC, Vessey AE, Askonas BA. Purified influenza virus nucleoprotein
protects
mice from lethal infection. J Gen Virol 1987 Feb;68 (Pt 2):433-40.
[50] Aguilar JC, Rodriguez EG. Vaccine adjuvants revisited. Vaccine 2007 May
10;25(19):3752-62.
[51] Grgacic EV, Anderson DA. Virus-like particles: passport to immune
recognition.
Methods 2006 Sep;40(1):60-5.
[52] Bachmann MF, Rohrer UH, Kundig TM, Burki K, Hengartner H, Zinkernagel RM.
The influence of antigen organization on B cell responsiveness. Science 1993
Nov
26;262(5138):1448-51.
59
CA 02763795 2012-01-10
[53] Jegerlehner A, Tissot A, Lechner F, Sebbel P. Erdmann 1, Kundig T, et al.
A
molecular assembly system that renders antigens of choice highly repetitive
for induction of
protective B cell responses. Vaccine 2002 Aug 19;20(25-26):3104-12.
[54] Chackerian B, Lowy DR, Schiller JT. Conjugation of a self antigen to
papillomavirus-
like particles allows for efficient induction of protective autoantibodies. J
Clin Invest 2001
Aug;108(3):415-23.
[55] Coutelier JP, van der Logt JT, Heessen FW, Warnier G, Van Snick J. 1gG2a
restriction of murine antibodies elicited by viral infections. J Exp Med 1987
Jan 1;165(1):64-
9.
[56] Hocart MJ, Mackenzie JS, Stewart GA. The immunoglobulin G subclass
responses of
mice to influenza A virus: the effect of mouse strain, and the neutralizing
abilities of
individual protein A-purified subclass antibodies. J Gen Virol 1989 Sep;70 (
Pt 9):2439-48.
[57] Zheng B, Zhang Y, He H, Marinova E, Switzer K, Wansley D, et al.
Rectification of
age-associated deficiency in cytotoxic T cell response to influenza A virus by
immunization
with immune complexes. J Immunol 2007 Nov 1;179(9):6153-9.
[58] Stitz L, Schmitz C, Binder D, Zinkernagel R, Paoletti E, Becht H.
Characterization
and immunological properties of influenza A virus nucleoprotein (NP): cell-
associated NP
isolated from infected cells or viral NP expressed by vaccinia recombinant
virus do not
confer protection. J Gen Virol 1990 May;71 ( Pt 5):1169-79.
[59] Epstein SL, Lo CY, Misplon JA, Bennink JR. Mechanism of protective
immunity
against influenza virus infection in mice without antibodies. J Immunol 1998
Jan
1;160(l):322-7.
[60] McMichael A. Cytotoxic T lymphocytes specific for influenza virus. Curr
Top
Microbiol lmmunol 1994;189:75-91.
[0164] Although the invention has been described with reference to certain
specific
embodiments, various modifications thereof will be apparent to those skilled
in the art
CA 02763795 2012-01-10
without departing from the spirit and scope of the invention. All such
modifications as would
be apparent to one skilled in the art are intended to be included within the
scope of the
following claims.
61
