Note: Descriptions are shown in the official language in which they were submitted.
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
METHODS AND COMPOSITIONS FOR DETECTING GENETIC MATERIAL
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit under 35 U.S.C. 119(e) of U.S.
Provisional Application No.
61/264,591, filed on November 25, 2009; U.S. Provisional Application No.
61/309,837, filed on March 2, 2010;
U.S. Provisional Application No. 61/309,845, filed on March 2, 2010; U.S.
Provisional Application No. 61/317,635,
filed on March 25, 2010; U.S. Provisional Application No. 61/317,639, filed on
March 25, 2010; U.S. Provisional
Application No. 61/317,684, filed on March 25, 2010; U.S. Provisional
Application No. 61/341,065, filed on March
25, 2010; U.S. Provisional Application No. 61/341,218, filed on March 25,
2010; U.S. Provisional Application No.
61/380,981, filed on September 8, 2010; U.S. Provisional Application No.
61/409,106, filed on November 1, 2010;
U.S. Provisional Application No. 61/409,473, filed on November 2, 2010; and
U.S. Provisional Application No.
61/410,769, filed on November 5, 2010, each of which is incorporated herein by
reference in its entirety
BACKGROUND OF THE INVENTION
[0001] Fetal aneuploidies are aberrations in chromosome number and commonly
arise as a result of a meiotic
nondisjunction during oogenesis or spermatogenesis; however, certain
aneuploidies, such as trisomy 8, result more
often from postzygotic mitotic disjunction (Nicolaidis & Petersen (1998) Human
Reproduction 13:313-319). Such
aberrations include both reductions and increases in the normal chromosome
number and can involve autosomes as
well as the sex chromosomes. An example of a reduction aneuploidy is Turner's
syndrome, which is typified by the
presence of a single X sex chromosome. Examples of increases in chromosome
number include Down's syndrome
(trisomy of chromosome 21), Patau syndrome (trisomy of chromosome 13), Edwards
syndrome (trisomy of
chromosome 18), and Kleinfelter's syndrome (an XXY trisomy of the sex
chromosomes). Aneuploidies commonly
lead to significant physical and neurological impairments which result in a
large percentage of affected individuals
failing to reach adulthood. In fact, fetuses having an autosomal aneuploidy
involving a chromosome other than 13,
18, or 21 generally die in utero. However, certain aneuploidies, such as
Kleinfelter's syndrome, present far less
pronounced phenotypes and those affected with other trisomies, such as XXY &
XXX, often will mature to be
fertile adults. In some cases, partial aneuploidy resulting in an abnormal
copy number of a portion of a
chromosome may result from an imbalanced nondisjunction.
[0002] Prenatal diagnosis of fetal aneuploidies using invasive testing by
amniocentesis or Chorionic Villus
Sampling (CVS), are associated with a 0.5% to 2% procedure-related risk of
pregnancy loss (D'Alton, M. E., (1994)
Semin Perinatol 18:140-62; Caughey AB (2006) Obstet Gynecol 108:612-6).
[0003] Another barrier to accurately screening fetal aneuploidy is the low
concentration of fetal DNA in maternal
plasma, particularly at earlier gestational ages. Single or low multiplex
assay approaches are unlikely to provide
enough target counts to differentiate between an aneupoloid fetus (e.g.,
trisomy of chromosome 21) from a euploid
fetus. There is also, generally, a need in the art for methods and
compositions for detecting copy number variations
in biological samples, not necessarily from maternal blood.
SUMMARY OF THE INVENTION
[0004] The present disclosure provides methods and compositions for detecting
copy number of a target
polynucleotide within a population of genetic material. Partitioning may be
used to subdivide the target
-1-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
polynucleotide into a plurality of reaction volumes. In some cases, a probe to
the target polynucleotide is
subdivided into a plurality of reaction volumes.
[0005] In some cases, the methods comprise the following steps: a. binding a
first ligation probe to a first target
polynucleotide; b. binding a second ligation probe to a second target
polynucleotide; c. subjecting said first and
second ligation probes to a ligation reaction in order to obtain one or more
ligated products; d. partitioning said
one or more ligated products into two or more partitions; e. amplifying a
sequence within said one or more ligated
products to obtain amplified products; f. determining a number of said
partitions that contain said amplified
products; and g. calculating a copy number of said first target
polynucleotide. In some cases, the target
polynucleotide is not partitioned into said two or more partitions.
[0006] Partitions can include a wide variety of types of partitions, including
solid partitions (e.g., wells, tubes,
etc.) and fluid partitions (e.g., aqueous droplets within an oil phase, such
as a continuous oil phase, or aqueous
droplets within a mixture of at least two immiscible fluids). The partitions
may also be stable or unstable. For
example, in some cases, during the amplification process said two or more
partitions remain substantially intact. In
some cases, the partitions are aqueous droplets within an oil phase and said
aqueous droplets remain substantially
intact during the amplification reaction of the instant methods. The
partitions (e.g., said aqueous droplets) may
also remain substantially intact during the determination steps, when
partitions are evaluated for the presence of
one or more target polynucleotides (or probes to said polynucleotides). The
partitions may comprise an
amplification reaction that is initiated from said ligated product.
[0007] The first and second ligation probes may bind (or be designed to bind)
a variety of target polynucleotides;
often a first ligation probe binds a first target polynucleotide and a second
ligation probe binds a second
polynucleotide. In some cases, the first and second ligation probes are each
designed to bind to said first target
polynucleotide. In other cases, said first ligation probe binds a first target
polynucleotide that has a sequence that
differs from the sequence of said second target poynucleotide. In some cases,
first ligation probe is designed to
bind to a polynucleotide sequence that is conserved between individuals within
a species. In some cases, first
ligation probe is designed to bind to a polynucleotide sequence that is
conserved across two or more different
species. In some cases, a ligation probe binds to a nonpolymorphic region of a
chromosome.
[0008] In some embodiments, the method comprises ligating multiple ligation
probes to said first target
polynucleotide. For example, the method may comprise binding at least four
ligation probes to said first target
polynucleotide. In other cases, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15,
20, 25, 30, 35, 40, 45, 50, 100, 200, 500, 1000,
5000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 100,000,
2,000,000, 3, 000,000, 4,000,000,
5,000,000, 6,000,000, 7,000,000, 8,000,000, 9,000,000 or 10,000,000 ligation
probes are used in the methods
provided herein. Often, one or more of said ligation probes bind to a
different polynucleotide (e.g., different
chromosomes, different regions within the same chromosome). In some cases, a
plurality of first ligation probes
(e.g., target ligation probes) are used and a plurality of second ligation
probes (e.g., reference ligation probes) are
used in the present methods and compositions. The methods may further comprise
binding at least four ligation
probes to said first target polynucleotide and at least four ligation probes
to said second target polynucleotide. In
some cases, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40,
45, 50, 100, 200, 500, 1000, 5000, 10,000,
20,000, 30,000, 40,000, 50,000, 60,000, 70,000, 100,000, 2,000,000, 3,
000,000, 4,000,000, 5,000,000, 6,000,000,
7,000,000, 8,000,000, 9,000,000 or 10,000,000 ligation probes are bound to
said first or said second target
polynucleotide.
-2-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[0009] The first ligation probe may bind (or be designed to bind) to a first
region within said first target
polynucleotide and said second ligation probe may bind (or be designed to
bind) to a second region within said first
target polynucleotide, wherein said first and second regions do not have
identical sequences.
[0010] Often the first target polynucleotide is not identical to said second
target polynucleotide. In some cases the
first target polynucleotide is identical to the second target polynucleotide.
In some examples, said first target
polynucleotide is a test chromosome and said second target polynucleotide is a
reference chromosome. Examples of
test chromosomes include but are not limited to: chromosome 21, chromosome 13,
chromosome 18, and the X
chromosome. Said test chromosome may also be from the group consisting of
chromosome 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, X, and Y. A first target
polynucleotide may be a segment of a
chromosome, such as a segment of a chromosome that is associated with fetal
aneuploidy (either the chromosome
or the segment may be associated with fetal aneuploidy).
[0011] The methods and compositions provided herein often relate to ligating a
probe to itself, ligating two probes
together, and/or ligation products of said ligation reactions. Said ligation
reactions may result in the ligation of a
5' region of said first ligation probe to a 3' region of said first ligation
probe to obtain a circular ligated product.
In some cases, a ligation reaction results in the ligation of the 5' region of
said first ligation probe to the 3' region
of said second ligation probe, in order to obtain a linear ligated product
comprising at least a portion of said first
and second ligation probes. Said 5' region and said 3' region of said first
ligation probe may each bind (or be
designed to bind) adjacent sequences within said first target polynucleotide.
Said adjacent sequences are separated
by 0 nucleotides. Said 5' region and said 3' region of said first ligation
probe may bind, or be designed to bind,
neighboring sequences within said first target polynucleotide. Said
neighboring sequences may be separated by at
least one nucleotide. In some cases, the neighboring sequences are separated
by a gap of at least 5, 10, 20, 30, 40
,50, 100, 200, 300, 400, or 500 nucleotides.
[0012] The ligation reaction may further comprise a template-driven gap fill
reaction to incorporate nucleotides in
the gap between said 5' region and said 3' region of said first ligation probe
(or of said second ligation probe).
[0013] The ligation probes may comprise a site cleavable by an enzyme. For
example, the site cleavable by an
enzyme may comprise one or more uracils. The uracils may be separated by other
nucleotides in some cases. The
site cleavable by an enzyme may comprise a restriction site. The first
ligation probe may be of a specific type, such
as a molecular inversion probe, a padlock probe, a linear ligation probe,
etc..
[0014] The methods provided herein may further comprise performing an
enzymatic reaction to remove linear
polynucleotides or single-stranded polynucleotides or double-stranded
polynucleotides. For example, an
exonuclease (e.g., Exo I, II, and/or III) may be used in the methods described
herein. Often, exonuclease treatment
removes all, or a substantial amount, of unbound ligation probes from a sample
volume.
[0015] The probes provided herein maybe conjugated to signaling agent. Said
first ligation probe maybe
conjugated to a first signaling agent and a second ligation probe is
conjugated a second signaling agent. Often, a
plurality of such first and second ligation probes are used in the methods and
compositions herein, wherein said
probes are conjugated to the same signaling agent (e.g., identical
fluorophore) or to different signaling agents (e.g.,
fluorophores of different colors). Said first signaling agent may be a
fluorescent marker of a first color and said
second signaling agent may be a fluorescent marker of a second color.
[0016] Detection of ligation probes is also often a step in the methods
provided herein. The methods may
comprise detecting said first ligation probe with a first signaling agent and
detecting said second ligation probe with
-3-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
a second signaling agent. Said first ligation probe may comprise a first
plurality of ligation probes, wherein each
probe within said plurality is directed to a different region of a first
chromosome, and wherein said second ligation
probe comprises a second plurality of ligation probes, wherein each probe
within said plurality is directed to a
different region of a second chromosome. In some cases, said first target
polynucleotide is a test chromosome and
said second target polynucleotide is a reference chromosome. In some cases,
said first and second ligation probes
are conjugated to the same color.
[0017] The methods and compositions provided herein may also involve a method
of detecting copy number of a
target polynucleotide within a population of genetic material comprising: a.
binding a first ligation probe to a first
target polynucleotide; b. binding a second ligation probe to a second target
polynucleotide; c. subjecting said
first and second ligation probes to a ligation reaction in order to obtain one
or more ligated products; d.
partitioning said one or more ligated products into two or more aqueous
droplets within a continuous oil phase;
amplifying a sequence within said one or more ligated products to obtain
amplified products; determining a
number of said two or more aqueous droplets that contain said amplified
products; and g. calculating a copy
number of said target polynucleotide based on said number. In some cases, said
target polynucleotide is not
partitioned into said two or more aqueous droplets. In some cases, said target
polynucleotide is not amplified. In
some cases, or during said amplifying or determining steps, said two or more
aqueous droplets remain
substantially intact.
[0018] In some cases, said two or more aqueous droplets comprise on average
more than one ligated probe and
said method further comprises using an algorithm to calculate an average
number of target ligated probes per
aqueous droplet. Said two or more aqueous droplets may be greater than 4,000
droplets. In some cases, said two or
more aqueous droplets may be greater than 1,000, 10,000, 20,000, 50,000,
100,000, 200,000, 500,000, 1,000,000, or
5,000,000 droplets.
[0019] In some cases, said droplets are present in a single chamber at a high
droplet/ml density. The density may
be greater than 100,000 aqueous droplets/ml. Examples of densities of droplets
in a single chamber include: 10,000
droplets/mL, 100,000droplets/mL, 200,000droplets/mL, 300,000droplets/mL,
400,000droplets/mL,
500,000droplets/mL, 600,000droplets/mL, 700,000droplets/mL,
800,000droplets/mL, 900,000droplets/mL or
1,000,000droplets/mL. The droplets used in any of the methods or compositions
provided herein may be
monodisperse droplets. The droplets may have, on average, a diameter of
between 50 nm and 300 m. In some
embodiments, the droplet diameter maybe, on average, about.001, .01, .05, .1,
1, 5, 10, 20, 30, 40, 50, 60, 70, 80,
100, 120, 130, 140, 150, 160, 180, 200, 300, 400, or 500 microns In some
cases, the droplets do not comprise a
substantial number of beads conjugated to oligonucleotides.
[0020] The aqueous droplets may be present within an oil fluid or phase. The
oil phase may comprise an anionic
flourosurfactant an ammonium salt of an anionic fluorosurfactant, such as
KrytoxTM. Krytox may be selected from
a group consisting of Krytox AS, Krytox FSH, and morpholino derivative of
Krytox FSH. The oil phase may
comprise a fluorinated oil.
[0021] The methods provided herein (e.g., detecting copy number using
droplets) can be used to detect said first
target polynucleotide within a population of genetic material comprising less
than 1,000 copies of said first target
polynucleotide. In some cases, said two or more aqueous droplets comprise on
average more than one ligated
probe and said method further comprises using an algorithm to calculate an
average number of target ligated probes
per aqueous droplet.
-4-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[0022] The droplets may comprise a first target polynucleotide that is a
chromosomal segment associated with a
genetic disorder. The droplets may comprise a specific type of ligation probe
(e.g., padlock probe, molecular
inversion probe, ligation detection reaction (LDR) probe, etc.). The ligation
probe may be subjected to a ligation
reaction that ligates the 5' region of the ligation probe to the 3' region of
the ligation probe.
[0023] The methods and compositions provided herein may also relate to a
method of detecting a fetal genetic
condition comprising: a. obtaining a mixture of maternal and fetal genetic
material comprising target
polynucleotides; b. combining said mixture with targeting oligonucleotides
that bind said target polynucleotides;c.
subdividing said targeting oligonucleotides into reaction volumes, wherein at
least one of said reaction volumes
comprises no target polynucleotide and no targeting oligonucleotide; d.
performing an amplification reaction within
said reaction volumes; e. detecting the presence of said target polynucleotide
or said targeting oligonucleotide
within said reaction volumes; and
f. determining the relative level of said target polynucleotide in said
mixture in order to detect a fetal genetic
condition.
[0024] The reaction volumes may be aqueous droplets within a continuous oil
phase. The targeting
oligonucleotides may comprise one or more primer pairs; ligation probes;
molecular inversion probes; ligation
detection reaction (LDR) probes; padlock probes; and any combination thereof.
The reaction volumes may
comprise, on average, greater than one copy of targeting oligonucleotid,
and/or, on average, greater than one copy
of target polynucleotide. Said reaction volumes may further comprise primers
to a reference polynucleotide. In
some cases, said reaction volumes further comprise a ligation probe to a
reference polynucleotide.
[0025] In some embodiments, the ligation probes are amplified within said
reaction volumes.
[0026] The fetal genetic material used in the methods for detecting a fetal
genetic condition may be derived from a
cellular sample that was selectively pre-enriched for fetal genetic material.
But, in some embodiments, fetal genetic
material used in the methods for detecting a fetal genetic condition is not
derived from a cellular sample that was
selectively pre-enriched for fetal genetic material
[0027] The target polynucleotide may be within a chromosome selected from the
group consisting of
chromosome 18, 13, 21, and X; or from the group consisting of chromosome 1, 2,
3, 4, 5, 6, 7, 8, 9, 10,11, 12, 13,
14, 15, 16, 17, 18, 19,20, 21, 22, X, or Y.
[0028] In some cases, said reaction volumes are aqueous droplets within an oil
phase, said targeting
oligonucleotides are ligation probes, and said determining step comprises
comparing a number of droplets
comprising an amplified product of said ligation probes with a number of
droplets comprising an amplified product
of ligation probes directed to a reference polynucleotide. In some cases, said
reference polynucleotide is a region of
a chromosome that is not associated with a fetal genetic abnormality.
[0029] As used in the methods and compositions provided herein, said targeting
oligonucleotides may be ligation
probes that become circular upon ligation following hybridization to a target
polynucleotide.
[0030] This disclosure also provides compositions, such as microcapsule
compositions, as well as methods for
using said microcapsule compositions. In some cases, the composition is a
microcapsule comprising a ligated probe
wherein said microcapsule is obtained by: a. selectively binding a plurality
of ligation probes to target
polynucleotides within a genetic sample; b. ligating a 5' end of at least one
of said bound ligation probes to a 3'
end of the same or different bound ligation probe, thereby obtaining at least
one ligation product; c. introducing an
aqueous solution comprising said at least one ligation product into a device
for generating droplets; d. using said
-5-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
device to produce an aqueous droplet comprising said at least one ligation
product, wherein said aqueous droplet is
within an immiscible fluid; and
e. converting said droplet into a microcapsule comprising a solid-phase
exterior. In some cases, said converting
comprises heating above 50 C, or heating above 70 C. The immiscible liquid
(e.g., oil) may comprise a
fluorinated surfactant. In some cases, the aqueous phase comprises a
fluorinated surfactant. The oil may be a
fluorocarbon oil. The oil phase may comprise an anionic surfactant. The oil
phase may comprises ammonium
Krytox. In some cases, said microcapsule does not comprise a bead bound to an
oligonucleotide. Said
microcapsule may remain substantially intact at temperatures above 70 C. The
microcapsule may comprise ligation
probes capable of selectively binding to a target polynucleotide associated
with a genetic disorder. In some cases,
said ligation probes are capable of selectively binding to a target
polynucleotide associated with fetal aneuploidy.
In some cases, said genetic target is within a chromosome selected from the
group consisting of chromosome 21,
chromosome 13, chromosome 18, and the X chromosome. In some cases, the genetic
target is within chromosome
1, 2, 3, 4, 5, 6, 7, 8, 9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19,20, 21, 22,X,
or Y.
[0031] The microcapsule may comprise one or more of said ligation probes
(e.g., padlock probe, molecular
inversion probe, ligation detection reaction (LDR) probe, circular probe,
etc.). The microcapsules may comprise a
linear probe obtained by linearizing a probe previously circularized after a
ligation reaction. In some cases, the
microcapsules comprise circularized ligation probe. In some cases, the
microcapsules contain linear products of a
ligation detection reaction (LDR).
[0032] The compositions and method provided herein may also relate to a water-
in-oil mixture comprising two or
more aqueous droplets, wherein at least one of said two or more aqueous
droplets comprises a first ligation probe
directed to a first target polynucleotide and at least one of said two or more
aqueous droplets comprises a second
ligation probe directed to a second target polynucleotide. Said first target
polynucleotide and said second target
polynucleotide may be the same molecule, or different molecules with identical
sequences or structures, or different
molecules with different sequences or structures. In some cases, said first
target polynucleotide has a different
sequence than that of said second target polynucleotide. In some instances,
said first target polynucleotide has an
identical sequence to said second target polynucleotide. Said first target
polynucleotide may comprise a first region
within a genomic segment and said second target polynucleotide may comprise a
second region within said
genomic segment, wherein said first region does not have the same sequence as
said second region.
[0033] In some cases, said water-in-oil mixture further comprises an ammonium
krytox surfactant. Said krytox
surfactant may be present in the oil phase of said mixture at a concentration
of at least 0.01 %.
[0034] In some cases, said mixture comprises a ligation probe that is the
linearized product of a circular probe
that was subjected to enzymatic cleavage. In some cases, said mixture
comprises the circularized probe itself. In
some cases, the ligation probe may comprise an enzymatic cleavage site, such
as where enzymatic cleavage is
catalyzed by uracil-N-glycosylase or a restriction enzyme.
[0035] The present invention includes a method of differential detection of
target sequences in a mixture of
maternal and fetal genetic material, comprising the steps of: a) obtaining
maternal tissue containing both maternal
and fetal genetic material; b) distributing the genetic material into discrete
samples, each sample containing on
average not more than about one target sequence per sample, wherein the
discrete sample contains a set of primers
to a known target sequence and/or a set of reference primers to a known
reference sequence; c) performing an
amplification reaction; d) detecting the presence of the target or reference
sequence in the discrete samples; and e)
-6-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
comparing the ratio of target sequences detected to reference sequences
detected to determine a differential amount
of target sequence. Said method may further comprise a step of comparing the
ratio of target sequences detected to
reference sequences detected to determine a differential amount of target
sequence, wherein a difference in target
sequences detected to reference sequences detected indicates a fetal genetic
abnormality. In some embodiments the
method is a method of detecting fetal aneuploidy. In some cases, the target
sequence is a marker for aneuploidy and
the reference sequence is diploid in maternal and fetal genetic material. The
maternal tissue may be maternal
peripheral blood, blood plasma or serum, or other tissue described herein. In
some embodiments, the reaction
samples are in aqueous phases in an emulsion. In some cases, detecting the
presence of the target or reference
sequence further includes hybridizing it in situ with a nucleic acid having a
fluorescent label. In some cases, the
number of reaction samples is at least about 10,000. In some cases, steps b)
to e) are repeated with a primer set to a
different target sequence. In some cases, the reaction volume comprises more
than one primer set with each primer
set to a particular target sequence. In some cases, the reaction volume
comprises more than one reference primer set
with each primer set to a particular reference sequence. Examples of primer
sets that can be used include primer
sets specific for human chromosome 21, human chromosome 18, human chromosome
13, or human chromosome
X. In some cases, aneuploidy is detected where the ratio of target to
reference sequence detected is greater than 1.
In some cases, an aneuploidy is detected where the ratio of target to
reference sequence detected is less than 1. In
some cases, the target sequence is at least a portion of a CFTR, Factor VIII
(F8 gene), beta globin,
hemachromatosis, G6PD, neurofibromatosis, GAPDH, beta amyloid, or pyruvate
kinase gene.
INCORPORATION BY REFERENCE
[0036] All publications and patent applications mentioned in this
specification are herein incorporated by
reference in their entirety and to the same extent as if each individual
publication or patent application was
specifically and individually indicated to be incorporated by reference.
BRIEF DESCRIPTION OF THE FIGURES
[0037] The novel features of the invention are set forth with particularity in
the appended claims. A better
understanding of the features and advantages of the present invention will be
obtained by reference to the following
detailed description that sets forth illustrative embodiments, in which the
principles of the invention are utilized,
and the accompanying figures of which:
[0038] FIG. 1 is a schematic overview illustrating the steps that can be taken
to detect copy number variations in a
patient sample through the use of droplet digital PCR and ligation probes.
[0039] FIG. 2 is a schematic illustration of an example of steps that can be
followed to detect changes in the
number of chromosomes (or portions thereof) in a sample.
[0040] FIG. 3 depicts a workflow of an exemplary method for diagnosing fetal
aneuploidy.
[0041] FIG. 4 is a schematic illustration of the use of Molecular Inversion
Probes (MIPs) to detect two genetic
targets.
[0042] FIG. 5 shows multiplexing of the MIP approach to increase sensitivity
of detection of genetic targets.
[0043] FIG. 6 shows a two-color system for detection of nucleic acids in
droplets using universal primers and
universal probes without cleavage.
[0044] FIG. 7 shows a scheme for detecting two genetic targets with two colors
using a ligation-detection reaction
(LDR) followed by PCR in droplets.
-7-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[0045] FIG. 8 depicts the use of multiplexed oligonucleotides for LDR-PCR in
droplets to enhance sensitivity of
detection.
[0046] FIG. 9 depicts a computer useful for displaying, storing, retrieving,
or calculating data or results obtained
by the methods and compositions described herein.
[0047] FIG. 10 shows a correlation between number of input copies of template
DNA and number of positive
droplets (or counts), and increased sensitivity when using 12-plex MIPs (lower
panels) compared to 3-plex MIPs
(upper panels), for a test sample.
[0048] FIG. 11 shows number of positive droplets (or counts) versus number of
template copies, for a reference
sample.
[0049] FIG. 12 shows hybridization efficiency for different template copy
numbers and at different levels of MIP
multiplexing.
[0050] FIG. 13 shows 24 MIPs directed to different regions within Chromosome 1
(SEQ ID NOS: 1-24).
[0051] FIG. 14 shows 24 MIPs directed to different regions within Chromosome
21 (SEQ ID NOS: 25-48).
[0052] FIG. 15 shows a 3-plex set of MIPs directed to different regions within
Chromosome 1 (SEQ ID NOS: 49-
51) and a 12-plex set of MIPs directed to different regions within Chromosome
1 (SEQ ID NOS: 52-63).
[0053] FIG. 16 shows a 3-plex set of MIPs directed to different regions within
Chromosome 21 (SEQ ID NOS:
64-66) and a 12-plex set of MIPs directed to different regions within
Chromosome 21 (SEQ ID NOS: 67-78).
[0054] FIG. 17 shows exemplary universal primers and probes for the detection
of a MIP (SEQ ID NOS: 79-82).
DETAILED DESCRIPTION OF THE INVENTION
General Overview
[0055] This disclosure provides methods and compositions for detecting genetic
variations in a biological sample.
In some cases, this disclosure provides methods and compositions for detecting
the number of copies of a target
polynucleotide (e.g., chromosome, chromosome fragment, gene, etc.) within a
biological sample. In some cases,
methods and compositions for detecting genetic mutations and/or single
nucleotide polymorphisms (SNPs) within a
biological sample are also provided.
[0056] This disclosure also provides compositions and methods for detecting
fetal aneuploidy, or other genetic
abnormality, in a biological sample derived from maternal tissue. Often such a
biological sample comprises a
mixture of maternal and fetal nucleic acids (e.g., DNA, RNA). Aneuploidy is a
chromosomal abnormality, and
refers to an aberration in the copy number of a chromosome, or fragment
thereof, or portion thereof. The methods
and materials described herein apply techniques for analyzing numerous nucleic
acids contained in a tissue sample,
such as blood (whole blood or peripheral blood), serum or plasma, containing a
mixture of DNA (and/or DNA
fragments) from both the mother and the fetus, and allowing detection of small
differences between target and
reference DNA levels that may indicate fetal aneuploidy.
[0057] As used herein, copy number variations (CNVs) refer to gains or losses
of segments of genetic material.
There are large numbers of CNV regions in humans and a broad range of genetic
diversity among the general
population. CNVs also play a role in many human genetic disorders. The method
is especially useful for detection
of a translocation, addition, amplification, transversion, inversion,
aneuploidy, polyploidy, monosomy, trisomy,
trisomy 21, trisomyl3, trisomy 14, trisomy 15, trisomy 16, trisomy 18, trisomy
22, triploidy, tetraploidy, and sex
chromosome abnormalities including but not limited to XO, XXY, XYY, and XXX.
The method also provides a
non-invasive technique for determining the sequence of fetal DNA and
identifying mutations within the fetal DNA.
-8-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[0058] This disclosure provides means for the detection of CNV, genetic
variations, and/or fetal aneuploidy, for
example, by the use of digital PCR (e.g., droplet digital PCR), as well as
specialized probes, often referred to herein
as ligation probes (e.g., molecular inversion probes and other probes) capable
of being ligated together directly or
indirectly when hybridized to a target polynucleotide. In the methods provided
herein, a sample comprising a target
nucleotide, or probes to said target nucleotide is partitioned into a
plurality of compartments (e.g., droplets). The
compartments (e.g., droplets) are then subjected to a thermocyling reaction to
encourage PCR reactions within
compartments that contain either a target nucleotide, or a probe to said
target nucleotide, resulting in amplified
products (e.g., amplified DNA, RNA or other nucleic acid).
[0059] In some embodiments, a single probe is ligated at its ends following
hybridization to a target
polynucleotide (e.g., molecular inversion probe). In other embodiments, the
ligation probes comprise two separate
molecules that can be ligated together following hybridization to a target
polynucleotide.
[0060] The compositions described herein include compositions comprising
mixtures of two or more immiscible
fluids such as oil and water that contain a type of nucleic acid probe (e.g.,
molecular inversion probe, ligation probe,
etc.). In other cases, the compositions described herein comprise
microcapsules that contain a type of nucleic acid
probe (e.g., molecular inversion probe, ligation probe, etc.). Such
microcapsules may resist coalescence,
particularly at high temperatures, and therefore enable amplification
reactions to occur at a very high density (e.g.,
number of reactions per unit volume).
[0061] FIG 1 provides a schematic overview illustrating the steps that can be
taken to detect copy number
variations in a sample from a patient through the use of droplet digital PCR
(ddPCR) and ligation probes. A sample
of genomic nucleic acids (e.g., genomic DNA or RNA) is extracted (101) from a
sample obtained from a patient
(101). Probes (such as the ligation probes described herein) are allowed to
hybridize to a target nucleotide sequence
within the patient sample (103); following hybridization, the probes are
ligated together (104) and then the sample
is, optionally, subjected to an enzymatic treatment (e.g., exonuclease) to
breakdown genomic nucleic acids and
residual unligated probes (105). PCR reaction components (e.g., primers,
fluorescence detection probes,
polymerase, dNTPs, etc.) are then added to the sample (106), which is then
partitioned into multiple droplets (107).
After droplet formation, the droplets are subjected to thermocycling to
amplify the probes within the sample (108).
The number of positive and negative droplets are then determined (109), which
is used to determine relative copy
number of a target polynucleotide. Although Figure 1 depicts droplets as being
the means of partitions, other means
of partitioning known in the art can be used as well, e.g., partitioning among
wells within a nano- or microfluidic
device, etc. Also, although Figure 1 depicts detecting copy number variations,
other genetic conditions can be
detected as well.
[0062] The detection of copy number within a sample may involve the detection
of chromosomal abnormalities,
including aneuploidy. FIG. 2 is a general overview of steps that can be taken
to identify fetal aneuploidy in a
maternal sample. A starting tissue sample (201) contains a mixture of maternal
and fetal DNA. The DNA is
extracted, and mixed with probes for chromosome 1 (202) (a reference
chromosome) and chromosome 21 (a test
chromosome) (203). Probes are bound to a genetic target and then partitioned
into multiple compartments (204).
Probes are detected within the compartments, and the number of compartments
containing the test chromosome
(e.g., chr. 21) is compared to the number of compartments containing the
reference chromosome (e.g., chr. 1)(205),
followed by calculation of the relative copy number of chromosome 21.
-9-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[0063] The present disclosure provides for the analysis of maternal tissue
(e.g., blood, serum or plasma) for a
genetic condition, wherein the mixed fetal and maternal DNA in the maternal
tissue is analyzed to distinguish a
fetal mutation or genetic abnormality from the background of the maternal DNA.
Using a combination of steps, a
DNA sample containing DNA (or RNA) from a mother and a fetus can be analyzed
to measure relative
concentrations of cell-free, peripherally circulating DNA sequences. Such
concentration differences can be used to
distinguish a genetic condition present in a minor fraction of the DNA, which
represents the fetal DNA.
[0064] The method may employ digital analysis, in which the DNA in the sample
is translated into a plurality of
ligated probes that are partitioned to a nominal single ligated probe molecule
in a reaction volume to create a
sample mixture. For example, the reaction volume can be a droplet, such as a
droplet of an aqueous phase dispersed
in an immiscible liquid, such as described in U.S. Patent No. 7,041,481, which
is hereby incorporated by reference
in its entirety. Each reaction volume has a possibility of having distributed
in it less than 1 target (e.g., target
polynucleotide, targeting probe, or other target molecule) or one or more
targets (e.g., target polynucleotide,
targeting probe or other targeting molecule). The target molecules can be
detected in each reaction volume,
preferably as target sequences which are amplified, which can include a
quantization (or quantification) of starting
copy number of the target sequence, that is, 0, 1, 2, 3, etc. A reference
sequence can be used to distinguish an
abnormal increase in the target sequence, e.g., a trisomy. Thus there can be a
differential detection of target
sequence to reference sequence that indicates the presence of a fetal
aneuploidy. It is not necessary that the
reference sequence be maternal sequence.
[0065] In addition, the method may employ a wide range of approaches to
capture and detect fetal genetic
material, either directly or indirectly. One method described herein involves
a combination of using a molecular
inversion probe (MIP) (or other oligonucleotide probe) instead of a pair of
primers to bind to genomic DNA,
followed by steps comprising a hybridization step to bind MIP probes to a
complementary sequence within a target
polynucleotide, a ligation reaction step to circularize bound probes, an
exonuclease treatment step to digest residual
non-circularized MIP probes, an optional treatment step, where an enzyme such
as uracil-N-glycosylase is used to
linearize circularized probes; a partitioning step, where the circularized
probes, or linearized probes (that were
previously circular) are partitioned or subdivided into two or more partitions
(e.g., droplets); followed by an
amplification step involving amplification of a sequence unique to the
oligonucleotide probe through droplet digital
PCR.
[0066] In some cases, multiplexed MIPs (or other oligonucleotide) are used
herein in order to improve sensitivity
of detection. For example, a group of two or more MIPs can be used, wherein
each of such MIPs binds to a
different sequence on the same chromosome (e.g., chromosome 21). In some
cases, multiple MIPs recognizing, for
example, a target and reference sequence, can be differentially detected
during amplification using fluorophores of
different colors. In some cases, binding of a single linear probe to genomic
DNA and a subsequent ligation reaction
produces a circular molecule. In other cases, two linear probes bind to
adjacent regions of genomic DNA, and a
subsequent ligation reaction produces a ligation-dependent molecule that can
be detected in a ligation-detection
reaction (LDR).
[0067] As used herein, the term ligation refers to a covalent bond or linkage
between two or more nucleic acids,
e.g. oligonucleotides and/or polynucleotides. Often, a ligation may comprise
ligating the 5' terminus of a
polynucleotide (e.g., ligation probe) to the 3' terminus of another
polynucleotide (e.g., ligation probe), or to the
same polynucleotide. The nature of the bond or linkage may vary widely and the
ligation may be carried out
-1o-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
enzymatically or chemically. Ligations are usually carried out enzymatically
to form a phosphodiester linkage
between a 5' carbon of a terminal nucleotide of one oligonucleotide with 3'
carbon of another oligonucleotide. A
variety of binding-driven ligation reactions are described in the following
references: Whitely et al, U.S. Pat. No.
4,883,750; Letsinger et al, U.S. Pat. No. 5,476,930; Fung et al, U.S. Pat. No.
5,593,826; Kool, U.S. Pat. No.
5,426,180.
[0068] The present disclosure provides methods and compositions for the
removal of undesired material,
including unbound genomic DNA and unligated probe, and the selection or
isolation of desired material, including
ligation product. In some cases where the product of ligation is circular,
such as in reactions involving a MIP,
unbound genomic DNA and unligated probe is removed using exonuclease
treatment. In some cases, the circular
ligation product is then released using treatment with an enzyme such as
uracil-N-glycosylase, which depurinates
uracil residues in the probes. In these cases, the abasic site is cleaved upon
heating, resulting in a linearized ligation
product.
[0069] Detection can occur using a variety of methods. In some cases, a
product of ligation is detected using a
droplet digital PCR reaction in which DNA synthesis proceeds by the extension
of at least one detection probe
containing a fluorescer-quencher pair within a single molecule. Fluorescer
refers to a molecule that emits
detectable light after absorbing light or other electromagnetic radiation
(e.g. a fluorophore). Quencher refers to a
molecule that decreases the fluorescence intensity of a substance, and in the
case of a fluorescer-quencher pair, the
quencher may reduce detection of a covalently-attached fluorescer by absorbing
the detectable light it emits.
During the process of DNA synthesis, the 5'4 3' exonuclease activity of a
polymerase enzyme such as Taq
polymerase cleaves the detection probe, resulting in release of the fluorescer
from the quencher. A variety of
fluorescence detection methods can detect the released fluorescer, but not the
fluorescer-quencher pair. In some
embodiments, detection of a product of ligation provides a quantitative
measurement of the presence of a specific
sequence, such as a target or reference sequence in fetal or maternal genetic
material.
[0070] The present disclosure may further provide compositions and methods for
the detection of a nucleic acid
molecule of interest, where the sample may comprise DNA, RNA, or cDNA from any
organism that is detected
using droplet digital PCR. In some cases, the sample is isolated using a
ligation reaction which is followed in some
cases by exonuclease treatment to remove unwanted material. In some
embodiments, detection occurs by
fluorescence monitoring of droplet digital PCR, where a droplet comprises
reagents for PCR and one or more
ligation products detectable by PCR reaction, suspended in aqueous phases in
an emulsion.
Tissue Acquisition and Preparation
[0071] The methods and compositions of the present disclosure provide a means
for obtaining fetal or maternal
genetic material. The methods and compositions provide for detecting a
difference in copy number of a target
polynucleotide without the need of an invasive surgical procedure,
amniocentesis, chorionic villus sampling, etc. In
other cases, the methods and compositions provide for detecting a difference
in copy number of a target
polynucleotide from a sample (e.g., blood sample), to be used in addition to,
supplementary to, preliminary step to,
or as an adjunct to a more invasive test such as a surgical procedure. Often,
the fetal/maternal genetic material is
obtained via a blood draw, or other method provided herein. In some preferred
embodiments, the starting material
is maternal plasma or peripheral blood, such as maternal peripheral venous
blood. The peripheral blood cells may
be enriched for a particular cell type (e.g., mononuclear cells; red blood
cells; CD4+ cells; CD8+ cells; B cells; T
cells, NK cells, or the like). The peripheral blood cells may also be
selectively depleted of a particular cell type
_11_
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
(e.g., mononuclear cells; red blood cells; CD4+ cells; CD8+ cells; B cells; T
cells, NK cells, or the like). The
starting material may also be bone marrow-derived mononuclear cells. The
starting material may also include
tissue extracted directly from a placenta (e.g., placental cells) or umbilical
cord (e.g., umbilical vein endothelial
cells, umbilical artery smooth muscle cell, umbilical cord blood cells). The
starting material may also derive
directly from the fetus in the form, e.g., of fetal tissue, e.g., fetal
fibroblasts or blood cells. The starting material
may also be from an infant or child, including neonatal tissue.
[0072] This starting material may be obtained in some cases from a hospital,
laboratory, clinical or medical
laboratory. In some embodiments, the sample is taken from a subject (e.g., an
expectant mother) at at least 4, 5, 6,
7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26
weeks of gestation. In some
embodiments, the subject is affected by a genetic disease, a carrier for a
genetic disease or at risk for developing or
passing down a genetic disease, where a genetic disease is any disease that
can be linked to a genetic variation such
as mutations, insertions, additions, deletions, translocation, point mutation,
trinucleotide repeat disorders and/or
single nucleotide polymorphisms (SNPs). In other embodiments, the sample is
taken from a female patient of child-
bearing age and, in some cases, the female patient is not pregnant or of
unknown pregnancy status. In still other
cases, the subject is a male patient, a male expectant father, or a male
patient at risk of, diagnosed with, or having a
specific genetic abnormality. In some cases, the female patient is known to be
affected by, or is a carrier of, a
genetic disease or genetic variation, or is at risk of, diagnosed with, or has
a specific genetic abnormality. In some
cases, the status of the female patient with respect to a genetic disease or
genetic variation may not be known. In
further embodiments, the sample is taken from any child or adult patient of
known or unknown status with respect
to copy number variation of a genetic sequence. In some cases, the child or
adult patient is known to be affected by,
or is a carrier of, a genetic disease or genetic variation.
[0073] An advantage of the methods and compositions provided herein is that
they can enable detection of fetal
nucleic acids (e.g., DNA, RNA) at a relatively early stage of gestation and at
stages when the total concentration of
fetal nucleic acids (e.g., DNA, RNA) in the maternal plasma is low. The
starting material may have a fetal
concentration that is at least 0.1%, 0.2%, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%,
4%, 4.5%, 5%, 5.5%, 6%, 6.5%,
7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%,
14%, 14.5%, 15%, 15.5%,
16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 20.5%, 21%, 21.5%, 22%,
22.5%, 23%, 23.5%, 24%,
24.5%, or 25% of the total maternal genomic DNA load in a maternal sample, and
preferably at least 3% of the total
maternal genomic DNA load. In some cases, the fetal DNA concentration maybe
less than about 0.1 %, 0.2%,
0.5 %, 1 %, 1.5 %, 2%, 2.5 %, 3 %, 3.5 %, 4%, 4.5 %, 5 %, 5.5 %, 6%, 6.5 %,
7%, 7.5 %, 8%, 8.5 %, 9%, 9.5%, 10%,
10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%,
17%, 17.5%, 18%, 18.5%,
19%,19.5%,20%,20.5%,21%,21.5%,22%,22.5%,23%,23.5%, 24%, 24.5%, or 25% of the
total maternal
genomic DNA load in a maternal sample. In cases where the starting material
comprises a type of polynucleotide
(e.g., DNA, RNA) present in one quantity (H) and a type of polynucleotide
(e.g., DNA, RNA, etc.) present at a
lower quantity compared to H, the starting material may have a concentration
of L that is at least 0.1 %, 0.2%, 0.5%,
1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%,
8.5%, 9%, 9.5%, 10%, 10.5%,
11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%,
17.5%, 18%, 18.5%, 19%,
19.5%, 20%, 20.5%, 21%, 21.5%, 22%, 22.5%, 23%, 23.5%, 24%, 24.5%, or 25% of
the total concentration of H
in the sample, and preferably at least 3% of the H. In some cases, the L may
be less than about 0.1%, 0.2%, 0.5%,
1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%,
8.5%, 9%, 9.5%, 10%, 10.5%,
-12-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
11%, 11.5 %, 12%, 12.5%, 13 %, 13.5 %, 14%, 14.5 %, 15 %, 15.5 %, 16%, 16.5%,
17%, 17.5 %, 18%, 18.5 %, 19%,
19.5%, 20%, 20.5%, 21%, 21.5%, 22%, 22.5%, 23%, 23.5%, 24%, 24.5%, or 25% of
the total quantity of H in the
sample.
[0074] In some cases, in order to obtain sufficient nucleic acid for testing,
a blood volume of at least 1, 2, 3, 4, 5,
10, 20, 25, 30, 35, 40, 45, or 50 mL is drawn. This blood volume can provide
at least 1,000 genome equivalents
(GE) of total DNA. Total DNA is present at roughly 1,000 GE/mL of maternal
plasma in early pregnancy, and a
fetal DNA concentration of about 3.5% of total plasma DNA. However, less blood
can be drawn for a genetic
screen where less statistical significance is required, or the DNA sample is
enriched for fetal DNA. Also, the fetal
DNA concentration may vary according to the gestational age of the fetus. In
some embodiments, fetal DNA or
RNA may be enriched by isolating red blood cells, in particular fetal
nucleated red blood cells, which differ from
anucleated adult red blood cells, as described below. In other embodiments,
red blood cells may be removed from a
maternal blood sample, and genetic material may be obtained from maternal
plasma.
[0075] In some embodiments, the starting material can be a tissue sample
comprising a solid tissue, with non-
limiting examples including brain, liver, lung, kidney, prostate, ovary,
spleen, lymph node (including tonsil),
thyroid, pancreas, heart, skeletal muscle, intestine, larynx, esophagus, and
stomach. In other embodiments, the
starting material can be cells containing nucleic acids, including connective
tissue, muscle tissue, nervous tissue,
and epithelial cells, and in particular exposed epithelial cells such as skin
cells and hair cells. In yet other
embodiments, the starting material can be a sample containing nucleic acids,
from any organism, from which
genetic material can be obtained and detected by droplet digital PCR, as
outlined herein.
Enrichment of Fetal Material
[0076] Fetal cells may be enriched from a maternal sample containing a mixture
of fetal and maternal cells. Such
enrichment may occur, in some cases, where fetal concentration is at least
0.1%, 0.2%, 0.5%, 1%, 1.5%, 2%, 2.5%,
3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%,
9.5%,10%,10.5%,11%,11.5%,12%,
12.5 %, 13 %, 13.5%, 14%, 14.5 %, 15 %, 15.5 %, 16%, 16.5 %, 17%, 17.5%, 18%,
18.5 %, 19%, 19.5%, 20%, 20.5 %,
21%,21.5%,22%,22.5%,23%,23.5%, 24%, 24.5%, or 25% of the total maternal
genomic DNA (or RNA) load.
Such enrichment may occur, in some cases, where fetal concentration is more
than 0.1 %, 0.2%, 0.5%, 1%, 1.5%,
2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%,
9.5%, 10%,10.5%,11%,11.5%,
12%, 12.5 %, 13 %, 13.5%, 14%, 14.5 %, 15%, 15.5 %, 16%, 16.5 %, 17%, 17.5%,
18%, 18.5 %, 19%, 19.5 %, 20%,
20.5%,21%,21.5%,22%,22.5%,23%,23.5%, 24%, 24.5%, or 25% of the total maternal
genomic DNA (or RNA)
load.
[0077] In some embodiments, fetal cells are enriched by affinity methods,
which may include collection of fetal
cells on a solid structure conjugated with molecules with greater affinity for
fetal cells compared to non-fetal cells,
such as fetal-specific antibodies. Non-limiting examples of a solid structure
include a polymer surface, magnetic
beads, polymer beads, and surface of a microfluidic channel. In some
embodiments, a biological sample is not
enriched for fetal cells prior to, or as part of, the methods or compositions
described herein. In some embodiments,
the fetal cells are not enriched by affinity methods. In some embodiments, the
fetal cells are not enriched by the use
of fetal-specific antibodies. In some cases, the fetal cells are not enriched
via the introduction of the sample to a
microfluidic device.
[0078] Flow cytometry techniques can also be used to enrich fetal cells
(Herzenberg et al., PNAS 76: 1453-1455
(1979); Bianchi et al., PNAS 87: 3279-3283 (1990); Bruch et al., Prenatal
Diagnosis 11: 787-798 (1991)). U.S. Pat.
-13-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
No. 5,432,054 also describes a technique for separation of fetal nucleated red
blood cells, using a tube having a
wide top and a narrow, capillary bottom made of polyethylene. In some cases,
flow cytometry is not used to enrich
fetal cells in samples analyzed using the present methods or compositions.
Centrifugation using a variable speed
program results in a stacking of red blood cells in the capillary based on the
density of the molecules. The density
fraction containing low-density red blood cells, including fetal red blood
cells, is recovered and then differentially
hemolyzed to preferentially destroy maternal red blood cells. A density
gradient in a hypertonic medium is used to
separate red blood cells, now enriched in the fetal red blood cells from
lymphocytes and ruptured maternal cells.
The use of a hypertonic solution shrinks the red blood cells, which increases
their density, and facilitates
purification from the more dense lymphocytes. After the fetal cells have been
isolated, fetal DNA can be purified
using standard techniques in the art, detailed herein.
[0079] In some embodiments, the maternal blood can be processed to enrich the
fetal DNA concentration in the
total DNA, as described in Li et al., (2005) J. Amer. Med. Assoc. 293:843-849.
Briefly, circulatory DNA can be
extracted from 5- to 10-mL maternal plasma using commercial column technology
(e.g., Roche High Pure Template
DNA Purification Kit; Roche) in combination with a vacuum pump. After
extraction, the DNA can be separated by
agarose gel (1%) electrophoresis (Invitrogen), and the gel fraction containing
circulatory DNA with a size of
approximately 300 nucleotides can be carefully excised. The DNA can be
extracted from this gel slice by using an
extraction kit (QIAEX II Gel Extraction Kit; Qiagen) and eluted into a final
volume of 40- L sterile 10-mM TRIS-
hydrochloric acid, pH 8.0 (Roche).
[0080] In some embodiments, free fetal DNA is isolated from a maternal blood
sample containing whole cells. In
preferred embodiments, free fetal DNA is isolated from a sample of maternal
plasma. In some embodiments, the
plasma sample is at least 50%, 75%, or 95% free of intact cells. In some
embodiments, the plasma is completely
free of intact cells.
[0081] United States Patent Application 20040137470 to Dhallan, Ravinder S,
published Jul. 15, 2004, entitled
"Methods for detection of genetic disorders," describes an enrichment
procedure for fetal DNA," in which blood is
collected into 9 ml EDTA Vacuette tubes (catalog number NC9897284) and 0.225
ml of 10% neutral buffered
solution containing formaldehyde (4% w/v), is added to each tube, and each
tube gently is inverted. The tubes are
stored at 4 C. until ready for processing. Agents that impede cell lysis or
stabilize cell membranes can be added to
the tubes including but not limited to formaldehyde, and derivatives of
formaldehyde, formalin, glutaraldehyde, and
derivatives of glutaraldehyde, crosslinkers, primary amine reactive
crosslinkers, sulthydryl reactive crosslinkers,
sulthydryl addition or disulfide reduction, carbohydrate reactive
crosslinkers, carboxyl reactive crosslinkers,
photoreactive crosslinkers, cleavable crosslinkers, etc. Any concentration of
agent that stabilizes cell membranes or
impedes cell lysis can be added. In a preferred embodiment, the agent that
stabilizes cell membranes or impedes cell
lysis is added at a concentration that does not impede or hinder subsequent
reactions.
[0082] In another embodiment, the DNA is isolated using techniques and/or
protocols that substantially reduce the
amount of maternal DNA in the sample including but not limited to centrifuging
the samples, with the braking
power for the centrifuge set to zero (the brake on the centrifuge is not
used), transferring the supernatant to a new
tube with minimal or no disturbance of the "buffy-coat," and transferring only
a portion of the supernatant to a new
tube. In a preferred embodiment, both acceleration power and braking power for
the centrifuge are set to zero. In
another embodiment, the DNA is isolated using techniques and/or protocols that
substantially reduce the amount of
maternal DNA in the sample including but not limited to centrifuging the
samples, with the acceleration power for
-14-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
the centrifuge set to zero, transferring the supernatant to a new tube with
minimal or no disturbance of the "buffy-
coat," and transferring only a portion of the supernatant to a new tube. In
another embodiment, the "buffy-coat" is
removed from the tube prior to removal of the supernatant using any applicable
method including but not limited to
using a syringe or needle to withdraw the "buffy-coat." In another embodiment,
the braking power for the centrifuge
is set at a percentage including but not limited to 1-5%, 5-10%, 10-20%, 20-
30%, 30-40%, 40-50%, 50-60%, 60-
70%, 70-80%, 80-90%, 90-95%, 95-99% of maximum braking power.
[0083] In another embodiment, the acceleration power for the centrifuge is set
at a percentage including but not
limited to 1-5%, 5-10%, 10-20%, 20-30%, 30-40%, 40-50%, 50-60%, 60-70%, 70-
80%, 80-90%, 90-95%, 95-99%
of maximum acceleration power. In another embodiment, the present invention is
directed to a composition
comprising free fetal DNA and free maternal DNA, wherein the composition
comprises a relationship of free fetal
DNA to free maternal DNA including but not limited to at least about 15% free
fetal DNA, at least about 20% free
fetal DNA, at least about 30% free fetal DNA, at least about 40% free fetal
DNA, at least about 50% free fetal
DNA, at least about 60% free fetal DNA, at least about 70% free fetal DNA, at
least about 80% free fetal DNA, at
least about 90% free fetal DNA, at least about 91 % free fetal DNA, at least
about 92% free fetal DNA, at least
about 93% free fetal DNA, at least about 94% free fetal DNA, at least about
95% free fetal DNA, at least about
96% free fetal DNA, at least about 97% free fetal DNA, at least about 98% free
fetal DNA, at least about 99% free
fetal DNA, and at least about 99.5% free fetal DNA.
[0084] Further, an agent that stabilizes cell membranes can be added to the
maternal blood to reduce maternal cell
lysis including but not limited to aldehydes, urea formaldehyde, phenol
formaldehyde, DMAE
(dimethylaminoethanol), cholesterol, cholesterol derivatives, high
concentrations of magnesium, vitamin E, and
vitamin E derivatives, calcium, calcium gluconate, taurine, niacin,
hydroxylamine derivatives, bimoclomol, sucrose,
astaxanthin, glucose, amitriptyline, isomer A hopane tetral phenylacetate,
isomer B hopane tetral phenylacetate,
citicoline, inositol, vitamin B, vitamin B complex, cholesterol hemisuccinate,
sorbitol, calcium, coenzyme Q,
ubiquinone, vitamin K, vitamin K complex, menaquinone, zonegran, zinc, ginkgo
biloba extract,
diphenylhydantoin, perftoran, polyvinylpyrrolidone, phosphatidylserine,
tegretol, PABA, disodium cromglycate,
nedocromil sodium, phenyloin, zinc citrate, mexitil, dilantin, sodium
hyaluronate, or polaxamer 188. In another
embodiment, an agent that preserves or stabilizes the structural integrity of
cells can be used to reduce the amount
of cell lysis. In another embodiment, any protocol that reduces the amount of
free maternal DNA in the maternal
blood can be used prior to obtaining the sample. In another embodiment, prior
to obtaining the sample, the pregnant
female rests with- out physical activity for a period of time including but
not limited to 0-5, 5-10, 10-15, 15-20, 20-
25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-120, 120-180, 180-
240, 240-300, 300-360, 360-420, 420-
480, 480-540, 540- 600, 600-660, 660-720, 720-780, 780-840, 840-900, 900-
1200, 1200-1500, 1500-1800, 1800-
2100, 2100-2400, 2400- 2700, 2700-3000, 3000-3300, 3000-3600, 3600-3900, 3900-
4200, 4200-4500, and greater
than 4500 minutes. In another embodiment, the sample is obtained from the
pregnant female after her body has
reached a relaxed state. The period of rest prior to obtaining the sample may
reduce the amount of maternal nucleic
acid in the sample. In another embodiment, the sample is obtained from the
pregnant female in the a.m., including
but not limited to 4-5 am, 5-6 am, 6-7 am, 7-8 am, 8-9 am, 9-10 am, 10-11 am,
and 11-12 am. In another
embodiment, the sample is obtained from the pregnant female after she has
slept for a period of time including but
not limited to 0-1, 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-
12, or greater than 12 hours. In another
embodiment, prior to obtaining the sample, the pregnant female exercises for a
period of time followed by a period
-15-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
of rest. In another embodiment, the period of exercise includes but is not
limited to 0-15, 15-30, 30-45, 45-60, 60-
120, 120-240, or greater than 240 minutes. In another embodiment, agents that
prevent the destruction of DNA,
including but not limited to a DNase inhibitor, zinc chloride,
ethylenediaminetetraacetic acid, guanidine-HC1,
guanidine isothiocyanate, N-lauroylsarcosine, and Na-dodecylsulphate, can be
added to the blood sample. In
another embodiment, fetal DNA is obtained from a fetal cell, wherein said
fetal cell can be isolated from sources
including but not limited to maternal blood, umbilical cord blood, chorionic
villi, amniotic fluid, embryonic tissues
and mucous obtained from the cervix or vagina of the mother.
[0085] In another embodiment, any blood drawing technique, method, protocol,
or equipment that reduce the
amount of cell lysis can be used, including but not limited to a large boar
needle, a shorter length needle, a needle
coating that increases laminar flow, e.g., teflon, a modification of the bevel
of the needle to increase laminar flow,
or techniques that reduce the rate of blood flow. The fetal cells likely are
destroyed in the maternal blood by the
mother's immune system. However, it is likely that a large portion of the
maternal cell lysis occurs as a result of the
blood draw or processing of the blood sample. Thus, methods that prevent or
reduce cell lysis will reduce the
amount of maternal DNA in the sample, and increase the relative percentage of
free fetal DNA.
[0086] An example of a protocol for using this agent is as follows: The blood
is stored at 4 C. until processing.
The tubes are spun at 1000 rpm for ten minutes in a centrifuge with braking
power set at zero. The tubes are spun a
second time at 1000 rpm for ten minutes. The supernatant (the plasma) of each
sample is transferred to a new tube
and spun at 3000 rpm for ten minutes with the brake set at zero. The
supernatant is transferred to a new tube and
stored at -80 C. Approximately two milliliters of the buffy coat, which
contains maternal cells, is placed into a
separate tube and stored at -80 C.
Extraction of DNA or RNA
[0087] Genomic DNA may be isolated from plasma (e.g., maternal plasma) using
techniques known in the art,
such as using the Qiagen Midi Kit for purification of DNA from blood cells.
DNA can be eluted in 100 l of
distilled water. The Qiagen Midi Kit also is used to isolate DNA from the
maternal cells contained in the buffy coat.
A QlAamp Circulating Nucleic Acid Kit may also be used for such purposes, see,
e.g.,
http://www.qiagen.com/products/giaampcirculatingnucleicacidkit.aspx.
[0088] Methods of extracting polynucleotides (e.g., DNA) may also include the
use of liquid extraction (e.g,
Trizol, DNAzo1) techniques.
[0089] For example, the starting sample (e.g., blood or plasma) may have a
starting volume of 15-30 ml, from
which about 100-200 ul of DNA or other polynucleotide may be extracted. The
200 ul of DNA of the extracted
sample may then be converted (or concentrated) into a final sample with a
smaller volume, e.g., 5 ul, 10 ul. In
some cases, the volume of the starting sample may be greater than 2-, 5-, 10-,
20-, 30-, 40-, 50-, 75-, 100-, 500-,
1000-, 5000-, 10,000-, 50,000-, 100,000-, 500,000-, or 1,000,000- fold the
volume of the final sample. The final
sample may also be a sample that is introduced into a device for droplet
generation.
[0090] The final sample may be from 1 to 20 ul in volume. In some embodiments,
the final sample is greater
than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 ul. In some
embodiments, the final sample is less than 1, 5,
10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 ul. In some embodiments, the
final sample is greater than 1, 5, 10, 15,
20, 25, 30, 35, 40, 45, 50, 75, or 100 nl. In some embodiments, the final
sample is less than 1, 5, 10, 15, 20, 25,
30, 35, 40, 45, 50, 75, or 100 nl. In some embodiments, the final sample is
greater than 1, 5, 10, 15, 20, 25, 30, 35,
-16-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
40, 45, 50, 75, or 100 pl. In some embodiments, the final sample is less than
1, 5, 10, 15, 20, 25, 30, 35, 40, 45,
50, 75, or 100 pl.
[0091] In some embodiments, DNA can be concentrated by known methods,
including centrifugation and the use
of various enzyme inhibitors (e.g. for DNase). The DNA can be bound to a
selective membrane (e.g., silica) to
separate it from contaminants. The DNA can also be enriched for fragments
circulating in the plasma which are less
than 1000, 500, 400, 300, 200 or 100 base pairs in length. This size selection
can be done on a DNA size separation
medium, such as an electrophoretic gel or chromatography material (Huber et
al. (1993) Nucleic Acids Res.
21:1061-6), gel filtration chromatography, TSK gel (Kato et al. (1984) J.
Biochem, 95:83-86). In some cases, the
polynucleotide (e.g., DNA, RNA) may be selectively precipitated, concentrated
(e.g., sample may be subjected to
evaporation), or selectively captured using a solid-phase medium. Following
precipitation, DNA or other
polynucleotide may be reconstituted or dissolved into a small volume. A small
volume may enable hybridization,
or enable improved hybridization, of a probe with target polynucleotide.
[0092] In some embodiments, the starting material may comprise cells or
tissue, including connective tissue,
muscle tissue, nervous tissue, blood cells, or epithelial cells. In some
cases, non-nucleic acid materials can be
removed from the starting material using enzymatic treatments (such as
protease digestion). Other non-nucleic acid
materials can be removed in some cases by treatment with membrane-disrupting
detergents and/or lysis methods
(e.g. sonication, French press, freeze/thaw, dounce), which may be followed by
centrifugation to separate nucleic
acid-containing fractions from non-nucleic acid-containing fractions. The
extracted nucleic acid can be from any
appropriate sample including but not limited to, nucleic acid-containing
samples of tissue, bodily fluid (for
example, blood, serum, plasma, saliva, urine, tears, peritoneal fluid, ascitic
fluid, vaginal secretion, breast fluid,
breast milk, lymph fluid, cerebrospinal fluid or mucosa secretion), umbilical
cord blood, chorionic villi, amniotic
fluid, an embryo, a two-celled embryo, a four- celled embryo, an eight-celled
embryo, a 16-celled embryo, a 32-
celled embryo, a 64-celled embryo, a 128-celled embryo, a 256-celled embryo, a
512-celled embryo, a 1024-celled
embryo, embryonic tissues, lymph fluid, cerebrospinal fluid, mucosa secretion,
or other body exudate, fecal matter,
an individual cell or extract of the such sources that contain the nucleic
acid of the same, and subcellular structures
such as mitochondria, using protocols well established within the art.
[0093] In a preferred embodiment, blood can be collected into an apparatus
containing a magnesium chelator
including but not limited to EDTA, and is stored at 4 C. Optionally, a
calcium chelator, including but not limited to
EGTA, can be added. In another embodiment, a cell lysis inhibitor is added to
the maternal blood including but not
limited to formaldehyde, formaldehyde derivatives, formalin, glutaraldehyde,
glutaral- dehyde derivatives, a protein
cross-linker, a nucleic acid cross-linker, a protein and nucleic acid cross-
linker, primary amine reactive crosslinkers,
sulthydryl reactive crosslinkers, sultydryl addition or disulfide reduction,
carbohydrate reac- tive crosslinkers,
carboxyl reactive crosslinkers, photoreac- tive crosslinkers, cleavable
crosslinkers
[0094] Plasma RNA extraction is described in Enders et al. (2003), Clinical
Chemistry 49:727-731. Briefly,
plasma harvested after centrifugation steps can be mixed with Trizol LS
reagent (Invitrogen) and chloroform. The
mixture can be centrifuged, and the aqueous layer transferred to new tubes.
Ethanol is added to the aqueous layer.
The mixture is then applied to an RNeasy mini column (Qiagen) and processed
according to the manufacturer's
recommendations.
[0095] In some cases when the extracted material comprises single-stranded
RNA, double-stranded RNA, or
DNA-RNA hybrid, these molecules may be converted to double-stranded DNA using
techniques known in the field.
-17-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
For example, reverse transcriptase may be employed to synthesize DNA from RNA
molecules. In some cases,
conversion of RNA to DNA may require a prior ligation step, to ligate a linker
fragment to the RNA, thereby
permitting use of universal primers to initiate reverse transcription. In
other cases, the poly-A tail of an mRNA
molecule, for example, may be used to initiate reverse transcription.
Following conversion to DNA, the methods
detailed herein may be used, in some cases, to further capture, select, tag,
or isolate a desired sequence.
[0096] While the present description refers throughout to fetal DNA, fetal RNA
found in maternal blood (as well
as RNA in general) can be analyzed as well. As described previously, "mRNA of
placental origin is readily
detectable in maternal plasma," (Ng et al. (2003) Proc. Nat. Acad. Sci.
100:4748-4753), hPL (human placental
lactogen) and hCG (human chorionic gonadotropin) mRNA transcripts are
detectable in maternal plasma, as
analyzed using the respective real-time RT-PCR assays. In the present method,
mRNA encoding genes expressed in
the placenta and present on a chromosome of interest can be used. For example,
DSCR4 (Down syndrome critical
region 4) is found on chromosome 21 and is mainly expressed in the placenta.
Its mRNA sequence can be found at
GenBank NM005867. In this case, it is preferred to use RNase H minus (RNase H-
) reverse transcriptases (RTs) to
prepare cDNA for detection. RNase H- RTs are available from several
manufacturers, such as SuperScript(TM) II
(Invitrogen). Reverse transcriptase PCR can be used as described herein for
chromosomal DNA. The RNA may
include siRNA, miRNA, cRNA, tRNA, rRNA, mRNA, or any other type of RNA.
Ligation Probes
[0097] In some preferred embodiments, target polynucleotides are tagged,
selected, captured, isolated and/or
processed through the use of one or more ligation probes (also, at times,
referred to herein as "ligatable probes"). A
ligation probe comprises either: (1) a "circularizable probe", wherein each
end (5' and 3') of a single polynucleotide
(or oligonucleotide) binds to adjacent or neighboring regions of a target
polynucleotide, and where following such
binding, a ligation reaction can join the 5' terminus to the 3' terminus of
the probe, thereby circularizing the probe;
or (2) two polynucleotide (or oligonucleotide) probes wherein, after two
probes bind to regions within a target
polynucleotide, the 5' end of one probe can be ligated to the 3' end of a
different probe. After two of such probes
hybridize to neighboring or adjacent sequences of a target polynucleotide, a
ligation reaction results in joining the
two probes together into one linear probe.
[0098] In some embodiments, a ligation probe may also comprise: an enzymatic
cleavage site, a universal primer
site, and/or a universal probe-binding site. In some embodiments, the ligation
probe is phosphorylated at its 5'
terminus. In other embodiments, the ligation probe is not phosphorylated at it
5' terminus. Such phosphorylation
at the 5' terminus may enable ligation of the 5' terminus to the 3' terminus
of the same (or different) ligation probe
that is bound to an adjacent region of target polynucleotide, without the need
of a gap-fill reaction. In other cases, a
probe is synthesized without phosphorylation at the 5' end. In such cases, the
probe is designed so that the 5' end
binds to a region neighboring, but not directly adjacent to, the binding site
of the 3' end of the same (or different)
probe. Ligation of such probe may additionally require a gap-fill, or
extension reaction.
[0099] In some embodiments, a ligation probe is a molecular inversion probe.
US patent 7,368,242 describes a
molecular inversion probe and how it can be used to generate an amplicon after
interacting with a target
polynucleotide in a sample. A linear version of the probe is combined with a
sample containing target
polynucleotide under conditions that permit neighboring regions in the genetic
target to form stable duplexes with
complementary regions of the molecular inversion probe (or other ligation
probe). In general, the 5' terminus of the
probe binds to one of the target sequences, and the 3' terminus of the probe
binds to the adjacent sequence, thereby
-Is-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
forming a loop structure. The ends of the target-specific regions may abut one
another (being separated by a nick)
or there may be a gap of several (e.g. 1-10 nucleotides) between them. In some
embodiments, the gap is greater
than 5, 10, 20, 30, 40 ,50, 100, 200, 300, 400, or 500 nucelotides. In some
preferred embodiments, the target-
specific regions are directly adjacent (e.g., separated by 0 nucleotides). In
either case, after hybridization of the
target-specific regions, the ends of the two target specific regions are
covalently linked by way of a ligation reaction
or a multiextension reaction followed by a ligation reaction, using a gap-
filling reaction.
[00100] FIG. 4 is a schematic illustration of the use of Molecular Inversion
Probes (MIPs) to detect two genetic
targets. One genetic target is recognized by one probe (MIP1-1), and a second
genetic target is recognized by a
second probe (MIP2-1). After binding of a MIP to a genetic target, a ligation
reaction is conducted to ligate the 5-
terminus of a bound MIP probe to the 3-terminus, thereby forming a circular
MIP. In some cases, a MIP probe
binds two sequences of neighboring DNA that are separated by one or more
nucleotides. In such cases, a gap-fill
(or extension) reaction is performed to fill in the gap using the target DNA
as a template. After a MIP binds its
target sequences, the MIP forms a loop, and the sequence of the probe may be
inverted (see FIG. 4). This inversion
may be followed by a ligation reaction, in which the ends of the inverted
molecule are ligated to form a circularized
probe.
[00101] Following the binding of the MIP probe to the DNA (and, optionally the
gap-fill reaction), a ligation
reaction is conducted with a ligase enzyme to circularize the MIP probe. The
circular MIP probe is then retained
during exonuclease digestion, which digests unused, linear, single-stranded
probe and single-stranded linear
genomic DNA and double-stranded linear genomic DNA. The circular MIPs are then
combined with PCR reagents
into droplets for analysis by droplet digital PCR. In some embodiments, the
circular probes are linearized prior to,
or during the PCR reaction. As shown in FIG. 4, a probe may contain a site
that comprises an enzymatic cleavate
site (e.g., a series of uracil residues that are susceptible to enzymatic
cleavage by uracil N-glycosylase enzyme).
In some cases, there is an enzymatic cleavage step, wherein the polynucleotide
is cleaved and forms a linear
molecule. In other cases, there is no enzymatic cleavage step at this step,
and the polynucleotide remains in a
circular state. Next, the ligated MIP probes (either circularized, linear, or
a mixture of both) are subdivided among
one of more partitions. Preferably, the partitions are droplets (e.g., aqueous
droplets within an oil phase). The
droplets are then subjected to a thermal cycling reaction. During the thermal
cycling reaction, a linearized MIP (or
in some cases, a circular MIP) serves as the template for a reaction primed by
a universal forward primer (UF 1 or
UF2) and a universal reverse primer (UR1 or UR2). During amplification, a
universal probe that hybridizes to a
sequence in each MIP (UP1 or UP2) is cleaved such that the fluorescent side of
the probe is separated from the
quencher side of the probe. As a result of this cleavage, fluorescence from
the fluorescer side of the probe
increases.
[00102] In some embodiments, a gap-fill reaction is performed by a polymerase
with a 5'->3' polymerization
activity. Polymerases useful in this method include those that will initiate
5'-3' polymerization at a nick site. The
polymerase may also displace the polymerized strand downstream from the nick.
In some embodiments, the
polymerase used for the gap-fill reaction lacks any 5' ->3'exonuclease
activity. A polymerase ordinarily having
such exonuclease activity may lack such activity if that activity is blocked
by the addition of a blocking agent; if a
domain or fragment of the polymerase where such domain or fragment performs 5'
->3'exonuclease activity is
deleted, mutated, or otherwise modified; if the polymerase is chemically
modified; or any other method known in
the art.
_19_
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[00103] In some embodiments, the polymerase used for the gap-fill reaction
comprises a 3'->5' editing
exonuclease activity. Examples of suitable polymerases include the klenow
fragment of DNA polymerase I and the
exonuclease deficient klenow fragment of DNA polymerase I and a similar
fragment from the Bst polymerase (Bio-
Rad, Richmond, Calif.). SEQUENASE 1.0 and SEQUENASE 2.0 (US Biochemical), T5
DNA polymerase and
Phi29 DNA polymerases also work, as does Stoffel Fragment of AmpliTaq DNA
Polymerase (Life Technologies,
Carlsbad, CA).
[00104] Although the present disclosure describes ligation probes (e.g., MIP
probes) comprising DNA, the ligation
probes described herein may contain any other nucleic acid (e.g., RNA, mRNA,
cDNA, rRNA, tRNA, siRNA,
miRNA, etc.), polypeptide, synthetic nucleic acid, or synthetic polypeptide.
In some cases, the ligation probes may
comprise a two or more different types of polynucleotides (e.g., comprising
both RNA and DNA) or the ligation
probe may comprise a polynucleotide and a polypeptide (e.g., RNA plus
polypeptide; DNA plus polypeptide). In
certain other applications, the ligation probe (e.g., MIP probe) may be
conjugated to a fluorescent dye, solid
support, or bead in the methods described herein.
[00105] Nucleic acid refers to naturally occurring and non-naturally occurring
nucleic acids, as well as nucleic acid
analogs that function in a manner similar to the naturally occurring nucleic
acids. The nucleic acids may be
selected from RNA, DNA or nucleic acid analog molecules, such as sugar- or
backbone-modified ribonucleotides or
deoxyribonucleotides. Other nucleic analogs, such as peptide nucleic acids
(PNA) or locked nucleic acids (LNA),
are also suitable. Examples of non-naturally occurring nucleic acids include:
halogen-substituted bases, alkyl-
substituted bases, hydroxy-substituted bases, and thiol-substituted bases, as
well as 5-propynyl-uracil, 2-thio-5-
propynyl-uracil, 5-methylcytosine, isoguanine, isocytosine, pseudoisocytosine,
4-thiouracil, 2-thiouracil and 2-
thiothymine, inosine, 2-aminopurine, N9-(2-amino-6-chloropurine), N9-(2,6-
diaminopurine), hypoxanthine, N9-(7-
deaza-guanine), N9-(7-deaza-8-aza-guanine) and N8-(7-deaza-8-aza-adenine), 2-
amino-6-"h"-purines, 6-amino-2-
"h"-purines, 6-oxo-2-"h"-purines, 2-oxo-4-"h"-pyrimidines, 2-oxo 6-"h"-
purines, 4-oxo-2-"h"-pyrimidines. Those
will form two hydrogen bond base pairs with non-thiolated and thiolated bases;
respectively, 2,4 dioxo and 4-oxo-2-
thioxo pyrimidines, 2,4 dioxo and 2-oxo-4-thioxo pyrimidines, 4-amino-2-oxo
and 4-amino-2-thioxo pyrimidines,
6-oxo-2-amino and 6-thioxo-2-amino purines, 2-amino-4-oxo and 2-amino-4-thioxo
pyrimidines, and 6-oxo-2-
amino and 6-thioxo-2-amino purines.
[00106] In some preferred embodiments, the method comprises selection,
tagging, capture and/or isolation of a
desired sequence from genomic DNA by selectively protecting the desired
sequence from enzymatic digestion
(from enzymes such as endonucleases and exonucleases). For example,
circularization of a MIP probe (after it has
bound its target) protects the probe from digestion by certain enzymes (e.g.,
exo I, exo III). Other methods of
protecting the probe after it has bound its target may also be used.
[00107] In some cases, the ligation reaction may then be followed by enzymatic
digestion, such as exonuclease
treatment (e.g., exonuclease I, exonuclease III), to digest unbound genomic
DNA and unbound probe but not
circular DNA, thereby isolating the circular MIP representing the desired
sequence. In some cases, MIPs allow for
multiplexing, when more than one probe binds a desired genetic target and
undergoes ligation to form a circular
MIP. Multiple MIPs may thereby represent a given genetic target, enhancing the
sensitivity of detection.
[00108] In some cases wherein circular MIPs are generated to represent
sequences of interest, these circular MIPs
may be linearized prior to (or during) detection by PCR reaction. In some
cases, the MIPs contain uracil bases that
may be depurinated by treatment with an enzyme such as uracil-N-glycosylase,
and the circular molecule may
-20-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
become linearized at the abasic sites upon heating. In other cases, the MIPs
may contain restriction enzyme sites
that are targeted by site-specific restriction enzymes, cleaving the circular
probes to form linear DNA molecules. In
some embodiments in which circular MIPs are linearized, enzymes that occupy
the solution containing MIPs,
including exonucleases, are inactivated by such methods as heat-inactivation,
pH denaturation, or physical
separation prior to MIP linearization. In some cases, DNA may be purified from
proteins using gel purification or
ethanol precipitation, or proteins may be removed from the solution using
precipitation with organic solutions such
as trichloroacetic acid.
[00109] Examples of restriction enzymes include AatII, Acc651, Accl, Acil,
Acll, Acul, Afel, AflII, AflIII, Agel,
Ahdl, Alel, Alul, Alwl, A1wNI, Apal, ApaLI, ApeKI, Apol, Ascl, Asel, AsiSI,
Aval, AvaII, AvrII, BaeGI, BaeI,
BamHI, Banl, BanII, BbsI, BbvCI, BbvI, Bccl, BceAI, Bcgl, BciVI, Bell, Mal,
BfuAI, BfuCI, Bgll, BglII, Blpl,
BmgBI, Bmrl, Bmtl, Bpml, Bpul0l, BpuEI, BsaAI, BsaBI, BsaHI, Bsal, BsaJI,
BsaWI, BsaXI, BseRI, BseYI,
BsgI, BsiEI, BsiHKAI, BsiWI, Bsll, BsmAI, BsmBI, BsmFI, Bsml, BsoBI, Bsp12861,
BspCNI, BspDI, BspEI,
BspHI, BspMI, BspQI, BsrBI, BsrDI, BsrFI, BsrGI, Bsrl, BssHII, BssKI, BssSI,
BstAPI, BstBI, BstEII, BstNI,
BstBI, BstXI, BstYI, BstZl7l, Bsu361, BtgI, BtgZI, BtsCI, Btsl, Cac8I, Clal,
CspCI, CviAII, CviKI-1, CviQI, Ddel,
DpnI, DpnII, Dral, DraIII, DrdI, Eael, Eagl, Earl, EciI, Eco53kI, EcoNI,
EcoO109I, EcoP151, EcoRl, EcoRV, Fail,
Faul, Fnu4HI, Fokl, Fsel, Fspl, HaeII, HaeIII, Hgal, Hhal, HincII, HindlII,
Hinfl, HinP11, Hpal, HpaII, Hphl,
Hpyl6611, Hpy188I, Hpy188III, Hpy991, HpyAV, HpyCH4III, HpyCH4IV, HpyCH4V,
KasI, KpnI, MboI, MboII,
Mfel, Mlul, Mlyl, Mmcl, Mnll, Mscl, Msel, MslI, MspAll, Mspl, Mwol, Nael,
NarI, Nb.BbvCI, Nb.Bsml,
Nb.BsrDI, Nb.Btsl, Ncil, Ncol, Ndel, NgoMIV, NheI, Nlalll, N1aIV, NmeAIII,
Noll, Nrul, Nsil, Nspl, Nt.AlwI,
Nt.BbvCI, Nt.BsmAI, Nt.BspQI, Nt.BstNBI, Nt.CviPII, PacI, PaeR7I, Pcil, PflFI,
PflMI, Phol, Plel, Pmel, Pmll,
PpuM1, PshA1, Psil, PspGI, PspOMI, PspXI, Pst1, Pvu1, Pvu11, Rsa1, RsrII,
Sac1, Sac11, Sall, Sap1, Sau3AI, Sau961,
Sbfl, Scal, ScrFI, SexAl, SfaNI, Sfcl, SfiI, Sfol, SgrAI, Smal, Stull, SnaBI,
Spel, Sphl, Sspl, Stul, StyD4I, Styl,
Swal, T, Taqal, TfiI, TliI, Tsel, Tsp451, Tsp5091, TspMI, TspRI, Tthl11I,
Xbal, Xcml, Xhol, Xmal, Xmnl, and
Zral.
[00110] Other types of probes, and other methods of selecting a genetic probe,
may also be used in the methods and
compositions described herein. For example, although use of MIP probes
generally involves circularization of a
single ligation probe; a circularization step is not always necessary. For
example, ligation detection PCR
techniques can be used, where two different probes, each of which hybridizes
to neighboring DNA (or adjacent
DNA), are ligated together followed by addition of universal primers and
probes to detect the ligated fragments.
[00111] FIG. 7 shows a scheme for detecting two genetic targets with two
colors using a ligation-detection reaction
(LDR) followed by PCR in droplets. Two linear oligonucleotides bind to
adjacent or neighboring regions on a
genetic target. These regions may be directly adjacent or separated by a gap.
Alternatively, the regions can be
separated by a gap that can be filled-in using a polymerase reaction, that
extends the length of the 3' end of the first
probe so that its 3' end is directly adjacent to the 5' end of the second
probe. The two probes are then ligated to
each other (as depicted in FIG. 7). During ligation, the two linear
oligonucleotides are ligated to form a single
template oligonucleotide (LDR1-1 or LDR2-1). This single template
oligonucleotide, but not the pairs of
oligonucleotides from which it was formed, can produce a product in a PCR
reaction using universal forward (UF 1
or UF2) and reverse (UR1 or UR2) primers. Additionally, the PCR reaction
contains a universal probe (UP1 or
UP2) comprising a fluorescer-quencher pair that hybridizes to a portion of the
template oligonucleotide. During the
PCR reaction, a 5'-->3' exonuclease activity of a DNA polymerase (such as Taq)
cleaves the probe, resulting in
-21-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
detachment of the fluorescer end from the quencher end of the molecule. As a
result of this separation between
fluorescer probe and quencher probe, fluorescence intensity will increase in
the reaction, and can be detected in
following steps. This analysis can be performed using two universal probes
(UP1 and UP2) containing fluorescers
of two different colors that can be distinguished during detection. For
example, LDR1-1 may recognize a target
sequence such as a suspected aneuploid chromosome, while LDR2-1 recognizes a
reference sequence such as a
presumed diploid chromosome, allowing detection of aneuploidy.
[00112] The ligation probes used in ligation detection reactions described
herein may be protected from
exonuclease treatment once they are bound to a target polynucleotide. For
example, addition of a protective group,
a chemical blocking unit, or a phosphorothiate modification may protect a
hybridized ligation probe from being
digested by certain exonucleases capable of digesting unbound probe and/or
unbound target polynucleotides (e.g.,
genomic DNA). Phosphorothioate-modification may protect a ligation probe from
the activity of exo III, a 3' to 5'
exonuclease. Similarly, phosphorothioate-modification may protect a ligation
probe from the activity exo T7, a 5'
to 3' exonuclease. In some cases, exo T, a 3' to 5' exonuclease, and RecJf, a
5' to 3' exonuclease can be used.
Disclosure of phosphorothioate providing protection against exo T activity is
provided in Putney et al. (1981) PNAS
78(12):7350-54. For RecJf, see alsoTosch et al, (2007) J. ofPhysics:
Conference Series 61 (2007) 1241-1245;
doi:10.1088/1742-6596/61/1/245 International Conference on Nanoscience and
Technology (ICN&T 2006). Both
exo T and RecJF digest ssDNA and are blocked by phosphorothioates. The
phosphothiorate modification may be
located at the ends of the universal PCR primer sequences in the probes, or at
tails upstream of the unversal PCR
primer sequences.
[00113] In some embodiments, the probes comprise a mixture of different linear
oligonucleotides, wherein the
5'region of one of the linear oligonucleotides is able to be ligated to the 3'
region of a different linear
oligonucleotide, after each probe hybridizes to a target polynucleotide. In
some embodiments, two identical (or
substantially identical) oligonucleotides can each bind to a region of
adjacent or neighboring target polynucleotide
in a manner such that the 5' end of one such probe can then be ligated to the
3' end of another such probe. Such
ligation occurs following hybridization of each probe to the target
polynucleotide.
[00114] In other embodiments, the method comprises capture of a desired
sequence without subsequent isolation.
In some cases, more than one linear probe recognizes the desired sequence and
binds to it. Following the binding of
probe, a ligation reaction may be performed to ligate one or more probes to
one another. In some cases, the desired
sequence is captured as a result of the ligation, which may allow PCR
detection of ligated probe (known as ligase
detection reaction-PCR, or LDR-PCR) in subsequent steps, while unligated probe
is not detectable by PCR. In
some cases, multiple probes may bind a genetic target and undergo ligation,
enhancing the sensitivity of detection
of the genetic target by LDR-PCR.
[00115] Ligation probes (e.g., MIP probes) can be designed to satisfy certain
criteria in order to minimize sample
to sample variation in assay performance, or to otherwise optimize an assay.
Some criteria of use in the design of a
ligation probe include: (1) target sequences that do not contain any known
SNPs (eg all the SNPs in dbSNP); 2)
target sequences within conserved regions of genomic DNA; (3) target sequences
that do not overlap any known
CNV regions (e.g. all the CNVs present in CNV tracks in the UCSC genome
database); 4) target sequences within
in regions of a target polynucleotide (e.g., genomic DNA, RNA) that are
conserved across species (e.g. as assessed
by conservation tracks in the UCSC genome database). Additionally, to optimize
universal and consistent
performance of the probes, several criteria can be applied to the selection of
the target sequences. Target sequences
-22-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
can be chosen so that they are unique in the human genome. Target sequences
can be chosen so that both termini of
the MIP probes contain G/C nucleotides, so that they are near 40 nucleotides
in length, so that combined homer
arms have similar melting temperatures (e.g. within 2 of 67 degrees using
default parameters from Primer3
software) and so that individual homer arms have similar melting temperatures
(e.g. within 2 degrees of 50 degrees
using default parameters from Primer3 software). (The 5'- and 3'- ends of the
probe, which are complementary to
genomic DNA are called homer arms: H2 and Hl, respectively.)
[00116] The MIPs and the targets can also be screened to discard MIPs and
targets that form secondary structures
because they may not bind well to their counterparts. Additionally, MIPs can
be compared to each other to reduce
the possibility of reactions between MIP probes in solution. Some generic
rules for avoiding secondary structure
can be found in Hyman et al. (2010), Applied and Environmental Microbiology
76: 3904-3910. Secondary
structure screening can be aided by building distributions of dG scores and
removing outliers.
[00117] The methods provided herein include methods for assessing multiple
abnormalities simultaneously, for
example on chromosomes 13, 18, and 21. For such studies, the chromosomes can
be used as references for each
other, and therefore an extra reference sample or reference probe (e.g., to
Chromosome 1) may be unnecessary
[00118] The sample containing the genetic target may comprise genomic DNA in
the form of whole chromosomes,
chromosomal fragments, or non-chromosomal fragments. In some cases, the
average length of the genomic DNA
fragment may be less than about 100, 200, 300, 400, 500, or 800 base pairs, or
less than about 1, 2, 5, 10, 20, 30, 40,
50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200
nucleotides, or less than about 1, 2, 5,
10, 20, 30, 40, 50, 60, 70, 80, 90, 100 kilobases . In some cases, the
fragments range from 10 to 500, 10-1000, or
100-150 bases (or nucleotides) in length, and, in some embodiments, preferably
between 100-150 bases.
[00119] In some cases in which fetal genomic DNA is enriched compared to
maternal DNA, the fragment size
maybe an average of about 300 base pair or 100 or 150 base pairs. In some
cases, the sample will comprise at least
one genome equivalent. In other cases, the sample will comprise less than one
genome equivalent, but include
enough genomic DNA to make a determination of the ratios of target and
reference sequences in fetal or maternal
samples. In still other cases, the sample will comprise about half of one
genome equivalent. The term genome
equivalent is used to refer to the calculated distribution of sample DNA based
on a calculated genome size and
DNA weight, wherein the haploid genome weighs about 3.3 pg, and the genomic
content of a diploid normal cell
(46 chromosomes) weighs about 6.6 pg and corresponds to two genomic
equivalents (GE)( "genomic equivalent'
and "genome equivalent' are used interchangeably herein). In practice, there
may be some variation in DNA sample
size. Also, due to random fragment distribution, a given genome equivalent may
not contain exactly the DNA
fragments corresponding only to a single complete diploid genome.
[00120] Multiplexing
[00121] The amplification methods (e.g., PCR) described herein, and known in
the art, can be multiplexed, that is,
run with multiple primers and probes in each reaction volume. In some
embodiments of the methods and
compositions provided herein, there are at least 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 200,
500, 1000, 5000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000, 70,000,
100,000, 2,000,000, 3, 000,000,
4,000,000, 5,000,000, 6,000,000, 7,000,000, 8,000,000, 9,000,000 or 10,000,000
or more different probes in a
given sample volume. In some embodiments, there are at least 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45,
50, 100, 200, 500, 1000, 5000, 10,000, 20,000, 30,000, 40,000, 50,000, 60,000,
70,000, 100,000, 2,000,000, 3,
-23-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
000,000, 4,000,000, 5,000,000, 6,000,000, 7,000,000, 8,000,000, 9,000,000 or
10,000,000 or more primers in a
given sample volume.
[00122] In some embodiments, a plurality of probes (or primer sets) are used,
and the probes (or primer sets) differ
with respect to one or more aspects. The probes may bind identical target
polynucleotides; or different target
polynucleotides (e.g., different chromosomes; or identical chromosomes, but
different regions within said
chromosomes). For example, greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, or 20 probes
directed to different targets may be used. In some cases, greater than 20, 30,
40, 50, 100, 500, 1000, 5000, 10000,
50000, 100000, 500000, 1000000, or more probes directed to different targets
are used. In other cases, the probes
differ as to the type of cleavage site that is present within said probe. In
some cases, the plurality of probes
comprises a plurality of different types of probes (e.g., ligation probes,
MIPs, padlock probes, sets of PCR primers,
universal primers, universal probes, and any combination thereof). In some
cases, said plurality of different types
of probes differ in that each probe is conjugated to a different signaling
agent (e.g., green fluorophore vs. red
fluorophore, etc.). In some cases, the probes differ in that they comprise
different primer binding sites. In other
cases, the same set of universal primers may be used to bind all, or most of,
the probes within a plurality of probes.
[00123] Multiplexing in reaction volumes, such as droplets, allows for
detection of small changes in DNA ratio
between a target and reference sequence from the expected ratio of 1:1 for
diploid sequences. Multiplexing allows
for a large number of sequences to be counted for any set of target and
reference sequences, despite samples where
the GE/mL is low (e.g. 1000 GE/mL), such as in maternal plasma. The intact
target and reference chromosomes are
large molecules and have multiple conserved and unique regions that can be
recognized and amplified by specific
primer sets. In plasma, the circulating DNA can be present as small fragments
(300 bp). By designing multiplexed
primers that produce small products (e.g., 100 base pairs), small fragments
(e.g. 300 base pairs) of the target or
reference sequence can be efficiently amplified.
[00124] Multiplexing may increase the likelihood that a target isolated in a
reaction volume, such as a droplet, can
be recognized by one of the multiplexed primers. Multiplexing may also
increase the likelihood that amplification
will occur and may permit a positive measurement of a target sequence that
would be counted as negative in a
single-plex assay. The same can be done for a reference sequence. In some
embodiments, the degree of
multiplexing can include more than one primer set to a target sequence, such
as at least 2, 3, 4, 5, 10, 15, 20 or 25
primer sets, each to a particular target sequence. In some embodiments, the
degree of multiplexing can include
more than one reference primer set to a reference sequence, such as at least
2, 3, 4, 5, 10, 15, 20 or 25 primer sets,
each to a particular reference sequence. In some embodiments, the degree of
multiplexing can include more than
one primer set to a target sequence and more than one reference primer set to
a reference sequence, such as at least
2, 3, 4, 5, 10, 15, 20 or 25 primer sets to particular target or reference
sequences. In some embodiments, the
number of primer sets to a target sequence is not the same as the number of
primer sets to a reference sequence. In
some embodiments, the degree of multiplexing can be less than 500, 250, 200,
150, or 100 primer sets for each
target and reference sequence. The target and reference sequence multiplexes
can be combined into a single reaction
volume.
[00125] The different primer pair amplified sequences can be differentiated
based on spectrally distinguishable
probes (e.g. 2 different dye-labeled probes such as Taqman or Locked Nucleic
Acid Probes (Universal Probe
Library, Roche)). In such approach, all probes are combined into a single
reaction volume and distinguished based
on the differences in the color emitted by each probe. For example, the probes
targeting one polynucleotide (e.g., a
-24-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
test chromosome, chr. 21) may be conjugated to a dye with a first color and
the probes targeting a second
polynucleotide (e.g., a reference chromosome, chr. 1) in the reaction may be
conjugated to a dye of a second color.
The ratio of the colors then reflects the ratio between the test and the
reference chromosome.
[00126] In some cases a set of probes (e.g., a set of probes targeting a test
chromosome, e.g., Chromosome 21),
may target different regions of a target polynucleotide, yet each probe within
the set has the same universal primer
binding sites. In some cases, each probe has the same probe-binding site. In
some cases, two or more probes in the
reaction may have different probe-binding sites. In some cases, the probes
added to such reactions are conjugated
to the identical signal agent (e.g., fluorophore of same color). In some
cases, different signal agents (e.g., two
different colors) are conjugated to one or more probes.
[00127] Alternatively the set of reaction volumes (e.g. droplets) can be split
into two sample sets, with
amplification of target sequence in one set and reference sequence in the
other set. The target and reference genes
are then measured independently of each other. This would allow the use of a
single fluorescence probe such as
SYBR Green. In some instances, this requires splitting the sample and
potentially doubling the number of primers
in each multiplex set to achieve an equivalent sensitivity. In some cases, the
sample is split and a plurality of
ligation probes to a test chromosome is added to one half of the sample, and a
plurality of ligation probes to a
reference chromosome is added to the second half of the sample. In such
examples, the ligation probes may then be
hybridized to a universal probe conjugated to the same signaling agent (e.g.,
fluorophore of the same color
spectrum).
[00128] The multiplexing provided by the instant disclosure can also be
accomplished using a probe for a target,
instead of using a primer pair, at an early step. An example of a probe that
can be used is a linear oligonucleotide
with two ends specifically designed to hybridize to adjacent, or neighboring,
sequences within a target
polynucleotide. A non-limiting example of such a probe is a padlock probe,
which is a linear oligonucleotide with
two ends specifically designed to hybridize to adjacent target sequences. Once
hybridized, the two ends can be
joined by ligation and the padlock probe becomes circularized. Padlock probes
are disclosed in, e.g., Lizardi et al.
(1998) Nat Genetics 19:225-232; U.S. patent 5,871,921; 6,235,472; and
5,866,337. In some cases, the probe (e.g.,
oligonucleotide) binds to adjacent sequences of genomic DNA and the ends can
then be directly ligated via a ligase
reaction. In other cases, there is a gap of one or more bases between the two
ends. In such cases, an extension, or
gap fill, reaction can be performed. For the gap fill reaction, any known
method in the art will suffice. For
example, a mix of nucleotides (dATP, dCTP, dGTP, dTTP, dUTP) can be added to a
reaction mix, as well as a
polymerase, ligase and other reaction components and incubating at about 60 C
for about 10 minutes, followed by
incubation at 37 C for about 1 minute. Following binding to a target
polynucleotide, and ligation, a ligation probe
(e.g., molecular inversion probe, padlock probe, etc.) may become
circularized.
[00129] In some cases, the probe is an oligonucleotide probe that binds to a
genetic target, as described herein. In
other cases, the probe is an oligonucleotide probe that binds to a reference
target. An example of a reference target
is Chromosome 1, or other Chromosome unlikely to be associated with fetal
aneuploidy. In some cases, the
oligonucleotide or reference oligonucleotide comprises a site cleavable by an
enzyme. For example, the
oligonucleotide may be a DNA oligonucleotide that comprises a series of one or
more uracil residues, e.g., at least
1, 2, 3, 4, 5, 6, 7, 10, 15, or 20 uracil residues, and may be cleavable by an
enzyme such as uracil-N-glycosylase
(UNG). In other cases, the oligonucleotide may comprise one or more
restriction sites. The oligonucleotide may
comprise one or more of the same restriction sites, or one or more different
restriction sites. Examples of restriction
-25-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
sites are well known in the literature. In general, a site cleavable by a
restriction enzyme may be used. The
restriction enzymes may be any restriction enzyme (or endonuclease) that can
cut at a specific site. In some cases,
the restriction enzymes are blunt cutters; in others, the restriction enzymes
cut at an asymmetrical site to create an
overhang. Non-limiting examples of restriction enzymes are provided herein.
[00130] The oligonucleotide probe may further comprise sites that hybridize to
forward and reverse primers, e.g.,
universal primers. As used herein, universal primers include one or more pairs
of 5' and 3' primers that recognize
and hybridize to sequences flanking a region to be amplified. The region to be
amplified may be within a genetic
target such as a suspected fetal aneuploid chromosome, with non-limiting
examples of such chromosomes including
chromosome 21, chromosome 13, chromosome 18, and the X chromosome. In some
cases, the region to be
amplified is within a genetic target of a presumed diploid chromosome.
[00131] In some cases, the region to be amplified is not within a genetic
target, but within a probe to a genetic
target, such as a molecular inversion probe. Primer pairs may be directed to a
genetic target, or they may be
universal primers that recognize sequences flanking a multitude of
amplification targets. For example, probes to a
genetic target may comprise one or more segments that recognize and bind to a
specific sequence in a genetic
target, and the probes may additionally comprise a universal sequence common
to all of a set of probes. A single
pair of universal primers may therefore be employed to amplify any probes
within such a set. In some cases, the
universal pair of primers only produces a detectable PCR product when the
molecular inversion probe has been
inverted. Inversion of a molecular inversion probe can be induced by cleavage
of a site within a circular molecular
inversion probe that results in an inverse orientation of a primer with
respect to its primer pair. In some cases, a
universal pair of primers only produces a detectable PCR product when
amplifying the product of a ligation
reaction, such as in a ligation detection reaction.
[00132] The oligonucleotide probe may also comprise a sequence that is
complementary to a probe attached to a
marker, such as a dye or fluorescent dye (e.g., TaqMan probe). In some cases,
the TaqMan probe is bound to one
type of dye (e.g., FAM, VIC, TAMRA, ROX). In other cases, there are more than
one TaqMan probe sites on the
oligonucleotide, with each site capable of binding to a different TaqMan probe
(e.g., a TaqMan probe with a
different type of dye). There may also be multiple TaqMan probe sites with the
same sequence of the
oligonucleotide probe described herein. Often, the TaqMan probe may bind only
to a site on the oligonucleotide
probe described herein, and not to genomic DNA, but in some cases a TaqMan
probe may bind genomic DNA.
[00133] The advantage of using the oligonucleotide probes described herein is
that the signal-to-background noise
is improved greater than 1-, 2-, 5-, 10-, 15-, 20-, 30-, 40-, 50-, 75-, or 100-
fold over using conventional PCR
techniques such as techniques that use a primer set. One reason is that,
potentially, only one probe is needed for all
the oligonucleotide probes to a specific target, e.g., a chromosome. For
example, there may be a large number of
oligonucleotide probes (e.g., greater than 50), wherein each binds to a
separate site on a chromosome, but wherein
each also comprisese a TaqMan site that is universal or the same, and
therefore will fluoresce at the same
wavelength when a TaqMan probe bound to a specific fluorescent dye is annealed
to the probe.
[00134] The methods provided herein include methods with the following steps:
a denaturation and annealing step
in order to permit hybridization of one or more oligonucleotide probes with
genomic DNA. An optional gap fill
reaction, if the 5' and 3' ends of the probes do not target directly adjacent
sequences of genomic DNA, followed by
a ligase reaction to circularize the probe. The method may further comprise an
exonuclease treatment step wherein
the sample is treated with exonuclease enzymes, e.g., exonuclease I and/or
III, that digest linear probes (in other
-26-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
words, probes that did not successfully hybridize) as well as ssDNA and dsDNA
(e.g., genomic DNA), followed by
an inversion step. The method may further comprise an amplification step
wherein PCR reagents are added to the
samples, e.g., Taq polymerase, universal primers, fluorescence probes (e.g.,
TaqMan probe), and other PCR
reaction components, in order to amplify one or more sites on the
oligonucleotide probe. The method may further
comprise a partitioning step, wherein the sample is emulsified into
monodisperse water-in-oil droplets, e.g., greater
than 1,000, 10,000, 20,000, 50,000, 100,000, 200,000, 500,000 or more water-in-
oil droplets (also referred to as
reaction volumes, herein), followed by thermal cycling, and detecting the
fluorescence of each droplet at a
wavelength corresponding to the fluorescent probes that were used. In some
cases, on average, about 1, 2, 3, 4, or 5
copies of DNA are present in each droplet. In some cases, an average of about
.001, .005, .01, .05, .1, .5, 1, 2, 3, 4,
or 5 oligonucleotide probes are present in each droplet. The methods described
herein may function at high
multiplex depths. When a high multiplex depth is coupled with ddPCR counting
it can provide a large number of
target counts to enable high resolution for relative chromosome dosage. This
multiplex approach may be coupled
with ddPCR fetal load quantification using paternally inherited SNPs, Y
chromosome targets or fetal- specific
methylation markers, to protect against false negatives. The fetal load
measurement may be performed separately on
an aliquot of the extracted sample, or may be conducted after the inversion
step of the assay by multiplexing the two
orthogonal assays (universal MIP PCR+fetal specific quantitation assay).
[00135] In some cases, ligation is coupled with universal PCR methods in order
to achieve multiplexing. Examples
include but are not limited to: a Molecular Inversion Probe (MIP) strategy
(see Hardenbol et al., (2003) Nature
Biotechnology, 21(6): 673-78);U.S. Patent Application Pubication No.
2004/0101835; Multiplex Ligation-
dependent Probe Amplification (MLPA) (see Schouten JP, McElgunn CJ, Waaijer R,
Zwijnenburg D, Diepvens F,
Pals G (2002), Nucleic Acids Res. 30 (12); Ligation Detection Reaction (LDR);
and Ligase Chain Reaction. The
Figures of the instant specification provide a summary of different multiplex
strategies using different types of
probes or probe/primer combinations.
[00136] FIG. 5 shows multiplexing of the MIP approach to increase sensitivity
of detection of genetic targets. A
MIP recognizing a particular genetic target (MIP1-1) can be combined with a
second MIP recognizing a different
portion of the same genetic target (MIP1-2). This process can be repeated,
generating many MIPs (MIP1-50
shown) to recognize the same genetic target. Similarly, a collection of MIPs
can be generated to recognize a second
genetic target (MIP2-50). These MIPs can be employed in analysis such as that
depicted in Figure 3, to compare
two genetic targets.
[00137] The ligation, padlock or other oligonucleotide probe described herein
may be mixed with genomic DNA.
In some cases, a plurality of oligonucleotide probes are used, comprisomg
greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
15, 20, 25, 30, 35, 40, 45, 50, 100, 200, 500, 1000, 5000, or 10,000
oligonucleotide probes to a specific site on a
chromosome or different chromosomes.
[00138] FIG. 8 depicts the use of multiplexed oligonucleotides for LDR-PCR in
droplets to enhance sensitivity of
this approach to detect genetic targets in droplets. As described in FIG. 7, a
single pair of linear oligonucleotides
(LDR1-1) is designed to recognize neighboring regions of a genetic target. A
different pair (LDR2- 1) recognizes a
second genetic target. Multiple pairs of oligonucleotides (LDR1-50 and LDR2-
50) maybe designed to recognize
different portions of a genetic target. These pairs of oligonucleotides bind a
portion of the genetic target and
undergo ligation as described in FIG. 7. Two different colors are used to
detect the two different genetic targets
depicted. For example, half the LDR probes may recognize a target sequence
such as a suspected aneuploid
-27-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
chromosome, while the other half recognize a reference sequence such as a
presumed diploid chromosome,
allowing detection of aneuploidy with improved sensitivity.
[00139] In some embodiments, a target and reference sequence can be pre-
amplified prior to analysis using digital
droplet detection. Methods of amplification are known in the art, and include
a self-sustained sequence reaction,
ligase chain reaction, rapid amplification of cDNA ends, polymerase chain
reaction and ligase chain reaction, Q-
beta phage amplification, strand displacement amplification, isothermal
amplification or splice overlap extension
polymerase chain reaction. The pre-amplification product can then be used in
the methods described in the present
invention.
Genetic Targets
[00140] In some embodiments, extracted DNA or RNA may be processed to select,
tag, capture and/or isolate
target sequence polynucleotides, which may particularly include genetic
targets described herein. In some cases,
capture and isolation involves physical separation of target sequences from
bulk genetic material, and removal of
unwanted genetic material. In some cases, physical separation may be achieved
by hybridizing desired sequences
to complementary sequences immobilized on a solid structure such as a polymer
surface, polymer beads, magnetic
beads, or surface of a microfluidic channel. In other cases, physical
separation is achieved by affinity methods,
such as capturing a desired sequence using a probe of complementary sequence
conjugated with an affinity tag,
non-limiting examples of affinity interactions including streptavidin-biotin,
antibody-antigen, enzyme-substrate,
receptor-ligand, and protein-small molecule interactions having a binding
affinity of greater than micromolar,
nanomolar, picomolar, femtomolar, or greater than femtomolar strength.
Following capture, desired sequences may
in some cases be isolated from bulk genetic material using wash methods that
are well-known in the arts, including
washing with buffered saline solutions comprising mild ionic or non-ionic
detergents, protease inhibitors, and
DNase inhibitors. In some embodiments, the droplets described herein do not
comprise beads , polymer beads, or
magnetic beads.
[00141] The targets for the assays and probes described herein can be any
genetic target associated with fetal
genetic abnormalities, including aneuploidy as well as other genetic
variations, such as mutations, insertions,
additions, deletions, translocation, point mutation, trinucleotide repeat
disorders and/or single nucleotide
polymorphisms (SNPs), as well as control targets not associated with fetal
genetic abnormalities. Other assays
unrelated to fetal aneuploidy are also described herein.
[00142] Often the methods and compositions described herein can enable
detection of extra or missing
chromosomes, particularly those typically associated with birth defects or
miscarriage. For example, the methods
and compositions described herein enable detection of autosomal trisomies
(e.g., Trisomy 13, 15, 16, 18, 21, or 22).
In some cases the trisomy may be associated with an increased chance of
miscarriage (e.g., Trisomy 15, 16, or 22).
In other cases, the trisomy that is detected is a liveborn trisomy that may
indicate that an infant will be born with
birth defects (e.g., Trisomy 13 (Patau Syndrome), Trisomy 18 (Edwards
Syndrome), and Trisomy 21 (Down
Syndrome)). The abnormality may also be of a sex chromosome (e.g., XXY
(Klinefelter's Syndrome), XYY
(Jacobs Syndrome), or XXX (Trisomy X). In certain preferred embodiments, the
genetic target is one or more
targets on one or more of the following chromosomes: 13, 18, 21, X or Y. For
example, the genetic target may be
50 sites on chromosome 21 and/or 50 sites on chromosome 18, and/or 50 sites on
chromosome 13.
-28-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[00143] Further fetal conditions that can be determined based on the methods
and systems herein include
monosomy of one or more chromosomes (X chromosome monosomy, also known as
Turner's syndrome), trisomy
of one or more chromosomes (13, 18, 21, and X), tetrasomy and pentasomy of one
or more chromosomes (which in
humans is most commonly observed in the sex chromosomes, e.g. XXXX, XXYY,
XXXY, XYYY, XXXXX,
XXXXY, XXXYY, XYYYY and XXYYY), monoploidy, triploidy (three of every
chromosome, e.g. 69
chromosomes in humans), tetraploidy (four of every chromosome, e.g. 92
chromosomes in humans), pentaploidy
and multiploidy.
[00144] In some cases, the genetic target comprises more than 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,
18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,4
4,45,46,47,48,
49, 50, 75, 100, 125, 150, 175, 200, 225, 250, 300, 350, 400, 450, 500, 1,000,
5,000, 10,000, 20,000, 30,000,
40,000, 50,000, 60,000, 70,000, 80,000, 90,000 or 100,000 sites on a specific
chromosome. In some cases, the
genetic target comprises targets on more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or
22 different chromosomes. In some cases the genetic target comprises targets
on less than 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 chromosomes. In some
cases, the genetic target comprises a
gene that is known to be mutated in an inherited genetic disorder, including
autosomal dominant and recessive
disorders, and sex-linked dominant and recessive disorders. Non-limiting
examples include genetic mutations that
give rise to autoimmune diseases, neurodegenerative diseases, cancers, and
metabolic disorders. In some
embodiments, the method detects the presence of a genetic target associated
with a genetic abnormality (such as
trisomy), by comparing it in reference to a genetic target not associated with
a genetic abnormality (such as a gene
located on a normal diploid chromosome).
[00145] The methods or compositions herein may also comprise primer sets
and/or probes targeting separate
regions of a chromosome. For example, a plurality of probes (e.g.., MIP
probes, ligation probes) may include at
least one first probe that targets a first specific region of a chromosome and
at least one second probe that targets a
second specific region of a chromosome. In some cases, the first probe is
tagged with a signaling molecule or
agent (e.g., fluorophore), and the second probe is tagged with a second
signaling molecule (e.g., a fluorophore of a
color/wavelength distinguishable from that of the fluorophore conjugated to
the first probe). The plurality of probes
can then bind to the target polynucleotide. Following a selection protocol
(e.g., ligation, circularization followed by
exonuclease, etc.), the selected probes are partitioned into multiple
partitions (e.g., droplets) followed by analysis of
the number of partitions (e.g., droplets) containing a selected probe. The
ratio between the number of first probes
and the number of second probes may then be used to evaluate whether a target
polynucleotide contains partial
deletions, translocations, or amplifications. For example, such method may be
used to detect a partial deletion of a
chromosome, where probe 1 is directed to the intact chromosome and probe 2 is
directed to a sequence within the
deleted portion of the chromosome. In some embodiments, greater than 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, or 20 probes directed to different targets may be used. In
some cases , this number may be
greater than 20, 30, 40, 50, 100, 500, 1000, 5000, 10000, 50000, 100000,
500000, 1000000, or more.
[00146] In a nonlimiting example, a ligation probe (or primer set) targets the
q arm of chromosome 21 and a
second ligation probe (or primer set) targets the p arm. If both are giving
answers that are reasonably close (e.g.,
within some pre-defined confidence interval) to each other, this may provide
validation of the measurement of
chromosome 21 concentration. If, on the other hand, the measurement made with
the targets on the p arm is
-29-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
significantly different from the measurement made with those on the q arm,
this may indicate a partial aneuploidy
(fragment of a chromosome), or may indicate that the assay requires further
optimization or validation.
[00147] The actual measurement of the target sets can be performed
simultaneously by using one color for 21q
targets and another color for 21p targets. Alternatively, the sample may be
split so that the 21q measurements are
made in one portion and the 21p measurement in the other. Also, chromosomes
can be partitioned into more than
two primer sets (or oligonucleotide probes) to have a more fine-grained
assessment of the chromosomal copy
number.
[00148] The term polynucleotide refers to any nucleic acid molecule containing
more than one nucleotide, and can
include, but is not limited to lengths of 2, 3, 5, 10, 20, 30, 50, 100, 200,
300, 400, 500, or 900 nucleotides, or 1, 2, 3,
5, 10, 20, 30, 50, 100, 200, 300, 400, 500, or 900 kilobases, or 1, 2, 3, 5,
10, 20, 30, 50, 100, 200, 300, 400, 500, or
900 megabases. A polynucleotide may also refer to the coding region of a gene,
or non-coding regions of DNA, or a
whole chromosome.
[00149] As used herein, an allele is one of several alternate forms of a gene
or non-coding regions of DNA that
occupy the same position on a chromosome. The term allele can be used to
describe DNA from any organism
including but not limited to bacteria, viruses, fungi, protozoa, molds,
yeasts, plants, humans, non-humans, animals,
and archeabacteria. For example, bacteria typically have one large strand of
DNA. The term allele with respect to
bacterial DNA refers to the form of a gene found in one cell as compared to
the form of the same gene in a different
bacterial cell of the same species.
[00150] Alternate forms of a gene (e.g., alleles) may include one or more
single nucleotide polymorphisms (SNPs)
in which a single nucleotide varies between alternate forms. Alternate forms
of a gene or noncoding region may
encompass short tandem repeats (STR), adjacent repeated patterns of two or
more nucleotides.
[00151] Alleles can have the identical sequence or can vary by a single
nucleotide or more than one nucleotide.
With regard to organisms that have two copies of each chromosome, if both
chromosomes have the same allele, the
condition is referred to as homozygous. If the alleles at the two chromosomes
are different, the condition is referred
to as heterozygous.
[00152] Examples of diseases where the target sequence exist in one copy in
the maternal DNA (heterozygous)
disease in a fetus (homozygous), include sickle cell cystic fibrosis,
hemophilia, and Tay Sachs disease.
Accordingly, using the methods described here, one may distinguish genomes
with one specific mutation at a
certain site from genomes with two specific mutations at a certain site.
[00153] Sickle-cell anemia is an autosomal recessive disease. Nine-percent of
US blacks are heterozygous, while
0.2% are homozygous recessive. The recessive allele causes amino acid
substitution in the beta chains of
hemoglobin.
[00154] Tay-Sachs Disease is an autosomal recessive resulting degeneration of
the nervous system. Symptoms
manifest after birth. Children homozygous recessive for this allele rarely
survive past five years of age. Sufferers
lack the ability to make the enzyme N-acetyl-hexosaminidase, which breaks down
the GM2 ganglioside lipid.
[00155] Another example is phenylketonuria (PKU), a recessively inherited
disorder whose sufferers lack the
ability to synthesize an enzyme to convert the amino acid phenylalanine into
tyrosine. Individuals homozygous
recessive for this allele have a buildup of phenylalanine and abnormal
breakdown products in the urine and blood.
[00156] Hemophilia is a group of diseases in which blood does not clot
normally. Factors in blood are involved in
clotting. Hemophiliacs lacking the normal Factor VIII are said to have
Hemophilia A, and those who lack Factor IX
-30-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
have hemophilia B. These genes are carried on the X chromosome, so primers and
probes may be used in the
present method to detect whether or not a fetus inherited the mother's
defective X chromosome, or the father's
normal allele.
[00157] In some cases, the genetic target is a gene, or portion of a gene,
e.g., CFTR, Factor VIII (F8 gene), beta
globin, hemachromatosis, G6PD, neurofibromatosis, GAPDH, beta amyloid, or
pyruvate kinase gene.
[00158] In some embodiments, the genetic target is any sequence whose copy
number variation may be associated
with a disease or disorder. Other diseases arising from genetic abnormalities
include Achondroplasia,
Adrenoleukodystrophy, X-Linked, Agammaglobulinemia, X-Linked, Alagille
Syndrome, Alpha-Thalassemia X-
Linked Mental Retardation Syndrome, Alzheimer Disease, Alzheimer Disease,
Early-Onset Familial, Amyotrophic
Lateral Sclerosis Overview, Androgen Insensitivity Syndrome, Angelman
Syndrome, Ataxia Overview, Hereditary,
Ataxia-Telangiectasia, Becker Muscular Dystrophy also The Dystrophinopathies),
Beckwith-Wiedemann
Syndrome, Beta-Thalassemia, Biotinidase Deficiency, Branchiootorenal Syndrome,
BRCA1 and BRCA2
Hereditary Breast/Ovarian Cancer, Breast Cancer, CADASIL, Canavan Disease,
Cancer, Charcot-Marie-Tooth
Hereditary Neuropathy, Charcot-Marie-Tooth Neuropathy Type 1, Charcot-Marie-
Tooth Neuropathy Type 2,
Charcot-Marie-Tooth Neuropathy Type 4, Charcot-Marie-Tooth Neuropathy Type X,
Cockayne Syndrome, Colon
Cancer, Contractural Arachnodactyly, Congenital, Cranio synostosis Syndromes
(FGFR-Related), Cystic Fibrosis,
Cystinosis,, Deafness and Hereditary Hearing Loss, DRPLA (Dentatorubral-
Pallidoluysian Atrophy), DiGeorge
Syndrome (also 22g1 1 Deletion Syndrome), Dilated Cardiomyopathy, X-Linked,
Down Syndrome (Trisomy 21),
Duchenne Muscular Dystrophy (also The Dystrophinopathies), Dystonia, Early-
Onset Primary (DYT1),
Dystrophinopathies, The, Ehlers-Danlos Syndrome, Kyp ho scoliotic Form, Ehlers-
Danlos Syndrome, Vascular
Type, Epidermolysis Bullosa Simplex, Exostoses, Hereditary Multiple,
Facioscapulohumeral Muscular Dystrophy,
Factor V Leiden Thrombophilia, Familial Adenomatous Polyposis (FAP), Familial
Mediterranean Fever, Fragile X
Syndrome, Friedreich Ataxia, Frontotemporal Dementia with Parkinsonism- 17,
Galactosemia, Gaucher Disease,
Hemochromatosis, Hereditary, Hemophilia A, Hemophilia B, Hemorrhagic
Telangiectasia, Hereditary 55, Hearing
Loss and Deafness, Nonsyndromic, DFNA (Connexin 26), Hearing Loss and
Deafness, Nonsyndromic, DFNB 1
(Connexin 26), Hereditary Spastic Paraplegia, Hermansky-Pudlak Syndrome,
Hexosaminidase A Deficiency (also
Tay-Sachs), Huntington Disease, Hypochondroplasia, Ichthyosis, Congenital,
Autosomal Recessive, Incontinentia
Pigmenti, Kennedy Disease (also Spinal and Bulbar Muscular Atrophy), Krabbe
Disease, Leber Hereditary Optic
Neuropathy, Lesch-Nyhan Syndrome Leukemias, Li-Fraumeni Syndrome, Limb-Girdle
Muscular Dystrophy,
Lipoprotein Lipase Deficiency, Familial, Lissencephaly, Marfan Syndrome, MELAS
(Mitochondrial
Encephalomyopathy, Lactic Acidosis, and, Stroke-Like Episodes), Monosomies,
Multiple Endocrine Neoplasia
Type 2, Multiple Exostoses, Hereditary Muscular Dystrophy, Congenital,
Myotonic Dystrophy, Nephrogenic
Diabetes Insipidus, Neurofibromatosis 1, Neurofibromatosis 2,, Neuropathy with
Liability to Pressure Palsies,
Hereditary, Niemann-Pick Disease Type C, Nijmegen Breakage Syndrome Norrie
Disease, Oculocutaneous
Albinism Type 1, Oculopharyngeal Muscular Dystrophy, Ovarian Cancer, Pallister-
Hall Syndrome, Parkin Type of
Juvenile Parkinson Disease, Pelizaeus-Merzbacher Disease, Pendred Syndrome,
Peutz-Jeghers Syndrome
Phenylalanine Hydroxylase Deficiency, Prader-Willi Syndrome, PROP 1-Related
Combined Pituitary Hormone
Deficiency (CPHD), Prostate Cancer, Retinitis Pigmentosa, Retinoblastoma,
Rothmund-Thorns on Syndrome,
Smith-Lemli-Opitz Syndrome, Spastic Paraplegia, Hereditary, Spinal and Bulbar
Muscular Atrophy (also Kennedy
Disease), Spinal Muscular Atrophy, Spinocerebellar Ataxia Type 1,
Spinocerebellar Ataxia Type 2, Spinocerebellar
-31-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
Ataxia Type 3, Spinocerebellar Ataxia Type 6, Spinocerebellar Ataxia Type 7,
Stickler Syndrome (Hereditary
Arthroophthalmopathy), Tay-Sachs (also GM2 Gangliosidoses), Trisomies,
Tuberous Sclerosis Complex, Usher
Syndrome Type I, Usher Syndrome Type II, Velocardiofacial Syndrome (also 22g1
1 Deletion Syndrome), Von
Hippel-Lindau Syndrome, Williams Syndrome, Wilson Disease, X-Linked Adreno
leukodystrophy, X-Linked
Agammaglobulinemia, X-Linked Dilated Cardiomyopathy (also The
Dystrophinopathies), and X-Linked Hypotonic
Facies Mental Retardation Syndrome.
Droplet Generation
[00159] The present disclosure includes compositions and methods for the
detection of fetal genetic material using
droplet digital PCR. The droplets described herein include emulsion
compositions (or mixtures of two or more
immiscible fluids) described in US Patent No. 7,622,280, and droplets
generated by devices described in
International Application No. PCT/US2009/005317, filed 9-23-2009, first
inventor: Colston. The term emulsion, as
used herein, refers to a mixture of immiscible liquids (such as oil and
water). Oil-phase and/or water-in-oil
emulsions allow for the compartmentalization of reaction mixtures within
aqueous droplets. In preferred
embodiments, the emulsions comprise aqueous droplets within a continuous oil
phase. In other cases, the emulsions
provided herein are oil-in-water emulsions, wherein the droplets are oil
droplets within a continuous aqueous phase.
The droplets provided herein are designed to prevent mixing between
compartments, with each compartment
protecting its contents from evaporation and coalescing with the contents of
other compartments.
[00160] The mixtures or emulsions described herein may be stable or unstable.
In preferred embodiments, the
emulsions are relatively stable and have minimal coalescence. Coalescence
occurs when small droplets combine to
form progressively larger ones. In some cases, less than
.00001%,.00005%,.00010%,.00050%,.001%,,.005%,
.01%, .05%, .1%, .5%, 1%, 2%. 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 6%, 7%, 8%, 9%, or
10% of droplets generated
from a droplet generator coalesce with other droplets. The emulsions may also
have limited flocculation, a process
by which the dispersed phase comes out of suspension in flakes.
[00161] Splitting a sample into small reaction volumes as described herein,
may enable the use of reduced amounts
of reagents, thereby lowering the material cost of the analysis. Reducing
sample complexity by partitioning also
improves the dynamic range of detection, since higher-abundance molecules are
separated from low-abundance
molecules in different compartments, thereby allowing lower-abundance
molecules greater proportional access to
reaction reagents, which in turn enhances the detection of lower-abundance
molecules.
[00162] In some cases, droplets may be generated having an average diameter of
about .001, .01, .05, .1, 1, 5, 10,
20, 30, 40, 50, 60, 70, 80, 100, 120, 130, 140, 150, 160, 180, 200, 300, 400,
or 500 microns. Microfluidic methods
of producing emulsion droplets using microchannel cross-flow focusing or
physical agitation are known to produce
either monodisperse or polydisperse emulsions. In some embodiments, the
droplets are monodisperse droplets. In
some cases, the droplets are generated such that the size of said droplets
does not vary by more than plus or minus
5% of the average size of said droplets. In some cases, the droplets are
generated such that the size of said droplets
does not vary by more than plus or minus 2% of the average size of said
droplets. In some cases, a droplet generator
will generate a population of droplets from a single sample, wherein none of
the droplets vary in size by more than
plus or minus .1%, .5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%,
6.5%, 7%, 7.5%, 8%, 8.5%,
9%, 9.5%, or 10% of the average size of the total population of droplets.
-32-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[00163] Higher mechanical stability is useful for microfluidic manipulations
and higher-shear fluidic processing
(e.g. in microfluidic capillaries or through 90 degree turns, such as valves,
in fluidic path). Pre- and post- thermally
treated droplets or capsules are mechanically stable to standard pipet
manipulations and centrifugation.
[00164] In some cases, the droplet is formed by flowing an oil phase through
an aqueous sample. In some
preferred embodiments, the aqueous phase comprises a buffered solution and
reagents for performing a PCR
reaction, including nucleotides, primers, probe(s) for fluorescent detection,
template nucleic acids, DNA
polymerase enzyme, and optionally, reverse transcriptase enzyme.
[00165] In some cases, the aqueous phase comprises a buffered solution and
reagents for performing a PCR
reaction without solid-state beads, such as magnetic-beads. In some cases, the
buffered solution may comprise
about 1, 5, 10, 15, 20, 30, 50, 100, or 200 mM Tris. In some cases, the
concentration of potassium chloride may be
about 10, 20, 30, 40, 50, 60, 80, 100, 200 mM. In one preferred embodiment,
the buffered solution comprises 15
mM Tris and 50 mM KC1. In some cases, the nucleotides comprise
deoxyribonucleotide triphosphate molecules,
including dATP, dCTP, dGTP, dTTP, in concentrations of about 50, 100, 200,
300, 400, 500, 600, or 700 M each.
In some cases dUTP is added within the aqueous phase to a concentration of
about 50, 100, 200, 300, 400, 500, 600,
or 700, 800, 900, or 1000 M. In some cases, magnesium chloride (MgC12) is
added to the aqueous phase at a
concentration of about 1.0, 2.0, 3.0, 4.0, or 5.0 mM. In one preferred
embodiment, the concentration of MgC12 is
3.2mM.
[00166] A non-specific blocking agent such as BSA or gelatin from bovine skin
may be used, wherein the gelatin
or BSA is present in a concentration range of approximately 0.1-0.9% w/v.
Other possible blocking agents may
include betalactoglobulin, casein, dry milk, or other common blocking agents.
In some cases, preferred
concentrations of BSA and gelatin are 0.1% w/v.
[00167] Primers for amplification within the aqueous phase may have a
concentration of about 0.1, 0.2, 0.3, 0.4,
0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 M. In one preferred embodiment, the
concentration of primers is 0.5 M. In some
cases, the aqueous phase comprises one or more probes for fluorescent
detection, at a concentration of about 0.1,
0.2, 0.3, 0.4, or 0.5 M. In one preferred embodiment, the concentration of
probes for fluorescent detection is 0.25
M. Amenable ranges for target nucleic acid concentrations in PCR are between
about 1 pg and about 500 ng.
[00168] In some embodiments, the aqueous phase may also comprise additives
including, but not limited to, non-
specific background/blocking nucleic acids (e.g., salmon sperm DNA),
biopreservatives (e.g. sodium azide), PCR
enhancers (e.g. Betaine, Trehalose, etc.), and inhibitors (e.g. RNAse
inhibitors).
[00169] In some cases, a non-ionic Ethylene Oxide/Propylene Oxide block
copolymer is added to the aqueous
phase in a concentration of about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%,
0.8%, 0.9%, or 1.0%. Common
biosurfactants include non-ionic surfactants such as Pluronic F-68, Tetronics,
Zonyl FSN. In one preferred
embodiment, Pluronic F-68 is present at a concentration of 0.5% w/v.
[00170] In some cases magnesium sulfate may be substituted for magnesium
chloride, at similar concentrations. A
wide range of common, commercial PCR buffers from varied vendors may be
substituted for the buffered solution.
[00171] The oil phase may comprise a fluorinated base oil which may be
additionally stabilized by combination
with a fluorinated surfactant such as a perfluorinated polyether. In some
cases, the base oil may be one or more of
HFE 7500, FC-40, FC-43, FC-70, or another common fluorinated oil. In some
cases, the anionic surfactant is
Ammonium Krytox (Krytox-AM), the ammonium salt of Krytox FSH, or morpholino
derivative of Krytox-FSH.
Krytox-AS may be present at a concentration of about 0.1%, 0.2%, 0.3%, 0.4%,
0.5%, 0.6%, 0.7%, 0.8%, 0.9%,
-33-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
1.0%, 2.0%, 3.0%, or 4.0% w/w. In some preferred embodiments, the
concentration of Krytox-AS is 1.8%. In other
preferred embodiments, the concentration of Krytox-AS is 1.62%. Morpholino
derivative of Krytox-FSH may be
present at a concentration of about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%,
0.8%, 0.9%, 1.0%, 2.0%, 3.0%, or
4.0% w/w. In some preferred embodiments, the concentration of morpholino
derivative of Krytox-FSH is 1.8%. In
some preferred embodiments, the concentration of morpholino derivative of
Krytox-FSH is 1.62%.
[00172] The oil phase may further comprise an additive for tuning the oil
properties, such as vapor pressure or
viscosity or surface tension. Nonlimiting examples include perfluoro-octanol
and 1H,1H,2H,2H-Perfluorodecanol.
In some preferred embodiments, 1H,1H,2H,2H-Perfluorodecanol is added to a
concentration of about 0.05%,
0.06%, 0.07%, 0.08%, 0.09%, 1.00%, 1.25%, 1.50%, 1.75%, 2.00%, 2.25%, 2.50%,
2.75%, or 3.00% w/w. In some
preferred embodiments, 1H,1H,2H,2H-Perfluorodecanol is added to a
concentration of 0.18% w/w.
[00173] In some embodiments, the emulsion is formulated to produce highly
monodisperse droplets having a
liquid-like interfacial film that can be converted by heating into
microcapsules having a solid-like interfacial film;
such microcapsules may behave as bioreactors able to retain their contents
through a reaction process such as PCR
ampflication. The conversion to microcapsule form may occur upon heating. For
example, such conversion may
occur at a temperature of greater than about 50, 60, 70, 80, 90, or 95 degrees
Celsius. In some cases this heating
occurs using a thermocycler. During the heating process, a fluid or mineral
oil overlay may be used to prevent
evaporation. Excess continuous phase oil may or may not be removed prior to
heating. The biocompatible capsules
may be resistant to coalescence and/or flocculation across a wide range of
thermal and mechanical processing.
[00174] Following conversion, the capsules maybe stored at about 3, 4, 5, 6,
7, 8, 9, 10, 15, 20, 25, 30, 35, or 40
degrees, with one preferred embodiment comprising storage of capsules at less
than about 25 degrees. In some
embodiments, these capsules are useful in biomedical applications, such as
stable, digitized encapsulation of
macromolecules, particularly aqueous biological fluids containing a mix of
nucleic acids or protein, or both
together; drug and vaccine delivery; biomolecular libraries; clinical imaging
applications, and others.
[00175] The microcapsules may contain one or more nucleic acid probes (e.g.,
molecular inversion probe, ligation
probe, etc.) and may resist coalescence, particularly at high temperatures.
Accordingly, PCR amplification
reactions may occur at a very high density (e.g., number of reactions per unit
volume). In some cases, greater than
100,000, 500,000, 1,000,000, 1,500,000, 2,000,000, 2,500,000, 5,000,000, or
10,000,000 separate reactions may
occur per ml. In some cases, the reactions occur in a single well, e.g.., a
well of a microliter plate, without inter-
mixing between reaction volumes. The microcapsules may also contain other
components necessary to enable a
PCR reaction to occur, e.g., primers, probes, dNTPs, DNA or RNA polymerases,
etc. These capsules exhibit
resistance to coalescence and flocculation across a wide range of thermal and
mechanical processing.
Role of Devices
[00176] A variety of devices may be used to effectuate the methods described
herein. FIG. 3 depicts a workflow of
an exemplary method for diagnosing fetal aneuploidy and highlights some
devices that may be used in the methods
herein. A maternal tissue sample containing maternal and fetal genetic
material (201) is obtained. DNA is extracted
from the sample, and bound to probes recognizing chromosome 1 (202) and 21
(203), which then undergo a ligation
reaction. A sample comprising ligated probes (as well as components necessary
for a PCR reaction) is introduced
into a droplet generator (301), which partitions the probes into multiple
droplets within a water-in-oil emulsion.
Examples of some droplet generators useful in the present disclosure are
provided in International Application No.
-34-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
PCT/US2009/005317, filed 9-23-2009, first inventor: Colston. Droplets are then
incubated in a thermocycler (302)
to allow amplification of the probes. During the amplification reaction, a
droplet comprising an amplified probe
experiences an increase in fluorescence relative to droplets that do not
contain amplified probe. The droplets are
then processed individually through a droplet reader (303), and data is
collected to detect fluorescence. Examples
of some droplet readers useful in the present disclosure are provided in
International Application No.
PCT/US2009/005317, filed 9-23-2009, first inventor: Colston.
[00177] As depicted in FIG. 3, data relating to the copy number of chromosome
1 and 21 is then compared in order
to detect fetal aneuploidy. Often, the data is analyzed using an algorithm
applied by a device such as a computer. In
some cases, the droplet generator, thermocycler, droplet reader, and computer
are each a separate device. In other
cases, one device comprises two or more of such devices, in any combination.
For example, one device may
comprise a droplet generator in communication with a thermocycler. In other
cases, a device may comprise a
droplet generator, thermocycler, and droplet reader.
[00178] The present disclosure provides means for rapid, efficient and
sensitive detection of copy number and/or
detection of copy number variations (e.g., fetal aneuploidy). The present
disclosure is particularly useful for
identifying changes in copy number of polynucleotides present in rare amounts
within a genetic sample (e.g., fetal
polynucleotides within a sample of maternal blood). In some cases, less than
.00001,.00005,.00010,.00050,.001,,
.005, .01, .05, .1, .5, 1, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, or 10 copies
of target polynucleotide are detected. In some
cases, less than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25,
30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90,
95, 100, 150, 200, 250, 300, 350, 400, 450, or 500 copies of a target
polynucleotide are detected.. In some cases,
the droplets described herein are generated at a rate of greater than 1, 2, 3,
4, 5, 10, 50, 100, 200, 300, 400, 500,
600, 700, 800, 900, or 1000 droplets/second.
Amplification
[00179] Techniques for amplification of target and reference sequences (as
well as sequences within ligation
probes) are known in the art, and include the methods described in US Patent
No. 7,048,481. Briefly, the
techniques include methods and compositions that separate samples into small
droplets, in some instances with each
containing on average less than one nucleic acid molecule per droplet,
amplifying the nucleic acid sequence in each
droplet and detecting the presence of a particular target sequence. In some
cases, the sequence that is amplified is
present on a probe to the genomic DNA, rather than the genomic DNA itself.
[00180] Primers are designed according to known parameters for avoiding
secondary structures and self-
hybridization. In some embodiments, different primer pairs will anneal and
melt at about the same temperatures, for
example, within 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 C of another primer pair. In
some cases, only ligatable probes, and no
primers, are initially added to genomic DNA, followed by partitioning the
ligated probes, followed by amplification
of one or more sequences on the probe within each partition using, for
example, universal primers. In some cases,
greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50,
100, 200, 500, 1000, 5000, 10,000 or more
probes are initially used. Such probes may be able to hybridize to the genetic
targets described herein. For
example, a mixture of probes can be used, wherein at least one probe targets a
specific site on a chromosome and a
second probe targets a different site on the same chromosome or a different
chromosome. Each set of ligatable
probes can have its own universal probe set and be distinguished by the
corresponding TaqMan probe for each set.
Or, all ligatable probe sets can use the same universal primer set and be
distinguished by the corresponding TaqMan
-35-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
probe for each set. Exemplary sequences for universal primers bearing no
homology to human genomic DNA
include SEQ ID NOS: 79 and 80 (FIG. 17).
[00181] While the preferred embodiment of the invention is described in terms
of PCR, the invention is primarily
directed to the use of multiple individual genetic sequence detections. In
some embodiments, the method of
amplification can be, for example, a self-sustained sequence reaction, ligase
chain reaction, rapid amplification of
cDNA ends, and polymerase chain reaction, Q-beta phage amplification, strand
displacement amplification,
isothermal amplification or splice overlap extension polymerase chain
reaction.
[00182] Primers can be prepared by a variety of methods including but not
limited to cloning of appropriate
sequences and direct chemical synthesis using methods well known in the art
(Narang et al., Methods Enzymol.
68:90 (1979); Brown et al., Methods Enzymol. 68:109 (1979)). Primers can also
be obtained from commercial
sources such as Operon Technologies, Amersham Pharmacia Biotech, Sigma, and
Life Technologies. The primers
can have an identical melting temperature. The lengths of the primers can be
extended or shortened at the 5' end or
the 3' end to produce primers with desired melting temperatures. In a
preferred embodiment, one of the primers of
the prime pair is longer than the other primer. In a preferred embodiment, the
3' annealing lengths of the primers,
within a primer pair, differ. Also, the annealing position of each primer pair
can be designed such that the sequence
and length of the primer pairs yield the desired melting temperature. The
simplest equation for determining the
melting temperature of primers smaller than 25 base pairs is the Wallace Rule
(Td=2(A+T)+4(G+C)). Computer
programs can also be used to design primers, including but not limited to
Array Designer Software (Arrayit Inc.),
Oligonucleotide Probe Sequence Design Software for Genetic Analysis (Olympus
Optical Co.), NetPrimer, and
DNAsis from Hitachi Software Engineering. The TM (melting or annealing
temperature) of each primer is
calculated using software programs such as Net Primer (free web based program
at http://premierbio soft.
com/netprimer/netprlaunch/netprlaunch.html; internet address as of Apr. 17,
2002). In another embodiment, the
annealing temperature of the primers can be recalculated and increased after
any cycle of amplification, including
but not limited to cycle 1, 2, 3, 4, 5, cycles 6-10, cycles 10-15, cycles 15-
20, cycles 20-25, cycles 25-30, cycles 30-
35, or cycles 35-40. After the initial cycles of amplification, the 5' half of
the primers is incorporated into the
products from each loci of interest, thus the TM can be recalculated based on
both the sequences of the 5' half and
the 3' half of each primer.
[00183] In some preferred embodiments, desired sequences that may include
target and reference sequences are
represented by template MIPs, which are formerly-circularized MIPs that have
been isolated and linearized as
described above. Template MIPs serve as template molecules in PCR. In some
cases, template MIPs are produced
prior to droplet generation, and in other cases, template MIPs are produced
during or following droplet generation.
In an example of the last case, a circular MIP containing abasic sites
resulting from uracil-N-deglycosylase
treatment of uracil bases undergoes a spontaneous ring-opening reaction upon
heating in a melting step of a PCR
reaction in a thermocycler. In some cases, template MIPs serve as DNA
templates for droplet digital PCR, wherein
amplification of the template MIP corresponds to detection of the desired
sequence that the MIP represents (e.g. a
target or reference sequence). In some embodiments, the method involves
producing a droplet for a droplet digital
PCR reaction by flowing an immiscible liquid in a sample fluid, wherein the
sample fluid comprises one or more
MIPs or one or more template MIPs, and a master mix containing reagents
necessary for PCR. In some preferred
embodiments, a master mix for PCR comprises a thermostable polymerase enzyme,
universal primers for template
MIP amplification, free DNA nucleotides for incorporation, and buffer
components for the reaction. The
-36-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
thermostable polymerase enzyme may retain activity when exposed to
temperatures greater than 99, 98, 97, 96, 95,
94, 93, 92, 91, 90, 80, 70 degrees or less. In some cases, the sample fluid
additionally comprises digested genomic
DNA or inactivated enzymes such as endonucleases and/or deglycosylases
retained from MIP template generation.
In some embodiments, the method involves generating droplets comprising less
than one, one, or more than one
genome equivalents of DNA represented by MIPs or MIP templates.
[00184] In some embodiments, desired sequences that may include target and
reference sequences are present as
part of a mixture containing unwanted background genomic DNA. In some cases,
only desired sequences, and not
background genomic DNA sequences, are detected using ligation detection
reaction and droplet digital PCR (e.g., in
cases where only ligation products are competent to form detectable products
in PCR using a master mix
comprising universal primers). In other cases, desired sequences are detected
in droplet digital PCR using
sequence-specific primers.
[00185] In some preferred embodiments, the present disclosure involves
compositions comprising emulsions
comprising an average of about one genome equivalent of DNA that can be used
to detect fetal genetic material. In
some cases, one or more MIPs or MIP templates represent a sequence of interest
(such as a region of chromosome
21) whose detection can enable determination of fetal aneuploidy. In some
cases, a composition containing a
sequence of interest representing a genetic target that may be associated with
a genetic abnormality (such as
trisomy) can be compared to a composition containing a sequence representing a
reference sequence that may not
be associated with a genetic abnormality. In some cases, sensitivity of
detection may be enhanced through
multiplexing of probes directed to a genetic target. Furthermore, multiple
genetic targets may be examined in
parallel using multiple simultaneous detection modes, such as different colors
in the fluorescence detection methods
detailed below.
[00186] In some embodiments, genetic targets may include any nucleic acid
molecules that can be represented by
ligation products such as MIPs, MIP templates, or ligated probes. These
ligation products are present in a sample
fluid in which an immiscible liquid is flowed to generate a droplet. Reagents
necessary for PCR may also be
contained in the droplet, for subsequent droplet digital PCR. Examples of
genetic targets that may be analyzed
herein include genetic variations, such as aneuploidy, mutations, insertions,
additions, deletions, translocation, point
mutation, trinucleotide repeat disorders and/or single nucleotide
polymorphisms (SNPs), that may not be associated
with fetal genetic abnormalities.
[00187] The annealing temperature of the primers can be recalculated and
increased after any cycle of
amplification, including but not limited to cycle 1, 2, 3, 4, 5, cycles 6-10,
cycles 10-15, cycles 15-20, cycles 20-25,
cycles 25-30, cycles 30-35, or cycles 35-40. After the initial cycles of
amplification, the 5' half of the primers is
incorporated into the products from each loci of interest, thus the TM can be
recalculated based on both the
sequences of the 5' half and the 3' half of each primer. Any DNA polymerase
that catalyzes primer extension can be
used including but not limited to E. coli DNA polymerase, Klenow fragment of
E. coli DNA polymerase 1, T7
DNA polymerase, T4 DNA polymerase, Taq polymerase, Pfu DNA polymerase, Vent
DNA polymerase,
bacteriophage 29, REDTagTM. Genomic DNA polymerase, or sequenase. Preferably,
a thermostable DNA
polymerase is used. A hot start PCR can also be performed wherein the reaction
is heated to 95 C. for two minutes
prior to addition of the polymerase or the polymerase can be kept inactive
until the first heating step in cycle 1. Hot
start PCR can be used to minimize nonspecific amplification. Any number of PCR
cycles can be used to amplify the
DNA, including but not limited to 2, 5, 10, 15, 20, 25, 30, 35, 40, or 45
cycles.
-37-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[00188] Amplification of target nucleic acids (e.g., ligation probes, MIP
probes) can be performed by any means
known in the art. In some cases, target nucleic acids are amplified by
polymerase chain reaction (PCR). Examples
of PCR techniques that can be used include, but are not limited to,
quantitative PCR, quantitative fluorescent PCR
(QF-PCR), multiplex fluorescent PCR (MF-PCR), real time PCR(RT-PCR), single
cell PCR, restriction fragment
length polymorphism PCR (PCR-RFLP), PCR-RFLP/RT-PCR-RFLP, hot start PCR,
nested PCR, in situ polonony
PCR, in situ rolling circle amplification (RCA), bridge PCR, picotiter PCR and
emulsion PCR. Other suitable
amplification methods include the ligase chain reaction (LCR), transcription
amplification, self-sustained sequence
replication, selective amplification of target polynucleotide sequences,
consensus sequence primed polymerase
chain reaction (CP-PCR), arbitrarily primed polymerase chain reaction (AP-
PCR), degenerate oligonucleotide-
primed PCR (DOP-PCR) and nucleic acid based sequence amplification (NABSA).
Other amplification methods
that can be used herein include those described in U.S. Pat. Nos. 5,242,794;
5,494,810; 4,988,617; and 6,582,938.
In some embodiments, amplification of target nucleic acids may occur on a
bead. In other embodiments,
amplification does not occur on a bead.
In some cases, thermocycling reactions are performed on samples contained in
droplets. In some preferred cases,
the droplets remain intact during thermocycling. Droplets may remain intact
during thermocycling at densities of
greater than about 10,000 droplets/mL, 100,000droplets/mL, 200,000droplets/mL,
300,000droplets/mL,
400,000droplets/mL, 500,000droplets/mL, 600,000droplets/mL,
700,000droplets/mL, 800,000droplets/mL,
900,000droplets/mL or 1,000,000droplets/mL.In other cases, two or more
droplets may coalesce during
thermocycling. In other cases, greater than 100 or greater than 1,000 droplets
may coalesce during thermocycling.
Detection and Analysis
[00189] Detection of PCR products can be accomplished using fluorescence
techniques. DNA-intercalating dyes
such as ethidium bromide or SYBR green that increases fluorescence upon
binding DNA can provide a quantitative
readout of the amount of DNA present in a reaction volume. As this amount of
DNA increases over the course of a
reaction, the fluorescence intensity increases. Methods involving DNA-
intercalating dyes are susceptible to
background fluorescence since they do not measure DNA in a sequence-specific
manner, and do not distinguish
between reaction products and other molecules such as primer dimers. A method
for detecting PCR products that
provides sequence specificity involves probes that contain a fluorescer-
quencher pair and hybridize to a specific
sequence. The fluorescer may be any molecule emitting detectable light such as
a fluorophore, and the quencher
may be any molecule that absorbs this emission, reducing the intensity of
emission by the fluorescer. When present
in a solution containing a complementary sequence, the fluorescer-quencher
probe binds to the sequence. During a
PCR reaction, a polymerase such as Taq can use this probe as a primer, and the
probe is cleaved by a 5'43'
exonuclease activity that functions in cells to excise RNA primers. In the
case of PCR reactions using synthetic
fluorescer-quencher probes as primers, the 5'43' exonuclease activity causes
the probes to be cleaved, resulting in
separation of the fluorescer from the quencher. Once it is no longer
covalently attached to the quencher, the
fluorescence emission from the fluorescer can be detected.
[00190] A preferred embodiment of the present disclosure involves detecting
droplet digital PCR products
produced using MIP templates. In some cases, detection occurs via cleavage of
a fluorescer-quencher probe that
binds a sequence that is specific to the MIP, distinct from the genetic
target. This strategy allows the use of
universal fluorescer-quencher probes that detect MIPs without requiring
sequence specificity to the genetic target
represented by the MIP.
-38-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[00191] In some embodiments, molecular beacon (MB) probes, which become
fluorescent on binding to the target
sequence(s) may be used. MB probes are oligonucleotides with stem-loop
structures that contain a fluorescer at the
5' end and a quencher at the 3' end. The degree of quenching via fluorescence
energy resonance transfer is inversely
proportional to the 6th power of the distance between the quencher and the
fluorescer. After heating and cooling,
MB probes reform a stem-loop structure, which quenches the fluorescent signal
from the fluorescer. If a PCR
product whose sequence is complementary to the loop sequence is present during
the heating/cooling cycle,
hybridization of the MB to one strand of the PCR product will increase the
distance between the quencher and the
fluorescer, resulting in increased fluorescence.
[00192] In some embodiments, detection occurs through the use of universal
probes. A universal fluorescer probe
(UFP) contains a fluorescent molecule that emits a detectable electromagnetic
radiation upon absorbing
electromagnetic radiation in a range of wavelengths. A universal quencher
probe (UQP) contains a quencher
molecule that reduces the intensity of fluorescent emission of a proximal
fluorescer probe. In one case, a universal
fluorescer probe contains a nucleic acid segment that hybridizes to a
complementary nucleic acid segment on a
universal quencher probe or a complementary nucleic acid segment within a
target sequence, such as a MIP.
During PCR, amplification of such a target sequence results in increased
binding of a universal fluorescer probe to a
target sequence, compared to a quencher probe, which results in increased
detectable fluorescence. In some cases,
the length of complementary sequence between a universal fluorescer probe and
a universal quencher probe may be
varied to modulate the melting temperature of the complex of universal
fluorescer probe bound to universal
quencher probe. In some cases, the length of the complementary sequence may be
15 base pairs. In some cases, the
length of the complementary sequence may be more than about 5, 10, 15, 20, 25,
30, 35, 40, 45, 50, 55, 60, 70, or
80 base pairs. The melting temperature of the complex of universal fluorescer
probe bound to universal quencher
probe may be greater than about 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or
95 degrees Celsius.
[00193] FIG. 6 shows a two-color system for detection of nucleic acids in
droplets using universal primers and
universal probes without cleavage. A universal probe comprises two
complementary oligonucleotides, one
fluorescer probe containing a fluorescent molecule (UFP1 or UFP2) and one
quencher probe containing a
quenching molecule (UQP1 or UQP2). UFP1 and UFP2 fluoresce at different colors
and are distinguishable in
detection. When bound to the quencher probe, the fluorescence intensity of the
fluorescer probe is substantially
reduced. Additionally, two pairs of universal forward and reverse primers
contain regions that are complementary
to the fluorescer probe and promote PCR amplification of a target sequence. In
the first round of amplification, the
region complementary to the fluorescer probe is incorporated via the universal
primers into the template. In
subsequent rounds of amplification, the fluorescer probes UFP1 or UFP2 can
therefore hybridize to this template,
rather than to their respective quencher probes. As more of these templates
are generated exponentially by
amplification reactions, UFP 1 -UQP 1 and UFP2-UQP2 complexes are replaced by
UFP 1 -template and UFP2-
template complexes through competitive binding. As a result of this separation
between fluorescer probe and
quencher probe, fluorescence intensity will increase in the reaction, and can
be detected in following steps.
[00194] Universal probes may be designed by methods known in the art. In some
embodiments, the probe is a
random sequence. The universal probe may be selected to ensure that it does
not bind the target polynucleotide in
an assay, or to other non-target polynucleotides likely to be in a sample
(e.g., genomic DNA outside the region
occupied by the target polynucleotide). Exemplary sequences for universal
probes include SEQ ID NOS: 81 and
82.
-39-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[00195] Fluorescence detection can be achieved using a variety of detector
devices equipped with a module to
generate excitation light that can be absorbed by a fluorescer, as well as a
module to detect light emitted by the
fluorescer. In some cases, samples (such as droplets) may be detected in bulk.
For example, samples may be
allocated in plastic tubes that are placed in a detector that measures bulk
fluorescence from plastic tubes. In some
cases, one or more samples (such as droplets) may be partitioned into one or
more wells of a plate, such as a 96-
well or 3 84-well plate, and fluorescence of individual wells may be detected
using a fluorescence plate reader.
[00196] In some cases, the detector further comprises handling capabilities
for droplet samples, with individual
droplets entering the detector, undergoing detection, and then exiting the
detector. For example, a flow cytometry
device can be adapted for use in detecting fluorescence from droplet samples.
In some cases, a microfluidic device
equipped with pumps to control droplet movement is used to detect fluorescence
from droplets in single file. In
some cases, droplets are arrayed on a two-dimensional surface and a detector
moves relative to the surface,
detecting fluorescence at each position containing a single droplet.
[00197] Following acquisition of fluorescence detection data, a computer is
used in some cases to store and process
the data. A computer-executable logic may be employed to perform such
functions as subtraction of background
fluorescence, assignment of target and/or reference sequences, and
quantification of the data. For example, the
number of droplets containing fluorescence corresponding to the presence of an
suspected aneuploid chromosome
(such as chromosome 21) in the sample may be counted and compared to the
number of droplets containing
fluorescence corresponding to the presence of chromosome not suspected to be
aneuploidy (such as chromosome
1). FIG. 9 depicts a computer useful for displaying, storing, retrieving, or
calculating diagnostic results from the
molecular profiling; displaying, storing, retrieving, or calculating raw data
from genomic or nucleic acid expression
analysis; or displaying, storing, retrieving, or calculating any sample or
patient information useful in the methods of
the present invention.
[00198] Following digital PCR of samples having primers to amplify a target
and a reference sequence, the number
of positive samples having a target sequence and the number of positive
samples having a reference sequence can
be compared. Since this is a comparison of sequences present in the maternal
tissue, there is no need to
differentiate between maternal and fetal DNA. When a target sequence contains
the same number of copies as a
reference sequence known to be diploid, then the sample can be determined to
be diploid as well. When the target
sequence differs from the reference sequence, then the sample possibly
contains an aneuploidy.
[00199] In some embodiments, the genomic DNA obtained from a maternal tissue
as described above is partitioned
into multiple reaction volumes (e.g. droplets), so that there is, on average,
less than one genome equivalent (GE) per
droplet. In some cases, the droplets contain much more than, on average, one
GE per droplet, such as, on average,
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 30, 45, or 50 GE/droplet.
In some cases, a sample will produce greater
than on average 1, 5, or 10 GE/droplet, but, nonetheless some of the droplets
will contain no GE, or no target
polynucleotide . In such cases, it may be necessary to apply an algorithm to
calculate the average number of
copies/droplet of a particular genetic target. In some cases, the genetic
target is actually an entire chromosome (or
fragment), that is then fragmented and therefore one copy may appear in
multiple droplets.
[00200] Often, when individual discrete reaction volumes are analyzed for the
presence of a genetic abnormality to
be tested, the DNA (chromosomal) to be analyzed may on average, either be
present or absent, permitting so-called
digital analysis. The collective number of reaction volumes containing a
particular target sequence can be compared
to a reference sequence for differences in number. A ratio other than normal
(e.g., 1:1) between a target sequence
-40-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
and a reference sequence known to be a diploid sequence is indicative of an
aneuploidy. For example, a sample can
be partitioned into reaction volumes, such as droplets, such that each droplet
contains less than a nominal single
genome equivalent of DNA. The relative ratio of the target of interest (e.g.,
a genetic marker for chromosome 21
trisomy, or related probe) to a reference sequence (e.g. known diploid
sequence on chromosome 1, or related probe)
can be determined by examining a large number of reaction volumes (e.g.,
droplets), such as 10,000, 20,000,
50,000, 100,000, 200,000, 500,000 or more. In other cases, the reaction
volumes, such as droplets, comprise on
average one or more target nucleotides (or genomic equivalents) per droplet.
In such cases, the average copy
number of the target nucleotide may be calculated by applying an algorithm,
such as that described in Dube et al.
(2008) Plos One 3(8): e2876.
[00201] By analyzing a large number of reaction volumes, a change in the
relative ratio from 1:1 resulting from
the fetal aneuploidy can be measured from a mixture of fetal and maternal DNA
in the starting sample, where the
relative concentration of fetal DNA is low compared to the maternal DNA. This
is termed a digital analysis,
because each reaction volume will have, on average, one genome equivalent per
reaction volume, and furthermore,
the dilution can be read as a binary "yes-no" result as to the presence of the
sequence (e.g. target or reference) to be
counted.
[00202] The methods and compositions described herein can be used in a wide
range of applications. In some
embodiments, the methods and compositions related to methods for diagnosing,
detecting, identifying, predicting,
evaluating, or prognosing a condition associated with a genetic disorder. Such
condition may due to genetic causes,
including genetic disorders, variations, mutations, SNPs, deletions,
amplifications, translocations, inversions, or any
other abnormality within a specific genetic locus (including any locus
provided herein).
[00203] The methods and compositions provided herein may be used to diagnose,
detect, predict, identify, or
otherwise evaluate the risk that a fetus has a genetic abnormality (e.g.,
Down's Syndrome, fetal aneuploidy, etc.).
The methods may also be used to identify, quantify, diagnose, prognose,
evaluate, or analyze the risk that an
expectant mother will experience issues in pregnancy including miscarriage
within the first trimester, second
trimester, or third trimester; still birth; birth defects in her infant; pre-
term labor, or other issues with labor; and any
other condition associated with pregnancy, labor, or the birth of a child.
[00204] The methods and compositions provided herein may be used to evaluate
the relative copy number of a first
polynucleotide (e.g., DNA, RNA, genomic DNA, mRNA, siRNA, miRNA, cRNA, single-
stranded DNA, double-
stranded DNA, single-stranded RNA, double-stranded RNA, tRNA, rRNA, cDNA,
etc.) compared to a second
polynucleotide. The methods may be used to analyze the quantity of synthetic
plasmids in a solution; to detect the
sequence of a pathogenic organism (e.g., bacteria, virus, retrovirus,
lentivirus, HIV- 1, HIV-2, influenza virus, etc.)
within a sample obtained from a subject. The methods also may be used in other
applications wherein a rare
population of polynucleotides exists within a larger population of
polynucleotides.
Some examples of methods
[00205] In some embodiments, the present method comprises generally the
following steps:
[00206] 1. Obtaining a tissue containing DNA from a pregnant subject. In some
embodiments, the tissue can be
maternal blood (whole blood or peripheral blood), plasma or serum. This
material can be drawn blood, and the
circulating DNA can be found in the blood plasma, rather than in cells. In
some embodiments, the maternal tissue
(such as blood or plasma) can be enriched for fetal DNA by known methods, such
as size fractionation to select for
DNA fragments less than about 300 nucleotides. In some embodiments, maternal
DNA, which tends to be larger
-41-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
than about 500 nucleotides can be excluded. In other embodiments, another
enrichment step can be used to treat the
blood sample with formaldehyde, as described in Dhallan et al. "Methods to
Increase the Percentage of Free Fetal
DNA Recovered From the Maternal Circulation," (2004) J. Am. Med. Soc. 291:1114-
1119. In still other
embodiments, the DNA is purified from other material in the sample using
methods well-known in the art, such as
ethanol precipitation.
[00207] Optionally, sequences of interest in genomic DNA can be captured by
specific binding to one or more
oligonucleotides, or probes. In some cases, the mixture of genomic DNA and
probes is subjected to a ligase
reaction that results in selective ligation of probes that are bound to
genomic DNA. In some cases, binding to the
DNA results in inversion and circularization of a linear probe such as a MIP,
and the ligation reaction produces a
circular product. In some of these cases, genomic DNA and unbound probe can be
removed from the sample using
exonuclease treatment.
[00208] 2. Distributing single DNA molecules from this sample to a number of
discrete reaction volumes (e.g.
aqueous phase droplets) that are partitioned from the starting sample. In some
embodiments, the number of reaction
volumes can be selected to give a statistically significant result for the
number of copies of a target in the starting
sample DNA molecules. The reaction volume can be confined to a small volume to
bring the reaction molecules
into close proximity which can decrease reaction times. The amount of DNA
molecules per reaction volume can be
on the order of 0.5, 1, 2, 3, 4, or more DNA molecules per reaction volume. In
some cases, the number of DNA
molecules per reaction volume is on average about 1 DNA molecule per reaction
volume. In some cases, the
reaction volume of a single droplet can be up to 100pL, 500pL, lnL, lOnL or
100nL.
[00209] 3. Detecting the presence of the target sequence in the DNA with a
nucleic acid amplification technique
such as a PCR reaction. Each reaction volume (e.g. droplet) can contain all
the necessary reagents for performing
PCR which are well known in the art. In one embodiment, the maternal tissue
sample is partitioned into droplets
that are amplified in a continuous flow PCR amplification, such as described
in US Patent No. 7,048,481 and US
Patent Serial No. 61/194,043, both of which are hereby incorporated by
reference in their entirety. In some cases,
the amplification is of a sequence within a probe that binds to genomic DNA,
rather than of the genomic DNA
itself. In other embodiments, the maternal tissue sample is partitioned into
droplets that are amplified in wells of a
thermocycler. In some embodiments, the PCR product can be probed or labeled to
give a convenient quantitative
read out. For example, a fluorescence signal can be read for one or more
sequences in each reaction volume, such
as through the use of fluorescence labels, probes or intercalating dyes. The
detection step is referred to here as
digital PCR and can be carried out by a variety of methods, such as by
measuring fluorescence of (a) individual
droplets containing PCR products in a flowing stream or in a stopped flow; (b)
PCR products from samples diluted
into individual wells of a microliter plate; (c) PCR products from samples
diluted into emulsions; or (d) PCR
products from samples trapped in a microfluidic chamber; and
[00210] 4. Quantitative analysis of the detection of the maternal and fetal
target sequences. In some cases this may
include targets to different regions, such as probes to a target on a
chromosome suspected of being present in an
abnormal copy number (such as trisomy) compared to a sequence on a normal
diploid chromosome, which is used
as a reference. The analysis may also involve the detection of ligation
products, such as circular MIPs which have
been isolated from genomic DNA and unbound probe (for example, using
exonuclease treatment) and linearized
using enzymatic treatment. In some cases, quantitative determinations are made
by measuring the fluorescence
intensity of individual partitions, while in other cases, measurements are
made by counting the number of partitions
-42-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
containing detectable signal. In some embodiments, control samples can be
included to provide background
measurements that can be subtracted from all the measurements to account for
background fluorescence. In other
embodiments, 1, 2, 3, 4, or more than 4 different colors can be used to
measure different sequences, such as by
using fluorophores of different colors on different PCR primers matched to
probes recognizing different sequences.
EXAMPLES
Example 1. Detection of fetal DNA using a two-color detection scheme
[00211] In this example, detection of a trisomy 21 fetal aneuploidy is
described, where there is 3 % fetal DNA in a
maternal plasma sample. There are 1000 genome equivalents (GE) per mL in the
maternal plasma, and a maternal
blood volume of 20 mL is collected.
[00212] Plasma is isolated from the maternal blood sample by centrifugation,
and the nucleic acids are purified and
concentrated to a volume of 50 L. The sample is mixed with an equal volume of
PCR reagent containing the
multiplexed assay components. The entire 100 L sample is partitioned into
100,000 aqueous droplets having a
volume of 1 nL per droplet. For an ideal positive droplet percentage for
quantitation of 75%, this would mean 1.47
copies of target sequence per droplet, based on Poisson distribution, which
translates to 147,000 targets that need to
be compartmentalized into 100,000 lnL droplets. The number of primer sets
required to reach this is
147,000GE/10,000GE, which is a 15 plex. Thus, in each droplet, there would be
a 15 plex for each target and
reference sequence, or a total of 30 primer sets per droplet. The samples are
analyzed using a two-color detection
scheme, where the target sequence probes fluoresce using a green emitter and
the reference sequence probes
fluoresce using a yellow, orange or red emitter. Detection is performed over
the 100,000 droplets and the ratio of
target (green) to reference (yellow, orange or red) sequence is calculated.
Example 2. Detection of fetal DNA using a one-color detection scheme.
[00213] The conditions for Example 1 are used here, except that rather than
using different colored target and
reference probes, the sample is split (e.g. in half), then two set of droplets
are generated, amplified and separately
analyzed, with one half using a target probe and the other half using a
reference probe.
Example 3. Detecting fetal DNA using MIP-ddPCR
[00214] Cell-free plasma is isolated from a maternal blood sample by
centrifugation. The nucleic acids are then
purified and concentrated using a cell free DNA kit (Qiagen). The purified
genomic DNA is then mixed with 1000
chromosome-sequence specific oligonucleotide probes (e.g., MIP probe) to
Chromosome 21 (MIP-2 1 Chr), and
1000 chromosome-sequence specific oligonucleotide probes (e.g., MIP probe) to
Chromosome 1 (MIP-1Chr).
Ligase, polymerase and other reaction components are added to the mix. The
sample is incubated at 20 C for 4
minutes. The sample is then incubated at 95 C for 5 minutes to promote
denaturation, and then at 60 C for 15
minutes in order to promote annealing of the MIP probes to the genomic DNA. A
gap fill reaction is then
performed in order to circularize the MIP probes. (In some cases, the ends may
be directly ligated without a gap fill
reaction). Nucleotides are added to the sample, which is then incubated at 60
C for 10 minutes in order to allow
binding of the ligase and polymerase to the gap in the MIP probes. The sample
is then incubated at 37 C for 1
minute. Next, the sample is treated with Exonuclease I and III in order to
digest remaining linear probes and
ssDNA such as genomic DNA that is not hybridized to a probe, followed by
incubation at 37 C for 14 minutes to
-43-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
promote exonuclease activity, an incubation at 95 C for 2 minutes to
inactivate the exonucleases, and, finally, an
incubation at 37 C for 1 minute. Uracil-N-glycosylase is next added to the
sample, which is incubated at 37 C for
minutes in order to promote enzymatic depurination, followed by incubation at
95 C for 20 minutes in order to
allow cleavage of abasic depurinated uracil residues in the MIP probes. The
linearized probes now have an inverted
primer orientation.
[00215] Next, droplet digital PCR is performed on the sample. Taq polymerase,
universal primers, Taqman
fluorescence probes, and PCR reaction components are added to the sample. The
Taqman fluorescent probes
complementary to the universal probe binding sequence on the MIP-2 1 Chr probe
are tagged with a FAM dye; and
the Taqman fluorescent probes complementary to the universal probe binding
sequence on the MIP-1Chr probe are
tagged with a VIC dye. The sample is then emulsified into 100,000 monodisperse-
water-in-oil droplets stabilized
by surfactant additives into emulsification oil phase and/or aqueous PCR
reaction phase. As a result, the sample is
partitioned into 100,000 droplets. The sample then undergoes 15-50 thermal
cycles under conditions to drive each
PCR reaction in each droplet to end-point. The droplets are then analyzed by
using a two-color detection scheme to
detect the emission of the FAM and VIC dyes. The number of targets counted for
Ch21 is determined by
identifying the fraction of positive and negative droplets for FAM
fluorescence. Similarly, the number of targets
counted for the reference sample (Chl) is determined by identifying the
fraction of positive and negative droplets
for VIC fluorescence. The number of positive and negative droplets are then
used as input in a Poisson distribution
to determine the number of copies per droplet (lambda) for both the target and
reference chromosomes. The
relative copy number of Ch21 is then determined using equations known in the
art, e.g., as described in Dube et al.
(2008) Plos ONE 3(8):e2876. doi:10.1371/journal.pone.0002876. The confidence
of the estimate is also determined
using such equations.
Example 4. Separation of positive and negative droplet signals and
sensitivity of ddPCR to Template Copy number in MIP reaction.
Circularization Reactions
[00216] Multiplexed MIP circularization products were generated using either 3-
plex or 12-plex probe pools
containing 100 attomoles (amol) of each MIP species in the multiplex per 10 L
annealing mixture. One attomole is
equivalent to 10-18 mole. 100 amol equals approximately -60M copies of each
MIP probe sequence. The volume
of the annealing reactions was 20 ul.
[00217] (Note that in the current experiment, all volumes cited in this
protocol were doubled, beginning with a
20u1 annealing reaction; however, all DNA, buffer and enzyme concentrations
were maintained the same as in the
standard 1 Oul annealing reaction protocol). The probe pools were formulated
from mass-dilutions of selected MIP
probes (the IDT Ultramers, purified by PAGE) from among either the Chromosome
1 Reference set of 24 nucleic
acids (SEQ ID NOS: 1-24); detected by SEQ ID NO: 81, or from the Chromosome 21
Test set of 24 nucleic acids
(SEQ ID NOS: 25-48); detected by the SEQ ID NO: 82.
[00218] MIP probes were combined with varying numbers of copies of Raji human
gDNA (0; 100; 1,000; or
10,000 copies, 3pg gDNA/copy) in 1X Ampligase buffer in 96-well PCR plates,
denatured for 5 minutes at 95 C in
a thermocycler (Eppendorf Mastercycler Pro. S or ABI 9700), then cooled to 58
C and allowed to incubate and
anneal at this temperature for >12h.
-44-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[00219] After annealing, while remaining in the thermocycler at 58 C, 0.75U
of Ampligase was added to each
reaction in 5 L of 1X Ampligase buffer with mixing to provide mixtures with a
total volume of 15 L, and the
plates were resealed and allowed to incubate for 15 additional minutes at 58
C.
Digestion of Uncircularized Materials
[00220] Immediately following the circularization reaction, the temperature of
the thermocycler was ramped down
to 4 C, and exonuclease digestion of uncircularized excess MIP probes and
gDNA was carried out by adding to
each reaction well a 5 L mixture of 6U Exo I & 30U Exo III in 1X Exo III
buffer (EpiCentre) with mixing and
plate resealing (total reaction volume = 20 L). Digestion proceeded for 20
minutes at 37 C on the thermocycler,
followed by heat denaturation at 95 C for 10 minutes.
[00221] MIP reaction products were analyzed by qPCR (4 L of circularization
reaction mixture per 20 L qPCR
reaction) and subsequently frozen at -20 C and stored for use in droplet
digital PCR (ddPCR) experiments.
Preparation of a general 2X stock solution
The general stock solution (10 mL) was formulated as follows.
Component Volume per 10 L aliquot ( L) Volume per 10 mL solution ( L)
FastStart Taq polymerase 0.16 160
(Roche) (5U/ L)
l OX Buffer 2 2000
mM dNTP / 0.4 400
mM dUTP
Glycerol (50% w/v) 3.2 3200
BSA (20 mg/mL) 1 1000
Pluronic 10% 1 1000
Water 2.24 2240
Total Volume 10.0 10,000
[00222] The general stock solution was stored at 4 C, and was used for
multiple experiments.
Preparation of 2x Hbprl ddPCR stock solution
The 2x Hb prl ddPCR stock solution (520.5 L) was formulated as follows.
Component Volume per 52.05 L aliquot ( L) Volume per 520.5 L solution ( L)
General stock solution 50 500
Primer Hb_Fwd (100 M) 0.9 9
CCGAATAGGAACGTTGAGCCGT
(SEQ ID NO: 79)
Primer Hb_Rev (100 M) 0.9 9
GCAAATGTTATCGAGGTCCGGC
(SEQ ID NO: 80)
Taqman Hb prl(FAM-BHQ) (100 0.25 2.5
M)
ttggcagcctttgccgcggc
-45-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
(SEQ ID NO: 81)
Total Volume 52.05 520.5
Preparation of 1.25x Hbprl ddPCR stock solution
The 1.25x HB_PR1 ddPCR stock solution (800 L) was formulated as follows.
Component Volume per 800 L solution ( L)
2x Hb prl ddPCR stock solution 520.5
Aqueous MgCl2 (25 mM) 80
Water 199.5
Total Volume 800
[00223] The 1.25x Hb prl ddPCR stock solution was partitioned among 4
centrifuge tubes (1.5 mL capacity) in
160 L aliquots.
Preparation of 2x Hb pr2 ddPCR stock solution
The 2x Hb pr2 ddPCR stock solution (936.9 L) was formulated as follows.
Component Volume per 52.05 L aliquot ( L) Volume per 936.9 L solution ( L)
General stock solution 50 900
Primer Hb_Fwd (100 M) 0.9 16.2
CCGAATAGGAACGTTGAGCCGT
(SEQ ID NO: 79)
Primer Hb_Rev (100 M) 0.9 16.2
GCAAATGTTATCGAGGTCCGGC
(SEQ ID NO: 80)
Taqman Hb pr2(FAM-BHQ) (100 0.25 4.5
M)
tctgccacctaagcggccgcag (SEQ ID
NO: 82)
Total Volume 52.05 936.9
Preparation of 1.25x Hb pr2 ddPCR stock solution
The 1.25x Hb pr2 ddPCR stock solution (1440 L) was formulated as follows.
Component Volume per 1440 L solution ( L)
2x Hb2 ddPCR stock solution 936.9
Aqueous MgCl2 (25 mM) 144
Water 359.1
Total Volume 1440
-46-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
[00224] The 1.25x Hb_pr2 ddPCR stock solution was partitioned among 8
centrifuge tubes (1.5 mL capacity) in
160 L aliquots.
ddPCR Procedure
[00225] The products of the MIP circularization experiments were thawed and
centrifuged (2,000 rpm for 2 min).
40 L aliquots of MIP products, i.e. 2x 20 L aliquots from duplicate assay
reactions, were combined with 160 L
of either 1.25x Hb_prl ddPCR stock solution for MIPs designed to contain the
Taqman Assay Hb_prl, or 1.25x
Hb2 ddPCR stock solution for MIPs designed to contain the Taqman Assay Hb_pr2.
The reaction mixtures were
partitioned into 1 nL droplets using a ChipShop droplet generation system with
a syringe pump system.
[00226] Droplet samples were transferred to thermocycler plates (3 x 30 L
aliquots per droplet sample), sealed
with a foil seal, then thermocycled for about 1.25 h. Thermocycling began by
holding the plates at 94 C for 10
minutes, subsequently cycling the plates through 35 or 40 cycles of (94 C, 20
s / 65 C, 60s), and finally cooling
and holding the plates at 4 C. Thermocycled plates were stored at that
temperature.
[00227] Leftover droplet aliquots were visualized under a Nikon light
microscope to assess uniformity and proper
size.
[00228] Thermocycled samples were placed on a QuantaLife Box 2 Alpha detector
system, where droplet samples
were automatically withdrawn from one well at-a-time, and passed single-file
by a detector, which was used to
assess both droplet size and fluorescence intensity from reacted FAM Taqman
probes.
[00229] Droplets in each well of the appropriate size were scored as either
positive or negative droplets, depending
upon their fluorescence amplitude, and these distributions were used to
compute the concentration of the assayed
sample target according to Poisson statistics.
[00230] The upper panel of Fig. 10 shows that increasing numbers of positive
droplets (or counts) is correlated
with increasing input copies of template DNA. Here, Raji genomic DNA was used
(derived from Raji cancer cells)
for the experiments. For these experiments, 0 copies (or no template control
"NTC") of input copies of DNA were
used in the sample as indicated in the first three columns (D4-6 in upper
panel, F4-6 in lower panel); 100 copies in
the next set of three (D7-9 upper , F7-9 lower); 1000 copies in the next set
of three columns (E4-6 upper, G4-6
lower); and for the last three, 10,000 copies were used (E7-E9 upper, and G7-
G9 lower). In the upper panel, all
MIP reactions were carried out with a MIP three-plex, using three different
MIP probes, each directed to a different
site on the test chromosome (which is Chromosome 21, also corresponding to hb
pr2). For the upper panel, the
horizontal line at 10605 RFUs (relative fluorescent units) on the left panel,
and the vertical line at 10605 RFUs on
the right panel demarcate the threshold between positive and negative
droplets. Experiments as shown are
conducted in triplicate.
[00231] The lower panel is the identical experiment conducted with a larger
set of MIP probes. In the lower panel,
a MIP 12-plex was used, wherein each of 12 MIP probes is directed to a
different region within chromosome 21.
As depicted in Fig. 10, the lower panel exhibits a roughly 4-fold greater
number of positive droplets at a given input
number (e.g., NTC, 100, 1000, 10000) of DNA template. The y-axis shows the
relative fluorescent units for the
FAM signal (or Taqman probe) emitted from each droplet. For both upper and
lower panels, the right panel
provides a frequency histogram showing the varying fluorescence amplitudes of
the droplets and combines data
from all 12 lanes presented in the left panel. Here, the X-axis provides the
relative fluorescent units for the FAM
-47-
CA 02767028 2011-12-30
WO 2011/066476 PCT/US2010/058124
signal. For the lower panel, the horizontal line at 10,431 RFUs (relative
fluorescent units) on the left panel, and the
vertical line at 10,431 RFUs on the right panel demarcate the threshold
between positive and negative droplets.
[00232] Fig. 11 shows that results similar to those shown in Fig. 10 are
obtained when MIP probe pools are derived
from probes to the reference polynucleotide (hb_pr1, or chromosome 1). The
boxed counts on the left side of the
panel reflect the number of counts obtained by using a three-plex MIP probe
pool with 10,000 copies of template
DNA, while the boxed counts on the right side of the graph reflect the number
of counts obtained by using a 12-
plex MIP probe pool with 10,000 copies of template DNA. Experiments as shown
are conducted in triplicate.
[00233] Fig. 12 illustrates that the hybridization efficiency is similar
whether a thousand copies or 10,000 copies of
template are present in the reaction, as shown by the 10-fold increase in
counts when going from 1,000 to 10,000
copies of template. Fig. 12 also shows that for a given number of copies of
genomic DNA, the number of counts
can be increased by increasing the degree of multiplexing of the MIP probes.
MIP probes enable multiplexing
across a given chromosome, providing a large number of counts from a small
number of genomic equivalents, that
is important for differentiation of small copy number changes between a target
and reference. Experiments as
shown are conducted in triplicate.
[00234] While alternative embodiments of the present invention have been shown
and described herein, it will be
obvious to those skilled in the art that such embodiments are provided by way
of example only. Numerous
variations, changes, and substitutions will now occur to those skilled in the
art without departing from the invention.
It should be understood that various alternatives to the embodiments of the
invention described herein may be
employed in practicing the invention. It is intended that the following claims
define the scope of the invention and
that methods and structures within the scope of these claims and their
equivalents be covered thereby.
-48-
