Note: Descriptions are shown in the official language in which they were submitted.
CA 02771581 2016-12-15
55006-19
1
DETECTION OF AAD-1 EVENT DAS-40278-9 IN CORN
BACKGROUND OF THE INVENTION
The aad-1 gene (originally from Sphingobium herbicidovorans) encodes the
aryloxyalkanoate dioxygenase (AAD-1) protein. The
trait confers tolerance to 2,4-
dichlorophenoxyacetic acid and aryloxyphenoxypropionate (commonly referred to
as "fop"
herbicides such as diclofop and quizalofop) herbicides and may be used as a
selectable marker
during plant transformation and in breeding nurseries. The aad-1 gene, itself,
for herbicide tolerance
in plants was first disclosed in WO 2005/107437 (see also US 2009-0093366).
Various methods of event detection are known. However, they each have issues.
One
method is the Pyrosequencing technique as described by Winge (Innov. Pharma.
Tech. 00:18-24,
2000). In this method an oligonucleotide is designed that overlaps the
adjacent genomic DNA and
insert DNA junction. The oligonucleotide is hybridized to single-stranded PCR
product from the
region of interest (one primer in the inserted sequence and one in the
flanking genomic sequence)
and incubated in the presence of a DNA polymerase, ATP, sulfurylase,
luciferase, apyrase,
adenosine 5' phosphosulfate and luciferin. DNTPs are added individually and
the incorporation
results in a light signal that is measured. A light signal indicates the
presence of the transgene
insert/flanking sequence due to successful amplification, hybridization, and
single or multi-base
extension.
Fluorescence Polarization is another method that can be used to detect an
amplicon of the
present invention. Following this method, an oligonucleotide is designed which
overlaps the
genomic flanking and inserted DNA junction. The oligonucleotide is hybridized
to single-stranded
PCR product from the region of interest (one primer in the inserted DNA and
one in the flanking
genomic DNA sequence) and incubated in the presence of a DNA polymerase and a
fluorescent-
labeled ddNTP. Single base extension results in incorporation of the ddNTP.
Incorporation can be
measured as a change in polarization using a fluorometer. A change in
polarization indicates the
presence of the transgene insert/flanking sequence due to successful
amplification, hybridization,
and single base extension.
CA 02771581 2016-12-15
55006-19
2
Molecular Beacons have been described for use in sequence detection. Briefly,
a FRET
oligonucleotide probe is designed that overlaps the flanking genomic and
insert DNA junction. The
unique structure of the FRET probe results in it containing secondary
structure that keeps the
fluorescent and quenching moieties in close proximity. The FRET probe and PCR
primers (one
primer in the insert DNA sequence and one in the flanking genomic sequence)
are cycled in the
presence of a thermostable polymerase and dNTPs. Following successful PCR
amplification,
hybridization of the FRET probe to the target sequence results in the removal
of the probe secondary
structure and spatial separation of the fluorescent and quenching moieties. A
fluorescent signal
results. A fluorescent signal indicates the presence of the flanking
genomic/transgene insert
sequence due to successful amplification and hybridization.
Hydrolysis probe assay, otherwise known as TAQMANTm (PE Applied Biosystems,
Foster
City, Calif.), is a method of detecting and quantifying the presence of a DNA
sequence. Briefly, a
FRET oligonucleotide probe is designed that overlaps the genomic flanking and
insert DNA
junction. The FRET probe and PCR primers (one primer in the insert DNA
sequence and one in the
flanking genomic sequence) are cycled in the presence of a thermostable
polymerase and dNTPs.
During specific amplification, Taq DNA polymerase cleans and releases the
fluorescent moiety
away from the quenching moiety on the FRET probe. A fluorescent signal
indicates the presence of
the flanking/transgene insert sequence due to successful amplification and
hybridization.
Another challenge, among many, is finding a suitable reference gene for a
given test. For
example, as stated in the abstract of Czechowski et al., "An exceptionally
large set of data from
Affymetrix ATH1 whole-genome GeneC hip studies provided the means to identify
a new
generation of reference genes with very stable expression levels in the model
plant species
Arabidopsis (Arabidopsis thaliana). Hundreds of Arabidopsis genes were found
that outperform
traditional reference genes in terms of expression stability throughout
development and under a
range of environmental conditions." (Czechowski et al. (2005) Genome-wide
identification and
testing of superior reference genes for transcript normalization in
Arabidopsis. Plant Physiol.
139, 5-17.)
Brodmann et al. (2002) relates to real-time quantitative PCR detection of
transgenic
maize content in food for four different maize varieties approved in the
European Union.
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
3
Brodmann, P.D., P.D., Jig E.C., Berthoud H., and Herrmann, A. Real-Time
Quantitative
Polymerase Chain Reaction Methods for Four Genetically Modified Maize
Varieties and Maize
DNA Content in Food. J. of AOAC international 2002 85 (3)
Hernandez et al. (2004) mentions four possible genes for use with real-time
PCR.
Hernandez, M., Duplan, M.-N., Berthier, G., Vaitilingom, M., Hauser, W.,
Freyer, R., Pia, M.,
and Bertheau, Y. Development and comparison of four real-time polymerase chain
reaction
systems for specific detection and quantification of Zea mays L. J. Agric.
Food Chem. 2004,
52, 4632-4637.
Costa et al. (2007) looked at these four genes (also in the real-time PCR
context) and
concluded that the alcohol dehydrogenase and zein genes were the best
reference genes for
detecting a sample "event" (a lectin gene) for transgenic feed intermix
issues. Costa, L. D., and
Martinelli L. Development of a Real-Time PCR Method Based on Duplo Target
Plasmids for
Determining an Unexpected Genetically Modified Soybean Intermix with Feed
Components. J.
Agric. Food Chem. 2007, 55, 1264-1273.
Huang et al. (2004) used plasmid pMulM2 as reference molecules for detection
of
MON810 and NK603 transgenes in maize. Huang and Pan, "Detection of Genetically
Modified
Maize MON810 and NK603 by Multiplex and Real-Time Polymerase Chain Reaction
Methods,"
J. Agric. Food Chem., 2004, 52 (11), pp 3264-3268.
Gasparic et al. (2008) suggest LNA technology, from a comparison to cycling
probe
technology, TaqMan, and various real-time PCR chemistries, for quantitatively
analyzing maize
events (such as MON810). Gagpari6,Cankar, 'el, and Gruden, "Comparison of
different real-
time PCR chemistries and their suitability for detection and quantification of
genetically
modified organisms," BMC Biotechnol. 2008; 8: 26.
US 20070148646 relates to a primer extension method for quantification that
requires
controlled dispensation of individual nucleotides that can be detected and
quantified by the
amount of nucleotides incorporated. This is different from the TaqMan PCR
method using an
internal reference gene.
To distinguish between homozygous and hemizygous genotypes of TC1507, an
Invader
assay has been successfully used for this event. Gupta, M., Nirunsuksiri, W.,
Schulenberg, G.,
CA 02771581 2016-12-15
55006-19
4
Hartl, T., Novak, S., Bryan, J., Vanopdorp, N., Bing, J. and Thompson, S. A
non-PCR-based
Invader Assay Quantitatively Detects Single-Copy Genes in Complex Plant
Genomes. Mol.
Breeding 2008, 21, 173-181.
Huabang (2009) relates to PCR-based zygosity testing of transgenic maize.
However, no
reference gene appears to be used. Huabang, "An Accurate and Rapid PCR-Based
Zygosity Testing
Method for Genetically Modified Maize," Molecular Plant Breeding, 2009, Vol.7,
No.3, 619-623.
BRIEF SUMMARY OF THE INVENTION
The subject invention provides assays for detecting the presence of the AAD-1
corn event
designated DAS-40278-9 in a sample (of corn grain, for example).
(Representative seed was
deposited with American Type Culture Collection (ATCC) under Accession No. PTA-
10244
(Yellow Dent maize hybrid seed (Zea Mays L.):DAS-40278-9; deposited in
accordance with the
Budapest Treaty on behalf of Dow AgroSciences LLC; date of receipt of
seeds/strain(s) by the
ATTC: July 10, 2009; viability confirmed August 17, 2009.) Kits and conditions
useful in
conducting the assays are also provided.
More specifically, the present invention relates in part to endpoint TaqMan
PCR assays for
the AAD-1 event in corn utilizing a maize endogenous reference gene. Some
embodiments are
directed to assays that are capable of high throughput zygosity analysis. The
subject invention
further relates, in part, to the discovery of a preferred invertase reference
gene for use in determining
zygosity.
Thus, this invention also relates in part to plant breeding incorporating any
of the subject
detection methods. In some embodiments, said event can be "stacked" with other
traits, including,
for example, other herbicide tolerance gene(s) and/or insect-inhibitory
proteins. The subject
procedures can be used to uniquely identify corn lines comprising the event of
the subject invention.
CA 02771581 2016-12-15
55006-19
4a
In an embodiment, the invention provides a method for determining zygosity
of a corn plant comprising an aryloxyalkanoate dioxygenase (AAD-1) transgene
as found in
corn event DAS-40278-9, said event comprising SEQ ID NO: 1, said method
comprising:
obtaining a DNA sample of genomic DNA from said corn plant; producing a
contacted
sample by contacting said DNA sample with: a. a first event primer and a
second event
primer, wherein said first event primer specifically binds to said AAD-1
transgene as defined
by residues 1874-6689 of SEQ ID NO: 1, said second event primer specifically
binds to a 5'
corn genomic flanking DNA defined by residues 1-1873 of SEQ ID NO: 1, or to a
3' corn
genomic flanking DNA defined by residues 6690-8557 of SEQ ID NO: 1, and
wherein said
first event primer and said second event primer produce an event amplicon when
subjected to
PCR conditions; b. a reference forward primer and a reference reverse primer
that produce a
reference amplicon from an endogenous corn reference gene when subjected to
PCR
conditions; c. a florescent event probe that hybridizes with said event
amplicon; d. a florescent
reference probe that hybridizes with said reference amplicon; subjecting said
contacted
sample to fluorescence-based endpoint PCR conditions; quantitating said
florescent event
probe that hybridized to said event amplicon; quantitating said florescent
reference probe that
hybridized to said reference amplicon; comparing amounts of hybridized
florescent event
probe to hybridized florescent reference probe; and determining zygosity of
DAS-40278-9 by
comparing florescence ratios of hybridized fluorescent event probe and
hybridized fluorescent
reference probe.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows a cloning Strategy for the DNA Insert in the Corn Event
DAS-40278-9.
CA 02771581 2016-12-15
55006-19
Figure 2 is a diagram of the Primers Used in PCR Amplification for
Confirmation of
Flanking Border Regions of the Corn Event DAS-40278-9 The schematic diagram
depicts the
primer locations for confirming the full length sequencing of the AAD-1 corn
event DAS-40278-
9 from 5' to 3' borders.
5
Figure 3 shows a cloning Strategy for the Flanking Border Sequences from the
Corn
Event DAS-40278-9 Genomic DNA of the Corn Event DAS-40278-9 was digested with
EcoR V,
Stu I, or Sca I and generated corresponding GenomeWalkerTM libraries, which
were used as
templates to amplify the target DNA sequences.
BRIEF DESCRIPTION OF THE SEQUENCES
SEQ ID NO:1 provides a sequence of 5' and 3' genomic flanking sequences on
either side of
the AAD-1 insert, including the insert, for Corn Event DAS-40278-9.
SEQ ID NOs: 2-7 are primers and probes for use according to the subject
invention.
SEQ ID NO:8 is the exemplified event amplicon.
SEQ ID NO:9 is the exemplified reference amplicon.
DETAILED DESCRIPTION OF THE INVENTION
Transgenic AAD-1 (providing herbicide tolerance) corn event DAS-40278-9 was
generated
by Whisker-mediated transformation. Both 5' and 3' end flanking sequences of
this AAD-1
transgene insert were cloned, sequenced, and characterized.
Specific TAQMAN primers and probe were designed, as detailed herein, in part
according to
the DNA sequences located in the 5' insert-to-plant junction. Event
specificity of the primers and
probe was successfully tested in duplex format with the corn invertase as a
reference gene in real
time PCR against 16 different AAD-1 corn events and two non-transgenic corn
varieties.
Procedures for end-point event specific TAQMAN assays for AAD-1 corn DAS-40278-
9 were
developed, as detailed herein.
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
6
The sequence spanning the region of the integration junction between host
plant DNA and
the integrated gene construct in this AAD-1 corn is a unique sequence. It was
used to develop event
specific assays (conventional PCR or realt time PCR) to detect presence of AAD-
1 Corn DAS-
40278-9 for GMO testing and to determine zygosity status of plants in breeding
populations. The
event-specific TAQMAN assay reported herein can be employed for both
applications.
The subject invention provides assays for detecting the presence of the
subject transgenic
corn event DAS-40278-9 (also known as pDAS1740-278) in a sample. Aspects of
the subject
invention include methods of designing and/or producing any diagnostic nucleic
acid molecules
exemplified or suggested herein.
This invention also relates in part to plant breeding incorporating any of
these methods. In
some embodiments, the subject event can be "stacked" with other traits (such
as other herbicide
tolerance gene(s) and/or gene(s) that encode insect-inhibitory proteins, for
example. Plant lines
comprising the subject event can be detected using sequences disclosed and
suggested herein.
In some embodiments, this invention relates to the identification of herbicide-
tolerant corn
lines. The subject invention relates in part to detecting the presence of the
subject event in order to
determine whether progeny of a sexual cross contain the event of interest. In
addition, a method for
detecting the event is included and is helpful, for example, for complying
with regulations requiring
the pre-market approval and labeling of foods derived from recombinant crop
plants, for example.
The subject invention relates in part to a fluorescence-based endpoint TaqMan
PCR assay
utilizing an endogenous gene as a reference (copy number) control for high-
throughput zygosity
analysis of the AAD-1 maize event. The subject invention further relates, in
part, to the
discovery of a preferred reference gene, invertase. Several reference genes
were identified as
possible options.
The subject invention also relates in part to the development of a biplex
endpoint
TaqMan PCR for AAD-1 event specific zygosity analysis. Further, the subject
invention relates
in part to the development of AAD-1 breeding test kits.
Endpoint TaqMan assays are based on a plus/minus strategy, by which a "plus"
signifies
the sample is positive for the assayed gene and a "minus" signifies the sample
is negative for the
assayed gene. These assays typically utilize two sets of oligonucleotides for
identifying the
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
7
AAD-1 transgene sequence and the wild-type gene sequence respectively, as well
as dual-
labeled probes to measure the content of transgene and wild type sequence.
Although the Invader assay has been a robust technique for characterizing
events, it is
very sensitive to DNA quality. In addition, the assay requires a high quantity
of DNA. Invader
also requires an additional denaturing step which, if not handled properly,
can render the Invader
assay unsuccessful. Additionally, the longer assay time of the Invader assay
is limited in its
flexibility to efficiently handle large numbers of AAD-1 samples for analysis
in a commercial
setting. One main advantage of the subject invention is time savings and
elimination of the
denaturing step.
The subject Endpoint TaqMan analysis for detecting AAD-1 events offers
surprising
advantages over Invader, particularly in analyzing large number of samples.
This invention can impact the development and characterization of AAD-1
herbicide
tolerance traits in crops including corn, soybean, and cotton.
Definitions and examples are provided herein to help describe the present
invention and to
guide those of ordinary skill in the art to practice the invention. Unless
otherwise noted, terms are to
be understood according to conventional usage by those of ordinary skill in
the relevant art. The
nomenclature for DNA bases as set forth at 37 CFR 1.822 is used. As used
herein, the term
"progeny" denotes the offspring of any generation of a parent plat which
comprises AAD-1 corn
event DAS-40278-9.
A transgenic "event" is produced by transformation of plant cells with
heterologous DNA,
i.e., a nucleic acid construct that includes a transgene of interest,
regeneration of a population of
plants resulting from the insertion of the transgene into the genome of the
plant, and selection of a
particular plant characterized by insertion into a particular genome location.
The term "event" refers
to the original transformant and progeny of the transformant that include the
heterologous DNA.
The term "event" also refers to progeny produced by a sexual outcross between
the transformant and
another variety that includes the genomic/transgene DNA. Even after repeated
back-crossing to a
recurrent parent, the inserted transgene DNA and flanking genomic DNA
(genomic/transgene DNA)
from the transformed parent is present in the progeny of the cross at the same
chromosomal location.
The term "event" also refers to DNA from the original transformant and progeny
thereof comprising
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
8
the inserted DNA and flanking genomic sequence immediately adjacent to the
inserted DNA that
would be expected to be transferred to a progeny that receives inserted DNA
including the transgene
of interest as the result of a sexual cross of one parental line that includes
the inserted DNA (e.g., the
original transformant and progeny resulting from selfing) and a parental line
that does not contain
the inserted DNA.
A "junction sequence" spans the point at which DNA inserted into the genome is
linked to
DNA from the corn native genome flanking the insertion point. Included are the
DNA sequences
that span the insertions in herein-described corn events and similar lengths
of flanking DNA.
The subject invention relates to the identification of the subject event.
Related PCR primers
and amplicons are included in the invention. These molecules can be used to
detect or identify
commercialized transgenic corn varieties or lines derived from the subject
transgenic corn lines.
The entire sequence of the insert, together with portions of the respective
flanking sequences,
are provided herein as SEQ ID NO: 1. The coordinates of the insert and
flanking sequences for this
event with respect to SEQ ID NO:1 (8557 basepairs total) are printed below.
5' Flanking Insert 3'Flanking
residue #s (SEQ:29): 1-1873 1874-6689 6690-8557
length (bp): 1873 bp 4816 bp 1868 bp
The components of the AAD-1 insert and flanking sequences for this event are
further
illustrated in Figures 1 through 3.
Detection techniques of the subject invention can be used in conjunction with
plant breeding,
to determine which progeny plants comprise a given event, after a parent plant
comprising an event
of interest is crossed with another plant line in an effort to impart one or
more additional traits of
interest in the progeny. The subject methods are useful in, for example, corn
breeding programs as
well as quality control, especially for commercialized transgenic cornseeds.
This can also benefit
product registration and product stewardship. These methods can be used for
accelerated breeding
strategies.
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
9
In some embodiments, the fluorescence-based end-point TaqMan assay for
zygosity
analysis allows the results to be directly read in a plate reader for
identification of the AAD-1
event in corn and the reference gene.
The subject invention includes breeding applications such as testing the
introgression of
the AAD-1 event into other corn lines.
Detection methods and kits of the subject invention can be used to identify
events according
to the subject invention. Methods and kits of the subject invention can be
used for accelerated
breeding strategies and to establish linkage data.
Detection techniques of the subject invention are especially useful in
conjunction with plant
breeding, to determine which progeny plants comprise a given event, after a
parent plant comprising
an event of interest is crossed with another plant line in an effort to impart
one or more additional
traits of interest in the progeny. These Taqman PCR analysis methods benefit
maize breeding
programs as well as quality control, especially for commercialized transgenic
maize seeds. Taqman
PCR detection kits for these transgenic maize lines can also now be made and
used. This can also
benefit product registration and product stewardship.
Still further, subject methods can be used to study and characterize transgene
integration
processes, genomic integration site characteristics, event sorting, stability
of transgenes and their
flanking sequences, and gene expression (especially related to gene silencing,
transgene methylation
patterns, position effects, and potential expression-related elements such as
MARS [matrix
attachment regions], and the like).
As used herein, the term "corn" means maize (Zea mays) and includes all
varieties thereof
that can be bred with corn.
This invention further includes processes of making crosses and using methods
of the subject
invention. For example, the subject invention includes a method for producing
an F1 hybrid seed by
crossing an exemplified plant with a different (e.g. in-bred parent) plant,
harvesting the resultant
hybrid seed, and detecting for the subject event. Characteristics of the
resulting plants may also be
improved by incorporating methods of the subject invention.
A herbicide-tolerant corn plant can be bred by first sexually crossing a first
parental corn
plant consisting of a corn plant grown from seed of a line referred to herein,
and a second parental
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
corn plant, thereby producing a plurality of first progeny plants; and then
selecting a first progeny
plant that is resistant to a herbicide (or that possesses a subject event);
and selfing the first progeny
plant, thereby producing a plurality of second progeny plants; and then
selecting from the second
progeny plants a plant that is resistant to a herbicide (or that possesses at
least one of the events).
5 These steps can further include the back-crossing of the first progeny
plant or the second progeny
plant to the second parental corn plant or a third parental corn plant. A corn
crop comprising corn
seeds of the subject invention, or progeny thereof, can then be planted.
It is also to be understood that two different transgenic plants can also be
mated to produce
offspring that contain two independently segregating added, exogenous genes.
Selfing of
10 appropriate progeny can produce plants that are homozygous for both
added, exogenous genes.
Back-crossing to a parental plant and out-crossing with a non-transgenic plant
are also contemplated,
as is vegetative propagation. Other breeding methods commonly used for
different traits and crops
are known in the art. Backcross breeding has been used to transfer genes for a
simply inherited,
highly heritable trait into a desirable homozygous cultivar or inbred line,
which is the recurrent
parent. The source of the trait to be transferred is called the donor parent.
The resulting plant is
expected to have the attributes of the recurrent parent (e.g., cultivar) and
the desirable trait
transferred from the donor parent. After the initial cross, individuals
possessing the phenotype of the
donor parent are selected and repeatedly crossed (backcrossed) to the
recurrent parent. The resulting
parent is expected to have the attributes of the recurrent parent (e.g.,
cultivar) and the desirable trait
transferred from the donor parent.
The present invention can be used in conjunction with a marker assisted
breeding (MAB)
method. Likewise, DNA molecules of the present invention can be used with
other methods (such
as, AFLP markers, RFLP markers, RAPD markers, SNPs, and SSRs) that identify
genetically linked
agronomically useful traits. The herbicide-resistance trait can be tracked in
the progeny of a cross
(or progeny thereof and any other corn cultivar or variety) using the MAB
methods. The methods of
the present invention can be used to identify any corn variety having the
subject event.
Methods of the subject invention include a method of producing a herbicide-
tolerant corn
plant wherein said method comprises breeding with a plant having a subject
event. Preferred
methods further comprise selecting progeny of said cross by analyzing said
progeny for an event
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
11
detectable according to the subject invention. For example, the subject
invention can be used to
track the subject event through breeding cycles with plants comprising other
desirable traits, such as
agronomic traits. Plants comprising the subject event and the desired trait
can be detected,
identified, selected, and quickly used in further rounds of breeding, for
example. The subject event /
trait can also be combined through breeding, and tracked according to the
subject invention, with an
insect resistant trait(s) and/or with further herbicide tolerance traits. One
preferred embodiment of
the latter is a plant comprising the subject event combined with a gene
encoding resistance to an
imidazolinone herbicide, glyphosate, and/or glufosinate. A dicamba tolerance
gene can be used in
some embodiments.
Thus, the subject invention can be combined with, for example, traits encoding
glyphosate
resistance (e.g., resistant plant or bacterial EPSPS, GOX, GA]), glufosinate
resistance (e.g., Pat,
bar), acetolactate synthase (ALS)-inhibiting herbicide resistance (e.g.,
imidazolinones [such as
imazethapyr], sulfonylureas, triazolopyrimidine sulfonanilide,
pyrmidinylthiobenzoates, and other
chemistries [Csr 1 , SurA, et al.]), bromoxynil resistance (e.g., Bxn),
resistance to inhibitors of HPPD
(4-hydroxlphenyl-pyruvate-dioxygenase) enzyme, resistance to inhibitors of
phytoene desaturase
(PDS), resistance to photosystem II inhibiting herbicides (e.g., psbA),
resistance to photosystem I
inhibiting herbicides, resistance to protoporphyrinogen oxidase IX (PPO)-
inhibiting herbicides (e.g.,
PPO-1), resistance to phenylurea herbicides (e.g., CYP76B1), dicamba-degrading
enzymes (see, e.g.,
US 20030135879), and others could be stacked alone or in multiple combinations
to provide the
ability to effectively control or prevent weed shifts and/or resistance to any
herbicide of the
aforementioned classes.
Regarding additional herbicides, some additional preferred ALS (also known as
AHAS)
inhibitors include the triazolopyrimidine sulfonanilides (such as cloransulam-
methyl, diclosulam,
florasulam, flumetsulam, metosulam, and penoxsulam), pyrimidinylthiobenzoates
(such as
bispyribac and pyrithiobac), and flucarbazone. Some preferred HPPD inhibitors
include mesotrione,
isoxaflutole, and sulcotrione. Some preferred PPO inhibitors include
flumiclorac, flumioxazin,
flufenpyr, pyraflufen, fluthiacet, butafenacil, carfentrazone, sulfentrazone,
and the diphenylethers
(such as acifluorfen, fomesafen, lactofen, and oxyfluorfen).
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
12
Additionally, AAD-1 alone or stacked with one or more additional HTC traits
can be stacked
with one or more additional input (e.g., insect resistance, fungal resistance,
or stress tolerance, et al.)
or output (e.g., increased yield, improved oil profile, improved fiber
quality, et al.) traits. Thus, the
subject invention can be used to provide a complete agronomic package of
improved crop quality
with the ability to flexibly and cost effectively control any number of
agronomic pests.
As used herein, a "line" is a group of plants that display little or no
genetic variation between
individuals for at least one trait. Such lines may be created by several
generations of self-pollination
and selection, or vegetative propagation from a single parent using tissue or
cell culture techniques.
As used herein, the terms "cultivar" and "variety" are synonymous and refer to
a line which
is used for commercial production.
"Stability" or "stable" means that with respect to the given component, the
component is
maintained from generation to generation and, preferably, at least three
generations at substantially
the same level, e.g., preferably 15%, more preferably 10%, most preferably
5%. The stability
may be affected by temperature, location, stress and the time of planting.
Comparison of subsequent
generations under field conditions should produce the component in a similar
manner.
"Commercial Utility" is defined as having good plant vigor and high fertility,
such that the
crop can be produced by farmers using conventional farming equipment, and the
oil with the
described components can be extracted from the seed using conventional
crushing and extraction
equipment. To be commercially useful, the yield, as measured by seed weight,
oil content, and total
oil produced per acre, is within 15% of the average yield of an otherwise
comparable commercial
maize variety without the premium value traits grown in the same region.
"Agronomically elite" means that a line has desirable agronomic
characteristics such as
yield, maturity, disease resistance, and the like, in addition to insect
resistance due to the subject
event(s). Agronomic traits, taken individually or in any combination.
As one skilled in the art will recognize in light of this disclosure,
preferred embodiments of
detection kits, for example, can include probes and/or primers. For example,
this includes a
polynucleotide probes, primers, and/or amplicons as indicated herein.
One skilled in the art will also recognize that primers and probes can be
designed to
hybridize, under a range of standard hybridization and/or PCR conditions, to a
segment of SEQ ID
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
13
NO:1 (or the complement), and complements thereof, wherein the primer or probe
is not perfectly
complementary to the exemplified sequence. That is, some degree of mismatch
can be tolerated.
For an approximately 20 nucleotide primer, for example, typically one or two
or so nucleotides do
not need to bind with the opposite strand if the mismatched base is internal
or on the end of the
primer that is opposite the amplicon. Various appropriate hybridization
conditions are provided
below. Synthetic nucleotide analogs, such as inosine, can also be used in
probes. Peptide nucleic
acid (PNA) probes, as well as DNA and RNA probes, can also be used. What is
important is that
such probes and primers are diagnostic for (able to uniquely identify and
distinguish) the presence of
an event of the subject invention.
The components of each of the "inserts" are illustrated in Figures 1 through
3. The DNA
polynucleotide sequences of these components, or fragments thereof, can be
used as DNA primers or
probes in the methods of the present invention.
In some embodiments of the invention, compositions and methods are provided
for detecting
the presence of the transgene/genomic insertion region, in plants and seeds
and the like, from a corn
plant.
In some embodiments, DNA sequences that comprise a contiguous fragment of the
novel
transgene/genomic insertion region are an aspect of this invention. Included
are DNA sequences
that comprise a sufficient length of polynucleotides of transgene insert
sequence and a sufficient
length of polynucleotides of corn genomic sequence and/or sequences that are
useful as primer
sequences for the production of an amplicon product diagnostic for one or more
of these corn plants.
Related embodiments pertain to DNA sequences that comprise at least 2, 3, 4,
5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more
contiguous nucleotides of a
transgene portion of a DNA sequence identified herein, or complements thereof
Such sequences
can be useful as DNA primers in DNA amplification methods. The amplicons
produced using these
primers are diagnostic for the corn event referred to herein. Therefore, the
invention also includes
amplicons and amplicons produced by such DNA primers and homologous primers.
This invention includes methods of detecting the presence of DNA, in a sample,
that
corresponds to the corn event referred to herein. Such methods can comprise:
(a) contacting the
sample comprising DNA with a primer set that, when used in a nucleic acid
amplification reaction
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
14
with DNA from at least one of these corn events, produces an amplicon that is
diagnostic for said
event(s); (b) performing a nucleic acid amplification reaction, thereby
producing the amplicon; and
(c) detecting the amplicon.
Further detection methods of the subject invention include a method of
detecting the
presence of a DNA, in a sample, corresponding to at least one of said events,
wherein said method
comprises: (a) contacting the sample comprising DNA with a probe that
hybridizes under stringent
hybridization conditions with DNA from at least one of said corn events and
which does not
hybridize under the stringent hybridization conditions with a control corn
plant (non-event-of-
interest DNA); (b) subjecting the sample and probe to stringent hybridization
conditions; and (c)
detecting hybridization of the probe to the DNA.
This invention includes methods of detecting the presence of DNA, in a sample,
from at least
one of the maize plants referred to herein. Such methods can comprise: (a)
contacting the sample
comprising DNA with a primer set that, when used in a nucleic acid
amplification reaction, of the
subject invention, with DNA from at least one of these maize events; (b)
performing a TAQMAN
PCR amplification reaction using a reference gene identified herein; and (c)
analyzing the results.
In still further embodiments, the subject invention includes methods of
producing a corn
plant comprising the AAD-1 event of the subject invention, wherein said method
comprises the steps
of: (a) sexually crossing a first parental corn line (comprising an expression
cassettes of the present
invention, which confers said herbicideresistance trait to plants of said
line) and a second parental
corn line (that lacks this herbicide tolerance trait) thereby producing a
plurality of progeny plants;
and (b) selecting a progeny plant by the use of molecular markers. Such
methods may optionally
comprise the further step of back-crossing the progeny plant to the second
parental corn line to
producing a true-breeding corn plant that comprises said herbicide tolerance
trait.
According to another aspect of the invention, methods of determining the
zygosity of
progeny of a cross involving the subject event are provided. Said methods can
comprise contacting
a sample, comprising corn DNA, with a primer set of the subject invention.
Said primers, when used
in a nucleic-acid amplification reaction with genomic DNA from at least one of
said corn events,
produce a first amplicon that is diagnostic for at least one of said corn
events. Such methods further
comprise performing a nucleic acid amplification reaction, thereby producing
the first amplicon;
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
detecting the first amplicon; and contacting the sample comprising corn DNA
with said primer set,
when used in a nucleic-acid amplification reaction with genomic DNA from corn
plants, produces a
second amplicon comprising the native corn genomic DNA homologous to the corn
genomic region;
and performing a nucleic acid amplification reaction, thereby producing the
second amplicon. The
5 methods further comprise detecting the second amplicon, and comparing the
first and second
amplicons in a sample, wherein the presence of both amplicons indicates that
the sample is
heterozygous for the transgene insertion.
DNA detection kits can be developed using the compositions disclosed herein
and methods
well known in the art of DNA detection. The kits are useful for identification
of the subject corn
10 event DNA in a sample and can be applied to methods for breeding corn
plants containing this DNA.
The kits contain DNA sequences homologous or complementary to the amplicons,
for example,
disclosed herein, or to DNA sequences homologous or complementary to DNA
contained in the
transgene genetic elements of the subject events. These DNA sequences can be
used in DNA
amplification reactions or as probes in a DNA hybridization method. The kits
may also contain the
15 reagents and materials necessary for the performance of the detection
method.
A "probe" is an isolated nucleic acid molecule which is attached to a
conventional detectable
label or reporter molecule (such as a radioactive isotope, ligand,
chemiluminescent agent, or
enzyme). Such a probe is complementary to a strand of a target nucleic acid,
in the case of the
present invention, to a strand of genomic DNA from one of said corn events,
whether from a corn
plant or from a sample that includes DNA from the event. Probes according to
the present invention
include not only deoxyribonucleic or ribonucleic acids but also polyamides and
other probe
materials that bind specifically to a target DNA sequence and can be used to
detect the presence of
that target DNA sequence.
"Primers" are isolated/synthesized nucleic acids that are annealed to a
complementary target
DNA strand by nucleic acid hybridization to form a hybrid between the primer
and the target DNA
strand, then extended along the target DNA strand by a polymerase, e.g., a DNA
polymerase. Primer
pairs of the present invention refer to their use for amplification of a
target nucleic acid sequence,
e.g., by the polymerase chain reaction (PCR) or other conventional nucleic-
acid amplification
methods.
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
16
Probes and primers are generally 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48,
49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60,61, 62, 63, 64, 65, 66, 67,68,
69,70, 71,72, 73, 74, 75,
76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,
95, 96, 97, 98, 99, 100, 101,
102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116,
117, 118, 119, 120, 121,
122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136,
137, 138, 139, 140, 141,
142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156,
157, 158, 159, 160, 161,
162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176,
177, 178, 179, 180, 181,
182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196,
197, 198, 199, 200, 201,
202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216,
217, 218, 219, 220, 221,
222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236,
237, 238, 239, 240, 241,
242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256,
257, 258, 259, 260, 261,
262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276,
277, 278, 279, 280, 281,
282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296,
297, 298, 299, 300, 301,
302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316,
317, 318, 319, 320, 321,
322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336,
337, 338, 339, 340, 341,
342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356,
357, 358, 359, 360, 361,
362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376,
377, 378, 379, 380, 381,
382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396,
397, 398, 399, 400, 401,
402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416,
417, 418, 419, 420, 421,
422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436,
437, 438, 439, 440, 441,
442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456,
457, 458, 459, 460, 461,
462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476,
477, 478, 479, 480, 481,
482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496,
497, 498, 499, or 500
polynucleotides or more in length. Such probes and primers hybridize
specifically to a target
sequence under high stringency hybridization conditions. Preferably, probes
and primers according
to the present invention have complete sequence similarity with the target
sequence, although probes
differing from the target sequence and that retain the ability to hybridize to
target sequences may be
designed by conventional methods.
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
17
Methods for preparing and using probes and primers are described, for example,
in
Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, ed. Sambrook et
at., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. PCR-primer pairs can
be derived from a
known sequence, for example, by using computer programs intended for that
purpose.
Primers and probes based on the flanking DNA and insert sequences disclosed
herein can be
used to confirm (and, if necessary, to correct) the disclosed sequences by
conventional methods, e.g.,
by re-cloning and sequencing such sequences.
The nucleic acid probes and primers of the present invention hybridize under
stringent
conditions to a target DNA sequence. Any conventional nucleic acid
hybridization or amplification
method can be used to identify the presence of DNA from a transgenic event in
a sample. Nucleic
acid molecules or fragments thereof are capable of specifically hybridizing to
other nucleic acid
molecules under certain circumstances. As used herein, two nucleic acid
molecules are said to be
capable of specifically hybridizing to one another if the two molecules are
capable of forming an
anti-parallel, double-stranded nucleic acid structure. A nucleic acid molecule
is said to be the
"complement" of another nucleic acid molecule if they exhibit complete
complementarity. As used
herein, molecules are said to exhibit "complete complementarity" when every
nucleotide of one of
the molecules is complementary to a nucleotide of the other. Two molecules are
said to be
"minimally complementary" if they can hybridize to one another with sufficient
stability to permit
them to remain annealed to one another under at least conventional "low-
stringency" conditions.
Similarly, the molecules are said to be "complementary" if they can hybridize
to one another with
sufficient stability to permit them to remain annealed to one another under
conventional "high-
stringency" conditions. Conventional stringency conditions are described by
Sambrook et al., 1989.
Departures from complete complementarity are therefore permissible, as long as
such departures do
not completely preclude the capacity of the molecules to form a double-
stranded structure. In order
for a nucleic acid molecule to serve as a primer or probe it need only be
sufficiently complementary
in sequence to be able to form a stable double-stranded structure under the
particular solvent and salt
concentrations employed.
As used herein, a substantially homologous sequence is a nucleic acid sequence
that will
specifically hybridize to the complement of the nucleic acid sequence to which
it is being compared
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
18
under high stringency conditions. The term "stringent conditions" is
functionally defined with regard
to the hybridization of a nucleic-acid probe to a target nucleic acid (i.e.,
to a particular nucleic-acid
sequence of interest) by the specific hybridization procedure discussed in
Sambrook et at., 1989, at
9.52-9.55. See also, Sambrook et at., 1989 at 9.47-9.52 and 9.56-9.58.
Accordingly, the nucleotide
sequences of the invention may be used for their ability to selectively form
duplex molecules with
complementary stretches of DNA fragments.
Depending on the application envisioned, one can use varying conditions of
hybridization to
achieve varying degrees of selectivity of probe towards target sequence. For
applications requiring
high selectivity, one will typically employ relatively stringent conditions to
form the hybrids, e.g.,
one will select relatively low salt and/or high temperature conditions, such
as provided by about 0.02
M to about 0.15 M NaC1 at temperatures of about 50 C to about 70 C.
Stringent conditions, for
example, could involve washing the hybridization filter at least twice with
high-stringency wash
buffer (0.2X SSC, 0.1% SDS, 65 C). Appropriate stringency conditions which
promote DNA
hybridization, for example, 6.0X sodium chloride/sodium citrate (SSC) at about
45 C, followed by a
wash of 2.0X SSC at 50 C are known to those skilled in the art. For example,
the salt concentration
in the wash step can be selected from a low stringency of about 2.0X SSC at 50
C to a high
stringency of about 0.2X SSC at 50 C. In addition, the temperature in the
wash step can be
increased from low stringency conditions at room temperature, about 22 C, to
high stringency
conditions at about 65 C. Both temperature and salt may be varied, or either
the temperature or the
salt concentration may be held constant while the other variable is changed.
Such selective
conditions tolerate little, if any, mismatch between the probe and the
template or target strand.
Detection of DNA sequences via hybridization is well-known to those of skill
in the art, and the
teachings of U.S. Patent Nos. 4,965,188 and 5,176,995 are exemplary of the
methods of
hybridization analyses.
In a particularly preferred embodiment, a nucleic acid of the present
invention will
specifically hybridize to one or more of the primers (or amplicons or other
sequences) exemplified
or suggested herein, including complements and fragments thereof, under high
stringency
conditions. In one aspect of the present invention, a nucleic acid molecule of
the present invention
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
19
has the nucleic acid sequence set forth in SEQ ID NOS:2-7, or complements
and/or fragments
thereof
In another aspect of the present invention, a marker nucleic acid molecule of
the present
invention shares between 80% and 100% or 90% and 100% sequence identity with
such nucleic acid
sequences. In a further aspect of the present invention, a marker nucleic acid
molecule of the present
invention shares between 95% and 100% sequence identity with such sequence.
Such sequences
may be used as markers in plant breeding methods to identify the progeny of
genetic crosses. The
hybridization of the probe to the target DNA molecule can be detected by any
number of methods
known to those skilled in the art, these can include, but are not limited to,
fluorescent tags,
radioactive tags, antibody based tags, and chemiluminescent tags.
Regarding the amplification of a target nucleic acid sequence (e.g., by PCR)
using a
particular amplification primer pair, "stringent conditions" are conditions
that permit the primer pair
to hybridize only to the target nucleic-acid sequence to which a primer having
the corresponding
wild-type sequence (or its complement) would bind and preferably to produce a
unique amplification
product, the amplicon.
The term "specific for (a target sequence)" indicates that a probe or primer
hybridizes under
stringent hybridization conditions only to the target sequence in a sample
comprising the target
sequence.
As used herein, "amplified DNA" or "amplicon" refers to the product of nucleic-
acid
amplification of a target nucleic acid sequence that is part of a nucleic acid
template. For example,
to determine whether the corn plant resulting from a sexual cross contains
transgenic event genomic
DNA from the corn plant of the present invention, DNA extracted from a corn
plant tissue sample
may be subjected to nucleic acid amplification method using a primer pair that
includes a primer
derived from flanking sequence in the genome of the plant adjacent to the
insertion site of inserted
heterologous DNA, and a second primer derived from the inserted heterologous
DNA to produce an
amplicon that is diagnostic for the presence of the event DNA. The amplicon is
of a length and has a
sequence that is also diagnostic for the event. The amplicon may range in
length from the combined
length of the primer pairs plus one nucleotide base pair, and/or the combined
length of the primer
pairs plus about 2, 3, 4, 5, 6, 7, 8,9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20, 21, 22, 23, 24, 25, 26,
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45,
46, 47, 48, 49, 50, 51, 52, 53,
54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72,
73, 74, 75, 76, 77, 78, 79, 80,
81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99,
100, 101, 102, 103, 104, 105,
106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120,
121, 122, 123, 124, 125,
5 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139,
140, 141, 142, 143, 144, 145,
146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160,
161, 162, 163, 164, 165,
166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180,
181, 182, 183, 184, 185,
186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200,
201, 202, 203, 204, 205,
206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220,
221, 222, 223, 224, 225,
10 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239,
240, 241, 242, 243, 244, 245,
246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260,
261, 262, 263, 264, 265,
266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280,
281, 282, 283, 284, 285,
286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300,
301, 302, 303, 304, 305,
306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320,
321, 322, 323, 324, 325,
15 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339,
340, 341, 342, 343, 344, 345,
346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360,
361, 362, 363, 364, 365,
366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380,
381, 382, 383, 384, 385,
386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400,
401, 402, 403, 404, 405,
406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420,
421, 422, 423, 424, 425,
20 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439,
440, 441, 442, 443, 444, 445,
446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460,
461, 462, 463, 464, 465,
466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480,
481, 482, 483, 484, 485,
486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, or 500,
750, 1000, 1250, 1500,
1750, 2000, or more nucleotide base pairs (plus or minus any of the increments
listed above).
Alternatively, a primer pair can be derived from flanking sequence on both
sides of the inserted
DNA so as to produce an amplicon that includes the entire insert nucleotide
sequence. A member of
a primer pair derived from the plant genomic sequence may be located a
distance from the inserted
DNA sequence. This distance can range from one nucleotide base pair up to
about twenty thousand
CA 02771581 2016-12-15
55006-19
.
.
21
nucleotide base pairs. The use of the term "amplicon" specifically excludes
primer dimers that may
be formed in the DNA thermal amplification reaction.
Nucleic-acid amplification can be accomplished by any of the various nucleic-
acid
amplification methods known in the art, including the polymerase chain
reaction (PCR). A variety of
amplification methods are known in the art and are described, inter alia, in
U.S. Patent
No. 4,683,195 and U.S. Patent No. 4,683,202. PCR amplification methods have
been developed to
amplify up to 22 kb of genomic DNA. These methods as well as other methods
known in the art of
DNA amplification may be used in the practice of the present invention. The
sequence of the
heterologous transgene DNA insert or flanking genomic sequence from a subject
corn event can be
verified (and corrected if necessary) by amplifying such sequences from the
event using primers
derived from the sequences provided herein followed by standard DNA sequencing
of the PCR
amplicon or of the cloned DNA.
The amplicon produced by these methods may be detected by a plurality of
techniques.
Agarose gel electrophoresis and staining with ethidium bromide is a common
well known method of
detecting DNA amplicons. Another such method is Genetic Bit Analysis where an
DNA
oligonucleotide is designed which overlaps both the adjacent flanking genomic
DNA sequence and
the inserted DNA sequence. The oligonucleotide is immobilized in wells of a
microwell plate.
Following PCR of the region of interest (using one primer in the inserted
sequence and one in the
adjacent flanking genomic sequence), a single-stranded PCR product can be
hybridized to the
immobilized oligonucleotide and serve as a template for a single base
extension reaction using a
DNA polymerase and labeled ddNTPs specific for the expected next base. Readout
may be
fluorescent or ELISA-based. A signal indicates presence of the insert/flanking
sequence due to
successful amplification, hybridization, and single base extension.
The following abbreviations are used unless otherwise indicated.
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
22
AAD-1 aryloxyalkanoate dioxygenase-1
bp base pair
C degrees Celcius
DNA deoxyribonucleic acid
DIG digoxigenin
EDTA ethylenediaminetetraacetic acid
kb kilobase
1-ig microgram
ilL microliter
mL milliliter
M molar mass
OLP overlapping probe
PCR polymerase chain reaction
PTU plant transcription unit
SDS sodium dodecyl sulfate
SOP standard operating procedure
SSC a buffer solution containing a mixture of sodium
chloride and sodium
citrate, pH 7.0
TBE a buffer solution containing a mixture of Tris base,
boric acid and EDTA,
pH 8.3
V volts
EXAMPLES
Example 1. Event Specific Taqman Assay
An event specific Taqman assay was developed to detect the presence of maize
event
DAS-40278-9 and to determine zygosity status of plants in breeding
populations. To develop an
event specific assay, specific Taqman primers and probes were designed
according to the DNA
sequences located in the 5' insert-to-plant junction. For specific detection
of DAS-40278-9, a
73-bp DNA fragment that spans this 5'-integration junction was amplified using
two specific
primers. The amplification of this PCR product was measured by a target-
specific MGB probe
synthesized by Applied Biosystems containing the FAM reporter at its 5'end.
Specificity of this
Taqman detection method for AAD-1 corn event DAS-40278-9 was tested against 16
different
AAD-1 corn events and non-transgenic corn variety in duplex format with the
corn specific
endogenous reference gene, Invertase.
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
23
Example 1.1. gDNA Isolation
gDNA samples of 16 different AAD-1 corn events and non-transgenic corn
varieties
were tested in this study. gDNA was extracted with two approaches, Qiagen kit
or CTAB. For
the gDNA samples extracted with the Qiagen kit, eight corn fresh leaf discs
were used for gDNA
extraction according to a modified Qiagen DNeasy 96 Plant Kit protocol. For
the gDNA samples
extracted by using CTAB procedure, about 0.3 g lyophilized leaf tissue was
used following a
protocol from Permingeat et al., 1998. gDNA was quantified with the Pico Green
method
according to vendor's instructions (Molecular Probes, Eugene, OR). The gDNA
samples were
diluted with DNase-free water resulting in a concentration of 10 ng/iat for
the purpose of this
study.
Example 1.2. Taqman Assay and Results
Specific Taqman primers and probes were designed for the DAS-40278-9 event
specific
Taqman assay. These reagents can be used with the conditions listed below to
detect AAD-1
corn event DAS-40278-9. Table 1 lists the primer and probe sequences that were
developed
specifically for the detection of event DAS-40278-9.
Table 1. PCR Primers and Probes
Event Target Reaction
Descriptio
Name n 5 to 3' sequence
Corn278-F Forward
Seq ID NO:2: 5' ¨ ATTCTGGCTTTGCTGTAAATCGT ¨3'
Primer
Corn278-R Reverse
Seq ID NO: 3: 5' ¨ TTACAATCAACAGCACCGTACCTT ¨3'
Primer
Corn278- Seq ID NO: 4: 5' ¨ FAM- CTAACCTTCATTGTATTCC-MGB
Probe
Probe ¨3'
Invertase Reference System Reaction
Descriptio
Name n 5' to 3' sequence
Forward
IVF Seq ID NO: 5: 5' ¨ TGGCGGACGACGACTTGT ¨3'
Primer
CA 02771581 2012-02-17
WO 2011/022471
PCT/US2010/045871
24
Reverse
IVR Seq ID NO: 6: 5' ¨ AAAGTTTGGAGGCTGCCGT ¨3'
Primer
Seq ID NO: 7:5' ¨HEX-
IV-Probe Probe
CGAGCAGACCGCCGTGTACTTCTACC-BHQ2 ¨3'
The multiplex PCR conditions for amplification are as follows: 1X PCR buffer,
.5 - 2.5
mM MgC12, .2 mM dNTP, 0.2 jaM Primer Corn-278-F, 0.2 jaM Primer Corn-278-R,
0.2 jaM
Primer IV-F, 0.2 jaM Primer IV-R, 0.08 jaM Probe Corn-278-Probe, 0.08 uM Probe
IV-probe,
40 U/mL HotStart Taq, 0.6 to 2.4 ug/mL DNA in a total reaction of 25 pl.
Various
concentrations of MgC12 and DNA were tested. Concentrations of .5 mM, 1.0 mM,
1.8 mM, and
2.5 mM of MgC12 were used. The cocktail was amplified using the following
conditions: i)
95 C for 15 min., ii) 95 C for 20 sec, iii) 60 C for 60 sec, iv) repeat step
ii-iii for 50 cycles, v)
4 C hold. The Real time PCR was carried out on Bio-rad iCyclerTM system. Data
analysis was
based on measurement of the cycle threshold (CT), which is the PCR cycle
number when the
fluorescence measurement reaches a set value. CT value was calculated
automatically by iCycler
software.
The amplicon sequences generated using the above primers were as follows:
278F and 278R:
ttacaatcaacagcaccgtaccttgaagcggaatacaatgaaggttagctacgatttacagcaaagccagaat
(SEQ ID NO:8)
IVF and IVR:
tggcggacgacgacttgtccgagcagaccgccgtgtacttctacctgctcaagggcacggacggcagcctccaaacttt
(SEQ ID NO:9)
The Taqman detection method for AAD-1 corn event DAS-40278-9 was tested
against
16 different AAD-1 corn events and non-transgenic corn variety in duplex
format with corn
specific endogenous Invertase as a reference gene. This assay specifically
detected the AAD-1
corn event DAS-40278-9 and did not produce or amplify any false-positive
results from the
controls (i.e. the 16 different AAD-1 corn events and non-transgenic corn
varieties). The event
specific primers and probes can be used for the detection of the AAD-1 corn
event DAS-40278-9
CA 02771581 2012-02-17
and these conditions and reagents are applicable for zygosity assays.
SEQUENCE LISTING IN ELECTRONIC FORM
In accordance with Section 111(1) of the Patent Rules, this
description contains a sequence listing in electronic form in ASCII
text format (file: 54323-15 Seq 09-FEB-12 vl.txt).
A copy of the sequence listing in electronic form is available from
the Canadian Intellectual Property Office.
The sequences in the sequence listing in electronic form are
reproduced in the following table.
SEQUENCE TABLE
<110> Dow AgroSciences LLC
<120> DETECTION OF AAD-1 EVENT DAS-40278-9
<130> 54323-15
<140> CA national phase of PCT/US2010/045871
<141> 2010-08-18
<150> US 61/235,248
<151> 2009-08-19
<150> US 61/237,366
<151> 2010-04-23
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 8557
<212> DNA
<213> Artificial Sequence
<220>
<223> AAD-1 insert and flanking sequences
CA 02771581 2012-02-17
25a
<400> 1
actggtattt aatatacttt aataaatatt attagattcc tcgtcaaaga actttttaca 60
atatatctat ttagaatcat atatgtcata gttttttttc taagagtcta gtttactagt 120
aaaatccgac tcacattttt cgaacttggg atgcaacact taaatagtac aaaaccttgg 180
tatgcagtat tttacattgt aagattcaaa atttctaaag cagtatatat atgtttccag 240
aaacttatag atatagaaaa aacagagaga cgtatgcgaa aattcgataa aggtgtacat 300
tggattcgca aggctaaata catatttatc gtggatccat gcagagtttg ggtaataaaa 360
ttagatactt ccaatcatgt gccacataat cacgtaacat tagtaattta aatgacatta 420
ccatgtccaa ctgatttaaa acacaaactc ttcttgaacc atatagtttg acaaaccaaa 480
tatatataac tggagctact agttatgaat caattaaaaa ttactttgaa gattcaacgt 540
agtgccagtt tggctctagc acatctaacc agaagggcta aggctggctt caacaggaac 600
agccaaatcc gagatcgagc catttgccat ttttgggtag ttagtttaac tttcatatat 660
cttcccatcc ttttttgcct agcctaaatg gctttgatgt tgaagaccat attaatttgc 720
ttcagtggca ctaggacaac catattggct ttggctgacc cgttagagtt agcctaatgg 780
gtggaagggg agggaagggg aggatcgatg gtggcatgag agaggggttg acgatcacga 840
tgatgatgcg agtgaggagg agagggtggc gacgacacag gggagaaagg agagggacgc 900
taggagcgtc aagggcgtgg gggaggggag ggtcggaggg atgaaggatg acctaaatat 960
tattgttgag tgatagaggg ttattcaact atccgacccg tcgattttga tggtatgtta 1020
aatttgtgtg tcatttgttt gatggattta gtaaaggtta tgggtctaga ggtgattttt 1080
gttgggtggg ttttacagag tttaaactag cggattatat agtggtatag aagatatagt 1140
tttattagaa catctccaaa atgtgactcg aaataatacc cccaaaattt aaaatactac 1200
atcattttga taaaaaaggt aaagtagagc actgttggaa cagtttttaa aagttgtgcc 1260
ctatatttta aaatagggta ctgatttaaa atattgttgt gggggataga tatcccaggg 1320
tccactagaa ggcgagaagg cctcgcgtgt ggccacgggc cagttacccc gcaaggccat 1380
cccttcgtgg gtcgagctag aattactggt agaatgggct gaccgaagaa ggcaacagac 1440
tcgagcccaa acaatccatc ggctcgtgcg ctatccacag aaactacccg actttccggc 1500
gcatggcatc ctagaatatc ggggcgtatt agggatgagt cagcgagatt ttcggaagat 1560
tagttcagtt tgttcgctat tatttaggag acatatgatc ctcatgtacg tatggagtgc 1620
cccacggtcg tgtatataag gtccagaggg taccccatca tttctatcga ccatctacct 1680
atctcatcag cttttctcca ttcaggagac ctcgcttgta acccaccaca tatagatcca 1740
tcccaagaag tagtgtatta cgcctctcta agcggcccaa acttgcagaa aaccgcctat 1800
ccctctctcg tgcgtccagc acgaaccatt gagttacaat caacagcacc gtaccttgaa 1860
gcggaataca atgaaggtta gctacgattt acagcaaagc cagaatacaa tgaaccataa 1920
agtgattgaa gctcgaaata tacgaaggaa caaatatttt taaaaaaata cgcaatgact 1980
tggaacaaaa gaaagtgata tattttttgt tcttaaacaa gcatcccctc taaagaatgg 2040
cagttttcct ttgcatgtaa ctattatgct cccttcgtta caaaaatttt ggactactat 2100
tgggaacttc ttctgaaaat agtggccacc gcttaattaa ggcgcgccat gcccgggcaa 2160
gcggccgctt aattaaattt aaatgtttaa actaggaaat ccaagcttgc atgcctgcag 2220
atccccgggg atcctctaga gtcgacctgc agtgcagcgt gacccggtcg tgcccctctc 2280
tagagataat gagcattgca tgtctaagtt ataaaaaatt accacatatt ttttttgtca 2340
cacttgtttg aagtgcagtt tatctatctt tatacatata tttaaacttt actctacgaa 2400
taatataatc tatagtacta caataatatc agtgttttag agaatcatat aaatgaacag 2460
ttagacatgg tctaaaggac aattgagtat tttgacaaca ggactctaca gttttatctt 2520
tttagtgtgc atgtgttctc cttttttttt gcaaatagct tcacctatat aatacttcat 2580
ccattttatt agtacatcca tttagggttt agggttaatg gtttttatag actaattttt 2640
ttagtacatc tattttattc tattttagcc tctaaattaa gaaaactaaa actctatttt 2700
agttttttta tttaatagtt tagatataaa atagaataaa ataaagtgac taaaaattaa 2760
acaaataccc tttaagaaat taaaaaaact aaggaaacat ttttcttgtt tcgagtagat 2820
aatgccagcc tgttaaacgc cgtcgacgag tctaacggac accaaccagc gaaccagcag 2880
cgtcgcgtcg ggccaagcga agcagacggc acggcatctc tgtcgctgcc tctggacccc 2940
tctcgagagt tccgctccac cgttggactt gctccgctgt cggcatccag aaattgcgtg 3000
gcggagcggc agacgtgagc cggcacggca ggcggcctcc tcctcctctc acggcaccgg 3060
cagctacggg ggattccttt cccaccgctc cttcgctttc ccttcctcgc ccgccgtaat 3120
aaatagacac cccctccaca ccctctttcc ccaacctcgt gttgttcgga gcgcacacac 3180
acacaaccag atctccccca aatccacccg tcggcacctc cgcttcaagg tacgccgctc 3240
gtcctccccc cccccccccc tctctacctt ctctagatcg gcgttccggt ccatgcatgg 3300
CA 02771581 2012-02-17
25b
ttagggcccg gtagttctac ttctgttcat gtttgtgtta gatccgtgtt tgtgttagat 3360
ccgtgctgct agcgttcgta cacggatgcg acctgtacgt cagacacgtt ctgattgcta 3420
acttgccagt gtttctcttt ggggaatcct gggatggctc tagccgttcc gcagacggga 3480
tcgatttcat gatttttttt gtttcgttgc atagggtttg gtttgccctt ttcctttatt 3540
tcaatatatg ccgtgcactt gtttgtcggg tcatcttttc atgctttttt ttgtcttggt 3600
tgtgatgatg tggtctggtt gggcggtcgt tctagatcgg agtagaattc tgtttcaaac 3660
tacctggtgg atttattaat tttggatctg tatgtgtgtg ccatacatat tcatagttac 3720
gaattgaaga tgatggatgg aaatatcgat ctaggatagg tatacatgtt gatgcgggtt 3780
ttactgatgc atatacagag atgctttttg ttcgcttggt tgtgatgatg tggtgtggtt 3840
gggcggtcgt tcattcgttc tagatcggag tagaatactg tttcaaacta cctggtgtat 3900
ttattaattt tggaactgta tgtgtgtgtc atacatcttc atagttacga gtttaagatg 3960
gatggaaata tcgatctagg ataggtatac atgttgatgt gggttttact gatgcatata 4020
catgatggca tatgcagcat ctattcatat gctctaacct tgagtaccta tctattataa 4080
taaacaagta tgttttataa ttatttcgat cttgatatac ttggatgatg gcatatgcag 4140
cagctatatg tggatttttt tagccctgcc ttcatacgct atttatttgc ttggtactgt 4200
ttcttttgtc gatgctcacc ctgttgtttg gtgttacttc tgcagggtac ccccggggtc 4260
gaccatggct catgctgccc tcagccctct ctcccaacgc tttgagagaa tagctgtcca 4320
gccactcact ggtgtccttg gtgctgagat cactggagtg gacttgaggg aaccacttga 4380
tgacagcacc tggaatgaga tattggatgc cttccacact taccaagtca tctactttcc 4440
tggccaagca atcaccaatg agcagcacat tgcattctca agaaggtttg gaccagttga 4500
tccagtgcct cttctcaaga gcattgaagg ctatccagag gttcagatga tccgcagaga 4560
agccaatgag tctggaaggg tgattggtga tgactggcac acagactcca ctttccttga 4620
tgcacctcca gctgctgttg tgatgagggc catagatgtt cctgagcatg gcggagacac 4680
tgggttcctt tcaatgtaca cagcttggga gaccttgtct ccaaccatgc aagccaccat 4740
cgaagggctc aacgttgtgc actctgccac acgtgtgttc ggttccctct accaagcaca 4800
gaaccgtcgc ttcagcaaca cctcagtcaa ggtgatggat gttgatgctg gtgacagaga 4860
gacagtccat cccttggttg tgactcatcc tggctctgga aggaaaggcc tttatgtgaa 4920
tcaagtctac tgtcagagaa ttgagggcat gacagatgca gaatcaaagc cattgcttca 4980
gttcctctat gagcatgcca ccagatttga cttcacttgc cgtgtgaggt ggaagaaaga 5040
ccaagtcctt gtctgggaca acttgtgcac catgcaccgt gctgttcctg actatgctgg 5100
caagttcaga tacttgactc gcaccacagt tggtggagtt aggcctgccc gctgagtagt 5160
tagcttaatc acctagagct cgtttaaact gagggcactg aagtcgcttg acgtgctgaa 5220
ttgtttgtga tgttggtggc gtattttgtt taaataagta agcatggctg tgattttatc 5280
atatgatcga tctttggggt tttatttaac acattgtaaa atgtgtatct attaataact 5340
caatgtataa gatgtgttca ttcttcggtt gccatagatc tgcttatttg acctgtgatg 5400
ttttgactcc aaaaaccaaa atcacaactc aataaactca tggaatatgt ccacctgttt 5460
cttgaagagt tcatctacca ttccagttgg catttatcag tgttgcagcg gcgctgtgct 5520
ttgtaacata acaattgtta cggcatatat ccaatagcgg ccggcctcct gcagggttta 5580
aacttgccgt ggcctatttt cagaagaagt tcccaatagt agtccaaaat ttttgtaacg 5640
aagggagcat aatagttaca tgcaaaggaa aactgccatt ctttagaggg gatgcttgtt 5700
taagaacaaa aaatatatca ctttcttttg ttccaagtca ttgcgtattt ttttaaaaat 5760
atttgttcct tcgtatattt cgagcttcaa tcactttatg gttctttgta ttctggcttt 5820
gctgtaaatc gtagctaacc ttcttcctag cagaaattat taatacttgg gatatttttt 5880
tagaatcaag taaattacat attaccacca catcgagctg cttttaaatt catattacag 5940
ccatataggc ttgattcatt ttgcaaaatt tccaggatat tgacaacgtt aacttaataa 6000
tatcttgaaa tattaaagct attatgatta ggggtgcaaa tggaccgagt tggttcggtt 6060
tatatcaaaa tcaaaccaaa ccaactatat cggtttggat tggttcggtt ttgccgggtt 6120
ttcagcattt tctggttttt tttttgttag atgaatatta ttttaatctt actttgtcaa 6180
atttttgata agtaaatata tgtgttagta aaaattaatt ttttttacaa acatatgatc 6240
tattaaaata ttcttatagg agaattttct taataacaca tgatatttat ttattttagt 6300
cgtttgacta atttttcgtt gatgtacact ttcaaagtta accaaattta gtaattaagt 6360
ataaaaatca atatgatacc taaataatga tatgttctat ttaattttaa attatcgaaa 6420
tttcacttca aattcgaaaa agatatataa gaattttgat agattttgac atatgaatat 6480
ggaagaacaa agagattgac gcattttagt aacacttgat aagaaagtga tcgtacaacc 6540
aattatttaa agttaataaa aatggagcac ttcatattta acgaaatatt acatgccaga 6600
agagtcgcaa atatttctag atatttttta aagaaaattc tataaaaagt cttaaaggca 6660
= CA 02771581 2012-02-17
25c
tatatataaa aactatatat ttatattttt tacccaaaag caccgcaagg ggtagccctg 6720
ggtgtgcgga cggactctaa acaccgacag ctggcgcgcc aggtaggggg tgtgtctttg 6780
atctgagcta gctcaatgac cattacctcc aaatgcaaga tcgccottcg ccccgggact 6840
atgttttgct ttggaaccat ctcatccata gcagatgaag agggaactct gcaccgcata 6900
gcagatctat tggagaagaa gctttcctca gaaatctcga ggggagccag ggcagaacag 6960
cgggtggcac catcacccgc acctcaagcg aagatgacct cttacaaacc gaaagtcggg 7020
agctcaccta cccgaaaaac tccgctgtcc acttcgccca caaaggagtg gacacggatt 7080
actcgaaaga aggaagcgag tgtcccgagt caggggacgg gaacacgcca agccatcttt 7140
ccgacgcctt cgccctcaaa tgaggatgga aagaagagcg ccatcgcgct ggctcctttc 7200
taccccgacg tcctcttcat cagggggaga ttggagttag cacccgtctt caacgatgag 7260
ccaaccatgc aaggggaaga gcctccccag cgtgaggcgc gacgacggag gaatagaagc 7320
cagaacgtgc ggcgacatca cgaggctggg gaacgggatc cggcgcaacc cgtatcccgg 7380
gacgaagctt tagaagtagg aaaaactccc gacgagtggg tacaccgaga aaggcggaac 7440
tctcgccgcc gtgatcgccg acaagcttag gaccgagaac gagagcaagc cgagcaaggt 7500
gcaaggctgc gccgagagaa tgctctcttt gctcggaacc tgtaccccga cttcgctcgt 7560
gcaatgaaca cgccgagtga agtcggaggg gtactggccc agatagctga cggcctcccg 7620
cgaaccctag acacggaagg ctaccggcgg ctgcttactc gagcagttaa tcaccttcta 7680
cccatcacta atcctccaag cgacctacgc catgccatca acagccggcg agacacgcgg 7740
agctccatca acgcttcgcg cgaccgatga cacgaaagtg agatagggaa ccgagaggag 7800
tatgtccgag atcatgccat cctggcatga agtcatgcca cccgagctga gtcggttgcg 7860
gcctcgacca gtgtcccgtt ccagggacga tcaagatgac acacaactgg ctcccctcct 7920
tgggaccgac ctcacgaacg ccgacatgaa gacacgtgcg gagtcttcgc acttactccg 7980
tgtctccggg ccatccagtg gcccctaact tcaaggtctc caacgtcagc aagtatgagc 8040
gcaagcagga cctgggtggc tggttagcca tctacacgat tgtcacatgg gccgccggag 8100
cgacggagga cgtgatgaca gtgtattttc ccattgtcct agggcaagac gcaatgcagt 8160
ggctccgaca tctaccccaa cattgcatag acaattggag cgacttcagt tggtgcttca 8220
tcgccaactt ccagtccctc tttgacaagc cggcgcagcc atgggaccta aaatccattg 8280
ggcatcaggg cgatgaaacg ctccggttgt acctcaagag gttttagacc atgaggaacc 8340
acacccccga agtcgccgag gcgggggtga ttgaagactt ctaccgagga tccaatgact 8400
cggctttcgt ccgagccata ctccagaaaa gcgtcggcca cctccgaaca cttgttccgg 8460
gaggcagacc tctacatcac cacggattaa cgggcccagg acctcatcgg aggcacgaaa 8520
gccgcgccac acgcgccacg gtgtgacacg aaccagc 8557
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> forward event primer
<400> 2
attctggctt tgctgtaaat cgt 23
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> event reverse primer
<400> 3
ttacaatcaa cagcaccgta cctt 24
CA 02771581 2012-02-17
=
25d
<210> 4
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> event probe
<400> 4
ctaaccttca ttgtattcc 19
<210> 5
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> reference forward primer
<400> 5
tggcggacga cgacttgt 18
<210> 6
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> reference reverse primer
<400> 6
aaagtttgga ggctgccgt 19
<210> 7
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> reference probe
<400> 7
cgagcagacc gccgtgtact tctacc 26
<210> 8
<211> 73
<212> DNA
<213> Artificial Sequence
<220>
<223> event amplicon
CA 02771581 2012-02-17
=
25e
<400> 8
ttacaatcaa cagcaccgta ccttgaagcg gaatacaatg aaggttagct acgatttaca 60
gcaaagccag aat 73
<210> 9
<211> 79
<212> DNA
<213> Artificial Sequence
<220>
<223> reference amplicon
<400> 9
tggcggacga cgacttgtcc gagcagaccg ccgtgtactt ctacctgctc aagggcacgg 60
acggcagcct ccaaacttt 79
