Note: Descriptions are shown in the official language in which they were submitted.
81714991
Brassica plants comprising mutant FAD3 alleles
FIELD OF THE INVENTION
[1] This invention relates to crop plants and parts, particularly of the
Brassicaceae
family, in particular Brassica species, with improved fatty acid composition,
more
specifically, reduced alpha-linolenic acid content in seed. This invention
also relates to a
fatty acid desaturases and nucleic acids encoding desaturase proteins. More
particularly,
this invention relates to nucleic acids encoding delta-15 fatty acid
desaturase proteins,
and mutants thereof, that affect fatty acid composition in plant seed oil.
Methods are also
provided to identify molecular markers associated with reduced alpha-linolenic
acid
content in seed in a population of plants.
BACKGROUND OF THE INVENTION
[2] Vegetable oils are increasingly important economically because they are
widely
used in human and animal diets and in many industrial applications. However,
the fatty
- acid compositions of these oils are often not optimal for many of these
uses. Because
specialty oils with particular fatty acid composition are needed for both
nutritional and
industrial purposes, there is considerable interest in modifying oil
composition by plant
breeding and/or by new molecular tools of plant biotechnology.
[3] The specific performance and health attributes of edible oils are
determined
largely by their fatty acid composition. Most vegetable oils derived from
commercial
plant varieties are composed primarily of palmitic (C16:0), stearic (C18:0),
oleic (C18:1),
linoleic (C18:2) and linolenic (C18:3) acids. Palmitic and stearic acids are,
respectively,
16 and 18 carbon-long, saturated fatty acids. Oleic, linoleic, and linolenic
acids are 18-
carbon-long, unsaturated fatty acids containing one, two, and three double
bonds,
respectively. Oleic acid is referred to as a mono-unsaturated fatty acid,
while linoleic and
linolenic acids are referred to as poly-unsaturated fatty acids.
1
CA 2781278 2019-06-14
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[4] Brassica species like Brassica napus (B. napus) and Brassica rapa (B.
rapa)
constitute the third most important source of vegetable oil in the world. hi
Canada, plant
scientists focused their efforts on creating so-called "double-low" varieties
which were
low in erucic acid in the seed oil and low in glucosinolates in the solid meal
remaining
after oil extraction (i.e., an erucic acid content of less than 2.0 percent by
weight based
upon the total fatty acid content (called herein after wt %), and a
glucosinolate content of
less than 30 micromoles per gram of the oil-free meal). These higher quality
forms of
rape developed in Canada are known as canola.
[5] Oil extracted from natural and previously commercially useful varieties
of canola
contains a relatively high (8%-10%) alpha-linolenic acid content (C18:3) (US
Patent
Application 20080034457). Higher values of e.g. 11 % have also been reported
(http://www.canolacouncil.org/canola_oil_properties_and_uses.aspx). This
trienoic fatty
acid is unstable and easily oxidized during cooking, which in turn creates off-
flavors of
the oil (Gailliard, 1980, Vol. 4, pp. 85-116 In: Stumpf, P. K., ed., The
Biochemistry of
Plants, Academic Press, New York). It also develops off odors and rancid
flavors during
storage (Hawrysh, 1990, Stability of canola oil, Chapter 7, pp. 99-122 In: F.
Shahidi, ed.
Canola and Rapeseed: Production, Chemistry, Nutrition, and Processing
Technology,
Van Nostrand Reinhold, New York). Both flavor and nutritional quality of the
oil is
improved by reducing the C18:3 levels in favor of C18:2 (Diepenbrock and
Wilson, Crop
Sci 27:75-77, 1987)
[6] It is known that reducing the alpha-linolenic acid content level by
hydrogenation
increases the oxidative stability of the oil. Unfortunately, chemical
hydrogenation leads
to the formation of trans-fatty acids, which have been linked to elevated
levels of low-
density lipoprotein cholesterol (LDL or "bad" cholesterol) in the blood, and
consequently,
to an increased risk of coronary heart disease.
[7] Another strategy to improve oil quality is by breeding for low
linolenic varieties,
which is particularly challenging since C18:3 content is a multi-gene trait
and inherited in
a recessive manner with a relatively low heritability (W004072259). Burns et
al.
2
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
(Heredity 90:39-48, 2003) identified five qualitative trait loci (QTL)
associated with
C18:3 content in B. napus, of which three with positive effect located on N6,
N7 and N18,
and two with negative effect on N7 and N11. Genetic analysis of a population
derived
from the cross between "Stellar" (having a low C18:3 content (3%)) and
"Draldcar'
(having a "conventional" C18:3 level (9-10%)) indicated that the low C18:3
trait was
controlled by two major loci with additive effects designated Li and L2
(Jourdren et at.,
Euphytica 90:351-357, 1996). These two major loci controlling C18:3 content
were
found to correspond to two FAD3 (fatty acid desaturase 3) genes; one located
on A
genome (originating from Brassica rapa) on N4 and the other on the C genome
(originating from Brassica oleracea) on N14 (Jourdren et al., Theor. Appl.
Genet.
93:512-518, 1996; Barret et al., GCIRC, 1999).
[8] Canola varieties with mutations in the FAD3 gene have been described in
the art.
For example, W006/034059 describes that two canola varieties with reduced
linolenic
acid content, IMC01 and IMCO2 (originally disclosed in US5750827 and US patent
application 20080034457, respectively) are thought to have mutations in FAD3
genes.
W004/072259 discloses a FAD3 allele (of the C genome) with a single nucleotide
substitution in a 5' splice site from a mutant canola line DMS100 with a
linolenic acid
content of about 3%. W001/25453 describes new FAD3 variants with multiple
amino
acid substitutions, one of which is also present in "Stellar", from the low
linolenic
"Apollo" variety. In US patent application 20040083503 a non-functional FAD3
mutant
is disclosed with an amino acid substitution in a conserved domain. However,
the
linolenic acid phenotype of canola plants comprising such mutant FAD3 alleles
can be
highly variable depending on the genetic background.
[9] Therefore, despite the fact that sequences of various FAD3 alleles are
available in
the art, a need remains for alternative methods (especially non-transgenic
methods) for
stably reducing the amount of alpha-linolenic acid in seed, without having a
negative
effect on the plants growth and development. The inventions described
hereinafter in the
different embodiments, examples and claims provide methods and means for
developing
crop plants which produce seed oil that is low in C18:3 content.
3
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
SUMMARY OF THE INVENTION
[10] The inventors have found that Brassica napus plants comprise five
different
FAD3 genes and that the levels of C18:3 in Brassica plants, particularly in
the seed oil of
said Brassica plants, can be controlled by controlling the number and/or types
of FAD3
genes/alleles that are "functionally expressed" in seeds, i.e. that result in
functional
(biologically active) FAD3 protein. By combining certain mutant alleles of the
five FAD3
genes ("fad3 alleles"), resulting in a reduction of the level of functional
FAD3 protein,
the level of C18:3 in the seed oil can be significantly reduced. It is thought
that the more
FAD3 mutant alleles are combined in a plant the greater the reduction in C18:3
seed oil
content will be, while remaining a normal plant growth and seed development.
[11] Thus, in a first aspect, the present invention provides in one embodiment
a
Brassica plant (and parts thereof, such as seeds) comprising at least two
mutant FAD3
alleles in its genome, wherein
i. the first mutant FAD3 allele is selected from the group consisting of
FAD3-Al
or FAD3-Cl; and
ii. the second mutant FAD3 allele is selected from the group consisting of
FAD3-
A2, FAD3-A3 or FAD3-C2.
wherein the seed oil of said plant displays a significant reduction in the
amount of total
alpha-linolenic acid (C18:3) present in the seed oil of a plant said mutant
FAD3 alleles
when compared to the seed oil of similar plants not comprising said mutant
FAD3
allele(s).
[12] The invention also provides a plant further comprising a third full knock-
out
mutant FAD3 allele, wherein said third full knock-out mutant FAD3 allele is
selected
from the group consisting of FAD3-A1 or FAD3-C1, whereby the mutant FAD3
alleles
are mutant alleles of at least three different FAD3 genes.
4
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[13] Also provided herein is a plant further comprising fourth full knock-out
mutant
FAD3 allele, wherein said fourth full knock-out mutant FAD3 allele is selected
from the
group consisting of FAD3-A2, FAD3-A3 or FAD3-C2, whereby the mutant FAD3
alleles
are mutant alleles of at least four different FAD3 genes.
[14] The invention furthermore provides a plant further comprising a fifth
full knock-
out mutant FAD3 allele, wherein said fifth full knock-out mutant FAD3 allele
is selected
from the group consisting of FAD3-A2, FAD3-A3 or FAD3-C2, whereby the mutant
FAD3 alleles are mutant alleles of at least five different FAD3 genes.
[15] In another aspect, the invention provides (isolated) nucleic acid
sequences
encoding wild type and/or mutant FAD3 proteins, as well as fragments thereof,
and
methods of using these nucleic acid sequences to modify the Brassica seed oil
composition. Also provided herein are the wild type and/or mutant FAD3
proteins
themselves and their use, as well as plants comprising these mutant FAD3
alleles and
FAD3 proteins.
[16] The invention further relates to a plant, and cells, parts, seeds and
progeny thereof,
comprising one or more knock-out mutant FAD3 alleles. In one aspect, the plant
comprises a reduced amount of functional FAD3 proteins compared to a plant,
and cells,
parts, seeds and progeny thereof, comprising a FAD3 allele encoding the
corresponding
functional FAD3 protein. Such plants, and cells, parts, seeds and progeny
thereof, can be
used for obtaining plants producing seed or grain with altered seed oil
composition, in
particular for obtaining Brassica plants producing seed or grain with a
significantly
reduced C18:3 seed oil content that preferably maintain an agronomically
suitable plant
development. As used herein, "plant part" includes anything derived from a
plant of the
invention, including plant parts such as cells, tissues, organs, seeds, seed
pods, seed meal,
seed cake, seed fats or oils.
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[17] In a further aspect, the invention relates to seed or grain with a
reduced C18:3 oil
content, which can be obtained from a plant according to the present
invention, and the
use of said seed or grain, for example for planting and growing progeny from
the plants
or for producing seed meal, seed cake, seed fats or oils.
[18] In yet another aspect of the invention, methods are provided for
generating and
selecting plants, and cells, parts, seeds, and progeny thereof, containing one
or more full
knock-out FAD3 alleles. In particular, methods are provided for generating and
selecting
Brassica plants comprising at least two FAD3 genes, in particular Brassica
napus plants,
and cells, parts, seeds and progeny thereof, containing at least two full
knock-out mutant
FAD3 alleles at at least two different loci in the gcnome (i.e. at least two
different FAD3
genes) and to distinguish between the presence of mutant FAD3 alleles and wild
type
FAD3 alleles in a plant or plant part. Thus methods are provided (such as
mutagenesis
and/or marker assisted selection) for generating and/or identifying mutant
FAD3 alleles
or plants or plant parts comprising such alleles and for combining a suitable
number of
mutant FAD3 alleles in a single plant, whereby the plant has a significantly
reduced
C18:3 seed oil content.
[19] Methods are also provided for using the plant, and cells, parts, seeds
and progeny
thereof; of the invention, for obtaining "low linolenic acid" seed oil from
crushed
Brassica seeds. As used herein, "plant product" includes anything derived from
a plant of
the invention, including plant parts such as seeds, seed meal, seed cake, seed
fats or oils.
GENERAL DEFINITIONS
[20] The term "nucleic acid sequence" (or nucleic acid molecule) refers to a
DNA or
RNA molecule in single or double stranded form, particularly a DNA encoding a
protein
or protein fragment according to the invention. An "endogenous nucleic acid
sequence"
refers to a nucleic acid sequence which is within a plant cell, e.g. an
endogenous allele of
a FAD3 gene present within the nuclear genome of a Brassica cell. An "isolated
nucleic
6
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
acid sequence" is used to refer to a nucleic acid sequence that is no longer
in its natural
environment, for example in vitro or in a recombinant bacterial or plant host
cell.
[21] The term "gene" means a DNA sequence comprising a region (transcribed
region),
which is transcribed into an RNA molecule (e.g. a pre-mRNA, comprising intron
sequences, which is then spliced into a mature mRNA) in a cell, operable
linked to
regulatory regions (e.g. a promoter). A gene may thus comprise several
operably linked
sequences, such as a promoter, a 5' leader sequence comprising e.g. sequences
involved
in translation initiation, a (protein) coding region (cDNA or genomic DNA) and
a 3' non-
translated sequence comprising e.g. transcription termination sites.
"Endogenous gene"
is used to differentiate from a "foreign gene", "transgene" or "chimeric
gene", and refers
to a gene from a plant of a certain plant genus, species or variety, which has
not been
introduced into that plant by transformation (i.e. it is not a `transgene'),
but which is
normally present in plants of that genus, species or variety, or which is
introduced in that
plant from plants of another plant genus, species or variety, in which it is
normally
present, by normal breeding techniques or by somatic hybridization, e.g., by
protoplast
fusion. Similarly, an "endogenous allele" of a gene is not introduced into a
plant or plant
tissue by plant transformation, but is, for example, generated by plant
mutagenesis and/or
selection or obtained by screening natural populations of plants.
[22] The terms "protein" or "polypeptide" are used interchangeably and refer
to
molecules consisting of a chain of amino acids, without reference to a
specific mode of
action, size, 3-dimensional structure or origin. A "fragment" or "portion" of
a FAD3
protein may thus still be referred to as a "protein". An "isolated protein" is
used to refer
to a protein which is no longer in its natural environment, for example in
vitro or in a
recombinant bacterial or plant host cell. An "enzyme" is a protein comprising
enzymatic
activity, such as functional FAD3 proteins, which are capable of desaturation
linoleic
acid to linolenic acid.
[23] As used herein "FAD3 protein", also known as "fatty acid desaturase 3",
"omega-
3 fatty acid desaturase" or "delta-15 desaturase", refers to an ER resident
protein that
7
81714991
introduces the the third double bond in the biosynthesis of C18:3 fatty acids.
Fatty acid
desaturases are iron-containing enzymes that catalyze the NAD-(P)H- and 02-
dependent
introduction of double bonds into methylene-interrupted fatty acyl chains.
Hydropathy
analyses indicate that these enzymes contain up to three long hydrophobic
domains which
would be long enough to span the membrane bilayer twice. The enzymes contain
three
conserved His-containing regions (His-boxes), which have a consistent
positioning with
respect to these potential membrane spanning domains. All single histidine
residues in
these conserved regions, which are putatively involved in iron binding,
appeared essential
for protein function (Shanldin et al., Biochemistry 33:12787-94, 1994). In
FAD3-Al
(SEQ ID NO: 2), eight conserved putative diiron-binding histidines are present
on amino
acid positions 92, 96, 128, 131, 132, 295, 298 and 299 (GenBank: ACS26169.1).
[24] The term "signal sequence" or "signal peptide" refers to a short (3-60
amino acids
long) peptide chain on the N-terminus of a protein which directs initial
targeting of a
protein to intracellular organelles such as the endoplasmatic reticulum (ER).
ER resident
proteins, such as FAD3, may comprise a cleavable N-terminal signal sequence
for initial,
co-translational targeting to the ER, but the first transmembrane domain may
also act as a
non-cleavable signal sequence directing co-translational protein synthesis and
acting as a
stop transfer sequence for anchoring the protein in the membrane. It was
demonstrated
that Brassica FAD3 is inserted into the ER membrane in a co-translational
manner
(McCartney et al., 2004, Plant Journal 37, pages 156-173).
[25] "ER retention
motif " as used herein, is a C-terminal tetrapeptide motif -
H/K/RDEL which is responsible for static ER retention or retrieval from other
compartments in the secretory pathway. Any non-conserved amino acid change to
the
motif is known to result in loss of ER retrieval. FAD3 comprises a conserved
dilysine
motif (amino acid positions -3 and -5 relative to the C-terminus) which
functions as an
ER retention signal. Truncation of the five C-terminal amino acids -KSKIN or a
substitution of the two lysines to alanines resulted in mislocalization of
FAD3 to the
Golgi or to the plasma membrane respectively, as well as a severe impairment
of FAD3
enzymatic activity (McCartney et al., 2004, Plant Journal 37, pages 156-173).
8
CA 2781278 2019-06-14
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
Corresponding amino acid regions or residues in other FAD3 sequences can be
found by
methods known in the art, such as by determining the optimal alignment, as
described
below.
[26] The term "FAD3 gene" refers herein to the nucleic acid sequence encoding
a fatty
acid desaturase (i.e. a FAD3 protein). A functional "FAD3 protein" has fatty
acyl
desaturase activity, more specifically, it is capable of desaturating linoleic
acid (C18:2)
into linolenic acid (C18:3). The functionality of FAD3 proteins can be tested
using a
biological assay. To determine the function and/or the functionality of a
specific FAD3
gene/protein, a yeast expression system as described by Vrinten et al. (2005,
Plant
Physiol. 139:79-87) or by Reed et al. (2000, Plant Physiol. 122:715-20) or a
bacterial
expression system as described by e.g. Reddy et al. (Plant Mol Biol 22:293-
300, 1993)
can, for example be used. Alternatively, the gene encoding the FAD3 protein
can e.g. be
transformed into Brassica (or another plant) and the resulting transformants
screened for
overexpression phenotypes, as described in e.g. US Patent Application
20040083503.
[27] As used herein, the term "allele(s)" means any of one or more alternative
forms of
a gene at a particular locus. In a diploid (or amphidiploid) cell of an
organism, alleles of
a given gene are located at a specific location or locus (loci plural) on a
chromosome.
One allele is present on each chromosome of the pair of homologous
chromosomes.
[28] As used herein, the term "homologous chromosomes" means chromosomes that
contain information for the same biological features and contain the same
genes at the
same loci but possibly different alleles of those genes. Homologous
chromosomes are
chromosomes that pair during meiosis. "Non-homologous chromosomes",
representing
all the biological features of an organism, form a set, and the number of sets
in a cell is
called ploidy. Diploid organisms contain two sets of non-homologous
chromosomes,
wherein each homologous chromosome is inherited from a different parent. In
amphidiploid species, essentially two sets of diploid genomes exist, whereby
the
chromosomes of the two genomes are referred to as "homeologous chromosomes"
(and
similarly, the loci or genes of the two genomes are referred to as homeologous
loci or
9
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
genes). A diploid, or amphidiploid, plant species may comprise a large number
of
different alleles at a particular locus.
[29] As used herein, the term "heterozygous" means a genetic condition
existing when
two different alleles reside at a specific locus, but are positioned
individually on
corresponding pairs of homologous chromosomes in the cell. Conversely, as used
herein,
the term "homozygous" means a genetic condition existing when two identical
alleles
reside at a specific locus, but are positioned individually on corresponding
pairs of
homologous chromosomes in the cell.
[30] As used herein, the term "locus" (loci plural) means a specific place or
places or a
site on a chromosome where for example a gene or genetic marker is found. For
example,
the "FAD3-Al" refers to the position on a chromosome where the FAD3-A/ gene
(and
two FAD3-Al alleles) may be found, while the "FAD3-C1 locus" refers to the
position on
a chromosome where the FAD3-C1 gene (and two FAD3-CI alleles) may be found.
[31] "Essentially similar", as used herein, refers to sequences having at
least 75%, at
least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence
identity.
These nucleic acid sequences may also be referred to as being "substantially
identical" or
"essentially identical" to the FAD3 sequences provided in the sequence
listing. The
"sequence identity" of two related nucleotide or amino acid sequences,
expressed as a
percentage, refers to the number of positions in the two optimally aligned
sequences
which have identical residues (x100) divided by the number of positions
compared. A
gap, i.e., a position in an alignment where a residue is present in one
sequence but not in
the other, is regarded as a position with non-identical residues. The "optimal
alignment"
of two sequences is found by aligning the two sequences over the entire length
according
to the Needleman and Wunsch global alignment algorithm (Needleman and Wunsch,
1970, J Mol Biol 48(3):443-53) in The European Molecular Biology Open Software
Suite
(EMBOSS, Rice et al. , 2000, Trends in Genetics 16(6): 276-277; see e.g.
http://www.ebi.ac.uk/emboss/align/index.html) using default settings (gap
opening
penalty = 10 (for nucleotides) / 10 (for proteins) and gap extension penalty =
0.5 (for
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
nucleotides) / 0.5 (for proteins)). For nucleotides the default scoring matrix
used is
EDNAFULL and for proteins the default scoring matrix is EBLOSUM62.
[32] "Stringent hybridization conditions" can be used to identify nucleotide
sequences,
which are substantially identical to a given nucleotide sequence. Stringent
conditions are
sequence dependent and will be different in different circumstances.
Generally, stringent
conditions are selected to be about 5 C lower than the thermal melting point
(T.) for the
specific sequences at a defined ionic strength and pH. The T. is the
temperature (under
defined ionic strength and pH) at which 50% of the target sequence hybridizes
to a
perfectly matched probe. Typically stringent conditions will be chosen in
which the salt
concentration is about 0.02 molar at pH 7 and the temperature is at least 60
C. Lowering
the salt concentration and/or increasing the temperature increases stringency.
Stringent
conditions for RNA-DNA hybridizations (Northern blots using a probe of e.g.
100nt) are
for example those which include at least one wash in 0.2X SSC at 63 C for
20min, or
equivalent conditions.
[33] "High stringency conditions" can be provided, for example, by
hybridization at
65 C in an aqueous solution containing 6x SSC (20x SSC contains 3.0 M NaC1,
0.3 M
Na-citrate, pH 7.0), 5x Denhardt's (100X Denhardt's contains 2% Ficoll, 2%
Polyvinyl
pyrollidone, 2% Bovine Serum Albumin), 0.5% sodium dodecyl sulphate (SDS), and
20
jig/m1 denaturated carrier DNA (single-stranded fish sperm DNA, with an
average length
of 120 - 3000 nucleotides) as non-specific competitor. Following
hybridization, high
stringency washing may be done in several steps, with a final wash (about 30
min) at the
hybridization temperature in 0.2-0.1x SSC, 0.1% SDS.
[34] "Moderate stringency conditions" refers to conditions equivalent to
hybridization
in the above described solution but at about 60-62 C. Moderate stringency
washing may
be done at the hybridization temperature in lx SSC, 0.1% SDS.
[35] "Low stringency" refers to conditions equivalent to hybridization in the
above
described solution at about 50-52 C. Low stringency washing may be done at the
11
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
hybridization temperature in 2x SSC, 0.1% SDS. See also Sambrook et al. (1989)
and
Sambrook and Russell (2001).
[36] The term "ortholog" of a gene or protein refers herein to the homologous
gene or
protein found in another species, which has the same function as the gene or
protein, but
is (usually) diverged in sequence from the time point on when the species
harboring the
genes diverged (i.e. the genes evolved from a common ancestor by speciation).
Orthologs
of the Brassica napus FAD3 genes may thus be identified in other plant species
(e.g.
Brassica juncea, etc.) based on both sequence comparisons (e.g. based on
percentages
sequence identity over the entire sequence or over specific domains) and/or
functional
analysis.
[37] The term "mutant" or "mutation" refers to e.g. a plant or gene that is
different
from the so-called "wild type" variant (also written "wildtype" or "wild-
type"), which
refers to a typical form of e.g. a plant or gene as it most commonly occurs in
nature. A
"wild type plant" refers to a plant with the most common phenotype of such
plant in the
natural population. A "wild type allele" refers to an allele of a gene
required to produce
the wild-type phenotype. A mutant plant or allele can occur in the natural
population or
be produced by human intervention, e.g. by mutagenesis, and a "mutant allele"
thus
refers to an allele of a gene required to produce the mutant phenotype. As
used herein, the
term "mutant FAD3 allele" (e.g. mutant FAD3-Al, FAD3-CI, FAD3-A2, FAD3-A3 or
FAD3-C2) refers to a FAD3 allele, which directs expression of a significantly
reduced
amount of functional FAD3 protein than the corresponding wild type allele.
This can
occur either by the mutant FAD3 allele encoding a non-functional FAD3 protein
which,
as used herein, refers to a FAD3 protein having no biological activity a
significantly
modified and/or a significantly reduced biological activity as compared to the
corresponding wild-type functional FAD3 protein, or by the mutant FAD3 allele
encoding a significantly reduced amount of functional FAD3 protein or no FAD3
protein
at all. Such a "mutant FAD3 allele" thus comprises one or more mutations in
its nucleic
acid sequence when compared to the wild type allele, whereby the mutation(s)
preferably
12
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
result in a significantly reduced (absolute or relative) amount of functional
FAD3 protein
in the cell in vivo.
[38] Mutations in nucleic acid sequences may include for instance:
(a) a "missense mutation", which is a change in the nucleic acid sequence that
results in
the substitution of an amino acid for another amino acid;
(b) a "nonsense mutation" or "STOP codon mutation", which is a change in the
nucleic
acid sequence that results in the introduction of a premature STOP codon and
thus the
termination of translation (resulting in a truncated protein); plant genes
contain the
translation stop codons "TGA" (UGA in RNA), "TAA" (UAA in RNA) and "TAG"
(UAG in RNA); thus any nucleotide substitution, insertion, deletion which
results in one
of these codons to be in the mature mRNA being translated (in the reading
frame) will
terminate translation.
(c) an "insertion mutation" of one or more amino acids, due to one or more
codons
having been added in the coding sequence of the nucleic acid;
(d) a "deletion mutation" of one or more amino acids, due to one or more
codons having
been deleted in the coding sequence of the nucleic acid;
(e) a "frameshift mutation", resulting in the nucleic acid sequence being
translated in a
different frame downstream of the mutation. A frameshift mutation can have
various
causes, such as the insertion, deletion or duplication of one or more
nucleotides, but also
mutations which affect pre-tnRNA splicing (splice site mutations) can result
in
frameshifts;
(f) a "splice site mutation", which alters or abolishes the correct splicing
of the pre-
mRNA sequence, resulting in a protein of different amino acid sequence than
the wild
type. For example, one or more exons may be skipped during RNA splicing,
resulting in
a protein lacking the amino acids encoded by the skipped exons. Alternatively,
the
reading frame may be altered through incorrect splicing, or one or more
introns may be
retained, or alternate splice donors or acceptors may be generated, or
splicing may be
initiated at an alternate position (e.g. within an intron), or alternate
polyadenylation
signals may be generated. Correct pre-mRNA splicing is a complex process,
which can
be affected by various mutations in the nucleotide sequence of the FAD3-
encoding genes.
13
81714991
In higher eukaryotes, such as plants, the major spliceosome splices introns
containing GU
at the 5' splice site (donor site) and AG at the 3' splice site (acceptor
site). This GU-AG
rule (or GT-AG rule; see Lewin, Genes VI, Oxford University Press 1998, pp885-
920,
ISBN 0198577788) is followed in about 99% of splice sites of nuclear
eukaryotic genes,
while introns containing other dinucleotides at the 5' and 3' splice site,
such as GC-AG
and AU-AC account for only about 1% and 0.1% respectively
[39] It is desired
that the mutation(s) in the nucleic acid sequence preferably result in
a mutant protein comprising significantly reduced or no enzymatic activity in
vivo, i.e.
C18:2 to C18:3 desaturase activity. Basically, any mutation which results in a
protein
comprising at least one amino acid insertion, deletion and/or substitution
relative to the
wild type protein can lead to significantly reduced or no enzymatic activity.
It is, however,
understood that mutations in certain parts of the protein are more likely to
result in a
reduced function of the mutant FAD3 protein, such as mutations leading to
truncated
proteins, whereby significant portions of the functional and/or structural
domains, are
lacking.
[40] As used herein, a "full knock-out allele" is a mutant allele directing a
significantly
reduced or no functional FAD3 expression, i.e. a significantly reduced amount
of
functional FAD3 protein or no functional FAD3 protein, in the cell in vivo.
Full knock-
out mutant FAD3 alleles include for instance deletion mutations of the entire
or a
substantial part of the coding region, or frameshift or stop-codon mutations
that lead to a
substantial or entire deletion of the protein. For example, a full knock-out
FAD3 allele
comprises a mutation that disrupts or deletes the ER retention motif that is
present in the
most C-terminal amino acids (-KSKIN). This will result in a complete loss of
ER
retrieval and subsequent accumulation of the protein in the Golgi or plasma
membrane,
rendering it incapable of performing its function (McCartney et al., 2004,
Plant Journal
37, pages 156-173). Therefore, for example any stop codon, frame shift or
splice site
mutation that leads to a C-terminal truncation of the protein that includes
the ER retention
motif will result in a full knock-out FAD3 allele, as does a missense mutation
(e.g. a
substitution of one or both of the two lysines), insertion or deletion in the
nucleotide
14
CA 2781278 2019-06-14
81714991
WO 2011/060946 PCT/EP2010/007028
sequence encoding the motif itself, i.e. starting from nt 1117 of SEQ ID NO:
11
(corresponding to Lys373 of SEQ ID NO: 2) and further downstream relative to
the ATG
start codon in the coding sequence of FAD3-Al or homologous residues hereto.
[41] Alternatively, a full knock-out mutant FAD3 allele comprises a mutation
that
deletes or disrupts any one of the eight conserved histidine residues. For
example, a full
knock-out mutant FAD3 allele comprises a mutation, e.g. nonsense or frameshift
mutation, between nucleotide (nt) 274-276 and nt 895-897 relative to the ATG
start
codon in the coding sequence of FAD3-Al (genbank accession number FJ985689.1)
encoding respectively the first and last conserved histidines (His92 and
His299 of the
FAD3-A1 protein; genbank accession number ACS26169.1), or homologous residues
hereto. In another example, missense mutations that lead to substitution of
any of these
eight histidine residues will result in a non-functional FAD3 protein. In yet
another
example, a full knock-out mutant FAD3 allele comprises insertion, deletion or
splice site
mutation(s) that delete or alter any of the nucleotides encoding the eight di-
iron binding
histidines, or alter the positioning of one ore more of the eight di-iron
binding histidines
with respect to the potential membrane spanning domains or to each other.
[42] Another example of a full knock-out mutant FAD3 allele is a FAD3 allele
encoding a N-terminally truncated FAD3 protein. In case of a mutation upstream
of the
nucleotides encoding the first di-iron histidine, an alterative ATG,
downstream of the
original start codon, may be used for translation initations, whereby an N-
terminally
truncated protein may still be formed. However, such a truncation will disrupt
or delete
the potential N-terminal signal sequence, which normally functions to target
the protein
to the ER, leading to a dislocation of FAD3 to the cytosol, thus rendering it
incapable of
performing its normal function.
[43] As used herein, a "significantly reduced amount of functional FAD3
protein" (e.g.
functional FAD3-A1, FAD3-A2, FAD3-A3, FAD3-C1 and/or FAD3-C2 protein) refers
to
a reduction in the amount of a functional FAD3 protein produced by the cell
comprising a
mutant FAD3 allele by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100%
(i.e.
no functional protein is produced by the cell) as compared to the amount of
the functional
CA 2781278 2019-06-14
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
FAD3 protein produced by the cell not comprising the mutant FAD3 allele. This
definition encompasses the production of a "non-functional" FAD3 protein (e.g.
truncated FAD3 protein) having no biological activity (C18:2 to C18:3
desaturase
activity) in vivo, the reduction in the absolute amount of the functional FAD3
protein (e.g.
no functional FAD3 protein being made due to the mutation in the FAD3 gene)
and/or the
production of an FAD3 protein with significantly reduced biological activity
compared to
the activity of a functional wild type FAD3 protein (such as an FAD3 protein
in which
one or more amino acid residues that are crucial for the biological activity
of the encoded
FAD3 protein, are substituted for another amino acid residue or deleted).
[44] The term "mutant FAD3 protein", as used herein, refers to a FAD3 protein
encoded by a mutant FAD3 nucleic acid sequence ("fad3 allele") whereby the
mutation
results in a significantly reduced and/or no biological FAD3 activity (C18:2
to C18:3
desaturase activity) in vivo, compared to the activity of the FAD3 protein
encoded by a
non-mutant, wild type FAD3 sequence ("FAD3 allele").
[45] As used herein, "a significantly reduced C18:3 content" or "low alpha-
linolenic
acid" refers to a significant reduction in the amount of total alpha-linolenic
acid (C18:3)
present in the seed oil of a plant comprising one or more mutant FAD3 alleles
when
compared to the seed oil of a corresponding plant not comprising said mutant
FAD3
allele(s). In another embodiment the C18:3 seed oil content of said plants
comprising one
or more mutant FAD3 alleles is reduced to below 11 % wt, 10 % wt, 9 % wt, 8 %
wt, 7.0
wt %, 6.0 wt %, 5.0 wt %, 4.0 wt %, 3.0 wt %, 2.5 wt %, 2.0 wt %, 1.5 % wt,
1.0 wt %,
0.5 wt of the total seed oil content.
[46] It is understood that the C18:3 seed oil content may vary depending on
genetic
background and growth conditions (e.g. temperature). Without intending to
limit the
invention, it is expected that the C18:3 seed oil levels will generally be
higher when
plants are grown in the field than when they are grown in the greenhouse.
Therefore, in
order to determine whether a plant according to the invention, i.e. a plant
comprising one
or more mutant FAD3 alleles, has a significantly reduced C18:3 seed oil
content, a
16
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
comparison should be made with a corresponding plant (i.e. of the same genetic
background) not comprising said mutant FAD3 allele(s) grown under the same
conditions,
rather than evaluating absolute C18:3 seed oil levels.
[47] The fatty acid composition of seed oil, including the C18:3 content, can
be
determined using methods known in the art, for example by extracting the fatty
acyls
from the seeds and analyzing their relative levels in the seed oil by
capillary gas-liquid
chromatography as described in e.g. W009/007091.
[48] "Mutagenesis", as used herein, refers to the process in which plant cells
(e.g., a
plurality of Brassica seeds or other parts, such as pollen, etc.) are
subjected to a technique
which induces mutations in the DNA of the cells, such as contact with a
mutagenic agent,
such as a chemical substance (such as ethylmethylsulfonate (EMS),
ethylnitrosourea
(ENU), etc.) or ionizing radiation (neutrons (such as in fast neutron
mutagenesis, etc.),
alpha rays, gamma rays (such as that supplied by a Cobalt 60 source), X-rays,
UV-
radiation, etc.), or a combination of two or more of these. Thus, the desired
mutagenesis
of one or more FAD3 alleles may be accomplished by use of chemical means such
as by
contact of one or more plant tissues with ethylmethylsulfonate (EMS),
ethylnitrosourea,
etc., by the use of physical means such as x-ray, etc, or by gamma radiation,
such as that
supplied by a Cobalt 60 source. While mutations created by irradiation are
often large
deletions or other gross lesions such as translocations or complex
rearrangements,
mutations created by chemical mutagens are often more discrete lesions such as
point
mutations. For example, EMS alkylates guanine bases, which results in base
mispairing:
an alkylated guanine will pair with a thymine base, resulting primarily in G/C
to A/T
transitions. Following mutagenesis, Brassica plants are regenerated from the
treated cells
using known techniques. For instance, the resulting Brassica seeds may be
planted in
accordance with conventional growing procedures and following self-pollination
seed is
formed on the plants. Alternatively, doubled haploid plantlets may be
extracted to
immediately form homozygous plants, for example as described by Coventry et
al. (1988,
Manual for Microspore Culture Technique for Brassica napus. Dep. Crop Sci.
Techn.
Bull. OAC Publication 0489. Univ. of Guelph, Guelph, Ontario, Canada).
Additional
17
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
seed that is formed as a result of such self-pollination in the present or a
subsequent
generation may be harvested and screened for the presence of mutant FAD3
alleles.
Several techniques are known to screen for specific mutant alleles, e.g.,
DeleteageneTM
(Delete-a-gene; Li etal., 2001, Plant J 27: 235-242) uses polymerase chain
reaction (PCR)
assays to screen for deletion mutants generated by fast neutron mutagenesis,
TILLING
(targeted induced local lesions in genomes; McCallum et al., 2000, Nat
Biotechnol
18:455-457) identifies EMS-induced point mutations, etc. Additional techniques
to
screen for the presence of specific mutant FAD3 alleles are described in the
Examples
below.
[49] Whenever reference to a "plant" or "plants" according to the invention is
made, it
is understood that also plant parts (cells, tissues or organs, seed pods,
seeds, severed parts
such as roots, leaves, flowers, pollen, etc.), progeny of the plants which
retain the
distinguishing characteristics of the parents (especially the C18:3 seed oil
content), such
as seed obtained by selfing or crossing, e.g. hybrid seed (obtained by
crossing two inbred
parental lines), hybrid plants and plant parts derived there from are
encompassed herein,
unless otherwise indicated.
[50] "Crop plant" refers to plant species cultivated as a crop, such as
Brassica napus
(AACC, 2n=38), Brassica juncea (AABB, 2n=36), Brassica carinata (BBCC, 2n=34),
Brassica rapa (syn. B. campestris) (AA, 2n=20), Brassica oleracea (CC, 2n=18)
or
Brassica nigra (BB, 2n=16). The definition does not encompass weeds, such as
Arabidopsis thaliana.
[51] A "variety" is used herein in conformity with the UPOV convention and
refers to
a plant grouping within a single botanical taxon of the lowest known rank,
which
grouping can be defined by the expression of the characteristics resulting
from a given
genotype or combination of genotypes, can be distinguished from any other
plant
grouping by the expression of at least one of the said characteristics and is
considered as
a unit with regard to its suitability for being propagated unchanged (stable).
18
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[52] As used herein, the term "non-naturally occurring" or "cultivated" when
used in
reference to a plant, means a plant with a genome that has been modified by
man. A
transgenic plant, for example, is a non-naturally occurring plant that
contains an
exogenous nucleic acid molecule, e.g., a chimeric gene comprising a
transcribed region
which when transcribed yields a biologically active RNA molecule capable of
reducing
the expression of an endogenous gene, such as a FAD3 gene according to the
invention,
and, therefore, has been genetically modified by man. In addition, a plant
that contains a
mutation in an endogenous gene, for example, a mutation in an endogenous FAD3
gene,
(e.g. in a regulatory element or in the coding sequence) as a result of an
exposure to a
mutagenic agent is also considered a non-naturally plant, since it has been
genetically
modified by man. Furthermore, a plant of a particular species, such as
Brassica napus,
that contains a mutation in an endogenous gene, for example, in an endogenous
FAD3
gene, that in nature does not occur in that particular plant species, as a
result of, for
example, directed breeding processes, such as marker-assisted breeding and
selection or
introgression, with a plant of the same or another species, such as Brassica
juncea or
rapa, of that plant is also considered a non-naturally occurring plant. In
contrast, a plant
containing only spontaneous or naturally occurring mutations, i.e. a plant
that has not
been genetically modified by man, is not a "non-naturally occurring plant" as
defined
herein and, therefore, is not encompassed within the invention. One skilled in
the art
understands that, while a non-naturally occurring plant typically has a
nucleotide
sequence that is altered as compared to a naturally occurring plant, a non-
naturally
occurring plant also can be genetically modified by man without altering its
nucleotide
sequence, for example, by modifying its methylation pattern.
[53] As used herein, "an agronomically suitable plant development" refers to a
development of the plant, in particular an oilseed rape plant, which does not
adversely
affect its performance under normal agricultural practices, more specifically
its
establishment in the field, vigor, flowering time, height, maturation, lodging
resistance,
yield, disease resistance, resistance to pod shattering, etc. Thus, lines with
significantly
reduced C18: seed oil content with agronomically suitable plant development
have a
C18:3 seed oil content that has decreased as compared to the C18:3 seed oil
content of a
19
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
plant known to have an average C18:3 seed oil content while maintaining a
similar
establishment in the field, vigor, flowering time, height, maturation, lodging
resistance,
yield, disease resistance, resistance to pod shattering, etc.
[54] The term "comprising" is to be interpreted as specifying the presence of
the stated
parts, steps or components, but does not exclude the presence of one or more
additional
parts, steps or components. A plant comprising a certain trait may thus
comprise
additional traits.
[55] It is understood that when referring to a word in the singular (e.g.
plant or root),
the plural is also included herein (e.g. a plurality of plants, a plurality of
roots). Thus,
reference to an element by the indefinite article "a" or "an" does not exclude
the
possibility that more than one of the element is present, unless the context
clearly
requires that there be one and only one of the elements. The indefinite
article "a" or "an"
thus usually means "at least one".
DETAILED DESCRIPTION
[56] Brassica napus (genome AACC, 2n=4x=38), which is an allotetraploid
(amphidiploid) species containing essentially two diploid genomes (the A and
the C
genome) due to its origin from diploid ancestors, is described to comprise two
FAD3
genes in its genome located on the A and C genome, herein after called FAD3-Al
and
FAD3-C1 respectively. It was found by the inventors that the Brassica napus
genome
contains three additional FAD3 genes, which were designated FAD3-A2, FAD3-A3
and
FAD3-C2. It was found in crosses with an elite male and an elite female
Brassica
breeding line that Brassica napus plants that are homozygous for either a
mutant FAD3-
Al or FAD3-C1 allele, show a significant decrease in C18:3 seed oil content
when
compared to Brassica napus plants not comprising mutant FAD3 alleles, while
plants
homozygous for a mutation in any of the newly identified FAD3 genes did not
display a
reduction in C18:3. It was further found that in addition to homozygosity for
the FAD3-
Al or FAD3-C1 mutant alleles, the presence of a second mutant FAD3 gene in
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
homozygous state, surprisingly also of the of the new FAD3 genes, in Brassica
napus
could further reduce C18:3 seed oil content. Moreover, in addition to both the
FAD3-Al
and FAD3-CI mutation in homozygous state, homozygosity for a third mutant FAD3
allele could reduce C18:3 content in seed oil of plants grown in the
greenhouse even to
below 3% of the total seed oil content It was furthermore observed that the
more
additional mutant FAD3 alleles are stacked on top of the mutant alleles of the
FAD3A1
and FAD3C1 genes, the lower the C18:3 oil content, both in Brassica plants
grown in the
greenhouse as well as for plants grown in the field.
[57] Thus, in a first embodiment the invention provides a Brassica plant
comprising at
least two full knock-out mutant FAD3 alleles of two different FAD3 genes,
wherein
i. the first mutant FAD3 allele is selected from the group consisting of FAD3-
Al
or FAD3-Cl; and
ii. the second mutant FAD3 allele is selected from the group consisting of
FAD3-
A2, FAD3-A3 or FAD3-C2.
[58] In one embodiment double mutant plants are provided herein that are
heterozygous or homozygous for the first mutant FAD3 allele and heterozygous
or
homozygous for the second mutant FAD3 allele, wherein the genotype of the
plant can be
described as (the mutant FAD3 allele is abbreviated to fad3 while the wild
type allele is
depicted as FAD3):
- FAD3-A1/ fad3-al , FAD3-A2/ fad3-a2
- FAD3-A1/ fad3-al , FAD3-A3/ fad3-a3
- FAD3-A1/ fad3-al , FAD3-C2/ fad3-c2
- FAD3-C1/ fad3-cl , FAD3-A2/ fad3-a2
- FAD3-C1/ fad3-cl , FAD3-A3/ fad3-a3
- FAD3-C1/ fad3-cl , FAD3-C2/ fad3-c2
- fad3-al/ fad3-al , FAD3-A2/ fad3-a2
- fad3-al/ fad3-al , FAD3-A3/ fad3-a3
- fad3-al/ fad3-al , FAD3-C2/ fad3-c2
- fad3-c1/ fad3-cl , FAD3-A2/ fad3-a2
21
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
- fad3-cl/fad3-cl, FAD3-A3/ fad3-a2
- fad3-cl/fad3-cl, FAD3-C2/ fad3-c2
- FAD3-A1/fad3-al, fad3-a2/ fad3-a2
- FAD3-A1/fad3-al, fad3-a3/ fad3-a3
- FAD3-A1/fad3-al, fad3-c2/ fad3-c2
- FAD3-C1/fad3-cl, fad3-a2/ fad3-a2
- FAD3-C1/fad3-cl, fad3-a3/ fad3-a3
- FAD3-C1/fad3-cl, fad3-c1/ fad3-c2
- fad3-al/fad3-al, fad3-a2/ fad3-a2
- fad3-al/fad3-al, fad3-a3/ fad3-a3
- fad3-al/fad3-al, fad3-c2/ fad3-c2
- fad3-cl/fad3-cl, fad3-a2/fad3-a2
- fad3-cl/fad3-cl, fad3-a3/fad3-a2
- fad3-cl/fad3-cl, fad3-c1/ fad3-c2
wherein the plant is homozygous for the wild type alleles of the remaining
FAD3
genes (e.g. FAD3-Al/fad3-al, FAD3-A2/fad3-a2 corresponds to the genotype FAD3-
Al/fad3-al, FAD3-A2/fad3-a2, FAD3-A3/FAD3-A3, FAD3-Cl/FAD3-C1, FAD3-
C2/FAD3-C2)
[59] The invention also provides a plant further comprising a third full knock-
out
mutant FAD3 allele, wherein said third full knock-out mutant FAD3 allele is
selected
from the group consisting of FAD3-Al or FAD3-C1, whereby the mutant FAD3
alleles
are mutant alleles of at least three different FAD3 genes.
[60] It will be clear to the skilled person that when FAD3-Al is chosen as the
first full
knock-out mutant FAD3 allele, the third full knock-out mutant FAD3 allele will
be
FAD3-CI, and vice versa.
[61] Thus, in another embodiment triple mutant plants are provided herein that
are
heterozygous or homozygous for the first mutant FAD3 allele, heterozygous or
homozygous for the second mutant FAD3 allele and heterozygous or homozygous
for the
22
CA 02781278 2012-05-17
WO 2011/060946 PC
T/EP2010/007028
third mutant FAD3 allele, wherein the genotype of the plant can be described
as (the
mutant FAD3 allele is abbreviated to fad3 while the wild type allele is
depicted as FAD3):
- FAD3-A1/fad3-al, FAD3-A2/fad3-a2, FAD3-C1/fad3-cl
- FAD3-A1/fad3-al, FAD3-A3/fad3-a3, FAD3-C1/fad3-cl
- FAD3-Al/fad3-al, FAD3-C2/fad3-c2, FAD3-C1/fad3-cl
- fad3-al/fad3-al, FAD3-A2/fad3-a2, FAD3-Cl/fad3-cl
- fad3-al/fad3-al, FAD3-A3/fad3-a3, FAD3-C1/fad3-cl
- fad3-al/fad3-al, FAD3-C2/fad3-c2, FAD3-C1/fad3-cl
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, FAD3-C1/fad3-cl
- FAD3-A1/fad3-al, fad3-a3/fad3-a3, FAD3-C1/fad3-cl
- FAD3-A1/fad3-al, fad3-c2/fad3-c2, FAD3-C1/fad3-cl
- FAD3-A1/fad3-al, FAD3-A2/fad3-a2, fad3-cl/fad3-cl
- FAD3-A1/fad3-al, FAD3-A3/fad3-a3, fad3-cl/fad3-cl
- FAD3-A1/fad3-al, FAD3-C2/fad3-c2, fad3-cl/fad3-cl
- fad3-al/fad3-al, FAD3-A2/fad3-a2, fad3-cl/fad3-cl
- fad3-al/fad3-al, FAD3-A3/fad3-a3, 1ad3-cl/fad3-cl
- fad3-al/fad3-al, FAD3-C2/fad3-c2, fad3-cl/fad3-cl
- fad3-al/fad3-al, fad3-a2/fad3-a2, FAD3-Cl/fad3-cl
- fad3-a1/fad3-al, fad3-a3/fad3-a3, FAD3-C1/fad3-cl
- fad3-al/fad3-al, fad3-c2/fad3-c2, FAD3-C1/fad3-cl
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, fad3-cl/fad3-cl
- FAD3-A1/fad3-al, fad3-a3/fad3-a3, fad3-cl/fad3-cl
- FAD3-A1/fad3-al, fad3-c2/fad3-c2, fad3-c1/fad3-c1
- fad3-al/fad3-al, fad3-a2/fad3-a2, fad3-cl/fad3-cl
- fad3-al/fad3-al, fad3-a3/fad3-a3, fad3-cl/fad3-cl
- fad3-al/fad3-al, fad3-c2/fad3-c2, fad3-cl/fad3-cl
wherein the plant is homozygous for the wild type alleles of the remaining
FAD3 genes
(e.g. FAD3-Allfad3-al, FAD3-A2/fad3-a2, FAD3-Cl/fad3-cl corresponds to the
genotype FAD3-Al ffad3-al, FAD3-A2/fad3-a2, FAD3-Cl/fad3-cl, FAD3-A3/FAD3-A3,
FAD3-C2/FAD3-C2).
23
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[62] It is believed that the more mutant FAD3 alleles will be combined in a
plant, the
greater the reduction in C18:3 seed oil content will be. Therefore, the
invention also
provides a plant further comprising fourth full knock-out mutant FAD3 allele,
wherein
said fourth full knock-out mutant FAD3 allele is selected from the group
consisting of
FAD3-A2, FAD3-A3 or FAD3-C2, whereby the mutant FAD3 alleles are mutant
alleles of
at least four different FAD3 genes.
[63] It will be clear to the skilled person that when FAD3-A2 is chosen as the
second
full knock-out mutant FAD3 allele, the fourth full knock-out mutant FAD3
allele will be
FAD3-A3 or FAD3-C2. Similarly, when FAD3-A3 is chosen as the second full knock-
out
mutant FAD3 allele, the fourth full knock-out mutant FAD3 allele will be FAD3-
A2 or
FAD3-C2 and when FAD3-C2 is chosen as the second full knock-out mutant FAD3
allele,
the fourth full knock-out mutant FAD3 allele will be FAD3-A2 or FAD3-A3.
[64] Thus, in another embodiment quadruple mutant plants are provided herein
that are
heterozygous or homozygous for the first mutant FAD3 allele, heterozygous or
homozygous for the second mutant FAD3 allele, heterozygous or homozygous for
the
third mutant FAD3 allele and heterozygous or homozygous for the fourth mutant
FAD3
allele are provided herein, wherein the genotype of the plant can be described
as (the'
mutant FAD3 allele is abbreviated to fad3 while the wild type allele is
depicted as FAD3):
- FAD3 -Al / f ad3 - a 1 , FAD3 -AM* a d3 - a 2 , FAD3 -C1 / f a d3 - cl ,
FAD3 -
A3 / f ad3 - a 3
- FAD3-A1/fad3-al, FAD3-A2/fad3-a2, FAD3-C1/fad3-cl, FAD3-
C2/fad3-c2
- FAD3 -Al / f ad3 -a 1 , FAD3 -A3/ f ad3 -a 3 , FAD3 -C1/ f ad3 - c 1 ,
FAD3 -
C2 / fad3-c2
- FAD3 -Al / f ad3 -a 1 , FAD3 -A2/ f a d3 - a 2 , FAD3 -C1 / f a d3 - cl ,
f ad3 -
a 3 / f a d3 - a3
- FAD3 -Al / f ad3 - a l , FAD3 -A2/ f a d3 - a 2 , FAD3 -C1 / fad3-cl ,
fad3-
c2/ fad3-c2
24
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
- FAD3-A1/fad3-al, FAD3-A3/fad3-a3, FAD3-C1/fad3-cl, fad3-
c2/fad3-c2
- FAD3-A1/fad3-al, FAD3-A2/fad3-a2, fad3-cl/fad3-cl, FAD3-
A3/fad3-a3
- FAD3-A1/fad3-al, FAD3-A2/fad3-a2, fad3-cl/fad3-cl, FAD3-
C2/fad3-c2
- FAD3-A1/fad3-al, FAD3-A3/fad3-a3, fad3-cl/fad3-cl, FAD3-
C2/fad3-c2
- FAD3-Al/fad3-al, fad3-a2/fad3-a2, FAD3-C1/fad3-cl, FAD3-
A3/fad3-a3
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, FAD3-C1/fad3-cl, FAD3-
C2/fad3-c2
- FAD3-A1/fad3-al, fad3-a3/fad3-a3, FAD3-C1/fad3-cl, FAD3-
C2/fad3-c2
- fad3-al/fad3-al, FAD3-A2/fad3-a2, FAD3-C1/fad3-cl, FAD3-
A3/1ad3-a3
- fad3-al/fad3-al, FAD3-A2/fad3-a2, FAD3-C1/fad3-cl, FAD3-
C2/fad3-c2
- fad3-al/fad3-al, FAD3-A3/fad3-a3, FAD3-C1/fad3-cl, FAD3-
C2/fad3-c2
- fad3-al/fad3-al, FAD3-A2/fad3-a2, fad3-cl/fad3-cl, FAD3-
A3/fad3-a3
- fad3-al/fad3-al, FAD3-A2/fad3-a2, fad3-cl/fad3-cl, FAD3-
C2/fad3-c2
- fad3-al/fad3-al, FAD3-A3/fad3-a3, fad3-cl/fad3-cl, FAD3-
C2/1ad3-c2
- fad3-al/fad3-a1, fad3-a2/fad3-a2, FAD3-C1/fad3-cl, FAD3-
A3/fad3-a3
- fad3-al/fad3-al, fad3-a2/fad3-a2, FAD3-C1/fad3-cl, FAD3-
C2/fad3-c2
CA 02781278 2012-05-17
WO 2011/060946 PC
T/EP2010/007028
- fad3-al/fad3-al, fad3-a3/fad3-a3, FAD3-C1/fad3-cl, FAD3-
C2/1ad3-c2
- fad3-al/fad3-al, FAD3-A2/fad3-a2, FAD3-C1/fad3-cl, fad3-
a3/fad3-a3
- fad3-al/fad3-al, FAD3-A2/fad3-a2, FAD3-C1/fad3-cl, fad3-
c2/fad3-c2
- fad3-al/fad3-al, FAD3-A3/fad3-a3, FAD3-C1/fad3-cl, fad3-
c2/fad3-c2
- FAD3-A1/fad3-al, FAD3-A2/fad3-a2, fad3-cl/fad3-cl, fad3-
a3/fad3-a3
- EAD3-A1/fad3-al, FAD3-A2/fad3-a2, fad3-cl/fad3-cl, fad3-
c2/fad3-c2
- FAD3-A1/fad3-al, FAD3-A3/fad3-a3, fad3-cl/fad3-cl, fad3-
c2/fad3-c2
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, FAD3-C1/fad3-cl, fad3-
a3/fad3-a3
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, FAD3-C1/fad3-cl, 1ad3-
c2/fad3-c2
- FAD3-A1/fad3-al, fad3-a3/fad3-a3, FAD3-C1/fad3-cl, fad3-
c2/fad3-c2
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, fad3-cl/fad3-cl, FAD3-
A3/fad3-a3
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, fad3-cl/fad3-cl, FAD3-
C2/fad3-c2
- FAD3-A1/fad3-al, fad3-a3/fad3-a3, fad3-cl/fad3-cl, FAD3-
C2/fad3-c2
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, fad3-cl/fad3-cl, fad3-
a3/fad3-a3
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, fad3-cl/fad3-cl, fad3-
c2/fad3-c2
26
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
- FAD3-A1/fad3-al, fad3-a3/fad3-a3, fad3-c1/ fad3-cl, fad3-
c2/1ad3-c2
- fad3-al/1ad3-al, FAD3-A2/fad3-a2, fad3-c1/ fad3-cl, fac13-
a3/fad3-a3
- faid3-al/fad3-al, FAD3-A2/fad3-a2, fad3-cl/fad3-cl, fad3-
c2/fad3-c2
- fad3-al/fad3-al, FAD3-A3/fad3-a3, fad3-cl/fad3--cl, fad3-
c2/fad3-c2
- fad3-al/fad3-al, fad3-a2/fad3-a2, FAD3-C1/ fad3-cl, fad3-
a3/fad3-a3
- fad3-al/fad3-al, fad3-a2/fad3-a2, FAD3-C1/ fad3-cl, fad3-
c2/fad3-c2
- fad3-al/faci3-al, fad3-a3/ fad3-a3, FAD3-C1/ fad3-cl, fad3-
c2/fad3-c2
- fad3-al/facI3-al, fad3-a2/ fad3-a2, fad3-cl / fad3-cl, FAD3-
A3/ fad3-a3
- fad3-al/fad3-al, fad3-a2/ fad3-a2, fad3-c1/ fad3-cl , FAD3-
C2/ fad3-c2
- fad3-al/1ad3-al, fad3-a3/fad3-a3, fad3-cl/fad3-cl , FAD3-
C2/ fad3-c2
- fad3-al/1ad3-al, fad3-a2/fad3-a2, fad3-c1/ fad3-cl, fad3-
a3/fad3-a3
- fad3-al/fad3-al, fad3-a2/fad3-a2, fad3-c1/ fad3-cl , fad3-
c2/ fad3-c2
- fad3-al/fad3-a1, fad3-a3/fad3-a3, fad3-c1/ fad3-cl, fad3-
c2/fad3-c2
wherein the plant is homozygous for the wild type alleles of the remaining
FAD3 genes
(e.g. FAD3-Al/fad3-al, FAD3-A2/fad3-a2, FAD3-Cl/fad3-cl, FAD3-A3/fad3-a3
corresponds to the genotype FAD3-Al/fad3-al, FAD3-A2/fad3-a2, FAD3-Cl/fad3-cl,
FAD3-A3ffad3-a3, FAD3-C2/FAD3-C2).
27
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[651 The invention furthermore provides a plant further comprising a fifth
full knock-
out mutant FAD3 allele, wherein said fifth full knock-out mutant FAD3 allele
is selected
from the group consisting of FAD3-A2, FAD3-A3 or FAD3-C2, whereby the mutant
FAD3 alleles are mutant alleles of at least five different FAD3 genes.
[66] Thus, in another embodiment quintuple mutant plants are provided herein
that are
heterozygous or homozygous for the first mutant FAD3 allele, heterozygous or
homozygous for the second mutant FAD3 allele, heterozygous or homozygous for
the
third mutant FAD3 allele, heterozygous or homozygous for the fourth mutant
FAD3
allele and heterozygous or homozygous for the fifth mutant FAD3 allele,
wherein the
genotype of the plant can be described as (the mutant FAD3 allele is
abbreviated to fad3
while the wild type allele is depicted as FAD3):
- FAD3-A1/ fad3 -a 1 , FAD3 -A2/ fad3-a2, FAD3 -A3/ fad3-a3, FAD3 -
Cl / fad3-cl , FAD3-C2/ fad3-c2
- fad3-a1/fad3-al, FAD3-A2/fad3-a2, FAD3 -A3/ fad3-a3, FAD3 -
Cl / fad3-cl , FAD3-C2/fad3-c2
- FAD3-A1/fad3-al, fad3 -a2/ fad3-a2 , FAD3 -A3/ fad3-a3 , FAD3-
C1 / fad3-cl , FAD3-C2/ fad3-c2
- FAD3-A1 / fad3 -al, FAD3 -A2 / fad3 -a2 , fad3-a3/fad3-a3, FAD3-
C1/ fad3-cl , FAD3-C2/fad3-c2
- FAD3-A1 / fad3 -al, FAD3 -A2 / fad3-a2 , FAD3 -A3/ fad3-a3, fad3-
cl / fad3-cl , FAD3-C2/ fad3-c2
- FAD3 / fad3 -al , FAD3 -AV fad3 -a2 , FAD3 -A3/ fad3-a 3 , FAD3-
C1 / fad3-cl , fad3-c2/fad3-c2
- fad3a1/ fad3-al, fad3-a2/ fad3-a2 , FAD3-A3/ fad3-a 3 , FAD3-
C1 / fad3-cl , FAD3-C2/ fad3-c2
- fad3al/fad3-al, FAD3-A2/fad3-a2, fad3-a3/1ad3-a3, FAD3-
C1/fad3-cl, FAD3-C2/fad3-c2
- fad3a1/ fad3-al, FAD3 -A2/ fad3-a2 , FAD3-A3/ fad3-a 3 , fad3-
cl / fad3-cl , FAD3-C2/ fad3-c2
28
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
- fad3al/1ad3-al, FAD3-A2/fad3-a2, FAD3-A3/fad3-a3, FAD3-
C1/ fad3-cl , fad3-c2/fad3-c2
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, fad3-a3/fad3-a3, FAD3-
C1/fad3-cl, FAD3-C2/fad3-c2
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, FAD3-A3/fad3-a3, fad3-
cl/fad3-cl, FAD3-C2/fad3-c2
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, FAD3-A3/fad3-a3, FAD3-
C1/fad3-cl, fad3-c2/fad3-c2
- FAD3-A1/fad3-al, FAD3-A2/fad3-a2, fad3-a3/fad3-a3, fad3-
cl/fad3-cl, FAD3-C2/fad3-c2
- FAD3-A1/fad3-al, FAD3-A2/fad3-a2, fad3-a3/fad3-a3, FAD3-
C1/1ad3-cl, fad3-c2/fad3-c2
- FAD3-A1/fad3-al, FAD3-A2/fad3-a2, FAD3-A3/fad3-a3, fad3-
cl/fad3-cl, fad3-c2/fad3-c2
- fad3-al/fad3-al, fad3-a2/1ad3-a2, fad3-a3/fad3-a3, FAD3-
C1/fad3-cl, FAD3-C2/fad3-c2
- fad3-al/fad3-al, fad3-a2/fad3-a2, FAD3-A3/fad3-a3, FAD3-
C1/fad3-cl, fad3-c2/fad3-c2
- fad3-al/1ad3-al, fad3-a2/fad3-a2, FAD3-A3/fad3-a3, fad3-
cl/fad3-cl, FAD3-C2/fad3-c2
- fad3-al/1ad3-al, FAD3-A2/fad3-a2, fad3-a3/fad3-a3, fad3-
cl/fad3-cl, FAD3-C2/fad3-c2
- fad3-al/fad3-al, FAD3-A2/fad3-a2, fad3-a3/fad3-a3, FAD3-
C1/fad3-cl, fad3-c2/fad3-c2
- fad3-al/fad3-al, FAD3-A2/fad3-a2, FAD3-A3/fad3-a3, fad3-
cl/fad3-cl, 1ad3-c2/fad3-c2
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, fad3-a3/fad3-a3, fad3-
cl/fad3-cl, FAD3-C2/fad3-c2
- FAD3-A1/fad3-al, fad3-a2/1ad3-a2, fad3-a3/fad3-a3, FAD3-
C1/fad3-cl, fad3-c2/fad3-c2
29
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
- FAD3-A1/fad3-al, fad3-a2/fad3-a2, FAD3-A3/fad3-a3, fad3-
cl/fad3-cl, fad3-c2/ fad3-c2
- FAD3-A1/fad3-al, FAD3-A2/fad3-a2, fad3-a3/fad3-a3, fad3-
cl/fad3-cl, fad3-c2/fad3-c2
- fad3-al/fad3-al, fad3-a2/fad3-a2, fad3-a3/fad3-a3, fad3-
cl/fad3-cl, FAD3-C2/fad3-c2
- fad3-al/fad3-al, 1ad3-a2/fad3-a2, daf3-a3/fad3-a3, FAD3-
C1/fad3-c1, fad3-c2/fad3-c2
- fad3-al/fad3-al, 1ad3-a2/fad3-a2, FAD3-A3/fad3-a3, fad3-
cl/fad3-cl, fad3-c2/fad3-c2
- fad3-al/fad3-al, FAD3-A2/fad3-a2, fad3-a3/faci3-a3, fad3-
cl/fad3-cl, fad3-c2/fad3-c2
- FAD3-A1/fad3-al, 1ad3-a2/fad3-a2, fad3-a3/fad3-a3, fad3-
cl/fad3-cl, fad3-c2/fad3-c2
- fad3-al/fad3-al, fad3-a2/fad3-a2, 1ad3-a3/1ad3-a3, fad3-
cl/fad3-cl, fad3-c2/fad3-c2
[67] In another embodiment the plants of the invention comprises mutant FAD3
alleles
comprising a nonsense (stopcodon) mutation.
[68] In yet another embodiment the plants of the invention comprise mutant
FAD3
alleles that are selected from the group consisting of LOLII05, LOLII03,
LOLII08,
LOLIIII or LOLI115.
[69] As used herein, LOLII05 or I_,OLI105 is a mutant allele of a FAD3-Al
genomic
sequence, coding sequence or amino acid sequence of respectively SEQ ID NO: 11
or
SEQ ID NO: 2, comprising a mutation in SEQ ID NO: 1 at nucleotide position
2405, in
SEQ ID NO: 11 at nucleotide position 732 or in SEQ ID NO: 2 at amino acid
position
244, resulting in a codon change in SEQ ID NO: 1 or SEQ ID NO: 11 of TGG to
TGA or
an amino acid change in SEQ ID NO: 2 of Trp to stop.
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[70] As used herein, LOLI103 or L0LI103 is a mutant allele of a FAD3-C1
genomic
sequence, coding sequence or amino acid sequence of respectively SEQ ID NO: 3,
SEQ
ID NO: 12 or SEQ ID NO: 4, comprising a mutation in SEQ ID NO: 3 at nucleotide
position 2702, in SEQ ID NO: 12 at nucleotide position 543 or in SEQ ID NO: 4
at
amino acid position 181, resulting in a codon change in SEQ ID NO: 3 or SEQ ID
NO:
12 of TGG to TGA or amino acid change in SEQ ID NO: 4 of Trp to stop.
[71] As used herein, LOLI]08 or LOLI108 is a mutant allele of a FAD3-A2
genomic
sequence, coding sequence or aminoacid sequence of respectively SEQ ID NO: 5,
SEQ
ID NO: 13 or SEQ ID NO: 6, comprising a mutation in SEQ ID NO: 5 at nucleotide
position 3934, in SEQ ID NO: 13 at nucleotide position 749 or in SEQ ID NO: 6
at
amino acid position 250, resulting in a codon change in SEQ ID NO: 5 or SEQ ID
NO:
13 of TGG to TAG or an amino acid change in SEQ ID NO: 6 of Trp to stop.
[72] As used herein, LOH] 11 or LOLI111 is a mutant allele of a FAD3-A3
genomic
sequence, coding sequence or aminoacid sequence of respectively SEQ ID NO: 7,
SEQ
ID NO: 14 or SEQ ID NO: 8, comprising a mutation in SEQ ID NO: 7 at nucleotide
position 2847, in SEQ ID NO: 14 at nucleotide position 552 or in SEQ ID NO: 8
at
amino acid position 184, resulting in a codon change in SEQ ID NO: 7 or SEQ ID
NO:
14 of TGG to TGA or an amino acid change in SEQ ID NO: 8 of Trp to stop.
[73] As used herein, LOLI115 or L0LI115 is a mutant allele of a FAD3-C2
genomic
sequence, coding sequence or aminoacid sequence of respectively SEQ ID NO: 9,
SEQ
ID NO: 15 or SEQ ID NO: 10, comprising a mutation in SEQ ID NO: 9 at
nucleotide
position 3909, in SEQ ID NO: 15 at nucleotide position 551 or in SEQ ID NO: 10
at
amino acid position 184, resulting in a codon change in SEQ ID NO: 9 or SEQ ID
NO:
15 of TGG to TAG or an amino acid change in SEQ ID NO: 10 of Trp to stop.
[74] In one embodiment, the plant of the invention may produce a significantly
reduced amount of functional FAD3 protein compared to the amount of functional
FAD3
protein produced by a corresponding plant not comprising the mutant FAD3
alleles of the
31
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
invention. In another embodiment, the seed of the plant may have a
significantly reduced
C18:3 seed oil content compared to plants not comprising the mutant FAD3
alleles.
[75] Further provided herein are nucleic acid sequences of wild type and
mutant FAD3
genes/alleles from Brassica species, as well as the wild type and mutant FAD3
proteins.
Also provided are methods of generating and combining mutant and wild type
FAD3
alleles in Brassica plants, as well as Brassica plants and plant parts
comprising specific
combinations of wild type and mutant FAD3 alleles in their genome, whereby the
C18:3
seed oil content is decreased. The use of these plants for transferring mutant
FAD3 alleles
to other plants is also an embodiment of the invention, as are the plant
products of any of
the plants described. In addition kits and methods for marker assisted
selection (IVIA.S) for
combining or detecting FAD3 genes and/or alleles are provided. Each of the
embodiments of the invention is described in detail herein below.
Nucleic acid sequences according to the invention
[76] Provided are both wild type FAD3 nucleic acid sequences encoding
functional
FAD3 proteins and mutant FAD3 nucleic acid sequences (comprising one or more
mutations, preferably mutations which result in no or a significantly reduced
biological
activity of the encoded FAD3 protein or in no FAD3 protein being produced) of
FAD3
genes from Brassicaceae, particularly from Brassica species, especially from
Brassica
napus, but also from other Brassica crop species. For example, Brassica
species
comprising an A and/or a C genome may comprise different alleles of FAD3
genes,
which can be identified and combined in a single plant according to the
invention. In
addition, mutagenesis methods can be used to generate mutations in wild type
FAD3
alleles, thereby generating mutant FAD3 alleles for use according to the
invention.
Because specific FAD3 alleles are preferably combined in a plant by crossing
and
selection, in one embodiment the FAD3 nucleic acid sequences are provided
within a
plant (i.e. endogenously), e.g. a Brassica plant, preferably a Brassica plant
which can be
crossed with Brassica napus or which can be used to make a "synthetic"
Brassica napus
plant. Hybridization between different Brassica species is described in the
art, e.g., as
32
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
referred to in Snowdon (2007, Chromosome research 15: 85-95). Interspecific
hybridization can, for example, be used to transfer genes from, e.g., the C
genome in B.
napus (AACC) to the C genome in B. carinata (BBCC), or even from, e.g., the C
genome
in B. napus (AACC) to the B genome in B. juncea (AABB) (by the sporadic event
of
illegitimate recombination between their C and B genomes). "Resynthesized" or
"synthetic" Brassica napus lines can be produced by crossing the original
ancestors, B.
oleracea (CC) and B. rapa (AA). Interspecific, and also intergeneric,
incompatibility
barriers can be successfully overcome in crosses between Brassica crop species
and their
relatives, e.g., by embryo rescue techniques or protoplast fusion (see e.g.
Snowdon,
above).
[77] However, isolated FAD3 and FAD3 nucleic acid sequences (e.g. isolated
from the
plant by cloning or made synthetically by DNA synthesis), as well as variants
thereof and
fragments of any of these are also provided herein, as these can be used to
determine
which sequence is present endogenously in a plant or plant part, whether the
sequence
encodes a functional, a non-functional or no protein (e.g. by expression in a
recombinant
host cell as described herein) and for selection and transfer of specific
alleles from one
plant into another, in order to generate a plant having the desired
combination of
functional and mutant alleles.
[78] Nucleic acid sequences of FAD3 alleles have been isolated from Brassica
napus
as depicted in the sequence listing. The wild type FAD3 sequences are
depicted, while the
mutant FAD3 sequences of these sequences, and of sequences essentially similar
to these,
are described herein below and in the Examples, with reference to the wild
type FAD3
sequences. The genomic FAD3 protein-encoding DNA, and corresponding pre-mRNA,
comprises 8 exons (numbered exons 1-8 starting from the 5' end) interrupted by
7 introns
(numbered introns 1-7, starting from the 5'end). In the cDNA and corresponding
processed mRNA (i.e. the spliced RNA), introns are removed and exons are
joined, as
depicted in the sequence listing. Exon sequences are more conserved
evolutionarily and
are therefore less variable than intron sequences.
33
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[79] "FAD3-Al nucleic acid sequences" or "FAD3-Al variant nucleic acid
sequences"
according to the invention are nucleic acid sequences encoding an amino acid
sequence
having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
98%, 99% or
100% sequence identity with SEQ ID NO: 2 or nucleic acid sequences having at
least
80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100%
sequence
identity with SEQ ID NO: 1 or SEQ ID NO: 11. These nucleic acid sequences may
also
be referred to as being "essentially similar" or "essentially identical" to
the FAD3
sequences provided in the sequence listing.
[80] "FAD3-C1 nucleic acid sequences" or "FAD3-C1 variant nucleic acid
sequences"
according to the invention are nucleic acid sequences encoding an amino acid
sequence
having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
98%, 99% or
100% sequence identity with SEQ ID NO: 4 or nucleic acid sequences having at
least
80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100%
sequence
identity with SEQ ID NO: 3 or SEQ ID NO: 12 These nucleic acid sequences may
also
be referred to as being "essentially similar" or "essentially identical" to
the FAD3
sequences provided in the sequence listing.
[81] "FAD3-A2 nucleic acid sequences" or "FAD3-A2 variant nucleic acid
sequences"
according to the invention are nucleic acid sequences encoding an amino acid
sequence
having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
98%, 99% or
100% sequence identity with SEQ ID NO: 6 or nucleic acid sequences having at
least
80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100%
sequence
identity with SEQ ID NO: 5 or SEQ ID NO: 13. These nucleic acid sequences may
also
be referred to as being "essentially similar" or "essentially identical" to
the FAD3
sequences provided in the sequence listing.
[82] "FAD3-A3 nucleic acid sequences" or "FAD3-A3 variant nucleic acid
sequences"
according to the invention are nucleic acid sequences encoding an amino acid
sequence
having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
98%, 99% or
100% sequence identity with SEQ ID NO: 8 or nucleic acid sequences having at
least
34
81714991
80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100%
sequence
identity with SEQ ID NO: 7 or SEQ ID NO: 14. These nucleic acid sequences may
also
be referred to as being "essentially similar" or "essentially identical" to
the FAD3
sequences provided in the sequence listing.
[83] "FAD3-C2 nucleic acid sequences" or "FAD3-C2 variant nucleic acid
sequences"
according to the invention are nucleic acid sequences encoding an amino acid
sequence
having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%,
98%, 99% or
100% sequence identity with SEQ ID NO: 10 or nucleic acid sequences having at
least
80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100%
sequence
identity with SEQ ID NO: 9 or SEQ ID NO: 15. These nucleic acid sequences may
also
be referred to as being "essentially similar" or "essentially identical" to
the FAD3
sequences provided in the sequence listing.
[84] Thus the invention provides both nucleic acid sequences encoding wild
type,
functional FAD3 proteins, including variants and fragments thereof (as defined
further
below), as well as mutant nucleic acid sequences of any of these, whereby the
mutation in
the nucleic acid sequence preferably results in one or more amino acids being
inserted,
deleted or substituted in comparison to the wild type FAD3 protein. As already
mentioned, preferably the mutation(s) in the nucleic acid sequence result in
one or more
amino acid changes (i.e. in relation to the wild type amino acid sequence one
or more
amino acids are inserted, deleted and/or substituted) whereby the biological
activity of
the FAD3 protein is significantly reduced or completely abolished or whereby a
significantly reduced amount of functional FAD3 protein or no functional FAD3
protein
is expressed. A significant reduction in or complete abolishment of the
biological activity
of the FAD3 protein refers herein to a deletion or disruption of structurally
and/or
functionally relevant amino acid residues or domains, such as the C-terminal
ER
retention motif , a deletion, substitution or repositioning of any of the
eight conserved
histidines, and/or a deletion or disruption the signal sequence, such that the
C18:3 seed
oil content of a plant expressing the mutant FAD3 allele is decreased as
compared to a
plant expressing the corresponding wild type FAD3 allele.
CA 2781278 2019-06-14
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[85] Both endogenous and isolated nucleic acid sequences are provided herein.
Also
provided are fragments of the FAD3 sequences and FAD3 variant nucleic acid
sequences
defined above, for use as primers or probes and as components of kits
according to
another aspect of the invention (see further below). A "fragment" of a FAD3 or
FAD3
nucleic acid sequence or variant thereof (as defined) may be of various
lengths, such as at
least 10, 20, 50, 100, 200, 500, 1000, 1100 contiguous nucleotides of the FAD3
coding
sequence (or of the variant sequence) or such as at least 10, 20, 50, 100,
200, 500, 1000,
2000, 2900 contiguous nucleotides of the FAD3 genome sequence (or of the
variant
sequence)
Nucleic acid sequences encoding functional FAD3 proteins
[86] The nucleic acid sequences depicted in the sequence listing encode wild
type,
functional FAD3 proteins from Brassica napus. Thus, these sequences are
endogenous to
the Brassica napus plants from which they were isolated. Other Brassica crop
species,
varieties, breeding lines or wild accessions may be screened for other FAD3
alleles,
encoding the same FAD3 proteins or variants thereof. For example, nucleic acid
hybridization techniques (e.g. Southern blot analysis, using for example
stringent
hybridization conditions) or PCR-based techniques may be used to identify FAD3
alleles
endogenous to other Brassica plants, such as various Brassica napus varieties,
lines or
accessions, but also Brassica juncea (especially FAD3 alleles on the A-
genome),
Brassica carinata (especially FAD3 alleles on the C-genome) and Brassica rapa
(A-
genome) and Brassica oleracea (C-genome) plants, organs and tissues can be
screened
for other wild type FAD3 alleles. Also, Brassica nigra (B-genome), Brassica
carinata
(B- and C-genome), and Brassica juncea (A- and B-genome) plants, organs and
tissues
can be screened for FAD3 alleles on the B-genome. To screen such plants, plant
organs
or tissues for the presence of FAD3 alleles, the FAD3 nucleic acid sequences
provided in
the sequence listing, or variants or fragments of any of these, may be used.
For example
whole sequences or fragments may be used as probes or primers. For example
specific or
degenerate primers may be used to amplify nucleic acid sequences encoding FAD3
36
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
proteins from the genomic DNA or cDNA of the plant, plant organ or tissue.
These FAD3
nucleic acid sequences may be isolated and sequenced using standard molecular
biology
techniques. Bioinformatics analysis may then be used to characterize the
allele(s), for
example in order to determine which FAD3 allele the sequence corresponds to
and which
FAD3 protein or protein variant is encoded by the sequence.
[87] Whether a nucleic acid sequence encodes a functional FAD3 protein can be
analyzed by recombinant DNA techniques as known in the art, e.g., by a genetic
complementation test using, e.g., an Arabidopsis plant, which is homozygous
for a full
knock-out FAD3, or by methods as described above.
[88] In addition, it is understood that FAD3 nucleic acid sequences and
variants
thereof (or fragments of any of these) may be identified in silico, by
screening nucleic
acid databases for essentially similar sequences. Likewise, a nucleic acid
sequence may
be synthesized chemically. Fragments of nucleic acid molecules according to
the
invention are also provided, which are described further below.
Nucleic acid sequences encoding mutant FAD3 proteins
[89] Nucleic acid sequences comprising one or more nucleotide deletions,
insertions or
substitutions relative to the wild type nucleic acid sequences are another
embodiment of
the invention, as are fragments of such mutant nucleic acid molecules. Such
mutant
nucleic acid sequences (referred to as fad3 sequences) can be generated and/or
identified
using various known methods, as described further below. Again, such nucleic
acid
molecules are provided both in endogenous form and in isolated form. In one
embodiment, the mutation(s) result in one or more changes (deletions,
insertions and/or
substitutions) in the amino acid sequence of the encoded FAD3 protein (i.e. it
is not a
"silent mutation"). In another embodiment, the mutation(s) in the nucleic acid
sequence
result in a significantly reduced or completely abolished biological activity
of the
encoded FAD3 protein relative to the wild type protein.
37
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[90] The nucleic acid molecules may, thus, comprise one or more mutations,
such as:
a missense mutation, nonsense mutation or "STOP codon mutation, an insertion
or
deletion mutation, a frameshift mutation and/or a splice site mutation, as is
already
described in detail above.
[91] As already mentioned, it is desired that the mutation(s) in the nucleic
acid
sequence preferably result in a significantly reduced amount of or no
functional FAD3
protein in the cell in vivo. Basically, any mutation which results in a
protein comprising
at least one amino acid insertion, deletion and/or substitution relative to
the wild type
protein can lead to significantly reduced or no biological activity. It is,
however,
understood that mutations in certain parts of the protein are more likely to
result in a
reduced function of the mutant FAD3 protein, such as mutations leading to
truncated
proteins, whereby significant portions of the functional amino acid residues
or domains,
such as the ER retention signal, the eight conserved histidine residues or the
signal
sequence, are deleted or substituted.
[92] Thus in one embodiment, nucleic acid sequences comprising one or more of
any
of the types of mutations described above are provided. In another embodiment,
fad3
sequences comprising one or more stop codon (nonsense) mutations are provided.
Any of
the above mutant nucleic acid sequences are provided per se (in isolated
form), as are
plants and plant parts comprising such sequences endogenously. In Table 2
herein below
the most preferred fad3 alleles are described.
[93] A nonsense mutation in a FAD3 allele, as used herein, is a mutation in a
FAD3
allele whereby one or more translation stop codons are introduced into the
coding DNA
and the corresponding mRNA sequence of the corresponding wild type FAD3
allele.
Translation stop codons are TGA (UGA in the rnRNA), TAA (UAA) and TAG (UAG).
Thus, any mutation (deletion, insertion or substitution) that leads to the
generation of an
in-frame stop codon in the coding sequence will result in termination of
translation and
truncation of the amino acid chain. In one embodiment, a mutant FAD3 allele
comprising
a nonsense mutation is an FAD3 allele wherein an in-frame stop codon is
introduced in
38
81714991
the FAD3 codon sequence by a single nucleotide substitution, such as LOLI103,
LOLI105,
LOLI108, LOLI111 and LOURS. In another embodiment, a mutant FAD3 allele
comprising a nonsense mutation is a FAD3 allele wherein an in-frame stop codon
is
introduced in the FAD3 coding sequence by double nucleotide substitutions. In
yet
another embodiment, a mutant FAD3 allele comprising a nonsense mutation is a
FAD3
allele wherein an in-frame stop codon is introduced in the FAD3 coding
sequence by
triple nucleotide substitutions. The truncated protein lacks the amino acids
encoded by
the coding DNA downstream (3') of the mutation (i.e. the C-termimal part of
the FAD3
protein) and maintains the amino acids encoded by the coding DNA upstream (5')
of the
mutation (i.e. the N-terminal part of the FAD3 protein). In one embodiment,
the
invention provides a mutant FAD3 allele comprising a nonsense mutation is a
FAD3
allele wherein the nonsense mutation is present anywhere upstream of or
including the
nucleotides encoding the ER retention motif (nt 1117-1131 of SEQ ID NO: 11),
so that
at least lysine 375 and/or lysine 373, or homologues residues hereto, are
lacking.
[94] The more truncated the mutant FAD3 protein is in comparison to the wild
type
FAD3 protein, the more likely the truncation may result in a significantly
reduced or no
functionality of the FAD3 protein in vivo. Therefore, in another embodiment,
the
invention provides a mutant FAD3 allele comprising a nonsense mutation
upstream of or
including nt 895-897, nt 892-894 or nt 883-885 of SEQ ID NO: 11, i.e.
resulting in a
truncated protein of less than about 299, 298 or 295 amino acids of SEQ ID NO:
2
(lacking the eighth, seventh, and/or sixth conserved histidines of the third
his-box). In yet
another embodiment, the invention provides a mutant FAD3 allele comprising a
nonsense
mutation upstream of or including nt 394-396, nt 391-393 or nt 382-384 of SEQ
ID NO:
11, i.e. resulting in a truncated protein of less than about 131, 130 or 128
amino acids of
SEQ ID NO: 2 (lacking the fifth, fourth and/or third histidines of the second
His-box). In
yet another embodiment, the invention provides a mutant FAD3 allele comprising
a
nonsense mutation upstream of or including nt 286-288 or nt 274-276 of SEQ ID
NO: 11,
i.e. resulting in a truncated protein of less than about 96 or 92 amino acids
of SEQ ID NO:
2 (lacking the second and/or first sixth conserved histidines of the first His-
box). As
already mentioned, corresponding regions or residues in other FAD3 nucleic
acid
39
CA 2781278 2019-06-14
81714991
=
sequences and FAD3 amino acid sequences can be identified by determining the
optimal
alignment.
[95] In yet another embodiment, the invention provides mutant FAD3 allele
comprising a nonsense mutation which results in the usage of an alternative
ATG as start
codon and the synthesis of an N-terminally truncated protein lacking the
putative signal
sequence.
[96] A missense mutation in a FAD3 allele, as used herein, is any mutation
(deletion,
insertion or substitution) in a FAD3 allele whereby one or more codons are
changed into
the coding DNA and the corresponding mRNA sequence of the corresponding wild
type
FAD3 allele, resulting in the substitution of one or more amino acids in the
wild type
FAD3 protein for one or more other amino acids in the mutant FAD3 protein. In
one
embodiment, a mutant FAD3 allele comprising a missense mutation is an FAD3
allele
wherein one or more of amino acids of the ER retention motif , i.e. residues
373-377,
especially lysine 373 and/or 375 of FAD3-Al, or homologous residues hereto,
are
substituted. Such mutations will lead to a loss of ER localization. Also
missense
mutations which result in the substitution of one or more of the eight
conserved di-iron
binding histidine residues will in a complete loss of protein function.
Further, missense
mutations which result in the substitution of, amino acids in the N-terminal
signal
sequence are likely to result in a non-functional enzyme, due to loss of its
ER localization.
[97] A frameshift mutation in a FAD3 allele, as used herein, is a mutation
(deletion,
insertion, duplication, and the like) in a FAD3 allele that results in the
nucleic acid
sequence being translated in a different frame downstream of the mutation
leading to a
significantly reduced amount of or no functional FAD3 enzyme in vivo.
[98] A splice site mutation in a FAD3 allele is a mutation that results in
aberrant
splicing of the pre-mRNA thereby resulting in a mutant protein having
significantly
reduced or no activity. Any mutation (insertion, deletion and/or substitution
of one or
more nucleotides) which alters pre-mRNA splicing and thereby leads to a
significantly
reduced amount of or no functional FAD3 enzyme in vivo is encompassed herein.
In one
CA 2781278 2019-06-14
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
embodiment, a mutant FAD3 allele comprising a splice site mutation is a FAD3
allele
wherein altered splicing is caused by the introduction in the FAD3 transcribed
DNA
region of one or more nucleotide substitution(s)of the consensus dinucleotides
of the 5'
splice site or 3' splice site, as described above. For example, GU may for
example be
mutated to AU in the donor splice site and/or AG may be mutated to AA in the
acceptor
splice site sequence.
Amino acid sequences according to the invention
[99] Provided are both wild type (functional) FAD3 amino acid sequences and
mutant
FAD3 amino acid sequences (comprising one or more mutations, preferably
mutations
which result in a significantly reduced amount of functional FAD3 enzyme or no
functional FAD3 enzyme in vivo) from Brassicaceae, particularly from Brassica
species,
especially from Brassica napus, but also from other Brassica crop species. For
example,
Brassica species comprising an A and/or a C genome may encode different FAD3
amino
acids. In addition, mutagenesis methods can be used to generate mutations in
wild type
FAD3 alleles, thereby generating mutant alleles which can encode further
mutant FAD3
proteins. In one embodiment the wild type and/or mutant FAD3 amino acid
sequences are
provided within a Brassica plant (i.e. endogenously). However, isolated FAD3
amino
acid sequences (e.g. isolated from the plant or made synthetically), as well
as variants
thereof and fragments of any of these are also provided herein.
[100] Amino acid sequences of FAD3 proteins have been deduced from the genomic
DNA FAD3 sequences that have been isolated from Brassica napus as depicted in
the
sequence listing. The wild type FAD3 sequences are depicted, while the mutant
FAD3
sequences of these sequences, and of sequences essentially similar to these,
are described
herein below, with reference to the wild type FAD3 sequences. The FAD3
proteins of
Brassica described herein are 377 to 388 amino acids in length and comprise a
number of
structural and functional domains and amino acid residues, as described above.
41
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[101] "FAD3-A1 amino acid sequences" or "FAD3-Al variant amino acid sequences"
according to the invention are amino acid sequences having at least 75%, at
least 80%, at
least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with
SEQ ID
NO: 2. These amino acid sequences may also be referred to as being
"essentially similar"
or "essentially identical" to the FAD3 sequences provided in the sequence
listing.
[102] "FAD3-C1 amino acid sequences" or "FAD3-C1 variant amino acid sequences"
according to the invention are amino acid sequences having at least 75%, at
least 80%, at
least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with
SEQ ID
NO: 4. These amino acid sequences may also be referred to as being
"essentially similar"
or "essentially identical" to the FAD3 sequences provided in the sequence
listing.
[103] "FAD3-A2 amino acid sequences" or "FAD3-A2 variant amino acid sequences"
according to the invention are amino acid sequences having at least 75%, at
least 80%, at
least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with
SEQ ID
NO: 6. These amino acid sequences may also be referred to as being
"essentially similar"
or "essentially identical" to the FAD3 sequences provided in the sequence
listing.
[104] "FAD3-A3 amino acid sequences" or "FAD3-A3 variant amino acid sequences"
according to the invention are amino acid sequences having at least 75%, at
least 80%, at
least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with
SEQ ID
NO: 8. These amino acid sequences may also be referred to as being
"essentially similar"
or "essentially identical" to the FAD3 sequences provided in the sequence
listing.
[105] "FAD3-C2 amino acid sequences" or "FAD3-C2 variant amino acid sequences"
according to the invention are amino acid sequences having at least 75%, at
least 80%, at
least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with
SEQ ID
NO: 10. These amino acid sequences may also be referred to as being
"essentially
similar" or "essentially identical" to the FAD3 sequences provided in the
sequence listing.
42
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[106] Thus, the invention provides both amino acid sequences of wild type,
functional
FAD3 proteins, including variants and fragments thereof (as defined further
below), as
well as mutant amino acid sequences of any of these, whereby the mutation in
the amino
acid sequence preferably results in a significant reduction in or a complete
abolishment of
the biological activity of the FAD3 protein as compared to the biological
activity of the
corresponding wild type FAD3 protein. A significant reduction in or complete
abolishment of the biological activity of the FAD3 protein refers herein to a
significant
reduction in conversion of C18:2 to C18:3, such that the seed oil of a plant
expressing the
mutant FAD3 protein is has a reduced C18:3 content as compared to a plant
expressing
the corresponding wild type FAD3 protein.
[107] Both endogenous and isolated amino acid sequences are provided herein.
Also
provided are fragments of the FAD3 amino acid sequences and FAD3 variant amino
acid
sequences defined above. A "fragment" of a FAD3 amino acid sequence or variant
thereof (as defined) may be of various lengths, such as at least 10, 12, 15,
18, 20, 50, 100,
150, 200, 250, 300, 350 or 370 contiguous amino acids of the FAD3 sequence (or
of the
variant sequence).
Amino acid sequences of functional FAD3 proteins
[108] The amino acid sequences depicted in the sequence listing are wild type,
functional FAD3 proteins from Brassica napus. Thus, these sequences are
endogenous to
the Brassica napus plants from which they were isolated. Other Brassica crop
species,
varieties, breeding lines or wild accessions may be screened for other
functional FAD3
proteins with the same amino acid sequences or variants thereof, as described
above.
[109] In addition, it is understood that FAD3 amino acid sequences and
variants thereof
(or fragments of any of these) may be identified in silico, by screening amino
acid
databases for essentially similar sequences. Fragments of amino acid molecules
according to the invention are also provided.
43
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
Amino acid sequences of mutant FAD3 proteins
[110] Amino acid sequences comprising one or more amino acid deletions,
insertions or
substitutions relative to the wild type amino acid sequences are another
embodiment of
the invention, as are fragments of such mutant amino acid molecules. Such
mutant amino
acid sequences can be generated and/or identified using various known methods,
as
described above. Again, such amino acid molecules are provided both in
endogenous
form and in isolated form.
[111] In one embodiment, the mutation(s) in the amino acid sequence result in
a
significantly reduced or completely abolished biological activity of the FAD3
protein
relative to the wild type protein. As described above, basically, any mutation
which
results in a protein comprising at least one amino acid insertion, deletion
and/or
substitution relative to the wild type protein can lead to significantly
reduced or no
biological activity. It is, however, understood that mutations in certain
parts of the protein
are more likely to result in a reduced function of the mutant FAD3 protein,
such as
mutations leading to truncated proteins, whereby significant portions of the
functional
and/or structural amino acid residues or domains, such as the ER retention
signal, the
eight conserved histidine residues or the signal sequence, are deleted or
substituted, as is
described above.
[112] Thus in one embodiment, mutant FAD3 proteins are provided comprising one
or
more deletion or insertion mutations, whereby the deletion(s), insertion(s) or
substitutions
result(s) in a mutant protein which has significantly reduced or no activity
in vivo. Such
mutant FAD3 proteins are FAD3 proteins wherein at least 1, at least 2, 3, 4,
5, 10, 20, 30,
50, 100, 150, 200, 250, 300, 350, 370 or more amino acids are deleted,
inserted or
substituted as compared to the wild type FAD3 protein, whereby the deletion(s)
or
insertion(s) result(s) in a mutant protein which has significantly reduced or
no activity in
vivo.
44
81714991
[113] In another embodiment, mutant FAD3 proteins are provided which are
truncated
whereby the truncation results in a mutant protein that has significantly
reduced or no
activity in vivo. The truncated protein lacks the amino acids encoded by the
coding DNA
downstream (3') of the mutation (i.e. the C-terminal part of the FAD3 protein)
and
maintains the amino acids encoded by the coding DNA upstream (5') of the
mutation (i.e.
the N-terminal part of the FAD3 protein). In one embodiment, the invention
provides a
truncated FAD3 protein comprising the N-terminal part of the corresponding
wild type
FAD3 protein up to but not (fully) including the ER retention motif , i.e.
corresponding
to anywhere upstream of the lysine residue(s) at position 375 and/or 373 of
SEQ ID NO:
2, so that at least lysine 375 and/or lysine 373 are lacking (or corresponding
lysine
residues in other FAD3 proteins). The more truncated the mutant FAD3 protein
is in
comparison to the wild type FAD3 protein, the more the truncation may result
in a
significantly reduced or no activity in vivo of the FAD3 protein. In another
embodiment,
the invention provides a truncated protein of less than about 299, 298 or 295
amino acids
(lacking the eighth, seventh, and/or sixth conserved histidines of the third
his-box), less
than about 131, 130 or 128 amino acids (lacking the fifth, fourth and/or third
sixth
conserved histidines of the second his-box), less than about 96 or 92 amino
acids (lacking
the second and/or first sixth conserved histidines of the first his-box) of
SEQ ID NO: 2 or
homologues residues hereto. In yet another embodiment, the invention provides
an N-
terminally truncated protein lacking the putative signal sequence.
[114] In yet another embodiment, mutant FAD3 proteins are provided comprising
one
or more substitution mutations, whereby the substitution(s) result(s) in a
mutant protein
that has significantly reduced or no activity in vivo. Such mutant FAD3
proteins are
FA13 proteins whereby conserved amino acid residues which have a specific
function,
such as ER targeting or retention, or iron-binding, are substituted. In one
embodiment, a
mutant FAD3 protein is provided wherein one or more of amino acids of the ER
retention
motive, i.e. residues 373-377, especially lysine 373 and/or 375 of SEQ ID NO:
2, or
homologues residues hereto, are substituted. Such mutations will lead to a
loss of ER
localization. Also provided are mutant FAD3 proteins with substitution of one
or more of
the eight conserved histidine residues, which will result in in a complete
loss of protein
CA 2781278 2019-06-14
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
function. Further, mutant FAD3 proteins are provided with substitution(s) of
amino
acid(s) in the N-terminal signal sequence. Such substitutions are likely to
result in a non-
functional FAD3 protein, due to loss of initial ER targeting.
[115] In yet another embodiment, mutant FAD3 proteins are provided comprising
one
or more insertion or deletion mutations, whereby the insertion(s) and/or
deletion(s)
result(s) in a mutant protein that has significantly reduced or no activity in
vivo. Such
mutant FAD3 proteins are FAD3 proteins whereby the positioning between
conserved
amino acid residues which have a specific function has been altered. In one
embodiment,
a mutant FAD3 protein is provided wherein one or more of amino acids have been
inserted between any of the eight conserved histidines and the putative
transmembrane
domains. In another embodiment, a mutant FAD3 protein is provided wherein one
or
more of amino acids have been deleted between any of the eight conserved
histidines and
the putative transmembrane domains. Such mutations are likely to result in an
altered
structure and possibly loss of function of the FAD3 protein.
Methods according to the invention
[116] Mutant FAD3 alleles may be generated (for example induced by
mutagenesis)
and/or identified using a range of methods, which are conventional in the art,
for example
using PCR based methods to amplify part or all of the FAD3 genomic or cDNA.
[117] Following mutagenesis, plants are grown from the treated seeds, or
regenerated
from the treated cells using known techniques. For instance, mutagenized seeds
may be
planted in accordance with conventional growing procedures and following self-
pollination seed is formed on the plants. Alternatively, doubled haploid
plantlets may be
extracted from treated microspore or pollen cells to immediately form
homozygous plants,
for example as described by Coventry et al. (1988, Manual for Microspore
Culture
Technique for Brassica napus. Dep. Crop Sci. Techn. Bull. OAC Publication
0489. Univ.
of Guelph, Guelph, Ontario, Canada). Additional seed which is formed as a
result of such
self-pollination in the present or a subsequent generation may be harvested
and screened
46
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
for the presence of mutant FAD3 alleles, using techniques which are
conventional in the
art, for example polymerase chain reaction (PCR) based techniques
(amplification of the
FAD3 alleles) or hybridization based techniques, e.g. Southern blot analysis,
BAC library
screening, and the like, and/or direct sequencing of FAD3 alleles. To screen
for the
presence of point mutations (so called Single Nucleotide Polymorphisms or
SNPs) in
mutant FAD3 alleles, SNP detection methods conventional in the art can be
used, for
example oligoligation-based techniques, single base extension-based
techniques, such as
pyrosequencing, or techniques based on differences in restriction sites, such
as TILLING.
[118] As described above, mutagenization (spontaneous as well as induced) of a
specific wild-type FAD3 allele results in the presence of one or more deleted,
inserted, or
substituted nucleotides (hereinafter called "mutation region") in the
resulting mutant
FAD3 allele. The mutant FAD3 allele can thus be characterized by the location
and the
configuration of the one or more deleted, inserted, or substituted nucleotides
in the wild
type FAD3 allele. The site in the wild type FAD3 allele where the one or more
nucleotides have been inserted, deleted, or substituted, respectively, is
herein also
referred to as the "mutation region or sequence". A "5' or 3' flanking region
or sequence"
as used herein refers to a DNA region or sequence in the mutant (or the
corresponding
wild type) FAD3 allele of at least 20 bp, preferably at least 50 bp, at least
750 bp, at least
1500 bp, and up to 5000 bp of DNA different from the DNA containing the one or
more
deleted, inserted, or substituted nucleotides, preferably DNA from the mutant
(or the
corresponding wild type) FAD3 allele which is located either immediately
upstream of
and contiguous with (5' flanking region or sequence") or immediately
downstream of and
contiguous with (3' flanking region or sequence") the mutation region in the
mutant
FAD3 allele (or in the corresponding wild type FAD3 allele). A "joining
region" as used
herein refers to a DNA region in the mutant (or the corresponding wild type)
FAD3 allele
where the mutation region and the 5' or 3' flanking region are linked to each
other. A
"sequence spanning the joining region between the mutation region and the 5'
or 3'
flanking region thus comprises a mutation sequence as well as the flanking
sequence
contiguous therewith.
47
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[119] The tools developed to identify a specific mutant FAD3 allele or the
plant or plant
material comprising a specific mutant FAD3 allele, or products which comprise
plant
material comprising a specific mutant FAD3 allele are based on the specific
genomic
characteristics of the specific mutant FAD3 allele as compared to the genomic
characteristics of the corresponding wild type FAD3 allele, such as, a
specific restriction
map of the genomic region comprising the mutation region, molecular markers or
the
sequence of the flanking and/or mutation regions.
[120] Once a specific mutant FAD3 allele has been sequenced, primers and
probes can
be developed which specifically recognize a sequence within the 5' flanking,
3' flanking
and/or mutation regions of the mutant FAD3 allele in the nucleic acid (DNA or
RNA) of
a sample by way of a molecular biological technique. For instance a PCR method
can be
developed to identify the mutant FAD3 allele in biological samples (such as
samples of
plants, plant material or products comprising plant material). Such a PCR is
based on at
least two specific "primers": (1) one recognizing a sequence within the 5' or
3' flanking
region of the mutant FAD3 allele and the other recognizing a sequence within
the 3' or 5'
flanking region of the mutant FAD3 allele, respectively; or (2) one
recognizing a
sequence within the 5' or 3' flanking region of the mutant FAD3 allele and the
other
recognizing a sequence within the mutation region of the mutant FAD3 allele;
or (3) one
recognizing a sequence within the 5' or 3' flanking region of the mutant FAD3
allele and
the other recognizing a sequence spanning the joining region between the 3' or
5'
flanking region and the mutation region of the specific mutant FAD3 allele (as
described
further below), respectively.
[121] The primers preferably have a sequence of between 15 and 35 nucleotides
which
under optimized PCR conditions "specifically recognize" a sequence within the
5' or 3'
flanking region, a sequence within the mutation region, or a sequence spanning
the
joining region between the 3' or 5' flanking and mutation regions of the
specific mutant
FAD3 allele, so that a specific fragment ("mutant FAD3 specific fragment" or
discriminating amplicon) is amplified from a nucleic acid sample comprising
the specific
48
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
mutant FAD3 allele. This means that only the targeted mutant FAD3 allele, and
no other
sequence in the plant genome, is amplified under optimized PCR conditions.
[122] PCR primers suitable for the invention may be the following:
- oligonucleotides ranging in length from 17 nt to about 200 nt, comprising a
nucleotide sequence of at least 17 consecutive nucleotides, preferably 20
consecutive nucleotides selected from the 5' or 3' flanking sequence of a
specific
mutant FAD3 allele or the complement thereof (i.e., for example, the sequence
5'
or 3' flanking the one or more nucleotides deleted, inserted or substituted in
the
mutant FAD3 alleles of the invention, such as the sequence 5' or 3' flanking
the
nonsense, missense, insertion, deletion, frameshift or splice site mutations
described above or the complement thereof) (primers recognizing 5' flanking
sequences); or
- oligonucleotides ranging in length from 17 nt to about 200 nt, comprising a
nucleotide sequence of at least 17 consecutive nucleotides, preferably 20
nucleotides selected from the sequence of the mutation region of a specific
mutant
FAD3 allele or the complement thereof (i.e., for example, the sequence of
nucleotides inserted or substituted in the FAD3 genes of the invention or the
complement thereof) (primers recognizing mutation sequences).
[123] The primers may of course be longer than the mentioned 17 consecutive
nucleotides, and may e.g. be 18, 19, 20, 21, 30, 35, 50, 75, 100, 150, 200 nt
long or even
longer. The primers may entirely consist of nucleotide sequence selected from
the
mentioned nucleotide sequences of flanking and mutation sequences. However,
the
nucleotide sequence of the primers at their 5' end (i.e. outside of the 3'-
located 17
consecutive nucleotides) is less critical. Thus, the 5' sequence of the
primers may consist
of a nucleotide sequence selected from the flanking or mutation sequences, as
appropriate,
but may contain several (e.g. 1, 2, 5, 10) mismatches. The 5' sequence of the
primers may
even entirely consist of a nucleotide sequence unrelated to the flanking or
mutation
sequences, such as e.g. a nucleotide sequence representing restriction enzyme
recognition
sites. Such unrelated sequences or flanking DNA sequences with mismatches
should
49
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
preferably be not longer than 100, more preferably not longer than 50 or even
25
nucleotides.
[124] Moreover, suitable primers may comprise or consist of a nucleotide
sequence
spanning the joining region between flanking and mutation sequences (i.e., for
example,
the joining region between a sequence 5' or 3' flanking one or more
nucleotides deleted,
inserted or substituted in the mutant FAD3 alleles of the invention and the
sequence of
the one or more nucleotides inserted or substituted or the sequence 3' or 5',
respectively,
flanking the one or more nucleotides deleted, such as the joining region
between a
sequence 5' or 3' flanking non-sense, missense, insertion, deletion,
frameshift or splice
site mutations in the FAD3 genes of the invention described above and the
sequence of
the non-sense, missense or frameshift mutations, or the joining region between
a
sequence 5' or 3' flanking a potential STOP codon mutation as indicated above
or the
substitution mutations indicated above and the sequence of the potential STOP
codon
mutation or the substitution mutations, respectively), provided the nucleotide
sequence is
not derived exclusively from either the mutation region or flanking regions.
[125] It will also be immediately clear to the skilled artisan that properly
selected PCR
primer pairs should also not comprise sequences complementary to each other.
[126] For the purpose of the invention, the "complement of a nucleotide
sequence
represented in SEQ ID No: X" is the nucleotide sequence which can be derived
from the
represented nucleotide sequence by replacing the nucleotides through their
complementary nucleotide according to Chargaff's rules (M-->T; G.(--->C) and
reading the
sequence in the 5' to 3' direction, i.e. in opposite direction of the
represented nucleotide
sequence.
[127] Examples of primers suitable to identify specific mutant FAD3 alleles
are
described in the Examples.
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[128] As used herein, "the nucleotide sequence of SEQ ID No. Z from position X
to
position Y" indicates the nucleotide sequence including both nucleotide
endpoints.
[129] Preferably, the amplified fragment has a length of between 50 and 1000
nucleotides, such as a length between 50 and 500 nucleotides, or a length
between 100
and 350 nucleotides. The specific primers may have a sequence which is between
80 and
100% identical to a sequence within the 5' or 3' flanking region, to a
sequence within the
mutation region, or to a sequence spanning the joining region between the 3'
or 5'
flanking and mutation regions of the specific mutant FAD3 allele, provided the
mismatches still allow specific identification of the specific mutant FAD3
allele with
these primers under optimized PCR conditions. The range of allowable
mismatches
however, can easily be determined experimentally and are known to a person
skilled in
the art.
[130] Detection and/or identification of a "mutant FAD3 specific fragment" can
occur in
various ways, e.g., via size estimation after gel or capillary electrophoresis
or via
fluorescence-based detection methods. The mutant FAD3 specific fragments may
also be
directly sequenced. Other sequence specific methods for detection of amplified
DNA
fragments are also known in the art.
[131] Standard PCR protocols are described in the art, such as in 'PCR
Applications
Manual" (Roche Molecular Biochemicals, 2nd Edition, 1999) and other
references. The
optimal conditions for the PCR, including the sequence of the specific
primers, is
specified in a "PCR identification protocol" for each specific mutant FAD3
allele. It is
however understood that a number of parameters in the PCR identification
protocol may
need to be adjusted to specific laboratory conditions, and may be modified
slightly to
obtain similar results. For instance, use of a different method for
preparation of DNA
may require adjustment of, for instance, the amount of primers, polymerase,
MgCl2
concentration or annealing conditions used. Similarly, the selection of other
primers may
dictate other optimal conditions for the PCR identification protocol. These
adjustments
51
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
will however be apparent to a person skilled in the art, and are furthermore
detailed in
current PCR application manuals such as the one cited above.
[132] Alternatively, specific primers can be used to amplify a mutant FAD3
specific
fragment that can be used as a "specific probe" for identifying a specific
mutant FAD3
allele in biological samples. Contacting nucleic acid of a biological sample,
with the
probe, under conditions that allow hybridization of the probe with its
corresponding
fragment in the nucleic acid, results in the formation of a nucleic acid/probe
hybrid. The
formation of this hybrid can be detected (e.g. labeling of the nucleic acid or
probe),
whereby the formation of this hybrid indicates the presence of the specific
mutant FAD3
allele. Such identification methods based on hybridization with a specific
probe (either on
a solid phase carrier or in solution) have been described in the art. The
specific probe is
preferably a sequence that, under optimized conditions, hybridizes
specifically to a region
within the 5' or 3' flanking region and/or within the mutation region of the
specific
mutant FAD3 allele (hereinafter referred to as "mutant FAD3 specific region").
Preferably, the specific probe comprises a sequence of between 10 and 1000 bp,
50 and
600 bp, between 100 to 500 bp, between 150 to 350bp, which is at least 80%,
preferably
between 80 and 85%, more preferably between 85 and 90%, especially preferably
between 90 and 95%, most preferably between 95% and 100% identical (or
complementary) to the nucleotide sequence of a specific region. Preferably,
the specific
probe will comprise a sequence of about 13 to about 100 contiguous nucleotides
identical
(or complementary) to a specific region of the specific mutant FAD3 allele.
[133] Specific probes suitable for the invention may be the following:
- oligonucleotides ranging in length from 13 nt to about 1000 nt, comprising a
nucleotide sequence of at least 13 consecutive nucleotides selected from the
5' or
3' flanking sequence of a specific mutant FAD3 allele or the complement
thereof
(i.e., for example, the sequence 5' or 3' flanking the one or more nucleotides
deleted, inserted or substituted in the mutant FAD3 alleles of the invention,
such
as the sequence 5' or 3' flanking the nonsense, missense, insertion, deletion,
frameshift mutations or splice site described above or the sequence 5' or 3'
52
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
flanking the nonsense, missense, insertion, deletion or frameshift mutations),
or a
sequence having at least 80% sequence identity therewith (probes recognizing
5'
or 3' flanking sequences); or
- oligonucleotides ranging in length from 13 nt to about 1000 nt, comprising a
nucleotide sequence of at least 13 consecutive nucleotides selected from the
mutation sequence of a specific mutant FAD3 allele or the complement thereof
(i.e., for example, the sequence of nucleotides inserted or substituted in the
FAD3
genes of the invention, or the complement thereof), or a sequence having at
least
80% sequence identity therewith (probes recognizing mutation sequences).
[134] The probes may entirely consist of nucleotide sequence selected from the
mentioned nucleotide sequences of flanking and mutation sequences. However,
the
nucleotide sequence of the probes at their 5' or 3' ends is less critical.
Thus, the 5' or 3'
sequences of the probes may consist of a nucleotide sequence selected from the
flanking
or mutation sequences, as appropriate, but may consist of a nucleotide
sequence unrelated
to the flanking or mutation sequences. Such unrelated sequences should
preferably be not
longer than 50, more preferably not longer than 25 or even not longer than 20
or 15
nucleotides.
[135] Moreover, suitable probes may comprise or consist of a nucleotide
sequence
spanning the joining region between flanking and mutation sequences (i.e., for
example,
the joining region between a sequence 5' or 3' flanking one or more
nucleotides deleted,
inserted or substituted in the mutant FAD3 alleles of the invention and the
sequence of
the one or more nucleotides inserted or substituted or the sequence 3' or 5',
respectively,
flanking the one or more nucleotides deleted, such as the joining region
between a
sequence 5' or 3' flanking nonsense, missense, insertion, deletion, frameshift
or splice
site mutations in the FAD3 genes of the invention described above and the
sequence of
the nonsense, missense, insertion, deletion, frameshift or splice site
mutations), provided
the mentioned nucleotide sequence is not derived exclusively from either the
mutation
region or flanking regions.
53
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[136] Examples of specific probes suitable to identify specific mutant FAD3
alleles are
described in the Examples.
[137] Detection and/or identification of a "mutant FAD3 specific region"
hybridizing to
a specific probe can occur in various ways, e.g., via size estimation after
gel
electrophoresis or via fluorescence-based detection methods. Other sequence
specific
methods for detection of a "mutant FAD3 specific region" hybridizing to a
specific probe
are also known in the art.
[138] Alternatively, plants or plant parts comprising one or more mutant FAD3
alleles
can be generated and identified using other methods, such as the "Delete-a-
geneTM"
method which uses PCR to screen for deletion mutants generated by fast neutron
mutagenesis (reviewed by Li and Zhang, 2002, Funct Integr Genomics 2:254-258),
by the
TILLING (Targeting Induced Local Lesions IN Genomes) method which identifies
EMS-
induced point mutations using denaturing high-performance liquid
chromatography
(DHPLC) to detect base pair changes by heteroduplex analysis (McCallum et al.,
2000,
Nat Biotech 18:455, and McCallum et a/. 2000, Plant Physiol. 123, 439-442),
etc. As
mentioned, TILLING uses high-throughput screening for mutations (e.g. using
Cel 1
cleavage of mutant-wildtype DNA heteroduplexes and detection using a
sequencing gel
system). Thus, the use of TILLING to identify plants or plant parts comprising
one or
more mutant FAD3 alleles and methods for generating and identifying such
plants, plant
organs, tissues and seeds is encompassed herein. Thus in one embodiment, the
method
according to the invention comprises the steps of mutagenizing plant seeds
(e.g. EMS
mutagenesis), pooling of plant individuals or DNA, PCR amplification of a
region of
interest, heteroduplex formation and high-throughput detection, identification
of the
mutant plant, sequencing of the mutant PCR product. It is understood that
other
mutagenesis and selection methods may equally be used to generate such mutant
plants.
[139] Instead of inducing mutations in FAD3 alleles, natural (spontaneous)
mutant
alleles may be identified by methods known in the art. For example, ECOTILLING
may
be used (Henikoff et al. 2004, Plant Physiology 135(2):630-6) to screen a
plurality of
54
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
plants or plant parts for the presence of natural mutant FAD3 alleles. As for
the
mutagenesis techniques above, preferably Brassica species are screened which
comprise
an A and/or a C genome, so that the identified FAD3 allele can subsequently be
introduced into other Brassica species, such as Brassica napus, by crossing
(inter- or
intraspecific crosses) and selection. In ECOTILLING natural polymorphisms in
breeding
lines or related species are screened for by the TILLING methodology described
above,
in which individual or pools of plants are used for PCR amplification of the
FAD3 target,
heteroduplex formation and high-throughput analysis. This can be followed by
selecting
individual plants having a required mutation that can be used subsequently in
a breeding
program to incorporate the desired mutant allele.
[140] The identified mutant alleles can then be sequenced and the sequence can
be
compared to the wild type allele to identify the mutation(s). Optionally,
functionality can
be tested as indicated above. Using this approach a plurality of mutant FAD3
alleles (and
Brassica plants comprising one or more of these) can be identified. The
desired mutant
alleles can then be combined with the desired wild type alleles by crossing
and selection
methods as described further below. Finally a single plant comprising the
desired number
of mutant FAD3 and the desired number of wild type FAD3 alleles is generated.
[141] Oligonucleotides suitable as PCR primers or specific probes for
detection of a
specific mutant FAD3 allele can also be used to develop methods to determine
the
zygosity status of the specific mutant FAD3 allele.
[142] To determine the zygosity status of a specific mutant FAD3 allele, a PCR-
based
assay can be developed to determine the presence of a mutant and/or
corresponding wild
type FAD3 specific allele:
[143] To determine the zygosity status of a specific mutant FAD3 allele, two
primers
specifically recognizing the wild-type FAD3 allele can be designed in such a
way that
they are directed towards each other and have the mutation region located in
between the
primers. These primers may be primers specifically recognizing the 5' and 3'
flanking
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
sequences, respectively. This set of primers allows simultaneous diagnostic
PCR
amplification of the mutant, as well as of the corresponding wild type FAD3
allele.
[144] Alternatively, to determine the zygosity status of a specific mutant
FAD3 allele,
two primers specifically recognizing the wild-type FAD3 allele can be designed
in such a
way that they are directed towards each other and that one of them
specifically recognizes
the mutation region. These primers may be primers specifically recognizing the
sequence
of the 5' or 3' flanking region and the mutation region of the wild type FAD3
allele,
respectively. This set of primers, together with a third primer which
specifically
recognizes the sequence of the mutation region in the mutant FAD3 allele,
allow
simultaneous diagnostic PCR amplification of the mutant FAD3 gene, as well as
of the
wild type FAD3 gene.
[145] Alternatively, to determine the zygosity status of a specific mutant
FAD3 allele,
two primers specifically recognizing the wild-type FAD3 allele can be designed
in such a
way that they are directed towards each other and that one of them
specifically recognizes
the joining region between the 5' or 3' flanking region and the mutation
region. These
primers may be primers specifically recognizing the 5' or 3' flanking sequence
and the
joining region between the mutation region and the 3' or 5' flanking region of
the wild
type FAD3 allele, respectively. This set of primers, together with a third
primer which
specifically recognizes the joining region between the mutation region and the
3' or 5'
flanking region of the mutant FAD3 allele, respectively, allow simultaneous
diagnostic
PCR amplification of the mutant FAD3 gene, as well as of the wild type FAD3
gene.
[146] Alternatively, the zygosity status of a specific mutant FAD3 allele can
be
determined by using alternative primer sets that specifically recognize mutant
and wild
type FAD3 alleles.
[147] If the plant is homozygous for the mutant FAD3 allele or the
corresponding wild
type FAD3 allele, the diagnostic PCR assays described above will give rise to
a single
PCR product typical, preferably typical in length, for either the mutant or
wild type FAD3
56
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
allele. If the plant is heterozygous for the mutant FAD3 allele, two specific
PCR products
will appear, reflecting both the amplification of the mutant and the wild type
FAD3 allele.
[148] Identification of the wild type and mutant FAD3 specific PCR products
can occur
e.g. by size estimation after gel or capillary electrophoresis (e.g. for
mutant FAD3 alleles
comprising a number of inserted or deleted nucleotides which results in a size
difference
between the fragments amplified from the wild type and the mutant FAD3 allele,
such
that said fragments can be visibly separated on a gel); by evaluating the
presence or
absence of the two different fragments after gel or capillary electrophoresis,
whereby the
diagnostic PCR amplification of the mutant FAD3 allele can, optionally, be
performed
separately from the diagnostic PCR amplification of the wild type FAD3 allele;
by direct
sequencing of the amplified fragments; or by fluorescence-based detection
methods.
[149] Examples of primers suitable to determine the zygosity of specific
mutant FAD3
alleles are described in the Examples.
[150] Alternatively, to determine the zygosity status of a specific mutant
FAD3 allele, a
hybridization-based assay can be developed to determine the presence of a
mutant and/or
corresponding wild type FAD3 specific allele:
[151] To determine the zygosity status of a specific mutant FAD3 allele, two
specific
probes recognizing the wild-type FAD3 allele can be designed in such a way
that each
probe specifically recognizes a sequence within the FAD3 wild type allele and
that the
mutation region is located in between the sequences recognized by the probes.
These
probes may be probes specifically recognizing the 5' and 3' flanking
sequences,
respectively. The use of one or, preferably, both of these probes allows
simultaneous
diagnostic hybridization of the mutant, as well as of the corresponding wild
type FAD3
allele.
[152] Alternatively, to determine the zygosity status of a specific mutant
FAD3 allele, -
two specific probes recognizing the wild-type FAD3 allele can be designed in
such a way
57
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
that one of them specifically recognizes a sequence within the FAD3 wild type
allele
upstream or downstream of the mutation region, preferably upstream of the
mutation
region, and that one of them specifically recognizes the mutation region.
These probes
may be probes specifically recognizing the sequence of the 5' or 3' flanking
region,
preferably the 5' flanking region, and the mutation region of the wild type
FAD3 allele,
respectively. The use of one or, preferably, both of these probes, optionally,
together with
a third probe which specifically recognizes the sequence of the mutation
region in the
mutant FAD3 allele, allow diagnostic hybridization of the mutant and of the
wild type
FAD3 gene.
[153] Alternatively, to determine the zygosity status of a specific mutant
FAD3 allele, a
specific probe recognizing the wild-type FAD3 allele can be designed in such a
way that
the probe specifically recognizes the joining region between the 5' or 3'
flanking region,
preferably the 5' flanking region, and the mutation region of the wild type
FAD3 allele.
This probe, optionally, together with a second probe that specifically
recognizes the
joining region between the 5' or 3' flanking region, preferably the 5'
flanking region, and
the mutation region of the mutant FAD3 allele, allows diagnostic hybridization
of the
mutant and of the wild type FAD3 gene.
[154] Alternatively, the zygosity status of a specific mutant FAD3 allele can
be
determined by using alternative sets of probes that specifically recognize
mutant and wild
type FAD3 alleles.
[155] If the plant is homozygous for the mutant FAD3 gene or the corresponding
wild
type FAD3 gene, the diagnostic hybridization assays described above will give
rise to a
single specific hybridization product, such as one or more hybridizing DNA
(restriction)
fragments, typical, preferably typical in length, for either the mutant or
wild type FAD3
allele. If the plant is heterozygous for the mutant FAD3 allele, two specific
hybridization
products will appear, reflecting both the hybridization of the mutant and the
wild type
FAD3 allele.
58
=
CA 02781278 2017-01-30
= 75749-72
[156] Identification of the wild type and mutant FAD3 specific hybridization
products
can occur e.g. by size estimation after gel or capillary electrophoresis (e.g.
for mutant
FAD3 alleles comprising a number of inserted or deleted nucleotides which
results in a
size difference between the hybridizing DNA (restriction) fragments from the
wild type
and the mutant FAD3 allele, such that said fragments can be visibly separated
on a gel);
by evaluating the presence or absence of the two different specific
hybridization products
after gel or capillary electrophoresis, whereby the diagnostic hybridization
of the mutant
FAD3 allele can, optionally, be performed separately from the diagnostic
hybridization of
the wild type FAD3 allele; by direct sequencing of the hybridizing DNA
(restriction)
fragments; or by fluorescence-based detection methods.
[157] Examples of probes suitable to determine the zygosity of specific mutant
FAD3
alleles are described in the Examples.
[158] Furthermore, detection methods specific for a specific mutant FAD3
allele that
differ from PCR- or hybridization-based amplification methods can also be
developed
using the specific mutant FAD3 allele specific sequence information provided
herein.
Such alternative detection methods include linear signal amplification
detection methods
based on invasive cleavage of particular nucleic acid structures, also known
as Invaderrm
technology, (as described e.g. in US patent 5,985,557 "Invasive Cleavage of
Nucleic
Acids", 6,001,567 "Detection of Nucleic Acid sequences by Invader Directed
Cleavage),
RT-PCR-based detection methods, such as Taqman, or
other detection methods, such as SNPlex. Briefly, in the InvaderTm technology,
the target
mutation sequence may e.g. be hybridized with a labeled first nucleic acid
oligonucleotide comprising the nucleotide sequence of the mutation sequence or
a
sequence spanning the joining region between the 5' flanking region and the
mutation
region and with a second nucleic acid oligonucleotide comprising the 3'
flanking
sequence immediately downstream and adjacent to the mutation sequence, wherein
the
first and second oligonucleotide overlap by at least one nucleotide. The
duplex or triplex
structure that is produced by this hybridization allows selective probe
cleavage with an
enzyme (Cleavasee) leaving the target sequence intact. The cleaved labeled
probe is
59
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
subsequently detected, potentially via an intermediate step resulting in
further signal
amplification.
[159] A "kit", as used herein, refers to a set of reagents for the purpose of
performing
the method of the invention, more particularly, the identification of a
specific mutant
FAD3 allele in biological samples or the determination of the zygosity status
of plant
material comprising a specific mutant FAD3 allele. More particularly, a
preferred
embodiment of the kit of the invention comprises at least two specific
primers, as
described above, for identification of a specific mutant FAD3 allele, or at
least two or
three specific primers for the determination of the zygosity status.
Optionally, the kit can
further comprise any other reagent described herein in the PCR identification
protocol.
Alternatively, according to another embodiment of this invention, the kit can
comprise at
least one specific probe, which specifically hybridizes with nucleic acid of
biological
samples to identify the presence of a specific mutant FAD3 allele therein, as
described
above, for identification of a specific mutant FAD3 allele, or at least two or
three specific
probes for the determination of the zygosity status. Optionally, the kit can
further
comprise any other reagent (such as but not limited to hybridizing buffer,
label) for
identification of a specific mutant FAD3 allele in biological samples, using
the specific
probe.
[160] The kit of the invention can be used, and its components can be
specifically
adjusted, for purposes of quality control (e.g., purity of seed lots),
detection of the
presence or absence of a specific mutant FAD3 allele in plant material or
material
comprising or derived from plant material, such as but not limited to food or
feed
products.
[161] The term "primer" as used herein encompasses any nucleic acid that is
capable of
priming the synthesis of a nascent nucleic acid in a template-dependent
process, such as
PCR. Typically, primers are oligonucleotides from 10 to 30 nucleotides, but
longer
sequences can be employed. Primers may be provided in double-stranded form,
though
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
the single-stranded form is preferred. Probes can be used as primers, but are
designed to
bind to the target DNA or RNA and need not be used in an amplification
process.
[162] The term "recognizing" as used herein when referring to specific
primers, refers
to the fact that the specific primers specifically hybridize to a nucleic acid
sequence in a
specific mutant FAD3 allele under the conditions set forth in the method (such
as the
conditions of the PCR identification protocol), whereby the specificity is
determined by
the presence of positive and negative controls.
[163] The term "hybridizing", as used herein when referring to specific
probes, refers to
the fact that the probe binds to a specific region in the nucleic acid
sequence of a specific
(mutant or wild type) FAD3 allele under standard stringency conditions.
Standard
stringency conditions as used herein refers to the conditions for
hybridization described
herein or to the conventional hybridizing conditions as described by Sambrook
et al.,
1989 (Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring
Harbour
Laboratory Press, NY) which for instance can comprise the following steps: 1)
immobilizing plant genomic DNA fragments or BAC library DNA on a filter, 2)
prehybridizing the filter for 1 to 2 hours at 65 C in 6 X SSC, 5 X Denhardt's
reagent,
0.5% SDS and 20 ig/m1 denaturated carrier DNA, 3) adding the hybridization
probe
which has been labeled, 4) incubating for 16 to 24 hours, 5) washing the
filter once for 30
min. at 68 C in 6X SSC, 0.1 %SDS, 6) washing the filter three times (two times
for 30
min. in 30m1 and once for 10 min in 500m1) at 68 C in 2 X SSC, 0.1 %SDS, and
7)
exposing the filter for 4 to 48 hours to X-ray film at -70 C.
[164] As used in herein, a "biological sample" is a sample of a plant, plant
material or
product comprising plant material. The term "plant" is intended to encompass
plant
tissues, at any stage of maturity, as well as any cells, tissues, or organs
taken from or
derived from any such plant, including without limitation, any seeds, leaves,
stems,
flowers, roots, single cells, gametes, cell cultures, tissue cultures or
protoplasts. "Plant
material", as used herein refers to material that is obtained or derived from
a plant.
Products comprising plant material relate to food, feed or other products that
are
61
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
produced using plant material or can be contaminated by plant material. It is
understood
that, in the context of the present invention, such biological samples are
tested for the
presence of nucleic acids specific for a specific mutant FAD3 allele, implying
the
presence of nucleic acids in the samples. Thus the methods referred to herein
for
identifying a specific mutant FAD3 allele in biological samples, relate to the
identification in biological samples of nucleic acids that comprise the
specific mutant
FAD3 allele.
[165] The present invention also relates to the combination of specific FAD3
alleles in
one plant, to the transfer of one or more specific mutant FAD3 allele(s) from
one plant to
another plant, to the plants comprising one or more specific mutant FAD3
allele(s), the
progeny obtained from these plants and to plant cells, plant parts, and plant
seeds derived
from these plants.
[166] Thus, in one embodiment of the invention a method for combining two or
more
selected mutant FAD3 alleles in one plant is provided comprising the steps of:
a. generating and/or identifying two or more plants each comprising one or
more
selected mutant FAD3 alleles, as described above,
b. crossing a first plant comprising one or more selected mutant FAD3 alleles
with a
second plant comprising one or more other selected mutant FAD3 alleles,
collecting Fl seeds from the cross, and, optionally, identifying an Fl plant
comprising one or more selected mutant FAD3 alleles from the first plant with
one or more selected mutant FAD3 alleles from the second plant, as described
above,
c. optionally, repeating step (b) until an Fl plant comprising all selected
mutant
FAD3 alleles is obtained,
d. optionally,
- identifying an Fl plant, which is homozygous or heterozygous for a selected
mutant FAD3 allele by determining the zygosity status of the mutant FAD3
alleles,
as described above, or
62
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
- generating
plants which are homozygous for one or more of the selected mutant
FAD3 alleles by performing one of the following steps:
- extracting doubled haploid plants from treated microspore or pollen cells
of Fl plants comprising the one or more selected mutant FAD3 alleles, as
described above,
- selfmg the F! plants comprising the one or more selected mutant FAD3
allele(s) for one or more generations (y), collecting Fl Sy seeds from the
selfings, and identifying F! Sy plants, which are homozygous for the one
or more mutant FAD3 allele, as described above.
[167] In another embodiment of the invention a method for transferring one or
more
mutant FAD3 alleles from one plant to another plant is provided comprising the
steps of:
a. generating and/or identifying a first plant comprising one or more selected
mutant
FAD3 alleles, as described above, or generating the first plant by combining
the
one or more selected mutant FAD3 alleles in one plant, as described above
(wherein the first plant is homozygous or heterozygous for the one or more
mutant FAD3 alleles)
b. crossing the first plant comprising the one or more mutant FAD3 alleles
with a
second plant not comprising the one or more mutant FAD3 alleles, collecting Fl
seeds from the cross (wherein the seeds are heterozygous for a mutant FAD3
allele if the first plant was homozygous for that mutant FAD3 allele, and
wherein
half of the seeds are heterozygous and half of the seeds are azygous for, i.e.
do not
comprise, a mutant FAD3 allele if the first plant was heterozygous for that
mutant
FAD3 allele), and, optionally, identifying Fl plants comprising one or more
selected mutant FAD3 alleles, as described above,
c. backcrossing Fl plants comprising one or more selected mutant FAD3 alleles
with the second plant not comprising the one or more selected mutant FAD3
alleles for one or more generations (x), collecting BCx seeds from the
crosses,
and identifying in every generation BCx plants comprising the one or more
selected mutant FAD3 alleles, as described above,
63
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
d. optionally, generating BCx plants which are homozygous for the one or more
selected mutant FAD3 alleles by performing one of the following steps:
- extracting doubled haploid plants from treated microspore or pollen cells of
BCx plants comprising the one or more desired mutant FAD3 allele(s), as
described above
- selfing the BCx plants comprising the one or more desired mutant FAD3
allele(s) for one or more generations (y), collecting BCx Sy seeds from the
selfings, and identifying BCx Sy plants, which are homozygous for the one
or more desired mutant FAD3 allele, as described above.
[168] In one aspect of the invention, the first and the second plant are
Brassicaceae
plants, particularly Brassica plants, especially Brassica napus plants or
plants from
another Brassica crop species. In another aspect of the invention, the first
plant is a
Brassicaceae plant, particularly a Brassica plant, especially a Brassica napus
plant or a
plant from another Brassica crop species, and the second plant is a plant from
a
Brassicaceae breeding line, particularly from a Brassica breeding line,
especially from a
Brassica napus breeding line or from a breeding line from another Brassica
crop species.
"Breeding line", as used herein, is a preferably homozygous plant line
distinguishable
from other plant lines by a preferred genotype and/or phenotype that is used
to produce
hybrid offspring.
[169] In yet another embodiment of the invention, a method for making a plant,
in
particular a Brassica crop plant, such as a Brassica napus plant, of which the
seed oil has
a significantly reduced C18:3 content, but which preferably maintains an
agronomically
suitable development, is provided comprising combining and/or transferring
mutant
FAD3 alleles according to the invention in or to one Brassica plant, as
described above.
[170] In one aspect of the invention, the plant is a Brassica plant comprising
at least two
mutant FAD3 genes wherein the seed oil has a significantly reduced C18:3
content, but
which preferably maintains an agronomically suitable development, by combining
and/or
64
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
transferring at least two mutant FAD3 alleles according to the invention in or
to the
Brassica plant, as described above.
[171] The invention also relates to the use of a plant, in particular a
Brassica crop plant,
such as a Brassica napus plant, comprising one or more of the mutant FAD3
alleles of the
invention for combining and/or transferring mutant FAD3 alleles according to
the
invention in or to one Brassica plant, as described above.
[172] In yet another embodiment, the invention relates to the use of a mutant
FAD3
allele of the invention to reduce the C18:3 content in the seed oil of a
Brassica plant
[173] In another aspect of the invention the use of the plants and seeds of
the invention
to produce oilseed rape oil is provided.
[174] In a further embodiment, the invention provides the use of the plants of
the
invention to produce seed comprising mutant FAD3 alleles or to produce a crop
of
oilseed rape comprising mutant FAD3 proteins.
SEQUENCES
[175] SEQ ID NO: 1: Genomic DNA of the FAD3-Al gene from Brassica napus.
[176] SEQ ID NO: 2: Amino acid sequence of the FAD3-Al protein from Brassica
napus
[177] SEQ ID NO: 3: Genomic DNA of the FAD3-C1 gene from Brassica napus
[178] SEQ ID NO: 4: Amino acid sequence of the FAD3-A2 protein from Brassica
napus
[179] SEQ ID NO: 5: Genomic DNA of the FAD3-A2 gene from Brassica napus
[180] SEQ ID NO: 6: Amino acid sequence of the FAD3-A2 protein from Brassica
napus
[181] SEQ ID NO: 7: Genomic DNA of the FAD3-A3 gene from Brassica napus
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[182] SEQ ID NO: 8: Amino acid sequence of the FAD3-A3 protein from Brassica
napus
[183] SEQ ID NO: 9: Genomic DNA of the FAD3-C2 gene from Brassica napus
[184] SEQ ID NO: 10: Amino acid sequence of the FAD3-C2 protein from Brassica
napus
[185] SEQ ID NO: 11: Coding region of the FAD3-A1 gene from Brassica napus
[186] SEQ ID NO: 12: Coding region of the FAD3-C1 gene from Brassica napus
[187] SEQ ID NO: 13: Coding region of the FAD3-A2 gene from Brassica napus
[188] SEQ ID NO: 14: Coding region of the FAD3-A3 gene from Brassica napus
[189] SEQ ID NO: 15: Coding region of the FAD3-C2 gene from Brassica napus
[190] SEQ ID NO: 16: Arabidopsis FAD3 forward PCR primer
[191] SEQ ID NO: 17: Arabidopsis FAD3 reverse PCR primer
[192] SEQ ID NO: 18: LOLI105 FAM probe
[193] SEQ ID NO: 19: LOLI105 VIC probe
[194] SEQ ID NO: 20: LOLI105 Fw primer
[195] SEQ ID NO: 21: LOLI105 Rw primer
[196] SEQ ID NO: 22: LOLI103 FAM probe
[197] SEQ ID NO: 23: LOLI103 VIC probe
[198] SEQ ID NO: 24: LOLI103 Fw primer
[199] SEQ ID NO: 25: LOLI103 Rw primer
[200] SEQ ID NO: 26: LOL1108 FAM probe
[201] SEQ ID NO: 27: LOLI108 VIC probe
[202] SEQ ID NO: 28: LOLI108 Fw primer
[203] SEQ ID NO: 29: LOLI108 Rw primer
[204] SEQ ID NO: 30: LOLI111 FAM probe
[205] SEQ ID NO: 31: LOLI111 VIC probe
[206] SEQ ID NO: 32: LOLI111 Fw primer
[207] SEQ ID NO: 33: LOLI111 Rw primer
[208] SEQ ID NO: 34: LOLI115 FAM probe
[209] SEQ ID NO: 35: LOLI115 VIC probe
[210] SEQ ID NO: 36: LOLI115 Fw primer
66
CA 02781278 2017-01-30
. 75749-72
[211] SEQ ID NO: 37: LOLI115 Rw primer
EXAMPLES
[212] All examples were essentially carried out as described in W009/007091.
Example 1 - Determination of number of FAD3 genes in Brassica napus and
isolation of the DNA sequences of the FAD3 genes
[213] A Bacterial Artificial Chromosome (BAC) library of a Brassica napus
research
spring OSR line was screened using a probe that was amplified from Arabidopsis
genomic DNA with primers with SEQ ID NO: 16 and SEQ ID NO: 17 according to
standard molecular biological techniques and BAC clones hybridizing to the
probe were
isolated (hereinafter called "positive colonies").
[214] Southern blot analysis was performed using the same probe as above
according to
standard molecular biological techniques on BAC clone DNA isolated from the
positive
colonies and on genomic DNA isolated from B. napus (AC). Brassica rapa (AA)
and
Brassica oleracea (CC). Based on a comparison between the hybridization
patterns
obtained after digestion of BAC clone DNA of the identified positive colonies
and of
genomic DNA isolated from B. napus, B. rapa and B. oleracea, the BAC clones
were
grouped in 5 groups, of which three could be mapped to the A genome and two to
the C
genome. For each of the 5 groups a BAC clone was selected.
Example 2 - Characterization of FAD3 gene sequences from Brassica napus
[215] The entire DNA sequences of the BAC clones of the selected positive
colonies
were determined by 454 sequencing, after which the FAD3 sequences were
identified by
blast analysis (Blast2seq) using the Arabidopsis thaliana FAD3 gene (genbank
accession
number D26508) as query sequence.
67
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[216] The intron-exon structures of the FAD3 sequences were determined with
FgeneSH (Softberry, Inc. Mount Kisco, NY, USA) and by optimal alignment of the
gene
sequence with the A. thaliana coding sequence (genbank accession number
NM_128552).
The protein encoding regions of the FAD3 genes as well as the FAD3 amino acid
sequences encoded by these nucleic acid sequences are represented in the
sequence
listing. Of the FAD3 genes mapping to the A-genome, the sequence of the FAD3
gene
mapping to N04 was found to correspond to FAD3-A gene (genbank accession
number
L22962) and was designated FAD3-Al, while the sequences mapping to NOS and NO3
were designated FAD3-A2 and FAD3-A3 respectively. Of the FAD3 genes mapping on
C
genome, one of the sequences was found to correspond to a FAD3-C gene
(described in
W004/072259) and was designated FAD3-C1, while the other was found to be
homologous to FAD3-A2 and was designated FAD3-C2. These designations are used
throughout the specification. The genomic sequences of the FAD3 genes are
represented
in the sequence listing.
Example 3 - Expression of Brassica FAD3 genes
[217] The relative and absolute expression levels of the various FAD3 genes in
developing embryo's from B. napus were determined by whole transcriptome
sequencing
of cDNAs using the Roche 454 GS
FLX Titanium technology
(http://www.454.com/products-solutions/how-it-works/index.asp). For the
production of
cDNA total RNA was extracted using TRIZOL reagent (Invitrogen). This was done
in
triplicate for every embryo developmental stage. Subsequently, total RNA
samples
derived from embryos of the same developmental stage were pooled and mRNA was
purified from the total RNA samples with the GE Healthcare mRNA Purification
Kit. In
the next step, cDNA was prepared using the SuperScript Double-Stranded cDNA
Synthesis Kit (Invitrogen). Then, cDNA was size fractionated using CHROMA Spin-
400
columns according to the protocol described in the SMART cDNA Library
Construction
Kit (Clontech). Following cDNA sequence analysis transcript quantification was
done by
68
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
read counting of target sequences. Expression of each FAD3 gene was normalized
for the
number of sequences in each time-point dataset.
Table 1: Normalized (norm) FAD3 expression and percentage (%) of total FAD3
expression in embryos of Brassica napus 14-35 days after flowering (DAF).
14-20 DAF 21-25 DAF 26-30 DAF 31-35 DAF
norm norm norm norm
FAD3-A1 210.0 38.9% 213.9 39.8% 150.5 42.6% 22.8 26.9%
FAD3-C1 227.0 42.0% 226.9 42.2% 148.8 42.2% 43.3 50.9%
FAD3-A2 35.0 6.5% 36.7 6.8% 11.6 3.3% 6.3 7.4%
FAD3-A3 32.0 5.9% 38.9 7.2% 30.6 8.7% 9.5 11.1%
FAD3-C2 36.0 6.7% 21.6 4.0% 11.6 3.3% 3.2 3.7%
tot 540.0 100.0% 538.0 100.0% 353.0 100.0% 85.1 100.0%
[218] From table 1 it is clear that the total FAD3 expression diminishes over
time.
FAD3-Al and FAD3-C1 constitute the larger part of the total FAD3 mRNA
expression,
both around 40%. This is followed by FAD3-A3, FAD-A2 and FAD-C2, comprising at
most 11.1%, 7.4% and 6.7% of the total FAD3 expression, respectively.
Example 4 - Generation and isolation of mutant Brassica FAD3 alleles
[219] Mutations in the FAD3 genes identified in Example 1 were generated and
identified as follows:
- 30,000 seeds from an elite spring oilseed rape breeding line (MO
seeds) were
preimbibed for two hours on wet filter paper in deionized or distilled water.
Half of the
seeds were exposed to 0.8% EMS and half to 1% EMS (Sigma: M0880) and incubated
for 4 hours.
- The mutagenized seeds (M1 seeds) were rinsed 3 times and dried in a
fume hood
overnight. 30,000 M1 plants were grown in soil and selfed to generate M2
seeds. M2
seeds were harvested for each individual MI plant.
- Two times 4800 M2 plants, derived from different M1 plants, were
grown and DNA
samples were prepared from leaf samples of each individual M2 plant according
to the
CTAB method (Doyle and Doyle, 1987, Phytochemistry Bulletin 19:11-15).
69
CA 02781278 2012-05-17
WO 2011/060946 PCT/EP2010/007028
- The DNA samples were screened for the presence of point mutations in the
FAD3
genes causing the introduction of STOP codons in the protein-encoding regions
of the
FAD3 genes or the disruption of splice sites in the FAD3 mRNA, by direct
sequencing by
standard sequencing techniques (Agowa) and analyzing the sequences for the
presence of
the point mutations using the NovoSNP software (VIB Antwerp).
- The following mutant FAD3 alleles were thus identified:
Table 2: Mutations in FAD3 genes
Nucleotide position Wild Amino acid
Mutant sequence Mutation
Allele type
Genomic Coding codon and type
co don
sequence sequence position
FAD3-Al SEQ ID: 1 SEQ ID: 11 SEQ ID: 2
LOLI105 2405 732 TGG TGA 244 Trp-
>Stop
FAD3-C1 SEQ ID: 3 SEQ ID: 12 SEQ ID: 4
LOLI103(1) 2702 543 TGG TGA 181
TrpH>Stop
FAD3-A2 SEQ ID: 5 SEQ ID: 13 SEQ ID: 6
LOLI108(2) 3934 749 TGG TAG 250
Trp7>Stop
FAD3-A3 SEQ ID: 7 SEQ ID: 14 SEQ ID: 8
LOLI111(3) 2847 552 TGG TGA 184
TrpStop
FAD3-C2 SEQ ID: 9 SEQ ID: 15 SEQ ID: 10
LOLI115(2) 3909 551 TGG TAG 184
Trp4Stop
(1) Seeds comprising FAD3-A1-LOLI 05 and FAD3-CJ -LOLI1 03 (designated
09MBBN001740) have been deposited at the NCIMB Limited (Ferguson Building,
Craibstone Estate, Bucksburn, Aberdeen, Scotland, AB21 9YA, UK) on October 9,
2009, under accession number NCIMB 41655.
(2) Seeds comprising FAD3-A2-LOL1108 and FAD3-C2-LOL1115 (designated
09MBBN001742) have been deposited at the NCIMB Limited (Ferguson Building,
Craibstone Estate, Bucksburn, Aberdeen, Scotland, AB21 9YA, UK) on October 9,
2009, under accession number NCIMB 41656.
(3) Seeds comprising FAD3-A3-LOL1111 (designated 09MBBN000519) have been
deposited at the NCIMB Limited (Ferguson Building, Craibstone Estate,
Bucksburn,
Aberdeen, Scotland, AB21 9YA, UK) on October 9, 2009, under accession number
NCIMB 41657.
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
[220] In conclusion, the above examples show how mutant FAD3 alleles can be
generated and isolated. Also, plant material comprising such mutant alleles
can be used to
combine selected mutant and/or wild type alleles in a plant, as described in
the following
examples.
Example 5- Identification of a Brassica plant comprising a mutant Brassica
FAD3
allele
[221] Brassica plants comprising the mutations in the FAD3 genes identified in
Example 4 were identified as follows:
- For each
mutant FAD3 allele identified in the DNA sample of an M2 plant, at least 48
M2 plants derived from the same M1 plant as the M2 plant comprising the FAD3
mutation were grown and DNA samples were prepared from leaf samples of each
individual M2 plant.
- The DNA samples were screened for the presence of the identified point
FAD3
mutation as described above in Example 4.
- Heterozygous and homozygous (as determined based on the
electropherograms) M2
plants comprising the same mutation were selfed and M3 seeds were harvested.
Example 6 - Analysis of the fatty acid composition of the seed oil of Brassica
plants
comprising one to three mutant Brassica FAD3 genes in elite Brassica lines
[222] The correlation between the presence of multiple mutant FAD3 alleles in
a
Brassica plant grown in the greenhouse and the fatty acid composition of the
seed oil of
the Brassica plant was determined as follows. Of the Brassica plants
identified in
Example 5 (F1S2), plants comprising a mutant allele of each of the FAD3 genes
(L0LI105, LOLI103, L0LI108, LOLII15 and LOLI111) were first crossed with an
elite
male and an elite female Brassica breeding line, and the progeny plants
comprising the
mutation were subsequently selfed to obtain homozygous plants. For comparison,
the
same crossings were performed with plants comprising mutant FAD-Al and FAD-C1
alleles as described in W001/25453 and W004/072259, respectively.
Subsequently, the
71
CA 02781278 2012-05-17
WO 2011/060946 PC
T/EP2010/007028
fatty acid composition of the seed oil of individual progeny Brassica plants
homozygous
for the mutant FAD3 allele(s) was determined by extracting the fatty acyls
from the seeds
and analyzing their relative levels in the seed oil by capillary gas-liquid
chromatography
as described in W009/007091. Table 3 displays the percentage C18:3 of the
total oil
content of at least 0.2g of mature seed of the Fl S2 x elite crosses of
Brassica plants
grown in the greenhouse.
Table 3: Average (Av) and standard deviation (SD) of C18:3 seed oil content
percentage
(%) in elite male and female crosses. ND: could not be determined.
Female Male
allele Av SD Av SD
FAD3A1/EAD3C1/FAD3A2/FAD3A3/EAD3C2 C18:3 C18:3
C18:3 C18:3
LOLI103
FAD3A1/FAD3C1/W-TYPE/W-TYPE/W-TYPE 3.59 0.32 3.97 0.38
FAD3A1/LOLI103/W-TYPE/W-TYPE/W-TYPE 3.90 0.30 3.97 0.63
WTYPE/FAD3C1/W-TYPE/W-TYPE/W-TYPE 5.89 0.51 5.99 0.53
WTYPE/LOLI103/W-TYPE/W-TYPE/W-TYPE 6.37 0.74 6.15 0.67
LOLI105
FAD3A1/FAD3C1/W-TYPE/W-TYPE/W-TYPE 3.82 0.74 3.69 0.88
LOLI105/FAD3C1/W-TYPE/W-TYPE/W-TYPE 3.68 0.42 4.35 1.54
FAD3A1/W-TYPE/W-TYPE/W-TYPE/W-TYPE 5.81 0.46 5.78 0.85
LOLI105/W-TYPE/W-TYPE/W-TYPE/W-TYPE 6.24 0.50 5.98 0.87
LOLI108
FAD3A1/FAD3C1/W-TYPE/W-TYPE/W-TYPE 3.42 0.11 2.84 0.12
EAD3A1/FAD3C1/LOLI108/W-TYPE/W TYPE 2.62 0.08 2.96 0.31
FAD3A1/W-TYPE/W-TYPE/W-TYPE/W-TYPE 5.89 0.83 5.55 0.67
FAD3A1/W-TYPE/LOLI108/W-TYPE/W-TYPE 4.83 0.32 4.93 0.26
W-TYPE/FAD3C1/W-TYPE/W-TYPE/W-TYPE 5.48 0.32 5.04 0.23
W-TYPE/FAD3C1/L0LI108/W-TYPE/W-TYPE 4.31 0.37 4.36 1.06
W-TYPE/W-TYPE/W-TYPE/W-TYPE/W-TYPE 6.54 0.55 7.20 0.92
W-TYPE/W-TYPE/LOLI108/W-TYPE/W-TYPE 6.51 0.19 5.92 0.63
LOLI111
FAD3A1/FAD3C1/W-TYPE/W-TYPE/W-TYPE 3.77 0.23 3.42 0.78
FAD3A1/FAD3C1/W-TYPE/LOLI111/W-TYPE 2.58 0.17 2.43 0.55
FAD3A1/W-TYPE/W-TYPE/W-TYPE/W-TYPE 6.12 0.24 4.71 0.83
FAD3A1/W-TYPE/W-TYPE/LOLI111/W-TYPE 4.43 0.18 3.53 0.62
W-TYPE/FAD3C1/W-TYPE/W-TYPE/W-TYPE 5.60 0.85 5.01 0.96
W-TYPE/EAD3C1/W-TYPE/LOLI111/W-TYPE 4.59 0.24 4.17 0.16
W-TYPE/W-TYPE/W-TYPE/W-TYPE/W-TYPE 6.90 2.02 7.43 0.63
72
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
W-TYPE/W-TYPE/W-TYPE/LOLI111/W-TYPE 6.68 0.40 7.06 1.02
LOLI115
FAD3A1/FAD3C1/W-TYPE/W-TYPE/W-TYPE 4.02 0.24 3.44 0.49
FAD3A1/FAD3C1/W-TYPE/W-TYPE/LOLI115 3.20 0.13
FAD3A1/W-TYPE/W-TYPE/W-TYPE/W-TYPE 5.17 ND
FAD3A1/W-TYPE/W-TYPE/W-TYPE/LOLI115 6.06 0.55 4.33 0.08
W-TYPE/FAD3C1/W-TYPE/W-TYPE/W-TYPE 4.35 0.58 4.71 1.22
W-TYPE/FAD3C1/W-TYPE/W-TYPE/LOLI115 3.29 ND
W-TYPE/W-TYPE/W-TYPE/W-TYPE/W-TYPE 5.93 0.69 5.86 0.79
W-TYPE/W-TYPE/W-TYPE/W-TYPE/LOLI115 6.49 0.99
[223] First, plants comprising the FAD3-Al and FAD3-C1 mutant alleles as
described
in W001/25453 and W004/072259 were compared with plants comprising the LOLI105
(FAD3-A1) and LOLI103 (FAD3-C1) mutant alleles, respectively, for their seed
oil
composition. Plants homozygous for the LOLI103 allele displayed a similar
reduction in
C18:3 seed oil content when compared to wild type plants (i.e. not comprising
any
mutant FAD3 allele) as plants homozygous for the FAD3-Al allele. Likewise,
plants
homozygous for the LOLI105 allele displayed a similar reduction in C18:3 seed
oil
content when compared to wild type plants as plants homozygous for the FAD3-CI
allele.
[224] Next, the seed oil composition of plants comprising the mutant FAD3
alleles
LOLI108 (FAD3-A2), LOLI111 (FAD3-A3) or LOLI115 (FAD3-C2) was compared to
that of wild type plants and plants comprising the FAD3-Al and/or FAD3-C1
mutant
alleles of W001/25453 and W004/072259. The wild type plants (i.e. not
comprising any
mutant FAD3 allele) displayed a C18:3 seed oil content of about 7%. In seed
oil of plants
comprising the FAD3-Al or FAD3-C1 mutant alleles in homozygous state, a
reduction of
C18:3 seed oil content of about 1-2% was observed. Plants comprising both the
FAD3-Al
and FAD3-C1 mutant alleles of W001/25453 and W004/072259 in homozygous state
showed a reduction in C18:3 seed oil seed content of at most 4%. Plants
comprising
mutant alleles LOLI108, LOUR] or LOLI115 in homozygous state did not show a
significant reduction in C18:3 in seed oil when compared to seed oil from wild
type
plants. Surprisingly however, the LOLI108 and LOLI111 alleles did have an
additional
effect on the C18:3 reduction in seed oil by the FAD3-Al and/or FAD3-C1 mutant
alleles.
73
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
Particularly in progeny plants from crosses with the elite female line,
homozygosity for
LOLI108 allele was found to further reduce the C18:3 seed oil content of
plants
homozygous for the FAD3-C1 mutant allele alone or of plants homozygous for
both the
FAD3-Al and FAD3-C1 mutant alleles, leading to a total C18:3 seed oil content
in the
triple homozygous mutant of below 3%. A similar effect was observed for the
LOLI111
allele in combination with the FAD3-Al mutant allele alone or in combination
with both
FAD3-A/ and FAD3-C1 mutant alleles, again resulting in a reduction of the
C18:3 seed
oil content in the triple homozygous mutant to below 3%. In the male elite
line a similar
trend was observed. Similar to LOLI108 and LOLI111, homozygosity for the
LOLI115
allele alone did not have an effect C18:3 seed oil content when compared to
wild type
plants, but could sometimes further reduce the C18:3 seed oil content of
plants already
comprising the FAD3-Al and/or FAD3-C1 mutant alleles.
[225] In conclusion, these data show that, although the FAD3-A2, FAD3-A3 and
FAD3-C2 genes only contribute to a small fraction of the total FAD3 expression
in the
developing seed and mutations in these genes alone did not alter C18:3 content
in seed oil
in elite crosses, in combination with mutations in the FAD3-A1 and FAD3-C1
genes a
reduction of C18:3 to about below 3% could be achieved when plants were grown
in the
greenhouse.
[226] In a similar experiment, oil composition of plants comprising the mutant
FAD3
alleles LOLI108 (FAD3-A2), LOLI111 (FAD3-A3) or LOLI115 (FAD3-C2) in a
background comprising the FAD3-Al and/or FAD3-C1 mutant alleles of W001/25453
and W004/072259 was determined after two backcrossings with elite male or
female
breeding lines. The progeny plants comprising the mutation were subsequently
selfed to
obtain homozygous plants, and oil composition in seeds of these plants upon a
second
selfing (BC2S2) were analyzed as described above. Table 4 displays the
percentage
C18:3 of the total oil content.
Table 4: Average (Av) and standard deviation (SD) of C18:3 seed oil content
percentage
(%) in elite male and female crosses.
74
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
Female Male
allele Av SD Av SD
FAD3A1/EAD3C1/FAD3A2/EAD3A3/EAD3C2 018:3 018:3
018:3 C18:3
LOLI108
FAD3A1/FAD3C1 /W-TYPE/W-TYPE/W-TYPE 3.76 0.13 3.68 0.09
FAD3A1/FAD3C1/LOLI108/W-TYPE/W-TYPE 2.99 0.07 3.89 0.03
LOLI111
FAD3A1/FAD3C1/W-TYPE/W-TYPE/W-TYPE 3.88 0.09 3.79 0.08
FAD3A1/FAD3C1/W-TYPE/LOLI111/W-TYPE 2.70 0.04 2.33 0.05
LOLI115
FAD3A1/FAD3C/A17-TYPE/W-TYPE/W-TYPE 3.86 0.10 3.09 0.06
FAD3A1/FAD3C1/W-TYPE/W-TYPE/LOLI115 2.98 0.05 4.26 0.09
[227] These data confirm that, although the FAD3-A2, FAD3-A3 and FAD3-C2 genes
only contribute to a small fraction of the total FAD3 expression in the
developing seed
and mutations in these genes alone did not alter C18:3 content in seed oil in
elite crosses,
in combination with mutations in the FAD3-Al and FAD3-C1 genes a reduction of
C18:3
to about below 3% could be achieved when plants were grown in the greenhouse.
Example 7 - Analysis of the fatty acid composition of the seed oil of Brassica
plants
comprising one to four mutant Brassica FAD3 genes in elite Brassica lines
grown in
the greenhouse
[228] The effect of more than three mutant FAD3 alleles on fatty acid
composition of
the seed oil of Brassica plants was determined in the greenhouse. Of the
Brassica plants
identified in Example 5 (F1S2), plants comprising a mutant allele of each of
the FAD3
genes (LOLII 05, LOH] 03, LOLI108, LOLI115 and LOLI111) were selfed to obtain
homozygous plants. Further crosses between the lines containing the mutant
FAD3 alleles
were made to obtain plants with more than one mutant FAD3 gene. Subsequently,
the
fatty acid composition of the seed oil of individual progeny Brassica plants
(nonBC)
homozygous for the mutant FAD3 allele(s) was determined as described above.
Table 5
shows the percentace C18:3 of the total oil of the Brassica plants in the
greenhouse.
Table 5: Average (Av) and standard deviation (SD) of C18:3 seed oil content
percentage
(%) from Brassica plants grown in the greenhouse
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
allele Av SD
FAD3A1/FAD3A2/FAWA3/FAD3C1/EAD3C2 C18:3 C18:3
W-TYPE/W-TYPE/W-TYPE/W-TYPE/W-TYPE 9.08 0.11
Single mutants
LOLI105/W-TYPE/W-TYPE/W-TYPE/W-TYPE 7.33 0.20
w-TYPE/LOLI108/W-TYPE/w-TYPE/W-TYPE 9. 10 0.09
W-TYPE/W-TYPE/W-TYPE/LOLI103/W- TYPE 7. 67 0.15
W-TYPE/W-TYPE/W-TYPE/W-TYPE/LOLI115 9.25 0.30
Double mutants
LOLI105/LOLI108/W-TYPE/W-TYPE/W-TYPE 6.45 0.09
LOLI105/W-TYPE/W-TYPE/LOLI103/W-TYPE 4 . 57 0. 05
LOLI105/W-TYPE/W-TYPE/W-TYPE/LOLI115 6.17 0.06
W-TYPE/LOLI108/W-TYPE/LOLI103/W-TYPE 6. 92 0. 08
W-TYPE/LOLI108/W-TYPE/W-TYPE/LOLI115 8.26 0. 10
Triple mutants
LOLI105/LOLI108/W-TYPE/LOLI103/W-TYPE 3.39 0.05
LOLI105/LOLI108/W-TYPE/W-TYPE/LOLI115 5.52 0.09
W-TYPE/LOLI108/W-TYPE/LOLI103/LOLI11 5 5.27 0.03
Quadruple mutant
LOLI/05/LOL//08/W-TYPE/LOL/103/LOL/1/5 2.36 0.07
[229] From the experiment with the single mutants, it can be concluded that
only
FAD3A1 and in FAD3C1 mutant alleles cause a significant reduction of C18:3
seed oil
content. As also observed in the previous experiment, FAD3A2, FAD3A3 and
FAD3C2
mutants do further reduce C18:3 seed oil content in a genetic background
already
containing either mutant FAD3A1, or mutant FAD3C1, or both. In addition, it is
consistently observed that, in the double and triple mutants, lines comprising
both the
FAD3A1 and FAD3C1 mutant alleles contain a significantly lower C18:3 seed oil
content
than the other lines containing the same number of mutant FAD3 genes.
Moreover, there
seems to be a trend towards the more mutant FAD3 alleles present, the lower
the C18:3
content in the seed oil.
Example 8 - Analysis of the effect of stacking multiple mutant FAD3 genes on
fatty
acid composition in Brassica plants grown in the greenhouse
[230] Next, it was investigated to what extent stacking of mutant alleles of
different
FAD3 genes, on top of the FAD3A1 and FAD3C1 mutant alleles, had an effect on
fatty
76
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
acid composition in Brassica grown in the greenhouse. To this end, the lines
containing
the LOLI108, LOLI111 and LOLI115 mutations were backcrossed twice or three
times
with elite male and female lines comprising the FAD3-Al and/or FAD3-C1 mutant
alleles
of W001/25453 and W004/072259. The progeny plants comprising the mutant
alleles
were subsequently selfed to obtain homozygous plants. Further crosses between
the lines
containing the mutant alleles of FAD3 genes that had been backcrossed twice
were made
to obtain plants with mutant alleles of multiple FAD3 genes. Oil composition
in seeds of
these plants upon a second selfing (BC2S2 for the quadruple mutants and BC3S2
for the
triple mutants) were analyzed as described above. Table 6 displays the
percentage C18:3
of the total oil content.
Table 6: Average (Av) and standard deviation (SD) of C18:3 seed oil content
percentage
(%) in elite male and female crosses upon stacking the different FAD3 mutant
alleles on
top of the mutant FAD3A1 and FAD3C1 alleles.
Female Male
allele Av SD Av SD
EAD3A1/EAD3C1/FAD3A2/FAD3A3/EAD3C2 C18:3 C18:3
C18:3 C18:3
LOLI108
FAD3A1/FAD3C1/W-TYPE/W-TYPE/W-TYPE 2.56 0.07 2.18 0.05
FAD3A1/FAD3C1/L0LI108/W-TYPE/W-TYPE 2.02 0.04 2.09 0.03
LOLI111
EAD3A1/FAD3C1/W-TYPE/W-TYPE/W-TYPE 2.70 0.08 2.29 0.03
FAD3A1/FAD3C1/W-TYPE/LOLI111/W-TYPE 2.24 0.04 1.56 0.02
LOLI115
FAD3A1/FAD3C1/W-TYPE/W-TYPE/W-TYPE 2.49 0.06 2.47 0.07
FAD3A1/FAD3C1/W-TYPE/W-TYPE/LOLI115 2.05 0.08 1.92 0.04
LOLI108/LOLI111
FAD3A1/FAD3C1/W-TYPE/W-TYPE/W-TYPE 2.44 0.07 2.21 0.06
FAD3A1/FAD3C1/LOLI108/W-TYPE/W-TYPE 2.02 0.05 2.50 0.03
FAD3A1/FAD3C1/W-TYPE/LOLI111/W-TYPE 2.22 0.03 1.51 0.14
EAD3A1/FAD3C1/LOLI108/LOLI111/W-TYPE 1.59 0.02 1.60 0.05
[231] These results show that, in line with the previous results, the
FAD3A2,FAD3A3
and FAD3C2 mutant alleles further reduce the C18:3 content in lines containing
FAD3A1
and FAD3C1 mutant alleles. Moreover, especially in the female line, stacking
the
77
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
FAD3A2 and FAD3A3 mutants in a background with FAD3A1 and FAD3CI mutants
even further reduces the C18:3 content to levels clearly below 2%.
[232] To investigate in more detail the effect of stacking mutants of
different FAD3
genes on top of the FAD3A1 and FAD3 Cl mutants LOH] 05 and LOLI108, the fatty
acid
composition was determined in lines containing two, three, four or five mutant
FAD3
genes. To this end, the lines containing the LOLI105, LOLI103, LOLI108,
LOLI111 and
LOLI115 alleles were backcrossed three times in elite Brassica lines. The
progeny plants
comprising the mutation were subsequently selfed to obtain homozygous plants,
and
further crossed with lines containing other mutant FAD3 alleles in order to
obtain
combinations of different mutants. Oil composition in seeds of these plants
upon a second
selfing (BC3S2) was analyzed as described above. Table 7 displays the
percentage C18:3
of the total oil content.
Table 7: Average (Av) and standard deviation (SD) of C18:3 seed oil content
percentage
(%) in elite male and female crosses upon stacking the the different mutant
FAD3 alleles
on top of the mutant FAD3A1 and FAD3C1 alleles.
allele Av SD
FAD3A1/FAD3C1/EAD3A2/EAD3A3/FAD3C2 C18:3 C18:3
W-TYPE/W-TYPE/W-TYPE/W-TYPE/W-TYPE 4.84 0.10
Double mutant
LOLI105/LOLI103/W-TYPE/W-TYPE/W-TYPE 2.95 0.05
Triple mutants
LOLI105/LOLI103/LOLI108/W-TYPE/W-TYPE 2.39 0.11
LOLI105/LOLI103/W-TYPE/LOLI111/W-TYPE 2.23 0.04
LOLI105/LOLI103/W-TYPE/W-TYPE/LOLI115 2.42 0.04
Quadruple mutants
LOL1105/LOLI103/LOLI108/LOL1111/W-TYPE 1.48 0.01
LOLI105/LOL1103/LOL1108/W-TYPE/LOLI115 1.62 0.05
LOLI105/LOLI103/W-TYPE/LOLI111/LOLI115 1.50 0.01
Quintuple mutant
LOLI105/LOLI103/LOLI108/LOL1111/LOLI115 0.80 0.02
[233] From Table 7, it can be observed that the more mutant alleles of other
FAD genes
on top of mutant alleles of FAD3A1 and FAD3C1, the lower the C18:3 content. In
the
78
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
quadruple mutants comprising both FAD3A1 and FAD3C1 mutant alleles as well as
mutant alleles of two other FAD3 genes, the C18:3 content can be reduced
towards about
1.5%, and in the quintuple mutants comprising mutant alleles of FAD3A1,
FAD3C1,
FAD3A2, FAD3A2 and FAD3C2, the C18:3 oil content can be further reduced to
0.8%.
[234] It is believed that in a background with a higher C18:3 seed oil content
than these
male and female elite lines, introduction of the LOLI103 allele will also have
an
additional effect on the C18:3 reduction in seed oil by the FAD3-Al and/or
FAD3-C1
mutant alleles. It is furthermore believed that the more mutant FAD3 alleles
will be
combined in a plant, the greater the reduction in C18:3 seed oil content will
be.
Example 9 - Analysis of the effect of mutant FAD3 genes on fatty acid
composition
in Brassica plants grown in the field
[235] Tests were set up and are conducted to further analyze the correlation
between
the presence of mutant FAD3 genes in Brassica plants and the C18:3 seed oil
content of
the Brassica plants in the field. Of the Brassica plants identified in Example
5 (Fl S2),
plants comprising a mutant allele of each of the FAD3 genes (LOL1105 ,
LOLI103,
LOLI108, LOLI115 and LOLI111) were selfed to obtain homozygous plants. Further
crosses between the lines containing the mutant FAD3 genes were made to obtain
plants
with more than one mutant FAD3 gene. The plants were grown in the field in
Belgium
(one location) and in Canada (two locations). The fatty acid composition of
the seed oil
of these plants (nonBC) was determined as described above. Table 8 shows the
percentace C18:3 of the total oil of the Brassica plants grown in the field in
Belgium, and
Table 9 shows the percentage of C18:3 of the total oil of the Brassica plants
grown at two
locations in the field Canada.
Table 8: Average (Av) and standard deviation (SD) of C18:3 seed oil content
percentage
(%) in Brassica plants with different mutant FAD3 genes grown in the field in
Belgium.
allele Av SD
FAWA1/EAD3A2/EAD3A3/EAD3C1/FAD3C2 C18:3 C18:3
W-TYPE/W-TYPE/W-TYPE/W-TYPE/W-TYPE 10.0 0.38
79
CA 02781278 2012-05-17
WO 2011/060946 PC
T/EP2010/007028
Single mutants
LOLI105/W-TYPE/W-TYPE/W-TYPE/W-TYPE 7.05 0.28
W-TYPE/LOLI108/W-TYPE/W-TYPE/W-TYPE 9. 33 0.22
W- TYPE/W-TYPE/LOLI111/W-TYPE/W-TYPE 8.76 0. 43
W- TYPE/W- TYPE/W- TYPE/LOM 031w-TYPE 7. 69 0. 15
W-TYPE/W-TYPE/W-TYPE/W-TYPE/LOLIII5 9.71 0.25
Double mutants
LOLI105/W-TYPE/W-TYPE/LOLI103/W-TYPE 4.10 0.10
W-TYPE/LOLI108/W-TYPE/LOLI103/W-TYPE 6.95 0.29
W-TYPEALOL_T108/W-TYPE/W-TYPE/LOLI115 9 . 2 0 0.28
W-TYPE/W-TYPE/LOLI111/LOLI103/W-TYPE 6.76 0.41
Table 9: Average of C18:3 seed oil content percentage (%) in Brassica plants
with
different mutant FAD3 genes grown at two locations in the field in Canada. LSD
-
Fisher's least significant difference.
allele
FAD3A1/EAD3A2/FAD3A3/EAD3C1/FAD3C2 C18:3
W-TYPE/W-TYPE/W-TYPE/W-TYPE/W-TYPE 12.26
Single mutants
LOLI105/W-TYPE/W-TYPE/W-TYPE/W-TYPE 9.58
W-TYPE/LOLI108/W-TYPE/W-TYPE/W-TYPE 11.84
W-TYPE/W-TYPE/W-TYPE/LOLI103/W-TYPE 9.00
W-TYPE/W-TYPE/W-TYPE/W-TYPE/LOLI115 11.98
Double mutants
LOLI105/LOLI108/W-TYPE/W-TYPE /W-TYPE 8.07
LOLI105/W-TYPE/W-TYPE/LOLI103/W-TYPE 5.73
LOLI105/W-TYPE/W-TYPE/W-TYPE/LOLI115 7.68
W-TYPE/LOLI108/W-TYPE/LOLI103/W-TYPE 8.23
W-TYPE/IOLI108/W-TYPE/W-TYPE/LOLI115 10.62
Triple mutants
LOLI105/LOLI108/w-TYPE/LDLI103/w-TYPE 4 _ 49
LOLI105/LOLI108/W-TYPE/W-TYPE/L0LI115 7.08
W-TYPE/IOLI108/W-TYPE/LOLI103/LOLI115 8.12
Quadruple mutant
LOLI105/LOLI108/W-TYPE/LOL1103/LOLI115 3.54
LSD 0.62
[236] Tables 8 and 9 show that, also in the field, seed oil of plants
comprising the
FAD3-Al or FAD3-C1 mutant alleles in homozygous state, C18:3 seed oil content
was
reduced as compared to wild-type plants. Plants comprising mutant alleles
LOLI108,
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
LOLI111 or LOLI115 in homozygous state show only a minor reduction in C18:3 in
seed
oil when compared to seed oil from wild type plants. However, similar to in
the
greenhouse, the LOLI108, LOLI111 and LOLI115 alleles do have an additional
effect on
the C18:3 reduction in seed oil by the FAD3-Al and/or FAD3-C1 mutant alleles.
In
addition, it is consistently observed that, for the double and triple mutants,
lines
comprising both the FAD3A1 and FAD3C1 mutant contain a significantly lower
C18:3
seed oil content than other lines containing the same number of mutant FAD3
alleles. For
the triple and quadruple mutants, it can also be observed, in particular when
mutant
alleles of both FAD3A1 and FAD3C1 are present, that the more mutant FAD3
alleles are
stacked in the genome, the further is the reduction in C18:3 content.
[237] Further tests are set up to analyze the correlation between the presence
of mutant
FAD3 genes in Brassica plants and the C18:3 seed oil content of the Brassica
plants in
the field upon further backcrossing with elite Brassica lines.
Example 10 - Detection and/or transfer of mutant FAD3 alleles into (elite)
Brassica
lines
[238] The mutant FAD3 genes are transferred into (elite) Brassica breeding
lines by
the following method: A plant containing a mutant FAD3 gene (donor plant), is
crossed
with an (elite) Brassica line (elite parent / recurrent parent) or variety
lacking the mutant
FAD3 gene. The following introgression scheme is used (the mutant FAD3 allele
is
abbreviated tofad3 while the wild type is depicted as FAD3):
Initial cross: fad3 / fad3 (donor plant) X FAD3 / FAD3 (elite parent)
Fl plant: FAD3 / fad3
BC1 cross: FAD3 / fad3 X FAD3 / FAD3 (recurrent parent)
BC1 plants: 50% FAD3 / fad3 and 50% FAD3 / FAD3
The 50% FAD3 / fad3 are selected using molecular markers (e.g. AFLP, PCR,
InvaderTM,
TaqMan and the like; see also below) for the mutant FAD3 allele (fad3).
BC2 cross: FAD3 / fad3 (BC1 plant) X FAD3 / FAD3 (recurrent parent)
BC2 plants: 50% FAD3 / fad3 and 50% FAD3 / FAD3
81
CA 02781278 2012-05-17
WO 2011/060946
PCT/EP2010/007028
The 50% FAD3 / fad3 are selected using molecular markers for the mutant FAD3
allele
(fad3).
Backcrossing is repeated until BC3 to BC6
BC3-6 plants: 50% FAD3 / fad3 and 50% FAD3 / FAD3
The 50% FAD3 / fad3 are selected using molecular markers for the mutant FAD3
allele
(fad3). To reduce the number of backcrossings (e.g. until BC3 in stead of
BC6),
molecular markers can be used specific for the genetic background of the elite
parent.
BC3-6 S1 cross: FAD3 / fad3 X FAD3 / fad3
BC3-6 S1 plants: 25% FAD3 / FAD3 and 50% FAD3 / fad3 and 25%fad3 / fad3
Plants containing fad3 are selected using molecular markers for the mutant
FAD3 allele
(fad3). Individual BC3-6 Si or BC3-6 S2 plants that are homozygous for the
mutant
FAD3 allele (fad3 / fad3) are selected using molecular markers for the mutant
and the
wild-type FAD3 alleles. These plants are then used for seed production.
[239] To select for plants comprising a point mutation in a FAD3 allele,
direct
sequencing by standard sequencing techniques known in the art, such as those
described
in Example 4, can be used.
[240] Alternatively, InvaderTM technology (Third Wave Agbio) can be used to
discriminate plants comprising a specific point mutation in an FAD3 allele
from plants
not comprising that specific point mutation. Discriminating InvaderTM probes
were thus
developed to detect the presence or absence and the zygosity status of mutant
alleles
identified in Example 4, in particular of LOLI103, LOLI105, LOLI108, LOLI111
and
LOLI115, based on the single nucleotide difference between the mutant and
wildtype
allele. Briefly, probes specific for the mutant or corresponding wild-type
target FAD3
gene (indicated hereinafter as "5' flap 1 -xl" and "5' flap2-x2",
respectively, wherein x 1
and x2 represent wildtype and mutant allele-specific sequences) and "invading"
probes
which can be used in combination with them were developed. Generally, each
probe set
consists of one probe specific for the mutant or the wild type target gene of
which the
first nucleotide after the 5' flap sequence matches with the nucleotide
difference (the so-
called "primary probe") and one probe specific for the nucleotides upstream of
the
82
CA 02781278 2012-05-17
WO 2011/060946 PCT/EP2010/007028
nucleotide difference (the so-called "invader oligo"). The last nucleotide of
the latter
primer may match with the nucleotide difference in the mutant, but other
nucleotides may
be used as well for this last nucleotide as long as the primary probe and the
invader
oligo are still able to form a single base overlap when hybridized to the
target DNA to
generate the specific invasive structure recognized by the Cleavase enzymes
(Third
Wave Agbio). The InvaderTM assay procedure and interpretation of the data are
performed as prescribed by the manufacturer (Third Wave Agbio). Briefly, the
nucleotide
sequences indicated as "flapl" and "flap2" represent the sequences of the 5'
"flaps"
which are cleaved from the primary probes in the primary phase of the
InvaderTM assay
and which are complementary to sequences in FRETTm cassette 1 and 2,
respectively, and
not complementary to the target mutant or wild type sequences. If the primary
probes are
cleaved in the primary phase and the flap 1-probe and/or flap2-probe hybridise
to FRETTm
cassette 1 and 2, respectively, in the secondary phase, a signal is generated
indicative of
the presence in the sample of the mutant or corresponding wild-type target
FAD3 gene,
respectively. The following discriminating InvaderTM assays were thus
developed to
detect the presence or absence and the zygosity status of the mutant alleles
identified in
Example 4 (see Table 2):
Table 10: Invader probes, forward (Fw) and reverse (Rv) primers. Mutation
position is
underlined, FAM probe: mutant allele, VIC probe: wild-type allele.
probe primer
allele
dye sequence (5'-3') Fw/Rv sequence (5f-3')
FAN TCTTTGTAATGTGATTGGA Fw CAGTCACAGITCTCAAAGTCTATGGAG
LOLI SEQ ID NO: 18 SEQ ID NO: 20
105 VIC CTTTG1AATUTGGTTGGAC Ry TGCCTCTGTACCAAGGCAACTTAT
SEQ ID NO: 19 SEQ ID NO: 21
FAN GGATGACTACAGTGATACA Fw CCTCTCTATCTGGTAAATCCTAATTCCTAA
LOLI SEQ ID NO: 22 SEQ ID NO: 24
103 VIC GATGACTACAGTGGTACAGA Rxr GTATGGGTTATAATGTGACCCTTCTTTAC
SEQ ID NO: 23 SEQ ID NO: 25
FAN ATCTTTGTAATGTAGTTGGA Fw GGTGTTCCTIACATTGTAAGTTTCACA
LOLI SEQ ID NO: 26 SEQ ID NO: 28
108 VIC ATCTTTGTAATGTGGTTGGA Rxr GCCTCTGTACCAAGGCAACTTCT
SEQ ID NO: 27 SEQ ID NO: 29
83
81714991
FAN TTACTGCAGTGATACAGAA Fw
CGCTTACCCGATCTATCTGGTATTT
LOLI SEQ ID NO: 30 SEQ ID NO: 32
111 VIC TTACTGCAGTGGTACAGA Rv GGGTTAAAATGTGACCCTTCTTTTC
SEQ ID NO: 31 SEQ ID NO: 33
FAN GACCTTAACTACAGTAGTAC Fw ATGCTCGCTTACCCGATCTATTT
LOLI SEQ ID NO: 34 SEQ ID NO: 36
115 VIC ACCTTAACTACAGTGGTACA Rv
CTCTCGCTTGGAGCAAATAAACTA
SEQ ID NO: 35 SEQ ID NO: 37
[241] In conclusion, the current invention as claimed is directed at least to
the
plants, nucleic acid molecules, proteins, plant cells, seeds, methods, uses
and kits as
described in the following paragraphs:
84
CA 2781278 2019-06-14
81714991
[241A] A
Brassica plant cell comprising at least two full knock-out mutant FAD3
alleles,
wherein
i. the first full knock-out mutant FAD3 allele is a full knock-out mutant FAD3
allele of a FAD3-A1 gene or of a FAD3-C1 gene, wherein
(a) said FAD3-Al gene comprises
a. a nucleotide sequence which is at least 90% identical to the sequence of
SEQ ID NO: 1;
b. a coding region which is at least 95% identical to the sequence of
SEQ ID NO: 11; or
c. a nucleotide sequence encoding an amino acid sequence which is at
least 98% identical to the sequence of SEQ ID NO: 2; and
(b) said FAD3-C1 gene comprises
a. a nucleotide sequence which is at least 90% identical to the sequence of
SEQ ID NO: 3;
b. a coding region which is at least 95% identical to the sequence of
SEQ ID NO: 12; or
c. a nucleotide sequence encoding an amino acid sequence which is at
least 98% identical to the sequence of SEQ ID NO: 4; and
ii. the second full knock-out mutant FAD3 allele is a full knock-out mutant
FAD3
allele of a FAD3-A2 gene, of a FAD3-A3 gene, or of a FAD3-C2 gene, wherein
(a) said FAD3-A2 gene comprises
a. a nucleotide sequence which is at least 90% identical to the sequence of
SEQ ID NO: 5;
CA 2781278 2019-06-14
81714991
b. a coding region which is at least 95% identical to the sequence of
SEQ ID NO: 13; or
c. a nucleotide sequence encoding an amino acid sequence which is at
least 98% identical to the sequence of SEQ ID NO: 6;
(b) said FAD3-A3 gene comprises
a. a nucleotide sequence which is at least 90% identical to the sequence of
SEQ ID NO: 7;
b. a coding region which is at least 95% identical to the sequence of
SEQ ID NO: 14; or
c. a nucleotide sequence encoding an amino acid sequence which is at
least 98% identical to the sequence of SEQ ID NO: 8; and
(c) said FAD3-C2 gene comprises
a. a nucleotide sequence which is at least 90% identical to the sequence of
SEQ ID NO: 9;
b. a coding region which is at least 95% identical to the sequence of
SEQ ID NO: 15; or
c. a nucleotide sequence encoding an amino acid sequence which is at
least 98% identical to the sequence of SEQ ID NO: 10; and
86
CA 2781278 2019-06-14
81714991
wherein said at least two full knock-out mutant FAD3 alleles comprise a
mutation selected
from the group consisting of:
i. a
deletion, frameshift or stop-codon mutation that lead to an entire deletion of
the encoded
FAD3 protein;
ii. a stop-codon, frameshift or splice site mutation leading to a disruption
or deletion of the
ER retention motif at a position corresponding to position 373-377 of SEQ ID
NO: 2 of the
encoded protein;
iii. a missense, insertion or deletion mutation in the sequence encoding the
ER retention motif
at a position corresponding to position 373-377 of SEQ ID NO: 2 of the encoded
protein;
iv. a missense mutation in the codon encoding any of the conserved histidines
at a position
corresponding to position 92, 96, 128, 131, 132, 295, 298, or 299 of SEQ ID
NO: 2 of the
encoded protein;
v. an insertion, deletion or splice site mutation that deletes or disrupts any
one of the eight
conserved histidine residues at a position corresponding to position 92, 96,
128, 131, 132,
295, 298, or 299 of SEQ ID NO: 2 of the encoded protein; and
vi. a nonsense mutation which results in a change of the position of the start
ATG codon
thereby encoding an N-terminally truncated protein lacking the putative signal
sequence.
87
CA 2781278 2019-06-14
81714991
[241B] A
full knock-out mutant allele of a FAD3 gene on a chromosomal locus of said
FAD3 gene, wherein said FAD3 gene comprises
(a) a nucleotide sequence which is at least 90% identical to the sequence of
SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 9;
(b) a coding region which is at least 95% identical to the sequence of
SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15; or
(c) a nucleotide sequence encoding an amino acid sequence which is at least
98%
identical to the sequence of SEQ ID NO: 6, SEQ ID NO: 8 or SEQ ID NO: 10; and
wherein said full knock-out mutant FAD3 allele comprises a mutation selected
from the group
consisting of:
i. a frameshift or stop-codon mutation that lead to an entire deletion of the
encoded FAD3
protein;
ii. a stop-codon, frameshift or splice site mutation leading to a disruption
or deletion of the
ER retention motif at a position corresponding to position 373-377 of SEQ ID
NO: 2 of the
encoded protein;
iii. a missense or insertion mutation in the sequence encoding the ER
retention motif at a
position corresponding to position 373-377 of SEQ ID NO: 2 of the encoded
protein;
iv. a missense mutation in the codon encoding any of the conserved histidines
at a position
corresponding to position 92, 96, 128, 131, 132, 295, 298, or 299 of SEQ ID
NO: 2 of the
encoded protein;
v. an insertion or splice site mutation that deletes or disrupts any one of
the eight conserved
histidine residues at a position corresponding to position 92, 96, 128, 131,
132, 295, 298, or
299 of SEQ ID NO: 2 of the encoded protein;
vi. a nonsense mutation which results in a change of the position of the start
ATG codon
thereby encoding an N-terminally truncated protein lacking the putative signal
sequence; and
88
Date Recue/Date Received 2020-06-04
81714991
vii a partial deletion that leads to a deletion of the ER retention motif at a
position
corresponding to position 373-377 of SEQ ID NO: 2 of the encoded protein, or a
deletion of
any one of the eight conserved histidine residues at a position corresponding
to position 92,
96, 128, 131, 132, 295, 298, or 299 of SEQ ID NO: 2 of the encoded protein.
[241C] A Brass/ca plant cell comprising at least one full knock-out mutant
allele of a
FAD3 gene, wherein said FAD3 gene comprises
(a) a nucleotide sequence which is at least 90% identical to the sequence of
SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 9;
(b) a coding region which is at least 95% identical to the sequence of
SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15; or
(c) a nucleotide sequence encoding an amino acid sequence which is at least
98%
identical to the sequence of SEQ ID NO: 6, SEQ ID NO: 8 or SEQ ID NO: 10; and
wherein said full knock-out mutant FAD3 allele comprises a mutation selected
from the group
consisting of:
i. a deletion, frameshift or stop-codon mutation that lead to an entire
deletion of the encoded
FAD3 protein;
ii. a stop-codon, frameshift or splice site mutation leading to a disruption
or deletion of the
ER retention motif at a position corresponding to position 373-377 of SEQ ID
NO: 2 of the
encoded protein;
iii. a missense, insertion or deletion mutation in the sequence encoding the
ER retention motif
at a position corresponding to position 373-377 of SEQ ID NO: 2 of the encoded
protein;
iv. a missense mutation in the codon encoding any of the conserved histidines
at a position
corresponding to position 92, 96, 128, 131, 132, 295, 298, or 299 of SEQ ID
NO: 2 of the
encoded protein;
89
Date Recue/Date Received 2020-06-04
81714991
v. an insertion, deletion or splice site mutation that deletes or disrupts any
one of the eight
conserved histidine residues at a position corresponding to position 92, 96,
128, 131, 132,
295, 298, or 299 of SEQ ID NO: 2 of the encoded protein; and
vi. a nonsense mutation which results in a change of the position of the start
ATG codon
thereby encoding an N-terminally truncated protein lacking the putative signal
sequence.
[241D] Use of seeds comprising the plant cell of [241A] or [241C] for
producing seed oil.
[241E] A method for determining the zygosity status of at least two mutant
FAD3 alleles
as defined herein in a plant, or a cell, plant part, seed or progeny thereof,
comprising
determining the presence of a mutant and/or a corresponding wild type FAD3
specific region
for each mutant FAD3 allele in the genomic DNA of said plant, or a cell, part,
seed or progeny
thereof, wherein the plant part is tissue, organ, seed pod, seed meal, or seed
cake.
[241F] A method for combining a least two selected mutant FAD3 alleles as
defined
in [241A] in one plant comprising the steps of:
(a) identifying at least two plants each comprising at least one selected
mutant
FAD3 allele by determining the zygosity status of the at least one selected
mutant
FAD3 allele according to [241E];
(b) crossing the at least two plants and collecting Fl hybrid seeds from the
at least
one cross; and
(c) identifying an Fl plant comprising at least two selected mutant FAD3
alleles as
defined in [241A] by determining the zygosity status of the at least two
selected
mutant FAD3 alleles according to [241E].
Date Recue/Date Received 2020-06-04
81714991
[241G] A method to reduce the C18:3 content in the seed oil of a Brassica
plant
comprising combining at least two full knock-out FAD3 alleles in the genomic
DNA of said
plant, wherein:
i. the first full knock-out mutant FAD3 allele is a full knock-out mutant
FAD3 allele of a
FAD3-A1 gene or of a FAD3-C1 gene as defined herein; and
ii. the second full knock-out mutant FAD3 allele is a full knock-out mutant
FAD3 allele of a
FAD3-A2 gene, of a FAD3-A3 gene or of a FAD3-C2 gene as defined herein,
wherein said at least two full knock-out mutant FAD3 alleles comprises a
mutation selected
from the group consisting of:
i. a deletion, frameshift or stop-codon mutation that lead to an entire
deletion of the encoded
FAD3 protein;
ii. a stop-codon, frameshift or splice site mutation leading to a disruption
or deletion of the
ER retention motif at a position corresponding to position 373-377 of SEQ ID
NO: 2 of the
encoded protein;
iii. a missense, insertion or deletion mutation in the sequence encoding the
ER retention motif
at a position corresponding to position 373-377 of SEQ ID NO: 2 of the encoded
protein;
iv. a missense mutation in the codon encoding any of the conserved histidines
at a position
corresponding to position 92, 96, 128, 131, 132, 295, 298, or 299 of SEQ ID
NO: 2 of the
encoded protein;
v. an insertion, deletion or splice site mutation that deletes or disrupts
any one of the eight
conserved histidine residues at a position corresponding to position 92, 96,
128, 131, 132,
295, 298, or 299 of SEQ ID NO: 2 of the encoded protein; and
vi. a nonsense mutation which results in a change of the position of the start
ATG codon
thereby encoding an N-terminally truncated protein lacking the putative signal
sequence.
91
CA 2781278 2019-06-14
81714991
[241H] Use of a combination of a first and second full knock-out mutant
FAD3 allele as
defined herein combined by crossing in a Brassica plant to reduce the C18:3
content in the
seed oil of the Brassica plant.
[2411] Use of a plant comprising the plant cell of [241A] or [241C] to
produce oilseed
rape oil or an oilseed rape seed cake.
SEQUENCE LISTING IN ELECTRONIC FORM
In accordance with Section 111(1) of the Patent Rules, this description
contains a sequence
listing in electronic form in ASCII text format (file: 75749-72 Seq 08-05-12
vl.txt).
A copy of the sequence listing in electronic form is available from the
Canadian Intellectual
Property Office.
92
Date Recue/Date Received 2020-06-04
