PLANT CELLS AND PLANTS WITH INCREASED TOLERANCE TO ENVIRONMENTAL STRESS

CELLULES VEGETALES ET PLANTES PRESENTANT UNE TOLERANCE ACCRUE AU STRESS ENVIRONNEMENTAL

English Abstract

This invention relates generally to transformed plant cells and plants
comprising an
inactivated or down-regulated gene resulting in increased tolerance and/or
resistance to environmental stress as compared to non-transformed wild type
cells
and methods of producing such plant cells or plants. This invention further
relates
generally to transformed plant cells with increased tolerance and/or
resistance to an
environmental stress as compared to a corresponding non-transformed wild type
plant cell, methods of producing, screening for and breeding such plant cells
or
plants and method of detecting stress in plants cells or plants.

Claims

88


CLAIMS


1. A transformed plant cell with tolerance and/or resistance to an
environmental
stress as compared to a corresponding non-transformed wild type plant cell,
wherein the tolerance and/or resistance to an environmental stress is
increased
by an inactivated or down-regulated gene.


2. The transformed plant cell of claim 1, wherein the tolerance and/or
resistance to
an environmental stress is increased by one or more inactivated or down-
regulated genes encoded by one or more nucleic acid sequences selected from
the group consisting of:
a) nucleic acid molecule encoding the polypeptide according to SEQ ID NO:
2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40,
42,
44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80
and/or 82
and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,
184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,
334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,




89



754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
b) nucleic acid molecule comprising the nucleic acid molecule according to
SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35,
37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73,
75,
77, 79 and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121,
123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151,
153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181,
183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211,
213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241,
243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271,
273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301,
303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331,
333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361,
363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391,
393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421,
423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451,
453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481,
483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511,
513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541,
543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631,
633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661,
663, 665, 667, 669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691,
693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721,
723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751,
753, 755, 757, 759, 761, 763, 765, 767, 769, 771, 773, 775, 777, 779, 781,
783, 785, 787, 789, 791, 793, 795, 797, 799, 801, 803, 805, 807, 809, 811,
813, 815, 817, 819, 821, 823, 825, 827, 829, 831, 833, 835, 837, 839, 841,
843, 845, 847, 849, 851, 853, 855, 857, 859, 861, 863, 865 and/or 867;
c) nucleic acid molecule comprising a nucleic acid sequence, which, as a
result of the degeneracy of the genetic code, can be derived from a
polypeptide sequence depicted in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16,




90



18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54,
56,
58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and/or 82
and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,
184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,
334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
d) nucleic acid molecule encoding a polypeptide having at least 50% identity
with the amino acid sequence of the polypeptide encoded by the nucleic
acid molecule of (a) to (c) and having the biological activity represented by
protein of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30,
32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68,
70,
72, 74, 76, 78, 80 and/or 82
and/or 96,98,100,102,104,106,108,110,112,114,116,118,120,122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,




91



184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,
334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
e) nucleic acid molecule encoding a polypeptide which is isolated with the aid

of monoclonal antibodies against a polypeptide encoded by one of the
nucleic acid molecules of (a) to (d) and having the biological activity
represented by the protein of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20,
22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58,
60,
62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and/or 82
and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,
184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,




92



334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
nucleic acid molecule which is obtainable by screening a suitable nucleic
acid library under stringent hybridisation conditions with a probe
comprising one of the sequences of the nucleic acid molecule of (a) or (b)
or with a fragment thereof having at least 15 nt, preferably 20 nt, 30 nt, 50
nt, 100 nt, 200 nt or 500 nt of the nucleic acid molecule characterized in (a)

to (c) and encoding a polypeptide having the biological activity represented
by protein whose reduction or deletion results in increased tolerance
and/or resistance to an environmental stress
or which comprises a sequence which is complementary thereto.


3. The transformed plant cell of claim 1 or 2 with one or more nucleic acid
sequences homolog to one of the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11,
13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49,
51, 53,
55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79 and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123,

125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153,
155,
157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185,
187,
189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217,
219,
221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249,
251,




93



253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281,
283,
285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313,
315,
317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345,
347,
349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377,
379,
381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409,
411,
413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441,
443,
445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473,
475,
477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505,
507,
509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537,
539,
541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569,
571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603,
605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633,
635,
637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665,
667,
669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697,
699,
701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729,
731,
733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761,
763,
765, 767, 769, 771, 773, 775, 777, 779, 781, 783, 785, 787, 789, 791, 793,
795,
797, 799, 801, 803, 805, 807, 809, 811, 813, 815, 817, 819, 821, 823, 825,
827,
829, 831, 833, 835, 837, 839, 841, 843, 845, 847, 849, 851, 853, 855, 857,
859,
861, 863, 865 and/or 867, wherein the plant is selected from the group
comprised of maize, wheat, rye, oat, triticale, rice, barley, soybean, peanut,

cotton, rapeseed, canola, manihot, pepper, sunflower, flax, borage, safflower,

linseed, primrose, rapeseed, turnip rape, tagetes, solanaceous plants, potato,

tobacco, eggplant, tomato, Vicia species, pea, alfalfa, coffee, cacao, tea,
Salix
species, oil palm, coconut, perennial grass, forage crops and Arabidopsis
thaliana.


4. The transformed plant cell of claim 3, wherein the nucleic acid is at least
about
50 % homologous to said sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17,

19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55,
57, 59,
61, 63, 65, 67, 69, 71, 73, 75, 77, 79 and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123,

125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153,
155,
157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185,
187,
189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217,
219,
221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249,
251,
253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281,
283,




94



285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313,
315,
317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345,
347,
349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377,
379,
381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409,
411,
413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441,
443,
445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473,
475,
477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505,
507,
509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537,
539,
541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569,
571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603,
605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633,
635,
637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665,
667,
669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697,
699,
701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729,
731,
733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761,
763,
765, 767, 769, 771, 773, 775, 777, 779, 781, 783, 785, 787, 789, 791, 793,
795,
797, 799, 801, 803, 805, 807, 809, 811, 813, 815, 817, 819, 821, 823, 825,
827,
829, 831, 833, 835, 837, 839, 841, 843, 845, 847, 849, 851, 853, 855, 857,
859,
861, 863, 865 and/or 867.


5. The transformed plant cell of one of the claims 1- 4 derived from a
monocotyledonous plant.


6. The transformed plant cell of one of the claims 1- 4 derived from a
dicotyledonous plant.


7. The transformed plant cell of one of the claims 1 - 6, wherein the plant is

selected from the group comprised of maize, wheat, rye, oat, triticale, rice,
barley, soybean, peanut, cotton, rapeseed, canola, manihot, pepper, sunflower,

flax, borage, safflower, linseed, primrose, rapeseed, turnip rape, tagetes,
solanaceous plants, potato, tobacco, eggplant, tomato, Vicia species, pea,
alfalfa, coffee, cacao, tea, Salix species, oil palm, coconut, perennial
grass,
forage crops and Arabidopsis thaliana, preferably Brassica napus, Glycine max,

Zea mays or Oryza sativa.


8. The transformed plant cell of one of the claims 1- 4, derived from a
gymnosperm plant.




95


9. A transformed plant generated from a plant cell according to of one of the
claims 1- 7 and which is a monocot or dicot plant.


10. A transformed plant of claim 12, which is selected from the group
comprised of
maize, wheat, rye, oat, triticale, rice, barley, soybean, peanut, cotton,
rapeseed,
canola, manihot, pepper, sunflower, flax, borage, safflower, linseed,
primrose,
rapeseed, turnip rape, tagetes, solanaceous plants, potato, tobacco, eggplant,

tomato, Vicia species, pea, alfalfa, coffee, cacao, tea, Salix species, oil
palm,
coconut, perennial grass, forage crops and Arabidopsis thaliana, preferably
Brassica napus, Glycine max, Zee mays or Oryza sativa.


11. A transformed plant generated from a plant cell according to of one of the

claims 1- 4 or 8 and which is a gymnosperm plant.


12. A seed produced by a transformed plant of one of the claims 9 to 11,
wherein
the seed is at least genetically heterozygous for a gene, that when
inactivated
or down-regulated confers increased tolerance to environmental stress as
compared to a wild type plant.


13. A method of producing a transformed plant with increased tolerance and/or
resistance to environmental stress as compared to a corresponding non-
transformed wild type plant by inactivation or down-regulation of a gene in
the
transformed plant resulting in increased tolerance and/or resistance to
environmental stress as compared to a corresponding non-transformed wild
type plant, comprising
(a) transforming a plant cell by inactivation or down-regulation of one or
more genes, preferably encoded by one or more nucleic acids selected
from a group consisting of sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11,
13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49,
51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79 and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119,
121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147,
149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175,
177, 179, 181, 183, 185, 187, 189, 191,193, 195, 197, 199, 201, 203,
205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231,
233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259,




96


261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287,
289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315,
317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343,
345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371,
373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 395, 397, 399,
401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427,
429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455,
457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483,
485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511,
513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539,
541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567,
569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595,
597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623,
625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651,
653, 655, 657, 659, 661, 663, 665, 667, 669, 671, 673, 675, 677, 679,
681, 683, 685, 687, 689, 691, 693, 695, 697, 699, 701, 703, 705, 707,
709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733, 735,
737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761, 763,
765, 767, 769, 771, 773, 775, 777, 779, 781, 783, 785, 787, 789, 791,
793, 795, 797, 799, 801, 803, 805, 807, 809, 811, 813, 815, 817, 819,
821, 823, 825, 827, 829, 831, 833, 835, 837, 839, 841, 843, 845, 847,
849, 851, 853, 855, 857, 859, 861, 863, 865 and/or 867 and/or
homologs thereof and
(b) generating from the plant cell a transformed plant with an increased
tolerance and/or resistance to environmental stress as compared to a
corresponding wild type plant.


14. A method of inducing increased tolerance and/or resistance to
environmental
stress as compared to a corresponding non-transformed wild type plant in a
plant cell of one of the claims 1 - 8 or plant of one of the claims 9-12 by
inactivation or down-regulation of one or more genes encoded by one or more
nucleic acids selected from a group consisting of sequences of SEQ ID NO: 1,
3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41,
43, 45,
47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79 and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113,115, 117, 119, 121, 123,
125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153,
155,
157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185,
187,




97



189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217,
219,
221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249,
251,
253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281,
283,
285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313,
315,
317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345,
347,
349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377,
379,
381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409,
411,
413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441,
443,
445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473,
475,
477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505,
507,
509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537,
539,
541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569,
571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603,
605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633,
635,
637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665,
667,
669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697,
699,
701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729;
731,
733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761,
763,
765, 767, 769, 771, 773, 775, 777, 779, 781, 783, 785, 787, 789, 791, 793,
795,
797, 799, 801, 803, 805, 807, 809, 811, 813, 815, 817, 819, 821, 823, 825,
827,
829, 831, 833, 835, 837, 839, 841, 843, 845, 847, 849, 851, 853, 855, 857,
859,
861, 863, 865 and/or 867 and/or homologs thereof.


15. The method of claim 14, wherein the gene encoding nucleic acid is at least

about 50% homologous to sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15,
17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53,
55, 57,
59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79 and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123,

125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153,
155,
157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185,
187,
189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217,
219,
221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249,
251,
253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281,
283,
285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313,
315,
317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345,
347,
349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377,
379,
381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409,
411,




98



413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441,
443,
445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473,
475,
477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505,
507,
509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537,
539,
541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569,
571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603,
605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633,
635,
637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665,
667,
669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697,
699,
701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729,
731,
733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761,
763,
765, 767, 769, 771, 773, 775, 777, 779, 781, 783, 785, 787, 789, 791, 793,
795,
797, 799, 801, 803, 805, 807, 809, 811, 813, 815, 817, 819, 821, 823, 825,
827,
829, 831, 833, 835, 837, 839, 841, 843, 845, 847, 849, 851, 853, 855, 857,
859,
861, 863, 865 and/or 867.


16. A plant expression cassette comprising a nucleic acid construct, which
when
expressed allows inactivation or down-regulation of one or more genes encoded
by one or more nucleic acids selected from the group consisting of sequences
of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33,
35,
37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73,
75, 77,
79 and/or 81; and/or
95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125,
127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155,
157,
159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187,
189,
191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219,
221,
223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251,
253,
255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283,
285,
287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315,
317,
319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347,
349,
351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379,
381,
383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411,
413,
415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443,
445,
447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475,
477,
479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507,
509,
511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539,
541,
543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571,
573,




99



575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603,
605,
607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635,
637,
639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667,
669,
671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699,
701,
703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731,
733,
735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761, 763,
765,
767, 769, 771, 773, 775, 777, 779, 781, 783, 785, 787, 789, 791, 793, 795,
797,
799, 801, 803, 805, 807, 809, 811, 813, 815, 817, 819, 821, 823, 825, 827,
829,
831, 833, 835, 837, 839, 841, 843, 845, 847, 849, 851, 853, 855, 857, 859,
861,
863, 865 and/or 867 and/or homologs thereof and/or parts thereof by a method
of one of the claims 13-15.


17. A method of detecting environmental stress in plant cells or plants
comprising
screening the plant cells for increased tolerance and/or resistance to
environmental stress as compared to non-stress conditions.


18. A method of screening plant cells or plants for increased tolerance and/or

resistance to environmental stress comprising screening the plant cells under
stress conditions for increased tolerance and/or resistance to environmental
stress as compared to non-stress conditions.


19. A method of breeding plant cells or plants towards increased tolerance
and/or
resistance to environmental stress comprising screening the plant cells under
stress conditions for increased tolerance and/or resistance to environmental
stress as compared to non-stress conditions and selecting those with increased

tolerance and/or resistance to environmental stress.


20. The method of one of the claims 24 - 25, wherein the increased tolerance
and/or resistance to environmental stress is due to one or more inactivated or

down-regulated genes.


21. The method of one of the claims 18 - 19, wherein tolerance and/or
resistance to
environmental stress is increased by one or more inactivated or down-regulated

genes encoded by one or more nucleic acid sequences selected from the group
consisting of sequences of nucleic acids shown in SEQ ID NO: 1, 3, 5, 7, 9,
11,
13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49,
51, 53,
55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79 and/or 81




100



and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123,

125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153,
155,
157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185,
187,
189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217,
219,
221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249,
251,
253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281,
283,
285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313,
315,
317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345,
347,
349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377,
379,
381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409,
411,
413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441,
443,
445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473,
475,
477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505,
507,
509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537,
539,
541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569,
571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603,
605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633,
635,
637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665,
667,
669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697,
699,
701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729,
731,
733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761,
763,
765, 767, 769, 771, 773, 775, 777, 779, 781, 783, 785, 787, 789, 791, 793,
795,
797, 799, 801, 803, 805, 807, 809, 811, 813, 815, 817, 819, 821, 823, 825,
827,
829, 831, 833, 835, 837, 839, 841, 843, 845, 847, 849, 851, 853, 855, 857,
859,
861, 863, 865 and/or 867 and/or homologs thereof.


22. A transformed plant cell with an inactivated or down-regulated gene
encoded by
a nucleic acid sequence selected from the group consisting of sequences of
SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35,
37,
39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75,
77, 79
and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123,

125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153,
155,
157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185,
187,
189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217,
219,
221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249,
251,
253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, 279, 281,
283,




101



285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313,
315,
317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345,
347,
349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377,
379,
381, 383, 385, 387, 389, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409,
411,
413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441,
443,
445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473,
475,
477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505,
507,
509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537,
539,
541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569,
571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603,
605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633,
635,
637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665,
667,
669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697,
699,
701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729,
731,
733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761,
763,
765, 767, 769, 771, 773, 775, 777, 779, 781, 783, 785, 787, 789, 791, 793,
795,
797, 799, 801, 803, 805, 807, 809, 811, 813, 815, 817, 819, 821, 823, 825,
827,
829, 831, 833, 835, 837, 839, 841, 843, 845, 847, 849, 851, 853, 855, 857,
859,
861, 863, 865 and/or 867 and/or homologs thereof.


23. An isolated nucleic acid molecule which comprises a nucleic acid molecule
selected from the group consisting of:
a) nucleic acid molecule which encodes a polypeptide comprising the
polypeptide according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22,
24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60,
62,
64, 66, 68, 70, 72, 74, 76, 78, 80 and/or 82
and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,
184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,
334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,




102



424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
b) nucleic acid molecule which comprising the polynucleotide shown in SEQ
ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37,
39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75,
77,
79 and/or 81
and/or 95,97,99,101,103,105,107,109,111,113,115,117,119,121,
123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151,
153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181,
183, 185, 187, 189, 191,193,195, 197, 199, 201, 203, 205, 207, 209, 211,
213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241,
243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271,
273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301,
303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331,
333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361,
363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391,
393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421,
423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451,
453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481,
483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511,
513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541,
543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631,




103


633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661,
663, 665, 667, 669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691,
693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721,
723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751,
753, 755, 757, 759, 761, 763, 765, 767, 769, 771, 773, 775, 777, 779, 781,
783, 785, 787, 789, 791, 793, 795, 797, 799, 801, 803, 805, 807, 809, 811,
813, 815, 817, 819, 821, 823, 825, 827, 829, 831, 833, 835, 837, 839, 841,
843, 845, 847, 849, 851, 853, 855, 857, 859, 861, 863, 865 and/or 867;
c) nucleic acid molecule comprising a nucleic acid sequence, which, as a
result of the degeneracy of the genetic code, can be derived from a
polypeptide sequence depicted (b) and having the biological activity
represented by protein according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16,
18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54,
56,
58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and/or 82
and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,
184, 186,188, 190, 192,194,196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,
334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,




104

784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
d) nucleic acid molecule encoding a polypeptide having at least 50% identity
with the amino acid sequence of the polypeptide encoded by the nucleic
acid molecule of (a) or (c) and having a biological activity represented by
protein according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24,
26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62,
64,
66, 68, 70, 72, 74, 76, 78, 80 and/or 82
and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,
184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,
334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
e) nucleic acid molecule encoding a polypeptide, which is isolated with the
aid of monoclonal antibodies against a polypeptide encoded by one of the




105

nucleic acid molecules of (a) to (c) and having a biological activity
represented by protein X;
f) nucleic acid molecule which is obtainable by screening a suitable library
under stringent hybridisation conditions with a probe comprising one of the
sequences of the nucleic acid molecule of (a) to (c) or with a fragment of at
least 15 nt, preferably 20 nt, 30 nt, 50 nt, 100 nt, 200 nt or 500 nt of the
nucleic acid molecule characterized in (a) to (i) and encoding a polypeptide
having the biological activity represented by protein X;
g) a nucleic acid molecule having at least 70% sequence identity to
polynucleotide selected from the groups consisting of the polynucleotides
shown in SEQ ID NO 1 , 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29,
31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67,
69,
71, 73, 75, 77, 79 and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121,
123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151,
153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181,
183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211,
213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241,
243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271,
273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301,
303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331,
333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361,
363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391,
393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421,
423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451,
453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481,
483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511,
513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541,
543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631,
633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661,
663, 665, 667, 669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691,
693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721,
723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751,
753, 755, 757, 759, 761, 763, 765, 767, 769, 771, 773, 775, 777, 779, 781,
783, 785, 787, 789, 791, 793, 795, 797, 799, 801, 803, 805, 807, 809, 811,




106

813, 815, 817, 819, 821, 823, 825, 827, 829, 831, 833, 835, 837, 839, 841,
843, 845, 847, 849, 851, 853, 855, 857, 859, 861, 863, 865 and/or 867 ;
or which comprises a sequence which is complementary thereto; whereby the
nucleic acid molecule according to (a) to (g) is at least in one or more
nucleotides different from the sequence depicted in SEQ ID NO: 1, 3, 5, 7, 9,
11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47,
49, 51,
53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79 and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123,

125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153,
155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183,
185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213,
215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243,
245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273,
275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303,
305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333,
335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363,
365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393,
395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423,
425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453,
455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483,
485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513,
515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543,
545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573,
575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603,
605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633,
635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663,
665, 667, 669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693,
695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723,
725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753,
755, 757, 759, 761, 763, 765, 767, 769, 771, 773, 775, 777, 779, 781, 783,
785, 787, 789, 791, 793, 795, 797, 799, 801, 803, 805, 807, 809, 811, 813,
815, 817, 819, 821, 823, 825, 827, 829, 831, 833, 835, 837, 839, 841, 843,
845, 847, 849, 851, 853, 855, 857, 859, 861, 863, 865 and/or 867
and which encodes a protein which differs at least in one or more amino acids
from the protein sequences depicted in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16,
18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54,
56, 58,
60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and/or 82




107

and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,
184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,
334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868.

24. An isolated polypeptide encoded by a nucleic acid molecule as claimed in
claim 23.

25. An antibody, which specifically binds to the polypeptide as claimed in
claim 24.
26. A transformed plant cell wherein the increased tolerance and/or resistance
to an
environmental stress is conferred by one or more inactivated or down-regulated

genes encoded by one or more nucleic acid sequences selected from the group
consisting of:




108

a) nucleic acid molecule encoding the polypeptide shown in SEQ ID NO: 2, 4,
6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44,
46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and/or
82
and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,
184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,
334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368; 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
b) nucleic acid molecule comprising the nucleic acid molecule shown in SEQ
ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37,
39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75,
77,
79 and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121,
123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151,
153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181,




109

183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211,
213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241,
243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271,
273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301,
303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331,
333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361,
363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391,
393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421,
423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451,
453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481,
483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511,
513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541,
543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631,
633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661,
663, 665, 667, 669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691,
693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721,
723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751,
753, 755, 757, 759, 761, 763, 765, 767, 769, 771, 773, 775, 777, 779, 781,
783, 785, 787, 789, 791, 793, 795, 797, 799, 801, 803, 805, 807, 809, 811,
813, 815, 817, 819, 821, 823, 825, 827, 829, 831, 833, 835, 837, 839, 841,
843, 845, 847, 849, 851, 853, 855, 857, 859, 861, 863, 865 and/or 867;
c) nucleic acid molecule comprising a nucleic acid sequence, which, as a
result of the degeneracy of the genetic code, can be derived from a
polypeptide sequence depicted in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16,
18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54,
56,
58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and/or 82;
d) nucleic acid molecule encoding a polypeptide having at least 50% identity
with the amino acid sequence of the polypeptide encoded by the nucleic
acid molecule of (a) to (c) and having the biological activity represented by
protein of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30,
32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68,
70,
72, 74, 76, 78, 80 and/or 82
and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,




110

184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,
334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
e) nucleic acid molecule encoding a polypeptide which is isolated with the aid

of monoclonal antibodies against a polypeptide encoded by one of the
nucleic acid molecules of (a) to (d) and having the biological activity
represented by the protein of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20,
22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58,
60,
62, 64, 66, 68, 70, 72, 74, 76, 78, 80 and/or 82
and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,
184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,




111

334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
f) nucleic acid molecule which is obtainable by screening a suitable nucleic
acid library under stringent hybridisation conditions with a probe
comprising one of the sequences of the nucleic acid molecule of (a) or (b)
or with a fragment thereof having at least 15 nt, preferably 20 nt, 30 nt, 50
nt, 100 nt, 200 nt or 500 nt of the nucleic acid molecule characterized in (a)

to (c) and encoding a polypeptide having the biological activity represented
by protein whose reduction or deletion results in increased tolerance
and/or resistance to an environmental stress; and
g) a nucleic acid molecule having at least 70% sequence identity to
polynucleotide selected from the groups consisting of the polynucleotides
shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29,
31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67,
69,
71, 73, 75, 77, 79 and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121,
123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151,
153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181,
183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211,
213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241,
243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271,




112
273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301,
303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331,
333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361,
363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391,
393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421,
423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451,
453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481,
483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511,
513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541,
543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631,
633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661,
663, 665, 667, 669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691,
693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721,
723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751,
753, 755, 757, 759, 761, 763, 765, 767, 769, 771, 773, 775, 777, 779, 781,
783, 785, 787, 789, 791, 793, 795, 797, 799, 801, 803, 805, 807, 809, 811,
813, 815, 817, 819, 821, 823, 825, 827, 829, 831, 833, 835, 837, 839, 841,
843, 845, 847, 849, 851, 853, 855, 857, 859, 861, 863, 865 and/or 867;
or which comprises a sequence which is complementary thereto.
27. A plant comprising a cell of claim 26.

Description

CA 02798495 2012-11-09
1

PLANT CELLS AND PLANTS WITH INCREASED TOLERANCE TO
ENVIRONMENTAL STRESS

This invention relates generally to transformed plant cells and plants
comprising
an inactivated or down-regulated gene resulting in increased tolerance and/or
resistance to environmental stress as compared to non-transformed wild type
cells and
methods of producing such plant cells or plants.

This invention further relates generally to transformed plant cells with
increased
tolerance and/or resistance to environmental stress as compared to a
corresponding
non-transformed wild type plant cell, wherein the increased tolerance and/or
resistance
to environmental stress as compared to a corresponding non-transformed wild
type
plant cell is altered by an inactivated or down-regulated gene, methods of
producing,
screening for and breeding such plant cells or plants and method of detecting
stress in
plants cells or plants.
In particular, this invention relates to transformed plant cells and plants
comprising an inactivated or down-regulated gene resulting in increased
tolerance
and/or resistance to environmental stress, preferably by altering the
metabolic activity,
as compared to non-transformed wild type cells and methods of producing such
plant
cells or plants.
Abiotic environmental stress, such as drought stress, salinity stress, heat
stress,
and cold stress, is a major limiting factor of plant growth and productivity
(Boyer. 1982.
Science 218, 443-448). Crop losses and crop yield losses of major crops such
as rice,
maize (com) and wheat caused by these stresses represent a significant
economic and
political factor and contribute to food shortages in many underdeveloped and
third-
world countries.
Plants are typically exposed during their life cycle to conditions of reduced
environmental water content. Most plants have evolved strategies to protect
themselves against these conditions of low water or desiccation (drought) for
short
period of time. However, if the severity and duration of the drought
conditions are too
great, the effects on plant development, growth and yield of most crop plants
are
profound. Continuous exposure to drought causes major alterations in the plant


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCTIEP2005/055023
BASF/PF 56031 PCT 2

metabolism. These great changes in metabolism ultimately lead to cell death
and
consequently yield losses.
Developing stress-tolerant and/or resistant plants is a strategy that has the
potential to solve or mediate at least some of these problems (McKersie and
Leshem,
1994. Stress and Stress Coping in Cultivated Plants, Kluwer Academic
Publishers).
However, traditional plant breeding strategies to develop new lines of plants
that exhibit
resistance (tolerance) to these types of stress are relatively slow and
require specific
resistant lines for crossing with the desired line. Limited germplasm
resources for
stress tolerance and incompatibility in crosses between distantly related
plant species
represent significant problems encountered in conventional breeding.
Additionally, the
cellular processes leading to drought, cold and salt tolerance and/or
resistance are
complex in nature and involve multiple mechanisms of cellular adaptation and
numerous metabolic pathways (McKersie and Leshem, 1994. Stress and Stress
Coping in Cultivated Plants, Kluwer Academic Publishers). This multi-component
nature of stress tolerance and/or resistance has not only made breeding for
tolerance
and/or resistance largely unsuccessful, but has also limited the ability to
genetically
engineer stress tolerance plants using biotechnological methods.
Drought, heat, cold and salt stress have a common theme important for plant
growth and that is water availability. Plants are exposed during their entire
life cycle to
conditions of reduced environmental water content. Most plants have evolved
strategies to protect themselves against lack of water. However, if the
severity and
duration of the drought conditions are too great, the effects on plant
development,
growth and yield of most crop plants are profound. Since high salt content in
some soils
result in less available water for cell intake, its effect is similar to those
observed under
drought conditions. Likewise, under freezing temperatures, plant cells loose
water as a
result of ice formation that starts in the apoplast and withdraws water from
the symplast
(McKersie and Leshem, 1994. Stress and Stress Coping in Cultivated Plants,
Kluwer
Academic Publishers). Commonly, a plant's molecular response mechanisms to
each
of these stress conditions are the same.
The results of current research indicate that drought tolerance and/or
resistance
is a complex quantitative trait and that no real diagnostic marker is
available yet. High
salt concentrations or dehydration may cause damage at the cellular level
during
drought stress but the precise injury is not entirely clear (Bray, 1997.
Trends Plant Sci.
2, 48-54). This lack of a mechanistic understanding makes it difficult to
design a
transgenic approach to improve drought tolerance and/or resistance. However,
an
important consequence of damage may be the production of reactive oxygen
radicals


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 3

that cause cellular injury, such as lipid peroxidation or protein and nucleic
acid
modification. Details of oxygen free radical chemistry and their reaction with
cellular
components such as cell membranes have been described (McKersie and Leshem,
1994. Stress and Stress Coping in Cultivated Plants, Kluwer Academic
Publishers).
There are numerous sites of oxygen activation in the plant cell, which are
highly
controlled and tightly coupled to prevent release of intermediate products
(McKersie
and Leshem, 1994. Stress and Stress Coping in Cultivated Plants, Kluwer
Academic
Publishers). Under abiotic stress situations, it is likely that this control
or coupling
breaks down and the process "dysfunctions" leaking activated oxygen. These
uncoupling events are not detrimental provided that they are short in duration
and that
the oxygen scavenging systems are able to detoxify the various forms of
activated
oxygen. If the production of activated oxygen exceeds the plant's capacity to
detoxify it,
deleterious degenerative reactions occur. At the subcellular level,
disintegration of
membranes and aggregation of proteins are typical symptoms. Therefore it is
the
balance between the production and the scavenging of activated oxygen that is
critical
to the maintenance of active growth and metabolism of the plant and overall
environmental (abiotic) stress tolerance and/or resistance.
Preventing or diminishing the accumulation of oxygen free radicals in response
to drought is a potential way to engineer tolerance (Allen, 1995. Plant
Physiol. 107,
1049-1054). Overexpression of antioxidant enzymes or ROS-scavenging enzymes is
one possibility for the induction of functional detoxification systems. For
example,
transgenic alfalfa plants expressing Mn-superoxide dismutase tend to have
reduced
injury after water-deficit stress (McKersie et al., 1996. Plant Physiol. 111,
1177-1181).
These same transgenic plants have increased biomass production in field trials
(McKersie et al., 1999. Plant Physiology, 119: 839-847; McKersie et al., 1996.
Plant
Physiol. 111, 1177-1181). Transgenic plants that overproduce osmolytes such as
mannitol, fructans, proline or glycine-betaine also show increased resistance
to some
forms of abiotic stress and it is proposed that the synthesized osmolytes act
as ROS
scavengers (Tarczynski. et al. 1993 Science 259, 508-510; Sheveleva,. et al.
1997.
Plant Physiol.115, 1211-1219).
It is the object of this invention to identify new, unique genes capable of
conferring stress tolerance to plants upon inactivation or down-regulation of
genes.
It is further object of this invention to identify, produce and breed new,
unique
stress tolerant and/or resistant plant cells or plants and methods of inducing
and
detecting stress tolerance and/or resistance in plants or plant cells. It is a
further object


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 4

to identify new methods to detect stress tolerance and/or resistance in plants
or plant
cells.
The present invention provides a transformed plant cell, preferably with
altered
metabolic activity compared to a corresponding non transformed wild type plant
cell,
wherein the increased tolerance and/or resistance to an environmental stress
as
compared to a corresponding non-transformed wild type plant cell is altered by
an
inactivated or down-regulated gene.
The present invention provides a transformed plant cell with increased
tolerance
and/or resistance to an environmental stress as compared to a corresponding
non-
transformed wild type plant cell, wherein the increased tolerance and/or
resistance to
an environmental stress is altered by an inactivated or down-regulated gene.
As used herein, the term "inactivated or down-regulated gene" means the
transgenic reduction or deletion of the expression of nucleic acid of SEQ ID
NO: 1, 3, 5,
7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45,
47, 49, 51, 53,
55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79 and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123,
125,
127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155,
157, 159,
161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189,
191, 193,
195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223,
225, 227,
229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257,
259, 261,
263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291,
293, 295,
297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325,
327, 329,
331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359,
361, 363,
365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393,
395, 397,
399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427,
429, 431,
433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461,
463, 465,
467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495,
497, 499,
501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529,
531, 533,
535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563,
565, 567,
569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597,
599, 601,
603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631,
633, 635,
637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665,
667, 669,
671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699,
701, 703,
705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733,
735, 737,
739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761, 763, 765, 767,
769, 771,
773, 775, 777, 779, 781, 783, 785, 787, 789, 791, 793, 795, 797, 799, 801,
803, 805,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 5

807, 809, 811, 813, 815, 817, 819, 821, 823, 825, 827, 829, 831, 833, 835,
837, 839,
841, 843, 845, 847, 849, 851, 853, 855, 857, 859, 861, 863, 865 and/or 867
leading to an increased tolerance and/or resistance to an environmental stress
as
compared to a corresponding non-transformed wild type plant cell.
In the transgenic plant cell of the invention, the reduction or deletion of
the
expression of said nucleic acid results in increased tolerance to an
environmental
stress as compared to a corresponding non-transformed wild type plant cell.
Herein,
the environmental stress is selected from the group consisting of salinity,
drought,
temperature, metal, chemical, pathogenic and oxidative stresses, or
combinations
thereof, preferably drought and/or temperature.
The term "expression" refers to the transcription and/or translation of a
codogenic gene segment or gene. As a rule, the resulting product is an mRNA or
a
protein. However, expression products can also include functional RNAs such
as, for
example, antisense, nudeic acids, tRNAs, snRNAs, rRNAs, RNAi, siRNA, ribozymes
etc. Expression may be systemic,local or temporal, for example limited to
certain cell
types, tissuesorgans or time periods.
Unless otherwise specified, the terms "polynucleotides", "nucleic acid" and
"nucleic acid molecule" are interchangeably in the present context. Unless
otherwise
specified, the terms "peptide", "polypeptide" and "protein" are
interchangeably in the
present context. The term "sequence" may relate to polynucleotides, nucleic
acids,
nucleic acid molecules, peptides, polypeptides and proteins, depending on the
context
in which the term "sequence" is used. The terms "gene(s)", "polynucleotide",
"nucleic
acid sequence", "nucleotide sequence", or "nucleic acid molecule(s)" as used
herein
refers to a polymeric form of nucleotides of any length, either
ribonucleotides or
deoxyribonucleotides. The terms refer only to the primary structure of the
molecule.
Thus, the terms "gene(s)", "polynucleotide", "nucleic acid sequence",
"nucleotide
sequence", or "nucleic acid molecule(s)" as used herein include double- and
single-
stranded DNA and RNA. They also Include known types of modifications, for
example,
methylation, "caps", substitutions of one or more of the naturally occurring
nucleotides
with an analog. Preferably, the DNA or RNA sequence of the invention comprises
a
coding sequence encoding the herein defined polypeptide.
A "coding sequence" is a nucleotide sequence, which is transcribed into mRNA
and/or translated into a polypeptide when placed under the control of
appropriate
regulatory sequences. The boundaries of the coding sequence are determined by
a
translation start codon at the 5'-terminus and a translation stop codon at the
3'-
terminus. A coding sequence can include, but is not limited to mRNA, cDNA,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 6

recombinant nucleotide sequences or genomic DNA, while introns may be present
as
well under certain circumstances.
For the purposes of the invention, as a rule the plural is intended to
encompass
the singular and vice versa.
The terms "reduction", "decrease" or "deletion" relate to a corresponding
change
of a property in an organism, a part of an organism such as a tissue, seed,
root, leave,
flower etc. or in a cell. Under "change of a property" it is understood that
the activity,
expression level or amount of a gene product or the metabolite content is
changed in a
specific volume or in a specific amount of protein relative to a corresponding
volume or
amount of protein of a control, reference or wild type. Preferably, the
overall activity in
the volume is reduced, decreased or deleted in cases if the reduction,
decrease or
deletion is related to the reduction, decrease or deletion of an activity of a
gene
product, independent whether the amount of gene product or the specific
activity of the
- gene product or both is reduced, decreased or deleted or whether the amount,
stability
or translation efficacy of the nucleic acid sequence or gene encoding for the
gene
product is reduced, decreased, or deleted.
The terms "reduction", "decrease" or "deletion" include the change of said
property in only parts of the subject of the present invention, for example,
the
modification can be found in compartment of a cell, like an organelle, or in a
part of a
plant, like tissue, seed, root, leave, flower etc. but is not detectable if
the overall
subject, i.e. complete cell or plant, is tested. Preferably, the "reduction",
"decrease" or
"deletion" is found cellular, thus the term "reduction, decrease or deletion
of an acitivity"
or "reduction, decrease or deletion of a metabolite content" relates to the
cellular
reduction, decrease or deletion compared to the wild typ cell. In addition the
terms
"reduction", "decrease" or "deletion" include the change of said property only
during
different growth phases of the organism used in the inventive process, for
example the
reduction, decrease or deletion takes place only during the seed growth or
during
blooming. Furtheremore the terms include a transitional reduction, decrease or
deletion
for example because the used RNAi is not stable integrated in the genom of the
organism and has therefore only a transient effect.
Accordingly, the term "reduction", "decrease" or "deletion" means that the
specific activity of an enzyme or other protein or regulatory RNA as well as
the amount
of a compound or metabolite, e.g. of a polypeptide, a nucleic acid molelcule
or the fine
chemical of the invention or an encoding mRNA or DNA, can be reduced,
decreased or
deleted in a volume.


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 7

The terms "wild type", "control" or "reference" are exchangeable and can be a
cell or a part of organisms such as an organelle or tissue, or an organism, in
particular
a microorganism or a plant, which was not modified or treated according to the
herein
described process according to the invention. Accordingly, the cell or a part
of
organisms such as an organelle or a tissue, or an organism, in particular a
microorganism or a plant used as wild type, control or reference corresponds
to the
cell, organism or part thereof as much as possible and is in any other
property but in
the result of the process of the invention as identical to the subject matter
of the
invention as possible. Thus, the wild type, control or reference is treated
identically or
as identical as possible, saying that only conditions or properties might be
different
which do not influence the quality of the tested property.
Preferably, any comparison is carried out under analogous conditions. The term
"analogous conditions" means that all conditions such as, for example, culture
or
growing conditions, assay conditions (such as buffer composition, temperature,-

substrates, pathogen strain, concentrations and the like) are kept identical
between the
experiments to be compared.
The "reference", "control", or "wild type" is preferably a subject, e.g. an
organelle, a cell, a tissue, an organism, in particular a plant or a
microorganism, which
was not modified or treated according to the herein described process of the
invention
and is in any other property as similar to the subject matter of the invention
as possible.
The reference, control or wild type is in its genome, transcriptome, proteome
or
metabolome as similar as possible to the subject of the present invention.
Preferably,
the term "reference-" "control-" or "wild type-"-organelle, -cell, -tissue or -
organism, in
particular plant or microorganism, relates to an organelle, cell, tissue or
organism, in
particular plant or micororganism, which is nearly genetically identical to
the organelle,
cell, tissue or organism, in particular microorganism or plant, of the present
invention or
a part thereof preferably 95%, more peferred are 98%, even more preferred are
99,00%, in particular 99,10%, 99,30%, 99,50%, 99,70%, 99,90%, 99,99%, 99, 999%
or
more. Most preferable the "reference", "control", or "wild type" is preferably
a subject,
e.g. an organelle, a cell, a tissue, an organism, which is genetically
identical to the
organism, cell organelle used according to the process of the invention except
that
nucleic acid molecules or the gene product encoded by them are changed
according to
the inventive process.
Preferably, the reference, control or wild type differs form the subject of
the
present invention only in the cellular activity of the polypeptide or RNA of
the invention,
e.g. as result of a reduction, decrease or deletion in the level of the
nucleic acid


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 8

molecule of the present invention or a reduction, decrease or deletion of the
specific
activity of the polypeptide or RNA of the invention, e.g. by or in the
expression level or
activity of protein or RNA that means its biological activity and/or its
biochemical or
genetical causes.
The term "expression" means the transcription of a gene into structural RNA
(rRNA, tRNA, miRNA) or messenger RNA (mRNA) with the subsequent translation of
the latter into a protein. Experimentally, expression can be detected by e.g.
Northern,
qRT PCR, transcriptional run-on assays or Western blotting and other immuno
assays.
As consequence of the reduction, decrease or deletion of the expression that
means as
consequence of the reduced, decreased or deleted transcription of a gene a
related
phenotypic trait appears such as the enhanced or increased stress tolerance.
Accordingly, preferred reference subject is the starting subject of the
present
process of the invention. Preferably, the reference and the subject matter of
the
invention are compared after standardization and normalization, e.g. to the
amount of
total RNA, DNA, or Protein or activity or expression of reference genes, like
housekeeping genes, such as ubiquitin.
A series of mechanisms exists via which a modification in the polypeptide of
the
invention can directly or indirectly affect stress tolerance. For example, the
molecule
number or the specific activity of the polypeptide of the invention or the
number of
expression of the nucleic acid molecule of the invention may be reduced,
decreased or
deleted. However, it is also possible to reduce, decrease or delete the
expression of
the gene which is naturally present in the organisms, for example by modifying
the
regulation of the gene, or by reducing or decreasing the stability of the mRNA
or of the
gene product encoded by the nucleic acid molecule of the invention.
This also applies analogously to the combined reduction, decrease or deletion
of the expression of the nucleic acid molecule of the present invention or its
gene
product together with the manipulation of further acitivities such as enzymes
wich
confer stress tolerance.
The reduction, decrease, deletion or modulation according to this invention
can
be constitutive, e.g. due to a stable permanent transgenic expression or to a
stable
mutation in the corresponding endogenous gene encoding the nucleic acid
molecule of
the invention or to a modulation of the expression or of the behaviour of a
gene
conferring the expression of the polypeptide of the invention, or transient,
e.g. due to
an transient transformation, a transiently active promotor or temporary
addition of a
modulator such as an antagonist or inductor, e.g. after transformation with a
inducible
construct carrying a double-stranded RNA nucleic acid molecule, an antisense
nucleic


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 9

acid molecule, a ribozyme of the invention etc. under control of a inducible
promoter
and adding the inducer, e.g. tetracycline or as described herein below.
The reduction, decrease or deletion in activity amounts preferably by at least
10%, preferably by at least 30% or at least 60%, especially preferably by at
least 70%,
80%, 85%, 90% or more, very especially preferably are at least 95%, more
preferably
are at least 99% or more in comparison to the control, reference or wild type.
Most
preferably the reduction, decrease or deletion in activity amounts to 100%.
In this context, inactivation means that the enzymatic or biological activity
of the
polypeptides encoded is no longer detectable in the organism or in the cell
such as, for
example, within the plant or plant cell. For the purposes of the invention,
downregulation (= reduction) means that the enzymatic or biological activity
of the
polypeptides encoded is partly or essentially completely reduced in comparison
with
the activity of the untreated organism. This can be achieved by different cell-
biological
mechanisms. In this context, the activity can be downregulated in the entire
organism
or, in the case of multi-celled organisms, in individual parts of the
organism, in the case
of plants for example in tissues such as the seed, the leaf, the root or other
parts. In
this context, the enzymatic activity or biological activity is reduced by at
least 10%,
advantageously at least 20%, preferably at least 30%, especially preferably at
least
40%, 50% or 60%, very especially preferably at least 70%, 80%, 85% or 90% or
more,
very especially preferably are at least 95%, more preferably are at least 99%
or more in
comparison to the control, reference or wild type. Most preferably the
reduction,
decrease or deletion in activity amounts to 100%.
Various strategies for reducing the quantity (= expression), the activity or
the
function of proteins encoded by the nucleic acids or the nucleic acid
sequences itself
according to the invention are encompassed in accordance with the invention.
The
skilled worker will recognize that a series of different methods are available
for
influencing the quantity of a protein, the activity or the function in the
desired manner.
The term "biological activity' means the biological function of the protein of
the
invention. In contrast to the term "biological activity" the term "activity"
means the
increase in the production of the compound produced by the inventive process.
The
term "biological activity" preferably refers to the enzymatic function,
transporter carrier
function, DNA-packaging function, heat shock protein function, recombination
protein
function, beta-galactosidase function, Serine/threonine-protein kinase CTR1
function,
lipase function, enoyl-CoA hydratase function, UDP-glucose glucosyltransferase
function, cell division protein function, flavonol synthase function,
tracylglycerol lipase,
MADS-box protein function, pectinesterase function, pectin metylesterase
function,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 10

calcium transporting ATPase function, protein kinase function,
lysophospholipase
function, Chlorophyll A-B binding proteins function, Ca2+-transporting ATPase-
like
protein function, peroxidase function, disease resistance RPP5 like protein
function, or
regulatory function of a peptide or protein in an organism, a tissue, a cell
or a cell
compartment. Suitable substrates are low-molecular-weight compounds and also
the
protein interaction partners of a protein. The term "reduction" of the
biological function
refers, for example, to the quantitative reduction in binding capacity or
binding strength
of a protein for at least one substrate in an organism, a tissue, a cell or a
cell
compartment - for example by one of the methods described herein below - in
comparison with the wild type of the same genus and species to which this
method has
not been applied, under otherwise identical conditions (such as, for example,
culture
conditions, age of the plants and the like). Reduction is also understood as
meaning
the modification of the substrate specificity as can be expressed for example,
by the
kcat/Km value. In this context, a reduction of the function of at least 10%,
advantageously of at least 20%, preferably at least 30%, especially preferably
of at
least 40%, 50% or 60%, very especially preferably of at least 70%, 80%, 90% or
95%,
in comparison with the untreated organism is advantageous. A particularly
advantageous embodiment is the inactivation of the function. Binding partners
for the
protein can be identified in the manner with which the skilled worker is
familiar, for
example by the yeast 2-hybrid system.
A modification, i.e. a decrease, can be caused by endogenous or exogenous
factors. For example, a decrease in activity in an organism or a part thereof
can be
caused by adding a chemical compound such as an antagonist to the media,
nutrition,
soil of the plants or to the plants themselves.
The transformed plant cells are compared to the corresponding non-
transformed wild type of the same genus and species under otherwise identical
conditions (such as, for example, culture conditions, age of the plants and
the like). In
this context, a change of at least 10%, advantageously of at least 20%,
preferably at
least 30%, especially preferably of at least 40%, 50% or 60%, very especially
preferably of at least 70%, 80%, 90%, 95% or even 100% or more, in comparison
with
the non-transformed organism is advantageous.
In the invention inactivation or down-regulation of a gene in the plant cell
results
in altered metabolic activity as compared to a corresponding non-transformed
wild type
plant cell. One preferred wild type plant cell is a non-transformed
Arabidopsis plant cell.
An example here is the Arabidopsis wild type C24 (Nottingham Arabidopsis Stock
Centre, UK; NASC Stock N906).


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 11

Other preferred wild type plant cells are a non-transformed from plants
selected
from the group consisting of maize, wheat, rye, oat, triticale, rice, barley,
soybean,
peanut, cotton, rapeseed, canola, manihot, pepper, sunflower, flax, borage,
safflower,
linseed, primrose, rapeseed, turnip rape, tagetes, solanaceous plants, potato,
tobacco,
eggplant, tomato, Vicia species, pea, alfalfa, coffee, cacao, tea, Salix
species, oil palm,
coconut, perennial grass and forage crops.
More preferred wild type plant cells are a non-transformed Linum plant cell,
preferably Linum usitatissimum, more preferably the variety Brigitta, Golda,
Gold
Merchant, Helle, Juliel, Olpina, Livia, Marlin, Maedgold, Sporpion, Serenade,
Linus,
Taunus, Lifax or Liviola, a non-transformed Heliantus plant cell, preferably
Heliantus
annuus, more preferably the variety Aurasol, Capella, Flavia, Flores, Jazzy,
Palulo,
Pegasol, PIR64A54, Rigasol, Sariuca, Sideral, Sunny, Alenka, Candisol or
Floyd, or a
non-transformed Brassica plant cell, preferably Brassica napus, more
preferably the
variety Dorothy, Evita, Heros, Hyola, Kimbar, Lambada, Licolly, Liconira,
Licosmos,
Lisonne, Mistral, Passat, Serator, Siapula, Sponsor, Star, Caviar, Hybridol,
Baical,
Olga, Lara, Doublol, Karola, Falcon, Spirit, Olymp, Zeus, Libero, Kyola,
Licord, Lion,
Lirajet, Lisbeth, Magnum, Maja, Mendel, Mica, Mohican, Olpop, Ontarion,
Panthar,
Prinoe, Pronio, Susanna, Talani, Titan, Transfer, Wiking, Woltan, Zeniah,
Artus,
Contact or Smart.
Inactivation or down-regulation of a gene is advantageous since no new gene
must be introduced to achieve the altered metabolic activity resulting in
increased
tolerance and/or resistance to environmental stress. Only an endogenous gene
is
hindered in its expression.
The inactivated or down-regulated gene or genes directly or indirectly
influence
the stress tolerance of plants, preferably the metabolic activity of the
transformed plant
cells.
Stress tolelance may be confered by one or more inactivated or down-regulated
genes encoded by one or more nucleic acid sequences selected from the group
consisting of
a) nucleic acid molecule encoding on of the polypeptides shown in SEQ ID NO:
2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40,
42,
44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80
and/or 82
and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124,126,128,130,132,134,136,138,140,142,144,146,148,150,152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCTIEP2005/055023
BASF/PF 56031 PCT 12

184, 186,188, 190,192,194, 196,198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,
334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
b) nucleic acid molecule comprising a nucleic acid sequence, which, as a
result
of the degeneracy of the genetic code, can be derived from a polypeptide
sequence depicted in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24,
26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62,
64,
66, 68, 70, 72, 74, 76, 78, 80 and/or 82
and/or 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,
184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,
334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 13

364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,
514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540,542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
c) nucleic acid molecule encoding a polypeptide having at least 50% identity
with the amino acid sequence of the polypeptide encoded by the nucleic acid
molecule of (a) to (c) and having the biological activity represented by
protein
according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28,
30,
32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68,
70,
72, 74, 76, 78, 80 and/or 82
and/or 96,98,100,102,104,106,108,110,112,114,116,118,120,122,
124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152,
154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182,
184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212,
214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242,
244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272,
274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302,
304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 332,
334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362,
364, 366, 368, 370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392,
394, 396, 398, 400, 402, 404, 406, 408, 410, 412, 414, 416, 418, 420, 422,
424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452,
454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482,
484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCTIEP2005/055023
BASF/PF 56031 PCT 14

514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542,
544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568, 570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632,
634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662,
664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692,
694, 696, 698, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722,
724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752,
754, 756, 758, 760, 762, 764, 766, 768, 770, 772, 774, 776, 778, 780, 782,
784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806, 808, 810, 812,
814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840, 842,
844, 846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868;
d) nucleic acid molecule encoding a polypeptide which is isolated with the aid
of
monoclonal antibodies against a polypeptide encoded by one of the nucleic
acid molecules of (a) to (d) and having the biological activity represented by
the protein according to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22,
24,
26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62,
64,
66, 68, 70, 72, 74, 76, 78, 80 and/or 82;
e) nucleic acid molecule which is obtainable by screening a suitable nucleic
acid library under stringent hybridisation conditions with a probe comprising
one of the sequences of the nucleic acid molecule of (a) or (b) or with a
fragment thereof having at least 15 nt, preferably 20 nt, 30 nt, 50 nt, 100
nt,
200 nt or 500 nt of the nucleic acid molecule characterized in (a) to (c) and
encoding a polypeptide having the biological activity represented by protein
whose reduction or deletion results in increased tolerance and/or resistance
to an environmental stress
or which comprises a sequence which is complementary thereto.

With the present invention it is possible to identify the genes encoded by a
nucleic acid sequence selected from the group consisting of sequences
according to
SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35,
37, 39, 41,
43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79
and/or 81
and/or 95, 97, 99, 101, 103, 105, 107, 109, 111, 113,115, 117, 119, 121, 123,
125,
127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155,
157, 159,
161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189,
191, 193,
195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223,
225, 227,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 15

229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257,
259, 261,
263, 265, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291,
293, 295,
297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325,
327, 329,
331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359,
361, 363,
365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393,
395, 397,
399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427,
429, 431,
433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461,
463, 465,
467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495,
497, 499,
501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529,
531, 533,
535, 537, 539,541,543,545,547, 549, 551, 553, 555, 557, 559, 561, 563, 565,
567,
569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597,
599, 601,
603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631,
633, 635,
637, 639, 641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665,
667, 669,
671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699,
701, 703,
705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733,
735, 737,
739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761, 763, 765, 767,
769, 771,
773, 775, 777, 779, 781, 783, 785, 787, 789, 791, 793, 795, 797, 799, 801,
803, 805,
807, 809, 811, 813, 815, 817, 819, 821, 823, 825, 827, 829, 831, 833, 835,
837, 839,
841, 843, 845, 847, 849, 851, 853, 855, 857, 859, 861, 863, 865 and/or 867
and/or homologs thereof in target plants, especially crop plants, and then
inactivate or
down-regulate the corresponding gene to achieve an increased tolerance and/or
resistance to environmental stress (prefarably by the altered metabolic
activity).
Consequently the invention is not limited to a specific plant.

For the purpose of the present invention the SEQ ID NOs and the expression:
SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35,
37, 39, 41,
43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79
and/or 81;
and/or
95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125,
127, 129,
131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159,
161, 163,
165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193,
195, 197,
199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227,
229, 231,
233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261,
263, 265,
267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295,
297, 299,
301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329,
331, 333,
335, 337, 339,341, 343, 345,347,349, 351, 353, 355, 357, 359, 361, 363, 365,
367,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCTIEP2005/055023
BASF/PF 56031 PCT 16

369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 395, 397,
399, 401,
403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431,
433, 435,
437, 439, 441, 443,445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467,
469,
471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499,
501, 503,
505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533,
535, 537,
539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567,
569, 571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603, 605,
607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635,
637, 639,
641,643, 645,647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669, 671,
673,
675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699, 701, 703,
705, 707,
709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733, 735, 737,
739, 741,
743, 745, 747, 749, 751, 753, 755, 757, 759, 761, 763, 765, 767, 769, 771,
773, 775,
777, 779, 781, 783, 785, 787, 789, 791, 793, 795, 797, 799, 801, 803, 805,
807, 809,
811, 813, 815, 817, 819, 821, 823, 825, 827, 829, 831, 833, 835, 837, 839,
841, 843,
845, 847, 849, 851, 853, 855, 857, 859, 861, 863, 865 and/or 867
are summarized and named as "SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to
433".
This means, throughout the instant specification the term:
" SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33,
35, 37, 39, 41,
43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79
and/or 81;
and/or
95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125,
127, 129,
131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 157, 159,
161, 163,
165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193,
195, 197,
199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227,
229, 231,
233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261,
263, 265,
267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295,
297, 299,
301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329,
331, 333,
335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363,
365, 367,
369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 395, 397,
399, 401,
403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431,
433, 435,
437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465,
467, 469,
471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499,
501, 503,
505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533,
535, 537,
539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567,
569, 571,
573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601,
603, 605,
607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635,
637, 639,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCTIEP2005/055023
BASF/PF 56031 PCT 17

641, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 667, 669,
671, 673,
675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699, 701, 703,
705, 707,
709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733, 735, 737,
739, 741,
743, 745, 747, 749, 751, 753, 755, 757, 759, 761, 763, 765, 767, 769, 771,
773, 775,
777, 779, 781, 783, 785, 787, 789, 791, 793, 795, 797, 799, 801, 803, 805,
807, 809,
811, 813, 815, 817, 819, 821, 823, 825, 827, 829, 831, 833, 835, 837, 839,
841, 843,
845, 847, 849, 851, 853, 855, 857, 859, 861, 863, 865 and/or 867"

and the term "SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433" are
identical and
interchangeably in the present context.
For the purpose of the present invention, the SEQ ID NOs and the expression:
SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36,
38, 40, 42,
44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80
and/or 82,
and/or

96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126,
128, 130,
132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160,
162, 164,
166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194,
196, 198,
200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228,
230, 232,
234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262,
264, 266,
268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296,
298, 300,
302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330,
332, 334,
336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364,
366, 368,
370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398,
400, 402,
404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432,
434, 436,
438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466,
468, 470,
472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500,
502, 504,
506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534,
536, 538,
540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568,
570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606,
608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636,
638, 640,
642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670,
672, 674,
676, 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 702, 704,
706, 708,
710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 732, 734, 736, 738,
740, 742,
744, 746, 748, 750, 752, 754, 756, 758, 760, 762, 764, 766, 768, 770, 772,
774, 776,
778, 780, 782, 784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806,
808, 810,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 18

812, 814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840,
842, 844,
846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868
are summarized and named as "SEQ ID NO: (2n+2) for n=0 to 40 and for n=47 to
433".
This means, throughout the instant specification the term:
"SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34,
36, 38, 40, 42,
44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80
and/or 82;
and/or
96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126,
128, 130,
132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160,
162, 164,
166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194,
196, 198,
200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228,
230, 232,
234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262,
264, 266,
268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296,
298, 300,
302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330,
332, 334,
336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364,
366, 368,
370, 372, 374, 376, 378, 380, 382, 384, 386, 388, 390, 392, 394, 396, 398,
400, 402,
404, 406, 408, 410, 412, 414, 416, 418, 420, 422, 424, 426, 428, 430, 432,
434, 436,
438, 440, 442, 444, 446, 448, 450, 452, 454, 456, 458, 460, 462, 464, 466,
468, 470,
472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500,
502, 504,
506, 508, 510, 512, 514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534,
536, 538,
540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 562, 564, 566, 568,
570, 572,
574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602,
604, 606,
608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636,
638, 640,
642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670,
672, 674,
676, 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 702, 704,
706, 708,
710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 732, 734, 736, 738,
740, 742,
744, 746, 748, 750, 752, 754, 756, 758, 760, 762, 764, 766, 768, 770, 772,
774, 776,
778, 780, 782, 784, 786, 788, 790, 792, 794, 796, 798, 800, 802, 804, 806,
808, 810,
812, 814, 816, 818, 820, 822, 824, 826, 828, 830, 832, 834, 836, 838, 840,
842, 844,
846, 848, 850, 852, 854, 856, 858, 860, 862, 864, 866 and/or 868
and the term "SEQ ID NO: (2n+2) for n=0 to 40 and for n=47 to 433" are
identical and
interchangeably in the present context.

It is further possible to detect environmental stress in plant cells or plants
by
screening the plant cells for altered metabolic activity as compared to non-
stress


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCTIEP2005/055023
BASF/PF 56031 PCT 19

conditions. This allows for monitoring of stress levels in plants, even when
no
symptoms are visuable. Therefore counter action can be taken ealier and e.g.
crop
losses minimized by timely watering.
It is also within the scope of the invention to screen plant cells or plants
for
increased tolerance and/or resistance to environmental stress by screening the
plant
cells under stress conditions for increased tolerance and/or resistance to
environmental
stress as compared to non-stress conditions. This allows selection of plants
with
increased tolerance and/or resistance to environmental stress without the
identification
of genes or visual symptoms.
With the invention it is further possible to breed plant cells or plants
towards
increased tolerance and/or resistance to environmental stress by screening the
plant
cells under stress conditions for increased tolerance and/or resistance to
environmental
stress as compared to non-stress conditions and selecting those with increased
tolerance and/or resistance to environmental stress. The screening for stress
tolerance
is faster and easier than e.g. screening for genes.
Screening is well known to those skilled in the art and generally refers to
the
search for a particular attribute or trait. In the invention this trait in a
plant or plant cell is
preferably the concentration of a metabolite or estimate the general
appearance. The
methods and devices for screening are familiar to those skilled in the art and
include
GC (gas chromatography), LC (liquid chromatography), HPLC (high performance
(pressure) liquid chromatography), MS (mass spectrometry), NMR (nuclear
magnetic
resonance) spectroscopy, IR (infra red) spectroscopy, photometric methods etc
and
combinations of these methods.
Breeding is also customary knowledge for those skilled in the art. It is
understood
as the directed and stable incorporation of a particular attribute or trait
into a plant or
plant cell.
The various breeding steps are characterized by well-defined human
intervention
such as selecting the lines to be crossed, directing pollination of the
parental lines, or
selecting appropriate progeny plants. Different breeding measures can be
taken,
depending on the desired properties. All the techniques are well known by a
person
skilled in the art and include for example, but are not limited to
hybridization,
inbreeding, backcross breeding, multiline breeding, variety blend,
interspecific
hybridization, aneuploid techniques, etc. Hybridization techniques also can
include the
sterilization of plants to yield male or female sterile plants by mechanical,
chemical, or
biochemical means. Cross pollination of a male sterile plant with pollen of a
different
line assures that the genome of the male sterile but female fertile plant will
uniformly


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 20

obtain properties of both of the parental lines. The transgenic seeds and
plants
according to the invention can therefor be used for the breeding of improved
plant
lines, which can increase the effectiveness of conventional methods such as
herbicide
or pesticide treatment or which allow one to dispense with said methods due to
their
modified genetic properties. Alternatively new crops with improved stress
tolerance,
preferably drought and temperature, can be obtained, which, due to their
optimized
genetic "equipment', yield harvested product of better quality than products
that were
not able to tolerate comparable adverse developmental conditions.
Environmental stress includes but is not limited to salinity, drought,
temperature,
metal, chemical, pathogenic and oxidative stress, or combinations thereof,
preferably
drought and/or temperature.
As used herein, the term "environmental stress" refers to any sub-optimal
growing condition and includes, but is not limited to, sub-optimal conditions
associated
with salinity, drought, temperature, metal, chemical, pathogenic and oxidative
stresses,
or combinations thereof. In preferred embodiments, environmental stress may be
salinity, drought, heat, or low temperature, or combinations thereof, and in
particular,
may be low water content or low temperature. Wherein drought stress means any
environmental stress which leads to a lack of water in plants or reduction of
water
supply to plants, wherein low temperature stress means freezing of plants
below + 4 C
as well as chilling of plants below 15 C and wherein high temperature stress
means
for example a temperature above 35 C. The range of stress and stress response
depends on the different plants which are used for the invention, i.e. it
differs for
example between a plant such as wheat and a plant such as Arabidopsis. It is
also to
be understood that as used in the specification and in the claims, "a" or "an"
can mean
one or more, depending upon the context in which it is used. Thus, for
example,
reference to "a cell" means that at least one cell may be utilized.
The invention also provides a transformed plant cell with one or more nucleic
acid sequences homologous to one or more of sequences of SEQ ID NO: (2n+1) for
n=0 to 40 and for n=47 to 433, wherein the plant is selected from the group
comprised
of maize, wheat, rye, oat, triticale, rice, barley, soybean, peanut, cotton,
rapeseed,
canola, manihot, pepper, sunflower, flax, borage, safflower, linseed,
primrose,
rapeseed, turnip rape, tagetes, solanaceous plants, potato, tobacco, eggplant,
tomato,
Vicia species, pea, alfalfa, coffee, cacao, tea, Salix species, oil palm,
coconut,
perennial grass, forage crops and Arabidopsis thaliana, preferably Brassica
napus,
Glycine max, Zea mays or Oryza sativa.


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 21

The present invention further provides a transgenic plant cell with an
inactivated or
down-regulated gene selected from the group comprising sequences of SEQ ID NO:
(2n+1) for n=0 to 40 and for n=47 to 433 and/or homologs thereof, preferably
from
Brassica napus, Glycine max, Zea mays or Oryza sativa..
Furthermore it is possible to identify the genes encoded by a nucleic acid
sequence selected from the group consisting of sequences of SEQ ID NO: (2n+1)
for
n=0 to 40 and for n=47 to 433 and/or homologs thereof in target plants,
especially crop
plants, and then inactivate or down-regulate the corresponding gene to achieve
increased tolerance and/or resistance to environmental stress. Consequently
the
invention is not limited to a specific plant.
The invention also provides a transformed plant cell with a nucleic acid
sequence
homologous to one of sequences of SEQ ID NO: (2n+1) for n=0 to 40 and for n=47
to
433, wherein the plant is selected from the group comprised of maize, wheat,
rye, oat,
- triticale, rice, barley, soybean, peanut, cotton, rapeseed, canola, manihot,
pepper,
sunflower, flax, borage, safflower, linseed, primrose, rapeseed, turnip rape,
tagetes,
solanaceous plants, potato, tobacco, eggplant, tomato, Vicia species, pea,
alfalfa,
coffee, cacao, tea, Salix species, oil palm, coconut, perennial grass, forage
crops and
Arabidopsis thaliana, preferably Brassica napus, Glycine max, Zea mays or
Oryza
sativa.
Also the invention provides a transformed plant cell, wherein the nucleic acid
or
acids are at least about 30 %, especially at least about 50 % homologous to
sequences
of SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433.
According to the invention the transformed plant cell may be derived from a
monocotyledonous or a dicotyledonous plant.
The monocotyledonous or a dicotyledonous plant may be selected from the
group comprised of maize, wheat, rye, oat, triticale, rice, barley, soybean,
peanut,
cotton, rapeseed, canola, manihot, pepper, sunflower, flax, borage, safflower,
linseed,
primrose, rapeseed, turnip rape, tagetes, solanaceous plants, potato, tobacco,
eggplant, tomato, Vicia species, pea, alfalfa, coffee, cacao, tea, Salix
species, oil palm,
coconut, perennial grass, forage crops and Arabidopsis thaliana, preferably
Brassica
napus, Glycine max, Zea mays or Oryza sativa.
The transformed plant cell may be derived from a gymnosperm plant and can
preferably be selected from the group of spruce, pine and fir.
The invention also provides a transformed plant generated from said plant cell
and which is a monocot or dicot plant.


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT1EP2005/055023
BASF/PF 56031 PCT 22

The transformed plant may be selected from the group comprised of maize,
wheat, rye, oat, triticale, rice, barley, soybean, peanut, cotton, rapeseed,
canola,
manihot, pepper, sunflower, flax, borage, safflower, linseed, primrose,
rapeseed, turnip
rape, tagetes, solanaceous plants, potato, tobacco, eggplant, tomato, Vicia
species,
pea, alfalfa, coffee, cacao, tea, Salix species, oil palm, coconut, perennial
grass, forage
crops and Arabidopsis thaliana, preferably Brassica napus, Glycine max, Zea
mays or
Oryza sativa.
Preferably the transformed plant generated from said plant cell is a
gymnosperm
plant, more preferred a plant selected from the group consisting of spruce,
pine and fir.
The invention not only deals with plants but also with an agricultural product
produced by any of the described transformed plants, plant parts such as
leafs, petal,
anther, roots, tubers, stems, buds, flowers or especially seeds produced by
said
transformed plant, which are at least genetically heterozygous, preferably
homozygous
for a gene or its homolog, that when inactivated or down-regulated confers an
increased tolerance and/or resistance to environmental stress as compared to a
wild
type plant.
Homologs of the aforementioned sequences can be isolated advantageously
from yeast, fungi, viruses, algae bacteria, such as Acetobacter (subgen.
Acetobacter)
aceti; Acidithiobacillus ferrooxidans; Acinetobacter sp.; Actinobacillus sp;
Aeromonas
salmonicida; Agrobacterium tumefaciens; Aquifex aeolicus; Arcanobacterium
pyogenes; Aster yellows phytoplasma; Bacillus sp.; Bifidobacterium sp.;
Borrelia
burgdorfen; Brevibacterium linens; Brucella melitensis; Buchnera sp.;
Butyrivibrio
fibrisolvens; Campylobacter jejuni; Caulobacter crescentus; Chlamydia sp.;
Chlamydophila sp.; Chlorobium limicola; Citrobacter rodentium; Clostridium
sp.;
Comamonas testosteroni; Corynebacterium sp.; Coxiella burnetii; Deinococcus
radiodurans; Dichelobacter nodosus; Edwardsiella ictaluri; Enterobacter Sp.;
Erysipelothrix rhusiopathiae; Escherichia coli; Flavobacterium sp.;
Francisella
tularensis; Frankia sp. Cpll; Fusobacterium nudeatum; Geobacillus
stearothermophilus; Gluconobacter oxydans; Haemophilus sp.; Helicobacter
pylori;
Klebsiella pneumoniae; Lactobacillus sp.; Lactococcus lactis; Listeria sp.;
Mannheimia
haemolytica; Mesorhizobium loti; Methylophaga thalassica; Microcystis
aeruginosa;
Microscilla sp. PRE1; Moraxella sp. TA144; Mycobacterium sp.; Mycoplasma sp.;
Neisseria sp.; Nitrosomonas sp.; Nostoc sp. PCC 7120; Novosphingobium
aromaticivorans; Oenococcus oeni; Pantoea citrea; Pasteurella multocida;
Pediococcus pentosaceus; Phormidium foveolarum; Phytoplasma sp.; Plectonema
boryanum; Prevotella ruminicola; Propionibacterium sp.; Proteus vulgaris;


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 23

Pseudomonas sp.; Ralstonia sp.; Rhizobium sp.; Rhodococcus equi; Rhodothermus
marinus; Rickettsia sp.; Riemerella anatipestifer; Ruminococcus flavefaciens;
Salmonella sp.; Selenomonas ruminantium; Serratia entomophila; Shigella sp.;
Sinorhizobium meliloti; Staphylococcus sp.; Streptococcus sp.; Streptomyces
sp.;
Synechococcus sp.; Synechocystis sp. PCC 6803; Thermotoga maritima; Treponema
sp.; Ureaplasma urealyticum; Vibrio cholerae; Vibrio parahaemolyticus; Xylella
fastidiosa; Yersinia sp.; Zymomonas mobilis, preferably Salmonella sp. or
Escherichia
coli or plants, preferably from yeasts such as from the genera Saccharomyces,
Pichia,
Candida, Hansenula, Torulopsis or Schizosaccharomyces, or even more preferred
from plants such as Arabidopsis thaliana, maize, wheat, rye, oat, triticale,
rice, barley,
soybean, peanut, cotton, borage, safflower, linseed, primrose, rapeseed,
canola and
turnip rape, manihot, pepper, sunflower, tagetes, solanaceous plant such as
potato,
tobacco, eggplant and tomato, Vicia species, pea, alfalfa, bushy plants such
as coffee,
cacao, tea, Salix species, trees such as oil palm, coconut, perennial grass,
such as
ryegrass and fescue, and forage crops, such as alfalfa and clover and from
spruce,
pine or fir for example, more preferably from Saccharomyces cerevisiae or
plants,
preferably Brassica napus, Glycine max, Zea mays or Oryza sativa.
"Homologs" are defined herein as two nucleic acids or proteins that have
similar,
or "homologous", nucleotide or amino acid sequences, respectively. Homologs
include
allelic variants, orthologs, paralogs, agonists and antagonists of SRP as
defined
hereafter. The term "homolog" further encompasses nucleic acid molecules that
differ
from one of the nucleotide sequences shown in sequences of SEQ ID NO: (2n+1)
for
n=0 to 40 and for n=47 to 433 (and portions thereof) due to degeneracy of the
genetic
code and thus encode the same SRP as that encoded by the amino acid sequences
shown in sequences of SEQ ID NO: (2n+2) for n=0 to 40 and for n=47 to 433. As
used
herein a "naturally occurring" SRP refers to a SRP amino acid sequence that
occurs in
nature.
The term "homology" means that the respective nucleic acid molecules or
encoded proteins are functionally and/or structurally equivalent. The nucleic
acid
molecules that are homologous to the nucleic acid molecules described above
and that
are derivatives of said nucleic acid molecules are, for example, variations of
said
nucleic acid molecules which represent modifications having the same
biological
function, in particular encoding proteins with the same or substantially the
same
biological function. They may be naturally occurring variations, such as
sequences
from other plant varieties or species, or mutations. These mutations may occur
naturally or may be obtained by mutagenesis techniques. The allelic variations
may be


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 24

naturally occurring allelic variants as well as synthetically produced or
genetically
engineered variants. Structurally equivalents can, for example, be identified
by testing
the binding of said polypeptide to antibodies or computer based predictions.
Structurally equivalent have the similar immunological characteristic, e.g.
comprise
similar epitopes.
Functional equivalents derived from one of the polypeptides as shown in SEQ ID
NO: (2n+2) for n=0 to 40 and for n=47 to 433 according to the invention by
substitution, insertion or deletion have at least 30%, 35%, 40%, 45% or 50%,
preferably at least 55%, 60%, 65% or 70% by preference at least 80%,
especially
preferably at least 85% or 90%, 91%, 92%, 93% or 94%, very especially
preferably at
least 95%, 97%, 98% or 99% homology with one of the polypeptides as shown in
SEQ
ID NO: (2n+2) for n=0 to 40 and for n=47 to 433 according to the invention and
are
distinguished by essentially the same properties as the polypeptide as shown
in SEQ
ID NO: (2n+2) for n=0 to 40 and for n=47 to 433.
Functional equivalents derived from the nucleic acid sequence according to SEQ
ID NO: (2n+1) for n=0 to 40 and for n=47 to 433 according to the invention by
substitution, insertion or deletion have at least 30%, 35%, 40%, 45% or 50%,
preferably at least 55%, 60%, 65% or 70% by preference at least 80%,
especially
preferably at least 85% or 90%, 91%, 92%, 93% or 94%, very especially
preferably at
least 95%, 97%, 98% or 99% homology with one of the polypeptides as shown in
SEQ
ID NO: (2n+2) for n=0 to 40 and for n=47 to 433 according to the invention and
encode polypeptides having essentially the same properties as the polypeptide
as shown in SEQ ID NO: (2n+2) for n=0 to 40 and for n=47 to 433.
"Essentially the same properties" of a functional equivalent is above all
understood as meaning that the functional equivalent has above mentioned
acitivty, e.g
conferring an increase in the fine chemical amount while increasing the amount
of
protein, activity or function of said functional equivalent in an organism,
e.g. a
microorgansim, a plant or plant or animal tissue, plant or animal cells or a
part of the
same.
By "hybridizing" it is meant that such nucleic acid molecules hybridize under
conventional hybridization conditions, preferably under stringent conditions
such as
described by, e.g., Sambrook (Molecular Cloning; A Laboratory Manual, 2nd
Edition,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)) or in
Current
Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989), 6.3.1-6.3.6.
According to the invention, DNA as well as RNA molecules of the nucleic acid
of
the invention can be used as probes. Further, as template for the
identification of


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 25

functional homologues Northern blot assays as well as Southern blot assays can
be
performed. The Northern blot assay advantageously provides further
informations
about the expressed gene product: e.g. expression pattern, occurance of
processing
steps, like splicing and capping, etc. The Southern blot assay provides
additional
information about the chromosomal localization and organization of the gene
encoding
the nucleic acid molecule of the invention.
A preferred, nonlimiting example of stringent hydridization conditions are
hybridizations in 6 x sodium chloridelsodium citrate (= SSC) at approximately
45 C,
followed by one or more wash steps in 0.2 x SSC, 0.1% SDS at 50 to 65 C, for
example at 50 C, 55 C or 60 C. The skilled worker knows that these
hybridization
conditions differ as a function of the type of the nucleic acid and, for
example when
organic solvents are present, with regard to the temperature and concentration
of the
buffer. The temperature under "standard hybridization conditions" differs for
example
as a function of the type of the nucleic acid between 42 C and 58 C,
preferably
between 45 C and 50 C in an aqueous buffer with a concentration of 0.1 x 0.5
x, 1 x,
2x, 3x, 4x or 5 x SSC (pH 7.2). If organic solvent(s) is/are present in the
abovementioned buffer, for example 50% formamide, the temperature under
standard
conditions is approximately 40 C, 42 C or 45 C. The hybridization conditions
for
DNA:DNA hybrids are preferably for example 0.1 x SSC and 20 C, 25 C, 30 C, 35
C,
40 C or 45 C, preferably between 30 C and 45 C. The hybridization conditions
for
DNA:RNA hybrids are preferably for example 0.1 x SSC and 30 C, 35 C, 40 C, 45
C,
50 C or 55 C, preferably between 45 C and 55 C. The abovementioned
hybridization
temperatures are determined for example for a nucleic acid approximately 100
bp (=
base pairs) in length and a G + C content of 50% in the absence of formamide.
The
skilled worker knows to determine the hybridization conditions required with
the aid of
textbooks, for example the ones mentioned above, or from the following
textbooks:
Sambrook et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989;
Harries
and Higgins (Ed.) 1985, "Nucleic Acids Hybridization: A Practical Approach",
IRL Press
at Oxford University Press, Oxford; Brown (Ed.) 1991, "Essential Molecular
Biology: A
Practical Approach", IRL Press at Oxford University Press, Oxford.
A further example of one such stringent hybridization condition is
hybridization
at 4XSSC at 65 C, followed by a washing in 0.1XSSC at 65 C for one hour.
Alternatively, an exemplary stringent hybridization condition is in 50 %
formamide,
4XSSC at 42 C. Further, the conditions during the wash step can be selected
from the
range of conditions delimited by low-stringency conditions (approximately 2X
SSC at
50 C) and high-stringency conditions (approximately 0.2X SSC at 50 C,
preferably at


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP20051055023
BASF/PF 56031 PCT 26

65 C) (20X SSC: 0.3M sodium citrate, 3M NaCl, pH 7.0). In addition, the
temperature
during the wash step can be raised from low-stringency conditions at room
temperature, approximately 22 C, to higher-stringency conditions at
approximately
65 C. Both of the parameters salt concentration and temperature can be varied
simultaneously, or else one of the two parameters can be kept constant while
only the
other is varied. Denaturants, for example formamide or SDS, may also be
employed
during the hybridization. In the presence of 50% formamide, hybridization is
preferably
effected at 42 C. Relevant factors like i) length of treatment, ii) salt
conditions, iii)
detergent conditions, iv) competitor DNAs, v) temperature and vi) probe
selection can
be combined case by case so that not all possibilities can be mentioned
herein.
Thus, in a preferred embodiment, Northern blots are prehybridized with Rothi-
Hybri-Quick buffer (Roth, Karlsruhe) at 68 C for 2h. Hybridzation with
radioactive
labelled probe is done overnight at 68 C. Subsequent washing steps are
performed at
68 C with 1xSSC.
For Southern blot assays the membrane is prehybridized with Rothi-Hybri-Quick
buffer (Roth, Karisruhe) at 68 C for 2h. The hybridzation with radioactive
labelled probe
is conducted over night at 68 C. Subsequently the hybridization buffer is
discarded and
the filter shortly washed using 2xSSC; 0,1% SDS. After discarding the washing
buffer
new 2xSSC; 0,1 % SDS buffer is added and incubated at 68 C for 15 minutes.
This
washing step is performed twice followed by an additional washing step using
1xSSC;
0,1% SDS at 68 C for 10 min.
Some further examples of conditions for DNA hybridization (Southern blot
assays) and
wash step are shown hereinbelow:
(1) Hybridization conditions can be selected, for example, from the following
conditions:
a) 4X SSC at 65 C,
b) 6X SSC at 45 C,
c) 6X SSC, 100 mg/ml denatured fragmented fish sperm DNA at 68 C,
d) 6X SSC, 0.5% SDS, 100 mg/ml denatured salmon sperm DNA at 68 C,
e) 6X SSC, 0.5% SDS, 100 mg/ml denatured fragmented salmon sperm
DNA, 50% formamide at 42 C,

f) 50% formamide, 4X SSC at 42 C,
g) 50% (vol/vol) formamide, 0.1 % bovine serum albumin, 0.1 % Ficoll, 0.1 %
polyvinylpyrrolidone, 50 mM sodium phosphate buffer pH 6.5, 750 mM
NaCl, 75 mM sodium citrate at 42 C,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 27

h) 2X or 4X SSC at 50 C (low-stringency condition), or

i) 30 to 40% formamide, 2X or 4X SSC at 42 C (low-stringency condition).
(2) Wash steps can be selected, for example, from the following conditions:
a) 0.015 M NaCI/0.0015 M sodium citrate/0.1 % SDS at 50 C.
b) 0.1X SSC at 65 C.
C) 0.1X SSC, 0.5 % SIDS at 68 C.
d) 0.1X SSC, 0.5% SDS, 50% formamide at 42 C.
e) 0.2X SSC, 0.1 % SIDS at 42 C.
f) 2X SSC at 65 C (low-stringency condition).
With regard to the invention described here, "transformed" means all those
plants
or parts thereof which have been brought about and/or modified by manipulation
methods and in which either
a) one or more genes, preferably encoded by one or more nucleic acid
sequence as depicted in sequences of SEQ ID NO: (2n+1) for n=0 to 40
and for n=47 to 433 or a homolog thereof, or

b) a genetic regulatory element or elements, for example promoters, which
are functionally linked e.g. to a nucleic acid sequence of sequences of
SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433 or a homolog
thereof, or
c) (a) and (b)
is/are not present in its/their natural genetic environment and/or has/have
been
modified by means of manipulation methods.
It is possible for the modification to be, by way of example, a substitution,
addition, deletion, inversion or insertion of one or more nucleotides.
Manipulation in the present invention is also meant to encompass all changes
in the
plant cell, including induced or non-induced (spontaneous) mutagenesis,
directed or
non-directed genetic manipulation by conventional breeding or by modem genetic
manipulation methods, e. g. reduction of gene expression by double-stranded
RNA
interference (dsRNAi), introduction of an antisense nucleic acid, a ribozyme,
an
antisense nucleic acid combined with a ribozyme, a nucleic acid encoding a co-
suppressor, a nucleic acid encoding a dominant negative protein, DNA- or RNA-
or
protein-binding factors targeting said gene or -RNA or -proteins, RNA
degradation
inducing viral nucleic acids and expression systems, systems for inducing a
homolog
recombination of said genes, mutations in said genes or a combination of the
above.


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 28

Additional modifications and manipulation methods will become apparent from
the
further description.
"Natural genetic environment" means the natural chromosomal locus in the
organism of origin or the presence in a genomic library. In the case of a
genomic
library, the natural, genetic environment of the nucleic acid sequence is
preferably at
least partially still preserved. The environment flanks the nucleic acid
sequence at least
on one side and has a sequence length of at least 50 bp, preferably at least
500 bp,
particularly preferably at least 1000 bp, very particularly preferably at
least 5000 bp.
A plant or plant cell is considered "true breeding" for a particular attribute
if it is
genetically homozygous for that attribute to the extent that, when the true-
breeding
plant is self-pollinated, a significant amount of independent segregation of
the attribute
among the progeny is not observed.
As also used herein, the terms "nucleic acid" and "nucleic acid molecule" are
intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA
molecules
(e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs.
This term also encompasses untranslated sequence located at both the 3' and 5'
ends
of the coding region of the gene: at least about 1000 nucleotides of sequence
upstream
from the 5' end of the coding region and at least about 200 nucleotides of
sequence
downstream from the 3' end of the coding region of the gene. The nucleic acid
molecule can be single-stranded or double-stranded, but preferably is double-
stranded
DNA.
An "isolated" nucleic acid molecule is one that is substantially separated
from
other nucleic acid molecules, which are present in the natural source of the
nucleic
acid. That means other nucleic acid molecules are present in an amount less
than 5%
based on weight of the amount of the desired nucleic acid, preferably less
than 2% by
weight, more preferably less than 1% by weight, most preferably less than 0.5%
by
weight. Preferably, an "isolated" nucleic acid is free of some of the
sequences that
naturally flank the nucleic acid (i.e., sequences located at the 5' and 3'
ends of the
nucleic acid) in the genomic DNA of the organism from which the nucleic acid
is
derived. For example, in various embodiments, the isolated gene encoding
nucleic acid
molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or
0.1 kb of
nucleotide sequences which naturally flank the nucleic acid molecule in
genomic DNA
of the cell from which the nucleic acid is derived. Moreover, an "isolated"
nucleic acid
molecule, such as a cDNA molecule, can be free from some of the other cellular
material with which it is naturally associated, or culture medium when
produced by


CA 02798495 2012-11-09

29
recombinant techniques, or chemical precursors or other chemicals when
chemically
synthesized.

A nucleic acid molecule of the present invention, e.g., a nucleic acid
molecule
encoding a gene or a portion thereof or a homolog thereof which confers
tolerance
and/or resistance to environmental stress in plants, when inactivated or down-
regulated, can be isolated using standard molecular biology techniques and the
sequence information provided herein. For example, an Arabidopsis thaliana
gene
encoding cDNA can be isolated from an A. thaliana library using all or portion
of one of
sequences of the nucleic acid according to SEQ ID NO: (2n+1) for n=0 to 40 and
for
n=47 to 433. Moreover, a nucleic acid molecule encompassing all or a portion
of one of
the sequences of sequences of SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to
433
can be isolated by the polymerase chain reaction using oligonucleotide primers
designed based upon this sequence. For example, mRNA can be isolated from
plant
cells (e.g., by the guanidinium-thiocyanate extraction procedure of Chirgwin
et al., 1979
Biochemistry 18:5294-5299) and cDNA can be prepared using reverse
transcriptase
(e.g., Moloney MLV reverse transcriptase, available from Gibco/BRL, Bethesda,
MD; or
AMV* reverse transcriptase, available from Seikagaku America, Inc., St-
Petersburg,
FL). Synthetic oligonucleotide primers for polymerase chain reaction
amplification can
be designed based upon one of the nucleotide sequences according to SEQ ID NO:
(2n+1) for n=0 to 40 and for n=47 to 433. A nucleic acid molecule of the
invention can
be amplified using cDNA or, alternatively, genomic DNA, as a template and
appropriate
oligonucleotide primers according to standard PCR amplification techniques.
The
nucleic acid molecule so amplified can be cloned into an appropriate vector
and
characterized by DNA sequence analysis. Furthermore, oligonucleotides
corresponding
to a gene encoding nucleotide sequence can be prepared by standard synthetic
techniques, e.g., using an automated DNA synthesizer.
In a preferred embodiment, an isolated nucleic acid molecule of the invention
comprises one of the nucleotide sequences shown in sequences of SEQ ID NO:
(2n+1)
for n=0 to 40 and for n=47 to 433 or homologs thereof encoding a gene (i.e.,
the

* trademark


CA 02798495 2012-11-09
rJ

29a
"coding region"), as well as 5' untranslated sequences and 3' untranslated
sequences.
Moreover, the nucleic acid molecule of the invention can comprise only a
portion of the coding region of one of sequences of SEQ ID NO: (2n+1) for n=0
to 40
and for n=47 to 433 or homologs thereof, for example, a fragment which can be
used
as a probe or primer or a fragment encoding a biologically active portion of a
gene.
Portions of genes or proteins encoded by said gene encoding nucleic acid
molecules of
the invention are preferably biologically active portions of genes or proteins
described


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 30

herein. As used herein, the term "biologically active portion of' a gene or
protein
encoded by said gene is intended to include a portion, e.g., a domain/motif,
of the gene
or protein that participates in stress tolerance and/or resistance response in
a plant,
which is preferably achieved by altering metabolic activity, and finally
resulting in
increased tolerance and/or resistance to environmental stress. To determine
whether
inactivation or down-regulation of a gene or protein encoded by said gene, or
a
biologically active portion thereof, results in increased stress tolerance in
a plant, which
is preferably achieved by altering metabolic activity, a stress analysis of a
plant
comprising the protein may be performed for example by the above screening
method
or by estimating the general appearance and health. More specifically, nucleic
acid
fragments encoding biologically active portions of a gene or protein encoded
by said
gene can be prepared by isolating a portion of one of sequences of the nucleic
acid
according to SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433 or homologs
thereof expressing the encoded portion of the gene, protein or peptide (e.g.,
by
recombinant expression in vitro) and assessing the activity of the encoded
portion of
the gene, protein or peptide.
Moreover, it is possible to identify conserved regions from various organisms
by
carrying out protein sequence alignments with the polypeptide used in the
process of
the invention, in particular with sequences of the polypeptide of the
invention, from
which conserved regions, and in turn, degenerate primers can be derived.
Conserved
region for the polypeptide of the invention are indicated in the alignments
shown in the
figures. Conserved regions are those, which show a very little variation in
the amino
acid in one particular position of several homologs from different origin.
Typically portions of a protein encompassed by the present invention include
peptides comprising amino acid sequences derived from the amino acid sequence
of
the protein encoded by one of sequences of SEQ ID NO: (2n+2) for n=0 to 40 and
for
n=47 to 433, or the amino acid sequence of a protein homologous to the
protein, which
include fewer amino acids than the full length protein or a full length
protein which is
homologous to the protein, and exhibits at least some activity of the protein.
Prefered
portions according to the present invention (e.g., peptides or proteins which
are, for
example, 5, 10, 15, 20, 30, 35, 36, 37, 38, 39, 40, 50, 100 or more amino
acids in
length) comprise a domain or motif with at least some activity of the protein.
Moreover,
other biologically active portions in which other regions of the protein are
deleted can
be prepared by recombinant techniques and evaluated for one or more of the
activities
described herein. Preferably, the biologically active portions of the protein
include one
or more selected domains/motifs or portions thereof having biological
activity.


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 31

In addition to fragments of the protein described herein, the present
invention
especially includes homologs and analogs of naturally occurring proteins and
protein
encoding nucleic acids in a plant.
"Homologs" are defined herein as two nucleic acids or proteins that have
similar, or "homologous", nucleotide or amino acid sequences, respectively.
Homologs
include allelic variants, orthologs, paralogs, agonists and antagonists of the
protein as
defined hereafter. The term "homolog" further encompasses nucleic acid
molecules
that differ from one of the nucleotide sequences shown in sequences of SEQ ID
NO:
(2n+1) for n=0 to 40 and for n=47 to 433 (and portions thereof) due to
degeneracy of
the genetic code and thus encode the same protein as that encoded by the amino
acid
sequences. As used herein a "naturally occurring" refers to an amino acid
sequence
that occurs in nature.
In addition to fragments and fusion polypeptides of the invention described
herein, the present invention includes homologs and analogs of naturally
occurring
proteins and protein encoding nucleic acids of the invenion in a plant.
"Homologs" are
defined herein as two nucleic acids or polypeptides that have similar, or
substantially
identical, nucleotide or amino acid sequences, respectively. Homologs include
allelic
variants, orthologs, paralogs, agonists and antagonists of SRPs as defined
hereafter.
The term "homolog" further encompasses nucleic acid molecules that differ from
one of
the nucleotide sequences shown in SEQ ID NO: (2n+1) for n=0 to 40 and for n=47
to
433 (and portions thereof) due to degeneracy of the genetic code and thus
encode the
same SRP as that encoded by the nucleotide sequences shown in SEQ ID NO: (2n+
1)
for n=0 to 40 and for n=47 to 433. As used herein a "naturally occurring"
protein refers
to amino acid sequence that occurs in nature. Preferably, a naturally
occurring protein
whose reduction or deletion results in increased tolerance and/or resistance
to an
environmental stress comprises an amino acid sequence selected from the group
consisting of ones shown in SEQ ID NO: (2n+2) for n=0 to 40 and for n=47 to
433.
An agonist of the protein whose reduction or deletion results in increased
tolerance and/or resistance to an environmental stress can retain
substantially the
same, or a subset, of the biological activities of the said protein. An
antagonist of the
said protein can inhibit one or more of the activities of the naturally
occurring form of
the protein whose reduction or deletion results in increased tolerance and/or
resistance
to an environmental stress. For example, an antagonist can competitively bind
to a
downstream or upstream member of the cell membrane component metabolic cascade
that includes said protein, or bind to the protein of the invention that
mediates transport


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 32

of compounds across such membranes, thereby preventing translocation from
taking
place.

Nucleic acid molecules corresponding to natural allelic variants and analogs,
orthologs and paralogs of a protein of the invention cDNA can be isolated
based on
their identity to the Arabidopsis thaliana, Saccharomyces cerevisiae, E.coli,
, preferably
Brassica napus, Glycine max, Zea mays or Oryza sativa protein nucleic acids
described herein using said proteins cDNAs, or a portion thereof, as a
hybridization
probe according to standard hybridization techniques under stringent
hybridization
conditions. In an alternative embodiment, homologs of the protein whose
reduction or
deletion results in increased tolerance and/or resistance to an environmental
stress can
be identified by screening combinatorial libraries of mutants, e.g.,
truncation mutants,
of said protein for their agonist or antagonist activity. In one embodiment, a
variegated
library of protein whose reduction or deletion results in increased tolerance
and/or
resistance to an environmental stress variants is generated by combinatorial
mutagenesis at the nucleic acid level and is encoded by a variegated gene
library. A
variegated library of SRP variants can be produced by, for example,
enzymatically
ligating a mixture of synthetic oligonucleotides into gene sequences such that
a
degenerate set of potential SRP sequences is expressible as individual
polypeptides,
or alternatively, as a set of larger fusion polypeptides (e.g., for phage
display)
containing the set of protein whose reduction or deletion results in increased
tolerance
and/or resistance to an environmental stress sequences therein. There are a
variety of
methods that can be used to produce libraries of potential protein homologs
from a
degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene
sequence can be performed in an automatic DNA synthesizer, and the synthetic
gene
is then ligated into an appropriate expression vector. Use of a degenerate set
of genes
allows for the provision, in one mixture, of all of the sequences encoding the
desired
set of potential protein of the invention sequences. Methods for synthesizing
degenerate oligonucleotides are known in the art. See, e.g., Narang, SA.,
1983,
Tetrahedron 39:3; Itakura et al., 1984, Annu. Rev. Biochem. 53:323; Itakura et
al.,
1984, Science 198:1056; Ike et al., 1983, Nucleic Acid Res. 11:477.
In addition, libraries of fragments of the protein of the invention coding
regions
can be used to generate a variegated population of protein fragments for
screening and
subsequent selection of homologs of a said proteins. In one embodiment, a
library of
coding sequence fragments can be generated by treating a double stranded PCR
fragment of a protein of the invention coding sequence with a nuclease under
conditions wherein nicking occurs only about once per molecule, denaturing the
double


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 33

stranded DNA, renaturing the DNA to form double stranded DNA, which can
include
sense/antisense pairs from different nicked products, removing single stranded
portions from reformed duplexes by treatment with S1 nuclease, and ligating
the
resulting fragment library into an expression vector. By this method, an
expression
library can be derived which encodes N-terminal, C-terminal, and internal
fragments of
various sizes of the protein whose reduction or deletion results in increased
tolerance
and/or resistance to an environmental stress.
Several techniques are known in the art for screening gene products of
combinatorial libraries made by point mutations or truncation, and for
screening cDNA
libraries for gene products having a selected property. Such techniques are
adaptable
for rapid screening of the gene libraries generated by the combinatorial
mutagenesis of
SRP homologs. The most widely used techniques, which are amenable to high
through-put analysis, for screening large gene libraries typically include
cloning the
gene library into replicable expression vectors, transforming appropriate
cells with the
resulting library of vectors, and expressing the combinatorial genes under
conditions in
which detection of a desired activity facilitates isolation of the vector
encoding the gene
whose product was detected. Recursive ensemble mutagenesis (REM), a new
technique that enhances the frequency of functional mutants in the libraries,
can be
used in combination with the screening assays to identify SRP homologs (Arkin
and
Yourvan, 1992, PNAS 89:7811-7815; Delgrave at al., 1993, Polypeptide
Engineering
6(3):327-331). In another embodiment, cell based assays can be exploited to
analyze a
variegated protein (of the invention) library, using methods well known in the
art. The
present invention further provides a method of identifying a novel protein
whose
reduction or deletion results in increased tolerance and/or resistance to an
environmental stress, comprising (a) raising a specific antibody response to
said
protein, or a fragment thereof, as described herein: (b) screening putative
SRP material
with the antibody, wherein specific binding of the antibody to the material
indicates the
presence of a potentially novel protein whose reduction or deletion results in
increased
tolerance and/or resistance to an environmental stress; and (c) analyzing the
bound
material in comparison to known proteins, to determine its novelty.
As stated above, the present invention includes protein whose reduction or
deletion results in increased tolerance and/or resistance to an environmental
stress
and homologs thereof. To determine the percent sequence identity of two amino
acid
sequences (e.g., one of the sequences of SEQ ID NO: (2n+2) for n=0 to 40 and
for
n=47 to 433, and a mutant form thereof), the sequences are aligned for optimal
comparison purposes (e.g., gaps can be introduced in the sequence of one
polypeptide


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCTIEP2005/055023
BASF/PF 56031 PCT 34

for optimal alignment with the other polypeptide or nucleic acid). The amino
acid
residues at corresponding amino acid positions are then compared. When a
position in
one sequence (e.g., one of the sequences of SEQ ID NO: (2n+2) for n=0 to 40
and for
n=47 to 433) is occupied by the same amino acid residue as the corresponding
position in the other sequence (e.g., a mutant form of the sequence selected
from the
polypeptide of SEQ ID NO: (2n+2) for n=0 to 40 and for n=47 to 433), then the
molecules are identical at that position. The same type of comparison can be
made
between two nucleic acid sequences.
The percent sequence identity between the two sequences is a function of the
number of identical positions shared by the sequences (i.e., percent sequence
identity
= numbers of identical positions/total numbers of positions x 100).
Preferably, the
isolated amino acid homologs included in the present invention are at least
about 50-
60%, preferably at least about 60-70%, and more preferably at least about 70-
75%, 75-
80%, 80-85%, 85-90% or 90-95%, and most preferably at least about 96%, 97%,
98%,
99% or more identical to an entire amino acid sequence shown in SEQ ID NO:
(2n+2)
for n=0 to 40 and for n=47 to 433. In yet another embodiment, the isolated
amino acid
homologs included in the present invention are at least about 50-60%,
preferably at
least about 60-70%, and more preferably at least about 70-75%, 75-80%, 80-85%,
85-
90% or 90-95%, and most preferably at least about 96%, 97%, 98%, 99% or more
identical to an entire amino acid sequence encoded by a nucleic acid sequence
according to SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433. In other
embodiments, the amino acid homologs of the proteins of the invention have
sequence
identity over at least 15 contiguous amino acid residues, more preferably at
least 25
contiguous amino acid residues, and most preferably at least 35 contiguous
amino acid
residues of a polypeptide of SEQ ID NO: (2n+2) for n=0 to 40 and for n=47 to
433.
In another preferred embodiment, an isolated nucleic acid homolog of the
invention comprises a nucleotide sequence which is at least about 50-60%,
preferably
at least about 60-70%, more preferably at least about 70-75%, 75-80%, 80-85%,
85-
90% or 90-95%, and even more preferably at least about 95%, 96%, 97%, 98%, 99%
or more identical to a nucleotide sequence according to SEQ ID NO: (2n+1) for
n=0 to
and for n=47 to 433, or to a portion comprising at least 20, 30, 40, 50, 60
consecutive nucleotides thereof. The preferable length of sequence comparison
for
nucleic acids is at least 75 nucleotides, more preferably at least 100
nucleotides and
most preferably the entire length of the coding region.
35 It is further preferred that the isolated nucleic acid homolog of the
invention
encodes a SRP, or portion thereof, that is at least 85% identical to an amino
acid


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCTIEP2005/055023
BASF/PF 56031 PCT 35

sequence of SEQ ID NO: (2n+2) for n=0 to 40 and for n=47 to 433 and that
functions
as a modulator of an environmental stress response in a plant. In a more
preferred
embodiment, overexpression of the nucleic acid homolog in a plant increases
the
tolerance of the plant to an environmental stress.
For the purposes of the invention, the percent sequence identity between two
nucleic acid or polypeptide sequences may be determined using the Vector NTI
6.0
(PC) software package (InforMax, 7600 Wisconsin Ave., Bethesda, MD 20814). A
gap
opening penalty of 15 and a gap extension penalty of 6.66 are used for
determining the
percent identity of two nucleic acids. A gap opening penalty of 10 and a gap
extension
penalty of 0.1 are used for determining the percent identity of two
polypeptides. All
other parameters are set at the default settings. For purposes of a multiple
alignment
(Clustal W algorithm), the gap opening penalty is 10, and the gap extension
penalty is
0.05 with blosum62 matrix. It is to be understood that for the purposes of
determining
sequence identity when comparing a DNA sequence to an RNA sequence, a
thymidine
nucleotide is equivalent to a uracil nucleotide.
In another aspect, the invention provides an isolated nucleic acid comprising
a
polynucleotide that hybridizes to the polynucleotide of SEQ ID NO: (2n+1) for
n=0 to 40
and for n=47 to 433 under stringent conditions. More particularly, an isolated
nucleic
acid molecule of the invention is at least 15 nucleotides in length and
hybridizes under
stringent conditions to the nucleic acid molecule comprising a nucleotide
sequence of
SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433. In other embodiments, the
nucleic acid is at least 30, 50, 100, 250 or more nucleotides in length.
Preferably, an
isolated nucleic acid homolog of the invention comprises a nucleotide sequence
which
hybridizes under highly stringent conditions to the nucleotide sequence shown
in SEQ
ID NO: (2n+1) for n=0 to 40 and for n=47 to 433, and functions as a modulator
of
stress tolerance in a plant. In a further preferred embodiment, overexpression
of the
isolated nucleic acid homolog in a plant increases a plant's tolerance to an
environmental stress.
As used herein with regard to hybridization for DNA to DNA blot, the term
"stringent conditions" refers in one embodiment to hybridization overnight at
60 C in
1 OX Denharts solution, 6X SSC, 0.5% SDS and 100 lag/ml denatured salmon sperm
DNA. Blots are washed sequentially at 62 C for 30 minutes each time in 3X
SSC/0.l %
SDS, followed by 1X SSC/0.l % SDS and finally 0.1 X SSC/0.l % SDS. As also
used
herein, "highly stringent conditions" refers to hybridization overnight at 65
C in 1 OX
Denharts solution, 6X SSC, 0.5% SDS and 100 g/ml denatured salmon sperm DNA.
Blots are washed sequentially at 65 C for 30 minutes each time in 3X SSC/0.1 %
SDS,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 36

followed by 1X SSC/0.1 % SDS and finally 0.1X SSC/0.1 % SDS. Methods for
nucleic
acid hybridizations are described in Meinkoth and Wahl, 1984, Anal. Biochem.
138:267-284; Ausubel et al. eds, 1995, Current Protocols in Molecular Biology,
Chapter
2, Greene Publishing and Wiley-Interscience, New York; and Tijssen, 1993,
Laboratory
Techniques in Biochemistry and Molecular Biology: Hybridization with Nucleic
Acid
Probes, Part I, Chapter 2, Elsevier, New York. Preferably, an isolated nucleic
acid
molecule of the invention that hybridizes under stringent or highly stringent
conditions
to a sequence of SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433
corresponds to
a naturally occurring nucleic acid molecule. As used herein, a "naturally
occurring"
nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide
sequence
that occurs in nature (e.g., encodes a natural polypeptide). In one
embodiment, the
nucleic acid encodes a naturally occurring Arabidopsis thaliana, Brassica
napus,
Glycine max, Zea mays or Oryza sativa protein whose reduction or deletion
results in
increased tolerance and/or resistance to an environmental stress.
Using the above-described methods, and others known to those of skill in the
art, one of ordinary skill in the art can isolate homologs of the protein
whose reduction
or deletion results in increased tolerance and/or resistance to an
environmental stress
comprising amino acid sequences shown in SEQ ID NO: (2n+1) for n=0 to 40 and
for
n=47 to 433. One subset of these homologs are allelic variants. As used
herein, the
term "allelic variant" refers to a nucleotide sequence containing
polymorphisms that
lead to changes in the amino acid sequences of said protein and that exist
within a
natural population (e.g., a plant species or variety). Such natural allelic
variations can
typically result in 1-5% variance in a nucleic acid of the invention. Allelic
variants can
be identified by sequencing the nucleic acid sequence of interest in a number
of
different plants, which can be readily carried out by using hybridization
probes to
identify the same SRP genetic locus in those plants. Any and all such nucleic
acid
variations and resulting amino acid polymorphisms or variations in a protein
whose
reduction or deletion results in increased tolerance and/or resistance to an
environmental stress that are the result of natural allelic variation and that
do not alter
the functional activity of said protein, are intended to be within the scope
of the
invention.
An isolated nucleic acid molecule encoding a protein whose reduction or
deletion results in increased tolerance and/or resistance to an environmental
stress
having sequence identity with a polypeptide sequence according to SEQ ID NO:
(2n+2)
for n=0 to 40 and for n=47 to 433 can be created by introducing one or more
nucleotide substitutions, additions or deletions into a nucleotide sequence of
SEQ ID


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP20051055023
BASF/PF 56031 PCT 37

NO: (2n+1) for n=0 to 40 and for n=47 to 433, respectively, such that one or
more
amino acid substitutions, additions, or deletions are introduced into the
encoded
polypeptide. Mutations can be introduced into one of the sequences of SEQ ID
NO:
(2n+1) for n=0 to 40 and for n=47 to 433 by standard techniques, such as site-
directed
mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid
substitutions are made at one or more predicted non-essential amino acid
residues. A
"conservative amino acid substitution" is one in which the amino acid residue
is
replaced with an amino acid residue having a similar side chain.
To knock the mutation is carried out preferably at essential positions.
Families of amino acid residues having similar side chains have been defined
in
the art. These families include amino acids with basic side chains (e.g.,
lysine, arginine,
histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged
polar side
chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine,
cysteine),
nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline,
phenylalanine,
methionine, tryptophan), beta-branched side chains (e.g., threonine, valine,
isoleucine)
and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan,
histidine). Thus, a
predicted nonessential amino acid residue in a protein of the invention is
preferably
replaced with another amino acid residue from the same side chain family.
Alternatively, in another embodiment, mutations can be introduced randomly
along all
or part of a protein of the invention coding sequence, such as by saturation
mutagenesis, and the resultant mutants can be screened for a SRP activity
described
herein to identify mutants that retain protein activity. Following mutagenesis
of one of
the sequences of SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433, the
encoded
polypeptide can be expressed recombinantly and the activity of the polypeptide
can be
determined by analyzing the stress tolerance of a plant expressing the
polypeptide as
described herein.
In addition to the nucleic acid molecules encoding the protein whose reduction
or deletion results in increased tolerance and/or resistance to an
environmental stress
described above, another aspect of the invention pertains to isolated nucleic
acid
molecules that are antisense thereto. Antisense polynucleotides are thought to
inhibit
gene expression of a target polynucleotide by specifically binding the target
polynucleotide and interfering with transcription, splicing, transport,
translation, and/or
stability of the target polynucleotide. Methods are described in the prior art
for
targeting the antisense polynucleotide to the chromosomal DNA, to a primary
RNA
transcript, or to a processed mRNA. Preferably, the target regions include
splice sites,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 38

translation initiation codons, translation termination codons, and other
sequences
within the open reading frame.
The term "antisense," for the purposes of the invention, refers to a nucleic
acid
comprising a polynudeotide that is sufficiently complementary to all or a
portion of a
gene, primary transcript, or processed mRNA, so as to interfere with
expression of the
endogenous gene. "Complementary" polynucleotides are those that are capable of
base pairing according to the standard Watson-Crick complementarity rules.
specifically, purines will base pair with pyrimidines to form a combination of
guanine
paired with cytosine (G:C) and adenine paired with either thymine (A:T) in the
case of
DNA, or adenine paired with uracil (A:U) in the case of RNA. It is understood
that two
polynucleotides may hybridize to each other even if they are not completely
complementary to each other, provided that each has at least one region that
is
substantially complementary to the other. The term "antisense nucleic acid"
includes
single stranded RNA as well as double-stranded DNA expression cassettes that
can be
transcribed to produce an antisense RNA. "Active" antisense nucleic acids are
antisense RNA molecules that are capable of selectively hybridizing with a
primary
transcript or mRNA encoding a polypeptide having at least 80% sequence
identity with
the polypeptide of SEQ ID NO: (2n+2) for n=0 to 40 and for n=47 to 433.
The antisense nucleic acid can be complementary to an entire SRP coding
strand, or to only a portion thereof. In one embodiment, an antisense nucleic
acid
molecule is antisense to a "coding region" of the coding strand of a
nucleotide
sequence encoding a SRP. The term "coding region" refers to the region of the
nucleotide sequence comprising codons that are translated into amino acid
residues. In
another embodiment, the antisense nucleic acid molecule is antisense to a
"noncoding
region" of the coding strand of a nucleotide sequence encoding a SRP. The term
"noncoding region" refers to 5' and 3' sequences that flank the coding region
that are
not translated into amino acids (i.e., also referred to as 5' and 3'
untranslated regions).
The antisense nucleic acid molecule can be complementary to the entire coding
region
of SRP mRNA, but more preferably is an oligonucleotide which is antisense to
only a
portion of the coding or noncoding region of SRP mRNA. For example, the
antisense
oligonucleotide can be complementary to the region surrounding the translation
start
site of PKSRP mRNA. An antisense oligonucleotide can be, for example, about 5,
10,
15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. Typically, the
antisense
molecules of the present invention comprise an RNA having 60-100% sequence
identity with at least 14 consecutive nucleotides of SEQ ID NO: (2n+1) for n=0
to 40


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 39

and for n=47 to 433. Preferably, the sequence identity will be at least 70%,
more
preferably at least 75%, 80%, 85%, 90%, 95%, 98% and most preferably 99%.

An antisense nucleic acid of the invention can be constructed using chemical
synthesis and enzymatic ligation reactions using procedures known in the art.
For
example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be
chemically synthesized using naturally occurring nucleotides or variously
modified
nucleotides designed to increase the biological stability of the molecules or
to increase
the physical stability of the duplex formed between the antisense and sense
nucleic
acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides
can be
used. Examples of modified nucleotides which can be used to generate the
antisense
nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-
iodouracil,
hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-
carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil,
dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-
methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-
methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-
methylguanine, 5-
methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-
mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-
N6-
isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil,
queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-
methyluracil, uracil-5-
oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-
thiouracil, 3-(3-
amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
Alternatively, the
antisense nucleic acid can be produced biologically using an expression vector
into
which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA
transcribed from the inserted nucleic acid will be of an antisense orientation
to a target
nucleic acid of interest, described further in the following subsection).
In yet another embodiment, the antisense nucleic acid molecule of the
invention
is an a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule
forms
specific double-stranded hybrids with complementary RNA in which, contrary to
the
usual R-units, the strands run parallel to each other (Gaultier et al., 1987,
Nucleic
Acids. Res. 15:6625-6641). The antisense nucleic acid molecule can also
comprise a
2'-o-methylribonucleotide (Inoue et al., 1987, Nucleic Acids Res. 15:6131-
6148) or a
chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Left. 215:327-330).
The antisense nucleic acid molecules of the invention are typically
administered
to a cell or generated in situ such that they hybridize with or bind to
cellular mRNA
and/or genomic DNA encoding a SRP to thereby inhibit expression of the
polypeptide,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 40

e.g., by inhibiting transcription and/or translation. The hybridization can be
by
conventional nucleotide complementarity to form a stable duplex, or, for
example, in
the case of an antisense nucleic acid molecule which binds to DNA duplexes,
through
specific interactions in the major groove of the double helix. The antisense
molecule
can be modified such that it specifically binds to a receptor or an antigen
expressed on
a selected cell surface, e.g., by linking the antisense nucleic acid molecule
to a peptide
or an antibody which binds to a cell surface receptor or antigen. The
antisense nucleic
acid molecule can also be delivered to cells using the vectors described
herein. To
achieve sufficient intracellular concentrations of the antisense molecules,
vector
constructs in which the antisense nucleic acid molecule is placed under the
control of a
strong prokaryotic, viral, or eukaryotic (including plant) promoter are
preferred.
As an alternative to antisense polynucleotides, ribozymes, sense
polynucleotides, or double stranded RNA (dsRNA) can be used to reduce
expression
of a SRP polypeptide. By "ribozyme" is meant a catalytic RNA-based enzyme with
ribonuclease activity which is capable of cleaving a single-stranded nucleic
acid, such
as an mRNA, to which it has a complementary region. Ribozymes (e.g.,
hammerhead
ribozymes described in Haselhoff and Gerlach, 1988, Nature 334:585-591) can be
used to catalytically cleave proteins of the invention mRNA transcripts to
thereby inhibit
translation of SRP mRNA. A ribozyme having specificity for a nucleic acid of
the
invention can be designed based upon the nucleotide sequence of a cDNA, as
disclosed herein (i.e., sequences according to SEQ ID NO: (2n+1) for n=0 to 40
and for
n=47 to 433) or on the basis of a heterologous sequence to be isolated
according to
methods taught in this invention. For example, a derivative of a Tetrahymena L-
19 IVS
RNA can be constructed in which the nucleotide sequence of the active site is
complementary to the nucleotide sequence to be cleaved in a SRP-encoding mRNA.
See, e.g., U.S. Patent Nos. 4,987,071 and 5,116,742 to Cech et al.
Alternatively, SRP
mRNA can be used to select a catalytic RNA having a specific ribonuclease
activity
from a pool of RNA molecules. See, e.g., Bartel, D. and Szostak, J.W., 1993,
Science
261:1411-1418. In preferred embodiments, the ribozyme will contain a portion
having
at least 7, 8, 9, 10, 12, 14, 16, 18 or 20 nucleotides, and more preferably 7
or 8
nucleotides, that have 100% complementarity to a portion of the target RNA.
Methods
for making ribozymes are known to those skilled in the art. See, e.g., U.S.
Patent Nos.
6,025,167; 5,773,260; and 5,496,698.
The term "dsRNA," as used herein, refers to RNA hybrids comprising two
strands of RNA. The dsRNAs can be linear or circular in structure. In a
preferred
embodiment, dsRNA is specific for a polynucleotide encoding either the
polypeptide of


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 41

SEQ ID NO: (2n+2) for n=0 to 40 and for n=47 to 433 or a polypeptide having at
least
70% sequence identity with SEQ ID NO: (2n+2) for n=0 to 40 and for n=47 to
433. The
hybridizing RNAs may be substantially or completely complementary. By
"substantially
complementary," is meant that when the two hybridizing RNAs are optimally
aligned
using the BLAST program as described above, the hybridizing portions are at
least
95% complementary. Preferably, the dsRNA will be at least 100 base pairs in
length.
Typically, the hybridizing RNAs will be of identical length with no over
hanging 5' or 3'
ends and no gaps. However, dsRNAs having 5' or 3' overhangs of up to 100
nucleotides may be used in the methods of the invention.
The dsRNA may comprise ribonucleotides or ribonucleotide analogs, such as
2'-O-methyl ribosyl residues, or combinations thereof. See, e.g., U.S. Patent
Nos.
4,130,641 and 4,024,222. A dsRNA polyriboinosinic acid:polyribocytidylic acid
is
described in U.S. patent 4,283,393. Methods for making and using dsRNA are
known
in the art. One method comprises the simultaneous transcription of two
complementary DNA strands, either in vivo, or in a single in vitro reaction
mixture.
See, e.g., U.S. Patent No. 5,795,715. In one embodiment, dsRNA can be
introduced
into a plant or plant cell directly by standard transformation procedures.
Alternatively,
dsRNA can be expressed in a plant cell by transcribing two complementary RNAs.
Other methods for the inhibition of endogenous gene expression, such as triple
helix
formation (Moser et al., 1987, Science 238:645-650 and Cooney et al., 1988,
Science
241:456-459) and cosuppression (Napoli et al., 1990, The Plant Cell 2:279-289)
are
known in the art. Partial and full-length cDNAs have been used for the
cosuppression
of endogenous plant genes. See, e.g., U.S. Patent Nos. 4,801,340, 5,034,323,
5,231,020, and 5,283,184; Van der Kroll et al., 1990, The Plant Cell 2:291-
299; Smith
et al., 1990, Mol. Gen. Genetics 224:477-481 and Napoli et al., 1990, The
Plant Cell
2:279-289.
For sense suppression, it is believed that introduction of a sense
polynucleotide
blocks transcription of the corresponding target gene. The sense
polynucleotide will
have at least 65% sequence identity with the target plant gene or RNA.
Preferably, the
percent identity is at least 80%, 90%, 95% or more. The introduced sense
polynucleotide need not be full length relative to the target gene or
transcript.
Preferably, the sense polynucleotide will have at least 65% sequence identity
with at
least 100 consecutive nucleotides of SEQ ID NO: (2n+1) for n=0 to 40 and for
n=47 to
433. The regions of identity can comprise introns and and/or exons and
untranslated
regions. The introduced sense polynucleotide may be present in the plant cell


CA 02798495 2012-11-09

42
transiently, or may be stably integrated into a plant chromosome or
extrachromosomal
replicon.

Moreover, nucleic acid molecules encoding proteins from the same or other
species such as protein analogs, orthologs and paralogs, are intended to be
within the
scope of the present invention. As used herein, the term "analogs" refers to
two nucleic
acids that have the same or similar function, but that have evolved separately
in
unrelated organisms. As used herein, the term "orthologs" refers to two
nucleic acids
from different species that have evolved from a common ancestral gene by
speciation.
Normally, orthologs encode proteins having the same or similar functions. As
also used
herein, the term "paralogs" refers to two nucleic acids that are related by
duplication
within a genome. Paralogs usually have different functions, but these
functions may be
related (Tatusov, R.L. et al. 1997 Science 278(5338):631-637). Analogs,
orthologs and
paralogs of naturally occurring proteins can differ from the naturally
occurring proteins
by post-translational modifications, by amino acid sequence differences, or by
both.
Post-translational modifications include in vivo and in vitro chemical
derivatisation of
polypeptides, e.g., acetylation, carboxylation, phosphorylation, or
glycosylation, and
such modifications may occur during polypeptide synthesis or processing or
following
treatment with isolated modifying enzymes. In particular, orthologs of the
invention will
generally exhibit at least 30%, more preferably 50%, and most preferably 90%,
91 %,
92%, 93%, 94%, 95%, 96%, 97%, 98% or even 99% identity or homology with all or
part of a naturally occurring protein amino acid sequence and will exhibit a
function
similar to a protein.

Such homologs, analogs, orthologs and paralogs will be referred to in general
as homologs or being homologous throughout the present application.

Homologs of the sequences given in SEQ ID NO: (2n+2) for n=0 to 40 and for
n=47 to
433 are furthermore to be understood as meaning, for example, homologs,
analogs,
orthologs and paralogs which have at least 30% homology (= identity) at the
derived
amino acid level, preferably at least 50 %, 60 %, 70 % or 80 % homology,
especially
preferably at least 85 % homology, very especially preferably 90 %, 91%, 92%,
93%,
94%, homology, most preferably 95 %, 96 %, 97 %, 98 % or 99 % homology. The
homology (= identity) was calculated over the entire amino acid range. The
program
used was Pileup (J. Mol. Evolution., 25 (1987), 351 - 360, Higgens et al.,
CABIOS, 5


CA 02798495 2012-11-09

42a
1989: 151 - 153) or the program Gap* and BestFit* [Needleman and Wunsch (J.
Mol.
Biol. 48; 443-453 (1970) and Smith and Waterman respectively (Adv. Appl. Math.
2;
482 -489 (1981)] which are part of the GCG* software package [Genetics
Computer
Group, 575 Science Drive, Madison, Wisconsin, USA 53711 (1991)]. The above
* trademarks


CA 02798495 2012-11-09
= CA 02579927 2007-03-09
WO 20061032707 PCTIEP20051055023
BASF/PF 56031 PCT 43

mentioned percentages of sequence homology are calculated with the program
BestFit
or Gap, preferably Gap, over the total sequence length with the following
parameters
used: Gap Weight: 8, Length Weight: 2.
Furthermore the invention provides a method of producing a transformed plant,
wherein inactivation or down-regulation of a gene in the transformed plant
results in
increased tolerance and/or resistance to environmental stress as compared to a
corresponding non-transformed wild type plant, comprising
(a) transforming a plant cell by inactivation or down-regulation of one or
more genes, preferably encoded by one or more nucleic acids selected
from a group consisting of the nucleic acids according to SEQ ID NO:
(2n+1) for n=0 to 40 and for n=47 to 433 and/or homologs thereof and
(b) generating from the plant cell a transformed plant with an increased
tolerance and/or resistance to environmental stress as compared to a
corresponding wild type plant.
The invention also incorporates a method of inducing increased tolerance
and/or resistance to environmental stress as compared to a corresponding non-
transformed wild type plant in said plant cell or said plant by inactivation
or down-
regulation of one or more genes encoded by one or more nucleic acids selected
from a
group consisting of the nucleic acids according to SEQ ID NO: (2n+1) for n=0
to 40 and
for n=47 to 433 and/or homologs thereof.
Preferably the nucleic acid is at least about 30 %, especially at least 50 %
homologous to said sequence (see above). It is also possible that the homolog
sequence stems form a plant selected from the group comprised of maize, wheat,
rye,
oat, triticale, rice, barley, soybean, peanut, cotton, rapeseed, canola,
manihot, pepper,
sunflower, flax, borage, safflower, linseed, primrose, rapeseed, turnip rape,
tagetes,
solanaceous plants, potato, tobacco, eggplant, tomato, Vicia species, pea,
alfalfa,
coffee, cacao, tea, Salix species, oil palm, coconut, perennial grass, forage
crops and
Arabidopsis thallana, preferably Brassica napus, Glycine max, Zea mays or
Oryza
sativa.
Inactivation or down-regulation of said gene or genes may be achieved by all
methods known to one skilled in the art, preferably by double-stranded RNA
interference (dsRNAi), introduction of an antisense nucleic acid, a ribozyme,
an
antisense nucleic acid combined with a ribozyme, a nucleic acid encoding a co-
suppressor, a nucleic acid encoding a dominant negative protein, DNA- or
protein-
binding factors targeting said gene or -RNA or -proteins, RNA degradation
inducing


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 44

viral nucleic acids and expression systems, systems for inducing a homolog
recombination of said genes, mutations in said genes or a combination of the
above.
The nucleic acid sequences of the invention or their homologs are isolated
nucleic acid sequences which encode polypeptides. These nucleic acids or the
polypeptides encoded by them and their biological and enzymatic activity are
inactivated or downregulated in the method according to the invention which
leads to
increased resistance and/or tolerance to environmental stress.
In this context, inactivation means that the enzymatic or biological activity
of the
polypeptides encoded is no longer detectable in the organism or in 'the cell
such as, for
example, within the plant or plant cell. For the purposes of the invention,
downregulation (= reduction) means that the enzymatic or biological activity
of the
polypeptides encoded is partly or essentially completely reduced in comparison
with
the activity of the untreated organism. This can be achieved by different cell-
biological
mechanisms. In this context, the activity can be downregulated in the entire
organism
or, in the case of multi-celled organisms, in individual parts of the
organism, in the case
of plants for example in tissues such as the seed, the leaf, the root or other
parts. In
this context, the enzymatic activity or biological activity is reduced by at
least 10%,
advantageously at least 20%, preferably at least 30%, especially preferably at
least
40%, 50% or 60%, very especially preferably at least 70%, 80%, 90% or 95%, 99%
or
even 100% in comparison with the untreated organism. A particularly
advantageous
embodiment is the inactivation of the nucleic acids or of the polypeptides
encoded by
them.
Various strategies for reducing the quantity (= expression), the activity or
the
function of proteins encoded by the nucleic acids according to the invention
are
encompassed in accordance with the invention. The skilled worker will
recognize that a
series of different methods are available for influencing the quantity of a
protein, the
activity or the function in the desired manner.
A reduction in the activity or the function is preferably achieved by a
reduced
expression of a gene encoding an endogenous protein.
A reduction in the protein quantity, the activity or function can be achieved
using
the following methods:
a) introduction of a double-stranded RNA nucleic acid sequence (dsRNA)
or of an expression cassette, or more than one expression cassette,
ensuring the expression of the latter;
b) introduction of an antisense nucleic acid sequence or of an expression
cassette ensuring the expression of the latter. Encompassed are those


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 45

methods in which the antisense nucleic acid sequence is directed
against a gene (i.e. genomic DNA sequences) or a gene transcript (i.e.
RNA sequences). Also encompassed are a-anomeric nucleic acid
sequences.
c) introduction of an antisense nucleic acid sequence in combination with a
ribozyme or of an expression cassette ensuring the expression of the
former
d) introduction of sense nucleic acid sequences for inducing cosuppression
or of an expression cassette ensuring the expression of the former
e) introduction of a nucleic acid sequence encoding dominant-negative
protein or of an expression cassette ensuring the expression of the latter
f) introduction of DNA-, RNA- or protein-binding factors against genes,
RNA's or proteins or of an expression cassette ensuring the expression
of the latter
g) introduction of viral nucleic acid sequences and expression constructs
which bring about the degradation of RNA, or of an expression cassette
ensuring the expression of the former
h) introduction of constructs for inducing homologous recombination on
endogenous genes, for example for generating knockout mutants.
i) introduction of mutations into endogenous genes for generating a loss of
function (e.g. generation of stop codons, reading-frame shifts and the
like)
Each of these methods may bring about a reduction in the expression, the
activity or the function for the purposes of the invention. A combined use is
also
feasible. Further methods are known to the skilled worker and may encompass
hindering or preventing processing of the protein, transport of the protein or
its mRNA,
inhibition of ribosomal attachment, inhibition of RNA splicing, induction of
an enzyme
which degrades RNA and/or inhibition of translational elongation or
termination.

The term "protein quantity" refers to the amount of a polypeptide in an
organism, a tissue, a cell or cell compartment. The term "reduction" of the
protein
quantity refers to the quantitative reduction of the amount of a protein in an
organism, a
tissue, a cell or a cell compartment - for example by one of the methods
described
herein below - in comparison with the wild type of the same genus and species
to
which this method has not been applied under otherwise identical conditions
(such as,
for example, culture conditions, age of the plants and the like). In this
context, a


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 46

reduction of at least 10%, advantageously of at least 20%, preferably at least
30%,
especially preferably of at least 40%, 50% or 60%, very especially preferably
of at least
70%,80%,90% or 95%, 99% or even 100% in comparison with the untreated
organism is advantageous. An especially advantageous embodiment is the
inactivation
of the nucleic acids, or of the polypeptides encoded by them.
The term "activity" preferably refers to the activity of a polypeptide in an
organism, a tissue, a cell or a cell compartment. The term "reduction" in the
activity
refers to the reduction in the overall activity of a protein in an organism, a
tissue, a cell
or a cell compartment - for example by one of the methods described herein
below - in
comparison with the wild type of the same genus and species, to which this
method
has not been applied, under otherwise identical conditions (such as, for
example,
culture conditions, age of the plants and the like). In this context, a
reduction in activity
of at least 10%, advantageously of at least 20%, preferably at least 30%,
especially
preferably of at least 40%, 50% or 60%, very especially preferably of at least
70%,
80%, 90% or 95%, 99% or even 100% in comparison with the untreated organism is
advantageous. A particularly advantageous embodiment is the inactivation of
the
nucleic acids or of the polypeptides encoded by them.
The term "function" preferably refers to the enzymatic or regulatory function
of a
peptide in an organism, a tissue, a cell or a cell compartment. Suitable
substrates are
low-molecular-weight compounds and also the protein interaction partners of a
protein.
The term "reduction" of the function refers, for example, to the quantitative
reduction in
binding capacity or binding strength of a protein for at least one substrate
in an
organism, a tissue, a cell or a cell compartment - for example by one of the
methods
described herein below - in comparison with the wild type of the same genus
and
species to which this method has not been applied, under otherwise identical
conditions (such as, for example, culture conditions, age of the plants and
the like).
Reduction is also understood as meaning the modification of the substrate
specificity
as can be expressed for example, by the kcat/Km value. In this context, a
reduction of
the function of at least 10%, advantageously of at least 20%, preferably at
least 30%,
especially preferably of at least 40%, 50% or 60%, very especially preferably
of at least
70%, 80%, 90% or 95%, 99% or even 100% in comparison with the untreated
organism is advantageous. A particularly advantageous embodiment is the
inactivation
of the function. Binding partners for the protein can be identified in the
manner with
which the skilled worker is familiar, for example by the yeast 2-hybrid
system.
What follows is a brief description of the individual preferred methods:


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 47

A) Introduction of a double-stranded RNA nucleic acid sequence (dsRNA)
The method of regulating genes by means of double-stranded RNA ("double-
stranded
RNA interference"; dsRNAi) has been described extensively for animal and plant
organisms (for example Matzke MA et al. (2000) Plant Mol. Biol. 43: 401-415;
Fire A. et
al. (1998) Nature 391: 806-811; WO 99/32619; WO 99/53050; WO 00/68374; WO
00/44914; WO 00/44895; WO 00/49035; WO 00/63364). The techniques and methods
described in the above references are expressly referred to. Efficient gene
suppression
can also be observed in the case of transient expression or following
transient
transformation, for example as the consequence of a biolistic transformation
(Schweizer P et al. (2000) Plant J 2000 24: 895-903). dsRNAi methods are based
on
the phenomenon that the simultaneous introduction of complementary strand and
counterstrand of a gene transcript brings about highly effective suppression
of the
expression of the gene in question. The resulting phenotype is very similar to
that of an
analogous knock-out mutant (Waterhouse PM et al. (1998) Proc. Natl. Acad. Sci.
USA
95: 13959-64).

Tuschl et al. [Gens Dev., 1999, 13 (24): 3191 - 3197] was able to show that
the
efficiency of the RNAi method is a function of the length of the duplex, the
length of the
3'-end overhangs, and the sequence in these overhangs. Based on the work of
Tuschl
et al. and assuming that the underlining principles are conserved between
different
species the following guidelines can be given to the skilled worker:
= to achieve good results the 5' and 3' untranslated regions of the used
nucleic
acid sequence and regions close to the start codon should be ingeneral avoided
as this regions are richer in regulatory protein binding sites and
interactions
between RNAi sequences and such regulatory proteins might lead to undesired
interactions;
= in plants the 5' and 3' untranslated regions of the used nucleic acid
sequence
and regions close to the start codon preferably 50 to 100 nt upstream of the
start codon give good results and therefore should not be avoided;
= preferably a region of the used mRNA is selected, which is 50 to 100 nt
(= nucleotides or bases) downstream of the AUG start codon;
= only dsRNA (= double-stranded RNA) sequences from exons are useful for the
method, as sequences from introns have no effect;
= the G/C content in this region should be greater than 30% and less than 70%
ideally around 50%;


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCTIEP2005/055023
BASF/PF 56031 PCT 48

= a possible secondary structure of the target mRNA is less important for the
effect of the RNAi method.

The dsRNAi method has proved to be particularly effective and advantageous for
reducing the expression of the nucleic acid sequences of sequences according
to SEQ
ID NO: (2n+1) for n=0 to 40 and for n=47 to 433 and/or homologs thereof. As
described inter alia in WO 99/32619, dsRNA1 approaches are clearly superior to
traditional antisense approaches.
The invention therefore furthermore relates to double-stranded RNA molecules
(dsRNA
molecules) which, when introduced into an organism, advantageously into a
plant (or a
cell, tissue, organ or seed derived therefrom), bring about the reduction in
the
expression of the nucleic acid sequences of SEQ ID NO: (2n+1) for n=0 to 40
and for
n=47 to 433 and/or homologs thereof. In a double-stranded RNA molecule for
reducing the expression of an protein encoded by a nucleic acid sequence of
one of
sequences of SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433 and/or
homologs
thereof,
i) one of the two RNA strands is essentially identical to at least part of a
nucleic acid sequence, and

ii) the respective other RNA strand is essentially identical to at least part
of
the complementary strand of a nucleic acid sequence.
The term "essentially identical" refers to the fact that the dsRNA sequence
may
also include insertions, deletions and individual point mutations in
comparison to the
target sequence while still bringing about an effective reduction in
expression.
Preferably, the homology as defined above amounts to at least 75%, preferably
at least
80%, very especially preferably at least 90%, most preferably 100%, between
the
"sense" strand of an inhibitory dsRNA and a part-segment of a nucleic acid
sequence
of the invention (or between the "antisense" strand and the complementary
strand of a
nucleic acid sequence, respectively). The part-segment amounts to at least 10
bases,
preferably at least 25 bases, especially preferably at least 50 bases, very
especially
preferably at least 100 bases, most preferably at least 200 bases or at least
300 bases
in length. As an alternative, an "essentially identical" dsRNA may also be
defined as a
nucleic acid sequence which is capable of hybridizing with part of a gene
transcript (for
example in 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA at 50 C or 70 C for 12
to
16 h).
The dsRNA may consist of one or more strands of polymerized ribonucleotides.
Modification of both the sugar-phosphate backbone and of the nucleosides may


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 49

furthermore be present. For example, the phosphodiester bonds of the natural
RNA
can be modified in such a way that they encompass at least one nitrogen or
sulfur
hetero atom. Bases may undergo modification in such a way that the activity
of, for
example, adenosine deaminase is restricted. These and other modifications are
described herein below in the methods for stabilizing antisense RNA.
The dsRNA can be prepared enzymatically; it may also be synthesized
chemically,
either in full or in part.
Short dsRNA up to 30 bp, which effectively mediate RNA interference, can be
for example efficiently generated by partial digestion of long dsRNA templates
using E.
coli ribonuclease III (RNase III). (Yang, D., et al. (2002) Proc. Natl. Acad.
Sci. USA 99,
9942.)
The double-stranded structure can be formed starting from a single, self-
complementary strand or starting from two complementary strands. In a single,
self-
complementary strand, "sense" and "antisense" sequence can be linked by a
linking
sequence ("linker") and form for example a hairpin structure. Preferably, the
linking
sequence may take the form of an intron, which is spliced out following dsRNA
synthesis. The nucleic acid sequence encoding a dsRNA may contain further
elements
such as, for example, transcription termination signals or polyadenylation
signals. If the
two strands of the dsRNA are to be combined in a cell or an organism
advantageously
in a plant, this can be brought about in a variety of ways:
a) transformation of the cell or of the organism, advantageously of a plant,
with a vector encompassing the two expression cassettes,
b) cotransformation of the cell or of the organism, advantageously of a
plant, with two vectors, one of which encompasses the expression
cassettes with the "sense" strand while the other encompasses the
expression cassettes with the "antisense" strand.
c) hybridization of two organisms, advantageously of plants, each of which
has been transformed with one vector, one of which encompasses the
expression cassettes with the "sense" strand while the other
encompasses the expression cassettes with the "antisense" strand.
d) supertransformation of the cell or of the organism, advantageously of a
plant, with a vector encompassing the expression cassettes with the
"sense" strand, after the cell or the organism had already been
transformed with a vector encompassing the expression cassettes with
the "antisense" strand;


CA 02798495 2012-11-09
I

CA 02579927 2007-03-09
WO 2006/032707 PCTIEP2005/055023
BASF/PF 56031 PCT 50

e) introduction of a construct comprising two promoters that lead to
transcription of the desired sequence from both directions; and/or
f) infecting of the cell or of the organism with, advantageously of a plant,
with an engeniered virus, which is able to produce the disered dsRNA
molecule.

Formation of the RNA duplex can be initiated either outside the cell or within
the cell.
If the dsRNA is synthesized outside the target cell or organism it can be
introduced into the organism or a cell of the organism by injection,
microinjection,
electroporation, high velocity particles, by laser beam or mediated by
chemical
compounds (DEAE-dextran, calciumphosphate, liposomes) or in case of animals it
is
also possible to feed bacteria such as E. coli strains engineered to express
double-
stranded RNAi to the animals.
As shown in WO 99/53050, the dsRNA may also encompass a hairpin
structure, by linking the "sense" and "antisense" strands by a "linker" (for
example an
intron). The self-complementary dsRNA structures are preferred since they
merely
require the expression of a construct and always encompass the complementary
strands in an equimolar ratio.
As shown in WO 99/53050, the dsRNA may also encompass a hairpin
structure, by linking the "sense" and "antisense" strands by a "linker" (for
example an
intron). The self-complementary dsRNA structures are preferred since they
merely
require the expression of a construct and always encompass the complementary
strands in an equimolar ratio.
The expression cassettes encoding the "antisense" or the "sense" strand of the
dsRNA or the self-complementary strand of the dsRNA are preferably inserted
into a
vector and stably inserted into the genome of a plant, using the methods
described
herein below (for example using selection markers), in order to ensure
permanent
expression of the dsRNA.
The dsRNA can be introduced using an amount which makes possible at least
one copy per cell. A larger amount (for example at least 5, 10, 100, 500 or 1
000 copies
per cell) may bring about more efficient reduction.
As has already been described, 100 % sequence identity between the dsRNA
and a gene transcript of a nucleic acid sequence of sequences according to SEQ
ID
NO: (2n+1) for n=0 to 40 and for n=47 to 433 or it's homolog is not
necessarily
required in order to bring about effective reduction in the expression. The
advantage is,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASFIPF 56031 PCT 51

accordingly, that the method is tolerant with regard to sequence deviations as
may be
present as a consequence of genetic mutations, polymorphisms or evolutionary
divergences. Thus, for example, using the dsRNA, which has been generated
starting
from a sequence of one of sequences of the nucleic acid according to SEQ ID
NO:
(2n+1) for n=0 to 40 and for n=47 to 433 or homologs thereof of the one
organism, may
be used to suppress the corresponding expression in another organism.
Due to the high degree of sequence homology between the sequences
according to SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433 from various
organisms (e. g. plants), i. e. proteins may be conserved to a high degree
within, for
example other plants, it is optionally possible that the expression of a dsRNA
derived
from one of the disclosed sequences according to SEQ ID NO: (2n+1) for n=0 to
40
and for n=47 to 433 or homologs thereof also has an advantageous effect in
other
plant species.
The dsRNA can be synthesized either in vivo or in vitro. To this end, a DNA
sequence encoding a dsRNA can be introduced into an expression cassette under
the
control of at least one genetic control element (such as, for example,
promoter,
enhancer, silencer, splice donor or splice acceptor or polyadenylation
signal). Suitable
advantageous constructs are described herein below. Polyadenylation is not
required,
nor do elements for initiating translation have to be present.
A dsRNA can be synthesized chemically or enzymatically. Cellular RNA
polymerases or bacteriophage RNA polymerases (such as, for example T3, T7 or
SP6
RNA polymerase) can be used for this purpose. Suitable methods for the in-
vitro
expression of RNA are described (WO 97/32016; US 5,593,874; US 5,698,425,
US 5,712,135, US 5,789,214, US 5,804,693). Prior to introduction into a cell,
tissue or
organism, a dsRNA which has been synthesized in vitro either chemically or
enzymatically can be isolated to a higher or lesser degree from the reaction
mixture, for
example by extraction, precipitation, electrophoresis, chromatography or
combinations
of these methods. The dsRNA can be introduced directly into the cell or else
be applied
extracellularly (for example into the interstitial space).
Stable transformation of the plant with an expression construct which brings
about the
expression of the dsRNA is preferred, however. Suitable methods are described
herein
below.

B) Introduction of an antisense nucleic acid sequence
Methods for suppressing a specific protein by preventing the accumulation of
its
mRNA by means of "antisense" technology can be used widely and has been


CA 02798495 2012-11-09
I

CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 52

described extensively, including for plants (Sheehy et al. (1988) Proc. Natl.
Acad. Sci.
USA 85: 8805-8809; US 4,801,100; Mol JN at al. (1990) FEBS Left 268(2): 427-
430).
The antisense nucleic acid molecule hybridizes with, or binds to, the cellular
mRNA
and/or the genomic DNA encoding the target protein to be suppressed. This
process
suppresses the transcription andlor translation of the target protein.
Hybridization can
be brought about in the conventional manner via the formation of a stable
duplex or, in
the case of genomic DNA, by the antisense nucleic acid molecule binding to the
duplex
of the genomic DNA by specific interaction in the large groove of the DNA
helix.
An antisense nucleic acid sequence which is suitable for reducing the activity
of
a protein can be deduced using the nucleic acid sequence encoding this
protein, for
example the nucleic acid sequence as shown in SEQ ID NO: (2n+1) for n=0 to 40
and
for n=47 to 433 (or homologs, analogs, paralogs, orthologs thereof), by
applying the
base-pair rules of Watson and Crick. The antisense nucleic acid sequence can
be
complementary to all of the transcribed mRNA of the protein; it may be limited
to the
coding region, or it may only consist of one oligonucleotide which is
complementary to
part of the coding or noncoding sequence of the mRNA. Thus, for example, the
oligonucleotide can be complementary to the nucleic acid region which
encompasses
the translation start for the protein. Antisense nucleic acid sequences may
have an
advantageous length of, for example, 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50
nucleotides
but they may also be longer and encompass at least 100, 200, 500, 1000, 2000
or
5000 nucleotides. Prefered is a length of 15-35, more preferd a length of 15,
20, 2, 30
or 35 nucleotides. Antisense nucleic acid sequences can be expressed
recombinantly
or synthesized chemically or enzymatically using methods known to the skilled
worker.
In the case of chemical synthesis, natural or modified nucleotides may be
used.
Modified nucleotides may confer increased biochemical stability to the
antisense
nucleic acid sequence and lead to an increased physical stability of the
duplex formed
by antisense nucleic acid sequence and sense target sequence. Examples of
substances which can be used are phosphorothioate derivatives and acridine-
substituted nucleotides such as 5-fluorouracil, 5-bromouracil, 5-chlorouracil,
5-iodouracil, hypoxanthin, xanthin, 4-acetylcytosine, 5-
(carboxyhydroxymethyl)uracil,
5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil,
dihydrouracil, 3-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-
methyl-
guanine, 1-methylinosine, 2,2-dimethyiguanine, 2-methyladenine, 2-
methylguanine, 3-
methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylamino-
methyluracil, 5-methoxyaminomethyl-2-thiouracil, (i-D-mannosylqueosine, 5'-
methoxy-
carboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine,
uracil-5-
oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil,


CA 02798495 2012-11-09
i

CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 53

2-thiouracil, 4-thiouracil, 5-methyluracil, methyl uracil-5-oxyacetate, uracil-
5-oxyacetic
acid, 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil and 2,6-
diaminopurine.
In a further preferred embodiment, the expression of a protein encoded by one
of sequences of SEQ ID NO: (2n+2) for n=0 to 40 and for n=47 to 433 or
homologs,
analogs, paralogs, orthologs thereof can be inhibited by nucleotide sequences
which
are complementary to the regulatory region of a gene (for example a promoter
and/or
enhancer) and which form triplex structures with the DNA double helix in this
region so
that the transcription of the gene is reduced. Such methods have been
described
(Helene C (1991) Anticancer Drug Res. 6(6): 569-84; Helene C et al. (1992)
Ann. NY
Acad. Sci. 660: 27-36; Maher U (1992) Bioassays 14(12): 807-815).
In a further embodiment, the antisense nucleic acid molecule can be an a-
anomeric nucleic acid. Such a-anomeric nucleic acid molecules form specific
double-
stranded hybrids with complementary RNA in which - as opposed to the
conventional
R-nucleic acids - the two strands run in parallel with one another (Gautier C
at at.
(1987) Nucleic Acids Res. 15: 6625-6641). Furthermore, the antisense nucleic
acid
molecule can also comprise 2'-O-methylribonucleotides (Inoue et al. (1987)
Nucleic
Acids Res. 15: 6131-6148) or chimeric RNA-DNA analogs (Inoue et al. (1987)
FEBS
Left 215: 327-330).
The antisense nucleic acid molecules of the invention are typically
administered
to a cell or generated in situ such that they hybridize with or bind to
cellular mRNA
and/or genomic DNA encoding a polypeptide having the biological activity of
protein of
the invention thereby inhibit expression of the protein, e.g., by inhibiting
transcription
and/or translation and leading to the aforementioned compound X increasing
activity.

The antisense molecule of the present invention comprises also a nucleic acid
molecule comprising a nucleotide sequences complementary to the regulatory
region
of an nucleotide sequence encoding the natural occurring polypeptide of the
invention,
e.g. the polypeptide sequences shown in the sequence listing, or identified
according to
the methods described herein, e.g., its promoter and/or enhancers, e.g. to
form triple
helical structures that prevent transcription of the gene in target cells. See
generally,
Helene, C. (1991) Anticancer Drug Des. 6(6):569-84; Helene, C. et at. (1992)
Ann. N.Y.
Acad. Sci. 660:27-36; and Maher, L.J. (1992) Bioassays 14(12):807-15.

C) Introduction of an antisense nucleic acid sequence combined with a ribozyme
It is advantageous to combine the above-described antisense strategy with a
ribozyme method. Catalytic RNA molecules or ribozymes can be adapted to any
target


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 54

RNA and cleave the phosphodiester backbone at specific positions, thus
functionally
deactivating the target RNA (Tanner NK (1999) FEMS Microbiol. Rev. 23(3): 257-
275).
The ribozyme per se is not modified thereby, but is capable of cleaving
further target
RNA molecules in an analogous manner, thus acquiring the properties of an
enzyme.
The incorporation of ribozyme sequences into "antisense" RNAs imparts this
enzyme-
like RNA-cleaving property to precisely these "antisense" RNAs and thus
increases
their efficiency when inactivating the target RNA. The preparation and the use
of
suitable ribozyme "antisense" RNA molecules is described, for example, by
Haseloff at
al. (1988) Nature 310: 585-591.
In this manner, ribozymes [for example "Hammerhead" ribozymes; Haselhoff
and Gerlach (1988) Nature 310: 585-591] can be used to catalytically cleave
the mRNA
of an enzyme to be suppressed and to prevent translation. The ribozyme
technology
can increase the efficacy of an antisense strategy. Methods for expressing
ribozymes
for reducing specific proteins are described in (EP 0 291 533, EP 0 321 201,
EP 0
360 257). Ribozyme expression has also been described for plant cells
(Steinecke P et
al. (1992) EMBO J 11(4): 1525-1530; de Feyter R at al. (1996) Mol. Gen. Genet.
250(3): 329-338). Suitable target sequences and ribozymes can be identified
for
example as described by Steinecke P, Ribozymes, Methods in Cell Biology 50,
Galbraith at al. eds, Academic Press, Inc. (1995), pp. 449-460 by calculating
the
secondary structures of ribozyme RNA and target RNA and by their interaction
[Bayley
CC et al. (1992) Plant Mol. Biol. 18(2): 353-361; Lloyd AM and Davis RW at al.
(1994)
Mol. Gen. Genet. 242(6): 653-657]. For example, derivatives of the tetrahymena
L-19
IVS RNA which have complementary regions to the mRNA of the protein to be
suppressed can be constructed (see also US 4,987,071 and US 5,116,742). As an
alternative, such ribozymes can also be identified from a library of a variety
of
ribozymes via a selection process (Bartel D and Szostak JW (1993) Science 261:
1411-1418).

D) Introduction of a (sense) nucleic acid sequence for inducing cosuppression
The expression of a nucleic acid sequence in sense orientation can lead to
cosuppression of the corresponding homologous, endogenous genes. The
expression
of sense RNA with homology to an endogenous gene can reduce or indeed
eliminate
the expression of the endogenous gene, in a similar manner as has been
described for
the following antisense approaches: Jorgensen et al. [(1996) Plant Mol. Biol.
31(5):
957-973], Goring at al. [(1991) Proc. Natl. Acad. Sci. USA 88: 1770-1774],
Smith et al.
[(1990) Mol. Gen. Genet. 224: 447-481], Napoli et al. [(1990) Plant Cell 2:
279-289] or


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 55

Van der Krol et at. [(1990) Plant Cell 2: 291-99]. In this context, the
construct
introduced may represent the homologous gene to be reduced either in full or
only in
part. The application of this technique to plants has been described for
example by
Napoli et at. [(1990) The Plant Cell 2: 279-289 and in US 5,010,323].
E) Introduction of nucleic acid sequences encoding a dominant-negative protein
The function or activity of a protein can efficiently also be reduced by
expressing a dominant-negative variant of said protein. The skilled worker is
familiar
with methods for reducing the function or activity of a protein by means of
coexpression
of its dominant-negative form [Lagna G and Hemmati-Brivanlou A (1998) Current
Topics in Developmental Biology 36: 75-98; Perlmutter RM and Alberola-Ila J
(1996)
Current Opinion in Immunology 8(2): 285-90; Sheppard D (1994) American Journal
of
Respiratory Cell & Molecular Biology 11(1): 1-6; Herskowitz 1 (1987) Nature
329
(6136): 219-22].
A dominant-negative variant can be realized for example by changing of an
amino acid in the proteins encoded by one of sequences of SEQ ID NO: (2n+2)
for n=0
to 40 and for n=47 to 433 or homologs thereof. This change can be determined
for
example by computer aided comparison ("alignment"). These mutations for
achieving a
dominant-negative variant are preferably carried out at the level of the
nucleic acid
sequences. A corresponding mutation can be performed for example by PCR-
mediated
in-vitro mutagenesis using suitable oligonucleotide primers by means of which
the
desired mutation is introduced. To this end, methods are used with which the
skilled
worker is familiar. For example, the "LA PCR in vitro Mutagenesis Kit' (Takara
Shuzo,
Kyoto) can be used for this purpose. It is also possible and known to those
skilled in
the art that deleting or changing of functional domains, e. g. TF or other
signaling
components which can bind but not activate may achieve the reduction of
protein
activity.

F) Introduction of DNA- or protein-binding factors against genes, RNAs or
proteins
A reduction in the expression of a gene encoded by one of sequences of SEQ
ID NO: (2n+2) for n=0 to 40 and for n=47 to 433 or homologs thereof according
to the
invention can also be achieved with specific DNA-binding factors, for example
factors
of the zinc finger transcription factor type. These factors attach to the
genomic
sequence of the endogenous target gene, preferably in the regulatory regions,
and
bring about repression of the endogenous gene. The use of such a method makes
possible the reduction in the expression of an endogenous gene without it
being


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 56

necessary to recombinantly manipulate the sequence of the latter. Such methods
for
the preparation of relevant factors are described in Dreier B et al. 1(2001)
J. Biol.
Chem. 276(31): 29466-78 and (2000) J. Mol. Biol. 303(4): 489-502], Beerli RR
at al.
[(1998) Proc. Natl. Acad. Sci. USA 95(25): 14628-14633; (2000) Proc. Natl.
Acad. Sci.
USA 97(4): 1495-1500 and (2000) J. Biol. Chem. 275(42): 32617-32627)], Segal
DJ
and Barbas CF [3rd (2000) Curr. Opin. Chem. Biol. 4(1):10-39], Kang JS and Kim
JS
[(2000) J. Biol. Chem. 275(12): 8742-8748], Kim JS et al. [(1997) Proc. Natl.
Acad. Sci.
USA 94(8): 3616-3620], Klug A [(1999) J. Mol. Biol. 293(2): 215-218], Tsai SY
et al.
[(1998) Adv. Drug Deliv. Rev. 30(1-3): 23-31], Mapp AK et al. [(2000) Proc.
Natl. Acad.
Sci. USA 97(8): 3930-3935], Sharrocks AD et al. [(1997) Int. J. Biochem. Cell
Biol.
29(12): 1371-1387] and Zhang Let al. [(2000) J. Biol. Chem. 275(43): 33850-
33860].
Examples for the application of this technology in plants have been described
in WO
01/52620, Ordiz MI et al., (Proc. Natl. Acad. Sci. USA, Vol. 99, Issue 20,
13290 -
13295, 2002) or Guan et al., (Proc. NatI. Acad. Sci. USA, Vol. 99, Issue 20,
13296 -
13301, 2002)
These factors can be selected using any portion of a gene. This segment is
preferably located in the promoter region. For the purposes of gene
suppression,
however, it may also be located in the region of the coding exons or introns.
The skilled
worker can obtain the relevant segments from Genbank by database search or
starting
from a cDNA whose gene is not present in Genbank by screening a genomic
library for
corresponding genomic clones.
It is also possible to first identify sequences in a target crop which are
encoded
by one of sequences of SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433 or
homologs thereof, then find the promoter and reduce expression by the use of
the
above mentioned factors.
The skilled worker is familiar with the methods required for doing so.
Furthermore, factors which are introduced into a cell may also be those which
themselves inhibit the target protein. The protein-binding factors can, for
example, be
aptamers [Famulok M and Mayer G (1999) Curr. Top Microbiol. Immunol. 243: 123-
36]
or antibodies or antibody fragments or single-chain antibodies. Obtaining
these factors
has been described, and the skilled worker is familiar therewith. For example,
a
cytoplasmic scFv antibody has been employed for modulating activity of the
phytochrome A protein in genetically modified tobacco plants [Owen M et al.
(1992)
Biotechnology (NY) 10(7): 790-794; Franken E et al. (1997) Curr. Opin.
Biotechnol.
8(4): 411-416; Whitelam (1996) Trend Plant Sci. 1: 286-272].


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 20061032707 PCT/EP20051055023
BASF/PF 56031 PCT 57

Gene expression may also be suppressed by tailor-made low-molecular-weight
synthetic compounds, for example of the polyamide type [Dervan PB and Burli RW
(1999) Current Opinion in Chemical Biology 3: 688-693; Gottesfeld JM et al.
(2000)
Gene Expr. 9(1-2): 77-91]. These oligomers consist of the units 3-
(dimethylamino)propylamine, N-methyl-3-hydroxypyrrole, N-methylimidazole and
N-methylpyrroles; they can be adapted to each portion of double-stranded DNA
in such
a way that they bind sequence-specifically to the large groove and block the
expression
of the gene sequences located in this position. Suitable methods have been
described
in Bremer RE et al. [(2001) Bioorg. Med. Chem. 9(8): 2093-103], Ansari AZ et
al.
[(2001) Chem. Biol. 8(6): 583-92], Gottesfeld JM et al. [(2001) J. Mol. Biol.
309(3): 615-
29], Wurtz NR et al. [(2001) Org. Left 3(8): 1201-3], Wang CC et al. [(2001)
Bioorg.
Med. Chem. 9(3): 653-7], Urbach AR and Dervan PB [(2001) Proc. Natl. Acad.
Sci.
USA 98(8): 4103-8] and Chiang SY et al. [(2000) J. Biol. Chem. 275(32): 24246-
54].

G) Introduction of viral nucleic acid sequences and expression constructs
which
bring about the degradation of RNA
Inactivation or downregulation can also be efficiently brought about by
inducing
specific RNA degradation by the organism, advantageously in the plant, with
the aid of
a viral expression system (Amplikon) [Angell, SM et al. (1999) Plant J. 20(3):
357-362].
Nucleic acid sequences with homology to the transcripts to be suppressed are
introduced into the plant by these systems - also referred to as' VIGS" (viral
induced
gene silencing) with the aid of viral vectors. Then, transcription is switched
off,
presumably mediated by plant defense mechanisms against viruses. Suitable
techniques and methods are described in Ratcliff F at al. [(2001) Plant J.
25(2): 237-
45], Fagard M and Vaucheret H [(2000) Plant Mol. Biol. 43(2-3): 285-93],
Anandalakshmi R et al. [(1998) Proc. Natl. Acad. Sci. USA 95(22): 13079-84]
and
Ruiz MT [(1998) Plant Cell 10(6): 937-46].

H) Introduction of constructs for inducing a homologous recombination on
endogenous genes, for example for generating knock-out
mutants
To generate a homologously-recombinant organism with reduced activity, a
nucleic acid construct is used which, for example, comprises at least part of
an
endogenous gene which is modified by a deletion, addition or substitution of
at least
one nucleotide in such a way that the functionality is reduced or completely
eliminated.
The modification may also affect the regulatory elements (for example the
promoter) of


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 58

the gene so that the coding sequence remains unmodified, but expression
(transcription and/or translation) does not take place and is reduced.
In the case of conventional homologous recombination, the modified region is
flanked at its 5' and 3' end by further nucleic acid sequences which must be
sufficiently
long for allowing recombination. Their length is, as a rule, in a range of
from one
hundred bases up to several kilobases [Thomas KR and Capecchi MR (1987) Cell
51:
503; Strepp et al. (1998) Proc. Natl. Acad. Sci. USA 95(8): 4368-4373]. In the
case of
homologous recombination, the host organism - for example a plant - is
transformed
with the recombination construct using the methods described herein below, and
clones which have successfully undergone recombination are selected using for
example a resistance to antibiotics or herbicides. Using the cotransformation
technique, the resistance to antibiotics or herbicides can subsequently
advantageously
be re-eliminated by performing crosses. An example for an efficient homologous
recombination system in plants has been published in Nat. Biotechnol. 2002
Oct;
20(10):1030-4, Terada R et al.: Efficient gene targeting by homologous
recombination
in rice.
Homologous recombination is a relatively rare event in higher eukaryotes,
especially in plants. Random integrations into the host genome predominate.
One
possibility of removing the randomly integrated sequences and thus increasing
the
number of cell clones with a correct homologous recombination is the use of a
sequence-specific recombination system as described in US 6,110,736, by means
of
which unspecifically integrated sequences can be deleted again, which
simplifies the
selection of events which have integrated successfully via homologous
recombination.
A multiplicity of sequence-specific recombination systems may be used,
examples
which may be mentioned being Cre/lox system of bacteriophage P1, the FLP/FRT
system from yeast, the Gin recombinase of phage Mu, the Pin recombinase from
E.
coli and the R/RS system of the pSR1 plasmid. The bacteriophage P1 CreAox
system
and the yeast FLP/FRT system are preferred. The FLPIFRT and the cre/lox
recombinase system have already been applied to plant systems [Odell et al.
(1990)
Mol. Gen. Genet. 223: 369-378].

I) Introduction of mutations into endogenous genes for bringing about a loss
of
function (for example generation of stop codons, reading-frame
shifts and the like)
Further suitable methods for reducing activity are the introduction of
nonsense
mutations into endogenous genes, for example by introducing RNA/DNA


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 59

oligonucleotides into the plant [Zhu et al. (2000) Nat. Biotechnol. 18(5): 555-
558], and
the generation of knock-out mutants with the aid of, for example, T-DNA
mutagenesis
[Koncz et al. (1992) Plant Mol. Biol. 20(5): 963-976], ENU-(N-ethyl-N-
nitrosourea) -
mutagenesis or homologous recombination [ENU - (N-ethyl-N-nitrosourea) -
mutagenesis or homologous recombination [Hohn B and Puchta (1999) H. Proc.
Natl.
Acad. Sci. USA 96:8321-8323]. Point mutations may also be generated by means
of
DNA-RNA hybrids also known as "chimeraplasty" [Cole-Strauss et al. (1999)
Nucl.
Acids Res. 27(5): 1323-1330; Kmiec (1999) Gene Therapy American Scientist
87(3):
240-247]. The mutation sites may be specifically targeted or randomly
selected.
Nucleic acid sequences as described in item B) to I) are expressed in the cell
or
organism by transformation/transfection of the cell or organism or are
introduced in the
cell or organism by known methods, for example as disclosed in item A).
Other suitable method for reducing activity is the introduction of a nucleic
acid in
the plant cell, which interacts with a gene encoded by one or more nucleic
acid
sequences selected from the group consisting of sequences of SEQ ID NO: (2n+1)
for
n=0 to 40 and for n=47 to 433 and/or homologs thereof. The interaction of the
introduced nucleic acid, which can be active itself, with said gene leads by
deletion,
inversion or insertion finally to inactivation, i. e. by frameshift, or
destruction of said
gene.
In particular, the invention provides a method of producing a transformed
plant
with a gene encoding nucleic acid, wherein inactivation or down-regulation of
said
gene(s) in the plant results in increased tolerance to environmental stress as
compared
to a wild type plant, comprising the inactivation or down-regulation by
mutation of a
nucleic acid sequence of SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433
or
homologs thereof.
For such plant transformation, binary vectors such as pBinAR can be used
(Hofgen and Willmitzer, 1990 Plant Science 66:221-230). Moreover suitable
binary
vectors are such as pBIN19, pB1101, pGPTV or pPZP (Hajukiewicz, P. et al.,
1994,
Plant Mol. Biol., 25: 989-994). An overview of binary vectors and their
specific features
is given in Hellens et al., 2000, Trends in plant science, 5: 446 - 451.
Construction of the binary vectors can be performed by ligation of the cDNA in
sense or antisense orientation into the T-DNA. 5-prime to the cDNA a plant
promoter
activates transcription of the cDNA. A polyadenylation sequence is located 3-
prime to
the cDNA. Tissue-specific expression can be achieved by using a tissue
specific
promoter as listed below. Also, any other promoter element can be used. For
constitutive expression within the whole plant, the CaMV 35S promoter can be
used.


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 60

The expressed protein can be targeted to a cellular compartment using a signal
peptide, for example for plastids, mitochondria or endoplasmic reticulum
(Kermode,
1996 Crit. Rev. Plant Sci. 4(15):285-423). The signal peptide is cloned 5-
prime in frame
to the cDNA to archive subcellular localization of the fusion protein.
Additionally,
promoters that are responsive to abiotic stresses can be used with, such as
the
Arabidopsis promoter RD29A. One skilled in the art will recognize that the
promoter
used should be operatively linked to the nucleic acid such that the promoter
causes
transcription of the nucleic acid which results in the synthesis of a mRNA
which
encodes a polypeptide. Alternatively, the RNA can be an antisense RNA for use
in
affecting subsequent expression of the same or another gene or genes.
Alternate methods of transfection include the direct transfer of DNA into
developing flowers via electroporation or Agrobacterium mediated gene
transfer.
Agrobacterium mediated plant transformation can be performed using for example
the
GV3101 (pMP90) (Koncz and Schell, 1986 Mol. Gen. Genet. 204:383-396) or
LBA4404
(Ooms at al., Plasmid, 1982, 7: 15-29; Hoekema at al., Nature, 1983, 303: 179-
180)
Agrobacterium tumefaciens strain. Transformation can be performed by standard
transformation and regeneration techniques (Deblaere at al., 1994 Nud. Acids.
Res.
13:4777-4788; Galvin and Schilperoort, Plant Molecular Biology Manual, 2nd Ed.
-
Dordrecht: Kluwer Academic Publ., 1995. - in Sect., Ringbuch Zentrale
Signatur: BT11-
P ISBN 0-7923-2731-4; Glick, B R and Thompson, J E, Methods in Plant Molecular
Biology and Biotechnology, Boca Raton : CRC Press, 1993. - 360 S., ISBN 0-8493-

5164-2). For example, rapeseed can be transformed via cotyledon or hypocotyl
transformation (Moloney et al., 1989 Plant Cell Reports 8:238-242; De Block et
al.,
1989 Plant Physiol. 91:694-701). Use of antibiotics forAgrobacterium and plant
selection depends on the binary vector and the Agrobacterium strain used for
transformation. Rapeseed selection is normally performed using kanamycin as
selectable plant marker. Agrobacterium mediated gene transfer to flax can be
performed using, for example, a technique described by Mlynarova et al., 1994
Plant
Cell Report 13:282-285. Additionally, transformation of soybean can be
performed
using for example a technique described in European Patent No. 0424 047, U.S.
Patent No. 5,322,783, European Patent No. 0397 687, U.S. Patent No. 5,376,543
or
U.S. Patent No. 5,169,770. Transformation of maize can be achieved by particle
bombardment, polyethylene glycol mediated DNA uptake or via the silicon
carbide fiber
technique. (See, for example, Freeling and Walbot "The maize handbook"
Springer
Verlag: New York (1993) ISBN 3-540-97826-7). A specific example of maize
transformation is found in U.S. Patent No. 5,990,387 and a specific example of
wheat
transformation can be found in PCT Application No. WO 93/07256.


CA 02798495 2012-11-09
r

CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 61

In particular, a useful method to ascertain the level of transcription or
activity of
the gene (an indicator of the amount of mRNA available for translation to the
gene
product) is to perform a Northern blot (for reference see, for example,
Ausubel et al.,
1988 Current Protocols in Molecular Biology, Wiley: New York). This
information at
least partially demonstrates the degree of transcription of the transformed
gene. Total
cellular RNA can be prepared from cells, tissues or organs by several methods,
all
well-known in the art, such as that described in Bormann, E.R. et al., 1992
Mol.
Microbiol. 6:317-326. To assess the presence or relative quantity of protein
translated
from this mRNA, standard techniques, such as a Western blot, may be employed.
These techniques are well known to one of ordinary skill in the art. (See for
example
Ausubel et al., 1988 Current Protocols in Molecular Biology, Wiley: New York).
The use
of Real Time PCR is also possible.
The invention may further be combined with an isolated recombinant expression
vector comprising a stress related protein encoding nucleic acid, wherein
expression of
the vector or stress related protein encoding nucleic acid, respectively in a
host cell
results in increased tolerance and/or resistance to environmental stress as
compared
to the wild type of the host cell. As used herein, the term "vector" refers to
a nucleic
acid molecule capable of transporting another nucleic acid to which it has
been linked.
One type of vector is a "plasmid", which refers to a circular double stranded
DNA loop
into which additional DNA segments can be ligated. Another type of vector is a
viral
vector, wherein additional DNA segments can be ligated into the viral genome.
Certain
vectors are capable of autonomous replication in a host cell into which they
are
introduced (e.g., bacterial vectors having a bacterial origin of replication
and episomal
mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are
integrated into the genome of a host cell upon introduction into the host
cell, and
thereby are replicated along with the host genome. Moreover, certain vectors
are
capable of directing the expression of genes to which they are operatively
linked. Such
vectors are referred to herein as "expression vectors". In general, expression
vectors of
utility in recombinant DNA techniques are often in the form of plasmids. In
the present
specification, "plasmid" and "vector" can be used interchangeably as the
plasmid is the
most commonly used form of vector. However, the invention is intended to
include such
other forms of expression vectors, such as viral vectors (e.g., replication
defective
retroviruses), which serve equivalent functions.
A plant expression cassette comprising a nucleic acid construct, which when
expressed allows inactivation or down-regulation of a gene encoded by a
nucleic acid
selected from the group consisting of sequences according to SEQ ID NO: (2n+1)
for


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 62

n=0 to 40 and for n=47 to 433 and/or homologs thereof and/or parts thereof by
a
method mentioned above leading to increased stress tolerance and/or resistance
is
also included in the scope of the present invention.
The plant expression cassette preferably contains regulatory sequences
capable of driving gene expression in plant cells and operably linked so that
each
sequence can fulfill its function, for example, termination of transcription
by
polyadenylation signals. Preferred polyadenylation signals are those
originating from
Agrobacterium tumefaciens T-DNA such as the gene 3 known as octopine synthase
of
the Ti-plasmid pTiACH5 (Gielen et al., 1984 EMBO J. 3:835) or functional
equivalents
thereof but also all other terminators functionally active in plants are
suitable.
Plant gene expression must be operably linked to an appropriate promoter
conferring gene expression in a time, cell or tissue specific manner.
Preferred
promoters are such that drive constitutive expression (Benfey et al., 1989
EMBO J.
8:2195-2202) like those derived from plant viruses like the 35S CaMV (Franck
et at.,
1980 Cell 21:285-294), the 19S CaMV (see also U.S. Patent No. 5352605 and PCT
Application No. WO 8402913) or plant promoters like those from Rubisco small
subunit
described in U.S. Patent No. 4,962,028.
Additional advantageous regulatory sequences are, for example, included in the
plant promoters such as CaMV/35S [Franck et at., Cell 21 (1980) 285 - 294],
PRP1
[Ward et al., Plant. Mol. Biol. 22 (1993)], SSU, OCS, IN, usp, STLS1, B33,
LEB4, nos
or in the ubiquitin, napin or phaseolin promoter. Additional useful plant
promoters are
the cytosolic FBPase promoter or ST-LSI promoter of the potato (Stockhaus et
al.,
EMBO J. 8, 1989, 2445), the phosphorybosyl phyrophoshate amido transferase
promoter of Glycine max (gene bank accession No. U87999) or the noden specific
promoter described in EP-A-O 249 676. Additional particularly advantageous
promoters
are seed specific promoters which can be used for monocotyledons or
dicotyledons.
Described in US 5,608,152 (napin promoter from rapeseed), WO 98/45461
(phaseolin
promoter from Arobidopsis), US 5,504,200 (phaseolin promoter from Phaseolus
vulgaris), WO 91/13980 (Bce4 promoter from Brassica) and Baeumlein et al.,
Plant J.,
2, 2, 1992: 233-239 (LEB4 promoter from leguminosa) are promoters useful in
dicotyledons. The following promoters are useful for example in monocotyledons
lpt-2-
or lpt-1- promoter from barley (WO 95/15389 and WO 95/23230) or hordein
promoter
from barley. Other useful promoters described in WO 99/16890.
It is possible in principle to inactivate or down-regulate all natural
promoters with
their regulatory sequences like those mentioned above in order to e. g. reduce
the level
of production of a targeted protein.


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 63

The construct may also comprise further genes which are to be inserted into
the
organisms and which are for example involved in stress resistance, i.e. next
to
inactivating certain genes or incorporating inactivated genes at their place,
it is possible
to introduce favorable genes that are related to production of proteins which
actively
increase stress tolerance or resistance. It is therefore feasible and
advantageous to
insert and express in host organisms regulatory genes such as genes for
inducers,
repressors or enzymes which intervene by their enzymatic activity in the
regulation of
one or more or all genes of a biosynthetic pathway. These genes can be
heterologous
or homologous in origin. The inserted genes may have their own promoter or
else be
under the control of same promoter as sequences of SEQ ID NO: (2n+1) for n=0
to 40
and for n=47 to 433 or their homologs.
The gene construct advantageously comprises, for expression of the other
genes present, additionally 3' and/or 5' terminal regulatory sequences to
enhance
expression, which are selected for optimal expression depending on the
selected host
organism and gene or genes.
These regulatory sequences are intended to make specific expression of the
genes and protein expression possible as mentioned above. This may mean,
depending on the host organism, for example that the gene is expressed or
overexpressed only after induction, or that it is immediately expressed and/or
overexpressed.
The regulatory sequences or factors may moreover preferably have a beneficial
effect on expression of the introduced genes, and thus increase it. It is
possible in this
way for the regulatory elements to be enhanced advantageously at the
transcription
level by using strong transcription signals such as promoters and/or
enhancers.
However, in addition, it is also possible to enhance translation by, for
example,
improving the stability of the mRNA.
Other preferred sequences for use in plant gene expression cassettes are
targeting-sequences necessary to direct the gene product in its appropriate
cell
compartment (for review see Kermode, 1996 Crit. Rev. Plant Sci. 15(4):285-423
and
references cited therein) such as the vacuole, the nucleus, all types of
plastids like
amyloplasts, chloroplasts, chromoplasts, the extracellular space,
mitochondria, the
endoplasmic reticulum, oil bodies, peroxisomes and other compartments of plant
cells.
Tab. 1: Examples of Tissue-specific and Stress inducible promoters in plants
Expression Reference


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 64

Cor78- Cold, drought, salt, Ishitani, et al., Plant Cell 9:1935-1949 (1997).
ABA, wounding-inducible Yamaguchi-Shinozaki and Shinozaki, Plant Cell 6:251-
264 (1994).

Rci2A - Cold, dehydration- Capel et al., Plant Physiol 115:569-576 (1997)
inducible

Rd22 - Drought, salt Yamaguchi-Shinozaki and Shinozaki, Mol Gen Genet
238:17-25 (1993).

Cor15A - Cold, Baker et al., Plant Mol. Biol. 24:701-713 (1994).
dehydration, ABA

GH3- Auxin inducible Liu et al., Plant Cell 6:645-657 (1994)
ARSK1-Root, salt inducible Hwang and Goodman, Plant J 8:37-43 (1995).
PtxA - Root, salt inducible GenBank accession X67427

SbHRGP3 - Root specific Ahn et al., Plant Cell 8:1477-1490 (1998).
KSTI - Guard cell specific Plesch et al., Plant Journal 28(4):455-64(2001).
KAT1 - Guard cell specific Plesch et al., Gene 249:83-89 (2000)
Nakamura et al., Plant Physiol. 109:371-374 (1995)
salicylic acid inducible PCT Application No. WO 95/19443

tetracycline inducible Gatz at al. Plant J. 2:397-404 (1992)
Ethanol inducible PCT Application No. WO 93/21310

pathogen inducible PRP1 Ward et al., 1993 Plant. Mol. Biol. 22:361-366
heat inducible hsp80 U.S. Patent No. 5187267

cold inducible alpha- PCT Application No. WO 96/12814
amylase

Wound-inducible pinli European Patent No. 375091

RD29A - salt-inducible Yamaguchi-Shinozalei et al. (1993) Mol. Gen. Genet.
236:331-100

plastid-specific viral RNA- PCT Application No. WO 95/16783 and. WO 97/06250
polymerase


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 65

Selection marker systems, like the AHAS marker or other promotors, e.g.
superpromotor (Ni et al,., Plant Journal 7, 1995: 661-676), Ubiquitin promotor
(Callis et
al., J. Biol. Chem., 1990, 265: 12486-12493; US 5,510,474; US 6,020,190;
Kawalleck
et al., Plant. Molecular Biology, 1993, 21: 673-684) or 10S promotor (GenBank
Accession numbers M59930 and X16673) may be similar useful for the combination
with the present invention and are known to a person skilled in the art.
In particular, the present invention describes the use of comparing particular
attributes or traits, estimating the general appearance or comparing the
altered
metabolic activity by inactivation or down-regulation of genes to engineer
stress-
tolerant and/or resistant, i.e. drought-, salt- and/or cold-tolerant and/or
resistant plants.
This strategy has herein been demonstrated for Arabidopsis thaliana, but its
application
is not restricted to these plants. Accordingly, the invention provides a
transformed plant
containing one or more (stress related protein encoding) genes selected from
sequences of SEQ ID NO: (2n+1) for n=0 to 40 and for n=47 to 433 or homologs
thereof, that are inactivated or down-regulated and stress tolerance and/or
resistance,
wherein the (environmental) stress is drought, increased salt or decreased or
increased
temperature but its application is not restricted to these adverse
environments.
Protection against other adverse conditions such as heat, air pollution, heavy
metals
and chemical toxicants, for example, may be obtained. In particullary
preferred
embodiments, the environmental stress is drought.
Growing the modified plants under stress conditions and then screening and
analyzing the growth characteristics and/or metabolic activity assess the
effect of the
genetic modification in plants on stress tolerance and/or resistance. Such
analysis
techniques are well known to one skilled in the art. They include next to
screening
(Rompp Lexikon Biotechnologie, Stuttgart/New York: Georg Thieme Verlag 1992,
"screening" p. 701) dry weight, wet weight, protein synthesis, carbohydrate
synthesis,
lipid synthesis, evapotranspiration rates, general plant and/or crop yield,
flowering,
reproduction, seed setting, root growth, respiration rates, photosynthesis
rates, etc.
(Applications of HPLC in Biochemistry in: Laboratory Techniques in
Biochemistry and
Molecular Biology, vol. 17; Rehm et at., 1993 Biotechnology, vol. 3, Chapter
III: Product
recovery and purification, page 469-714, VCH: Weinheim; Better, P.A. et at.,
1988
Bioseparations: downstream processing for biotechnology, John Wiley and Sons;
Kennedy, J.F. and Cabral, J.M.S., 1992 Recovery processes for biological
materials,
John Wiley and Sons; Shaeiwitz, J.A. and Henry, J.D., 1988 Biochemical
separations,
in: Ulmann's Encyclopedia of Industrial Chemistry, vol. B3, Chapter 11, page 1-
27,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 66

VCH: Weinheim; and Dechow, F.J. (1989) Separation and purification techniques
in
biotechnology, Noyes Publications).
The methods of the invention may be used to detect environmental stress in
plant cells or plants by screening the plant cells for particular attributes
or traits,
estimating the general appearance, analyzing the growth characteristics or
screening
for altered metabolic activity as compared to non-stress conditions, which
allows for
selection of resistant or tolerant plants or plant cells and also provides
detection of
stress in plants or plant cells before symptoms are visable and damage is
high.
The methods of the invention also allow breeding of plant cells or plants
towards increased tolerance and/or resistance to environmental stress by
screening
the plant cells under stress conditions for particular attributes or traits,
estimating the
general appearance, analyzing the growth characteristics or screening for
altered
metabolic activity as compared to non-stress conditions and selecting those
with
increased tolerance and/or resistance to environmental stress for further
replication.
The engineering of one or more stress related genes of the invention may also
result in stress related proteins having altered activities which indirectly
impact the
stress response and/or stress tolerance of plants. For example, the normal
biochemical
processes of metabolism result in the production of a variety of products
(e.g.,
hydrogen peroxide and other reactive oxygen species) which may actively
interfere
with these same metabolic processes (for example, peroxynitrite is known to
react with
tyrosine side chains, thereby inactivating some enzymes having tyrosine in the
active
site (Groves, IT., 1999 Curr. Opin. Chem. Biol. 3(2):226-235). By optimizing
the
inactivation or down-regulation of one or more stress related genes of the
invention, it
may be possible to improve the metabolic activity leading to higher stress
tolerance
and/or resistance of the cell.
Additionally, the sequences disclosed herein, or fragments thereof, can be
targeted to generate knockout mutations in the genomes of various other plant
cells
(Girke, T., 1998 The Plant Journal 15:39-48). The resultant knockout cells can
then be
evaluated for their ability or capacity to tolerate various stress conditions,
their
response to various stress conditions, and the effect on the phenotype and/or
genotype
of the mutation. For other methods of gene inactivation see U.S. Patent No.
6004804
"Non-Chimeric Mutational Vectors" and Puttaraju et al., 1999 Spliceosome-
mediated
RNA trans-splicing as a tool for gene therapy Nature Biotechnology 17:246-252.
Throughout this application, various publications are referenced. The
disclosures of all
of these publications and those references cited within those publications in
their


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 67

entireties are hereby incorporated by reference into this application in order
to more
fully describe the state of the art to which this invention pertains.

This invention is not limited to specific nucleic acids, specific
polypeptides,
specific cell types, specific host cells, specific conditions, or specific
methods, etc., as
such may, of course, vary, and the numerous modifications and variations
therein will
be apparent to those skilled in the art. It is also to be understood that the
terminology
used herein is for the purpose of describing specific embodiments only and is
not
intended to be limiting.
It should also be understood that the foregoing relates to preferred
embodiments of the present invention and that numerous changes may be made
therein without departing from the scope of the invention. The invention is
further
illustrated by the following examples, which are not to be construed in any
way as
imposing limitations upon the scope thereof. On the contrary, it is to be
dearly
understood that resort may be had to various other embodiments, modifications,
and
equivalents thereof, which, after reading the description herein, may suggest
themselves to those skilled in the art without departing from the spirit of
the present
invention and/or the scope of the appended claims.

Example

Engineering stress-tolerant Arabidopsis plants by inactivation or down-
regulation stress related genes.
Transformation of Arabidopsis thaliana
Vector preparation
A binary vector was constructed based on the modified pPZP binary vector
backbone
(comprising the kanamydn-gene for bacterial selection; Hajdukiewicz, P. et
at., 1994,
Plant Mol. Biol., 25: 989-994) and the selection marker bar-gene (De Block et
al., 1987,
EMBO J. 6, 2513-2518) driven by the mas2'1' and mas271f promoters (Velten et
at.,
1984, EMBO J. 3, 2723-2730; Mengiste, Amedeo and Paszkowski, 1997, Plant J.,
12,
945-948). The complete vector (Fig. 2) and plasmid are shown in the annex.
Examples of other usable binary vectors for insertional mutagenesis are
pBIN19,
pBI101, pBinAR or pGPTV. An overview over binary vectors and their specific
features
is given in Hellens et al., 2000, Trends in plant Science, 5:446-451 and in
Guerineau F.,
Mullineaux P., 1993, Plant transformation and expression vectors in plant
molecular


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCTIEP2005/055023
BASF/PF 56031 PCT 68

biology, LABFAX Series, (Croy R.R.D., ed.) pp. 121-127 Bios Scientific
Publishers,
Oxford.

Transformation of Agrobacteria
The plasmid was transformed into Agrobacterium tumefaciens (GV3101pMP90; Koncz
and Schell, 1986 Mol. Gen. Genet. 204:383-396) using heat shock or
electroporation
protocols. Transformed colonies were grown on YEB medium and selected by
respective antibiotics (Rif/Gent/Km) for 2 d at 28 C. These agrobacteria
cultures were
used for the plant transformation.
Arabidopsis thaliana of the ecotype C24 were grown and transformed according
to
standard conditions (Bechtold, N., Ellis, J., Pelletier, G. 1993. In planta
Agrobacterium
mediated gene transfer by infiltration of Arabidopsis thaliana plants, C. R.
Acad. Sci.
Paris 316:1194-1199; Bent, A. F., Clough, J. C., 1998; Floral dip: a
simplified method
for Agrobacterium-mediated transformation of Arabidopsis thaliana, PLANT J.
16:735 -
743).
Transformed plants (Fl) were selected by the use of their respective
resistance
marker. In case of BASTA -resistance, plantlets were sprayed four times at an
interval
of 2 to 3 days with 0.02 % BASTA and transformed plants were allowed to set
seeds.
50-100 seedlings (F2) were subjected again to marker selection, in case of
BASTA-
resistance by spaying with 0.1 % BASTA on 4 consecutive days during the
plantlet
phase. Plants segregating for a single resistance locus (approximately 3:1
resistant
seedling to sensitive seedlings) were chosen for further analysis. From these
lines
three of the resistant seedlings (F2) were again allowed to set seeds and were
tested
for homozygosis through in-vitro germination of their seeds (F3) on agar
medium
containing the selection agent (BASTA , 15 mg/L ammonium glufosinate,
Pestanal,
Riedel de Haen, Seelze, Germany). Those F2 lines which showed nearly 100%
resistant offspring (F3) were considered homozygote and taken for functional
analysis.

Measurement of Stress Tolerance
Transformed A. thaliana plants were grown individually in pots containing a
4:1 (v/v)
mixture of soil and quartz sand in a growth chamber (York lndustriekalte GmbH,
Mannheim, Germany). To induce germination, sown seeds were kept at 4 C, in the
dark, for 3 days. Standard growth conditions were: photoperiod of 16 h light
and 8 h
dark, 20 C, 60% relative humidity, and a photon flux density of 150 NE.
Plants were
watered daily until they were approximately 3 weeks old at which time drought
was
imposed by withholding water. Simultaneously, the relative humidity was
reduced in


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 69

10% increments every second day to 20%. After approximately 12 days of
withholding
water, most plants showed visual symptoms of injury, such as wilting and leaf
browning, whereas tolerant or resistant plants were identified as being
visually turgid
and healthy green in color. Plants were scored for symptoms of drought injury
in
comparison to wild type and neighboring plants for 3 - 5 days in succession.
In one experiment (table 2), at least 4, but usually 20 - 25 replicates of
each confirmed
tolerant line, i.e. those that had been scored as tolerant or resistant in
precoursery
experiments, were grown and treated as before. In this experiment the average
and
maximum number of days of drought survival after the wild-type control had
visually
died was determined. Additionally measurements of chlorophyll fluorescence
(table 3)
were made in stressed and non-stressed plants using a Mini-PAM (Heinz Walz
GmbH,
Effeltrich, Germany).
In the drought tolerance experiment (table 2) the control (non-transformed
Arabidopsis
thaliana) and most transformed lines in the test showed extreme visual
symptoms of
stress including necrosis and cell death. Several transformed plants retained
viability
as shown by their turgid appearance and maintenance of green color.
Chlorophyll fluorescence measurements of photosynthetic yield (in non-dark
adapted
plants) confirmed that 14 days of drought stress completely inhibited
photosynthesis in
the control plants. In most cases the transformed lines maintained
photosynthetic
function longer (table 3).

Analysis of the selected stress resistant lines
Since the lines were preselected for single insertion loci and a homozygous
situation of the resistance marker, the disruption (or mutation) of single
genes through
the integration of the T-DNA were expected to have lead to the stress-
resistant
phenotype. Lines which showed a consistent phenotype were chosen for molecular
analysis.
Genomic DNA was purified from approximately 100 mg of leaf tissue from these
lines
using standard procedures (either spins columns from Qiagen, Hilden, Germany
or the
Nucleon Phytopure Kit from Amersham Biosciences, Freiburg, Germany). The
amplification of the insertion side of the T-DNA was achieved using two
different
methods. Either by an adaptor PCR-method according to Spertini D, Beliveau C.
and
Bellemare G., 1999, Biotechniques, 27, 308 - 314 using T-DNA specific primers
LB1 (5'
- TGA CGC CAT TTC GCC TTT TCA - 3'; SEQ ID NO: 83) for the first and LB2 (5'-
CAG AAA TGG ATA AAT AGC CTT GCT TCC -3'; SEQ ID NO: 84) or RB4-2 (5' -
AGC TGG CGT AAT AGC GAA GAG - T; SEQ ID NO: 85) for the second round of


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 70

PCR. Alternatively TAIL-PCR (Liu Y-G, Mitsukawa N, Oosumi T and Whittier RF,
1995,
Plant J. 8, 457-463 was preformed. In this case in the first round PCR LB1 (5'
- TGA
CGC CAT TTC GCC TTT TCA - 3' SEQ ID NO: 83) or RBI-2 (5'- CAA CTT AAT CGC
CTT GCA GCA CA-T; SEQ ID NO: 86), for the second round LB2 (5'- CAG AAA TGG
ATA AAT AGC CTT GCT TCC - 3' SEQ ID NO: 84) or RB4-2 (5' - AGC TGG CGT
AAT AGC GAA GAG - 3' SEQ ID NO: 87) and in the last round LB3 (5' - CCA ATA
CAT TAC ACT AGC ATC TG - 3'; SEQ ID NO: 88) or RB5 (5' - AAT GCT AGA GCA
GCT TGA - 3'; SEQ ID NO: 89) were used as T-DNA specific primers for left or
right T-
DNA borders respectively.
Appropriate PCR-products were identified on agarose gels and purified using
columns
and standard procedures (Qiagen, Hilden, Germany). PCR-products were sequenced
with additional T-DNA-specific primers located towards the borders relative to
the
primers used for amplification. For PCR products containing left border
sequences
primer LBseq (5' - CAA TAC ATT ACA CTA GCA TCT G - 3'; SEQ ID NO: 90) and for
sequences containing right border sequences primer RBseq (5' - AGA GGC CCG CAC
CGA TCG - 3'; SEQ ID NO: 91) was used for sequencing reactions. The resulting
sequences were taken for comparison with the available Arabidopsis genome
sequence from Genbank using the blast algorithm (Altschul et al., 1990. J Mol
Biol,
215:403-410).
Details on PCR products used to identify the genomic locus are given in table
4.
Indicated are the identified annotated open reading frame in the Arabidopsis
genome,
the estimated size of the obtained PCR product (in base pairs), the T-DNA
border (LB:
left border, RB: right border) for which the amplification was achieved, the
method
which resulted in the indicated PCR product (explanation see text above), the
respective restriction enzymes in case of adaptor PCR, and the degenerated
primer in
the case of TAIL PCR. Routinely degenerated primers ADP3 (5'-
WGTGNAGWANCANAGA-3'; SEQ ID NO: 92), ADP6 (5'-AGWGNAGWANCANAGA-
3"; SEQ ID NO: 93) and ADP8 (5'-NTGCGASWGANWAGAA-3'; SEQ ID NO: 94) were
used next to the other known primers given in table 4.
The identification of the insertion locus in each case was confirmed by a
control PCR,
using a T-DNA-specific primer and a primer deduced from the identified genomic
locus,
near to the insertion side. The amplification of a PCR-product of the expected
size from
the insertion line using these two primers proved the disruption of the
identified locus
by the T-DNA integration.
Tables 2 - 5:


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 71

Table 2: Duration of survival of transformed Arabidopsis thaliana after
imposition of
drought stress on 3-week-old plants. Drought tolerance was measured visually
at daily
intervals. Survival duration is the average of all plants that survived longer
than the wild
type control. The Maximum duration is the longest period that any single
transformed
plant survived longer than the wild type control.

SEQ ID Gene Plants Average days of Maximum days of
No. tested survival after WT survival
CONTROL 0 0

1 At1g10410 15 2.0 3
3 At1g10420 15 2.0 3
5 At1g22400 24 0.8 3
7. At1g22410 24 0.8 3
9 At1g26230 14 1 3
11 At1g26240 14 1 3
13 At1 g64625 24 2.33 6
At1g77730 25 1.04 3
17 At1g77740 25 1.04 3
19 At1 g78060 25 1.2 3
21 At2g30770 25 1.28 2
23 At2g30780 25 1.28 2
At2g44580 22 0.92 4
27 At2g44800 24 1.14 4
29 At2g44810 24 1.14 4
31 At3g06280 24 0.83 4
33 At3g06290 24 0.83 4
At3g08970 24 1.21 4
37 At3g08980 24 1.21 4
39 At3g13000 23 0.7 4
41 At3g14820 24 0.88 3


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 72

43 At3g14830 24 0.88 3
45 At3g46900 19 1.84 3
47 At3g46910 19 1.84 3
49 At3g54360 40 7.03 20
51 At3g54370 40 7.03 20
53 At3g55990 40 7.03 20
55 At3g60570 21 1.76 4
57 At3g60580 21 1.76 4
59 At3g60680 24 1.08 4
61 At3g60690 24 1.08 4
63 At4g00890 4 2.25 3
65 At4g00900 4 2.25 3
67 At4g25340 24 0.42 1
69 At5g01750 24 2.33 6
71 At5g09620 24 1.25 5
73 At5g09630 25 2.6 9
75 At5g25240 23 1.52 3
77 At5g25250 23 1.2 3
79 At5g55280 24 0.8 3
81 At5g66190 21 0.81 3
Table 3: Photosynthetic yield as determined by chlorophyll florescence of
transformed
Arabidopsis thaliana after imposition of drought stress on 3-week-old plants.
Measurements were taken at intervals after withholding water and reported as
photosynthetic yield (Y). Values are the average of 5 randomly selected
plants. These
are compared to the MC24 strain for reference.

SEQ Gene Photosynt MC24 Photosynth MC24 Photosynt MC24


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 73

ID No. hetic yield Referen etic yield Reference hetic yield Reference
6 days ce 10 days 14 days
after final after final after final
watering watering watering
At1g22400 751 623 401 100
7 At1g22410 751 623 401 100
9 At1g26230 760 623 80 100

11 At1g26240 760 623 80 100
13 At1g64625 672 610 138 16
At1g77730 779 783 425 211
17 At1g77740 779 783 425 211
19 At1g78060 784 783 0 211
21 At2g30770 784 783 643 211
23 At2g30780 784 783 643 211
At2g44580 778 623 579 100
27 At2g44800 750 623 249 100
29 At2g44810 750 623 249 100
31 At3g06280 704 623 55 100
33 At3g06290 704 623 55 100
At3g08970 776 623 573 100
37 At3g08980 776 623 573 100
39 At3g13000 753 623 152 100
41 At3g14820 683 623 174 100
43 At3g14830 683 623 174 100

At3g46900 757 783 751 211 84 0
47 At3g46910 757 783 751 211 84 0
49 At3g54360 774 794 776 413 747 54
51 At3g54370 774 794 776 413 747 54


CA 02798495 2012-11-09
= CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASFIPF 56031 PCT 74

53 At3g55990 774 794 776 413 747 54
55 At3g60570 757 623 569 100

57 At3g60580 757 623 569 100
59 At3g60680 767 623 358 100
61 At3g60690 767 623 358 100
63 At4g00890 762 623 354 100
65 At4g00900 762 623 354 100
67 At4g25340 767 783 190 211
69 At5g01750 672 610 138 16

71 At5g09620 759 757 639 610 148 107
73 At5g09630 722 750 761 576 369 31
75 At5g25240 683 783 774 211

77 At5g25250 774 783 683 211

79 At5g55280 751 623 401 100
81 At5g66190 777 783 367 211

Table 4: Details on PCR products used to identify the down-regulated genomic
locus.
SEQ Length Sequence Border Method Restriction enzyme or
ID No. Gene PCR length deg. Primer
Product
1 At1910410 1700 194 LB Adaptor Spe 1
3 At1g10420 1700 194 LB Adaptor Spe 1
At1g22400 2000 695 LB Adaptor Mun 1
7 At1g22410 2000 695 LB Adaptor Mun I
9 At1g26230 550 441 LB Adaptor Mun I
11 At1g26240 550 441 LB Adaptor Mun I

13 At1g64625 900 717 RB Adaptor Psp14061/Bsp1191


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP20051055023
BASF/PF 56031 PCT 75

15 At1g77730 700 596 RB TAIL ADP3
17 At1g77740 700 596 RB TAIL ADP3
19 At1g78060 2000 647 RB Adaptor Mun 1
21 At2g30770 2000 630 RB Adaptor Spe I
23 At2g30780 2000 630 RB Adaptor Spe I
25 At2g44580 1000 564 LB Adaptor BgIII
27 At2g44800 1400 663 LB Adaptor BgIII
29 At2g44810 1400 663 LB Adaptor BgIII
31 At3g06280 1500 604 LB Adaptor BgIII
33 At3g06290 1500 604 LB Adaptor BgIII
35 At3g08970 900 473 RB Adaptor Mun 1
37 At3g08980 900 473 RB Adaptor Mun I
39 At3g13000 450 273 LB Adaptor Spe I
41 At3g14820 1200 556 LB Adaptor BgIII
43 At3g14830 1200 556 LB Adaptor BgIII
45 At3g46900 750 503 LB TAIL ADP8
47 At3g46910 750 503 LB TAIL ADP8
49 At3g54360 1300 579 LB Adaptor Pspl406 I/Bspll9 1

51 At3g54370 1300 579 LB Adaptor Psp1406I/Bspl191
53 At3g55990 1300 579 LB Adaptor Psp14061/Bspl191
55 At3g60570 850 499 LB Adaptor Psp1406I/Bspll9I
57 At3g60580 850 499 LB Adaptor Psp1406I/Bspl19I
59 At3g60680 2000 577 LB Adaptor Spe I

61 At3g60690 2000 577 LB Adaptor Spe I

63 At4g00890 850 624 LB Adaptor Psp1406I/Bsp1191
65 At4g00900 850 624 LB Adaptor Psp14061/Bsp1191
67 At4g25340 600 439 LB TAIL ADP3


CA 02798495 2012-11-09
= CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 76

69 At5g01750 1400 699 LB Adaptor Mun 1
71 At5g09620 800 562 LB Adaptor Spe 1
73 At5g09630 800 562 LB Adaptor Spe I

75 At5g25240 350 285 LB Adaptor Psp1406I/Bsp1191
77 At5g25250 350 285 LB Adaptor Psp1406I/Bsp1191
79 At5g55280 1100 622 LB Adaptor Pspl4061/Bspl191
81 At5g66190 900 483 RB Adaptor Spe I

Construction of antisense constructs for repression of the genes of the
invention
Fragments of SEQ ID NO: 95 or other nucleic acids of the invention are
amplified by
PCR using pairs of gene specific primers. To enable cloning of the PCR
product,
restriction sites may be added to the primers used for the amplification.
Alternatively
recombination sites may be added to the primers to enable a recombination
reaction.
The PCR fragment is either cloned or recombined into a binary vector,
preferently
under control of a strong constitutive, tissue or developmental specific
promoters in a
way, that the orientation to the promoter is opposite of the direction the
gens has in its
original genomic position.
The amplification of the fragment of the SEQ ID NO: 95 was
performed using the oligonucleotides that have been deduced from the gene
sequence:
Seqlantifw: 5' - atagaattcatgcttcgactgatcgacga - 3' (SEQ ID NO: 869)
Seglantirev: 5' - atagtcgaccaccgggcacattgagcaat - 3' (SEQ ID NO: 870)
The Oligonucleotides have been solved in water to give a concentration of 20
NM. The
standard protocol of RNA extraction (Qiagen) and cDNA production (Invitrogen)
is used
for the isolation procedure of RNA from different tissues of Brassica napus,
Glycine
max, Zea mays or Oryza sativa and sysnthesis of ther respective cDNA. The PCR
reaction contained 5 pl ThermalAce buffer (Invitrogen), 0,4 pl dNTPs (25 mM
each)
(Invitrogen), 0,5 pl Primer Seqlantifw, 0,5 Ni Primer Seqlantirev, 0,5 p1
ThermalAce
(Invitrogen), 0,5 pl cDNA and 42,6 pl water. The PCR was performed on MJ-
Cycler
Tetrad (BioZym) with the following programm:
4 min 94 C, followed by 30 cycles of 1 min 94 C, 1 min 57 C, 1 min 72 C
followed
by 10 min 72 C and cooling to 25 C.


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 77

The PCR product has been purified using a Kit from Qiagen. The DNA was
subsequently digested with EcoRl / Sall (NEB) at 37 C over night. The
fragment was
then cloned into the vector BaseVectorCorn (see figure 1) which has been
digested
with EcoRl / Sall. The resulting construct was named BaseVectorCorn_antiSegl.
From this vector the cassette comprising the ScBV Promoter, the antisense
fragment of
Segl and the NOS terminator has been cut out using the restriction enzymes
Ascl /
Pacl and has been ligated in the vector TrafoVectorCorn (see figure 2)
yielding the
vector TrafoVectorCom_antiSeq 1 (Fig. 3).

Construction of RNAi constructs for repression of the genes of the invention
Two fragments of SEQ ID NO: 95 are amplified by PCR. To enable cloning of
the PCR product, restriction sites may be added to the primers used for the
ampli-
fication. Alternatively recombination sites may be added to the primers to
enable a
recombination reaction. The PCR fragment is either cloned or recombined into a
binary
vector, preferently under control of a strong constitutive, tissue or
developmental
specific promoters in a way, that the fragment is introduced twice in the
vector as
an inverted repeat, the repeats separated by a DNA spacer.
The amplification of the fragments of the SEQ ID NO: 95 was
performed using the oligonucleotides that have been deduced from the
gene sequence:
Seg1 rifwl: 5' - atagtcgacatgcttcgactgatcgacga - 3' (SEQ ID NO: 871)
Seglrirevl: 5' - atagaattccaccgggcacattgagcaat - 3' (SEQ ID NO: 872)
Seglrifw2: 5' - atacccgggatgcttcgactgatcgacga - 3' (SEQ ID NO: 873)
Seglrirev2: 5' - atatctagacaccgggcacattgagcaat- 3' (SEQ ID NO: 874)
The Oligonucleotides have been solved in water to give a concentration of
20 NM. The PCR reactions contained 5 pi ThermalAce buffer (Invitrogen),
0,4 pl dNTPs (25 mM each) (Invitrogen), 0,5 pl Primer Seg1rifwl, 0,5 pl
Primer Seglrirevl, 0,5 pl ThermalAce (Invitrogen), 0,5 pl cDNA and 42,6 pl
water and 5 pl ThermalAce buffer (Invitrogen), 0,4 pl dNTPs (25 mM each)
(Invitrogen), 0,5 pl Primer Seglrifw2, 0,5 pl Primer Seglrirev2, 0,5 pl
ThermalAce (Invitrogen), 0,5 pl cDNA and 42,6 p1 water respectively. The
PCRs were performed on MJ-Cyder Tetrad (BioZym) with the following
programm:
4 min 94 C, followed by 30 cycles of 1 min 94 C, 1 min 57 C, 1 min 72 C
followed by 10 min 72 C and cooling to 25 0C.


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 78

The PCR products have been purified using a Kit from Qiagen. The
DNA was subsequently digested with Sall / EcoRl at 37 C over night and
Smal for 6h at 28 C followed by digestion with Xbal overnight at 37 C
respectively. The Smal / Xbal digested fragment was then cloned into the
vector BaseVectorCorn_Spacer (see figure 4) wich has been digested with
Smal/Xbal. The resulting construct was digested with EcoRl / Sall and the
EcoRl / Sall PCR fragment was ligated into this vector. Subsequently, the
expression cassette comprising the ScBV promoter, inverted repeat of Seg1
separated by the spacer sequence and NOS terminator has been cut out
using the restriction enzymes Ascl/Pact and has been ligated in the vector
TrafoVectorCom (see figure 2) yielding the vector.

Construction of Cosuppression constructs for repression of the genes of the
invention
A fragment of SEQ ID NO: 95 is amplified by PCR. To enable cloning of the
PCR product, restriction sites may be added to the primers used for the
amplification.
Alternatively recombinationsites may be added to the primers to enable a
recombination reaction. The PCR fragment is either cloned or recombined into a
binary
vector, preferently under control of a strong constitutive, tissue or
developmental
specific promoters in a way, that the orientation to the promoter is identical
to the
direction the gen has in its original genomic position.
The amplification of the fragment of the SEQ ID NO: 95 was
performed using the oligonucleotides that have been deduced from the gene
sequence:
Seqlcofw: 5' - atagtcgacatgcttcgactgatcgacga - 3' (SEQ ID NO:875)
Seqlcorev: 5' - atagaattcccaccgggcacattgagcaat - 3' (SEQ ID NO:876)
The Oligonucleotides have been solved in water to give a concentration of 20
NM. The
PCR reactions contained 5 p1 ThermalAce buffer (Invitrogen), 0,4 p1 dNTPs (25
mM
each) (Invitrogen), 0,5 pl Primer Seglcofw, 0,5 p1 Primer Seqlcorev, 0,5 pl
ThermalAce (Invitrogen), 0,5 pl cDNA and 42,6 pl water. The PCR was performed
on
MJ-Cycler Tetrad (BioZym) with the following programm:
4 min 94 C, followed by 30 cycles of 1 min 94 C, 1 min 57 C, 1 min 72 C
followed
by 10 min 72 C and cooling to 25 C.
The PCR product has been purified using a Kit from Qiagen. The DNA was
subsequently digested with EcoRl / Sall (NEB) at 37 C over night. The
fragment was


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 79

then cloned into the vector BaseVectorCom (see figure 1) which has been
digested
with EcoRl / Sall. The resulting construct was named BaseVectorCorn_coSegl.
From this vector the cassette comprising the ScBV Promoter, the cosuppression
fragment of Segl and the NOS terminator has been cut out using the restriction
enzymes Ascl / Pacl and has been ligated in the vector TrafoVectorCom (see
figure 2)
yielding the vector TrafoVectorCom_coSeg1 (Fig. 5).
Engineering stress-tolerant corn plants by reducing the expression of stress
related genes from Zea mays in corn.
Transformation of corn (Zea mays L.) is performed with a modification of the
method
described by Ishida et al. (1996. Nature Biotech 14745-50). Transformation is
genotype-dependent in corn and only specific genotypes are amenable to
transformation and regeneration. The inbred line A188 (University of
Minnesota) or
hybrids with A188 as a parent are good sources of donor material for
transformation
(Fromm et al. 1990 Biotech 8:833-839), but other genotypes can be used
successfully
as well. Ears are harvested from corn plants at approximately 11 days after
pollination
(DAP) when the length of immature embryos is about 1 to 1.2 mm. Immature
embryos
are co-cultivated with Agrobacterium tumefaciens that carry "super binary"
vectors and
transgenic plants are recovered through organogenesis. The super binary vector
system of Japan Tobacco is described in WO patents W094/00977 and W095/06722.
Vectors are constructed as described. Various selection marker genes can be
used
including the corn gene encoding a mutated acetohydroxy acid synthase (AHAS)
enzyme (US patent 6025541). Similarly, various promoters can be used to
provide
constitutive, developmental, tissue or environmental regulation of gene
suppression
construct, eg the cosuppresion or the antisense or the RNAi construct.. In
this example,
the 34S promoter (GenBank Accession numbers M59930 and X16673) is used to
provide constitutive expression of the cosuppression or antisense or RNAi
constructs .
Excised embryos are grown on callus induction medium, then corn regeneration
medium, containing imidazolinone as a selection agent. The Petri plates were
incubated in the light at 25 C for 2-3 weeks, or until shoots develop. The
green shoots
from each embryo are transferred to corn rooting medium and incubated at 25 C
for 2-
3 weeks, until roots develop. The rooted shoots are transplanted to soil in
the
greenhouse. Ti seeds are produced from plants that exhibit tolerance to the
imidazolinone herbicides and are PCR positive for the transgenes.
The Ti transgenic plants are then evaluated for their improved stress
tolerance
according to the standard methods eg the withdraw of water and the performance
othe
the plant in comparison the wildtype or mock transformed plants.. The
seedlings


CA 02798495 2012-11-09

receive no water for a period up to 3 weeks at which time the plant and soil
are
desiccated. At various times after withholding water, a normal watering
schedule is
resumed. At one week after resuming watering, the lengths of leaf blades, and
the
fresh and dry weights of the shoots is determined. At an equivalent degree of
drought
stress, tolerant plants are able to resume normal growth whereas susceptible
plants
have died or suffer significant injury resulting in shorter leaves and less
dry matter. The
T1 generation of single locus insertions of the T-DNA will segregate for the
transgene
in a 1:2:1 ratio. Those progeny containing one or two copies of the transgene
(3/4 of
the progeny) are tolerant of the imidazolinone herbicide, and exhibit greater
tolerance
of drought stress than those progeny lacking the transgenes. Tolerant plants
have
higher seed yields, maintained their stomatal aperture and showed only slight
changes
in osmotic potential and proline levels, whereas the susceptible non-
transgenic control
plants closed their stomata and exhibited increased osmotic potential and
proline
levels. Homozygous T2 plants exhibited similar phenotypes. Hybrid plants (F1
progeny)
of homozygous transgenic plants and non-transgenic plants also exhibited
increased
environmental stress tolerance.

Engineering stress-tolerant soybean plants by reducing the expression of
stress
related genes from Glycine max in Glycine max.

In order to reduce the expression of the stress related soybean gene ins
Soybean,
antisense, cosuppression or RNAi constructs are constructed in a way similar
to what
has been described in the previous examples. Soybean is transformed according
to the
following modification of the method described in the Texas A&M patent US
5,164,310.
Several commercial soybean varieties are amenable to transformation by this
method.
The cultivar Jack* (available from the Illinois Seed Foundation) is a commonly
used for
transformation. Seeds are sterilized by immersion in 70% (v/v) ethanol for 6
min and in
25% commercial bleach (NaOCI) supplemented with 0.1% (v/v) Tween* for 20 min,
* trademarks


CA 02798495 2012-11-09
81

followed by rinsing 4 times with sterile double distilled water. Seven-day old
seedlings
are propagated by removing the radicle, hypocotyl and one cotyledon from each
seedling. Then, the epicotyl with one cotyledon is transferred to fresh
germination
media in petri dishes and incubated at 25 C under a 16-hr photoperiod
(approx. 100
gE-m-2s-1) for three weeks. Axillary nodes (approx. 4 mm in length) are cut
from 3 - 4
week-old plants. Axillary nodes are excised and incubated in Agrobacterium
LBA4404
culture.
Many different binary vector systems have been described for plant
transformation
(e.g. An, G. in Agrobacterium Protocols. Methods in Molecular Biology vol 44,
pp 47-
62, Gartland KMA and MR Davey eds. Humana Press, Totowa, New Jersey) and can
be used to carry the antisense, cosuppression or RNAI constructs . Many are
based on
the vector pBIN19 described by Bevan (Nucleic Acid Research. 1984. 12:8711-
8721)
that includes a plant gene expression cassette flanked by the left and right
border
sequences from the Ti plasmid of Agrobacterium tumefaciens. A plant gene
expression
cassette consists of at least two components - a selection marker gene with a
suitable
promoter and a plant promoter regulating the transcription of the cDNA or the
antisense
fragment or the RNAi construct. Various selection marker genes can be used
including
the Arabidopsis gene encoding a mutated acetohydroxy acid synthase (AHAS)
enzyme
(US patents 57673666 and 6225105). Similarly, various promoters can be used to
regulate the cosuppression, RNA oder antisense construct to provide
constitutive,
developmental, tissue or environmental regulation. In this example, the 34S
promoter
(GenBank Accession numbers M59930 and X16673) is used to provide constitutive
expression the gene repression constructs.
After the co-cultivation treatment, the explants are washed and transferred to
selection
media supplemented with 500 mg/L timentin. Shoots are excised and placed on a
shoot elongation medium. Shoots longer than 1 cm are placed on rooting medium
for
two to four weeks prior to transplanting to soil.

The primary transgenic plants (TO) are analyzed by PCR to confirm the presence
of T-
DNA. These results are confirmed by Southern hybridization in which DNA is
electrophoresed on a 1 % agarose gel and transferred to a positively charged
nylon


CA 02798495 2012-11-09

82
membrane (Roche Diagnostics). The PCR DIG* Probe Synthesis Kit (Roche
Diagnostics) is used to prepare a digoxigenin-labelled probe by PCR, and used
as
recommended by the manufacturer.

The transgenic plants are then evaluated for their improved stress tolerance
according
to the method standard methods, or like described in the following. The
seedlings
receive no water for a period up to 3 weeks at which time the plant and soil
are
desiccated. At various times after withholding water, a normal watering
schedule is
resumed. At one week after resuming watering, the lengths of leaf blades, and
the
fresh and dry weights of the shoots is determined. At an equivalent degree of
drought
stress, tolerant plants are able to resume normal growth whereas susceptible
plants
have died or suffer significant injury resulting in shorter leaves and less
dry matter.

Stress-tolerant soybean plants reduced in the expression of the stress related
genes from soybean have higher seed yields, maintain their stomatal aperture
and
show only slight changes in osmotic potential and proline levels, whereas the
susceptible non-transgenic control plants close their stomata and exhibit
increased
osmotic potential and proline levels.

Transgenic plants that displaytolerance to salinity or cold have higher seed
yields,
photosynthesis and dry matter production than susceptible plants.
Engineering stress-tolerant Rapeseed/Canola plants by by reducing the
expression of stress related genes from Brassica napus, in Brassica napus.
Cotyledonary petioles and hypocotyls of 5-6 day-old young seedlings are used
as
explants for tissue culture and transformed according to Babic et al. (1998,
Plant Cell
Rep 17: 183-188). The commercial cultivar Westar (Agriculture Canada) is the
standard variety used for transformation, but other varieties can be used.
Agrobacterium tumefaciens LBA4404 containing a binary vector carrying an
antisense
or an cosuppression or an RNAi constructs as described in the examples above
is
used for canola transformation. Many different binary vector systems have been
described for plant transformation (e.g. An, G. in Agrobacterium Protocols.
Methods in
Molecular Biology vol 44, pp 47-62, Gartland KMA and MR Davey eds. Humana
Press,
* trademark


CA 02798495 2012-11-09

82a
Totowa, New Jersey). Many are based on the vector pBIN19 described by Bevan
(Nucleic Acid Research. 1984. 12:8711-8721) that includes a plant gene
expression
cassette flanked by the left and right border sequences from the Ti plasmid of
Agrobacterium tumefaciens. A plant gene expression cassette consists of at
least two
components - a selection marker gene with a suitable promoter and a plant
promoter
regulating the transcription of the cDNA or a fragment of it for cosupression
or the
antisense fragment or the RNAi construct.. Various selection marker genes can
be
used including the Arabidopsis gene encoding a mutated acetohydroxy acid
synthase
(AHAS) enzyme (US patents 57673666 and 6225105). Similarly, various promoters
can be used to regulate the constructs for reducing gene expression to provide
constitutive, developmental, tissue or environmental regulation of
transcription. In this
example, the 34S promoter (GenBank Accession numbers M59930 and X16673) is
used to provide constitutive expression.of the gene repression constructs.
Canola seeds are surface-sterilized in 70% ethanol for 2 min., and then in 30%
Clorox*
with a drop of Tween-20 for 10 min, followed by three rinses with sterilized
distilled
water. Seeds are then germinated in vitro 5 days on half strength MS medium
without
hormones, 1 % sucrose, 0.7% Phytagar at 23oC, 16 hr. light. The cotyledon
petiole
explants with the cotyledon attached are excised from the in vitro seedlings,
and

* trademark


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 83

inoculated with Agrobacterium by dipping the cut end of the petiole explant
into the
bacterial suspension. The explants are then cultured for 2 days on MSBAP-3
medium
containing 3 mg/I BAP, 3 % sucrose, 0.7 % Phytagar at 23 C, 16 hr light.
After two
days of co-cultivation with Agrobacterium, the petiole explants are
transferred to
MSBAP-3 medium containing 3 mg/1 BAP, cefotaxime, carbenicillin, or timentin
(300
mg/I) for 7 days, and then cultured on MSBAP-3 medium with cefotaxime,
carbenicillin,
or timentin and selection agent until shoot regeneration. When the shoots are
5 - 10
mm in length, they are cut and transferred to shoot elongation medium (MSBAP-
0.5,
containing 0.5 mg/I BAP). Shoots of about 2 cm in length are transferred to
the rooting
medium (MSO) for root induction.
Samples of the primary transgenic plants (TO) are analyzed by PCR to confirm
the
presence of T-DNA. These results are confirmed by Southern hybridization in
which
DNA is electrophoresed on a 1 % agarose gel and transferred to a positively
charged
nylon membrane (Roche Diagnostics). The PCR DIG Probe Synthesis Kit (Roche
Diagnostics) is used to prepare a digoxigenin-labelled probe by PCR, and used
as
recommended by the manufacturer.
The transgenic plants are then evaluated for their improved stress tolerance
according
to the method standard methods, or like described in the following. The
seedlings
receive no water for a period up to 3 weeks at which time the plant and soil
are
desiccated. At various times after withholding water, a normal watering
schedule is
resumed. At one week after resuming watering, the lengths of leaf blades, and
the
fresh and dry weights of the shoots is determined. At an equivalent degree of
drought
stress, tolerant plants are able to resume normal growth whereas susceptible
plants
have died or suffer significant injury resulting in shorter leaves and less
dry matter. It is
found that transgenic Rapeseed/Canola reduced in the expression of stress
related
genes from Brassica napus, are more tolerant to environmental stress than non-
transgenic control plants. Tolerant plants have higher seed yields, maintain
their
stomatal aperture and show only slight changes in osmotic potential and
proline levels,
whereas the susceptible non-transgenic control plants close their stomata and
exhibited increased osmotic potential and proline levels. Plants that have
tolerance to
salinity or cold have higher seed yields, photosynthesis and dry matter
production than
susceptible plants.

Identification of Identical and Heterologous Genes
Gene sequences can be used to identify identical or heterologous genes from
cDNA or
genomic libraries. Identical genes (e. g. full-length cDNA clones) can be
isolated via


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 84

nucleic acid hybridization using for example cDNA libraries. Depending on the
abundance of the gene of interest, 100,000 up to 1,000,000 recombinant
bacteriophages are plated and transferred to nylon membranes. After
denaturation with
alkali, DNA is immobilized on the membrane by e. g. UV cross linking.
Hybridization is
carried out at high stringency conditions. In aqueous solution, hybridization
and
washing is performed at an ionic strength of 1 M NaCl and a temperature of 68
C.
Hybridization probes are generated by e.g. radioactive (32P) nick
transcription labeling
(High Prime, Roche, Mannheim, Germany). Signals are detected by
autoradiography.
Partially identical or heterologous genes that are similar but not identical
can be
identified in a manner analogous to the above-described procedure using low
stringency hybridization and washing conditions. For aqueous hybridization,
the ionic
strength is normally kept at 1 M NaCl while the temperature is progressively
loared
from 68 to 42 C.
Isolation of gene sequences with homology (or sequence identity/similarity) in
only a
distinct domain of for example 10-20 amino acids can be carried out using
synthetic
radio labeled oligonucleotide probes. Radiolabeled oligonucleotides are
prepared by
phosphorylation of the 5-prime end of two complementary oligonucleotides with
T4
polynucleotide kinase. The complementary oligonucleotides are annealed and
ligated
to form concatemers. The double stranded concatemers are then radiolabeled by,
for
example, nick transcription. Hybridization is normally performed at low
stringency
conditions using high oligonucleotide concentrations.
Oligonucleotide hybridization solution:
6 x SSC
0.01 M sodium phosphate
1 mM EDTA (pH 8)
0.5 % SIDS
100 pg/mI denatured salmon sperm DNA
0.1 % nonfat dried milk

During hybridization, temperature is lowered stepwise to 5-10 C below the
estimated
oligonucleotide T,õ or down to room temperature followed by washing steps and
autoradiography. Washing is performed with low stringency such as 3 washing
steps
using 4 x SSC. Further details are described by Sambrook, J. et al., 1989,
"Molecular
Cloning: A Laboratory Manual," Cold Spring Harbor Laboratory Press or Ausubel,
F.M.
et al., 1994, "Current Protocols in Molecular Biology," John Wiley & Sons.


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 85

Identification of Identical or homologous Genes by Screening Expression
Libraries with Antibodies

c-DNA clones can be used to produce recombinant polypeptide for example in E.
coil
(e.g. Qiagen QlAexpress pQE system). Recombinant polypeptides are then
normally
affinity purified via Ni-NTA affinity chromatography (Qiagen). Recombinant
polypeptides are then used to produce specific antibodies for example by using
standard techniques for rabbit immunization. Antibodies are affinity purified
using a Na
NTA column saturated with the recombinant antigen as described by Gu et al.,
1994,
BioTechniques 17:257-262. The antibody can then be used to screen expression
cDNA
libraries to identify identical or heterologous genes via an immunological
screening
(Sambrook, J. et al., 1989, "Molecular Cloning: A Laboratory Manual," Cold
Spring
Harbor Laboratory Press or Ausubel, F.M. et al., 1994, "Current Protocols in
Molecular
Biology", John Wiley & Sons).

Reducing the expression of the genes of the invention by artificial
transcription
factors
The genes of the invention and their homologous ORFs in other species may also
be
down regulated by introducing a synthetic specific repressor. For this
purpose, a gene
for a chimeric zinc finger protein, which binds to a specific region in the
regulatory or
coding region of the genes of interests or its homologs in other spezies is
constructed.
The artificial zinc finger protein comprises a specific DNA-binding domain
consting for
example of zinc finger and optional an repression like the EAR domain (Hiratsu
et al.,
2003. Plant J. 34(5), 733-739 Dominant repression of target genes by chimeric
repressors that include the EAR motif, a repression domain, in Arabidopsis.)
Expression of this chimeric repressor for example in plants then results in
specific
repression of the target gene or of its homologs in other plant species lead
to increased
metabolite production The experimental details expecially about the desing and
construction of specific zinc finger domains may be carried out as described,
or
WO 01/52620 or Ordiz MI, (Proc. Natl. Acad. Sci. USA, 2002, Vol. 99, Issue 20,
13290)
or Guan, (Proc. Nati. Acad. Sci. USA, 2002, Vol. 99, Issue 20, 13296).

Knock out of the genes of the invention by homologous recombination
Identifying mutations In the genes of the invention in random mutagenized
populations
a) In chemically or radiation mutated population


CA 02798495 2012-11-09
86

Production of chemically or radiation mutated populations is a common
technique and
known to the skilled worker. Methods are described by Koorneef et al. 1982 and
the
citations therein and by Lightner and Caspar in "Methods in Molecular Biology"
Vol 82.
These techniques usually induce point mutations that can be identified in any
known
gene using methods such as TILLING (Colbert T, Till BJ, Tompa R, Reynolds S,
Steine MN, Yeung AT, McCallum CM, Comai L, Henikoff S. High-throughput
screening for induced point mutations. Plant Physiol. 2001 Jun; 126(2):480-4.
PMID:
11402178).

b) in T-DNA or transposon mutated population by reserve genetics

Reverse genetic strategies to identify insertion mutants in genes of interest
have been
described for various cases expecially Arabidopsis eg. Krysan et al., 1999
(Plant Cell
1999, 11, 2283-2290); Sessions et al., 2002 (Plant Cell 2002, 14, 2985-2994);
Young
et al., 2001, (Plant Physiol. 2001, 125, 513-518); Koprek et al., 2000 (Plant
J. 2000, 24,
253-263) ; Jeon et al., 2000 (Plant J. 2000, 22, 561-570) ; Tissier et at.,
1999 (Plant
Cell 1999, 11, 1841-1852); Speulmann et al., 1999 (Plant Cell 1999,11 , 1853-
1866).
Also for crops insertional Briefly material from all plants of a large T-DNA
or transposon
mutagenized plant population is harvested and genomic DNA prepared. Then the
genomic DNA is pooled following specific architectures as described for
example in
Krysan et al., 1999 (Plant Cell 1999, 11, 2283-2290). Pools of genomics DNAs
are then
screened by specific multiplex PCR reactions detecting the combination of the
insertional mutagen (e.g. T-DNA or Transposon) and the gene of interest.
Therefore
PCR reactions are run on the DNA pools with specific combinations of T-DNA or
transposon border primers and gene specific primers. General rules for primer
design
can again be taken from Krysan et al., 1999 (Plant Cell 1999, 11, 2283-2290).
Rescreening of lower levels DNA pools lead to the identification of individual
plants in
which the gene of interest is disrupted by the insertional mutagen. These
methods can
as well be applied to crop populations that are mutated with insertional
mutagenesis


CA 02798495 2012-11-09

86a
such as corn (Fernandes J, Dong Q, Schneider B, Morrow DJ, Nan GL, Brendel V,
Walbot V.Genome Biol. 2004;5(10):R82. Epub 2004 Sep 23 Genome-wide
mutagenesis of Zea mays L. using RescueMu transposons) or rice (Sallaud C, Gay
C,
Larmande P, Bes M, Piffanelli P, Piegu B, Droc G, Regad F, Bourgeois E,
Meynard D,
Perin C, Sabau X, Ghesquiere A, Glaszmann JC, Delseny M, Guiderdoni E. Plant
J.
2004 Aug;39(3):450-64. High throughput T-DNA insertion mutagenesis in rice: a
first
step towards in silico reverse genetics)

Furthermore systematic sequencing of insertions sides in T-DNA or transposon
mutagenized population is under way also in crops allowing the simple in
silico search
for crop lines having mutated the genes of the invention (Sallaud C, Gay C,
Larmande
P, Bes M, Piffanelli P, Piegu B, Droc G, Regad F, Bourgeois E, Meynard D,
Perin C,


CA 02798495 2012-11-09
CA 02579927 2007-03-09
WO 2006/032707 PCT/EP2005/055023
BASF/PF 56031 PCT 87

Sabau X, Ghesquiere A, Glaszmann JC, Delseny M, Guiderdoni E. Plant J. 2004
Aug;39(3):450-64. High throughput T-DNA insertion mutagenesis in rice: a first
step
towards in silico reverse genetics;
Ryu CH, You JH, Kang HG, Hur J, Kim YH, Han MJ, An K, Chung BC, Lee CH, An G.,
Plant Mol Biol. 2004 Mar;54(4):489-502., Generation of T-DNA tagging lines
with a
bidirectional gene trap vector and the establishment of an insertion-site
database.)

Representative Drawing