Note: Descriptions are shown in the official language in which they were submitted.
CA 02810336 2013-03-25
CA PATENT APPLICATION
DOCKET NO. 55326.154
GENE COMBINATIONS FOR PRODUCING PUNICIC ACID IN TRANSGENIC
PLANTS
INVENTORS: WESELAKE, Randall J.; MIETKIEWSKA, Elzbieta
ASSIGNEE: THE GOVERNORS OF THE UNIVERSITY OF ALBERTA
FIELD OF THE INVENTION
[0001] The present invention relates to isolated desaturases (FAD2) and fatty
acid conjugases
(FADX), diacylglycerol acyltransferases: type 1 (DGAT1) and type 2 (DGAT2),
and
phospholipid:diacylglycerol acyltransferases (FDA Ti) and polynucleotide
sequences encoding
the DGATs and PDAT1 enzymes; polynucleotide constructs, vectors and host cells
incorporating
the polynucleotide sequences; and methods of producing and using same.
BACKGROUND OF THE INVENTION
[0002] Pomegranate (Punica granatum) seed oil has been attracting increasing
interest since
its main component, punicic acid, may be used as a therapeutic agent in
inflammatory diseases
and as a dietary agent for chemoprevention of prostate and breast cancer (Kim
et al., 2002;
Shyed et al., 2008; Boussetta et aL, 2009). Punicic acid (18:3A9cis' I trans,
13cis.
) is an uncommon
form of conjugated linolenic acid. The conjugated double bond in punicic acid
is synthesized by
a divergent form of the A 12-oleic acid desaturase (fatty acid conjugase,
designated here as
FADX) which catalyzes the conversion of the Al2 double bond of linoleic acid
(18:2A9cis'126s)
into two conjugated and trans-cis configurated double bonds at the 11 and 13
positions (Hornung
et al., 2002; Iwabuchi et al., 2003). Delta-12 desaturase (PgFAD2, GenBank
accession
#AY178447) and fatty acid conjugase (PgFADX, GenBank accession #AY178446)
involved in
the synthesis of punicic acid in pomegranate have been isolated by PCR based
cloning. Over-
expression of PgFADX in Arab idopsis thaliana resulted in the limited
accumulation of punicic
acid up to 3.5% accompanied by increased accumulation of oleic acid (Iwabuchi
et al., 2003;
Cahoon et al., 2006). These amounts of punicic acid are considerably lower
compared to the
1
CA 02810336 2013-03-25
amounts in seeds of P. granatum (up to 80%).
[0003] Similar problems with low accumulation of other conjugated fatty acids
in transgenic
plants have been reported. Genes encoding divergent FAD2 enzymes have been
expressed
transgenically in A. thaliana and oilseed plants, but resulted in relatively
low levels of
accumulation of the unusual fatty acid, usually <20% compared to the 60-90%
typically found in
the source species (Broun and Somerville, 1997; Cahoon et al., 1999; Dyer and
Mullen 2007;
Dyer etal., 2008, van Erp et al., 2011). Oleic acid content increased
considerably in these
transgenic plants, suggesting that production of the unusual fatty acids in
some way inhibits the
FAD2 desaturase activity (Cahoon etal., 2006; Zhou et al., 2006; Thomaeus
etal., 2001). This
was ascribed to the competition between the housekeeping FAD2 and the diverged
FAD2-like
enzymes, and an inhibition of the normal FAD2 by the conjugated acyl residues
in the
phosphatidylcholine (PC) substrate molecules (Drexler et al., 2003).
[0004] It has been recently demonstrated that levels of unusual/conjugated
fatty acids present
on PC in transgenic plants were substantially higher than those observed in
the source plants,
indicating that accumulation of these fatty acids in transgenic plants is
primarily limited by their
inefficient removal from PC and passage through the Kennedy pathway (Cahoon et
al., 2006;
Cahoon etal., 2007; Dyer etal., 2008). The route to a high-level of
accumulation of punicic
acid in transgenic plants may necessitate the identification and introduction
of genes encoding
key enzymes such as phospholipases PLA1 and PLA2 (Stahl etal., 1995; Singh
eta!,, 2005),
diacylglycerol acyltransferase type 1 (DGAT1) and 2 (DGAT2) (Burgal etal.,
2008; Li etal.,
2010; Shockey et al., 2006), and phospholipid:diacylglycerol acyliransferase
(PDAT) (van Erp et
al., 2011). Over-expression of DGAT1, DGAT2 and PDAT led to increased levels
of other
unusual fatty acids such as epoxy and hydroxyl fatty acids in transgenic
plants (Li et al., 2010;
Burgal etal., 2008; van Erp et al., 2011).
[0005] Accordingly, there is a need in the art for methods of producing
punicic acid from a
sustainable source.
SUMMARY OF THE INVENTION
[0006] In general terms, the present invention relates to transgenic plants
with enhanced
punicic acid accumulation resulting from overexpression of PgFADX and PgFAD2.
The present
2
CA 02810336 2013-03-25
invention also relates to isolated PgDGAT1, PgDGAT2, and PgPDAT1 genes from
Pun/ca
granatum, and methods for their use.
[0007] In one aspect, the present invention comprises an isolated
polynucleotide sequence
encoding a protein or polypeptide comprising or consisting of an amino acid
sequence selected
from SEQ ID NO: 2, 4 or 6, respective biologically active variants and
biologically active
portions thereof, with respective sequences having at least 85% identity
thereto, and wherein the
variants have diacylglycerol acyltransferases type 1 (DGAT I) and type 2
(DGAT2) or
phospholipid diacylglycerol acyltransferasc (PDAT1) activity.
[0008] In one embodiment, the polynucleotide encodes a polypeptide having type
1 (DGAT1)
and type 2 (DGAT2) activity and comprising the amino acid sequence of SEQ ID
NO: 2 or 4, or
an amino acid sequence having DGAT activity and having at least 85% sequence
identity
therewith.
[0009] In one embodiment, the polynucleotide encodes a polypeptide having PDAT
activity
and comprising the amino acid sequence of SEQ ID NO: 6, or an amino acid
sequence having
PDAT activity and having at least 85% sequence identity therewith.
[00010] In one embodiment, the polynucleotide comprises the nucleotide
sequence of SEQ ID
NO: 1,3 or 5.
[00011] In one embodiment, the encoded polypeptide comprises an amino acid
sequence
having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%,
or at least 99%
sequence identity to one of SEQ ID NO: 2, 4 or 6.
[00012] In one embodiment, the polynucleotide is derived from Pun/ca granatum.
[00013] In another aspect, the invention comprises a recombinant expression
vector
comprising at least one polynucleotide as described herein, operably linked
with transcriptional
and translational regulatory regions or sequences to provide for expression of
the at least one
polynucleotide sequence in a host cell.
[00014] In another aspect, the invention comprises a transgenic plant, plant
cell, plant seed,
callus, plant embryo, microspore-derived embryo, or microspore, comprising (a)
the above
3
CA 02810336 2013-03-25
recombinant expression vector, or (b) a recombinant expression vector encoding
PgFADX and
i
PgFAD2.
[00015] In one embodiment, the transgenic plant, plant cell, plant seed,
callus, plant embryo,
microspore-derived embryo, or microspore comprises PgFADX and PgFAD2, and one
or more
of a DGAT and PDAT1.
[00016] In one embodiment, the transgenic plant, plant cell, plant seed,
callus, plant embryo,
microspore-derived embryo, or microspore comprises a progeny plant generated
from the
transgenic plant, wherein the progeny plant comprises PgFADX and PgFAD2, and
one or more
of a DGAT and PDAT.
[00017] In one embodiment, the transgenic plant, plant cell, plant seed,
callus, plant embryo,
microspore-derived embryo, or microspore comprises PgFADX, PgFAD2, PgDGAT1 or
PgDGAT2 or both, and PgPDAT1.
[00018] In one embodiment, the transgenic plant, plant cell, plant seed,
callus, plant embryo,
microspore-derived embryo, or microspore is selected from a linseed, rapeseed,
canola, peanut,
safflower, flax, hemp, camelina, soybean, pea, sunflower, olive, palm, oats,
wheat, triticale,
barley, corn, thale cress, and legume plant, plant cell, plant seed, callus,
plant embryo, or
microspore-derived embryo or microspore.
[00019] In one embodiment, the transgenic plant, plant cell, plant seed,
callus, plant embryo,
microspore-derived embryo, or microspore comprises Arabidopsis thaliana.
[00020] In one embodiment, the transgenic plant, plant cell, plant seed,
callus, plant embryo,
microspore-derived embryo, or microspore comprises Arabidopsis thaliana
fad3/fael double
mutant.
[00021] In another aspect, the invention comprises a method of increasing
punicic acid
production in an oilseed plant, comprising the steps of:
4
CA 02810336 2013-03-25
a) constructing one or more vectors comprising one or more of the
polynucleotides
described herein; and
b) transforming the one or more vectors into a host cell under conditions
sufficient
for over-expression of PgFADX and PgFAD2.
[00022] In one embodiment, the host cell is also transformed to over-express
one or more of a
DGAT and PDAT.
[00023] In one embodiment, the method further comprises generating a
transgenic plant from
the host cell and obtaining a progeny plant, wherein the progeny plant
comprises PgFADX and
PgFAD2, and one or more of a DGAT and PDAT encoded by the polynucleotides, and
the
polynucleotides are over-expressed in the progeny plant.
[00024] In one embodiment, PgFADX, PgFAD2, PgDGAT1 or PgDGAT2 or both, and
PgPDAT1 are over-expressed in the plant.
[00025] In one embodiment, the plant comprises Arab idopsis thaliana. In one
embodiment,
the plant comprises an Arabidopsis thaliana fad3/fae 1 double mutant.
[00026] Additional aspects and advantages of the present invention will be
apparent in view of
the description, which follows. It should be understood, however, that the
detailed description
and the specific examples, while indicating preferred embodiments of the
invention, are given by
way of illustration only, since various changes and modifications within the
spirit and scope of
the invention will become apparent to those skilled in the art from this
detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
[00027] The invention will now be described by way of an exemplary embodiment
with
reference to the accompanying simplified, diagrammatic, not-to-scale drawings.
In the drawings:
[00028] Figure 1 is a schematic diagram showing the pathway for synthesizing
punicic acid.
,=
[00029] Figure 2 is a schematic diagram showing the NCJ and NCJD constructs
used to
CA 02810336 2013-03-25
transform A. thaliana fadVael plants.
[00030] Figure 3 shows the fatty acid composition (i.e., proportions of 18:1,
18:2, and punicic
acid contributing to the total fatty acid profile) in the seed oils of A.
thalianafad3ffael mutant-T2
(Hi) plants transformed with the NCJ construct to express the PgFADX gene
compared to non-
transformed plants.
[00031] Figure 4 shows the fatty acid composition (i.e., proportions of 18:1,
18:2, and punicic
acid contributing to the total fatty acid profile) in the seed oils of A.
thalianafad3/fael mutant-T2
(Hi) plants transformed with the NCJD construct to express the PgFADX and
PgFAD2 genes
compared to non-transformed plants.
[00032] Figure 5 shows the fatty acid composition (i.e., proportions of 18:1,
18:2, and punicic
acid contributing to the total fatty acid profile) in the seed oils of A.
thallanafad3/fael mutant-T3
(Ho) plants transformed with the NCJ construct to express the PgFADX gene
compared to non-
transformed and null segregant plants.
[00033] Figure 6 shows the fatty acid composition (i.e., proportions of 18:1,
18:2, and punicic
acid within the total fatty acid profile) in the seed oils of A. thaliana
fad3/fael mutant-T3 (Ho)
plants transformed with the NCJD construct to express the PgFADX and PgFAD2
genes
compared to non-transformed plants.
[00034] Figure 7 shows the relative content of punicic acid in
phosphatidylcholine (PC) and
triacylglycerol (TAG) from P. granatum and A. thaliana seed line NCJD-30-2.
The values
represented by the bars are the average SD from analyses of three
independent samples.
[00035] Figure 8A shows the PgDGAT1 nucleotide sequence, and Figure 8B shows
the
PgDGAT1 amino acid sequence.
[00036] Figure 9A shows the PgDGAT2 nucleotide sequence, and Figure 9B shows
the
PgDGAT2 amino acid sequence.
[00037] Figure 10A shows the PgPDAT1 nucleotide sequence, and Figure 10B shows
the
PgPDAT1 amino acid sequence.
[00038] Figure 11 shows the relative content of punicic acid in polar lipids
(PL) and
triacylglycerol (TAG) from yeast cells over-expressing PgFADX, PgFADX PgDGAT1,
and
6
CA 02810336 2013-03-25
PgFADX + PgDGAT2. The values represented by the bars are the average SD from
analyses of
three independent samples.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[00039] The present invention relates to transgenic plants with enhanced
punicic acid
accumulation resulting from overexpression of PgFADX and PgFAD2. The present
invention
also relates to isolated polynucleotides and polypeptides of the PgDGAT1,
PgDGAT2, and
PgPDAT1 genes from Punica granatum; nucleic acid constructs, recombinant
expression vectors
and host cells incorporating the polynucleotide sequences; and methods of
producing and using
same. When describing the present invention, all terms not defined herein have
their common
art-recognized meanings. To the extent that the following description is of a
specific
embodiment or a particular use of the invention, it is intended to be
illustrative only, and not
limiting of the claimed invention. The following description is intended to
cover all alternatives,
modifications and equivalents that are included in the spirit and scope of the
invention, as
defined in the appended claims.
[00040] To facilitate understanding of the invention, the following
definitions are provided.
[00041] A "cDNA" is a polynucleotide which is complementary to a molecule of
mRNA. The
"cDNA" is formed of a coding sequence flanked by 5' and 3' untranslated
sequences.
[00042] A "coding sequence" or "coding region" or "open reading frame (ORF)"
is part of a
gene that codes for an amino acid sequence of a polypeptide.
[00043] A "complementary sequence" is a sequence of nucleotides which forms a
duplex with
another sequence of nucleotides according to Watson-Crick base pairing rules
where "A" pairs
with "T" and "C" pairs with "G." For example, for the polynucleotide 5'-
AATGCCTA-3' the
complementary sequence is 5'-TAGGCATT-3'.
[00044] A "construct" is a polynucleotide which is formed by polynucleotide
segments =
isolated from a naturally occurring gene or which is chemically synthesized.
The "construct"
7
CA 02810336 2013-03-25
which is combined in a manner that otherwise would not exist in nature, is
usually made to
achieve certain purposes. For instance, the coding region from "gene A" can be
combined with
an inducible promoter from "gene B" so the expression of the recombinant
construct can be
induced.
[00045] "Downstream" means on the 3' side of a polynucleotide while "upstream"
means on
the 5' side of a polynucleotide.
[00046] "Expression" refers to the transcription of a gene into RNA (rRNA,
tRNA) or
messenger RNA (mRNA) with subsequent translation into a protein.
[00047] "Gene" means a DNA segment which contributes to phenotype or function,
and which
may be characterized by sequence, transcription or homology.
[00048] "Isolated" means that a substance or a group of substances is removed
from the
coexisting materials of its natural state.
[00049] "Nucleic acid" means polynucleotides such as deoxyribonucleic acid
(DNA), and,
where appropriate, ribonucleic acid (RNA). The term should also be understood
to include, as
equivalents, analogs of either RNA or DNA.
[00050] As used herein, the term "plasmid" means a DNA molecule which is
separate from,
and can replicate independently of, the chromosomal DNA. They are double
stranded and, in
many cases, circular. Plasmids used in genetic engineering are known as
vectors and are used to
multiply or express particular genes. Any plasmid may be used for the present
invention
provided that the plasmid contains a gene which encodes a PgDGAT1, PgDGAT2,
and
PgPDAT1, or a variant thereof in an expressible manner. In one embodiment, the
plasmid
comprises a yeast expression vector. Those skilled in art will recognize that
any plasmid in the
art may be modified for use in the compositions and methods of the present
invention.
8
CA 02810336 2013-03-25
[00051] As used herein, the term "regulatory element" includes, but is not
limited to, a
promoter, enhancer, terminator, and the like which are required for the
expression of the encoded
PgDGAT1, PgDGAT2, and PgPDAT1, or variant thereof.
[00052] A "polynucleotide" is a linear sequence of ribonucleotides (RNA) or
deoxyribonucleotides (DNA) in which the 3' carbon of the pentose sugar of one
nucleotide is
linked to the 5' carbon of the pentose sugar of another nucleotide. The
deoxyribonucleotide
bases are abbreviated as "A" deoxyadenine; "C" deoxycytidine; "G"
deoxyguanine; "T"
deoxythymidinc; "I" dcoxyinosine. Some oligonucleotides described herein are
produced
synthetically and contain different deoxyribonucleotides occupying the same
position in the
sequence. The blends of deoxyribonucleotides are abbreviated as "W" A or T;
"Y" C or T; "H"
A, C or T; "K" G or T; "D" A, G or T; "B" C, G or T; "N" A, C, G or T.
[00053] A "polypeptide" is a linear sequence of amino acids linked by peptide
bonds.
Common amino acids are abbreviated as "A" alanine; "R" arginine; "N"
asparagine; "D" aspartic
acid; "C" cysteine; "Q" glutamine; "E" glutamic acid; "G" glycine; "H"
histidine; "I" isoleucine;
"L" leucine; "K" lysine; "M" methionine; "F" phenylalanine; "P" proline; "S"
serine; "T"
threonine; "W" tryptophan; "Y" tyrosine and "V" valine.
[00054] Two polynucleotides or polypeptides are "identical" if the sequence of
nucleotides or
amino acids, respectively, in the two sequences is the same when aligned for
maximum
correspondence as described here. Sequence comparisons between two or more
polynucleotides
or polypeptides can be generally performed by comparing portions of the two
sequences over a
comparison window which can be from about 20 to about 200 nucleotides or amino
acids, or
more. The "percentage of sequence identity" may be determined by comparing two
optimally
aligned sequences over a comparison window, wherein the portion of a
polynucleotide or a
polypeptide sequence may include additions (i.e., insertions) or deletions
(i.e., gaps) as compared
to the reference sequence. The percentage is calculated by determining the
positions at which
identical nucleotides or identical amino acids are present, dividing by the
number of positions in
the window and multiplying the result by 100 to yield the percentage of
sequence identity.
Polynucleotide and polypeptide sequence alignment may be performed by
implementing
9
CA 02810336 2013-03-25
specialized algorithms or by inspection. Examples of sequence comparison and
multiple
sequence alignment algorithms are: BLAST and ClustalW software. Identity
between nucleotide
sequences can also be determined by DNA hybridization analysis, wherein the
stability of the
double-stranded DNA hybrid is dependent on the extent of base pairing that
occurs. Conditions
of high temperature and/or low salt content reduce the stability of the
hybrid, and can be varied
to prevent annealing of sequences having less than a selected degree of
homology.
Hybridization methods are described in Ausubel et al. (2000).
[00055] An "oleic acid" is a monounsaturated omega-9 fatty acid which is
abbreviated with a
lipid number of 18:1 cis-9.
[00056] A "linoleic acid" is an unsaturated omega-6 fatty acid which is
abundant in many
vegetable oils, and is an essential dietary requirement for all mammals
lacking the delta-12
desaturase involved in its synthesis.
[00057] A "punicic acid" is a conjugated linolenic acid isomer containing cis-
A9, trans-A11,
cis-A13 double bonds in the C15 carbon chain and having the structure below:
HO
.\\N
[00058] A Punica granatum conjugase (FADX) is an enzyme which catalyzes the
conversion
of the delta-12 double bond of linoleic acid (18:26,96s' 12els) into two
conjugated and trans-cis
configurated double bonds at the 11 and 13 positions. A "fatty acid conjugase"
(FADX) is an
enzyme which utilizes linoleic acid as a substrate for punicic acid synthesis.
[00059] A "PgFAD2" is a gene encoding a FAD2 from Punica granatum
(pomegranate).
[00060] A "PgFAD2" refers to a polypeptide from Punica granatum which exhibits
FAD2
CA 02810336 2013-03-25
enzymatic activity (delta-12 desaturase). A polypeptide having "FAD2 activity"
is a polypeptide
that has, to a greater or lesser degree, the enzymatic activity of FAD2.
[00061] A "PgFADX' is a gene encoding a FADX from Pun/ca granatum.
[00062] A "PgFADX" refers to a polypeptide from Pun/ca granatum which exhibits
FADX
enzymatic activity. A polypeptide having "FADX activity" is a polypeptide that
has, to a greater
or lesser degree, the enzymatic activity of FADX.
[00063] A "triacylglycerol" is an ester having three fatty carboxylic acids
attached to a single
glycerol backbone. It is the main component of vegetable oil and animal fats.
Alternative names
include: triglyceride, triacylglyceride, TG and TAG.
[00064] A diacylglycerol acyl transferase (DGAT) is an enzyme of the class EC
2.3.1.20
which catalyzes the reaction: acyl-CoA + sn-1,2-diacylglycerol CoA +
triacylglycerol.
Alternative names include: diacylglycerol 0-acyltransferase, diacylglycerol
acyltransferase,
diglyceride acyltransferase and acylCoA:diacylglycerol acyltransferase.
[00065] A "PgDGAT" is a gene encoding a DGAT from Pun/ca granatum. Two types
of
P.granatum DGATs are described here: type 1 (DGAT]) and type 2 (DGAT2).
[00066] A "PgDGAT" refers to a polypeptide from Pun/ca granatum which exhibits
DGAT
enzymatic activity. Two types of PgDGATs are described here (for example, type
1: PgDGAT1
or type 2: PgDGAT2) refers to a specific polypeptide which exhibits DGAT
enzyme activity.
[00067] A polypeptide having "DGAT activity" is a polypeptide that has, to a
greater or lesser
degree, the enzymatic activity of DGAT.
[00068] A "phospholipid:diacylglycerol acyl transferase" (PDAT) is an enzyme
of the class
EC 2.3.1.158 which catalyzes the reaction: phospholipid + 1,2-diacylglycerol 4-
4
lysophospholipid + TAG.
11
CA 02810336 2013-03-25
[00069] A "PgPDAT]" is a gene encoding a PDAT from Punica granatum. A number
denoted after PgPDAT (for example, PgDGAT1) refers to a specific gene encoding
a PDAT.
[00070] A "PgPDAT1" refers to a polypeptide from Punica granatum which
exhibits PDAT
enzymatic activity. A number denoted after PgPDAT (for example, PgPDAT1)
refers to a
specific polypeptide which exhibits PDAT enzyme activity.
[00071] A polypeptide having "PDAT activity" is a polypeptide that has, to a
greater or lesser
degree, the enzymatic activity of PDAT.
[00072] A "promoter" is a polynucleotide usually located within 20 to 5000
nucleotides
upstream of the initiation of translation site of a gene. The "promoter"
determines the first step
of expression by providing a binding site to DNA polymerase to initiate the
transcription of a
gene. The promoter is said to be "inducible" when the initiation of
transcription occurs only
when a specific agent or chemical substance is presented to the cell. For
instance, the GAL
"promoter" from yeast is "inducible by galactose," meaning that this GAL
promoter allows
initiation of transcription and subsequent expression only when galactose is
presented to yeast
cells.
[00073] "Transformation" means the directed modification of the genome of a
cell by external
application of a polynucleotide, for instance, a construct. The inserted
polynucleotide may or
may not integrate with the host cell chromosome. For example, in bacteria, the
inserted
polynucleotide usually does not integrate with the bacterial genome and might
replicate
autonomously. In plants, the inserted polynucleotide integrates with the plant
chromosome and
replicates together with the plant chromatin.
[00074] A "transgenic" organism is the organism that was transformed with an
external
polynucleotide. The "transgenic" organism encompasses all descendants, hybrids
and crosses
thereof, whether reproduced sexually or asexually and which continue to harbor
the foreign
polynucleotide.
12
CA 02810336 2013-03-25
[00075] A "vector" is a polynucleotide that is able to replicate autonomously
in a host cell and
is able to accept other polynucleotides. For autonomous replication, the
vector contains an
"origin of replication." The vector usually contains a "selectable marker"
that confers the host
cell resistance to certain environment and growth conditions. For instance, a
vector that is used
to transform bacteria usually contains a certain antibiotic "selectable
marker" which confers the
transformed bacteria resistance to such antibiotic.
[00076] The present invention relates to isolated polynucleotides and
polypeptides of the
PgDGAT1, PgDGAT2, and PgPDAT1 genes from Punica granatum; nucleic acid
constructs,
vectors and host cells incorporating the polynucleotide sequences; and methods
of producing and
using same. In particular, the invention relates to a method for increasing
the production of
punicic acid in oilseed plants through the over-expression of PgFADX and
PgFAD2, and one or
more of PgDGAT1 , PgDGAT2, and PgPDAT1, and a method for the production of
oils having an
increased content of punicic acid. The invention furthermore relates to the
production of
transgenic plants, preferably a transgenic oilseed plant, having an increased
content of punicic
acid.
[00077] In one aspect, the invention provides isolated PgDGAT1, PgDGAT2, and
PgPDAT1
polynucleotides, and polypeptides having DGAT or PDAT activity. PgDGAT1,
PgDGAT2, and
PgPDAT1 polynucleotides include, without limitation (1) single- or double-
stranded DNA, such
as cDNA or genomic DNA including sense and antisense strands; and (2) RNA,
such as mRNA.
PgDGAT1, PgDGAT2, and PgPDAT1 polynucleotides include at least a coding
sequence which
codes for the amino acid sequence of the specified PgDGAT1, PgDGAT2 and PgPDAT
polypeptide, but may also include 5' or 3' untranslated regions and
transcriptional regulatory
elements such as promoters and enhancers found upstream or downstream from the
transcribed
region.
[00078] In one embodiment, the invention provides a PgDGAT I polynucleotide
which is a
cDNA comprising the nucleotide sequence of 1732 base pairs depicted in SEQ ID
NO: 1 (Figure
8A), and which was isolated from Punica granatum. The cDNA comprises a coding
region of
13
CA 02810336 2013-03-25
1623 base pairs (107-1729 region/position of SEQ ID NO: 1). The PgDGAT1
encoded by the
coding region (SEQ ID NO: 2; Figure 8B) is a 540 amino acid polypeptide.
1000791 In one embodiment, the invention provides a PgDGAT2 polynucleotide
which is a
cDNA comprising the nucleotide sequence of 1479 base pairs depicted in SEQ ID
NO: 3 (Figure
9A), and which was isolated from Punica granatum. The cDNA comprises a coding
region of
1005 base pairs (243-1247 region/position of SEQ ID NO: 3). The PgDGAT2
encoded by the
coding region (SEQ ID NO: 4; Figure 9B) is a 334 amino acid polypeptide.
1000801 In one embodiment, the invention provides a PgPDAT1 polynucleotide
which is a
cDNA comprising the nucleotide sequence of 2743 base pairs depicted in SEQ ID
NO: 5 (Figure
10A), and which was isolated from Punica granatum. The cDNA comprises a coding
region of
2052 base pairs (129-2180 region/position of SEQ ID NO: 5). The PgPDAT1
encoded by the
coding region (SEQ ID NO: 6; Figure 10B) is a 683 amino acid polypeptide.
[00081] Those skilled in the art will recognize that the degeneracy of the
genetic code allows
for a plurality of polynucleotides to encode for identical polypeptides.
Accordingly, the
invention includes polynucleotides of SEQ ID NOS: 1, 3, and 5, and variants of
polynucleotides
.=
encoding the polypeptides of SEQ ID NOS: 2, 4 and 6. In one embodiment,
polynucleotides
having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%,
at least 98%, or at
least 99% sequence identity to the nucleotide sequences depicted in SEQ ID
NOS: 1, 3, and 5 are
included in the invention. Methods for isolation of such polynucleotides are
well known in the
art (see for example, Ausubel et al., 2000).
1000821 In one embodiment, the invention provides isolated polynucleotides
which encode
PgDGAT1, PgDGAT2, and PgPDAT1, or polypeptides having amino acid sequences
having at
least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least
98%, or at least 99%
sequence identity to the amino acid sequences depicted in SEQ ID NOS: 2, 4,
and 6.
1000831 The above described polynucleotides of the invention may be used to
express
= polypeptides in recombinantly engineered cells including, for example,
bacterial, yeast, fungal,
14
CA 02810336 2013-03-25
mammalian or plant cells. In one embodiment, the invention provides
polynucleotide constructs,
vectors and cells comprising PgDGAT1, PgDGAT2, and PgPDAT1 polynucleotides.
Those
skilled in the art are knowledgeable in the numerous systems available for
expression of a
polynucleotide. All systems employ a similar approach, whereby an expression
construct is
assembled to include the protein coding sequence of interest and control
sequences such as
promoters, enhancers, and terminators, with signal sequences and selectable
markers included if
desired. Briefly, the expression of isolated polynucleotides encoding
polypeptides is typically
achieved by operably linking, for example, the DNA or cDNA to a constitutive
or inducible
promoter, followed by incorporation into an expression vector. The vectors can
be suitable for
replication and integration in either prokaryotes or eukaryotes. Typical
expression vectors
include transcription and translation terminators, initiation sequences, and
promoters useful for
regulation of the expression of the DNA. High level expression of a cloned
gene is obtained by
constructing expression vectors which contain a strong promoter to direct
transcription, a
ribosome binding site for translational initiation, and a
transcription/translation terminator.
Vectors may further comprise transit and targeting sequences, selectable
markers, enhancers or
operators. Means for preparing vectors are well known in the art. Typical
vectors useful for
expression of polynucleotides in plants include for example, vectors derived
from the Ti plasmid
of Agrobacterium tumefaciens and the pCaM-VCN transfer control vector.
Promoters suitable
for plant cells include for example, the nopaline synthase, octopine synthase,
and mannopine
synthase promoters, and the caulimovirus promoters. Seed-specific promoters,
such as ACP and
napin-derived transcription initiation regions, have been shown to confer
preferential expression
of a specific gene in plant seed tissue. In one embodiment, the seed-specific
napin promoter is
preferred.
[00084] Those skilled in the art will appreciate that modifications (i.e.,
amino acid
substitutions, additions, deletions and post-translational modifications) can
be made to a
polypeptide of the invention without eliminating or diminishing its biological
activity.
Conservative amino acid substitutions (i.e., substitution of one amino acid
for another amino acid
of similar size, charge, polarity and conformation) or substitution of one
amino acid for another
within the same group (i.e., nonpolar group, polar group, positively charged
group, negatively
charged group) are unlikely to alter protein function adversely. Some
modifications may be
CA 02810336 2013-03-25
1
made to facilitate the cloning, expression or purification. Variant PgDGAT1,
PgDGAT2, and
PgPDAT1 polypeptides may be obtained by mutagenesis of the corresponding
polynucleotides
depicted in SEQ ID NOS: 1, 3 and 5 using techniques known in the art
including, for example,
oligonucleotide-directed mutagenesis, region-specific mutagenesis, linker-
scanning mutagenesis,
and site-directed mutagenesis by PCR (Ausubel et al., 2000).
[00085] Various methods for transformation or transfection of cells are
available. For
prokaryotes, lower eukaryotes and animal cells, such methods include for
example, calcium
phosphate precipitation, fusion of the recipient cells with bacterial
protoplasts containing the
DNA, treatment of the recipient cells with liposomes containing the DNA, DEAE
dextran,
electroporation, biolistics and microinjection. The transfected cells are
cultured, and the
produced PgDGAT1, PgDGAT2, and PgPDAT1 polypeptides may be isolated and
purified from
the cells using standard techniques known in the art. Various industrial
strains of
microorganisms including for example, fungi, such as Mortierella or
Traustochytrium; mosses
such as Physcomitrella or Ceratodon; algae such as Crypthecodinium or
Phaeodactylum; or
Aspergillus, Pichia pastoris, Saccharomyces cerevislae may be used to produce
PgDGAT1,
PgDGAT2, and PgPDAT1 polypeptides. Alternatively, exogenous DNA may be
transferred into
yeast by electroporation, biolistics, glass bead agitation and spheroplasts.
[00086] Methods for transformation of plant cells include for example,
infiltration,
electroporation, PEG poration, particle bombardment, Agrobacterium tumefaciens-
or
Agrobacterium rhizogenes-mediated transformation, direct protoplast
transformation, and
microinjection. The transformed plant cells, seeds, callus, embryos,
microspore-derived
embryos, microspores, organs or explants are cultured or cultivated using
standard plant tissue
culture techniques and growth media to regenerate a whole transgenic plant
which possesses the
transformed genotype. Transformation may be confirmed by use of a DNA marker
gene
encoding for an enzyme that confers herbicide tolerance or antibiotic
resistance; catalyzes
deamination of D-amino acids; or by conducting methods such as PCR or Southern
blot
hybridization. Transgenic plants may pass polynucleotides encoding PgDGAT1,
PgDGAT2, and
PgPDAT1 polypeptides to their progeny, or can be further crossbred with other
species.
Accordingly, in one embodiment, the invention provides methods for producing
transgenic
16
CA 02810336 2013-03-25
plants, plant cells, callus, seeds, plant embryos, microspore-derived embryos,
and microspores
comprising PgDGAT1 , PgDGAT2, and PgPDAT1 polynucleotides.
[00087] In one embodiment, the invention provides transgenic plants, plant
cells, callus, seeds,
plant embryos, microspore-derived embryos, or microspores, comprising PgDGAT1,
PgDGAT2,
and PgPDAT1 polynucleotides. Plant species of interest for transformation
include, without
limitation, oilseeds (for example, the linseed plant, rapeseed or canola,
peanut, safflower), flax,
hemp, camelina, canola, sunflower, olive, palm, oats, wheat, triticale,
barley, corn, thale cress,
and legume plants including soybean and pea. In one embodiment, the plant
comprises
Arabidopsis thaliana. In one embodiment, the plant comprises Arabidopsis
thaliana fadVfael
double mutant.
[00088] In one embodiment, the invention comprises a method of increasing
punicic acid
production in an oilseed plant, comprising the steps of:
a) constructing one or more vectors comprising one or more of the
polynucleotides
claimed herein;
b) transforming the one or more vectors into a host cell under conditions
sufficient
for over-expression of PgFADX and PgFAD2.
[00089] In one embodiment, the host cell is also transformed to over-express
one or more of a
DGAT or PDAT.
[00090] The following describes specific examples of embodiments of the
present invention.
It will be appreciated by those skilled in the art that the isolated
polynucleotide and polypeptides
of the PgDGAT1 , PgDGAT2, and PgPDATI genes from Punica granatum have
industrial and
nutritional applications. The PgDGAT1, PgDGAT2, and PgPDAT1 genes encode
PgDGAT1,
PgDGAT2, and PgPDAT1, respectively. The DGAT and PDAT polynucleotides and
polypeptides may be used in the industrial production of punicic acid using
recombinant
technology using transformed bacterial, yeast or fungal cells. Transformed
cells may be
engineered to accumulate punicic acid which may be incorporated into human
food and animal
feed applications to produce health supplements or to improve the nutritional
quality of products.
17
CA 02810336 2013-03-25
1
These examples demonstrate how these genes can be used to produce punicic
acid.
[00091] The A. thaliana fad3/fae 1 double mutant is deficient in delta-15-
desaturase (FAD3)
and fatty acid elongase (FAE1) activity. A. thaliana FAD3 catalyzes the
conversion of linoleic
acid (18:2A9' 12) into linolenic (8:3A9'12, 15), while FAE1 catalyzes the
elongation of oleic acid
(18:1A9) mostly into eicosenoic acid (20:1A"). Since oleic acid is a
substrate for ongoing
desaturation and elongation, consequently, the A, thaliana fad3/fael double
mutant has a two-
fold higher amount of linoleic acid substrate than is present in a wild type
A. thaliana, resulting
in a significant increase of punicic acid accumulation in the seed oil.
However, since substrate
availability limits punicic acid production in transgenic A. thaliana seeds,
additional genes and
enzymes are needed to enhance punicic acid accumulation.
[00092] As described in the following Examples, the A. thaliana fad3/fael
double mutant was
transformed with various expression constructs comprising PgFADX and PgFAD2,
as well as
with PgDGAT1, and PgDGAT2. Seeds from the treated plants were plated out, with
the
transformants being selected and transferred to soil to establish primary
transgenic plants (Ti)
which were grown to maturity. T2 seeds were harvested from the Ti plants,
analyzed for the
fatty acid composition, and used to establish T2 progeny plants. T3 seeds were
harvested and
analyzed for the fatty acid composition.
[00093] PgFADX catalyzes the conversion of the delta-12 double bond of
linoleic acid into
two conjugated and trans-cis configurated double bonds at the 11 and 13
positions. PgFADX is
a fatty acid conjugase which utilizes linoleic acid as a substrate for punicic
acid synthesis. Over-
expression of both PgFADX and PgFAD2 genes in the transformed A. thaliana
fad3/fael double
mutant restored the relative proportion of C18:1 fatty acids to normal levels
and resulted in a
two-fold increase in the punicic acid content compared to that which was
present in plants over-
expressing only PgFADX.
[00094] Punicic acid is synthesized in developing seed tissues and accumulates
in the seed
storage lipid in the form of triacylglycerol (TAG). TAGs may be synthesized
through a
combination of DGAT and PDAT activities. DGAT catalyzes the acyl-CoA-dependent
synthesis
18
CA 02810336 2013-03-25
of TAG, whereas PDAT catalyzes the transfer of a fatty acyl chain from sn-2
position of
phosphatidylcholine (PC) to the sn-3 position of diacylglycerol DAG, producing
TAG, Without
being bound by theory, over-expression of PgDGAT1, PgDGAT2, and/or FDA Ti to
produce
PgDGAT1, PgDGAT2, and/or PDAT1 may facilitate the incorporation of punicic
acid into
TAGs, further enhancing the punicic acid accumulation in transformed plants
carrying both
PgFADX and PgFAD2.
[00095] Exemplary embodiments of the present invention are described in the
following
Examples, which are set forth to aid in the understanding of the invention,
and should not be
construed to limit in any way the scope of the invention as defined in the
claims which follow
thereafter. As will be apparent to those skilled in the art, various
modifications, adaptations and
variations of the specific disclosure herein can be made without departing
from the scope of the
invention claimed herein.
[00096] Example 1 - Isolation and characterization of fatty acid conjugase
(PgFADX)
and delta-12 desaturase (PgFAD2) from Punica granatum
[00097] Using sequence information available at GenBank (NCBI), PgFADX
(1188bp) and
PgFAD2 (1164bp) ORFs were amplified by PCR and cloned into pCR4-TOPO
(Invitrogen).
Sequence analysis confirmed that isolated PgFADX and PgFAD2 were identical
with sequences
submitted by Iwabuchi et aL, 2003 (AY178446 and AY178447, respectively).
[00098] To confirm the function of PgFADX, the coding region was amplified by
PCR with
primers 5'-GAAATGGGAGCTGATGGAACAAT-3' (forward Fl, SEQ ID NO: 7) and 5'-
TCAGAACTTGCTCTTGAACC-3 (reverse R1, SEQ ID NO: 8); cloned under the control of
GAL1 inducible promoter into pYES2.1N5-His-TOPO yeast expression vector
(Invitrogen); and
expressed in Saccharomyces cerevisiae strain INVScl (Invitrogen).
[00099] Punicic acid was detected (up to 1.2%) only in yeast cells expressing
PgFADX after
supplementation of the growth media with linoleic acid (18:2 A9.12) at the
final concentration of
300 M. The results indicated that isolated PgFADX encodes a functional fatty
acid conjugase
utilizing linoleic acid as a substrate for punicic acid synthesis (Figure 1).
19
CA 02810336 2013-03-25
[000100] Example 2 - Preparation of plant transformation vectors
[000101] The binary constructs NCJ and NCJD carrying the cassettes described
below were
developed in pRD400 vector background (CLONTECH) (Figure 2).
[000102] For NCJ (napin-P/PgFADX/NOS-T), PCR was used to amplify the napin
promoter
(Josefsson et at, 1987), PgFADX, and Nos terminator (Bevan, 1983) using the
primers set out in
Table 1. The napin-P/PgFADX/NOS-T expression cassette was cloned in EcoRI and
KpnI sites
of pRD400 to yield the NCJ construct.
Table 1.
napin forward F2, EcoRI 5'-ATAGAATTCAAGCTTTCTTCATCGGTGAT-3'
promoter site is underlined (SEQ ID NO: 9)
reverse R2, Smal 51-ATACCC000GTCCGTGTATGTTITTAATC-3'
site is underlined (SEQ ID NO: 10)
PgFADX forward F3, SmaI 5'-TATCCCGGGATGGGAGCTGATGGAACA-3'
is underlined (SEQ ID NO: 11)
reverse R3, Not! 5'-CGCGCGGCCGCTCAGAACTTGCTCTTGAAC-3'
site is underlined (SEQ ID NO: 12)
Nos forward primer F4, 5'-CGCCGGCGGCCGCGATCGTTCAAACATTTGGCA-3'
terminator NotI site is (SEQ ID NO: 13)
underlined
reverse primer R4, 5'-TATGGTACCCGATCTAGTAACATAGATGAC-3'
KpnI site is (SEQ ID NO: 14)
underlined
[000103] For NCJD (napin-P/PgFADX/NOS-T/Napin-P/PgFAD2/NOS-T), PCR was used to
amplify the napin promoter, PgFAD2, and NOS terminator using the primers set
out in Table 2.
The napin-P/PgFAD2/NOS-T expression cassette was cloned into KpnI and Sall
sites of NCJ
(described above) to yield the NCJD construct.
Table 2.
napin forward F5, KpnI 5'-ATAGGTACCAAGCTTTCTTCATCGGTGAT-3'
promoter site is underlined (SEQ ID NO: 15)
reverse R5, XhoI 5LATACTCGAGGTCCGTGTATG MTIAATCT-3'
site is underlined (SEQ ID NO: 16)
PgFAD2 forward F6, XhoI 51-TAACTCGAGATGGGAGCCGGTGGAAG-3'
is underlined (SEQ ID NO: 17)
reverse R6, XbaI 5t-TAITCTAGATCAGAGGITCTTCTTGTAC-3'
site is underlined (SEQ ID NO: 18)
Nos forward F7, Xbal 5'-TATTCTAGAGATCGTTCAAACATTTGGCAA-3'
CA 02810336 2013-03-25
terminator site is underlined (SEQ ID NO: 19)
reverse R7, Sall 5'-ATAGTCGACCGATCTAGTAACATAGATGAC-3'
site is underlined (SEQ ID NO: 20)
[000104] Example 3 - Production of punicic acid in A. (Indiana seeds
[000105] The binary vectors NCJ or NCJD were electroporated into Agrobacterium
tumefaciens cell strain GV3101 and introduced into Arabidopsis thaliana
fad3/fael (Smith et al.,
2003) double mutant background using the floral dip method (Clough and Bent,
1998).
Transgcnic plants were selected and analyzed as described before (Mietkiewska
et al., 2007).
[000106] Seeds from twenty-eight independent transgenic lines carrying NCJ
construct in high
linoleic acid (52%) A. thaliana fad3ffael mutant background were analyzed.
Results from the
best 11 A. thalina T2 lines are shown in Figure 3. Significant changes in
fatty acid composition
in comparison to the control lines (fad3/fael) were found. Seed specific
expression of PgFADX
resulted in an increased proportion of punicic acid (18:36,9z'l1E'13z) from 0%
in the controls up to
11.26% in the best transgenic line NCJ-11. The increased proportion of punicic
acid was
correlated with concomitant reduction in the proportion of its corresponding
precursor 18:2
(reduced by 52%). The production of punicic acid in A. thaliana seeds was
accompanied by up
to a 43% increase in oleic acid content, indicating that over-expression of
PgFADX led to the
inhibition of the native FAD2 activity.
[000107] To enhance the accumulation of punicic acid and reduce the effect of
native FAD2
inhibition observed in seeds over-expressing PgFADX, a second construct
carrying PgFADX and
PgFAD2 (NCJD) was developed. The fatty acid compositions of forty-five
independent
transgenic lines carrying NCJD construct in A. thaliana fad3/fae 1 mutant were
determined. The
results from the best 17 A. thaliana T2 seeds are shown in Figure 4. Over-
expression of
PgFADX and PgFAD2 in A. thaliana seeds resulted in higher proportion of
punicic acid
compared to the seeds over-expressing only PgFADX (Figure 3). In the best
transgenic line,
NCJD-33, punicic acid content was increased up to 15.24% at the expense of its
precursor 18:2
(reduced by 27%). Oleic acid content in NCJD-33 seeds was reduced by 8.5%
compared to not-
transformed A. thaliana .fad3/fael mutant. These results indicate that over-
expression of
PgFAD2 reduced significantly the inhibition effect of native FAD2 desaturase
activity observed
in the seeds over-expressing only PgFADX.
[000108] Since the preliminary analysis of fatty acid composition was
performed on T2
segregating seeds for the presence of the transgene(s), it was proposed that
T3 homozygous seeds
21
CA 02810336 2013-03-25
of A. thaliana might contain higher proportions of punicic acid. Seeds from
the T2 lines with the
highest proportion of punicic acid were thus sown and grown to obtain the T3
seed generation.
[000109] Seeds from eight T3 homozygous transgenic lines carrying NCJ
construct in high
linoleic acid (52%) A. thaliana fad3/fael mutant background were analyzed
(Figure 5).
Significant changes in fatty acid composition in comparison to the control
lines (fad3/fael) were
found. The proportion of punicic acid (18:3A9Z,11E,13Z ) increased from 0% in
control lines
(fad3/fael) to as high as 11.4% in the best transgenic line, NCJ-11-4. The
increased proportion
of punicic acid was correlated with concomitant reduction in the proportion of
its precursor 18:2
(reduced by 51.3%). The production of punicic acid in A. thaliana seeds was
accompanied by up
to a 45% increase in oleic acid content, indicating that over-expression of
PgFADX led to the
inhibition of the native FAD2 activity.
[000110] To enhance the accumulation of punicic acid and reduce the effect of
native FAD2
inhibition observed in seeds over-expressing PgFADX, a second construct
carrying PgFADX and
PgFAD2 (NCJD) was developed. The fatty acid compositions of nine T3 transgenic
lines
carrying NCJD construct in A. thaliana fad3/fael mutant are shown in Figure 6.
Over-
expression of PgFADX and PgFAD2 in A. thaliana seeds resulted in higher
proportion of punicic
acid compared to the seeds over-expressing only PgFADX (Figure 5). In the best
transgenic
lines, NCJD-33-2 and 34-3, punicic acid content was increased up to 21% at the
expense of its
precursor 18:2 (reduced by 28.6%). Oleic acid content in the best transgenic
NCJD-33-2 seed
line was reduced by 24% compared to non-transformed A. thaliana fad3/fael
mutant, indicating
that over-expression of PgFAD2 reduced significantly the inhibition effect of
native FAD2
activity observed in the seeds over-expressing only PgFADX.
[000111] Example 4 - Fatty acid composition of the selected lipid classes in
P. granatum
seeds and A. thaliana engineered to synthesize punicic acid in the seed oil
[000112] Examination of the fatty acid content of specific lipid classes was
performed for the
A. thaliana line over-expressing PgFADX+PgFAD2 (NCJD-30-2) with the highest
content of
punicic acid (21.2%) in the T3 seeds (Figure 7). Total lipids from seeds were
extracted and
separated as described earlier (Mieticiewska et al., 2011). In transgenic A.
thaliana seeds NCJD-
30-2, the punicic acid content of phosphatidylcholine (PC) was 12.5% which was
higher than
that observed in TAG (6.6%). A different situation was found in P. granatum
seeds where the
punicic acid content was 60% of the fatty acids in TAG, and only 0.8% of fatty
acids in PC. The
data indicate that in A. thaliana, an efficient mechanism of trafficking
punicic acid from PC to
TAG is missing.
22
CA 02810336 2013-03-25
[000113] Example 5 - Isolation of strategic genes involved in punicic acid
trafficking
[000114] Using a degenerate primer RT-PCR approach performed on cDNA amplified
from
P. granatum seeds, the following genes were isolated:
[000115] a) P. granatum diacylglycerol acyltransferase type I (PgDGAT1):
[000116] Degenerate primers designed in the conserved region included the
forward primer
(YQDWWNA, SEQ ID NO: 21) and reverse primer (HELCIAVP, SEQ ID NO: 22) which
were
used to amplify a 190 bp PCR internal fragment of a putative DGATI from P.
granatum showing
up to 89% of identity to plant DGAT1 amino acid sequences. The sequence of 190
bp PCR
product was used to design a gene specific primer to amplify the 5' and 3'
ends of cDNA using a
SMART RACE cDNA Amplification kit (CLONTECH, Palo Alto, CA, USA). Using the
sequence information coming from the assembly of the partial sequences, the
full length ORF
(1623 bp) of a putative DGAT1 was amplified by PCR using the forward F8 primer
(5'-
ATGGCGACCTCCGACGGC-3'; SEQ ID NO: 23) and the reverse R8 primer (5'-
TTACGGCCGGGAGCCITTT-3'; SEQ ID NO: 24). The PgDGAT1 cDNA (SEQ ID NO: 1;
Figure 8A) encodes a polypeptide of 540 amino acids (SEQ ID NO: 2; Figure 8B)
that is most
closely related to DGAT1 from Glycine max and Vernica fordii (70% identity to
both of them).
The PgDGAT1 sequence was submitted to GenBank and accorded NCBI accession
#JQ478414.
[000117] b) P. granatum diacylglycerol acyltransferase type 2 (PgDGAT2):
[000118] Degenerate primers designed in the conserved regions included the
forward primer
(VPGGVQE, SEQ ID NO: 25) and reverse primer (PMHVVVG, SEQ ID NO: 26) which
were
used to amplify a 276 bp PCR internal fragment of a putative DGAT2 from P.
granatum showing
up to 78% of identity to plant DGAT2 amino acid sequences. A similar approach
as above was
used to isolate full-length ORF (1005bp) of DGAT2 from pomegranate seeds by
PCR using the
forward F9 primer (5'-ATGGGAGAGGAGGCGAGC-3', SEQ ID NO: 27) and reverse R9
primer (5'-TCAGAGGATCTTCAGTTCC-3', SEQ ID NO: 28). The P. granatum DGAT2
cDNA (SEQ ID NO: 3) encodes a polypeptide of 334 amino acids (SEQ ID NO: 4)
with the
highest sequence identity (71%) to DGAT2 from Olea europaea. The sequence of
the
PgDGAT2 homolog was submitted to GenBank and accorded NCBI accession
#.1Q513387.
[000119] c) P. granatum phospholipid:diacylglycerol acyltransferase 1
(PgPDAT1):
[000120] Degenerate primers designed in the conserved regions included the
forward primer
(LCWVEHM, SEQ ID NO: 29) and reverse primer (TQSGAHV, SEQ ID NO: 30) which
were
used to amplify a 1.4 kb PCR internal fragment of a putative PDAT from P.
granatum showing
23
CA 02810336 2013-03-25
up to 82% of identity to plant PDAT homologs. A similar approach as above was
used to isolate
full-length ORF (2052bp) of PDAT from pomegranate seeds by PCR using the
forward F10
primer (5'-ATGGCGTTTCTCTGGCGGA-3', SEQ ID NO: 31) and the reverse R10 primer
(5'-
CTAGAGTGGCAAGTCAATCC-3', SEQ ID NO: 32). The PgPDAT1 cDNA (SEQ ID NO: 5)
encodes a polypeptide of 683 amino acids (SEQ ID NO: 6) with the highest
sequence identity
(83%) to PDAT1 from Glycine max and Vitis vinifera (82%). The sequence of the
PgPDAT1
homolog was submitted to GenBank and accorded NCBI accession OQ513388.
[000121] Example 6 - Functional characterization of PgDGAT1 and PgDGAT2
[000122] To establish the function of PgDGAT1 and PgDGAT2, constructs carrying
two genes
were developed, namely PgFADX + DGAT1 and PgFADX + DGAT2, in the yeast
expression
vector pESC-URA (Agilent).
[000123] PgFADX was amplified by PCR using the forward Fl 1 primer (5'-
AATAGGATCCGAAAT000AGCTGATGGAACA-3'; BamHI site is underlined; SEQ ID NO:
33) and the reverse R11 primer (5'-TTATGGTACCTCAGAACTTGCTCTTGAAC-3'; KpnI site
is underlined; SEQ ID NO: 34), and cloned in BamHI and KpnI sites of pESC-URA
to yield the
pEX construct.
[000124] PgDGAT1 was amplified by PCR using the forward F12 primer (5'-
GCAGAGCGGCCGCGAAATGGCGACCTCCGACGGC-3'; NotI site is underlined; SEQ ID
NO: 35) and the reverse R12 primer (5'ATATTTAATTAATTACGGCCGGGAGCCTTTT'-3';
Pad site is underlined; SEQ ID NO: 36), and cloned in the NotI and Pad sites
of pEX.
[000125] PgDGAT2 was amplified by PCR using the forward F13 primer (5'-
GCAGAGCGGCCGCGAAATGGGAGAGGAGGCGAG-3'; NotI site is underlined; SEQ ID
NO: 37) and the reverse R13 primer (5'-ATATTTAATTAATCAGAGGATCTTCAGTTCC-3';
Pad site is underlined; SEQ ID NO: 38); and cloned in NotI and Pad sites of
pEX.
[000126] The prepared constructs were transformed into yeast cells H1246
(Sandager et al.,
2002). Yeast cultures were grown at 30 C for 48 h. Expression of the
recombinant genes was
induced using minimal medium containing 2% (w/v) galactose and 1% (w/v)
raffinose
supplemented with 100 uM of linoleic acid (18:2).
[000127] In yeast cells over-expressing only PgFADX, punicic acid was found
only in the
polar lipids (PL) fraction where its synthesis occurs (Figure 11). In yeast
cells over-expressing
PgFADX + PgDGAT1, the punicic acid content of polar lipids was 0.82% and was
higher than
24
CA 02810336 2013-03-25
that observed in triacylglycerol (TAG, 0.13%). Significantly higher
accumulation of punicic
acid in TAG (0.4%) was found in yeast cells over-expressing PgFADX + PgDGAT2.
[0001281 Without being bound by theory, these results indicate that PgDGAT1
and PgDGAT2
encode enzymes involved in the efficient trafficking of punicic acid from the
origin of its
synthesis (PL) to the storage lipids (TAG). PgDGAT1 and PgDGAT2 appear to be
suitable
strategic genes to enhance the accumulation of punicic acid to higher levels
than those observed
in A. thaliana plants over-expressing only PgFADX+ PgFAD2.
REFERENCES
10001291 The following references are incorporated herein by reference (where
permitted) as
if reproduced in their entirety. All references are indicative of the level of
skill of those skilled
in the art to which this invention pertains.
Bevan, M. (1983) Binary Agrobacterium vectors for plant transformation.
Nucleic Acid Res. 12,
8711-8721,
Boussetta T., Raad H., Letteron P., Gougerot-Pocidalo M.A., Marie IC, Driss
F., and El-Benna
J. (2009) Punicic acid: a conjugated linolenic acid inhibits TNFa-induced
neutrophil
hyperactivation and protects from experimental colon inflammation in rats.
PLOS ONE 4:
e6458.
Broun P. and Somerville C. (1997) Accumulation of ricinoleic, lesquerolic, and
densipolic acids
in seeds of transgenic Arabidopsis plants that express a fatty acyl
hydroxylase cDNA from castor
bean. Plant PhysioL 113: 933-942.
Burgal J., Shockey J., Lu C., Dyer J., Larson T., Graham I. and Browse J.
(2008) Metabolic
engineering of hydroxy fatty acid production in plants: RcDGAT2 drives
dramatic increases in
ricinoleate levels in seed oil. Plant Biotechnol, J 6: 819-831,
Cahoon E.B., Dietrich C.R., Meyer K., Damude H,G., Dyer J.M. and Kinney A.J.
(2006)
Conjugated fatty acids accumulate to high levels in phospholipids of
metabolically engineered
soybean and Arabidopsis seeds. Phytochemistry 67: 1166-1176.
Cahoon E.B., Shockey J.M., Dietrich C.R., Gidda S.K, Mullen R.T. and Dyer J.M.
(2007)
Engineering oilseeds for sustainable production of industrial and nutritional
feedstocks: solving
bottlenecks in fatty acid flux. Curt% Opin. Plant Biol. 10: 236-244.
Clough S.J. and Bent A.F. (1998) Floral dip: a simplified method for
Agrobacterium-mediated
transformation of Arabidopsis thaliana. Plant J. 16: 735-743.
CA 02810336 2013-03-25
Drexler H., Spiekermann P., Meyer A., Domergue F., Zank T., Sperling P.,
Abbadi A. and Heinz
E. (2003) Metabolic engineering of fatty acids for breeding of new oilseed
crops: strategies,
problems and first results. J Plant Physiol. 160: 779-802.
Dyer J.M. and Mullen R.T. (2008) Engineering plant oils as high-value
industrial feedstocks
forbiorefining: the need for underpinning cell biology research. PhysioL
Plant. 132:11-22.
Dyer J.M., Stymne S., Green A.G. and Carlsson A.S. (2008) High-value oils from
plants. Plant J
54: 640-655.
Hornung E., Pernstich C. and Feussner I. (2002) Formation of conjugated All
6.13-double bonds
by Al2 ¨linoleic acid (1,4)-acyl-lipid-desaturase in pomegranate seeds. Eur.
J. Biochem. 269:
4852-4859.
Iwabuchi M., Kolmo-Murase J. and Imamura 3. (2003) ,612-o1eate desaturase-
related enzymes
associated with formation of conjugated trans-All, cis-A13 double bonds. J.
Biol. Chem. 278:
4603-4610.
Josefsson, L.G., Lenman, M., Ericson, M.L. and Rask, L. (1987) Structure of a
gene encoding
the 1.7 S storage protein, napin, from Brassica napus. J Biol. Chem. 262,
12196-12201.
Kim N.D., Mehta R., Yu W., Neeman I., Livney T., Amichay A., Poirier D.,
Nicholls P., Kirby
A., Jiang W., Mansel R., Ramachandran C., Rabi T., Kaplan B. and Lansky E.
(2002)
Chemopreventive and adjuvant therapeutic potential of pomegranate (Punica
granatum) for
human breast cancer. Breast Cancer Research and Treatment 71: 203-217.
Li R., Yu K., Hatanaka T. and Hildebrand D.F. (2010) Vernonia DGATs increase
accumulation
of epoxy fatty acids in oil. Plant BiotechnoL J. 8: 184-195.
Mietkiewska E., Brost J.M., Giblin E.M., Barton D.L. and Taylor D.C. (2007)
Cloning and
functional characterization of the Fatty Acid Elongase 1 (FAE1) gene from high
erucie Crambe
abyssinica cv. Prophet. Plant Biotechnol. J 5: 636-645.
Mietkiewska E., Siloto R.M., Dewald J., Shah S., Brindley D.N. and Weselake
R.J. (2011)
Lipins from plants are phosphatidate phosphatases that restore lipid synthesis
in apahlA mutant
strain of Saccharomyces cerevisiae. FEBS Journal 278: 764-775,
Sandager, L., Gustavsson, M.H., Stahl, U., Dahlqvist, A., Wiberg, E., Banas,
A., Leman, M.,
Ronne, H. and Stymne, S. (2002) Storage lipid synthesis is non-essential in
yeast. J. Biol. Chem.
277: 6478-6482.
Singh S.P., Zhou X-R, Liu Q., Stymne S. and Green A.G. (2005) Metabolic
engineering of new
fatty acids in plants, Curr. Opin. Plant Biol. 8: 197-203.
Shockey, J.M., Gidda, S.K., Chapital, D.C., Kuan, J.C., Dhanoa, P.K., Bland
J.M., Rothstein
S.J., Mullen R.T. and Dyer J.M. (2006) Tung tree DGAT1 and DGAT2 have
nonredundant
26
CA 02810336 2013-03-25
functions in triacylglycerol biosynthesis and are localized to different
subdomains of the
endoplasmic reticulum. Plant Cell 18: 2294-2313.
Smith M.A., Moon H., Chowrira G. and Kunst L. (2003) Heterologous expression
of a fatty acid
hydroxylase gene in developing seeds of Arabidopsis thaliana. Planta 217: 507-
516,
Stahl U., Banas A. and Stymne S. (1995) Plant microsomal phospholipid acyl
hydrolases have
selectivities for uncommon fatty acids. Plant Physiol. 107: 953-962.
Syed D., Suh Y., Afaq F. and Mukhtar H. (2008) Dietary agents for
chemoprevention of prostate
cancer. Cancer Lett. 265:167-176.
Thomaeus S., Carlsson A.S., Lee M. and Stymne S. (2001) Distribution of fatty
acids in polar
and neutral lipids during seed development in Arabidopsis thaliana genetically
engineered to
produce acetylenic, epoxy and hydroxy fatty acids. Plant Sci. 161: 997-1003.
van Erp H., Bates D.P., Burgal J., Shockey J. and Browse J. (2011) Castor
phospholipid:diacylglycerol acyltransferase facilitates efficient metabolism
of hydroxy fatty
acids in transgenic Arabidopsis. Plant Physiol. 155: 683-693.
Zhou X.R., Singh S., Liu Q. and Green A. (2006) Combined transgenic expression
of D12-
desaturase and D12-epoxygenase in high linoleic substrate seed oil leads to
increased
accumulation of vernolic acid. Funct, Plant Biol. 33: 585-592.
27
