Note: Descriptions are shown in the official language in which they were submitted.
CA 02816177 2016-05-05
DESATURASE INTRONS AND METHOD OF USE FOR THE
PRODUCTION OF PLANTS WITH MODIFIED POLYUNSATURATED FATTY
ACIDS
INTRODUCTION
This is a division of Canadian Serial No. 2,382,693 filed August 11, 2000.
Technical Field
The present invention is directed to nucleic acid sequences and constructs,
and
methods related thereto.
Background
Plant oils are used in a variety of applications. Novel vegetable oils
compositions
andfor improved means to obtain oils compositions, from biosynthetic or
natural plant
sources, are needed. Depending upon the intended oil use, various different
fatty acid
compositions are desired.
One means postulated to obtain such oils and/or modified fatty acid
compositions
is through the genetic engineering of plants. However, it is necessary to
identify the
appropriate nucleic acid sequences which are capable of producing the desired
phenotypic
result, regulatory regions capable of directing the correct application of
such sequences,
and the like.
1
CA 02816177 2013-05-22
Higher plants appear to synthesize fatty acids via a common metabolic pathway
(fatty acid synthetase pathway). In developing seeds, where fatty acids are
attached to
glycerol backbones, forming triglycerides, for storage as a source of energy
for further
germination, the FAS pathway is located in the proplastids. The first
committed step is
the formation of acetyl-ACP (acyl carrier protein) from acetyl-CoA and ACP
catalyzed by
the enzyme, acetyl-CoA:ACP transacylase (ATA). Elongation of acetyl-ACP to 16-
and
18- carbon fatty acids involves the cyclical action of the following sequence
of reactions:
condensation with a two-carbon unit from malonyl-ACP to form a B-ketoacyl-ACP
(B-
ketoacyl-ACP synthase), reduction of the keto-function to an alcohol (B-
ketoacyl-ACP
reductase), dehydration to form an enoyl-ACP (B-hydroxyacyl-ACP dehydrase),
and
finally reduction of the enoyl-ACP to form the elongated saturated acyl-ACP
(enoyl-ACP
reductase). B-ketoacyl-ACP synthase I, catalyzes elongation up to palmitoyl-
ACP
(C16:0), whereas B-ketoacyl-ACP synthase II catalyzes the final elongation to
stearoyl-
ACP (C18:0). Common plant unsaturated fatty acids, such as oleic, linoleic and
a-
linolenic acids found in storage triglycerides, originate from the
desaturation of stearoyl-
ACP to form oleoyl-ACP (C18:1) in a reaction catalyzed by a soluble plastid A-
9
desaturase (also often referred to as "stearoyl-ACP desaturase"). Molecular
oxygen is
required for desaturation in which reduced ferredoxin serves as an electron co-
donor.
Additional desaturation is effected sequentially by the actions of membrane
bound A-12
desaturase and A-15 desaturase. These "desaturases" thus create mono- or
polyunsaturated fatty acids respectively.
Obtaining nucleic acid sequences capable of producing a phenotypic result in
FAS, desaturation ancUor incorporation of fatty acids into a glycerol backbone
to produce
an oil is subject to various obstacles including but not limited to the
identification of
metabolic factors of interest, choice and characterization of an enzyme source
with useful
2
CA 02816177 2013-05-22
(
kinetic properties, purification of the protein of interest to a level which
will allow for its
amino acid sequencing, utilizing amino acid sequence data to obtain a nucleic
acid
sequence capable of use as a probe to retrieve the desired DNA sequence, and
the
preparation of constructs, transformation and analysis of the resulting
plants.
Thus, additional nucleic acid targets and methods for modifying fatty acid
compositions are needed. In particular, constructs and methods to produce a
variety of
ranges of different fatty acid compositions are needed.
SUMMARY OF THE INVENTION
The present invention is generally directed to genomic desaturase
polynucleotides,
and in particular to genomic desaturase polynucleotides which encode enzymes
that
catalyze the insertion of a double bond into a fatty acyl moiety at the
twelfth (Al2
desaturase or fad2) or fifteenth (A15 desaturase or fad3) carbon position in a
fatty acyl
chain as counted from the carboxyl terminus. Further, the present invention
provides
isolated non-coding regions of such genomic polynucleotide sequences,
particularly
including the introns, and promoter regions. Specific oligonucleotides are
provided which
include partial or complete sequences which are derived from Al2 and M5
desaturase
promoter and intron sequences. Although the sequences disclosed herein are
obtained
from soybean plants, it is contemplated that additional sequences can be
derived from
intron and promoter regions of desaturase genomic polynucleotide sequences
which are
homologous or have identity to the soybean desaturase sequences. Such
additional
desaturase sequences can be obtained using standard methods described below
from a
variety of plant sources, in particular oilseed crops.
3
CA 02816177 2013-05-22
It is also an aspect of the present invention to provide recombinant DNA
constructs
which can be used for the modification of the fatty acid composition in a
plant and in
particular, to modify the transcription or transcription and translation
(expression) of
desaturase genes or proteins, such as Al2 and A15 desaturase. The invention is
particularly
directed to DNA constructs which include sequences which are derived from the
intron or
promoter regions of a genomic clone wherein said sequences are in a sense or
antisense,
orientation in a DNA construct. These DNA constructs are then used to
transform or
transfect host cells to produce plants with modified levels of fatty acids,
particularly
modified levels of oleic, linoleic and linolenic acid. It is particularly
contemplated to
provide constructs and methods for down regulating Al2 and A15 desaturase gene
expression, so as to increase the levels of oleic acid and to decrease the
levels of linoleic
acid and linolenic acid. It is particularly contemplated to alter the fatty
acid composition in
seed tissue of oilseed crops.
The modified plant cells, plants, seeds and oils obtained by the expression of
the
Al2 and L15 desaturase polynucleotides are also considered part of the
invention. Further,
it is contemplated to produce oil compositions with specific relative levels
of each fatty
acid. One preferred embodiment comprises at least about 80-85% oleic acid, no
more than
about 1-2% linoleic acid, and no more than about 1-3% linolenic acid; and a
second
preferred embodiment comprising at least about 50-75% oleic acid, at least
about 10-30%
linoleic acid, and no more than about 3% linolenic acid.
4
CA 02816177 2013-05-22
In accordance with one embodiment of the present invention there is provided
an
isolated polynucleotide selected from the group consisting of:
a) a polynucleotide comprising SEQ ID NO: 3;
b) a polynucleotide sequence having at least 95% identity to that of SEQ ID
NO: 3 over
the entire length of SEQ ID NO: 3;
c) a polynucleotide sequence having at least 97% identity to that of SEQ ID
NO: 3 over
the entire length of SEQ ID NO: 3;
d) a polynucleotide sequence having at least 98% identity to that of SEQ ID
NO: 3 over
the entire length of SEQ ID NO: 3;
e) a polynucleotide sequence having at least 99% identity to that of SEQ ID
NO: 3 over
the entire length of SEQ ID NO: 3; and
f) a polynucleotide sequence complementary to the polynucleotide sequence
of (a), (b),
(c), (d), or (e).
In accordance with another embodiment of the present invention there is
provided
an isolated polynucleotide selected from the group consisting of:
a) a polynucleotide comprising SEQ ID NO: 4;
b) a polynucleotide sequence having at least 95% identity to that of SEQ ID
NO: 4 over
the entire length of SEQ ID NO: 4;
c) a polynucleotide sequence having at least 97% identity to that of SEQ ID
NO: 4 over
the entire length of SEQ ID NO: 4;
d) a polynucleotide sequence having at least 98% identity to that of SEQ ID
NO: 4 over
the entire length of SEQ ID NO: 4;
e) a polynucleotide sequence having at least 99% identity to that of SEQ ID
NO: 4 over
the entire length of SEQ ID NO: 4; and
f) a polynucleotide sequence complementary to the polynucleotide sequence
of (a), (b),
(c), (d), or (e).
4a
CA 02816177 2013-05-22
In accordance with another embodiment of the present invention there is
provided
an isolated polynucleotide selected from the group consisting of:
a) a polynucleotide comprising SEQ ID NO: 5;
b) a polynucleotide sequence having at least 95% identity to that of SEQ ID
NO: 5 over
the entire length of SEQ ID NO: 5;
c) a polynucleotide sequence having at least 97% identity to that of SEQ ID
NO: 5 over
the entire length of SEQ ID NO: 5;
d) a polynucleotide sequence having at least 98% identity to that of SEQ ID
NO: 5 over
the entire length of SEQ ID NO: 5;
e) a polynucleotide sequence having at least 99% identity to that of SEQ ID
NO: 5 over
the entire length of SEQ ID NO: 5; and
f) a polynucleotide sequence complementary to the polynucleotide sequence
of (a), (b),
(c), (d), or (e).
In accordance with another embodiment of the present invention there is
provided
an isolated polynucleotide selected from the group consisting of:
a) a polynucleotide comprising SEQ ID NO: 6;
b) a polynucleotide sequence having at least 95% identity to that of SEQ ID
NO: 6 over
the entire length of SEQ ID NO: 6;
c) a polynucleotide sequence having at least 97% identity to that of SEQ ID
NO: 6 over
the entire length of SEQ ID NO: 6;
d) a polynucleotide sequence having at least 98% identity to that of SEQ ID
NO: 6 over
the entire length of SEQ ID NO: 6;
e) a polynucleotide sequence having at least 99% identity to that of SEQ ID
NO: 6 over
the entire length of SEQ ID NO: 6; and
f) a polynucleotide sequence complementary to the polynucleotide sequence
of (a), (b),
(c), (d), or (e).
4b
CA 02816177 2013-05-22
In accordance with another embodiment of the present invention there is
provided
an isolated polynucleotide selected from the group consisting of:
a) a polynucleotide comprising SEQ ID NO: 7;
b) a polynucleotide sequence having at least 95% identity to that of SEQ ID
NO: 7 over
the entire length of SEQ ID NO: 7;
c) a polynucleotide sequence having at least 97% identity to that of SEQ ID
NO: 7 over
the entire length of SEQ ID NO: 7;
d) a polynucleotide sequence having at least 98% identity to that of SEQ ID
NO: 7 over
the entire length of SEQ ID NO: 7;
e) a polynucleotide sequence having at least 99% identity to that of SEQ ID
NO: 7 over
the entire length of SEQ ID NO: 7; and
f) a polynucleotide sequence complementary to the polynucleotide sequence
of (a), (b),
(c), (d), or (e).
In accordance with another embodiment of the present invention there is
provided
an isolated polynucleotide selected from the group consisting of:
a) a polynucleotide comprising SEQ ID NO: 8;
b) a polynucleotide sequence having at least 95% identity to that of SEQ ID
NO: 8 over
the entire length of SEQ ID NO: 8;
c) a polynucleotide sequence having at least 97% identity to that of SEQ ID
NO: 8 over
the entire length of SEQ ID NO: 8;
d) a polynucleotide sequence having at least 98% identity to that of SEQ ID
NO: 8 over
the entire length of SEQ ID NO: 8;
e) a polynucleotide sequence having at least 99% identity to that of SEQ ID
NO: 8 over
the entire length of SEQ ID NO: 8; and
f) a polynucleotide sequence complementary to the polynucleotide sequence
of (a), (b),
(c), (d), or (e).
4c
CA 02816177 2013-05-22
In accordance with another embodiment of the present invention there is
provided
an isolated polynucleotide selected from the group consisting of:
a) a polynucleotide comprising SEQ ID NO: 25;
b) a polynucleotide sequence having at least 95% identity to that of SEQ ID
NO: 25
over the entire length of SEQ ID NO: 25;
c) a polynucleotide sequence having at least 97% identity to that of SEQ ID
NO: 25
over the entire length of SEQ ID NO: 25;
d) a polynucleotide sequence having at least 98% identity to that of SEQ ID
NO: 25
over the entire length of SEQ ID NO: 25;
e) a polynucleotide sequence having at least 99% identity to that of SEQ ID
NO: 25
over the entire length of SEQ ID NO: 25; and
f) a polynucleotide sequence complementary to the polynucleotide sequence
of (a), (b),
(c), (d), or (e).
In accordance with another embodiment of the present invention there is
provided
an isolated polynucleotide selected from the group consisting of:
a) a polynucleotide comprising SEQ ID NO: 26;
b) a polynucleotide sequence having at least 95% identity to that of SEQ ID
NO: 26
over the entire length of SEQ ID NO: 26;
c) a polynucleotide sequence having at least 97% identity to that of SEQ ID
NO: 26
over the entire length of SEQ ID NO: 26;
d) a polynucleotide sequence having at least 98% identity to that of SEQ ID
NO: 26
over the entire length of SEQ ID NO: 26;
e) a polynucleotide sequence having at least 99% identity to that of SEQ ID
NO: 26
over the entire length of SEQ ID NO: 26; and
f) a polynucleotide sequence complementary to the polynucleotide sequence
of (a), (b),
(c), (d), or (e).
4d
CA 02816177 2013-05-22
In accordance with another embodiment of the present invention there is
provided
an intron obtained from a genomic polynucleotide sequence selected from the
group
consisting of:
a) a genomic polynucleotide sequence having at least 95% identity
to coding regions
of SEQ ID NO: 3 over the entire coding regions of SEQ ID NO: 3;
b) a genomic polynucleotide sequence having at least 97% identity to coding
regions
of SEQ ID NO: 3 over the entire coding regions of SEQ ID NO: 3;
c) a genomic polynucleotide sequence having at least 98% identity to coding
regions
of SEQ ID NO: 3 over the entire coding regions of SEQ ID NO: 3; and
d) a genomic polynucleotide sequence having at least 99% identity to coding
regions
of SEQ ID NO: 3 over the entire coding regions of SEQ ID NO: 3.
In accordance with another embodiment of the present invention there is
provided
a recombinant DNA construct comprising at least one of the polynucleotide
sequences
specified hereinabove.
In accordance with another embodiment of the present invention there is
provided
a method of inhibiting gene expression in a plant cell, comprising the steps
of:
transforming a plant cell with a DNA construct comprising a non-coding region
of a gene
to be inhibited positioned in a sense orientation; and growing said cell under
conditions
wherein transcription of said non-coding region is initiated, whereby said
expression of
said gene is inhibited.
In accordance with another embodiment of the present invention there is
provided
a method of inhibiting desaturase expression in a plant cell, comprising the
steps of:
transforming a plant cell with a DNA construct comprising a non-coding region
of a gene
encoding desaturase positioned in an antisense orientation; and
growing said cell under conditions wherein transcription of said non-coding
region is
initiated, whereby said expression of said desaturase is inhibited.
4e
CA 02816177 2013-05-22
In accordance with another embodiment of the present invention there is
provided
a method of modifying fatty acid composition in a plant cell, comprising the
steps of:
transforming a plant cell with a DNA construct comprising a non-coding region
of a gene
encoding desaturase positioned in a sense or an antisense orientation; and
growing said cell under conditions wherein transcription of said non-coding
region is
initiated, whereby said expression of said desaturase is inhibited.
In accordance with another embodiment of the present invention there is
provided
a method of inhibiting desaturase expression in a plant cell, comprising the
steps of:
transforming a plant cell with a DNA construct comprising a nucleic acid
sequence
capable of binding to or cleaving a non-coding region of a gene encoding
desaturase; and
growing said cell under conditions wherein transcription of said nucleic acid
sequence is
initiated, whereby said expression of said desaturase is inhibited.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is directed to genomic desaturase sequences,
particularly the isolated non-coding sequences from genomic fatty acid
desaturase nucleic acid sequences from host cell sources. A desaturase
sequence of this invention includes any nucleic acid
35
4f
CA 02816177 2013-05-22
genomic sequence, including all non-coding regions, encoding amino acids from
a source,
such as a protein, polypeptide or peptide, obtainable from a cell source,
which is capable
of catalyzing the insertion of a double bond into a fatty acyl moiety in a
plant host cell,
i.e., in vivo, or in a plant cell-like environment, i.e. in vitro. As will be
described in more
detail below, specific genomic polynucleotide sequences encoding enzymes which
add
double bonds at the twelfth (M2 desaturase) and fifteenth (A.15 desaturase)
carbon
positions in a fatty acyl chain as counted from the carboxyl terminus are
provided. In
addition, provided herein are specific non-coding regions of such genomic
sequences.
The term "non-coding" refers to sequences of polynucleotides that do not
encode
part or all of an expressed protein. Non-coding sequences include but are not
limited to
introns, promoter regions, and 5' untranslated regions.
The term "intron" as used herein refers to the normal sense of the term as
meaning
a segment of polynucleotides, usually DNA, that does not encode part or all of
an
expressed protein.
The term "exon" as used herein refers to the normal sense of the term as
meaning
a segment of polynucleotides, usually DNA, that encodes part or all of an
expressed
protein.
Thus, the term "intron" refers to gene regions that are transcribed into RNA
molecules, but which are spliced out of the RNA before the RNA is translated
into a
protein. As contrasted to the term "exon" which refers to gene regions that
are transcribed
into RNA and subsequently translated into proteins.
As set forth in detail in the sequence listing and the examples, genomic Al2
desaturase and Al5 desaturase sequences and intron and promoter regions
obtained from
such sequences are provided herein. In particular, two M2 desaturase genomic
clones
5
CA 02816177 2013-05-22
were identified and are set forth in SEQ ID NOs:1 and 23. A single M5
desaturase
genomic clone was identified and is set forth in SEQ ID NO:3. A single intron
region
was obtained from each of the M2 desaturase genomic clones with the sequences
provided in SEQ ID NOs:2 and 24, respectively. The promoter region from each
of the
,Al2 desaturase genomic clones are respectively included in SEQ ID NO:1 (base
pairs 1 -
1094) and SEQ ID NO:23 (base pairs 1 - 1704). The M5 desaturase included seven
introns in the coding region (set forth as SEQ ID NOs:4, 5, 6, 7, 8, 25 and
26). In
addition, preliminary results suggest that there is an additional intron
within the 5'
untranslated region.
Although the sequences described herein are obtained from soybean, it is
contemplated that intron and promoter regions can be obtained from desaturase
genomic
polynucleotide sequences which are homologous or have identity to the soybean
desaturase sequences. In particular, sequences can be obtained from other
plant sources
and particularly from oilseed crops. Such genomic sequences can be obtained
using
standard methods, certain of which are described below.
The sequences of the present invention can be used to modify the fatty acid
composition in a plant (see Example 3 and Table I). In particular, it is shown
that sense
and antisense suppression can be used to obtain broad ranges in the levels of
oleic,
linoleic and linolenic acid. In particular, it is shown that levels of oleic
acid can range
from about 26 to 80 %, levels of linoleic acid can range from about 2.97 to
49.92 % and
levels of linolenic acid can range from about 3.38 to 8.81%. However, these
are merely
representative of the broad range that be can achieved. Moreover, it is
contemplated that
combinations of the sequences could be used to achieve additional fatty acid
compositions. Certain compositions are preferred based on the intended use of
the oil.
6
CA 02816177 2013-05-22
One preferred composition includes at least about 50 - 75% oleic acid, at
least about 10 -
30% linoleic acid and no more than about 3% linolenic acid. A particularly
preferred
embodiment includes at least about 60 - 70% oleic acid, at least about 15 -
20% linoleic
acid and no more than about 3% linolenic acid.
Although the examples set forth herein utilize sense or antisense suppression
to
downregulate the gene of interest, it is contemplated that other means of
modifying gene
expression can be used. In particular, it is contemplated that gene expression
can be down
regulated using DNA binding proteins which can be designed to specifically
bind to the
non-coding regions identified herein or that ribozymes can be designed to
cleave such
non-coding regions. In addition, as described below, other methods of
downregulation of
gene expression which are well known in the art are contemplated and can be
used with
the sequences of the present invention.
Isolated Polynucleotides, Proteins, and Polypeptides
A first aspect of the present invention relates to isolated desaturase
polynucleotides. The polynucleotide sequences of the present invention include
isolated
polynucleotides that are obtainable from genomic nucleic acid sequences.
The invention provides a polynucleotide sequence identical over its entire
length
to each sequence as set forth in the Sequence Listing. The polynucleotide
includes non-
coding sequences, including for example, but not limited to, non-coding 5' and
3'
sequences, such as the transcribed, untranslated sequences, termination
signals, ribosome
binding sites, sequences that stabilize mRNA, introns, polyadenylation
signals, and
additional coding sequence that encodes additional amino acids. For example, a
marker
sequence can be included to facilitate the purification of the fused
polypeptide.
7
CA 02816177 2013-05-22
1
Polynucleotides of the present invention also include polynucleotides
comprising a
structural gene and the naturally associated sequences that control gene
expression.
The invention also includes polynucleotides of the formula:
X-(R1).-(R2)-(R3)n-Y
wherein, at the 5' end, X is hydrogen, and at the 3' end, Y is hydrogen or a
metal, RI and
R3 are any nucleic acid residue, n is an integer between 1 and 3000,
preferably between 1
and 1000 and R2 is a nucleic acid sequence of the invention, particularly a
nucleic acid
sequence selected from the group set forth in the Sequence Listing and
preferably SEQ ID
NOs: 1 - 8, and 23 - 29. In the formula, R2 is oriented so that its 5' end
residue is at the
left, bound to RI, and its 3' end residue is at the right, bound to R3. Any
stretch of nucleic
acid residues denoted by either R group, where R is greater than 1, may be
either a
heteropolymer or a homopolymer, preferably a heteropolymer.
Further preferred embodiments of the invention that are at least 50%, 60%, or
70%
identical over their entire length to a polynucleotide of the invention, and
polynucleotides
that are complementary to such polynucleotides. More preferable are
polynucleotides that
comprise a region that is at least 80% identical over its entire length to a
polynucleotide of
the invention and polynucleotides that are complementary thereto. In this
regard,
polynucleotides at least 90% identical over their entire length are
particularly preferred,
those at least 95% identical are especially preferred. Further, those with at
least 97%
identity are highly preferred and those with at least 98% and 99% identity are
particularly
highly preferred, with those at least 99% being the most highly preferred.
Preferred embodiments are polynucleotides that are obtained from genornic
polynucleotide sequences and set forth in the Sequence Listing.
The invention further relates to polynucleotides that hybridize to the above-
described sequences. In particular, the invention relates to polynucleotides
that hybridize
8
CA 02816177 2013-05-22
under stringent conditions to the above-described polynucleotides. As used
herein, the
terms "stringent conditions" and "stringent hybridization conditions" mean
that
hybridization will generally occur if there is at least 95% and preferably at
least 97%
identity between the sequences. An example of stringent hybridization
conditions is
overnight incubation at 42 C in a solution comprising 50% formamide, 5x SSC
(150 mM
NaC1, 15 mM trisodium citrate), 50 rnM sodium phosphate (pH 7.6), 5x
Denhardt's
solution, 10% dextran sulfate, and 20 micrograms/milliliter denatured, sheared
salmon
sperm DNA, followed by washing the hybridization support in 0.1x SSC at
approximately
65 C. Other hybridization and wash conditions are well known and are
exemplified in
Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, cold
Spring
Harbor, NY (1989), particularly Chapter 11.
The invention also provides a polynucleotide consisting essentially of a
polynucleotide sequence obtainable by screening an appropriate library
containing the
complete gene for a polynucleotide sequence set forth in the Sequence Listing
under
stringent hybridization conditions with a probe having the sequence of said
polynucleotide sequence or a fragment thereof; and isolating said
polynucleotide
sequence. Fragments useful for obtaining such a polynucleotide include, for
example,
probes and primers as described herein.
As discussed herein regarding polynucleotide assays of the invention, for
example,
polynucieotides of the invention can be used as a hybridization probe for RNA,
cDNA, or
genomic DNA to isolate full length cDNAs or genomic clones encoding a
polypeptide
and to isolate cDNA or genomic clones of other genes that have a high sequence
similarity to a polynucleotide set forth in the Sequence Listing. Such probes
will
generally comprise at least 15 bases. Preferably such probes will have at
least 30 bases
9
CA 02816177 2013-05-22
and can have at least 50 bases. Particularly preferred probes will have
between 30 bases
and 50 bases, inclusive.
The region of each gene that comprises or is comprised by a polynucleotide
sequence set forth in the Sequence Listing may be isolated by screening using
a DNA
sequence provided in the Sequence Listing to synthesize an oligonucleotide
probe. A
labeled oligonucleotide having a sequence complementary to that of a
polynucleotide of
the invention is then used to screen a library of cDNA, genornic DNA or mRNA
to
identify members of the library which hybridize to the probe. For example,
synthetic
oligonucleotides are prepared which correspond to the desaturase promoter and
intron
sequences. In particular, screening of cDNA libraries in ph age vectors is
useful in such
methods due to lower levels of background hybridization.
Typically, a desaturase sequence obtainable from the use of nucleic acid
probes
will show 60-70% sequence identity between the target desaturase sequence and
the
encoding sequence used as a probe. However, lengthy sequences with as little
as 50-60%
sequence identity may also be obtained. The nucleic acid probes may be a
lengthy
fragment of the nucleic acid sequence, or may also be a shorter,
oligonucleotide probe.
When longer nucleic acid fragments are employed as probes (greater than about
100 bp),
one may screen at lower stringencies in order to obtain sequences from the
target sample
which have 20-50% deviation (i.e., 50-80% sequence homology) from the
sequences used
as probe. Oligonucleotide probes can be considerably shorter than the entire
nucleic acid
sequence encoding an desaturase enzyme, but should be at least about 10,
preferably at
least about 15, and more preferably at least about 20 nucleotides. A higher
degree of
sequence identity is desired when shorter regions are used as opposed to
longer regions.
It may thus be desirable to identify regions of highly conserved amino acid
sequence to
design oligonucleotide probes for detecting and recovering other related
desaturase genes.
1 0
CA 02816177 2013-05-22
Shorter probes are often particularly useful for polymerase chain reactions
(PCR),
especially when highly conserved sequences can be identified. (See, Gould, et
al., PNAS
USA (1989) 86:1934-1938.).
"Identity", as is well understood in the art, is a relationship between two or
more
polypeptide sequences or two or more polynucleotide sequences, as determined
by
comparing the sequences. In the art, "identity" also means the degree of
sequence
relatedness between polypeptide or polynucleotide sequences, as determined by
the match
between strings of such sequences. "Identity" can be readily calculated by
known
methods including, but not limited to, those described in Computational
Molecular
Biology, L,esk, A.M., ed., Oxford University Press, New York (1988);
Biocomputing:
Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York,
1993;
Computer Analysis of Sequence Data, Part I, Griffin, A.M. and Griffin, H.G.,
eds.,
Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology, von
Heinje,
G., Academic Press (1987); Sequence Analysis Primer, Gribskov, M. and
Devereux, J.,
eds., Stockton Press, New York (1991); and Carillo, H., and Lipman, D., SIAM
.1 Applied
Math, 48:1073 (1988). Methods to determine identity are designed to give the
largest
match between the sequences tested. Moreover, methods to determine identity
are
codified in publicly available programs. Computer programs which can be used
to
determine identity between two sequences include, but are not limited to, GCG
(Devereux, J., et al., Nucleic Acids Research 12(1):387 (1984); suite of five
BLAST
programs, three designed for nucleotide sequences queries (BLASTN, BLASTX, and
TBLASTX) and two designed for protein sequence queries (BLASTP and TBLASTN)
(Coulson, Trends in Biotechnology, 12: 76-80 (1994); Birren, et al., Genome
Analysis,]:
543-559 (1997)). The BLAST X program is publicly available from NCBI and other
sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH, Bethesda, MD 20894;
11
CA 02816177 2013-05-22
Altschul, S., et al., J. Mol. Biol., 215:403-410 (1990)). The well known Smith
Waterman
algorithm can also be used to determine identity.
Parameters for polypeptide sequence comparison typically include the
following:
Algorithm: Needleman and Wunsch, ./. Mol. Biol. 48:443-453 (1970)
Comparison matrix: BLOSSUM62 from Hentikoff and Hentikoff, Proc. Natl.
Acad. Sci USA 89:10915-10919 (1992)
Gap Penalty: 12
Gap Length Penalty: 4
A program which can be used with these parameters is publicly available as the
"gap" program from Genetics Computer Group, Madison Wisconsin. The above
parameters along with no penalty for end gap are the default parameters for
peptide
comparisons.
Parameters for polynucleotide sequence comparison include the following:
Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970)
Comparison matrix: matches = +10; mismatches = 0
Gap Penalty: 50
Gap Length Penalty: 3
A program which can be used with these parameters is publicly available as the
"gap" program from Genetics Computer Group, Madison Wisconsin. The above
parameters are the default parameters for nucleic acid comparisons.
For immunological screening, antibodies to the protein can be prepared by
injecting rabbits or mice with the purified protein or portion thereof, such
methods of
preparing antibodies being well known to those in the art. Either monoclonal
or
polyclonal antibodies can be produced, although typically polyclonal
antibodies are more
useful for gene isolation. Western analysis may be conducted to determine that
a related
12
CA 02816177 2013-05-22
protein is present in a crude extract of the desired plant species, as
determined by cross-
reaction with the antibodies to the encoded proteins. When cross-reactivity is
observed,
genes encoding the related proteins are isolated by screening expression
libraries
representing the desired plant species. Expression libraries can be
constructed in a variety
of commercially available vectors, including lambda gt11, as described in
Sambrook, et
al. (Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring
Harbor Laboratory, Cold Spring Harbor, New York).
Plant Constructs and Methods of Use
Of particular interest is the use of the polynucleotide sequences in
recombinant
DNA constructs to direct the transcription of the desaturase genornic
sequences of the
present invention in a host plant cell. The expression constructs generally
comprise a
promoter functional in a host plant cell operably linked to a nucleic acid
sequence of the
present invention and a transcriptional termination region functional in a
host plant cell.
Those skilled in the art will recognize that there are a number of promoters
which
are functional in plant cells, and have been described in the literature.
Chloroplast and
plastid specific promoters, chloroplast or plastid functional promoters, and
chloroplast or
plastid operable promoters are also envisioned.
2 0 One set of promoters are constitutive promoters such as the CaMV35S or
FMV35S promoters that yield high levels of expression in most plant organs.
Enhanced or
duplicated versions of the CaMV35S and FMV35S promoters are useful in the
practice of
this invention (Odell, et al. (1985) Nature 313:810-812; Rogers, U.S. Patent
Number
5,378, 619). In addition, it may also be preferred to bring about expression
of the
sequences of the present invention in specific tissues of the plant, such as
leaf, stem, root,
13
CA 02816177 2013-05-22
tuber, seed, fruit, etc., and the promoter chosen should have the desired
tissue and
developmental specificity.
Of particular interest is the expression of the nucleic acid sequences of the
present
invention from transcription initiation regions which are preferentially
expressed in a
plant seed tissue. Examples of such seed preferential transcription initiation
sequences
include those sequences derived from sequences encoding plant storage protein
genes or
from genes involved in fatty acid biosynthesis in oilseeds. Examples of such
promoters
include the 5' regulatory regions from such genes as napin (Kridlet al., Seed
Sci. Res.
1:209:219 (1991)), phaseolin, zein, soybean trypsin inhibitor, ACP, stearoyl-
ACP
desaturase, soybean a' subunit of P-conglycinin (soy 7s, (Chen et al., Proc.
NatL Acad.
Sci., 83:8560-8564 (1986))) and oleosin.
It may be advantageous to direct the localization of proteins conferring
desaturase
to a particular subcellular compartment, for example, to the mitochondrion,
endopiasmic
reticulum, vacuoles, chloroplast or other plastidic compartment. For example,
where the
genes of interest of the present invention will be targeted to plastids, such
as chloroplasts,
for expression, the constructs will also employ the use of sequences to direct
the gene to
the plastid. Such sequences are referred to herein as chloroplast transit
peptides (CTP) or
plastid transit peptides (PT?). In this manner, where the gene of interest is
not directly
inserted into the plastid, the expression construct will additionally contain
a gene
encoding a transit peptide to direct the gene of interest to the plastid. The
chloroplast
transit peptides may be derived from the gene of interest, or may be derived
from a
heterologous sequence having a CTP. Such transit peptides are known in the
art. See, for
example, Von Heijne et al. (1991) Plant Mol. Biol. Rep. 9:104-126; Clark et
al. (1989) J.
Biol. Chem. 264:17544-17550; della-Cioppa et al. (1987) Plant Physiol. 84:965-
968;
14
CA 02816177 2013-05-22
Romer et al. (1993) Biochem. Biophys. Res Commun. 196:1414-1421; and, Shah
etal.
(1986) Science 233:478-481.
Depending upon the intended use, the constructs may contain the entire genomic
nucleic acid sequence or a particular non-coding region of such a sequence or
a portion of
such sequences. For example, where antisense inhibition of a given desaturase
protein is
desired, the entire sequence is not required. Furthermore, where desaturase
sequences
used in constructs are intended for use as probes, it may be advantageous to
prepare
constructs containing only a particular portion of a desaturase sequence, for
example a
sequence which encodes a highly conserved desaturase region.
The skilled artisan will recognize that there are various methods for the
inhibition
of expression of endogenous sequences in a host cell. Such methods include,
but are not
limited to, antisense suppression (Smith, et al. (1988) Nature 334:724-726) ,
co-
suppression (Napoli, et al. (1989) Plant Cell 2:279-289), ribozymes (PCT
Publication
WO 97/10328), combinations of sense and antisense (Waterhouse, et a/. (1998)
Proc.
Natl. Acad. Sci. USA 95:13959-13964), promoter silencing (Park, et al. (1996)
Plant J.
9(2):183-194), DNA binding proteins (Beerli, et al. (1997) Proc. Natl. Acad.
Sci. USA,
95:14628-14633; and Liu, et al. (1998) Proc. Natl. Acad. Sci. USA, 94:5525-
5530).
Methods for the suppression of endogenous sequences in a host cell typically
employ the
transcription or transcription and translation of at least a portion of the
sequence to be
suppressed. Such sequences may be homologous to coding as well as non-coding
regions
of the endogenous sequence.
Regulatory transcript termination regions may be provided in plant expression
constructs of this invention as well. Transcript termination regions may be
provided by
the DNA sequence encoding the desaturase or a convenient transcription
termination
region derived from a different gene source, for example, the transcript
termination region
CA 02816177 2013-05-22
which is naturally associated with the transcript initiation region. The
skilled artisan will
recognize that any convenient transcript teimination region which is capable
of
terminating transcription in a plant cell may be employed in the constructs of
the present
invention.
Alternatively, constructs may be prepared to direct the expression of the
desaturase sequences directly from the host plant cell plastid. Such
constructs and
methods are known in the art and are generally described, for example, in
Svab, et at.
(1990) Proc. Natl. Acad. Sci. USA 87:8526-8530 and Svab and Maliga (1993)
Proc. Natl.
Acad. Sci. USA 90:913-917 and in U.S. Patent Number 5,693,507.
A plant cell, tissue, organ, or plant into which the recombinant DNA
constructs
containing the expression constructs have been introduced is considered
transformed,
transfected, or transgenic. A transgenic or transformed cell or plant also
includes progeny
of the cell or plant and progeny produced from a breeding program employing
such a
transgenic plant as a parent in a cross and exhibiting an altered phenotype
resulting from
the presence of a desaturase nucleic acid sequence.
Plant expression or transcription constructs having a desaturase
polynucleotide of
the present invention as the DNA sequence of interest for increased or
decreased
expression thereof may be employed with a wide variety of plant life,
particularly, plant
life involved in the production of vegetable oils for edible and industrial
uses. Most
especially preferred are temperate oilseed crops. Plants of interest include,
but are not
limited to, rapeseed (Canola and High Erucic Acid varieties), sunflower,
safflower,
cotton, soybean, peanut, coconut and oil palms, and corn. Depending on the
method for
introducing the recombinant constructs into the host cell, other DNA sequences
may be
required. Importantly, this invention is applicable to dicotyledons and
monocotyledons
16
CA 02816177 2013-05-22
species alike and will be readily applicable to new and/or improved
transformation and
regulation techniques.
Of particular interest, is the use of plant desaturase promoter and/or intron
constructs in plants to produce plants or plant parts, including, but not
limited to leaves,
stems, roots, reproductive, and seed, with a modified fatty acid composition.
Of
particular interest in the desaturase promoter and/or intron constructs is the
use of the
promoter and/or intron sequences of the A-12 and A-I5 desaturase genomic
sequences in
sense or antisense orientations for the modification of fatty acid
compositions in host
cells.
The polynucleotides of the present invention can be used in the preparation of
constructs for use in a variety of host cells. Host for use in the present
invention include,
but are not limited to plant cells, bacterial cells, fungal cells (including
yeast), insect cells,
and mammalian cells.
For example, to confirm the activity and specificity of the proteins encoded
by the
identified nucleic acid sequences as desaturase enzymes, in vitro assays can
be performed
in insect cell cultures using baculovirus expression systems. Such baculovirus
expression
systems are known in the art and are described by Lee, et al. U.S. Patent
Number
5,348,886.
The method of transformation in obtaining such transgenic plants is not
critical to
the instant invention, and various methods of plant transformation are
currently available.
Furthermore, as newer methods become available to transform crops, they may
also be
directly applied hereunder. For example, many plant species naturally
susceptible to
Agrobacteriurn infection may be successfully transformed via tripartite or
binary vector
methods of Agrobacterium mediated transformation. In many instances, it will
be
desirable to have the construct bordered on one or both sides by T-DNA,
particularly
17
CA 02816177 2013-05-22
having the left and right borders, more particularly the right border. This is
particularly
useful when the construct uses A. tumefaciens or A. rhizo genes as a mode for
transformation, although the T-DNA borders may find use with other modes of
transformation. In addition, techniques of microinjection, DNA particle
bombardment,
and electroporation have been developed which allow for the transformation of
various
monocot and dicot plant species.
Normally, included with the DNA construct will be a structural gene having the
necessary regulatory regions for expression in a host and providing for
selection of
transformant cells. The gene may provide for resistance to a cytotoxic agent,
e.g.
antibiotic, heavy metal, toxin, etc., complementation providing prototrophy to
an
auxotrophic host, viral immunity or the like. Depending upon the host species
the
expression construct or components thereof are introduced, one or more markers
may be
employed, where different conditions for selection are used for the different
hosts.
Where Agrobacterium is used for plant cell transformation, a vector may be
used
which may be introduced into the Agrobacterium host for homologous
recombination
with T-DNA or the Ti- or Ri-plasrnid present in the Agrobacterium host. The Ti-
or Ri-
plasmid containing the T-DNA for recombination may be armed (capable of
causing gall
formation) or disarmed (incapable of causing gall formation), the latter being
permissible,
so long as the vir genes are present in the transformed Agrobacterium host.
The armed
plasmid can give a mixture of normal plant cells and gall.
In some instances where Agrobacterium is used as the vehicle for transforming
host plant cells, the expression or transcription construct bordered by the T-
DNA border
region(s) will be inserted into a broad host range vector capable of
replication in E. coli
and Agrobacterium, there being broad host range vectors described in the
literature.
Commonly used is pRI(2 or derivatives thereof. See, for example, Ditta, et
al., (Proc.
18
CA 02816177 2013-05-22
Nat. Acad. Sci., U.S.A. (1980) 77:7347-7351) and EPA 0 120 515..
Alternatively, one may insert the sequences to be expressed in plant
cells into a vector containing separate replication sequences, one of which
stabilizes the
vector in E. coli, and the other in Agrobacterium. See, for example, McBride
and
Summerfelt (Plant Mol. Biol. (1990) /4:269-276), wherein the pRiHRI (Jouanin,
et al.,
Mol. Gen. Genet. (1985) 201:370-374) origin of replication is utilized and
provides for
added stability of the plant expression vectors in host Agrobacterium cells.
Included with the expression construct and the T-DNA will be one or more
markers, which allow for selection of transformed Agrobacterium and
transformed plant
cells. A
number of markers have been developed for use with plant cells, such as
resistance to
chloramphenicol, kanamycin, the aminoglycoside G418, hygromycin, or the like.
The
particular marker employed is not essential to this invention, one or another
marker being
preferred depending on the particular host and the manner of construction.
:For transformation of plant cells using Agrobacteriurn, explants may be
combined
and incubated with the transformed Agrobacterium for sufficient time for
transformation,
the bacteria killed, and the plant cells cultured in an appropriate selective
medium. Once
callus forms, shoot formation can be encouraged by employing the appropriate
plant
hormones in accordance with known methods and the shoots transferred to
rooting
medium for regeneration of plants.- The plants may then be grown to seed and
the seed
used to establish repetitive generations and for isolation of vegetable oils.
For the alteration of unsaturated fatty acid production in a host cell, a
second
expression construct can be used in accordance with the present invention. For
example,
the desaturase expression construct can be introduced into a host cell in
conjunction with
19
CA 02816177 2013-05-22
a second expression construct having a nucleotide sequence for a protein
involved in
fatty acid biosynthesis.
There are several possible ways to obtain the plant cells of this invention
which
contain multiple expression constructs. Any means for producing a plant
comprising a
construct having a DNA sequence encoding the expression construct of the
present
invention, and at least one other construct having another DNA sequence
encoding an
enzyme are encompassed by the present invention. For example, the expression
construct
can be used to transform a plant at the same time as the second construct
either by
inclusion of both expression constructs in a single transformation vector or
by using
separate vectors, each of which express desired genes. The second construct
can be
introduced into a plant which has already been transformed with the desaturase
expression
construct, or alternatively, transformed plants, one expressing the desaturase
construct and
one expressing the second construct, can be crossed to bring the constructs
together in the
same plant.
The invention now being generally described, it will be more readily
understood
by reference to the following examples which are included for purposes of
illustration
only and are not intended to limit the present invention.
EXAMPLES
Example 1 Cloning of Desaturase Genomic Sequences
1A. Soybean 4I2 Desaturase (fad2-1)
The soybean fad 2-1A sequence was identified by screening a soybean genomic
library using a soybean fad2-1 cDNA probe. Three putative soy fad 2-1 clones
were
CA 02816177 2013-05-22
identified and plaque purified. Two of the three soy fad 2-1 clones were
ligated into
pBluescript II KS+ (Stratagene) and sequenced. Both clones (14-1 and 11-12)
were the
same and matched the soy fad 2-1 cDNA exactly. The sequence of the entire fad2-
1A
clone is provided in SEQ ID NO: 1.
Prior to obtaining this full length clone, a portion of the fad2-1A genomic
clone
was PCR amplified using PCR primers designed from the 5' untranslated sequence
(Primer 12506, 5'-ATACAA GCCACTAGGCAT-3', SEQ ID NO:9) and within the
cDNA (Primer 11698: 5'-GATTGGCCATGCAATGAGGGAAAAGG-3', SEQ ID
NO:10. The resulting PCR product, which contained the fad2-1A intron, was
cloned into
the vector pCR 2.1 (Invitrogen) and sequenced. The soy fad 2-1A partial
genomic clone
(SEQ ID NO:27) and its intron region (SEQ ID NO:2) were identified by
comparison to
the soybean cDNA sequence using the Pustell comparison program in Macvector.
The
intron sequence begins after the ATG start codon, and is 420 bases long.
A second fad2-1 gene family member was also identified and cloned, and is
referred to herein as fad2-1B. The soy fad 2-1B partial genomic clone (SEQ ID
NO:23)
(contains the promoter (base pairs 1 - 1704); 5'UTR (base pairs 1705 - 1782);
intron#1
(base pairs 1786 - 2190); and a portion of the fad2-1B coding region (base
pairs 1783-
1785 and 2191 - 2463)) and its intron region (SEQ ID NO:24) were identified by
comparison to the soybean cDNA sequence using the Pustell comparison program
in
Macvector. The intron sequence begins after the ATG start codon and is 405
bases long.
1B. Soybean d15 Desaturase (fad3)
The partial soybean fad 3 genomic sequence was PCR amplified from soybean
DNA using primers 10632, 5'-
CUACUACUACUACTCGAGACAAAGCC1-1 AGCCTATG-3' (SEQ ID NO:11), and
21
CA 02816177 2013-05-22
10633: 5'-CAUCAUCAUCAUGGATCCCATGTC TCTCTATGCAAG-3' (SEQ ID
NO:12). The Expand Long Template PCR system (Boehringer Mannheim) was used
according to the manufacturers directions. The resulting PCR products were
cloned into
the vector pCR 2.1 (Invitrogen) and sequenced. The soy fad 3 partial genomic
clone
sequence and the intron regions were confirmed by comparisons to the soybean
fad 3
cDNA sequence using the Pustell program in Macvector. From the identified
partial
genomic soybean fad3 sequence (SEQ ID NO:3), seven introns were identified
(SEQ ID
NO:4 (intron #1), SEQ ID NO:5 (intron #2), SEQ ID NO:6 (intron #3A), SEQ ID
NO:7
(intron #4), SEQ ID NO:8 (intron #5), SEQ ID NO:25 (intron #3B) and SEQ ID
NO:26
(intron #3C)). Intron #1 is 192 base pairs long and is located between
positions 294 and
485, intron #2 is 348 base pairs long and is located between positions 576 and
923, intron
#3A is 142 base pairs long and is located between positions 991 and 1132,
intron 4i3B is
98 base pairs long and is located between positions 1225 and 1322 , intron #3C
is 115
base pairs long and is located between positions 1509 and 1623, intron #4 is
1231 base
pairs long and is located between positions 1705 and 2935, and intron #5 is
626 base pairs
long and is located between positions 3074 and 3699.
Example 2 Expression constructs
The soybean fad2-1A intron sequence was amplified via PCR using the fad2-1A
partial genomic clone (SEQ ID NO:27) as a template and primers 12701 (5'-
ACGAATTCCTCGAGGTAAA TTAAATTGTGCCTGC-3' (SEQ ID NO:13)) and
12702 (5'-GCGAGATCTATCG ATCTGTGTCAAAGTATAAAC-3' (SEQ ID NO:14)).
The resulting amplification products were cloned into the vector pCR 2.1
(Lnvitrogen) and
sequenced. The soyfad2-1A intron was then cloned into the expression cassette,
22
CA 02816177 2013-05-22
pCGN3892, in sense and antisense orientations. The vector pCGN3892 contains
the
soybean 7S promoter and a pea RBCS 3'. Both gene fusions were then separately
ligated into pCGN9372, a vector that contains the CP4 gene regulated by the
FMV
promoter. The resulting expression constructs (PCGN5469 sense and pCGN5471
antisense) were used for transformation of soybean using biolistic methods
described
below.
The soybean fad2-1B intron sequence was amplified via PCR using the fad2-1B
partial
genomic clone (SEQ ID NO:23) as a template and primers 13883 (5'-
GCGATCGATGTATGATGCTAAATTAAATTGTGCCTG -3' (SEQ ID NO:30)) and
13876 (5'- GCGGAATTCCTGTGTCAAAGTATAAAGAAG -3' (SEQ ID NO:31)). The
resulting amplification products were cloned into the vector pCR 2.1
(Invitrogen) and
sequenced. The soyfad2-1B intron was fused to the 3' end of the soy fad 2-1A
intron in
plasmids pCGN5468 (contains the soybean 7S promoter fused to the soy fad2-1A
intron
(sense) and a pea RBCS 3') or pCGN5470 (contains the soybean 7S promoter fused
to
the soy fad2-1A intron (antisense) and a pea RBCS 3') in sense or antisense
orientation
respectively. The resulting intron combo fusions were then ligated separately
into
pCGN9372, a vector that contains the CP4 gene regulated by the FMV promoter.
The
resulting expression constructs (pCGN5485, fad2-1A&B intron sense and
pCGN5486,
fad2-1A&B intron antisense) were used for transformation of soybean using
biolistic
methods described below.
Four of the seven introns identified from the soybean fad 3 genomic clone were
PCR amplified using the soy fad 3 partial genomic clone as template and
primers as
follows: Intron #1, primers 12568: GATCGATGCCCGGGGTAATAA 1-1"1".1-1GTGT
23
CA 02816177 2013-05-22
(SEQ ID NO:15) and 12569: CACGCCTCGAGTGTTCAATTCAATCAATG (SEQ ID
NO:16); Intron #2, primers 12514: 5'-CACTCGAGTTAGTTCATACTGGCT (SEQ ID
NO:17) and 12515: 5'-CGCATCGATTGCAAAATCCATCAAA (SEQ ID NO:18);
Intron #4, primers 10926: 5'-
CUACUACUACUACTCGAGCGTAAATAGTGGGTGAACAC (SEQ ID NO:19) and
10927: 5'-CAUCAUCAUCAUCTCGAGGAATTCGTCCA ______________________________ FYI
TAGTACACC (SEQ ID
NO:20) ; Intron #5, primers 10928: 5'-CUACUACUACUACTCGAGGCGCGT
ACA1-1-1-1ATTGCTTA (SEQ ID NO:21) and 10929: 5'-CAUCAUCAUCAUCT
CGAGGAATTCTGCAGTGAATCCAAATG (SEQ ID NO:22). The resulting PCR
products for each intron were cloned into the vector pCR 2.1 (Invitrogen) and
sequenced.
Introns #1, #2, #4 and #5 were all ligated separately into the, pCGN3892, in
sense or
antisense orientations. pCGN3892 contains the soybean 7S promoter and a pea
RBCS
3'. These fusions were ligated into pCGN9372, a vector that contains the CP4
gene
regulated by the FMV promoter for transformation into soybean. The resulting
expression
constructs (pCGN5455, fad3 intron#4 intron sense; pCGN5459, fad3 intron#4
intron
antisense; pCGN5456, fad3 intron#5 intron sense; pCGN5460, fad3 intron#5
intron
antisense; pCGN5466, fad3 intron#2 intron antisense; pCGN5473, fad3 intron#1
intron
antisense;) were used for transformation of soybean using biolistic methods
described
below.
The soy fad3 Intron #3C and #4 were also PCR amplified from a second fad3 gene
family member, herein referred to as fad3-1B. The soy fad3-1B introns #3C and
#4 were
PCR amplified from soybean DNA using the following primers, 5'
CATGC1"1"1CTGTGC'FTCTC 3' (SEQ ID NO:32) and , 5'
GTTGATCCAACCATAGTCG 3' (SEQ ID NO:33). The PCR products were cloned into
24
CA 02816177 2013-05-22
f
the vector pCR 2.1 (Invitrogen) and sequenced. The sequences for the soy fad3-
1B
introns #3C and #4 are provided in SEQ ID NOs:28 and 29.
Example 3 Plant Transformation and Analysis
Linear DNA fragments containing the expression constructs for sense and
antisense expression of the Al2 and A15 desaturase introns were stably
introduced into
soybean (Asgrow variety A4922) by the method of McCabe, et.al. (1988)
BioiTechnology
6:923-926. Transformed soybean plants were identified by selection on media
containing
glyphosate.
Fatty acid compositions were analyzed from seed of soybean lines
transformed with the intron expression constructs using gas chromatography. T2
pooled
seed and T2 single seed oil compositions demonstrate that the mono and
polyunsaturated
fatty acid compositions were altered in the oil of seeds from transgenic
soybean lines as
compared to that of the seed from non-transformed soybean. Table I provides a
summary
of results which were obtained using the described constructs. These data
clearly show
that sense and antisense expression of the non-coding regions of the
desaturase gene
results in the modification of the fatty acid compositions. The data also
shows that
introns can be used to obtain a variety of lines with varying fatty acid
compositions.
Selections can be made from such lines depending on the desired relative fatty
acid
composition. In addition, since each of the introns is able to modify the
levels of each
fatty acid to varying extents, it is contemplated that combinations of introns
can be used
depending on the desired compositions.
CA 02 81 6177 2013-05-22
,
TABLE I
Linoleic -Linolenic
r..
Fad 2 orientation event _ Oleic
,
wildtype (control) 5469-5 null T2 pool 18.15% 55.59% 7.97%
seed average 13.89% 55.89% 9.067%
5469-27 null T2 pool 19.15% 54.62% 9.32%
A4922 15.75% 56.1% 8.75%
5471-13 null T2 pool 17.02% 56.49% 9.08%
10 seed average 13.86% 56.14% 9.49%
A4922 14.95% 55.95% 9.07%
_
_
full length cDNA sense 5462-133 T2 pool 84% 2.17% 1.55%
(control) best 5462-133 T2 seed 84% 0.59% 1.76%
intron 1 sense 5469-6 T2 pool 79.93% 46.53%
5469-8 T2 pool 36.5% 42.11% 5.98%
best 5469-6 T2 seed 44.41% 29.34% 6.68%
best 5469-8 T2 seed 41.26% 33.16% 5.74%
5469-14T2 pool 61.06% 16.42% 7.75%
5469-20T2 pool 48.89% 31.61% 4.89%
5469-22 T2 pool 80% 2.97% 4.78%
best 5469-14 T2 seed 62.21% 11.97% 8.81%
5485-3 T2 pool .63.54% 14.09% 7.32%
. 5485-53 T2 pool 47.58% 27.64% 7.81%
antisense 5471-8 T2 pool 31.05% 43.62% 7.07%
5471-2 T2 pool 27.98% 48.88% 6.83%
5471-26 T2 pool 32.66% 44.54% 6.76%
best 5471-8 T2 seed 57.4% 23.37% 5.73%
best 5471-2 T2 seed 28.08% 46.14% 6.52%
best 5471-26 T2 seed 43.3% 34.15% 5.6%
5486-33 T2 pool 32.37% 43.66% 6.87%
5486-12 T2 pool 27.32% 46.97% 6.4%
5486-40 T2 pool 26.79% 48.72% 6.55%
_
_
Fad 3 , .
wildtype (control) 5473-7 null T2 pool 15.65% 56.74% 9.55%
A4922 T2 pool 19.84% 56.79% . 7.48%
full length cDNA sense 5464-50 T2 pool 18.06% 62.03%
2.75%
(control) , best 5464-50 T2 seed 17.08% 62.44% _ 1.72%
intron I antisense 5473-8 T2 pool 33.47% 45.97% 5.54%
5473-1 T2 pool 33.34% 42.67% 7.59%
intron 2 antisense 5466-20 T2 pool 28.43% 48.83%
6.37%
5466-16 T2 pool 27.61% 49.92% . 5.96%
-1
intron 4 sense 5455-19 T2 pool 40.35% 39.97% 4.61%
5455-10T2 pool 35.14% 43.59% 5.53%
5455-57 T2 pool 38.04% 42.44% 5.24%
5455-76 T2 pool 37.24% 42.42% 5.37%
5455-107 T2 pool 36.44% 42.72% 5.62%
best 5455-57 T2 seed 45.36% 35.55% 4.92%
best 5455-76 T2 seed 35.3% 43.54% 5.53%
. best 5455-107 T2 seed 45.56% 34.85% . 5.12%
_
antisense 5459-2 T2 pool 34.5% 43.87% 5.59%
5459-6 T2 pool 33.78% 44.12% 5.62%
5459-20 T2 pool 28.26% 49.48% 5.5%
best 5459-2 T2 seed 61.45% 23.45% 3.38%
best 5459-6T2 seed 53.51% 29.68% 3.53%
26
CA 02816177 2013-05-22
[best 5459-20T2 seed 30% 50.55% 4.15%
intron 5 sense 5456-38 T2 pool 28.23% 49.59% 6.74%
5456-62 T2 pool 28.94% 48.66% 6.25%
best 5456-62 T2 seed 29.5% 43.69% 5.4%
anusense 5460-9 12 pool 29.78% 48.57% 5.54%
5460-21 T2 pool 2837% 49.79% 5.54%
best 5460-21 T2 seed 35.18% 40.52% 5.33%
All publications and patent applications mentioned in this specification are
indicative of the level of skill of those skilled in the art to which this
invention pertains.
Although the foregoing invention has been described in some detail by way of
illustration and example for purposes of clarity of understanding, it will be
obvious that
certain changes and modifications may be practiced within the scope of the
appended
claims.
0
27
