Note: Descriptions are shown in the official language in which they were submitted.
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
Disease Risk Factors and Methods of Use
Related Applications
This application claims priority under 35 U.S.C. 119(e) to provisional
patent
application no. 61/431,294, filed January 10, 2011, the disclosure of which is
incorporated by
reference herein in its entirety.
Field of the Invention
The present invention relates to the field of genomics, genetics,
pharmacogenetics, and
bioinformatics, including genome analysis and the study of DNA sequence
variation. The
invention also relates to studies of association between variations in DNA
sequences and
anticipation of an individual's susceptibility to a particular disease,
disorder, or condition and/or
response to or suitability for a particular drug or treatment.
Background
The search for genetic markers associated with complex diseases is ongoing.
Genome-
wide scanning studies with SNP arrays continue to highlight the APOE region as
the most
important area for investigation in the study of Alzheimer's disease (Coon et
al., J. Clin.
Psychiatry 68: 613-8 (2007); Li et al., Arch. Neurol. 65: 45-53 (2007)).
The APOE 4 isoform has previously been strongly associated with increased risk
of
developing late-onset Alzheimer's disease. (Pericak-Vance et al., Am. J. Hum.
Genet. 48, 1034-
50(1991); Martin et al., 2000, US Patent No. 6,027,896 to Roses, et al., US
Patent No. 5,716,828
to Roses et al.). The relationship is dose dependent (Yoshizawa et al.,1994;
Schellenberg, 1995).
That is to say, a carrier of two APOE 4 alleles is more likely to develop late-
onset Alzheimer's
disease (LOAD) than a carrier of only one APOE 4 allele, and at an earlier age
(Corder et al.,.
Science 261, 921-3 (1993)).
Nevertheless, E4 alleles only account for roughly 50% of the inherited risk
for late onset
Alzheimer's disease. One explanation is that APOE 4 is merely serving as a
surrogate marker for
something in linkage disequilibrium nearby. Alternatively, considering the
recent discovery of a
mechanistic role for ApoE 4 in mitochondrial toxicity, the negative effects of
APOE 4 may be
abrogated or exacerbated by another gene product encoded nearby (Chang et al.,
2005).
As APOE status is also associated with risk for coronary artery disease and
likely also a
host of other diseases and disorders, the implications of the study of the
APOE region are not
limited to Alzheimer's disease, but are potentially far-reaching (Mahley et
al., Proc. Natl. Acad.
Sci. USA 103: 5644-51 (2006)). More broadly, the examination of variant
sequences for
processes or pathways surrounding genes in linkage disequilibrium with other
genetic regions
1
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
known to be involved in complex disease processes will provide valuable
information in
deciphering the mechanisms of those diseases.
Summary of the Invention
Provided herein are methods of determining risk for the development of
Alzheimer's
disease in a subject, including in some embodiment: (a) detecting from a
biological sample
containing deoxyribonucleic acid taken from said subject a genetic variant of
the TOMM40 gene
associated with increased or decreased risk of Alzheimer's disease, wherein
the variant is
rs10524523, and wherein the detecting comprises determining a poly-T length
thereof; and/or (b)
determining whether the subject is at increased or decreased risk of the
development of
Alzheimer's disease based upon said poly-T length.
In some embodiments, the method further comprises determining the age of the
subject.
In some embodiments, the method further comprises determining the APOE
genotype of the
subject. In some embodiments, the age and/or APOE genotype of the subject may
also be use in
determining whether the subject is at increased or decreased risk of the
development of
Alzheimer's disease in conjunction with the poly-T length.
In some embodiments, a poly-T length of at least 19 indicates increased risk
of the
development of Alzheimer's disease. In some embodiments, a poly-T length of at
least 26
indicates increased risk of the development of Alzheimer's disease. In some
embodiments, a
poly-T length of at least 30 indicates increased risk of the development of
Alzheimer's disease.
In some embodiments, the detecting step includes determining a poly-T length
of each
rs10524523 allele of the TOMM40 gene in said subject.
In some embodiments, the method further includes the step of: (c)
administering an active
agent to said subject in a treatment effective amount when said subject is
determined to be at
increased risk of Alzheimer's disease. In some embodiments, the agent is
administered in an
amount effective to delay the onset of Alzheimer's disease or a symptom
thereof.
In some embodiments, the administering step is carried out in said subject at
an earlier
age when the subject is determined to be at increased risk by the presence of
a poly-T length of
at least 19, as compared to a subject in which said poly-T length of at least
19 is not present (e.g.,
beginning at age 45, 46, 47, 48, 49, 50, 51, 52, or 53, and continuously
through each year
thereafter, rather than beginning at age 55 or more; at age 50, 51, 52, 53,
54, 55, 56, 57, or 58,
and continuously through each year thereafter, rather than beginning at age 60
or more; at age
55, 56, 57, 58, 59, 60, 61, 62, or 63, and continuously through each year
thereafter, rather than
beginning at age 65 or more; and at age 60, 61, 62, 63, 64, 65, 66, 67, or 68,
and continuously
through each year thereafter, rather than beginning at age 70 or more).
2
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
In some embodiments, the active agent is a peroxisome proliferator-activated
receptor
agonist or modulator, for example, pioglitazone or a pharmaceutically
acceptable salt thereof.
Also provided is a method of treating a subject for Alzheimer's disease by
administering
an active agent to said subject in a treatment-effective amount; the method
including
administering said active agent to said subject at an earlier age when said
subject carries a
genetic variant of the TOMM40 gene associated with increased risk of
Alzheimer's disease as
compared to a corresponding subject who does not carry said genetic variant,
wherein said
genetic variant of the TOMM40 gene is rs10524523, to thereby treat said
Alzheimer's disease.
In some embodiments, treating is carried out by delaying the onset of
Alzheimer's
disease or a symptom thereof with the administering.
In some embodiments, the active agent is a peroxisome proliferator-activated
receptor
agonist or modulator, for example, pioglitazone or a pharmaceutically
acceptable salt thereof.
In some embodiments, the variant comprises a poly-T of at least 19 contiguous
base
pairs. In some embodiments, the variant comprises a poly-T of at least 26
contiguous base pairs.
In some embodiments, the variant comprises a poly-T of at least 30 contiguous
base pairs.
Also provided is a method of determining a risk for developing Alzheimer's
disease in a
patient including: (a) obtaining a patient profile, wherein said obtaining a
patient profile may
include: (i)detecting a genetic variant of the TOMM40 gene associated with
increased or
decreased risk of Alzheimer's disease, wherein said variant is rs10524523, and
wherein said
detecting comprises determining the poly-T length thereof; wherein the length
identifies said
patient as a patient at risk for developing Alzheimer's disease at an earlier
or later age, (it)
determining the age of said patient, and then (b) converting said patient
profile into said risk.
In some embodiments, obtaining a patient profile may include determining the
APOE
genotype of said patient. In some embodiments, the converting step may be
carried out by
computer program instructions.
Provided herein is a method for identifying a genetic variant that is
associated with
development of a condition of interest (e.g., earlier or later onset of a
disease of interest),
comprising: (a) determining from biological samples containing DNA the
nucleotide sequences
carried by a plurality of individual human subjects at a genetic locus of
interest, wherein subjects
include both (i) subjects affected with the condition of interest and (it)
subjects unaffected with
the condition of interest; (b) identifying genetic variants at said genetic
locus from nucleotide
sequences observed in said plurality of subjects (e.g., using a multiple
sequence alignment
analysis); (c) mapping said genetic variants by constructing a phylogenetic
tree of said
nucleotide sequences of said subjects, said tree comprising branches that
identify variant changes
between said subjects (e.g., variant changes on the same cistron); (d)
examining the genetic
3
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
variants represented as branches in said tree and determining the ratio of
affected and unaffected
subjects to identify those changes that lead to a changed ratio of affected to
unaffected subjects
(preferably wherein the starting point is the genetic variant representing the
greatest number of
subjects); and then (e) identifying a genetic variant or group of variants (a
haplotype) where the
ratio of affected to unaffected subjects is substantially different from one
or more adjacent
variants on said tree (e.g., at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50,
55, 60, 65, 70, 75, 80, 85,
or 90 % different) to thereby identify a genetic variant associated with the
development of said
condition of interest.
In some embodiments, all subjects carry a same known polymorphism that is
associated
with the condition of interest.
In some embodiments, the condition of interest is a neurodegenerative disease,
a
metabolic disease (e.g., dyslipidemia), a cardiovascular disease, a
psychiatric disorder, or cancer.
In some embodiments, the disease of interest is a disease in which ApoE and/or
TOMM40 are
implicated in disease pathogenesis.
In some embodiments, the condition of interest is associated with increased or
decreased
mitochondrial dysfunction. In some embodiments, the condition of interest is
schizophrenia. In
some embodiments, the condition of interest is coronary artery disease. In
some embodiments,
the condition of interest is diabetes mellitus, type II. In some embodiments,
the condition of
interest is Parkinson's disease. In some embodiments, the condition of
interest is Alzheimer's
disease.
In some embodiments, the known polymorphism risk factor is the Apolipoprotein
E allele
(e.g., ApoE 2, ApoE 3 or ApoE 4).
In some embodiments, the genetic locus of interest is in linkage
disequilibrium with the
known polymorphism. In some embodiments, the genetic locus of interest is on
the same
chromosome and less than 10, 20, 30, 40, or 50 kilobases away from the known
polymorphism.
In some embodiments, the genetic locus is TOMM40.
Also provided is a method of determining increased risk for development of a
condition
of interest, comprising: (a) determining from a biological sample containing
DNA a genetic
variant identified by the method of any of the preceding paragraphs carried by
an individual
subject; and then (b) determining the subject is at increased risk for
development of the condition
of interest when the genetic variant is present.
Further provided is a method of determining increased risk for development of
Alzheimer's disease in a subject (e.g., a subject carrying at least one Apo E3
allele), comprising:
(a) detecting from a biological sample containing DNA taken from the subject
the presence or
absence of a genetic variant of the TOMM40 gene associated with increased or
decreased risk of
4
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
Alzheimer's disease; and (b) determining the subject is at increased or
decreased risk of
Alzheimer's disease when the genetic variant is present or absent.
In some embodiments, it is determined whether the subject is an Apo E2/E2,
E2/E3,
E2/E4, E3/E3, E3/E4, or E4/E4 subject. In some embodiments, it is determined
whether the
subject is an Apo E3/E3 or E3/E4 subject.
In some embodiments, the method further includes the step of: (c)
administering an anti-
Alzheimer's disease active agent to the subject in a treatment effective
amount when the subject
is determined to be at increased risk of Alzheimer's disease.
In some embodiments, the administering step is carried out in the subject at
an earlier age
when the subject is determined to be at increased risk by the presence or
absence of the genetic
variant as compared to a subject in which the genetic variant is not present
or absent (e.g., for an
ApoE 4/4 subject, beginning at age 45, 46, 47, 48, 49, 50, 51, 52, or 53, and
continuously
through each year thereafter, rather than beginning at age 55 or more; for an
ApoE 4/3 subject, at
age 50, 51, 52, 53, 54, 55, 56, 57, or 58, and continuously through each year
thereafter, rather
than beginning at age 60 or more; for an ApoE 3/3 subject, at age 55, 56, 57,
58, 59, 60, 61, 62,
or 63, and continuously through each year thereafter, rather than beginning at
age 65 or more;
and for an ApoE 2/3 subject, at age 60, 61, 62, 63, 64, 65, 66, 67, or 68, and
continuously
through each year thereafter, rather than beginning at age 70 or more).
In some embodiments, the active agent is selected from the group consisting of
acetylcholinesterase inhibitors, NMDA receptor antagonists, PPAR agonists or
modulators (e.g.,
drugs in the thiazolidinedione or glitazar classes), antibodies, fusion
proteins, therapeutic RNA
molecules, and combinations thereof. In some embodiments, the active agent is
rosiglitazone or a
pharmaceutically acceptable salt thereof.
In some embodiments, the genetic variant of the TOMM40 is a variant listed in
Table 1
as set forth below. In some embodiments, the genetic variant of TOMM40 is
rs10524523, and
increased risk is determined by a poly-T of 19 or greater at this locus.
Also provided is a method of treating a subject (e.g., a subject having at
least one ApoE
3) allele for Alzheimer's disease by administering an anti-Alzheimer's disease
active agent to the
subject in a treatment-effective amount; the improvement comprising:
administering the active
agent to the subject at an earlier age when the subject carries a genetic
variant of the TOMM40
gene associated with increased risk of Alzheimer's disease as compared to a
corresponding
subject who does not carry the genetic variant (e.g., for an ApoE 4/4 subject,
beginning at age
45, 46, 47, 48, 49, 50, 51, 52, or 53, and continuously through each year
thereafter, rather than
beginning at age 55 or more; for an ApoE 4/3 subject, at age 50, 51, 52, 53,
54, 55, 56, 57, or 58,
and continuously through each year thereafter, rather than beginning at age 60
or more; for an
5
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
ApoE 3/3 subject, at age 55, 56, 57, 58, 59, 60, 61, 62, or 63, and
continuously through each year
thereafter, rather than beginning at age 65 or more; and for an ApoE 2/3
subject, at age 60, 61,
62, 63, 64, 65, 66, 67, or 68, and continuously through each year thereafter,
rather than beginning
at age 70 or more).
In some embodiments, the subject is an Apo E2/E2, E2/E3, E2/E4, E3/E3, E3/E4,
E4/E4
subject. In some embodiments, the subject is an Apo E3/E3 or E3/E4 subject.
In some embodiments, the active agent is selected from the group consisting of
acetylcholinesterase inhibitors, NMDA receptor antagonists, PPAR agonists or
modulators (e.g.,
drugs in the thiazolidinedione or glitazar classes), antibodies, fusion
proteins, therapeutic RNA
molecules, and combinations thereof. In some embodiments, the active agent is
pioglitazone,
rosiglitazone, or a pharmaceutically acceptable salt thereof.
In some embodiments, the genetic variant of the TOMM40 gene is a
deletion/insertion
polymorphism (DIP). In some embodiments, the DIP is an insertion polymorphism.
In some
embodiments, the DU' is poly-T deletion/insertion polymorphism (e.g., between
5 and 100, or
10 and 80, or 20 and 50 bp poly-T).
In some embodiments, the genetic variant of the TOMM40 is a variant listed in
Table 1
as set forth below. In some embodiments, the DIP is rs10524523, rs10602329 or
DIP3. In some
embodiments, the genetic variant of TOMM40 is rs10524523, and increased risk
is determined
by a poly-T of 19 or greater at this locus.
Further provided is a method of treatment for a condition of interest, wherein
the _
condition of interest is associated with ApoE and/or TOMM40, for a patient in
need thereof, the
method including the steps: (a) determining the presence or absence of a
genetic variant
identified by the method as detailed herein carried by an individual subject
to generate a genetic
profile of the patient; and then, if the profile is indicative of the patient
being responsive to an
active agent, (b) administering the active agent to the subject in a treatment
effective amount to
treat the condition of interest.
In some embodiments, the active agent is selected from the group consisting of
acetylcholinesterase inhibitors, NMDA receptor antagonists, PPAR agonists or
modulators (e.g.,
drugs in the thiazolidinedione or glitazar classes), antibodies, fusion
proteins, therapeutic RNA
molecules, and combinations thereof In some embodiments, the active agent is
rosiglitazone or a
pharmaceutically acceptable salt thereof.
In some embodiments, the genetic variant of the TOMM40 gene is a
deletion/insertion
polymorphism (DIP). In some embodiments, the DIP is an insertion polymorphism.
In some
embodiments, the DIP is poly-T deletion/insertion polymorphism (e.g., between
5 and 100, or
10 and 80, or 20 and 50 bp poly-T insertion).
6
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
In some embodiments, the genetic variant of the TOMM40 is a variant of TOMM40
listed in Table 1 as set forth below. In some embodiments, the DIP is
rs10524523, rs10602329
or DIP3. In some embodiments, the DIP is rs10524523.
Also provided is a method of treatment for Alzheiiner's disease in a subject,
including:
(a) detecting from a biological sample containing DNA taken from the subject
the presence or
absence of a genetic variant of the TOMM40 gene associated with responsiveness
to an active
agent; and, if the genetic variant is present, (b) administering the active
agent to the subject in a
treatment effective amount to treat the Alzheimer's disease.
In some embodiments, the subject carries at least one ApoE 3 allele. In some
embodiments, the subject is an Apo E3/E3 or E3/E4 subject.
In some embodiments, the active agent is selected from the group consisting of
acetylcholinesterase inhibitors, NMDA receptor antagonists, PPAR agonists or
modulators (e.g.,
drugs in the thiazolidinedione or glitazar classes), antibodies, fusion
proteins, therapeutic RNA
molecules, and combinations thereof In some embodiments, the active agent is
pioglitazone,
rosiglitazone, or a pharmaceutically acceptable salt thereof
In some embodiments, the genetic variant of the TOMM40 gene is a
deletion/insertion
polymorphism (DIP). In some embodiments, the DIP is an insertion polymorphism.
In some
embodiments, the DIP is poly-T deletion/insertion polymorphism (e.g., between
5 and 100, or
10 and 80, or 20 and 50 bp poly-T).
In some embodiments, the genetic variant of the TOMM40 gene is a variant
listed in
Table 1 as set forth below. In some embodiments, the DIP is rs10524523,
rs10602329 or DIP3.
In some embodiments, the genetic variant of TOMM40 is rs10524523, and
increased risk is
determined by a poly-T of 19 or greater at this locus.
A method of determining a prognosis for a patient at risk for developing
Alzheimer's
disease is provided, including obtaining a patient profile, wherein the
obtaining a patient profile
includes: detecting the presence or absence of at least one ApoE allele in a
biological sample of
the patient, and detecting the presence or absence of at least one TOMM40
deletion/insertion
polymorphism (DIP) located in intron 6 or intron 9 of the TOMM40 gene, and
then, converting
the patient profile into the prognosis, wherein the presence of the ApoE
allele and the presence
of the at least one TOMM40 DIP polymorphism identifies the patient as a
patient at risk for
developing Alzheimer's disease.
In some embodiments, the DIP is an insertion polymorphism. In some
embodiments, the
DIP is poly-T deletion/insertion polymorphism (e.g., between 5 and 100, or 10
and 80, or 20 and
50 poly-T).
7
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
In some embodiments, the DIP is rs10524523, rs10602329 or DIP3. In some
embodiments, the genetic variant of TOMM40 is rs10524523, and increased risk
is determined
by a poly-T of 19 or greater at this locus.
In some embodiments, the method further includes detecting whether the subject
is an
Apo E2/E2, E2/E3, E2/E4, E3/E3, E3/E4, E4/E4 subject. In some embodiments, the
subject is an
Apo E3/E3 or E3/E4 subject.
Also provided is a method for stratifying a subject into a subgroup of a
clinical trial of a
therapy for the treatment of Alzheimer's disease, the method including:
detecting the presence or
absence of at least one ApoE allele in a biological sample of the patient, and
detecting the
presence or absence of at least one TOMM40 deletion/insertion polymorphism
(DIP) located in
intron 6 or intron 9 of the TOMM40 gene, wherein the subject is stratified
into the subgroup for
the clinical trial of the therapy based upon the presence or absence of the at
least one ApoE
and/or TOMM40 DIP allele.
In some embodiments, the DIP is an insertion polymorphism. In some
embodiments, the
DIP is poly-T insertion polymorphism (e.g., between 5 and 100, or 10 and 80,
or 20 and 50
poly-T insertion).
In some embodiments, the DIP is rs10524523, rs10602329 or DIP3. In some
embodiments, the genetic variant of TOMM40 is rs10524523, and increased risk
is determined
by a poly-T of 19 or greater at this locus.
In some embodiments, the method further includes detecting whether the subject
is an
Apo E2/E2, E2/E3, E2/E4, E3/E3, E3/E4, E4/E4 subject. In some embodiments, the
subject is an
Apo E3/E3 or E3/E4 subject.
Further provided is a method for identifying a patient in a clinical trial of
a treatment for
Alzheimer's disease including: a) identifying a patient diagnosed with
Alzheimer's disease; and
b) determining a prognosis for the patient diagnosed with Alzheimer's disease
comprising
obtaining a patient profile, wherein the patient profile comprises i)
detecting the presence or
absence of at least one ApoE allele in a biological sample of the patient, ii)
detecting the
presence or absence of at least one TOMM40 deletion/insertion polymorphism
(DIP) located in
intron 6 or intron 9 of the TOMM40 gene, and Hi) converting the patient
profile into the
prognosis, the prognosis including a prediction of whether the patient is a
candidate for the
clinical trial for the treatment of Alzheimer's disease.
In some embodiments, the DIP is an insertion polymorphism.ln some embodiments,
the
DIP is poly-T deletion/insertion polymorphism (e.g., between 5 and 100, or 10
and 80, or 20 and
50 poly-T).
8
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
In some embodiments, the DIP is rs10524523, rs10602329 or DIP3. In some
embodiments, the genetic variant of TOMM40 is rs10524523, and increased risk
is determined
by a poly-T of 19 or greater at this locus.
In some embodiments, the method further includes detecting whether the subject
is an
Apo E2/E2, E2/E3, E2/E4, E3/E3, E3/E4, E4/E4 subject. In some embodiments, the
subject is an
Apo E3/E3 or E3/E4 subject.
A kit for determining if a subject is at increased risk of developing late
onset Alzheimer's
disease is provided, including: at least one reagent that specifically detects
the presence or
absence of at least one TOMM40 deletion/insertion polymorphism (DIP) located
in intron 6 or
intron 9 of the TOMM40 gene; and instructions for determining that the subject
is at increased
risk of developing late onset Alzheimer's disease by: (i) detecting the
presence or absence of at
least one TOMM40 deletion/insertion polymorphism (DIP) located in intron 6 or
intron 9 of the
TOMM40 gene; and (iii) observing whether or not the subject is at increased
risk of developing
late onset Alzheimer's disease by observing if the presence of the TOMM40 DIP
is or is not
detected with the at least one reagent, wherein the presence of the TOMM40 DIP
indicates the
subject is at increased risk of developing late onset Alzheimer's disease.
In some embodiments, the at least one reagent and the instructions are
packaged in a
single container.
In some embodiments, the DIP is an insertion polymorphism. In some
embodiments, the
DIP is poly-T deletion/insertion polymorphism (e.g., between 5 and 100, or 10
and 80, or 20 and
50 poly-T).
In some embodiments, the DIP is rs10524523, rs10602329 or DIP3. In some
embodiments, the genetic variant of TOMM40 is rs10524523, and increased risk
is determined
by a poly-T of 19 or greater at this locus.
In some embodiments, the determining step further includes detecting whether
the subject
is an Apo E2/E2, E2/E3, E2/E4, E3/E3, E3/E4, or E4/E4 subject. In some
embodiments, the
subject is an Apo E3/E3 or E3/E4 subject.
A kit is provided for determining if a subject is responsive to treatment for
a condition of
interest, wherein the condition of interest is associated with ApoE and/or
TOMM40, with an
active agent, the kit including: at least one reagent that specifically
detects the presence or
absence of at least one TOMM40 deletion/insertion polymorphism (DIP) located
in intron 6 or
intron 9 of the TOMM40 gene; and instructions for determining that the subject
is responsive to
treatment for the condition of interest with the active agent of interest by:
(i) detecting the
presence or absence of at least one TOMM40 deletion/insertion polymorphism
(DIP) located in
intron 6 or intron 9 of the TOMM40 gene; and (iii) determining whether or not
the subject is
9
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
responsive to treatment by observing if the presence of the TOMM40 DIP is or
is not detected
with the at least one reagent, wherein the presence of the TOMM40 DIP
indicates that the
subject is responsive to the treatment with the active agent.
In some embodiments, the at least one reagent and the instructions are
packaged in a
single container.
In some embodiments, the DIP is an insertion polymorphism. In some
embodiments, the
DIP is poly-T deletion/insertion polymorphism (e.g., between 5 and 100, or 10
and 80, or 20 and
50 bp poly-T).
In some embodiments, the DIP is rs10524523, rs10602329 or DIP3. In some
embodiments, the DIP is rs10524523. In some embodiments, the genetic variant
of TOMM40 is
rs10524523, and increased risk is determined by a poly-T of 19 or greater at
this locus.
In some embodiments, the determining step further includes detecting whether
the subject
is an Apo E2/E2, E2/E3, E2/E4, E3/E3, E3/E4, or E4/E4 subject. In some
embodiments, the
subject is an Apo E3/E3 or E3/E4 subject.
It will be understood that all of the foregoing embodiments can be combined in
any way
and/or combination. The foregoing and other objects and aspects of the present
invention are
explained in greater detail in the drawings provided herewith and in the
specification set forth
below.
Brief Description of the Drawings
Figure 1 shows a general flowchart for identifying a genetic variant in a
predetermined
region of genomic sequence in a genetic locus of interest, which may be
associated with a
condition of interest, according to some embodiments.
Figure 2 shows a graph of the mean age of onset of Alzheimer's disease as a
function of
the inheritance of the five common APOE genotypes, and representing APOE 4 as
a risk factor
for Alzheimer's disease (1993).
Figure 3 shows Regions A, B, and C on Chromosome 19, which are exemplary
genetic
loci of interest. The TOMM40 gene is in close proximity to the ApoE gene and
encodes a 40 kD
protein directed to the outer mitochondrial membrane. TOMM40 is thought to
interact with
ApoE directly in regulation of mitochondrial protein import, and a present
hypothesis is that the
presence of a particular TOMM40 variant(s) exacerbates the increased risk for
Alzheimer's
disease associated with the dose-dependent presence of the APOE 3 allele.
Figure 4 shows the phylogenetic tree that is formed using the sequence data
for the AS
case/control cohort of subjects. 'A' and '13' refer to the two major clades
that arise from the first
branch point. The lengths of the various alleles of rs10524523 ('523) in each
of the terminal
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
clades of this tree are indicated. The APOE allele that is linked in cis to
each rs10524523 length
allele is also indicated.
Figure 5 is a schematic diagram of the phylogenetic tree based on Region B
constructed
for TOMM40, showing the percentages of the APOE genotypes comprising each of
the two
major groupings, or clades, of the TOMM40 variants in this region.
Figure 6 is a schematic overview of the TOMM40-APOE locus including an LD plot
showing haplotype blocks and regions subject to primary sequencing in the
exploratory (R1) (23
Kb) and confirmatory (R2) (10 Kb) studies (NCBI Build 36.3). The LD plot is
shown for
Hapmap data (CEU analysis panel), solid spine haplotype block definition, r2
values with
D'/LOD color scheme represented by different line characteristics.
Figure 7 illustrates the SNPs (Figure 7A) and rs10524523 length polymorphisms
(Figure
7B) in the two major clades. Descriptive statistics are provided for each
group of length
polymorphisms (Figure 7B). Several long haplotypes that formed individual
outgroups in the
tree, or very small clades, are in the group identified as 'Remainder.'
Figure 8 presents histograms of the length of the rs10524523 length
polymorphism
stratified by ApoE genotypes 3/3 (8A), 3/4 (8B), and 4/4 (8C). N=210
haplotypes (AS cohort).
Figure 9 shows the association between AD age of onset and length of the
rs10524523
polymorphism for AD patients with the APOE3/4 genotype with onset between 60
and 86 years.
Box plots indicate the 95% range (vertical lines), median (horizontal line in
box) and
interquartile range (box). "Length" refers to poly-T length of the rs10524523
allele that is
inferred to be linked to APOE.
Figure 10 shows the frequency distributions of the different rs10524523 length
alleles in
diverse populations, Ghanaian (A, n=41), Han Chinese, Japanese, Korean (B¨D
respectively,
n=60 in each case). As with Caucasians, there are three peaks in the
distribution of TOMM40
rs10524523 poly-T lengths in Japanese, Han Chinese, Korean (collectively Far
Eastern) and
Ghanaian populations. The frequency and mode of the distribution of the
Ghanaian and Far
Eastern populations are different from each other and different from
Caucasians. Poly-T length is
in number of deoxythymidine residues.
Detailed Description
The present invention is explained in greater detail below. This description
is not
intended to be a detailed catalog of all the different ways in which the
invention may be
implemented, or all of the features that may be added to the instant
invention. For example,
features illustrated with respect to one embodiment may be incorporated into
other embodiments,
and features illustrated with respect to a particular embodiment may be
deleted from that
embodiment. In addition, numerous variations and additions to the various
embodiments
11
CA 02824024 2013-07-05
WO 2012/096680
PCT/US2011/025241
suggested herein will be apparent to those skilled in the art in light of the
instant disclosure
which do not depart from the instant invention. Hence, the following
specification is intended to
illustrate some particular embodiments of the invention, and not to
exhaustively specify all
permutations, combinations and variations thereof.
As used in the description of the invention and the appended claims, the
singular forms
"a", "an" and "the" are intended to include the plural forms as well, unless
the context clearly
indicates otherwise. Also, as used herein, "and/or" refers to and encompasses
any and all possible
combinations of one or more of the listed items, as well as the lack of
combinations when
interpreted in the alternative ("or").
In one aspect, the analysis of the genetic variation is based on variant
sequence data. In a
second aspect, the -structure is uncovered using diploid genotype data,
thereby avoiding the need
to either experimentally or computationally infer the component haplotypes
(see, e.g., U.S.
Patent No. 6,027,896 to Roses et al.). In another aspect, the present method
can be applied onto
uncharacterized allelic variation that results from the interrogation of a
target nucleic acid with
an experimental procedure that provides a record of the sequence variation
present but does not
actually provide the entire sequence. The underlying structure of genetic
variation is also useful
for the deduction of the constituent haplotypes from diploid genotype data.
It is preferred and contemplated that the methods described herein be used in
conjunction
with other clinical diagnostic information known or described in the art which
are used in
evaluation of subjects with diseases or disorders (e.g., those believed to
involve mitochondrial
dysfunction (e.g. Alzheimer's disease or other neurodegenerative diseases)) or
for evaluation of
subjects suspected to be at risk for developing such disease. The invention is
also applicable for
discovery of genetic risk factors for other complex diseases, disorders, or
conditions.
The disclosures of all United States patent references cited herein are hereby
incorporated
. 25 by reference herein in their entirety.
1. Definitions. The following definitions are used herein:
"Condition of interest" refers to a specific condition, disease, or disorder
designated for
phylogenetic study and/or subsequent diagnosis or prognosis, including, but
not limited to, the
age of onset thereof. "Condition" as used herein includes, but is not limited
to, conditions
associated with ApoE and/or TOMM40 and/or mitochondrial dysfunction, e.g.,
neurodegenerative diseases, metabolic diseases, psychiatric disorders, and
cancer.
Examples of conditions in which ApoE and/or TOMM40 have been implicated
include,
but are not limited to, cardiovascular disease; metabolic disease;
neurodegenerative disease;
neurological trauma or disease; autoimmune disease (e.g., multiple sclerosis
(Pinholt M, et al.
Apo E in multiple sclerosis and optic neuritis: the apo E-epsilon4 allele is
associated with
12
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
progression of multiple sclerosis. Mull Scler. 11:511-5 (2005); Masterman, T.
& Hillert, J. The
telltale scan: APOE E 4 in multiple sclerosis. Lancet Neurol. 3: 331 (2004),
neuropsychiatric
systemic lupus erythematosus (Pullmann Jr. R, et al. Apolipoprotein E
polymorphism in patients
with neuropsychiatric SLE. Clin RheumatoL 23: 97-101 (2004)), etc.)); viral
infection (e.g., liver
disease associated with hepatitis C infection (Wozniak MA, et al.
Apolipoprotein E-E4 protects
against severe liver disease caused by hepatitis C virus.. tlepatol. 36: 456-
463 (2004)), HIV
disease (Burt TD, et al. Apolipoprotein (apo) E4 enhances HIV-1 cell entry in
vitro, and the
APOE epsilon4/epsilon4 genotype accelerates HIV disease progression. Proc Natl
Acad Sci U S
A. 105:8718-23 (2008)), etc.)); hip fracture/osteoporosis (Pluijm SM, et al.
Effects of gender and
age on the association of apolipoprotein E epsilon4 with bone mineral density,
bone turnover and
the risk of fractures in older people. Osteoporos Int. 13: 701-9 (2002));
mitochondrial diseases
(Chang S, et al. Lipid- and receptor-binding regions of apolipoprotein E4
fragments act in
concert to cause mitochondrial dysfunction and neurotoxicity. Proc Nail Acad
Sci U S A.
102:18694-9 (2005)); aging (Schachter F, et al. Genetic associations with
human longevity at he
APOE and ACE loci. Nat Genet. 6:29-32 (1994); Rea IM, et al., Apolipoprotein E
alleles in
nonagenarian subjects in the Belfast Elderly Longitudinal Free-living Ageing
Study
(BELFAST).. Mech. Aging and Develop. 122: 1367-1372 (2001)); inflammation (Li
L, et al.,
Infection induces a positive acute phase apolipoprotein E response from a
negative acute phase
gene: role of hepatic LDL receptors. J Lipid Res. 49:1782-93 (2008)); and
memory dysfunction
(Caselli RJ, et al. Longitudinal modeling of age-related memory decline and
the APOE epsilon4
effect. N Engl J Med. 361:255-63 (2009)).
"Cardiovascular disease" as used herein refers to a disease involving the
heart and/or
blood vessels, including, but not limited to, coronary artery disease (Song Y,
et al. Meta-
analysis: apolipoprotein E genotypes and risk for coronary heart disease. Ann
Intern Med.
141:137-47 (2004); Bennet AM, et al., Association of apolipoprotein E
genotypes with lipid
levels and coronary risk.. JAMA 298:1300-11(2007)), atherosclerosis (Norata
GD, et al. Effects
of PCSK9 variants on common carotid artery intima media thickness and relation
to ApoE
alleles. Atherosclerosis (2009) Jun 27. [Epub ahead of print],
doi:10.1016/j.atherosclerosis
2009.06.023; Paternoster L, et al. Association Between Apolipoprotein E
Genotype and Carotid
lntima-Media Thickness May Suggest a Specific Effect on Large Artery
Atherothrombotic
Stroke. Stroke 39:48-54 (2008)), ischemic heart disease (Schmitz F, et al.,
Robust association of
the APOE 4 allele with premature myocardial infarction especially in patients
without
hypercholesterolaemia: the Aachen study. Eur. J. Clin. Investigation 37: 106-
108 (2007)),
vascular disease such as ischemic stroke (Peck G, et al. The genetics of
primary haemorrhagic
stroke, subarachnoid haemorrhage and ruptured intracranial aneurysms in
adults. PLoS One.
13
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
3:e3691 (2008); Paternoster L, et al. Association Between Apolipoprotein E
Genotype and
Carotid Intima-Media Thickness May Suggest a Specific Effect on Large Artery
Atherothrombotic Stroke. Stroke 39:48-54 (2008)), vascular dementia (Bang OY,
et al.
Important link between dementia subtype and apolipoprotein E: a meta-analysis.
Yonsei Medi.
44:401-13 (2003); Baum L, et al. Apolipoprotein E epsilon4 allele is
associated with vascular
dementia. Dement Geriatr Cogn Disord. 22:301-5 (2006)), etc.
"Neurodegenerative disease" as used herein refers to Alzheimer's disease
(Corder EH, et
al. Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer's
disease in late onset
families. Science 261:921-3 (1993).; Corder EH, et al. There is a pathologic
relationship between
ApoE-epsilon 4 and Alzheimer's disease. Arch Neurol. 52:650-1 (1995)),
Parkinson's disease
(Huang X, et al. Apolipoprotein E and dementia in Parkinson disease: a meta-
analysis. Arch
Neurol. 63:189-93 (2006); Huang X et al. APOE-[epsilon]2 allele associated
with higher
prevalence of sporadic Parkinson disease. Neurology. 62:2198-202 (2004);
Martinez, M. et al.
Apolipoprotein E4 is probably responsible for the chromosome 19 linkage peak
for Parkinson's
disease. Am. J. Med. Genet. B Neuropsychiatr. Genet. 136B, 172-174 (2005)),
Huntington's
disease, and a plurality of less common diseases and disorders which cause
neurons to decline,
e.g., age-related macular degeneration (Thakkinstian A, et al. , Association
between
apolipoprotein E polymorphisms and age-related macular degeneration: A HuGE
review and
meta-analysis. Am J EpidemioL 164:813-22 (2006); Bojanowski CM, et al. An
apolipoprotein E
variant may protect against age-related macular degeneration through cytokine
regulation.
Environ Mol Mutagen. 47:594-602 (2006)).
"Neurological trauma or disease" includes, but is not limited to, outcome
after head
injury (Zhou W, et al. Meta-analysis of APOE4 allele and outcome after
traumatic brain injury. J
Neurotrauma. 25:279-90 (2008); Lo TY, et al. Modulating effect of
apolipoprotein E
polymorphisms on secondary brain insult and outcome after childhood brain
trauma. Childs Nerv
Syst. 25:47-54 (2009)), migraine (Gupta R, et al. Polymorphism in
apolipoprotein E among
migraineurs and tension-type headache subjects. J Headache Pain. 10:115-20
(2009)), vasogenic
edema (James ML, et al. Apolipoprotein E modifies neurological outcome by
affecting cerebral
edema but not hematoma size after intracerebral hemorrhage in humans. J Stroke
Cerebrovasc
Dis. 18:144-9 (2009); James ML, et al. Pharmacogenomic effects of
apolipoprotein e on
intracerebral hemorrhage. Stroke 40:632-9 (2009)), etc.
"Metabolic disease" as used herein includes, but is not limited to,
dyslipidemia (Willer
CJ, et al. Newly identified loci that influence lipid concentrations and risk
of coronary artery
disease. Nat Genet. 40:161-9 (2008); Bennet AM, et al., Association of
apolipoprotein E
genotypes with lipid levels and coronary risk.. JAMA 298:1300-11 (2007)),. end
stage renal
14
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
disease (Oda H, et al. Apolipoprotein E polymorphism and renal disease. Kidney
Int Suppl.
71:S25-7 (1999); Hubacek JA, et al. Apolipoprotein E Polymorphism in
Hemodialyzed Patients
and Healthy Controls. Biochem Genet. (2009) Jun 30. [Epub ahead of print] DO!
10.1007/s10528-009-9266-y.), chronic kidney disease (Yoshida T, et al.
Association of a
polymorphism of the apolipoprotein E gene with chronic kidney disease in
Japanese individuals
with metabolic syndrome. Genomics 93:221-6 (2009); Leiva E, et al.
Relationship between
Apolipoprotein E polymorphism and nephropathy in type-2 diabetic patients.
Diabetes Res Clin
Pract. 78:196-201 (2007)), gallbladder disease (Boland LL,et al.
Apolipoprotein E genotype and
gallbladder disease risk in a large population-based cohort. Ann Epidemiol.
16:763-9 (2006);
Andreotti G, et al. Polymorphisms of genes in the lipid metabolism pathway and
risk of biliary
tract cancers and stones: a population-based case-control study in Shanghai,
China. Cancer
Epidemiol Biomarkers Prey. 17:525-34 (2008)), diabetes mellitus (type II)
(Elosua R, et al.
Obesity Modulates the Association among APOE Genotype, Insulin, and Glucose in
Men. Obes
Res. 11:1502-1508 (2003); Moreno JA, et al. The Apolipoprotein E Gene Promoter
(-219G/T)
Polymorphism Determines Insulin Sensitivity in Response to Dietary Fat in
Healthy Young
Adults. J. Nutr. 135:2535-2540 (2005)), metabolic syndrome, cholelithiasis
(Abu Abeid S, et al.
Apolipoprotein-E genotype and the risk of developing cholelithiasis following
bariatric surgery:
a clue to prevention of routine prophylactic cholecystectomy. Obes Surg.
12:354-7 (2002)), etc.
"Psychiatric Disorder" as used herein refers to schizophrenia (Kampman 0, et
al.
Apolipoprotein E polymorphism is associated with age of onset in
schizophrenia. J Hum Genet.
49:355-9 (2004); Dean B. et al., Plasma apolipoprotein E is decreased in
schizophrenia spectrum
and bipolar disorder. Psychiatry Res. 158:75-78 (2008)), obsessive compulsive
disorder (OCD),
addictive behavior (smoking addiction, alcohol addiction, etc.), bipolar
disorder (Dean B. et al.,
Plasma apolipoprotein E is decreased in schizophrenia spectrum and bipolar
disorder. Psychiatry
Res. 158:75-78 (2008)), and other diseases, disorders, or conditions of a
psychiatric nature.
"Development of a condition" as used herein refers to either an initial
diagnosis of a
disease, disorder, or other medical condition, or exacerbation of an existing
disease, disorder, or
medical condition for which the subject has already been diagnosed.
"Diagnosis" or "prognosis" as used herein refers to the use of information
(e.g., genetic
information or data from other molecular tests on biological samples, signs
and symptoms,
physical exam findings, cognitive performance results, etc.) to anticipate the
most likely
outcomes, timeframes, and/or response to a particular treatment for a given
disease, disorder, or
condition, based on comparisons with a plurality of individuals sharing common
nucleotide
sequences, symptoms, signs, family histories, or other data relevant to
consideration of a
patient's health status.
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
"Biological sample" as used herein refers to a material suspected of
containing a nucleic
acid of interest. Biological samples containing DNA include hair, skin, cheek
swab, and
biological fluids such as blood, serum, plasma, sputum, lymphatic fluid,
semen, vaginal mucus,
feces, urine, spinal fluid, and the like. Isolation of DNA from such samples
is well known to
those skilled in the art.
"Gene" as used herein means a segment of DNA that contains all the information
for the
regulated biosynthesis of an RNA product, including promoters, exons, introns,
and other
untranslated regions that control expression.
"Genetic locus" or "locus" as used herein means a location on a chromosome or
DNA
molecule, often corresponding to a gene or a physical or phenotypic feature or
to a particular
nucleotide or stretch of nucleotides. Loci is the plural form of locus.
"Amplification," as applied to nucleic acids herein refers to any method that
results in the
formation of one or more copies of a nucleic acid, where preferably the
amplification is
exponential. One such method for enzymatic amplification of specific sequences
of DNA is
known as the polymerase chain reaction (PCR), as described by Saiki et al.,
1986, Science
230:1350-1354. Primers used in PCR normally vary in length from about 10 to 50
or more
nucleotides, and are typically selected to be at least about 15 nucleotides to
ensure sufficient
specificity. The double stranded fragment that is produced is called an
"amplicon," and may vary
in length from as few as about 30 nucleotides, to 20,000 or more.
A "marker" or "genetic marker" as used herein is a known variation of a DNA
sequence
at a particular locus. The variation may be present in an individual due to
mutation or
inheritance. A genetic marker may be a short DNA sequence, such as a sequence
surrounding a
single base-pair change (single nucleotide polymorphism, SNP), or a long one,
like
minisatellites. Markers can be used to study the relationship between an
inheritedl disease and its
genetic cause (for example, a particular mutation of a gene that results in a
defective or otherwise
undesirable form of protein).
A "genetic risk factor" as used herein means a genetic marker that is
associated with
increased susceptibility to a condition, disease, or disorder. It may also
refer to a genetic marker
that is associated with a particular response to a selected drug or treatment
of interest.
"Associated with" as used herein means the occurrence together of two or more
characteristics more often than would be expected by chance alone. An example
of association
involves a feature on the surface of white blood cells called HLA (HLA stands
for human
leukocyte antigen). A particular HLA type, HLA type B-27, is associated with
an increased risk
for a number of diseases including ankylosing spondylitis. Ankylosing
spondylitis is 87 times
more likely to occur in people with HLA B-27 than in the general population.
16
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
A subject "at increased risk of developing a condition" due to a genetic risk
factor is one
who is predisposed to the condition, has genetic susceptibility for the
condition, and/or is more
likely to develop the condition than subjects in which the genetic risk factor
is absent. For
example, a subject who is "at increased risk of developing Alzheimer's
disease" due to the
presence of one or two ApoE 4 alleles is more likely to develop Alzheimer's
disease than a
subject who does not carry an ApoE 4 allele.
"Polymorphism" as used herein refers to the existence of two or more different
nucleotide
sequences at a particular locus in the DNA of the genome. Polymorphisms can
serve as genetic
markers and may also be referred to as genetic variants. Polymorphisms include
nucleotide
substitutions, insertions, deletions and microsatellites, and may, but need
not, result in detectable
differences in gene expression or protein function. A polymorphic site is a
nucleotide position
within a locus at which the nucleotide sequence varies from a reference
sequence in at least one
individual in a population.
A "deletion/insertion polymorphism" or "DIP" as used herein is an insertion of
one or
more nucleotides in one version of a sequence relative to another. If it is
known which of the
alleles represent minor alleles, the term "deletion" is used when the minor
allele is a deletion of
one or more nucleotides, and the term "insertion" is used when the minor
allele is an addition of
one or more nucleotides. The term "deletion/insertion polymorphism" is also
used when there are
multiple forms or lengths and the minor allele is not apparent. For example,
for the poly-T
polymorphisms described herein, multiple lengths of polymorphisms are
observed.
"Polymorphism data" as used herein means information concerning one or more of
the
following for a specific gene: location of polymorphic sites; sequence
variation at those sites;
frequency of polymorphisms in one or more populations; the different genotypes
and/or
haplotypes determined for the gene; frequency of one or more of these
genotypes and/or
haplotypes in one or more populations; and any known association(s) between a
trait and a
genotype or a haplotype for the gene.
"Haplotype" as used herein refers to a genetic variant or combination of
variants carried
on at least one chromosome in an individual. A haplotype often includes
multiple contiguous
polymorphic loci. All parts of a haplotype as used herein occur on the same
copy of a
chromosome or haploid DNA molecule. Absent evidence to the contrary, a
haplotype is
presumed to represent a combination of multiple loci that are likely to be
transmitted together
during meiosis. Each human carries a pair of haplotypes for any given genetic
locus, consisting
of sequences inherited on the homologous chromosomes from two parents. These
haplotypes
may be identical or may represent two different genetic variants for the given
locus. Haplotyping
17
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
is a process for determining one or more haplotypes in an individual.
Haplotyping may include
use of family pedigrees, molecular techniques and/or statistical inference.
A "variant" or "genetic variant" as used herein, refers to a specific isoform
of a haplotype
found in a population, the specific form differing from other forms of the
same haplotype in the
sequence of at least one, and frequently more than one, variant sites or
nucleotides within the
sequence of the gene. The sequences at these variant sites that differ between
different alleles of
a gene are termed "gene sequence variants," "alleles," or "variants." The term
"alternative form"
refers to an allele that can be distinguished from other alleles by having at
least one, and
frequently more than one, variant sites within the gene sequence. "Variants"
include isoforms
having single nucleotide polymorphisms (SNPs) and deletion/insertion
polymorphisms (DIPs).
Reference to the presence of a variant means a particular variant, i.e.,
particular nucleotides at
particular polymorphic sites, rather than just the presence of any variance in
the gene.
"Isoform" as used herein means a particular form of a gene, mRNA, cDNA or the
protein
encoded thereby, distinguished from other forms by its particular sequence
and/or structure. For
example, the ApoE 4 isoform of apolipoprotein E as opposed to the ApoE2 or
ApoE 3 isoforms.
"Cistron" as used herein means a section of DNA found on a single chromosome
that
contains the genetic code for a single polypeptide and functions as a
hereditary unit. A cistron
includes exons, introns, and regulatory elements related to a single
functional unit (i.e., a gene).
The term derives from the classic cis-trans test for determining whether
genetic elements were
able to functionally interact regardless of whether they were located on the
same DNA molecule
("trans" complementation) or only when they were located on the same DNA
molecule ("cis"
acting elements).
The term "genotype" in the context of this invention refers to the particular
allelic form of
a gene, which can be defined by the particular nucleotide(s) present in a
nucleic acid sequence at
a particular site(s). Genotype may also indicate the pair of alleles present
at one or more
polymorphic loci. For diploid organisms, such as humans, two haplotypes make
up a genotype.
Genotyping is any process for determining a genotype of an individual, e.g.,
by nucleic acid
amplification, antibody binding, or other chemical analysis. The resulting
genotype may be
unphased, meaning that the sequences found are not known to be derived from
one parental
chromosome or the other.
"Linkage disequilibrium" as used herein means the non-random association of
alleles at
two or more loci. Linkage disequilibrium describes a situation in which some
combinations of
alleles or genetic markers occur more or less frequently in a population than
would be expected
from a random formation of haplotypes from alleles based on their frequencies.
Non-random
18
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
associations between polymorphisms at different loci are measured by the
degree of linkage
disequilibrium.
"Multiple sequence alignment" or "MSA" as used herein means alignment of three
or
more nucleotide sequences from genomic DNA derived from a plurality of
individuals to
determine homology and heterology between the sequences. In general, the input
set of query
sequences are assumed to have an evolutionary relationship by which they share
a lineage and
are descended from a common ancestor. Computer algorithms are most often used
to perform the
analysis of aligned sequences.
Some embodiments of the present invention may include steps implemented by a
computer and/or computer program products, including analog and/or digital
hardware, and/or
computer program instructions. These computer program instructions may be
provided to a
processor of a general purpose computer, special purpose computer, Application
Specific
Integrated Circuits (ASIC), and/or other programmable data processing
apparatus, such that the
instructions, which execute via the processor of the computer and/or other
programmable data
processing apparatus, create means for implementing the functions/acts
specified. Other
software, such as an operating system, also may be included. It will be
further appreciated that
the functionality of the multiple sequence alignment module, mapping module
and/or other
modules described herein may be embodied, at least in part, using discrete
hardware
components, one or more ASIC and/or one or more special purpose digital
processors and/or
computers.
"Mapping" as used herein means creating a phylogenetic tree by assigning a
node to each
new nucleotide sequence variant observed, connecting that node to another node
representing a
known sequence carried by the same individual on the same chromosome or
cistron, and
counting the numbers of each type of subject represented at each node. See
Figure 4 for an
example of a phylogenetic tree developed in this manner.
"Phylogenetic" means related to the study of evolutionary connections among
various
groups of organisms or individuals within a species. Before genetic
information was readily
available, phylogeny was based mostly on phenotypic observation. "Phylogenetic
mapping" as
used herein means using DNA sequence data to connect related sequence variants
carried by a
plurality of individuals in order to determine evolutionary connections and
the chronology of
divergence. A "phylogenetic tree" is the result of mapping the connections
between variants.
"Node" as used herein means a polymorphism data point on a phylogenetic tree
representing an actual variant sequence carried by at least one subject. A
node is connected by a
.branch to another node representing a variant sequence carried by the same
individual on the
same chromosome and in the same cistron but at a different genetic locus
within the cistron. The
19
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
presence of a node indicates that at least one subject carried both the
sequence indicated by the
node as well as the sequence represented by the neighboring node to which it
is connected by a
branch.
"Branch" as used herein means a connection between two nodes representing two
distinct
variant sequences or haplotypes, wherein the two variants are located on the
same chromosome
and in the same cistron from an individual subject. "Branching point" means
any node from
which more than two branches extend, but it is especially used herein to refer
to a root node from
which three or more nodes extend. A "root node" represents the genetic
sequence of a common
evolutionary ancestor from which genetic divergence has generated the variety
of nearby
sequence variants represented by the connected nodes.
"Iteratively" as used herein refers to repetitive calculation of values for
each character in
a series. For example, each node on a phylogenetic tree is analyzed to
calculate the ratio of the
number of subjects affected with a condition of interest (such as Alzheimer's
disease) to control
unaffected subjects; this ratio is compared with the connected nodes to locate
correlations with
increased or decreased risk for developing a disease, disorder, or condition
of interest. A
substantial change in this ratio between one node and the next indicates the
presence of a variant
that either increases or decreases the risk of earlier disease onset.
"Iteratively examining the
genetic variants" means beginning the analysis with nodes representing the
sequences shared by
the greatest numbers of individual subjects and successively analyzing the
nodes connected by
branches extending from that node, followed by the second level of nodes, and
so on. The
analysis then moves overall from the roots of the tree toward the outer
branches and nodes of the
tree.
"Treatment" as used herein includes any drug, procedure, lifestyle change, or
other
adjustment introduced in attempt to effect a change in a particular aspect of
a subject's health
(i.e. directed to a particular disease, disorder, or condition).
"Drug" as used herein refers to a chemical entity or biological product, or
combination of
chemical entities or biological products, administered to a person to treat or
prevent or control a
disease or condition. The term "drug" as used herein is synonymous with the
terms "medicine,"
"medicament," "therapeutic intervention," or "pharmaceutical product." Most
preferably the drug
is approved by a government agency for treatment of at least one specific
disease or condition.
"Disease," "disorder," and "condition" are commonly recognized in the art and
designate
the presence of signs and/or symptoms in an individual or patient that are
generally recognized
as abnormal and/or undesirable. Diseases or conditions may be diagnosed and
categorized based
on pathological changes. The disease or condition may be selected from the
types of diseases
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
listed in standard texts such as Harrison's Principles of Internal Medicine,
1997, or Robbins
Pathologic Basis of Disease, 1998.
"Mitochondrial dysfunction" as used herein means any detrimental abnormalities
of the
mitochondria within a cell or cells. Some diseases, disorders, or conditions
presently known in
the art to be associated with mitochondrial dysfunction include Alzheimer's
disease, Parkinson's
disease, and other neurodegenerative diseases, ischemia-reperfusion injury in
stroke and heart
attack, epilepsy, diabetes, and aging. Many other diseases, disorders, and
conditions have been
associated with mitochondrial dysfunction in the art. Indeed, the
mitochondrion is critical for
proper functioning of most cell types, and mitochondrial decline often leads
to cell death. This
mitochondrial dysfunction causes cell damage and death by compromising ATP
production,
disrupting calcium homeostasis and increasing oxidative stress. Furthermore,
mitochondrial
damage can lead to apoptotic cell death by causing the release of cytochrome c
and other pro-
apoptotic factors into the cytoplasm (for review, see Wallace, 1999; Schapira,
2006). Regarding
a specific example found herein, the ApoE 3 and ApoE 4 isoforms are
hypothesized to cause
mitochondrial dysfunction through interactions with TOMM40. Some TOMM40
variants may
act synergistically with ApoE 3 isoform to accelerate mitochondrial decline.
This mitochondrial
mechanism is believed to contribute to many complex genetic diseases,
disorders, and
conditions.
"Subjects" are preferably, but not limited to, human subjects. The subjects
may be male
or female and may be of any race or ethnicity, including, but not limited to,
Caucasian, African-
American, African, Asian, Hispanic, Indian, etc. The subjects may be of any
age, including
newborn, neonate, infant, child, adolescent, adult, and geriatric. Subjects
may also include
animal subjects, particularly mammalian subjects such as canines, felines,
bovines, caprines,
equines, ovines, porcines, rodents (e.g., rats and mice), lagomorphs, primates
(including non-
human primates), etc., screened for veterinary medicine or pharmaceutical drug
development
purposes.
A "subject" according to some embodiments is an individual whose genotype(s)
or
haplotype(s) are or have been determined, and may have been recorded in
conjunction with the
individual's condition (i.e., disease or disorder status, including, but not
limited to, the disease
risk status and/or age of onset prediction) and/or response to a candidate
drug or treatment.
Nucleotide sequences from a plurality of subjects are used to construct a
phylogenetic tree to
identify nucleotide sequences associated with the trait, or condition of
interest. Then analogous
nucleotide sequences from an individual subject may be compared to those that
are identified as
being associated with the trait, or condition of interest, for diagnostic,
prognostic and/or
predictive purposes.
21
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
"Treat," "treating," or "treatment" as used herein refers to any type of
measure that
imparts a benefit to a patient afflicted with or at risk for developing a
disease, including
improvement in the condition of the patient (e.g., in one or more symptoms),
delay in the onset
or progression of the disease, etc.
"Late-onset Alzheimer's disease" or "LOAD" as used herein is known in the art,
and is
the classification used if the Alzheimer's disease has an onset or is
diagnosed after the age of 65.
It is the most common form of Alzheimer's disease.
"Cognitive impairment" includes deficiencies in information processing. "Mild
cognitive
impairment" or "MCI" is cognitive impairment that is worse than that expected
for a given age
and education level, but does not interfere significantly with daily
activities. "Amnesic MCI" is
MCI where the predominant symptom is memory loss, and may be a risk factor for
Alzheimer's
disease.
2. Methods for Identifvine Genetic Variants
While lists of associations derived from genome-wide scans are useful, they
are generally
inadequate to explain disease complexity. Families, pathways, and interactions
of genes can
provide specificities. High-resolution variant mapping may reveal answers to
complex genetic
interactions. This is particularly applicable where one known genetic risk
factor which does not
itself entirely explain an association to the disease, disorder, or condition
of interest may present
an excellent candidate genetic locus for more detailed investigations.
Furthermore,
pharmacogenetics, while useful for drug development, can also extend
biological relevance. The
analysis of sequence data from large numbers of individuals to discover
variants in the gene
sequence between individuals in a population will result in detection of a
greater fraction of all
the variants in the population.
The initial sequence information to be analyzed by the method of the present
invention is
derived from the genomic DNA of a plurality of subjects. The organism can be
any organism for
which multiple sequences are available, but is preferably from human. In
identifying new
variants it is often useful to screen different population groups based on
race, ethnicity, gender,
and/or geographic origin because particular variants may differ in frequency
between such
groups. Most preferably, for diseases or disorders believed to be multigenic
(genetically complex
diseases/disorders), the phenotypes represented by the subject population are
from the extremes
of a spectrum. Biological samples containing DNA may be blood, semen, cheek
swab, etc.
Isolation of DNA from such samples is well known in the art.
In some embodiments, the invention relates to the analysis of nucleotide
sequence data
from a plurality of subjects having at least one known risk factor for a given
disease, disorder, or
condition (genetic or otherwise). The nucleotide sequences are analyzed to
generate haplotype
22
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
data, and the haplotypes or genetic variants are then mapped onto a
phylogenetic tree to
demonstrate the evolution of the sequences represented. By comparing this tree
to phenotype
data about the plurality of subjects, a prognosis or diagnosis is possible for
an individual subject
carrying haplotypes observed on the phylogenetic tree.
In other embodiments, the invention relates to the fields of pharmacogenetics
and
pharmacogenomics and the use of genetic haplotype information to predict an
individual's
susceptibility to disease and/or their response to a particular drug or drugs,
so that drugs tailored
to genetic differences of population groups may be developed and/or
administered to individuals
with the appropriate genetic profile.
Nucleotide sequence information is derived from genomic DNA. Genomic sequence
data
used may be obtained from clinical or non-human animals or from cultured cells
or isolated
tissue studies. The organism can be any organism for which multiple sequences
are available, but
is preferably from human. In identifying new variants it is often useful to
screen different
population groups based on race, ethnicity, gender, and/or geographic origin
because particular
variants may differ in frequency between such groups. Most preferably, for
diseases or disorders
believed to be multigenic (genetically complex diseases/disorders), the
phenotypes represented
by the subject population are extreme opposites.
Biological samples containing DNA may be blood, semen, cheek swab, etc.
Isolation of
DNA from such samples is well known in the art. Methods for determining DNA
sequence at a
particular genetic locus of interest are also known in the art. Automated
sequencing is now
widely available and requires only an isolated DNA sample and at least one
primer that is
specifically designed to recognize a highly conserved sequence within or in
close proximity to
the genetic locus of interest.
According to some embodiments, a defined genetic region or locus of interest
(e.g.,
defined by a set of forward and reverse PCR primers or coordinates on a
reference sequence) is
carefully sequenced from a cohort of people inclusive of patients who are well
characterized for
a particular disorder.
A consensus sequence is determined, and all observed sequence variants for a
given
genetic locus are compiled into a list. Variation in a genomic region during
evolution results in
divergence from the ancestral sequence. In the absence of recombination
events, all the
variations that occur in cis on the ancestral sequence are inherited together
on a collinear piece of
DNA. During initial phases of investigation at least, it is preferred that
populations be parsed into
groups of subjects sharing a common general phenotype representing similar
ancestry.
Otherwise, analysis of these data through construction of phylogenetic trees
will require a
prohibitively large number of subjects.
23
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
3. Multiple sequence alignments.
Determining the presence of a particular variant or plurality of variants in a
gene or gene
region in a population can be performed in a variety of ways, all of which
involve locating a
particular genetic locus by targeting sequences within the region of interest
that are known to be
highly conserved. From the highly conserved locus, the contiguous sequences
are easily obtained
through one of many techniques well-known in the art.
The first step in analyzing parallel DNA sequences from a plurality of
subjects is multiple
sequence alignment ("MSA"). MSA is typically used to display sequence
alignment from
homologous samples with polymorphic differences within genes or gene regions
to show
conserved areas and variant sequences. MSAs of the sequence information
obtained at the locus
of interest may be constructed using one or more various known techniques and
publicly
available software, and are publicly available from many sources including the
Internet. Methods
for analyzing multiple sequence alignments known in the art include, e.g.,
those described in
U.S. Patent 6,128,587 to Sjolander; U.S. Patent 6,291,182 to Schork et al.;
and U.S. Patent
6,401,043 to Stanton et at.
4. Phylogenetic trees and analysis.
Various methods for construction of "phylogenetic trees" are known in the art.
(See, e.g.,
Sanderson, 2008). Sun et al. used "haplotype block" analyses to study
associations between toll-
like receptor (TLR) variants and prostate cancer (2005) and Bardel et al.
(2005) used a cladistic
analysis approach to investigate associations between CARD15 gene variants and
Crohn's
disease. However, neither utilized genetic loci previously associated with the
disease to
investigate linkages.
Phylogenetic trees according to some embodiments may be constructed with a
topology
in which haplotype sequence variants observed in individual human subjects
studied form nodes
(representing each sequence observed in the data) on a tree. Nodes may be
joined to other nodes,
and the common ancestor is found at the branching site, common root or root
node of the tree. A
phylogenetic tree reflects the evolutionary relationship between genetic loci
for which data are
analyzed (see Sanderson, 2008; Tzeng, 2005; Seltman, 2003).
The starting point for phylogenetic tree estimation is generally an MSA (see
above).
Multiple software applications are available for constructing phylogenetic
trees based on
sequence data. See, e.g., U.S. Patent 7,127,466 and U.S. Patent 6,532,467 to
Brocklebank, et al.
The basic premise is that a genetic locus exhibiting many variants is
represented by these
variants connected in cis. Polymorphisms create branching points (nodes) in
the tree that define
groups of related sequences or haplotypes.
24
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
The phylogenetic tree is utilized for information by iteratively examining
ratios of
subjects affected with a condition to unaffected control subjects; the
calculations begin with
nodes observed in the greatest numbers of subjects and move toward the
periphery of the tree to
nodes observed in fewer subjects. The goal is to locate a branching point,
branch, or node where
there is substantial change in the ratio of subjects affected with the
condition of interest to
unaffected control subjects. Such a branching point represents the
evolutionary divergence of
higher risk subjects from lower risk subjects or vice versa.
Statistical analysis of the phylogenetic tree generated may be performed in
accordance
with the methods known in the art. One art-recognized method is the
calculation of bootstrap
confidence levels (see Efron et al., Proc. Natl. Acad. Sci. USA 93, 13429-
13434 (1996)).
5. Patient evaluation.
Once a phylogenetic tree has been generated for a particular genetic locus, an
individual
subject may be evaluated by comparing their DNA sequence to the sequences that
comprise the
phylogenetic tree. The presence of haplotypes or sequence variants
corresponding with regions
of the tree representing subjects with higher incidence of the condition of
interest (i.e., higher
ratios of subjects affected with the disease or disorder to unaffected control
subjects) would
mean that the individual subject is also at increased risk. Conversely,
substantially lower ratios
correspond to reduced risk of developing the condition of interest.
Phylogenetic trees may also be analyzed based upon responsiveness of the
condition of
interest to treatment with an active agent or treatment method of interest
according to some
embodiments.
6. APOE and TOMM40.
ApoE phenotypes and genotypes are well known in the art. The established
nomenclature
- system as well as the phenotypes and genotypes for ApoE are described in,
for example, Zannis
et al., 1982, which is incorporated by reference herein.
TOMM40 (The Outer Mitochondrial Membrane channel subunit, 40kDa) phenotypes
and genotypes are also known. TOMM40 functions as a channel-forming subunit of
the
translocase found in the outer mitochondrial membrane and is essential for
protein import into
mitochondria.
Genome-wide association scanning data from studies of Alzheimer's disease
patients
have unequivocally identified the linkage disequilibrium region that contains
the apolipoprotein
E (ApoE) gene. The ApoE 4 allele has been widely replicated as a confirmed
susceptibility gene
since the initial publications in 1993 (see, e.g., Corder et al.). The genome-
wide association
scanning studies identified polymorphisms adjacent to APOE within the linkage
disequilibrium
region, with many of the associated polymorphisms located in the TOMM40 gene.
This is a
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
remarkable "coincidence" as cell biology studies have identified co-
localization of ApoE and
TOMM40 to the outer mitochondrial membrane. This other gene, TOMM40, was first
encountered during studies modeling linkage disequilibrium around ApoE in
1998. The
polymorphisms were located adjacent to ApoE within a small linkage
disequilibrium region.
ApoE binds to mitochondria in human neuronal cultures (Chang, 2005). The
localization
of ApoE to the outer mitochondrial membrane suggests isoform-specific
interactions, leading to
a potential role for ApoE-induced mitochondrial apoptosis as an early step in
Alzheimer's
disease expression. Biological data have demonstrated that the proportion of
mobile
mitochondria in neuronal cell culture, as well as the speed at which they move
and the distance
that they traverse, are factors affecting increased mitochondrial apoptosis.
Phylogenetic data
suggest an independent genetic effect on the development of Alzheimer's
disease for TOMM40.
TOMM40 and ApoE proteins are, therefore, of particular interest for
Alzheimer's
disease. The TOMM40 and APOE genes are in linkage disequilibrium on chromosome
19.
Sequencing of the linkage disequilibrium region in hundreds of disease
patients and matched
controls, combined with mapping the evolution of genetic variants in TOMM40,
identifies the
region of particular interest in TOMM40-APOE, as shown in Figure 3.
Phylogenetic data
suggest an independent genetic effect from TOMM40 on the development of
Alzheimer's
disease. These data support the hypothesis that a genetic interaction between
APOE and
TOMM40 contributes to Alzheimer's disease risk and suggest that mitochondrial
dysfunction
could be responsible for neuronal cell death occurring over many years and
leading to disease.
As detailed herein, the interaction between multiple haplotypes of TOMM40
variants and
APOE alleles contribute to Alzheimer's disease pathogenesis; in particular,
haplotypes of
TOMM40 in linkage to the E 3 allele of APOE contribute to disease
pathogenesis. Several of the
TOMM40 gene variants evolved only cis-linked to APOE 3. (Similarly, specific
TOMM40
variants may have evolved cis-linked to APOE 4 or APOE 2.) Thus, any added
genetic effect of
the TOMM40 variants that are cis-linked to APOE 3 segregates independently of
APOE 4 but
the two variant protein products, ApoE and Tom40, may functionally interact,
in trans, to
produce a given observable phenotype or trait. This "coincidence" of adjacent
interacting genes
may account for the extraordinarily significant statistical association signal
for this genomic
region found in all Alzheimer's disease genome-wide association scanning
studies. It is of
interest to note that the initial commercially available genome-wide
association scanning
platforms did not contain any APOE polymorphisms, but the disease associations
were identified
with TOMM40 and ApoC1 SNPs ¨ but the region is virtually always referred to as
the "APOE
region."
26
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
These data, which combine disease genetics and putative molecular mechanisms
of
pathogenesis, can also be viewed within a pharmacogenetics context. Because of
the strong
genetic effect of inheriting an ApoE 4 allele, ApoE 4 has been referred to as
a complex
susceptibility gene for more than a decade. Consistent replications of the age
of onset
distributions as a function of ApoE genotype confirm that the role of ApoE 3
inheritance is not
totally benign, but it has been viewed as a lower risk factor than inheritance
of APOE 4 and is
observed as a later disease onset. There are genetic variants of TOMM40 that
are located only on
DNA strands containing ApoE 3 in the linkage disequilibrium regions (Roses et
al., The
Pharmacogenomics Journal (2010) 10, 375-384), and thus not in Hardy-Weinberg
equilibrium as
was required for SNPs in genome-wide association panels. Evolutionary changes
in TOMM40
sequences that are cis-linked only to ApoE 3 act to increase the risk of
Alzheimer's disease
associated with ApoE 3, while other variants of TOMM40 cis-linked to ApoE 3
decrease the risk
associated with ApoE 3. An independent genetic test would be to determine
whether those
TOMM40 polymorphisms associated with less Alzheimer's disease segregate at a
later age in
age of onset distribution plots for ApoE 3 containing genotypes [ApoE 3/3 or
ApoE 4/3].
Detecting the presence or absence of APOE 2, 3 or 4, and/or TOMM40 haplotypes
or of
DNA encoding the same (including, in some embodiments, the number of alleles
for each) in a
subject may be carried out either directly or indirectly by any suitable
means. A variety of
techniques are known to those skilled in the art. All generally involve the
step of collecting a
sample of biological material containing nucleic acid and/or protein from the
subject, and then
detecting whether or not the subject possesses the haplotype of interest. The
detecting step with
respect to ApoE, for example, may also be carried out by collecting an ApoE
sample from the
subject (for example, from cerebrospinal fluid, or any other fluid or tissue
containing ApoE), and
then determining the presence or absence of an ApoE 2, 3, or 4 isoform in the
ApoE sample
(e.g., by isoelectric focusing or immunoassay).
Determining the presence or absence of DNA encoding an ApoE and/or TOMM40
isoform may be carried out by direct sequencing of the genomic DNA region of
interest, with an
oligonucleotide probe labeled with a suitable detectable group, and/or by
means of an
amplification reaction such as a polymerase chain reaction or ligase chain
reaction (the product
of which amplification reaction may then be detected with a labeled
oligonucleotide probe or a
number of other techniques). In embodiments in which an insertion/deletion
polymorphism is
determined, detection can also be performed by making use of assays that
detect the relative
length of the relevant portion of genomic DNA (e.g., by electrophoresis).
Further, the detecting
step may include the step of detecting whether the subject is heterozygous or
homozygous for the
gene encoding an ApoE and/or TOMM40 haplotype. Numerous different
oligonucleotide probe
27
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
assay formats are known which may be employed to carry out the present
invention. See, e.g.,
U.S. Pat. No. 4,302,204 to Wahl et al.; U.S. Pat. No. 4,358,535 to Falkow et
al.; U.S. Pat. No.
4,563,419 to Ranki et al.; and U.S. Pat. No. 4,994,373 to Stavrianopoulos et
al. (applicants
specifically intend that the disclosures of all U.S. Patent references cited
herein be incorporated
herein by reference).
In some embodiments, detection may include multiplex amplification of the DNA
(e.g.,
allele-specific fluorescent PCR). In some embodiments, detection may include
hybridization to a
microarray (a chip, beads, etc.). In some embodiments, detection may include
sequencing
appropriate portions of the gene containing the haplotypes sought to be
detected. In some
embodiments, haplotypes that change susceptibility to digestion by one or more
endonuclease
restriction enzymes may be used for detection. For example, restriction
fragment length
polymorphism (RFLP), which refers to the digestion pattern when various
restriction enzymes
are applied to DNA, may be used. In some embodiments, the presence of one or
more haplotypes
can be determined by allele specific amplification. In some embodiments, the
presence of
haplotypes can be determined by primer extension. In some embodiments, the
presence of
haplotypes can be determined by oligonucleotide ligation. In some embodiments,
the presence of
haplotypes can be determined by hybridization with a detectably labeled probe.
See, e.g., U.S.
Patent Application Publication No. 2008/0153088 to Sun et al.; Kobler etal.,
Identification of an
11T allele in the polypyrimidine tract of intron 8 of the CFTR gene, Genetics
in Medicine
8(2):125-8 (2006); Costa et al., Multiplex Allele-Specific Fluorescent PCR for
Haplotyping the
IVS8 (TG)m(T)n Locus in the CFTR Gene, Clin. Chem., 54:1564-1567 (2008);
Johnson et al., A
Comparative Study of Five Technologically Diverse CFTR Testing Platforms, J.
Mol.
Diagnostics, 9(3) (2007); Pratt et al., Development of Genomic Reference
Materials for Cystic
Fibrosis Genetic Testing, J. Mol. Diagnostics, 11:186-193 (2009).
Amplification of a selected, or target, nucleic acid sequence may be carried
out by any
suitable means on DNA isolated from biological samples. See generally D. Kwoh
and T. Kwoh,
1990. Examples of suitable amplification techniques include, but are not
limited to, polymerase
chain reaction, ligase chain reaction, strand displacement amplification (see
generally Walker et
al., 1992a; Walker et al., 1992b), transcription-based amplification (see Kwoh
et al., 1989), self-
sustained sequence replication (or "35R") (see Guatelli et al., 1990), the Qi3
replicase system (see
Lizardi et al., 1988), nucleic acid sequence-based amplification (or "NASBA")
(see Lewis,
1992), the repair chain reaction (or "RCR") (see Lewis, supra), and boomerang
DNA
amplification (or "BDA") (see Lewis, supra). Polymerase chain reaction is
currently preferred.
DNA amplification techniques such as the foregoing can involve the use of a
probe, a
pair of probes, or two pairs of probes which specifically bind to DNA encoding
ApoE 4, but do
28
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
not bind to DNA encoding ApoE 2 or ApoE 3 under the same hybridization
conditions, and
which serve as the primer or primers for the amplification of the ApoE 4 DNA
or a portion
thereof in the amplification reaction. Likewise, one may use a probe, a pair
of probes, or two
pairs of probes which specifically bind to DNA encoding ApoE 2, but do not
bind to DNA
encoding ApoE 3 or ApoE 4 under the same hybridization conditions, and which
serve as the
primer or primers for the amplification of the ApoE 2 DNA or a portion thereof
in the
amplification reaction; and one may use a probe, a pair of probes, or two
pairs of probes which
specifically bind to DNA encoding ApoE 3, but do not bind to DNA encoding ApoE
2 or ApoE
4 under the same hybridization conditions, and which serve as the primer or
primers for the
amplification of the ApoE 3 DNA or a portion thereof in the amplification
reaction.
Similarly, one m-ay use a probe, a pair of probes, or two pairs of probes
which
specifically bind to DNA encoding a TOMM40 haplotype of interest, but do not
bind to other
TOMM40 haplotypes under the same hybridization conditions, and which serve as
the primer or
primers for the amplification of the TOMM40 DNA or a portion thereof in the
amplification
reaction.
In general, an oligonucleotide probe which is used to detect DNA encoding ApoE
and/or
TOMM40 haplotypes is an oligonucleotide probe which binds to DNA encoding the
haplotype
of interest, but does not bind to DNA encoding other haplotypes under the same
hybridization
conditions. The oligonucleotide probe is labeled with a suitable detectable
group, such as those
set forth below in connection with antibodies.
Polymerase chain reaction (PCR) may be carried out in accordance with known
techniques. See, e.g., U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and
4,965,188. In general,
PCR involves, first, treating a nucleic acid sample (e.g., in the presence of
a heat stable DNA
polymerase) with one oligonucleotide primer for each strand of the specific
sequence to be
detected under hybridizing conditions so that an extension product of each
primer is synthesized
which is complementary to each nucleic acid strand, with the primers
sufficiently
complementary to each strand of the specific sequence to hybridize therewith
so that the
extension product synthesized from each primer, when it is separated from its
complement, can
serve as a template for synthesis of the extension product of the other
primer, and then treating
the sample under denaturing conditions to separate the primer extension
products from their
templates if the sequence or sequences to be detected are present. These steps
are cyclically
repeated until the desired degree of amplification is obtained. Detection of
the amplified
sequence may be carried out by adding to the reaction product an
oligonucleotide probe capable
of hybridizing to the reaction product (e.g., an oligonucleotide probe of the
present invention),
29
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
the probe carrying a detectable label, and then detecting the label in
accordance with known
techniques, or by direct visualization on a gel.
When PCR conditions allow for amplification of all ApoE allelic types, the
types can be
distinguished by hybridization with allelic specific probe, by restriction
endonuclease digestion,
by electrophoresis on denaturing gradient gels, or other techniques. A PCR
protocol for
determining the ApoE genotype is described in Wenham et al. (1991),
incorporated by reference
herein. Examples of primers effective for amplification and identification of
the ApoE isoforms
are described therein. Primers specific for the ApoE polymorphic region
(whether ApoE 4, E3 or
E2) can be employed. In Wenham, for example, PCR primers are employed which
amplify a 227
bp region of DNA that spans the ApoE polymorphic sites (codons 112 and 158,
which contain
nucleotides 3745 and 3883). The amplified fragments are then subjected to
restriction
endonuclease CfoI which provides different restriction fragments from the six
possible ApoE
genotypes which may be recognizable on an electrophoresis gel. See also, Hixon
et al. (1990);
Houlston et al. (1989) Wenham et al. (1991); and Konrula et al. (1990) for
additional methods,
all of which are incorporated by reference herein.
7. Active agents, compositions and treatment.
As noted above, phylogenetic trees created using the methods detailed herein
may also be
analyzed based upon responsiveness of the condition of interest to treatment
with an active agent
or treatment method of interest according to some embodiments, and treatment
decisions for a
subject or patient may be based upon specific genetic variants identified.
Active agents. Active agents include those known for treatment of a condition
of interest,
and are inclusive of anti-Alzheimer's disease active agents, including, but
are not limited to,
acetylcholinesterase inhibitors, NMDA receptor antagonists, and peroxisome
proliferator-
activated receptor (PPAR) agonists or modulators, including but not limited to
those drugs in the
thiazolidinedione (rosiglitazone and pioglitazone) or glitazar classes. The
active agent could also
be a biopharmaceutical product, for example an antibody (e.g., monoclonal,
polyclonal,
derivatives of or modified antibodies such as Domain AntibodiesTM,
Bapineuzumab, etc.), fusion
proteins or therapeutic RNA molecules. The active agent could also be a
combination of any of
these products.
Examples of acetylcholinesterase inhibitors include, but are not limited to,
donepezil
(commercially available as ARICEPT), galantamine (commercially available as
RAZADYNE),
and rivastigmine (commercially available as EXELON) and the pharmaceutically
acceptable
salts thereof. Additional examples include, but are not limited to, those
described in U.S. Patent
Nos. 6,303,633; 5,965,569; 5,595,883; 5,574,046; and 5,171,750 (the
disclosures of all U.S.
Patent references cited herein are to be incorporated by reference herein in
their entirety).
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
Examples of NMDA receptor antagonists include, but are not limited to,
memantine
(commercially available as AKATINOL, AXURA, EBIXIA/ABIXIA, MEMOX and
NAMENDA) and the pharmaceutically acceptable salts thereof. Additional
examples include,
but are not limited to, those described in US Patent Nos. 6,956,055;
6,828,462; 6,642,267;
6,432,985; and 5,990126. =
Examples of PPAR agonists or modulators include, but are not limited to,
glitazones
(e.g., troglitazone, pioglitazone, englitazone, MC-555, rosiglitazone,
balaglitazone,
netoglitazone, ciglitazone, rivoglitazone, and the like), and those without a
glitazone structure
(e.g., K-111, INT-131, MBX-102 (metaglidisen), MBX-2044, FK614 including
SPPARgammaM GSK-376501 and the like). Another is psi-baptigenin (Chemical
Biology and
Drug Design, 71(1):57-70 (2008)).
Thiazolidinedione drugs include rosiglitazone (commercially available as
AVANDA).
Thiazolidinedione compounds related to rosiglitazone, include, but are not
limited to: 5-(442-(N-
methyl-N-(2-benzothiazolypamino)ethoxy]benzy1)-2,4-thiazolidine dione; 5-(4-[2-
(N-methyl-N-
(2-benzothiazolyl)amino)ethoxy]benzylidene)-2,4-thiazol idinedione; 5-(442-(N-
methyl-N-(2-
benzoxazolyl)amino)ethoxy]benzy1)-2,4-thiazolidinedione; 5-
(442-(N-methyl-N-(2-
benzoxazolyl)amino)ethoxyThenzylidene)-2,4-thiazolidinedione; 5
-(4- [2-(N-methyl-N-(2-
pyrimidinyDamino)ethoxy]benzy1)-2,4-thiazolidinedione; 5-
(4-[2-(N-methyl-N-(2-
pyrimidinyl)amino)ethoxy]benzylidene)-2,4-thiazolidinedione; 5-
(4-(2 -(N-methyl-N-[2-(4,5 -
dimethylthiazoly1)]amino)ethoxyThenzy1)-2,4-thiazolidinedione; 5-(442-(N-
methyl-N42-(4,5-
dimethylthiazoly1)]amino)ethoxylbenzylidene)-2, 4-thiazolidinedione; 5-(442-(N-
methyl-N-(2-
thiazolyl)amino)ethoxyThenzyl) -2,4-thiazolidinedione; 5-
(4-[2-(N-methyl-N-(2-
thiazolyl)amino)ethoxyThenzylidene)-2,4-thiazolidinedione;. 5-
[4-(2-(N-methyl-N-(2-(4-
phenylthiazoly1))amino) ethoxy)benzy1]-2,4-thiazolidinedione; 5-(4-[2-(N-
methyl-N-(2-(4-
phenylthiazoly1))amino) ethoxyThenzylidene)-2,4-thiazolidinedione; 5-(442-(N-
methyl-N42-(4-
pheny1-5-methylthiazoly1)]amino)ethoxyThenzy1)-2,4-thiazolidinedione; 5-(442-
(N-methyl-N42-
(4-pheny1-5-methylthiazoly1)Jamino)ethoxy] benzylidene)-2,4-thiazolidinedione;
5-(442-(N-
methyl-N-[2-(4-methy1-5-phenylthiazoly1)]amino)ethoxy]benzy1)-2,4-
thiazolidinedione; 54442-
(N-methyl-N42-(4-methy1-5-phenylthiazolyWamino)ethoxylbenzyliden
e)-2,4-
thiazolidinedione; 5-(442-(N-methyl-N42-(4-
methylthiazoly1)]amino)ethoxylbenzy1)-2,4- =
thiazolidinedione; 5-(442-(N-methyl-N[2-(4-methylthiazoly1)]amino)
ethoxyThenzylidene)-2,4-
thiazolidinedione; 544-(2-(N-methyl-N-[2-(5-phenyloxazoly1)]amino)
ethoxy)benzy1]-2,4-
thiazolidinedione; 5-(442-(N-methyl-N[2-(5-phenyloxazoly1)]amino)
ethoxyThenzylidene)-2,4-
thiazolidinedione; 5-(442-(N-methyl-N-[2-(4,5-dimethyloxazoly1)]amino)
ethoxy]benzy1)-2,4-
thiazolidinedione; 5-(442-(N-methyl-N42-(4,5-
dimethyloxazoly1)]amino)ethoxylbenzylidene)-
31
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
2,4-thiazolidinedione; 544-(2-(2-pyrimidinylamino)ethoxy)benzy1]-2,4-
thiazolidinedione; 544-
(2-(2-pyrimidinylamino)ethoxy)benzylidene]-2,4-thiazolidinedione; 5-
(442-(N-acetyl-N-(2-
pyrimidinyl)amino)ethoxy]benzyl) -2,4-thiazolidinedione; 5-(4-(2-(N-(2-
benzothiazoly1)-N-
benzylamino)ethoxy) benzylidene)-2,4-thiazolidinedione; 5-
(4 -(2-(N-(2-benzothiazoly1)-N-
benzylamino)ethoxy) benzy1)-2,4-thiazolidinedione; 5-(4-
[3-(N-methyl-N-(2-
benzoxazolyDamino)propoxyThenzy1)-2,4-thiazolidinedione; 5 -
(4-[3 -(N-methyl-N-(2-
benzoxazolypamino)propoxyThenzylidene)-2,4-thiazolidinedione;. 5-
(442-(N-methyl-N-(2-
pyridyl)amino)ethoxy]benzy1)-2,4-thiazolidinedione; 5-(4 [2-
(N-methyl-N-(2-
pyridyl)amino)ethoxyThenzylidene)-2,4-thiazolidinedione; 5 -
(4-[4-(N-methyl-N-(2-
benzoxazolypamino)butoxy]benzylidene)-2,4-thiazolidinedione;. 5-(4-[4-(N-
methyl-N-(2-
benzoxazolyDamino)butoxyThenzy1)-2,4-thiazolidinedione; 5-
(4-[2-(N-(2-
benzoxazolyDamino)ethoxyThenzylidene)2,4-thiazolidinedione; 5-
(4-[2-(N-(2-
benzoxazolypamino)ethoxyThenzy1)-2,4-thiazolidinedione; 5-
(442-(N-isopropyl-N-(2-
benzoxazolyDamino)ethoxyThenzy1)-2,4-thiazolidin edione, and pharmaceutically
acceptable
salts thereof. See, e.g., U.S. Patent No. 5,002,953.
Thiazolidinedione drugs also include pioglitazone (( )-54p42-(5-ethyl-2-
pyridyl)ethoxyThenzyl]-2,4-thiazolidinedione, or a salt, solvate, co-crystal,
polymorphic
forms and optical isomers thereof) (commercially available as ACTOS).
Thiazolidinedione
compounds include, but are not limited to, 5-{442-(5-ethy1-2-
pyridypethoxyThenzy1}-2,4-
thiazolidinedione, 5-{442-(6-ethy1-2-pyridyl)ethoxyThenzyll-2,4-
thiazolidinedione, 5444243-
ethy1-2-pyridypethoxy)benzyl]-2,4-thiazolidinedione, 5-(4-(2-(4-ethy1-2-
pyridyl)ethoxy)benzy1)-
2,4-thiazolidinedione, 5-(4-(2-(5-ethy1-2-pyridyl)ethoxy)benzy1)-2,4-
thiazolidinedione, 54442-
(6-ethy1-2-pyridyl)ethoxy)benzy1)-2,4-thiazolidinedione, (R)-(+)-5-(3-(4-(2-(2-
fury1)-5-methy1-
4-oxazolylmethoxy)-3-methoxyphenyl)propy1)-2,4-oxazolidinedione, 5 -
((3 ,4-dihydro-2-
(phenylmethyl)-2H-1-benzopyran-6-yl)methyl)-2,4thiazolid
inedione, 54(443 -(5 -methy1-2-
pheny1-4-oxazoly1)-1-oxopropyl)phenyl)methyl)-2,4-thi
azolidinedione, 5 -(245 -methyl-2-
pheny1-4-oxazolylmethyl)benzofuran-5-ylmethyl)-2,4-oxazol idinedione, 5-
(2-
naphthalenylsulfony1)-2,4-thiazolidinedione, 54(4-(2-methy1-2-
pyridylamino)ethoxy)pheny1)-
methyl)-2,4-thiazolidinedione, and pharmaceutically acceptable salts thereof.
See U.S. Patent
Nos. 4,687,777 and 5,965,584.
The active agents disclosed herein can, as noted above, be prepared in the
form of their
pharmaceutically acceptable salts. Pharmaceutically acceptable salts are salts
that retain the
desired biological activity of the parent compound and do not impart undesired
toxicological
effects. Examples of such salts are (a) acid addition salts formed with
inorganic acids, for
example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid,
nitric acid and the
32
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
like; and salts formed with organic acids such as, for example, acetic acid,
oxalic acid, tartaric
acid, succinic acid, maleic acid, fimaric acid, gluconic acid, citric acid,
malic acid, ascorbic acid,
benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid,
naphthalenesulfonic
acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic
acid, polygalacturonic
acid, and the like; (b) salts formed from elemental anions such as chlorine,
bromine, and iodine,
and (c) salts derived from bases, such as ammonium salts, alkali metal salts
such as those of
sodium and potassium, alkaline earth metal salts such as those of calcium and
magnesium, and
salts with organic bases such as dicyclohexylamine and N-methyl-D-glucamine.
Active agents can be administered as prodrugs. "Prodrugs" as used herein
refers to those
prodrugs of the compounds of the present invention which are, within the scope
of sound
medical judgment, suitable for use in contact with the tissues of humans and
lower animals
without undue toxicity, irritation, allergic response and the like,
commensurate with a reasonable
risk/benefit ratio, and effective for their intended use, as well as the
zwitterionic forms, where
possible, of the compounds of the invention. The term "prodrug" refers to
compounds that are
rapidly transformed in vivo to yield the parent compound of the above
formulae, for example, by
hydrolysis in blood. A thorough discussion is provided in T. Higuchi and V.
Stella, Prodrugs as
Novel delivery Systems, Vol. 14 of the A.C.S. Symposium Series and in Edward
B. Roche, ed.,
Bioreversible Carriers in Drug Design, American Pharmaceutical Association and
Pergamon
Press, 1987, both of which are incorporated by reference herein. See also U.S.
Patent No.
6,680,299. Examples include a prodrug that is metabolized in vivo by a subject
to an active drug
having an activity of active compounds as described herein, wherein the
prodrug is an ester of an
alcohol or carboxylic acid group, if such a group is present in the compound;
an acetal or ketal of
an alcohol group, if such a group is present in the compound;. an N-Mannich
base or an imine of
an amine group, if such a group is present in the compound; or. a Schiff base,
oxime, acetal, enol
ester, oxazolidine, or thiazolidine of a carbonyl group, if such a group is
present in the
compound, such as described in U.S. Patent No. 6,680,324 and U.S. Patent No.
6,680,322.
Compositions. The active agents described above may be formulated for
administration
in a pharmaceutical carrier in accordance with known techniques. See, e.g.,
Remington, The
Science And Practice of Pharmacy (9th Ed. 1995). In the manufacture of a
pharmaceutical
formulation according to the invention, the active compound (including the
physiologically
acceptable salts thereof) is typically admixed with, inter alia, an acceptable
carrier. The carrier
must, of course, be acceptable in the sense of being compatible with any other
ingredients in the
formulation and must not be deleterious to the patient. The carrier may be a
solid or a liquid, or
both, and is preferably formulated with the compound as a unit-dose
formulation, for example, a
tablet, which may contain from 0.01 or 0.5% to 95% or 99% by weight of the
active compound.
33
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
One or more active compounds may be incorporated in the formulations of the
invention, which
may be prepared by any of the well known techniques of pharmacy comprising
admixing the
components, optionally including one or more accessory ingredients.
The formulations of the invention include those suitable for oral, rectal,
topical, buccal
(e.g., sub-lingual), vaginal, parenteral (e.g., subcutaneous, intramuscular,
intradermal, or
intravenous), topical (i.e., both skin and mucosal surfaces, including airway
surfaces) and
transdermal administration, although the most suitable route in any given case
will depend on the
nature and severity of the condition being treated and on the nature of the
particular active
compound which is being used.
Formulations suitable for oral administration may be presented in discrete
units, such as
capsules, cachets, lozenges, or tablets, each containing a predetermined
amount of the active
compound; as a powder or granules; as a solution or a suspension in an aqueous
or non-aqueous
liquid; or as an oil-in-water or water-in-oil emulsion. Such formulations may
be prepared by any
suitable method of pharmacy which includes the step of bringing into
association the active
compound and a suitable carrier (which may contain one or more accessory
ingredients as noted
above). In general, the formulations of the invention are prepared by
uniformly and intimately
admixing the active compound with a liquid or finely divided solid carrier, or
both, and then, if
necessary, shaping the resulting mixture. For example, a tablet may be
prepared by compressing
or molding a powder or granules containing the active compound, optionally
with one or more
accessory ingredients. Compressed tablets may be prepared by compressing, in a
suitable
machine, the compound in a free-flowing form, such as a powder or granules
optionally mixed
with a binder, lubricant, inert diluent, and/or surface active/dispersing
agent(s). Molded tablets
may be made by molding, in a suitable machine, the powdered compound moistened
with an
inert liquid binder.
Formulations suitable for buccal (sub-lingual) administration include lozenges
comprising the active compound in a flavored base, usually sucrose and acacia
or tragacanth; and
pastilles comprising the compound in an inert base such as gelatin and
glycerin or sucrose and
acacia.
Formulations of the present invention suitable for parenteral administration
comprise
sterile aqueous and non-aqueous injection solutions of the active compound(s),
which
preparations are preferably isotonic with the blood of the intended recipient.
These preparations
may contain anti-oxidants, buffers, bacteriostats and solutes which render the
formulation
isotonic with the blood of the intended recipient. Aqueous and non-aqueous
sterile suspensions
may include suspending agents and thickening agents. The formulations may be
presented in
unit\dose or multi-dose containers, for example sealed ampoules and vials, and
may be stored in
34
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
a freeze-dried (lyophilized) condition requiring only the addition of the
sterile liquid carrier, for
example, saline or water-for-injection immediately prior to use.
Extemporaneous injection
solutions and suspensions may be prepared from sterile powders, granules and
tablets of the kind
previously described. For example, in one aspect of the present invention,
there is provided an
injectable, stable, sterile composition comprising an active agent(s), or a
salt thereof, in a unit
dosage form in a sealed container. The compound or salt is provided in the
form of a lyophilizate
which is capable of being reconstituted with a suitable pharmaceutically
acceptable carrier to
form a liquid composition suitable for injection thereof into a subject. The
unit dosage form
typically comprises from about 10 mg to about 10 grams of the compound or
salt. When the
compound or salt is substantially water-insoluble, a sufficient amount of
emulsifying agent
which is physiologically acceptable may be employed in sufficient quantity to
emulsify the
compound or salt in an aqueous carrier. One such useful emulsifying agent is
phosphatidyl
choline.
Formulations suitable for topical application to the skin preferably take the
form of an
ointment, cream, lotion, paste, gel, spray, aerosol, or oil. Carriers which
may be used include
petroleum jelly, lanoline, polyethylene glycols, alcohols, transdermal
enhancers, and
combinations of two or more thereof.
Formulations suitable for transdermal administration may be presented as
discrete
patches adapted to remain in intimate contact with the epidermis of the
recipient for a prolonged
period of time. Formulations suitable for transdermal administration may also
be delivered by
iontophoresis (see, for example, Pharmaceutical Research 3 (6):318 (1986)) and
typically take
the form of an optionally buffered aqueous solution of the active compound.
Suitable
formulations comprise citrate or bis\tris buffer (pH 6) or ethanol/water and
contain from 0.1 to
0.2M active ingredient.
In addition to active compound(s), the pharmaceutical compositions may contain
other
additives, such as pH-adjusting additives. In particular, useful pH-adjusting
agents include acids,
such as hydrochloric acid, bases or buffers, such as sodium lactate, sodium
acetate, sodium
phosphate, sodium citrate, sodium borate, or sodium gluconate. Further, the
compositions may
contain microbial preservatives. Useful microbial preservatives include
methylparaben,
propylparaben, and benzyl alcohol. The microbial preservative is typically
employed when the
formulation is placed in a vial designed for multidose use. Of course, as
indicated, the
pharmaceutical compositions of the present invention may be lyophilized using
techniques well
known in the art.
Dosage. The therapeutically effective dosage of any specific active agent, the
use of
which is in the scope of present invention, will vary somewhat from compound
to compound,
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
and patient to patient, and will depend upon the condition of the patient and
the route of delivery.
For oral administration, a total daily dosage of from 1, 2 or 3 mg, up to 30,
40 or 50 mg, may be
used, given as a single daily dose or divided into two or three daily doses.
For example, when
administering rosigitazone in accordance with the methods of the present
invention, a single
daily dose may be the FDA approved dose for Avandia of 2 mg, 4 mg or 8mg. By
further
example, when administering pioglitazone in accordance with the methods of the
present
invention, a single daily dose may be the FDA approved dose for Actos4.1) of
15 mg, 30 mg or 45
mg.
Treatment. Genetic variants as described herein or discovered using the
methods as
taught herein may be used to determine the course of treatment of a patient
afflicted with a
condition (e.g., a condition associated with ApoE and/or TOMM40), by, e.g.,
determining which
active agent and/or course of treatment and/or dosage to administer based upon
the presence or
absence of the genetic variant or variants. The presence or absence of the
genetic variants may
indicate efficacy of an active agent and/or course of treatment for the
patient, predict age of onset
for a condition, indicate preferred dose regimens, etc. A genetic profile may
be generated for a
patient, and the profile consulted to determine whether the patient is among a
group of patients
that are likely to be responsive to a particular active agent.
Instructions for use may be packaged with or otherwise associated with an
active agent
indicating recommendations for treatment, time to treatment, dose regimens,
etc., based upon the
presence or absence of the genetic variants.
8. Methods of determining a prediction of disease risk or a prognosis.
To determine a prediction of disease risk for a non-symptomatic individual or
a prognosis
(the prospect of affliction or disease course as anticipated from the usual
course of disease or
peculiarities of the case) according to some embodiments of the present
invention, diagnostic
data, including the patient's diagnosis or medical history or age, and genetic
data, such as the
patient's genotype (e.g., ApoE and/or TOMM40 genotype), may be processed to
provide
therapeutic options and outcome predictions. Processing may include obtaining
a "patient
profile" such as the collection of a patient's medical history including age
and gender,
genotyping of the loci of interest (e.g., using appropriately designed primers
and using an RT-
PCR or PCR amplification step and/or phenotyping, e.g., using an antibody-
mediated method or
enzymatic test), and statistical or other analyses that converts this raw data
into a prognosis. The
prognosis may include a prediction of a patient's age of disease onset,
response to drug therapy,
time to treatment, treatment efficacy, etc. In some embodiments, the prognosis
may include the
use of a computer software program to analyze patient data and run statistical
cross-checks
against relational databases in order to convert the patient data or profile
to a prognosis.
36
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
A "patient profile" includes data and/or materials pertaining to the patient
for whom the
predictive and/or prognostic analysis is being performed. Data may include
information on the
patient's diagnosis, age, gender, and/or genotype. The patient profile may
also include materials
from the patient such as blood, serum protein samples, cerebrospinal fluid, or
purified RNA or
DNA.
A physician may choose to prescribe an active agent that treats Alzheimer's
disease,
cognitive impairment, etc., according to an individual's risk of developing
the disease. An
individual's risk according to some embodiments is determined by a TOMM40
genotype (e.g., at
rs10524523), optionally in conjunction with any of a number of other factors
that may include,
for example, the individual's age, gender, APOE genotype, cognitive status,
brain images (e.g.,
of atrophy or brain volume generated using magnetic resonance imaging (MRI) or
metabolic
activity assayed by BOLD functional MRI), biochemical markers (e.g. serum or
CSF amyloid
beta, tau or phospho-tau), etc., or a combination of these factors.
9. Genotype stratification in clinical trials.
Detection of a genotype taught herein or as determined with the methods herein
can be
used in conducting a clinical trial in like manner as other genotype
information is used to
conduct a clinical trial, such as described in, e.g., U.S. Patent Nos.
6,573,049 6,368,797 and
6,291,175.
In some embodiments, such methods advantageously stratify or permit the
refinement of
the patient population (e.g., by division of the population into one or more
subgroups) so that
advantages of particular treatment regimens can be more accurately detected,
particularly with
respect to particular sub-populations of patients with particular genotypes.
In some
embodiments, such methods comprise administering a test active agent or
therapy to a plurality
of subjects (a control or placebo therapy typically being administered to a
separate but similarly
characterized plurality of subjects) and detecting the presence or absence of
a genotype (e.g.,
ApoE and/or TOMM40) as described above in the plurality of subjects. The
genotype may be
detected before, after, or concurrently with the step of administering the
test therapy. The
influence of one or more detected alleles on the test therapy can then be
determined on any
suitable parameter or potential treatment outcome or consequence, including,
but not limited to,
the efficacy of said therapy, lack of side effects of the therapy, etc.
A clinical trial can be set up to test the efficacy of test compounds to treat
any number of
diseases for which a particular genotype has been determined to be associated,
for subjects who
are diagnosed with the disease or are at risk for developing the disease. If
subjects are genotyped
after the completion of a clinical trial, the analyses may still be aimed at
determining a
relationship between a treatment for a disease and the allele to be assessed
for efficacy.
37
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
Alternatively, if a symptomatic or asymptomatic subject has not yet been
diagnosed with the
disease but has been determined to be at risk of developing the disease, a
similar clinical trial to
the clinical trial described above may be carried out.
The underlying biological mechanisms may also be considered when designing the
treatment groups. For example, the ApoE 4 (1-272) fragment binds to
mitochondria, decreases
mitochondrial cellular dynamics and decreases synaptogenesis more than ApoE 3
(1-272).
Rosiglitazone, a drug candidate for the treatment of Alzheimer's disease,
increases mitogenesis
and increases synaptogenesis ¨ opposing the effects of ApoE fragment binding ¨
for ApoE 3
greater than with ApoE 4. Therefore, the drug or treatment candidate (e.g.,
rosiglitazone or
pioglitazone) may be selected based upon an underlying mechanism of action as
it relates to the
genetic markers used for the stratifications (e.g., ApoE 2, E 3, E 4 and/or
TOMM40 variants).
Assessment of the efficacy of a drug chosen for the trial may include
monitoring the
subject over a period of time and analyzing the delay of onset of the disease
and the intensity of
the disease at the time of onset, as well as measuring the onset of symptoms
which are associated
with the disease. A drug that, in a clinical trial, eliminates or delays the
onset of the disease, or
reduces the symptoms of the disease may be a beneficial drug to use in
patients diagnosed with
the disease or at risk of developing the disease. Test compounds which may be
used in such trials
" include the agents as described above, including those previously approved
for clinical use and
new compounds not yet approved for use, or approved for treating a particular
disease. Thus, in
some embodiments the clinical trial may include the optimization of drug
administration,
including dosage, timing of administration, toxicities or side effects, route
of administration,
formulation, and efficacy of the treatment.
10. Kits useful for the detection of genotype variants at loci of interest
and/or determining
treatment.
Kits for determining if a subject is at increased risk of developing a
disease, developing a
disease at an earlier age of onset, and/or a candidate for a particular
treatment, where the disease
is associated with ApoE and/or TOMM40 (e.g., late onset Alzheimer's disease),
are provided
herein. The kits include at least one reagent specific for, detecting for the
presence or absence of
an ApoE and/or TOMM40 variant as described herein, and may include
instructions to aid in
determining whether the subject is at increased risk of developing the
disease. The kit may
optionally include a nucleic acid for detection of an ApoE gene (e.g., ApoE 2,
ApoE 3 and/or
ApoE 4) or instructions for isoelectric focusing methods for detecting the
ApoE genotype; and/or
a nucleic acid or multiple nucleic acids for detection of a TOMM40 variant
(e.g., the length of a
TOMM40 variant) as described herein. In some embodiments, the kit may
optionally include one
or more antibodies which binds to ApoE 2, ApoE 3, ApoE 4, or to isoforms of
TOMM40. The
38
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
test kit may be packaged in any suitable manner, typically with all elements
in a single container
. along with a sheet of printed instructions for carrying out the test.
In some embodiments, the kit may optionally contain buffers, enzymes, and
reagents for
amplifying the genomic nucleic acids via primer-directed amplification. The
kit also may include
one or more devices for detecting the presence or absence of particular
haplotypes in the
amplified nucleic acid. Such devices may include one or more probes that
hybridize to a
haplotype nucleic acid, which may be attached to a bio-chip or microarray
device, such as any of
those described in U.S. Pat. No. 6,355,429. The bio-chip or microarray device
optionally has at
least one capture probe attached to a surface that can hybridize to a
haplotype sequence. In
preferred embodiments, the bio-chip or microarray contains multiple probes,
and most preferably
contains at least one probe for a haplotype sequence which, if present, would
be amplified by a
set of flanking primers. For example, if five pairs of flanking primers are
used for amplification,
the device would contain at least one haplotype probe for each amplified
product, or at least five
probes. The kit also preferably includes instructions for using the components
of the kit.
The kit may include a device that permits the determination of length of the
polyT
variant. Such a device may include a microcapillary electrophoresis device
such as those
described in U.S. Pat. No. 5,112,460 or a component thereof, or a microfluidic
electrophoresis
device such as those described in U. S. Pat. No. 5,904,824.
11. Computer program products useful for determining risk and/or treatment.
Determining risk and/or treatment for a disease such as Alzheimer's disease
according to
some embodiments of the present invention may be implemented by computer
program
instructions for convenient implementation in a clinic. In some embodiments, a
user may be
prompted to enter specific information about an individual, e.g., one or more
of the following:
TOMM40 genotype (including, but not limited to, poly-T length at rs10524523,
and optionally,
for each TOMM40 allele), age, APOE genotype, signs or symptoms of a disease of
interest (if
present), family history, etc. The data may be processed and a readout
provided of relative risk of
onset of the disease or symptoms thereof, in the form of a list, chart, etc.,
and/or may determine a
course of treatment for the individual (e.g., what active agent to prescribe,
what dosage and
administrations, etc.).
In some embodiments, the determining may make use a prospectively validated
algorithm, a retrospectively validated algorithm, or a planned retrospectively
validated
algorithm.
These computer program instructions may be provided to a processor of a
general
purpose computer, special purpose computer, and/or other programmable data
processing
apparatus to produce a machine, such that the instructions, which execute via
the processor of the
39
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
computer and/or other programmable data processing apparatus, create means for
implementing
the, desired operations.
These computer program instructions may also be stored in a computer-readable
memory
that can direct a computer or other programmable data processing apparatus to
function in a
particular manner, such that the instructions stored in the computer-readable
memory produce an
article of manufacture including instructions which implement the operations.
The computer program instructions may also be loaded onto a computer or other
programmable data processing apparatus to cause a series of operational steps
to be performed
on the computer or other programmable apparatus to produce a computer-
implemented process
such that the instructions which execute on the computer or other programmable
apparatus
provide steps for implementing the operations.
Accordingly, the present invention may be embodied in hardware and/or in
software
(including firmware, resident software, micro-code, etc.). Furthermore,
embodiments of the may
take the form of a computer program product on a computer-usable and/or
computer-readable
storage medium having computer-usable or computer-readable program code
embodied in the
medium for use by or in connection with an instruction execution system. As
used herein, a
computer-usable or computer-readable medium may be any medium that can contain
or store the
program for use by or in connection with the instruction execution system,
apparatus, or device.
The computer-usable and/or computer-readable medium may be, for example but
not
limited to, an electronic, magnetic, optical, electromagnetic, infrared, or
semiconductor system,
apparatus or device. More specific examples (a non-exhaustive list) of the
computer-readable
medium would include the following: a portable computer diskette, a random
access memory
(RAM), a read-only memory (ROM), an erasable programmable read-only memory
(EPROM or
Flash memory), and a portable compact disc read-only memory (CD-ROM).
The present invention is explained in greater detail in the following non-
limiting
Examples.
EXAMPLE 1: Construction of Phylogenetic Trees
All of the known genome-wide scanning studies demonstrate extremely
significant p
values around the apolipoproteinC1 [ApoCl] locus. (Mahley et al., Proc. Natl.
Acad. Sci. U S A
103: 5644-51 (2006), Coon et al., J. Clin. Psychiatry 68: 613-8 (2007); Li et
al., Arch. Neurol.
65: 45-53 (2007)). Of equal importance is that each series identified a
"favored" borderline
significant candidate gene outside of the ApoE linkage disequilibrium area,
but these favored
candidate genes were different in each study. TOMM40 is near ApoC1 and in
linkage
disequilibrium with ApoE. Interactions between ApoE 3 or ApoE 4 and different
TOMM40
isoforms are believed to be associated with increased or decreased risk of
developing
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
Alzheimer's disease within an earlier age range. Age of Alzheimer's disease
onset curves for
Apo 4/4, 3/4, 3/3, 2/4, and 2/3 genotypes is shown in Figure 2, indicating a
range of risk for
earlier development of the disease, depending upon the ApoE profile. ApoE
alone does not
appear to explain all of the data in these age of onset curves, however.
Various methods for polymorphic profiling of Alzheimer's disease risk
associated with
the different ApoE alleles have been proposed (see, e.g., U.S. Application of
Cox et al., No.
20060228728; U.S. Application of Li and Grupe, No. 20080051318). A
phylogenetic approach
to the ApoE 4 puzzle is demonstrated herein.
Biological samples, DNA isolation, amplification of loci of interest. A total
of 148
subjects included 74 Alzheimer's disease cases and 31 controls in the AS
cohort and 40 cases
and 33 controls in the DS cohort. All subjects carried the ApoE genotypes
previously associated
with higher risk for earlier disease onset (i.e. 3/3, 3/4, or 4/4). Biological
samples containing
DNA were collected from all subjects. Genomic DNA was then isolated according
to
conventional methods for sequencing of genetic loci on Chromosome 19.
Figure 3 shows the genetic regions on Chromosome 19 targeted for study using
multiple
sequence alignment and phylogenetic analysis. The region is encompassed within
GenBank
reference sequence AF050154. Software was used to generate multiple sequence
alignments for
variant loci (e.g., ClustalW2, European Bioinformatics Institute).
Subsequently, the multiple
sequence alignments were analyzed using software for developing phylogenetic
trees (e.g.,
MEGA version 2.1, Center for Evolutionary Functional Genomics, TREEVOLVE,
Department
of Zoology, University of Oxford, or parsimony-based construction software
such as PAUP,
Sinauer Associates). Statistical analyses may be performed with, e.g., Genetic
Data Analysis
(GDA:. Software for the Analysis of Discrete Genetic Data, The Bioinformatics
Research Center
of North Carolina State University). The results of Region B analysis are
demonstrated in the
phylogenetic tree of Figure 4.
Each piece of data in Figure 4 represents an observed sequence variant. These
variants
may be nucleotide substitutions, insertions, deletions, or microsatellites and
may or may not
result in detectable differences in gene expression or protein function. Each
node represents a
variant (or a number of variants) that occurs on more than one chromosome.
Adjacent nodes
define the boundaries of sequences that are in cis, and therefore more likely
to be inherited as a
unit, in the region of interest on a subject's chromosome. Nodes that precede
the greatest number
of subsequent nodes represent evolutionarily ancestral variants from which
genetic divergence
has occurred over time.
The presence of haplotypes or sequence variants corresponding with regions of
the tree
representing subjects with substantially higher incidence of Alzheimer's
disease (i.e., higher
41
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
ratios of subjects affected with the disease to unaffected control subjects)
would mean that the
individual subject is also at increased risk. Conversely, substantially lower
ratios correspond to
reduced risk of developing Alzheimer's disease.
While not wishing to be bound by theory, it is thought that TOMM40 interacts
with
ApoE directly in regulation of mitochondrial protein import, and a present
hypothesis is that the
expression of a particular TOMM40 variant(s) exacerbates the relatively
moderate risk for
Alzheimer's disease associated with the dose-dependent presence of the ApoE 3
allele. Such a
TOMM40 variant is discovered within Region B using the methods of the present
invention.
Testing new drugs on human subjects carries immense risk (see Kenter and
Cohen,
Lancet, 368: 1387-91 (2006)). The use of phylogenetic trees to anticipate
individual response to
a drug or treatment of interest has potential to alleviate that risk
significantly. Preliminary studies
indicated that rosiglitazone (Avandia) may have genetic-profile specific
efficacy in the treatment
of Alzheimer's disease (see Risner et al., The Pharmacogenomics Journal 6, 246-
254 (2006);
Brodbeck et al., Proc. Nat. Acad. Sci. 105, 1343-6 (2008)). Phase II clinical
trial data indicate
that Alzheimer's disease patients without an ApoE 4 allele responded better to
rosiglitazone than
patients who carry either 1 or 2 ApoE 4 alleles (data not shown). This
supports the hypothesis
that variants identified with the methods taught herein may be used to
anticipate individual
response to treatment based upon genotype.
EXAMPLE 2:. Identification of.TOMM40 Variants of Interest
210 sequences (from 105 subjects in the AS cohort) were aligned using the
CLUSTAL X
program (version 2Ø10, Larkin et al., Clustal W and Clustal X version 2Ø
Bioinformatics,
23:2947-2948 (2007)). The multiple sequence alignment was used to construct a
phylogenetic
tree using a neighbor joining algorithm (Saitou and Nei, The neighbor-joining
method: a new
method for reconstructing phylogenetic trees. Mol. Evol. Biol., 4:406-425
(1987)) as
implemented on the European Bioinformatics Institute (EBI) website.
The resulting phylogenetic tree has a structure of two major clades (A, B) at
the first
divergence. The ApoE genotype frequencies for these clades are tabulated and
shown in Figure
5. It is clear that group B contains subject-haplotypes of primarily E3/E3 and
E3/E4 ApoE
genotypes and almost no e4/e4. Clade A contains almost all of the subject
haplotypes with the
e4/E4 genotype.
The list of polymorphisms generated by the SNP discovery platform
(Polymorphic) were
used to identify specific variants in the TOMM40 gene that separated the data
into the two
groups. A likelihood ratio test was used to identify significant variants with
a p value less than
0.005.
42
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
The list of variants is summarized in Table 1. In the table, the term
"deletion" is used
when the minor allele is a deletion of a nucleotide, and the term "insertion"
is used when the
minor allele is an addition of a nucleotide. The term "deletion/insertion
polymorphism" is used
when there are more than two possible forms and the minor allele is not
apparent. For example,
for the poly-T polymorphisms, there are multiple length polymorphisms
observed. The second
column of the table provides information on the identities of the specific
alleles associated with
the variant that divide the sequences into the two groups. For example, T>A
indicates that the T
allele segregates sequences into group "A" on the phylogenetic tree. When two
alleles are listed,
e.g. G>B; A>A, each allele uniquely segregates the sequence data into the two
groups, while
when a single allele is listed it is associated with the predominate
separation of the data, and the
remaining allele does not uniquely separate the data into a homogenous group,
but instead a
mixture of both groups.
Table 1. TOMM40 variants associated with groups on phylogenetic tree that
distribute
by ApoE genotype.
Variant Allele>tree group Genomic Function UCSC
Location Classification
50,092,565 T>A 50,092,565 Intron 6 single
50,092,587 T>A 50,092,587 Intron 6 single
rs8106922 G>B; A>A 50,093,506 - Intron 6 single
rs34896370, T12_C_T15, T12_C_T16, 50,093,609 Intron 6 complex
rs55821237, T13_C_T14, T13_C_T15,
rs56290633 T13 C T16>A;
T14 C T14,
T14 C T15>B
rs34878901 T>B; C>A 50,094,317 Intron 6 single
rs35568738 C>B 50,094,558 Intron 6 single
rs10602329 T16,17,18>A 50,094,716 Intron 6
insertion/deletion
T14,15>B
50,094,733 ->A 50,094,733 Intron 7 insertion
rs10524523 T12,14,15,16,17>B 50,094,889 Intron 6
insertion/deletion
T19,T20,T21,22,26,27,28,29,
30,31,32,33,34
35,36>A
rs1160985 T>B; C>A 50,095,252 Intron 6 single
50,095,056 T>A 50,095,506 Intron 6 single
rs760136 A>A; G>B 50,095,698 Intron 6 single
rs1160984 T>B 50,095,764 Intron 6 single
rs741780 C>B; T>A 50,096,271 Intron 8 single
rs405697 A>A 50,096,531 Intron 9 single
50,096,647 ->A 50,096,647 Intron 9 'deletion
(D1P3)
43
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
= 50,096,697 C>A 50,096,697 Intron 9
single
rs1038025 C>B; T>A 50,096,812 Intron 9 single
rs1038026 G>B; A>A 50,096,902 Intron 9 single
rs1305062 C>B; G>A 50,097,361 Intron 9 single
rs34215622 G>B; ->A 50,098,378 Exon 10 insertion
rs10119 A>A 50,098,513 Exon 10 single
rs7259620 G>A; A>B 50,099,628 unknown single
EXAMPLE 3: Two distinct forms of ApoE 3 : those linked to TOMM40 haplotypes
that
increase risk and decrease age of onset, and those that decrease risk
The association of apolipoprotein E (ApoE) genotypes, particularly ApoE E4
(ApoE 4),
with the risk and age of onset of Alzheimer's disease (AD) remains the most
confirmed genetic
association for any complex disease. Estimates of the heritability of ApoE 4
for late onset AD
range from 58% to 79%, and the population attributable risk due to the ApoE 4
allele is between
20% and 70%. These estimates suggest that other genetic variants and/or
interactions between
variants incur additional disease risk and modify age of onset distributions.
Genome wide scan association results for AD have consistently reproduced the
extraordinary Alzheimer's disease association of the LD region containing
ApoE. TOMM40, the
protein translocase of the outer mitochondrial membrane, is in high LD with
ApoE, and codes
for the membrane channel- through which cytoplasmic peptides and proteins
traverse in order to
synthesize new mitochondria. Our objectives were to identify additional
haplotypes within the
LD region that increase the estimates of heritability.
Methods: We examined the LD region containing both ApoE and TOMM40 using deep
(10X) primary sequencing in AD patients and controls. We performed
phylogenetic analyses of
the LD region covering TOMM40 and ApoE in 74 Alzheimer's disease cases and 31
age-
matched, unaffected controls with respect to disease risk. Age of onset
distribution was also
analyzed.
Conclusion: We found that unique and distinct inherited families of different
TOMM40
variants are located on the same genomic interval as ApoE 3, versus different
and distinct
TOMM40 variants on the ApoE 4-containing genomic interval, and can either
increase or
decrease the age of risk distribution of AD. Therefore, the genetic
inheritance of these APOE3-
linked TOMM40 variants are independent of the inheritance of ApoE 4,
effectively providing a
differentiation of two distinct forms of ApoE 3 : those linked to TOMM40
haplotypes that
increase risk and decrease age of onset of disease, and those that decrease
risk and increase age
of onset. These data increase the accuracy of genetic age of onset risk,
dependent on age, ApoE
and TOMM40 genotypes and provide the opportunity to define high risk of AD
over the next 5-7
years, versus lower risk of AD.
44
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
EXAMPLE 4: Analysis of three identified TOMM40 DIP variants
Three of the TOMM40 variants identified in this application are
deletion/insertion
polymorphisms (DIPs) located in intron 6 or intron 9. These DIPs are
identified as rs10524523
and rs10602329 in the National Center for Biotechnology Information dbSNP
database, and a
previously undescribed polymorphism, designated as DIP3. These polymorphisms
are located at
chrl 9:50,094,889, chr19:50,094,731, and chr19:50,096,647, respectively,
according to NCBI
build 36. This invention describes the identification of these DIPs using
phylogenetic analysis of
the TOMM40 gene, specifically of a 10 Kb fragment of the gene, and that the
DIPs are
associated with different evolutionary groups determined by phylogenetic
analysis. This
invention further discloses the utility of these DIPs for (1) determining risk
of a healthy person
for developing Alzheimer's disease in the future, and (2) for predicting age
of onset of AD
within an approximately 8 year time-frame.
The three DIP polymorphisms characterized herein correspond to different
lengths of DIP
poly-T repeats in the TOMM40 gene. The association of DIP poly-T variants with
disease risk
has precedence. For example a poly-T variant in intron 8 of the cystic
fibrosis transmembrane
conductance regulator (CFTR) gene is associated with skipping of exon 9 and
the development
of cystic fibrosis (Groman et al., Am J Hum Genet 74(1):176-9 (2004)). Herein
is disclosed: (1)
use of the novel method - phylogenetic association analysis (described above) -
to identify DIPs
that are predictive of disease risk and/or differences in age of disease
onset, (2) the identity of
three specific DIPs associated with differences in AD age of onset and AD
risk, (3) the use of
these DIPs individually, together, or with other sequence variants in TOMM40
or ApoE to
diagnose disease or predict or determine disease characteristics such as age
of disease onset,
disease prognosis, disease sub-types, disease severity, and also to analyze or
determine the
response to drugs.
Phylogenetic analysis reveals the distribution of rs10524523 and rs10602329
DIPs into
two different clades. This analysis reveals that shorter poly-T lengths at
these loci map to the
phylogenetically-identified clades in group B, the group that also comprises
higher percentages
of ApoE e3/e3 genotype subjects, effectively few (0%) ApoE e4/e4 subjects and
lower
case/control ratios (i.e., lower AD disease risk) (Figure 5). The association
between DIP length
and phylogenetic group is statistically significant (p < 0.0001) by the
likelihood ratio test or
Pearson Chi-square test.
Due to the genomic architecture, the high linkage disequilibrium and the
evolutionary
relationships as indicated the phylogenetic analysis, between the two genes,
and the putative
physical interaction between the two gene products, the influence of TOMM40
genotype is likely
to extend to other diseases that are influenced by ApoE genotype. These
diseases include, but are
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
not limited to, Parkinson's disease, Multiple sclerosis, cardiovascular
disease, dyslipidemia,
recovery from traumatic brain injury, recovery from brain ischemic events,
response to
anaesthetics, and response to drugs used to treat AD and the diseases listed
here. These
polymorphisms could also be used to, prospectively or retrospectively,
stratify subjects in a
clinical trial.
These polymorphisms could also be used in drug discovery efforts for the
screening of
compounds useful for treating diseases influenced by variations in TOMM40 or
ApoE protein or
gene variants.
In addition, the variants may influence or determine therapies based on
specifically
targeted biopharmaceuticals as exemplified by monoclonal antibodies and siRNA
molecules.
The DIP polymorphisms in TOMM40 that are disclosed herein can be identified
from an
individual's DNA sample using many different molecular nucleotide analysis
methodologies,
including, but not limited to, DNA sequencing with the primers denoted in
Table 4 listed below.
EXAMPLE 5: Longer poly-T tracts at rs10524523 are
significantly associated with earlier age of onset of LOAD
Phylogenetic analysis has been used to identify genomic relationships between
low
frequency genetic variants and to cluster evolutionarily related haplotypes
(Hahn et al.
Population genetic and phylogenetic evidence for positive selection on
regulatory mutations at
the factor VII locus in humans. Genetics 167, 867-77 (2004)). This methodology
was employed
to explore the ApoE-TOMM40 LD block for the existence of novel risk
determinants for late-
onset Alzheimer's disease (LOAD). In an exploratory study, 23 Kb of DNA
containing the
TOMM40 and ApoE genes were amplified and sequenced, and phase-resolved
haplotypes were
determined, for 83 LOAD cases and 67 age-matched controls (Li et al. Candidate
single-
nucleotide polymorphisms from a genome-wide association study of Alzheimer
disease. Arch
Neurol 65, 45-53 (2008)). It was possible to construct a distinct phylogenetic
tree for 10 Kb,
encoding exons 2-10, of this region. Two clades (A and B) were distinguished
with strong
bootstrap support (98%, 1000 replicates). There was a significant difference
in the distribution of
the ApoE genotypes between the two clades of TOMM40 haplotypes on this
phylogenetic tree,
suggesting that this region could be functionally significant. Both clades
contained subjects with
the e3/E3 genotype, but 98% of all clade B haplotypes occurred in cis with the
ApoE E3 allele (P
= 1.2 x 108, Fisher's exact test, two-tailed).
The phylogenetic structure of this 10 Kb region of TOMM40, the ApoE e3-
specific
inheritance of particular haplotypes, and the identify of the clade-specific
polymorphisms were
subsequently confirmed in two independent LOAD case/control cohorts, including
one cohort
with autopsy-confirmed AD status and age of disease onset data. The
association between the
46
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
two clades and disease risk and age of disease onset, where the data was
available, was also
explored for these two cohorts. The first cohort (AS) comprised AD cases (n =
74) and controls
(n = 31) ascertained at the Arizona Alzheimer's Disease Research Center
(ADRC). The second
cohort (DS) was assembled at the Duke Bryan ADRC and comprised ApoE 3/4
subjects only
(40 autopsy-confirmed cases with known age of disease onset and 33 controls)
(Table 2).
Although DNA sequencing was successful for a subset of the DS cohort who had
disease onset
from 50 to 68 years of age, association analyses were limited to a subset of
patients who
developed AD after the age of 60.
Table 2. Cohort compositions. The number of cases and controls, mean age, and
percentage that are female are shown for each series. Mean age is given as age-
at-diagnosis of
AD for cases and age-at-examination for controls. The standard deviation from
the mean is given
in parenthesis.
Mean Age (SD) % Females
Series Cases Controls Cases Controls Cases Controls
AS 74 31 81.7 (8.01) 77 (8.93) 56.3
46.7
DS 40 33 69.3 (8.3) 71.9 (7.5) 70
66.7
A phylogenetic tree of similar structure to that generated in the exploratory
study was
developed with strong bootstrap support (97%, 1000 replicates) for the AS
cohort. ApoE 4/4
subjects occurred only in clade A (98% separation between groups, P = 2.0 x 10-
4 Fisher's exact
test, two-tailed), while the remaining ApoE genotypes were distributed between
clades A and B.
(Figure 5). That is, ApoE 4 was always in LD with clade A variants whereas
ApoE 3 occurred
in both clade A and clade B haplotypes. Examination of the distribution of the
few ApoE 2/4
subjects on the phylogenetic tree suggests that ApoE 2-TOMM40 haplotypes
share a similar
evolutionary history with Ap0E3-TOMM40 haplotypes (data not shown). To verify
the
phylogenetic structure using a separate method, and to ensure that
recombination within the
genetic interval did not confound the phylogenetic tree structure developed
for the AS cohort,
haplotype networks were also constructed using statistical parsimony (TCS
version 1.21
(Clement et al. TCS: a computer program to estimate gene genealogies. Mol Ecol
9, 1657-9
(2000))). The major subject-haplotype clusters derived from the two methods
(maximum
parsimony and TCS) were congruent.
Clade A was more frequently associated with AD cases than was clade B (OR =
1.44,
95% CI = 0.76 - 2.70). ApoE 3/4 heterozygotes (n = 36) were analyzed to
estimate disease risk
associated with clade A haplotypes while controlling for the effect of ApoE O.
There was a
47
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
trend to higher incidence of LOAD for the subset that was homozygous for
TOMM40 clade A
relative to the subset that was heterozygous for clade A and clade B (OR =
1.36, 95% CI = 0.40
¨4.61) and thus it was postulated that at least some of the TOMM40 variants
which define clade
A confer ApoE c4-independent risk of LOAD.
Analysis of the AS cohort sequence data identified 39 polymorphic sites in the
TOMM40
Kb region, of which there were 30 parsimony-informative sites (at least two
different
nucleotides, each represented in at least two sequences). Of the 30 parsimony-
informative sites,
18 had a minor allele frequency (MAF) > 0.10 and six SNPs were outside the
boundary of the
TOMM40 gene (Figure 7A). 10 SNPs occurred exclusively in the context of ApoE
c3 (P = 6.07
10 x 10-50, Fisher's exact test, two-tailed, n = 210) and were never
observed in ApoE 4/e4
homozygous subjects (n = 16). The majority of the 0-specific TOMM40 variants
were located
in intronic regions.
Figure 78 gives descriptive statistics for the rs10524523 polyT length
polymorphism in
clades A and B for the AS cohort. Table 3 lists the SNPs that were tested
individually and as
haplotypes for association with LOAD risk. The odds ratios for disease risk
for each clade B
distinguishing SNP, in all cases the minor allele, suggest that the clade B
alleles are protective of
AD risk in the AS cohort, however, in each case the association narrowly
missed significance.
To account for.the effect of ApoE e4 on the odds ratios reported in Table 3, a
balanced set of 48
AD cases and 48 AD controls was constructed by selecting sequences at random
from ApoE
0/E4 subjects from the pooled AS and DS cohorts. Single SNPs again were not
significantly
associated with LOAD in this balanced data set. However, the minor alleles of
four of the SNPs
(rs8106922, rs1160985, rs760136, rs741780) that distinguish TOMM40 clade B
were assayed
previously in three LOAD case/control genome-wide association studies and were
found to be
protective of disease risk (OR < 1 in each case), which is consistent with the
trend observed in
our study (Abraham et al. A genome-wide association study for late-onset
Alzheimer's disease
using DNA pooling. BMC Med Genomics 1, 44 (2008); Carrasquillo et al. Genetic
variation in
PCDH11X is associated with susceptibility to late-onset Alzheimer's disease.
Nat Genet 41, 192-
198 (2009); Takei et al. Genetic association study on in and around the ApoE
in late-onset
Alzheimer disease in Japanese. Genomics 93, 441-448 (2009)).
48
_
Table 3. Descriptive statistics and allelic and genotypic association results
for the individual SNPs.
All ApoE genotypes
I
c
0 lade Contro 95% 95%
MAF MAF
MAF LOAD LOAD Control Control LOAD LOAD LOAD Contro Control t...)
SNP ID Position Allele
B 1 OR CI CI c=
(all) (cases) (controls) (M) (m) (M)
(n) (MM) (M111) (min) 1 (Mm) (mm)
allele
(MM) lower upper
rs1038025 50096812 T/c c 0.31 0.28 0.37 106 41 39 23 40 27 7 11 17 3 0.66
0.35 1.23 -a-,
c7,
rs1038026 50096902 A/g g 0.31 0.28 0.37 106 41 39 23 40 27 7 II 17 3 0.66 0.35
1.23 cA
oe
c=
m1160985 50095252 Cit t 0.30 0.28 0.37 107 41 39 23 40 27 7 11 17 3 0.65 0.34
1.19
rsI305062 50097361 G/c c 0.28 0.26 0.31 106 38 43
19 43 24 7 13 17 1 0.81 0.42 1.56
rs342 I 5622 50098378 -/g g 0.28 0.26 0.34 110 38
40 21 42 26 6 12 17 2 0.66 0.35 1.25 .
rs34878901 50094317 C/t t 0.26 0.25 0.28 105 35 44 17 45
23 6 15 15 1 0.86 0.44 1.70
rs7259620 50099628 G/a a 0.30 0.27 0.37 108 40 39
23 41 26 7 1 I 17 3 0.63 0..33 1.18
rs741780 50096271 T/c c 0.30 0.28 0.37 107 41 ' 39
23 . 40 27 - 7 11 17 3 0.65 0.34 1.19
0
rs760 136 50095698 kg g 0.30 0.28 0.37 107 41 39
23 40 27 7 11 17 3 0.65 0.34 1.19
o
rs8106922 50093506 A/g g 0.28 0.26 0.31 109 39 43
19 42 25 7 13 17 1 0.81 0.42 1.55 n.)
op
N.)
APOE 63/e4
11.
0
clade
Contro 95% 95% n.)
MAF MAF MAF LOAD LOAD Control Control LOAD LOAD LOAD
Contro Control 11.
SNP ID Position Allele
B 1 OR Cl Cl
(all) (cases) (controls) (M) (m) (M)
(m) (MM) (Mm) (mm) 1 (Mm) (mm)
allele
(MM) lower upper 1\-)
o
rs1038025 50096812 T/c c 0.28 0.25 0.38 68 28 63 .
33 22 24 2 17 29 2 0.79 0.43 1.45 H
CA
rs1305062 50097361 G/c c 0.27 0.24 0.38 69 25 64 32 25 21 2 17 30 1 0.72
0.39 1.35 0
---.1
m34215622 50098378 -/g g 0.28 0.25 0.38 70 26 64 32 24 22 2 17 30 1 0.74
0.40 1.38 O
in
rs34878901 50094317 Cit t 0.24 0.20 0.38 69 25 61
31 25 21 2 18 29 1 0.71 0.38 1.34
rs8 106922 50093506 A/g g 0.28 0.25 0.38 70 25 64
32 25 21 2 17 30 1 0.71 0.38 1.33
IV
n
,-i
cp
w
-a-,
w
u,
w
.6.
49
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
Another polymorphism that distinguished the two clades and, therefore, two
groups of
ApoE Ã3 haplotypes, was a poly-T variant (rs10524523) located in intron 6 of
TOMM40. On
ApoE Ã4 chromosomes, the variant was relatively long, with a narrow, unimodal
distribution of
lengths (19 ¨ 30 T residues, mean = 26.78, s.d. = 2.60, n = 32), whereas on
ApoE Ã3
chromosomes, a bimodal distribution of lengths was evident with peaks at 15.17
(s.d. = 0.85, n =
36) and 33.15 (s.d. = 2.09, n = 55) T residues (Figures 8B and 8C). Longer
poly-T lengths (T
>= 19) segregated almost exclusively into clade A, the higher risk clade, in
the AS cohort (P
7.6 x 10-46, n = 210, Fisher's exact test, two-tailed). The case/control ratio
for the category
containing the two, most common, shorter lengths (15 or 16 T residues) was
1.46 (95% CI = 1.25
¨ 1.75), and the case/control ratio for the longer length category (28, 29, 33
and 34 T residues)
was 2.02 (95% CI = 1.13 ¨ 2.87). This data showed a trend to an association
between the longer
rs10524523 poly-T length and AD (OR = 1.38, 95% CI = 0.80 ¨ 2.39).
While there were only trends toward association of TOMM40 haplotypes or
individual
polymorphisms with LOAD for the AS cohort, there was a significant association
between poly-
T length category of rs10524523 and age of LOAD onset. This was tested using
the DS cohort of
autopsy-confirmed ApoE c3/c4 subjects for whom there was disease onset data.
Longer poly-T
alleles (>= 27 T residues) were significantly associated with onset of disease
at a much younger
age (70.5 years +/- 1.2 versus 77.6 years +/- 2.1, P = 0.02, n= 34) (Fig. 5).
This polymorphism, therefore, significantly impacted age of disease onset for
individuals
who carry an ApoE Ã3 allele. Three other poly-T length polymorphisms located
in intron 6
(rs34896370, rs56290633 and rs10602329) also distinguish clades A and B, but
these
polymorphisms were not associated with age of disease onset. Similarly, there
was no
relationship between haplotypes of clade-distinguishing SNPs and age of LOAD,
or for the
single SNP, rs8106922, which had been significantly associated with AD risk in
three genome-
wide association studies (Abraham et al. A genome-wide association study for
late-onset
Alzheimer's disease using DNA pooling. BMC Med Genomics 1, 44 (2008);
Carrasquillo et al.
Genetic variation in PCDH11X is associated with susceptibility to late-onset
Alzheimer's
disease. Nat Genet 41, 192-198 (2009); Takei et al. Genetic association study
on in and around
the ApoE in late-onset Alzheimer disease in Japanese. Genomics 93, 441-448
(2009)) (data not
shown).
We conclude that longer poly-T tracts at rs10524523 are significantly
correlated with
earlier age of onset of LOAD. The length of this variant is relatively
homogeneous, and
relatively long, on APOE4 chromosomes, whereas there are two categories of
poly-T lengths
linked to APOE3. APOE2 chromosomes also appear to carry variable-length poly-T
repeats
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
similar to APOE3 chromosomes, and we anticipate the inheritance of the polyT
with APOE2
will be similar to that of APOE3.
While it is possible that there are other variants that influence age of onset
of LOAD for
individuals who are not homozygous for APOE4, the length of the poly-T
polymorphism in
TOMM40 intron 6 appears to be the most powerful genetic predictor in this
linkage region and
should be validated prospectively. These data suggest that ApoE genotype-
stratified age of onset
curves (Corder et al. Gene dose of apolipoprotein E type 4 allele and the risk
of Alzheimer's
disease in late onset families. Science 261, 921-3 (1993); Li et al. Candidate
single-nucleotide
polymorphisms from a genomewide association study of Alzheimer disease. Arch
Neurol 65, 45-
53(2008)) are, in reality, sets of curves with each curve reflecting a
specific interaction of linked
polymorphisms in ApoE and TOMM40. Therefore, these data add resolution to the
prediction of
age of LOAD onset, within a 5-7 year window, at least for individuals over 60
years of age, and
likely for younger individuals. The study to validate the association of ApoE
genotypes and
TOMM40 haplotypes or rs10524523 with age of disease onset is currently b,eing
planned. This
study will be a prospective, 5 year, population-based study conducted in
several ethnic groups,
and will be combined with a prevention or delay of disease onset drug trial.
METHODS
The two cohorts analyzed in this study were from the Arizona Alzheimer's
Disease
Research Center (ADRC), Phoenix, Arizona and the Duke Bryan ADRC, Durham,
North
Carolina. All subjects were of European descent. The Arizona and Duke studies
were approved
by institutional review boards and appropriate informed consent was obtained
from all
participants. Age and gender data for the cases and controls in each cohort
are shown in Table 2.
For the Duke cohort, the age of disease onset was determined retrospectively
and disease
diagnosis was confirmed by autopsy.
Samples were plated on 96 well plates for long-range PCR and DNA sequencing at
Polymorphic DNA Technologies (Alameda, CA).
Long-range PCR was performed using Takara LA Taq Polymerase (Takara Mirus
Bio).
The reaction mix and PCR conditions were the same as those recommended by the
manufacturer.
PCR was conducted in a 50 !AL volume with 2.5 U of LA Taq and 200-400 ng human
genomic
DNA. Thermocycling was carried out with the following conditions: 94 C, 1 min
for 1 cycle;.
94 C, 30 sec; 57 C, 30 sec; 68 C,. 9 min for 14 cycles; 94 C, 30 sec;. 57 C,
30 sec; 68 C, 9 min
+15 sec/cycle for 16 cycles; 72 C, 10 min for 1 cycle. Primers for long-range
PCR are shown in
Table 4.
51
Table 4. Forward and reverse sequencing primers are listed. The shaded row
indicates the forward and reverse primers used for long-range
PCR of R2 (Figure 2)
0
n.)
o
Forward Primers Reverse Primers
n.)
Primer PositionPrimer Position
-a-,
UCSC Primer
UCSC Primer
in Cloned PCR
in Cloned PCR cA
Coordinate SEO ID Coordinate SEO ID
cA
Sequence Product
Sequence,Product oe
(of 3'-end of NO: (of 3-end of NO:
(of 3'-end of(of 3'-end of
primer)
primer)
primer)
primer)
AACTCAGAGGCCAGAGATTCTAAGT 50,092,429 25 1
AACAGCCTAATCCCAGCACATTTAC 50,101,560 9,156 2
CAGGAAACAGCTATGAC 50,092,292 -112 3
CCCACTGGTTGTTGA 50,093,034 630 4
GTGTGATGGTGATTCAAC 50,093,038 634 5
GAATAGGGGCCTTTCA 50,093,282 878 6
,
CTGCAGGTATGAAAG 50,093,287 883 7
CAATCTCCTAGGGTGC 50,093,512 1108 8
GTCTCTGCAGATGTG 50,093,601 1197 9
CGGAAGTTGCAGTAAG 50,093,706 1302 10
n
TACTGCAACTTCCGC 50,093,722 1318 11
AAGGTCAAGGTTACACT 50,094,318 1914 12
TCTCTGTTGCCCACG 50,094,289 1885 13
ACAAGCCTAGGTGACAT 50,094,790 2386 14 o
n.)
CCCAACTAA 1 1 1 1 1GTATTCG 50,094,609 2205 15
CCTGTAATCCCAGCTAT 50,095,002 2598 16 co
n.)
ACATTTGTGGCCTGTAC 50,095,129 2725 17
TCATCTCTCTGTGAACCTAA 50,095,324 2920 18 11.
0
N.)
CCACATGGGCTTGTGT 50,095,603 3199 19
GGCAAAATGACGATCAGT 50,095,804 3400 20 11.
CCCAGATGCCCAAATC 50,096,082 3678 21
GCAGCACCAGCTAGT 50,096,218 3814 22 n.)
o
AACTCTGAGTGGATGTG 50,096,471 4067 23
GATGGTCTCAATCTCCTTA 50,096,620 4216 24 H
CA
oI
CTATAGTCCCAACTACTGA 50,096,730 4326
25 TTTTTTCCAAGCATAAAACATAGTA 50,096,863 4459 26
-A
AGTCCCCGCTACTTA 50,097,080 4676 27
GGGGATGGACAAAGCT 50,097,268 4864 28
o1
ACCACAGGTGTATGCC 50,097,451 5047 29
TGAAAAGCCCTCTAGAC 50,097,898 5494 30 in
GAACAGATTCATCCGCA 50,097,864 5460 31
CACCCACGATCCAGTT 50,098,141 5737 32
TGTGGATAGCAACTGGAT 50,098,148 5744 33
CAAAGCCACACTGAAACTT 50,098,231 5827 34
GGGATTCTGAGTAGCA 50,098,469 6065 35
CAGAATCCTGCGT 50,098,526 6122 36
TGCTGCCTTAAGTCCG 50,098,937 6533 37
ACACTTGAGAAAACGG 50,098,797 6393 38
CTGGGGTCAGCTGAT 50,099,350 6946 39
AC AAAGTCCTCTATAGCC 50,099,077 6673 40
TGAAACATCTGGGATTTATAAC 50,099,679 7275 41
TAACCTGGGGTTGGTT 50,099,429 7025 42 IV
n
CTGGAAACCACAATACC 50,099,990 7586 43
AAGTTCCTTTGCTCATC AG 50,099,829 7425 44 1-3
ATCTCGGCTCACTGTA 50,100,261 7857 45
GCAAGAGGGAGACTGT 50,100,207 7803 46
ci)
GTCAAAAGACCTCTATGC 50,100,739 8335 47
TGTGCCTGGATGAATGTA 50,100,567 8163 48 n.)
AGGACTCCACGAGT 50,101,197 8793 49
TGAGCTCATCCCCGT 50,100,960 8556 50
1¨,
CCGTGITCCATITATGAG
50,101,328 8924 51 -a-,
n.)
GTAAAACGACGGCCAG
50,101,681 9277 52 uvi
n.)
.6.
1¨,
52
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
PCR products were run on a 0.8% agarose gel, visualized by crystal violet dye,
compared
to size standards, cut out of the gel, and extracted with purification
materials included with the
TOPO XL PCR Cloning kit (Invitrogen). Long-range PCR products were cloned into
a TOPO
XL PCR cloning vector. This system uses a TA cloning vector and is recommended
for inserts of
up to 10 kb. Per the manufacturer's instructions, electro-competent cells
(from the same kit) were
transformed by the vector, plated in the presence of antibiotic, and
incubated. Ten clones from
each plate were picked and cultured in a 96-well format.
Diluted cultures were transferred to a denaturing buffer that was part of the
TempliPhi
DNA Sequencing Template Amplification kit (GE HealthCare/Amersham
Biosciences). This
buffer causes the release of plasmid DNA but not bacterial DNA. Cultures were
heated, cooled,
spun, and transferred to fresh plates containing the TempliPhi enzyme and
other components.
This mixture was incubated at 30 C for 18 hours to promote amplification of
the plasmid
templates. These products were then spun and heated to 65 C to destroy the
enzyme.
Plasmid templates were used in DNA sequencing reactions using the Big Dye,
version
3.1 sequencing kit (Applied Biosystems). For each reaction, an appropriate
sequencing primer
(Table 4) was used that was designed to anneal to a unique location of the
template. Cycle
sequencing was carried out with an annealing temperature of 50 C, an
elongation temperature of
60 C, and a denaturation temperature of 96 C, for a total of 30 cycles.
Sequencing reaction
products were run on an ABI 3730XL DNA sequencer with a 50 cm capillary array
using
standard run mode.
A proprietary sequencing analysis program called 'Agent' (developed by Celera)
was
used to align sequencing reads to the appropriate reference sequence, and
produce `contigs'
associated with each clone. The system provides estimated quality scores for
all bases for which
there is any variation for any of the samples. The sequencing report for each
sample was
analyzed for the presence of SNPs that were correlated in one haplotype
pattern for one subset of
clones and in a different haplotype pattern for the remaining clones. A
reference file for the
region of interest was prepared by listing the known variations for that
region publicly available
from NCBI dbSNP. A genotype file for the region of interest was created by
searching each
subject's haplotype report for all variations between the known reference
sequence and the
consensus haplotype sequences.
The magnitude of the length-reading error for the poly-T variants (e.g.,
rs10524523) was
estimated by examining the observed lengths from the 10 clones that were
prepared for samples
that had a single haplotype. For a typical sample with short poly-T length of
16, the standard
deviation for the 10 clones was 0.97. For a typical sample with longer poly-T
length, e.g., 27, the
standard deviation was 1.58.
53
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
Phylogenetic analysis was conducted. A multiple sequence alignment of the
sequences
was performed using the ClustalW2 (version 2Ø10) program using default
parameters. Manual
adjustment of the alignments was completed using Genedoc (version 2.7.000).
Phylogenetic trees
were constructed using Bayesian, maximum likelihood .and distance-based
reconstructions. The
phylogenetic tree construction software used was Paup* (version 4.0b10),
ClustalX2 (neighbor-
joining methods, version 2Ø10) and Mr. Bayes (version 3.1.2).
Tree-bisection and reconnection branch swapping were used in all methods. The
best
fitting model of sequence evolution was estimated using the Modeltest program
(version 3.7)
which provided estimates for the following key determinants: rate matrix,
shape of the gamma
distribution and proportion of invariant sites. Bootstrap analysis was
performed using 1000
replicates to determine statistical support for specific tree morphology.
Haplotype networks were also constructed from the sequence data using the
program
TCS (version 1.21 (Clement et al. TCS: a computer program to estimate gene
genealogies. Mol
Ecol 9, 1657-9 (2000))) to compare the phylogenetic trees to cladograms
estimated using
statistical parsimony. The phylogenetic trees and haplotype networks were
constructed twice,
with gaps treated as missing data for the first instance and as a fifth
character for the second
instance. Nucleotide diversity in the region of interest was calculated using
DnaSP (version
5.00.02 (Librado et al. DnaSP v5: a software for comprehensive analysis of DNA
polymorphism
data. Bioinformatics 25, 1451-2 (2009))).
After construction of the phylogenetic trees, the haplotype network, and
completion of
the analysis of nucleotide diversity in the region of interest, the results
from the different
methods were compared and reconciled to a consensus tree. Groups of sequences
sharing a
recent disease mutation were presumed to segregate more closely on the
phylogenetic tree,
however, sporadic cases due to phenocopies, dominance and epistasis can
introduce noise into
the phenotype-haplotype relationship (Tachmazidou et al. Genetic association
mapping via
evolution-based clustering of haplotypes. PLoS Genet 3, elll (2007)).
However, sporadic cases due to phenocopies, dominance and epistasis can
introduce
noise into the phenotype-haplotype relationship. This phylogenetic analysis
focused on a high-
level aggregation of clades in order to minimize these effects. The clades
determined at the first
split in the phylogenetic tree were used to test the hypothesis that TOMM40
subject-haplotypes
from clade 13' were associated with onset of AD at a later age than subject-
haplotypes from
clade 'A', (each subject contributed two haplotypes to the AD age of onset
association signal).
The number of tests of association that are performed using this approach was
orders of
= magnitude less than in typical genomewide association studies since the
phylogenetic analysis
identified categories of evolutionarily-related subject-haplotypes. If the
tests of association
54
CA 02824024 2013-07-05
WO 2012/096680 PCT/US2011/025241
confirmed that the different clades classified the subject-haplotype data by
age of onset, further
statistical analysis was done to identify the variants that separated the
sequences into each clade.
Effectively, this analysis assessed the significance of each variant as a
factor that influences age
of onset using a series of one-degree of freedom tests guided by the tree
structure. The
phylogenetic analyses were conducted using single nucleotide and
insertion/deletion
polymorphisms. The statistical tests of association were adjusted with a
Bonferroni correction for
the number of polymorphic sites included in the analysis.
Haplotype reports from the Polymorphic analysis software and reports from
DnaSP
software (version 5.00.02 (Librado et al. DnaSP v5: a software for
comprehensive analysis of
DNA polymorphism data. Bioinformatics 25, 1451-2 (2009))) were used for
subsequent
statistical analyses. We analyzed individual TOMM40 SNP variants, TOMM40
haplotypes and
length of poly-T repeats for association with LOAD risk for the AS cohort and
LOAD age of
onset for the DS cohort. Differences in the proportions of specific TOMM40
alleles associated
with each ApoE allele or ApoE genotype were compared using Fisher's exact test
(two-tailed).
Starting with 30 parsimony-informative sites and a = 0.05, a Bonferroni
correction for the
significance of a specific allelic association would require a P value of
0.001. Odds ratios (OR)
were calculated as the (number of minor alleles in cases/number of minor
alleles in
controls)/(number of major alleles in cases/number of major alleles in
controls) and reported
with 95% confidence interval. Means for defined LOAD age of onset groups were
compared by t
tests, two-tailed. A standard F test on group variances was performed to
determine whether the t
test was calculated assuming equal or unequal variances. Statistical analysis
was completed
using JMP software (version 8, SAS Institute, Cary, NC).
Accession Codes: GenBank: TOMM40, translocase of outer mitochondrial membrane
40
homolog, 10452; ApoE, apolipoprotein E, 348
The foregoing is illustrative of the present invention, and is not to be
construed as
limiting thereof. The invention is defined by the following claims, with
equivalents of the claims
to be included therein.
55
= CA 02824024 2013-07-05
SEQUENCE LISTING IN ELECTRONIC FORM
In accordance with Section 111(1) of the Patent Rules, this description
contains a sequence listing in electronic form in ASCII text format (file:
73529-332 SEQ 03-07-2013 vl.txt).
A copy of the sequence listing in electronic form is available from the
Canadian Intellectual Property Office.
The sequences in the sequence listing in electronic form are reproduced in
the following table.
SEQUENCE TABLE
<110> Zinfandel Pharmaceuticals, Inc.; Roses, Alan D.
<120> DISEASE RISK FACTORS AND METHODS OF USE
<130> 070805-0142
<150> US 61/431,294
<151> 2011-01-10
<160> 52
<170> PatentIn version 3.3
<210> 1
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> Long range PCR primer
<400> 1
aactcagagg ccagagattc taagt 25
<210> 2
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> Long range PCR primer
<400> 2
aacagcctaa tcccagcaca tttac 25
55a
3
CA 02824024 2013-07-05
=
<210> 3
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 3
caggaaacag ctatgac 17
<210> 4
<211> 15
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 4
cccactggtt gttga 15
<210> 5
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 5
gtgtgatggt gattcaac 18
<210> 6
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 6
gaataggggc ctttca 16
<210> 7
<211> 15
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
5b
r,
, v CA 02824024 2013-07-05
. .
<400> 7
ctgcaggtat gaaag 15
<210> 8
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 8
caatctccta gggtgc 16
<210> 9
<211> 15
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 9
gtctctgcag atgtg 15
<210> 10
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 10
cggaagttgc agtaag 16
<210> 11
<211> 15
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 11
tactgcaact tccgc 15
<210> 12
<211> 17
<212> DNA
<213> Artificial sequence
550
* CA 02824024 2013-07-05
<220>
<223> Sequencing primer
<400> 12
aaggtcaagg ttacact 17
<210> 13
<211> 15
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 13
tctctgttgc ccacg 15
<210> 14
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 14
acaagcctag gtgacat 17
<210> 15
<211> 21
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 15
cccaactaat ttttgtattc g 21
<210> 16
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 16
cctgtaatcc cagctat 17
<210> 17
<211> 17
55d
CA 02824024 2013-07-05
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 17
acatttgtgg cctgtac 17
<210> 18
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 18
tcatctctct gtgaacctaa 20
<210> 19
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 19
ccacatgggc ttgtgt 16
<210> 20
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 20
ggcaaaatga cgatcagt 18
<210> 21
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 21
cccagatgcc caaatc 16
55e
CA 02824024 2013-07-05
<210> 22
<211> 15
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 22
gcagcaccag ctagt 15
<210> 23
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 23
aactctgagt ggatgtg 17
<210> 24
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 24
gatggtctca atctcctta 19
<210> 25
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 25
ctatagtccc aactactga 19
<210> 26
<211> 25
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
55f
f .
f " CA 02824024 2013-07-05
= .
<400> 26
ttttttccaa gcataaaaca tagta 25
<210> 27
<211> 15
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 27
agtccccgct actta 15
<210> 28
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 28
ggggatggac aaagct 16
<210> 29
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 29
accacaggtg tatgcc 16
<210> 30
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 30
tgaaaagccc tctagac 17
<210> 31
<211> 17
<212> DNA
<213> Artificial sequence
55g
e v CA 02824024 2013-07-05
, .
,
<220>
<223> Sequencing primer
<400> 31
gaacagattc atccgca 17
<210> 32
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 32
cacccacgat ccagtt 16
<210> 33
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 33
tgtggatagc aactggat 18
<210> 34
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 34
caaagccaca ctgaaactt 19
<210> 35
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 35
gggattctga gtagca 16
<210> 36
<211> 13
55h
, .
, * CA 02824024 2013-07-05
, .
,
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 36
cagaatcctg cgt 13
<210> 37
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 37
tgctgcctta agtccg 16
<210> 38
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 38
acacttgaga aaacgg 16
<210> 39
<211> 15
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 39
ctggggtcag ctgat 15
<210> 40
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 40
acaaagtcct ctatagcc 18
55i
CA 02824024 2013-07-05
-
<210> 41
<211> 22
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 41
tgaaacatct gggatttata ac 22
<210> 42
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 42
taacctgggg ttggtt 16
<210> 43
<211> 17
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 43
ctggaaacca caatacc 17
<210> 44
<211> 19
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 44
aagttccttt gctcatcag 19
<210> 45
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
55j
..- .
, b CA 02824024 2013-07-05
= .
,
<400> 45
atctcggctc actgta 16
<210> 46
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 46
gcaagaggga gactgt 16
<210> 47
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 47
gtcaaaagac ctctatgc 18
<210> 48
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 48
tgtgcctgga tgaatgta 18
<210> 49
<211> 14
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 49
aggactccac gagt 14
<210> 50
<211> 15
<212> DNA
<213> Artificial sequence
55k
41"
= CA 02824024 2013-07-05
=
<220>
<223> Sequencing primer
<400> 50
tgagctcatc cccgt 15
<210> 51
<211> 18
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 51
ccgtgttcca tttatgag 18
<210> 52
<211> 16
<212> DNA
<213> Artificial sequence
<220>
<223> Sequencing primer
<400> 52
gtaaaacgac ggccag 16
551
