Note: Descriptions are shown in the official language in which they were submitted.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
CA 02826522 2015-10-26
CA 2566256
GENETIC POLYMORPHISM IN PNLPA3 ASSOCIATED WITH LIVER FIBROSIS
METHODS OF DETECTION AND USES THEREOF
FIELD OF THE INVENTION
The present invention is in the field of fibrosis diagnosis and therapy and in
particular
liver fibrosis diagnosis and therapy, and more particularly, liver fibrosis
associated with
hepatitis C virus (HCV) infection. More specifically, the present invention
relates to specific
single nucleotide polymorphisms (SNPs) in the human genome, and their
association with liver
fibrosis and related pathologies. Based on differences in allele frequencies
in the patient
population with advanced or bridging fibrosis/cirrhosis relative to
individuals with no or
minimal fibrosis, the naturally-occurring SNPs disclosed herein can be used as
targets for the
design of diagnostic reagents and the development of therapeutic agents, as
well as for disease
association and linkage analysis. In particular, the SNPs of the present
invention are useful for
identifying an individual who is at an increased or decreased risk of
developing liver fibrosis
and for early detection of the disease, for providing clinically important
information for the
prevention and/or treatment of liver fibrosis, and for screening and selecting
therapeutic agents.
The SNPs disclosed herein may also be useful for human identification
applications. Methods,
assays, kits, and reagents for detecting the presence of these polymorphisms
and their encoded
products are provided.
BACKGROUND OF THE INVENTION
Fibrosis
Fibrosis is a quantitative and qualitative change in the extracellular matrix
that
surrounds cells as a response to tissue injury. The trauma that generates
fibrosis is varied and
includes radiological trauma (i.e., x-ray, gamma ray, etc.), chemical trauma
(ie., radicals,
ethanol, phenols, etc.) viral infection and physical trauma. Fibrosis
encompasses pathological
conditions in a variety of tissues such as pulmonary fibrosis, retroperitoneal
fibrosis, epidural
fibrosis, congenital fibrosis, focal fibrosis, muscle fibrosis, massive
fibrosis, radiation fibrosis
(e.g. radiation induced lung fibrosis), liver fibrosis and cardiac fibrosis.
1
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
Liver Fibrosis in HCV-Infected Subjects
HCV affects about 4 million people in the United States and more than
170 million people worldwide. Approximately 85% of the infected individuals
develop chronic hepatitis, and up to 20% progress to bridging
fibrosis/cirrhosis, which is end-stage severe liver fibrosis and is generally
= irreversible (Lauer et al. 2001, N Eng J Med 345: 41-52). HCV
infection is =
the major cause of cirrhosis and hepatocellular carcinoma (HCC), and
accounts for one third of liver transplantations. The interval between
infection and the development of Cirrhosis may exceed 30 years but varies
widely among individuals. Based on fibrosis progression rate, chronic HCV
patients can be roughly divided into three groups (Poynard et al 1997, Lancet
349: 825-832): rapid, median, and slow fibrosers.
Previous studies have indicated that host factors may play a role in the
progression of fibrosis, and these include age at infection, duration of
infection, alcohol consumption, and gender. However, these host factors
account for only 17%-29% of the variability in fibrosis progression (Poynard
et
al., 1997, Lancet 349: 825-832; Wright et al Gut. 2003, 52(4):574-9). Viral
load or viral genotype has not shown significant correlation with fibrosis
progression (Poynard et al., 1997, Lancet 349: 825-832). Thus, other factors,
such as host genetic factors, are likely to play an important role in
determining the rate of fibrosis progression.
Recent studies suggest that some genetic polymorphisms influence the
progression of fibrosis in patients with HCV infection (Powell et al.
Hepatology 31(4): 828-33, 2000), autoimmune chronic cholestasis (Tanaka et
al. J. Infec. Dis. 187:1822-5, 2003), alcohol induced liver diseases (Yamauchi
et al., J. Hepatology 23(5):519-23, 1995), and nonalcoholic fatty liver
diseases
(Bernard et al. Diabetologia 2000, 43(8):995-9). However, none of these
genetic polymorphisms have been integrated into clinical practice for various
reasons (Bataller et at Hepatology. 2003, 37(3):493-503). For example,
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
limitations in study design, such as small study populations, lack of
replication sample sets, and lack of proper control groups have contributed to
contradictory results; an example being the conflicting results reported on
the
role of mutations in the hemochromatosis gene (HFE) on fibrosis progression
in HCV-infected patients (Smith et al., Hepatology. 1998, 27(6):1695-9; =
Thorburn et al., Gut. 2002, 50(2):248-52).
Currently, there is no diagnostic test that can identify patients who
are predisposed to developing liver damage from chronic HCV infection,
despite the large variability in fibrosis progression rate among HCV patients.
Furthermore, diagnosis of fibrosis stage (early, middle or late) and =
monitoring of fibrosis progression is currently accomplished by liver biopsy,
which is invasive, painful, and costly, and generally must be performed
multiple firnes to assess fibrosis status. The discovery of genetic markers
which are=useful in identifying HCV-infected individuals who are at
increased risk for advancing from early stage fibrosis to cirrhosis and/or HCC
may lead to, for example, better therapeutic strategies, economic models, and
health care policy decisions.
SNPs .=
The genomes of all organisms undergo spontaneous mutation in-the course of
their continuing evolution, generating variant forms of progenitor genetic
sequences
(Gusella, Ann. Rev. Biochern. 55, 831-854 (1986)). A variant form may confer
an
evolutionary advantage or disadvantage relative to a progenitor form or may be
neutral.
' In some instances, a variant form confers an evolutionary advantage to the
species and is
eventually incorporated into the DNA of many or most members of the species
and
effectively becomes the progenitor form. Additionally, the effects of a
variant form
may be both beneficial and detrimental, depending on the circumstances. For
example, a heterozygous sickle cell mutation confers resistance to malaria,
but a homozygous sickle cell mutation is usually lethal. In many cases, both
progenitor and variant forms survive and co-exist in a species population. The
3
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
coexistence of multiple forms of a genetic sequence gives rise to genetic
polymorphisms,
including SNPs.
Approximately 90% of all polymorphisms in the human genome are SNPs. SNPs
are single base positions in DNA at which different alleles, or alternative
nucleotides,
exist in a population. The SNP position (interchangeably referred to herein as
SNP, SNP
site, SNP locus, SNP marker, or marker) is usually preceded by and followed by
highly
conserved sequences of the allele (e.g., sequences that vary in less than
1/100 or 1/1000 =
members of the populations). An individual may be homozygous or heterozygous
for an =
allele at each SNP position. A SNP can, in some instances, be referred to as a
"cSNP" to
denote that the nucleotide sequence containing the SNP is an amino acid coding
sequence.
A SNP may arise from a substitution of one nucleotide for another at the
polymorphic site: Substitutions can be transitions or transversions. A
transition is the
replacement of one purine nucleotide by another purine nucleotide, or one
pyrimidine by
another pyrimidine. A transversion is the replacement of a purine by a
pyrimidine, or
vice versa. A SNP may also be a single base insertion or deletion variant
referred to as
an "indel" (Weber et al., "Human diallelic insertion/deletion polymorphisms",
Am J Hum
Genet 2002 Oct;71(4):854-62).
A synonymous codon change, or silent mutation/SNP (terms such as "SNP",
"polymorphism", "mutation", "mutant", "variation", and "variant" are used
herein
interchangeably), is one that does not result in a change of amino acid due to
the
degeneracy of the genetic code. A substitution that changes a codon coding for
one
amino acid to a codon coding for a different amino acid (i.e., a non-
synonymous codon
change) is referred to as a missense mutation. A nonsense mutation results in
a type of
non-synonymous codon change in which a stop codon is formed, thereby leading
to
premature termination of a polypeptide chain and a truncated protein. A read-
through
mutation is another type of non-synonymous codon change that causes the
destruction of
a stop codon, thereby resulting in an extended polypeptide product. While SNPs
can be
bi-, tri-, or tetra- allelic, the vast majority of the SNPs are bi-allelic,
and are thus often
referred to as "bi-allelic markers", or "di-allelic markers".
4
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
As used herein, references to SNPs and SNP genotypes include individual SNPs
, and/or ,haplotypes, which are groups of SNPs that are generally inherited
together.
Haplotypes can have stronger correlations with diseases or other phenotypic
effects
compared with individual SNPs, and therefore may provide increased diagnostic
accuracy in some cases (Stephens et al. Science 293,489-493, 20 July 2001).
Causative SNPs are those SNPs that produce alterations in gene expression or
in
the expression, structure, and/or function of a gene product, and therefore
are most
, predictive of a possible clinical phenotype. One such class includes SNPs
falling within
regions of genes encoding a polypeptide product, i.e. cSNPs. These SNPs may
result in
an alteration of the amino acid sequence of the polypeptide product (i.e., non-
synonymous codon changes) and give rise to the expression of a defective or
other
variant protein. Furthermore, in the case of nonsense mutations, a SNP may
lead to
premature termination of a polypeptide product. Such variant products can
result in a
pathological condition, e.g., genetic disease. Examples of genes in which a
SNP within a
coding sequence causes a genetic disease include sickle cell anemia and cystic
fibrosis. .
Causative SNPs do not necessarily have to occur in coding regions; causative
SNPs can occur in, for example, any genetic region that can ultimately affect
the
expression, structure, and/or activity of the protein encoded by a nucleic
acid. Such
genetic regions include, for example, those involved in transcription, such as
SNPs.in
transcription factor binding domains, SNPs in promoter regions, in areas
involved in
transcript processing, such as SNPs at intron-exon boundaries that may cause
defective
splicing, or SNPs in mRNA processing signal sequences such as polyadenylation
signal
regions. Some SNPs that are not causative SNPs nevertheless are in close
association
-with, and therefore segregate with, a disease-causing sequence In this
situation, the
presence of a SNP correlates with the presence of, or predisposition to, or an
increased
risk in developing the disease. These SNPs, although not causative, are
nonetheless also
useful for diagnostics, disease predisposition screening, and other uses.
An association study of a SNP and a specific disorder involves determining the
presence or frequency of the SNP allele in biological samples from individuals
with the
disorder of interest, such as liver fibrosis and related pathologies and
comparing the
information to that of controls (i.e., individuals who do not have the
disorder; controls
5
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
may be also referred to as "healthy" or "normal" individuals) who are
preferably of
similar, age and race. The appropriate selection of patients and controls is
important to
the success of SNP association studies. Therefore, a pool of individuals with
well-
characterized phenotypes is extremely desirable.
A SNP may be screened in diseased tissue samples or any biological sample
obtained from a diseased individual, and compared to control samples, and
selected for
= its increased (or decreased) occurrence in a specific pathological
condition, such as .
pathologies related to liver fibrosis, increased or decreased risk of
developing bridging
fibrosis/cirrhosis, and progression of liver fibrosis. Once a statistically
significant
association is established between one or more SNP(s) and a pathological
condition (or
other phenotype) of interest, then the region around the SNP can optionally be
thoroughly
screened to identify the.causative genetic locus/sequence(s) (e.g., causative
SNP/mutation, gene, regulatory region, etc.) that influences the pathological
condition or
= phenotype. Association studies may be conducted within the general
population and are
:not limited to studies performed on related individuals in affected families
(linkage
studies).
Clinical trials have shown that patient response to treatment with
pharmaceuticals
is often heterogeneous. There is a continuing need to improve pharmaceutical
agent
design and therapy. In that regard, SNPs can be used to identify patients most
suited to =
therapy with particular pharmaceutical agents (this is often termed
"pharrnacogenomics").
Similarly, SNPs can be used to exclude patients from certain treatment due to
the =
patient's increased likelihood of developing toxic side effects or their
likelihood of not _
responding to the treatment. Pharmacogenomics can .also be used in
pharmaceutical
research to assist the drug development and selection process. (Linder et al.
(1997),
Clinical Chemistry, 43, 254; Marshall (1997), Nature Biotechnology, 15, 1249;
International Patent Application WO 97/40462, Spectra Biomedical; and Schafer
et aL
(1998), Nature Biotechnology, 16:3).
SUMMARY OF THE INVENTION
The present invention relates to the identification of novel SNPs, unique
combinations of such SNPs, and haplotypes of SNPs that are associated with
liver
6
CA 02826522 2014-01-22
fibrosis and in particular the increased or decreased risk of developing
bridging
fibrosis/cirrhosis, and the rate of progression of liver fibrosis. The
polymorphisms disclosed
herein are directly useful as targets for the design of diagnostic reagents
and the development
of therapeutic agents for use in the diagnosis and treatment of liver fibrosis
and related
pathologies.
Based on the identification of SNPs associated with liver fibrosis, the
present invention
also provides methods of detecting these variants as well as the design and
preparation of
detection reagents needed to accomplish this task. The invention specifically
provides, for
example, novel SNPs in genetic sequences involved in liver fibrosis and
related pathologies,
isolated nucleic acid molecules (including, for example, DNA and RNA
molecules) containing
these SNPs, variant proteins encoded by nucleic acid molecules containing such
SNPs,
antibodies to the encoded variant proteins, computer-based and data storage
systems containing
the novel SNP information, methods of detecting these SNPs in a test sample,
methods of
identifying individuals who have an altered (i.e., increased or decreased)
risk of developing
liver fibrosis based on the presence or absence of one or more particular
nucleotides (alleles) at
one or more SNP sites disclosed herein or the detection of one or more encoded
variant
products (e.g., variant mRNA transcripts or variant proteins), methods of
identifying
individuals who are more or less likely to respond to a treatment (or more or
less likely to
experience undesirable side effects from a treatment, etc.), methods of
screening for
compounds useful in the treatment of a disorder associated with a variant
gene/protein,
compounds identified by these methods, methods of treating disorders mediated
by a variant
gene/protein, methods of using the novel SNPs of the present invention for
human
identification, etc.
In Tables 1-2, the present invention provides gene information, transcript
sequences
(SEQ ID NOS:1-14), encoded amino acid sequences (SEQ ID NOS:15-28), genomic
sequences
(SEQ ID NOS:43-50), transcript-based context sequences (SEQ ID NOS:29-42) and
genomic-
based context sequences (SEQ ID NOS:51-58) that contain the SNPs of the
present invention,
and extensive SNP information that includes observed alleles, allele
frequencies,
populations/ethnic groups in which alleles have been observed, information
about the type of
SNP and corresponding functional effect, and, for cSNPs, information about the
encoded
7
CA 02826522 2014-01-22
polypeptide product. The transcript sequences (SEQ ID NOS:1-14), amino acid
sequences
(SEQ ID NOS:15-28), genomic sequences (SEQ ID NOS:43-50), transcript-based SNP
context
sequences (SEQ ID NOS: 29-42), and genomic-based SNP context sequences (SEQ ID
NOS:51-58) are also provided in the Sequence Listing.
In a specific embodiment of the present invention, SNPs that occur naturally
in the
human genome are provided as isolated nucleic acid molecules. These SNPs are
associated
with liver fibrosis and related pathologies. In particular the SNPs are
associated with either an
increased or decreased risk of developing bridging fibrosis/cirrhosis and
affect the rate of
progression of liver fibrosis. As such, they can have a variety of uses in the
diagnosis and/or
treatment of liver fibrosis and related pathologies. In an alternative
embodiment, a nucleic acid
of the invention is an amplified polynucleotide, which is produced by
amplification of a SNP-
containing nucleic acid template. In another embodiment, the invention
provides for a variant
protein that is encoded by a nucleic acid molecule containing a SNP disclosed
herein.
In yet another embodiment of the invention, a reagent for detecting a SNP in
the context
of its naturally-occurring flanking nucleotide sequences (which can be, e.g.,
either DNA or
mRNA) is provided. In particular, such a reagent may be in the form of, for
example, a
hybridization probe or an amplification primer that is useful in the specific
detection of a SNP
of interest. In an alternative embodiment, a protein detection reagent is used
to detect a variant
protein that is encoded by a nucleic acid molecule containing a SNP disclosed
herein. A
preferred embodiment of a protein detection reagent is an antibody or an
antigen-reactive
antibody fragment.
Various embodiments of the invention also provide kits comprising SNP
detection
reagents, and methods for detecting the SNPs disclosed herein by employing
detection
reagents. In a specific embodiment, the present invention provides for a
method of identifying
an individual having an increased or decreased risk of developing liver
fibrosis by detecting the
presence or absence of one or more SNP alleles disclosed herein.
8
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
In another embodiment, a method for diagnosis of liver fibrosis and related
pathologies
by detecting the presence or absence of one or more SNP alleles disclosed
herein is
provided. =
- The nucleic acid molecules of the invention can be inserted in an
expression
vector, such as to produce a variant protein in a host cell. Thus, the present
invention
also provides for a vector comprising a SNP-containing nucleic acid molecule,
genetically-engineered host cells containing the vector, and methods for
expressing a = .
recombinant variant protein using such host cells. In another specific
embodiment, the
host cells, SNP-containing nucleic acid molecules, and/or variant proteins can
be used as
targets in a method for screening and identifying therapeutic agents or
pharmaceutical
compounds useful in the treatment of liver fibrosis and related pathologies.
An aspect of this invention is a method for treating liver fibrosis in a human
subject wherein said human subject harbors a SNP, gene, transcript, and/or
encoded
protein identified in Tables 1-2, which method comprises administering to said
human
subject a therapeutically or prophylactically effective amount of one or more
agents
counteracting the effects of the disease, such as by inhibiting (or
stimulating) the activity
of the gene, transcript, and/or encoded protein identified in Tables 1-2.
Another aspect of this invention is a method for identifying an agent useful
in
therapeutically or prophylactically treating liver fibrosis and related
pathologies in a
human subject wherein said human subject harbors a SNP, gene, transcript,
and/or
encoded protein identified in Tables 1-2, which method comprises contacting
the
gene, transcript, or encoded protein with a candidate agent under conditions
suitable =
to allow formation of a binding complex between the gene, transcript, or
encoded
protein and the candidate agent and detecting the formation of the binding
complex,
wherein the presence of the complex identifies said agent.
Another aspect of this invention is a method for treating liver fibrosis and
related
pathologies in a human subject, which method comprises:
(i) determining that said human subject harbors a SNP, gene, transcript,
and/or
encoded protein identified in Tables 1-2, and
9
CA 02826522 2015-10-26
CA 2826522
(ii) administering to said subject a therapeutically or prophylactically
effective amount of one or
more agents counteracting the effects of the disease.
Various embodiments of the invention provide a method for determining whether
a human
has an increased risk for developing liver fibrosis, comprising testing
nucleic acid from said human
to determine the presence or absence of a polymorphism in gene PATATIN-LIKE
PHOSPHOLIPASE DOMAIN CONTAINING 3(PNPLA3) at position 101 of the nucleotide
sequence defined by SEQ ID NO:51 or its complement, wherein the presence of G
at position 101
of SEQ ID NO:51 or C at position 101 of its complement indicates said human
has said increased
risk for developing liver fibrosis. The human may be homozygous or
heterozygous for said G or C.
The method may be performed in an automated fashion and the correlating may be
performed using
computer software. The human may be a hepatitis C virus-infected human.
Various embodiments of the invention provide an allele-specific polynucleotide
for use in a
method as described above, wherein said polynucleotide specifically hybridizes
to said
polymorphism in which said G or said C is present.
Various embodiments of the invention provide a kit for use in a method as
described
above, wherein said kit comprises at least one polynucleotide as described
above and a least one
further component, wherein the at least one further component is a buffer,
deoxynucleotide
triphosphates (dNTPs), an amplification primer pair, an enzyme, or any
combination thereof.
Many other uses and advantages of the present invention will be apparent to
those skilled in
the art upon review of the detailed description of the preferred embodiments
herein. Solely for
clarity of discussion, the invention is described in the sections below by way
of non-limiting
examples.
The Sequence Listing provides the transcript sequences (SEQ ID NOS: 1-14) and
protein
sequences (SEQ ID NOS:15-28) as shown in Table 1, and genomic sequences (SEQ
ID NOS:43-
50) as shown in Table 2, for each liver fibrosis-associated gene that contains
one or more SNPs of
the present invention. Also provided in the Sequence Listing are context
sequences flanking each
SNP, including both transcript-based context sequences as shown in Table 1
(SEQ ID NOS:29-42)
and genomic-based context sequences as shown in Table 2 (SEQ ID NOS:51-58).
The context
sequences generally provide 100bp upstream (5') and 100b downstream (3') of
each SNP, with the
SNP in the middle of the context sequence, for a total of 200bp of context
sequence surrounding
each SNP.
CA 02826522 2014-01-22
DESCRIPTION OF TABLE 1 AND TABLE 2
Table 1 and Table 2 disclose the SNP and associated gene/transcript/protein
information
of the present invention. For each gene, Table 1 and Table 2 each provide a
header containing
gene/transcript/protein information, followed by a transcript and protein
sequence (in Table 1)
or genomic sequence (in Table 2), and then SNP information regarding each SNP
found in that
gene/transcript.
NOTE: SNPs may be included in both Table 1 and Table 2; Table 1 presents the
SNPs
relative to their transcript sequences and encoded protein sequences, whereas
Table 2 presents
the SNPs relative to their genomic sequences (in some instances Table 2 may
also include, after
the last gene sequence, genomic sequences of one or more intergenic regions,
as well as SNP
context sequences and other SNP information for any SNPs that lie within these
intergenic
regions). SNPs can readily be cross-referenced between Tables based on their
hCV (or, in
some instances, hDV) identification numbers.
The gene/transcript/protein information includes:
- a gene number (1 through n, where n = the total number of genes in the
Table)
- a Celera hCG and UID internal identification numbers for the gene
- a Celera hCT and UID internal identification numbers for the transcript
(Table 1 only)
- a public Genbank accession number (e.g., RefSeq NM number) for the
transcript
(Table 1 only)
- a Celera hCP and UID internal identification numbers for the protein encoded
by the
hCT transcript (Table 1 only)
- a public Genbank accession number (e.g., RefSeq NP number) for the protein
(Table 1
only)
- an art-known gene symbol
- an art-known gene/protein name
11
CA 02826522 2014-01-22
- Celera genomic axis position (indicating start nucleotide position-stop
nucleotide
position)
- the chromosome number of the chromosome on which the gene is located
- an OMIM (Online Mendelian Inheritance in Man; Johns Hopkins University/NCBI)
public reference number for obtaining further information regarding the
medical significance of
each gene
- alternative gene/protein name(s) and/or symbol(s) in the OMIM entry
NOTE: Due to the presence of alternative splice forms, multiple
transcript/protein
entries can be provided for a single gene entry in Table 1; i.e., for a single
Gene Number,
multiple entries may be provided in series that differ in their
transcript/protein information and
sequences.
Following the gene/transcript/protein information is a transcript sequence and
protein
sequence (in Table 1), or a genomic sequence (in Table 2), for each gene, as
follows:
- transcript sequence (Table 1 only) (corresponding to SEQ ID NOS:1-14 of the
Sequence Listing), with SNPs identified by their IUB codes (transcript
sequences can include
5' UTR, protein coding, and 3' UTR regions). (NOTE: If there are differences
between the
nucleotide sequence of the hCT transcript and the corresponding public
transcript sequence
identified by the Genbank accession number, the hCT transcript sequence (and
encoded
protein) is provided, unless the public sequence is a RefSeq transcript
sequence identified by an
NM number, in which case the RefSeq NM transcript sequence (and encoded
protein) is
provided. However, whether the hCT transcript or RefSeq NM transcript is used
as the
transcript sequence, the disclosed SNPs are represented by their TUB codes
within the
transcript.)
- the encoded protein sequence (Table 1 only) (corresponding to SEQ ID
NOS:15-28 of
the Sequence Listing)
- the genomic sequence of the gene (Table 2 only), including 6kb on each side
of the
gene boundaries (i.e., 6kb on the 5' side of the gene plus 6kb on the 3' side
of the gene)
(corresponding to SEQ ID NOS:43-50 of the Sequence Listing).
12
CA 02826522 2014-01-22
After the last gene sequence, Table 2 may include additional genomic sequences
of
intergenic regions (in such instances, these sequences are identified as -
Intergenic region:"
followed by a numerical identification number), as well as SNP context
sequences and other
SNP information for any SNPs that lie within each intergenic region (and such
SNPs are
identified as INTERGENIC" for SNP type).
NOTE: The transcript, protein, and transcript-based SNP context sequences are
provided in both Table 1 and in the Sequence Listing. The genomic and genomic-
based SNP
context sequences are provided in both Table 2 and in the Sequence Listing.
SEQ ID NOS are
indicated in Table 1 for each transcript sequence (SEQ ID NOS:1-14), protein
sequence (SEQ
ID NOS:15-28), and transcript-based SNP context sequence (SEQ ID NOS:29-42),
and SEQ ID
NOS are indicated in Table 2 for each genomic sequence (SEQ ID NOS:43-50), and
genomic-
based SNP context sequence (SEQ ID NOS:51-58).
The SNP information includes:
- context sequence (taken from the transcript sequence in Table 1, and taken
from the
genomic sequence in Table 2) with the SNP represented by its IUB code,
including 100 bp
upstream (5') of the SNP position plus 100 bp downstream (3') of the SNP
position (the
transcript-based SNP context sequences in Table 1 are provided in the Sequence
Listing as
SEQ ID NOS:15-28; the genomic-based SNP context sequences in Table 2 are
provided in the
Sequence Listing as SEQ ID NOS:51-58).
- Celera hCV internal identification number for the SNP (in some instances, an
`11DV"
number is given instead of an "hCV" number)
- SNP position [position of the SNP within the given transcript sequence
(Table 1) or
within the given genomic sequence (Table 2)]
- SNP source (may include any combination of one or more of the following five
codes,
depending on which internal sequencing projects and/or public databases the
SNP has been
observed in: "Applera" = SNP observed during the re-sequencing of genes and
regulatory
regions of 39 individuals, "Celera" = SNP observed during shotgun sequencing
and assembly
of the Celera human genome sequence, "Celera Diagnostics" =
13
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
SNP observed during re-sequencing of nucleic acid samples from individuals who
have a
disease, "dbSNP" = SNP observed in the dbSNP public database, "HGBASE" = SNP
observed in the HGBASE public database, "HGMD" = SNP observed in the Human
Gene Mutation Database (FIGMD) public database, "HapMap" = SNP observed in the
International HapMap Project public database, "CSNP" = SNP observed in an.
internal =
Applied Biosystems (Foster City, CA) database of coding SNPS (cSNPs)) (NOTE:
- multiple "Applera" source entries for a single SNP indicate that the same
SNP was
-covered by multiple overlapping amplification products and the re-sequencing
results
(e.g., observed allele counts) from each of these amplification products is
beingzgfided)
- Population/allele/allele count information in the format of
[populationl(first_allele,countisecond allele,count)population2(first
allele,countlsecond =
allele,count) total (first_allele,total countlsecond_allele,total count)].
Thednformation in
this field includes populations/ethnic groups in which particular SNP alleles
have been
observed ("cau" = Caucasian, "his" = Hispanic, "chn" = Chinese, and "afr" =
African-
-- American, "jpn" = Japanese, "id" = Indian, "mex" = Mexican, "am" =
"American
Indian, "cra" = Celera donor, "no_pop" = no population information available),
identified
SNP alleles, and observed allele counts (within each population group and
total allele
counts), where available ["-" in the allele field represents a deletion allele
of an
insertion/deletion ("inder) polymorphism (in which case the corresponding
insertion
-- allele, which may be comprised of one or more nucleotides, is indicated in
the allele field
on the opposite side of the "I"); "-"in the count field indicates that allele
count =
information is not available]. For certain SNPs from the public dbSNP
database,
population/ethnic information is indicated as follows (this population
information is
publicly available in dbSNP): "IIISP1" = human individual DNA (anonymized
samples)
-- from 23 individuals of self-described HISPANIC heritage; "PAC" = human
individual
DNA (anonymized samples) from 24 individuals of self-described PACIFIC RIM
heritage; "CAUCl" =human individual DNA (anonymized samples) from 31
individuals
of self-described CAUCASIAN heritage; "AFR1" = human individual DNA
(anonymized samples) from 24 individuals of self-described AFRICAN/AFRICAN
-- AMERICAN heritage; "Pl" = human individual DNA (anonymized samples) from
102
individuals of self-described heritage; "PA130299515"; "SC_12_A" = SANGER 12
14
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
DNAs of Asian origin from Corielle cell repositories, 6 of which are male and
6 female;
"SC_12_C" = SANGER 12 DNAs of Caucasian origin from Corielle cell repositories
from the CEPH/UTAH library. Six male and 6 female; "SC_12_AA" = SANGER 12
DNAs of African-American origin from Corielle cell repositories 6 of which are
male
and 6 female; "SC_95_C" = SANGER 95 DNAs of Caucasian origin from Corielle
cell
repositories from the CEPH/UTAH library; and "SC_12 CA" = Caucasians - 12 DNAs-
from Corielle cell repositories that are from the CEPH/UTAH library. Six male
and 6
female.
NOTE: For SNPs of "Applera" SNP source, genes/regulatory regions of 39
. 10
individuals (20 Caucasians and 19 African Americans) were re-sequenced and,
since each =
SNP position is represented by two chromosomes in each individual (with the
exception
of SNPs on X and Y chromosomes in males, for which each SNP position is
represented
by a single chromosome), up to 78 chromosomes were genotyped for each SNP
position.
Thus, the sum of the African-American ("afr") allele counts is up to 38, the
sum of the
Caucasian allele counts ("cau") is up to 40, and the total sum of all allele
counts is ti-p to
78.
(NOTE: semicolons separate population/allele/count information corresponding
to
each indicated SNP source; i.e., if four SNP. sources are indicated, such as
"Celera",
= "dbSNP", "HGBASE", and "HGMD", then population/allele/count information
is
provided in four groups which are separated by semicolons and listed in the
same order
as the listing of SNP sources, with each population/allele/count information
group .
corresponding to the respective SNP source based on order; thus, in this
example, the first
population/allele/count information group would correspond to the first listed
SNP source
(Celera) and the third population/allele/count information group separated by
semicolons
would correspond to the third listed SNP source (HGBASE); if
population/allele/count
information is not available for any particular SNP source, then a pair of
semicolons is
still inserted as a place-holder in order to maintain correspondence between
the list of
SNP sources and the corresponding listing of population/allele/count
information)
- SNP type (e.g., location within gene/transcript and/or predicted functional
effect) ["MIS-SENSE MUTATION" = SNP causes a change in the encoded amino acid
(i.e., a non-synonymous coding SNP); "SILENT MUTATION" = SNP does not cause a
CA 02826522 2014-01-22
change in the encoded amino acid (i.e., a non-synonymous coding SNP); "SILENT
MUTATION" = SNP does not cause a change in the encoded amino acid (i.e., a
synonymous
coding SNP); "STOP CODON MUTATION" = SNP is located in a stop codon; -NONSENSE
MUTATION" = SNP creates or destroys a stop codon; "UTR 5" = SNP is located in
a 5' UTR
of a transcript; "UTR 3" = SNP is located in a 3' UTR of a transcript;
"PUTATIVE UTR 5" ¨
SNP is located in a putative 5' UTR; "PUTATIVE UTR 3" = SNP is located in a
putative 3'
UTR; -DONOR SPLICE SITE" = SNP is located in a donor splice site (5' intron
boundary);
"ACCEPTOR SPLICE SITE" = SNP is located in an acceptor splice site (3' intron
boundary);
"CODING REGION" = SNP is located in a protein-coding region of the transcript;
"EXON" =
SNP is located in an exon; "INTRON" = SNP is located in an intron; "hmCS" =
SNP is located
in a human-mouse conserved segment; "TFBS" = SNP is located in a transcription
factor
binding site; "UNKNOWN" = SNP type is not defined; "INTERGENIC" = SNP is
intergenic,
i.e., outside of any gene boundary]
- Protein coding information (Table 1 only), where relevant, in the format of
[protein
SEQ ID NO:#, amino acid position, (amino acid-1, codonl) (amino acid-2,
codon2)]. The
information in this field includes SEQ ID NO of the encoded protein sequence,
position of the
amino acid residue within the protein identified by the SEQ ID NO that is
encoded by the
codon containing the SNP, amino acids (represented by one-letter amino acid
codes) that are
encoded by the alternative SNP alleles (in the case of stop codons, s`X" is
used for the one-letter
amino acid code), and alternative codons containing the alternative SNP
nucleotides which
encode the amino acid residues (thus, for example, for missense mutation-type
SNPs, at least
two different amino acids and at least two different codons are generally
indicated; for silent
mutation-type SNPs, one amino acid and at least two different codons are
generally indicated,
etc.). In instances where the SNP is located outside of a protein-coding
region (e.g., in a UTR
region), "None" is indicated following the protein SEQ ID NO.
16
CA 02826522 2014-01-22
DESCRIPTION OF TABLE 3
Table 3 provides sequences (SEQ ID NOS: 59-82) of primers that have been
synthesized and used in the laboratory to carry out allele-specific PCR
reactions in order to
assay the SNPs disclosed in Tables 4 and 5 during the course of association
studies to verify the
association of these SNPs with liver fibrosis.
Table 3 provides the following:
- the column labeled -Marker" provides an hCV identification number for
each SNP
site
- the column labeled -Alleles" designates the two alternative alleles at
the SNP site
identified by the hCV identification number that are targeted by the allele-
specific primers (the
allele-specific primers are shown as "Sequence A" and "Sequence B") [NOTE:
Alleles may be
presented in Table 3 based on a different orientation (i.e., the reverse
complement) relative to
how the same alleles are presented in Tables 1, 2, 4, and 5].
- the column labeled "Sequence A (allele-specific primer)" provides an
allele-specific
primer that is specific for an allele designated in the "Alleles" column
- the column labeled "Sequence B (allele-specific primer)" provides an
allele-specific
primer that is specific for the other allele designated in the "Alleles"
column
- the column labeled "Sequence C (common primer)" provides a common primer
that is
used in conjunction with each of the allele-specific primers (the "Sequence A"
17
CA 02826522 2014-01-22
primer and the "Sequence B" primer) and which hybridizes at a site away from
the SNP
position.
All primer sequences are given in the 5' to 3' direction.
Each of the nucleotides designated in the "Alleles" column matches or is the
reverse
complement of (depending on the orientation of the primer relative to the
designated allele) the
3' nucleotide of the allele-specific primer (either "Sequence A" or "Sequence
B") that is
specific for that allele.
DESCRIPTION OF TABLE 4
Table 4 provides results of statistical analyses for SNPs disclosed in Tables
1-2 (SNPs
can be cross-referenced between tables based on their hCV identification
numbers), and the
association of these SNPs with early and late stages of fibrosis (minimal or
moderate to severe
fibrosis). The statistical results shown in Table 4 provide support for the
association of a SNP
with minimal to severe fibrosis. Table 4 shows the association of this SNP
with fibrosis is
supported by p-values <0.05 in a genotype association based on ordinal (ord)
(major
homozygotes, heterozygotes and minor homozygotes) or dominant/recessive (dom)
modes
(major homozygotes vs. heterozygotes and minor homozygotes) of inheritance.
Table 4 presents statistical associations of the SNP with the trial endpoint.
The column
labeled -Marker" presents the SNP as identified by its unique identifier
number and its mode of
association with the fibrosis stage endpoint. The column labeled "Gene symbol"
presents the
common gene name of the gene containing the SNP. The data obtained from the
individual
sample sets are presented in two groups of columns. The groups of columns
labeled "Stanford
Samples" means the samples were obtained from patients at Stanford. This
sample set
contains samples obtained from patients that had extreme cases of fibrosis.
62% of the patients
had a minimum fibrosis stage (level 0-2) (controls) and 38% had a severe
fibrosis stage (level
3-4) (cases). The groups of columns labeled "UCSF Samples" means the samples
were
obtained from a study performed at the University of California, San
Francisco. These samples
were obtained from patients that had a variety of stages of fibrosis including
minimal, moderate
and severe stages of fibrosis (46%, 26% and 28% respectively), which reflects
the distribution
of fibrosis patients in clinics. The column labeled "OR's indicates the Odds
Ratio, an
18
CA 02826522 2014-01-22
approximation of the relative risk for an individual for the defined endpoint
associated with the
SNP. ORs less than 1 indicate the risk allele is protective for the defined
endpoint, and ORs
greater than 1 indicate the risk allele increases the risk of having the
defined endpoint. The
columns labeled -LCL" and "UCL" give the lower and upper confidence levels of
the ORs.
The column labeled "p val" indicates the results of either the chi-square test
(Dom) or the
Fisher Exact test (Ord) to determine if the qualitative phenotype is a
function of the SNP
genotype.
DESCRIPTION OF TABLE 5
io Table 5 provides results of statistical analyses for SNPs disclosed in
Tables 1-2 (SNPs
can be cross-referenced between tables based on their hCV identification
numbers), and the
association of these SNPs with mild or severe fibrosis stage. The statistical
results shown in
Table 5 provide support for the association of these SNPs with bridging
fibrosis/cirrhosis. For
example, the statistical results provided in Table 5 show that the association
of these SNPs with
is supported by p-values <0.1 in an allelic association test in the University
of California
(UCSF) and the Virginia Commonwealth University (VCU) sample sets in at least
one of the
following strata; all patients (A), Caucasian only (C), or other than
Caucasian (0). Additional
SNP association with bridging fibrosis/cirrhosis is seen in the sample sets
obtained from the
University of Illinois, Chicago (UIC) and Stanford University (Stanford).
Table 5 presents statistical associations of SNPs with trial endpoints. The
column
labeled "Marker" presents each SNP as identified by its unique identifier
number. The column
labeled -Risk allele" presents the risk allele for each of the identified
SNPs. The risk allele
may also be presented in the Tables 1-2 as the reverse complement of the
allele presented in
Table 4. The column labeled "Strata" indicates the group of individuals in
which the
association was observed. "A" indicates that the association was observed in
all individuals,
"C" indicates that the association was observed in Caucasians, "0" indicates
the association
was observed in other than Caucasians. The groups of columns labeled "UCSF"
means the
samples were obtained from the University of California, San Francisco. Among
the 537
patients from UCSF, the samples had minimal (stage 0-1,
19
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
52%), moderate (stage 2, 23%) or severe (stage 3-4, 25%) fibrosis. The groups
of
columns labeled "VCU" means the samples were obtained from the Virginia
,
Commonwealth University. These samples were obtained from 483 patients that
had
minimal (stage 0-1, 18%), moderate (stage 2, 34%) or severe (stage 3-4, 48%)
fibrosis.
The groups of columns labeled "UIC" means the samples were obtained from the
University of Minois, Chicago. These samples were obtained from 115 patients
that had
minimal (stage 0-1, 29%), moderate (stage 2, 30%) or severe (stage 3-4, 41%)
fibrosis.
The groups of columns labeled "Stanford" means the samples were obtained from
Stanford University. These samples were obtained from extreme cases, 62%
contained
minimal (stage 0-1) fibrosis and 38% contained severe (stage 3-4) fibrosis.
The column =
labeled "CT AF" gives the control allele frequency of that SNP in that
stratum. The
column labeled "CASE AF" gives the case allele frequency of that SNP in that
stratum.
The column labeled "OR" indicates an approximation of the relative risk for an
individual for the defined endpoint associated with the SNP. ORs less than 1
indicate the
risk allele is protective for the defined endpoint, and ORs greater than 1
indicate the risk
- allele increases the risk of having the defined endpoint. The column labeled
"p_2tail"
indicates the p-value generated by the Fisher Exact test (allelic association)
to determine
if the qualitative phenotype is a function of the SNP genotype and is either a
protective or
risk allele in the UCSF sample set. The column labeled "p_ltail" indicates the
p-value
generated by the Fisher Exact test to determine if the qualitative phenotype
is a function
of the SNP genotype in the VCU, UIC or Stanford samples and the OR is going in
the
same direction as the OR for that SNP in the UCSF sample.
DESCRIPTION OF THE FIGURE
Figure 1 provides a diagrammatic representation of a computer-based discovery
.
system containing the SNP information of the present invention in computer
readable
form.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides SNPs associated with liver fibrosis and related
pathologies, nucleic acid molecules containing SNPs, methods and reagents for
the
CA 02826522 2014-01-22
detection of the SNPs disclosed herein, uses of these SNPs for the development
of detection
reagents, and assays or kits that utilize such reagents. The liver fibrosis-
associated SNPs
disclosed herein are useful for diagnosing, screening for, and evaluating
predisposition to liver
fibrosis, including an increased or decreased risk of developing bridging
fibrosis/cirrhosis, the
rate of progression of fibrosis, and related pathologies in humans.
Furthermore, such SNPs and
their encoded products are useful targets for the development of therapeutic
agents.
A large number of SNPs have been identified from re-sequencing DNA from 39
individuals, and they are indicated as "Applera" SNP source in Tables 1-2.
Their allele
frequencies observed in each of the Caucasian and African-American ethnic
groups are
o provided. Additional SNPs included herein were previously identified
during shotgun
sequencing and assembly of the human genome, and they are indicated as
"Celera" SNP source
in Tables 1-2. Furthermore, the information provided in Table 1-2,
particularly the allele
frequency information obtained from 39 individuals and the identification of
the precise
position of each SNP within each gene/transcript, allows haplotypes (i.e.,
groups of SNPs that
are co-inherited) to be readily inferred. The present invention encompasses
SNP haplotypes, as
well as individual SNPs.
Thus, the present invention provides individual SNPs associated with liver
fibrosis, as
well as combinations of SNPs and haplotypes in genetic regions associated with
liver fibrosis,
polymorphic/variant transcript sequences (SEQ ID NOS:1-14) and genomic
sequences (SEQ
ID NOS:43-50) containing SNPs, encoded amino acid sequences (SEQ ID NOS: 15-
28), and
both transcript-based SNP context sequences (SEQ ID NOS: 29-42) and genomic-
based SNP
context sequences (SEQ ID NOS:51-58) (transcript sequences, protein sequences,
and
transcript-based SNP context sequences are provided in Table 1 and the
Sequence Listing;
genomic sequences and genomic-based SNP context sequences are provided in
Table 2 and the
Sequence Listing), methods of detecting these polymorphisms in a test sample,
methods of
determining the risk of an individual of having or developing liver fibrosis,
methods of
screening for compounds useful for treating disorders associated with a
variant gene/protein
such as liver fibrosis, compounds identified by these screening methods,
methods of using the
disclosed SNPs to select a treatment strategy, methods of treating a
21
CA 02826522 2014-01-22
disorder associated with a variant gene/protein (i.e., therapeutic methods),
and methods of
using the SNPs of the present invention for human identification.
The present invention provides novel SNPs associated with liver fibrosis and
related
pathologies, as well as SNPs that were previously known in the art, but were
not previously
known to be associated with liver fibrosis. Accordingly, the present invention
provides novel
compositions and methods based on the novel SNPs disclosed herein, and also
provides novel
methods of using the known, but previously unassociated, SNPs in methods
relating to liver
fibrosis (e.g., for diagnosing liver fibrosis, etc.). In Tables 1-2, known
SNPs are identified
based on the public database in which they have been observed, which is
indicated as one or
more of the following SNP types: "dbSNP" = SNP observed in dbSNP, "HGBASE" =
SNP
observed in HGBASE, and "FIGMD" = SNP observed in the Human Gene Mutation
Database
(HGMD).
Particular SNP alleles of the present invention can be associated with either
an
increased risk of having or developing liver fibrosis and related pathologies,
or a decreased risk
of having or developing liver fibrosis. SNP alleles that are associated with a
decreased risk of
having or developing liver fibrosis may be referred to as "protective"
alleles, and SNP alleles
that are associated with an increased risk of having or developing liver
fibrosis may be referred
to as "susceptibility" alleles, "risk" alleles, or "risk factors". Thus,
whereas certain SNPs (or
their encoded products) can be assayed to determine whether an individual
possesses a SNP
allele that is indicative of an increased risk of having or developing liver
fibrosis (i.e., a
susceptibility allele), other SNPs (or their encoded products) can be assayed
to determine
whether an individual possesses a SNP allele that is indicative of a decreased
risk of having or
developing liver fibrosis (i.e., a protective allele). Similarly, particular
SNP alleles of the
present invention can be associated with either
22
CA 02826522 2013-08-13
W02005/111241 PCT/US2005/016051
an increased or decreased likelihood of responding to a particular treatment =
or therapeutic compound, or an increased or decreased likelihood of
experiencing toxic effects from a particular treatment or therapeutic =
compound. The term "altered" may be used herein to encompass either of
these two possibilities (e.g., an increased or a decreased risk/likelihood).
Those skilled in the art will readily recognize that nucleic acid molecules
may be
double-stranded molecules and that reference to a particular site on one
strand refers, as
well, to the corresponding site on a complementary strand. In defining a SNP
position,
SNP allele, or nucleotide sequence, reference to an adenine, a thymine
(uridine), a
cytosine, or a guanine at a particular site on one strand of a nucleic acid
molecule also
- defines the thymine (uridine), adenine, guanine, or cytosine
(respectively) at the
corresponding site on a complementary strand of the nucleic acid molecule.
Thus,
reference may be made to either strand in order to refer to a particular SNP
position, SNP
allele, or nucleotide sequence. Probes and primers, may be designed to
hybridize to
either strand and SNP genotyping methods disclosed herein may generally target
either
strand. Throughout the specification, in identifying a SNP position, reference
is
generally made to the protein-encoding strand, only for the purpose of
convenience.
. = References to variant peptides, polypeptides, or proteins of the
present invention
include peptides, polypeptides, proteins, or fragments thereof, that contain
at least one
amino acid residue that differs from the corresponding amino acid sequence of
the art-
known peptide/polypeptide/protein (the art-known protein may be
interchangeably
=
referred to as the "wild-type", "reference", or "normal" protein). Such
variant
peptides/polypeptides/proteins can result from a codon change caused by a
nonsynonymous nucleotide substitution at a protein-coding SNP position (i.e.,
a missense
mutation) disclosed by the present invention. Variant
peptides/polypeptides/proteins of
the present invention can also result from a nonsense mutation, i.e., a SNP
that creates a
premature stop codon, a SNP that generates a read-through mutation by
abolishing a stop
codon, or due to any SNP disclosed by the present invention that otherwise
alters the
structure, function/activity, or expression of a protein, such as a SNP in a
regulatory
region (e.g. a promoter or enhancer) or a SNP that leads to alternative or
defective
23
CA 02826522 2014-01-22
splicing, such as a SNP in an intron or a SNP at an exon/intron boundary. As
used herein, the
terms -polypeptide", "peptide", and "protein" are used interchangeably.
ISOLATED NUCLEIC ACID MOLECULES
AND SNP DETECTION REAGENTS & KITS
Tables 1 and 2 provide a variety of information about each SNP of the present
invention
that is associated with liver fibrosis, including the transcript sequences
(SEQ ID NOS:1-14),
genomic sequences (SEQ ID NOS:43-50), and protein sequences (SEQ ID NOS:15-28)
of the
encoded gene products (with the SNPs indicated by IUB codes in the nucleic
acid sequences).
In addition, Tables 1 and 2 include SNP context sequences, which generally
include 100
nucleotide upstream (5') plus 100 nucleotides downstream (3') of each SNP
position (SEQ ID
NOS:29-42 correspond to transcript-based SNP context sequences disclosed in
Table 1, and
SEQ ID NOS:51-58 correspond to genomic-based context sequences disclosed in
Table 2), the
alternative nucleotides (alleles) at each SNP position, and additional
information about the
variant where relevant, such as SNP type (coding, missense, splice site, UTR,
etc.), human
populations in which the SNP was observed, observed allele frequencies,
information about the
encoded protein, etc.
Isolated Nucleic Acid Molecules
The present invention provides isolated nucleic acid molecules that contain
one or more
SNPs disclosed Table 1 and/or Table 2. Isolated nucleic acid molecules
containing one or
more SNPs disclosed in at least one of Tables 1-2 may be interchangeably
referred to
throughout the present text as "SNP-containing nucleic acid molecules".
Isolated nucleic acid
molecules may optionally encode a full-length variant protein or fragment
thereof. The isolated
nucleic acid molecules of the present invention also include probes and
primers (which are
described in greater detail below in the section entitled "SNP Detection
Reagents"), which may
be used for assaying the
24
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
disclosed SNPs, and isolated full-length genes, transcripts, cDNA molecules,
and
, fragments thereof, which may be used for such purposes as expressing an
encoded
protein.
As used herein, an "isolated nucleic acid molecule" generally is one that
contains a
SNP of the present inyention or one that hybridizes to such molecule such as a
nucleic acid =
with a complementary sequence, and is separated from most other nucleic acids
present in
the natural source of the nucleic acid molecule. Moreover, an "isolated"
nucleic acid
molecule, such as a cDNA molecule containing a SNP of the present invention,
can be
substantially free of other cellular material, or culture medium when produced
by
recombinant techniques, or chemical precursors, or other chemicals when
chemically
synthesized. A nucleic acid molecule can be fused to other coding or
regulatory sequences
and still be considered "isolated". Nucleic acid molecules present in non-
human transgenic
animals, which do not naturally occur in the animal, are also considered
"isolated". For
example, recombinant DNA molecules contained in a vector are considered
"isolated".
Further examples of "isolated" DNA molecules include recombinant DNA molecules
maintained in heterologous host cells, and purified (partially or
substantially) DNA
molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA
transcripts
of the isolated SNP-containing DNA molecules of the present invention.
Isolated nucleic
acid molecules according to the present invention further include such
molecules produced
synthetically.
Generally, an isolated SNP-containing nucleic acid molecule comprises one or
more
SNP positions disclosed by the present invention with flanking nucleotide
sequences on
either side of the SNP positions. A flanking sequence can include nucleotide
residues that
are naturally associated with the SNP site and/or heterologous nucleotide
sequences.
Preferably the flanking sequence is up to about 500, 300, 100, 60, 50, 30, 25,
20, 15, 10, 8,
or 4 nucleotides (or any other length in-between) on either side of a SNP
position, or as long
as the full-length gene or entire protein-coding sequence (or any portion
thereof such as an
exon), especially if the SNP-containing nucleic acid molecule is to be used to
produce a
protein or protein fragment.
For full-length genes and entire protein-coding sequences, a SNP flanking
sequence
can be, for example, up to about 5KB, 4KB, 3KB, 2KB, 1KB on either side of the
SNP.
CA 02826522 2014-01-22
Furthermore, in such instances, the isolated nucleic acid molecule comprises
exonic sequences
(including protein-coding and/or non-coding exonic sequences), but may also
include intronic
sequences. Thus, any protein coding sequence may be either contiguous or
separated by introns.
The important point is that the nucleic acid is isolated from remote and
unimportant flanking
sequences and is of appropriate length such that it can be subjected to the
specific manipulations or
uses described herein such as recombinant protein expression, preparation of
probes and primers
for assaying the SNP position, and other uses specific to the SNP-containing
nucleic acid
sequences.
An isolated SNP-containing nucleic acid molecule can comprise, for example, a
full-length
gene or transcript, such as a gene isolated from genomic DNA (e.g., by cloning
or PCR
amplification), a cDNA molecule, or an mRNA transcript molecule. Polymorphic
transcript
sequences are provided in Table 1 and in the Sequence Listing (SEQ ID NOS: 1-
14), and
polymorphic genomic sequences are provided in Table 2 and in the Sequence
Listing (SEQ ID
NOS:43-50). Furthermore, fragments of such full-length genes and transcripts
that contain one or
more SNPs disclosed herein are also encompassed by the present invention, and
such fragments
may be used, for example, to express any part of a protein, such as a
particular functional domain
or an antigenic epitope.
Thus, the present invention also encompasses fragments of the nucleic acid
sequences
provided in Tables 1-2 (transcript sequences are provided in Table 1 as SEQ ID
NOS:1-14,
genomic sequences are provided in Table 2 as SEQ ID NOS:43-50, transcript-
based SNP context
sequences are provided in Table 1 as SEQ ID NO:29-42, and genomic-based SNP
context
sequences are provided in Table 2 as SEQ ID NO:51-58) and their complements. A
fragment
typically comprises a contiguous nucleotide sequence at least about 8 or more
nucleotides, more
preferably at least about 12 or more nucleotides, and even more preferably at
least about 16 or
more nucleotides. Further, a fragment could comprise at least about 18, 20,
22, 25, 30, 40, 50, 60,
80, 100, 150, 200, 250 or 500 (or any other number in-between) nucleotides in
length. The length
of the fragment will be based on its intended use. For example, the fragment
can encode epitope-
bearing regions of a variant peptide or regions of a variant peptide that
differ from the
normal/wild-type protein, or can be useful as a polynucleotide probe or
primer. Such fragments
can be isolated using the nucleotid
26
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
sequences provided in Table 1 and/or Table 2 for the synthesis of a
polynucleotide probe. A
, labeled, robe can then be used, for example, to screen a cDNA library
genomic DNA
library, or mRNA to isolate nucleic acid corresponding to the coding region.
Further,
primers can be used in amplification reactions, such as for purposes of
assaying one or.more
SNPS sites or for cloning specific regions of a gene.
An isolated nucleic acid molecule of the present invention further encompasses
a
SNP-containing polynucleotide that is the product of any one of a variety of
nucleic acid
amplification methods, which are used to increase the copy numbers of a
polynucleotide
of interest in a nucleic acid sample. Such amplification methods are well
known in the
art, and they include but are not limited to, polymerase chain reaction (PCR)
(U.S. Patent
= Nos. 4,683,195; and 4,683,202; PCR Technology: Principles and
Applications for DNA
Amplification, ed. H.A. Erlich, Freeman Press, NY, NY, 1992), ligase chain
reaction
(LCR) (Wu and Wallace, Genomics 4:560, 1989; Landegren et al., Science
241:1077,
1988), strand displacement amplification (SDA) (U.S. Patent Nos. 5,270,184;
and
5,422,252), transcription-mediated amplification (TmA) (U.S. Patent No.
5,399,491),
linked linear amplification (LLA) (U.S. Patent No. 6,027,923), and the like,
and
isothermal amplification methods such as nucleic acid sequence based
amplification
(NASBA), and self-sustained sequence replication (Guatelli et al., Proc. Natl.
Acad. Sci.
USA 87: 1874, 1990). Based on such methodologies, a person skilled in the art
can .
readily design primers in any suitable regions 5' and 3' to a SNP disclosed
herein. Such
primers may be used to amplify DNA of any length so long that it contains the
SNP of
interest in its sequence.
As used herein, an "amplified polynucleotide" of the invention is a SNP-
containing nucleic acid molecule whose amount has been increased at least two
fold by
any nucleic acid amplification method performed in vitro as compared to its
starting
amount in a test sample. In other preferred embodiments, an amplified
polynucleotide is
the result of at least ten fold, fifty fold, one hundred fold, one thousand
fold, or even ten
thousand fold increase as compared to its starting amount in a test sample. In
a typical
PCR amplification, a polynucleotide of interest is often amplified at least
fifty thousand
fold in amount over the unamplified genonaic DNA, but the precise amount of
27
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
amplification needed for an assay depends on the 'sensitivity of the
subsequent detection
õ
method used.
Generally, an amplified polynucleotide is at least about 16 nucleotides in
length.
More typically, an amplified polynucleotide is at least about 20 nucleotides
in length. In
a preferred embodiment of the invention, an amplified polynucleotide is at
least about 30
nucleotides in length. In a more preferred embodiment of the invention, an
amplified
=polynucleotide is at least about 32, 40, 45, 50, or 60 nucleotides in length.
In yet another
= preferred embodiment of the invention, an amplified polynucleotide is at
least about 100,
= 200, 300, 400, or 500 nucleotides in length. While the total length of an
amplified
=polynucleotide of the invention can be as long as an ern, an intron or the
entire gene =
where the SNP of interest resides, an amplified product is typically up to
about 1,000 =
= nucleotides in length (although certain amplification methods may
generate amplified
products greater than 1000 nucleotides in length). More preferably, an
amplified =
= polynucleotide is not greater than about 600-700 nucleotides in length.
It is understood
that irrespective of the length of an amplified polynucleotide, a SNP of
interest may be
located anywhere along its sequence.
= In a specific embodiment of the invention, the amplified product is at
least about
201 nucleotides in length, comprises one of the transcript-based context
sequences or the
genomic-based context sequences shown in Tables 1-2. Such a product may. have
, additional sequences on its 5' end or 3' end or both. In another embodiment,
the =
amplified product is about 101 nucleotides in length, and it contains a SNP
disclosed
herein. Preferably, the SNP is located at the middle of the amplified product
(e.g., at
position 101 in an amplified product that is 201 nucleotides in length, or at
position 51 in
an amplified product that is 101 nucleotides in length), or within 1, 2, 3,4,
5, 6, 7, 8,9,
10, 12, 15, or 20 nucleotides from the middle of the amplified product
(however, as
indicated above, the SNP of interest may be located anywhere along the length
of the
amplified product). =
The present invention provides isolated nucleic acid molecules that comprise,
consist of, or consist essentially of one or more polynucleotide sequences
that contain one or
more SNPs disclosed herein, complements thereof, and SNP-containing fragments
thereof.
28
CA 02826522 2014-01-22
Accordingly, the present invention provides nucleic acid molecules that
consist of any of
the nucleotide sequences shown in Table 1 and/or Table 2 (transcript sequences
are provided in
Table 1 as SEQ ID NOS:1-14, genomic sequences are provided in Table 2 as SEQ
ID NOS:43-50,
transcript-based SNP context sequences are provided in Table 1 as SEQ ID NO:15-
42, and
genomic-based SNP context sequences are provided in Table 2 as SEQ ID NO:51-
58), or any
nucleic acid molecule that encodes any of the variant proteins provided in
Table 1 (SEQ ID
NOS:15-28). A nucleic acid molecule consists of a nucleotide sequence when the
nucleotide
sequence is the complete nucleotide sequence of the nucleic acid molecule.
The present invention further provides nucleic acid molecules that consist
essentially of
any of the nucleotide sequences shown in Table 1 and/or Table 2 (transcript
sequences are
provided in Table 1 as SEQ ID NOS:1-14, genomic sequences are provided in
Table 2 as SEQ ID
NOS:43-50, transcript-based SNP context sequences are provided in Table 1 as
SEQ ID NO:29-
42, and genomic-based SNP context sequences are provided in Table 2 as SEQ ID
NO:51-58), or
any nucleic acid molecule that encodes any of the variant proteins provided in
Table 1 (SEQ ID
NOS:15-28). A nucleic acid molecule consists essentially of a nucleotide
sequence when such a
nucleotide sequence is present with only a few additional nucleotide residues
in the final nucleic
acid molecule.
The present invention further provides nucleic acid molecules that comprise
any of the
nucleotide sequences shown in Table 1 and/or Table 2 or a SNP-containing
fragment thereof
(transcript sequences are provided in Table 1 as SEQ ID NOS:1-14, genomic
sequences are
provided in Table 2 as SEQ ID NOS:43-50, transcript-based SNP context
sequences are provided
in Table 1 as SEQ ID NO:29-42, and genomic-based SNP context sequences are
provided in Table
2 as SEQ ID NO:51-58), or any nucleic acid molecule that encodes any of the
variant proteins
provided in Table 1 (SEQ ID NOS:15-28). A nucleic acid molecule comprises a
nucleotide
sequence when the nucleotide sequence is at least part of the final nucleotide
sequence of the
nucleic acid molecule. In such a fashion, the nucleic acid molecule can be
only the nucleotide
sequence or have additional nucleotide residues, such as residues that are
naturally associated with
it or heterologous nucleotide sequences. Such a nucleic acid molecule can have
one to a few
additional nucleotides or can comprise many more additional nucleotides. A
brief
29
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
description of how various types of these nucleic acid molecules can be
readily made and
=
isolated is.pmvided below, and such techniques are well known to those of
ordinary skill in
= the art (Sambrook and Russell, 2000, Molecular Cloning: A Laboratory
Manual, Cold
= Spring Harbor Press, NY).
The isolated nucleic acid molecules can encode mature proteins plus additional
amino or carboxyl-tenninal amino acids or both, or amino acids interior to the
mature
peptide (when the mature form has more than one peptide chain, for instance).
Such
sequences may play a role in processing of a protein from precursor to a
mature form, . =
facilitate protein trafficking, prolong or shorten protein half-life, or
facilitate manipulation- of
a protein for assay or production. As generally is the case in situ, the
additional amino acids
may be processed away from the mature protein by cellular enzymes.
Thus, the isolated nucleic acid molecules include, but are not limited to,
nucleic acid
= 'molecules having a sequence encoding a peptide alone, a sequence
encoding a mature
=peptide and additional coding sequences such as a leader or secretory
sequence (e.g., a pre-
. pro or pro-protein sequence), a sequence encoding a mature peptide with or
without
additional coding sequences, plus additional non-coding sequences, for example
introns and
= non-coding 5' and 3' sequences such as transcribed but untranslated
sequences that play a =
role in, for example, transcription, mRNA processing (including splicing and
polyadenylation signals), ribosome binding, and/or stability of mRNA. In
addition, the .
nucleic acid molecules may be fused to heterologous marker sequences encoding,
for
example, a peptide that facilitates purification.
Isolated nucleic acid molecules can be in the form of RNA, such as mRNA, or in
= the form DNA, including cDNA and genomic DNA, which may be obtained, for
example, by molecular cloning or produced by chemical synthetic techniques or
by a
combination thereof (Sambrook and Russell, 2000, Molecular Cloning: A
Laboratory
Manual, Cold Spring Harbor Press, NY). Furthermore, isolated nucleic acid
molecules,
particularly SNP detection reagents such as probes and primers, can also be
partially or
completely in the form of one or more types of nucleic acid analogs, such as
peptide
nucleic acid (PNA) (U.S. Patent Nos. 5,539,082; 5,527,675; 5,623,049;
5,714,331). The
nucleic acid, especially DNA, can be double-stranded or single-stranded.
Single-stranded
nucleic acid can be the coding strand (sense strand) or the complementary non-
coding
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
strand (anti-sense strand). DNA, RNA, or PNA segments can be assembled, for
example,
from fragments of the human genome (in the case of DNA or RNA) or single
nucleotides,
short oligonucleotide linkers, or from a series of oligonucleotides, to
provide a synthetic
nucleic acid molecule. Nucleic acid molecules can be readily synthesized using
the
sequences provided herein as a reference; oligonucleotide and PNA oligomer
synthesis
techniques are well known in the art (see, e.g., Corey, "Peptide nucleic
acids: expanding
the scope of nucleic acid recognition", Trends Biotechnol. 1997 Jun;15(6):224-
9, and
Hyrup et al., "Peptide nucleic acids (PNA): synthesis, properties and
potential
applications", Bioorg Med Chem. 1996 Jan;4(1):5-23). Furthermore, large-scale
automated oligonucleotide/PNA synthesis (including synthesis on an array or
bead
surface or other solid support) can readily be accomplished using commercially
available
nucleic acid synthesizers, such as the Applied Biosystems (Foster City, CA)
3900 High-
= Throughput DNA Synthesizer or Expedite 8909 Nucleic Acid Synthesis
System, and the
= sequence information provided herein.
The present invention encompasses nucleic acid analogs that contain
modified, synthetic, or non-naturally occurring nucleotides or structural
= elements or other alternative/modified nucleic acid chemistries known in
the
art. Such nucleic acid analogs are useful, for example, as detection reagents
= (e.g., primers/probes) for detecting one or more SNPs identified in Table
1
and/or Table 2. Furthermore, kits/systems (such as beads, arrays, etc.) that
include these analogs are also encompassed by the present invention. For=
example, PNA oligomers that are based on the polymorphic sequences of the
present invention are specifically contemplated. PNA oligomers are analogs
of DNA in which the phosphate backbone is replaced with a peptide-like =
backbone (Lagriffoul et at., Bioorganic & Medicinal Chemistry Letters, 4:
1081-1082 (1994), Petersen et at., Bioorganic & Medicinal Chemistry Letters,
6: 793-796 (1996), Kumar et at., Organic Letters 3(9): 1269-1272 (2001),
W096/04000). PNA hybridizes to complementary RNA or DNA with higher
affinity and specificity than conventional oligonucleotides and
oligonucleotide
analogs. The properties of PNA enable novel molecular biology and
31
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
biochemistry applications unachievable with traditional oligonucleotides and
peptides:
Additional examples of nucleic acid modifications that improve the =
binding properties and/or stability of a nucleic acid include the use of base
analogs such as inosine, intercalators (U.S. Patent No. 4,835,263) and the =
minor groove binders (U.S. Patent No. 5,801,115). Thus, references herein to
nucleic acid molecules, SNP-containing nucleic acid molecules, SNP detection
reagents (e.g., probes and primers), oligonucleotides/polynucleotides include
PNA oligomers and other nucleic acid analogs. Other examples of nucleic
acid analogs and alternatiVe/modified nucleic acid chemistries known in the
art are described in Current Protocols in Nucleic Acid Chemistry, John Wiley &
Sons, N.Y. (2002).
The present invention further provides nucleic acid molecules that encode
fragments of the variant polypeptides disclosed herein as well as nucleic acid
molecules
that encode obvious variants of such variant polypeptides. Such nucleic acid
molecules
may be naturally occurring, such as paralogs (different locus) and orthologs
(different
organism), or may be constructed by recombinant DNA methods or by chemical
synthesis. Non-naturally occurring variants may be made by mutagenesis
techniques,
including those applied to nucleic acid molecules, cells, or organisms.
Accordingly, the
variants can contain nucleotide substitutions, deletions, inversions and
insertions (in =
addition to the SNPs disclosed in Tables 1-2). Variation can occur in either
or both the
coding and non-coding regions. The variations can produce conservative and/or
non-
conservative amino acid substitutions. =
Further variants of the nucleic acid molecules disclosed in Tables 1-2, such
as
naturally occurring allelic variants (as well as orthologs and paralogs) and
synthetic .
variants produced by mutagenesis techniques, can be identified and/or produced
using
methods well known in the art. Such further variants can comprise a nucleotide
sequence
that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%,
98%, or 99% sequence identity with a nucleic acid sequence disclosed in Table
1 and/or
Table 2 (or a fragment thereof) and that includes a novel Sls.TP allele
disclosed in Table 1
and/or Table 2. Further, variants can comprise a nucleotide sequence that
encodes a
32
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
polypeptide that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%, 93%, 94%,
95%,
96%; 97%, 98%, or 99% sequence identity with a polypeptide sequence disclosed
in
Table 1 (or a fragment thereof) and that includes a novel SNP allele disclosed
in Table 1
and/or Table 2. Thus, an aspect of the present invention that is specifically
contemplated
are isolated nucleic acid molecules that have a certain degree of sequence
variation
= . -
compared with the sequences shown in Tables 1-2, but that contain a novel SNP
allele
disclosed herein. In other words, as long as an isolated nucleic acid molecule
contains a
novel SNP allele disclosed herein, other portions of the nucleic acid molecule
that flank
the novel SNP allele can vary to some degree from the specific transcript,
genomic, and
context sequences shown in Tables 1-2, and can encode a polypeptide that
varies to some
degree from the specific polypeptide sequences shown in Table 1.
To determine the percent identity of two amino acid sequences or two
nucleotide
sequences of two molecules that share sequence homology, the sequences are
aligned for
optimal comparison purposes (e.g., gaps can be introduced in one or both of a
first and a
second amino acid or nucleic acid sequence for optimal alignment and non-
homologous
sequences can be disregarded for comparison purposes). In a preferred
embodiment, at
least 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the length of a
reference
sequence is aligned for comparison purposes. The amino acid residues or
nucleotides at
corresponding amino acid positions or nucleotide positions are then compared.
When a
position in the first sequence is occupied by the same amino acid residue or
nucleotide as
the corresponding position in the second sequence, then the molecules are
identical at that
position (as used herein, amino acid or nucleic acid "identity" is equivalent
to amino acid
or nucleic acid "homology"). The percent identity between the two sequences is
a
function of the number of identical positions shared by the sequences, taking
into account
the number of gaps, and the length of each gap, which need to be introduced
for optimal
alignment of the two sequences.
The comparison of sequences and determination of percent identity between two
sequences can be accomplished using a mathematical algorithm. (Computational
Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988;
Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic
Press, New
York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A.M., and
Griffin, H.G.,
33
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology,
von
q, Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and
. Devereux, J., eds., M Stockton Press, New York, 1991). In a preferred
embodiment, the
percent identity between two amino acid sequences is determined using the
Needleman
and Wunsch algorithm (J. Mol. Biol. (48)All /53 (1970)) which has been
incorporated .
= into the GAP program in the GCG software package, using either a Blossom
62 matrix or
= a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a
length weight of 1, =
= 2, 3,' 4, 5, or 6.
= = In yet another preferred embodiment, the percent identity between
two nucleotide
sequences is determined using the GAP program in the GCG software package =
=(Devereux, J., et al., Nucleic Acids Res. 12(1):387 (1984)), using a
NWSgapdna.CMP
matrix and a gap weight of 40,50, 60,70, or 80 and a length weight of 1, 2, 3,
4, 5, or 6.
In another embodiment, the percent identity between two amino acid or
nucleotide
sequences is -determined using the algorithm of E. Myers and W. Miller
(CABIOS, 4:11- = =
17 (1989)) which has been incorporated into the ALIGN program (version 2.0),
using a
PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of
4.
The nucleotide and amino acid sequences of the present invention can further
be
used as a "query sequence" to perform a search against sequence databases to,
for
example, identify other family members or related sequences. Such searches can
be :
performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et
al. (J.
MoL Biol. 215:403-10 (1990)). BLAST nucleotide searches can be performed with
the
NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences
homologous to the nucleic acid molecules of the invention. BLAST protein
searches can
be performed with the XBLAST program, score = 50, wordlength =3 to obtain
amino =
acid sequences homologous to the proteins of the invention. To obtain gapped
alignments for comparison purposes, Gapped BLAST can be utilized as described
in
Altschul et al. (Nucleic Acids Res. 25(17):3389-3402 (1997)). When utilizing
BLAST
and gapped BLAST programs, the default parameters of the respective programs
(e.g.,
XBLAST and NBLAST) can be used. In 'addition to BLAST, examples of other
search
and sequence comparison programs used in the art include, but are not limited
to, FASTA
(Pearson, Methods MoL Biol. 25, 365-389 (1994)) and KERR (Dufresne et al., Nat
34
=
CA 02826522 2014-01-22
Biotechnol 2002 Dec;20(12):1269-71). For further information regarding
bioinformatics
techniques, see Current Protocols in Bioinfbrmatics., John Wiley & Sons, Inc.,
N.Y.
The present invention further provides non-coding fragments of the nucleic
acid
molecules disclosed in Table 1 and/or Table 2. Preferred non-coding fragments
include, but are
not limited to, promoter sequences, enhancer sequences, intronic sequences, 5'
untranslated
regions (UTRs), 3' untranslated regions, gene modulating sequences and gene
termination
sequences. Such fragments are useful, for example, in controlling heterologous
gene
expression and in developing screens to identify gene-modulating agents.
SNP Detection Reagents
In a specific aspect of the present invention, the SNPs disclosed in Table 1
and/or Table 2,
and their associated transcript sequences (provided in Table 1 as SEQ ID NOS:1-
14), genomic
sequences (provided in Table 2 as SEQ ID NOS:43-50), and context sequences
(transcript-based
context sequences are provided in Table 1 as SEQ ID NOS:29-42; genomic-based
context
sequences are provided in Table 2 as SEQ ID NOS:51-58), can be used for the
design of SNP
detection reagents. As used herein, a "SNP detection reagent" is a reagent
that specifically detects
a specific target SNP position disclosed herein, and that is preferably
specific for a particular
nucleotide (allele) of the target SNP position (i.e., the detection reagent
preferably can differentiate
between different alternative nucleotides at a target SNP position, thereby
allowing the identity of
the nucleotide present at the target SNP position to be determined).
Typically, such detection
reagent hybridizes to a target SNP-containing nucleic acid molecule by
complementary base-
pairing in a sequence specific manner, and discriminates the target variant
sequence from other
nucleic acid sequences such as an art-known form in a test sample. An example
of a detection
reagent is a probe that hybridizes to a target nucleic acid containing one or
more of the SNPs
provided in Table 1 and/or Table 2. In a preferred embodiment, such a probe
can differentiate
between nucleic acids having a particular nucleotide (allele) at a target SNP
position from other
nucleic acids that have a different nucleotide at the same target SNP
position. In addition, a
detection reagent may hybridize to a specific region 5' and/or 3' to a SNP
position, particularly a
region corresponding to the context sequences
CA 02826522 2014-01-22
provided in Table 1 as SEQ ID NOS:29-42; genomic-based context sequences are
provided in
Table 2 as SEQ ID NOS:51-58). Another example of a detection reagent is a
primer which acts as
an initiation point of nucleotide extension along a complementary strand of a
target
polynucleotide. The SNP sequence information provided herein is also useful
for designing
primers, e.g allele-specific primers, to amplify (e.g, using PCR) any SNP of
the present
invention.
In one preferred embodiment of the invention, a SNP detection reagent is an
isolated or
synthetic DNA or RNA polynucleotide probe or primer or PNA oligomer, or a
combination of
DNA, RNA and/or PNA, that hybridizes to a segment of a target nucleic acid
molecule
containing a SNP identified in Table 1 and/or Table 2. A detection reagent in
the form of a
polynucleotide may optionally contain modified base analogs, intercalators or
minor groove
binders. Multiple detection reagents such as probes may be, for example,
affixed to a solid
support (e.g., arrays or beads) or supplied in solution (e.g., probe/primer
sets for enzymatic
reactions such as PCR, RT-PCR, TaqMan assays, or primer-extension reactions)
to form a SNP
detection kit.
A probe or primer typically is a substantially purified oligonucleotide or PNA
oligomer.
Such oligonucleotide typically comprises a region of complementary nucleotide
sequence that
hybridizes under stringent conditions to at least about 8, 10, 12, 16, 18, 20,
22, 25, 30, 40, 50, 55,
60, 65, 70, 80, 90, 100, 120 (or any other number in-between) or more
consecutive nucleotides in
a target nucleic acid molecule. Depending on the particular assay, the
consecutive nucleotides can
either include the target SNP position, or be a specific region in close
enough proximity 5' and/or
3' to the SNP position to carry out the desired assay.
Other preferred primer and probe sequences can readily be determined using the
transcript sequences (SEQ ID NOS:1-14), genomic sequences (SEQ ID NOS:43-50),
and SNP
context sequences (transcript-based context sequences are provided in Table 1
as SEQ ID NOS:
29-42; genomic-based context sequences are provided in Table 2 as SEQ ID
NOS:51-58)
disclosed in the Sequence Listing and in Tables 1-2. It will be apparent to
one of skill in the art
that such primers and probes are directly useful
36
CA 02826522 2013-08-13
WO 2005/111241 PCT/1JS2005/016051
as reagents for genotyping the SNPs of the present invention, and can be
incorporated
into any kit/system format.
In order to produce a probe or primer specific for a target SNP-containing
sequence, the gene/transcript and/or context sequence surrounding the SNP of
interest is
typically examined using a computer algorithm which starts at the 5' or at the
3' end of
the nucleotide sequence. Typical algorithms will then identify oligomers of
defined
length that are unique to the gene/SNP context sequence, have a GC content
within a
range suitable for hybridization, lack predicted secondary structure that may
interfere =
with hybridization, and/or possess other desired characteristics or that lack
other
undesired characteristics.
A primer or probe of the present invention is typically at least about 8
nucleotides =
in length. In one embodiment of the invention, a primer or a probe is at least
about 10
nucleotides in length. In a preferred embodiment, a prinier or a probe is at
least about 12
nucleotides in length. In a more preferred embodiment, a primer or probe is at
least about
16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. While the
maximal length
of a probe can be as long as the target sequence to be detected, depending on
the type of
assay in which it is employed, it is typically less than about 50, 60, 65, or
70 nucleotides
in length. In the case of a primer, it is typically less than about 30
nucleotides in length.
In a specific preferred embodiment of the invention, a primer or a probe is
within the
length of about 18 and about 28 nucleotides. However, in other embodiments,
such as -
nucleic acid arrays and other embodiments in which probes are affixed to a
substrate, the
probes can be longer, such as on the order of 30-70, 75, 80, 90, 100, or more
nucleotides
in length (see the section below entitled "SNP Detection Kits and Systems").
For analyzing SNPs, it may be appropriate to use oligonucleotides specific for
alternative SNP alleles. Such oligonucleotides which detect single nucleotide
variations in
target sequences may be referred to by such terms as "allele-specific
oligonucleotides",
"allele-specific probes", or "allele-specific primers". The design and use of
allele-specific
probes for analyzing polymoiphisms is described in, e.g., Mutation Detection A
Practical -
Approach, ed. Cotton et al. Oxford University Press, 1998; Saiki et al.,
Nature 324, 163-
166 (1986); Dattagupta, E2235,726; and Saiki, WO 89/11548.
37
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
While the design of each allele-specific primer or probe depends on variables
' such as the precise composition of the nucleotide sequences flanking a
SNP position in a
target nucleic acid molecule, and the length of the primer or probe, another
factor in the
use of primers and probes is the stringency of the condition under which the
hybridization
between the probe or primer and the target sequence is performed. Higher
stringency
conditions utilize buffers with lower ionic strength and/or a higher reaction
temperature,
and tend to require a more perfect match between probe/primer and a target
sequence in
order to form a stable duplex. If the stringency is too high, however,
hybridization may
not occur at all. In contrast, lower stringency conditions utilize buffers
with higher ionic
strength and/or a lower reaction temperature, and permit the formation of
stable duplexes -
with more mismatched bases between a probe/primer and a target sequence. By
way of = .
example and not limitation, exemplary conditions for high stringency
hybridization =
=
conditions using an allele-specific probe are as follows: Prehybridization
with a solution
containing 5X standard saline phosphate EDTA (SSPE), 0.5% NaDodSO4 (SDS) at 55
C,
and incubating probe with target nucleic acid molecules in the same.solution
at-the same
temperature, followed by washing with a sOlution containing 2X SSPE, and
0.1%SDS at =
55 C or room temperature. =
= Moderate stringency hybridization conditions may be used for allele-
specific
= primer extension reactions with a solution containing, e.g., about 50mM
KCI at about
46 C. Alternatively, the reaction may be carried out at an elevated
temperature such as
= 60 C. In another embodiment, a moderately stringent hybridization
condition suitable for
oligonucleotide ligation assay (OLA) reactions wherein two probes are ligated
if they are
completely complementary to the target sequence may utilize a solution of
about 100mM
KC1 at a temperature of 46 C.
In a hybridization-based assay, allele-specific probes can be designed that
= hybridize to a segment of target DNA from one individual but do not
hybridize to the
corresponding segment from another individual due to the presence of different
polymorphic forms (e.g., alternative SNP alleles/nucleotides) in the
respective DNA :
segments from the two individuals. Hybridization conditions should be
sufficiently
stringent that there is a significant detectable difference in hybridization
intensity
between alleles, and preferably an essentially binary response, whereby a
probe
38
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
hybridizes to only one of the alleles or significantly more strongly to one
allele. While a
probe may be designed to hybridize to a target sequence that contains a SNP
site such
that the SNP site aligns anywhere along the sequence of the probe, the probe
is preferably
designed to hybridize to a segment of the target sequence such that the SNP
site aligns
with a central position of the probe (e.g., a position within the probe that
is at least three
nucleotides from either end of the probe). This design of probe generally
achieves good
discrimination in hybridization between different allelic forms.
In another embodiment, a probe or primer may be designed to hybridize to a
segment of target DNA such that the SNP aligns with either the 5' most end or
the 3'
.10 most end of the probe or primer. In a specific preferred embodiment
which is particularly
suitable for use in a oligonucleotide ligation assay (U.S. Patent No.
4,988,617), the
3'most nucleotide of the probe aligns witlythe SNP position in the target
sequence.
Oligonucleotide probes and primers may be prepared by methods well known in
the art. Chemical synthetic methods include, but are 'limited to, the
phosphotriester
15. method described by Narang et al., 1979, Methods in Enzymology 68:90;
the
phosphodiester method described by Brown et al., 1979, Methods in Enzymology
68:109, the diethylphosphoamidate method described by Beaucage et aL, 1981,
Tetrahedron Letters 22:1859; and the solid support method described in U.S.
Patent No.
4,458,066.
20 Allele-specific probes are often used in pairs (or, less commonly,
in sets of 3 or 4,
such as if a SNP position is known to have 3 or 4 alleles, respectively, or to
assay both
strands of a nucleic acid molecule for a target SNP allele), and such pairs
may be identical
except for a one nucleotide mismatch that represents the allelic variants at
the SNP position.
Commonly, one member of a pair perfectly matches a reference form of a target
sequence
25 that has a more common SNP allele (i.e., the allele that is more
frequent in the target =
population) and the other member of the pair perfectly matches a form of the
target
sequence that has a less common SNP allele (i.e., the allele that is rarer in
the target
population). In the case of an array, multiple pairs of probes can be
immobilized on the
same support for simultaneous analysis of multiple different polymorphisms.
30 In one type of PCR-based assay, an allele-specific primer hybridizes
to a region
on a target nucleic acid molecule that overlaps a SNP position and only primes
39
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
amplification of an allelic form to which the primer exhibits perfect
complementarity
= , (Gibbs, 1989, Nucleic Acid Res. 17 2427-2448). Typically, the
primer's 3'-most
nucleotide is aligned with and complementary to the SNP position of the target
nucleic
acid molecule. This primer is used in conjunction with a second primer that
hybridizes at
a distal site. Amplification proceeds from the two primers, producing a
detectable
product that indicates which allelic form is present in the test sample. A
control is
usually performed with a second pair of primers, one of which shows a single
base
= mismatch at the polymorphic site and the other of which exhibits perfect
.
=
complementarity to a distal site. The single-base mismatch prevents
amplification or= =
substantially reduces amplification efficiency, so that either no detectable
product is
= . formed or it is formed in lower amounts or at a slower pace. The method
generally works
= most effectively when the mismatch is at the 3'-most position of the
oligonucleotide (i.e.,
the 3'-most position of the oligonucleotide aligns with the target SNP
position) because
this position is most destabilizing to elongation from the primer (see, e.g.,
WO
93/22456). This PCR-based assay can be utilized as part of the TaqMan assay,
described
= below.
= In a specific embodiment of the invention, a primer of the invention
contains a
= sequence substantially complementary to a-segment of a target SNP-
containing nucleic acid
molecule except that the primer has a mismatched nucleotide in one of the
three nucleotide
positions at the 3'-most end of the primer, such that the mismatched
nucleotide does not
base pair with a particular allele at the SNP site. In a preferred embodiment,
the
mismatched nucleotide in the primer is the second from the last nucleotide at
the 3'-most
= position of the primer. In a more preferred embodiment, the mismatched
nucleotide in the
= primer is the last nucleotide at the 3'-most position of the primer.
In another embodiment of the invention, a SNP detection reagent of the
invention is
labeled with a fluorogenic reporter dye that emits a detectable signal. While
the preferred
reporter dye is a fluorescent dye, any reporter dye that can be attached to a
detection reagent
such as an oligonucleotide probe or primer is suitable for use in the
invention. Such dyes
include, but are not limited to, Acridine, AMCA, BODIPY, Cascade Blue, Cy2,
Cy3, Cy5,
Cy7, Dabcyl, Edans, Eosin, Erythrosin, Fluorescein, 6-Fara, Tet, Joe, Hex,
Oregon Green,
RhodRmine, Rhodol Green, Tamra, Rox, and Texas Red.
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
In yet another embodiment of the invention, the detection reagent may be
further
' 'labeled with a quencher dye such as Tamra, especially when the reagent
is used as a self-
quenching probe such as a TaqMan (U.S. Patent Nos. 5,210,015 and 5,538,848) or
Molecular Beacon probe (U.S. Patent Nos. 5,118,801 and 5,312728), or other
stemless or
linear beacon probe (Livak et al., 1995, PCR Method Appl. 4:357-362; Tyagi et
al., 1996, ..
Nature Biotechnology 14: 303-308; Nazarenko et al., 1997, Nucl. Acids Res.
25:2516-2521;
U.S. Patent Nos. 5,866,336 and 6,117,635). =
The detection reagents of the invention may also contain other labels,
including but
not limited to, biotin for streptavidin binding, hapten for antibody binding,
and =
1.0
oligonucleotide for binding to another complementary oligonucle,otide such as
pairs of =
= zipcodes.
The present invention also contemplates reagents that do not contain
(or that are complementary to) a SNP nucleotide identified herein but that
= are
used to assay one or more SNPs disclosed herein. For example, primers =
= 15 that flank, but do not hybridize directly to a target SNP position
provided
herein are useful in primer extension reactions in which the primers
hybridize to a region adjacent to the target SNP position (i.e., within one or
more nucleotides from the target SNP site). During the primer extension
reaction, a primer is typically not able to extend past a target SNP site if a
20 particular nucleotide (allele) is present at that target SNP site, and
the
primer extension product can be detected in order to determine which SNP
allele is present at the target SNP site. For example, particular ddl\TTPs are
typically used in the primer extension reaction to terminate primer extension
once a ddNTP is incorporated into the extension product (a primer extension
25 product which includes a ddNTP at the 3'-most end of the primer
extension
product, and in which the ddNTP is a nucleotide of a SNP disclosed herein, is
a composition that is specifically contemplated by the present invention).
Thus, reagents that bind to a nucleic acid molecule in a region adjacent to a
SNP site and =
that are used for assaying the SNP site, even though the bound sequences do
not necessarily
30 include the SNP site itself, are also contemplated by the present
invention.
41
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
SNP Detection,Kits and Systems
A person skilled in the art will recognize that, based on the SNP and
associated
sequence information disclosed herein, detection reagents can be developed and
used to
assay any SNP of the present invention individually or in combination, and
such
detection reagents can be readily incorporated into one of the established kit
or system
formats which are well known in the art. The terms "kits" and "systems", as
used herein .
in the context of SNP detection reagents, are intended to refer to such things
as .
combinations of multiple SNP detection reagents, or one or more SNP detection
reagents
in combination with one or more other types of elements or components (e.g.,
other types =
of biochemical reagents, containers, packages such as packaging intended for
commercial .
= sale, substrates to which SNP detection reagents are attached, electronic
hardware
= components, etc.). Accordingly, the present invention further provides
SNP detection
kits and systems, including but not limited to, packaged probe and primer sets
(e.g., =
- 15 TaqMan probe/primer sets), arrays/microarrays of nucleic acid
molecules, and beads that
contain one or more probes, primers, or other detection reagents for detecting
one or
more SNPs of the present invention. The kits/systems can optionally include
various =
electronic hardware cornponents; for example, arrays ("DNA chips") and
microfluidic
systems ("lab-on-a-chip" systems) provided by various manufacturers typically
comprise
hardware components. Other kits/systems (e.g., probe/primer sets) may not
include:
electronic hardware components, but may be comprised of, for example, one or
more.
SNP detection reagents (along with, optionally, other biochemical reagents)
packaged in
one or more containers.
In some embodiments, a SNP detection kit typically contains one or more
detection reagents and other components (e.g., a buffer, enzymes such as DNA
polymerases or ligases, chain extension nucleotides such as deoxynucleotide
triphosphates, and in the case of Sanger-type DNA sequencing reactions, chain
= terminating nucleotides, positive control sequences, negative control
sequences, and the
like) necessary to carry out an assay or reaction, such as amplification
and/or detection of
a SNP-containing nucleic acid molecule. A kit may further contain means for
determining the amount of a target nucleic acid, and means for comparing the
amount
42
CA 02826522 2015-11-24
=
with a standard, and can comprise instructions for using the kit to detect the
SNP-
.
' containing nucleic acid molecule of interest. In one embodiment of the
present invention,
kits are provided which contain the necessary reagents to carry out one or
more assays to
detect one or more SNPs disclosed herein. In a preferred embodiment of the-
present
invention, SNP detection kits/systems are in the form of nucleic acid arrays,
or
,
compartmentaiized kits, including microfluidic/lab-on-a-chip systems.
SNP detection kits/systems may contain, for example, one or more probes, or
pairs of probes, that hybridize to a nucleic acid molecule at or near each
target SNP
position. Multiple pairs of allele-specific probes may be included in the
kit/system to
simultaneously assay large numbers of SNPs, at least one of which is a SNP-of
the
present invention. In some kits/systems, the allele-specific probes are
immobilized to a
substrate such as an array or bead. For example, the same substrate can
comprise allele-
specific probes for detecting at least 1; 10; 100; 1000; 10,000; 100,000 (or
any other =
number in-between) or substantially all of the SNPs shown in Table 1 and/or
Table Z.
The terms "arrays", "microarrays", and "DNA chips" are used herein
interchangeably to-refer to an array of distinct polynucleotides affixed to a
substrate, such as glass, plastic, paper, nylon or other type of membrane,
filter, chip, or any other suitable solid support. The polyn.ucleotides can be
synthesized directly on the substrate, or synthesized separate from the
substrate and then affixed to the substrate. In one embodiment, the
raicroarray is prepared and used according to the methods described in U.S.
Patent No. 5,837,832, Chee et al., PCT application W095/11995 (Chee et al.),
Lockhart, D. J. et al. (1996; Nat. Biotech. 14: 1675-1680) and Schena, M. et
al.
(1996; Proc. Natl. Acad. Sci. 93: 10614-10619)
. In other embodiments, such arrays are
produced by the methods described by Brown et al., U.S. Patent No.
5,807,522.
Nucleic acid arrays are reviewed in the following references:
Zamrnatteo et al., "New chips for molecular biology and diagnostics",
Biotechnol Annu Rev. 2002;8:85-101; Sosnowski et al., "Active microelectronic
43
CA 02826522 2013-08-13
WO 2005/111241
PCDES2005/016051
array system for DNA hybridization, genotyping and pharmacogenoraic
' applications", Psychiatr Genet. 2002 Dec;12(4):181-92; Heller, "DNA
microarray technology: devices, systems, and applications", Annu Rev Biomed
Eng. 2002;4:129-53. Epub 2002 Mar 22; Kolchinsky et al., "Analysis of SNPs
and other genoraic variations using gel-based chips", Hum Mutat. 2002
Apr;19(4):343-60; and McGall et al., "High-density genechip oligonucleotide
probe arrays", Adv Biochem Eng Biotechnol. 2002;77:21-42.
Any number of probes, such as allele-specific probes, may be
Implemented in an array, and each probe or pair of probes can hybridize to a
different SNP position. In the case of polynucleotide probes, they can be
synthesized at designated areas (or synthesized separately and then affixed to
designated areas) on a substrate using a light-directed chemical process. Each
DNA chip can contain, for example, thousands to millions of individual
synthetic pol3mucleotide probes arranged in a grid-like pattern and
miniaturized (e.g., to the size of a dime). Preferably, probes are attached to
a
solid support in an ordered, addressable array.
A microarray can be composed of a large number of unique, single-stranded
polynucleotides, usually either synthetic antisense polynucleotides or
fragments of
cDNAs, fixed to a solid support. Typical polynucleotides are preferably about
6-60 =
nucleotides in length, more preferably about 15-30 nucleotides M length, and
most
preferably about 18-25 nucleotides in length. For certain types of microarrays
or other
detection kits/systems, it may be preferable to use oligonucleotides that are
only about 7-
20 nucleotides in length. In other types of arrays, such as arrays used in
conjunction with
chemilumMescent detection technology, preferred probe lengths can be, for
example,
about 15-80 nucleotides in length, preferably about 50-70 nucleotides in
length, more
preferably about 55-65 nucleotides in length, and most preferably about 60
nucleotides in'
length. The microarray or detection kit can contain polynucleotides that cover
the known
5' or 3' sequence of a gene/transcript or target SNP site, sequential
polynucleotides that
cover the full-length sequence of a gene/transcript; or unique polynucleotides
selected
from particular areas along the length of a target gene/transcript sequence,
particularly
44
CA 02826522 2015-11-24
areas corresponding to one or more SNPs disclosed in Table 1 and/or Table 2.
. ' Polynucleotides used in the microarray or detection kit can be
specific to a SNP or SNPs
of interest (e.g., specific to a particular SNP allele at a target SNP site,
or specific to
particular SNP alleles at multiple different SNP sites), or specific to a
polymorphic
=
. 5 gene/transcript or gene/transcripts of interest.
Hybridization assays based on polynucleotide arrays rely on the
=
differences in hybridization stability of the probes to perfectly matched and
mismatched target sequence variants. For SNP genotyping, it is generally
preferable that stringency conditions used in hybridization assays are high
enough such that nucleic add molecules that differ from one another at as
little
as a single SNP position can be differentiated (e.g., typical SNP
hybridization
assays are designed so that hybridization will occur only if one particular
nucleotide is present at a SNP position, but will not occur if an. alternative
nucleotide is present at that SNP position). Such high stringency conditions
= 15 may be preferable when using, for example, nucleic acid arrays of
allele-specific
probes for SNP detection. Such high stringency conditions are described in the
preceding section, and are well known to those skilled in the art and can be
found in, for example, Current Protocols in Molecular Biology, John Wiley &
Sons, N.Y. (1989), 6.3.1-6.3.6.
In other embodiments, the arrays are used in conjunction with
chemilm-ninescent detection technology. The following patents and patent =
applications, , provide
additional
information pertaining to chemiluminescent detection: U.S. patent applications
10/620332 and 10/620333 describe chemiluminescent approaches for
microarray detection; U.S. Patent Nos. .6124478,6107024, 5994073, 5981768,
5871938, 5843681,5800999, and 5773628 describe methods and compositions
of dioxetane for performing chemiluminescent detection; and U.S. published
application US2002/0110828 discloses methods and compositions for
microarray controls.
CA 02826522 2015-11-24
In one embodiment of the invention, a nucleic acid array can comprise an array
of
probes of about 15-25 nucleotides in length. In further embodiments, a nucleic
acid array
can comprise any number of probes, in which at least one probe is capable of
detecting
one or more SNPs disclosed in Table 1 and/or Table 2, and/or at least one
probe
comprises a fragment of one of the sequences selected from the group
consisting of those
disclosed in Table 1, Table 2, the Sequence Listing, and sequences
complementary
thereto, said fragment comprising at least about 8 consecutive nucleotides,
preferably 10,
12, 15, 16, 18, 20, more preferably 22,25, 30, 40, 47, 50,55, 60, 65, 70, 80,
90, 100, or
' more consecutive nucleotides (or any other number in-between) and
containing (or being
complementary to) a novel SNP allele disclosed in Table 1 and/or Table 2. In,
some
embodiments, the nucleotide complementary to the SNP site is within 5, 4, 3,
2, or 1 '
nucleotide from the center of the probe, more preferably at the center of said
probe.
A polynucleotide probe can be synthesized on the surface of the substrate by
using a
chemical coupling procedure and an ink jet application apparatus, as described
in PCT
application W095/251116 (Baldeschweiler et al.)
. In another aspect, a "gridded" array analogous to a dot (or slot) blot may
be
used to arrange and link cIINA fragments or oligonucleotides to the surface of
a substrate
using a vacuum system, thermal, UV, mechanical or chemical bonding procedures.
An
array, such as those described above, may be produced by hand or by using
available
devices (slot blot or dot blot apparatus), materials (any suitable solid
support), and machines
(including robotic instruments), and may contain 8,24, 96, 384, 1536, 6144 or
more
polynucleotides, or any other number which lends itself to the efficient use
of commercially
available instrumentation.
Using such arrays or other kits/systems, the present invention provides
methods of
identifying the SNPs disclosed herein in a test sample. Such methods typically
involve
incubating a test sample of nucleic acids with an array comprising one or more
probes
corresponding to at least one SNP position of the present invention, and
assaying for binding
of a nucleic acid from the test sample with one or more of the probes.
Conditions for
incubating a SNP detection reagent (or a kit/system that employs one or more
such SNP
detection reagents) with a test sample vary. Incubation conditions depend on
such factors as
the format employed in the assay, the detection methods employed, and the type
and nature
46
=
CA 02826522 2015-11-24
of the detection reagents used in the assay. One skilled in the art will
recognize that any one
of the cdmmonly available hybridization, amplification and array assay formats
can readily
be adapted to detect the SNPs disclosed herein.
A SNP detection kit/system of the present invention may include
components that are used to prepare nucleic acids from a test sample for the
subsequent amplification and/or detection of a SNP-containi-ng nucleic acid
molecule. Such sample preparation compiments can be used to produce
nucleic acid extracts (including DNA and/or RNA), proteins or membrane
extracts from any bodily fluids (such as blood, serum, plasma, urine, saliva,
phlegm, gastric juices, semen, tears, sweat, etc.), skin, hair, cells
(especially
nucleated cells), biopsies, buccal swabs or tissue specimens. The test samples
used in the above-described methods will vary based on such factors as the
assay format, nature of the detection method, and the specific tissues, cells
or
extracts used as the test sample to be assayed. Methods of preparing nucleic
acids, proteins, and cell extracts are well known in. the art and can be
readily
adapted to obtain a sample that is compatible with the system utilized.
Automated sample preparation systems for extracting nucleic acids from a
test sample are commercially available, and examples are Qiagen's BioRobot
9600, Applied Biosystems' PIPW14 6700 sample preparation system, and
TM
Roche Molecular Systems' COBAS AmpliPrep System.
Another form of kit contemplated by the present invention is a
compartmentalized
kit. A compartmentalized kit includes any kit in which reagents are contained
in separate
=
containers. Such containers include, for example, small glass containers,
plastic
containers, strips of plastic, glass or paper, or arraying material such as
silica. Such
containers allow one to efficiently transfer reagents from one compartment to
another
compartment such that the test samples and reagents are not cross-
contaminated, or from
one container to another vessel not included in the kit, and the agents or
solutions of each
container can be added in a quantitative fashion from one compartment to
another or to
another vessel. Such containers may include, for example, one or more
containers which
will accept the test sample, one or more containers which contain at least one
probe or
47
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
other SNP detection reagent for detecting one or more SNPs of the present
invention, one
' or rabee containers which contain wash reagents (such as phosphate
buffered saline, Tris-
buffers, etc.), and one or more containers which contain the reagents used to
reveal the
presence of the bound probe or other SNP detection reagents. The kit can
optionally
further comprise compartments and/or reagents for, for example, nucleic acid
amplification
or other enzymatic reactions such as primer extension reactions,
hybridization, ligation,
electrophoresis (preferably capillary electrophoresis), mass spectrometry,
and/or laser-
induced fluorescent detection. The kit may also include instructions for using
the kit.
,. Exemplary compartmentalized kits include microfluidic devices known in the
art (see, e.g.,
Weigl et at., "Lab-on-a-chip for drug development", Adv Drug Deliv Rev. 2003
Feb
24;55(3):349-77). In such microfluidic devices, the containers may be referred
to as, for
example, microfluidic "compartments", "chambers", or "channels".
Microfluidic devices, which may also be referred to as "lab-on-a-chip"
systems, biomedical micro-electro-mechanical systems (bioMEMs), or
multicomponent integrated systems, are exemplary kits/systems of the
present invention for analyzing SNPs. Such systems miniaturize and
compartmentalize processes such as probe/target hybridization, nucleic acid
amplification, and capillary electrophoresis reactions in a single functional
device. Such microfluidic devices typically utilize detection reagents in at
least one aspect of the system, and such detection reagents may be used to
detect one or more SNPs of the present invention. One example of a
microfluidic system is disclosed in U.S. Patent No. 5,589,136, which describes
the integration of POE amplification and capillary electrophoresis in chips.
Exemplary microfluidic systems comprise a pattern of microchannels
designed onto a glass, silicon, quartz, or plastic wafer included on. a
microchip. The movements of the samples may be controlled by electric,
electroosmotic or hydrostatic forces applied across different areas of the
microchip to create functional microscopic valves and pumps with no moving
parts. Varying the voltage can be used as a means to control the liquid flow
at intersections between the micro-machined channels and to change the
48
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
liquid flow rate for pumping across different sections of the microchip. See,
' for dxample, U.S. Patent Nos. 6,153,073, Dubrow et al., and 6,156,181, Parce
et al.
For genotyping SNPs, an exemplary raicrofluidic system may integrate, for
example, nucleic acid amplification, primer extension, capillary
electrophoresis, and a =
detection method such as laser induced fluorescence detection. In a first step
of an
exemplary process for using such an exemplary system, nucleic acid samples are
amplified, preferably by PCR. Then, the amplification products are subjected
to
automated primer extension reactions using ddNTPs (specific fluorescence for
each
ddNTP) and the appropriate oligonucleotide primers to carry out primer
extension
reactions which hybridize just upstream of the targeted SNP. Once the
extension at the 3'
end is completed, the primers are separated from the unincorporated
fluorescent ddNTPs
by capillary electrophoresis. The separation medium used in capillary
electrophoresis
can be, for example, polyacrylamide, polyethyleneglycol or dextran. The
incorporated
ddNTPs in the single nucleotide primer extension products are identified by
laser-induced =
fluorescence detection. Such an exemplary microchip can be used to process,
for
example, at least 96 to 384 samples, or more, in parallel.
USES OF NUCLEIC ACID MOLECULES
The nucleic acid molecules of the present invention have a variety of uses,
especially
in the diagnosis and treatment of liver fibrosis and related pathologies. For
example, the
nucleic acid molecules are useful as hybridization probes, such as for
genotyping SNPs in
messenger RNA, transcript, cDNA, genomic DNA, amplified DNA or other nucleic
acid
molecules, and for isolating full-lengtb cDNA and genomic clones encoding the
variant
peptides disclosed in Table 1 as well as their orthologs.
A probe can hybridize to any nucleotide sequence along the entire length of a
nucleic acid molecule provided in Table 1 and/or Table 2. Preferably, a probe
of the present
invention hybridizes to a region of a target sequence that encompasses a SNP
position
indicated in Table 1 and/or Table 2. More preferably, a probe hybridizes to a
SNP-
containing target sequence in a sequence-specific manner such that it
distinguishes the target
sequence from other nucleotide sequences which vary from the target sequence
only by
49
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
which nucleotide is present at the SNP site. Such a probe is particularly
useful for detecting
1
the presenCe of a SNP-containing nucleic acid in a test sample, or for
determining which
nucleotide (allele) is present at a particular SNP site (i.e., genotyping the
SNP site).
A nucleic acid hybridization probe may be used for determining the presence,
level, form, and/or distribution of nucleic acid expression. The nucleic acid
whose level
is determined can be DNA or RNA. Accordingly, probes specific for the SNPs
described
herein can be used to assess the presence, expression and/or gene copy number
in a given
õ cell, tissue, or organism. These uses are relevant for diagnosis of
disorders involving an. .
increase or decrease in gene expression relative to normal levels. In vitro
techniques for =
detection of mRNA include, for example, Northern blot hybridizations and in
situ
hybridizations. In vitro techniques for detecting DNA include Southern blot
hybridizations and in situ hybridizations (Sambrook and Russell, 2000,
Molecular.
= Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring
Harbor, NY).
Probes can be used as part of a diagnostic test kit for identifying cells or
tissues in .
which a variant protein is expressed, such as by measuring the level of a
variant protein- = ,
encoding nucleic acid (e.g., mRNA) in a sample of cells from a subject or
determining if a
polynucleotide contains a SNP of interest.
Thus, the nucleic acid molecules of the invention can be used as hybridization
probes to detect the SNPs disclosed herein, thereby determining whether an
individual
with the polymorphisms is at risk for liver fibrosis and related pathologies
or has
developed early stage liver fibrosis. Detection of a SNP associated with a
disease
phenotype provides a diagnostic tool for an active disease and/or genetic
predisposition to =
the disease.
Furthermore, the nucleic acid molecules of the invention are therefore useful
for
detecting a gene (gene information is disclosed in Table 2, for example) which
contains a
SNP disclosed herein and/or products of such genes, such as expressed raRNA
transcript
molecules (transcript information is disclosed in Table 1, for example), and
are thus
useful for detecting gene expression. The nucleic acid molecules can
optionally be
implemented in, for example, an array or kit format for use in detecting gene
expression.
CA 02826522 2013-08-13
WO 2005/111241
PCT/1JS2005/016051
The nucleic acid molecules of the invention are also useful as primers to
amplify any
given region of a nucleic acid molecule, particularly a region containing a
SNP identified in
Table 1 and/or Table 2.
The nucleic acid molecules of the invention are also useful for constructing
recombinant vectors (described in greater detail below). Such vectors include
expression
vectors that express a portion of, or all of, any of the variant peptide
sequences provided in
Table. I. Vectors also include insertion vectors, used to integrate into
another nucleic acid
molecule sequence, such as into the cellular genome, to alter in situ
expression of a gene
and/or gene product. For example, an endogenous coding sequence can be
replaced via .
homologous recombination with all or part of the coding region containing one
or more
specifically introduced SNPs.
The nucleic acid molecules of the invention are also useful for
= expressing antigenic portions of the variant proteins, particularly
antigenic
portions that contain a variant amino acid sequence (e.g., an.amino acid
15- = substitution) caused by a SNP disclosed in Table 1 and/or Table 2. .
" The nucleic acid molecules of the invention are also useful for
constructing vectors
containing a gene regulatory region of the nucleic acid molecules of the
present invention.
The nucleic acid molecules of the invention are also useful for designing
ribozymes
corresponding to all, or a part, of an mRNA molecule expressed from a SNP-
containing = =
nucleic acid molecule described herein.
= The nucleic acid molecules of the invention are also useful for
constructing host
cells expressing a part, or all, of the nucleic acid molecules and valiant
peptides.
The nucleic acid molecules of the invention are also useful for constructing
transgenic animals expressing all, or a part, of the nucleic acid molecules
and variant
peptides. The production of recombinant cells and transgenic animals having
nucleic acid molecules which contain the SNPs disclosed in Table 1 and/or =
Table 2 allow, for example, effective clinical design of treatment compounds
and
dosage regimens.
The nucleic acid molecules of the invention are also useful in assays for
drug screening to identify compounds that, for example, modulate nucleic
acid expression.
51
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
=
The nucleic acid molecules of the invention are also useful in gene therapy in
Patientslvihose cells have aberrant gene expression. Thus, recombinant cells,
which
include a patient's cells that have been engineered ex vivo and returned to
the patient, can
= be introduced into an individual where the recombinant cells produce the
desired protein
= to treat the individual.
r4 SNP Genotvping Methods
The process of determining which specific nucleotide (Le., allele) is present
at each
. of one or more SNP positions, such as a SNP position in a nucleic acid
molecule disclosed
in Table 1 and/or Table 2, is referred to as SNP genotyping. The present
invention provides
methods of SNP genotyping, such as for use in screening for liver fibrosis or
related
pathologies, or determining predisposition thereto, or determining
responsiveness to a form
of .treatment, or in genome mapping or SNP association analysis, etc. }
Nucleic acid samples can be genotyped to determine which allele(s) is/are
present
: 15 at any given genetic region (e.g., SNP position) of interest by
methods well known in the
art. The neighboring sequence can be used to design SNP detection reagents
such as
oligonucleotide probes, which may optionally be implemented in a kit format.
Exemplary.
SNP genotyping methods are described in Chen et al., "Single nucleotide
polymorphism
genotyping: biochemistry, protocol, cost and throughput", Pharmacogenomica.
=
2003;3(2):77-96; Kwok et al., "Detection of single nucleotide polymorphisms",
Curr Issues
Mol Biol. 2003 Apr;5(2):43-60; Sin, "Technologies for individual genotyping:.
detection of
genetic polymorphisms in drug targets and disease genes", Am J
Pharmacogenomics.
20022(3):197-205; and Kwok, "Methods for genotyping single nucleotide
polymorphisms",
. Annu Rev Genomics Hum Genet 2001;2:235-58. Exemplary techniques for high-
throughput
SNP genotyping are described in Marnellos, "High-throughput SNP analysis for
genetic
association studies", Cum Opin Drug Discov Devel. 2003 May;6(3):317-21. Common
SNP
genotyping methods include, but are not limited to, TaqMan,assays, molecular
beacon
assays, nucleic acid arrays, allele-specific primer extension, allele-specific
PCR, arrayed
primer extension, homogeneous primer extension assays, primer extension with
detection by
mass spectrometry, pyrosequencing, multiplex primer extension sorted on
genetic arrays,
ligation with rolling circle amplification, homogeneous ligation, OLA (US.
Patent No.
52
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
4,988,167), multiplex ligation reaction sorted on genetic arrays, restriction-
fragment length
' polyhaorphism, single base extension-tag assays, and the Invader
assay. Such methods may
be used in combination with detection mechanisms such as, for example,
luminescence or
chemiluminescence detection, fluorescence detection, time-resolved
fluorescence detection,
fluorescence resonance energy transfer, fluorescence polarization, mass
spectrometry, and
electrical detection.
Various methods for detecting polymorphisms include, but are not limited to,
methods in which protection from cleavage agents is used to detect mismatched
bases in.
RNA/RNA or RNA/DNA duplexes (Myers et al., Science 230:1242 (1985); Cotton et
al.,
PNAS 85:4397 (1988); and Saleeba et al., Meth. EnzyrnoL 217:286-295 (1992)),
comparison
of the electrophoretic mobility of variant and wild type nucleic acid
molecules (Orita et al.,
PNAS 86:2766 (1989); Cotton et al., Mutat. Res. 285:125-144(1993); and Hayathi
et al.,
Genet. Anal. Tech. AppL 9:73-79 (1992)), and assaying the movement of
polymorphic or
wild-type fragments in polyacrylamide gels containing a gradient of denaturant
using
denaturing gradient gel electrophoresis (DOGE) (Myers et al., Nature 313:495
(1985)). =
Sequence variations at specific locations can also be assessed by nuclease
protection assays
.such as RNase and Si protection or chemical cleavage methods.
In a preferred embodiment, SNP genotyping is performed using the
TaqMan assay, which is also known as the 5' nuclease assay (U.S. Patent
Nos. 5,210,015 and 5,538,848). The TaqMan assay detects the accumulation
of a specific amplified product during PCR. The TaqMan assay utilizes an
= oligonucleotide probe labeled with a fluorescent reporter dye and a
quencher
= dye. The reporter dye is excited by irradiation at an appropriate
wavelength,
it transfers energy to the quencher dye in the same probe via a process called
fluorescence resonance energy transfer (FRET). When attached to the probe,
the excited reporter dye does not emit a signal. The proximity of the
quencher dye to the reporter dye in the intact probe maintains a reduced
fluorescence for the reporter. The reporter dye and quencher dye may be at
the 5' most and the 3' most ends, respectively, or vice versa. Alternatively,
the reporter dye may be at the 5' or 3' most end while the quencher dye is = =
attached to an internal nucleotide, or vice versa. In yet another embodiment,
53
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
both the reporter and the quencher may be attached to internal nucleotides
' at a distance from each other such that fluorescence of the reporter is
reduced.
During PCR, the 5' nuclease activity of DNA polymerase cleaves the =
probe, thereby separating the reporter dye and the quencher dye and
resulting in increased fluorescence of the reporter. Accumulation of PCR
product is detected directly by monitoring the increase in fluorescence of the
reporter dye. The DNA polymerase cleaves the probe between the reporter
dye and the quencher dye only if the probe hybridizes to the target SNP-
containing template which is amplified during PCR, and the probe is
designed to hybridize to the target SNP site only if a particular SNP allele
is
present.
Preferred TaqMan primer and probe sequences can readily be determined using
the SNP and associated nucleic acid sequence information provided herein. A
number of
computer programs, such as Primer Express (Applied Biosystems, Foster City,
CA), can =
be used to rapidly obtain optimal primer/probe sets. It will be apparent to
one of skill in
the art that such primers and probes for detecting the SNPs of the present
invention are
useful in diagnostic assays for liver fibrosis and related pathologies, and
can be readily
incorporated into a kit format. The present invention also includes
modifications of the
Taqman assay well known in the art such as the use of Molecular Beacon probes
(U.S.
Patent Nos. 5,118,801 and 5,312,728) and other variant formats (U.S. Patent
Nos.
5,866,336 and 6,117,635).
Another preferred method for genotyping the SNPs of the present invention is
the
use of two oligonucleotide probes in an OLA (see, e.g., U.S. Patent No.
4,988,617). lii.
this method, one probe hybridizes to a segment of a target nucleic acid with
its 3' most
end aligned with the SNP site. A second probe hybridizes to an adjacent
segment of the
target nucleic acid molecule directly 3' to the first probe. The two
juxtaposed probes
hybridize to the target nucleic acid molecule, and are ligated in the presence
of a linking
agent such as a ligase if there is perfect complementarily between the 3' most
nucleotide
of the first probe with the SNP site. If there is a mismatch, ligation would
not occur.
54
CA 02826522 2015-11-24
After the reaction, the ligated probes are separated from the target nucleic
acid molecule,
,
and Claected as indicators of the presence of a SNP.
TheH following patents, patent applications, and published international
patent
applications, provide additional
information pertaining to techniques for carrying out various types of OLA:
U.S. Patent
Nos. 6027889, 6268148, 5494810, 5830711, and 6054564 describe OLA strategies
for =
performing SNP detection; WO 97/31256 and WO 00/56927 describe OLA strategies
for
performing SNP detection using universal arrays, wherein a zipcode sequence
can be
introduced into one of the hybridization probes, and the resulting product, or
amplified
product, hybridized to a universal zip code array; U.S. application
US01/17329. (and
09/584,905) describes OLA (or LDR) followed by PCR, wherein zipcodes are
incorporated into OLA probes, and amplified PCR products are determined by
electrophoretic or universal zipcode array readout; U.S. applications
60/427818,
60/445636, and 60/445494 describe SNPlex methods and software for multiplexed
SNP
=
detection using OLA followed by PCR, wherein zipcodes are incorporated into
OLA
probes, and amplified PCR products are hybridized with a zipchute reagent, and
the
identity of the SNP determined from electrophoretic readout of the zipchute.
In some
embodiments, OLA is carried out prior to PCR (or another method of nucleic
acid
amplification). In other embodiments, PCR (or another method of nucleic acid
amplification) is carried out prior to OLA.
Another method for SNP genotyping is based on mass spectrometry. Mass
spectrometry takes advantage of the unique mass of each of the four
nucleotides of DNA.
SNPs can be unambiguously genotyped by mass spectrometry by measuring the
differences in the mass of nucleic acids having alternative SNP alleles. MALDI-
TOF
(Matrix Assisted Laser Desorption Ionization ¨ Time of Flight) mass
spectrometry
technology is preferred for extremely precise determinations of molecular
mass, such as
SNPs. Numerous approaches.to SNP analysis have been developed based on mass
spectrometry. Preferred mass spectrometry-based methods of SNP genotyping
include
primer extension assays, which can also be utilized in combination with other
approaches, such as traditional gel-based formats and microarrays.
=
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
Typically, the primer extension assay involves designing and annealing a
primer
' to a template PCR amplicon upstream (5') from a target SNP position. A
mix of
dideoxynucleotide triphosphates (ddNTPs) and/or deoxynucleotide tripbosphates
(dNTPs) are added to a reaction mixture containing template (e.g., a SNP-
containing
nucleic acid molecule which has typically been amplified, such as by PCR),
primer, and
DNA polymerase. Extension of the primer terminates at the first position in
the template -
where a nucleotide complementary to one of the ddNTPs in the mix occurs. The
primer
can be either immediately adjacent (i.e., the nucleotide at the 3' end of the
primer
. hybridizes to the nucleotide next to the target SNP site) or two or more
nucleotides
removed from the SNP position. If the primer is several nucleotides removed
from the
target SNP position, the only limitation is that the template sequence between
the 3' end
= of the primer and the SNP position cannot contain a nucleotide of the
same type as the 1
one to be detected, or this will cause premature termination of the extension
primer.
Alternatively, if all four ddNTPs alone, with no dNTPs, are added to the
reaction mixture,
- the primer will always be extended by only one nucleotide, corresponding to
the target
1
SNP position. In this instance, primers are designed to bind one nucleotide
upstream
= from the SNP position (i.e., the nucleotide at the 3' end of the primer
hybridizes to the .
= nucleotide that is immediately adjacent to the target SNP site on the 5'
side of the target
SNP site). Extension by only one nucleotide is preferable, as it minimizes the
overall
mass of the extended primer, thereby increasing the resolution of mass
differences
between alternative SNP nucleotides. Furthermore, mass-tagged ddNTPs can be
= employed in the primer extension reactions in place of unmodified ddNTPs.
This
increases the mass difference between primers extended with these ddNTPs,
thereby
providing increased sensitivity and accuracy, and is particularly useful for
typing
heterozygous base positions. Mass-tagging also alleviates the need for
intensive sample-:
preparation procedures and decreases the necessary resolving power of the mass
spectrometer.
The extended primers can then be purified and analyzed by MALDI-TOF mass
spectrometry to determine the identity of the nucleotide present at the target
SNP
position. In one method of analysis, the products from the primer extension
reaction are
combined with light absorbing crystals that form a matrix. The matrix is then
hit with an
56
CA 02826522 2013-08-13
WO 2005/111241 PCT/1JS2005/016051
- energy source such as a laser to ionize and desorb the nucleic acid
molecules into the gas=
-
'I phase.( The ionized molecules are then ejected into a flight tube and
accelerated down the
tube towards a detector. The time between the ionization event, such as a
laser pulse, and
collision of the molecule with the detector is the time of flight of that
molecule. The time
of flight is precisely correlated with the mass-to-charge ratio (m/z) of the
ionized
molecule. Ions with smaller m/z travel down the tube faster than ions with
larger m/z and
therefore the lighter ions reach the detector before the heavier ions. The
time-of-flight is
then converted into a corresponding, and highly precise, m/z. In this manner,
SNPs can
= be identified based on the slight differences in mass, and the
corresponding time of flight
differences, inherent in nucleic acid molecules having different nucleotides
at u.single
base position. For further information regarding the use of primer extension
assays in
conjunction with MALDI-TOF mass spectrometry for SNP genotyping, see, e.g.,
Wise et
=
at., "A standard protocol for single nucleotide primer extension in the human
genome
= using matrix-assisted laser desorption/ionization time-of-flight mass
spectrometry",
- 15 Rapid Commun Mass Spectrom. 2003;17(11):1195-202.
The following references provide further information describing mass
spectrometry-based methods for SNP genotyping: Bocker, "SNP and mutation
discovery
using base-specific cleavage and MALDI-TOF mass-spectrometry",
Bioinfornu2tics. 2003
Jul;19 Suppl 1:144-153; Storm et at., "MALDI-TOF mass spectrometry-based SNP
genotyping", Methods Mol Biol. 2003;212:241-62; Jurinke et at., "The use of
Mass
ARRAY technology for high throughput genotyping", Adv Biothem Eng Biotechnol.
2002;77:57-74; and Jurinke et at., "Automated genotyping using the DNA
MassArray
technology", Methods Mol Biol. 2002;187:179-92.
SNPs can also be scored by direct DNA sequencing. A variety of automated =
sequencing procedures can he utilized ((1995) Biotechniques /9:448), including
sequencing
by mass spectrometry (see, e.g., PCT International Publication No. W094/16101;
Cohen et
at., Adv. Chromatogr. 36:127-162 (1996); and Griffin et at., AppL Biochem.
Biotechnol.
38:147-159 (1993)). The nucleic acid sequences of the present invention enable
one of
ordinary skill in the art to readily design sequencing primers for such
automated
sequencing procedures. Commercial instrumentation, such as the Applied
Biosystems
57
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
377, 3100, 3700, 3730, and 3730x1 DNA Analyzers (Foster City, CA), is commonly
used
in the art for automated sequencing.
Other methods that can be used to genotype the SNPs of the present invention
include single-strand conformational polymorphism (SSCP), and denaturing
gradient gel
electrophoresis (DGGE) (Myers et al., Nature 313:495 (1985)). SSC? identifies
base -
differences by alteration in electrophoretic migration of single stranded PCR
products, as -
described in Orita et al., Proc. Nat. Acad. Single-stranded PCR products can
be
generated by heating or otherwise denaturing double stranded PCR products.
Single-
stranded nucleic acids may refold or form secondary structures that are
partially
dependent on the base sequence. The different electrophoretic mobilities of
single-
stranded amplification products are related to base-sequence differences at
SNP
positions. DGGE differentiates SNP alleles based on the different sequence-
dependent
stabilities and melting properties inherent in polymorphic DNA and the
corresponding
differences in electrophoretic migration patterns in a denaturing gradient gel
(Erlich, ed., =
PCR Technology, Principles and Applications for DNA Amplification, W.H.
Freeman
and Co, New York, 1992, Chapter 7). = =
Sequence-specific ribozymes (U.S.Patent No. 5,498,531) can also be used to
score SNPs based on the development or loss of a ribozyme cleavage site.
Perfectly
matched sequences can be distinguished from mismatched sequences by nuclease
cleavage digestion assays or by differences in melting temperature. If the SNP
affects a
restriction enzyme cleavage site, the SNP can be identified by alterations in
restriction
enzyme digestion patterns, and the corresponding changes in nucleic acid
fragment
lengths determined by gel electrophoresis
SNP genotyping can include the steps of, for example, collecting a
biological sample from a human subject (e.g., sample of tissues, cells;
fluids,
secretions, etc.), isolating nucleic acids (e.g., genomic DNA, raRNA or both)
from the cells of the sample, contacting the nucleic acids with one or more
primers which specifically hybridize to a region of the isolated nucleic acid
containing a target SNP under conditions such that hybridization and
amplification of the target nucleic acid region occurs, and determining the
nucleotide present at the SNP position of interest, or, in some assays,
58
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
detecting the presence or absence of an amplification product (assays can be
designed so that hybridization and/or amplification will only occur if a
particular SNP allele is present or absent). In some assays, the size of the
amplification product is detected and compared to the length of a control
sample; for example, deletions and insertions can be detected by a change in
size of the amplified product compared to a normal genotype.
SNP genotyping is useful for numerous practical applications, as described
below.
Examples of such applications include, but are not limited to, SNP-disease
association
analysis, disease predisposition screening, disease diagnosis, disease
prognosis, disease
' progression monitoring, determining therapeutic strategies based on an
individual's
genotype ("phannacogenomics"), developing therapeutic agents based on SNP
genotypes
associated with a disease or likelihood of responding to a drug, stratifying a
patient
population for clinical trial for a treatment regimen, predicting the
likelihood that an
individual will experience toxic side effects from a therapeutic agent, and
human
identification applications such as forensics.
Analysis of Genetic AssociationEetween SNPs and Phenotypic Traits
SNP genotyping for disease diagnosis, disease predisposition screening,
disease
prognosis, determining drug responsiveness (phamiacogenomics), drug toxicity
screening, and other uses described herein, typically relies on initially
establishing a,
genetic association between one or more specific SNPs and the particular
phenotypic
traits of interest.
Different study designs may be used for genetic association studies (Modern
Epidemiology, Lippincott Williams & Wilkins (1998), 609-622). Observational
studies =
are most frequently carried out in which the response of the patients is not
interfered
with. The first type of observational study identifies a sample of persons in
whom the
suspected cause of the disease is present and another sample of persons in
whom the
suspected cause is absent, and then the frequency of development of disease in
the two
samples is compared. These sampled populations are called cohorts, and the
study is a
prospective study. The other type of observational study is case-control or a
retrospective
study. In typical case-control studies, samples are collected from individuals
with the
59
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
phenotype of interest (cases) such as certain manifestations of a disease, and
from
individuals without the phenotype (controls) in a population (target
poplation) that .
conclusions are to be drawn from. Then the possible causes of the disease are
investigated retrospectively. As the time and costs of collecting samples in
case-control
studies are considerably...less than those for prospective studies, case-
control studies are
the more commonly used study design in genetic association studies, at least
during the
exploration and discovery stage.
In both types of observational studies, there may be potential confounding
factors
. that should be taken into consideration. Confounding factors are those
that are associated-
with both the real cause(s) of the disease and the disease itself, and they
include
, demographic information such as age, gender, ethnicity as well as
environmental factors.
When confounding factors are not matched in cases and controls in a.study, and
are not
controlled properly, spurious association results can arise. If potential
confounding
factors are identified, they should be controlled for by analysis methods
explained below.
In a genetic association study, the cause of interest to be tested is a
certain allele
or a SNP or a combination of alleles or a haplotype from several SNPs. Thus,
tissue
specimens (e.g., whole blood) from the sampled individuals may be collected
and .
genomic DNA genotyped for the SNP(s) of interest. In addition to the
phenotypic trait of
interest, other information such as demographic (e.g., age, gender, ethnicity,
etc.), . =
clinical, and environmental information that may influence the outcome of the
trait can be
collected to further characterize and define the sample set. In many cases,
these factors
are known to be associated with diseases and/or SNP allele frequencies. There
are likely
gene-environment and/or gene-gene interactions as well. Analysis methods to
address
gene-environment and gene-gene interactions (for example, the effects of the
presence of
both susceptibility alleles at two different genes can be greater than the
effects of the
individual alleles at two genes combined) are discussed below.
After all the relevant phenotypic and genotypic information has been obtained,
statistical analyses are carried out to determine if there is any significant
correlation
between the presence of an allele or a genotype with the phenotypic
characteristics of an
individual. Preferably, data inspection and cleaning are first performed
before carrying
out statistical tests for genetic association. Epidemiological and clinical
data of the
CA 02826522 2013-08-13
WO 2005/111241 PCT/1JS2005/016051
samples can be summarized by descriptive statistics with tables and graphs.
Data
' validation is preferably performed to check for data completion,
inconsistent entries, and
outliers. Chi-squared tests and t-tests (Wilcoxon rank-sum tests if
distributions are not
normal) may then be used to check for significant differences between cases
and controls
for discrete and continuous variables, respectively. To ensure genotyping
quality,
Hardy-
Weinberg disequilibrium tests can be performed on cases and controls
separately.
Significant deviation from Hardy-Weinberg equilibrium (HWE) in both cases and=
controls for individual markers can be indicative of genotyping errors. If HWE
is
violated in a majority of markers, it is indicative of population substructure
that should be =
further investigated. Moreover, Hardy-Weinberg disequilibrium in cases only
can
indicate genetic association of the markers with the disease (Genetic Data
Analysis, Weir
-B., Sinauer (1.990)).
To test whether an allele of a single SNP is associated with the case or
control
status of a phenotypic trait, one skilled in the art can compare allele
frequencies in cases
and controls. Standard chi-squared tests and Fisher exact tests can be carried
out on a
2x2 table (2 SNP alleles x 2 outcomes in the categorical trait of interest).
To test whether
genotypes of a SNP are associated, chi-squared tests can be carried out on a
3x2 table (3
genotypes x 2 outcomes). Score tests are also carried out for genotypic
association to
contrast the three genotypic frequencies (major homozygotes, heterozygotes and
minor
homozygotes) in cases and controls, and to look for trends using 3 different
modes of
inheritance, namely dominant (with contrast coefficients 2, ¨1, ¨1), additive
(with
contrast coefficients 1, 0, ¨1) and recessive (with contrast coefficients 1,
1, ¨2). Odds
ratios for minor versus major alleles, and odds ratios for heterozygote and
homozygote
variants versus the wild type genotypes are calculated with the desired
confidence limits,
usually 95%.
In order to control for confounders and to test for interaction and effect
modifiers,
stratified analyses may be performed using stratified factors that are likely
to be
confounding, including demographic information such as age, ethnicity, and
gender, or
1
an interacting element or effect modifier, such as a known major gene (e.g.,
APOE for
Alzheimer' s disease or HLA genes for autoimraune diseases), or environmental
factors
such as smoking in lung cancer. Stratified association tests may be carried
out using
61
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
Cochran-Mantel-Haenszel tests that take into account the ordinal nature of
genotypes
with 0,' l', and 2 variant alleles. Exact tests by StatXact may also be
performed when
computationally. possible. Another way to adjust for confounding effects and
test for
interactions is to perform stepwise multiple logistic regression analysis
using statistical
packages such as SAS or R. Logistic regression is a model-building technique
in which
the best fitting and most parsimonious model is built to describe the relation
between the
dichotomous outcome (for instance, getting a certain disease or not) and a set
of
independent variables (for instance, genotypes of different associated genes,
and the
associated demographic and environmental factors). The most common model is
one in
which the logit transformation of the odds ratios is expressed as a linear
combination of
the variables (main effects) and their cross-product terms (interactions)
(Applied Logistic
Regression, Hosmer and Lemeshow, Wiley (2000)). To test whether a certain
variable or
interaction is significantly associated with the outcome, coefficients in the
model are first
estimated and then tested for statistical significance of their departure from
zero.
In addition to performing association tests one marker at a time, haplotype
association analysis may also be performed to study a number of markers that
are closely
linked together. Haplotype association tests can have better power than
genotypic or.
allelic association tests when the tested markers are not the disease-causing
mutations
themselves but are in linkage disequilibrium with such mutations. The test
will even be
more powerful if the disease is indeed caused by a combination of alleles on a
haplotype
(e.g., APOE is a haplotype formed by 2 SNPs that are very close to each
other). In order
to perform haplotype association effectively, marker-marker linkage
disequilibrium
measures, both D' and R2, are typically calculated for the markers within a
gene to =
= elucidate the haplotype structure. Recent studies (Daly et al, Nature
Genetics, 29, 232-
235, 2001) in linkage disequilibrium indicate that SNPs within a gene are
organized in
block pattern, and a high degree of linkage disequilibrium exists within
blocks and very
little linkage disequilibrium exists between blocks. Haplotype association
with the
disease status can be performed using such blocks once they have been
elucidated.
Haplotype association tests can be carried out in a similar fashion as the
allelic
and genotypic association tests. Each haplotype in a gene is analogous to an
allele in a
multi-allelic marker. One skilled in the art can either compare the haplotype
frequencies
62
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
in cases and controls or test genetic association with different pairs of
haplotypes. It has
been proposed (Sebald et al, Am. J. Hum. Genet., 70,425-434, 2002) that score
tests can
be done on haplotypes using the program "haplo.score". In that method,
haplotypes are
first inferred by EM algorithm and score tests are carried out with a
generalized linear
model (GLM) framework that allows the adjustment of other factors.
An important decision in the performance of genetic association tests is the
determination of the significance level at which significant association can
be declared
when the p-value of the tests _reaches that level. In an exploratory analysis
where positive
hits will be followed up in subsequent confirmatory testing, an unadjustap-
value <0.2 (a
significance level on the lenient side), for example, may be used for
generating
. hypotheses for significant association of a SNP with certain phenotypic
characteristics of .
a disease. It is preferred that a p-value < 0.05 (a significance level
traditionally used in
-the art) is achieved in order for a SNP to be considered to have an
association with .a
disease. It is more preferred that a p-value <0.01 (a significance level on
the stringent
side) is achieved for an association to be declared. When hits are followed up
in .
confirmatory analyses in more samples of the same source or in different
samples from
different sources, adjustment for multiple testing will be performed as to
avoid excess
number of hits while maintaining the experiment-wise error rates at 0.05.
While there are
different methods to adjust for multiple testing to control for different
kinds of error rates,
a commonly used but rather conservative method is Bonferroni correction to
control the
experiment-wise or family-wise error rate (Multiple comparisons and multiple
tests,
Westfall et al, SAS Institute (1999)). Permutation tests to control for the
false discovery
rates, FDR, can be more powerful (Benjamini and Hochberg, Journal of the Royal
Statistical Society, Series B 57, 1289-1300, 1995, Resampling-based Multiple
Testing,
Westfall and Young, Wiley (1993)). Such methods to control for multiplicity
would be
preferred when the tests are dependent and controlling for false discovery
rates is
sufficient as opposed to controlling for the experiment-wise error rates.
In replication studies using samples from different populations after
statistically
significant markers have been identified in the exploratory stage, meta-
analyses can then
be performed by combining evidence of different studies (Modern Epidemiology,
63
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
Lippincott Williams & Wilkins, 1998, 643-673). If available, association
results known
in the art for the same SNPs can be included in the meta-analyses.
=
Since both genotyping and. disease status classification can involve =
errors, sensitivity analyses may be performed to see how odds ratios and p-
values would change upon various estimates on genotyping and disease
classification error rates.
= It has been well known that subpopulation-based sampling bias
between cases and controls can lead to spurious results in case-control
*association studies (Ewens and Spielman, Am. J. Hum. Genet. 62,450-458,
1995) when prevalence of the disease is associated with different
subpopulation groups. Such bias can also lead to a loss of statistical power
in
genetic association studies. To detect population stratification, Pritchard
and
Rosenberg (Pritchard et al. Am. J. Hum. Gen. 1999, 65220-228) suggested
typing markers that are unlinked to the disease and using results of
association tests on those markers to determine whether there is any
population stratification. When stratification is detected, the genomic
control
(GC) method as proposed by Devlin and Roeder (Devlin et al. Biometrics
1999, 55:997-1004) can be used to adjust for the inflation of test statistics
due
to population stratification. GC method is robust to changes in population
structure levels as well as being applicable to DNA pooling designs (Devlin et
al. Genet. Epidem. 20001, 21:273-284). =
While Pritchard's method recommended using 15-20 unlinked microsatellite
, markers, it suggested using more than 30 biallelic markers to get enough
power to detect
population stratification. For the GC method, it has been shown (Bacanu et al.
Am. J.
Hum. Genet. 2000, 66:1933-1944) that about 60-70 biallelic markers are
sufficient to
estimate the inflation factor for the test statistics due to population
stratification. Hence,
70 intergenic SNPs can be chosen in unlinked regions as indicated in a genome
scan
(Kehoe et al. Hum. Mol. Genet. 1999, 8:237-245).
Once individual risk factors, genetic or non-genetic, have been found for the
predisposition to disease, the next step is to set up a
classification/prediction scheme to
64
CA 02826522 2013-08-13
WO 2005/111241 PCT/IJS2005/016051
predict the category (for instance, disease or no-disease) that an individual
will be in
'depending on his genotypes of associated SNPs and other non-genetic risk
factors.
Logistic regression for discrete trait and linear regression for continuous
trait are standard .
techniques for such tasks (Applied Regression Analysis, Draper and Smith,
Wiley
(1998)). Moreover, other techniques can also be used for setting up
classification. Such -
techniques include, but are not limited to, MART, CART, neural network, and
=
discriminant analyses that are suitable for use in comparing the performance
of different
methods (The Elements of Statistical Learning, Hastie, Tibshirani & Friedman,
Springer
(2002)).
Disease Diagnosis and Predisposition Screening
Information on association/correlation between genotypes and disease-related
phenotypes can be exploited in several ways. For example, in the case of a
highly
statistically significant association between one or more SNPs with
predisposition to a
disease for which treatment is available, detection of such a genotype pattern
in an
individual may justify immediate administration of treatment, or at least the
institution of
regular monitoring of the individual. Detection of the susceptibility alleles
associated
with serious disease in a couple contemplating having children may also be
valuable to
the couple in their reproductiVe decisions. In the case of a weaker but still
statistically
significant association between a SNP and a human disease, immediate
therapeutic =
intervention or monitoring may not be justified after detecting the
susceptibility allele or
SNP. Nevertheless, the subject can be motivated to begin simple life-style
changes (e.g.,
diet, exercise) that can be accomplished at little or no cost to the
individual but would
confer potential benefits in reducing the risk of developing conditions for
which that
individual may have an increased risk by virtue of having the susceptibility
allele(s).
The SNPs of the invention may contribute to liver fibrosis and related
pathologies
in an individual in different ways. Some polymorphisms occur within a protein
coding
sequence and contribute to disease phenotype by affecting protein structure.
Other
pOlymorphisms occur in noncoding regions but may exert phenotypic effects
indirectly
via influence on, for example, replication, transcription, and/or translation.
A single SNP
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
may affect more than one phenotypic trait. Likewise, a single phenotypic trait
may be
affected by multiple SNPs in different genes.
As used herein, the terms "diagnose", "diagnosis", and "diagnostics" include,
but
are not limited to any of the following: detection of liver fibrosis that an
individual may
presently have, predisposition/susceptibility screening (i.e., determining the
increased
risk of an individual in developing liver fibrosis in the future, or
determining whether an
individual has a decreased risk of developing liver fibrosis in the future,
determining the
rate of progression of fibrosis to bridging fibrosis/cirrhosis), determining a
particular type
or subclass of liver fibrosis in an individual known to have liver fibrosis,
confirming or
reinforcing a previously made diagnosis of liver fibrosis, pharmacogenomic
evaluation of
an individual to determine which therapeutic strategy that individual is most
likely to
positively respond to or to predict whether a patient is likely to respond to
a particular
treatment, predicting whether a patient is likely to experience toxic effects
from a =
particular treatment or therapeutic compound, and evaluating the future
prognosis of an
individual having liver fibrosis. Such diagnostic uses are based on the SNIPS
individually
or in a unique combination or SNP haplotypes of the present invention.
= liaplotypes are particularly useful in that, for example, fewer SNPs can
be
genotyped to determine if a particular genornic region harbors a locus that
influences a
particular phenotype, such as in linkage disequilibrium-based SNP association
analysis. = =
Linkage disequilibrium (LD) refers to the co-inheritance of alleles (e.g.,
alternative nucleotides) at two or more different SNP sites at frequencies
greater than
= would be expected from the separate frequencies of occurrence of each
allele in a given
= population. The expected frequency of co-occurrence of two alleles that
are inherited
independently is the frequency of the first allele multiplied by the frequency
of the
second allele. Alleles that co-occur at expected frequencies are said to be in
"linkage
equilibrium". in contrast, LD refers to any non-random genetic association
between
allele(s) at two or more different SNP sites, which is generally due to the
physical
proximity of the two loci along a chromosome. LD can occur when two or more
SNPs
sites are in close physical proximity to each other on a given chromosome and
therefore
alleles at these SNP sites will tend to remain unseparated for multiple
generations with
the consequence that a particular nucleotide (allele) at one SNP site will
show a non-
66
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
random association with a particular nucleotide (allele) at a different SNP
site located
nearby. Hence, genotyping one of the SNP sites will give almost the same
information as
genotyping the other SNP site that is in LD.
Various degrees of LD can be encountered between two or more SNPs with the
result being that some SNPs are more closely associated (i.e., in stronger LD)
than others.
Furthermore, the physical distance over which Li) extends along a chromosome
differs
between different regions of the genome, and therefore the degree of physical
separation
- between two or more SNP sites necessary for LD to occur can differ
between different
= regions of the genome.
. For diagnostic
purposes and similar uses, if. a particular SNP site is found to be =
useful for diagnosing liver fibrosis and related pathologies (e.g., has a
significant
= statistical association with the condition and/or is recognized as a
causative
= polymorphism for the condition), then the skilled artisan would recognize
that other SNP
sites which are in ID with this SNP site would also be useful for diagnosing
the
= condition. Thus, polymorphisms (e.g., SNPs and/or haplotypes) that are not
the actual
disease-causing (causative) polymorphisms, but are in Li) with such causative
polymorphisms, are also useful. In such instances, the genotype of the
polymorphism(s)
that is/are in LD with the causative polymorphism is predictive of the
genotype of the
causative polymorphism and, consequently, predictive of the phenotype (e.g.,
liver
fibrosis) that is influenced by the causative SNP(s). Therefore, polymorphic
markers that
are in LD with causative polymorphisms are useful as diagnostic markers, and
are
particularly useful when the actual causative polymorphism(s) is/are unknown.
Examples of polymorphisms that can be in LD with one or more causative
polymorphisms (and/or in LD with one or more polymorphisms that have a
significant
statistical association with a condition) and therefore. useful for diagnosing
the same
condition that the causative/associated SNP(s) is used to diagnose, include,
for example,
other SNPs in the same gene, protein-coding, or mRNA transcript-coding region
as the
causative/associated SNP, other SNPs in the same exon or same intron as the
causative/associated SNP, other SNPs in the same haplotype block as the
causative/associated SNP, other SNPs in the same intergenic region as the
causative/associated SNP, SNPs that are outside but near a gene (e.g., within
6kb on
67
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
either side, 5' or 3', of a gene boundary) that harbors a causative/associated
SNP, etc.
,
Such useful ID SNPs can be selected from among the SNPs disclosed in Tables 1-
2, for
example.
= Linkage disequilibrium in the human genome is reviewed in: Wall et al.,
"Haplotype blocks and linkage disequilibrium in the human genome", Nat Rev
Genet.
2003 Aug;4(8):587-97; Garner et al., "On selecting markers for association
studies:
= patterns of linkage disequilibrium between two and three diallelic loci",
Genet Epidemiol.
=
2003 Jan;24(1):57-67; Ardlie et al., "Patterns of linkage disequilibrium in
the human =
.genome", Nat Rev Genet. 2002 Apr;3(4):299-309 (erratum in Nat Rev Genet 2002
Jul;3(7):566); and Remm et al., "High-density genotyping and linkage
disequilibrium in
the human genome using chromosome 22 as a model"; Curr Opin Chem Biol. 2002 -
Feb;6(1):24-30.
= The contribution or association of particular SNPs and/or SNP
haplotypes with disease phenotypes, such as liver fibrosis, enables the SNPs
of the present invention to be used to develop superior diagnostic tests
capable of identifying individuals who express a detectable trait, such as
liver
fibrosis, as the result of a specific genotype, or individuals whose genotype
=
places them at an increased or decreased risk of developing a detectable trait
at a subsequent time as compared to individuals who do not have that
.20 genotype. As described herein, diagnostics may be based on a single SNP
or
a group of SNPs. Combined detection of a plurality of SNPs (for example, 2, 3,
=
4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 24, 25, 30, 32,
48, 50,
64, 96, 100, or any other number in-between, or more, of the SNPs provided
in Table 1 and/or Table 2) typically increases the probability of an accurate
diagnosis. For example, the presence of a single SNP known to correlate with
liver fibrosis might indicate a probability of 20% that an individual has or
is
at risk of developing liver fibrosis, whereas detection of five SNPs, each of
which correlates with liver fibrosis, might indicate a probability of 80% that
. an individual has or is at risk of developing liver fibrosis. To further
increase
the accuracy of diagnosis or predisposition screening, analysis of the SNPs of
68
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
the present invention can be combined with that of other polyraorphisras or
I. 0
other risk factors of liver fibrosis, such as disease symptoms, pathological
characteristics, family history, diet, environmental factors or lifestyle
factors. =
It will, of course, be understood by practitioners skilled in the treatment or
diagnosis of liver fibrosis that the present invention generally does not
intend to provide
an absolute identification of individuals who are at risk (or less at risk) of
developing
liver fibrosis, and/or pathologies related to liver fibrosis, but rather to
indicate a certain
= increased (or decreased) degree or likelihood of developing the disease
based on
statistically significant association results. However, this information is
extremely
valuable as it can be used to, for example, initiate preventive treatments or
to allow an
= individual carrying one or more significant SNPs or SNP haplotypes to
foresee warning
signs such as minor clinical symptoms, or to have regularly scheduled physical
exams to
monitor for appearance of a condition in order to identify and begin treatment
of the
condition at an early stage. Particularly with diseases that are extremely
debilitating or
fatal if not treated on time, the knowledge of a potential predisposition,
even if this
predisposition is not absolute, would likely contribute in a very significant
manner to
treatment efficacy.
. The diagnostic techniques of the present invention may employ a
variety of
methodologies to determine whether a test subject has a SNP or a SNP pattern
associated
,20 with an increased or decreased risk of developing a detectable trait or
whether the
individual suffers from a detectable trait as a result of a particular
polymorphism/mutation, including, for example, methods which enable the
analysis of
individual chromosomes for haplotyping, family studies, single sperm DNA
analysis, or
somatic hybrids. The trait analyzed using the diagnostics of the invention may
be any
detectable trait that is commonly observed in pathologies and disorders
related to liver
fibrosis.
Another aspect of the present invention relates to a method of determining =
whether an individual is at risk (or less at risk) of developing one or more
traits or
whether an individual expresses one or more traits as a consequence of
possessing a
particular trait-causing or trait-influencing allele. These methods generally
involve
obtaining a nucleic acid sample from an individual and assaying the nucleic
acid sample
69
CA 02826522 2013-08-13
WO 2005/111241
PCT/1JS2005/016051
to determine which nucleotide(s) is/are present at one or more SNP positions,
wherein the
assayed nucleotide(s) is/are indicative of an increased or decreased risk of
developing the
trait or indicative that the individual expresses the trait as a result of
possessing a
particular trait-causing or trait-influencing allele.
In another embodiment, the SNP detection reagents of the present invention are
used to determine whether an individual has one or more SNP allele(s)
affecting the level
(e.g.,, the concentration of mRNA or protein in a sample, etc.) or pattern
(e.g., the kinetics
of expression, rate of decomposition, stability profile, Km, Vmax, etc.) of
gene
= expression (collectively, the "gene response" of a cell or bodily fluid).
Such a
determination can be accomplished by screening for naRNA or protein expression
(e.g.,
by using nucleic acid arrays, RT-PCR, TaqMan assays, or mass spectrometry),
identifying genes having altered expression in an individual, genotyping SNPs
disclosed
in Table 1 and/or Table 2 that could affect the expression of the genes having
altered
expression (e.g., SNPs that are in and/or around the gene(s) having altered
expression,
SNPs in regulatory/control regions, SNPs in and/or around other genes that are
involved
in pathways that could affect the expression of the gene(s) having altered
expression, or
all SNPs could be genotyped), and correlating SNP genotypes with altered gene
expression. In this manner, specific SNP alleles at particular SNP sites can
be identified
that-affect gene expression.
Pharmacogenomics and Therapeutics/Drug Development
The present invention provides methods for assessing the pharmacogenomics of a
subject harboring particular SNP alleles or haplotypes to a particular
therapeutic agent or
pharmaceutical compound, or to a class of such compounds. Pharmacogenomics
deals
with the roles which clinically significant hereditary variations (e.g., SNPs)
play in the
response to drugs due to altered drug disposition and/or abnormal action in
affected persons.
See, e.g., Roses, Nature 405, 857-865 (2000); Gould Rothberg, Nature
Biotechnology 19,
209-211(2001); Eichelbaum, Gun. Exp. Pharrnacol. Physiol. 23(10-11):983-985
(1996);
and Linder, Clin. Chem. 43(2):254-266 (1997). The clinical outcomes of these
variations
can result in severe toxicity of therapeutic drugs in certain individuals or
therapeutic failure
of drugs in certain individuals as a result of individual variation in
metabolism. Thus, the
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
SNP genotype of an individual can determine the way a therapeutic compound
acts on the
'bOdy or tbe way the body metabolizes the compound. For example, SNPs in drug
metabolizing enzymes can affect the activity of these enzymes, which in turn
can affect both
the intensity and duration of drug action, as well as drug metabolism and
clearance. =
The discovery of SNPs in drug metabolizing enzymes, drug transporters,
proteins =
for pharmaceutical agents, and other drug targets has explained why some
patients do not
= obtain
the expected drug effects, show an exaggerated drug effect, or experience
serious =
toxicity from standard drug dosages. SNPs can be expressed in the phenotype df
the =
extensive metabolizer andin the phenotype of the poor metabolizer.
Accordingly, SNPs
= 10
may lead to allelic variants of a protein in which one or more of the protein
functions in one .
, population are different from those in another population. SNPs and the
encoded variant
peptides thus provide targets to ascertain a genetic predisposition that can
affect treatment
mocinlity. For example, in a ligand-based treatment, SNPs may give rise to
amino terminal =
= extracellular domains and/or other ligand-binding regions of a receptor
that are more or less
active in ligand binding, thereby affecting subsequent protein activation.
Accordingly, =
ligand dosage would necessarily be modified to maximize the therapeutic effect
within =a
= given population containing particular SNP alleles or haplotypes.
= As an alternative to genotyping, specific variant proteins containing
variant amino
acid sequences encoded by alternative SNP alleles could be identified. Thus,
pharmacogenomic characterization of an individual permits the selection of
effective .
compounds and effective dosages of such compounds for prophylactic or
therapeutic uses
based on the individual's SNP genotype, thereby enhancing and optimizing the
effectiveness of the therapy. Furthermore, the production of recombinant cells
and
transgenic -animals containing particular SNPs/haplotypes allow effective
clinical design and
testing of treatment compounds and dosage regimens. For example, transgenic
animals can
be produced that differ only in specific SNP alleles in a gene that is
orthologous to a human
disease susceptibility gene.
Pharmacogenomic uses of the SNPs of the present invention provide several
significant advantages for patient care, particularly in treating liver
fibrosis.
Pharmacogenomic characterization of an individual, based on an individual's
SNP
genotype, can identify those individuals unlikely to respond to treatment with
a particular
71
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
medication and thereby allows physicians to avoid prescribing the ineffective
medication to
those individuals. On the other hand, SNP genotyping of an individual may
enable
physicians to select the appropriate medication and dosage regimen that will
be most
effective based on an individual's SNP genotype. This information increases a
physician's
confidence in prescribing medications and motivates patients to comply with
their drug
regimens. Furthermore, pharmacogenomics may identify patients predisposed to
toxicity
and adverse reactions to particular drugs or drug dosages. Adverse drug
reactions lead to
more than 100,000 avoidable deaths per year in the United States alone and
therefore
represent a significant cause of hospitali7ation and death, as well as a
significant economic
burden on the healthcare system (Pfost et. al., Trends in Biotechnology, Aug.
2000.). Thus,
pharmacogenomics based on the SNPs disclosed herein has the potential to both
save lives
and reduce healthcare costs substantially. .
Pharmacogenomics in general is discussed further in Rose et al., =
= "Pharmacogenetic analysis of clinically relevant genetic polymorphisms",
Methods Mol
Med. 2003;85:225-37. Pharmacogenomics as it relates to Alzheimer's disease
andother
.neuro degenerative disorders is discussed in Cacabelos, "Pharmacogenomics for
the
treatment of dementia", Ann Med. 2002;34(5):357-79, Maimone et al.,
"Pharmacogenomics of neurodegenerative diseases", Eur J Phannacol. 2001 Feb
9;413(1):11-29, and Poirier, "Apolipoprotein E: a pharmacogenetic target for
the
treatment of Alzheimer's disease", Mol Diagn. 1999 Dec;4(4):335-41.
-Pharmacogenonaics as it relates to cardiovascular disorders is discussed in
Siest et al., =
"Pharmacogenomics of drugs affecting the cardiovascular system", Clin Chem Lab
Med.
2003 Apr;41(4):590-9, Muldierjee et al., "Pharmacogenomics in cardiovascular
'
=diseases", Prog Cardiovasc Dis. 2002 May-Jun;44(6):479-98, and Mooser et al.,
"Cardiovascular pharmacogenetics in the SNP era", J Thromb Haemo,st. 2003
Jul:1(7):1398-402. Pharmacogenomics as it relates to cancer is discussed in
McLeod et
at., "Cancer pharmacogenomics: SNPs, chips, and the individual patient",
Cancer Invest.
2003;21(4):630-40 and Waters et al., "Cancer pharmacogenomics: current and
future
applications", Biochim Biophys Acta. 2003 Mar 17;1603(2):99-111.
The SNPs of the present invention also can be used to identify novel
therapeutic targets for liver fibrosis. For example, genes containing the
72
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
disease-associated variants ("variant genes") or their products, as well as
genes or their products that are directly or indirectly regulated by or -
interacting with these variant genes or their products, can be targeted for
the
development of therapeutics that, for example, treat the disease or prevent or
delay disease onset. The therapeutics may be composed of, for example,
small molecules, proteins, protein fragments or peptides, antibodies, nucleic
acids, or their derivatives or raimetics which modulate the functions or
levels
of the target genes or gene products.
The SNP-containing nucleic acid molecules disclosed herein, and their =
=
complementary nucleic acid molecules, may be used as antisense constructs to
control
gene expression in cells, tissues, and organisms. Antisense technology is well
established
in the art and extensively reviewed in Antisense Drug Technology: Principles,
Strategies,
and Applications, Crooke (ed.), Marcel Dekker, Inc.: New York (2001). An
antisense
=
nucleic acid molecule is generally designed to be complementary to a region of
mRNA =
expressed by a gene so that the antisense molecule hybridizes to the mRNA and
thereby
blocks translation of mRNA into protein. Various classes of antisense
oligonucleotides
are used in the art, two of which are cleavers and blockers. Cleavers, by
binding to target
RNAs, activate intracellular nucleases (e.g., RNaseH or RNase L) that cleave
the target
RNA. Blockers, which. also bind to target RNAs, inhibit protein translation
through steric
hindrance of ribosomes. Exemplary blockers include peptide nucleic acids,
morpholinos,
locked nucleic acids, and methylphosphonates (see, e.g., Thompson, Drug
Discoveiy
Today,7 (17): 912-917 (2002)). Antisense oligonucleotides are directly useful
as
therapeutic agents, and are also useful for determining and validating gene
function (e.g.,
in gene knock-out or knock-down experiments).
Antisense technology is further reviewed in: Lavery et al., "Antisense and
RNAi:
powerful tools in drug target discovery and validation", Curr Opin Drug Discov
Devel.
2003 Jul;6(4):561-9; Stephens et al., "Antisense oligonucleotide therapy in
cancer", Curr
Opin Mol Ther. 2003 Apr;5(2):118-22; Kurreck, "Antisense technologies..
Improvement
through novel chemical modifications", Eur JBioche,n. 2003 Apr;270(8):1628-44;
Dias
et al., "Antisense oligonucleotides: basic concepts and mechanisms", Mol
Cancer Then
2002 Mar;1(5):347-55; Chen, "Clinical development of antisense
oligonucleotides as
73
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
anti-cancer therapeutics", Methods Mol Med. 2003;75:621-36; Wang et al.,
`!Antisense
'anticancer oligonucleotide therapeutics", Cun- Cancer Drug Targets.
2001.Nov;1(3):177-
96; and Bennett, "Efficiency of antisense oligonucleotide drug discovery",
Antisense
Nucleic Acid Drug Dev. 2002 Jun;12(3):215-24. =
The SNPs of the present invention are particularly useful for designing
antisense =
reagents that are specific for particular nucleic acid variants. Based on the
SNP
information disclosed herein, antisense oligonucleotides can be produced that
specifically
target mRNA molecules that contain one or more particular SNP nucleotides. In
this
manner, expression of mRNA molecules that contain one or more undesired
polymorphisms (e.g., SNP nucleotides that lead to a defective protein such as
an amino
acid substitution in a catalytic domain) can be inhibited or completely
blocked. Thus,
antisense oligonucleotides can be used to specifically bind a particular
polymorphic form
(e.g., a SNP allele that encodes a defective protein), thereby inhibiting
translation of this
form, but which do not bind an alternative polymorphic form (e.g., an
alternative SNP
nucleotide that encodes a protein having normal function). =
Antisense molecules can be used to inactivate mRNA in order to inhibit gene
expression and production of defective proteins. Accordingly, these molecules
can be =
used to treat a disorder, such as liver fibrosis, characterized by abnormal or
undesired =
gene expression or expression of certain defective proteins. This technique
can involve
cleavage by means of ribozymes containing nucleotide sequences complementary
to one .
or more regions in the mRNA that attenuate the ability of the mRNA to be
translated.
Possible mRNA regions include, for example, protein-coding regions and
particularly
protein-coding regions corresponding to catalytic activities, substrate/ligand
binding, or
other functional activities of a protein.
The SNPs of the present invention are also useful for designing RNA
interference
reagents that specifically target nucleic acid molecules having particular SNP
variants.
RNA interference (RNAi), also referred to as gene silencing, is based on using
double-
stranded RNA (dsRNA) molecules to turn genes off. When introduced into a cell,
dsRNAs are processed by the cell into short fragments (generally about 21, 22,
or 23
nucleotides in length) known as small interfering RNAs (siRNAs) which the cell
uses in a
sequence-specific manner to recognize and destroy complementary RNAs
(Thompson,
74
=
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
Drug Discovery Today, 7 (17): 912-917 (2002)). Accordingly, an aspect of the
present
mvention specifically contemplates isolated nucleic acid molecules that are
about 18-26
nucleotides in length, preferably 19-25 nucleotides in length, and more
preferably 20, 21,
22, or 23 nucleotides in length, and the use of these nucleic acid molecules
for RNAi.
1
Because RNAi molecules, including siRNAs, act in a sequence-specific manner,
the
SNPs of the present invention can be used to design RNAi reagents that
recognize and
= = destroy nucleic acid molecules having specific SNP alleles/nucleotides
(such as
deleterious alleles that lead to the production of defective proteins); while
not affecting
nucleic acid molecules having alternative SNP alleles (such as alleles that
encode
proteins having normal function). As with antisense reagents, RNAi reagents
may be
1
- = = directly useful as therapeutic agents (e.g., for turning off
defective, disease-causing
genes), and are also useful for characterizing and validating gene function
(e.g., in gene =
knock-out or knock-down experiments).
The following references provide a further review of RNAi: Reynolds et al.,
"Rational siRNA design for RNA interference", Nat Biotechnol. 2004
Mar;22(3):326-30. =
Epub 2004 Feb 01; Chi et at., "Geriomewide view of gene silencing by small
interfering
RNAs", PNAS 100(11):6343-6346, 2003; Vickers et at., "Efficient Reduction=of
Target
RNAs by Small Interfering RNA and RNase H-dependent Antisense Agents", T.
Biol.
Chem. 278: 7108-7118, 2003; Agami, "RNAi and related mechanisms and their
potential
use for therapy", Curr Opin Chem Biol. 2002 Dec;6(6):829-34; Lavery et al.,
`..Arrtisense
and RNAi: powerful tools in drug target discovery and validation", Curr Opin
Drug =
Discov Devel. 2003 Jul;6(4):561-9; Shi, "Mammalian RNAi for the masses",
Trends
Genet 2003 Jan;19(1):9-12), Shuey et at., "RNAi: gene-silencing in therapeutic
intervention", Drug Discovery Today 2002 Oct;7(20):1040-1046; McManus et al.,
Nat
Rev Genet 2002 Oct;3(10):737-47; Xia et at., Nat Biotechnol 2002
Oct;20(10):1006-10; =
Plasterk et al., OPT Opin Genet Dev 2000 Oct;10(5):562-7; Bosher et at., Nat
Cell Biol
2000 Feb;2(2):E31-6; and Hunter, Curr Rio! 1999 Jun 17;9(12):R440-2).
A subject suffering from a pathological condition, such as liver fibrosis,
ascribed
to a SNP may be treated so as to correct the genetic defect (see Kren et at.,
Proc. Natl.
Acad. ScL USA 96:10349-10354 (1999)). Such a subject can be identified by any
method
that can detect the polymorphism in a biological sample drawn from the
subject. Such a
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
=
genetic defect may be permanently corrected by administering to such a subject
a nucleic
' acid'fragment incorporating a repair sequence that supplies the
normal/wild-type
nucleotide at the position of the SNP. This site-specific repair sequence can
encompass
an RNA/DNA oligonucleotide that operates to promote endogenous repair of a
subject's
genomic DNA. The site-specific repair sequence is administered in an
appropriate
vehicle, such as a complex with polyethylenimine, encapsulated in anionic
liposomes, a
viral vector such as an adenovirus, or other pharmaceutical composition that
promotes
intracellular uptake of the administered nucleic acid. A genetic defect
leading to an
inborn pathology may then be overcome, as the chimeric oligonucleotides induce
= la incorporation of the normal sequence into the subject's genome. Upon
incorporation, the
normal gene product is expressed, and the replacement is propagated, thereby
engendering a permanent repair and therapeutic enhancement of the clinical
condition of =
the subject.
In cases in which a cSNP results in a variant protein that is ascribed to be
the
cause of, or a contributing factor to, a pathological condition, a method of
treating such a =
condition can include administering to a subject experiencing the pathology
the wild-
type/normal cognate of the variant protein. Once administered in an effective
dosing .
regimen, the wild-type cognate provides complementation or remediation of the
= pathological condition.
The invention further provides a method for identifying a compound or agent
that =
can be used to treat liver fibrosis. The SNPs disclosed herein are useful as
targets for the
identification and/or development of therapeutic agents. A method for
identifying a
therapeutic agent or compound typically includes assaying the ability of the
agent or
compound to modulate the activity and/or expression of a SNP-containing
nucleic acid or =
the encoded product and thus identifying an agent or a compound that can be
used to treat a
disorder characterized by undesired activity or expression of the SNP-
containing nucleic
acid or the encoded product. The assays can be performed in cell-based and
cell-free
systems. Cell-based assays can include cells naturally expressing the nucleic
acid molecules
of interest or recombinant cells genetically engineered to express certain
nucleic acid
molecules.
76
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
Variant gene expression in a liver fibrosis patient can include, for example,
either
,
expression of a SNP-containing nucleic acid sequence (for instance, a gene
that contains a.
SNP can be transcribed into an mRNA transcript molecule containing the SNP,
which can in
turn be translated into a variant protein) or altered expression of a
normal/wild-type nucleic
acid sequence due to one or more SNPs (for instance, a regulatory/control
region can
contain a SNP that affects the level or pattern of expression of a normal
transcript):
Assays for variant gene expression can involve direct assays of nucleic acid
levels.
= (e.g., naRNA levels), expressed protein levels, or of collateral
compounds involved in a
= signal pathway. Further, the expression of genes that are up- or down-
regulated in response
to the signal pathway can also be assayed. In this embodiment, the regulatory
regions of =
these genes can be operably linked to a reporter gene such as luciferase.=
=
Modulators of variant gene expression can be identified in a method wherein,
for
example, a cell is contacted with a candidate compound/agent and the
expression of naRNA
determined. The level of expression of mRNA in the presence of the candidate
compound is
compared to the level of expression of mRNA in the absence of the candidate
compound.
The candidate compound can then be identified as a modulator of variant gene
expression
based on this comparison and be used to treat a disorder such as liver
fibrosis that is
characterized by variant gene expression (e.g., either expression of a SNP-
containing nucleic
acid or altered expression of a normal/wild-type nucleic acid molecule due to
one or more
SNPs that affect expression of the nucleic acid molecule) due to one or more
SNPs of the
present invention. When expression of roRNA is statistically significantly
greater in the
presence of the candidate compound than in its absence, the candidate compound
is
= identified as a stimulator of nucleic acid expression. When nucleic acid
expression is
statistically significantly less in the presence of the candidate compound
than in its. absence, =
the candidate compound is identified as an inhibitor of nucleic acid
expression.
The invention further provides methods of treatment, with the SNP or
associated
nucleic acid domain (e.g., catalytic domain, ligand/substrate-binding domain,
regulatory/control region, etc.) or gene, or the encoded naRNA transcript, as
a target, using a
compound identified through drug screening as a gene modulator to modulate
variant
nucleic acid expression. Modulation can include either up-regulation (i.e.,
activation or
77
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
agonization) or down-regulation (Le., suppression or antagonization) of
nucleic acid
exiaression:
Expression of mRNA transcripts and encoded proteins, either wild type or
variant,
may be altered in individuals with a particular SNP allele in a
regulatory/control element,
such as a promoter or transcription factor binding domain, that regulates
expression. In this
situation, methods of treatment and compounds can be identified, as discussed
herein, that
regulate or overcome the variant regulatory/control element, thereby
generating normal, or -
healthy, expression levels of either the wild type or variant protein. ,
.
The SNP-containing nucleic acid molecules of the present invention are also
useful
. 10 for monitoring the effectiveness of modulating compounds on the
expression or activity of a
variant gene, or encoded product, in clinical trials or in a treatment
regimen. Thus, the gene =
expression pattern can serve as an indicator for the continuing effectiveness
of treatment
= with the compound, particularly with compounds to which a patient can
develop resistance, .
as well as an indicator for tcndcities. The gene expression pattern can also
serve as a marker =
inclicative(of a physiological response of the affected cells to the compound.
Accordingly,
such monitoring would allow either increased administration of the compound or
the
administration of alternative compounds to which the patient has not become
resistant
Similarly, if the level of nucleic acid expression falls below a desirable
level, administration
of the compound could be commensurately decreased.
In another aspect of the present invention, there is provided .a
pharmaceutical pack '
comprising a therapeutic agent (e.g., a small molecule drug, antibody,
peptide, antisense
or RNAi nucleic acid molecule, etc.) and a set of instructions for
administration of the
therapeutic agent to humans diagnostically tested for one or more SNPs or SNP
=
haplotypes provided by the present invention.
The SNPs/haplotypes of the present invention are also usehil for improving
many
different aspects of the drug development process. For instance, an aspect of
the present
, invention includes selecting individuals for clinical trials based on their
SNP genotype.
For example, individuals with SNP genotypes that indicate that they are likely
to -
positively respond to a drug can be included in the trials, whereas those
individuals
whose SNP genotypes indicate that they are less likely to or would not respond
to the
drug, or who are at risk for suffering toxic effects or other adverse
reactions, can be
78
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
excluded from the clinical trials. This not only can improve the safety of
clinical trials,
but also can enhance the chances that the trial will demonstrate statistically
significant
efficacy. Furthermore, the SNPs of the present invention may explain why
certain '
previously developed drugs performed poorly in clinical trials and may help
identify a
= 5 subset of the population that would benefit from a drug that had
previously performed
poorly in clinical trials, thereby "rescuing" previously developed drags, and
enabling the
= drug to be made available to a particular liver fibrosis patient
population that can benefit
from it. =
SNPs have many important uses in drug discovery, screening, and development.
r 10 A high probability exists that, for any gene/protein selected as a
potential drug target;
variants of that gene/protein will exist in a patient population. Thus,
determining the. =
impact of gene/protein variants on the selection and delivery of a therapeutic
agent
= should be an integral aspect of the drug discovery and development
process. (Jazwinska,
A Trends Guide to Genetic Variation and Genomic Medicine, 2002 Mar; S30-S36).
15 Knowledge of variants (e.g., SNPs and any corresponding amino acid
polymorphisms) of a particular therapeutic target (e.g., a gene, mRNA
transcript, or
. protein) enables parallel screening of the variants in order to identify
therapeutic .
=,candidates (e.g., small molecule compounds, antibodies, antisense or RNAi
nucleic acid
compounds, etc.) that demonstrate efficacy across variants (Rothberg, Nat
Biotechnol
- 20 2001 Mar,19(3):209-11). Such therapeutic candidates would be expected
to show equal ,
, efficacy across a larger segment of the patient population, thereby leading
to a larger
potential market for the therapeutic candidate.
Furthermore, identifying variants of a potential therapeutic target enables
the most
common form of the target to be used for selection of therapeutic candidates,
thereby =
25 helping to ensure that the experimental activity that is observed for
the selected
candidates reflects the real activity expected in the largest proportion of a
patient
population (Jazwinska, A Trends Guide to Genetic Variation and Genomic
Medicine,
2002 Mar; S30-S36).
Additionally, screening therapeutic candidates against all known variants of a
30 target can enable the early identification of potential toxicities and
adverse reactions
relating to particular variants. For example, variability in drug absorption,
distribution, =
79
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
metabolism and excretion (ADME) caused by, for example, SNPs in therapeutic
targets
br drugnietabolizing genes, can be identified, and this information can be
utilized during
the drug development process to minimize variability in drag disposition and
develop
therapeutic agents that are safer across a wider range of-a patient
population. The SNPs =
of the present invention, including the variant proteins and encoding
polymorphic nucleic
acid molecules provided in Tables 1-2, are useful in conjunction with a
variety of
= toxicology methods established in the art, such as those set forth in
Current Protocols in
Toxicology, John Wiley & Sons, Inc., N.Y. =
= Furthermore, therapeutic agents that target any art-known proteins
(or nucleic acid molecules, either RNA or DNA) may cross-react with the
variant proteins (or polymorphic nucleic acid molecules) disclosed in Table 1,
-thereby significantly affecting the pharmacokinetic properties of the drug.
Consequently, the protein variants and the SNP-containing nucleic acid
molecules disclosed in Tables 1-2 are useful in developing, screening, and
evaluating therapeutic agents that target corresponding art-known protein
forms (or nucleic acid molecules). Additionally, as discussed above,
= knowledge of all polymorphic forms of a particular drug target enables
the
design of therapeutic agents that are effective against most or all such
polymorphic forms of the drug target. =
Pharmaceutical Compositions and Administration Thereof
Any of the liver fibrosis-associated proteins, and encoding nucleic acid
molecules,
disclosed herein can be used as therapeutic targets (or directly used
themselves as
therapeutic compounds) for treating liver fibrosis and related pathologies,
and the present
disclosure enables therapeutic compounds (e.g., small molecules, antibodies,
therapeutic =
proteins, RNAi and antisense molecules, etc.) to be developed that target (or
are
comprised of) any of these therapeutic targets.
In general, a therapeutic compound will be administered in a therapeutically
effective amount by any of the accepted modes of administration for agents
that serve
similar utilities. The actual amount of the therapeutic compound of this
invention, i.e.,
the active ingredient, will depend upon numerous factors such as the severity
of the
CA 02826522 2013-08-13
WO 2905/111241 PCT/US2005/016051
disease to be treated, the age and relative health of the subject, the potency
of the
I
.compound used, the route and form of administration, and other factors. =
Therapeutically effective amounts of therapeutic compounds may range from, for
example, approximately 0.01-50 mg per kilogram body weight of the recipient
per day;
= 5 preferably about 0.1-20 mg/kg/day. Thus, as an example, for
administration to a=70 kg
person, the dosage range would most preferably be about 7 mg to 1.4 g per day:
= In general, therapeutic compounds will be administered as pharmaceutical
compositions by any one of the following routes: oral, systemic (e.g.,
transdermal,
intranasal, or by suppository), or parenteral (e:g., intramuscular,
intravenous, or
= , 10 subcutaneous) administration. The preferred manner of administration
is oral or
parenteral using a convenient daily dosage regimen, which can be adjusted
according to
the degree of affliction. Oral compositions can take the form of tablets,
pills, capsules, =
.. semisolids, powders, sustained release formulations, solutions,
suspensions, elixirs,
aerosols, or any other appropriate compositions.
15 The choice of formulation depends on various factors such as the mode
of drug
administration (e.g., for oral administration, formulations in the form of
tablets; pills, or .
= capsules are preferred) and the bioavailability, of the drug substance.
Recently,
pharmaceutical formulations have been developed especially for drugs that show
poor .
bioavailability based upon the principle that bioavailability can be increased
by
20 increasing the surface area, i.e., decreasing particle size. For
example, U.S. Patent No.
4,107,288 describes a pharmaceutical formulation having particles in the size
range from . . =
to 1,000 nm in which the active material is supported on a cross-linked matrix
of
macromolecules. U.S. Patent No. 5,145,684 describes the production of a
pharmaceutical
formulation in which the drug substance is pulverized to nanoparticles
(average particle
25 size of 400 rim) in the presence of a surface modifier and then
dispersed in a liquid
medium to give a pharmaceutical formulation that exhibits remarkably high
bioavailability.
Pharmaceutical compositions are comprised of, in general, a therapeutic =
compound in combination with at least one pharmaceutically acceptable
dxcipient.
30 Acceptable excipients are non-toxic, aid administration, and do not
adversely affect the
therapeutic benefit of the therapeutic compound. Such excipients may be any
solid,
81
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
liquid, semi-solid or, in the case of an aerosol composition, gaseous
excipient that is
,
generally available to one skilled in the art.
Solid pharmaceutical excipients include starch, cellulose, talc, glucose,
lactose,
= sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium
stearate, sodium stearate,
glycerol monostearate, sodium chloride, dried skim milk and. the like. Liquid
and
semisolid excipients may be selected from glycerol, propylene glycol, water,
ethanol and
various oils, including those of petroleum, animal, vegetable or synthetic
origin, e.g.,
peanut oil, soybean oil, mineral oil, sesame oil, etc. Preferred liquid
carriers, particularly
for injectable solutions, include water, saline, aqueous dextrose, and
glycols.
-Compressed gases may be used to disperse a compound of this invention in
aerosol form. Inert gases suitable for this purpose are nitrogen, carbon
dioxide, etc.
Other suitable pharmaceutical excipients and their formulations are described
in
Remington's Pharmaceutical Sciences, edited by B. W. Martin (Mack Publishing =
Company, le ed., 1990).
The-amount of the therapeutic compound in a formulation can vary within the
full
range employed by those skilled in the art. Typically, the formulation will
contain, on a
= weight percent (wt %) basis, from about 0.01-99.99 wt % of the
therapeutic compound
based on the total formulation, with the balance being one or more suitable
pharmaceutical excipients. Preferably, the compound is present at a level of
about 1-80
wt %. =
Therapeutic compounds can be administered alone or in combination with other
therapeutic compounds or in combination with one or more other active
ingredient(s).
= For example, an inhibitor or stimulator of a liver fibrosis-associated
protein can be
administered in combination with another agent that inhibits or stimulates the
activity of
the same or a different liver fibrosis-associated protein to thereby
counteract the affects
of liver fibrosis.
For further information regarding pharmacology, see Current Protocols in
Pharmacology, John Wiley & Sons, Inc., N.Y.
82
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
Human Identification Applications
in addition to their diagnostic and therapeutic uses in liver fibrosis and
related =
pathologies, the SNPs provided by the present invention are also useful as
human
identification markers for such applications as forensics, paternity testing,
and biometrics
(see, e.g., Gill, "An assessment of the utility of single nucleotide
polymorphisms (SNPs)
for forensic purposes", hit .1" Legal Med. 2001;114(4-5):204-10). Genetic
variations in
the nucleic acid sequences between individuals can be used as genetic markers
to identify -
= individuals and to associate a biological sample with an individual.
Determination of
which nucleotides occupy a set of SNP positions in an individual identifies a
set of SNP
markers that distinguishes the individual. The more SNP positions that are
analyzed, the
lower the probability that the set of SNPs in one individual is the same as
that in an =
= unrelated individual. Preferably, if multiple sites are analyzed, the
sites are unlinked (L e.,
inherited independently). Thus, preferred sets of SNPs can be selected from
among the
SNPs disclosed herein, which may include SNPs on different chromosomes, SNPs
on
different chromosome arms, and/or SNPs that are dispersed over substantial
distances
along the same chromosome arm. =
Furthermore, among the SNPs disclosed herein, preferred SNPs for use in
certain
forensic/human identification applications include SNPs located at degenerate
codon
positions (i.e., the third position in certain codons which can be one of two
or more =
alternative nucleotides and still encode the same amino acid), since these
SNPs do not
affect the encoded protein. SNPs that do not affect the encoded protein are
expected to =
be under less selective pressure and are therefore expected to be more
polymorphic in a
population, which is typically an advantage for forensic/human identification
applications. However, for certain forensics/human identification
applications, such as
predicting phenotypic characteristics (e.g., inferring ancestry or inferring
one or more
physical characteristics of an individual) from a DNA sample, it may be
desirable to
utilize SNPs that affect.the encoded protein.
For many of the SNPs disclosed in Tables 1-2 (which are identified as
"Applera"
SNP source), Tables 1-2 provide SNP allele frequencies obtained by re-
sequencing the
DNA of chromosomes from 39 individuals (Tables 1-2 also provide allele
frequency
information for "Celera" source SNPs and, where available, public SNPs from
dbEST,
83
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
11GBASE, and/or HOOD). The allele frequencies provided in Tables 1-2 enable
these
'
SNP i 'to be readily used for human identification applications. Although any
SNP
disclosed in Table 1 and/or Table 2 could be used for human identification,
the closer that
the frequency of the minor allele at a particular SNP site is to 50%, the
greater the ability
of that SNP to discriminate between different individuals in a population
since it becomes
increasingly likely that two randomly selected individuals would have
different alleles at
that SNP site. Using the SNP allele frequencies provided in Tables 1-2, one of
ordinary .
skill in the art could readily select a subset of SNPs for which the frequency
of the minor
allele is, for example, at least 1%, 2%, 5%, 10%, 20%, 25%, 30%, 40%, 45%, or
50%, or
.10 any other frequency in-between. Thus, since Tables 1-2 provide allele
frequencies based
on the re-sequencing of the chromosomes from 39 individuals, a subset of SNPs
could
readily be selected for human identification in which the total allele count
of the minor
allele at a particular SNP.site is, for example, at least 1, 2, 4, 8, 10, 16,
20,24, 30, 32, 36,
. 38, 39, 40, or any other number in-between. =
Furthermore, Tables 1-2 also provide population group (interchangeably
referred
to herein as ethnic or racial groups) information coupled with the extensive
allele
frequency information. For example, the group of 39 individuals whose DNA was
re-
sequenced was made-up of 20 Caucasians and 19 African-Americans. This
population =
group information .enables further refinement of SNP selection for human
identification.
20, For example, preferred SNPs for human identification can be selected
from Tables 1-2
that have similar allele frequencies in both the Caucasian and African-
American
populations; thus, for example, SNPs can be selected that have equally high
discriminatory power in both populations. Alternatively, SNPs can be selected
for which
there is a statistically significant difference in allele frequencies between
the Caucasian
and African-American populations (as an extreme example, a particular allele
may be
observed only in either the Caucasian or the African-American population group
but not
observed in the other population group); such SNPs are useful, for example,
for
predicting the race/ethnicity of an unknown perpetrator from a biological
sample such as
a hair or blood stain recovered at a crime scene. For a discussion of using
SNPs to
predict ancestry from a DNA sample, including statistical methods, see
Frudakis et al.,
84
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
"A Classifier for the SNP-Based Inference of Ancestry", Journal of Forensic
Sciences
,
2003; 48(4Y:771-782. . .
SNPs have numerous advantages over other types of polymorphic markers, such
as short tandem repeats (STRs). For example, SNPs can be easily scored and are
amenable to automation, making SNPs the markers of choice for large-scale
forensic
databases. SNPs are found in much greater abundance throughout the genome than
repeat polymorphisms. Population frequencies of two polymorphic forms can
usually be
determined with greater accuracy than those of multiple polymorphic forms at
multi- =
= allelic loci. SNPs are mutationaly more stable than repeat polymorphisms.
..SNPs are not
- 10 . susceptible to artefacts such as stutter bands that can hinder
analysis. Stutter bands are
= frequently encountered when analyzing repeat polymorphisms, and are
particularly
troublesome when analyzing samples such as crime scene samples that may
contain -
. mixtures of DNA from multiple sources. Another significant advantage of
SNP markers .
over STR markers is the much shorter length of nucleic acid needed to score a
SNP. For
= 15 example, STR markers are generally several hundred base pairs in
length. A SNP, on the=
other hand, comprises a single nucleotide, and generally a short conserved
region on.
either side of the SNP position for primer and/or probe binding. This makes
SNPs more
= amenable to typing in highly degraded or aged biological samples that are
frequently
=
encountered in forensic casework in which DNA may be fragmented into short
pieces. =
20 SNPs also are not subject to microvariant and "off-ladder" alleles
frequently
= encountered when analyzing STR loci. Microvariants are deletions or
insertions within a =
repeat unit that change the size of the amplified DNA product so that the
amplified
product does not migrate at the same rate as reference alleles with normal
sized repeat
units. When separated by size, such as by electrophoresis on a polyacrylamide
gel,
25 microvariants do not align with a reference allelic ladder of standard
sized repeat units,
but rather migrate between the reference alleles. The reference allelic ladder
is used for
precise sizing of alleles for allele classification; therefore alleles that do
not align with the
reference allelic ladder lead to substantial analysis problems. Furthermore,
when
analyzing multi-allelic repeat polymorphisms, occasionally an allele is found
that consists
30 of more or less repeat units than has been previously seen in the
population, or more or
less repeat alleles than are included in a reference allelic ladder. These
alleles will
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
migrate outside the size range of known alleles in a reference allelic ladder,
and therefore
are, referrato as "off-ladder" alleles. In extreme cases, the allele may
contain so few or =
so many repeats that it migrates well out of the range of the reference
allelic ladder. In
this situation, the allele may not even be observed, or, with multiplex
analysis, it may
migrate within or close to the size range for another locus, further
confounding analysis.
SNP analysis avoids the problems of microvariants and off-ladder alleles
encountered in STR analysis. Importantly, microvariants and off-ladder alleles
may
provide significant problems, and may be completely missed, when using
analysis
= methods such as oligonucleotide hybridization arrays, which utilize
oligonucleotide
= 10 probes specific for certain known alleles. Furthermore, off-ladder
alleles and
microvariants encountered with STR analysis, even when correctly typed,Imay
leadto
improper statistical analysis, since their frequencies in the population are
generally
=.,unknown or poorly characterized, and therefore the statistical significance
of a matching
genotype may be questionable. All these advantages of SNP analysis are
considerable in
light of the consequences of most DNA identification cases, which may lead to
life = .
=. imprisonment for an individual, or re-association of remains to the
family of a deceased
individual.
= DNA can be isolated from biological samples such as blood, bone, hair,
saliva, or
semen, and compared with the DNA from a reference source at particular SNP
positions.
Multiple SNP markers can be assayed simultaneously in order to increase the
power of
discrimination and the statistical significance of a matching genotype. For
example,
oligonucleotide arrays can be used to genotype a large number of SNPs
simultaneously.
The SNPs provided by the present invention can be assayed in combination with
other
polymorphic genetic markers, such as other SNPs known in the art or STRs, in
order to
identify an individual or to associate an individual with a particular
biological sample.
Furthermore, the SNPs provided by the present invention can be genotyped for
inclusion in a database of DNA genotypes, for example, a criminal DNA databank
such
as the FBI's Combined DNA Index System (CODIS) database. A genotype obtained
from a biological sample of unknown source can then be queried against the
database to
find a matching genotype, with the SNPs of the present invention providing
nucleotide
positions at which to compare the known and unknown DNA sequences for
identity.
86
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
Accordingly, the present invention provides a database comprising novel SNPs
or SNP
' allele's'of the present invention (e.g., the database can comprise
information indicating
which alleles are possessed by individual members of a population at one or
more novel
SNP sites of the present invention), such as for use in forensics, biometrics,
or other .
= 5 human identification applications. Such a database typically
comprises a computer-based
system in which the SNPs or SNP alleles of the present invention are recorded
on a.
computer
computer readable medium (see the section of the present specification
entitled =
"Computer-Related Embodiments").
The SNPs of the present invention can also be assayed for use in paternity
testing.
-= 10 The object of paternity testing is usually to determine whether a male
is the father of a
child. In most cases, the mother of the child is .known and thus, the mother's
contribution
-to the child's genotype can be-traced. Paternity testing investigates whether
the part of
the child's genotype not attributable to the mother is consistent with that of
the putative
= father. Paternity testing can be performed by analyzing sets of
polymorphisms in the
15 putative father and the child, with the SNPs of the present invention
providing nucleotide
= 'positions at which to compare the putative father's and child's DNA
sequences for
identity. If the set of polymorphisms in the child attributable to the father
does not match
the set of polymorphisms of the putative father, it can be concluded, barring
experimental
.error, that the putative father is not the father of the child. If the set of
polymorphisms in
20 the-child attributable to the father match the set of polymorphisms of
the putative father, a
.statistical calculation can be performed to determine the probability of
coincidental = =
match, and a conclusion drawn as to the likelihood that the putative fatheris
the true
biological father of the child.
= In addition to paternity testing, SNPs are also useful for other types of
kinship
25 testing, such as for verifying familial relationships for immigration
purposes, or for cases
in which an individual alleges to be related to a deceased individual in order
to claim an
inheritance from the deceased individual, etc. For further information
regarding the =
utility of SNPs for paternity testing and other types of kinship testing,
including methods
for statistical analysis, see Krawczak, "Informativity assessment for
biallelic single
30 nucleotide polymorphisms", Electrophoresis 1999 Jun;20(8):1676-81.
87
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
The use of the SNPs of the present invention for human identification further
' extends to various authentication systems, commonly referred to as
biometric systems,
which typically convert physical characteristics of humans (or other
organisms) into digital
data. Biometric systems include various technological devices that measure'
such unique
anatomical or physiological characteristics as finger, thumb, or palm prints;
hand geometry;
vein patterning on the back of the hand; blood vessel patterning of the retina
and color and
texture of the iris; facial characteristics; voice patterns; signature and
typing dynamics; and
DNA. Such physiological measurements can be used to verify identity and, for
example,
restrict or allow access based on the identification. Examples of applications
for biometrics
. include physical area security, computer and network security, aircraft
passenger check-in
= and boarding, financial transactions, medical records access,
government benefit =
distribution, voting, law enforcement, passports, visas and immigration,
prisons, various
== õmilitary applications, and for restricting access to expensive or
dangerous items, such as =
= automobiles or guns (see, for example, O'Connor, Stanford Technology Law
Review and
U.S. Patent No. 6,119,096): _ =
Groups of SNPs, particularly the SNPs provided by the present invention, can
be
typed to uniquely identify an individual for biometric applications such as
those described
above. Such SNP typing can real-lily be accomplished using, for example, DNA
= chips/arrays. Preferably, a minimally invasive means for obtaining a DNA
sample is
utilized. For example, PCR amplification enables sufficient quantities of DNA
for analysis
to be obtained from buccal swabs or fingerprints, which contain DNA-containing
skin cells =
and oils that are naturally transferred during contact.
Further information regarding techniques for using SNPs in forensic/human
identification applications can be found in, for example, Current Protocols in
Human Genetics, John Wiley & Sons, N.Y. (2002), 14.1-14.7.
VARIANT PROTEINS, ANTIBODIES,
= VECTORS & HOST CELLS, & USES THEREOF
Variant Proteins Encoded by SNP-Containing Nucleic Acid Molecules
88
CA 02826522 2014-01-22
The present invention provides SNP-containing nucleic acid molecules, many of
which
encode proteins having variant amino acid sequences as compared to the art-
known (i.e., wild-
type) proteins. Amino acid sequences encoded by the polymorphic nucleic acid
molecules of the
present invention are provided as SEQ ID NOS:15-28 in Table 1 and the Sequence
Listing. These
variants will generally be referred to herein as variant
proteins/peptides/polypeptides, or
polymorphic proteins/peptides/polypeptides of the present invention. The terms
"protein",
"peptide", and "polypeptide" are used herein interchangeably.
A variant protein of the present invention may be encoded by, for example, a
nonsynonymous nucleotide substitution at any one of the cSNP positions
disclosed herein. In
addition, variant proteins may also include proteins whose expression,
structure, and/or
function is altered by a SNP disclosed herein, such as a SNP that creates or
destroys a stop
codon, a SNP that affects splicing, and a SNP in control/regulatory elements,
e.g. promoters,
enhancers, or transcription factor binding domains.
As used herein, a protein or peptide is said to be "isolated" or "purified"
when it is
substantially free of cellular material or chemical precursors or other
chemicals. The variant
proteins of the present invention can be purified to homogeneity or other
lower degrees of purity.
The level of purification will be based on the intended use. The key feature
is that the preparation
allows for the desired function of the variant protein, even if in the
presence of considerable
amounts of other components.
As used herein, "substantially free of cellular material" includes
preparations of the variant
protein having less than about 30% (by dry weight) other proteins (L e.,
contaminating protein),
less than about 20% other proteins, less than about 10% other proteins, or
less than about 5% other
proteins. When the variant protein is recombinantly produced, it can also be
substantially five of
culture medium, i.e., culture medium represents less than about 20% of the
volume of the protein
preparation.
The language "substantially free of chemical precursors or other chemicals"
includes
preparations of the variant protein in which it is separated from chemical
precursors or other
chemicals that are involved in its synthesis. In one embodiment, the language
"substantially free
of chemical precursors or other chemicals" includes preparations of the
variant protein having less
than about 30% (by dry weight) chemical precursors or other chemicals, less
89
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
than about 20% chemical precursors or other chemicals, less than about 10%
chemical
prectirsors or other chemicals, or less than about 5% chemical precursors or
other chemicals.
An isolated variant protein may be purified from cells that naturally express
it,
purified from cells that have been altered to express it (recombinant host
cells), or
synthesized using known protein synthesis methods. For example, a nucleic acid
molecule
containing SNP(s) encoding the variant protein can be cloned into an
expression vector, the
expression vector introduced into a host cell, and the variant protein
expressed in the host
cell. The variant protein can then be isolated from the cells by any
appropriate purification
scheme using standard protein purification techniques. Examples of these
techniques are
.10 described in detail below (Sambrook and Russell, 2000, Molecular
Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).
- The present invention provides isolated variant proteins that
comprise,
consist of or consist essentially of amino acid sequences that contain one or
more variant amino acids encoded by one or more codons which contain a
SNP of the present invention.
Accordingly, the present invention provides variant proteins that consist of
amino
- acid sequences that contain one or more amino acid polymorphisms (or
truncations or
extensions due to creation or destruction of a stop codon, respectively)
encoded by the SNPs
provided in Table 1 and/or Table 2. A protein consists of an amino acid
sequence when the
amino acid sequence is the entire amino acid sequence of the protein.
The present invention further provides variant proteins that consist
essentially of
amino acid sequences that contain one or more amino acid polymorphisms (or
truncations or
extensions due to creation or destruction of a stop codon, respectively)
encoded by the SNPs
provided in Table 1 and/or Table 2. A protein consists essentially of an amino
acid
sequence when such an amino acid sequence is present with only a few
additional amino
acid residues in the final protein.
The present invention further provides variant proteins that comprise amino
acid
sequences that contain one or more amino acid polymorphisms (or truncations or
extensions
due to creation or destruction of a stop codon, respectively) encoded by the
SNPs provided =
in Table 1 and/or Table 2. A protein comprises an amino acid sequence when the
amino
acid sequence is at least part of the final amino acid sequence of the
protein. In such a
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
fashion, the protein may contain only the variant amino acid sequence or have
additional
amino acid residues, such as a contiguous encoded sequence that is naturally
associated with
it or heterologous amino acid residues. Such a protein can have a few
additional amino acid.
residues or can comprise many more additional amino acids. A brief description
of how
various types of these proteins can be made and isolated is provided below.
The variant proteins of the present invention can be attached to heterologous
= sequences to form chimeric or fusion proteins. Such chimeric and fusion
proteins
comprise a variant protein Operatively linked to a heterologous protein having
an amino
= acid sequence not substantially homologous to the variant protein.
"Operatively linked" ,
indicates that the coding sequences for the variant protein and the
heterologous protein
are ligated in-frame. The heterologous protein can be fused to the N-terminus
or C-
terminus of the variant protein. In another embodiment, the fusion protein is
encoded by
a fusion polpucleotide that is synthesized by conventional techniques
including
automated DNA synthesizers. Alternatively, PCR amplification of gene fragments
can
be carried out using anchor primers which give rise to complementary overhangs
between
two consecutive gene fragments which can subsequently be annealed and re-
amplified to
, generate a chimeric gene sequence (see Ausubel et al., Current Protocols in
Molecular .
Biology, 1992). Moreover, many expression vectors are commercially available
that
=, already encode a fusion moiety (e.g., a psi' protein). A variant protein-
encoding nucleic
acid can be cloned into such an expression vector such that the fusion moiety
is linked in-
frame to the variant protein.
In many uses, the fusion protein does not affect the activity of the variant
protein.
The fusion protein can include, but is not limited to, enzymatic fusion
proteins, for example,
beta-galactosidase fusions, yeast two-hybrid GAL fusions, poly-His fusions,
MYC-tagged, =
HI-tagged and Ig fusions. Such fusion proteins, particularly poly-His fusions,
can facilitate
their purification following recombinant expression. In certain host cells
(e.g., mammalian
host cells), expression and/or secretion of a protein can be increased by
using a heterologous
signal sequence. Fusion proteins are further described in, for example, Terpe,
"Overview of
tag protein fusions: from molecular and biochemical fundamentals to commercial
systems",
Appl Microbiol Biotechnol. 2003 Jan;60(5):523-33. Epub 2002 Nov 07; Graddis et
al.,
'Designing proteins that work using recombinant technologies", Curr Phann
Biotechnol.
91
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
=
2002 Dec;3(4):285-97; and Nilsson et al., "Affinity fusion strategies for
detection;
purification, and immobilization of recombinant proteins", Protein Expr Punf.
1997
Oct;11(1):1-16.
The present invention also relates to further obvious variants of the variant
=
polypeptides of the present invention, such as naturally-occurring mature
forms (e.g.,
alleleic variants), non-naturally occurring recombinantly-derived variants,
and orthologs and
paralogs of such proteins that share sequence homology. Such variants can
readily be =
- generated using art-known techniques in the fields of recombinant nucleic
acidtechnology
and protein biochemistry. It is understood, however, that variants exclude
those known in =
the prior art before the present invention.
Further variants of the variant polypeptides disclosed in Table 1 can comprise
an
amino acid sequence that shares at least 70-80%, 80-85%, 85-90%, 91%, 92%,
93%,
94%, 95%, 96%, 97%, 98%, or 99% sequence identity with an amino acid sequence
disclosed in Table 1 (or a fragment thereof) and that includes a novel amino
acid residue
(allele) disclosed in Table 1 (which is encoded by a novel SNP allele). Thus,
an aspect of
the present invention that is specifically contemplated are polypeptides that
have a certain
degree of sequence variation compared with the .polypeptide sequences shown in
Table 1,
= but that contain a novel amino acid residue (allele) encoded by a novel
SNP allele
= disclosed herein. In other words, as long as a polypeptide contains a
novel amino acid
residue disclosed herein, other portions of die polypeptide that flank the
novel amino acid
residue can vary to some degree from the polypeptide sequences shown in Table
1.
Full-length pre-processed forms, as well as mature processed forms, of
= proteins that comprise one of the amino acid sequences disclosed herein
can
readily be identified as having complete sequence identity to one of the
variant proteins of the present invention as well as being encoded by the
same genetic locus as the variant proteins provided herein.
Orthologs of a variant peptide can readily be identified as having some degree
of
= significant sequence homology/identity to at least a portion of a variant
peptide as well as
being encoded by a gene from another organism. Preferred orthologs will be
isolated from
non-human mammals, preferably primates, for the development of human
therapeutic
targets and agents. Such orthologs can be encoded by a nucleic acid sequence
that
92
CA 02826522 2013-08-13
WO 2005/111241 PCT/11S2005/016051
hybridizes to a variant peptide-encoding nucleic acid molecule under moderate
to
stringent conditions depending on the degree of relatedness of the two
organisms yielding
the homologous proteins.
Variant proteins include, but are not limited to, proteins containing
deletions,
additions and substitutions in the amino acid sequence caused by the SNPs of
the present
invention. One class of substitutions is conserved amino acid substitutions in
which a given
amino acid in a polypeptide is substituted for another amino acid of like
characteristics. =
Typical conservative substitutions are replacements, one for another, among
the aliphatic
amino acids Ala, Val, Leu, and Be; interchange of the hydroxyl residues Ser
and Thr;
exchange of the acidic residues Asp and Glu; substitution between the amide
residues Asn
and Gin; exchange of the basic residues Lys and Arg; and replacements among
the aromatic =
residues Phe and Tyr. Guidance concerning which amino acid changes are likely
to be
. phenotypically silent are found in, for example, Bowie et al., Science
247:1306-1310
(1990).
= -
Variant proteins can be fully functional or can lack function in one or more
activities, e.g. ability to bind another molecule, ability to catalyze a
substrate, ability to
mediate signaling, etc. Fully functional variants typically contain only
conservative .
variations or variations in non-critical residues or in non-critical regions.
Functional
variants can also contain substitution of similar amino acids that result in
no change or an .
insignificant change in function. Alternatively, such substitutions may
positively or
negatively affect function to some degree. Non-functional variants typically
contain one
or more non-conservative amino acid substitutions, deletions, insertions,
inversions,
truncations or extensions, or a substitution, insertion, inversion, or
deletion of ,a critical
residue or in a critical region.
Amino acids that are essential for function of a protein can be identified by
methods
known in the art, such as site-directed mutagenesis or alanine-scanning
mutagenesis
(Cunningham et al., Science 244:1081-1085 (1989)), particularly using the
amino acid
sequence and polymorphism information provided in Table 1. The latter
procedure
introduces single alanine mutations at every residue in the molecule. The
resulting mutant
molecules are then tested for biological activity such as enzyme activity or
in assays such as
an in vitro proliferative activity. Sites that are critical for binding
partner/substrate binding
93
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
can also be determined by structural analysis such as crystallization, nuclear
magnetic
resonance or photoaffmity labeling (Smith et al., J. Mot. Biol. 224:899-
904(1992); de Vos
et aL Science 255:306-312(1992)).
Polypeptides can contain amino acids other than the 20 amino acids commonly
referred to as the 20 naturally occurring amino acids. Further, many amino
acids,
including the terminal amino acids, may be modified by natural processes, such
as
. processing and other post-translational modifications, or by chemical
modification
techniques well known in the art. Accordingly, the variant proteins of the
present
= invention also encompass derivatives or analogs in which a substituted
amino acid
10.residue is not one encoded by the genetic code, in which a substituent
group is included,
in which the mature polypeptide is fused with another compound, such as a
compound to
increase the half-life of the polypeptide (e.g., polyethylene glycol), or in
which additional
= amino acids are fused to the mature polypeptide, such as a leader or
secretory sequence or
a sequence for purification of the mature polypeptide or a pro-protein
sequence.
Known protein modifications include, but are not limited to, acetylation,
acylation,
ADP-ribosylation, amidation, covalent attachment of Ravin, covalent attachment
of a heme
= moiety, covalent attachment of a nucleotide or nucleotide derivative,
covalent attachment of =
a lipid or lipid derivative, covalent attachment of phosphotidylinositol,
cross-linking,
cyclization, disulfide bond formation, clemethylation, formation of covalent
crosslinks,
formation of cysiine, formation of pyroglutamate, formylation, gamma
carboxylation,
glycosylation, GPI anchor formation, hydroxylation, iodination, methylation,
rnyristoylation, oxidation; proteolytic processing, phosphorylation,
prenylation,
racemization, selenoylation, saltation, transfer-RNA mediated addition of
amino acids to
proteins such as arginylation, and ubiquitination.
Such protein modifications are well known to those of skill in the art and
have been
described in great detail in the scientific literature. Several particularly
common
modifications, glycosylation, lipid attachment, sulfation, gamma-carboxylation
of glutamic
acid residues, hydroxylation and ADP-ribosylation, for instance, are described
in most basic
texts, such as Proteins - Structure and Molecular Properties, 2nd Ed., T.E.
Creighton, W. H.
Freeman and Company, New York (1993); Wold, F., Posttranslational Covalent
Modification of Proteins, B.C. Johnson, Ed., Academic Press, New York 1-12
(1983);
94
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
Seifter et aL, Meth. Enzymol. 182: 626-646(1990); and Rattan et al., Ann. N.Y.
Acad. Sci.
663:48-62 (1992).
The present invention further provides fragments of the variant proteins in
which the
fragments contain one or more amino acid sequence variations (e.g.,
substitutions, or
truncations or extensions due to creation or destruction of a stop codon)
encoded by one or
=
more SNPs disclosed herein. The fragments to which the invention pertains,
however, are
=
not to be construed as encompassing fragments that have been disclosed in the
prior art . =
.- 'before the present invention. =
As used herein, a fragment may comprise at least about 4, 8, 10, 12, 14, 16,
18,20; ==
25, 30,50, 100 (or any other number in-between) or more contiguous amino acid
residues
from a variant protein, wherein at least one amino acid residue is affected by
a SNP of the
present invention, e.g., a variant amino acid residue encoded by a
nonsynonymous
=-= = nucleotide substitution at a cSNP position provided by the present
invention. The variant .
= amino acid encoded by a cSNP may occupy any residue position along the
sequence of the
fragment. Such fragments can be chosen based on the ability to retain one or
more of the
= biological activities of the variant protein or the ability to perform a
function, e.g., act as an
= immtnogen. Particularly important fragments are biologically.active
fragments. Such
fragments will typically comprise a domain or motif of a variant protein of
the present
= -= invention, e.g., active site, transmembrane domain, or
ligand/substratehinding domain.
Other fragments include, but are not limited to, domain or motif-containing
fragments,
soluble peptide fragments, and fragments containing immunogenic structures.
Predicted
domains and functional sites are readily identifiable by computer programs
well known to
= those of skill in the art (e.g., PROS1TE analysis) (Current Protocols.in
Protein Science, .
John Wiley & Sons, N.Y. (2002)).
Uses of Variant Proteins
The variant proteins of the present invention can be used in a variety
of ways, including but not limited to, in assays to determine the biological
activity of a variant protein, such as in a panel of multiple proteins for
high-
throughput screening; to raise antibodies or to elicit another type of immune
response; as a reagent (including the labeled reagent) in assays designed to
= 95
CA 02826522 2014-01-22
quantitatively determine levels of the variant protein (or its binding
partner) in biological
fluids; as a marker for cells or tissues in which it is preferentially
expressed (either
constitutively or at a particular stage of tissue differentiation or
development or in a disease
state); as a target for screening for a therapeutic agent; and as a direct
therapeutic agent to be
administered into a human subject. Any of the variant proteins disclosed
herein may be
developed into reagent grade or kit format for commercialization as research
products.
Methods for performing the uses listed above are well known to those skilled
in the art (see,
e.g., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory
Press,
Sambrook and Russell, 2000, and Methods in Enzymology: Guide to Molecular
Cloning
Techniques, Academic Press, Berger, S. L. and A. R. Kimmel eds., 1987).
In a specific embodiment of the invention, the methods of the present
invention include
detection of one or more variant proteins disclosed herein. Variant proteins
are disclosed in
Table 1 and in the Sequence Listing as SEQ ID NOS: 15-28. Detection of such
proteins can be
accomplished using, for example, antibodies, small molecule compounds,
aptamers,
ligands/substrates, other proteins or protein fragments, or other protein-
binding agents.
Preferably, protein detection agents are specific for a variant protein of the
present invention
and can therefore discriminate between a variant protein of the present
invention and the wild-
type protein or another variant form. This can generally be accomplished by,
for example,
selecting or designing detection agents that bind to the region of a protein
that differs between
the variant and wild-type protein, such as a region of a protein that contains
one or more amino
acid substitutions that is/are encoded by a non-synonymous cSNP of the present
invention, or a
region of a protein that follows a nonsense mutation-type SNP that creates a
stop codon thereby
leading to a shorter polypeptide, or a region of a protein that follows a read-
through mutation-
type SNP that destroys a stop codon thereby leading to a longer polypeptide in
which a portion
of the polypeptide is present in one version of the polypeptide but not the
other.
In another specific aspect of the invention, the variant proteins of the
present invention are
used as targets for diagnosing liver fibrosis or for determining
predisposition
96
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
tq liver fibrosis in a human. Accordingly, the invention provides methods for
detecting the
presence of, or levels of, one or more variant proteins of the present
invention in a cell,
tissue, or organism. Such methods typically involve contacting a test sample
with an agent =
(e.g., an antibody, small molecule compound, or peptide) capable of
interacting with the
variant protein such that specific binding of the agent to the variant protein
can be detected.
Such an assay can be provided in a single detection format or a multi-
detection format such
as an array, for example, an antibody or aptamer array (arrays for protein
detection may also
be referred to as "protein chips"). The variant protein of interest can be
isolated from a test
sample and assayed for the presence of a variant amino acid sequence encoded
by one or
more SNPs disclosed by the present invention. The SNPs may cause changes to
the protein
and the corresponding protein function/activity, such as through non-
synonymous -
substitutions in protein coding regions that can lead to amino acid
substitutions, deletions,
insertions, and/or rearrangements; formation or destruction of stop codons; or
alteration of
control elements such as promoters. SNPs may also cause inappropriate post-
translational
modifications.
One preferred agent for detecting a variant protein in a sample is an antibody
capable of selectively binding to a variant form of the protein (antibodies
are described in
greater detail in the next section). Such samples include, for example,
tissues, cells, and
biological fluids isolated from a subject, as well as tissues, cells and
fluids present within a
subject.
In vitro methods for detection of the variant proteins associated with liver
fibrosis =
that are disclosed herein and fragments thereof include, but are not limited
to; enzyme linked
immunosorbent assays (ELISAs), radioimmunoassays (R1A), Western blots,
immunoprecipitations, immunofluorescence, and protein arrays/chips (erg.,
arrays of
. antibodies or aptamers). For further information regarding immunoassays and
related
protein detection methods, see Current Protocols in Immunology, John Wiley &
Sons, N.Y.,
and Hage, "Immunoassays", Anal Chem. 1999 Jun 15;71(12):294R-304R.
Additional analytic methods of detecting amino acid variants include, but are
not
limited to, altered electrophoretic mobility, altered tryptic peptide digest,
altered protein
activity in cell-based or cell-free assay, alteration in ligand or antibody-
binding pattern,
altered isoelectric point, and direct amino acid sequencing.
97
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
Alternatively, variant proteins can be detected in vivo in a subject by
introducing
I
into the subject a labeled antibody (or other type of detection reagent)
specific for a variant
protein. For example, the antibody can be labeled with a radioactive marker
whose presence
and location in a subject can be detected by standard imaging techniques.
Other uses of the variant peptides of the present invention are based on the
class
. or action of the protein. For example, proteins isolated from humans and
their
mammalian orthologs serve as targets for identifying agents (e.g., small
molecule drugs
-= or antibodies) for use in therapeutic applications, particularly for
modulating a biological
. or pathological response in a cell or tissue that expresses the protein.
Pharmaceutical
agents can be developed that modulate protein activity. =- .
As an alternative to modulating gene expression, therapeutic compounds can be
developed that modulate protein function. For example, many SNPs disclosed
herein affect
= the amino acid sequence of the encoded protein (e.g., non-synonymous
cSNPs and nonsense
mutation-type SNPs). Such alterations in the encoded amino acid sequence may
affect =
protein function, particularly if such amino acid sequence variations occur in
functional
protein domains, such as catalytic domains, ATP-binding domains, or
ligand/substrate
binding domains. It is well established in the art that variant proteins
having amino acid
= sequence variations in functional domains can cause or influence
pathological conditions.
In such instances, compounds (e.g., small molecule drugs or antibodies) canhe
developed
that target the variant protein and modulate (e.g., up- or down-regulate)
protein
= function/activity.
=
The therapeutic methods of the present invention further include
methods that target one or more variant proteins of the present invention.
Variant proteins can be targeted using, for example, small molecule
compounds, antibodies, aptamers, ligands/substrates, other proteins, or other
protein-binding agents. Additionally, the skilled artisan will recognize that
the novel protein variants (and polyworphic nucleic acid molecules) disclosed
in Table 1 may themselves be directly used as therapeutic agents by acting as
competitive inhibitors of corresponding art-known proteins (or nucleic acid
molecules such as raRNA molecules).
98
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
' The variant proteins of the present invention are particularly useful in
drug screening
assays, in cell-based or cell-free systems. Cell-based systems can utilize
cells that naturally
express the protein, a biopsy specimen, or cell cultures. In one embodiment;
cell-based
assays involve recombinant host cells expressing the variant protein. Cell-
free assays can be
used to detect the ability of a compound to directly bind to a variant protein
or to the =
corresponding SNP-contsining nucleic acid fragment that encodes the variant
protein.
A variant protein of the present invention, as well as appropriate fragments
thereof,
can be used in high-throughput screening assays to test candidate compounds
for the ability
to bind and/or modulate the activity of the variant protein. These candidate
compounds can
be further screened against a protein having normal function (e.g., a wild-
type/non-variant
;protein) to further determine the effect of the compound on the protein
activity.
,Furthermore, these compounds can be tested in animal or invertebrate systems
to determine =
in vivo activity/effectiveness. Compounds can be identified that activate
(agonists) or.
inactivate (antagonists) the variant protein, and different compounds can be
identified that
cause various degrees of activation or inactivation of the variant protein.
Further, the variant proteins can be used to screen a compound for the ability
to
. stimulate or inhibit interaction between the variant protein and a target
molecule that =
'normally interacts with the protein. The target can be a ligand, a substrate
or a binding
partner that the protein normally interacts with (for example, epinephrine or.
norepinephrine). Such assays typically include the steps of combining the
variant protein
with a candidate compound under conditions that allow the variant protein, or
fragment
thereof, to interact with the target molecule, and to detect the formation of
a complex =
between the protein and the target or to detect the biochemical consequence of
the
= interaction with the variant protein and the target, such as any of the
associated effects of
signal transduction.
Candidate compounds include, for example, 1) peptides such as soluble
peptides,
including Ig-tailed fusion peptides and members of random peptide libraries
(see, e.g., Lam
et al., Nature 354:82-84 (1991); Houghten et al., Nature 354:84-86 (1991)) and
combinatorial chemistry-derived molecular libraries made of D- and/or L-
configuration
amino acids; 2) phosphopeptides (e.g., members of random and partially
degenerate,
directed phosphopeptide libraries, see, e.g., Songyang et al., Cell 72:767-778
(1993)); 3)
99
CA 02826522 2015-11-24
antibodies (e.g., polyclonal, monoclonal, humanized, anti-idiotypic, chimeric,
and single
Chain antii)odies as well as Fab, F(a1)2, Fab expression library fragments,
and epitope-
binding fragments of antibodies); and 4) small organic and inorganic molecules
(e.g.,
molecules obtained from combinatorial and natural product libraries).
One candidate compound is a soluble fragment of the variant protein that
competes
for ligand binding. Other candidstr compounds include mutant proteins or
appropriate
fragments containing mutations that affect variant protein function and thus
compete for
ligand. Accordingly, a fragment that competes for ligand, for example with a
higher
= affinity, or a fragment that binds ligand but does not allow release, is
encompassed by the
invention.
The invention further includes other end point assays to identify compounds
that
modulate (stimulate or inhibit) variant protein activity. The assays typically
involve an
= assay of events in the signal transduction pathway that indicate protein
activity. Thus, the =
expression of genes that are up or down-regulated in response to the variant
protein
dependent signal cascade can be assayed. = In one embodiment, the regulatory
region of such
=
- genes can be operably linked to a marker that is easily detectable, such as
luciferase.
Alternatively, phosphorylation of the variant protein, or a variant protein
target, could also .
be measured. Any of the biological or biochemical functions mediated by the
variant
protein can be used as an endpoint assay. These include all of the biochemical
or biological
events described herein, in the references cited herein, for these
endpoint assay targets, and other functions known to those of ordinary skill
in the art.
Binding and/or activating compounds can also be screened by using chimeric
variant
proteins in which an amino terminal extracellular domain or parts thereof, an
entire
transmembrane domain or subregions, and/or the carboxyl terminal intracellular
domain or=
parts thereof, can be replaced by heterologous domains or subregions. For
example, a
substrate-binding region can be used that interacts with a different substrate
than that which
is normally recognized by a variant protein. Accordingly, a different set of
signal
transduction components is available as an end-point assay for activation.
This allows for
assays to be performed in other than the specific host cell from which the
variant protein is
derived.
100
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
The variant proteins are also useful in competition binding assays in methods
,
designed to discover compounds that interact with the variant protein. Thus, a
compound
can be exposed to a variant protein under conditions that allow the compound
to bind or to ,
otherwise interact with the variant protein. A binding partner, such as
ligand, that normally
interacts with the variant protein is also added to the mixture. If the test
compound interacts
with the variant protein or its binding partner, it decreases the amount of
complex formed or
= activity from the variant protein. This type of assay is particularly
useful in screening for
compounds that interact with specific regions of the variant protein (Hodgson,
Bio I technology, 1992, Sept 10(9), 973-80).
To perform cell-free drug screening assays, it is sometimes desirable to
immobilize
either the variant protein or a fragment thereof, or its target molecule, to
facilitate separation
of complexes from uncomplexed forms of one or both of the proteins, as well as
to
accommodate automation of the assay. Any method for immobilizing proteins on
matrices
= can be used in drug screening assays. In one embodiment, a fusion protein
containing an
added domain allows the protein to be bound to a matrix. For example,.
glutathione-S-
= transferase/125I fusion proteins can be adsorbed onto glutathione
sepharose beads (Sigma
= Chemical, St. Louis, MO) or glutathione derivatized microtitre
plates, which are then =
combined with the cell lysates (e.g., 35S-labeled) and a candidate compound,
such as a drug =
' candidate, and the mixture incubated under conditions conducive to complex
formation
(e.g., at physiological conditions for salt and pH). Following incubation, the
beads.can be =
= washed to remove any unbound label, and the matrix immobilized and
radiolabel
determined directly, or in the supernatant after the complexes are
dissociated. Alternatively,
the complexes can be dissociated from the matrix, separated by SDS-PAGE, and
the level of
bound material found in the bead fraction quantitated from the gel using
standard =
electrophoretic techniques.
Either the variant protein or its target molecule can be immobilized utilizing
conjugation of biotin and streptavidin. Alternatively, antibodies reactive
with the variant
protein but which do not interfere with binding of the variant protein to its
target molecule
can be derivatized to the wells of the plate, and the variant protein trapped
in the wells by
antibody conjugation. Preparations of the target molecule and a candidate
compound are
incubated in the variant protein-presenting wells and the amount of complex
trapped in the
101
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
well can be quantitated. Methods for detecting such complexes, in addition to
those
described above for the GST-immobilized complexes, include immunodetection of
= complexes using antibodies reactive with the protein target molecule, or
which are reactive
with variant protein and compete with the target molecule, and enzyme-linked
assays that
rely on detecting an enzymatic activity associated with the target molecule.
=
Modulators of variant protein activity identified according to these .
drug screening assays can be used to treat a subject with a disorder mediated
by the protein pathway, such as liver fibrosis. These methods of treatment=
typically include the steps of administering the modulators of protein
activity
in a pharmaceutical composition to a subject in need of such treatment.
The variant proteins, or fragments thereof, disclosed herein can -
themselves be directly used to treat a disorder characterized by an absence
of,
inappropriate, or unwanted expression or activity of the variant protein.
Accordingly, methods for treatment include the use of a variant protein
= 15 disclosed herein or fragments thereof.
In yet another aspect of the invention, variant proteins can be used as
"bait proteins" in a two-hybrid assay or three-hybrid assay (see, e.g., U .S .
= Patent No. 5,283,317; Zervos et at. (1993) Cell 72:223-232; Madura et at.
(1993) J. Biol. Chem. 268:12046-12054; Bartel et al. (1993) Biotechniques
14:920-924; Iwabuchi et at. (1993) Oncogene 8:1693-1696; and Brent
W094/10300) to identify other proteins that bind to or interact with the
variant protein and are involved in variant protein activity. Such variant =
protein-binding proteins are also likely to be involved in the propagation of.
signals by the variant proteins or variant protein targets as, for example,
elements of a protein-mediated signaling pathway. Alternatively, such
variant protein-binding proteins are inhibitors of the variant protein.
The two-hybrid system is based on the modular nature of most
transcription factors, which typically consist of separable DNA-binding and
activation domains. Briefly, the assay typically utilizes two different DNA
constructs. In one construct, the gene that codes for a variant protein is
102
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
fused to a gene encoding the DNA binding domain of a known transcription
factor (e.g., GAL-4). In the other construct, a DNA sequence, from a library
of
DNA sequences, that encodes an unidentified protein ("prey" or "sample") is
fused to a gene that codes for the activation domain of the known
transcription factor. If the "bait" and the "prey" proteins are able to
interact,
in vivo, forming' a variant Protein-dependent complex, the DNA-binding .and
' activation domains of the transcription factor are brought into close
proximity. This proximity allows transcription of a reporter gene (e.g., LacZ)
that is operably linked to a-transcriptional regulatory site responsive to the
transcription factor. Expression of the reporter gene can be detected, and
cell .
colonies containing the functional transcription factor can be isolated and
used to obtain the cloned gene that encodes the protein that interacts with =
the variant protein. =
Antibodies Directed to Variant Proteins =
The present invention also provides antibodies that selectively bind to the
variant
= = proteins disclosed herein and fragments thereof. Such antibodies may
be used to
quantitatively or qualitatively detect the variant proteins of the present
invention. As
used herein, an antibody selectively binds a target variant protein when it
binds the variant -
protein and does not significantly bind to non-variant proteins, i.e., the
antibody does not
significantly bind to normal, wild-type, or art-known proteins that do not
contain a variant
amino acid sequence due to one or more SNPs of the present invention (variant
amino acid
sequences may be due to, for example, nonsynonymous cSNPs, nonsense SNPs that
create a
stop codon, thereby causing a truncation of a polypeptide or SNPs that cause
read-through
mutations resulting in an extension of a polypeptide).
As used herein, an antibody is defined in terms consistent with that
recognized in the
art: they are multi-subunit proteins produced by an organism in response to an
antigen
challenge. The antibodies of the present invention include both monoclonal
antibodies and
polyclonal antibodies, as well as antigen-reactive proteolytic fragments of
such antibodies,
such as Fab, F(ab)'2, and Fv fragments. In addition, an antibody of the
present invention
further includes any of a variety of engineered antigen-binding molecules such
as a chimeric
103
CA 02826522 2013-08-13
WO 2005/111241
PCT/1JS2005/016051
antibody (U.S. Patent Nos. 4,816,567 and 4,816,397; Morrison et al., Proc.
Natl. Acad. Sci. -
USA, 81:6851, 1984; Neuberger et aL, Nature 312:604, 1984), a humanized
antibody (U.S.
Patent Nos. 5,693,762; 5,585,089; and 5,565,332), a single-chain Fv (U.S.
Patent No.
4,946,778; Ward et al., Nature 334:544, 1989), a bispecific antibody with two
binding
specificities (Segal et al., J. ImmunoL Methods 248:1, 2001; Carter, J.
ImmunoL Methods.
248:7, 2001), a diabody, a triabody, and a tetrabody (Todorovska et al., J.
ImmunoL =
Methods, 248:47,2001), as well as a Fab conjugate (dimer or trimer), and a
minibody.
Many methods are known in the art for generating and/or identifying antibodies
to a
given target antigen (Harlow, Antibodies, Cold Spring Harbor Press, (1989)).
In general, an
isolated peptide (e.g., a variant protein of the present invention) is used as
an immunogen
and is administered to a mammalian organism, such as a rat, rabbit, hamster or
mouse.
Either a full-length protein, an antigenic peptide fragment (e.g., a peptide
fragment
containing a region that varies between a variant protein and a corresponding
wild-type
protein), or a fusion protein can be used. A protein used as an immunogen may
be =
naturally-occurring, synthetic or recombinantly produced, and may be
administered in
combination with an adjuvant, including but not limited to, Freund's (complete
and
incomplete), mineral gels such as aluminum hydroxide, surface active substance
such as
lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole
limpet
hemocyanin, dinitrophenol, and the like.
Monoclonal antibodies can be produced by hybridoma technology (Kohler and =
Milstein, Nature, 256:495, 1975), which immortalizes cells secreting a
specific
monoclonal antibody. The immortalized cell lines can be created in vitro by
fusing two =
different cell types, typically lymphocytes, and tumor cells. The hybridoma
cells may be
cultivated in vitro or in vivo. Additionally, fully human antibodies can be
generated by =
transgenic animals (He et al., .I. Immunol., 169:595, 2002). Fd phage and Pd
phagernid
technologies may be used to generate and select recombinant antibodies in
vitro
(Hoogenboom and Chames, ImmunoL Today 21:371, 2000; Liu et al., .1. MoL Biol.
315:1063, 2002). The complementarity-determining regions of an antibody can be
identified, and synthetic peptides corresponding to such regions may be used
to mediate
antigen binding (U.S. Patent No. 5,637,677).
104
CA 02826522 2013-08-13
W02005/111241 PCT/US2005/016051
Antibodies are preferably prepared against regions or discrete fragments of a
,
variant protein containing a variant amino acid sequence as compared to the
corresponding wild-type protein (e.g., a region of a variant protein that
includes an amino
acid encoded by a nonsynonymous cSNP, a region affected by truncation caused
by a
nonsense SNP that creates a stop codon, or a region resulting from the
destruction of a
stop codon due to read-through mutation caused by a SNP). Furthermore,
preferred
= regions
will include those involved in function/activity and/or protein/binding
partner = =
= interaction. Such fragments can be selected on a physical property, such
as fragments
= corresponding to regions that are located on the surface of the protein,
e.g., hydrophilic =
regions, or can be selected based on sequence uniqueness, or based on the
position of the =
variant amino acid residue(s) encoded by the SNPs provided by the present
invention. An
antigenic fragment will typically comprise at least about 8-10 contiguous
amino acid
residues in which at least one of the amino acid residues is an amino acid
affected by a SNP =
disclosed herein. The antigenic peptide can comprise, however, at least 12,
14, 16, 20,25,
= 15 50, 100 (or any other number in-between) or more amino acid residues,
provided that at
= = least one amino acid is affected by a SNP disclosed herein.
Detection of an antibody of the present invention can be facilitated by
coupling.(i.e.,
physically linking) the antibody or an antigen-reactive fragment thereof to a
detectable =
substance. Detectable substances include, but are not limited to, various
enzymes, prosthetic.
groups, fluorescent materials, luminescent materials, bioluminescent
materials, and
radioactive materials. Examples of suitable enzymes include horseradish
peroxidase,
alkaline phosphatase, P-galactosidase, or acetylcholinesterase; examples of
suitable
prosthetic group complexes include streptavidin/biotin and aviciin/biotin;
examples of
suitable fluorescent materials include umbelliferone, fluorescein, fluorescein
isothiocyanate,
rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an
example of a luminescent material includes luminol; examples of bioluminescent
materials
include luciferase, luciferin, and aequorin, and examples of suitable
radioactive material
include 1251, 1311, "S or 311. =
Antibodies, particularly the use of antibodies as therapeutic agents, are
reviewed in:
Morgan, "Antibody therapy for Alzheimer's disease", Expert Rev Vaccines. 2003
Feb;2(1):53-9; Ross et al., "Anticancer antibodies", Am J Clin Pathol. 2003
105
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
Apr;119(4):472-85; Goldenberg, "Advancing role of radiolabeled antibodies in
the therapy
of cancer", Cancer Immunol Immunother. 2003 May;52(5):281-96. Epub 2003 Mar
11;
Ross et aL, "Antibody-based therapeutics in oncology", Expert Rev Anticancer
Ther. 2003
Feb;3(1):107-21; Cao et aL, "Bispecific antibody conjugates in therapeutics",
Adv Drug
Deliv Rev. 2003 Feb 10;55(2):171-97; von Mehren et aL, "Monoclonal antibody
therapy for
µ. cancer", Armu Rev Med. 2003;54:343-69. Epub 2001 Dec 03; Hudson et al.,
"Engineered
antibodies", Nat Med. 2003 Jan;9(1):129-34; Brekke et al., "Therapeutic
antibodies for
human diseases at the dawn of the twenty-first century", Nat Rev Drug Discov.
2003 =
= . Jan;2(1):52-62 (Erratum in: Nat Rev Drug Discov. 2003 Mar;2(3):240);
Houdebine, '
"Antibody manufacture in transgenic animals and comparisons with other
systems",,Curr
= Opin Biotechnol. 2002 Dec;13(6):625-9; Andreakos et al., "Monoclonal
antibodies in
= immune and inflammatory diseases", Gun- Opin-Biotechnol. 2002
Dec;13(6):615-20;
. Kellermann et al., "Antibody discovery: the use of transgenic mice to
generate human
monoclonal antibodies for therapeutics", Gun- Opin Biotechnol..2002
Dec;13(6):593-7; Pini =
et at., "Phage display and colony filter screening for high-throughput
selection of antibody
libraries", Comb Chem High Throughput Screen. 2002 Nov;5(7):503-10; Batra et
at.,
= "Pharmacokinetics= and biodistribution of genetically engineered
antibodies", =Curr Opin
- BiotechnoL 2002 Dec;13(6):603-8; and Tangri et at., "Rationally engineered
proteins or
antibodies with absent or reduced immunogenicity", Gun -Med Chem. 2002
- 20 Dec;9(24):2191-9.
= Uses of Antibodies .
Antibodies can be used to isolate the variant proteins of the present
invention from a
natural cell source or from recombinant host cells by standard techniques,
such as affinity =
chromatography or immunoprecipitation. In addition, antibodies are useful for
detecting the
presence of a variant protein of the present invention in cells or tissues to
determine the
pattern of expression of the variant protein among various tissues in an
organism and over
the course of normal development or disease progression. Further, antibodies
can be used to
detect variant protein in situ, in vitro, in a bodily fluid, or in a cell
lysate or supernatant in
order to evaluate the amount and pattern of expression. Also, antibodies can
be used to
assess abnormal tissue distribution, abnormal expression during development,
or expression
106
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
in an abnormal condition, such as liver fibrosis. Additionally, antibody
detection of
circulating fragments of the full-length variant protein can be used to
identify turnover.
Antibodies to the variant proteins of the present invention are also useful in
=
pharraacogenomic analysis. Thus, antibodies against variant proteins encoded
by alternative
SNP alleles can be used to identify individuals that require modified
treatment modalities.
Further, antibodies can be used to assess expression of the variant protein in
disease
states such as in active stages of the disease or in an individual with a
predisposition to a
= disease related to the protein's function, particularly liver fibrosis.
Antibodies specific for a
variant protein encoded by a SNP-containing nucleic acid molecule of the
present invention
can be used to assay for the presence of the, variant protein, such as to
screen for
predisposition to liver fibrosis as indicated by the presence of the variant
protein.
Antibodies are also useful as diagnostic tools for evaluating the variant
proteins in = 1
= conjunction with analysis by electrophoretic mobility, isoelectric point,
tryptic peptide
digest, and other physical assays well known in the art. =
. 15. Antibodies are also useful for tissue typing. Thus, where a
specific variant protein
has been correlated with expression in a specific tissue, antibodies that are
specific for this
= protein can be used
to identify a tissue type. =
Antibodies can also be used to assess aberrant subcellular localization of a
variant
protein in cells in various tissues. The diagnostic uses can be applied, not
only in genetic .
testing, but also in monitoring a treatment modnlity. Accordingly, where
treatment is
= ultimately aimed at correcting the expression level or the presence of
variant protein or
aberrant tissue distribution or developmental expression of a variant protein,
antibodies
= directed against the variant protein or relevant fragments can be used to
monitor therapeutic
efficacy.
.25 , The antibodies are also useful for inhibiting variant protein
function, for example, by
blocking the binding of a variant protein to a binding partner. These uses can
also be
applied in a therapeutic context in which treatment involves inhibiting a
variant protein's
function. An antibody can be used, for example, to block or competitively
inhibit binding,
thus modulating (agonizing or antagonizing) the activity of a valiant protein.
Antibodies
can be prepared against specific variant protein fragments containing sites
required for
function or against an intact variant protein that is associated with a cell
or cell membrane.
107
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
For in vivo administration, an antibody may be linked with an additional
therapeutic payload
sudh is a rclionuclide, an enzyme, an immunogenic epitope, or a cytptoxic
agent. Suitable
cytotmdc agents include, but are not limited to, bacterial toxin such as
diphtheria, and plant
toxin such as ricin: The in vivo half-life of an antibody or a fragment
thereof may be
lengthened by pegylation through conjugation to polyethylene glycol (Leong et
al., Cytokine
16:106,2001).
The invention also encompasses kits for using antibodies, such as kits for
detecting
= the presence of a variant protein in a test sample. An exemplary kit can
comprise antibodies
such as a labeled or labelable antibody and a compound or agent for detecting
variant
proteins in a biological sample; means for determining the amount, or
presence/absence of
variant protein in the sample; means for comparing the amount of variant
protein in the
sample with a standard; and instructions for use. =
=
Vectors and Host Cells
. The present invention also provides vectors containing the SNP-
containing nucleic
acid molecules described herein. The term "vector" refers to a vehicle,
preferably a nucleic
acid molecule, which can transport a.SNP-containing nucleic acid molecule.
When the
= vector is a nucleic acid molecule, the SNP-containing nucleic acid
molecule can be
covalently linked to the vector nucleic acid. Such vectors include, but are
not limited to, a -=
plasmid, single or double stranded phage, a single or double stranded RNA or
DNA viral
vector, or artificial chromosome, such as a BAC, PAC, YAC, or MAC.
A vector can be maintained in a host cell as an extra.chromosomal element
where it =
replicates and produces additional copies of the SNP-containing nucleic acid
molecules.
Alternatively, the vector may integrate into the host cell genome and produce
additional
copies of the SNP-containing nucleic acid molecules when the host cell
replicates.
The invention provides vectors for the maintenance (cloning vectors) or
vectors for
expression (expression vectors) of the SNP-containing nucleic acid molecules.
The vectors
can function in prokaryotic or eukaryotic cells or in both (shuttle vectors).
Expression vectors typically contain cis-acting regulatory regions that are
operably
linked in the vector to the SNP-containing nucleic acid molecules such that
transcription of
the SNP-containing nucleic acid molecules is allowed in a host cell. The SNP-
containing
108
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
nucleic acid molecules can also be introduced into the host cell with a
separate nucleic acid
,
molecule capable of affecting transcription. Thus, the second nucleic acid
molecule may
provide a trans-acting factor interacting with the cis-regulatory control
region to allow =
transcription of the SNP-containing nucleic acid molecules from the vector.
Alternatively, a
trans-acting factor may. be supplied by the host cell. Finally, a trans-acting
factor can be
produced from the vector itself. It is understood, however, that in some
embodiments,
transcription and/or translation of the nucleic acid molecules can occur in a
cell-free system.
The regulatory sequences to which the SNP-containing nucleic acid molecules,
=
described herein an be operably linked include promoters for directing mRNA =
transcription. These include, but are not limited to, the left promoter from
bacteriophage X,
the lac, TRP, and TAC promoters from E. coli, the early and late promoters
from SV40, the =
CMV immediate early promoter, the adenovirus early and late promoters, and
retrovirus
long-terminal repeats.
In addition to control regions that promote transcription, expression vectors
may also
include regions that modulate transcription, such as repressor binding sites
and enhancers.
Examples include the SV40 enhancer, the cytomegalovirus immediate early
enhancer,
= polyoma enhancer, adenovirus enhancers, and retrovirus LTR enhancers.
In addition to containing sites for transcription initiation and control,
expression
vectors can also contain sequences necessary for transcription termination
and, in the
transcribed region; a ribosome-binding site for translation. Other regulatory
control
elements for expression include initiation and termination codons as well as
polyadenylation
signals. A person of ordinary skill in the art would be aware of the numerous
regulatory
sequences that are useful in expression vectors (see, e.g., Sambrook and
Russell, 2000,
Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press,
Cold
Spring Harbor, NY).
A variety of expression vectors can be used to express a SNP-containing
nucleic
acid molecule. Such vectors include chromosomal, episornal, and virus-derived
vectors, for
example, vectors derived from bacterial plasmids, from bacteriophage, from
yeast episomes,
from yeast chromosomal elements, including yeast artificial chromosomes, from
viruses
such as baculoviruses, papovaviruses such as SV40, Vaccinia viruses,
adenoviruses,
poxviruses, pseudorabies viruses, and retroviruses. Vectors can also be
derived from
109
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
combinations of these sources such as those derived from plasmid and
bacteriophage genetic
,
elements, e.g., cosmids and phagemids. Appropriate cloning and expression
vectors for
prokaryotic and eukaryotic hosts are described in Sambrook and Russell, 2000,
Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor,
NY.
The regulatory sequence in a vector may provide constitutive expression in one
or
more host cells (e.g., tissue specific expression) or may provide for
inducible expression in
one or more cell types such as by temperature, nutrient additive, or exogenous
factor, e.g., a
hormone or other ligand. A variety of vectors that provide constitutive or
inducible
expression of a nucleic acid sequence in prokaryotic and eukaryotic host cells
are well
known to those of ordinary skill in the art. V=
= A SNP-containing nucleic acid molecule can be inserted into the vector by
methodology well-known in the art. Generally, the SNP-containing nucleic acid
molecule
that will ultimately be expressed is joined to an expression vector by
cleaving the SNP-
containing nucleic acid molecule and the expression vector with one or more
restriction
enzymes and then ligating the fragments together. Procedures for restriction
enzyme
digestion and ligation are well known to those of ordinary skill in the art.
= =
The vector containing the appropriate nucleic acid molecule can be introduced
into
an appropriate host cell for propagation or expression using well-known
techniques.
Bacterial host cells include, but are not limited to, E. coil, Streptomyces,
and Salmonella
typhimurium. Eukaryotic host cells include, but are not limited to, yeast,
insect cells such as
Drosophila, animal cells such as COS and CHO cells, and plant cells. =
V=
As described herein, it may be desirable to express the variant peptide as a
fusion =
protein. Accordingly, the invention provides fusion vectors that allow for the
production of
the variant peptides. Fusion vectors can, for example, increase the expression
of a
recombinant protein, increase the solubility of the recombinant protein, and
aid in the
purification of the proteinby acting, for example, as a ligand for affinity
purification. A
proteolytic cleavage site may be introduced at the junction of the fusion
moiety so that the
desired variant peptide can ultimately be separated from the fusion moiety.
Proteolytic
enzymes suitable for such use include, but are not limited to, factor Xa,
thrombin, and
enterokinase. Typical fusion expression vectors include pGEX (Smith et al.,
Gene 67:31-40
=
110
CA 02826522 2013-08-13
WO 2005/111241 PCT/U52005/016051
= (1988)), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia,
Piscataway,
NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or
protein A,
= respectively, to the target recombinant protein. Examples of suitable
inducible non-fusion
E. coil expression vectors include pTrc (Amann et al., Gene 69:301-315 (1988))
and pET .
lid (Studier et al., Gene Expression Technology: Methods in Enzymology 185:60-
89
(1990)).
Recombinant protein expression can be maximized in a bacterial host by
providing a =
genetic background wherein the host cell has an impaired capacity to
proteolytically cleave
= the recombinant protein (Gottesman, S., Gene Expression Technology:
Methods in
Enzymology 185, Academic Press, San Diego, California (1990).119-128).
Alternatively, .
the sequence of the SNP-containing nucleic acid molecule of interest can be
altered to-
provide preferential codon usage for-a specific host cell, for example, E.
coil (Wada et at.,
= Nucleic Acids Res. 20:2111-2118
(1992)). = =
The SNP-containing nucleic acid molecules can also be expressed by expression
= .
vectors that are operative in yeast. Examples of vectors for expression in
yeast (e.g., S.
cerevisiae) include pYepSecl (Baldari, et al., EMBO J. 6:229-234 (1987)), pMFa
(Kurjan et
al., Cell 30:933-943(1982)), pJRY88 (Schultz et al., Gene 54:113-123 (1987)),
and pYES2 =
- . (lnvitrogen Corporation, San Diego, CA).
= The
SNP-containing nucleic acid molecules can also be expressed in insect cells
=
' 20 :using, for example, baculovirus expression vectors. Baculovirus
vectors available for=
expression of proteins in cultured insect cells (e.g., Sf 9 cells) include the
pAc series (Smith -
et al., Mol. Cell Biol. 3:2156-2165 (1983)) and the pVL series (Lucldow et
at., Virology
170:31-39 (1989)).
= In certain embodiments of the invention, the SNP-containing nucleic acid
molecules
described herein are expressed in mammalian cells using mammalian expression
vectors.
Examples of mammalian expression vectors include pCDM8 (Seed, B. Nature
329:840(1987)) and pMT2PC (Kaufman et al., EMBO T. 6:187-195 (1987)).
The invention also encompasses vectors in which the SNP-containing nucleic
acid
molecules described herein are cloned into the vector in reverse orientation,
but operably
linked to a regulatory sequence that permits transcription of antisense RNA.
Thus, an .
antisense transcript can be produced to the SNP-containing nucleic acid
sequences described
111
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/(J16051
herein, including both coding and non-coding regions. Expression of this
antisense RNA is
subject to each of the parameters described above in relation to expression of
the sense RNA
(regulatory sequences, constitutive or inducible expression, tissue-specific
expression).
The invention also relates to recombinant host coils containing the vectors
described
=
herein. Host cells therefore include, for example, prokaryotic cells, lower
eukaryotic cells
such as yeast, other eukaryotic cells such as insect cells, and higher
eukaryotic cells such as
mammalian cells. =
The recombinant host cells can be prepared by introducing the vector
constructs
described herein into the cells by techniques readily available to persons of
ordinary skill in
the art. These include, but are not limited to, calcium phosphate
transfection, DEAE- =
dextran-mediated transfection, cationic lipid-mediated transfection,
electroporation,
transduction, infection, lipofection, and other techniques such as those
described in
Sambrook and Russell, 2000, Molecular Cloning: A Laboratory Manual, Cold
Spring
Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NY).
Host cells can contain more than one vector. Thus, different SNP-containing
=
nucleotide sequences can be introduced in different vectors into the same
cell. Similarly, the
SNP-containing nucleic acid molecules can be introduced either alone or with
other nucleic
acid molecules that are not related to the SNP-containing nucleic acid
molecules,-such as =
those providing trans-acting factors for expression vectors. When more than
one vector is
=
introduced into a cell, the vectors can be introduced independently, co-
introduced, or joined
to the nucleic acid molecule vector.
In the case of bacteriophage and viral vectors, these can be introduced into
cells as
packaged or encapsulated virus by standard procedures for infection and
transduction. Viral
vectors can be replication-competent or replication-defective. In the case in
which viral
replication is defective, replication can occur in host cells that provide
functions that
complement the defects.
Vectors generally include selectable markers that enable the selection of the
subpopulation of cells that contain the recombinant vector constructs. The
marker can be
inserted in the same vector that contains the SNP-containing nucleic acid
molecules
described herein or may be in a separate vector. Markers include, for example,
tetracycline
or ampicillin-resistance genes for prokaryotic host cells, and dihydrofolate
reductase or
112
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
neomycin resistance genes for eukaryotic host cells. However, any marker that
provides
selection for a phenotypic trait can be effective.
While the mature variant proteins can be produced in bacteria, yeast,
mammalian
cells, and other cells under the control of the appropriate regulatory
sequences, cell-free
transcription and translation systems can also be used to produce these
variant proteins using =
RNA derived from the DNA constructs described herein.
Where secretion of the variant protein is desired, which is difficult to
achieve with
= multi-transmembrane domain containing proteins such as G-protein-coupled
receptors
= . (GPCRs), appropriate secretion signals can be incorporated into the
vector. The signal .
sequence can be endogenous to the peptides or heterologous to these peptides. -
. .
Where the variant protein is not secreted into the medium, the protein can be
isolated .
from the host cell by standard disruption procedures, including freeze/thaw,
sonication,
mechanical disruption, use of lysing agents, and the like. The variant protein
can then be
recovered and purified by well-known purification methods including, for
example, . =
. 15 ammonium sulfate precipitation, acid extraction, anion or cationic
exchange
" chromatography, phosphocellulose chromatography, hydrophobic-interaction
=
. chromatography, affinity chromatography; hydroxylapatite chromatography,
lectin
. chromatography, or high performance liquid chromatography. = =
It is also understood that, depending upon the host cell in which
= 20 recombinant production of the variant proteins described herein
occurs, they
can have various glycosylation patterns, or may be non-glycosylated, as when
produced in bacteria. In addition, the variant proteins may include an initial
= modified methionine in some cases as a result of a host-mediated process.
For further information regarding vectors and host cells, see Current
25 Protocols in Molecular Biology, John Wiley & Sons, N.Y.
Uses of Vectors and Host Cells, and Transgenic Animals
Recombinant host cells that express the variant proteins described herein have
a
variety of uses. For example, the cells are useful for producing a variant
protein that can be
30 further purified into a preparation of desired amounts of the variant
protein or fragments
113
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
thereof. Thus, host cells containing expression vectors are useful for variant
protein
production.
Host cells are also useful for conducting cell-based assays involving the
variant protein or variant protein fragments, such as those described above
as well as other formats known in the art. Thus, a recombinant host cell
expressing a variant protein is useful for assaying compounds that stimulate
or inhibit variant protein function. 'Such an ability of a compound to
modulate variant protein function may not be apparent from assays of the
compound on the native/wild-type protein, or from cell-free assays of the
compound. Recombinant host cells are also useful for assaying functional =
alterations in the variant proteins as compared with a known function.
Genetically-engineered host cells can be further used to produce non-human
transgenic animals. A transgenic animal is preferably a non-human mammal, for
example, a .
rodent, such as a rat or mouse, in which one or more of the cells of the
animal include a
transgene. A transgene is exogenous DNA containing a SNP of the present
invention which
is integrated into the genome of a cell from which a transgenic animal
develops and which,
remains in the genome of the mature animal in one or more of its cell types or
tissues. Such
animals are useful for studying the function of a variant protein in vivo, and
identifying and
evaluating modulators of variant protein activity. Other examples of
transgenic animals
include, but are not limited to, non-human primates, sheep, dogs, cows',
goats, chickens, and
amphibians. Transgenic non-human mammals such as cows and goats can be used to
produce variant proteins which can be secreted in the animal's milk and then
recovered.
A transgenic animal can be produced by introducing a SNP-containing nucleic
acid =
molecule into the male pronuclei of a fertilized oocyte, e.g., by
microinjection or retroviral
infection, and allowing the oocyte to develop in a pseudopregnant female
foster animal.
Any nucleic acid molecules that contain one or more SNPs of the present
invention can
potentially be introduced as a transgene into the genome of a non-human
animal.
Any of the regulatory or other sequences useful in expression vectors can form
part
of the transgenic sequence. This includes intronic sequences and
polyadenylation signals, if
not already included. A tissue-specific regulatory sequence(s) can be operably
linked to the
transgene to direct expression of the variant protein in particular cells or
tissues.
114
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
Methods for generating transgenic animals via embryo manipulation and =
microinjection, particularly animals such as mice, have become conventional in
the art and
are described in, for example, U.S. Patent Nos. 4,736,866 and 4,870,009, both
by Leder et -
al., U.S. Patent No. 4,873,191 by Wagner et al., and in Hogan, B.,
Manipulating the Mouse
Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).
Similar
methods are used for production of other transgenic animals. A transgenic
founder animal
can be identified based upon the presence of the transgene in its genome
and/or expression
of transgenic mRNA in tissues or.cells of the animals. A transgenic founder
animal can then
be used to breed additional animals carrying the transgene. Moreover,
transgenic animals =
carrying a transgene can further be bred to other transgenic animals carrying
other
transgenes. A transgenic animal also includes a non-human animal in which the
entire
animal or tissues in the animal have been produced using the homologously
recombinant
host cells described herein. =
=
In another embodiment, transgenic non-human animals can be produced which
contain selected systems that allow for regulated expression of the transgene.
One example
of such a system is the cre/loxP recombinase system of bacteriophage P1
(Lalcso et al. PNAS
89:6232-6236 (1992)). Another example of a recombinase system is the FLP
recombinase
system of S. cerevisiae (O'Gorman et al. Science 251:1351-1355 (1991)). If a
cre/loxP
recombinase system is used to regulate expression of the transgene, animals
containing
transgenes encoding both the Cre recombinase and a selected protein are
generally needed. =
Such animals can be provided through the construction. of "double" transgenic
animals, e.g.,
by mating two transgenic animals, one containing a transgene encoding a
selected variant .
protein and the other containing a transgene encoding a recombinase.
Clones of the non-human transgenic animals described herein can also be
produced
according to the methods described in, for example, Wilmut, I. et al. Nature
385:810-813
(1997) and PCT International Publication Nos. WO 97/07668 and WO 97/07669. In
brief, a
cell (e.g., a somatic cell) from the transgenic animal can be isolated and
induced to exit the
growth cycle and enter Go phase. The quiescent cell can then be fused, e.g.,
through the use
of electrical pulses, to an enucleated oocyte from an animal of the same
species from which
the quiescent cell is isolated. The reconstructed oocyte is then cultured such
that it develops
to morula or blastocyst and then transferred to pseudopregnant female foster
animal. The
115
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
offspring born of this female foster animal will be a clone of the animal from
which the cell
(e.g., a somatic cell) is isolated.
Transgenic animals containing recombinant cells that express the variant
proteins -
described herein are useful for conducting the assays described herein in an
in vivo context. =
Accordingly, the various physiological factors that are present in vivo and
that could =
influence ligand or substrate binding, variant protein activation, signal
transduction, or other
processes or interactions, may not be evident from in vitro cell-free or cell-
based assays.
Thus; non-human transgenic animals of the present invention may be used to
assay in vivo =
variant protein function as well as the activities of a therapeutic agent or
compound that =
modulates variant protein function/activity or expression. Such animals 'are
also suitable for
= assessing the effects of null mutations (i.e., mutations that
substantially or completely =
eliminate one or more variant protein functions).
For further information regarding transgenic animals, see Houdebine, "Antibody
manufacture in transgenic animals and comparisons with other systems", Curr
Opin
Biotechnol. 2002 Dec;13(6):625-9; Petters et at., "Transgenic animals as
models for human
disease", Transgenic Res. 2000;9(4-5):347-51; discussion 345-6; Wolf et al.,
"Use of
transgenic animals in understanding molecular mechanisms of toxicity", J Pharm
Pharmacol. 1998 Jun;50(6):567-74; Echelard, "Recombinant protein production in
transgenic animals", Curr Opin Blotechnol. 1996 Oct;7(5):536-40; Houdebine,
"Transgenic
animal bioreactors", Transgenic Res. 2000;9(4-5):305-20; Pirity et at.,
"Embryonic stem .
cells, creating transgenic animals", Methods Cell Biol. 1998;57:279-93; and
Robl et al.,
"Artificial chromosome vectors and expression of complex proteins in
transgenic =animals'
,
The riogenology. 2003 Jan 1;59(1):107-13:.
-COMPUTER-RELATED EMBODIMENTS
The SNPs provided in the present invention may be "provided" in a variety of
mediums to facilitate use thereof. As used in this section, "provided" refers
to a
manufacture, other than an isolated nucleic acid molecule, that contains SNP
information
of the present invention. Such a manufacture provides the SNP information in a
form
that allows a skilled artisan to examine the manufacture using means not
directly
applicable to examining the SNPs or a subset thereof as they -exist in nature
or in purified
116
CA 02826522 2014-01-22
form. The SNP information that may be provided in such a form includes any of
the SNP
information provided by the present invention such as, for example,
polymorphic nucleic acid
and/or amino acid sequence information such as SEQ ID NOS:1-14, SEQ ID NOS:15-
28, SEQ
ID NOS:43-50, SEQ ID NOS:29-42, and SEQ ID NOS:51-58; information about
observed SNP
alleles, alternative codons, populations, allele frequencies, SNP types,
and/or affected proteins;
or any other information provided by the present invention in Tables 1-2
and/or the Sequence
Listing.
In one application of this embodiment, the SNPs of the present invention can
be
recorded on a computer readable medium. As used herein, "computer readable
medium" refers
to any medium that can be read and accessed directly by a computer. Such media
include, but
are not limited to: magnetic storage media, such as floppy discs, hard disc
storage medium, and
magnetic tape; optical storage media such as CD-ROM; electrical storage media
such as RAM
and ROM; and hybrids of these categories such as magnetic/optical storage
media. A skilled
artisan can readily appreciate how any of the presently known computer
readable media can be
used to create a manufacture comprising computer readable medium having
recorded thereon a
nucleotide sequence of the present invention. One such medium is provided with
the present
application, namely, the present application contains computer readable medium
(CD-R) that
has nucleic acid sequences (and encoded protein sequences) containing SNPs
provided/recorded thereon in ASCII text format in a Sequence Listing along
with
accompanying Tables that contain detailed SNP and sequence information
(transcript
sequences are provided as SEQ ID NOS:1-14, protein sequences are provided as
SEQ ID
NOS:15-28, genomic sequences are provided as SEQ ID NOS:43-50, transcript-
based context
sequences are provided as SEQ ID NOS:29-42, and genomic-based context
sequences are
provided as SEQ ID NOS:51-58).
As used herein, "recorded" refers to a process for storing information on
computer
readable medium. A skilled artisan can readily adopt any of the presently
known methods for
recording information on computer readable medium to generate manufactures
comprising the
SNP information of the present invention.
A variety of data storage structures are available to a skilled artisan for
creating a
computer readable medium having recorded thereon a nucleotide or amino acid
sequence
117
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
of the present invention. The choice of the data storage structure will
generally be based
on the means chosen to access the stored information. In addition, a variety
of data =
processor programs and formats can be used to store the nucleotide/amino acid
sequence
information of the present invention on computer readable medium. For example,
the
sequence information can be represented in a word processing text file,
formatted in
= . commercially-available software such as WordPerfect and Microsoft
Word, represented
- in the form of an ASCII file, or stored in a database application, such
as 0B2, Sybase,
=.: Oracle, or the like. A skilled artisan can readily adapt any number of
data processor
. structuring formats (e.g., text file or database) in order to obtain
computer readable
' medium having recorded thereon the SNP information of the present invention.
= By providing the SNPs of the present invention in computer readable form,
a
skilled artisan can routinely access the SNP information for a variety of
purposes.
Computer software is publicly available which allows a skilled artisan to
access sequence
- information provided in a computer readable medium. Examples of publicly
available
computer software include BLAST (Altschul et al., J. Mol. Biol. 215:403-410
(1990))
and BLAZE (Brutlag et aL, Comp. Chem. 17:203-207 (1993)) search algorithms.
The present invention further provides systems, particularly computer-based
. systems, which contain the SNP information described herein. Such systems
may be
designed to store and/or analyze information on, for example, a large number
of SNP = '
positions, or information on SNP genotypes from a large number of individuals.
The
SNP information of the present invention represents a valuable information
source. The
SNP information of the present invention stored/analyzed in a computer-based
system
may be used for such computer-intensive applications as determining or
analyzing SNP
allele frequencies in a population, mapping disease genes, genotype-phenotype
association studies, grouping SNPs into haplotypes, correlating SNP haplotypes
with
response to particular drugs, or for various other bioinformatic,
pharmacogenomic, drug
development, or human identification/forensic applications.
As used herein, "a computer-based system" refers to the hardware means,
software means, and data storage means used to analyze the SNP information of
the
present invention. The minimum hardware means of the computer-based systems of
the
present invention typically comprises a central processing unit (CPU), input
means,
118
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
output means, and data storage means. A skilled artisan can readily appreciate
that any
one of the currently available computer-based systems are suitable for use in
the present
invention. Such a system can be changed into a system of the present invention
by
utilizing the SNP information provided on the CD-R, or a subset thereof,
without any
experimentation. =
As stated above, the computer-based systems of the present invention comprise
a
data storage means having stored therein SNPs of the present invention and the
necessary
= =
hardware means and software means for supporting and implementing a search
means. =
As used herein, "data storage means" refers to memory which can store SNP
information
of the present invention, or a memory access means which can access
manufactures
= having recorded thereon the SNP information of the present invention.
= As used herein, "search means" refers to one or more programs or
algorithms that =
= are
implemented on the computer-based system to identify or analyze SNPs in a
target = = =
sequence based on the SNP information stored within the data storage means.
Search :
means can be used to determine which nucleotide is present at a particular SNP
position
= in the target sequence. As used herein, a "target sequence" can be any
DNA sequence .
- containing the SNP position(s) to be searched or queried.
= As used herein, "a target structural motif," or "target motif," refers to
any
rationally selected sequence or combination of sequences containing a SNP
position in
which the sequence(s) is chosen based on a three-dimensional configuration
that is
formed upon the folding of the target motif. There are a variety of target
motifs known in
the art. Protein target motifs include, but are not limited to, enzymatic
active sites and =
= = signal sequences. Nucleic acid target motifs include, but are not
limited to, promoter =
sequences, hairpin structures, and inducible expression elements (protein
binding
= 25 sequences). =
A variety of structural formats for the input and output means can be used to
input
and output the information in the computer-based systems of the present
invention. An
exemplary format for an output means is a display that depicts the presence or
absence of
specified nucleotides (alleles) at particular SNP positions of interest. Such
presentation
can provide a rapid, binary scoring system for many SNPs simultaneously.
119
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
One exemplary embodiment of a computer-based system comprising SNP
µ1
information of the present invention is provided in Figure 1. Figure 1
provides a block
diagram of a computer system 102 that can be used to implement the present
invention.
The computer system 102 includes a processor 106 connected to a bus 104. Also
connected to the bus 104 are a main memory 108 (preferably implemented as
random
access memory, RAM) and a variety of secondary storage devices 110, such as a
hard
drive 112 and a removable medium storage device 114. The removable medium
storage =
device 114 may represent, for example, a floppy disk drive, a CD-ROM drive, a
magnetic
tapedrive, etc. A removable storage medium 116 (such as a floppy disk, a
compact disk,
a magnetic tape, etc.) containing control logic and/or data recorded therein
may be
inserted into the removable medium storage device 114. The computer system 102
includes appropriate software for reading the control logic and/or the data
from the
= removable storage medium 116 once inserted in the removable medium
storage device
= 114.
= The SNP information of the present invention may be stored in a
well:known
= manner in the main memory 108, any of the secondary storage devices 110,
and/or a
removable storage medium 116. Software for accessing and processing the SNP
information (such as SNP scoring tools, search tools, comparing tools, etc.)
preferably
resides in main memory 108 during execution.
EXAMPLES
The following examples are offered to illustrate, but not to limit the claimed
invention.
STATISTICAL ANALYSIS OF SNP ASSOCIATION WITH LIVER
FIBROSIS IN =HCV-INFECTED INDIVIDUALS
Example 1:
A case-control genetic study was performed to determine the association of
SNPs
in the human genome with liver fibrosis and in particular the increased or
decreased risk
of developing bridging fibrosis/cirrhosis, and the rate of progression of
fibrosis in HCV
infected patients. The study involved genotyping SNE's in DNA samples obtained
from
120
CA 02826522 2014-01-22
>500 HCV-infected patients. The study population came from 2 clinic sites, the
University of
California, San Francisco (UCSF) and Stanford University (Stanford). Among the
435 patients
from UCSF, the percentage for minimal, moderate, and severe fibrosis was 46%,
26%, and
28%, respectively, which reflects the distribution of HCV patients in their
clinics. The 100
samples obtained from Stanford were intentionally collected on extreme cases,
and therefore
comprised 62% minimal fibrosers and 38% severe fibrosers. Samples were divided
into a case
group or a control group. The cases comprised those samples obtained from
individuals
determined to have severe fibrosis (bridging fibrosis/cirrhosis) and the
controls comprised
those samples obtained from individuals with minimal and moderate fibrosis.
The stage of
fibrosis in each individual was determined according to the system of Batts et
al., Am J. Surg.
Pathol. 19:1409-1417 (1995) as reviewed by Brunt Hepatology 31:241-246 (2000).
All
patients who donated samples had signed informed, written consent, and the
study protocols
were approved by the respective Institutional Review Boards (IRB).
DNA was extracted from individual blood samples using conventional DNA
extraction
methods or by using commercially available kits according to manufacturer's
suggested
conditions, such as the Q1A-amp kit from Qiagen (Valencia, CA). SNP markers in
the
extracted DNA samples were analyzed by genotyping using primers such as those
presented in
Table 5. While some samples were individually genotyped, the same samples and
any
remaining samples were also used for pooling studies, in which DNA samples
from about 50
individuals were pooled and allele frequencies were obtained using a PRISM
7900 HT
Sequence Detection System (Applied Biosystems, Foster City, CA) by kinetic
allele-specific
PCR similar to the method described by Germer et al., Genome Research 10:258-
266 (2000).
The results of statistical analysis of association of a SNP with a decreased
risk of
developing bridging fibrosis/cirrhosis are presented in Table 4. For
statistical analysis, the
outcomes include only fibrosis stage (categorized into 0+1, 2, for controls
and 3+4 for cases)
(and identified as "stage" in Table 4). Genotypes were categorized into
ordinal (three groups,
including major homozygotes, heterozygotes, and minor homozygotes) as well as
using a
dominant model assumption (two groups, including major homozygotes versus
heterozygotes +
minor homozygotes). Multiple logistic regression as well as
121
CA 02826522 2013-08-13
WO 2005/111241 PCT/US2005/016051
proportional logistic regression analysis was used to generate age-adjusted
odds ratios
and 95% confidence intervals to assess the association between the genotypes
and
fibrosis stage. All reported p-values are two-sided. =
A marker having an odds ratio (OR) < 1.0 is protective (e.g., an individual is
less
likely to develop severe liver fibrosis), whereas a marker having an odds
ratio (OR) > 1.0
is associated with an increased risk (e.g., an individual is more likely to
develop severe
liver fibrosis). =
Among the 120 SNPs tested in the two sample sets, hCV11638783 is a marker
,=that is associated with decreased risk for severe fibrosis. hCV11638783 is a
replicated
marker because it shows significant association with severe fibrosis in both
the.UCSF
and Stanford sample sets(p-values of 0.0014 and 0.0175 respectively in the
ordinal
analyses and 0..0055 and 0.0071 respectively in the dominant analyses). The
odds ratio in =
. both sample sets was less than 1.0 (in the UCSF sample set, for ordinal,
the odds ratio -
was 0.583 for fibrosis stage, and, for dominant, the odds ratio was 0.586 for
fibrosis
stage. In the Stanford sample set, for ordinal, the odds ratio was 0.408 for
fibrosis stage;
in "Sample Set 2", for dominant, the odds ratio was 0.291 for fibrosis stage).
Thus, this
SNP may be used to identify individuals with a decreased risk of developing
fibrosis,
= especially bridging fibrosis/cirrhosis.
Example 2 =
=
Sample Set Description =
= In a second case control study, DNA samples obtained from the University
of =
California San Francisco (UCSF) were used as a discovery sample set to
initially identify
. SNPs in association with severe =fibrosis. Among the 537 patients in the
discovery
sample set, the percentage for minimal stage 0-1, moderate stage 2, and severe
stage 3-4
fibrosers was 52%, 23%, and 25%, respectively, which reflects the typical
distribution of
HCV infected patients in clinics.
In addition sample sets were collected from 3 additional but different clinic
sites
for use in replication studies: Virginia Commonwealth University (VCU),
University of
Illinois, Chicago (UIC) and Stanford University (Stanford). Among the
approximately
483 patients in the sample set from VCU, the percentage for minimal, moderate,
and
122
CA 02826522 2013-08-13
W02005/111241
PCT/US2005/016051
severe fibrosis was approximately 18%, 34%, and 48%, respectively. Among the
115
patients in the sample set from ITIC, the percentage for minimal, moderate,
and severe
fibrosis was 29%, 30%, and 41%, respectively. Samples from the Stanford sample
set
were intentionally collected on extreme cases, which contained 62% minimal
stage 0-1
fibrosers and 38% severe stage 3-4 fibrosers. The stage of fibrosis in each
individual in
tbeVCU sample set was determined according to the system of Knodell et al.,
Hepatology 1:431-435 (1981). The stage of fibrosis in individuals in the UCSF,
UIC and
Stanford sample sets was determined according to the system of Batts et al.,
Am J. Surg.
Pathol. 19:1409-1417 (1995). Both scoring systems are reviewed by Brunt
Hepatology =
31:241-246 (2000). All patients who donated samples had signed informed,
written
consent, and the study protocols were approved by their respective IRBs. =
All patients in the sample sets met the inclusion/exclusion criteria in the
study
= .protocol as follows:
Inclusion criteria:
= Adults (Age 18 ¨ 75).
' = HCV positive patients who have undergone a full course (at least 24 weeks)
of
= Interferon (IFN) treatment (any formulation +/- ribavirin) and for whom
six month
follow-up viral load data was available/potentially available.
Exclusion criteria:
= Discontinuation of IFN treatment secondary to poor tolerance of side
effects
= Evidence of other chronic active viral hepatitis including positive
hepatitis antigen,
= Evidence of co-infection with human immunodeficiency virus (HIV), e.g.
Positive anti-
antibody.
= Evidence of other serious liver disease: e.g. Wilson's Hemachromatosis, etc
= Other serious medical conditions: Rheumatic/renal/lung diseases,
cardiovascular
disease, cancer
Additional information used for data analysis:
= Age
= Race
= Gender
= HCV genotype
= Viral load
= Ethanol use
= Intravenous drug use
= Other medications
= Exact treatment regimen
= Alanine amino transferase levels
= Response to IFN treatment
123
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
= Other medical history, including serious medical illness such as kidney
disease,
cardiovascular disease, autoimmune disease, and cancer
Pooling and whole genome scan on discovery sample set
Association of SNP alleles in the human genome with fibrosis stage in HCV
patients was tested in the discovery sample set. DNA was extracted from blood
samples
using a standard protocol or DNA extraction kits as described above. DNA
samples from
patients were pooled based on similar clinical phenotypes of the patients.
While some
samples were individually genotyped, the same samples were also used for
pooling
" = studies, in which DNA samples from about 50 individuals were pooled and
allele
= frequencies in the pools were obtained using primers such as those
presented in Table 5. =
Genotypes and pool allele frequencies were measured using a PRISM 79001fT
Sequence Detection PCR System (Applied Biosystems) by kinetic allele-specific
PCR,
similar to the method described by Germer et al. (Germer S., Holland M.J.,
Higuchi R.
2000, Genome Res. 10: 258-266).
Data analysis on whole genome scan using pooled DNA
Approximately 21,470 SNPs throughout the genome were genotyped in the
discovery sample set. Allele odds ratios and p-values were generated comparing
the
201 advanced or high fibrosis stage group (case group) (also known as bridging
fibrosis/cirrhosis) vs .medium and low groups (mild or no fibrosis) (control
group).
Results were stratified by ethnicity (all ethnic groups (A) Caucasian (C) and
other than
Caucasian (0)) for the stage outcome to assess any confounding by these
factors.
Data analysis of individual genotyping results on replication sample sets
About 175 SNPs were selected from a study using the discovery sample set based
on their association with severe fibrosis. These SNPs were then retested by
individual =
genotyping in the UCSF sample set to confirm the initial results and in the
VCU, UIC or
Stanford sample sets. The data obtained from the VCU sample set was used to
replicate
=the results obtained from the UCSF sample set. The UIC and Stanford sample
sets
provided additional replication data. The Allelic Association, Fischer Exact
Test was
used to analyze the association of a SNP with fibrosis stage. In replication
studies, a SNP
124
CA 02826522 2013-08-13
WO 2005/111241
PCT/US2005/016051
was considered a replicated marker only if it had a significant p-value <0.1
for a
particular stage in the UCSF sample set and the VCU sample set, and the Odds
Ratio
(OR) had to go in the same direction ¨ that is, the regression coefficient had
to have the
same sign in each of the UCSF and VCU sample sets. 67 markers were replicated
in
these two sample sets in showing statistically significant association with
severe fibrosis
(Table 7). For example, marker hCV7450990 is a replicated marker when all
patients as
well as patients other than Caucasian populations (but not the Caucasian only
population
were analyzed, whereas marker hCV11935588, is a replicated marker when all
patients as
well as Caucasian-only population were analyzed. Both of these SNPs are
protective.
alleles with ORs <1.
hCV7450990 a missense SNP in DDX5, which encodes a DEAD (Asp-Gin-Ala-
Asp) box polypeptide 5, and it is shown to have an association with severe
fibrosis in
both the UCSF and VCU sample sets. Previous studies in the art have shown that
this
gene is expressed in multiple tissues including the liver. A recent report
indicates that
DDX5, an RNA helicase also known as p68, interacts with HCV NS5B (HCV RNA-
dependent RNA polymerase), suggesting that DDX5 is a human cellular factor
involved
in HCV RNA replication (Goh et al., J Virol., 2004, 78: 5288-98). Therefore,
SNPs in
the DDX5 gene, particularly missense SNPs such as hCV7450990, might render a
protective effect by affecting the ability of HCV to replicate.
SNP (hCV11935588), which is located in a gene on chromosome 16, is an
example of a marker associated with severe fibrosis in Caucasians in all four
sample sets:
In addition, hCV15851335 also showed association with severe fibrosis when all
patients as well as a Caucasian-only population were analyzed in the UCSF and
VCU
sample sets (Table 7). hCV15851335 is a missense SNP in CPT1A (camitine.
palmitoyltransferase 1A, liver). CPTIA is a key enzyme in carnitine-dependent
transport
across the mitochondria' inner membrane, and its deficiency results in a
decreased rate of
fatty acid beta-oxidation, which causes fatty liver diseases.
The SNPs disclosed herein could be used to identify other markers that are
associated with and increased risk of developing bridging fibrosis/cirrhosis,
and
progression of fibrosis in HCV-infected individuals and other liver disease
patients. For
125
CA 02826522 2014-01-22
example, the markers listed in Tables 4-5 can be used to identify other
mutations (preferably
SNPs), such as those that exhibit similar or enhanced predictive value, in the
identified genes or
surrounding nucleotide sequence (e.g., 500 Kb upstream to 500 Kb downstream of
the marker)
through database searches or through sequencing of DNA samples. Specifically,
marker
hCV7450990 is an A480S change in DDX5, a DEAD-Box RNA helicase. DEAD-Box
proteins
are characterized by an Asp-Glu-Ala-Asp motif. DDX5 is located on the long arm
of
chromosome 17, 17q24.1. The sex-averaged recombination rate in the region is
estimated to be
0.6 cM/Mb. The SNP appears to fall within a region of high linkage
disequilibrium that
extends roughly 20Kb centromeric of the SNP and extends roughly 244Kb
telomeric to the
SNP. Other SNPs in these two regions may be associated with fibrosis
progression rate or
inflammation. Given the high homology within the DEAD-Box protein family, all
DEAD-box
genes and SNPs in those genes are likely to play a role in advanced fibrosis
stage.
Marker hCV11935588 is located in a gene on chromosome 16. The following genes
are
located in the region and may also play a role in advanced fibrosis stage: 1)
CTRB1
(chymotrypsinogen B1) is located within roughly 10kb of marker hCV11935588.
CTRB1 is a
zymogen secreted by the pancreas (highly expressed in the pancreas) and
cleaved by trypsin to
become a protease in the small intestine. It is also expressed in the liver.
2) BCAR1 (breast
cancer antiestrogen resistance) is within 50kb of marker hCV11935588 and is
involved in
apoptosis. 3) LDHD (lactate dehydrogenase D) is roughly 100kb away from marker
hCV11935588. LDHD is in the electron transport chain and highly expressed in
the liver. It's
also expressed in the kidneys. Two isoforms of LDHD exist. 4) KARS (lysyl-tRNA
synthetase) is within 400kb of marker hCV11935588. KARS is expressed in many
immune
cells (NK, T-cells, B cells, etc.), and is also expressed in BM tissue. A p-
value of 0.01 was
observed in Sample Set 1 at a SNP in the KARS gene. KARS has been shown to
play a role in
autoimmune diseases and is a target for autoantibodies in polymyositis and
dermatomyositis.
The SNPs disclosed herein, alone, or in combination with other risk factors,
such as age,
gender, and alcohol consumption, can provide a non-invasive test that enables
physicians to
assess the fibrosis risk in HCV-infected individuals. Such a test offers
several advantages, such
as: 1) enabling better treatment strategies (for example,
126
CA 02826522 2013-08-13
individuals with a higher fibrosis risk can be given higher priority for
treatment, while =
treatment for individuals with a lower fibrosis risk can be delayed, thereby
alleviating
them from the side effects and high cost of treatment); and 2) reducing the
need for
repeated liver biopsies for all patients. =
Furthermore, the SNPs disclosed herein could be used in diagnostic kits to
assess
the increased or decreased risk of developing bridging fibrosis/cirrhosis and
progression. =
of fibrosis for patients with other liver diseases, such as hepatitis B, any
co-infection with = = =
other viruses (such as HIV, etc.), non-alcoholic fatty liver diseases (NAFLD),
drug-
induced liver diseases, alcoholic liver diseases (ALD), primary biliary
cirrhosis (PBC), :,
primary sclerosing cholangitis (PSC), autoimmune hepatitis (AM) and
cryptogenic
cirrhosis. Depending on the genotypes of one or multiple markers disclosedin
any of -
Tables 6-7, alone or in combination with other risk factors, physicians could
categorize -
these patients into slow, median, or rapid fibrosers.
15.
L
Various modifications and variations of the described
compositions, methods and systems of the invention will be apparent to those
skilled in
the art without departing from the scope of the invention. Although the
invention has been described in connection with specific preferred embodiments
and
certain working examples, it should be understood that the invention as
claimed should
not be unduly limited to such specific embodiments. Indeed, various
modifications of the =
above-described modes for carrying out the invention that are obvious to those
skilled in
the field of molecular biology, genetics and related fields are intended to be
within the . =
scope of the following claims. =
=
127
CA 02826522 2014-01-22
Gene Number: 25
Celera Gene: hCG1810767 - 64000126973272
Celera Transcript: hCT1950036 - 64000126973273
Public Transcript Accession: NM 025225
Celera Protein: hCP1765925 - 197000069451968
Public Protein Accession: NP 079501
Gene Symbol: C22orf20
Protein Name: chromosome 22 open reading frame 20
Celera Genomic Axis: GA_x5YUV32VY8D(1403768..1440680)
Chromosome: 22
OMIM NUMBER:
OMIM Information:
Transcript SEQ ID NO: 1
Protein SEQ ID NO: 15
SNP Information:
Context (SEQ ID NO: 29):
GCATCTCTCTTACCAGAGTGTCTGATGGGGAAAACGTTCTGGIGTCTGACTTTCGGTCCAAAGACGAAGTCCTG
GATGCCTTGGTATGTTCCTGCTTCAT
CCCTTCTACAGTGGCCTTATCCCICCTTCCTTCAGAGGCGTGCGATATGTGGATGGAGGACTGAGTGACAACGT
ACCCTTCATTGATGCCAAAACAACCA
Celera SNP ID: hCV7241
SNP Position Transcript: 617
SNP Source: dbSNP
Population(Allele,Count): no pop(C,71IG,21)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 15, 148,(I,ATC) (M,ATG)
Gene Number: 51
Celera Gene: hCG27399 - 146000220312482
Celera Transcript: hCT18539 - 146000220312504
Public Transcript Accession: NM 003266
Celera Protein: hCP43686 - 197000064928737
Public Protein Accession: NP 003257
Gene Symbol: TLR4
Protein Name: toll-like receptor 4
Celera Genomic Axis: GA_x5YUV32W1V9(4596116..4621277)
Chromosome: 9
OMIM NUMBER: 603030
OMIM Information: Endotoxin hyporesponsiveness (3)
Transcript SEQ ID NO: 2
Protein SEQ ID NO: 16
SNP Information:
Context (SEQ ID NO: 30):
GCTTTTTCAGAAGTTGATCTACCAAGCCTTGAGTTTCTAGATCTCAGTAGAAATGGCTTGAGTTTCAAAGGTTG
CTGTTCTCAAAGTGATTTTGGGACAA
CAGCCTAAAGTATTTAGATCTGAGCTTCAATGGTGTTATTACCATGAGTTCAAACTTCTTGGGCTTAGAACAAC
TACAACATCTGGATTTCCAGCATTCC
Celera SNP ID: hCV11722237
SNP Position Transcript: 1429
SNP Source: Applera
Population(Allele,Count): caucasian(C,37IT,3) african
american(C,36IT,2) total(C,73IT,5)
SNP Type: Missense Mutation
128
CA 02826522 2014-01-22
Protein Coding: SEQ ID NO: 16, 399,(T,ACC) (I,ATC)
SNP Source: HGMD; dbSNP; Nickerson
Population(Allele,Count): no_pop(C,-IT,-) ; no_pop(C,-IT,-) ;
no_pop(C,436IT,26)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 16, 399,(T,ACC) (I,ATC)
Gene Number: 51
Celera Gene: hCG27399 - 146000220312482
Celera Transcript: hCT1961394 - 146000220312489
Public Transcript Accession: NM 003266
Celera Protein: hCP1774277 - 197000064928735
Public Protein Accession: NP 003257
Gene Symbol: TLR4
Protein Name: toll-like receptor 4
Celera Genomic Axis: GA_x5YUV32W1V9(4596116..4621277)
Chromosome: 9
OMIM NUMBER: 603030
OMIM Information: Endotoxin hyporesponsiveness (3)
Transcript SEQ ID NO: 3
Protein SEQ ID NO: 17
SNP Information:
Context (SEQ ID NO: 31):
GCTTTTTCAGAAGTTGATCTACCAAGCCTTGAGTTTCTAGATCTCAGTAGAAATGGCTTGAGTTTCAAAGGTTG
CTGTTCTCAAAGTGATTTTGGGACAA
CAGCCTAAAGTATTTAGATCTGAGCTTCAATGGTGTTATTACCATGAGTTCAAACTTCTTGGGCTTAGAACAAC
TAGAACATCTGGATTTCCAGCATTCC
Celera SNP ID: hCV11722237
SNP Position Transcript: 1549
SNP Source: Applera
Population(Allele,Count): caucasian(C,37IT,3) african
american(C,36IT,2) total(C,73IT,5)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 17, 359,(T,ACC) (I,ATC)
SNP Source: HGMD; dbSNP; Nickerson
Population(Allele,Count): no_pop(C,-IT,-) ; no_pop(C,-IT,-) ;
no_pop(C,436IT,26)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 17, 359,(T,ACC) (I,ATC)
Gene Number: 51
Celera Gene: hCG27399 - 146000220312482
Celera Transcript: hCT1961395 - 146000220312483
Public Transcript Accession: NM 138554
Celera Protein: hCP1774243 - 197000064928734
Public Protein Accession: NP 612564
Gene Symbol: TLR4
Protein Name: toll-like receptor 4
Celera Genomic Axis: GA_x5YUV32W1V9(4596116..4621277)
Chromosome: 9
OMIM NUMBER: 603030
OMIM Information: Endotoxin hyporesponsiveness (3)
Transcript SEQ ID NO: 4
129
CA 02826522 2014-01-22
Protein SEQ ID NO: 18
SNP Information:
Context (SEQ ID NO: 32):
GCTTTTTCAGAAGTTGATCTACCAAGCCTTGAGTTTCTAGATCTCAGTAGAAATGGCTTGAGTTTCAAAGGTTG
CIGTTCTCAAAGTGATTTTGGGACAA
CAGCCTAAAGTATTTAGATCTGAGCTTCAATGGTGTTATTACCATGAGTTCAAACTTCTTGGGCTTAGAACAAC
TAGAACATCTGGATTTCCAGCATTCC
Celera SNP ID: hCV11722237
SNP Position Transcript: 1262
SNP Source: Applera
Population(Alle1e,Count): caucasian(C,37IT,3) african
american(C,36IT,2) total(C,73IT,5)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 18, 199,(T,ACC) (I,ATC)
SNP Source: HGMD; dbSNP; Nickerson
Population(Allele,Count): no_pop(C,-IT,-) ; no_pop(C,-IT,-) ;
no_pop(C,436IT,26)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 18, 199,(T,ACC) (I,ATC)
Gene Number: 51
Celera Gene: hCG27399 - 146000220312482
Celera Transcript: hCT2316295 - 146000220312497
Public Transcript Accession: NM 138554
Celera Protein: hCP1796095 - 197000064928736
Public Protein Accession: NP 612564
Gene Symbol: TLR4
Protein Name: toll-like receptor 4
Celera Genomic Axis: GA_x5YUV32W1V9(4596116..4621277)
Chromosome: 9
OMIM NUMBER: 603030
OMIM Information: Endotoxin hyporesponsiveness (3)
Transcript SEQ ID NO: 5
Protein SEQ ID NO: 19
SNP Information:
Context (SEQ ID NO: 33):
GCTTTTTCAGAAGTTGATCTACCAAGCCTTGAGTTTCTAGATCTCAGTAGAAATGGCTTGAGTTTCAAAGGTTG
CTGTTCTCAAAGTGATTTTGGGACAA
CAGCCTAAAGTATTTAGATCTGAGCTTCAATGGTGTTATTACCATGAGTTCAAACTTCTTGGGCTTAGAACAAC
TAGAACATCTGGATTTCCAGCATTCC
Celera SNP ID: hCV11722237
SNP Position Transcript: 1382
SNP Source: Applera
Population(Allele,Count): caucasian(C,37IT,3) african
american(C,36IT,2) total(C,73IT,5)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 19, 342,(T,ACC) (I,ATC)
SNP Source: HGMD; dbSNP; Nickerson
Population(Allele,Count): no_pop(C,-IT,-) ; no_pop(C,-IT,-) ;
no pop(C,436IT,26)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 19, 342,(T,ACC) (I,ATC)
130
CA 02826522 2014-01-22
Gene Number: 53
Celera Gene: hCG27643 - 62000133384069
Celera Transcript: hCT18784 - 62000133384087
Public Transcript Accession: NM 004396
Celera Protein: hCP43680 - 197000064924833
Public Protein Accession: NP 004387
Gene Symbol: DDX5
Protein Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
Celera Genomic Axis: GA_x5YUV32W3KM(353933..374581)
Chromosome: 17
OMIM NUMBER: 180630
OMIM Information:
Transcript SEQ ID NO: 6
Protein SEQ ID NO: 20
SNP Information:
Context (SEQ ID NO: 34):
ACCTAATAACATAAAGCAAGTGAGCGACCITATCTCTGTGOTTCGTGAAGCTAATCAAGCAATTAATCCCAAGT
TGCTTCAGTTGGTCGAAGACAGAGGT
CAGGTCGTTCCAGGGGTAGAGGAGGCATGAAGGATGACCGTCGGGACAGATACTCTGCGGGCAAAAGGGGTGGA
TTTAATACCTTTAGAGACAGGGAAAA
Celera SNP ID: hCV7450990
SNP Position Transcript: 1729
SNP Source: dbSNP; Nickerson; HapMap
Population(Allele,Count): no_pop(T,172)G,12) ; no_pop(T,-)G,-) ;
no_pop(T,-IG,-)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 20, 480,(S,TCA) (A,GCA)
Gene Number: 53
Celera Gene: hCG27643 - 62000133384069
Celera Transcript: hCT1971014 - 62000133384070
Public Transcript Accession: NM 004396
Celera Protein: hCP1783369 - 197000064924832
Public Protein Accession: NP 004387
Gene Symbol: DDX5
Protein Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
Celera Genomic Axis: GA_x5YUV32W3KM(353933..374581)
Chromosome: 17
OMIM NUMBER: 180630
OMIM Information:
Transcript SEQ ID NO: 7
Protein SEQ ID NO: 21
SNP Information:
Context (SEQ ID NO: 35):
ACCTAATAACATAAAGCAAGTGAGCGACCTTATCTCTGTGCTTCGTGAAGCTAATCAAGCAATTAATCCCAAGT
TGCTTCAGTTGGTCGAAGACAGAGGT
CAGGICGTTCCAGGGGTAGAGGAGGCATGAAGGATGACCGTCGGGACAGATACTCTGCGGGCAAAAGGGGTGGA
TTTAATACCTTTAGAGACAGGGAAAA
Celera SNP ID: hCV7450990
SNP Position Transcript: 1690
SNP Source: dbSNP; Nickerson; HapMap
Population(Allele,Count): no_pop(T,172IG,12) ; no_pop(T,-IG,-) ;
no_pop(T,-)G,-)
SNP Type: Missense Mutation
131
CA 02826522 2014-01-22
Protein Coding: SEQ ID NO: 21, 480,(S,TCA) (A,GCA)
Gene Number: 67
Celera Gene: hCG37774 - 104000117648431
Celera Transcript: hCT29008 - 104000117648432
Public Transcript Accession: NM 000253
Celera Protein: hCP48619 - 197000069479734
Public Protein Accession: NP 000244
Gene Symbol: MT-g
Protein Name: microsomal triglyceride transfer protein
(large polypeptide, 88kDa)
Celera Genomic Axis: GA_x5YUV32W7K2(47612373..47673550)
Chromosome: 4
OMIM NUMBER: 157147
OMIM Information: Abetalipoproteinemia, 200100 (3)
Transcript SEQ ID NO: 8
Protein SEQ ID NO: 22
SNP Information:
Context (SEQ ID NO: 36):
CAGAGAGGAGAGAAGAGCATCTTCAAAGGAAAAAGCCCATCTAAAATAATGGGAAAGGAAAACTTGGAAGCTCT
GCAAAGACCTACGCTCCTTCATCTAA
CCATGGAAAGGTCAAAGAGTTCTACTCATATCAAAATGAGGCAGTGGCCATAGAAAATATCAAGAGAGGCCTGG
CTAGCCTATTTCAGACACAGTTAAGC
Celera SNP ID: hCV22274307
SNP Position Transcript: 469
SNP Source: Applera
Population(Allele,Count): caucasian(C,10IT,26) african
american(C,16IT,22) total(C,26IT,48)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 22, 128,(I,ATC) (T,ACC)
SNP Source: dbSNP; Nickerson
Population(Allele,Count): no_pop(T,2502IC,490) ; no_pop(T,-IC,-)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 22, 128,(I,ATC) (T,ACC)
Gene Number: 98
Celera Gene: hCG2039431 - 208000027149733
Celera Transcript: hCT2258512 - 208000027149752
Public Transcript Accession: NM 000120
Celera Protein: hC-51806343 - 208000027149691
Public Protein Accession: NP 000111
Gene Symbol: EP-H-X1
Protein Name: epoxide hydrolase 1, microsomal
(xenobiotic)
Celera Genomic Axis: GA_x5YUV32VWMC(1764047..1812133)
Chromosome: 1
OMIM NUMBER: 132810
OMIM Information: ?Fetal hydantoin syndrome (1);
Diphenylhydantoin toxicity (1);/Hyperch
olanemia, familial, 607748 (3)
Transcript SEQ ID NO: 9
Protein SEQ ID NO: 23
SNP Information:
Context (SEQ ID NO: 37):
132
CA 02826522 2014-01-22
CAGGTGGAGATTCTCAACAGATACCCTCACTTCAAGACTAAGATTGAAGGGCTGGACATCCACTTCATCCACGT
GAAGCCCCCCCAGCTGCCCGCAGGCC
TACCCCGAAGCCCTTGCTGATGGTGCACGGCTGGCCCGGCTCTTTCTACGAGTTTTATAAGATCATCCCACTCC
TGACTGACCCCAAGAACCATGGCCTG
Celera SNP ID: hCV11638783
SNP Position Transcript: 917
SNP Source: HGMD; dbSNP; Nickerson; HapMap
Population(Allele,Count): no_pop(A,-1G,-) ; no_pop(A,24881G,504) ;
no_pop(A,632,1904) ; no_pop
(A,21761G,544)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 23, 139,(H,CAT) (R,CGT)
Gene Number: 98
Celera Gene: hCG2039431 - 208000027149733
Celera Transcript: hCT2258514 - 208000027149726
Public Transcript Accession: NM 000120
Celera Protein: hCP1806345 - 208000027149688
Public Protein Accession: NP 000111
Gene Symbol: EPHX1
Protein Name: epoxide hydrolase 1, microsomal
(xenobiotic)
Celera Genomic Axis: GA_x5YUV32VWMC(1764047-1812133)
Chromosome: 1
OMIM NUMBER: 132810
OMIM Information: ?Fetal hydantoin syndrome (1);
Diphenylhydantoin toxicity (1);/Hyperch
olanemia, familial, 607748 (3)
Transcript SEQ ID NO: 10
Protein SEQ ID NO: 24
SNP Information:
Context (SEQ ID NO: 38):
CAGGTGGAGATTCTCAACAGATACCCTCACTTCAAGACTAAGATTGAAGGGCTGGACATCCACTTCATCCACGT
GAAGCCCCCCCAGCTGCCCGCAGGCC
TACCCCGAAGCCCTTGCTGATGGTGCACGGCTGGCCCGGCTCTTTCTACGAGTTTTATAAGATCATCCCACTCC
TGACTGACCCCAAGAACCATGGCCTG
Celera SNP ID: hCV11638783
SNP Position Transcript: 438
SNP Source: HGMD; dbSNP; Nickerson; HapMap
Population(Allele,Count): no_pop(A,-1G,-) ; no pop(A,24881G,504) ;
no_pop(A,632)G,1904) ; no_pop
(A,2176IG,544)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 24, 139,(H,CAT) (R,CGT)
Gene Number: 98
Celera Gene: hCG2039431 - 208000027149733
Celera Transcript: hCT2258516 - 208000027149772
Public Transcript Accession: NM 000120
Celera Protein: hCP1806342 - 208000027149690
Public Protein Accession: NP 000111
Gene Symbol: EPHX1
133
CA 02826522 2014-01-22
Protein Name: epoxide hydrolase 1, microsomal
(xenobiotic)
Celera Genomic Axis: GA_x5YUV32VWMC(1764047..1812133)
Chromosome: 1
OMIM NUMBER: 132810
OMIM Information: ?Fetal hydantoin syndrome (1);
Diphenylhydantoin toxicity (1);/Hyperch
olanemia, familial, 607748 (3)
Transcript SEQ ID NO: 11
Protein SEQ ID NO: 25
SNP Information:
Context (SEQ ID NO: 39):
CAGGTGGAGATTCTCAACAGATACCCTCACTTCAAGACTAAGATTGAAGGGCTGGACATCCACTTCATCCACGT
GAAGCCCCCCCAGCTGCCCGCAGGCC
TACCCCGAAGCCCTTGCTGATGGTGCACGGCTGGCCCGGCTCTTTCTACGAGTTTTATAAGATCATCCCACTCC
TGACTGACCCCAAGAACCATGGCCTG
Celera SNP ID: hCV11638783
SNP Position Transcript: 691
SNP Source: HGMD; dbSNP; Nickerson; HapMap
Population(Allele,Count): no_pop(A,-1G,-) ; no_pop(A,24881G,504) ;
no_pop(A,6321G,1904) ; no pop
(A,21761G,544)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 25, 139,(H,CAT) (R,CGT)
Gene Number: 98
Celera Gene: hCG2039431 - 208000027149733
Celera Transcript: hCT2344145 - 208000027149694
Public Transcript Accession: NM 000120
Celera Protein: hCP1909440 - 208000027149693
Public Protein Accession: NP 000111
Gene Symbol: EPHX1
Protein Name: epoxide hydrolase 1, microsomal
(xenobiotic)
Celera Genomic Axis: GA_x5YUV32VWMC(1764047..1812133)
Chromosome: 1
OMIM NUMBER: 132810
OMIM Information: ?Fetal hydantoin syndrome (1);
Diphenylhydantoin toxicity (1);/Hyperch
olanemia, familial, 607748 (3)
Transcript SEQ ID NO: 12
Protein SEQ ID NO: 26
SNP Information:
Context (SEQ ID NO: 40):
CAGGTGGAGATTCTCAACAGATACCCTCACTTCAAGACTAAGATTGAAGGGCTGGACATCCACTTCATCCACGT
GAAGCCCCCCCAGCTGCCCGCAGGCC
TACCCCGAAGCCCTTGCTGATGGTGCACGGCTGGCCCGGCTOTTTCTACGAGTTTTATAAGATCATCCCACTCC
TGACTGACCCCAAGAACCATGGCCTG
Celera SNP ID: hCV11638783
SNP Position Transcript: 659
SNP Source: HGMD; dbSNP; Nickerson; HapMap
Population(Allele,Count): no_pop(A,-IG,-) ; no_pop(A,24881G,504) ;
no_pop(A,6321G,1904) ; no_pop
(A,21761G,544)
134
CA 02826522 2014-01-22
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 26, 139,(H,CAT) (R,CGT)
Gene Number: 99
Celera Gene: hCG2039450 - 208000027162714
Celera Transcript: hCT2309553 - 208000027162700
Public Transcript Accession: NM 001876
Celera Protein: hCi)-1901811 - 208000027162705
Public Protein Accession: NP 001867
Gene Symbol: CPT1A
Protein Name: carnitine palmitoyltransferase lA (liver)
Celera Genomic Axis: GA_x5YUV32VYAU(14202585..14299809)
Chromosome: 11
OMIM NUMBER: 600528
OMIM Information: CPT deficiency, hepatic, type IA, 255120 (3)
Transcript SEQ ID NO: 13
Protein SEQ ID NO: 27
SNP Information:
Context (SEQ ID NO: 41):
CCTCCGAGGACGAGGGCCGCTCATGGTGAACAGCAACTATTATGCCATGGATCTGCTGTATATCCTTCCAACTC
ACATTCAGGCAGCAAGAGCCGGCAAC
CCATCCATGCCATCCTGCTTTACAGGCGCAAACTGGACCGGGAGGAAATCAAACCAATTCGTCTTTTGGGATCC
ACGATTCCACTCTGCTCCGCTCAGTG
Celera SNP ID: hCV15851335
SNP Position Transcript: 920
SNP Source: Applera
Population(Allele,Count): caucasian(G,39)A,1) african
american(G,36IA,0) total(G,75IA,1)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 27, 275,(A,GCC) (T,ACC)
SNP Source: HGMD
Population(Allele,Count): no pop(G,-)A,-)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 27, 275,(A,GCC) (T,ACC)
Gene Number: 99
Celera Gene: hCG2039450 - 208000027162714
Celera Transcript: hCT2309554 - 208000027162777
Public Transcript Accession: NM 001876
Celera Protein: hCP1901807 - 208000027162702
Public Protein Accession: NP 001867
Gene Symbol: CPT1A
Protein Name: carnitine palmitoyltransferase 1A (liver)
Celera Genomic Axis: GA x5YUV32VYAU(14202585..14299809)
Chromosome: 11
OMIM NUMBER: 600528
OMIM Information: CPT deficiency, hepatic, type IA, 255120 (3)
Transcript SEQ ID NO: 14
Protein SEQ ID NO: 28
SNP Information:
Context (SEQ ID NO: 42):
CCTCCGAGGACGAGGGCCGCTCATGGTGAACAGCAACTATTATGCCATGGATCTGCTGTATATCCTTCCAACTC
ACATTCAGGCAGCAAGAGCCGGCAAC
135
CA 02826522 2014-01-22
CCATCCATGCCATCCTGCTITACAGGCGCAAACTGGACCGGGAGGAAATCAAACCAATTCGTCTTTTGGGATCC
ACGATTCCACTCTGCTCCGCTCAGTG
Celera SNP ID: hCV15851335
SNP Position Transcript: 977
SNP Source: Applera
Population(Allele,Count): caucasian(G,39IA,1) african
american(G,361A,O) total(G,751A,1)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 28, 275,(A,GCC) (T,ACC)
SNP Source: HGMD
Population(Allele,Count): no_pop(G,-IA,-)
SNP Type: Missense Mutation
Protein Coding: SEQ ID NO: 28, 275,(A,GCC) (T,ACC)
136
CA 02826522 2014-01-22
Gene Number: 25
Celera Gene: hCG1810767 - 64000126973272
Gene Symbol: C22orf20
Protein Name: chromosome 22 open reading frame 20
Celera Genomic Axis: GA_x5YUV32VY8D(1403768..1440680)
Chromosome: 22
OMIM NUMBER:
OMIM Information:
Genomic SEQ ID NO: 43
SNP Information:
Context (SEQ ID NO: 51):
TGGAGAAAGCTTATGAAGGATCAGGAAAATTAAAAGGGTGCTCTCGCCTATAACTTCTCTCTCCTTTGCTTTCA
CAGGCCTTGGTATGTTCCTGCTTCAT
CCCTTCTACAGTGGCCTTATCCCTCCTTCCTTCAGAGGCGTGGTAAGTCGGCTTTCTCTGCTAGCGCTGAGTCC
TGGGGGCCTCTGAAGTGTGCTCACAC
Celera SNP ID: hCV7241
SNP Position Genomic: -1403769
SNP Source: dbSNP
Population(Allele,Count): no_pop(C,71IG,21)
SNP Type: MISSENSE MUTATION;HUMAN-MOUSE SYNTENIC
REGION
Gene Number: 50
Celera Gene: hCG27192 - 104000117137572
Gene Symbol: LRP5
Protein Name: low density lipoprotein receptor-related
protein 5
Celera Genomic Axis: GA_x5YUV32VYAU(13757051..13906097)
Chromosome: 11
OMIM NUMBER: 603506
OMIM Information: Osteoporosis-pseudoglioma syndrome, 259770
(3); [Bone mineral density/
variability 1], 601884 (3); Osteopetrosis, autosomal dominant, type I,
607634 (3); Hyperostosis, end
osteal, 144750 (3); van Buchem disease, type 2, 607636/(3):
{Osteoporosis}, 166710 (3); Exudative vi
treoretinopathy, dominant, 133780 (3); Exudative vitreoretinopathy,
recessive, 601813 (3)
Genomic SEQ ID NO: 44
SNP Information:
Context (SEQ ID NO: 52):
GAGGCTIGCAAAGGTTAAGGGGCTGTTCGAGGCCCAGGCTGGCAGGAGATGGGCCTGGGCCAGAGTCTGGGACT
TCCCATGCCTGGGCTGTCTTTGGTCC
GTTGCTCACCATCCCTCCCTGGGGCCATGACCTTAGAGAGCCAAATGGAGGTGCAGGTAACCCACGGCAAGGAG
GGGTTGCCATGACTCAGAGTCCCCGT
Celera SNP ID: hCV8761599
SNP Position Genomic: -13757052
SNP Source: dhSNP; Celera; Nickerson; ABI_Val
Population(Allele,Count): no_pop(T,516IC,92) ; no_pop(T,144IC,36) ;
no_pop(T,402IC,99) ; no pop)
T,1041C,16)
SNP Type: INTRON
Gene Number: 51
137
CA 02826522 2014-01-22
Celera Gene: hCG27399 - 146000220312482
Gene Symbol: TLR4
Protein Name: toll-like receptor 4
Celera Genomic Axis: GA_x5YUV32W1V9(4596116..4621277)
Chromosome: 9
OMIM NUMBER: 603030
OMIM Information: Endotoxin hyporesponsiveness (3)
Genomic SEQ ID NO: 45
SNP Information:
Context (SEQ ID NO: 53):
GCTTTTTCAGAAGTTGATCTACCAAGCCTTGAGTTTCTAGATCTCAGTAGAAATGGCTTGAGTTTCAAAGGTTG
CTGTTCTCAAAGTGATTTTGGGACAA
CAGCCTAAAGTATTTAGATCTGAGCTTCAATGGTGTTATTACCATGAGTTCAAACTTCTTGGGCTTAGAACAAC
TAGAACATCTGGATTTCCAGCATTCC
Celera SNP ID: hCV11722237
SNP Position Genomic: -4596117
SNP Source: Applera
Population(Allele,Count): caucasian(C,37IT,3) african
american(C,36IT,2) total(C,73IT,5)
SNP Type: MISSENSE MUTATION;HUMAN-MOUSE SYNTENIC
REGION
SNP Source: HGMD; dbSNP; Nickerson
Population(Allele,Count): no_pop(C,-IT,-) ; no_pop(C,-IT,-) ;
no_pop(C,436IT,26)
SNP Type: MISSENSE MUTATION;HUMAN-MOUSE SYNTENIC
REGION
Gene Number: 53
Celera Gene: hCG27643 - 62000133384069
Gene Symbol: DDX5
Protein Name: DEAD (Asp-Glu-Ala-Asp) box polypeptide 5
Celera Genomic Axis: GA_x5Y0V32W3K4(353933..374581)
Chromosome: 17
OMIM NUMBER: 180630
OMIM Information:
Genomic SEQ ID NO: 46
SNP Information:
Context (SEQ ID NO: 54):
CATTCAAGGTTTTACTCACCCTccAATACCATTTAAATGGATTTGTAGACAACGATGTGACTCGTAACTACCAA
CATTTCCTATCAGTCATCCTTACCTG
ACCTCTGTCTTCGACCAACTGAAGCAACTTGGGATTAATTGCTTGATTAGCTTCACGAAGCACAGAGATAAGGT
CGCTCACTTGCTTTATGTTATTAGGT
Celera SNP ID: hCV7450990
SNP Position Genomic: 374583
SNP Source: dbSNP; Nickerson; HapMap
Population(Allele,Count): no_pop(A,172IC,12) ; no_pop(A,-1C,-) ;
no_pop(A,-IC,-)
SNP Type: MISSENSE MUTATION;TRANSCRIPTION FACTOR
BINDING SITE;HUMAN-MOUSE SYNTEN
IC REGION
Gene Number: 67
Celera Gene: hCG37774 - 104000117648431
138
CA 02826522 2014-01-22
Gene Symbol: MTP
Protein Name: microsomal triglyceride transfer protein
(large polypeptide, 88kDa)
Celera Genomic Axis: GA_x5YUV32W7K2(47612373..47673550)
Chromosome: 4
OMIM NUMBER: 157147
OMIM Information: Abetalipoproteinemia, 200100 (3)
Genomic SEQ ID NO: 47
SNP Information:
Context (SEQ ID NO: 55):
CAGAGAGGAGAGAAGAGCATCTTCAAAGGAAAAAGCCCATCTAAAATAATGGGAAAGGAAAACTTGGAAGCTCT
GCAAAGACCTACGCTCCTTCATCTAA
CCATGGAAAGGTAAAGGGGCGTTTAGATTCCACAACTTTTTCTCCAACTTCATATTTTTCTTCCCTTCAGTAGA
TATTATTTTGAGGTAATCACATTGTA
Celera SNP ID: hCV22274307
SNP Position Genomic: -47612374
SNP Source: Applera
Population(Allele,Count): caucasian(C,10IT,26) african
american(C,16IT,22) total(C,26IT,48)
SNP Type: MISSENSE MUTATION;HUMAN-MOUSE SYNTENIC
REGION
SNP Source: dbSNP; Nickerson
Population(Allele,Count): no_pop(T,2502IC,490) ; no_pop(T,-IC,-)
SNP Type: MISSENSE MUTATION;HUMAN-MOUSE SYNTENIC
REGION
Gene Number: 98
Celera Gene: hCG2039431 - 208000027149733
Gene Symbol: EPHX1
Protein Name: epoxide hydrolase 1, microsomal
(xenobiotic)
Celera Genomic Axis: GA_x5YUV32VWMC(1764047..1812133)
Chromosome: 1
OMIM NUMBER: 132810
OMIM Information: ?Fetal hydantoin syndrome (1);
Diphenylhydantoin toxicity (1);/Hyperch
olanemia, familial, 607748 (3)
Genomic SEQ ID NO: 48
SNP Information:
Context (SEQ ID NO: 56):
TGCAGGGTCTTCTCTCTCCCTCCACCCTGACTGTGCTCTGTCCCCCCAGGGCTGGACATCCACTTCATCCACGT
GAAGCCCCCCCAGCTGCCCGCAGGCC
TACCCCGAAGCCCTTGCTGATGGTGCACGGCTGGCCCGGCTCTTTCTACGAGTTTTATAAGATCATCCCACTCC
TGACTGACCCCAAGAACCATGGCCTG
Celera SNP ID: hCV11638783
SNP Position Genomic: -1764048
SNP Source: HGMD; dbSNP; Nickerson; HapMap
Population(Allele,Count): no_pop(A,-IG,-) ; no_pop(A,2488IG,504) ;
no_pop(A,632IG,1904) ; no pop
(A,2176IG,544)
SNP Type: MISSENSE MUTATION
Gene Number: 99
139
CA 02826522 2014-01-22
Celera Gene: hCG2039450 - 208000027162714
Gene Symbol: CPT1A
Protein Name: carnitine palmitoyltransferase íA (liver)
Celera Genomic Axis: GA x5YUV32VYAU(14202585..14299809)
Chromosome: 11
OMIM NUMBER: 600528
OMIM Information: CPT deficiency, hepatic, type IA, 255120 (3)
Genomic SEQ ID NO: 49
SNP Information:
Context (SEQ ID NO: 57):
AAGCTGTTTGAAAATAATTTTTTTAAAGCAATTTGTTTGCCTACTGGTTTGATTTCCTCCCGGTCCAGTTTGCG
CCTGTAAAGCAGGATGGCATGGATGG
GTTGCCGGCTCTTGCTGCCTGAATGTGAGTTGGAAGGATATACAGCAGATCCTGAAAAGCGACAAAGGTGGAGA
GAATTTGCATAGGGAAAGATAAGCAA
Celera SNP ID: hCV15851335
SNP Position Genomic: -14202526
SNP Source: Applera
Population(Allele,Count): caucasian(C,39IT,1) african
american(C,361T,0) total(C,75)T,1)
SNP Type: MISSENSE MUTATION;TRANSCRIPTION FACTOR
BINDING SITE;HUMAN-MOUSE SYNTEN
IC REGION
SNP Source: HGMD
Population(Allele,Count): no_pop(C,-IT,-)
SNP Type: MISSENSE MUTATION;TRANSCRIPTION FACTOR
BINDING SITE;HUMAN-MOUSE SYNTEN
IC REGION
Gene Number: 112
Celera Gene: hCG1642252 -
Gene Symbol:
Protein Name:
Celera Genomic Axis: GA x5YUV32W3V0(13011322..13024095)
Chromosome: 16
OMIM NUMBER:
OMIM Information:
Genomic SEQ ID NO: 50
SNP Information:
Context (SEQ ID NO: 58):
GTTGGATTCCCTTCATCCCCATAGTCACCTTCCTCACTTTGCACAGGTTGTACTTTGCCTCTTCGACTGTAACG
CGATCAACAGCAACACAGCCCTTGGG
CACAGACCAGGCAGAAATGCTCACCTGTCTTGATGCCGATGACATCCGTGAATCCAGCAGGGTATGTGATAGCC
ACTCGAACCTTGCCATCAATTTTAAT
Celera SNP ID: hCV11935588
SNP Position Genomic: 13024097
SNP Source: dbSNP; Celera; Nickerson; HapMap
Population(Allele,Count): no_pop(T,-IA,-) ; no_pop(T,7IA,1) ;
no_pop(T,-)A,-) ; no_pop(T,-IA,-)
SNP Type: UTR5
140
TABLE 3
Marker Alleles Sequence A (allele-specific primer) _Sequence B
(allele-specific primer) Sequence C (common primer)
hCV11638783 A/G AAGGGCTTCGGGGTAC AAGGGCTTCGGGGTAT
ACCGTGCAGGGTCTTCT
(SEQ ID NO: 59) (SEQ ID NO: 60)
(SEQ ID NO: 61)
hCV11722237 C/T CAAAGTGATTTTGGGACAAC CAAAGTGATTTTGGGACAAT
GAATACTGAAAACTCACTCATTTGT
(SEQ ID NO: 62) (SEQ ID NO: 63)
(SEQ ID NO: 64)
hCV11935588 A/T ATTTCTGCCTGGTCTGTGT Err CTGCCTGGTCTGTGA
CTCACTTTGCACAGGTTGTACT
(SEQ ID NO: 65) (SEQ ID NO: 66)
(SEQ ID NO: 67)
hCV15851335 C/T GATGGCATGGATGGC GGATGGCATGGATGGT
GCAGGATGTGCTGTGATTAT
(SEQ ID NO: 68 (SEQ ID NO: 69)
(SEQ ID NO: 70)
hCV22274307 C/T GACCTACGCTCCTTCATCTAAC GACCTACGCTCCTTCATCTAAT
CAATGTGATTACCTCAAAATAATATCTAC
(NI (SEQ ID NO: 71) (SEQ ID NO: 72)
(SEQ ID NO: 73)
(NI
hCV7241 C/G TGGTATGTTCCTGCTTCATC TGGTATGTTCCTGCTTCATG CAGGCAGGAGATGTGTGAG
(SEQ ID NO: 74) (SEQ ID NO: 75)
(SEQ ID NO: 76)
hCV7450990 A/C TGGTCGAAGACAGAGGTG TTGGTCGAAGACAGAGGTT
GTTTTCACATTCAAGG 1 11 TACTC
0 (SEQ ID NO: 77) (SEQ ID NO: 78)
(SEQ ID NO: 79)
(NI
hCV8761599 C/T GGGATGGTGAGCAACG AGGGATGGTGAGCAACA
GAACTTGAGGCTTGCAAAGGTTAAG
(NI
(NI (SEQ ID NO: 80) (SEQ ID NO: 81)
(SEQ ID NO: 82)
Io
co
0
141
CA 02826522 2014-01-22
= TABLE 4
= MarIcers.re,p8bat9d bbtwoon "Sbinforci Simples" anti "UM Semliki": Stade
ertaly14,
:NI/nicer Gene symbol "Stamfdrd salmi/A. fstagl ''UC8F9amplis" tamp)
OR LCL UCIL pia! ' OR LCL UCL p-vat
11838783 ord EPHX1 0.408 0.195 0.855
0.0175 10.588 0.419 0.811 0.0014
11838788 dam EPHX1 0.281 0.118 0.715
0.0071 = 0.580 0.402 0.855 9.0055 =
= =
=
=
=
= =
=
=
.=
142
CA 02826522 2014-01-22
Igµ gliONV 41 V
itstiosfatraimstot
1; 0111
s 5÷sootssssr:-A-631ssts =
.5! stsinsisuittitiiitig
2 :
11 011101ii
St551.695573.3.11/535
=
a It
= 1111ilililtIVIIM
= %I,ItiSIMS55SSiS55,3
StStaiSISIngliiitill
400400400400400400400
= =
II" Wit
t
143
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional volumes please contact the Canadian Patent Office.
