Note: Descriptions are shown in the official language in which they were submitted.
CA 02855992 2014-07-08
WO 02/066612 PCTiCTS02/05090
NOVEL SUBSTITUTION MUTANT RECEPTORS AND THEIR USE IN A NUCLEAR
RECEPTOR-BASED INDUCIBLE GENE EXPRESSION SYSTEM
= .
FIELD OF THE INVENTION =
This invention relates to the field of biotechnology or genetic engineering.
Specifically, this
invention relates to the field of gene expression. More specifically, this
invention relates to novel
nuclear receptors comprising a substitution mutation and their use in a
nuclear receptor-based inducible
gene expression system and methods of modulating the expression of a gene
within a host cell using this
inducible gene expression system.
BACKGROUND OF THE INVENTION
Various publications are cited herein.
However, the citation of any reference herein should not be construed as an
admission
that such reference is available as "Prior Art" to the instant application.
In the field of genetic engineering, precise control of gene expression is a
valuable tool for
studying, manipulating, and controlling development and other physiological
processes. Gene
expression is a complex biological process involving a number of specific
protein-protein interactions.
In order for gene expression to be triggered, such that it produces the RNA
necessary as the first step in
protein synthesis, a transcriptional activator must be brought into proximity
of a promoter that controls
gene transcription. Typically, the transcriptional activator itself is
associated with a protein that has at
least one DNA binding domain that binds to DNA binding sites present in the
promoter regions of genes.
Thus, for gene expression to occur, a protein comprising a DNA binding domain
and a transactivation
domain located at an appropriate distance from the DNA binding domain must be
brought into the
correct position in the promoter region of the gene.
The traditional transgenic approach utilizes a cell-type specific promoter to
drive the expression
of a designed transgene. A DNA construct containing the transgene is first
incorporated into a host
genome. When triggered by a transcriptional activator, expression of the
transgene occurs in a given cell
type.
Another means to regulate expression of foreign genes in cells is through
inducible promoters.
Examples of the use of such inducible promoters include the PR1-a promoter,
prokaryotic repressor-
operator systems, immunosuppressive-immunophilin systems, and higher
eukaryotic transcription
activation systems such as steroid hormone receptor systems and are described
below.
The PR1-a promoter from tobacco is induced during the systemic acquired
resistance response
following pathogen attack. The use of PR1-a may be limited because it often
responds to endogenous
1
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
materials and external factors such as pathogens, UV-B radiation, and
pollutants. Gene regulation
systems based on promoters induced by heat shock, interferon and heavy metals
have been described
(Wum et al., 1986, Proc..Natl. Acad. Sci. USA 83: 5414-5418; Arnheiter et al.,
1990, Cell 62:51-61;
Filmus et al., 1992, Nucleic Acids Research 20: 27550-27560). However, these
systems have limitations
due to their effect on expression of non-target genes. These systems are also
leaky.
Prokaryotic repressor-operator systems utilize bacterial repressor proteins
and the unique
operator DNA sequences to which they bind. Both the tetracycline ("let") and
lactose ("Lac")
repressor-operator systems from the bacterium Escherichia coil have been used
in plants and animals to
= control gene expression. In the Tet system, tetracycline binds to the
TetR repressor protein, resulting in a
conformational change that releases the repressor protein from the operator
which as a result allows
transcription to occur. In the Lac system, a lac operon is activated in
response to the presence of lactose,
or synthetic analogs such as isopropyl-b-D-thiogalactoside. Unfortunately, the
use of such systems is
restricted by unstable chemistry of the ligands, i.e. tetracycline and
lactose, their toxicity, their natural
presence, or the relatively high levels required for induction or repression.
For similar reasons, utility of
such systems in animals is limited.
Immunosuppressive molecules such as FK506, rapamycin and cyclosporine A can
bind to
immunophilins FKBP12, cyclophilin, etc. Using this information, a general
strategy has been devised to
bring together any two proteins simply by placing FK506 on each of the two
proteins or by placing
FK506 on one and cyclosporine A on another one. A synthetic homodimer of FK506
(FK1012) or a
compound resulted from fusion of FK506-cyclosporine (FKCsA) can then be used
to induce dimerization
of these molecules (Spencer et al., 1993, Science 262: 1019-24; Belshaw et
al., 1996 Proc Nati Acad Sci
USA 93: 4604-7). Ga14 DNA binding domain fused to FKBP12 and VP16 activator
domain fused to
cyclophilin, and FKCsA compound were used to show heterodimerization and
activation of a reporter
gene under the control of a promoter containing Gal4 binding sites.
Unfortunately, this system includes
immunosuppressants that can have unwanted side effects and therefore, limits
its use for various
mammalian gene switch applications.
Higher eukaryotic transcription activation systems such as steroid hormone
receptor systems
have also been employed. Steroid hormone receptors are members of the nuclear
receptor superfamily
and are found in vertebrate and invertebrate cells. Unfortunately, use of
steroidal compounds that
activate the receptors for the regulation of gene expression, particularly in
plants and mammals, is
limited due to their involvement in many other natural biological pathways in
such organisms. In order
to overcome such difficulties, an alternative system has been developed using
insect ecdysone receptors
(EcR).
Growth, molting, and development in insects are regulated by the ecdysone
steroid hormone
(molting hormone) and the juvenile hormones (Dhadialla, et al., 1998, Annu.
Rev. Entomol. 43: 545-
569). The molecular target for ecdysone in insects consists of at least
ecdysone receptor (EcR) and
ultraspiracle protein (USP). EcR is a member of the nuclear steroid receptor
super family that is
2
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
characterized by signature DNA and ligand binding domains, and an activation
domain (Koelle et al.
1991, Cell, 67:59-77). EcR receptors are responsive to a number of steroidal
compounds such as
ponasterone A and muristerone A. Recently, non-steroidal compounds with
ecdysteroid agonist activity
have been described, including the commercially available insecticides
tebufenozide and
methoxyfenozide that are marketed world wide by Rohm and Haas Company (see
International Patent
Application No. PCT/EP96/00686 and US Patent 5,530,028). Both analogs have
exceptional safety
profiles to other organisms.
The insect ecdysone receptor (EcR) heterodimerizes with Ultraspiracle (USP),
the insect
homologue of the mammalian RXR., and binds ecdysteroids and ecdysone receptor
response elements
and activate transcription of ecdysone responsive genes (Riddiford et al.,
2000). The EcR/USP/ligand
complexes play important roles during insect development and reproduction. The
EcR is a member of
the steroid hormone receptor superfarnily and has five modular domains, A/B
(transactivation), C (DNA
binding, heterodimerization)), D (Hinge, heterodimerization), E (ligand
binding, heterodimerization and
transactivation and F (transactivation) domains. Some of these domains such as
A/B, C and E retain
their function when they are fused to other proteins.
Tightly regulated inducible gene expression systems or "gene switches" are
useful for various
applications such as gene therapy, large scale production of proteins in
cells, cell based high throughput
screening assays, functional genomics and regulation of traits in transgenic
plants and animals.
The first version of EcR-based gene switch used Drosophila melanogaster EcR
(DmEcR) and
Mus musculus RXR (MmRXR) and showed that these receptors in the presence of
steroid, ponasteroneA,
transactivate reporter genes in mammalian cell lines and transgenic mice
(Christopherson et al., 1992; No
et al., 1996). Later, Suhr et al., 1998 showed that non-steroidal ecdysone
agonist, tebufenozide, induced
high level of transactivation of reporter genes in mammalian cells through
Bombyx mori EcR (BmEcR)
in the absence of exogenous heterodimer partner.
International Patent Applications No. PCT/US97/05330 (WO 97/38117) and
PCT/US99/08381
(W099/58155) disclose methods for modulating the expression of an exogenous
gene in which a DNA
construct comprising the exogenous gene and an ecdysone response element is
activated by a second
DNA construct comprising an ecdysone receptor that, in the presence of a
ligand therefor, and optionally
in the presence of a receptor capable of acting as a silent partner, binds to
the ecdysone response element
to induce gene expression. The ecdysone receptor of choice was isolated from
Drosophila melanogaster.
Typically, such systems require the presence of the silent partner, preferably
retinoid X receptor (RXR),
in order to provide optimum activation. In mammalian cells, insect ecdysone
receptor (EcR)
heterodimeriz,es with retinoid X receptor (RXR) and regulates expression of
target genes in a ligand
dependent manner. International Patent Application No. PCT/US98/14215 (WO
99/02683) discloses
that the ecdysone receptor isolated from the silk moth Bombyx mori is
functional in mammalian systems
without the need for an exogenous dimer partner.
U.S. Patent No. 6,265,173 B1 discloses that various members of the
steroid/thyroid superfamily
3
CA 02855992 2014-07-08
WO 02/066612 PCTTUS02/05090
of receptors can combine with Drosophila melanogaster ultraspiracle receptor
(USP) or fragments
thereof comprising at least the dimerization domain of USP for use in a gene
expression system. U.S.
Patent No. 5,880,333 discloses a Drosophila melanogaster EcR and ultraspiracle
(USP) heterodirner
system used in plants in which the transactivation domain and the DNA binding
domain are positioned
on two different hybrid proteins. Unfortunately, these USP-based systems are
constitutive in animal
cells and therefore, are not effective for regulating reporter gene
expression.
In each of these cases, the transactivation domain and the DNA binding domain
(either as native
EcR as in International Patent Application No. PCT/US98/14215 or as modified
EcR as in International
Patent Application No. PC-1 /US97/05330) were incorporated into a single
molecule and the other
heterodimeric partners, either USP or RXR, were used in their native state.
Drawbacks of the above described EcR-based gene regulation systems include a
considerable
background activity in the absence of ligands and non-applicability of these
systems for use in both
plants and animals (see U.S. Patent No. 5,880,333). Therefore, a need exists
in the art for improved =
EcR-based systems to precisely modulate the expression of exogenous genes in
both plants and animals.
Such improved systems would be useful for applications such as gene therapy,
large-scale production of
proteins and antibodies, cell-based high throughput screening assays,
functional genomics and regulation
of traits in transgenic animals. For certain applications such as gene
therapy, it may be desirable to have
an inducible gene expression system that responds well to synthetic non-
steroid ligands and at the same
is insensitive to the natural steroids. Thus, improved systems that are
simple, compact, and dependent on
ligands that are relatively inexpensive, readily available, and of low
toxicity to the host would prove
useful for regulating biological systems.
Recently, Applicants have shown that an ecdysone receptor-based inducible gene
expression
system in which the transactivation and DNA binding domains are separated from
each other by placing
them on two different proteins results in greatly reduced background activity
in the absence of a ligand
and significantly increased activity over background in the presence of a
ligand (pending application
PCT/US01/09050). This two-hybrid system is a
significantly improved inducible gene expression modulation system compared to
the two systems
disclosed in applications PCT/US97/05330 and PCT/US98/14215. The two-hybrid
system exploits the
ability of a pair of interacting proteins to bring the transcription
activation domain into a more favorable
position relative to the DNA binding domain such that when the DNA binding
domain binds to the DNA
binding site on the gene, the transactivation domain more effectively
activates the promoter (see, for
example, U.S. Patent No, 5,283,173). Briefly, the two-hybrid gene expression
system comprises two
gene expression cassettes; the first encoding a DNA binding domain fused to a
nuclear receptor
polypeptide, and the second encoding a transactivation domain fused to a
different nuclear receptor
polypeptide. In the presence of ligand, the interaction of the first
polypeptide with the second
polypeptide effectively tethers the DNA binding domain to the transactivation
domain. Since the DNA
binding and transactivation domains reside on two different molecules, the
background activity in the
4
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
absence of ligand is greatly reduced.
A two-hybrid system also provides improved sensitivity to non-steroidal
ligands for example,
diacylhydrazines, when compared to steroidal ligands for example, ponasterone
A ("PonA") or
muristerone A ("MurA"). That is, when compared to steroids, the non-steroidal
ligands provide higher
activity at a lower concentration. In addition, since transactivation based on
EcR gene switches is often
cell-line dependent, it is easier to tailor switching systems to obtain
maximum transactivation capability
for each application. Furthermore, the two-hybrid system avoids some side
effects due to overexpression
of RXR that often occur when unmodified RXR is used as a switching partner. In
a preferred two-hybrid
system, native DNA binding and transactivation domains of EcR or RXR are
eliminated and as a result,
these hybrid molecules have less chance of interacting with other steroid
hormone receptors present in
the cell resulting in reduced side effects.
The EcR is a member of the nuclear receptor superfamily and classified into
subfamily 1, group
H (referred to herein as "Group H nuclear receptors"). The members of each
group share 40-60% amino
acid identity in the E (ligand binding) domain (Laudet et al., A Unified
Nomenclature System for the
Nuclear Receptor Subfamily, 1999; Cell 97: 161-163). In addition to the
ecdysone receptor, other
members of this nuclear receptor subfamily 1, group H include: ubiquitous
receptor (UR), Orphan
receptor 1 (OR-1), steroid hormone nuclear receptor 1 (NER-1), RXR interacting
protein-15 (RIP-15),
liver x receptor 3 (LXR13), steroid hormone receptor like protein (RLD-1),
liver x receptor (LXR), liver x
receptor cc (LXRa.), famesoid x receptor (FXR), receptor interacting protein
14 (RIP-14), and farnesol
receptor (HRR-1).
To develop an improved Group H nuclear receptor-based inducible gene
expression system in
which ligand binding or ligand specificity is modified, Applicants created
several substitution mutant
EcRs that comprise substituted amino acid residues in the ligand binding
domain (LBD). A homology
modeling and docking approach was used to predict critical residues that
mediate binding of ecdysteroids
and non-ecdysteroids to the EcR LBD. These substitution mutant EcRs were
evaluated in ligand binding
and transactivation assays. As presented herein, Applicants' novel
substitution mutant nuclear receptors
and their use in a nuclear receptor-based inducible gene expression system
provides an improved
inducible gene expression system in both prokaryotic and eukaryotic host cells
in which ligand
sensitivity and magnitude of transactivation may be selected as desired,
depending upon the application.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1: In vitro 3H-RH2485 ligand binding of full-length Al 10P CfEcR mutant
while steroid binding is
completely disrupted. The ligand binding values are expressed as specific
counts (specific dpm).
Figure 2: Transactivation of reporter genes through GAL4/CfEcR-A/BCDEF (full
length CfEcR) or its
GAL4/A11013 mutant version constructs transfected into N1113T3 cells along
with VP16LmUSP-EF and
pFREcRE by PonA or GSTm-E. The numbers on top of the bars indicate fold
increase over DMSO
5
CA 02855992 2014-07-08
WO 02/066612 PCT/ITS02/05090
levels.
Figure 3: Transactivation of reporter genes through IE1VP16/CfEcRCDEF (Example
1.5) or its
VP16/AllOP mutant version constructs (Example 1.6) transfected into L57 cells
along with pMK43.2
reporter by 20E or GSTm-E. The numbers on top of the bars indicate fold
increase over DMSO levels.
Figure 4: Transactivation of reporter genes through GAL4/CfEcR-A/BCDEF (full
length CfEcR) or its
GAL4/A110 mutant versions (A1 10S, Al 10P, All OL, and Al 10M) constructs
transfected into NIH3T3
cells along with VP16LmUSP-EF and pFREcRE by PonA or GSTm-E. The numbers on
top of the bars =
indicate fold increase over DMSO levels.
Figure 5: In vitro 3H-PonA ligand binding of wild-type CfEcR-A/BCDEF (full
length CfEcR) or its A110
mutant versions (A110S, AllOP, Al 10L, and A110M). The ligand binding values
are expressed as
specific counts (specific dpm).
Figure 6: in vitro 3H-RH2485 ligand binding of wild-type CfEcR-A/13CDEF (full
length CfEcR) or its
A110 mutant versions (A110S, AllOP, Al10L, and A110M). These values were
expressed as specific
counts (specific dpm).
DETAILED DESCRIPTION OF THE INVENTION
Applicants describe herein the construction of Group H nuclear receptors that
comprise
substitution mutations (referred to herein as "substitution mutants") at amino
acid residues that are
2 0 involved in ligand binding to a Group H nuclear receptor ligand binding
domain that affect the ligand
sensitivity and magnitude of induction of the Group H nuclear receptor and the
demonstration that these
substitution mutant nuclear receptors are useful in methods of modulating gene
expression.
Specifically, Applicants have developed a novel nuclear receptor-based
inducible gene
expression system comprising a Group H nuclear receptor ligand binding domain
comprising a
substitution mutation. Applicants have shown that the effect of such a
substitution mutation may
increase or reduce ligand binding activity or ligand sensitivity and the
ligand may be steroid or non-
steroid specific. Thus, Applicants' invention provides a Group H nuclear
receptor-based inducible gene
expression system useful for modulating expression of a gene of interest in a
host cell. In a particularly
desirable embodiment, Applicants' invention provides an ecdysone receptor-
based inducible gene
3 0 expression system that responds solely to either steroidal ligand or non-
steroidal ligand. In addition, the
present invention also provides an improved non-steroidal ligand responsive
ecdysone receptor-based
inducible gene expression system. Thus, Applicants' novel inducible gene
expression system and its use
in methods of modulating gene expression in a host cell overcome the
limitations of currently available
inducible expression systems and provide the skilled artisan with an effective
means to control gene
expression.
The present invention is useful for applications such as gene therapy, large
scale production of
proteins and antibodies, cell-based high throughput screening assays,
orthogonal ligand screening assays,
6
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
functional genomics, proteomics, metabolomics, and regulation of traits in
transgenic organisms, where
control of gene expression levels is desirable. An advantage of Applicants'
invention is that it provides a
means to regulate gene expression and to tailor expression levels to suit the
user's requirements.
DEFINITIONS
In this disclosure, a number of terms and abbreviations are used. The
following definitions are
provided and should be helpful in understanding the scope and practice of the
present invention.
In a specific embodiment, the term "about" or "approximately" means within
20%, preferably
within 10%, more preferably within 5%, and even mare preferably within 1% of a
given value or range.
The term "substantially free" means that a composition comprising "A" (where
"A" is a single
protein, DNA molecule, vector, recombinant host cell, etc.) is substantially
free of "B' (where "B"
comprises one or more contaminating proteins, DNA molecules, vectors, etc.)
when at least about 75%
by weight of the proteins, DNA, vectors (depending on the category of species
to which A and B belong)
in the composition is "A". Preferably, "A" comprises at least about 90% by
weight of the A + B species
in the composition, most preferably at least about 99% by weight. It is also
preferred that a composition,
which is substantially free of contamination, contain only a single molecular
weight species having the
activity or characteristic of the species of interest.
The term "isolated" for the purposes of the present invention designates a
biological material
(nucleic acid or protein) that has been removed from its original environment
(the environment in which
it is naturally present). For example, a polynucleotide present in the natural
state in a plant or an animal
is not isolated, however the same polynucleotide separated from the adjacent
nucleic acids in which it is
naturally present, is considered "isolated". The term "purified" does not
require the material to be
present in a form exhibiting absolute purity, exclusive of the presence of
other compounds. It is rather a
relative definition.
A polynucleotide is in the "purified" state after purification of the starting
material or of the
natural material by at least one order of magnitude, preferably 2 or 3 and
preferably 4 or 5 orders of
magnitude.
A "nucleic acid" is a polymeric compound comprised of covalently linked
subunits called
-
nucleotides. Nucleic acid includes polyribonucleic acid (RNA) and
polydeoxyribonucleic acid (DNA),
both of which may be single-stranded or double-stranded. DNA includes but is
not limited to cDNA,
genornic DNA, plasmids DNA, synthetic DNA, and semi-synthetic DNA. DNA may be
linear, circular,
or supercoiled.
= A "nucleic acid molecule" refers to the phosphate ester polymeric form of
ribonucleosides
(adenosine, guanosine, uridine or cytidine; "RNA molecules") or
deoxyribonucleosides (deoxyadenosine,
deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules"), or any
phosphoester analogs
thereof, such as phosphorothioates and thioesters, in either single stranded
form, or a double-stranded
helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The
term nucleic
7
CA 02855992 2014-07-08
WO 02/066612
PCT/LTS02/05090
acid molecule, and in particular DNA or RNA molecule, refers only to the
primary and secondary
structure of the molecule, and does not limit it to any particular tertiary
forms. Thus, this term includes
double-stranded DNA found, inter alia, in linear or circular DNA molecules
(e.g., restriction fragments),
plasmids, and chromosomes. In discussing the structure of particular double-
stranded DNA molecules,
sequences may be described herein according to the normal convention of giving
only the sequence in
the 5' to 3' direction along the non-transcribed strand of DNA (i.e., the
strand having a sequence
homologous to the mRNA). A "recombinant DNA molecule" is a DNA molecule that
has undergone a
molecular biological manipulation.
The term "fragment" will be understood to mean a nucleotide sequence of
reduced length
relative to the reference nucleic acid and comprising, over the common
portion, a nucleotide sequence
identical to the reference nucleic acid. Such a nucleic acid fragment
according to the invention may be,
where appropriate, included in a larger polynucleotide of which it is a
constituent. Such fragments
comprise, or alternatively consist of, oligonucleotides ranging in length from
at least 6, 8, 9, 10, 12, 15,
18, 20, 21, 22, 23, 24, 25, 30, 39, 40,42, 45, 48, 50, 51, 54, 57, 60, 63, 66,
70, 75, 78, 80, 90, 100, 105,
120, 135, 150, 200, 300, 500, 720, 900, 1000 or 1500 consecutive nucleotides
of a nucleic acid according
to the invention.
As used herein, an "isolated nucleic acid fragment" is a polymer of RNA or DNA
that is single-
or double-stranded, optionally containing synthetic, non-natural or altered
nucleotide bases. An isolated
nucleic acid fragment in the form of a polymer of DNA may be comprised of one
or more segments of
cDNA, genomic DNA or synthetic DNA.
A "gene" refers to an assembly of nucleotides that encode a polypeptide, and
includes cDNA and
genomic DNA nucleic acids. "Gene" also refers to a nucleic acid fragment that
expresses a specific
protein or polypeptide, including regulatory sequences preceding (5 non-coding
sequences) and
following (3' non-coding sequences) the coding sequence. "Native gene" refers
to a gene as found in
nature with its own regulatory sequences. "Chimeric gene" refers to any gene
that is not a native gene,
comprising regulatory and/or coding sequences that are not found together in
nature. Accordingly, a
chimeric gene may comprise regulatory sequences and coding sequences that are
derived from different
sources, or regulatory sequences and coding sequences derived from the same
source, but arranged in a
manner different than that found in nature. A chimeric gene may comprise
coding sequences derived
from different sources and/or regulatory sequences derived from different
sources. "Endogenous gene"
refers to a native gene in its natural location in the genome of an organism.
A "foreign" gene or
"heterologous" gene refers to a gene not normally found in the host organism,
but that is introduced into
the host organism by gene transfer. Foreign genes can comprise native genes
inserted into a non-native
organism, or chimeric genes. A "transgene" is a gene that has been introduced
into the genome by a
transformation procedure.
"Heterologous" DNA refers to DNA not naturally located in the cell, or in a
chromosomal site of
the cell. Preferably, the heterologous DNA includes a gene foreign to the
cell.
8
CA 02855992 2014-07-08
WO 02/066612
PCTIUS02/05090
The term "genome" includes chromosomal as well as mitochondrial, chloroplast
and viral DNA
or RNA.
A nucleic acid molecule is "hybridizable" to another nucleic acid molecule,
such as a cDNA,
genomic DNA, or RNA, when a single stranded form of the nucleic acid molecule
can anneal to the other
nucleic acid molecule under the appropriate conditions of temperature and
solution ionic strength (see
Sambrook et al., 1989 infra). Hybridization and washing conditions are well
known and exemplified in
Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory
Manual, Second Edition,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor (1989), particularly
Chapter 11 and
Table 11.1 therein. The
conditions of temperature and ionic
strength determine the "stringency" of the hybridization.
Stringency conditions can be adjusted to screen for moderately similar
fragments, such as
homologous sequences from distantly related organisms, to highly similar
fragments, such as genes that
duplicate functional enzymes from closely related organisms. For preliminary
screening for homologous
nucleic acids, low stringency hybridization conditions, corresponding to a
Tfi, of 55 , can be used, e.g., 5x
SSC, 0.1% SDS, 0.25% milk, and no formamide; or 30% forrnamide, 5x SSC, 0.5%
SDS). Moderate
stringency hybridization conditions correspond to a higher Tfiõ e.g., 40%
formamide, with 5x or 6x SCC.
High stringency hybridization conditions correspond to the highest Tfi,, e.g.,
50% formamide, 5x or 6x
SCC.
Hybridization requires that the two nucleic acids contain complementary
sequences, although
depending on the stringency of the hybridization, mismatches between bases are
possible. The term
"complementary" is used to describe the relationship between nucleotide bases
that are capable of
hybridizing to one another. For example, with respect to DNA, adenosine is
complementary to thymine
and cytosine is complementary to guanine. Accordingly, the instant invention
also includes isolated
nucleic acid fragments that are complementary to the complete sequences as
disclosed or used herein as
well as those substantially similar nucleic acid sequences.
In a specific embodiment of the invention, polynucleotides are detected by
employing
hybridization conditions comprising a hybridization step at Tfi, of 55 C, and
utilizing conditions as set
forth above. In a preferred embodiment, the I'm is 60 C; in a more preferred
embodiment, the Tfi, is
63 C; in an even more preferred embodiment, the Tõ, is 65 C.
3 0 Post-hybridization washes also determine stringency conditions. One
set of preferred conditions
uses a series of washes starting with 6X SSC, 0.5% SDS at room temperature for
15 minutes (min), then
repeated with 2X SSC, 0.5% SDS at 45 C for 30 minutes, and then repeated twice
with 0.2X SSC, 0.5%
SDS at 50 C for 30 minutes. A more preferred set of stringent conditions uses
higher temperatures in
which the washes are identical to those above except for the temperature of
the final two 30 min washes
in 0.2X SSC, 0.5% SDS was increased to 60 C. Another preferred set of highly
stringent conditions uses
two final washes in 0.1X SSC, 0.1% SDS at 65 C. Hybridization requires that
the two nucleic acids
comprise complementary sequences, although depending on the stringency of the
hybridization,
9
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
mismatches between bases are possible.
The appropriate stringency for hybridizing nucleic acids depends on the length
of the nucleic
acids and the degree of complementation, variables well known in the art. The
greater the degree of
similarity or homology between two nucleotide sequences, the greater the value
of T. for hybrids of
nucleic acids having those sequences. The relative stability (corresponding to
higher T.) of nucleic acid
hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA.
For hybrids of
greater than 100 nucleotides in length, equations for calculating T. have been
derived (see Sambrook et
al., supra, 9.50-0.51). For hybridization with shorter nucleic acids, i.e.,
oligonucleotides, the position of
mismatches becomes more important, and the length of the oligonucleotide
determines its specificity (see
Sambrook et al., supra, 11.7-11.8).
In a specific embodiment of the invention, polynucleotides are detected by
employing
hybridization conditions L;onapiisirig a hybridization step in 15 than 500 :DM
salt and at least 37 degrees
Celsius, and a washing step in 2XSSPE at.at least 63 degrees Celsius. In a
preferred embodiment, the
hybridization conditions comprise less than 200 mM salt and at least 37
degrees Celsius for the
hybridization step. In a more preferred embodiment, the hybridization
conditions comprise 2XSSPE and
63 degrees Celsius for both the hybridization and washing steps.
In one embodiment, the length for a hybridizable nucleic acid is at least
about 10 nucleotides.
Preferable a minimum length for a hybridizable nucleic acid is at least about
15 nucleotides; more
preferably at least about 20 nucleotides; and most preferably the length is at
least 30 nucleotides.
Furthermore, the skilled artisan will recognize that the temperature and wash
solution salt concentration
may be adjusted as necessary according to factors such as length of the probe.
The term "probe" refers to a single-stranded nucleic acid molecule that can
base pair with a
complementary single stranded target nucleic acid to form a double-stranded
molecule.
As used herein, the term "oligonucleotide" refers to a nucleic acid, generally
of at least 18
nucleotides, that is hybridizable to a genomic DNA molecule, a cDNA molecule,
a plasmid DNA or an
mRNA molecule. Oligonucleotides can be labeled, e.g., with 32P-nucleotides or
nucleotides to which a
label, such as biotin, has been covalently conjugated. A labeled
oligonucleotide can be used as a probe
to detect the presence of a nucleic acid. Oligonucleotides (one or both of
which may be labeled) can be
used as PCR primers, either for cloning full length or a fragment of a nucleic
acid, or to detect the
presence of a nucleic acid. An oligonucleotide can also be used to form a
triple helix with a DNA
molecule. Generally, oligonucleotides are prepared synthetically, preferably
on a nucleic acid
synthesizer. Accordingly, oligonucleotides can be prepared with non-naturally
occurring phosphoester
analog bonds, such as thioester bonds, etc.
A "primer" is an oligonucleotide that hybridizes to a target nucleic acid
sequence to create a
double stranded nucleic acid region that can serve as an initiation point for
DNA synthesis under suitable
conditions. Such primers may be used in a polymerase chain reaction.
"Polymerase chain reaction" is abbreviated PCR and means an in vitro method
for enzymatically
CA 02855992 2014-07-08 =
WO 02/066612
PCT/US02/05090
amplifying specific nucleic acid sequences. PCR involves a repetitive series
of temperature cycles with
each cycle comprising three stages: denaturation of the template nucleic acid
to separate the strands of
the target molecule, annealing a single stranded PCR oligonucleotide primer to
the template nucleic acid,
and extension of the annealed primer(s) by DNA polymerase. PCR provides a
means to detect the
presence of the target molecule and, under quantitative or semi-quantitative
conditions, to determine the
relative amount of that target molecule within the starting pool of nucleic
acids.
"Reverse transcription-polymerase chain reaction" is abbreviated RT-PCR and
means an in vitro
method for enzymatically producing a target cDNA molecule or molecules from an
RNA molecule or
molecules, followed by enzymatic amplification of a specific nucleic acid
sequence or sequences within
the target cDNA molecule or molecules as described above. RT-PCR also provides
a means to detect the
presence of the target molecule and, under quantitative or semi-quantitative
conditions, to determine the
relative amount of that target molecule within the starting pool of nucleic
acids.
A DNA "coding sequence" is a double-stranded DNA sequence that is transcribed
and translated
into a polypeptide in a cell in vitro or in vivo when placed under the control
of appropriate regulatory
sequences. "Suitable regulatory sequences" refer to nucleotide sequences
located upstream (5' non-
coding sequences), within, or downstream (3' non-coding sequences) of a coding
sequence, and which
influence the transcription, RNA processing or stability, or translation of
the associated coding sequence.
Regulatory sequences may include promoters, translation leader sequences,
introns, polyadenylation
recognition sequences, RNA processing site, effector binding site and stem-
loop structure. The
20.boundaries of the coding sequence are determined by a start codon at the 5'
(amino) terminus and a
translation stop codon at the 3' (carboxyl) terminus. A coding sequence can
include, but is not limited
to, prokaryotic sequences, cDNA from mRNA, genomic DNA sequences, and even
synthetic DNA
sequences. If the coding sequence is intended for expression in a eukaryotic
cell, a polyadenylation
signal and transcription termination sequence will usually be located 3' to
the coding sequence.
"Open reading frame" is abbreviated ORF and means a length of nucleic acid
sequence, either
DNA, cDNA or RNA, that comprises a translation start signal or initiation
codon, such as an ATG or
AUG, and a termination codon and can be potentially translated into a
polypeptide sequence.
The term "head-to-head" is used herein to describe the orientation of two
polynucleotide
sequences in relation to each other. Two polynucleotides are positioned in a
head-to-head orientation
when the 5' end of the coding strand of one polynucleotide is adjacent to the
5' end of the coding strand
of the other polynucleotide, whereby the direction of transcription of each
polynucleotide proceeds away
from the 5' end of the other polynucleotide. The term "head-to-head" may be
abbreviated (5')-to-(5')
and may also be indicated by the symbols (*¨ -->) or (3'<-5'5'¨>3').
The term "tail-to-tail" is used herein to describe the orientation of two
polynucleotide sequences
in relation to each other. Two polynucleotides are positioned in a tail-to-
tail orientation when the 3' end
of the coding strand of one polynucleotide is adjacent to the 3' end of the
coding strand of the other
polynucleotide, whereby the direction of transcription of each polynucleotide
proceeds toward the other
11
CA 02855992 2014-07-08
WO 02/066612 PCT/US01/05090
polynucleotide. The term "tail-to-tail" may be abbreviated (3')-to-(3') and
may also be indicated by the
symbols E-) or (5'--->3'3'4--5').
The term "head-to-tail" is used herein to describe the orientation of two
polynucleotide
sequences in relation to each other. Two polynucleotides are positioned in a
head-to-tail orientation
when the 5' end of the coding strand of one polynucleotide is adjacent to the
3' end of the coding strand
of the other polynucleotide, whereby the direction of transcription of each
polynucleotide proceeds in the
same direction as that of the other polynucleotide. The term "head-to-tail"
may be abbreviated (5')-to-
(3') and may also be indicated by the symbols (---> ¨>) or (5'¨>3'5'-->3').
The term "downstream" refers to a nucleotide sequence that is located 3' to
reference nucleotide
sequence. In particular, downstream nucleotide sequences generally relate to
sequences that follow the
starting point of transcription. For example, the translation initiation codon
of a gene is located
downstream of the start site of transcription.
The term "upstream" refers to a nucleotide sequence that is located 5' to
reference nucleotide
sequence. In particular, upstream nucleotide sequences generally relate to
sequences that are located on
the 5' side of a coding sequence or starting point of transcription. For
example, most promoters are
located upstream of the start site of transcription.
The terms "restriction endonuclease" and "restriction enzyme" refer to an
enzyme that binds and
cuts within a specific nucleotide sequence within double stranded DNA.
"Homologous recombination" refers to the insertion of a foreign DNA sequence
into another
DNA molecule, e.g., insertion of a vector in a chromosome. Preferably, the
vector targets a specific
chromosomal site for homologous recombination. For specific homologous
recombination, the vector
will contain sufficiently long regions of homology to sequences of the
chromosome to allow
complementary binding and incorporation of the vector into the chromosome.
Longer regions of
homology, and greater degrees of sequence similarity, may increase the
efficiency of homologous
recombination.
Several methods known in the art may be used to propagate a polynucleotide
according to the
invention. Once a suitable host system and growth conditions are established,
recombinant expression
vectors can be propagated and prepared in quantity. As described herein, the
expression vectors which
can be used include, but are not limited to, the following vectors or their
derivatives: human or animal
viruses such as vaccinia virus or adenovirus; insect viruses such as
baculovirus; yeast vectors;
bacteriophage vectors (e.g., lambda), and plasmid and cosmid DNA vectors, to
name but a few.
A "vector" is any means for the cloning of and/or transfer of a nucleic acid
into a host cell. A
vector may be a replicon to which another DNA segment may be attached so as to
bring about the
replication of the attached segment. A "replicon" is any genetic element
(e.g., plasinid, phage, cosrnid,
chromosome, virus) that functions as an autonomous unit of DNA replication in
vivo, i.e., capable of
replication under its own control. The term "vector" includes both viral and
nonviral means for
introducing the nucleic acid into a cell in vitro, ex vivo or in vivo. A large
number of vectors known in
12
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
the art may be used to manipulate nucleic acids, incorporate response elements
and promoters into genes,
etc. Possible vectors include, for example, plasmids or modified viruses
including, for example
bacteriophages such as lambda derivatives, or plasmids such as pBR322 or pUC
plasmid derivatives, or
the Bluescript vector. For example, the insertion of the DNA fragments
corresponding to response
elements and promoters into a suitable vector can be accomplished by ligating
the appropriate DNA
fragments into a chosen vector that has complementary cohesive termini.
Alternatively, the ends of the
DNA molecules may be enzymatically modified or any site may be produced by
ligating nucleotide
sequences (linkers) into the DNA termini. Such vectors may be engineered to
contain selectable marker
genes that provide for the selection of cells that have incorporated the
marker into the cellular genome.
Such markers allow identification and/or selection of host cells that
incorporate and express the proteins
encoded by the marker.
Viral vectors, and particularly retroviral vectors, have been used in a wide
variety of gene
delivery applications in cells, as well as living animal subjects. Viral
vectors that can be used include
but are not limited to retrovirus, adeno-associated virus, pox, baculovirus,
vaccinia, herpes simplex,
Epstein-Barr, adenovirus, geminivirus, and caulimovirus vectors. Non-viral
vectors include plasmids,
liposomes, electrically charged lipids (cytofectins), DNA-protein complexes,
and biopolymers. In
addition to a nucleic acid, a vector may also comprise one or more regulatory
regions, and/or selectable
markers useful in selecting, measuring, and monitoring nucleic acid transfer
results (transfer to which
tissues, duration of expression, etc.).
The term "plasmid" refers to an extra chromosomal element often carrying a
gene that is not part
of the central metabolism of the cell, and usually in the form of circular
double-stranded DNA molecules.
Such elements may be autonomously replicating sequences, genome integrating
sequences, phage or
nucleotide sequences, linear, circular, or supercoiled, of a single- or double-
stranded DNA or RNA,
derived from any source, in which a number of nucleotide sequences have been
joined or recombined
into a unique construction which is capable of introducing a promoter fragment
and DNA sequence for a
selected gene product along with appropriate 3' untranslated sequence into a
cell.
A "cloning vector" is a "replicon", which is a unit length of a nucleic acid,
preferably DNA, that
replicates sequentially and which comprises an origin of replication, such as
a plasmid, phage or cosmid,
to which another nucleic acid segment may be attached so as to bring about the
replication of the
attached segment. Cloning vectors may be capable of replication in one cell
type and expression in
another ("shuttle vector").
Vectors may be introduced into the desired host cells by methods known in the
art, e.g.,
transfection, electroporation, microinjection, transduction, cell fusion, DEAE
dextran, calcium phosphate
precipitation, lipofection (lysosome fusion), use of a gene gun, or a DNA
vector transporter (see, e.g.,
Wu et al., 1992, J. Biol. Chem. 267: 963-967; Wu and Wu, 1988, J. Biol. Chem.
263: 14621-14624; and
Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15,
1990).
A polynucleotide according to the invention can also be introduced in vivo by
lipofection. For the
13
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
past decade, there has been increasing use of liposomes for encapsulation and
transfection of nucleic acids in
vitro. Synthetic cationic lipids designed to limit the difficulties and
dangers encountered with liposome-
mediated transfection can be used to prepare liposomes for in vivo
transfection of a gene encoding a marker
(Feigner et al., 1987, Proc. Natl. Acad. Sci. U.S.A. 84: 7413; Mackey, et al.,
1988, Proc. Natl. Acad. Sci.
U.S.A. 85:8027-8031; and Ulmer et al., 1993, Science 259: 1745-1748). The use
of cationic lipids may
promote encapsulation of negatively charged nucleic acids, and also promote
fusion with negatively charged
cell membranes (Feigner and Ringold, 1989, Science 337:387-388). Particularly
useful lipid compounds and
compositions for transfer of nucleic acids are described in International
Patent Publications W095/18863 and
W096/17823, and in U.S. Patent No. 5,459,127. The use of lipofection to
introduce exogenous genes into
= 10 the specific organs in vivo has certain practical advantages.
Molecular targeting of liposomes to specific cells
represents one area of benefit. It is clear that directing transfection to
particular cell types would be
particularly preferred in a tissue with cellular heterogeneity, such as
pancreas, liver, kidney, and the brain.
Lipids may be chemically coupled to other molecules for the purpose of
targeting (Mackey, et al., 1988,
supra). Targeted peptides, e.g., hormones or neurotransmitters, and proteins
such as antibodies, or non-
peptide molecules could be coupled to liposomes chemically.
Other molecules are also useful for facilitating transfection of a nucleic
acid in vivo, such as a
cationic oligopeptide (e.g., W095/21931), peptides derived from DNA binding
proteins (e.g., W096/25508),
or a cationic polymer (e.g., W095/21931).
It is also possible to introduce a vector in vivo as a naked DNA plasmid (see
U.S. Patents
5,693,622, 5,589,466 and 5,580,859). Receptor-mediated DNA delivery approaches
can also be used
(Curiel et al., 1992, Hum. Gene Then 3: 147-154; and Wu and Wu, 1987, J. Biol.
Chem. 262: 4429-
4432).
The term "transfection" means the uptake of exogenous or heterologous RNA or
DNA by a cell.
A cell has been "transfected" by exogenous or heterologous RNA or DNA when
such RNA or DNA has
been introduced inside the cell. A cell has been "transformed' by exogenous or
heterologous RNA or
DNA when the transfected RNA or DNA effects a phenotypic change. The
transforming RNA or DNA
can be integrated (covalently linked) into chromosomal DNA making up the
genome of the cell.
"Transformation" refers to the transfer of a nucleic acid fragment into the
genome of a host
organism, resulting in genetically stable inheritance. Host organisms
containing the transformed nucleic
acid fragments are referred to as "transgenic" or "recombinant" or
"transformed" organisms.
The term "genetic region" will refer to a region of a nucleic acid molecule or
a nucleotide
sequence that comprises a gene encoding a polypeptide.
In addition, the recombinant vector comprising a polynucleotide according to
the invention may
include one or more origins for replication in the cellular hosts in which
their amplification or their
expression is sought, markers or selectable markers.
The term "selectable marker" means an identifying factor, usually an
antibiotic or chemical
14
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
resistance gene, that is able to be selected for based upon the marker gene's
effect, i.e., resistance to an
antibiotic, resistance to a herbicide, colorimetric markers, enzymes,
fluorescent markers, and the like,
wherein the effect is used to track the inheritance of a nucleic acid of
interest and/or to identify a cell or
organism that has inherited the nucleic acid of interest. Examples of
selectable marker genes known and
used in the art include: genes providing resistance to ampicillin,
streptomycin, gentamycin, kanamycin,
hygromycin, bialaphos herbicide, sulfonamide, and the like; and genes that are
used as phenotypic
markers, i.e., anthocyanin regulatory genes, isopentanyl transferase gene, and
the like.
The term "reporter gene" means a nucleic acid encoding an identifying factor
that is able to be
identified based upon the reporter gene's effect, wherein the effect is used
to track the inheritance of a
nucleic acid of interest, to identify a cell or organism that has inherited
the nucleic acid of interest, and/or
to measure gene expression induction or transcription. Examples of reporter
genes known and used in
the art include: luciferase (Luc), green fluorescent protein (GFP),
chloramphenicol acetyltransferase
(CAT), 13-galactosidase (LacZ), p-glucuronidase (Gus), and the like.
Selectable marker genes may also
be considered reporter genes.
"Promoter" refers to a DNA sequence capable of controlling the expression of a
coding sequence
or functional RNA. In general, a coding sequence is located 3 to a promoter
sequence. Promoters may
be derived in their entirety from a native gene, or be composed of different
elements derived from
different promoters found in nature, or even comprise synthetic DNA segments.
It is understood by
those skilled in the art that different promoters may direct the expression of
a gene in different tissues or
cell types, or at different stages of development, or in response to different
environmental or
physiological conditions. Promoters that cause a gene to be expressed in most
cell types at most times
are commonly referred to as "constitutive promoters". Promoters that cause a
gene to be expressed in a
specific cell type are commonly referred to as "cell-specific promoters" or
"tissue-specific promoters".
Promoters that cause a gene to be expressed at a specific stage of development
or cell differentiation are
commonly referred to as "developmentally-specific promoters" or "cell
differentiation-specific
promoters". Promoters that are induced and cause a gene to be expressed
following exposure or
treatment of the cell with an agent, biological molecule, chemical, ligand,
light, or the like that induces
the promoter are commonly referred to as "inducible promoters" or "regulatable
promoters". It is further
recognized that since in most cases the exact boundaries of regulatory
sequences have not been
3 0 completely defined, DNA fragments of different lengths may have identical
promoter activity.
A "promoter sequence" is a DNA regulatory region capable of binding RNA
polymerase in a cell
and initiating transcription of a downstream (3' direction) coding sequence.
For purposes of defining the
present invention, the promoter sequence is bounded at its 3' terminus by the
transcription initiation site
and extends upstream (5' direction) to include the minimum number of bases or
elements necessary to
initiate transcription at levels detectable above background. Within the
promoter sequence will be found
a transcription initiation site (conveniently defined for example, by mapping
with nuclease Si), as well
as protein binding domains (consensus sequences) responsible for the binding
of RNA polymerase.
=
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
A coding sequence is "under the control" of transcriptional and translational
control sequences in
a cell when RNA polprierase transcribes the coding sequence into mRNA, which
is then trans-RNA
spliced (if the coding sequence contains introns) and translated into the
protein encoded by the coding
sequence.
"Transcriptional and translational control sequences" are DNA regulatory
sequences, such as
promoters, enhancers, terminators, and the like, that provide for the
expression of a coding sequence in a
host cell. In eukaryotic cells, polyadenylation signals are control sequences.
The term "response element" means one or more cis-acting DNA elements which
confer
responsiveness on a promoter mediated through interaction with the DNA-binding
domains of the first
chimeric gene. This DNA element may be either palindromic (perfect or
imperfect) in its sequence or
= composed of sequence motifs or half sites separated by a variable number
of nucleotides. The half sites
can be similar or identical and arranged as either direct or inverted repeats
or as a single half site or
multimers of adjacent half sites in tandem. The response element may comprise
a minimal promoter
isolated from different organisms depending upon the nature of the cell or
organism into which the
response element will be incorporated. The DNA binding domain of the first
hybrid protein binds, in the
presence or absence of a ligand, to the DNA sequence of a response element to
initiate or suppress
transcription of downstream gene(s) under the regulation of this response
element. Examples of DNA
sequences for response elements of the natural ecdysone receptor include:
RRGG/1 1CANTGAC/ACYY
(see Cherbas L., et. al., (1991), Genes Dev. 5, 120-131); AGGTCANwAGGTCA,where
N(,) can be one
or more spacer nucleotides (see D'Avino PP., et. al., (1995), MoL Cell.
Endocrinol, 113, 1-9); and
GGGTTGAATGAA1-1 I (see Antoniewsld C., et. al., (1994). Mol. Cell Biol. 14,
4465-4474).
The term "operably linked" refers to the association of nucleic acid sequences
on a single nucleic
acid fragment so that the function of one is affected by the other. For
example, a promoter is operably
linked with a coding sequence when it is capable of affecting the expression
of that coding sequence (i.e.,
that the coding sequence is under the transcriptional control of the
promoter). Coding sequences can be
operably linked to regulatory sequences in sense or antisense orientation.
The term "expression", as used herein, refers to the transcription and stable
accumulation of
sense (mRNA) or antisense RNA derived from a nucleic acid or polynucleotide.
Expression may also
refer to translation of mRNA into a protein or polypeptide.
The terms "cassette", "expression cassette" and "gene expression cassette"
refer to a segment of
DNA that can be inserted into a nucleic acid or polynucleotide at specific
restriction sites or by
homologous recombination. The segment of DNA comprises a polynucleotide that
encodes a
polypeptide of interest, and the cassette and restriction sites are designed
to ensure insertion of the
cassette in the proper reading frame for transcription and translation.
"Transformation cassette" refers to
a specific vector comprising a polynucleotide that encodes a polypeptide of
interest and having elements
in addition to the polynucleotide that facilitate transformation of a
particular host cell. Cassettes,
expression cassettes, gene expression cassettes and transformation cassettes
of the invention may also
16
CA 02855992 2014-07-08
WO 02/066612 PCTAIS02/05090
comprise elements that allow for enhanced expression of a polynucleotide
encoding a polypeptide of
interest in a host cell. These elements may include, but are not limited to: a
promoter, a minimal
promoter, an enhancer, a response element, a terminator sequence, a
polyadenylation sequence, and the
like.
For purposes of this invention, the term "gene switch" refers to the
combination of a response
element associated with a promoter, and an EcR based system which, in the
presence of one or more
ligands, modulates the expression of a gene into which the response element
and promoter are
incorporated.
= The terms "modulate" and "modulates" mean to induce, reduce or inhibit
nucleic acid or gene
expression, resulting in the respective induction, reduction or inhibition of
protein or polypeptide
production.
The plasmids or vectors according to the invention may further comprise at
least one promoter
suitable for driving expression of a gene in a host cell. The term "expression
vector" means a vector,
plasmid or vehicle designed to enable the expression of an inserted nucleic
acid sequence following
transformation into the host. The cloned gene, i.e., the inserted nucleic acid
sequence, is usually placed
under the control of control elements such as a promoter, a minimal promoter,
an enhancer, or the like.
Initiation control regions or promoters, which are useful to drive expression
of a nucleic acid in the
desired host cell are numerous and familiar to those skilled in the art.
Virtually any promoter capable of
driving these genes is suitable for the present invention including but not
limited to: viral promoters,
bacterial promoters, animal promoters, mammalian promoters, synthetic
promoters, constitutive
promoters, tissue specific promoter, developmental specific promoters,
inducible promoters, light
regulated promoters; CYC1, HIS3, GAL], GAL4, GAL10, ADHI, PGK, PH05, GAPDH,
ADC], TRPI ,
URA3, LEU2, ENO, TPI, alkaline phosphatase promoters (useful for expression in
Saccharomyces);
AOXI promoter (useful for expression in Pichia); J3-lactamase, lac, ara, let,
trp,IPL, IPR, 77, tac, and
trc promoters (useful for expression in Escherichia colt); light regulated-,
seed specific-, pollen specific-,
ovary specific-, pathogenesis or disease related-, cauliflower mosaic virus
35S, CMV 35S minimal,
cassava vein mosaic virus (CsVMV), chlorophyll a/b binding protein, ribulose
1, 5-bisphosphate
carboxylase, shoot-specific, root specific, chitinase, stress inducible, rice
tungro bacilliform virus, plant
super-promoter, potato leucine aminopeptidase, nitrate reductase, mannopine
synthase, nopaline
3 0 synthase, ubiquitin, zein protein, and anthocyanin promoters (useful for
expression in plant cells); animal
and mammalian promoters known in the art include, but are not limited to, the
SV40 early (SV40e)
promoter region, the promoter contained in the 3' long terminal repeat (LTR)
of Rous sarcoma virus
(RSV), the promoters of the El A or major late promoter (MLP) genes of
adenoviruses (Ad), the
cytomegalovirus (CMV) early promoter, the herpes simplex virus (HSV) thymidine
kinase (TK)
promoter, a baculovirus tEl promoter, an elongation factor 1 alpha (EF1)
promoter, a phosphoglycerate
kinase (PGK) promoter, a ubiquitin (Ubc) promoter, an albumin promoter, the
regulatory sequences of
the mouse metallothionein-L promoter and transcriptional control regions, the
ubiquitous promoters
17
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
(HPRT, vimentin, a-actin, tubulin and the like), the promoters of the
intermediate filaments (desmin,
neurofilaments, keratin, GFAP, and the like), the promoters of therapeutic
genes (of the MDR, CFTR or
factor VIII type, and the like), pathogenesis or disease related-promoters,
and promoters that exhibit
tissue specificity and have been utilized in transgenic animals, such as the
elastase I gene control region
which is active in pancreatic acinar cells; insulin gene control region active
in pancreatic beta cells,
immunoglobulin gene control region active in lymphoid cells, mouse mammary
tumor virus control
region active in testicular, breast, lymphoid and mast cells; albumin gene,
Apo Al and Apo All control
regions active in liver, alpha-fetoprotein gene control region active in
liver, alpha 1-antitrypsin gene
control region active in the liver, beta-globin gene control region active in
myeloid cells, myelin basic
protein gene control region active in oligodendrocyte cells in the brain,
myosin light chain-2 gene control
region active in skeletal muscle, and gonadotropic releasing hormone gene
control region active in the
hypothalamus, pyruvate kinase promoter, villin promoter, promoter of the fatty
acid binding intestinal
protein, promoter of the smooth muscle cell a-actin, and the like. In
addition, these expression
sequences may be modified by addition of enhancer or regulatory sequences and
the like.
Enhancers that may be used in embodiments of the invention include but are not
limited to: an
SV40 enhancer, a cytomegalovirus (CMV) enhancer, an elongation factor 1 (EF1)
enhancer, yeast
enhancers, viral gene enhancers, and the like.
Termination control regions, i.e., terminator or polyadenylation sequences,
may also be derived
from various genes native to the preferred hosts. Optionally, a termination
site may be unnecessary,
however, it is most preferred if included. In a preferred embodiment of the
invention, the termination
control region may be comprise or be derived from a synthetic sequence,
synthetic polyadenylation
signal, an SV40 late polyadenylation signal, an SV40 polyadenylation signal, a
bovine growth hormone
(BGH) polyadenylation signal, viral terminator sequences, or the like.
The terms "3' non-coding sequences" or "3' untranslated region (UTR)" refer to
DNA sequences
located downstream (3') of a coding sequence and may comprise polyadenylation
[poly(A)] recognition
sequences and other sequences encoding regulatory signals capable of affecting
mRNA processing or
gene expression. The polyadenylation signal is usually characterized by
affecting the addition of
polyadenylic acid tracts to the 3' end of the mRNA precursor.
"Regulatory region" means a nucleic acid sequence that regulates the
expression of a second
nucleic acid sequence. A regulatory region may include sequences which are
naturally responsible for
expressing a particular nucleic acid (a homologous region) or may include
sequences of a different origin
that are responsible for expressing different proteins or even synthetic
proteins (a heterologous region).
In particular, the sequences can be sequences of prokaryotic, eukaryotic, or
viral genes or derived
sequences that stimulate or repress transcription of a gene in a specific or
non-specific manner and in an
,inducible or non-inducible manner. Regulatory regions include origins of
replication, RNA splice sites,
promoters, enhancers, transcriptional termination sequences, and signal
sequences which direct the
polypeptide into the secretory pathways of the target cell.
18
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
A regulatory region from a "heterologous source" is a regulatory region that
is not naturally
associated with the expressed nucleic acid. Included among the heterologous
regulatory regions are
regulatory regions from a different species, regulatory regions from a
different gene, hybrid regulatory
sequences, and reguatory sequences which do not occur in nature, but which are
designed by one having
ordinary skill in the art.
"RNA transcript" refers to the product resulting from RNA polymerase-catalyzed
transcription of
a DNA sequence. When the RNA transcript is a perfect complementary copy of the
DNA sequence, it is
referred to as the primary transcript or it may be a RNA sequence derived from
post-transcriptional
processing of the primary transcript and is referred to as the mature RNA.
"Messenger RNA (mRNA)"
refers to the RNA that is without introns and that can be translated into
protein by the cell. "cDNA"
refers to a double-stranded DNA that is complementary to and derived from
mRNA. "Sense" RNA
refers to RNA transcript that includes the mRNA and so can be translated into
protein by the cell.
"Antisense RNA" refers to a RNA transcript that is complementary to all or
part of a target primary
transcript or mRNA and that blocks the expression of a target gene. The
complementarity of an antisense
RNA may be with any part of the specific gene transcript, i.e., at the 5' non-
coding sequence, 3' non-
coding sequence, or the coding sequence. "Functional RNA" refers to antisense
RNA, ribozyme RNA,
or other RNA that is not translated yet has an effect on cellular processes.
A "polypeptide" is a polymeric compound comprised of covalently linked amino
acid residues.
Amino acids have the following general structure:
R¨C¨COOH
NH2
Amino acids are classified into seven groups on the basis of the side chain R:
(1) aliphatic side chains,
(2) side chains containing a hydroxylic (OH) group, (3) side chains containing
sulfur atoms, (4) side
chains containing an acidic or amide group, (5) side chains containing a basic
group, (6) side chains
containing an aromatic ring, and (7) proline, an imino acid in which the side
chain is fused to the amino
group. A polypeptide of the invention preferably comprises at least about 14
amino acids.
3 0 A "protein" is a polypeptide that performs a structural or functional
role in a living cell.
An "isolated polypeptide" or "isolated protein" is a polypeptide or protein
that is substantially
free of those compounds that are normally associated therewith in its natural
state (e.g., other proteins or
polypeptides, nucleic acids, carbohydrates, lipids). "Isolated" is not meant
to exclude artificial or
synthetic mixtures with other compounds, or the presence of impurities which
do not interfere with
biological activity, and which may be present, for example, due to incomplete
purification, addition of
stabilizers, or compounding into a pharmaceutically acceptable preparation.
A "substitution mutant polypeptide" or a "substitution mutant" will be
understood to mean a
19
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
mutant polypeptide comprising a substitution of at least one (1) wild-type or
naturally occurring amino
acid with a different amino acid relative to the wild-type or naturally
occurring polypeptide. A
substitution mutant polypeptide may comprise only one (1) wild-type or
naturally occurring amino acid
substitution and may be referred to as a "point mutant" or a "single point
mutant" polypeptide.
Alternatively, a substitution mutant polypeptide may comprise a substitution
of two (2) or more wild-
type or naturally occurring amino acids with 2 or more amino acids relative to
the wild-type or naturally
occurring polypeptide. According to the invention, a Group H nuclear receptor
ligand binding domain
polypeptide comprising a substitution mutation comprises a substitution of at
least one (1) wild-type or
naturally occurring amino acid with a different amino acid relative to the
wild-type or naturally occurring
Group H nuclear receptor ligand binding domain polypeptide.
Wherein the substitution mutant polypeptide comprises a substitution of two
(2) or more wild-
type or naturally occurring amino acids, this substitution may comprise either
an c.A.julvalent number of
wild-type or naturally occurring amino acids deleted for the substitution,
i.e., 2 wild-type or naturally
occurring amino acids replaced with 2 non-wild-type or non-naturally occurring
amino acids, or a non-
equivalent number of wild-type amino acids deleted for the substitution, i.e.,
2 wild-type amino acids
replaced with 1 non-wild-type amino acid (a substitution+deletion mutation),
or 2 wild-type amino acids
replaced with 3 non-wild-type amino acids (a substitution+insertion mutation).
Substitution mutants may
be described using an abbreviated nomenclature system to indicate the amino
acid residue and number
replaced within the reference polypeptide sequence and the new substituted
amino acid residue. For
example, a substitution mutant in which the twentieth (20th) amino acid
residue of a polypeptide is
substituted may be abbreviated as "x2Oz", wherein "x" is the amino acid to be
replaced, "20" is the
amino acid residue position or number within the polypeptide, and "z" is the
new substituted amino acid.
Therefore, a substitution mutant abbreviated interchangeably as "E20A" or
"Glu20Ala" indicates that
the mutant comprises an alanine residue (commonly abbreviated in the art as
"A" or "Ala") in place of
the glutamic acid (commonly abbreviated in the art as "E" or "Glu") at
position 20 of the polypeptide.
A substitution mutation may be made by any technique for mutagenesis known in
the art,
including but not limited to, in vitro site-directed mutagenesis (Hutchinson,
C., et al., 1978, J. Biol.
Chem. 253: 6551; Zoller and Smith, 1984, DNA 3: 479-488; Oliphant et al.,
1986, Gene 44: 177;
Hutchinson et al., 1986, Proc. Natl. Acad. Sci. U.S.A. 83: 710), use of TAB
linkers (Pharmacia),
restriction endonuclease digestion/fragment deletion and substitution, PCR-
mediated/oligonucleotide-
. _
directed mutagenesis, and the like. PCR-based techniques are preferred for
site-directed mutagenesis
(see Higuchi, 1989, "Using PCR to Engineer DNA", in PCR Technology: Principles
and Applications for
DNA Amplification, H. Erlich, ed., Stockton Press, Chapter 6, pp. 61-70).
=
"Fragment" of a polypeptide according to the invention will be understood to
mean a polypeptide
whose amino acid sequence is shorter than that of the reference polypeptide
and which comprises, over
the entire portion with these reference polypeptides, an identical amino acid
sequence. Such fragments
may, where appropriate, be included in a larger polypeptide of which they are
a part. Such fragments of
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
a polypeptide according to the invention may have a length of at least 2, 3,
4, 5, 6, 8, 10, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 25, 26, 30, 35, 40, 45,50, 100, 200, 240, or 300 amino
acids.
A "variant" of a polypeptide or protein is any analogue, fragment, derivative,
or mutant which is
derived from a polypeptide or protein and which retains at least one
biological property of the
polypeptide or protein. Different variants of the polypeptide or protein may
exist in nature. These
variants may be allelic variations characterized by differences in the
nucleotide sequences of the
structural gene coding for the protein, or may involve differential splicing
or post-translational
modification. The skilled artisan can produce variants having single or
multiple amino acid
substitutions, deletions, additions, or replacements. These variants may
include, inter alia: (a) variants in
which one or more amino acid residues are substituted with conservative or non-
conservative amino
acids, (b) variants in which one or more amino acids are added to the
polypeptide or protein, (c) variants
in which one or more of the amino acids includes a substituent group, and (d)
variants in which the
polypeptide or protein is fused with another polypeptide such as serum
albumin. The techniques for
obtaining these variants, including genetic (suppressions, deletions,
mutations, etc.), chemical, and
enzymatic techniques, are known to persons having ordinary skill in the art. A
variant polypeptide
preferably comprises at least about 14 amino acids.
A "heterologous protein" refers to a protein not naturally produced in the
cell.
A "mature protein" refers to a post-translationally processed polypeptide;
i.e., one from which
any pre- or propeptides present in the primary translation product have been
removed. "Precursor"
protein refers to the primary product of translation of mRNA; i.e., with pre-
and propeptides still present.
Pre- and propeptides may be but are not limited to intracellular localization
signals.
The term "signal peptide" refers to an amino terminal polypeptide preceding
the secreted mature
protein. The signal peptide is cleaved from and is therefore not present in
the mature protein. Signal
peptides have the function of directing and translocating secreted proteins
across cell membranes. Signal
peptide is also referred to as signal protein.
A "signal sequence" is included at the beginning of the coding sequence of a
protein to be
expressed on the surface of a cell. This sequence encodes a signal peptide, N-
terminal to the mature
polypeptide, that directs the host cell to translocate the polypeptide. The
term "translocation signal
sequence" is used herein to refer to this sort of signal sequence.
Translocation signal sequences can be
3 0 found associated with a variety of proteins native to eukaryotes and
prokaryotes, and are often functional
in both types of organisms.
The term "homology" refers to the percent of identity between two
polynucleotide or two
polypeptide moieties. The correspondence between the sequence from one moiety
to another can be
determined by techniques known to the art. For example, homology can be
determined by a direct
comparison of the sequence information between two polypeptide molecules by
aligning the sequence
information and using readily available computer programs. Alternatively,
homology can be determined
by hybridization of polynucleotides under conditions that form stable duplexes
between homologous
21
CA 02855992 2014-07-08
WO 02/066612
PCTTUS02/05090
regions, followed by digestion with single-stranded-specific nuclease(s) and
size determination of the
digested fragments. =
As used herein, the term "homologous" in all its grammatical forms and
spelling variations refers
to the relationship between proteins that possess a "common evolutionary
origin," including proteins
from superfarnilies (e.g., the immunoglobulin superfamily) and homologous
proteins from different
species (e.g., myosin light chain, etc.) (Reeck et al., 1987, Cell 50: 667.).
Such proteins (and their
encoding genes) have sequence homology, as reflected by their high degree of
sequence similarity.
However, in common usage and in the instant application, the term
"homologous," when modified with
an adverb such as "highly," may refer to sequence similarity and not a common
evolutionary origin.
Accordingly, the term "sequence similarity" in all its grammatical forms
refers to the degree of
identity or correspondence between nucleic acid or amino acid sequences of
proteins that may or may not
share a common evolutionary origin (see Reeck et al., 1987, Cell 50:667).
In a specific embodiment, two DNA sequences are "substantially homologous" or
"substantially
similar" when at least about 50% (preferably at least about 75%, and most
preferably at least about 90 or
95%) of the nucleotides match over the defined length of the DNA sequences.
Sequences that are
substantially homologous can be identified by comparing the sequences using
standard software
available in sequence data banks, or in a Southern hybridization experiment
under, for example, stringent
conditions as defined for that particular system. Defining appropriate
hybridization conditions is within
the skill of the art. See, e.g., Sambrook etal., 1989, supra.
As used herein, "substantially similar" refers to nucleic acid fragments
wherein changes in one
or more nucleotide bases results in substitution of one or more amino acids,
but do not affect the
functional properties of the protein encoded by the DNA sequence.
"Substantially similar" also refers to
nucleic acid fragments wherein changes in one or more nucleotide bases does
not affect the ability of the
nucleic acid fragment to mediate alteration of gene expression by antisense or
co-suppression
technology. "Substantially similar" also refers to modifications of the
nucleic acid fragments of the
instant invention such as deletion or insertion of one or more nucleotide
bases that do not substantially
affect the functional properties of the resulting transcript. It is therefore
understood that the invention
encompasses more than the specific exemplary sequences. Each of the proposed
modifications is well
within the routine skill in the art, as is determination of retention of
biological activity of the encoded
products.
Moreover, the skilled artisan recognizes that substantially similar sequences
encompassed by this
invention are also defined by their ability to hybridize, under stringent
conditions (0.1X SSC, 0.1% SDS,
65 C and washed with 2X SSC, 0.1% SDS followed by 0.1X SSC, 0.1% SDS), with
the sequences
exemplified herein. Substantially similar nucleic acid fragments of the
instant invention are those
nucleic acid fragments whose DNA sequences are at least 70% identical to the
DNA sequence of the
nucleic acid fragments reported herein. Preferred substantially nucleic acid
fragments of the instant
invention are those nucleic acid fragments whose DNA sequences are at least
80% identical to the DNA
22
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
sequence of the nucleic acid fragments reported herein. More preferred nucleic
acid fragments are at
least 90% identical to the DNA sequence of the nucleic acid fragments reported
herein. Even more
preferred are nucleic acid fragments that are at least 95% identical to the
DNA sequence of the nucleic
acid fragments reported herein.
Two amino acid sequences are "substantially homologous" or "substantially
similar" when
greater than about 40% of the amino acids are identical, or greater than 60%
are similar (functionally
identical). Preferably, the similar or homologous sequences are identified by
alignment using, for
example, the GCG (Genetics Cot __ puter Group, Program Manual for the GCG
Package, Version 7,
Madison, Wisconsin) pileup program.
The term "corresponding to" is used herein to refer to similar or homologous
sequences, whether
=
the exact position is identical or different from the molecule to which the
similarity or homology is
measured. A nucleic acid or amino acid sequence alignment may include spaces.
Thus, the term
"corresponding to" refers to the sequence similarity, and not the numbering of
the amino acid residues or
nucleotide bases.
A "substantial portion" of an amino acid or nucleotide sequence comprises
enough of the amino
acid sequence of a polypeptide or the nucleotide sequence of a gene to
putatively identify that
polypeptide or gene, either by manual evaluation of the sequence by one
skilled in the art, or by
computer-automated sequence comparison and identification using algorithms
such as BLAST (Basic
Local Alignment Search Tool; Altschul, S. F., et al., (1993)J. Mol. Biol. 215:
403-410).
\ In general, a sequence of ten or more
contiguous amino acids or thirty
or more nucleotides is necessary in order to putatively identify a polypeptide
or nucleic acid sequence as
homologous to a known protein or gene. Moreover, with respect to nucleotide
sequences, gene specific
oligonucleotide probes comprising 20-30 contiguous nucleotides may be used in
sequence-dependent
methods of gene identification (e.g., Southern hybridization) and isolation
(e.g., in situ hybridization of
bacterial colonies or bacteriophage plaques). In addition, short
oligonucleotides of 12-15 bases may be
used as amplification primers in PCR in order to obtain a particular nucleic
acid fragment comprising the
primers. Accordingly, a "substantial portion" of a nucleotide sequence
comprises enough of the
sequence to specifically identify and/or isolate a nucleic acid fragment
comprising the sequence.
The term "percent identity", as known in the art, is a relationship between
two or more
polypeptide sequences or two or more polynucleotide sequences, as determined
by comparing the
sequences. In the art, "identity" also means the degree of sequence
relatedness between polypeptide or
polynucleotide sequences, as the case may be, as determined by the match
between strings of such
sequences. "Identity" and "similarity" can be readily calculated by known
methods, including but not
limited to those described in: Computational Molecular Biology (Lesk, A. M.,
ed.) Oxford University
Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith,
D. W., ed.)
Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I
(Griffin, A. M., and
Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in
Molecular Biology (von '
23
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer
(Gribskov, M. and Devereux, J.,
eds.) Stockton Press, New York (1991). Preferred methods to determine identity
are designed to give the
best match between the sequences tested. Methods to determine identity and
similarity are codified in
publicly available computer programs. Sequence alignments and percent identity
calculations may be
performed using the Megalign program of the LASERGENE bioinformatics computing
suite
(DNASTAR Inc., Madison, WI). Multiple alignment of the sequences may be
performed using the
Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with
the default parameters
(GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise
alignments
using the Clustal method may be selected: KTUPLE 1, GAP PENALTY=3, WINDOW=5
and
DIAGONALS SAVED=5.
The term "sequence analysis software" refers to any computer algorithm or
software program
that is useful for the analysis of nucleotide or amino acid sequences.
"Sequence analysis software" may
be commercially available or independently developed. Typical sequence
analysis software will include
but is not limited to the GCG suite of programs (Wisconsin Package Version
9.0, Genetics Computer
Group (GCG), Madison, WI), BLASTP, BLASTN, BLASTX (Altschul et al., .1. MoL
Biol. 215: 403410
(1990), and DNASTAR (DNASTAR, Inc. 1228 S. Park St. Madison, WI 53715 USA).
Within the
context of this application it will be understood that where sequence analysis
software is used for
analysis, that the results of the analysis will be based on the "default
values" of the program referenced,
unless otherwise specified. As used herein "default values" will mean any set
of values or parameters
which originally load with the software when first initialized.
"Synthetic genes" can be assembled from oligonucleotide building blocks that
are chemically
synthesized using procedures known to those skilled in the art. These building
blocks are ligated and
annealed to form gene segments that are then enzymatically assembled to
construct the entire gene.
"Chemically synthesized", as related to a sequence of DNA, means that the
component nucleotides were
assembled in vitro. Manual chemical synthesis of DNA may be accomplished using
well-established
procedures, or automated chemical synthesis can be performed using one of a
number of commercially
available machines. Accordingly, the genes can be tailored for optimal gene
expression based on
optimization of nucleotide sequence to reflect the codon bias of the host
cell. The skilled artisan
appreciates the likelihood of successful gene expression if codon usage is
biased towards those codons
favored by the host. Determination of preferred codons can be based on a
survey of genes derived from
the host cell where sequence information is available.
As used herein, two or more individually operable gene regulation systems are
said to be
"orthogonal" when; a) modulation of each of the given systems by its
respective ligand, at a chosen
concentration, results in a measurable change in the magnitude of expression
of the gene of that system,
and b) the change is statistically significantly different than the change in
expression of all other systems
simultaneously operable in the cell, tissue, or organism, regardless of the
simultaneity or sequentially of
the actual modulation. Preferably, modulation of each individually operable
gene regulation system
24
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
effects a change in gene expression at least 2-fold greater than all other
operable systems in the cell,
tissue, or organism. More preferably, the change is at least 5-fold greater.
Even more preferably, the
change is at least 10-fold greater. Still more preferably, the change is at
least 100 fold greater. Even still
more preferably, the change is at least 500-fold greater. Ideally, modulation
of each of the given systems
by its respective ligand at a chosen concentration results in a measurable
change in the magnitude of
expression of the gene of that system and no measurable change in expression
of all other systems
operable in the cell, tissue, or organism. In such cases the multiple
inducible gene regulation system is
said to be "fully orthogonal". The present invention is useful to search for
orthogonal ligands and
orthogonal receptor-based gene expression systems such as those described in
W020021029075.
GENE EXPRESSION MODULATION SYSTEM OF THE INVENTION
Applicants have identified herein amino acid residues that are involved in
ligand binding to a
Group H nuclear receptor ligand binding domain that affect the ligand
sensitivity and magnitude of
induction in an ecdysone receptor-based inducible gene expression system.
Applicants describe herein
the construction of Group H nuclear receptors that comprise substitution
mutations (referred to herein as
"substitution mutants") at these critical residues and the demonstration that
these substitution mutant
nuclear receptors are useful in methods of modulating gene expression. As
presented herein, Applicants'
novel substitution mutant nuclear receptors and their use in a nuclear
receptor-based inducible gene
expression system provides an improved inducible gene expression system in
both prokaryotic and
eukaryotic host cells in which ligand sensitivity and magnitude of
transactivation may be selected as
desired, depending upon the application.
Thus, the present invention relates to novel substitution mutant Group H
nuclear receptor
polynucleotides and polypeptides, a nuclear receptor-based inducible gene
expression system comprising
such mutated Group H nuclear receptor polynucleotides and polypeptides, and
methods of modulating
the expression of a gene within a host cell using such a nuclear receptor-
based inducible gene expression
system.
In particular, the present invention relates to a gene expression modulation
system
comprising at least one gene expression cassette that is capable of being
expressed in a host cell
comprising a polynucleotide that encodes a polypeptide comprising a Group H
nuclear receptor ligand
binding domain comprising a substitution mutation. Preferably, the Group H
nuclear receptor ligand
binding domain comprising a substitution mutation is from an ecdysone
receptor, a ubiquitous receptor,
an orphan receptor 1, a NER-1, a steroid hormone nuclear receptor 1, a
retinoid X receptor interacting
protein ¨15, a liver X receptor 13, a steroid hormone receptor like protein, a
liver X receptor, a liver X
receptor a., a farnesoid X receptor, a receptor interacting protein 14, and a
farnesol receptor. More
preferably, the Group H nuclear receptor ligand binding domain comprising a
substitution mutation is
from an ecdysone receptor.
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
In a specific embodiment, the gene expression modulation system comprises a
gene expression
cassette comprising a polynucleotide that encodes a polypeptide comprising a
transactivation domain, a
DNA-binding domain that recognizes a response element associated with a gene
whose expression is to
be modulated; and a Group H nuclear receptor ligand binding domain comprising
a substitution
mutation. The gene expression modulation system may further comprise a second
gene expression
cassette comprising: i) a response element recognized by the DNA-binding
domain of the encoded .
polypeptide of the first gene expression cassette; ii) a promoter that is
activated by the transactivation
domain of the encoded polypeptide of the first gene expression cassette; and
iii) a gene whose expression
is to be modulated.
In another specific embodiment, the gene expression modulation system
comprises a gene
=
expression cassette comprising a) a polynucleotide that encodes a polypeptide
comprising a
transactivation domain, a DNA-binding domain that recognizes a response
element associated with a
gene whose expression is to be modulated; and a Group H nuclear receptor
ligand binding domain
comprising a substitution mutation, and b) a second nuclear receptor ligand
binding domain selected
from the group consisting of a vertebrate retinoid X receptor ligand binding
domain, an invertebrate
retinoid X receptor ligand binding domain, an ultraspiracle protein ligand
binding domain, and a
chimeric ligand binding domain comprising two polypeptide fragments, wherein
the first polypeptide
fragment is from a vertebrate retinoid X receptor ligand binding domain, an
invertebrate retinoid X
receptor ligand binding domain, or an ultraspiracle protein ligand binding
domain, andthe second
polypeptide fragment is from a different vertebrate retinoid X receptor ligand
binding domain,
invertebrate retinoid X receptor ligand binding domain, or ultraspiracle
protein ligand binding domain.
The gene expression modulation system may further comprise a second gene
expression cassette
comprising: i) a response element recognized by the DNA-binding domain of the
encoded polypeptide of
the first gene expression cassette; ii) a promoter that is activated by the
transactivation domain of the
encoded polypeptide of the first gene expression cassette; and iii) a gene
whose expression is to be
modulated.
In another specific embodiment, the gene expression modulation system
comprises a
first gene expression cassette comprising a polynucleotide that encodes a
first polypeptide comprising a
DNA-binding domain that recognizes a response element associated with a gene
whose expression is to
be modulated and a nuclear receptor ligand binding domain, and a second gene
expression cassette
comprising a polynucleotide that encodes a second polypeptide comprising a
transactivation domain and
a nuclear receptor ligand binding domain, wherein one of the nuclear receptor
ligand binding domains is
a Group H nuclear receptor ligand binding domain comprising a substitution
mutation. In a preferred
embodiment, the first polypeptide is substantially free of a transactivation
domain and the second
polypeptide is substantially free of a DNA binding domain. For purposes of the
invention, "substantially
free" means that the protein in question does not contain a sufficient
sequence of the domain in question
to provide activation or binding activity. The gene expression modulation
system may further comprise a
26
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
third gene expression cassette comprising: i) a response element recognized by
the DNA-binding domain
of the first polypeptide of the first gene expression cassette; ii) a promoter
that is activated by the
transactivation domain of the second polypeptide of the second gene expression
cassette; and iii) a gene
whose expression is to be modulated.
Wherein when only one nuclear receptor ligand binding domain is a Group H
ligand binding
domain comprising a substitution mutation, the other nuclear receptor ligand
binding domain may be
from any other nuclear receptor that forms a dimer with the Group H ligand
binding domain comprising
the substitution mutation. For example, when the Group H nuclear receptor
ligand binding domain
comprising a substitution mutation is an ecdysone receptor ligand binding
domain comprising a
' 10 substitution mutation, the other nuclear receptor ligand binding
domain ("partner") may be from an
ecdysone receptor, a vertebrate retinoid X receptor (RXR), an invertebrate
RXR, an ultraspiracle protein
(USP), or a chimeric nuclear receptor comprising at least two different
nuclear receptor ligand binding
domain polypeptide fraguients selected from the group consisting of a
vertebrate RXR, an invertebrate
RXR, and a USP (see WO 2001/70816 and WO 2002/066614).
1 5 The "partner" nuclear receptor ligand binding domain
may further comprise a truncation mutation, a deletion mutation, a
substitution mutation, or another
modification.
Preferably, the vertebrate RXR ligand binding domain is from a human Homo
sapiens, mouse
Mus musculus, rat Rattus norvegicus, chicken Gallus gallus, pig Sus scrofa
domestica, frog Xenopus
20 laevis, zebrafish Danio rerio, tunicate Polyandrocarpa misakiensis, or
jellyfish Tripedalia cysophora
RXR.
Preferably, the invertebrate RXR ligand binding domain is from a locust
Locusta migratoria
ultraspiracle polypeptide ("LmUSP"), an ixodid tick Amblyomma americanum RXR
homolog 1
("ArnaRXRl"), a ixodid tick Amblyomma americanum RXR homolog 2 ("AmaRXR2"), a
fiddler crab
25 Celuca pugilator RXR homolog ("CpRXR"), a beetle Tenebrio molitor RXR
homolog ("TmRXR"), a
honeybee Apis mellifera RXR homolog ("AmRXR"), an aphid Myzus persicae RXR
homolog
("MpRXR"), or a non-Dipteran/non-Lepidopteran RXR homolog.
Preferably, the chimeric RXR ligand binding domain comprises at least two
polypeptide
fragments selected from the group consisting of a vertebrate species RXR
polypeptide fragment, an
30 invertebrate species RXR polypeptide fragment, and a non-Dipteran/non-
Lepidopteran invertebrate
species RXR homolog polypeptide fragment. A chimeric RXR ligand binding domain
for use in the
present invention may comprise at least two different species RXR polypeptide
fragments, or when the
species is the same, the two or more polypeptide fragments may be from two or
more different isoforms
of the species RXR polypeptide fragment.
35 In a preferred embodiment, the chimeric RXR ligand binding domain
comprises at least one
vertebrate species RXR polypeptide fragment and one invertebrate species RXR
polypeptide fragment.
In a more preferred embodiment, the chimeric RXR ligand binding domain
comprises at least
27
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
one vertebrate species RXR polypeptide fragment and one non-Dipteran/non-
Lepidopteran invertebrate
species RXR homolog polypeptide fragment.
In a specific embodiment, the gene whose expression is to be modulated is a
homologous gene
with respect to the host cell. In another specific embodiment, the gene whose
expression is to be
modulated is a heterologous gene with respect to the host cell.
The ligancis for use in the present invention as described below, when
combined with the ligand
binding domain of the nuclear receptor(s), which in turn are bound to the
response element linked to a
gene, provide the means for external temporal regulation of expression of the
gene. The binding
mechanism or the order in which the various components of this invention bind
to each other, that is, for
example, ligand to ligand binding domain, DNA-binding domain to response
element, transactivation
domain to promoter, etc., is not critical.
In a specific example, binding of the ligand to the ligand binding domain of a
Group H nuclear
receptor and its nuclear receptor ligand binding domain partner enables
expression or suppression of the
gene. This mechanism does not exclude the potential for ligand binding to the
Group E nuclear receptor -
(GHNR) or its partner, and the resulting formation of active homodimer
complexes (e.g. GHNR +
GHNR or partner+partner). Preferably, one or more of the receptor domains is
varied producing a
hybrid gene switch. Typically, one or more of the three domains, DBD, LBD, and
transactivation
domain, may be chosen from a source different than the source of the other
domains so that the hybrid
genes and the resulting hybrid proteins are optimized in the chosen host cell
or organism for
transactivating activity, complementary binding of the ligand, and recognition
of a specific response
element. In addition, the response element itself can be modified or
substituted with response elements
for other DNA binding protein domains such as the GAL-4 protein from yeast
(see Sadowski, et al.
(1988), Nature, 335: 563-564) or LexA protein from Escherichia colt (see Brent
and Ptashne (1985),
Cell, 43: 729-736), or synthetic response elements specific for targeted
interactions with proteins
designed, modified, and selected for such specific interactions (see, for
example, Kim, et al. (1997),
Proc. Natl. Acad. Sci., USA, 94:3 616-3620) to accommodate hybrid receptors.
Another advantage of
two-hybrid systems is that they allow choice of a promoter used to drive the
gene expression according
to a desired end result. Such double control can be particularly important in
areas of gene therapy,
especially when cytotoxic proteins are produced, because both the timing of
expression as well as the
cells wherein expression occurs can be controlled. When genes, operably linked
to a suitable promoter,
are introduced into the cells of the subject, expression of the exogenous
genes is controlled by the
presence of the system of this invention. Promoters may be constitutively or
inducibly regulated or may
be tissue-specific (that is, expressed only in a particular type of cells) or
specific to certain
developmental stages of the organism.
The ecdysone receptor is a member of the nuclear receptor superfamily and
classified into
subfamily I, group H (referred to herein as "Group H nuclear receptors"). The
members of each group
share 40-60% amino acid identity in the E (ligand binding) domain (Laudet et
al., A Unified
28
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
Nomenclature System for the Nuclear Receptor Subfamily, 1999; Cell 97: 161-
163). In addition to the =
ecdysone receptor, other members of this nuclear receptor subfamily 1, group H
include: ubiquitous
receptor (UR), orphan receptor 1 (OR-1), steroid hormone nuclear receptor 1
(NER-1), retinoid X
receptor interacting protein ¨15 (RIP-15), liver X receptor 0 (LX.R0), steroid
hormone receptor like
protein (RLD-1), liver X receptor (LXR), liver X receptor a (LXRa), farnesoid
X receptor (FXR),
receptor interacting protein 14 (RIP-14), and famesol receptor (HRR-1).
Applicants have developed a CfEcR homology model and have used this homology
model
together with a published Chironomous tetans ecdysone receptor ("CtEcR")
homology model (Wurtz et
al., 2000) to identify critical residues involved in binding to steroids and
non-steroids. The synthetic
non-steroids, diacylhydrazines, have been shown to bind lepidopteran EcRs with
high affinity and induce
precocious incomplete molt in these insects (Wing et al., 1988) and several of
these compounds are
currently marketed as insecticides. The ligand binding cavity or "pocket" of
EcRs has evolved to fit the
long backbone structures of ecdysteroids such as 20-hydroxyecdysone (20E). The
diacylhydrazines have
a compact structure compared to steroids and occupy only the bottom part of
the EcR binding pocket.
This leaves a few critical residues at the top part of the binding pocket that
make contact with steroids
but not with non-steroids such as bisacylhydrazines. Applicants describe
herein the construction of
mutant ecdysone receptors comprising a substitution mutation at these binding
pocket residues and have
identified several classes of substitution mutant ecdysone receptors with
modified ligand binding and
transactivation characteristics.
Given the close relatedness of ecdysone receptor to other Group H nuclear
receptors, Applicants'
identified ecdysone receptor ligand binding domain substitution mutations are
also expected to work
when introduced into the analogous position of the ligand binding domains of
other Group H nuclear
receptors to modify their ligand binding or ligand sensitivity. Applicants'
novel substitution mutated
Group H nuclear receptor polynucleotides and polypeptides are useful in a
nuclear receptor-based
inducible gene modulation system for various applications including gene
therapy, expression of proteins =
of interest in host cells, production of transgenic organisms, and cell-based
assays.
In particular, Applicants describe herein a novel gene expression modulation
system comprising
a Group H nuclear receptor ligand binding domain comprising a substitution
mutation. This gene
expression system may be a "single switch"-based gene expression system in
which the transactivation
domain, DNA-binding domain and ligand binding domain are on one encoded
polypeptide.
Alternatively, the gene expression modulation system may be a "dual switch"-
or "two-hybrid"-based
gene expression modulation system in which the transactivation domain and DNA-
binding domain are
located on two different encoded polypeptides. Applicants have demonstrated
for the first time that a
substitution mutated nuclear receptor can be used as a component of a nuclear
receptor-based inducible
gene expression system to modify ligand binding activity and/or ligand
specificity in both prokaryotic
and eukaryotic cells. As discussed herein, Applicants' findings are both
unexpected and surprising.
An ecdysone receptor-based gene expression modulation system of the present
invention may be
29
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
either heterodimeric and hommlimeric. A functional EcR complex generally
refers to a heterodimeric
protein complex consisting of two members of the steroid receptor family, an
ecdysone receptor protein
obtained from various insects, and an ultraspiracle (USP) protein or the
vertebrate homolog of USP,
retinoid X receptor protein (see Yao, et al. (1993) Nature 366: 476-479; Yao,
et al., (1992) Cell 71: 63-
72). However, the complex may also be a homodimer as detailed below. The
functional ecdysteroid
receptor complex may also include additional protein(s) such as immunophilins.
Additional members of
the steroid receptor family of proteins, known as transcriptional factors
(such as DHR38 or betaFTZ- I),
may also be ligand dependent or independent partners for EcR, USP, and/or RXR.
Additionally, other
cofactors may be required such as proteins generally known as coactivators
(also termed adapters or
mediators). These proteins do not bind sequence-specifically to DNA and are
not involved in basal
transcription. They may exert their effect on transcription activation through
various mechanisms,
including stimulation of DNA-binding of activators, by affecting chromatin
structure, or by mediating
activator-initiation complex interactions. Examples of such coactivators
include RIP140, TIF1,
RAP46/Bag-1, ARA70, SRC-1/NCoA-1, TIF2/GRIP/NCoA-2, ACTR/AIBURAC3/pCIP as well
as the
promiscuous coactivator C response element B binding protein, CBP/p300 (for
review see Glass et al.,
Curr. Opin. Cell Biol. 9: 222-232, 1997). Also, protein cofactors generally
known as corepressors (also
known as repressors, silencers, or silencing mediators) may be required to
effectively inhibit
transcriptional activation in the absence of ligand. These corepressors may
interact with the unliganded
ecdysone receptor to silence the activity at the response element. Current
evidence suggests that the
binding of ligand changes the conformation of the receptor, which results in
release of the corepressor
and recruitment of the above described coactivators, thereby abolishing their
silencing activity.
Examples of corepressors include N-CoR and SMRT (for review, see Horwitz et
al. Mol Endocrinol. 10:
1167-1177, 1996). These cofactors may either be endogenous within the cell or
organism, or may be
added exogenously as transgenes to be expressed in either a regulated or
unregulated fashion.
Homodimer complexes of the ecdysone receptor protein, USP, or RXR may also be
functional under
some circumstances.
The ecdysone receptor complex typically includes-proteins that are members of
the nuclear
receptor superfamily wherein all members are generally characterized by the
presence of an amino-
terminal transactivation domain, a DNA binding domain ("DBD"), and a ligand
binding domain
("LBD") separated from the DBD by a hinge region. As used herein, the term
"DNA binding domain"
comprises a minimal polypeptide sequence of a DNA binding protein, up to the
entire length of a DNA
binding protein, so long as the DNA binding domain functions to associate with
a particular response
element. Members of the nuclear receptor superfarnily are also characterized
by the presence of four or
five domains: AJB, C, D, E, and in some members F (see US patent 4,981,784 and
Evans, Science
240:889-895 (1988)). The "A/B" domain corresponds to the transactivati on
domain, "C" corresponds to
the DNA binding domain, "D" corresponds to the hinge region, and "E"
corresponds to the ligand
binding domain. Some members of the family may also have another
transactivation domain on the
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
carboxy-terminal side of the LBD corresponding to "F".
The DBD is characterized by the presence of two cysteine zinc fingers between
which are two
amino acid motifs, the P-box and the D-box, which confer specificity for
ecdysone response elements.
These domains may be either native, modified, or chimeras of different domains
of heterologous
receptor proteins. The EcR receptor, like a subset of the steroid receptor
family, also possesses less
well-defined regions responsible for heterodimerization properties. Because
the domains of nuclear
receptors are modular in nature, the LBD, DBD, and transactivation domains may
be interchanged.
Gene switch systems are known that incorporate components from the ecdysone
receptor
complex. However, in these known systems, whenever EcR is used it is
associated with native or
modified DNA binding domains and transactivation domains on the same molecule.
USP or RXR are
typically used as silent partners. Applicants have previously shown that when
DNA binding domains
and transactivation domains are on the same molecule the background activity
in the absence of ligand is
high and that such activity is dramatically reduced when DNA binding domains
and transactivation
domains are on different molecules, that is, on each of two partners of a
heterodimeric or homodimeric
complex (see PCT/US01/09050).
GENE EXPRESSION CASSE I I ES OF THE INVENTION
The novel nuclear receptor-based inducible gene expression system of the
invention comprises at
least one gene expression cassette that is capable of being expressed in a
host cell, wherein the gene
, 20 expression cassette comprises a polynucleotide that encodes a
polypeptide comprising a Group H nuclear
receptor ligand binding domain comprising a substitution mutation. Thus,
Applicants' invention also
provides novel gene expression cassettes for use in the gene expression system
of the invention.
In a specific embodiment, the gene expression cassette that is capable of
being expressed in a
host cell comprises a polynucleotide that encodes a polypeptide selected from
the group consisting of a)
a polypeptide comprising a transactivation domain, a DNA-binding domain, and a
Group H nuclear
receptor ligand binding domain comprising a substitution mutation; b) a
polypeptide comprising a DNA-
binding domain and a Group H nuclear receptor ligand binding domain comprising
a substitution
mutation; and c) a polypeptide comprising a transactivation domain and a Group
H nuclear receptor
ligand binding domain comprising a substitution mutation.
3 0 In another specific embodiment, the present invention provides a
gene expression cassette that is
capable of being expressed in a host cell, wherein the gene expression
cassette comprises a
polynucleotide that encodes a hybrid polypeptide selected from the group
consisting of a) a hybrid
polypeptide comprising a transactivation domain, a DNA-binding domain, and a
Group H nuclear
receptor ligand binding domain comprising a substitution mutation; b) a hybrid
polypeptide comprising a
3 5 DNA-binding domain and a Group H nuclear receptor ligand binding domain
comprising a substitution
mutation; and c) a hybrid polypeptide comprising a transactivation domain and
a Group H nuclear
receptor ligand binding domain comprising a substitution mutation. A hybrid
polypeptide according to
31
CA 02855992 2014-07-08
WO 02/066612 PCTTITS02/05090
the invention comprises at least two polypeptide fragments, wherein each
polypeptide fragment is from a
different source, i.e., a different polypeptide, a different nuclear receptor,
a different species, etc. The
hybrid polypeptide according to the invention may comprise at least two
polypeptide domains, wherein
each polypeptide domain is from a different source.
In a specific embodiment, the Group H nuclear receptor ligand binding domain
comprising a
substitution mutation is from an ecdysone receptor, a ubiquitous receptor, an
orphan receptor 1, a NER-1,
a steroid hormone nuclear receptor 1, a retinoid X receptor interacting
protein ¨15, a liver X receptor p, a
steroid hormone receptor like protein, a liver X receptor, a liver X receptor
a, a famesoid X receptor, a
receptor interacting protein 14, and a famesol receptor. In a preferred
embodiment, the Group H nuclear
receptor ligand binding domain is from an ecdysone receptor.
Thus, the present invention also provides a gene expression cassette
comprising a polynucleotide
that encodes a poiypeptide selected from the group consisting of a) a
polypeptide comprising a
transactivation domain, a DNA-binding domain, and an ecdysone receptor ligand
binding domain
comprising a substitution mutation; b) a polypeptide comprising a DNA-binding
domain and an ecdysone
receptor ligand binding domain comprising a substitution mutation; and c) a
polypeptide comprising a
transactivation domain and an ecdysone receptor ligand binding domain
comprising a substitution
mutation. Preferably, the gene expression cassette comprises a polynucleotide
that encodes a hybrid
polypeptide selected from the group consisting of a) a hybrid polypeptide
comprising a transactivation
domain, a DNA-binding domain, and an ecdysone receptor ligand binding domain
comprising a
substitution mutation; b) a hybrid polypeptide comprising a DNA-binding domain
and an ecdysone
receptor ligand binding domain comprising a substitution mutation; and c) a
hybrid polypeptide
comprising a transactivation domain and an ecdysone receptor ligand binding
domain comprising a
substitution mutation; wherein the encoded hybrid polypeptide comprises at
least two polypeptide
fragments, wherein each polypeptide fragment is from a different source.
The ecdysone receptor (EcR) ligand binding domain (LBD) may be from an
invertebrate EcR,
preferably selected from the class Arthropod EcR. Preferably the EcR is
selected from the group
consisting of a Lepidopteran EcR, a Dipteran EcR, an Orthopteran EcR, a
Homopteran EcR and a
Hemipteran EcR. More preferably, the EcR ligand binding domain for use in the
present invention is
from a spruce budworm Choristoneura fumiferana EcR ("CfEcR"), a beetle
Tenebrio molitor EcR
("TmEcR"), a Manduca sexta EcR ("MsEcR"), a Heliothies virescens EcR
("HvEcR"), a midge
Chironomus tentans EcR ("CtEcR"), a silk moth Bombyx mori EcR ("BmEcR"), a
squinting bush brown
Bicyclus anynana EcR ("BanEcR"), a buckeye Junonia coenia EcR ("JcEcR"), a
fruit fly Drosophila
rnelanogaster EcR ("DmEcR"), a mosquito Aedes aegypti EcR ("AaEcR"), a blowflY
Lucilia capitata
("LcEcR"), a blowfly Lucille cuprina EcR ("LucEcR"), a blowfly Calliphora
vicinia EcR ("CvEcR"), a
Mediterranean fruit fly Ceratitis capitata EcR ("CcEcR"), a locust Locusta
migratoria EcR ("LmEcR"),
an aphid Myzus persicae EcR ("MpEcR"), a fiddler crab Celuca pugilator EcR
("CpEcR"), an ixodid
tick Amblyomma americanum EcR ("AmaEcR"), a whitefly Bamecia argentifoli EcR
("BaEcR", SEQ ID
32
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
NO: 112) or a leafhopper Nephotetix cincticeps EcR ("NcEcR", SEQ ID NO: 113).
More preferably, the
LBD is from a CfEcR, a DmEcR, or an AmaEcR.
In a specific embodiment, the LBD is from a truncated EcR polypeptide. The EcR
polypeptide
truncation results in a deletion of at least 1, 2, 3, 4, 5, 10, 15, 20, 25,
30, 35, 40,45, 50, 55, 60, 65, 70,
75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150,
155, 160, 165, 170, 175, 180,
185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255,
260, or 265 amino acids.
Preferably, the EcR polypeptide truncation results in a deletion of at least a
partial polypeptide domain.
More preferably, the EcR polypeptide truncation results in a deletion of at
least an entire polypeptide
domain. In a specific embodiment, the EcR polypeptide truncation results in a
deletion of at least an
A/B-domain, a C-domain, a D-domain, an F-domain, an A/B/C-domains, an A/B/1/2-
C-domains, an
A/B/C/D-domains, an A/B/C/D/F-domains, an A/B/F-domains, an A/B/C/F-domains, a
partial E domain,
or a partial F domain. A combination of several complete ancVor partial domain
deletions may also be
performed.
In a specific embodiment, the Group H nuclear receptor ligand binding domain
is encoded by a
polynucleotide comprising a codon mutation that results in a substitution of
a) amino acid residue 20, 21,
48, 51, 52, 55, 58, 59, 61, 62,92, 93, 95, 96, 107, 109, 110, 120, 123, 125,
175, 218, 219, 223, 230, 234,
or 238 of SEQ ID NO: 1, b) amino acid residues 95 and 110 of SEQ ID NO: 1, c)
amino acid residues
218 and 219 of SEQ ID NO: 1, d) amino acid residues 107 and 175 of SEQ ID NO:
1, e) amino acid
residues 127 and 175 of SEQ ID NO: 1,1) amino acid residues 107 and 127 of SEQ
NO: 1, g) amino
acid residues 107, 127 and 175 of SEQ 1D NO: 1, h) amino acid residues 52, 107
and 175 of SEQ ID
NO: 1, i) amino acid residues 96, 107, and 175 of SEQ II) NO: 1,1) amino acid
residues 107, 110, and
175 of SEQ ID NO: 1, k) amino acid residue 107, 121, 213, or 217 of SEQ ID NO:
2, or I) amino acid
residue 91 or 105 of SEQ ID NO: 3. In a preferred embodiment, the Group H
nuclear receptor ligand
binding domain is from an ecdysone receptor.
In another specific embodiment, the Group H nuclear receptor ligand binding
domain is encoded
by a polynucleotide comprising a codon mutation that results in a substitution
of a) an alanine residue at
a position equivalent or analogous to amino acid residue 20, 21, 48, 51, 55,
58, 59, 61, 62, 92, 93, 95,
109, 120, 125, 218, 219, 223, 230, 234, or 238 of SEQ ID NO: 1, b) an alanine,
valine, isoleucine, or
leucine residue at a position equivalent or analogous to amino acid residue 52
of SEQ ID NO: 1, c) an
3 0 alanine, threonine, aspartic acid, or methionine residue at a position
equivalent or analogous to amino
acid residue 96 of SEQ ID NO: 1, d) a proline, serine, methionine, or leucine
residue at a position
equivalent or analogous to amino acid residue 110 of SEQ ID NO: 1, e) a
phenylalanine residue at a
position equivalent or analogous to amino acid residue 123 of SEQ ID NO: 1, f)
an alanine residue at a
position equivalent or analogous to amino acid residue 95 of SEQ ID NO: 1 and
a proline residue at a
position equivalent or analogous to amino acid residue 110 of SEQ ID NO: 1, g)
an alanine residue at a
position equivalent or analogous to amino acid residues 218 and 219 of SEQ ID
NO: 1, h) an isoleucine
residue at a position equivalent or analogous to amino acid residue 107 of SEQ
ID NO: 1, i) an glutamine
33
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
residue at a position equivalent or analogous to amino acid residues 175 of
SEQ ID NO: 1, j) an
isoleucine residue at a position equivalent or analogous to amino acid residue
107 of SEQ ID NO: 1 and
a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO: 1, k)
a glutamine residue at a position equivalent or analogous to amino acid
residues 127 and 175 of SEQ ID
NO: 1, I) an isoleucine residue at a position equivalent or analogous to amino
acid residue 107 of SEQ
ID NO: 1 and a glutamine residue at a position equivalent or analogous to
amino acid residue 127 of SEQ
ID NO: 1, m) an isoleucine residue at a position equivalent or analogous to
amino acid residue 107 of
SEQ ID NO: 1 and a glutamine residue at a position equivalent or analogous to
amino acid residues 127
and 175 of SEQ ID NO: 1, n) a valine residue at a position equivalent or
analogous to amino acid residue
lo 52 of SEQ ID NO: 1, an isoleucine residue at a position equivalent or
analogous to amino acid residue
107 of SEQ ID NO: 1 and a glutamine residue at a position equivalent or
analogous to amino acid residue
175 of SEQ ID NO: I, 0) an alanine residue at a position equivalent or
analogous to amino acid residue
96 of SEQ ID NO: 1, an isoleucine residue at a position equivalent or
analogous to amino acid residue
107 of SEQ ID NO: 1 and a glutamine residue at a position equivalent or
analogous to amino acid residue
175 of SEQ ID NO: 1, p) an alanine residue at a position equivalent or
analogous to amino acid residue
52 of SEQ ID NO: 1, an isoleucine residue at a position equivalent or
analogous to amino acid residue
. 107 of SEQ ID NO: 1, and a glutamine residue at a position equivalent or
analogous to amino acid
residue 175 of SEQ ID NO: 1, q) a threonine residue at a position equivalent
or analogous to amino acid
residue 96 of SEQ ID NO: 1, an isoleucine residue at a position equivalent or
analogous to amino acid
residue 107 of SEQ ID NO: 1, and a glutamine residue at a position equivalent
or analogous to amino
acid residue 175 of SEQ ID NO: 1, r) an isoleucine residue at a position
equivalent or analogous to
amino acid residue 107 of SEQ ID NO: 1, a proline residue at a position
equivalent or analogous to
amino acid 110 of SEQ ID NO: 1, and a glutamine residue at a position
equivalent or analogous to amino
acid 175 of SEQ ID NO: 1, s) a proline at a position equivalent or analogous
to amino acid residue 107 of
SEQ ID NO: 2, t) an arginine or a leucine at a position equivalent or
analogous to amino acid residue 121
of SEQ ID NO: 2, u) an alanine at a position equivalent or analogous to amino
acid residue 213 of SEQ
ID NO: 2, v) an alanine or a serine at a position equivalent or analogous to
amino acid residue 217 of
SEQ ID NO: 2, w) an alanine at a position equivalent or analogous to amino
acid residue 91 of SEQ ID
NO: 3, or x) a proline at a position equivalent or analogous to amino acid
residue 105 of SEQ ID NO: 3.
In a preferred embodiment, the Group H nuclear receptor ligand binding domain
is from an ecdysone
receptor.
In another specific embodiment, the Group H nuclear receptor ligand binding
domain comprising
a substitution mutation is an ecdysone receptor ligand binding domain
comprising a substitution mutation
encoded by a polynucleotide comprising a codon mutation that results in a
substitution mutation selected
from the group consisting of a) E20A, Q21A, F48A, I51A, T52A, T52V, T52I,
T52L, T55A, T58A,
V59A, L61A, I62A, M92A, M93A, R95A, V96A, V96T, V96D, V96M, VI071, F109A,
A11013, Al 10S,
Al 10M, Al 10L, Y120A, A123F, M125A, R175E, M218A, C219A, L223A, L230A, L234A,
W238A,
34
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
R95A/A110P, M218A/C219A, VI071/R175E, Y127E/R175E, V1071/Y127E,
V10711Y127E/R175E,
T52V/V1071/R175E, V96AN1071/R175E, T52A/V1071/R175E, V96TNI071/R175E or
V1071/A110P/R175E substitution mutation of SEQ ID NO: 1, b) A107P, G121R,
G121L, N213A,
C217A, or C217S substitution mutation of SEQ ID NO: 2, and c) G91A or A105P
substitution mutation
of SEQ ID NO: 3.
In another specific embodiment, the Group H nuclear receptor ligand binding
domain comprising
a substitution mutation is an ecdysone receptor ligand binding domain
polypeptide comprising a
substitution mutation encoded by a polynucleotide that hybridizes to a
polynucleotide comprising a
codon mutation that results in a substitution mutation selected from the group
consisting of a) T58A,
Al 10P, A110 L, Al 10S, or Al 10M of SEQ ID NO: 1, b) A107P of SEQ ID NO: 2,
and c) A105P of SEQ
ID NO: 3 under hybridization conditions comprising a hybridization step in
less than 500 mIVI salt and at
least 37 degrees Celsius, and a washing step in 2XSSPE at least 63 degrees
Celsius. In a preferred
embodiment, the hybridization conditions comprise less than 200 mM salt and at
least 37 degrees Celsius
for the hybridization step. In another preferred embodiment, the hybridization
conditions comprise
2XSSPE and 63 degrees Celsius for both the hybridization and washing steps. In
another preferred
embodiment, the ecdysone receptor ligand binding domain lacks steroid binding
activity, such as 20-
hydroxyecdysone binding activity, ponasterone A binding activity, or
muristerone A binding activity.
- In another specific embodiment, the Group H nuclear receptor ligand
binding domain comprises
a substitution mutation at a position equivalent or analogous to a) amino acid
residue 20, 21, 48,51, 52,
55, 58, 59, 61, 62, 92, 93, 95, 96, 107, 109, 110, 120, 123, 125, 175, 218,
219, 223, 230, 234, or 238 of
SEQ ID NO: 1, b) amino acid residues 95 and 110 of SEQ NO: 1, c) amino acid
residues 218 and 219
of SEQ ED NO: 1, d) amino acid residues 107 and 175 of SEQ ID NO: 1, e) amino
acid residues 127 and
175 of SEQ ID NO: 1, f) amino acid residues 107 and 127 of SEQ ID NO: 1, g)
amino acid residues 107,
127 and 175 of SEQ ID NO: 1, h) amino acid residues 52, 107 and 175 of SEQ ID
NO: 1, i) amino acid
residues 96, 107 and 175 of SEQ ID NO: 1,j) amino acid residues 107, 110, and
175 of SEQ ID NO: 1,
k) amino acid residue 107, 121, 213, or 217 of SEQ ID NO: 2, or I) amino acid
residue 91 or 105 of SEQ
ID NO: 3. In a preferred embodiment, the Group H nuclear receptor ligand
binding domain is from an
ecdysone receptor.
Preferably, the Group H nuclear receptor ligand binding domain comprises a
substitution of a) an
alanine residue at a position equivalent or analogous to amino acid residue
20, 21, 48, 51, 55, 58, 59, 61,
62, 92, 93, 95, 109, 120, 125, 218, 219, 223, 230, 234, or 238 of SEQ ID NO:
1, b) an alanine, valine,
isoleucine, or leucine residue at a position equivalent or analogous to amino
acid residue 52 of SEQ ID
NO: 1, c) an alanine, threonine, aspartic acid, or methionine residue at a
position equivalent or analogous
to amino acid residue 96 of SEQ ID NO: 1, d) a proline, serine, methionine, or
leucine residue at a
position equivalent or analogous to amino acid residue 110 of SEQ ID NO: I, e)
a phenylalanine residue
at a position equivalent or analogous to amino acid residue 123 of SEQ ID NO:
1, f) an alanine residue at
a position equivalent or analogous to amino acid residue 95 of SEQ ID NO: 1
and a proline residue at a
=
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
position equivalent or analogous to amino acid residue 110 of SEQ ID NO: 1, g)
an alanine residue at a
position equivalent or analogous to amino acid residues 218 and 219 of SEQ ID
NO: 1, h) an isoleucine
residue at a position equivalent or analogous to amino acid residue 107 of SEQ
ED NO: 1, i) a glutamine
residue at a position equivalent or analogous to amino acid residues 175, j)
an isoleucine residue at a
position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 1 and
a glutamine residue at a
position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 1, k)
a glutamine residue at a
position equivalent or analogous to amino acid residues 127 and 175 of SEQ ID
NO: 1,1) an isoleucine
residue at a position equivalent or analogous to amino acid residue 107 of SEQ
ID NO: 1 and a glutamine
residue at a position equivalent or analogous to amino acid residue 127 of SEQ
ID NO: 1, m) an
isoleucine residue at a position equivalent or analogous to amino acid residue
107 of SEQ ID NO: 1 and
a glutamine residue at a position equivalent or analogous to amino acid
residues 127 and 175 of SEQ ID
NO: 1, n) a valine residue at a position equivalent or analogous to amino acid
residue 52 of SEQ ID NO:
1, an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1
and a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO:
1, o) an alanine residue at a position equivalent or analogous to amino acid
residue 96 of SEQ ID NO: 1,
an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1
and a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO:
1, p) an alanine residue at a position equivalent or analogous to amino acid
residue 52 of SEQ ID NO: 1,
an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1,
and a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO:
1, q) a threonine residue at a position equivalent or analogous to amino acid
residue 96 of SEQ ID NO: 1,
an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1,
and a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO:
1, r) an isoleucine residue at a position equivalent or analogous to amino
acid residue 107 of SEQ ID
NO: 1, a proline residue at a position equivalent or analogous to amino acid
110 of SEQ ID NO: 1, and a
glutamine residue at a position equivalent or analogous to amino acid 175 of
SEQ ID NO: 1, s) a proline
at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO:
2, t) an arginine or a
leucine at a position equivalent or analogous to amino acid residue 121 of SEQ
ID NO: 2, u) an alanine
at a position equivalent or analogous to amino acid residue 213 of SEQ ID NO:
2, v) an alanine or a
serine at a position equivalent or analogous to amino acid residue 217 of SEQ
D NO: 2, w) an alanine at
a position equivalent or analogous to amino acid residue 91 of SEQ ED NO: 3,
or x) a proline at a
position equivalent or analogous to amino acid residue 105 of SEQ ID NO: 3. In
a preferred
embodiment, the Group H nuclear receptor ligand binding domain is from an
ecdysone receptor.
In another specific embodiment, the Group H nuclear receptor ligand binding
domain comprising
a substitution mutation is an ecdysone receptor ligand binding domain
polypeptide comprising a
substitution mutation, wherein the substitution mutation is selected from the
group consisting of a)
E20A, Q21A, F48A, 15 IA, T52A, T52V, T52I, T52L, T55A, T58A, V59A, L61A, 162A,
M92A, M93A,
36
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
R95A, V96A, V96T, V96D, V96M, V1071, F109A, Al 10P, Al 10S, Al 10M, Al 10L,
Y120A, A123F,
M125A, R175E, M218A, C219A, L223A, L230A, L234A, W238A, R95A/A110P,
M218A/C219A,
VI 071/R1 75E, Y127EJR175E, V107I/Y127E, V107UY127E/R175E, T52VN10711R175E,
V96AN1071/R175E, T52AN107I/R175E, V96TN107I/R175E, or V1071/A110P/R175E
substitution
mutation of SEQ ED NO: 1, b) A107P, G121R, G121L, N213A, C217A, or C217S
substitution mutation
of SEQ ID NO: 2, and c) G9 lA or A105P substitution mutation of SEQ ID NO: 3.
The DNA binding domain can be any DNA binding domain with a known response
element,
including synthetic and chimeric DNA binding domains, or analogs,
combinations, or modifications
thereof. Preferably, the DBD is a GAL4 DBD, a LexA DBD, a transcription factor
DBD, a Group H
nuclear receptor member DBD, a steroid/thyroid hormone nuclear receptor
superfamily member DBD,
or a bacterial LacZ DBD. More preferably, the DBD is an EcR DBD [SEQ ID NO: 4
(polynucleotide) or
SEQ ID NO: 5 (polypeptide)], a GAL4 DBD [SEQ ID NO: 6 (polynucleotide) or SEQ
ID NO: 7
(polypeptide)], or a LexA DBD [(SEQ ID NO: 8 (polynucleotide) or SEQ ID NO: 9
(polypeptide)].
The transactivation domain (abbreviated "AD" or "TA") may be any Group H
nuclear receptor -
member AD, steroid/thyroid hormone nuclear receptor AD, synthetic or chimeric
AD, polyglutamine
AD, basic or acidic amino acid AD, a VP16 AD, a GAL4 AD, an NF-KB AD, a BP64
AD, a 342 acidic
activation domain (B42AD), a p65 transactivation domain (p65AD), or an analog,
combination, or
modification thereof. In a specific embodiment, the AD is a synthetic or
chimeric AD, or is obtained
from an EcR, a glucocorticoid receptor, VP16, GAL4, NF-IcB, or B42 acidic
activation domain AD.
Preferably, the AD is an EcR AD [SEQ ID NO: 10 (polynucleotide) or SEQ ID NO:
11 (polypeptide)], a
VP16 AD [SEQ ID NO: 12 (polynucleotide) or SEQ ID NO: 13 (polypeptide)J, a B42
AD [SEQ ID NO:
14 (polynucleotide) or SEQ ID NO: 15 (polypeptide)J, or a p65 AD [SEQ ID NO:
16 (polynucleotide) or
SEQ ID NO: 17 (polypeptide)].
In a specific embodiment, the gene expression cassette encodes a hybrid
polypeptide comprising
either a) a DNA-binding domain encoded by a polynucleotide comprising a
nucleic acid sequence of
SEQ ID NO: 4, SEQ ID NO: 6, or SEQ ID NO: 8, orb) a transactivation domain
encoded by a
polynucleotide comprising a nucleic acid sequence of SEQ LD NO: 10, SEQ ID NO:
12, SEQ ID NO: 14,
or SEQ ID NO: 16; and a Group H nuclear receptor ligand binding domain
comprising a substitution
mutation encoded by a polynucleotide according to the invention. Preferably,
the Group H nuclear
3 0 receptor ligand binding domain comprising a substitution mutation is an
ecdysone receptor ligand
binding domain comprising a substitution mutation encoded by a polynucleotide
according to the
invention.
In another specific embodiment, the gene expression cassette encodes a hybrid
polypeptide
comprising either a) a DNA-binding domain comprising an amino acid sequence of
SEQ ID NO: 5, SEQ
ID NO: 7, or SEQ ID NO: 9, or b) a transactivation domain comprising an amino
acid sequence of SEQ
ID NO: 11, EQ ID NO: 13, SEQ ID NO: 15, or SEQ ID NO: 17; and a Group H
nuclear receptor ligand
binding domain comprising a substitution mutation according to the invention.
Preferably, the Group H
37
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
nuclear receptor ligand binding domain comprising a substitution mutation is
an ecdysone receptor
ligand binding domain comprising a substitution mutation according to the
invention.
The present invention also provides a gene expression cassette comprising: i)
a response element
comprising a domain recognized by a polypeptide comprising a DNA binding
domain; ii) a promoter that
is activated by a polypeptide comprising a transactivation domain; and iii) a
gene whose expression is to
be modulated.
The response element ("RE") may be any response element with a known DNA
binding domain,
or an analog, combination, or modification thereof. A single RE may be
employed or multiple REs,
either multiple copies of the same RE or two or more different REs, may be
used in the present
= 10 invention. In a specific embodiment, the RE is an RE from GAL4
("GAL4RE"), LexA, a Group H
nuclear receptor RE, a steroid/thyroid hormone nuclear receptor RE, or a
synthetic RE that recognizes a
synthetic DNA binding domain. Preferably, the RE is an ecdysone response
element (EcRE) comprising
a polynucleotide sequence of SEQ ID NO: 18, a GAL4RE comprising a
polynucleotide sequence of SEQ
ID NO: 19, or a LexA RE (operon, "op") comprising a polynucleotide sequence of
SEQ ID NO: 20
("2XLexA0pRE").
A steroid/thyroid hormone nuclear receptor DNA binding domain, activation
domain or response
element according to the invention may be obtained from a steroid/thyroid
hormone nuclear receptor
selected from the group consisting of thyroid hormone receptor a (TRa.),
thyroid receptor 1 (c-erbA-1),
thyroid hormone receptor 13 (TR13), retinoic acid receptor a (RARa), retinoic
acid receptor 13 (RARI3,
HAP), retinoic acid receptor y (RARy), retinoic acid recetor gamma-like
(RARD), peroxisome
proliferator-activated receptor a (PPARcx), peroxisome proliferator-activated
receptor 13 (PPAR13),
peroxisome proliferator-activated receptor 5 (PPAR5, NUC-1), peroxisome
proliferator-activator related
receptor (FFAR), peroxisome proliferator-activated receptor y (PPARy), orphan
receptor encoded by
non-encoding strand of thyroid hormone receptor a (REVERBcc), v-erb A related
receptor (EAR-1), v-
erb related receptor (EAR-1A), y), orphan receptor encoded by non-encoding
strand of thyroid hormone
receptor 13 (REVERB13), v-erb related receptor (EAR-113), orphan nuclear
recptor BD73 (BD73), rev-
erbA-related receptor (R'VR), zinc finger protein 126 (HZF2), ecdysone-
inducible protein E75 (E75),
ecdysone-inducible protein E78 (E78), Drosophila receptor 78 (DR-78), retinoid-
related orphan receptor
a (RORa), retinoid Z receptor a (RZRa), retinoid related orphan receptor 13
(ROM, retinoid Z receptor
13 (RZR13), retinoid-related orphan receptor y (RORy), retinoid Z receptor y
(RZRy), retinoid-related
orphan receptor (TOR), hormone receptor 3 (HR-3), Drosophila hormone receptor
3 (DHR-3), Manduca
hormone receptor (MHR-3), Galleria hormone receptor 3 (GHR-3), C. elegans
nuclear receptor 3 (CNR-
3), Choristoneura hormone receptor 3 (CHR-3), C. elegans nuclear receptor 14
(CNR-14), ecdysone
receptor (ECR), ubiquitous receptor (UR), orphan nuclear receptor (OR-1), NER-
1, receptor-interacting
protein 15 (RIP-15), liver X receptor 13 (LX12.13), steroid hormone receptor
like protein (RLD-1), liver X
receptor (LXR), liver X receptor a (LXRa), famesoid X receptor (FXR), receptor-
interacting protein 14
38
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
(RIP-14), HRR-1, vitamin D receptor (VDR), orphan nuclear receptor (ONR-1),
pregnane X receptor
(PXR), steroid and xenobiotic receptor (SXR), benzoate X receptor (BXR),
nuclear receptor (MB-67),
constitutive androstane receptor 1 (CAR-1), constitutive androstane receptor a
(CARa), constitutive
androstane receptor 2 (CAR-2), constitutive androstane receptor 0 (CARP),
Drosophila hormone
receptor 96 (DFER-96), nuclear hormone receptor 1 (NIR-1), hepatocyte nuclear
factor 4 (HNF-4),
hepatocyte nuclear factor 4G (HNF-4G), hepatocyte nuclear factor 4B (FINF-4B),
hepatocyte nuclear
factor 4D (HNF-4D, DHNF-4), retinoid X receptor a (RXRa), retinoid X receptor
3 (RXR0), H-2 region
II binding protein (H-2RIIBP), nuclear receptor co-regulator-1 (RCoR-1),
retinoid X receptor 7 (RXRy),
Ultraspiracle (USP), 2C1 nuclear receptor, chorion factor 1 (CF-1), testicular
receptor 2 (TR-2),
testicular receptor 2-11 (TR2-11), testicular receptor 4 (1R4), TAK-1,
Drosophila hormone receptor
(DHR78), Tailless (TLL), tailless homolog (TLX), XTLL, chicken ovalbumin
upstream promoter
transcription factor I (COUP-TFI), chicken ovalbumin upstream promoter
transcription factor A (COUP-
TFA), EAR-3, SVP-44, chicken ovalbumin upstream promoter transcription factor
II (COUP-TFII),
chicken ovalbumin upstream promoter transcription factor B (COUP-TFB), ARP-1,
SVP-40, S'VP,
chicken ovalbumin upstream promoter transcription factor III (COUP-TFIII),
chicken ovalbumin
upstream promoter transcription factor G (COUP-TFG), SVP-46, EAR-2, estrogen
receptor a (ERG.),
estrogen receptor 0 (ER0), estrogen related receptor 1 (ERR1), estrogen
related receptor a (ERRa.),
estrogen related receptor 2 (ERR2), estrogen related receptor p (ERR43),
glucocorticoid receptor (GR),
mineraIocorticoid receptor (MR), progesterone receptor (PR), androgen receptor
(AR), nerve growth
factor induced gene B (NGFI-B), nuclear receptor similar to Nur-77 (TRS), N10,
Orphan receptor (NUR-
77), Human early response gene (NAK.-.1), Nurr related factor 1 (N1JRR-1), a
human immediate-early
response gene (NOT), regenerating liver nuclear receptor 1 (RNR-1),
hematopoietic zinc finger 3 (HZF-
3), Nur rekated protein -1 (TINOR), Nuclear orphan receptor 1 (NOR-1), NOR1
related receptor
(MINOR), Drosophila hormone receptor 38 (DHR-38), C. elegans nuclear receptor
8 (CNR-8), C48D5,
steroidogenic factor 1 (SF1), endozepine-like peptide (ELP), fushi tarazu
factor 1 (FTZ-F1), adrenal 4
binding protein (AD4BP), liver receptor homolog (LRH-1), Ftz-F'1-related
orphan receptor A (xFFrA),
Ftz-Fl-related orphan receptor B (xFFrB), nuclear receptor related to LRH-1
(FFLR), nuclear receptor
related to LRH-1 (PHR), fetoprotein transcriptin factor (FTF), germ cell
nuclear factor (GCNFM),
retinoid receptor-related testis-associated receptor (RTR), lcnirps (KNI),
knirps related (KNRL),
Embryonic gonad (EGON), Drosophila gene for ligand dependent nuclear receptor
(EAGLE), nuclear
receptor similar to trithorax (ODR7), Trithorax, dosage sensitive sex reversal
adrenal hypoplasia
congenita critical region chromosome X gene (DAX-1), adrenal hypoplasia
congenita and
hypogonadotropic hypogonadism (ARCH), and short heterodimer partner (SHP).
For purposes of this invention, nuclear receptors and Group H nuclear
receptors also include
synthetic and chimeric nuclear receptors and Group H nuclear receptors and
their homologs.
Genes of interest for use in Applicants' gene expression cassettes may be
endogenous genes or
heterologous genes. Nucleic acid or amino acid sequence information for a
desired gene or protein can be
39
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
located in one of many public access databases, for example, GENBANK, EIVIBL,
Swiss-Prot, and PIR,
or in many biology related journal publications. Thus, those skilled in the
art have access to nucleic acid
sequence information for virtually all known genes. Such information can then
be used to construct the
desired constructs for the insertion of the gene of interest within the gene
expression cassettes used in
Applicants' methods described herein.
Examples of genes of interest for use in Applicants' gene expression cassettes
include, but are
not limited to: genes encoding therapeutically desirable polypeptides or
products that may be used to
treat a condition, a disease, a disorder, a dysfunction, a genetic defect,
such as monoclonal antibodies,
enzymes, proteases, cytolcines, interferons, insulin, erthropoietin, clotting
factors, other blood factors or
components, viral vectors for gene therapy, virus for vaccines, targets for
drug discovery, functional
genomics, and proteomics analyses and applications, and the like.
POLYNUCLEOTIDES OF THE INVENTION
The novel nuclear receptor-based inducible gene expression system of the
invention comprises at
least one gene expression cassette comprising a polynucleotide that encodes a
Group H nuclear receptor
ligand binding domain comprising a substitution mutation. These gene
expression cassettes, the
polynucleotides they comprise, and the polypeptides they encode are useful as
components of a nuclear
receptor-based gene expression system to modulate the expression of a gene
within a host cell.
Thus, the present invention provides an isolated polynucleotide that encodes a
Group H nuclear
receptor ligand binding domain comprising a substitution mutation.
In a specific embodiment, the Group H nuclear receptor ligand binding domain
is encoded by a
polynucleotide comprising a codon mutation that results in a substitution of
an amino acid residue at a
position equivalent or analogous to a) amino acid residue 20, 21, 48, 51, 52,
55, 58, 59, 61, 62, 92, 93,
95, 96, 107, 109, 110, 120, 123, 125, 175, 218, 219, 223, 230, 234, or 238 of
SEQ ID NO: 1, b) amino
acid residues 95 and 110 of SEQ ID NO: 1, c) amino acid residues 218 and 219
of SEQ ID NO: 1, d)
amino acid residues 107 and 175 of SEQ ID NO: 1, e) amino acid residues 127
and 175 of SEQ ID NO:
1, f) amino acid residues 107 and 127 of SEQ ID NO: 1, g) amino acid residues
107, 127 and 175 of SEQ
ID NO: 1, h) amino acid residues 52, 107 and 175 of SEQ ID NO: 1, i) amino
acid residues 96, 107 and
175 of SEQ ID NO: 1, j) amino acid residues 107, 110, and 175 of SEQ ID NO: 1,
k) amino acid residue
107, 121, 213, or 217 of SEQ ID NO: 2, or I) amino acid residue 91 or 105 of
SEQ ID NO: 3. In a
preferred embodiment, the Group H nuclear receptor ligand binding domain is
from an ecdysone
receptor.
In another specific embodiment, the Group H nuclear receptor ligand binding
domain is encoded
by a polynucleotide comprising a codon mutation that results in a substitution
of a) an alanine residue at
a position equivalent or analogous to amino acid residue 20, 21, 48, 51, 55,
58, 59, 61, 62, 92, 93, 95,
109, 120, 125, 218, 219, 223, 230, 234, or 238 of SEQ ID NO: 1, b) an alanine,
valine, isoleucine, or
leucine residue at a position equivalent or analogous to amino acid residue 52
of SEQ ID NO: 1, c) an
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
alanine, threonine, aspartic acid, or methionine residue at a position
equivalent or analogous to amino
acid residue 96 of SEQ ID NO: 1, d) a proline, serine, methionine, or leucine
residue at a position
equivalent or analogous to amino acid residue 110 of SEQ ID NO: 1, e) a
phenylalanine residue at a
position equivalent or analogous to amino acid residue 123 of SEQ ID NO: 1, f)
an alanine residue at a
position equivalent or analogous to amino acid residue 95 of SEQ ID NO: 1 and
a proline residue at a
position equivalent or analogous to amino acid residue 110 of SEQ ID NO: 1, g)
an alanine residue at a
position equivalent or analogous to amino acid residues 218 and 219 of SEQ ID
NO: 1, h) an isoleucine
residue at a position equivalent or analogous to amino acid residue 107 of SEQ
ID NO: 1, i) a glutamine
residue at a position equivalent or analogous to amino acid residues 175,j) an
isoleucine residue at a
position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 1 and
a glutamine residue at a
position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 1, k)
a glutamine residue at a
position equivalent or analogous to amino acid residues 127 and 175 of SEQ ID
NO: 1,1) an isoleucine
residue at a position equivalent or analogous to amino acid residue 107 of SEQ
ID NO: 1 and a glutamine
residue at a position equivalent or analogous to amino acid residue 127 of SEQ
ID NO: 1, m) an
isoleucine residue at a position equivalent or analogous to amino acid residue
107 of SEQ ID NO: 1 and
a glutamine residue at a position equivalent or analogous to amino acid
residues 127 and 175 of SEQ ID
NO: 1, n) a valine residue at a position equivalent or analogous to amino acid
residue 52 of SEQ ID NO:
1, an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1
and a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO:
1, o) an alanine residue at a position equivalent or analogous to amino acid
residue 96 of SEQ ID NO: 1,
an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1
and a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO:
1, p) an alanine residue at a position equivalent or analogous to amino acid
residue 52 of SEQ ID NO: 1,
an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1,
and a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO:
1, q) a threonine residue at a position equivalent or analogous to amino acid
residue 96 of SEQ ID NO: 1,
an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1,
and a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO:
1, r) an isoleucine residue at a position equivalent or analogous to amino
acid residue 107 of SEQ ID
NO: 1, a proline residue at a position equivalent or analogous to amino acid
110 of SEQ ID NO: 1, and a
glutamine residue at a position equivalent or analogous to amino acid 175 of
SEQ ID NO: I, s) a proline
at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO:
2, t) an arginine or a
leucine at a position equivalent or analogous to amino acid residue 121 of SEQ
ID NO: 2, u) an alanine
at a position equivalent or analogous to amino acid residue 213 of SEQ ID NO:
2, v) an alanine or a
serine at a position equivalent or analogous to amino acid residue 217 of SEQ
ID NO: 2, w) an alanine at
a position equivalent or analogous to amino acid residue 91 of SEQ ID NO: 3,
or x) a proline at a
position equivalent or analogous to amino acid residue 105 of SEQ ID NO: 3. In
a preferred
41
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
embodiment, the Group H nuclear receptor ligand binding domain is from an
ecdysone receptor.
In another specific embodiment, the Group H nuclear receptor ligand binding
domain comprising
a substitution mutation is an ecdysone receptor ligand binding domain
comprising a substitution mutation
encoded by a polynucleotide comprising a codon mutation that results in a
substitution mutation selected
from the group consisting of a) E20A, Q21A, F48A, 151A, T52A, T52V, T521,
T52L, T55A, T58A,
V59A, L61A, 162A, M92A, M93A, R95A, V96A, V96T, V96D, V96M, V1071, F109A, Al
10P, Al 10S,
Al 10M, Al 10L, Y120A, A123F, M125A, R175E, M218A, C219A, L223A, L230A, L234A,
W238A,
R95A/A110P, M218A/C219A, V107I/R175E, Y127E/R175E, V1071/Y127E,
V1071/Y127E/R175E,
T52V/V1071/R175E, V96AN107I/R175E, T52AJV1071/R175E, V96TN107I/R175E or
V1071/A110P/R175E substitution mutation of SEQ ID NO: 1, b) A107P, G121R,
G121L, N213A,
C217A, or C217S substitution mutation of SEQ ID NO: 2, and c) G91A or A105P
substitution mutation
of SEQ ID NO: 3.
In another specific embodiment, the Group H nuclear receptor ligand binding
domain comprising
a substitution mutation is an ecdysone receptor ligand binding domain
comprising a substitution mutation
encoded by a polynucleotide that hybridizes to a polynucleotide comprising a
codon mutation that results
in a substitution mutation selected from the group consisting of a) T58A, Al
10P, A110 L, Al 10S, or
Al 10M of SEQ ID NO: 1, b) A107P of SEQ ID NO: 2, and c) A105P of SEQ ID NO: 3
under
hybridization conditions comprising a hybridization step in less than 500 mM
salt and at least 37 degrees
Celsius, and a washing step in 2XSSPE at least 63 degrees Celsius. In a
preferred embodiment, the
hybridization conditions comprise less than 200 mM salt and at least 37
degrees Celsius for the
hybridization step. In another preferred embodiment, the hybridization
conditions comprise 2XSSPE and
63 degrees Celsius for both the hybridization and washing steps. In another
preferred embodiment, the
ecdysone receptor ligand binding domain lacks binding activity to a steroid
such as 20-hydroxyecdysone,
=
ponasterone A, or muristerone A.
The present invention also provides an isolated polynucleotide that encodes a
polypeptide
selected from the group consisting of a) a polypeptide comprising a
transactivation domain, a DNA-
binding domain, and a Group H nuclear receptor ligand binding domain
comprising a substitution
mutation according to the invention; b) a polypeptide comprising a DNA-binding
domain and a Group I-1
nuclear receptor ligand binding domain comprising a substitution mutation
according to the invention;
and c) a polypeptide comprising a transactivation domain and a Group H nuclear
receptor ligand binding
domain comprising a substitution mutation according to the invention.
In a specific embodiment, the isolated polynucleotide encodes a hybrid
polypeptide selected
from the group consisting of a) a hybrid polypeptide comprising a
transactivation domain, a DNA- =
binding domain, and a Group H nuclear receptor ligand binding domain
comprising a substitution
mutation according to the invention; b) a hybrid polypeptide comprising a DNA-
binding domain and a
Group H nuclear receptor ligand binding domain comprising a substitution
mutation according to the
invention; and c) a hybrid polypeptide comprising a transactivation domain and
a Group H nuclear
42
CA 02855992 2014-07-08
WO 02/066612 PCTTUS02/05090
receptor ligand binding domain comprising a substitution mutation according to
the invention.
The present invention also relates to an isolated polynucleotide encoding a
Group H nuclear
receptor ligand binding domain comprising a substitution mutation, wherein the
substitution mutation
affects ligand binding activity or ligand sensitivity of the Group 1-1 nuclear
receptor ligand binding
domain.
In particular, the present invention relates to an isolated polynucleotide
encoding a Group H
nuclear receptor ligand binding domain comprising a substitution mutation,
wherein the substitution
mutation reduces ligand binding activity or ligand sensitivity of the Group H
nuclear receptor ligand
binding domain.
In a specific embodiment, the present invention relates to an isolated
polynucleotide encoding a
Group H nuclear receptor ligand binding domain comprising a substitution
mutation, wherein the
substitution mutation reduces steroid binding activity or steroid sensitivity
of the Group H nuclear
receptor ligand binding domain. Preferably, the isolated polynucleotide
comprises a codon mutation that
results in a substitution of an amino acid residue at a position equivalent or
analogous to a) amino acid
residue 20, 21, 48, 51, 52, 55, 58, 59, 62, 92, 93, 95, 109, 110, 120, 123,
125, 218, 219, 223, 230, 234, or
238 of SEQ ID NO: 1, b) amino acid residues 95 and 110 of SEQ ID NO: 1, c)
amino acid residues 218
and 219 of SEQ ID NO: 1, d) amino acid residue 107, 121, 213, or 217 of SEQ ID
NO: 2, ore) amino
acid residue 105 of SEQ ID NO: 3. More preferably, the isolated polynucleotide
comprises a codon
mutation that results in a substitution of a) an alanine residue at a position
equivalent or analogous to
amino acid residue 20,21, 48, 51, 52, 55, 58, 59, 62, 92, 93, 95, 109, 120,
125, 218, 219, 223, 230, 234,
or 238 of SEQ ID NO: 1, b) a proline residue at a position equivalent or
analogous to amino acid residue
110 of SEQ ID NO: 1, c) a phenylalanine residue at a position equivalent or
analogous to amino acid
residue 123 of SEQ ID NO: 1, d) an alanine residue at a position equivalent or
analogous to amino acid
residue 95 of SEQ ID NO: 1 and a proline residue at a position equivalent or
analogous to amino acid
residue 110 of SEQ ID NO: 1, e) an alanine residue at a position equivalent or
analogous to amino acid
residues 218 and 219 of SEQ ID NO: 1, 1) a proline residue at a position
equivalent or analogous to
amino acid residue 107 of SEQ ID NO: 2, g) an arginine or leucine residue at a
position equivalent or
analogous to amino acid residue 121 of SEQ ID NO: 2, h) an alanine residue at
a position equivalent or
analogous to amino acid residue 213 of SEQ ID NO: 2, i) an alanine or a serine
residue at a position
equivalent or analogous to amino acid residue 217 of SEQ ID NO: 2, or j) a
proline residue at a position
equivalent or analogous to amino acid residue 105 of SEQ ID NO: 3. Even more
preferably, the isolated
polynucleotide comprises a codon mutation that results in a substitution
mutation of a) E20A, Q21A,
F48A, I51A, T52A, T55A, T58A, V59A, I62A, M92A, M93A, R95A, F109A, Al 10P,
Y120A, A123F,
M125A, M218A, C219A, L223A, L230A, L234A, W238A, R95A/A110P, or M218A/C219A of
SEQ ID
NO: 1, b) A107P, G121R, G121L, N213A, C217A, or C217S of SEQ ID NO: 2, or c)
A105P of SEQ ID
NO: 3.
In another specific embodiment, the present invention relates to an isolated
polynucleotide
43
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
encoding a Group H nuclear receptor ligand binding domain comprising a
substitution mutation, wherein
the substitution mutation eliminates steroid binding activity or steroid
sensitivity of the Group H ligand
binding domain. Preferably, the isolated polynucleotide comprises a codon
mutation that results in a
substitution of an amino acid residue at a position equivalent or analogous to
a) amino acid residue 58 or
110 of SEQ ID NO: 1, b) amino acid residues 107, 110 and 175 of SEQ ID NO: 1,
c) amino acid residue
107, 121, 213, or 217 of SEQ ID NO: 2, or d) amino acid residue 105 of SEQ ID
NO: 3. More
preferably, the isolated polynucleotide comprises a codon mutation that
results in a substitution of a) an
alanine at a position equivalent or analogous to amino acid residue 58 of SEQ
ID NO: 1, b) a proline,
leucine, serine, or methionine residue at a position equivalent or analogous
to amino acid residue 110 of
SEQ ID NO: 1, c) an isoleucine at a position equivalent or analogous to amino
acid residue 107 of SEQ
ID NO: 1, a proline at a position equivalent or analogous to amino acid
residue 110 of SEQ ID NO: 1,
and a glutamine at a position equivalent or analogous to amino acid residue
175 of SEQ ID NO: 1, d) a
proline at a position equivalent or analogous to amino acid residue 107 of SEQ
ID NO: 2, e) an arginine
or a leucine at a position equivalent or analogous to amino acid residue 121
of SEQ ID NO: 2, f) an
alanine at a position equivalent or analogous to amino acid residue 213 of SEQ
ID NO: 2, g) an alanine
or a serine at a position equivalent or analogous to amino acid residue 217 of
SEQ ID NO: 2, or h) a
proline at a position equivalent or analogous to amino acid residue 105 of SEQ
ID NO: 3. Even more
preferably, the isolated polynucleotide comprises a codon mutation that
results in a substitution mutation
selected from the group consisting of a) T58A, AllOP, Al 10L, A1 10S, Al 10M,
or V10711A110P/R175E
substitution mutation of SEQ ID NO: 1, b) A107P, G121R, G121L, N213A, C217A,
or C217S
substitution mutation of SEQ ID NO: 2, and c) A105P substitution mutation of
SEQ ID NO: 3.
The present invention also relates to an isolated polynucleotide encoding a
polypeptide
comprising an ecdysone receptor ligand binding domain comprising a
substitution mutation, wherein the
ecdysone receptor ligand binding domain lacks steroid binding activity.
Preferably, the ecdysone
receptor ligand binding domain comprises a codon mutation that results in a
substitution mutation at an =
equivalent or analogous amino acid residue to a) amino acid residue 58 or 110
of SEQ ID NO: 1, b)
amino acid residues 107, 110 and 175 of SEQ ID NO: 1, b) amino acid residue
107, 121, 213, or 217 of
SEQ ID NO: 2, or d) amino acid residue 105 of SEQ ID NO: 3. More preferably,
the ecdysone receptor
ligand binding domain comprises a codon mutation that results in a
substitution of a) an alanine at a
position equivalent or analogous to amino acid residue 58 of SEQ ID NO: 1, b)
a proline, leucine, serine,
or methionine residue at a position equivalent or analogous to amino acid
residue 110 of SEQ ID NO: 1,
c) an isoleucine at a position equivalent or analogous to amino acid residue
107 of SEQ ID NO: 1, a
proline at a position equivalent or analogous to amino acid residue 110 of SEQ
ID NO: 1, a glutamine at
a position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 1,
d) a proline at a position
equivalent or analogous to amino acid residue 107 of SEQ ID NO: 2, e) an
arginine or a leucine at a
position equivalent or analogous to amino acid residue 121 of SEQ ID NO: 2, f)
an alanine at a position
equivalent or analogous to amino acid residue 213 of SEQ ID NO: 2, g) an
alanine or a serine at a
44
CA 02855992 2014-07-08
WO 02/066612
PCTTUS02/05090
position equivalent or analogous to amino acid residue 217 of SEQ ID NO: 2,
orb) a proline at a position
equivalent or analogous to amino acid residue 105 of SEQ ID NO: 3. Even more
preferably, the isolated
the ecdysone receptor ligand binding domain comprises a codon mutation that
results in a substitution
mutation selected from the group consisting of a) T58A, Al 10P, Al 10L, Al
10S, All0M, or
V1071/A110P/R175E substitution mutation of SEQ ID NO: 1, b) A107P, G121R,
G121L, N2I 3A,
C217A, or C217S substitution mutation of SEQ ID NO: 2, and c) A105P
substitution mutation of SEQ
ID NO: 3. In a specific embodiment, the ecdysone receptor ligand binding
domain lacks steroid binding
activity selected from the group consisting of ecdysone binding activity, 20-
hydroxyecdysone binding
=
activity, ponasterone A binding activity, and muristerone A binding activity.
In another specific embodiment, the isolated polynucleotide encoding an
ecdysone receptor
ligand binding domain comprising a substitution mutation, wherein the ecdysone
receptor ligand binding
domain lacks steroid binding activity, hybridizes to a polynucleotide
comprising a codon mutation that
results in a substitution mutation selected from the group consisting of a)
T58A, Al 10P, A110L, Al 10S,
= Al 10M, or V107I/A110P/R175E substitution mutation of SEQ ID NO: 1, b)
A107P, G121R, G121L,
N213A, C217A, or C217S substitution mutation of SEQ ID NO: 2, and c) Al 05P
substitution mutation
of SEQ ID NO: 3 under hybridization conditions comprising a hybridization step
in less than 500 mM
salt and at least 37 degrees Celsius, and a washing step in 2XSSPE at at least
63 degrees Celsius. In a
preferred embodiment, the hybridization conditions comprise less than 200 mM
salt and at least 37
degrees Celsius for the hybridization step. In another preferred embodiment,
the hybridization
conditions comprise 2XSSPE and 63 degrees Celsius for both the hybridization
and washing steps. In
another preferred embodiment, the ecdysone receptor ligand binding domain
lacks steroid binding
activity selected from the group consisting of ecdysone binding activity, 20-
hydroxyecdysone binding
activity, ponasterone A binding activity, and muristerone A binding activity.
In another specific embodiment, the present invention relates to an isolated
polynucleotide
encoding a Group H nuclear receptor ligand binding domain comprising a
substitution mutation, wherein
the substitution mutation reduces non-steroid binding activity or non-steroid
sensitivity of the Group H
nuclear receptor ligand binding domain. Preferably, the isolated
polynucleotide comprises a codon
mutation that results in a substitution of an amino acid residue at a position
equivalent or analogous to
amino acid residue a) 21, 48, 51, 52, 59, 62, 93, 95, 96, 109, 120, 123, 125,
218, 219, 223, 230, 234, or
238 of SEQ ID NO: 1,b) 121, 213, or 217 of SEQ ID NO: 2, or c) 105 of SEQ ID
NO: 3. More
preferably, the isolated polynucleotide comprises a codon mutation that
results in a substitution of a) an
alanine residue at a position equivalent or analogous to amino acid residue
21, 48, 51, 59, 62, 93, 95, 96,
109, 120, 125, 218, 219, 223, 230, 234, or 238 of SEQ ID NO: 1, b) a leucine
residue at at a position
equivalent or analogous to amino acid residue 52 of SEQ ID NO: 1, c) a
threonine residue at at a position
equivalent or analogous to amino acid residue 96 of SEQ ID NO: 1, d) a
phenylalanine residue at at a
position equivalent or analogous to amino acid residue 123 of SEQ ID NO: 1, e)
an alanine residue at at a
position equivalent or analogous to amino acid residue 95 of SEQ ID NO: 1 and
a proline residue at a
CA 02855992 2014-07-08
=
WO 02/066612 PCT/TJS02/05090
position equivalent or analogous to amino acid residue 110 of SEQ ID NO: 1, f)
an alanine residue at at a
position equivalent or analogous to amino acid residues 218 and 219 of SEQ ID
NO: 1, g) an arginine or
a leucine residue at a position equivalent or analogous to amino acid residue
121 of SEQ ID NO: 2, h) an
alanine residue at a position equivalent or analogous to amino acid residue
213 of SEQ ID NO: 2, i) an
alanine or a serine residue at a position equivalent or analogous to amino
acid residue 217 of SEQ ID
NO: 2, or j) a proline residue at a position equivalent or analogous to amino
acid residue 105 of SEQ JD
NO: 3. Even more preferably, the isolated polynucleotide comprises a codon
mutation that results in a
substitution mutation of a) Q21A, F48A, 151A, T52L, V59A, I62A, M93A, R95A,
V96A, V96T, F109A,
Y120A, A123F, M125A, M218A, C219A, L223A, L230A, L234A, W238A, R95A/A110P, or
M218/C219A of SEQ TD NO: 1, b) G121R, G121L, N213A, C217A, or C217S of SEQ ID
NO: 2, or c)
A105P of SEQ ID NO: 3.
In another specific embodiment, The present invention relates to an isolated
polynucleotide
encoding a Group H nuclear receptor polypeptide ligand binding domain
comprising a substitution
mutation, wherein the substitution mutation eliminates non-steroid binding
activity or non-steroid
sensitivity of the Group H ligand binding domain.
In another specific embodiment, the present invention relates to an isolated
polynucleotide
encoding a Group H nuclear receptor polypeptide ligand binding domain
comprising a substitution
mutation, wherein the substitution mutation reduces both steroid binding
activity or steroid sensitivity
and non-steroid binding activity or non-steroid sensitivity of the Group H
ligand binding domain.
Preferably, the isolated polynucleotide comprises a codon mutation that
results in a substitution of an
amino acid residue at a position equivalent or analogous to a) amino acid
residue 21, 48, 51, 59, 62, 93,
95, 109, 120, 123, 125, 218, 219, 223, 230, 234, or 238 of SEQ ID NO: 1, b)
amino acid residues 95 and
110 of SEQ ID NO: 1, c) amino acid residues 218 and 219 of SEQ ID NO: 1, d)
amino acid residue 121,
213, or 217 of SEQ ID NO: 2, ore) amino acid residue 105 of SEQ ID NO: 3. More
preferably, the
isolated polynucleotide comprises a codon mutation that results in a
substitution of a) an alanine residue
at a position equivalent or analogous to amino acid residue 21, 48, 51, 59,
62, 93, 95, 109, 120, 125, 218,
219, 223, 230, 234, or 238 of SEQ ID NO: 1, b) a phenylalanine residue at a
position equivalent or
analogous to amino acid residue 123 of SEQ ID NO: 1, c) an alanine residue at
a position equivalent or
analogous to amino acid residue 95 of SEQ ID NO: 1 and a proline residue at a
position equivalent or
analogous to amino acid residue 110 of SEQ ID NO: 1, d) an alanine residue at
a position equivalent or
analogous to amino acid residues 218 and 219 of SEQ ID NO: 1, e) an arginine
or a leucine residue at a
position equivalent or analogous to amino acid residue 121 of SEQ ID NO: 2, f)
an alanine residue at a
position equivalent or analogous to amino acid residue 213 of SEQ ID NO: 2, g)
an alanine or a serine
residue at a position equivalent or analogous to amino acid residue 217 of SEQ
ID NO: 2, or h) a proline
residue at a position equivalent or analogous to amino acid residue 105 of SEQ
ID NO: 3. Even more
preferably, the isolated polynucleotide comprises a codon mutation that
results in a substitution mutation
of Q21A, F48A, I51A, V59A, I62A, M93A, R95A, F109A, Y120A, A123F, M125A,
M218A, C219A,
46
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
L223A, L230A, L234A, W238A, R95A/A11013, or M218A/C219A of SEQ ID NO: 1, b)
G121R, G121L,
N213A, C217A, or C2175 of SEQ ID NO: 2, or C) A105P of SEQ 1D NO: 3.
In addition, the present invention also relates to an isolated polynucleotide
encoding a Group H
nuclear receptor ligand binding domain comprising a substitution mutation,
wherein the substitution
mutation enhances ligand binding activity or ligand sensitivity of the Group H
nuclear receptor ligand
binding domain.
In a specific embodiment, the present invention relates to an isolated
polynucleotide encoding a
Group H nuclear receptor ligand binding domain comprising a substitution
mutation, wherein the
substitution mutation enhances steroid binding activity or steroid sensitivity
of the Group H nuclear
receptor ligand binding domain. Preferably, the isolated polynucleotide
comprises a codon mutation that
results in a substitution of an amino acid residue at a position equivalent or
analogous to a) amino acid
residue 52 or 96 of SEQ ID NO: 1 orb) amino acid residue 91 of SEQ ID NO: 3.
More preferably, the
isolated polynucleotide comprises a codon mutation that results in a
substitution of a) a leucine, valine,
or isoleucine residue at a position equivalent or analogous to amino acid
residue 52 of SEQ ID NO: 1, b)
an alanine, threonine, aspartic acid, or methionine residue at a position
equivalent or analogous to amino
acid residue 96 of SEQ ID NO: 1, c) a threonine residue at a position
equivalent or analogous to amino
acid residue 96 of SEQ ID NO: 1, an isoleucine residue at a position
equivalent or analogous to amino
acid residue 107 of SEQ ID NO: 1, and a glutamine residue at a position
equivalent or analogous to
amino acid residue 175 of SEQ ID NO: 1, or d) an alanine residue at a position
equivalent or analogous
to amino acid residue 91 of SEQ ID NO: 3. Even more preferably, the isolated
polynucleotide comprises
a codon mutation that results in a substitution mutation of a) T52L, T52V,
T52I, V96A, V96T, V96D, or
V96M of SEQ ID NO: 1 or b) G91A of SEQ ID NO: 3.
In another specific embodiment, the present invention relates to an isolated
polynucleotide
encoding a Group H nuclear receptor ligand binding domain comprising a
substitution mutation, wherein
the substitution mutation enhances non-steroid binding activity or non-steroid
sensitivity of the Group H
nuclear receptor ligand binding domain. Preferably, the isolated
polynucleotide comprises a codon
mutation that results in a substitution of an amino acid residue at a position
equivalent or analogous to
amino acid residue 52, 55, or 96 of SEQ ID NO: 1 orb) amino acid residue 91 of
SEQ ID NO: 3. More
preferably, the isolated polynucleotide comprises a codon mutation that
results in a substitution of a) an
alanine, valine, or isoleucine residue at a position equivalent or analogous
to amino acid residue 52 of
SEQ ID NO: 1, b) an alanine residue at a position equivalent or analogous to
amino acid residue 55 of
SEQ ID NO: 1, c) an aspartic acid or methionine residue at a position
equivalent or analogous to amino
acid residue 96 of SEQ ID NO: 1, or d) an alanine residue at a position
equivalent or analogous to amino
acid residue 91 of SEQ ID NO: 3. Even more preferably, the isolated
polynucleotide comprises a codon
mutation that results in a substitution mutation of a) T52A, T52V, T52I, T55A,
V96D, or V96M of SEQ
=
ID NO: 1 orb) G91A of SEQ ID NO: 3.
In another specific embodiment, the present invention relates to an isolated
polynucleotide
47
CA 02855992 2014-07-08
WO 02/066612 PCT/IJS02/05090
encoding a Group H nuclear receptor ligand binding domain comprising a
substitution mutation, wherein
the substitution mutation enhances both steroid binding activity or steroid
sensitivity and non-steroid
binding activity or non-steroid sensitivity of the Group H ligand binding
domain. Preferably, the isolated
polynucleotide comprises a codon mutation that results in a substitution of an
amino acid residue at a
position equivalent or analogous to a) amino acid residue 52, 96, 107 or 175
of SEQ ID NO: 1, b) amino
acid residues 107 and 175 of SEQ ID NO: 1, c) amino acid residues 127 and 175
of SEQ ID NO: 1, d)
amino acid residues 107 and 127 of SEQ ID NO: 1, e) amino acid residues 107,
127 and 175 of SEQ ID
NO: 1, f) amino acid residues 52, 107 and 175 of SEQ ID NO: 1, g) amino acid
residues 96, 107 and 175
of SEQ ID NO: 1, or h) amino acid residue 91 of SEQ D NO: 3. More preferably,
the isolated
polynucleotide comprises a codon mutation that results in a substitution of a)
a valine or isoleucine
residue at a position equivalent or analogous to amino acid residue 52 of SEQ
ID NO: 1, b) an aspartic
acid or methionine residue at a position equivalent or analogous to amino acid
residue 96 of SEQ ID NO:
1, c) an isoleucine residue at a position equivalent or analogous to amino
acid residue 107 of SEQ ID
NO: 1, d) a glutamine residue at a position equivalent or analogous to amino
acid residues 175, e) an
isoleucine residue at a position equivalent or analogous to amino acid residue
107 of SEQ ID NO: 1 and
a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO: 1, f)
a glutamine residue at a position equivalent or analogous to amino acid
residues 127 and 175 of SEQ ID
NO: 1, g) an isoleucine residue at a position equivalent or analogous to amino
acid residue 107 of SEQ
ID NO: 1 and a glutamine residue at a position equivalent or analogous to
amino acid residue 127 of SEQ
ID NO: 1, h) an isoleucine residue at a position equivalent or analogous to
amino acid residue 107 of
SEQ ID NO: 1 and a glutamine residue at a position equivalent or analogous to
amino acid residues 127
and 175 of SEQ ID NO: 1, i) a valine residue at a position equivalent or
analogous to amino acid residue
52 of SEQ ID NO: 1, an isoleucine residue at a position equivalent or
analogous to amino acid residue
107 of SEQ ID NO: 1 and a glutamine residue at a position equivalent or
analogous to amino acid residue
175 of SEQ ID NO: 1, j) an alanine residue at a position equivalent or
analogous to amino acid residue
96 of SEQ ID NO: 1, an isoleucine residue at a position equivalent or
analogous to amino acid residue
107 of SEQ ID NO: 1 and a glutamine residue at a position equivalent or
analogous to amino acid residue
175 of SEQ ID NO: 1, k) an alanine residue at a position equivalent or
analogous to amino acid residue
52 of SEQ ID NO: 1, an isoleucine residue at a position equivalent or
analogous to amino acid residue
107 of SEQ ID NO: 1, and a glutamine residue at a position equivalent or
analogous to amino acid
residue 175 of SEQ ID NO: 1, or 1) an alanine residue at a position equivalent
or analogous to amino acid
residue 91 of SEQ ID NO: 3. Even more preferably, the isolated polynucleotide
comprises a codon
mutation that results in a substitution mutation of a) T52V, T52I, V96D, V96M,
V1071, R175E,
V107I/R175E, Y127E/R175E, V1071/17127E, V1071/Y127E/R175E, T52VN1071/R175E,
V96A/V107I/R175E or T52A/V1071/R175E of SEQ ID NO: 1 orb) G91A of SEQ ID NO:
3.
In addition, the present invention relates to an expression vector comprising
a polynucleotide
according the invention, operatively linked to a transcription regulatory
element. Preferably, the
48
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
polynucleotide encoding a nuclear receptor ligand binding domain comprising a
substitution mutation is
operatively linked with an expression control sequence permitting expression
of the nuclear receptor
ligand binding domain in an expression competent host cell. The expression
control sequence may
comprise a promoter that is functional in the host cell in which expression is
desired. The vector may be
a plasmid DNA molecule or a viral vector. Preferred viral vectors include
retrovirus, adenovirus, adeno-
associated virus, herpes virus, and vaccinia virus. The invention further
relates to a replication defective
recombinant virus comprising in its genome, the polynucleotide encoding a
nuclear receptor ligand
binding domain comprising a substitution mutation as described above. Thus,
the present invention also
relates to an isolated host cell comprising such an expression vector, wherein
the transcription regulatory
element is operative in the host cell.
The present invention also relates to an isolated polypeptide encoded by a
polynucleotide
according to the invention.
POLYPEPTIDES OF THE INVENTION =
The novel nuclear receptor-based inducible gene expression system of the
invention comprises at
least one gene expression cassette comprising a polynucleotide that encodes a
polypeptide comprising a
Group H nuclear receptor ligand binding domain comprising a substitution
mutation. Thus, the present
invention also provides an isolated polypeptide comprising a Group H nuclear
receptor ligand binding
domain comprising a substitution mutation according to the invention.
In another specific embodiment, the Group H nuclear receptor ligand binding
domain comprises
a substitution mutation at a position equivalent or analogous to a) amino acid
residue 20, 21, 48, 51, 52,
55, 58, 59, 61, 62, 92, 93, 95, 96, 107, 109, 110, 120, 123, 125, 175, 218,
219, 223, 230, 234, or 238 of
SEQ ID NO: 1, b) amino acid residues 95 and 110 of SEQ ID NO: 1, c) amino acid
residues 218 and 219
of SEQ ID NO: 1, d) amino acid residues 107 and 175 of SEQ ID NO: 1, e) amino
acid residues 127 and
175 of SEQ ID NO: 1, f) amino acid residues 107 and 127 of SEQ ID NO: 1, g)
amino acid residues 107,
127 and 175 of SEQ ID NO: 1, h) amino acid residues 52, 107 and 175 of SEQ ID
NO: 1, i) amino acid
residues 96, 107 and 175 of SEQ ID NO: 1, j) amino acid residues 107, 110 and
175 of SEQ ID NO: 1, k)
amino acid residue 107, 121, 213, or 217 of SEQ ID NO: 2, or 1) amino acid
residue 91 or 105 of SEQ ID
NO: 3. In a preferred embodiment, the Group H nuclear receptor ligand binding
domain is from an
ecdysone receptor.
Preferably, the Group H nuclear receptor ligand binding domain comprises a
substitution of a) an
alanine residue at a position equivalent or analogous to amino acid residue
20, 21, 48, 51, 55, 58, 59, 61,
62, 92, 93, 95, 109, 120, 125, 218, 219, 223, 230, 234, or 238 of SEQ ID NO:
1, b) an alanine, valine,
isoleucine, or leucine residue at a position equivalent or analogous to amino
acid residue 52 of SEQ ID
NO: 1, c) an alanine, threonine, aspartic acid, or methionine residue at a
position equivalent or analogous
to amino acid residue 96 of SEQ ID NO: 1, d) a proline, serine, methionine, or
leucine residue at a
position equivalent or analogous to amino acid residue 110 of SEQ ID NO: 1, e)
a phenylalanine residue
=
49
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
at a position equivalent or analogous to amino acid residue 123 of SEQ ID NO:
1, f) an alanine residue at
a position equivalent or analogous to amino acid residue 95 of SEQ ID Nd: 1
and a proline residue at a
position equivalent or analogous to amino acid residue 110 of SEQ ID NO: 1, g)
an alanine residue at a
position equivalent or analogous to amino acid residues 218 and 219 of SEQ JD
NO: 1, h) an isoleucine
residue at a position equivalent or analogous to amino acid residue 107 of SEQ
ED NO: 1, i) a glutamine
residue at a position equivalent or analogous to amino acid residues 175, j)
an isoleucine residue at a
position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 1 and
a glutamine residue at a
position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 1, k)
a glutamine residue at a
position equivalent or analogous to amino acid residues 127 and 175 of SEQ ID
NO: 1,1) an isoleucine
residue at a position equivalent or analogous to amino acid residue 107 of SEQ
ID NO: 1 and a glutamine
residue at a position equivalent or analogous to amino acid residue 127 of SEQ
ID NO: 1, m) an
isoleucine residue at a position equivalent or analogous to amino acid residue
107 of SEQ ID NO: 1 and
a glutamine residue at a position equivalent or analogous to amino acid
residues 127 and 175 of SEQ ID
NO: 1, n) a valine residue at a position equivalent or analogous to amino acid
residue 52 of SEQ ID NO:
1, an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1
and a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO:
1, o) an alanine residue at a position equivalent or analogous to amino acid
residue 96 of SEQ ID NO: 1,
an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ED NO: 1
and a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO:
1, p) an alanine residue at a position equivalent or analogous to amino acid
residue 52 of SEQ ID NO: 1,
an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1,
and a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO:
1, q) a threonine residue at a position equivalent or analogous to amino acid
residue 96 of SEQ ID NO: 1,
an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1,
and a glutamine residue at a position equivalent or analogous to amino acid
residue 175 of SEQ ID NO:
1, r) an isoleucine residue at a position equivalent or analogous to amino
acid residue 107 of SEQ ID
NO: 1, a proline at a position equivalent or analogous to amino acid 110 of
SEQ ID NO: 1, and a
glutamine residue at a position equivalent or analogous to amino acid residue
175 of SEQ ID NO: 1, s) a
proline at a position equivalent or analogous to amino acid residue 107 of SEQ
ID NO: 2, t) an arginine
or a leucine at a position equivalent or analogous to amino acid residue 121
of SEQ ID NO: 2, u) an
alanine at a position equivalent or analogous to amino acid residue 213 of SEQ
ID NO: 2, v) an alanine
or a serine at a position equivalent or analogous to amino acid residue 217 of
SEQ ID NO: 2, w) an
alanine at a position equivalent or analogous to amino acid residue 91 of SEQ
ID NO: 3, or x) a proline
at a position equivalent or analogous to amino acid residue 105 of SEQ ID NO:
3. In a preferred
embodiment, the Group H nuclear receptor ligand binding domain is from an
ecdysone receptor.
In another specific embodiment, the Group H nuclear receptor ligand binding
domain comprising
a substitution mutation is an ecdysone receptor ligand binding domain
polypeptide comprising a
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
= substitution mutation, wherein the substitution mutation is selected from
the group consisting of a)
E20A, Q21A, F48A, I51A, T52A, T52V, T52I, T52L, T5-5A, T58A, V59A, L61A, 162A,
M92A, M93A,
R95A, V96A, V96T, V96D, V96M, V1071, F109A, Al 10P, AllOS, Al 10M, Al 10L,
Y120A, A123F,
M125A, R175E, M218A, C219A, L223A, L230A, L234A, W238A, R95A/A110P,
M218A/C219A,
V107I/R175E, Y127E/R175E, V1071/Y127E, V1071/Y127E/R175E, T52VN1071/12.175E,
V96A/V10711R175E, T52A/V1071/R175E V96TN107I/R175E, or V1071/A110P/R175E
substitution
mutation of SEQ ID NO: 1, b) A107P, G121R, G121L, N213A, C217A, or C217S
substitution mutation
of SEQ ID NO: 2, and c) G91A or A105P substitution mutation of SEQ ID NO: 3.
The present invention also provides an isolated polypeptide selected from the
group consisting of
a) an isolated polypeptide comprising a transactivation domain, a DNA-binding
domain, and a Group H
nuclear receptor ligand binding domain comprising a substitution mutation
according to the invention; b)
an isolated polypeptide comprising a DNA-binding domain and a Group H nuclear
receptor ligand
binding domain comprising a substitution mutation according to the invention;
and c) an isolated
polypeptide comprising a transactivation domain and a Group H nuclear receptor
ligand binding domain
comprising a substitution mutation according to the invention. In a preferred
embodiment, the Group H
nuclear receptor ligand binding domain is from an ecdysone receptor.
The present invention also provides an isolated hybrid polypeptide selected
from the group
consisting of a) an isolated hybrid polypeptide comprising a transactivation
domain, a DNA-binding
domain, and a Group H nuclear receptor ligand binding domain comprising a
substitution mutation
according to the invention; b) an isolated hybrid polypeptide comprising a DNA-
binding domain and a
Group H nuclear receptor ligand binding domain comprising a substitution
mutation according to the
, invention; and c) an isolated hybrid polypeptide comprising a
transactivation domain and a Group H
nuclear receptor ligand binding domain comprising a substitution mutation
according to the invention. In
a preferred embodiment, the Group H nuclear receptor ligand binding domain is
from an ecdysone
receptor.
The present invention also provides an isolated polypeptide comprising a Group
H nuclear
receptor ligand binding domain comprising a substitution mutation that affects
ligand binding activity or
ligand sensitivity of the Group H nuclear receptor ligand binding domain.
In particular, the present invention relates to an isolated Group H nuclear
receptor polypeptide
comprising a ligand binding domain comprising a substitution mutation that
reduces ligand binding
activity or ligand sensitivity of the Group H nuclear receptor ligand binding
domain.
In a specific embodiment, the present invention relates to an isolated
polypeptide comprising a
Group H nuclear receptor ligand binding domain comprising a substitution
mutation that reduces steroid
binding activity or steroid sensitivity of the Group H nuclear receptor ligand
binding domain. Preferably,
the isolated polypeptide comprises a substitution of an amino acid residue at
a position equivalent or
analogous to a) amino acid residue 20, 21, 48, 51, 52, 55, 58, 59, 62, 92, 93,
95, 109, 110, 120, 123, 125,
218, 219, 223, 230, 234, or 238 of SEQ ID NO: 1, b) amino acid residue 107,
121, 213, or 217 of SEQ ID
51
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
NO: 2, or c) amino acid residue 105 of SEQ ID NO: 3. More preferably, the
isolated polypeptide
comprises a substitution of a) an alanine residue at a position equivalent or
analogous to amino acid
residue 20, 21, 48, 51, 52, 55, 58, 59, 62, 92, 93, 95, 109, 120, 125, 218,
219, 223, 230, 234, or 238 of
SEQ ID NO: 1, b) a proline residue at a position equivalent or analogous to
amino acid residue 110 of
SEQ D NO: I, c) a phenylalanine residue at a position equivalent or analogous
to amino acid residue
123 of SEQ ID NO: 1, d) an alanine residue at a position equivalent or
analogous to amino acid residue
95 of SEQ ID NO: 1 and a proline residue at a position equivalent or analogous
to amino acid residue
110 of SEQ ID NO: 1, e) an alanine residue at a position equivalent or
analogous to amino acid residues
218 and 219 of SEQ ID NO: 1, 0 a proline residue at a position equivalent or
analogous to amino acid
residue 107 of SEQ ID NO: 2, g) an arginine or leucine residue at a position
equivalent or analogous to
amino acid residue 121 of SEQ ID NO: 2, h) an alanine residue at a position
equivalent or analogous to
amino acid residue 213 of SEQ ID NO: 2, i) an alanine or a serine residue at a
position equivalent or
analogous to amino acid residue 217 of SEQ ID NO: 2, or j) a proline residue
at a position equivalent or
analogous to amino acid residue 105 of SEQ ID NO: 3. Even more preferably, the
isolated polypeptide
comprises a substitution mutation of a) E20A, Q21A, F48A, I51A, T52A, T55A,
T58A, V59A, I62A,
M92A, M93A, R95A, F109A, Al 10P, Y120A, A123F, M125A, M218A, C219A, L223A,
L230A,
L234A, W238A, R95A/A110P, or M218A/C219A of SEQ ID NO: 1, b) A107P, G121R,
G121L, N213A,
C217A, or C217S of SEQ ID NO: 2, or c) A105P of SEQ ID NO: 3.
In another specific embodiment, the present invention relates to an isolated
polypeptide
comprising a Group H nuclear receptor ligand binding domain comprising a
substitution mutation that
eliminates steroid binding activity or steroid sensitivity of the Group H
ligand binding domain.
Preferably, the isolated polypeptide comprises a substitution of an amino acid
residue at a position
equivalent or analogous to a) amino acid residue 58 or 110 of SEQ ID NO: 1, b)
amino acid residues 107,
110 and 175 of SEQ ID NO: 1, c) amino acid residue 107, 121, 213, or 217 of
SEQ ID NO: 2, or d)
amino acid residue 105 of SEQ ED NO: 3. More preferably, the isolated
polynucleotide comprises a
codon mutation that results in a substitution of a) an alanine at a position
equivalent or analogous to
amino acid residue 58 of SEQ ID NO: 1, b) a proline, leucine, serine, or
methionine residue at a position
equivalent or analogous to amino acid residue 110 of SEQ ID NO: 1, c) an
isoleucine residue at a
position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 1, a
proline residue at a
position equivalent or analogous to amino acid 110 of SEQ ID NO: 1, and a
glutamine residue at a
position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 1, d)
a proline at a position
equivalent or analogous to amino acid residue 107 of SEQ ID NO: 2, e) an
arginine or a leucine at a
position equivalent or analogous to amino acid residue 121 of SEQ ID NO: 2, 0
an alanine at a position
equivalent or analogous to amino acid residue 213 of SEQ ID NO: 2, g) an
alanine or a serine at a
position equivalent or analogous to amino acid residue 217 of SEQ ID NO: 2,
orb) a proline at a position
equivalent or analogous to amino acid residue 105 of SEQ ID NO: 3. Even more
preferably, the isolated
polypeptide comprises a substitution mutation selected from the group
consisting of a) T58A, Al 10P,
52
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
Al 10L, Al 10S, Al 10M, or V1071/A110P/R175E substitution mutation of SEQ ID
NO: 1, b) A107P,
0121R, G121L, N213A, C217A, or C217S substitution mutation of SEQ ID NO: 2,
and c) A105P
substitution mutation of SEQ ID NO: 3.
The present invention also relates to an isolated polypeptide comprising an
ecdysone receptor
ligand binding domain comprising a substitution mutation, wherein the ecdysone
receptor ligand binding
domain lacks steroid binding activity. Preferably, the ecdysone receptor
ligand binding domain
comprises a substitution mutation at an equivalent or analogous amino acid
residue to a) amino acid
residue 58 or 110 of SEQ ID NO: 1, b) amino acid residues 107, 110 and 175 of
SEQ ID NO: 1, c) amino
acid residue 107, 121, 213, or 217 of SEQ ID NO: 2, or d) amino acid residue
105 of SEQ ID NO: 3.
20 More preferably, the ecdysone receptor ligand binding domain comprises a
substitution of a) an alanine
at a position equivalent or analogous to amino acid residue 58 of SEQ ID NO:
1, b) a proline, leucine,
serine, or methionine residue at a position equivalent or analogous to amino
acid residue 110 of SEQ ID
NO: 1, c) an isoleucine residue at a position equivalent or analogous to amino
acid residue 107 of SEQ
ID NO: 1, a proline residue at a position equivalent or analogous to amino
acid residue 110 of SEQ ID
NO: 1, and a glutamine residue at a position equivalent or analogous to amino
acid residue 175 of SEQ
ID NO: 1, d) a proline at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 2,
e) an arginine or a leucine at a position equivalent or analogous to amino
acid residue 121 of SEQ ID
NO: 2, f) an alanine at a position equivalent or analogous to amino acid
residue 213 of SEQ ID NO: 2, g)
an alanine or a serine at a position equivalent or analogous to amino acid
residue 217 of SEQ ID NO: 2,
orb) a proline at a position equivalent or analogous to amino acid residue 105
of SEQ ID NO: 3. Even
more preferably, the ecdysone receptor ligand binding domain comprises a
substitution mutation selected
from the group consisting of a) T58A, Al 10P, Al 10L, Al 10S, Al 10M, or
V1071/A110P/R175E
substitution mutation of SEQ ID NO: 1, b) A107P, G121R, G121L, N213A, C217A,
or C217S
substitution mutation of SEQ ID NO: 2, and c) A105P substitution mutation of
SEQ ID NO: 3. In a
specific embodiment, the ecdysone receptor ligand binding domain lacks steroid
binding activity selected
from the group consisting of ecdysone binding activity, 20-hydroxyecdysone
binding activity,
ponasterone A binding activity, and muristerone A binding activity.
In another specific embodiment, the isolated polypeptide comprising an
ecdysone receptor ligand
binding domain comprising a substitution mutation, wherein the ecdysone
receptor ligand binding
domain lacks steroid binding activity and is encoded by a polynucleotide that
hybridizes to a
polynucleotide comprising a codon mutation that results in a substitution
mutation selected from the
group consisting of a) T58A, Al 10P, Al 10L, Al 10S, Al 10M, or
V1071/A110P/R175E substitution
mutation of SEQ ID NO: 1, b) A107P, G121R, G121L, N213A, C217A, or C217S
substitution mutation
of SEQ ID NO: 2, and c) A105P substitution mutation of SEQ ID NO: 3 under
hybridization conditions
comprising a hybridization step in less than 500 mM salt and at least 37
degrees Celsius, and a washing
step in 2XSSPE at at least 63 degrees Celsius. In a preferred embodiment, the
hybridization conditions
comprise less than 200 rnM salt and at least 37 degrees Celsius for the
hybridization step. In another
53
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
preferred embodiment, the hybridi7ntion conditions comprise 2XSSPE and 63
degrees Celsius for both
the hybridization and washing steps. In another preferred embodiment, the
ecdysone receptor ligand
binding domain lacks steroid binding activity selected from the group
consisting of ecdysone binding
activity, 20-hydroxyecdysone binding activity, ponasterone A binding activity,
and muristerone A
binding activity.
In another specific embodiment, the present invention relates to an isolated
polypeptide
comprising a Group H nuclear receptor ligand binding domain comprising a
substitution mutation that
reduces non-steroid binding activity or non-steroid sensitivity of the Group H
nuclear receptor ligand
binding domain. Preferably, the isolated polypeptide comprises a substitution
of an amino acid residue at
a position equivalent or analogous to amino acid residue a) 21, 48, 51, 52,
59, 62, 93, 95, 96, 109, 120,
123, 125, 218, 219, 223, 230, 234, or 238 of SEQ ID NO: 1, b) 121, 213, or 217
of SEQ ID NO: 2, or c)
105 of SEQ ID NO: 3. More preferably, the isolated polypeptide comprises a
substitution of a) an
alanine residue at a position equivalent or analogous to amino acid residue
21, 48, 51, 59, 62, 93, 95, 96,
109, 120, 125, 218, 219, 223, 230, 234, or 238 of SEQ ID NO: 1, b) a leucine
residue at at a position
16 equivalent or analogous to amino acid residue 52 of SEQ ID NO: 1, c) a
threonine residue at at a position
equivalent or analogous to amino acid residue 96 of SEQ ID NO: 1, d) a
phenylalanine residue at at a
position equivalent or analogous to amino acid residue 123 of SEQ ID NO: 1, e)
an alanine residue at at a
position equivalent or analogous to amino acid residue 95 of SEQ ID NO: 1 and
a proline residue at a
position equivalent or analogous to amino acid residue 110 of SEQ ID NO: 1, f)
an alanine residue at at a
position equivalent or analogous to amino acid residues 218 and 219 of SEQ ID
NO: 1, g) an arginine or
a leucine residue at a position equivalent or analogous to amino acid residue
121 of SEQ ID NO: 2, h) an
alanine residue at a position equivalent or analogous to amino acid residue
213 of SEQ ID NO: 2, i) an
alanine or a serine residue at a position equivalent or analogous to amino
acid residue 217 of SEQ ID
NO: 2, or j) a proline residue at a position equivalent or analogous to amino
acid residue 105 of SEQ ID
NO: 3. Even more preferably, the isolated polypeptide comprises a substitution
mutation of a) Q21A,
F48A, I51A, T52L, V59A, 162A, M93A, R95A, V96A, V96T, F109A, Y120A, A123F,
M125A, M218A,
C219A, L223A, L230A, L234A, W238A, R95AJA110P, or M218/C219A of SEQ ID NO: 1,
b) G121R_,
G121L, N213A, C217A, or C217S of SEQ ID NO: 2, or c) A105P of SEQ ID NO: 3.
In another specific embodiment, the present invention relates to an isolated
polypeptide
3 0 comprising a Group H nuclear receptor polypeptide ligand binding domain
comprising a substitution
mutation that eliminates non-steroid binding activity or non-steroid
sensitivity of the Group H ligand
binding domain.
In another specific embodiment, the present invention relates to an isolated
polypeptide
comprising a Group H nuclear receptor polypeptide ligand binding domain
comprising a substitution
mutation that reduces both steroid binding activity or steroid sensitivity and
non-steroid binding activity
or non-steroid sensitivity of the Group H ligand binding domain. Preferably,
the isolated polypeptide
comprises a substitution of an amino acid residue at a position equivalent or
analogous to a) amino acid
54
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
residue 21, 48, 51, 59, 62, 93, 95, 109, 120, 123, 125, 218, 219, 223, 230,
234, or 238 of SEQ ID NO: 1,
b) amino acid residues 95 and 110 of SEQ ID NO: 1, c) amino acid residues 218
and 219 of SEQ ID NO:
1, d) amino acid residue 121, 213, or 217 of SEQ 1D NO: 2, ore) amino acid
residue 105 of SEQ ID NO:
3. More preferably, the isolated polypeptide comprises a substitution of a) an
alanine residue at a
position equivalent or analogous to amino acid residue 21,48, 51, 59, 62, 93,
95, 109, 120, 125, 218,
219, 223, 230, 234, or 238 of SEQ ID NO: 1, b) a phenylalanine residue at a
position equivalent or
analogous to amino acid residue 123 of SEQ DD NO: 1, c) an alanine residue at
a position equivalent or
analogous to amino acid residue 95 of SEQ ID NO: 1 and a proline residue at a
position equivalent or
analogous to amino acid residue 110 of SEQ ID NO: 1, d) an alanine residue at
a position equivalent or
analogous to amino acid residues 218 and 219 of SEQ ID NO: 1, e) an arginine
or leucine residue at a
position equivalent or analogous to amino acid residue 121 of SEQ ID NO: 2, f)
an alanine residue at a
position equivalent or analogous to amino acid residue 213 of SEQ ID NO: 2, g)
an alanine or serine
residue at a position equivalent or analogous to amino acid residue 217 of SEQ
ID NO: 2, or h) a proline
residue at a position equivalent or analogous to amino acid residue 105 of SEQ
ID NO: 3. Even more
preferably, the isolated polypeptide comprises a substitution mutation of
Q21A, F48A, 151A, V59A,
I62A, M93A, R95A, F109A, Y120A, A123F, M125A, M218A, C219A, L223A, L230A,
L234A,
W238A, R95A/A110P, or M218A/C219A of SEQ ID NO: 1, b) G121R, G121L, N213A,
C217A, or
C217S of SEQ ID NO: 2, or c) A105P of SEQ ID NO: 3.
In addition, the present invention also relates to an isolated polypeptide
comprising a Group H
nuclear receptor ligand binding domain comprising a substitution mutation that
enhances ligand binding
activity or ligand sensitivity of the Group H nuclear receptor ligand binding
domain.
In a specific embodiment, the present invention relates to an isolated
polypeptide comprising a
Group H nuclear receptor ligand binding domain comprising a substitution
mutation that enhances
steroid binding activity or steroid sensitivity of the Group H nuclear
receptor ligand binding domain.
Preferably, the isolated polypeptide comprises a substitution of an amino acid
residue at a position
equivalent or analogous to a) amino acid residue 52 or 96 of SEQ ID NO: 1, b)
amino acid residues 96,
107 and 175 of SEQ ID NO: 1, or c) amino acid residue 91 of SEQ ID NO: 3. More
preferably, the
isolated polypeptide comprises a substitution of a) a leucine, valine, or
isoleucine residue at a position
equivalent or analogous to amino acid residue 52 of SEQ ID NO: 1, b) an
alanine, threonine, aspartic
3 0 acid, or methionine residue at a position equivalent or analogous to amino
acid residue 96 of SEQ ID
NO: 1, c) a threonine residue at a position equivalent or analogous to amino
acid residue 96 of SEQ ID
NO: 1, an isoleucine residue at a position equivalent or analogous to amino
acid residue 107 of SEQ ID
NO: 1 and a glutamine residue at a position equivalent or analogous to amino
acid residue 175 of SEQ ID
NO: 1, or d) an alanine residue at a position equivalent or analogous to amino
acid residue 91 of SEQ ID
NO: 3. Even more preferably, the isolated polypeptide comprises a substitution
mutation of a) T52L,
T52V, T52I, V96A, V96T, V96D, V96M, or V96TNI 071/R175E of SEQ ID NO: 1 orb)
G91A of SEQ
ID NO: 3.
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
In another specific embodiment, the present invention relates to an isolated
polypeptide
comprising a Group H nuclear receptor ligand binding domain comprising a
substitution mutation that
enhances non-steroid binding activity or non-steroid sensitivity of the Group
H nuclear receptor ligand
binding domain. Preferably, the isolated polypeptide comprises a substitution
of an amino acid residue at
a position equivalent or analogous to amino acid residue 52, 55, or 96 of SEQ
JD NO: 1 orb) amino acid
residue 91 of SEQ ID NO: 3. More preferably, the isolated polypeptide
comprises a substitution of a) an
alanine, valine, or isoleucine residue at a position equivalent or analogous
to amino acid residue 52 of
SEQ ID NO: 1, b) an alanine residue at a position equivalent or analogous to
amino acid residue 55 of
SEQ ID NO: 1, c) an aspartic acid or methionine residue at a position
equivalent or analogous to amino
acid residue 96 of SEQ ID NO: 1, or d) an alanine residue at a position
equivalent or analogous to amino
acid residue 91 of SEQ ID NO: 3. Even more preferably, the isolated
polypeptide comprises a
substitution mutation of a) T52A, T52V, T52I, T55A, V96D, or V96Ivi of SEQ 1D
NO: 1 or b) G9 IA of
SEQ ID NO: 3.
In another specific embodiment, the present invention relates to an isolated
polypeptide
comprising a Group H nuclear receptor ligand binding domain comprising a
substitution mutation that
enhances both steroid binding activity or steroid sensitivity and non-steroid
binding activity or non-
steroid sensitivity of the Group H ligand binding domain. Preferably, the
isolated polypeptide comprises
a substitution of an amino acid residue at a position equivalent or analogous
to a) amino acid residue 52,
96, 107 or 175 of SEQ ID NO: 1, b) amino acid residues 107 and 175 of SEQ ID
NO: 1, c) amino acid
residues 127 and 175 of SEQ ID NO: 1, d) amino acid residues 107 and 127 of
SEQ ID NO: 1, e) amino
acid residues 107, 127 and 175 of SEQ ID NO: 1, f) amino acid residues 52, 107
and 175 of SEQ ID NO:
g) amino acid residues 96, 107 and 175 of SEQ ID NO: 1, or h) amino acid
residue 91 of SEQ ID NO:
3. More preferably, the isolated polypeptide comprises a substitution of a) a
valine or isoleucine residue
at a position equivalent or analogous to amino acid residue 52 of SEQ ID NO:
1, b) an aspartic acid or
=
methionine residue at a position equivalent or analogous to amino acid residue
96 of SEQ ID NO: 1, c)
an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1,
d) a glutamine residue at a position equivalent or analogous to amino acid
residues 175, e) an isoleucine
residue at a position equivalent or analogous to amino acid residue 107 of SEQ
ED NO: 1 and a glutamine
residue at a position equivalent or analogous to amino acid residue 175 of SEQ
ID NO: 1, f) a glutamine
residue at a position equivalent or analogous to amino acid residues 127 and
175 of SEQ ID NO: 1, g) an
isoleucine residue at a position equivalent or analogous to amino acid residue
107 of SEQ ID NO: 1 and
a glutamine residue at a position equivalent or analogous to amino acid
residue 127 of SEQ ID NO: 1, h)
an isoleucine residue at a position equivalent or analogous to amino acid
residue 107 of SEQ ID NO: 1
and a glutamine residue at a position equivalent or analogous to amino acid
residues 127 and 175 of SEQ
ID NO: 1, i) a valine residue at a position equivalent or analogous to amino
acid residue 52 of SEQ ID
NO: 1, an isoleucine residue at a position equivalent or analogous to amino
acid residue 107 of SEQ ID
NO: 1 and a glutamine residue at a position equivalent or analogous to amino
acid residue 175 of SEQ ID
56
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
NO: 1, j) an alanine residue at a position equivalent or analogous to amino
acid residue 96 of SEQ ID
NO: 1, an isoleucine residue at a position equivalent or analogous to amino
acid residue 107 of SEQ ID
NO: 1 and a glutamine residue at a position equivalent or analogous to amino
acid residue 175 of SEQ ID
NO: 1, k) an alanine residue at a position equivalent or analogous to amino
acid residue 52 of SEQ ID
NO: 1, an isoleucine residue at a position equivalent or analogous to amino
acid residue 107 of SEQ ID
NO: 1, and a glutamine residue at a position equivalent or analogous to amino
acid residue 175 of SEQ
ID NO: 1, or 1) an alanine residue at a position equivalent or analogous to
amino acid residue 91 of SEQ
ID NO: 3. Even more preferably, the isolated polypeptide comprises a
substitution mutation of a) T52V,
T52I, V96D, V96M, V107I, R175E, V1071/R175E, Y127E/R175E, V1071/Y127E,
V107I/Y127E/R175E, T52VN107I/R175E, V96A/V1071/R175E, or T52A/V10711R175E of
SEQ ID
NO: 1 or b) G91A of SEQ ID NO: 3.
The present invention also relates to compositions comprising an isolated
polypeptide according
to the invention.
METHOD OF MODULATING GENE EXPRESSION OF THE INVENTION
Applicants' invention also relates to methods of modulating gene expression in
a host
cell using a gene expression modulation system according to the invention.
Specifically, Applicants'
invention provides a method of modulating the expression of a gene in a host
cell comprising the steps
of: a) introducing into the host cell a gene expression modulation system
according to the invention; and
b) introducing into the host cell a ligand; wherein the gene to be modulated
is a component of a gene
expression cassette comprising: i) a response element comprising a domain
recognized by the DNA
binding domain of the gene expression system; ii) a promoter that is activated
by the transactivation
domain of the gene expression system; and iii) a gene whose expression is to
be modulated, whereby
upon introduction of the ligand into the host cell, expression of the gene is
modulated.
The invention also provides a method of modulating the expression of a gene in
a host cell
= comprising the steps of: a) introducing into the host cell a gene
expression modulation system according
to the invention; b) introducing into the host cell a gene expression cassette
according to the invention,
wherein the gene expression cassette comprises iya response element comprising
a domain recognized
by the DNA binding domain from the gene expression system; ii) a promoter that
is activated by the
transactivation domain of the gene expression system; and iii) a gene whose
expression is to be
modulated; and c) introducing into the host cell a ligand; whereby upon
introduction of the ligand into
the host cell, expression of the gene is modulated.
Applicants' invention also provides a method of modulating the expression of a
gene in a host
cell comprising a gene expression cassette comprising a response element
comprising a domain to which
the DNA binding domain from the first hybrid polypeptide of the gene
expression modulation system
binds; a promoter that is activated by the transactivation domain of the
second hybrid polypeptide of the
gene expression modulation system; and a gene whose expression is to be
modulated; wherein the
57
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
method comprises the steps of: a) introducing into the host cell a gene
expression modulation system
according to the invention; and b) introducing into the host cell a ligand;
whereby upon introduction of
the ligand into the host, expression of the gene is modulated.
Genes of interest for expression in a host cell using Applicants' methods may
be endogenous
genes or heterologous genes. Nucleic acid or amino acid sequence information
for a desired gene or
protein can be located in one of many public access databases, for example,
GENBANK, EMBL, Swiss-
Prot, and PIR, or in many biology related journal publications. Thus, those
skilled in the art have access
to nucleic acid sequence information for virtually all known genes. Such
information can then be used to
construct the desired constructs for the insertion of the gene of interest
within the gene expression
cassettes used in Applicants' methods described herein.
Examples of genes of interest for expression in a host cell using Applicants'
methods include,
but are not limited to: antigens produced in plants as vaccines, enzymes like
alpha-amylase, phytase,
glucanes, xylase and xylanase, genes for resistance against insects,
nematodes, fungi, bacteria, viruses,
and abiotic stresses, nutraceuticals, pharmaceuticals, vitamins, genes for
modifying amino acid content,
herbicide resistance, cold, drought, and heat tolerance, industrial products,
oils, protein, carbohydrates,
antioxidants, male sterile plants, flowers, fuels, other output traits, genes
encoding therapeutically
desirable polypeptides or products that may be used to treat a condition, a
disease, a disorder, a
dysfunction, a genetic defect, such as monoclonal antibodies, enzymes,
proteases, cytokines, interferons,
insulin, erthropoietin, clotting factors, other blood factors or components,
viral vectors for gene therapy,
virus for vaccines, targets for drug discovery, functional genomics, and
proteomics analyses and
applications, and the like.
Acceptable ligands are any that modulate expression of the gene when binding
of the DNA
binding domain of the gene expression system according to the invention to the
response element in the
presence of the ligand results in activation or suppression of expression of
the genes. Preferred ligands
include an ecdysteroid, such as ecdysone, 20-hydroxyecdysone, ponasterone A,
muristerone A, and the
like, 9-cis-retinoic acid, synthetic analogs of retinoic acid, N,N'-
diacylhydrazines such as those disclosed
in U. S. Patents No. 6,013,836; 5,117,057; 5,530,028; and 5,378,726;
dibenzoylallcyl cyanohydrazines
such as those disclosed in European Application No. 461,809; N-alkyl-N,N'-
diaroylhydrazines such as
those disclosed in U. S. Patent No. 5,225,443; N-acyl-N-
allcylcarbonylhydrazines such as those disclosed
in European Application No. 234,994; N-aroyl-N-alkyl-N'-aroylhydrazines such
as those described in U.
S. Patent No. 4,985,461; = and
other similar materials
including 3,5-di-tert-butyl-4-hydroxy-N-isobutyl-benzamide, 8-0-
acetylharpagide, oxysterols, 22(R)
hydroxycholesterol, 24(S) hydroxycholesterol, 25-epoxycholesterol, TO901317, 5-
alpha-6-alpha-
epoxycholesterol-3-sulfate (ECHS), 7-ketocholesterol-3-sulfate, famesol, bile
acids, 1,1-biphosphonate
=
esters, Juvenile hormone III, and the like.
In a preferred embodiment, the ligand for use in Applicants' method of
modulating expression of
gene is a compound of the formula:
58
CA 02855992 2014-07-08
WO 02/066612 PCT/TJS02/05090
R4
0 III N 01
R5
R3
_____________________________________________________________ R6
R2 R1
wherein:
E is a (C4-C6)allcyl containing a tertiary carbon or a cyano(C3-05)alkyl
containing a tertiary carbon;
R is H, Me, Et, i-Pr, F, formyl, CF3, CHF2, CHCl2, CH2F, CH2C1, CH2OH, CH20Me,
CH2CN, CN,
C CH, 1-propyn. yl, 2-propynyl, vinyl, OH, OMe, OEt, cyclopropyl, CF2CF3,
CH=CHCN, allyl,
azido, SCN, or SCHF3;
R2 is H, Me, Et, n-Pr, i-Pr, formyl, CF3, CHF2, CHCl2, CH2F, CH2C1, CH2OH,
CH20Me, CH2CN,
= CN, C CH, 1-propynyl, 2-propynyl, vinyl, Ac, F, Cl, OH, OMe, OEt, 0-n-Pr,
OAc, NMe2, NEtz,
= SMe, SEt, SOCF3, OCF2CF2H, COEt, cyclopropyl, CF2CF3, CH=CHCN, allyl,
azido, OCF3,
OCHF2, 0-i-Pr, SCN, SCHF2, SOMe, NH-CN, or joined with R3 and the phenyl
carbons to
which R2 and R3 are attached to form an ethylenedioxy, a dihydrofuryl ring
with the oxygen
adjacent tba phenyl carbon, or a dihydropyryl ring with the oxygen adjacent to
a phenyl carbon;
R3 is H, Et, or joined with R2 and the phenyl carbons to which R2 and R3 are
attached to form an
ethylenedioxy, a dihydrofuryl ring with the oxygen adjacent to a phenyl
carbon, or a
dihyclropyryl ring with the oxygen adjacent to a phenyl carbon;
R4, 126, and R6 are independently H, Me, Et, F, Cl, Br, formyl, CF3, CHF2,
CHC12, CH2F, CH2C1,
CH2OH, CN, CDCH, 1-propynyl, 2-propynyl, vinyl, OMe, OEt, SMe, or SEt.
In another preferred embodiment, the ligand for use in Applicants' method of
modulating
expression of gene is an ecdysone, 20-hydroxyecdysone, ponasterone A,
muristerone A, an oxysterol, a
22(R) hydroxycholesterol, 24(S) hydroxycholesterol, 25-epoxycholesterol,
TO901317, 5-alpha-6-alpha-
epoxycholesterol-3-sulfate (ECHS), 7-ketocholesterol-3-sulfate, farnesol, bile
acids, 1,1-biphosphonate
esters, or Juvenile hormone III.
In another preferred embodiment, a second ligand may be used in addition to
the first ligand
discussed above in Applicants' method of modulating expression of a gene.
Preferably, this second
ligand is 9-cis-retinoic acid or a synthetic analog of retinoic acid.
HOST CELLS AND NON-HUMAN ORGANISMS OF THE INVENTION
As described above, the gene expression modulation system of the present
invention may be used
to modulate gene expression in a host cell. Expression in transgenic host
cells may be useful for the
expression of various genes of interest. Applicants' invention provides for
modulation of gene
expression in prokaryotic and eukaryotic host cells. Expression in transgenic
host cells is useful for the
expression of various polypeptides of interest including but not limited to
antigens produced in plants as
59
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
vaccines, enzymes like alpha-amylase, phytase, glucanes, xylase and xylanase,
genes for resistance
against insects, nematodes, fungi, bacteria, viruses, and abiotic stresses,
antigens, nutraceuticals,
pharmaceuticals, vitamins, genes for modifying amino acid content, herbicide
resistance, cold, drought,
and heat tolerance, industrial products, oils, protein, carbohydrates,
antioxidants, male sterile plants,
flowers, fuels, other output traits, therapeutic polypeptides, pathway
intermediates; for the modulation of
pathways already existing in the host for the synthesis of new products
heretofore not possible using the
host; cell based assays; functional genomics assays, biotherapeutic protein
production, proteomics
assays, and the like. Additionally the gene products may be useful for
conferring higher growth yields of
the host or for enabling an alternative growth mode to be utilized.
Thus, Applicants' invention provides an isolated host cell comprising a gene
expression system
according to the invention. The present invention also provides an isolated
host cell comprising a gene
expression cassette according to the invention. Applicants' invention also
provides an isolated host cell
comprising a polynucleotide or a polypeptide according to the invention. The
present invention also
relates to a host cell transfected with an expression vector according to the
invention. The host cell may
be a bacterial cell, a fungal cell, a nematode cell, an insect cell, a fish
cell, a plant cell, an avian cell, an
animal cell, or a mammalian cell. In still another embodiment, the invention
relates to a method for
producing a nuclear receptor ligand binding domain comprising a substitution
mutation, wherein the
method comprises culturing the host cell as described above in culture medium
under conditions
permitting expression of a polynucleotide encoding the nuclear receptor ligand
binding domain
comprising a substitution mutation, and isolating the nuclear receptor ligand
binding domain comprising
a substitution mutation from the culture.
In a specific embodiment, the isolated host cell is a prokaryotic host cell or
a eukaryotic host
cell. In another specific embodiment, the isolated host cell is an
invertebrate host cell or a vertebrate
host cell. Preferably, the host cell is selected from the group consisting of
a bacterial cell, a fungal cell, a
yeast cell, a nematode cell, an insect cell, a fish cell, a plant cell, an
avian cell, an animal cell, and a
mammalian cell. More preferably, the host cell is a yeast cell, a nematode
cell, an insect cell, a plant
cell, a zebrafish cell, a chicken cell, a hamster cell, a mouse cell, a rat
cell, a rabbit cell, a cat cell, a dog
cell, a bovine cell, a goat cell, a cow cell, a pig cell, a horse cell, a
sheep cell, a simian cell, a monkey
cell, a chimpanzee cell, or a human cell. Examples of preferred host cells
include, but are not limited to,
fungal or yeast species such as Aspergillus, Trichoderma, Saccharomyces,
Pichia, Candida, Hansenula,
or bacterial species such as those in the genera Synechocystis, Synechococcus,
Salmonella, Bacillus,
Acinetobacter, Rhodococcus, Streptomyces, Escherichia, Pseudomonas, Met
hylomonas, Methylobacter,
Alcaligenes, Synechocystis, Anabaena, Thiobacillus, Methanobacterium and
Klebsiella; plant species
selected from the group consisting of an apple, Arabidopsis, bajra, banana,
barley, beans, beet,
3 5 blackgram, chickpea, chili, cucumber, eggplant, favabean, maize, melon,
millet, mungbean, oat, okra,
Pan icum, papaya, peanut, pea, pepper, pigeonpea, pineapple, Phaseolus,
potato, pumpkin, rice, sorghum,
soybean, squash, sugarcane, sugarbeet, sunflower, sweet potato, tea, tomato,
tobacco, watermelon, and
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
wheat; animal; and mammalian host cells.
In a specific embodiment, the host cell is a yeast cell selected from the
group consisting of a
Saccharomyces, a Pichia, and a Candicia host cell.
In another specific embodiment, the host cell is a Caenorhabdus elegans
nematode cell.
In another specific embodiment, the host cell is an insect cell.
In another specific embodiment, the host cell is a plant cell selected from
the group consisting of
an apple, Arabidopsis, bajra, banana, barley, beans, beet, blackgram,
chickpea, chili, cucumber, eggplant,
favabean, maize, melon, millet, mungbean, oat, okra, Panicum, papaya, peanut,
pea, pepper, pigeonpea,
pineapple, Phaseolus, potato, pumpkin, rice, sorghum, soybean, squash,
sugarcane, sugarbeet, sunflower,
sweet potato, tea, tomato, tobacco, watermelon, and wheat cell.
In another specific embodiment, the host cell is a zebrafish cell.
In another specific embodiment, the host cell is a chicken cell.
In another specific embodiment, the host cell is a mammalian cell selected
from the group
consisting of a hamster cell, a mouse cell, a rat cell, a rabbit cell, a cat
cell, a dog cell, a bovine cell, a
goat cell, a cow cell, a pig cell, a horse cell, a sheep cell, a monkey cell,
a chimpanzee cell, and a human
cell.
Host cell transformation is well known in the art and may be achieved by a
variety of methods
including but not limited to electroporation, viral infection, plasmid/vector
transfection, non-viral vector
= mediated transfection, Agrobacterium-mediated transformation, particle
bombardment, and the like.
Expression of desired gene products involves culturing the transformed host
cells under suitable
conditions and inducing expression of the transformed gene. Culture conditions
and gene expression
protocols in prokaryotic and eukaryotic cells are well known in the art (see
General Methods section of
Examples). Cells may be harvested and the gene products isolated according to
protocols specific for the
gene product.
In addition, a host cell may be chosen which modulates the expression of the
inserted
polynucleotide, or modifies and processes the polypeptide product in the
specific fashion desired.
Different host cells have characteristic and specific mechanisms for the
translational and post-
translational processing and modification [e.g., glycosylation, cleavage
(e.g., of signal sequence)] of
proteins. Appropriate cell lines or host systems can be chosen to ensure the
desired modification and
3 0 processing of the foreign protein expressed. For example, expression in a
bacterial system can be used to
produce a non-glycosylated core protein product. However, a polypeptide
expressed in bacteria may not
be properly folded. Expression in yeast can produce a glycosylated product
Expression in eukaryotic
cells can increase the likelihood of "native" glycosylation and folding of a
heterologous protein.
Moreover, expression in mammalian cells can provide a tool for reconstituting,
or constituting, the
polypeptide's activity. Furthermore, different vector/host expression systems
may affect processing
reactions, such as proteolytic cleavages, to a different extent.
Applicants' invention also relates to a non-human organism comprising an
isolated host cell
61
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
according to the invention. In a specific embodiment, the non-human organism
is a prokaryotic organism
or a eulcaryotic organism. In another specific embodiment, the non-human
organism is an invertebrate
organism or a vertebrate organism.
Preferably, the non-human organism is selected from the group consisting of a
bacterium, a
fungus, a yeast, a nematode, an insect, a fish, a plant, a bird, an animal,
and a mammal. More preferably,
the non-human organism is a yeast, a nematode, an insect, a plant, a
zebrafish, a chicken, a hamster, a
mouse, a rat, a rabbit, a cat, a dog, a bovine, a goat, a cow, a pig, a horse,
a sheep, a simian, a monkey, or
a chimpanzee.
In a specific embodiment, the non-human organism is a yeast selected from the
group consisting
of Saccharomyces, Pichia, and Candida.
In another specific embodiment, the non-human organism is a Caenorhabdus
elegans nematode.
In another specific embodiment, the non-human organism is a plant selected
from the group
consisting of an apple, Arabidopsis, bajra, banana, barley, beans, beet,
blackgram, chickpea, chili,
cucumber, eggplant, favabean, maize, melon, millet, mungbean, oat, okra,
Panicum, papaya, peanut, pea,
pepper, pigeonpea, pineapple, Phaseolus, potato, pumpkin, rice, sorghum,
soybean, squash, sugarcane,
sugarbeet, sunflower, sweet potato, tea, tomato, tobacco, watermelon, and
wheat.
In another specific embodiment, the non-human organism is a Mus muscu/us
mouse.
MEASURING GENE EXPRESSION/TRANSCRIPTION
One useful measurement of Applicants' methods of the invention is that of the
transcriptional
state of the cell including the identities and abundances of RNA, preferably
mRNA species. Such
measurements are conveniently conducted by measuring cDNA abundances by any of
several existing
gene expression technologies.
Nucleic acid array technology is a useful technique for determining
differential mRNA
expression. Such technology includes, for example, oligonucleotide chips and
DNA microarrays. These
techniques rely on DNA fragments or oligonucleotides which correspond to
different genes or cDNAs
which are immobilized on a solid support and hybridized to probes prepared
from total mRNA pools
extracted from cells, tissues, or whole organisms and converted to cDNA.
Oligonucleotide chips are
arrays of oligonucleotides synthesized on a substrate using photolithographic
techniques. Chips have
3 0 been produced which can analyze for up to 1700 genes. DNA microarrays are
arrays of DNA samples,
typically PCR products, that are robotically printed onto a microscope slide.
Each gene is analyzed by a
full or partial-length target DNA sequence. Microarrays with up to 10,000
genes are now routinely
prepared commercially. The primary difference between these two techniques is
that oligonucleotide
chips typically utilize 25-mer oligonucleotides which allow fractionation of
short DNA molecules
whereas the larger DNA targets of microarrays, approximately 1000 base pairs,
may provide more
sensitivity in fractionating complex DNA mixtures.
Another useful measurement of Applicants' methods of the invention is that of
determining the
62
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
translation state of the cell by measuring the abundances of the constituent
protein species present in the
cell using processes well known in the art.
Where identification of genes associated with various physiological functions
is desired, an
assay may be employed in which changes in such functions as cell
growth,.apoptosis, senescence,
differentiation, adhesion, binding to a specific molecules, binding to
anotlier cell, cellular organization,
organogenesis, intracellular transport, transport facilitation, energy
conversion, metabolism, myogenesis,
neurogenesis, and/or hematopoiesis is measured.
In addition, selectable marker or reporter gene expression may be used to
measure gene
expression modulation using Applicants' invention.
Other methods to detect the products of gene expression are well known in the
art and include
Southern blots (DNA detection), dot or slot blots (DNA, RNA), northern blots
(RNA), RT-PCR (RNA),
western blots (polypeptide detection), and ELISA (polypeptide) analyses.
Although less preferred,
labeled proteins can be used to detect a particular nucleic acid sequence to
which it hybidizes.
In some cases it is necessary to amplify the amount of a nucleic acid
sequence. This may be
carried out using one or more of a number of suitable methods including, for
example, polymerase chain
reaction ("PCR"), ligase chain reaction ("LCR"), strand displacement
amplification ("SDA"),
transcription-based amplification, and the like. PCR is carried out in
accordance with known techniques
in which, for example, a nucleic acid sample is treated in the presence of a
heat stable DNA polymerase,
under hybridizing conditions, with one pair of oligonucleotide primers, with
one primer hybridizing to
one strand (template) of the specific sequence to be detected. The primers are
sufficiently
complementary to each template strand of the specific sequence to hybridize
therewith. An extension
product of each primer is synthesized and is complementary to the nucleic acid
template strand to which
it hybridized. The extension product synthesized from each primer can also
serve as a template for
further synthesis of extension products using the same primers. Following a
sufficient number of rounds
of synthesis of extension products, the sample may be analyzed as described
above to assess whether the
sequence or sequences to be detected are present.
LIGAND SCREENING ASSAYS
The present invention also relates to methods of screening for a compound that
induces or
3 0 represses transactivation of a nuclear receptor ligand binding domain
comprising a substitution mutation
in a cell by contacting a nuclear receptor ligand binding domain with a
candidate molecule and detecting
reporter gene activity in the presence of the ligand. Candidate compounds may
be either agonists or
antagonists of the nuclear receptor ligand binding domain. In a preferred
embodiment, the nuclear
receptor ligand binding domain is expressed from a polynucleotide in the cell
and the transactivation
activity (i.e., expression or repression of a reporter gene) or compound
binding activity is measured.
Accordingly, in addition to rational design of agonists and antagonists based
on the structure of a
nuclear receptor ligand binding domain, the present invention contemplates an
alternative method for
63
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
identifying specific ligands of a nuclear receptor ligand binding domain using
various screening assays
known in the art.
Any screening technique known in the art can be used to screen for Group H
nuclear receptor
ligand binding domain agonists or antagonists. For example, a suitable cell
line comprising a nuclear
receptor-based gene expression system according to the invention can be
transfected with a gene
expression cassette encoding a marker gene operatively linked to an inducible
or repressible promoter. =
The transfected cells are then exposed to a test solution comprising a
candidate agonist or antagonist
compound, and then assayed for marker gene expression or repression. The
presence of more marker
gene expression relative to control cells not exposed to the test solution is
an indication of the presence
of an agonist compound in the test solution. Conversely, the presence of less
marker gene expression
relative to control cells not exposed to the test solution is an indication of
the presence of an antagonist
compound in the test solution.
The present invention contemplates screens for small molecule ligands or
ligand analogs and
mimics, as well as screens for natural ligands that bind to and agonize or
antagonize a Group H nuclear
receptor ligand binding domain according to the invention in vivo. For
example, natural products
libraries can be screened using assays of the invention for molecules that
agonize or antagonize nuclear
receptor-based gene expression system activity.
Identification and screening of antagonists is further facilitated by
determining structural features
of the protein, e.g., using X-ray crystallography, neutron diffraction,
nuclear magnetic resonance
spectrometry, and other techniques for structure determination. These
techniques provide for the rational
design or identification of agonists and antagonists.
Another approach uses recombinant bacteriophage to produce large libraries.
Using the "phage
method" [Scott and Smith, 1990, Science 249: 386-390 (1990); Cwirla, et al.,
Proc. Natl. Acad. Sci., 87:
6378-6382 (1990); Devlin et al., Science, 249: 404-406 (1990)], very large
libraries can be constructed
(106-108 chemical entities). A second approach uses primarily chemical
methods, of which the Geysen
method [Geysen et al., Molecular Immunology 23: 709-715 (1986); Geysen et al.
J. Immunologic Method
102: 259-274 (1987)] and the method of Fodor et al. [Science 251: 767-773
(1991)] are examples. Furka
et al. [/ 4th International Congress of Biochemist7y, Volume 5, Abstract
FR:013 (1988); Furka, Intl.
Peptide Protein Res. 37:487-493 (1991)], Houghton [U.S. Patent No. 4,631,211,
issued December 1986]
and Rutter et al. [U.S. Patent No. 5,010,175, issued April 23, 1991] describe
methods to produce a
mixture of peptides that can be tested as agonists or antagonists.
In another aspect, synthetic libraries [Needels et al., Proc. Natl. Acad. Sci.
USA 90: 10700-4
(1993); Ohlmeyer et al., Proc. Natl. Acad. Sci. USA 90: 10922-10926 (1993);
Lam et al., International
Patent Publication No. WO 92/00252; Kocis et al., International Patent
Publication No. WO 9428028].
and the like can be used to screen for
candidate ligands according to the present invention.
The screening can be performed with recombinant cells that express a nuclear
receptor ligand
64
- -
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
binding domain according to the invention, or alternatively, using purified
protein, e.g., produced
recombinantly, as described above. For example, labeled, soluble nuclear
receptor ligand binding
domains can be used to screen libraries, as described in the foregoing
references.
In one embodiment, a Group H nuclear receptor ligand binding domain according
to the
invention may be directly labeled. In another embodiment, a labeled secondary
reagent may be used to
detect binding of a nuclear receptor ligand binding domain of the invention to
a molecule of interest, e.g.,
a molecule attached to a solid phase support. Binding may be detected by in
situ formation of a
chromophore by an enzyme label. Suitable enzymes include, but are not limited
to, alkaline phosphatase
and horseradish peroxidase. In a further embodiment, a two-color assay, using
two chromogenic
substrates with two enzyme labels on different acceptor molecules of interest,
may be used. Cross-
reactive and singly-reactive ligands may be identified with a two-color assay.
Other labels for use in the invention include colored latex beads, magnetic
beads, fluorescent
labels (e.g., fluorescene isothiocyanate (FITC), phycoerythrin (PE), Texas red
(TR), rhodamine, free or
chelated lanthanide series salts, especially Eu3+, to name a few
fluorophores), chemiluminescent
molecules, radio-isotopes, or magnetic resonance imaging labels. Two-color
assays may be performed
with two or more colored latex beads, or fluorophores that emit at different
wavelengths. Labeled
molecules or cells may be detected visually or by mechanical/optical means.
Mechanical/optical means
include fluorescence activated sorting, i.e., analogous to FACS, and
micromanipulator removal means.
The present invention may be better understood by reference to the following
non-limiting
Examples, which are provided as exemplary of the invention.
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
EXAMPLES
Applicants have developed a CfEcR homology model and have used this homology
model
together with a published Chironomous tetans ecdysone receptor ("CtEcR")
homology model (Wurtz et
al., 2000) to identify critical residues involved in binding to steroids and
non-steroids. The synthetic
non-steroids, diacylhydrazines, have been shown to bind lepidopteran EcRs with
high affinity and induce
precocious incomplete molt in these insects (Wing et al., 1988) and several of
these compounds are
currently marketed as insecticides. The ligand binding cavity of EcRs has
evolved to fit the long back
bone structures of ecdysteroids such as 20E. The diacylhydrazines have a
compact structure compared to
steroids and occupy only the bottom part of the EcR binding pocket. This
leaves a few critical residues
at the top part of the binding pocket that make contact with steroids but not
with non-steroids such as
diacylhydrazines. Applicants made substitution mutations of the residues that
make contact with steroids
and/or non-steroids and determined the mutational effect on ligand binding.
Applicants describe herein
substitution mutations at several of these residues and have identified
several classes of substitution
mutant receptors based upon their binding and transactivation characteristics.
Applicants' novel
substitution mutated nuclear receptor polynucleotides and polypeptides are
useful in a nuclear receptor-
based inducible gene modulation system for various applications including gene
therapy, expression of
proteins of interest in host cells, production of transgenic organisms, and
cell-based assays.
GENERAL METHODS
Standard recombinant DNA and molecular cloning techniques used herein are well
known in the
art and are described by Sambrook, J., Fritsch, E. F. and Maniatis, T.
Molecular Cloning: A Laboratory
Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y. (1989)
(Maniatis) and by T. J.
Silhavy, M. L. Bennan, and L. W. Enquist, Experiments with Gene Fusions, Cold
Spring Harbor
Laboratory, Cold Spring Harbor, N.Y. (1984) and by Ausubel, F. M. et al.,
Current Protocols in
Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).
Materials and methods suitable for the maintenance and growth of bacterial
cultures are well
known in the art. Techniques suitable for use in the following examples may be
found as set out in
Manual of Methods for General Bacteriology (Phillipp Gerhardt, R. G. E.
Murray, Ralph N. Costilow,
Eugene W. Nester, Willis A. Wood, Noel R. Krieg and G. Briggs Phillips, eds),
American Society for
3 0 Microbiology, Washington, DC. (1994)) or by Thomas D. Brock in
Biotechnology: A Textbook of
Industrial Microbiology, Second Edition, Sinauer Associates, Inc., Sunderland,
MA (1989). All
reagents, restriction enzymes and materials used for the growth and
maintenance of host cells were
obtained from Aldrich Chemicals (Milwaukee, WI), DIFC0 Laboratories (Detroit,
MI), GIBCO/BRL
(Gaithersburg, MD), or Sigma Chemical Company (St. Louis, MO) unless otherwise
specified.
Manipulations of genetic sequences may be accomplished using the suite of
programs available
from the Genetics Computer Group Inc. (Wisconsin Package Version 9.0, Genetics
Computer Group
(GCG), Madison, WI). Where the GCG program "Pileup" is used the gap creation
default value of 12,
66
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
and the gap extension default value of 4 may be used. Where the CGC "Gap" or
"Bestfit" program is
used the default gap creation penalty of 50 and the default gap extension
penalty of 3 may be used. In
any case where GCG program parameters are not prompted for, in these or any
other GCG program,
default values may be used.
The meaning of abbreviations is as follows: "h" means hour(s), "min" means
minute(s), "sec"
means second(s), "d" means day(s), " l" means microliter(s), "ml" means
milliliter(s), "L" means
liter(s), "p.M" means micromolar, "mM" means millimolar, "pg" means
microgram(s), "mg" means
milligram(s), "A" means adenine or adenosine, "T" means thymine or thymidine,
"G" means guanine or
guanosine, "C" means cytidine or cytosine, "xg" means times gravity, "nt"
means nucleotide(s), "aa"
means amino acid(s), "bp" means base pair(s), "kb" means kilobase(s), "k"
means kilo, "p." means micro,
and "C" means degrees Celsius.
EXAMPLE 1
This Example describes the construction of several gene expression cassettes
comprising novel
substitution mutated Group H nuclear receptor polynucleotides and polypeptides
of the invention for use
in a nuclear receptor-based inducible gene expression system. Applicants
constructed several gene
expression cassettes based on the spruce budworm Choristoneura fumiferana EcR
("CfEcR"), fruit fly
Drosophila melanogaster EcR ("DmEcR"), ixodid tick Amblyomma americanum EcR
("AmaEcR"),
locust Locusta migratoria ultraspiracle protein ("LmUSP"), an invertebrate RXR
homolog of vertebrate
RXR, and C. fumiferana USP ("CfUSP"). The prepared receptor constructs
comprise a ligand binding
domain of either an EcR, an invertebrate TJSP, or an invertebrate RXR; and a
GAL4 DNA binding
domain (DBD) or a VP16 transactivation domain (AD). The reporter constructs
include a reporter gene,
luciferase or LacZ (13-galactosidase), operably linked to a synthetic promoter
construct that comprises a
GAL4 response element to which the Ga14 DBD binds. Various combinations of
these receptor and
reporter constructs were cotransfected into mammalian cells as described in
Examples 2-10 infra.
Gene Expression Cassettes: Ecdysone receptor-based gene expression cassettes
(switches) were
constructed as followed, using standard cloning methods available in the art.
The following is a brief
description of preparation and composition of each switch used in the Examples
described herein.
1.1 - GAL4CfEcR-DEF/VP16LmUSP-EF: The wild-type D, E, and F domains from
spruce budworrn
Choristoneura fumiferana EcR ("CfEcR-DEF"; SEQ ID NO: 21) were fused to a GAL4
DNA binding
domain ("Gal4DNABD" or "Gal4DBD"; SEQ ID NO: 6) and placed under the control
of an SV40e
promoter (SEQ ID NO: 22). The E and F domains from locust Locusta migratoria
ultraspiracle protein
("LmUSP-EF"; SEQ ID NO: 23) were fused to the transactivation domain from VP16
("VP16AD"; SEQ
ID NO: 12) and placed under the control of an SV40e promoter (SEQ ID NO: 22).
Five consensus
GAL4 response element binding sites ("5XGAL4RE"; comprising 5 copies of a
GAL4RE comprising
67
=
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
SEQ ID NO: 19) were fused to a synthetic Elb minimal promoter (SEQ ID NO: 24)
and placed upstream
of the luciferase gene (SEQ ID NO: 25).
1.2 - GAL4/mutantCfEcR-DEF/VP16LmUSP-EF: This construct was prepared in the
same way as in
switch 1.1 above except wild-type CfEcR-DEF was replaced with mutant CfEcR-DEF
comprising a
ligand binding domain comprising a substitution mutation selected from Table 1
below.
Table I. Substitution Mutants of Choristoneura fumiferana Ecdysone Receptor
("CfEcR") Ligand
Binding Domain (LBD).
CfEcR-DEF Resulting "WT to Mutant" Amino Corresponding
amino
LBD Mutation Acid Substitution acid in full length CfEcR
(SEQ ID NO: 26)
E20A Glutamic Acid (E) to Alanine (A) 303
Q21A Glutamine (Q) to Alai-line (A) 304
F48A Phenylalanine (F) to Alanine (A) 331
I51A Isoleucine (I) to Alanine (A) 334
T52A Threonine (T) to Alanine (A) 335
T52L Threonine (T) to Leucine (L) 335
T52V Threonine (T) to Valine (V) 335
T52I Threonine (T) to Isoleucine (I) 335
T55A Threonine (T) to Alanine (A) 338
T58A Threonine (T) to Alanine (A) 341
V59A Valine (V) to Alanine (A) 342
L61A Leucine (1_,) to Alanine (A) 344
I62A Isoleucine (I) to Alanine (A) 345
M92A Methionine (M) to Alanine (A) 375
M93A Methionine (M) to Alanine (A) 376
R95A Arginine (R) to Alanine (A) 378
V96A Valine (V) to Alanine (Al 379
V96T Valine (V) to Threonine (T) 379
V96D Valine (V) to Aspartic Acid (D) 379
V96M Valine (V) to Methionine (M) 379
V1071 Valine (V) to Isoleucine 390
F109A Phenylalanine (F) to Alanine (A) _ 392
AllOP Alanine (A) to Proline (P) 393
AllOS Alanine (A) to Serine (S) 393
Al 10L Alanine (A) to Leucine (L) 393
Al 10M Alanine (A) to Methionine (M) 393
Y120A Tyrosine (Y) to Alanine (A) 403
A123F Alanine (A) to Phenylalanine (F) 406
M125A Methionine (M) to Alanine 408
R175E Arginine (R) to Glutamine (E) 458
M218A Methionine (M) to Alanine 501
C219A Cysteine (C) to Alanine (A) 502
L223A Leucine (L) to Alanine (A) 506
L230A Leucine (L) to Alanine (A) 513
L234A Leucine (L) to Alanine (A) 517
W238A Trypto_phan (W) to Alanine (A) 521
R95A and Arginine (R) to Alanine (A) and 378 and 393, respectively
Al 10P double Alanine (A) to Proline (P),
68
CA 02855992 2014-07-08
WO 02/066612 PCTTUS02/05090
=
mutant respectively
V107I and Valine (V) to Isoleucine (I) and 390 and 458, respectively
R175E double Arginine (R) to Glutamine (E),
mutant respectively
V107E and Valine (V) to Isoleucine (I) and 390 and 410, respectively
Y127E double Tyrosine (Y) to Glutamine (E),
mutant respectively
Y127E and Tyrosine (Y) to Glutamine (E) and 410 and 458, respectively
R175E double Arginine (R) to Glutamine (E),
mutant respectively
M218A and Methionine (M) to Alanine (A) and 501 and 502, respectively
C219A double Cysteine (C) to Alanine (A),
mutant respectively
T52V, V107I Threonine (T) to Valine (V), 335,
390 and 458,
and R175E triple Valine (V) to Isoleucine (I) and respectively
mutant Arginine (R) to Glutamine (E),
respectively
T52A, V1071 Threonine (T) to Alanine (A),
335, 390 and 458,
and RI 75E triple Valine (V) to Isoleucine (I) and respectively
mutant Arginine (R) to Glutamine (E),
respectively
V96A, VI 071 Valine (V) to Alanine (A), 379,
390 and 458,
and RI 75E triple Valine (V) to Isoleucine (I) and respectively
mutant Arginine (R) to Glutamine (E),
respectively
V96T, V1071 Valine (V) to Threonine (T), 379,
390 and 458,
and R175E triple Valine (V) to Isoleucine (I) and respectively
mutant Arginine (R) to Glutamine (E),
respectively
V1071, Y127E Valine (V) to Isoleucine (1),
390, 410 and 458,
and R175E triple Tyrosine (Y) to Glutamine (E) and respectively
mutant Arginine (R) to Glutamine (E),
respectively
V1071, AllOP Valine (V) to Isoleucine (I),
390, 393, and 458,
and R175E triple Alanine (A) to Proline (P) and respectively
mutant Arginine (R) to Glutamine (E),
respectively
1.3 - GAL4CfEcR-A/BCDEF/VP16LmUSP-EF: The full-length spruce budwonn
Choristoneura
fumiferana EcR ("CfEcR-A/BCDEF"; SEQ ID NO: 27) was fused to a GAL4 DNA
binding domain
("Gal4DNABD" or "Gal4DBD"; SEQ ID NO: 6) and placed under the control of an
SV40e promoter
(SEQ ID NO: 22). The E and F domains from Locusta migratoria ultraspiracle
("LmUSP-EF"; SEQ ID
NO: 23) were fused to the transactivation domain from VP16 ("VP16AD"; SEQ ID
NO: 12) and placed
under the control of an SV40e promoter (SEQ ID NO: 22). Five consensus GAL4
response element
binding sites ("5XGAL4RE"; comprising 5 copies of a GAL4RE comprising SEQ ID
NO: 19) were
fused to a synthetic Elb minimal promoter (SEQ ID NO: 24) and placed upstream
of the luciferase gene
(SEQ ID NO: 25).
1.4- GAL4/A110PmutantCfEcR-A/BCDEFNPI6LmUSP-EF: This construct was prepared in
the same
way as in switch 1.3 above except wild-type CfEcR-A/BCDEF was replaced with a
mutant CfEcR-
69
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
A/BCDEF comprising a ligand binding domain comprising an Al 10P substitution
mutation as described
in Table 1 above.
1.5 - VP16/CfEcR-CDEF: This construct was prepared in the same way as switch
1.1 except the GAL4
DNA binding domain was replaced with the transactivation domain from VP16
("VP16AD"; SEQ ID
NO: 12) and placed under the control of a baculovirus El promoter (SEQ ID NO:
28). Six consensus
ec.dysone response element binding sites ("6XEcRE"; comprising 6 copies of an
ecdysone RE
comprising SEQ ID NO: 18) were fused to a synthetic El b minimal promoter (SEQ
ID NO: 24) and
placed upstream of the P-galactosidase gene (SEQ ID NO: 29). This construct
uses endogenous
ultraspiracle protein as a heterodimerization partner.
1.6 - VP16/A110PmutantCfEcR-CDEF: This construct was prepared in the same way
as in switch 1.5
above except wild-type CfEcR-CDEF was replaced with a mutant CfEcR-CDEF
comprising a ligand
binding domain comprising an Al 10P substitution mutation as described in
Table 1 above.
1.7 - Bacterially expressed CfUSP-A/BCDEF: This construct was prepared with
the A/BCDEF domains
from spruce budworrn C. fumiferarza USP ("CfUSP-A/BCDEF"; SEQ ID NO: 30).
1.8 - GAL4/DrnEcR-CDEF/VP16LmUSP-EF: The wild-type C, D, E, and F domains from
fruit fly
Drosophila melanogaster EcR ("DmEcR-CDEF"; SEQ ID NO: 31) were fused to a GAL4
DNA binding
domain ("Gal4DNABD" or "Gal4DBD"; SEQ ID NO: 6) and placed under the control
of an SV40e
promoter (SEQ ID NO: 22). The E and F domains from locust Locusta migratoria
ultraspiracle protein
("LmUSP-EF"; SEQ ID NO: 23) were fused to the transactivation domain from VP16
("VP16AD"; SEQ
ID NO: 12) and placed under the control of an SV40e promoter (SEQ ID NO: 22).
Five consensus
GAL4 response element binding sites ("5XGAL4RE"; comprising 5 copies of a
GAL4RE comprising
SEQ ID NO: 19) were fused to a synthetic Elb minimal promoter (SEQ ID NO: 24)
and placed upstream
of the luciferase gene (SEQ ID NO: 25).
1.9 - GAL4/mutantDmEcR-CDEF/VPI6LmUSP-EF: This construct was prepared in the
same way as in
switch 1.8 above except wild-type DmEcR-CDEF was replaced with mutant DmEcR-
CDEF comprising a
ligand binding domain comprising a substitution mutation selected from Table 2
below.
Table 2. Substitution Mutants of Drosophila melanogaster Ecdysone Receptor
("DmEcR") Ligand
Binding Domain (LBD).
DmEcR-CDEF Resulting "WT to Mutant" Amino Corresponding amino
LBD Mutation Acid Substitution acid in full length DmEcR
(SEQ ID NO: 32)
A107P Alanine (A) to Proline (P) 522
G121R Glycine (G) to Arginine (R) . 536
0121L Glycine (G) to Leucine (L) 536
N213A Asparagine (N) to Alanine (A) 628
C217A Cysteine (C) to Alanine (A) 632
C217S Cysteine (C) to Serine (S) 632
1.10 - VP16/DmEcR-CDEF: This construct was prepared in the same way as switch
1.8 except the
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
GAL4 DNA binding domain was replaced with the transactivation domain from VP16
("VP16AD"; SEQ
ID NO: 12) and placed under the control of a baculovirus El promoter (SEQ ID
NO: 28). Six consensus
ecdysone response element binding sites ("6XEcRE"; comprising 6 copies of an
ecdysone RE
comprising SEQ ID NO: 18) were fused to a synthetic Elb minimal promoter (SEQ
ID NO: 24) and
placed upstream of the 13-galactosidase gene (SEQ ID NO: 29). This construct
uses endogenous
ultraspiracle protein as a heterodimerization partner.
1.11 - VP I6/mutantDmEcR-CDEF: This construct was prepared in the same way as
in switch 1.10
above except wild-type DmEcR-CDEF was replaced with a mutant DmEcR-CDEF
comprising a ligand
binding domain comprising a substitution mutation selected from Table 2 above.
1.12 - GAL4/AmaEcR-DEF/VP16LmUSP-EF: The wild-type D, E, and F domains from
ixodid tick Amblyomma americanum EcR ("AmaEcR-DEF"; SEQ ID NO: 33) were fused
to a GAL4
DNA binding domain ("Gal4DNABD" or "Gal4DBD"; SEQ ID NO: 6) and placed under
the control of
an SV40e promoter (SEQ ID NO: 22). The E and F domains from locust Locusta
migratoria
ultraspiracle protein ("LmUSP-EF"; SEQ ID NO: 23) were fused to the
transactivation domain from
VP16 ("VP16AD"; SEQ ID NO: 12) and placed under the control of an SV40e
promoter (SEQ ID NO:
22). Five consensus GAL4 response element binding sites ("5XGAL4RE";
comprising 5 copies of a
GAL4RE comprising SEQ ID NO: 19) were fused to a synthetic Elb minimal
promoter (SEQ ID NO:
24) and placed upstream of the luciferase gene (SEQ ID NO: 25).
1.13 - GAL4/mutantAmaEcR-DEFNP16LmUSP-EF: This construct was prepared in the
same way as in
switch 1.12 above except wild-type AmaEcR-DEF was replaced with mutant AmaEcR-
DEF comprising a
ligand binding domain comprising a substitution mutation selected from Table 3
below.
Table 3. Substitution Mutants of Aniblyomma americanum Ecdysone Receptor
("AmaEcR") Ligand
Binding Domain (LBD).
AmaEcR-DEF Resulting "WT to Mutant" Amino Corresponding amino acid
LBD Mutation Acid Substitution in full length AmaEcR
(SEQ ID NO: 34)
G91A Glycine (G) to Alanine (A) 417
A105P Alanine (A) to Proline (P) 431
Construction of Ecdysone Receptor Ligand Binding Domains Comprising a
Substitution Mutation:
In an effort to modify EcR ligand binding, residues within the EcR ligand
binding domains that
were predicted to be important for ligand binding based upon a molecular
modeling analysis were
mutated in EcRs from three different classes of organisms. Tables 1-3 indicate
the amino acid residues
within the ligand binding domain of CfEcR (Lepidopteran EcR), DmEcR (Dipteran
EcR) and AmaEcR
(Arthopod EcR), respectively that were mutated and examined for modification
of steroid and non-
steroid binding.
Each one of the amino acid substitution mutations listed in Tables 1-3 was
constructed in an EcR
cDNA by PCR mediated site-directed mutagenesis to alanine (or to proline or
phenylalanine in the case
71
CA 02855992 2014-07-08
WO 02/066612 PCTrUS02/05090
of a wild-type alanine residue, e.g. CfEcR residues A110 and A123,
respectively). Amino acids T52,
V96 and A110 of CfEcR were mutated to four different amino acids. Five
different double point mutant
CfEcRs were also made: one comprising both the R95A and Al 10P substitutions
(R95A + AllOP,
a second comprising both the M218A and C219A substitutions (M218A + C219A), a
third
comprising both the V1071 and R175E substitutions (V107I + R175E), a fourth
comprising Y127E and
R175E substitutions (Y127E + R175E), and a fifth comprising V1071 and Y127E
substitutions (V107I +
Y127E). Six different triple point mutant CfEcRs were also made: one
comprising both the V1071 and
R175E substitutions and a Y127E substitution (V107I+ Y127E + R175E), .a second
comprising a T52V
substitution and the V107I and R175E substitutions (T52V + V1071+ R175E), a
third comprising the
V96A, V1071, and R175E substitutions (V96A + V107I+ R175E), a fourth
comprising the T52A, V107I
and R175E substitutions (T52A + V1071+ R175E), a fifth comprising a V96T
substitution and the
V1071 and R175E substitutions (V96T + V1071+ R1755), and a sixth comprising
the Al 10P, V1071,
and R175E substitutions.
PCR site-directed mutagenesis was performed using the Quikchange site-directed
mutagenesis
kit (Stratagene, La Jolla, CA) using the reaction conditions and cycling
parameters as follows. PCR site-
directed mutagenesis was performed using lx reaction buffer (supplied by
manufacturer), 50 ng of
dsDNA template, 125ng of forward primer (FP), 125ng of reverse complementary
primer (RCP), and 1
pi of dNTP mix (supplied by manufacturer) in a fuial reaction volume of 50 L.
The forward primer and
reverse complementary primer used to produce each EcR mutant are presented in
Tables 4-6. The
cycling parameters used consisted of one cycle of denaturing at 95 C for 30
seconds, followed by 16
cycles of denaturating at 95 C for 30 seconds, annealing at 55 C for 1 minute,
and extending at 68 C for
22 minutes.
Table 4: PCR Primers for Substitution Mutant CfEcR Liaand Binding Domain
Construction
MUTANT PRIMER PRIMER NUCLEOTIDE SEQUENCE (5' 10 3')
(SEQ ID NO:)
E20A FP gtaccaggacgggtacgcgcagccuctgatgaagatttg
(SEQ ID NO: 35)
E20A RCP caaatcttcatcagaaggctgcgcgtacccgtcctggtac
(SEQ ID NO: 36)
Q2 IA FP ccaggacgggtacgaggcgccttctgatgaagatttg
(SEQ ID NO: 37)
Q21A RCP caaatcttcatcagaaggcgcctcgtacccgtcctgg
(SEQ 1D NO: 38)
F48A FP gagtctgacactcccgcccgccagatcacag
(SEQ ID NO: 39)
=
F48A RCP ctgtgatctggcgggcgggagtgtcagactc
(SEQ ID NO: 40)
=
I51A FP cactcccttccgccaggccacagagatgac
(_SEQ ID NO: 41)
151A RCP gtcatctctgtggcctggcggaagggagtg
(SEQ ID NO: 42)
T52A FP cactcccttccgccagatcgcagagatgac
72
EL
21.2r2000121.1200ssou002E001E0 d011 VOZ IA
(69 :ON GI bas)
21E0221o2SEEo20002ogEou..532orgo di V0 IA
(89 :ON GI OHS)
21olfflo-eaeazoruMouSu2S1p2o dad dOIIV
(L9 :ON GI OHS)
2o2rroossoze20004.2pu.21.2EouSgo di dOI1V
(99 :ON GI OHS)
alol2puotrarooS23201121422103 dDZI V60 Ii
(59 :ON al bas)
2oEuEoogEnt2o2o022101121.2-eoaeol di V601.4
(79 :QN GI Ogs)
2131.81ouorr2eoonoBon.811f2po2D = V80I.3
(E9 :ON GI OHS)
fo8,,,,,..gEso200s210112is.a.. di V80 Ti
(Z9 :ON GI bas)
oropameolto2E2o2louSofoSolSom23 d311 VS6?I
(19 :ON OHS)
23Ew23r2o5o2o12E32opOlapar122u.212 di VS621
(09 :ON GE OHS)
oumoyeoSE22o13.32oS3501231E12 dad V96A
(6S :ON GI b3s)
maap232o2o&apolo2lawel2 di V96A
(8 :ON GI OHS)
32E2paeoloommo2o2E22olor2o5 d011 VE6TAI
(LS :ON al OHs)
osolaesD910202aTmival2too di VE6IAI
(95 :ON GI bas)
oae2lpeopoulo2oluD2ES2opp2o0 cox WON
(SS :omcii Ogs)
33o1Se2ooplE2o2E1f2tEISE-EoloB di VZ6IAI
(PS :ON cn bas)
5elu22E21.2oor.22EgonoEoolort2o2o VZ9I
(ES :ON ca OHS)
3Eoll.2u22.12oofflIonool.22oEoloolelo di VZ9I
(Zg :ON GI OHS)
aelE22-e2123or221132-eyeZouoopEu2o2o dolt VI 91
(I S :ON al bas)
&SollEr221,2312parool.,Uaeoloomo di VI 91
WC ca Ogg)
31tolfElunalgo322112Erve2otoo d021 V6SA
(6t :ON GI OHS)
2212?lupotwoonouoloolmalt2di V6SA
(8t :ON GI OHS)
ol3Teol2E2E5E2o2Doa21.1Bnlia2oto d311 V8 SI
(Lt :ON GI bas)
2;2olEuounoi2E32oloomoiE2E2di V8SI
(9t :ON GI bas)
23221o1P212iorlpoo2m22E2)2oae.22 dad VSSI,
(St :ON CII bas)
331.22oEoloomo21E2e2to-eoTatoo.ao di VSSI
(tt :ON GI OHS)
212a22-ar..22321D1E2321oioml.2 dD11 VZSI
(Et :ON cn Oas)
060C0/Z0SII/IDd Z19990/Z0
80-LO-VTOZ Z66SS8Z0 VD
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
(SEQ ID NO: 70) _
A123F FP cgacaactaccgcaagtttggcatggcctacgtc
(SEQ ID NO: 71)
A123F RCP gacgtaggccatgccaaa cttgcggtagttgtcg
(SEQ ID NO: 72)
M125A FP ctaccgcaaggctggcgcggcctacgtcatc
(SEQ ID NO: 73)
M 125A RCP gatgacgtaggccgcgccagccttgcggtag
(SEQ ID NO: 74)
L230A FP gctcaagaacagaaaggcgccgcctttcctcg
(SEQ ID NO: 75)
L230A RCP cgaggaaaggcggcgcctttctgttcttgagc
(SEQ ID NO: 76)
L223A FP ctccaacatgtgcatctccgccaagctcaagaacag
(SEQ ID NO: 77)
L223A RCP ctgacttg,agcttggcggagatgcacatgttggag
(SEQ ID NO: 78)
L234A FP gaaagctgccgcctttcgccgaggagatctg
(SEQ ID NO: 79)
L234A RCP cagatctcctcggcgaaaggcggcagctttc
(SEQ ID NO: 80)
=
W238A = FP ctttcctcgaggagatcgcggatgtggcagg
(SEQ ID NO: 81)
=
W238A RCP cctgccacatccgcgatctcctcgaggaaag
(SEQ ID NO: 82)
Al 10n RANDOM FP cagacagt, gttctgttgncgaacaaccaagcg
(SEQ ID NO: 83)
Al 10n RANDOM RCP cgcttggttgttcgncaacagaacactgtctg
(SEQ ID NO: 84)
Al 10n RANDOM2 FP cagacagtgttctgttgrmgaacaaccaagcg
(SEQ ID NO: 85)
Al 10n RANDOM2 RCP cgcttggttgttcnncaacagaacactgtctg
(SEQ ID NO: 86)
T52n RANDOM FP cacteccttccgccagatcrumgagatgactatcctcacg
(SEQ ID NO: 87)
T52n RANDOM RCP cgtgaggatagtcatctcnnngatctggcggaagggagt
(SEQ ID NO: 88)
V96n RANDOM FP gtaatgatgctccgarumgcgcgacgatacgatgeggc
(SEQ ID NO: 89)
V96n RANDOM RCP gccgcatcgtatcgtcgcgcnnntcggagcatcattac
(SEQ ID NO: 90)
V107I FP gcggcctcagacagtattctgttcgcgaac
(SEQ ID NO:
107)
R175E FP
(SEQ ID NO: ggtggaagaaatccaggagtactacctgaatacgctcc
108)
Y127E FP
(SEQ ID NO:
109) caaggctggcatggccgaggtcatcgagg
T52V FP
(SEQ ID NO:
110)
cccttccgccagatcgtagagatgactatcctcac
74
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
V96T FP
(SEQ ID NO:
111)
ggtaatgatgctccgaaccgcgcgacgatacg
Table 5: PCR Primers for Substitution Mutant DrnEcR Li gand Binding Domain
Construction
MUTANT PRIMER PRIMER NUCLEOTIDE SEQUENCE (5' TO 3')
(SEQ ID NO: ) _
A107P FP tcggactcaatattcttcccgaataatagatcatatac
(SEQ ID NO: 91)
A107P RCP gtatatgatctattattcgggaagaatattgagtccga
(SEQ ID NO: 92)
G121R FP tcttacaaaatggcccgaatggctgataacattg
(SEQ ID NO: 93)
0121R RCP caatgttatcagccattcgggccattttgtaaga
(SEQ ID NO: 94)
0121L FP tatacaaaatggccctaatggctgataacang
(SEQ ID NO: 95) _ =
G121L RCP caatgttatcagccattagggccanttgtaaga
(SEQ ID NO: 96)
N213A FP acgctgggcaaccaggccgccgagatgtgtttc
(SEQ ID NO: 97)
N213A RCP gaaacacatctcggcggcctggttgcccagcgt
(SEQ DD NO: 98)
C217A FP cagaacgccgagatggctttctcactaaagctc
(SEQ ID NO: 99) ,
C217A RCP gagctttagtgagaaagccatctcggcgttctg
(SEQ ID NO: 100) ,
C217S FP cagaacgccgagatgtattctcactaaagctc
(SEQ ID NO: 101)
C217S RCP gagctttagtgagaaagacatctcggcgttctg
(SEQ_1D NO: 102)
Table 6: PCR Primers for Substitution Mutant AmaEcR Ligand Binding Domain
Construction
MUTANT PRIMER PRIMER NUCLEOTIDE SEQUENCE (5' 10 3')
(SEQ ID NO: )
G91 A FP gtgatgatgctgagagctgcccggaa.atatgatg
(SEQ ID NO: 103)
G9 lA RCP catcatatttccgggcagctctcagcatcatcac
(SEQ ID NO: 104)
Al 05P FP acagattctatagtgtttcccaataaccagccgtacac
(SEQ DD NO: 105) ,
Al 05? RCP gtgtacggctggttattgggaaacactatagaatctgt
(SEQ_ID NO: 106)
The resulting PCR nucleic acid products encoding the mutant EcR ligand binding
domains were
then each fused to a GAL4 DNA binding domain as described in Examples 1.2,
1.4, 1.9 and 1.13 above.
The GAL4/mutant EcR receptor constructs were tested for activity by
transfecting them into NIH3T3
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
cells along with VP16/LmUSP-EF and pFRLuc in the presence of steroid or non-
steroid ligand.
The resulting nucleic acids encoding the mutant EcR ligand binding domains
were also each
fused to a VP16 transactivation domain as described in Examples 1.6 and 1.11
above. The VP16/mutant
CfEcR-DEF and VP16/mutant DmEcR-CDEF receptor constructs were tested for
activity by transfecting
them into L57 insect cells along with a 6XEcRE/l3-galactosidase reporter gene
in the presence of 20-
hydroxyecdysone (20E).
Ligands: The steroidal ligands muristeroneA, ponasterone A, ct-ecdysone, and
20-hydroxyecdysone
were purchased from Sigma Chemical Company and Invitrogen. The non-steroidal
ligands: N-(2-ethy1-
3-methoxybenzoy1)-N'-(3,5-dimethylbenzoy1)-N'-tert-butylhydrazine (GSTME non-
steroidal ligand); N'-
= 10 tert-butyl-N'-(3,5-dimethylbenzoy1)-3-methoxy-2-methylbenz,ohyclrazide
(RH-2485); N-tert-butyl-N'-(4-
ethylbenzoy1)-3,5-dimethylbenzohydrazide (R11-5992), and N'-tert-butyl-N'-(3,5-
dimethylbenzoy1)-3,4-
(1,2-ethylenedioxy)-2-methylbenzohydrazide (RH-125020) are synthetic stable
ecdysteroid ligands
synthesized at Rohm and Haas Company. All ligands were dissolved in DMSO and
the final
concentration of DMSO was maintained at 0.1% in both controls and treatments.
3H-PonA and 3H-a-
ecdysone were purchased from New England Nuclear. 3H-RH2485 was synthesized at
Robin and Haas
Company.
Transfections: DNAs corresponding to the various switch constructs outlined in
Example 1,
specifically switches 1.1-1.13, were transfected into mouse NIH3T3 cells
(ATCC) or L57 cells (Dr. Peter
Cherbas; Indiana University) as follows. Standard methods for culture and
maintenance of the cells were
followed. Cells were harvested when they reached 50% confluency and plated in
6-, 12- or 24- well
plates at 125,000, 50,000, or 25,000 cells, respectively, in 2.5, 1.0, or 0.5
ml of growth medium
containing 10% fetal bovine serum (FBS), respectively. The next day, the cells
were rinsed with growth
medium and transfected for four hours. SuperfectTM (Qiagen Inc.) was used for
313 cells and
LipofectamineTM (LifeTechnologies) was used for L57 cells as the transfection
reagents. For 12- well
plates, 4 I of SuperfectTM or LipofectamineTM was mixed with 100 1.1.1 of
growth medium. One p,g of
reporter construct and 0.25 g of each receptor construct of the receptor pair
to be analyzed were added
to the transfection mix. A second reporter construct was added [pT1CRL
(Promega), 0.1 ug/transfection
mix] that comprises a Renilla luciferase gene operably linked and placed under
the control of a
thymidine kinase (TK) constitutive promoter and was used for normalization.
The contents of the
transfection mix were mixed in a vortex mixer and let stand at room
temperature for 30 minutes. At the
end of incubation, the transfection mix was added to the cells maintained in
400 I growth medium. The
cells were maintained at 37 C and 5% CO2 for four hours. At the end of
incubation, 500 1 of growth
medium containing 20% FBS and either dimethylsulfoxide (DMSO; control) or a
DMSO solution of
steroidal or non-steroidal ligand was added and the cells were maintained at
37 C and 5% CO2 for 48
hours. The cells were harvested and reporter activity was assayed. The same
procedure was followed
for 6 and 24 well plates as well except all the reagents were doubled for 6
well plates and reduced to half
for 24-well plates.
76
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
Reporter Assays: Cells were harvested 40 hours after adding ligands. 125 41 of
passive lysis buffer
(part of Duallucifera.seTM reporter assay system from Promega Corporation)
were added to each well of
the 24-well plate. The plates were placed on a rotary shaker for 15 minutes.
Twenty }.11 of lysate were
assayed. Luciferase activity was measured using DualluciferaseTM reporter
assay system from Promega
Corporation following the manufacturer's instructions. p-Galactosidase was
measured using Galacto-
StarTM assay kit from TROP1X following the manufacturer's instructions. All
luciferase and p-
galactosidase activities were normalized using Renilla luciferase as a
standard. Fold activities were
calculated by dividing normalized relative light units ("RLU") in ligand
treated cells with normalized
RLU in DMSO treated cells (untreated control).
EXAMPLE 2
This Example describes the identification of improved non-steroid responsive
CfEcR ligand
binding domain substitution mutants that exhibit increased activity in
response to non-steroidal ligand
and decreased activity in response to steroidal ligand. Briefly, Applicants
mutated amino acid residues
predicted to be critical for ecdysteroid binding into alanine and created
GAL4/mutantCfEcR-DEF cDNA
gene expression cassettes as described in Example 1 above using the Quikchange
PCR-mediated site-
directed mutagenesis kit (Stratagene, La Jolla, CA). The mutated and the WT
cDNAs were tested in
GAL4-driven luciferase reporter assays.
Transfections: DNAs corresponding to the various switch constructs outlined in
Example 1,
specifically switches 1.1-1.2, were transfected into mouse N11-13T3 cells
(ATCC) as follows. Cells were
harvested when they reached 50% confluency and plated in 24 well plates at
12,500 cells/well in 0.5 ml
of growth medium containing 10% fetal bovine serum (FBS). The next day, the
cells were rinsed with
growth medium and transfected for four hours. SuperfectTM (Qiagen Inc.) was
found to be the best
transfection reagent for 3T3 cells. Two pi of SuperfectTM was mixed with 100
pi of growth medium and
50 ng of either GAL4/wild-type EcR or 0a14/mutant EcR cassette, 50 ng of
VP16/LmUSP-EF and 200
ng of pFRLuc were added to the transfection mix. A second reporter construct
was added [pTKRL
(Promega), 0.05 i.ig/transfection mix] that comprises a Renilla luciferase
gene operably linked and placed
under the control of a thymidine lcinase (TK) constitutive promoter and was
used for normalization. The
contents of the transfection mix were mixed in a vortex mixer and let stand at
room temperature for 30
mm. At the end of incubation, the transfection mix was added to the cells
maintained in 200 pi growth
medium. The cells were maintained at 37 C and 5% CO, for four hours. At the
end of incubation, 250
41 of growth medium containing 20% FI3S and either dimethylsulfoxide (DMSO;
control) or a DMSO
solution of 10 nM or 2.5 1AM PonA steroidal ligand or GSTm-E [N-(2-ethy1-3-
methoxybenzoyDN'-(3,5-
3 5 dimethylbenzoy1)-N'-tert-butylhydrazine] non-steroidal ligand was added
and the cells were maintained
at 37 C and 5% CO, for 40 hours. The cells were harvested and reporter
activity was assayed as
described above. Fold activities were calculated by dividing normalized
relative light units ("RLU") in
77
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
ligand treated cells with normalized RLU in DMSO treated cells (untreated
control).
Two amino acid residues were identified that, when substituted, yield a mutant
ecdysone
receptor that exhibits increased activity in response to a non-steroid ligand
and decreased activity in
response to a steroid ligand. The effect of alanine substitution at amino acid
residue 52 or 55 of SEQ ID
NO: 1 on the activity of the mutated CfEcR-DEF receptor is presented in Table
7 as a fold increase over
Ga14/wild-type CfEcR-DEF (WT) switch activity.
Table 7. CfEcR-DEF Mutants that show increased non-steroid activity and
decreased steroid activity
Fold increase over WT
MUTANTS 2.5 GSTME 2.5 p.M PonA
T52A 1.5 0.5
T55A 1.7 0.13
EXAMPLE 3
This Example describes the identification of steroid responsive CfEcR ligand
binding domain
substitution mutants that exhibit increased activity in response to steroidal
ligand and significantly
decreased activity in response to non-steroidal ligand. In an effort to
identify substitution mutations in
the CfEcR that increase steroidal ligand activity, but decrease non-steroidal
ligand activity, Applicants
mutated amino acid residues predicted to be critical for ecdysteroid binding
and created
GAL4/mutantCfEcR-DEF cDNA gene expression cassettes as described in Example 1
above using PCR-
mediated site-directed mutagenesis kit. The mutated and the WT cDNAs
corresponding to the various
switch constructs outlined above in Examples 1.1 and 1.2 were made and tested
in GAL4-driven
luciferase reporter assays as described in Example 2 above. Fold activity was
calculated by dividing
RLUs in the presence of ligand with RLUs in the absence of the ligand.
Specific amino acid residues were identified that, when substituted, yield a
mutant ecdysone
receptor that exhibits increased activity in response to a steroid ligand and
decreased activity in response
to a non-steroid ligand. The effect of an amino acid substitution at amino
acid residue 52 or 96 of SEQ
ED NO: 1 and amino acid substitution at amino acid residues 96, 107 and 175 of
SEQ ID NO: 1 on the
activity of the mutated CfEcR-DEF receptor is presented in Table 8 as a fold
increase over Ga14/wild-
type CfEcR-DEF (WT) switch activity.
Table 8. Mutants that show increased steroid and decreased non-steroid
activity
Fold increase over WT
MUTANTS 2.5 pM 2.5 pM PonA 10 nM GSTME 10 nM PonA
GSTME
T52L 0.26 3.4
V96A 0.35 408
V96T 0.018 45
V96TN1071/R175E 0.4 485.7
78
CA 02855992 2014-07-08
WO 02/066612
PCT/1JS02/05090
EXAMPLE 4
This Example describes the identification of improved steroid and non-steroid
responsive CfEcR
ligand binding domain substitution mutants that exhibit increased activity in
response to both a steroidal
ligand and a non-steroidal ligand. In an effort to identify substitution
mutations in the CfEcR that
increase both steroidal and non-steroidal ligand activity, Applicants mutated
amino acid residues
predicted to be critical for steroid binding and created GAL4/mutantCfEcR-DEF
cDNA gene expression
cassettes as described in Example 1 above using PCR-mediated site-directed
mutagenesis. The mutated
and the WT cDNAs corresponding to the various switch constructs outlined above
in Examples 1.1 and
1.2 were made and tested in GAL4-driven luciferase reporter assays as
described in Example 2 above.
Fold activity was calculated by dividing RLUs in the presence of ligand with
RLUs in the absence of the
ligand.
Specific amino acid residues were identified that, when substituted, yield a
mutant ecdysone
receptor that exhibits increased activity in response to both non-steroid and
steroid ligands. The effect of
an amino acid substitution at amino acid residue 52, 96, 107 or 175 of SEQ NO:
1, amino acid
substitution at amino acid residues 107 and 175of SEQ ID NO: 1, amino acid
substitution at amino acid
residues 127 and 175 of SEQ ID NO: 1, amino acid substitution at amino acid
residues 107 and 127 of
SEQ ID NO: 1, amino acid substitution at amino acid residues 107, 127 and 175
of SEQ ID NO: 1, amino
acid substitution at amino acid residues 52, 107 and 175 of SEQ ID NO: 1 or
amino acid substitution at
amino acid residues 96, 107 and 175 of SEQ NO: 1 on the activity of the
mutated CfEcR-DEF
receptor is presented in Table 9 as a fold increase over Ga14/wild-type CfEcR-
DEF (WT) switch activity.
Table 9. Mutants that show increased steroid and non-steroid activity
Fold increase over WT
MUTANTS 2.5 p.M 2.5 jj.M PonA 10 nM GSTME 10 nM PonA
GSTME
T52V 17.3 35.7
T52I 8 8
V96D 3.07 3.1
= V96M 122 3.37
V1071 12.4 26.6
R175E 22.0 11.3
V1071/R175E 386.4 1194.4
__________ Y127E/R175E 622.8 42.2
V1071/Y127E 314.6 35.8
V1071/Y127E/R175E 124.3 122.3
T52VN1071/R175E 62.8 136.6
V96AN1071/R175E 21.1 , 1005.1
T52A/V1071/R175E 2.3 20.3
EXAMPLE 5
79
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
This Example describes the identification of non-steroid responsive CfEcR
ligand binding
domain substitution mutants that exhibit significantly decreased activity in
response to steroidal ligand
but do not affect activity in response to non-steroidal ligand. In an effort
to identify substitution
mutations in the CfEcR that decrease steroidal ligand activity, but do not
affect non-steroidal ligand
activity, Applicants mutated amino acid residues predicted to be critical for
ecdysteroid binding and
created GAL4/mutantCfEcR-DEF cDNA gene expression cassettes as described in
Example 1 above
using PCR-mediated site-directed mutagenesis. The mutated and the WT cDNAs
corresponding to the
various switch constructs outlined above in Examples 1.1 and 1.2 were made and
tested in GAL4-driven
luciferase reporter assays as described in Example 2 above. Fold activity was
calculated by dividing
RLUs in the presence of ligand with RLUs in the absence of the ligand.
Four amino acid residues were identified that, when substituted, yield mutant
ecdysone receptor
that exhibit decreased activity in response to a steroid ligand and minimal
effect on activity in response
to a non-steroid ligand. The effect of an amino acid substitution at amino
acid residue 20, 58, 92, or 110
of SEQ ID NO: 1 on the activity of the mutated CfEcR-DEF receptor is presented
in Table 10 as a fold
increase over Ga14/wild-type CfEcR-DEF (WT) switch activity.
Table 10. Mutants that show decreased steroid activity, but non-steroid
activity is unaffected
Fold increase over WT
MUTANTS 2.5 j..tM GSTME 2.5 p.M PonA
E20A 0.9 0.35
T58A 0.8 0.008
M92A 0.7 0.39
=
AllOP 0.8 0.005
As described in Table 10, Applicants have identified point mutations in the
ligand binding
domain of CfEcR that significantly reduce steroid binding activity. CfEcR
point mutants T58A and
A11013 essentially eliminated steroid binding activity. Interestingly, the non-
steroid activity of these
point mutants was not significantly affected.
EXAMPLE 6
Applicants have further characterized the non-steroid Al 10P CfEcR receptor
identified in
Example 5 above. This Example demonstrates that the mutation of a critical
alanine residue (A110)
leads to the disruption of steroid binding and hence transactivation by the
EcR in the presence of
steroids. However, the binding as well as transactivation by non-steroids is
not impaired.
Ligand Binding Assay
Applicants tested the Al 10P mutant CfEcR receptor in a steroid and non-
steroid ligand binding
assay to confirm that steroid binding was eliminated. Briefly, PonA binding
activity was determined
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
using an in vitro ligand binding assay (LBA). Steroid ligand binding assay
(LBA) was performed using
3H-PonA (200 Ci/mmol). In vitro translated Ga14/wild-type or AllOP mutant
CfEcR-DEF and bacterial
expressed GST-CfUSP-A/BCDEF were used in the assay. The assay was performed
with 8 pL of
Ga14/wild-type or Al 10P mutant CfEcR-DEF, 2.5 uL of GST-CfUSP-A/BCDEF, 1 pL
of 3H-PonA, and
2 1.iL of unlabeled ("cold") PonA as competitor in the presence of T buffer
[90 mM Tris pH 8.0, 10 p.M
D'TT comprising CompleteTM protease inhibitor cocktail used according to the
manufacturer's
instructions (Boehringer Mannheim)]. The reaction was carried out at room
temperature for 1 hour
followed by the addition of dextran-coated charcoal (Sigma). The mixture was
centrifuged at 7000xg for
minutes the amount of 3H-PonA in the supematant was measured. The reactions
were done in
10 triplicate. The full-length WT EcR or its A1101) mutant were also in vitro
translated and transcribed
using the TNT system (Promega) according to the manufacturer's instructions
and tested in in vitro
ligand binding assays using 3H-RH2485, with cold 20E or non-steroids (RH2485
and GSTm-E) as
competitors. In addition, 5 'IL of the in vitro translations were assayed for
translation efficiency using
SDS-PAGE following standard methods (Maniatis, 1989). The ligand binding
results for both the wild-
type and Al 10P mutant CfECR-DEF receptors were calculated and are shown in
Figure 1.
The two non-steroid ligands, RH2485 and GS'-E, and the steroid ligand 20E
tested were able to
effectively compete with bound 31-1-RH2485 suggesting that they are able to
bind the WT full-length EcR
efficiently (see Figure 1). However, when the binding of the same ligands by
the Al 10P mutant was
examined, binding of the steroid 20E was completely disrupted but the binding
of the non-steroids was
unaffected (see Figure 1). These results indicate that the lack of steroid
binding in the case of the
GAL4CfEcR fusion protein is not an artifact of the truncation or fusion and
demonstrates that the Al 10?
mutant CfEcR is a selective non-steroid receptor.
Ligand Affinities of mutant AllOP CfEcR to various steroid and non-steroid
ligands: The ligand
binding affinities of the Al 10P GAL4/CfEcR mutant were measured by binding3H-
RH2485 and
competing it with different concentrations of cold steroids or non-steroids.
Briefly, 3H-RH2485 was
bound to in vitro translated full-length CfEcR and bacterially expressed CfUSP
and competed with
increasing concentrations of cold steraidalor non-steroidal ligands. The
reaction was carried out at room
temperature for 1 hour followed by addition of activated dextran coated
charcoal and centrifugation at
7000xg for 10 minutes at 4 C. The residual 3H-RH2485 in the supematant after
centrifugation was
measured using a scintillation counter. The fraction bound (f bound) values
were determined and plotted
against the concentration of ligand (in mM). The 1050 values were determined
for each of the steroid
PonA and MurA and non-steroid N-(2-ethy1-3-methoxybenzoy1)-N'-(3,5-
dimethylbenzoy1)-N'-tert-
butylhydrazine (GSTME non-steroidal ligand); N'-tert-butyl-N'-(3,5-
dimethylbenzoy1)-3-methoxy-2-
methylbenzohydrazide (RH-2485); N-tert-butyl-N'-(4-ethylbenzoy1)-3,5-
dimethylbenzohydrazide (RH-
3 5 5992), and N'-tert-butyl-N'-(3,5-dimethylbenzoy1)-3,4-(1,2-ethylenedioxy)-
2-methylbenzohydrazide
(RH-125020) ligands for the WT and the mutant was determined by plotting the
fraction bound against
the concentration of each ligand.
81
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
As shown in Table 11, the 1050 values for steroids PonA and MurA were
increased (more than 1
mM) in the case of the Al 10P mutant compared to the observed nanomolar values
for the WT receptor,
suggesting that the binding of steroids was impaired in the Al 10P mutant
CfEcR. On the other hand,
non-steroid 1050 values were similar for both the Al 10P mutant and WT
receptors (see Table 11).
These results confirm Applicants' findings presented in Example 5 above that
the Al 10P substitution
mutation results in a non-steroid dedysone receptor ligand binding domain that
has lost the ability to bind
steroid ligand.
Table 11. 1050 values determined for wild-type and Al 10P mutant CfEcR-A/BCDEF
using several
steroidal and non-steroidal ligands.
Wild-type 1050 (nM) A110P mutant 1050 (nM) I
Steroids:
Ponasterone A 345.95 > 1mM
Muristerone A 423.99 > 1mM
Non-Steroids:
GSTm-E 85.26 12.88
RH-5992 132.81 32234
RH-2485 1.80 x 103 350.42
RH-125020 10.11 25.71
AllOP in Truncated CfEcR or Full Length CfEcR Background
To eliminate the possibility that the loss of steroid activity may be due to
the truncated CfEcR-
DEF receptor or an artifact of the GAL4 fusion protein, Applicants introduced
the Al 10P mutation into
the full length (FL) CfEcR (CfEcR-A/BCDEF), fused it to the GALA DNA binding
domain as described
in Example 1.4, and comparatively assayed it in N1H3T3 cells in 24-well plates
as described in Example
2 above with full length wild type CfEcR (Example 1.3) in combination with
VP16/LmUSP-EF and
pFREcRE Luc that comprised the luciferase reporter gene operatively linked to
six copies of the
ecdysone response element (6X EcRE) and a synthetic TATAA. The transfected
cells were grown in the
presence of 0.25 or 10 p1\4 PonA or GSTME and the reporter activity was
measured at 40 hours after
adding ligand. The cells were harvested and the extracts were assayed for
luciferase activity. The results
are presented in Figure 2. The numbers on top of the bars indicate fold
increase over DMSO levels.
As shown in Figure 2, the Al 10P mutation had a similar effect when introduced
into the full-
length ecdysone receptor in the context of an EcRE-driven reporter gene.
Specifically, PonA activity
was completely lost for the full length Al 10P CfEcR mutant. However, there
was no significant
difference in non-steroid activity between the full length WT CfEcR and the
full-length Al 10P mutant
CfEcR in the presence of GSTm-E. These results indicate that the non-
responsiveness of the Al 10P
mutant to steroids observed with the GAL4-fusion CfEcR in Example 5 was not an
artifact of the GAL4-
fusion or truncation of EcR. Thus, Applicants have determined that the A110
amino acid residue is
critical for steroidal activity in the full-length ecdysone receptor.
A110 residue is critical for steroidal activity in insect cells
82
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
In mammalian cells, the natural ligand of EcR, 20-hydroxyecdysone (20E) does
not induce
transactivation through a CfEcR-based gene expression system. To determine
whether the Al 10P
mutant can respond to 20E, Applicants tested this Al 10P mutant-based gene
expression system in an
EcRE-driven reporter assay in insect L57 cells (a Drosophila melanogaster cell
line that lacks EcR
isoform B, the Drosophila melanogaster EcR isoform homolog of CfEcR isofrom B
from which the
Al TOP mutant is derived, however L57 cells still contain EcR isoform A). The
mutation was introduced
into the VP16/CfEcR-CDEF fusion protein and operably linked to an baculovirus
fEl promoter and L57
cells were transfected with LE1VP16CfEcRCDEF (Example 1.5) or its Al 10P
mutant version DNA
(Example 1.6) along with a pMK43.2 p-galactosidase reporter gene under the
control of 6X ecdysone
response elements ("6XEcRE"; the pMK43.2 construct was obtained from Michael
Koelle at Stanford
University) in 24-well plates. Reporter activity for Al 10P mutant-based gene
expression system
transactivation was measured after 40 hours of treatment of the transfected
cells with 0, 1, 10, 100, or
1000 nM 20E or GSTm-E. The cells were harvested and the extracts were assayed
for p-galactosidase (3-.
gal) and luciferase activity. p-Galactosidase was measured using GalactoStarTM
assay kit from TROPIX
following the manufacturer's instructions. The numbers on top of the bars
indicate fold increase over
DMSO levels. The results are presented in Figure 3.
In insect cells, the wild-type CfEcR-based gene expression system induced f3-
gal activity in a
dose dependent manner in response to both 20E and GSTm-E, whereas the Al 10P
mutant-based gene
expression system transactivated reporter gene expression in the presence of
GSTm-E, however, the L57
cells transfected with the AllOP mutant showed slightly increased reporter
gene activity in the presence
of 20E (see Figure 3). This low level activity in the presence of 20E is most
likely due to endogenous
activity of the EcR isoform A within the L57 cells since Applicants have
demonstrated that the Al 10P
mutant derived from CfEcR isoform B does not 20E (data not shown).
The Al 10P mutation had a similar effect when introduced into the full-length
receptor in the
context of an EcRE-driven reporter gene in the L57 cells indicating that the
mutation has an analogous
effect in insect cells, presumably in the presence of insect transcriptional
co-factors (data not shown).
These data confirm Applicants' results from mammalian cells and establish that
the Al l OP mutation
results in a drastic effect on the steroidal responsiveness of CfEcR but does
not affect the non-steroid
responsiveness of CfEcR.
EXAMPLE 7
Applicants' results presented above in Examples 5 and 6 describe the
identification of an alanine
residue at position 110 that is a critical residue for steroid but not for non-
steroid activity of the CfEcR
ligand binding domain. To further characterize the role of residue A110 in
CfEcR steroid and non-
steroid transactivation of reporter genes, a mini library of CfEcR-DEF
receptors was prepared by
mutating A110 using degenerate primers. These degenerate PCR primers (Al 10P
random primer pairs
83
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
comprising either SEQ JD NO: 83 and SEQ ED NO: 84 or SEQ ID NO: 85 and SEQ ID
NO: 86; see
Table 4) were designed to replace A110 with various amino acid residues. The
PCR mutagenesis
conditions used were as described above in Example 1. The resulting clones
were sequenced to identify
the mutants.
Reporter Gene Transactivation of A110 Mutants
Four mutations: Al 10S, Al 10P, Al 10L, and Al 10M were obtained. These four
mutant and
wild-type receptors were assayed in NIH3T3 cells. GAL4 fusions of each of the
four mutants or wild-
type CfEcR-DEF receptor, VP16LMUSP-EF and pFRLUC were transfected into NIH3T3
cells, the cells
were grown in the presence of 0, 0.04, 0.2, 1, 5, or 25 uM PonA, MurA, N-(2-
ethyl-3-methoxybenzoyI)-
1 0 N'-(3,5-dimethylbenzoy1)-N'-tert-butylhydrazine (GSTm-E non-steroidal
ligand), or N'-tert-butyl-N'-(3,5-
dimethylbenzoy1)-3,441,2-ethylenedioxy)-2-methylbenzohydrazide (RH-125020) for
48 hours and the
= reporter activity was measured. As shown in Figure 4, the wild-type
ecdysone receptor showed reporter
activity in the presence of both steroids and non-steroids. However, all
mutant receptors showed reporter
activity only in the presence of non-steroid ligands but not in the presence
of steroid ligands. The Al 10?
mutant exhibited similar non-steroid activity compared to wild-type receptor,
however the Al 10S,
Al 10L and Al 10M mutants demonstrated lower sensitivity and no detectable
transactivation at the two
lowest concentrations. These results confirm that an A110 substitution mutant
EcR ligand binding
domain is characterized by a significantly reduced response to steroids but
remains responsive to non-
steroids.
Ligand binding by the A110 mutants: Applicants have performed ligand binding
assays using 3H-PonA
or 3H-RH2485 (N'-tert-butyl-N'-(3,5-dimethylbenzoy1)-3-methoxy-2-
methylbenzohydrazide)
radioactively-labeled ligands to determine if the differences in ligand
response of substitution mutant and
wild-type ecdysone receptors are due to differences at the level of ligand
binding. The CfEcR wild-type
and mutant receptors were in vitro transcribed and translated and assayed in
the presence of bacterially
expressed GST-CfUSP-A/BCDEF (full length) PonA binding to Al 10P mutant was
undetectable while
other A110 substitution mutants showed 5-10% of wild-type receptor binding
(see Figure 5). Wild-type
EcR and all mutants tested showed similar binding to RH-2485, a close analog
of GSTME (see Figure 6).
It may be that the inflexible proline residue of the Al 10P mutant hinders
binding of steroidal but not
non-steroidal ligands.
The in vitro translated proteins were analyzed by SDS-PAGE and were found to
be translated
similar to the WT receptor, indicating that the differences in binding
observed between the mutants and
wild-type receptor are not due to variation in the amount of proteins present
in assay (data not shown).
The ligand binding activity correlates with the reporter gene activity in most
cases, providing further
evidence of Applicants' discovery that the A110 residue plays a critical role
in the binding of
ecdysteroids, but not non-steroids.
All of the A110 substitution mutants were impaired in steroid binding as well
as in their ability
to transactivate reporter genes in the presence of steroids in mammalian and
insect cells. These mutants
84
CA 02855992 2014-07-08
WO 02/066612 PCT/US02/05090
maintained wild-type levels of non-steroid binding and reporter gene
transactivation in the presence of
non-steroids.
The A110 residue, found adjoining the predicted 13-sheet between helix 5 and
6, is highly
conserved in EcRs from various species of insects, and in RXR, progesterone
receptor (PR) and estrogen
receptor (ER) further underlining that this residue is critical for ligand
binding and thus transactivation.
In addition, residue A110 is flanked by other highly conserved residues, some
of which may be also
critical for ligand binding and/or transactivation. Close comparison of the
three-dimensional structures
of nuclear receptors show that there are major structural changes even in the
conserved LBD among
different nuclear receptors. Important changes are observed not only between
different nuclear receptor
structures, but also complexes of the same receptor when bound to natural and
synthetic ligands as in the
case of ER. The binding of steroid and non-steroids may reflect a similar
situation. The homology
models generated suggest that the binding of the two ligands is different, in
terms of the helices involved
and contact residues. Close examination of the transactivation assay results
suggests that the dose
responses are slightly different in the two situations. The steroids are less
active at lower concentrations
while the non-steroids induced activity is several fold higher. However, at
higher doses the steroidal and
non-steroidal activities are similar. The higher activity of non-steroids at
lower concentrations may
reflect higher affinity of the non-steroids to the EcR. It has been suggested
that the presence of the tert-
..
butyl group allows some non-steroids to form extensive van der Waals contacts
with the EcR LBD and
thus fits in a groove that is not occupied by ecdysteroids. This may explain
to some extent the
differences seen in the activities of the steroids and the non-steroids in
reporter gene assays at low ligand
concentrations. The mechanism by which binding affects conformational changes
and thus
transactivation potential is yet unknown. However, in the case of the ER, the
binding of agonists and
antagonists have been shown to induce different conformational changes
resulting in displacement of the
helix 12. Helix 12 plays an active role in the recruitment and interaction of
coactivators to the receptor.
In the case of agonists like diethylstilbestrol (DES), coactivator GRIP1 binds
to a hydrophobic groove on
the surface of the LBD formed by helices 3,4, 5, and 12 and the turn between
helices 3 and 4. On the
other hand, in the presence a partial antagonist, 4-hydroxytamoxifen (OHT),
helix-12 blocks the
coactivator recognition groove by mimicking the interactions of GRIP NR box
with the LBD. The
binding of steroid and the non-steroids could also induce subtle
conformational changes which affects
3 0 coactivator recruitment and thus transactivation.
The A110 residue appears to interact with the side chain of the steroid
ligand. The introduction
of bulkier or inflexible residues in this-position would potentially disrupt
these interactions and thus
docking of the ligand to the LBD. This in turn results in non-activation of
the EcR. The identification of
a mutant that results in disruption of ecdysteroid binding without affecting
non-ecdysteroid binding and
activation provides a means for systematic evolution of the EcR to develop an
ecdysone inducible system
that can be precisely regulated for use in mammalian systems.
CA 02855992 2014-07-08
WO 02/066612 PCT/U502/05090
EXAMPLE 8
This Example describes the identification of CfEcR ligand binding domain
substitution mutants
that exhibit decreased activity in response to both a steroidal ligand and a
non-steroidal ligand. These
substitution mutants are useful in ligand screening assays for orthogonal
ligand identification. In an
effort to identify substitution mutations in the CfEcR that decrease both
steroidal and non-steroidal
ligand activity, Applicants mutated amino acid residues predicted to be
critical for ecdysteroid binding
and created GAL4/mutantCfEcR-DEF cDNA gene expression cassettes as described
in Example 1 above
using PCR-mediated site-directed mutagenesis. The mutated and the WT cDNAs
corresponding to the
various switch constructs outlined above in Examples 1.1 and 1.2 were made and
tested in GAL4-driven
luciferase reporter assays as described in Example 2 above. Fold activity was
calculated by dividing
RLUs in the presence of ligand with RI-Us in the abscnce of the ligand.
Seventeen amino acid residues were identified that, when substituted, yield a
mutant ecdysone
receptor that exhibits decreased activity in response to both non-steroid and
steroid ligands. The effect
of an amino acid substitution at amino acid residue 21, 48, 51, 59, 62, 93,
95, 109, 120, 123, 125, 218,
219, 223, 230, 234, or 238 of SEQ ID NO: 1 on the activity of the mutated
CfEcR-DEF receptor is
presented in Table 12 as a fold increase over Ga14/wild-type CfEcR-DEF (WT)
switch activity. In
addition, two double mutants (R95A/A1 10P and M218A/C219A) and one triple
mutant
(V1071/A110P/R175E) were made and were also identified as mutated CfEcR-DEF
receptors that exhibit
2 0 decreased activity in response to both non-steroid and steroid ligands
(see Table 12).
Table 12. Mutants that show decreased steroid and non-steroid activity
Fold increase over WT
MUTANTS 2.5 p.M 2.5 [IM 10 nM lOnM
GSTm-E PonA GSTm-E PonA
Q21A 0.32 0.37
F48A 0.007 0.007
151A 0.003 0.004
V59A 0.47 0.002
162A 0.12 0.004
M93A 0.46 0.07
R95A 0.4 0.006
F109A 0.22 0.005
Y120A 0.001 0.006
A123F 0.09 0.005
M125A 0.005 0.007
M218A 0.001 0.001
C219A 0.001 0.001
L223A 0.118 0.007
L230A 0.001 0.006
L234A 0.001 0.006
W238A 0.002 0.013
R95A/A1 10P 0.4 0.007
M218A/C219A 0.001 0.001
V1071/A110P/R175E 0.345 nd*
,86
-
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090 =
* Not detectable
EXAMPLE 9
This Example describes the introduction of substitution mutations within the
Drosophila
melanogaster EcR (DmEcR) at amino acid residues within the ffiinEcR ligand
binding domain that are
analogous to the CfEcR ligand binding domain substitution mutants identified
above. Specifically,
substitution mutations were introduced at DmEcR amino acid residues 107, 121,
213, and 217 of SEQ ID
NO: 2, corresponding to CfEcR amino acid residues 110, 124, 211, and 219 of
SEQ ID NO: 1,
respectively.
Applicants mutated amino acid residues predicted to be critical for
ecdysteroid binding and
created GAL4/mutantDmEcR-CDEF cDNA gene expression cassettes as described in
Example 1 above
using PCR-mediated site-directed mutagenesis. The mutated and the WT cDNAs
corresponding to the
various switch constructs outlined above in Examples 1.8 arid 1.9 were made
and tested in reporter
assays in NIH3T3 cells as described in Example 2. Each GAL4/DmEcR-CDEF
construct,
VP16/LmUSP-EF, and pFRLUC were transfected into NIH3T3 cells and the
transfected cells were
treated with 2.5 j.tM GS_TME or Ponasterone A. The cells were harvested and
the reporter activity was
measured at 48 hours after addition of ligand. The fold induction was
calculated by dividing reporter
activity in the presence of ligand with the reporter activity in the absence
of ligand. From the fold
induction, percent wild-type activity was calculated for each mutant. The
results are presented in Table
13.
Table 13. GAL4/DmEcR-CDEF wild-type and Substitution Mutants G121R, G121L,
G217A, and C217
S tested for transactivation in NIH3T3 cells.
Fold increase over WT:
DmEcR-CDEF Mutant 2.5 I.J.M Ponasterone A 2.5 p.M GSTME
G121R 0.05 0.0075
G121L 0.001 0.008
C217A 0.022 - 0.008
C2175 0.0064 0.014
As seen in Table 13, both non-steroid and steroid activities were decreased
significantly when
the DmEcR ligand binding domain was mutated at amino acid residues 121 or 217,
indicating that these
residues are improtant residues in the ligand binding pocket of DmEcR.
The wild-type and mutant DmEcR-CDEF receptors were also used to make VP16/wild-
type or
mutantDmEcR-CDEF constructs as described in Example 1.10 and 1.11. VP16DrnEcR-
CDEF and a
6XEcREI3-gal reporter were transfected into L57 cells and the transfected
cells were treated with luM
20-hydroxyecdysone (20E) or GSTm-E. The cells were harvested, lysed and the
reporter activity was
measured as described above in Example 6. The fold induction was calculated by
dividing reporter
87
CA 02855992 2014-07-08
WO 02/066612
PCT/US02/05090
activity in the presence of ligand with the reporter activity in the absence
of ligand. From the fold
induction, percent wild-type activity was calculated for each mutant. The
results are presented in Table
14.
Table 14. VP16/DmEcR-CDEF wild-type and Substitution Mutants A107P, G121R,
G121L, N213A,
G217A, and C217 S tested for transactivation in insect L57 cells.
Fold increase over WT:
DmEcR-CDEF Mutant 1 p.M 20-hydroxyecdysone 1 j.i.M GSTm-E
A107P 0.09 0.9
= G121R 0.5 0.92
G121L 0.09 0.15
N213A 0.01 0.08
C2I7A 0.48 0.70
C217S 0.39 0.92
The A107P mutation of DmEcR caused the loss of most steroid activity but had
very little effect
on non-steroid activity. The G121R and C217S mutations of DmEcR resulted in
50% and 61%
reductions respectively in steroid activity but minimal effect on non-steroid
activity. The C217A
mutation of DmEcR resulted in reduced non-steroid and steroid activities, and
the DmEcR mutants
G121L and N213A lost sensitivity to both steroids and non-steroids, indicating
that these residues are
involved in binding to both steroids and non-steroids.
EXAMPLE 10
This Example describes the introduction of substitution mutations within the
Amblyomma
americanum EcR (AmaEcR) at amino acid residues within the AmaEcR ligand
binding domain that are
analogous to the CfEcR ligand binding domain substitution mutants identified
above. Specifically,
substitution mutations were introduced at AmaEcR amino acid residues 91 and
105 of SEQ ID NO: 3,
corresponding to CfEcR amino acid residues 96 and 110 of SEQ ID NO: 1,
respectively.
Applicants mutated amino acid residues predicted to be critical for
ecdysteroid binding and
created GAL4/mutantAmaEcR-DEF cDNA gene expression cassettes as described in
Example 1 above
using PCR-mediated site-directed mutagenesis. The mutated and the WT cDNAs
corresponding to the
various switch constructs outlined above in Examples 1.12 and 1.13 were tested
in GAL4-driven
luciferase reporter assays in NIH3T3 cells as described in Example 2.
GAL4/AmaEcR-DEF,
VP16LmUSP-EF and pFRLUC were tilansfected into NIH3T3 cells and the
transfected cells were treated
with either 0.2 1.1.M Ponasterone A steroid ligand or 1 1.1.M GSTME non-
steroid ligand. The cells were
harvested and the reporter activity was measured at 48 hours after addition of
ligand. The fold induction
was calculated by dividing reporter activity in the presence of ligand with
the reporter activity in the
absence of ligand. From the fold induction, percent wild-type activity was
calculated for each mutant.
The results are presented in Table 15.
88
CA 02855992 2014-07-08
Table 15. AmaEcR-DEF Substitution Mutants at G91 and A105 in NII-13T3 cells.
Fold increase over WT:
AmaEcR-DEF Mutant 0.2 j.iM Ponasterone A 1 1.1.M GSTME
G91A 1.29 1.22
A105P 0.11 0.01
The G91A mutation of AmaEcR at the homologous amino acid residue position of
V96 in ClEcR
resulted in increased steroid and non-steroid activities. The A105P mutation
of AmaEcR at the
homologous amino acid residue position of A110 of CfEcR caused the loss of
most steroid activity and
essentially eliminated non-steroid activity.
It is further to be understood that all base sizes or amino acid sizes, and
all molecular weight or
molecular mass values, given for nucleic acids or polypeptides are
approximate, and are provided for
description.
89
