Note: Descriptions are shown in the official language in which they were submitted.
Compositions Containing Soluble Toso Protein and Uses Thereof
BACKGROUND OF THE INVENTION
[0002] Toso or Faim3 (Fas Apoptotic inducing molecule 3) is a single membrane
spanning cell surface receptor originally characterized through a retroviral
overexpression
screen in Jurkat cells, a T cell leukemic line, as a mediator of Fas-induced
apoptotic cell
death (Hitoshi, Y., et al., Toso, a cell surface, specific regulator of Fas-
induced apoptosis
in T cells. Immunity, 1998. 8(4): p. 461-71). Subsequent studies have
suggested that Toso
is the elusive receptor for IgM. The expression of Toso also seems to
correlate with
particularly aggressive forms of Chronic Lymphocytic Leukemia, or CLL.
[0003] There is a need for characterization of the in vivo role of Toso in
order to identify
its use as a therapeutic target and for compositions comprising agents that
can bind to
Toso and/or modulate its activity.
SUMMARY OF THE INVENTION
[0004] Accordingly, the present invention provides methods and compositions
for
modulating Toso activity and treating diseases and disorders in which Toso is
implicated.
[0005] In one aspect, the present invention provides a method of treating an
autoimmune disorder in a subject, the method including a step of treating the
subject with
a composition containing a therapeutically effective amount of a soluble Toso
protein. In
exemplary embodiments, the autoimmune disorder is without limitation
rheumatoid
arthritis, multiple sclerosis, lupus or Type I diabetes.
1
CA 2867444 2017-08-23
[0006] In a further aspect, the present invention provides a method of
treating Type II
diabetes in a subject, the method including a step of treating the subject
with a
composition comprising a therapeutically effective amount of a soluble Toso
protein.
[0007] In one aspect, the present invention provides a method of treating
asthma in a
subject, the method including a step of treating the subject with a
composition comprising
a therapeutically effective amount of a soluble Toso protein.
[0008] In a further aspect, the present invention provides methods of treating
diabetes,
asthma, multiple sclerosis, or rheumatoid arthritis in a subject by
administering a soluble
polypeptide having an amino acid sequence of SEQ ID NO: 5 or 6 or a fragment
or a
deletion variant thereof to that subject In further embodiments, the Toso
activity in the
subject is reduced in the subject. In stil further embodiments, the present
invention
provides methods of treating diabetes, asthma, multiple sclerosis, or
rheumatoid arthritis in
a subject by administering a soluble polypeptide comprising an amino acid
sequence of
any one or more of SEQ ID NOs. 1-25.
[0009] In a further aspect, the present invention provides methods of treating
cancer,
allergy, COPD, hyper-IgM syndrome, lupus, or a neutrophilia-associated
disorder in a
subject, the method including a step of treating the subject with a
composition comprising
a therapeutically effective amount of a soluble Toso protein.
[0010] In further embodiments and in accordance with any of the above, the
soluble
Toso protein of the invention includes amino acid residues amino acids P21 to
G251 of
NP_005440.1, human Toso isoform a (see Shima et al., Int. Immunol., 2010).
[0011] In still further embodiments and in accordance with any of the above,
the soluble
Toso protein of the invention includes the extracellular domain of a human
Toso protein.
In further embodiments, the soluble Toso protein of use in the invention
includes amino
acid residues 18-253 of SEQ ID NO: 7.
[0012] In still further embodiments and in accordance with any of the above,
the soluble
Toso protein used in methods of the present invention comprises an amino acid
sequence
according to SEQ ID NO: 5 or 6. In yet further embodiments, the soluble Toso
protein
comprises an amino acid sequence with at least 90% sequence identity to SEQ ID
NO: 5
or 6. In yet further embodiments, the soluble Toso protein of the present
invention includes
2
CA 2867444 2017-08-23
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
deletion variants of SEQ ID NO: 5 or 6. In stil further embodiments and in
accordance with
any of the above, the soluble Toso protein used in methods of the present
invention
comprises an amino acid sequence of any one or more of SEQ ID NOs. 1-25.
[0013] In further embodiments and in accordance with any of the above, the
soluble
Toso protein of the invention is a multimer. In still further embodiments, the
multimer is
made up of 6 monomers. In yet further embodiments, each monomer of the
multimeric
Toso protein comprises a sequence according to SEQ ID NO: 6.
[0014] In a further aspect, the present invention provides methods for
inhibiting Toso
activity that include applying a soluble Toso polypeptide to a cell comprising
a membrane-
bound Toso receptor.
[0015] In a still further aspect, the present invention provides a composition
that includes
a polypeptide of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, that
composition
inhibits Toso activity. In a further embodiment, the polypeptide is a
multimer. In a still
further embodiment, the multimer includes 6 monomers, where each monomer
comprises
a sequence according to SEQ ID NO: 6.
[0016] In a further embodiment, the present invention provides an isolated
nucleic acid
encoding a soluble Toso protein in accordance with any of the protein
described herein. In
a still further embodiment, the present invention provides a host cell
expressing an isolated
nucleic acid encoding a soluble Toso protein in accordance with any of the
protein
described herein.
[0017] In a further aspect, the present invention provides a fusion protein
comprising an
extracellular domain of a human Toso protein, an Fc region, and a
multimerization tag. In
a further embodiment, the extracellular domain comprises amino acids 21-251 of
a human
Toso protein. In a still further embodiment, the multimerization tag comprises
SEQ ID NO:
4. In a yet further embodiment, the Fc region comprises SEQ ID NO: 3.
[0018] In a further embodiment, the present invention provides an isolated
nucleic acid
encoding the fusion protein described above. In a still further embodiment,
the present
invention provides a host cell comprising a nucleic acid encoding the fusion
protein
described above.
[0019] In a further aspect, the present invention provides an isolated,
soluble
polypeptide comprising an amino acid sequence having at least 90% sequence
identity to
3
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
SEQ ID NOs. 8-24 or to a polypeptide region comprising amino acid residues 18-
251 of
SEQ ID NO: 7.
[0020] In a further aspect, the present invention provides methods for
producing a
polypeptide encoding any of the soluble Toso proteins described herein, the
method
including providing a cell comprising a nucleic acid encoding said
polypeptide, the cell is
cultured under conditions suitable for expression of said polypeptide. In
further
embodiments, the present invention provides a nucleic acid encoding any of the
soluble
Toso proteins described herein.
BRIEF DESCRIPTION OF THE DRAWINGS
[0021] FIG. 1 shows data related to inflammation in Toso-/- mice. FIG. 1A
shows
measures of joint inflammation as measured by the change in ankle thickness
using a
digital caliper. FIG. 1B shows disease severity scores for each joint based on
visible
swelling and mobility. FIG. 1C shows flow cytometric analysis of lymphocyte
populations
in the draining lymph node.
[0022] FIG. 2 shows data from an OVA induced asthma model on Toso-/- and wild
type
mice. FIG. 2A is a schematic illustration of the induction of the asthma
model. FIG. 2B
shows data on eosinophil migration into the broncheoalveolar space as assessed
by
DifQuik staining. FIG. 2C shows data on eosinophils quantified by counting at
least 200
leukocytes per slide.
[0023] FIG. 3A-C show data on OVA induced 1H2 cytokines IL-4, IL-5 and IL-13
in BALF
as assessed by ELISA. FIG. 3D shows data on Eotaxin, an eosinophil attracting
C-C
chemokine, in the BALF. FIG. 3E shows the levels of Eotaxin produced in
response to
TNFa treatment in smooth muscle cells.
[0024] FIG. 4 shows data on IgE in Toso-/- mice. FIG. 4A and B show total and
specific
IgE levels in Toso-/- mice, and FIG. 4C shows IgG1 levels between the wildtype
and Toso-
/-
mice.
[0025] FIG. 5 shows Penh values of Toso-/- mice compared to wildtype controls.
[0026] FIG. 6 shows EAE scores in a MOG-induced model in wildtype and Toso-/-
mice.
[0027] FIG. 7A shows data on cytokine production in the Broncho Alveolar
Lavage Fluid
(BALF) of wildtype animals in response to aerosolled OVA that had been
previously intra-
tracheally installed with Toso-/- and wildtype dendritic cells. FIG. 7B shows
proliferation of
4
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
T cells derived from 2d2 mice cultured with M0G35_55 loaded Toso-/- dendritic
cells. FIG.
7C shows blood glucose levels in RIP-GP animals injected intravenously with GP
loaded
Toso-/- and wildtype dendritic cells and a Kaplan-Meier plot of RIP-GP mice
injected with
GP peptide loaded wildtype and Toso dendritic dendritic cells. RIP-GP mice are
mice expressing
the major glycoprotein (GP) from lymphocytic chorio meningitis virus (LCMV)
under control
of the rat insulin promoter (RIP) ¨ such mice develop diabetes as assessed by
increased
levels of serum glucose.
[0028] FIG. 8A is a schematic illustration of the Toso soluble receptor. FIG.
8B shows
ELISA data on the soluble receptor. FIG. 8C shows data confirmation of the
secretion of
the Toso soluble receptor by Western Blot (FIG. 8Ci) and by Coomassie Blue
staining
(FIG. 8Cii). FIG. 8D shows binding data of the Toso soluble receptor to
splenocytes. FIG.
8E shows further data indicating that Toso-Fc bound most significantly to
CD11c+MHChi
mature dendritic cells, CD4+ T cells and B220+ B cells in the spleen. FIG. 8F
shows
ELISA results of Toso-Fc binding to platebound human IgM. FIG. 8G shows normal
weight gain in mouse treated with 50 lag daily of Toso-Fc.
[0029] FIG. 9A is a schematic illustration of the treatment protocol for the
murine model
of OVA induced asthma. FIG. 9B shows data on Th2 cytokines in the BALE and
FIG. 9C
shows cellularity data in the BALE, which are both measurements of the
severity of the
disease.
[0030] FIG. 10 provides sequences of embodiments of the invention, including
that of a
soluble Toso protein (FIG. 10A), an IL-2 signal sequence (FIG. 10B), an Fc
domain (FIG.
10C) and a hexamerization tag (FIG. 10D).
[0031] FIG. 11A provides a sequence of an embodiment of a soluble Toso protein
comprising a hexameric tag, allowing for expression of a multimeric form of
the soluble
receptor. FIG 11B provides a sequence of a human Toso protein, NP_005440.1
(SEQ ID
NO: 7).
[0032] FIG. 12 shows TOSO expression on granulocytes. a: RNA was isolated from
spleens and livers of wildtype (WT) and Toso - mice. Toso RNA was analyzed
using RT-
PCR and expressed as Expression per 18S RNA (n = 4) . b: Splenocytes from
C57BL/6
mice and Toso - mice were stained for CD19 (B cells) and CD3 (T cells) and co-
stained
with rat anti-mouse Toso antibody or isotype control. Grey areas indicate
isotype control,
bolded lines indicate staining with anti Toso antibody. One representative
histogram of
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
CD19 positive cells (B cells) and CD3 positive cells (T cells) is shown. c:
Splenocytes and
blood leukocytes from C57BL/6 mice and Toso - mice were stained for Gr1
together with
rat anti-mouse Toso antibody or isotype control. Grey areas indicate isotype
control,
bolded lines indicate staining with Toso. One representative histogram of Gr1
positive cells
is shown. d: Blood leukocytes from wildtype and Toso - mice were analyzed for
granulocytes and lymphocytes by forward and side scatter. Leukocytes per pl
are shown
(n = 4). e: Lymphocytes were analyzed for CD4 T cells (CD3+ CD8- cells) CD8 T
cells
(CD3+ CD8 + cells) and B cells (B2201- cells, n = 4). f: Spleen weight from
wildtype and
Toso-/- mice were analyzed (n = 4). g: Spleen lymphocytes were analyzed for
CD4 T cells
(CD3+ CD8- cells) CD8 T cells (CD3+ CD8 + cells) and B cells (B220+ cells, n =
4).
[0033] FIG 13 shows that threshold for activation is lowered in granulocytes
of TOSO
deficient mice. 13a: Blood from wildtype or Toso - mice was incubated with
different
concentrations of fMLP for 30 minutes at 37 C. Activation of granulocytes was
measured
by ROS production (Dihydrorhodamine staining) and degranulation (side-scatter)
as
described in methods. One representative dot plot of cells gated on
granulocytes is shown.
Gate is set on activated granulocytes. Percentage of activated granulocytes is
given (n =
6). 13b: Blood from WT and Toso-/- mice was incubated with different
concentrations of
TNF-a. Percentage of activated granulocytes is given (n = 6). 13c: Blood from
WT and
Toso - mice was incubated with different concentrations of Lipopolysacharide.
Percentage
of activated granulocytes is given (n = 6). 13d: Blood from WT and Toso - mice
was
incubated with different concentrations of GM-CSF (given as percent of
supernatant form
X630 cells). Percentage of activated granulocytes is given (n = 6). 13e: Blood
from
wildtype and Toso - mice was primed with 10% GM-CSF supernatant or 500 ng/ml
LPS.
After 30 minutes cells were stimulated with 2pM fMLP for 15 minutes.
Percentage of
activated granulocytes is given (n = 6). 13f: Blood from WT and Toso - mice
was
incubated at different temperatures for 30 minutes. Degranulation was measured
using
side scatter. Percentage of de-granulated cells is given (n = 6).
[0034] FIG. 14 shows that activation threshold in granulocytes is regulated
intrinsically.
C57BL/6 wildtype mice were irradiated and reconstituted with bone marrow form
wildtype
mice carrying a point mutation in the CD45 gene (CD45.1, group 1), Toso - mice
(CD45.2,
group 2) or a 1:1 mixture of wildtype (C045.1) bone marrow and Toso - bone
marrow cells
(CD45.2, group 3) as describe in methods. 30 days after bone marrow
transplantation,
6
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
peripheral blood was stimulated with fMLP and analyzed for activated
granulocytes 14a:
Representative FAGS plots of cells gated for Grl and stained for CD45.1,
CD45.2 and
Dihydrorhodamin (ROS) are shown. 14b: Percentages of granulocytes are
quantified for
the three different groups of bone marrow chimeras (n = 8). 14c: Percentages
of activated
granulocytes measured by side scatter and ROS production according to the gate
in Fig.
3a was analyzed (n = 8). 14d: The mean fluorescent intensity of side scatter
and
Dihydrorohdamin (ROS) was analyzed for total and activated granulocytes (n =
8).
[0035] FIG. 15 shows impaired control of Listeria in Toso deficient mice. 15a:
Toso
mice and corresponding wildtype mice were infected with 1x104 CFU of Listeria.
Survival
was monitored (n = 8 ¨ 15). 15b: Toso - mice and corresponding wildtype mice
were
infected with lx1 04 CFU of Listeria. Granulocyte activation (ROS formation)
was measured
in blood granulocytes dO and d2 after infection (n = 4 - 5). 15c: WT and Toso -
mice were
infected with lx106 CFU of Listeria. Myeloperoxidase was analyzed in plasma of
naive WT
mice, and Listeria infected WT and Toso - mice six hours after infection (n =
4). 15d:
Toso-l- mice and corresponding WT mice were infected with lx106 CFU of
Listeria
monocytogenes. Liver histology was analyzed 20 hours later. One representative
slide is
shown (n = 4). Scale bar = 50pm. 15e: Toso - mice and corresponding WT mice
were
infected with lx1 04 CFU of Listeria. After one day ROS production was
measured in
granulocytes of spleen and liver (n = 3). f: Toso - mice and corresponding WT
mice were
infected with lx1 04 CFU of Listeria. On day 3 and 4 after infection, Listeria
titers were
analyzed in spleen, liver and brain (n = 6).
[0036] FIG. 16 shows that expression of CD11 b and CD18 is influenced by Toso.
16a:
Blood granulocytes from Toso - mice and corresponding WT mice were formalin
fixed and
then stained for CD11a, CD1 lb and CD18. Mean fluorescent expression is shown
(n = 6).
p values are derived from paired students t test. 16b: Blood from wildtype and
Toso
mice was stimulated with different concentrations of GM-CSF and LPS. Mean
fluorescent
expression for CD11 b on granulocytes is shown (n = 6). 16c: Blood
granulocytes from
Cd11b mice and corresponding wildtype mice were stimulated with 2pM fMLP or
with
40% GM-CSF supernatant in addition to 2pM fMLP. Mean fluorescent intensity is
given for
CD11 b and CD18 (n = 4). 16d: Blood Granulocytes from Cd11 b4- mice and
corresponding
wildtype mice were stimulated with 2pM fMLP or with 40% GM-CSF supernatant in
addition to 2pM fMLP. Percentage of activated granulocytes is given (n = 4).
Mean
7
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
fluorescent intensity of ROS staining is given for total granulocytes as well
as for activated
granulocytes (n = 4).
[0037] FIG. 17 shows apoptosis in Toso - granulocytes. Blood from Toso- was
incubated at 37 C with and without GM-CSF (10%). Apoptosis was measured with
Annexin V and 7AAD after one and seven hours (n = 4).
[0038] FIG. 18 shows Listerium bacteraemia after infection of Toso - mice.
Toso- and
corresponding wildtype mice were infected with 1x106 CFU of Listeria
monocytogenes.
Blood Listeria titer was assessed one and 20 hours after infection (n = 4).
[0039] FIG. 19 shows data from wildtype and Toso - mice after initiation of a
high fat
diet. FIG. 19A shows body weights of wildtype and Toso-/- male mice, which
were
monitored since the initiation of a high fat diet starting at 5 weeks of age.
FIG. 19B shows
measurements of food intake in both sets of mice at 14 weeks post high fat
diet.
[0040] FIG. 20A shows data from a glucose tolerance test from wildtype and
Toso
mice after initiation of a high fat diet. FIG. 20B shows data from an insulin
tolerance test
from the same set of mice.
[0041] FIG. 21 shows data illustrating that wildtype and Toso - mice
maintained on a
regular chow (non-high fat) diet display similar levels of glucose tolerance
(FIG. 21A) and
insulin tolerance (FIG. 21B).
[0042] FIG. 22 shows data on glucose tolerance before treatment of wildtype
mice with
soluble Toso protein (FIG. 22A) and after treatment (FIG. 22B).
[0043] FIG. 23 shows EAE clinical scores in mice treated with PBS (closed
circle)
compared to mice treated with soluble Toso protein (Toso-Fc ¨ closed square).
[0044] FIG. 24A shows data in an arthritis mouse model comparing the additive
arthritis
score in mice treated with the control vehicle (closed circle) and mouse
treated with
soluble Toso protein (Toso-Fc ¨ open square). FIG. 24B shows data from an
arthritis
mouse model comparing the percent incidence of arthritis in the Toso-Fc
treated mice
(Toso-Fc ¨ open squares) as compared to control (vehicle ¨ closed circles).
[0045] FIG. 25 shows reduced proliferative responses to collagen in
splenocytes treated
with Toso-Fc.
[0046] FIG. 26 shows the therapeutic effect of soluble Toso protein (Toso-Fc ¨
open
square) in an arthritis mouse model as compared to control (vehicle ¨ closed
circle).
8
[0047] FIG. 27A-C provides sequences of different embodiments of soluble Toso
proteins of the invention.
DETAILED DESCRIPTION OF THE INVENTION
[0048] The practice of the present invention may employ, unless otherwise
indicated,
conventional techniques and descriptions of organic chemistry, polymer
technology,
molecular biology (including recombinant techniques), cell biology,
biochemistry, and
immunology, which are within the skill of the art. Such conventional
techniques include
polymer array synthesis, hybridization, ligation, phage display, and detection
of
hybridization using a label. Specific illustrations of suitable techniques can
be had by
reference to the example herein below. However, other equivalent conventional
procedures can, of course, also be used. Such conventional techniques and
descriptions
can be found in standard laboratory manuals such as Genome Analysis: A
Laboratory
Manual Series (Vols. I-IV), Using Antibodies: A Laboratory Manual, Cells: A
Laboratory
Manual, PCR Primer: A Laboratory Manual, and Molecular Cloning: A Laboratory
Manual
(all from Cold Spring Harbor Laboratory Press), Stryer, L. (1995) Biochemistry
(4th Ed.)
Freeman, New York, Gait, "Oligonucleotide Synthesis: A Practical
Approach"1984, IRL
Press, London, Nelson and Cox (2000), Lehninger, Principles of Biochemistry
3rd Ed., W.
H. Freeman Pub., New York, N.Y. and Berg et al. (2002) Biochemistry, 5Ih Ed.,
W. H.
Freeman Pub., New York, N.Y.
[0049] Note that as used herein and in the appended claims, the singular forms
"a,"
"an," and "the" include plural referents unless the context clearly dictates
otherwise. Thus,
for example, reference to "a polymerase" refers to one agent or mixtures of
such agents,
and reference to "the method" includes reference to equivalent steps and
methods known
to those skilled in the art, and so forth.
[0050] Unless defined otherwise, all technical and scientific terms used
herein have the
same meaning as commonly understood by one of ordinary skill in the art to
which this
invention belongs.
9
CA 2867444 2017-08-23
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
[0051] Where a range of values is provided, it is understood that each
intervening value,
to the tenth of the unit of the lower limit unless the context clearly
dictates otherwise,
between the upper and lower limit of that range and any other stated or
intervening value
in that stated range is encompassed within the invention. The upper and lower
limits of
these smaller ranges may independently be included in the smaller ranges is
also
encompassed within the invention, subject to any specifically excluded limit
in the stated
range. Where the stated range includes one or both of the limits, ranges
excluding either
both of those included limits are also included in the invention.
[0052] In the following description, numerous specific details are set forth
to provide a
more thorough understanding of the present invention. However, it will be
apparent to one
of skill in the art that the present invention may be practiced without one or
more of these
specific details. In other instances, well-known features and procedures well
known to
those skilled in the art have not been described in order to avoid obscuring
the invention.
[0053] As used herein, the term "comprising" is intended to mean that the
compositions
and methods include the recited elements, but not excluding others.
"Consisting
essentially of" when used to define compositions and methods, shall mean
excluding other
elements of any essential significance to the composition or method.
"Consisting of" shall
mean excluding more than trace elements of other ingredients for claimed
compositions
and substantial method steps. Embodiments defined by each of these transition
terms are
within the scope of this invention. Accordingly, it is intended that the
methods and
compositions can include additional steps and components (comprising) or
alternatively
including steps and compositions of no significance (consisting essentially
of) or
alternatively, intending only the stated method steps or compositions
(consisting of).
[0054] All numerical designations, e.g., pH, temperature, time, concentration,
and
molecular weight, including ranges, are approximations which are varied ( + )
or ( -) by
increments of 0.1. It is to be understood, although not always explicitly
stated that all
numerical designations are preceded by the term "about". The term "about" also
includes
the exact value "X" in addition to minor increments of "X" such as "X + 0.1"
or "X ¨0.1." It
also is to be understood, although not always explicitly stated, that the
reagents described
herein are merely exemplary and that equivalents of such are known in the art.
[0055] A "composition" may include any substance comprising an agent or
compound
and is also intended to encompass any combination of an agent or compound and
other
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
substances, including a carrier, e.g., compound or composition, inert (for
example, a
detectable agent or label) or active, such as an adjuvant, diluent, binder,
stabilizer, buffers,
salts, lipophilic solvents, preservative, adjuvant or the like. Carriers also
include
pharmaceutical excipients and additives proteins, peptides, amino acids,
lipids, and
carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, tetra-, and
oligosaccharides; derivatized sugars such as alditols, aldonic acids,
esterified sugars and
the like; and polysaccharides or sugar polymers), which can be present singly
or in
combination, comprising alone or in combination 1-99.99% by weight or volume.
Exemplary protein excipients include serum albumin such as human serum albumin
(HSA), recombinant human albumin (rHA), gelatin, casein, and the like.
Representative
amino acid/antibody components, which can also function in a buffering
capacity, include
alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid,
cysteine, lysine,
leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the
like.
Carbohydrate excipients are also intended within the scope of this invention,
examples of
which include but are not limited to monosaccharides such as fructose,
maltose, galactose,
glucose, D-mannose, sorbose, and the like; disaccharides, such as lactose,
sucrose,
trehalose, cellobiose, and the like; polysaccharides, such as raffinose,
melezitose,
maltodextrins, dextrans, starches, and the like; and alditols, such as
mannitol, xylitol,
maltitol, lactitol, xylitol sorbitol (glucitol) and myoinositol.
[0056] The term pharmaceutically acceptable carrier (or medium), which may be
used
interchangeably with the term biologically compatible carrier or medium,
refers to reagents,
cells, compounds, materials, compositions, and/or dosage forms that are not
only
compatible with the cells and other agents to be administered therapeutically,
but also are,
within the scope of sound medical judgment, suitable for use in contact with
the tissues of
human beings and animals without excessive toxicity, irritation, allergic
response, or other
complication commensurate with a reasonable benefit/risk ratio.
Pharmaceutically
acceptable carriers suitable for use in the present invention include liquids,
semi-solid
(e.g., gels) and solid materials (e.g., cell scaffolds and matrices, tubes
sheets and other
such materials as known in the art and described in greater detail herein).
These semi-
solid and solid materials may be designed to resist degradation within the
body (non-
biodegradable) or they may be designed to degrade within the body
(biodegradable,
bioerodable). A biodegradable material may further be bioresorbable or
bioabsorbable,
11
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
i.e., it may be dissolved and absorbed into bodily fluids (water-soluble
implants are one
example), or degraded and ultimately eliminated from the body, either by
conversion into
other materials or breakdown and elimination through natural pathways.
[0057] As used herein, the term "patient" or "subject" intends an animal, a
mammal or
yet further a human patient. For the purpose of illustration only, a mammal
includes but is
not limited to a human, a simian, a murine, a bovine, an equine, a porcine or
an ovine.
[0058] As used herein, the term "oligonucleotide" or "polynucleotide" refers
to a short
polymer composed of deoxyribonucleotides, ribonucleotides or any combination
thereof.
Oligonucleotides are generally at least about 10, 15, 20, 25, 30, 40, 50, 60,
70, 80, 90, 100
or more nucleotides in length. An oligonucleotide may be used as a primer or
as a probe.
[0059] The term "amino acid" refers to naturally occurring and synthetic amino
acids, as
well as amino acid analogs and amino acid mimetics that function in a manner
similar to
the naturally occurring amino acids. Naturally occurring amino acids are those
encoded by
the genetic code, as well as those amino acids that are later modified, e.g.,
hydroxyproline,
y-carboxyglutamate, and 0-phosphoserine. Amino acid analogs refers to
compounds that
have the same basic chemical structure as a naturally occurring amino acid,
i.e., an a
carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R
group,
e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl
sulfonium. Such
analogs have modified R groups (e.g., norleucine) or modified peptide
backbones, but
retain the same basic chemical structure as a naturally occurring amino acid.
Amino acid
mimetics refers to chemical compounds that have a structure that is different
from the
general chemical structure of an amino acid, but that function in a manner
similar to a
naturally occurring amino acid.
[0060] The term "isolated" as used herein refers to molecules or biological or
cellular
materials being substantially free from other materials, e.g., greater than
70%, or 80%, or
85%, or 90%, or 95%, or 98%. In one aspect, the term "isolated" refers to
nucleic acid,
such as DNA or RNA, or protein or polypeptide, or cell or cellular organelle,
or tissue or
organ, separated from other DNAs or RNAs, or proteins or polypeptides, or
cells or cellular
organelles, or tissues or organs, respectively, that are present in the
natural source and
which allow the manipulation of the material to achieve results not achievable
where
present in its native or natural state, e.g., recombinant replication or
manipulation by
mutation. The term "isolated" also refers to a nucleic acid or peptide that is
substantially
12
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
free of cellular material, viral material, or culture medium when produced by
recombinant
DNA techniques, or chemical precursors or other chemicals when chemically
synthesized.
Moreover, an "isolated nucleic acid" is meant to include nucleic acid
fragments which are
not naturally occurring as fragments and would not be found in the natural
state. The term
"isolated" is also used herein to refer to polypeptides which are isolated
from other cellular
proteins and is meant to encompass both purified and recombinant polypeptides,
e.g., with
a purity greater than 70%, or 80%, or 85%, or 90%, or 95%, 98%, or 99%. The
term
"isolated" is also used herein to refer to cells or tissues that are isolated
from other cells or
tissues and is meant to encompass both cultured and engineered cells or
tissues.
[0061] A "recombinant" nucleic acid refers an artificial nucleic acid that is
created by
combining two or more sequences that would not normally occur together. In one
embodiment, it is created through the introduction of relevant DNA into an
existing
organismal DNA, such as the plasmids of bacteria, to code for or alter
different traits for a
specific purpose, such as antibiotic resistance. A "recombinant" polypeptide
is a
polypeptide that is derived from a recombinant nucleic acid.
[0062] As used herein, the term "promoter" refers to a nucleic acid sequence
sufficient to
direct transcription of a gene. Also included in the invention are those
promoter elements
which are sufficient to render promoter dependent gene expression controllable
for cell
type specific, tissue specific or inducible by external signals or agents.
[0063] In some embodiments, a promoter is an inducible promoter or a discrete
promoter. Inducible promoters can be turned on by a chemical or a physical
condition
such as temperature or light. Examples of chemical promoters include, without
limitation,
alcohol-regulated, tetracycline-regulated, steroid-regulated, metal-regulated
and
pathogenesis-related promoters. Examples of discrete promoters can be found
in, for
examples, Wolfe et al. Molecular Endocrinology 16(3): 435-49.
[0064] As used herein, the term "regulatory element" refers to a nucleic acid
sequence
capable of modulating the transcription of a gene. Non-limiting examples of
regulatory
element include promoter, enhancer, silencer, poly-adenylation signal,
transcription
termination sequence. Regulatory element may be present 5' or 3' regions of
the native
gene, or within an intron.
[0065] Various proteins are also disclosed herein with their GenBank
Accession
Numbers for their human proteins and coding sequences. However, the proteins
are not
13
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
limited to human-derived proteins having the amino acid sequences represented
by the
disclosed GenBank Accession Nos, but may have an amino acid sequence derived
from
other animals, particularly, a warm-blooded animal (e.g., rat, guinea pig,
mouse, chicken,
rabbit, pig, sheep, cow, monkey, etc.).
[0066] As used herein, the term "Toso", "FAIM3" or "Fas apoptotic inhibitory
molecule 3"
refers to a protein having an amino acid sequence substantially identical to
any of the
representative Toso sequences, including any and all versions of GenBank
Accession
Nos. NP 001135945 (human isoform b), NP 001180267 (human isoform c), NP 005440
(human isoform a), NP 081252 (mouse) or NP 001014843 (rat). Suitable cDNA
encoding
Toso are provided at GenBank Accession Nos. NM 001142473, NM 001193338,
NM 005449, NM 026976, and NM 001014843.
[0067] As used herein, the term "biological activity of Toso" or "Toso
activity" refers to
any biological activity associated with the full length native Toso protein.
In some
embodiments, the biological activity of Toso refers to binding to an IgM
antibody. In further
embodiments, the biological activity of Toso refers to inhibiting CD11 b or
CD18 activity. In
yet further embodiments, the biological activity of Toso refers to increasing
the activation
threshold of granulocytes. Activation threshold can be measured by number of
activated
granulocytes from bone marrow. In further embodiments, the biological activity
of Toso
includes the activation of dendritic cells and their ability to present
antigen to T cells. In
further embodiments, the biological activity of Toso includes inhibition of
apoptosis or
enhancement of TNF signaling. In some embodiments, the Toso biological
activity is
equivalent to the activity of a protein having an amino acid sequence
represented by
GenBank Accession No. NP 001135945, NP 001180267, NP 005440, NP 081252 or
NP 001014843, including any and all versions of these accession numbers.
[0068] As used herein, the term "CD11b", "ITGAM" or "ITGAM integrin, alpha M
(complement component 3 receptor 3 subunit)" refers to a protein having an
amino acid
sequence substantially identical to the representative CDllb sequence of
GenBank
Accession No. NP_000623. A suitable cDNA encoding 0011 b is provided at
GenBank
Accession No. NM 000632.
[0069] As used herein, the term "biological activity of CD11b" refers to any
biological
activity associated with the full length native CD11 b protein. In one
embodiment, the
biological activity of CDllb refers to combining with the beta 2 chain (ITGB2)
to form a
14
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
leukocyte-specific integrin. In suitable embodiments, the CD11b biological
activity is
equivalent to the activity of a protein having an amino acid sequence
represented by
GenBank Accession No. NP 000623. Measurement of transcriptional activity can
be
performed using any known method, such as immunohistochemistry, reporter assay
or RT-
PCR.
[0070] As used herein, the term "CD18", "ITGB2" or "ITGB2 integrin, beta 2
(complement component 3 receptor 3 and 4 subunit)" refers to a protein having
an amino
acid sequence substantially identical to the representative 0D18 sequence of
GenBank
Accession No. NP 000202. A suitable cDNA encoding CD18 is provided at GenBank
Accession No. NM 000211.
[0071] As used herein, the term "treating" refers to administering a
pharmaceutical
composition for the purpose of improving the condition of a patient by
reducing, alleviating,
reversing, or preventing at least one adverse effect or symptom of a disease
or disorder.
[0072] As used herein, the term "preventing" refers to identifying a subject
(i.e., a
patient) having an increased susceptibility to a disease but not yet
exhibiting symptoms of
the disease, and administering a therapy according to the principles of this
disclosure. The
preventive therapy is designed to reduce the likelihood that the susceptible
subject will
later become symptomatic or that the disease will be delay in onset or
progress more
slowly than it would in the absence of the preventive therapy. A subject may
be identified
as having an increased likelihood of developing the disease by any appropriate
method
including, for example, by identifying a family history of the disease or
other degenerative
brain disorder, or having one or more diagnostic markers indicative of disease
or
susceptibility to disease.
[0073] As used herein, the term "sample" or "test sample" refers to any liquid
or solid
material containing nucleic acids. In suitable embodiments, a test sample is
obtained from
a biological source (i.e., a "biological sample"), such as cells in culture or
a tissue sample
from an animal, most preferably, a human.
[0074] As used herein, the term "substantially identical", when referring to a
protein or
polypeptide, is meant one that has at least 80%, 85%, 90%, 95%, or 99%
sequence
identity to a reference amino acid sequence. The length of comparison is
preferably the
full length of the polypeptide or protein, but is generally at least 10, 15,
20, 25, 30, 40, 50,
60, 80, or 100 or more contiguous amino acids. A "substantially identical"
nucleic acid is
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
one that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence
identity to a
reference nucleic acid sequence. The length of comparison is preferably the
full length of
the nucleic acid, but is generally at least 20 nucleotides, 30 nucleotides, 40
nucleotides, 50
nucleotides, 75 nucleotides, 100 nucleotides, 125 nucleotides, or more.
[0075] As used herein, an "amino acid substitution" or "substitution" refers
to the
replacement of an amino acid at a particular position in a starting
polypeptide sequence
with another amino acid. For example, the substitution M23Y refers to a
variant
polypeptide in which the methionine at position 23 is replaced with a
tyrosine.
[0076] A "biological equivalent" of a protein or nucleic acid refers to a
protein or nucleic
acid that is substantially identical to the protein or nucleic acid by amino
acid or nucleic
acid sequence or that has an equivalent biological activity.
[0077] As used herein, the term "effective amount" refers to a quantity of
compound
(e.g., a Toso protein or biologically active fragment thereof) delivered with
sufficient
frequency to provide a medical benefit to the patient. In one embodiment, an
effective
amount of a protein is an amount sufficient to treat or ameliorate a symptom
of a disease.
[0078] A population of cells intends a collection of more than one cell that
is identical
(clonal) or non-identical in phenotype and/or genotype.
[0079] "Substantially homogeneous" describes a population of cells in which
more than
about 50%, or alternatively more than about 60 %, or alternatively more than
70 %, or
alternatively more than 75 %, or alternatively more than 80%, or alternatively
more than 85
"Yo, or alternatively more than 90%, or alternatively, more than 95 %, of the
cells are of the
same or similar phenotype. Phenotype can be determined by a pre-selected cell
surface
marker or other marker.
[0080] The terms autologous transfer, autologous transplantation, autograft
and the like
refer to treatments wherein the cell donor is also the recipient of the cell
replacement
therapy. The terms allogeneic transfer, allogeneic transplantation, allograft
and the like
refer to treatments wherein the cell donor is of the same species as the
recipient of the cell
replacement therapy, but is not the same individual. A cell transfer in which
the donor's
cells and have been histocompatibly matched with a recipient is sometimes
referred to as
a syngeneic transfer. The terms xenogeneic transfer, xenogeneic
transplantation,
xenograft and the like refer to treatments wherein the cell donor is of a
different species
than the recipient of the cell replacement therapy.
16
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
[0081] As used herein, an "antibody" includes whole antibodies and any antigen
binding
fragment or a single chain thereof. Thus the term "antibody" includes any
protein or
peptide containing molecule that comprises at least a portion of an
immunoglobulin
molecule. Examples of such include, but are not limited to a complementarity
determining
region (CDR) of a heavy or light chain or a ligand binding portion thereof, a
heavy chain or
light chain variable region, a heavy chain or light chain constant region, a
framework (FR)
region, or any portion thereof, or at least one portion of a binding protein.
In general, the
term "antibody" includes any polypeptide that includes at least one constant
domain,
including, but not limited to, CH1, CH2, CH3 and CL. Antibodies that find use
in the
present invention can take on a number of formats as described herein,
including
traditional antibodies as well as antibody derivatives, fragments and
mimetics.
[0082] The antibodies can be polyclonal or monoclonal and can be isolated from
any
suitable biological source, e.g., murine, rat, sheep and canine.
[0083] A monoclonal antibody is an antibody produced by a single clone of
cells or a
hybridoma, and therefore is a single pure homogeneous type of antibody.
[0084] A hybridoma is a cell that is produced in the laboratory from the
fusion of an
antibody-producing lymphocyte and a non-antibody producing cancer cell,
usually a
myeloma or lymphoma. A hybridoma proliferates and produces a continuous supply
of a
specific monoclonal antibody.
[0085] The term "human antibody" as used herein, is intended to include
antibodies
having variable and constant regions derived from human germline
immunoglobulin
sequences. The human antibodies of the invention may include amino acid
residues not
encoded by human germline immunoglobulin sequences (e.g., mutations introduced
by
random or site-specific mutagenesis in vitro or by somatic mutation in vivo).
However, the
term "human antibody" as used herein, is not intended to include antibodies in
which CDR
sequences derived from the germline of another mammalian species, such as a
mouse,
have been grafted onto human framework sequences. Thus, as used herein, the
term
"human antibody" refers to an antibody in which substantially every part of
the protein
(e.g., CDR, framework, CL, CH domains (e.g., CHi, CH2, CH3), hinge, (VL, VH))
is
substantially non-immunogenic in humans, with only minor sequence changes or
variations. Similarly, antibodies designated primate (monkey, baboon,
chimpanzee, etc.),
rodent (mouse, rat, rabbit, guinea pig, hamster, and the like) and other
mammals
17
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
designate such species, sub-genus, genus, sub-family, family specific
antibodies. Further,
chimeric antibodies include any combination of the above. Such changes or
variations
optionally and preferably retain or reduce the immunogenicity in humans or
other species
relative to non-modified antibodies. Thus, a human antibody is distinct from a
chimeric or
humanized antibody. It is pointed out that a human antibody can be produced by
a non-
human animal or prokaryotic or eukaryotic cell that is capable of expressing
functionally
rearranged human immunoglobulin (e.g., heavy chain and/or light chain) genes.
Further,
when a human antibody is a single chain antibody, it can comprise a linker
peptide that is
not found in native human antibodies. For example, an Fv can comprise a linker
peptide,
such as two to about eight glycine or other amino acid residues, which
connects the
variable region of the heavy chain and the variable region of the light chain.
Such linker
peptides are considered to be of human origin.
[0086] As used herein, a human antibody is "derived from" a particular
germline
sequence if the antibody is obtained from a system using human immunoglobulin
sequences, e.g., by immunizing a transgenic mouse carrying human
immunoglobulin
genes or by screening a human immunoglobulin gene library. A human antibody
that is
"derived from" a human germline immunoglobulin sequence can be identified as
such by
comparing the amino acid sequence of the human antibody to the amino acid
sequence of
human germline immunoglobulins. A selected human antibody typically is at
least 90%
identical in amino acids sequence to an amino acid sequence encoded by a human
germline immunoglobulin gene and contains amino acid residues that identify
the human
antibody as being human when compared to the germline immunoglobulin amino
acid
sequences of other species (e.g., murine germline sequences). In certain
cases, a human
antibody may be at least 95%, or even at least 96%, 97%, 98%, or 99% identical
in amino
acid sequence to the amino acid sequence encoded by the germline
immunoglobulin
gene. Typically, a human antibody derived from a particular human germline
sequence
will display no more than 10 amino acid differences from the amino acid
sequence
encoded by the human germline immunoglobulin gene. In certain cases, the human
antibody may display no more than 5, or even no more than 4, 3, 2, or 1 amino
acid
difference from the amino acid sequence encoded by the germline immunoglobulin
gene.
[0087] The term "recombinant human antibody", as used herein, includes all
human
antibodies that are prepared, expressed, created or isolated by recombinant
means, such
18
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
as antibodies isolated from an animal (e.g., a mouse) that is transgenic or
transchromosomal for human immunoglobulin genes or a hybridoma prepared
therefrom,
antibodies isolated from a host cell transformed to express the antibody,
e.g., from a
transfectoma, antibodies isolated from a recombinant, combinatorial human
antibody
library, and antibodies prepared, expressed, created or isolated by any other
means that
involve splicing of human immunoglobulin gene sequences to other DNA
sequences.
Such recombinant human antibodies have variable and constant regions derived
from
human germline immunoglobulin sequences. In certain embodiments, however, such
recombinant human antibodies can be subjected to in vitro mutagenesis (or,
when an
animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis)
and thus
the amino acid sequences of the VH and VL regions of the recombinant
antibodies are
sequences that, while derived from and related to human germline VH and VL
sequences,
may not naturally exist within the human antibody germline repertoire in vivo.
Methods to
making these antibodies are described herein.
[0088] "Isotype" as used herein is meant any of the subclasses of
immunoglobulins
defined by the chemical and antigenic characteristics of their constant
regions. It should
be understood that therapeutic antibodies can also comprise hybrids of
isotypes and/or
subclasses.
[0089] The terms "polyclonal antibody" or "polyclonal antibody composition" as
used
herein refer to a preparation of antibodies that are derived from different B-
cell lines. They
are a mixture of immunoglobulin molecules secreted against a specific antigen,
each
recognizing a different epitope.
[0090] The terms "monoclonal antibody" or "monoclonal antibody composition" as
used
herein refer to a preparation of antibody molecules of single molecular
composition. A
monoclonal antibody composition displays a single binding specificity and
affinity for a
particular epitope.
[0091] As used herein, the term "label" intends a directly or indirectly
detectable
compound or composition that is conjugated directly or indirectly to the
composition to be
detected, e.g., N-terminal histidine tags (N-His), magnetically active
isotopes, e.g., 1155n,
1175n and 1195n, a non-radioactive isotopes such as 130 and 15N,
polynucleotide or protein
such as an antibody so as to generate a "labeled" composition. The term also
includes
sequences conjugated to the polynucleotide that will provide a signal upon
expression of
19
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
the inserted sequences, such as green fluorescent protein (GFP) and the like.
The label
may be detectable by itself (e.g. radioisotope labels or fluorescent labels)
or, in the case
of an enzymatic label, may catalyze chemical alteration of a substrate
compound or
composition which is detectable. The labels can be suitable for small scale
detection or
more suitable for high-throughput screening. As such, suitable labels include,
but are not
limited to magnetically active isotopes, non-radioactive isotopes,
radioisotopes,
fluorochromes, chemiluminescent compounds, dyes, and proteins, including
enzymes.
The label may be simply detected or it may be quantified. A response that is
simply
detected generally comprises a response whose existence merely is confirmed,
whereas a
response that is quantified generally comprises a response having a
quantifiable (e.g.,
numerically reportable) value such as an intensity, polarization, and/or other
property. In
luminescence or fluorescence assays, the detectable response may be generated
directly
using a luminophore or fluorophore associated with an assay component actually
involved
in binding, or indirectly using a luminophore or fluorophore associated with
another (e.g.,
reporter or indicator) component.
[0092] Examples of luminescent labels that produce signals include, but are
not limited
to bioluminescence and chemiluminescence. Detectable luminescence response
generally comprises a change in, or an occurrence of, a luminescence signal.
Suitable
methods and luminophores for luminescently labeling assay components are known
in the
art and described for example in Haugland, Richard P. (1996) Handbook of
Fluorescent
Probes and Research Chemicals (61h ed.). Examples of luminescent probes
include, but
are not limited to, aequorin and luciferases.
[0093] Examples of suitable fluorescent labels include, but are not limited
to, fluorescein,
rhodamine, tetramethylrhodamine, eosin, erythrosin, coumarin, methyl-
coumarins, pyrene,
Malacite green, stilbene, Lucifer Yellow, Cascade BlueTM, and Texas Red. Other
suitable
optical dyes are described in the Haugland, Richard P. (1996) Handbook of
Fluorescent
Probes and Research Chemicals (61h ed.).
[0094] In another aspect, the fluorescent label is functional ized to
facilitate covalent
attachment to a cellular component present in or on the surface of the cell or
tissue such
as a cell surface marker. Suitable functional groups, including, but not are
limited to,
isothiocyanate groups, amino groups, haloacetyl groups, maleimides,
succinimidyl esters,
and sulfonyl halides, all of which may be used to attach the fluorescent label
to a second
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
molecule. The choice of the functional group of the fluorescent label will
depend on the
site of attachment to either a linker, the agent, the marker, or the second
labeling agent.
[0095] Although the present invention is described primarily with reference
to specific
embodiments, it is also envisioned that other embodiments will become apparent
to those
skilled in the art upon reading the present disclosure, and it is intended
that such
embodiments be contained within the present inventive methods.
Overview of the invention
[0096] The present invention is directed to methods and compositions for
modulating the
activity of the Toso protein (which is also interchangeably referred to herein
as "Toso" or
"Toso receptor" or "Faim3" or "FCMR"). In some embodiments, the methods and
compositions of the invention increase activity of the Toso protein. In other
embodiments,
the methods and compositions of the invention inhibit activity of the Toso
protein. In some
embodiments, compositions for modulating the activity of the Toso protein
include agents
that bind to the Toso protein or to a ligand of the Toso protein. In further
embodiments, the
compositions of the invention include a soluble Toso protein. As will be
discussed in
further detail herein, soluble Toso proteins of the invention include all or
part of the
extracellular domain of a Toso receptor. Soluble Toso proteins of the
invention may
further include a signal peptide and/or an Fc domain. Soluble Toso proteins of
the
invention may further include variant extracellular domains of a Toso protein,
including
deletion variants (variants in which one or more amino acids of the full
extracellular domain
are deleted) and variants comprising one or more amino acid substitutions.
[0097] The present invention is further directed to methods of treating
disorders and
diseases by administering a soluble Toso protein (or a variant thereof) to a
subject. As will
be discussed in further detail herein, soluble Toso proteins of the invention
can be used to
treat subjects suffering from without limitation an autoimmune disorder
(including without
limitation Type 1 or Type 2 diabetes, multiple sclerosis, or rheumatoid
arthritis), asthma,
allergy, chronic obstructive pulmonary disease ("COPD"), hyper-IgM syndrome,
CLL,
lupus, or a neutrophilia-associated disorder (including without limitation
neutropenia,
severe congenital neutropenia, cyclical neutropenia, antibody mediated
neutropenia,
reticular dysgenesis, leukocyte adhesion deficiency, familiar
myeloproliferative disease,
21
chronic myelogenous leukemia, familiar cold urticaria and leukocytosis, and
chronic
granulomatous disease).
II. Soluble Toso protein
[0098] Compositions of the invention include agents that modulate Toso
activity. Such
compositions, as will be discussed in further detail below, include without
limitation a
soluble form of the Toso protein.
[0099] A soluble Toso protein of the invention (also referred to
interchangeably herein
as the "soluble Toso receptor," "Toso-Fc", and "soluble Toso polypeptide")
includes all or
part of an extracellular domain of a Toso receptor. The soluble Toso proteins
of the
invention in further embodiment include a signal domain and/or an Fc domain.
As will be
discussed in further detail herein, these components of the soluble Toso
protein may be
combined in any way with or without additional components and/or modifications
to provide
a soluble Toso protein of the invention.
[00100] In one aspect, the soluble Toso protein of the invention comprises an
extracellular domain of Toso. In a still further embodiments, the soluble Toso
protein
comprises the extracellular domain of human Toso isoform a. The extracellular
domain of
human Toso is predicted to span amino acids P21 to G251 of NP_005440.1, human
Toso
isoform a (see Shima et al., Int. Immunol., 2010).
For the sake of clarity, the majority of the discussion herein is directed to
soluble
Toso proteins comprising all or part of an extracellular domain of a human
Toso protein.
However, it will be appreciated that the extracellular domain of a Toso
protein from any
species can be used to produce soluble Toso proteins in accordance with the
description
herein, and it would be well within the ability of one of skill in the art to
identify the regions
of the Toso protein from another species that correspond to the regions of the
human Toso
protein discussed herein.
[0100] In one embodiment, the soluble Toso protein comprises an extracellular
domain
sequence according to SEQ ID NO: 1, which is shown in FIG. 10. In a further
embodiment, the soluble Toso protein has a sequence identity of about 70%,
75%, 80%,
85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% identity to SEO
ID NO: 1. In a still further embodiment, the soluble Toso protein comprises a
polypeptide
22
CA 2867444 2017-08-23
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
with 1-75, 2-70, 3-65, 4-60, 5-55, 6-50, 7-45, 8-40, 9-35, 10-30, 11-25, 12-
20, 13-15, 5-20,
6-18, 8-16, 10-14 amino acid substitutions in SEQ ID NO: 1. In a yet further
embodiments,
the soluble Toso protein comprises a polypeptide with 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 amino
acid
substitutions in SEQ ID NO: 1.
[0101] In one embodiment, the soluble Toso protein comprises an
extracellular domain
sequence according to SEQ ID NO: 8, which is shown in FIG. 27. In a further
embodiment, the soluble Toso protein has a sequence identity of about 70%,
75%, 80%,
85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% identity to SEQ
ID NO: 8. In a still further embodiment, the soluble Toso protein comprises a
polypeptide
with 1-75, 2-70, 3-65, 4-60, 5-55, 6-50, 7-45, 8-40, 9-35, 10-30, 11-25, 12-
20, 13-15, 5-20,
6-18, 8-16, 10-14 amino acid substitutions in SEQ ID NO: 8. In a yet further
embodiments,
the soluble Toso protein comprises a polypeptide with 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 amino
acid
substitutions in SEQ ID NO: 8.
[0102] In a further embodiment and in accordance with any of the above, the
soluble
Toso protein of the invention includes amino acids 18 to 253 of SEQ ID NO: 7.
In a still
further embodiment, the soluble Toso protein of the invention includes amino
acids 21 to
253 of SEQ ID NO: 7. In a still further embodiment, the soluble Toso protein
includes
amino acids 21 to 251 of SEQ ID NO: 7. In a yet further embodiment, the
soluble Toso
protein includes any of the following ranges of amino acids from SEQ ID NO: 7:
1-255,5-
245, 10-235, 15-225, 20-215, 25-205, 30-195, 35-185, 40-175, 45-165, 50-155,
45-145,
40-135, 35-125, 30-115, 35-105, 40-95, 45-85, 50-75, 55-65. In a still further
embodiment,
the soluble Toso protein includes a sequence with a sequence identity of about
70%, 75%,
80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% identity
to
amino acids 18 to 253 or 21 to 253 of SEQ ID NO: 7.
[0103] In a still further embodiment and in accordance with any of the above,
the soluble
Toso protein of the invention includes all or a portion of SEQ ID NO: 8,
pictured in FIG. 27.
In still further embodiments, the soluble Toso protein includes amino acids 1-
231, 6-221,
11-211, 16-201, 21-191, 26-181, 31-171, 36-161, 41-151, 46-141, 51-131, 56-
121, 61-111,
66-101, 71-91, 76-81 of SEQ ID NO: 8. In yet further embodiments, the soluble
Toso
protein includes a polypeptide with at least 70%, 75%, 80%, 85%, 90%, 91%,
92%, 93%,
23
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
94%, 95%, 96%, 97%, 98%, 99% and 100% sequence identity to the amino acid
regions
1-231, 6-221, 11-211, 16-201, 21-191, 26-181, 31-171, 36-161, 41-151, 46-141,
51-131,
56-121, 61-111, 66-101, 71-91, 76-81 of SEQ ID NO: 8.
[0104] In a yet further embodiment, the soluble Toso protein of the invention
comprises
any one of SEQ ID NOs: 8, 9, 11, 13, 15, 17, 19, 21, and 23. In a still
further embodiment,
the soluble Toso protein includes a sequence with a sequence identity of about
70%, 75%,
80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% identity
to
SEQ ID NOs: 8,9, 11, 13, 15, 17, 19, 21, and 23. These sequences include
deletion
variants of the extracellular domain of the Toso receptor.
[0105] In still further embodiments and in accordance with any of the above,
the soluble
Toso protein of the invention comprises a deletion variant of the full
extracellular domain of
the Toso protein. In exemplary embodiments, the deletion variants that are a
component
of a soluble Toso protein of the invention include a polypeptide in which one
or more of the
following amino acids have been deleted from SEQ ID NO:8: 1-21, 1-35, 1-87,
both
regions 1-21 and 211-231, 211-231,154-231, 105-231, and 93-231. In further
exemplary
embodiments, the deletion variants that are a component of a soluble Toso
protein of the
invention include a polypeptide with a sequence identity of about 70%, 75%,
80%, 85%,
90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% to a polypeptide according to
SEQ ID NO:8 with one or more of the following amino acid regions deleted: 1-
21, 1-35, 1-
87, both regions 1-21 and 211-231, 211-231,154-231, 105-231, and 93-231.
[0106] In further embodiments and in accordance with any of the above, the
soluble
Toso protein of the invention includes an extracellular domain component that
comprises
regions that bind to a ligand of the Toso receptor. In an exemplary
embodiment, the
soluble Toso protein of the invention includes an extracellular domain
component that
binds to IgM. In a still further embodiment, the soluble Toso protein of the
invention
includes amino acids 35 to 87 of SEQ ID NO: 8. In further exemplary
embodiments, the
soluble Toso protein of the invention includes amino acids 25-100, 29-95, 33-
90, 37-85,
41-80, 45-75, 49-70, 53-65, or 57-60 of SEQ ID NO: 8.
[0107] In a further aspect and in accordance with any of the above, the
soluble Toso
protein of the invention includes an extracellular domain component as is
discussed above
and further includes a signal sequence. In an exemplary embodiment, the signal
sequence enhances secretion from host cells. In a yet further embodiment, the
signal
24
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
sequence includes without limitation a member selected from an IL-2 signal
sequence, a-
mating factor pre-sequence from Saccharomyces cerevisiae, a-amylase signal
sequence
from Aspergillus niger, Glucoamylase signal sequence from Aspergillus awamori,
Serum
albumin signal sequence from Homo sapiens, Inulinase signal sequence from
Kluyveromcyes maxianus, Invertase signal sequence from Saccharomyces
cerevisiae,
Killer protein signal sequence from Saccharomyces cerevisiae, Lysozyme signal
sequence from Gallus gallus. In a still further embodiment, the signal
sequence comprises
a sequence according to SEQ ID NO: 2, which is shown in FIG. 10. In a still
further
embodiment, the signal sequence comprises a sequence with a sequence identity
of about
70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and
100% identity to SEQ ID NO: 2. In specific embodiments, the soluble Toso
protein of the
invention comprises any one of SEQ ID NOs: 1, 8, 9, 11, 13, 15, 17,21 and 23
or variants
of those sequences as a fusion protein with SEQ ID NO: 2 or with a sequence
with an
identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 98%, 97%,
98%, 99% and 100% identity to SEQ ID NO: 2.
[0108] In a further aspect and in accordance with any of the above, a soluble
Toso
protein of the invention comprises an extracellular domain of a Toso receptor
and an Fc
domain. In an exemplary embodiment, the soluble Toso protein is a fusion
protein
comprising the extracellular domain of isoform A of the human Toso protein and
an Fc
domain. In a further embodiment, the Fc domain includes any domain that
enhances the
half-life of the protein as compared to the protein without the Fc domain. In
a still further
embodiment, the Fc domain includes any domain that improves the
pharmacokinetic
profile of the protein as compared to the protein without the Fc domain. In a
still further
embodiment, the Fc domain is derived from human IgG1 at the C-terminus, which
in a yet
further embodiment includes mutations that diminish or ablate antibody-
dependent and
complement dependent cytotoxicity. In a still further embodiment, such
mutations include
one or more of the following mutations singly or in any combination: E233P;
L234V;
L235A; AG236; A327G; A330S; P331S. In a yet further embodiment, the Fc domain
comprises a sequence according to SEQ ID NO: 3, which is shown in FIG. 10. In
a still
further embodiment, the Fc domain comprises a sequence with a sequence
identity of
about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%
and 100% identity to SEQ ID NO: 3.
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
[0109] In further exemplary embodiments, the soluble Toso protein of the
invention
comprises a fusion protein comprising both an extracellular domain component
and an Fc
domain component. In still further exemplary embodiments, the soluble Toso
protein of
the invention comprises SEQ ID NOs: 1, 8, 9, 11, 13, 15, 17,21 and 23 or
variants of
those sequences as a fusion protein with SEQ ID NO: 3 or with a sequence with
an identity
of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%
and 100% identity to SEQ ID NO: 3.
[0110] In one aspect and in accordance with any of the above, the soluble Toso
protein
of the invention comprises an extracellular Toso domain, a signal sequence and
an Fc
domain - each of those components may comprise any of the above described
versions of
these components in any combination. In a still further embodiment, the
soluble Toso
protein of the invention comprises a sequence according to SEQ ID NO: 5, which
is shown
in FIG. 8. In a still further embodiment, the soluble Toso protein of the
invention
comprises a sequence with a sequence identity of about 70%, 75%, 80%, 85%,
90%, 91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% identity to SEQ ID NO: 5.
[0111] In further embodiments and in accordance with any of the above, the
soluble
Toso protein of the invention comprises a sequence according to any one of SEQ
ID NOs.
10, 12, 14, 16, 18, 20, 22 and 24, which comprise an extracellular domain
component, a
signal sequence, and an Fc domain. In further embodiments, the soluble Toso
protein of
the invention comprises a sequence with a sequence identity of about 70%, 75%,
80%,
85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100% to any one of
SEQ ID NOs. 10, 12, 14, 16, 18, 20, 22 and 24.
[0112] In further aspects and in accordance with any of the above, a soluble
Toso
protein of the invention may further include a linker between the Toso
extracellular domain
component and the Fc domain, between the Toso extracellular domain component
and the
signal sequence, or between both the Toso extracellular domain component and
the Fc
domain and the Toso extracellular domain component and the signal sequence. In
exemplary embodiments, such a linker may be an amino acid linker, a polymeric
linker, or
any other linker known in the art to be effective for joining two amino acid
sequences
together. In further exemplary embodiments, the linker is an amino acid
linker. In still
further embodiments, the linker is the amino acid sequence: ISAMVRS (SEQ ID
NO: 25).
26
In yet further embodiments, the linker is a variant of SEQ ID NO: 25
containing 1, 2, 3, 4,
5, or 6 amino acid substitutions.
[0113] In further embodiments and in accordance with any of the above,
variants of the
soluble Toso proteins of the invention can be made through modification of the
amino acid
sequences of any of the soluble Toso proteins discussed herein, including SEQ
ID NOs. 5,
6, or 8-24. Such modifications can be achieved using any known technique in
the art e.g.,
site-directed mutagenesis or PCR based mutagenesis. Such techniques are
described for
example in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold
Spring Harbor
Press, Plainview, N.Y., 1989 and Ausubel et al., Current Protocols in
Molecular Biology,
John Wiley & Sons, New York, N.Y.
[0114] In still further embodiments and in accordance with any of the above,
soluble
Toso proteins of the invention may be in monomeric or multimeric forms,
wherein each
monomer of the multimer comprises a single extracellular domain sequence. In
further
embodiments, the soluble Toso proteins of the invention are in multimers of 2,
3, 4, 5, 6, 7,
8, 9, 10 or more monomers. In a specific embodiment, soluble Toso proteins are
multimers of 6 monomers. In a further embodiment, a hexameric Toso multimer is
formed
of monomers comprising a hexamerization tag. In a further embodiment, the
hexamerization tag comprises a 21 amino acid tail piece from human IgA alpha
heavy
chain constant region as described in Hirano et al., Blood (2006).
In yet a further embodiment, the
hexamerization tag of the invention includes a sequence according to SEQ ID
NO: 4,
shown in FIG. 10.
[0115] In further embodiments and in accordance with any of the above, the
soluble
Toso protein of the invention is modified to alter one or more functional
properties of the
protein. In exemplary embodiments, the soluble Toso protein is chemically
modified. For
example, the soluble Toso protein may be modified with one or more polymers to
improve
its stability in vivo and/or alter its pharrnacokinetic profile. Such polymers
include without
limitation one or more of a variety of nonproteinaceous polymers, e.g.,
polyethylene glycol,
polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Pat
Nos.
27
CA 2867444 2017-08-23
4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192; or 4,179,337.
[0116] Modifications of the Toso soluble protein included within the scope of
this
invention include reacting targeted amino acid residues of a Toso polypeptide
in
accordance with any of the sequences and soluble Toso proteins discussed above
with an
organic derivatizing agent that is capable of reacting with selected side
chains or the N-or
C-terminal residues of a Toso polypeptide. Commonly used crosslinking agents
include,
e.g., 1,1-bis(diazoacetyI)-2-phenylethane, glutaraldehyde, N-
hydroxysuccinimide esters,
for example, esters with 4-azidosalicylic acid, homobifunctional imidoesters,
including
disuccinimidyl esters such as 3,3'-dithiobis(succinimidylpropionate),
bifunctional
maleimides such as bis-N-maleimido-1,8-octane and agents such as methyl-3-[(p-
azidophenyl)dithio]proploimidate.
[0117] Other modifications include deamidation of glutaminyl and asparaginyl
residues
to the corresponding glutamyl and aspartyl residues, respectively,
hydroxylation of proline
and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues,
methylation of
the "-amino groups of lysine, arginine, and histidine side chains [T. E.
Creighton, Proteins;
Structure and Molecular Properties, W. H. Freeman & Co., San Francisco, pp. 79-
86
(1983)], acetylation of the N-terminal amine, and amidation of any C-terminal
carboxyl
group.
[0118] Another type of modification of the soluble Toso protein included
within the scope
of this invention comprises altering the native glycosylation pattern of the
polypeptide.
"Altering the native glycosylation pattern" is intended for purposes herein to
mean deleting
one or more carbohydrate moieties found in native sequence Toso polypeptide,
and/or
adding one or more glycosylation sites that are not present in the native
sequence Toso
polypeptide.
[0119] Addition of glycosylation sites to Toso soluble protein may be
accomplished by
altering the amino acid sequence thereof. The alteration may be made, for
example, by the
addition of, or substitution by, one or more serine or threonine residues to
the native
sequence the soluble Toso protein (for 0-linked glycosylation sites). The
soluble Toso
protein amino acid sequence may optionally be altered through changes at the
DNA level,
28
CA 2867444 2017-08-23
particularly by mutating the DNA encoding the Toso soluble protein at
preselected bases
such that codons are generated that will translate into the desired amino
acids.
[0120] Another means of increasing the number of carbohydrate moieties on the
Toso
soluble protein is by chemical or enzymatic coupling of glycosides to the
polypeptide. Such
methods are described in the art, e.g., in WO 87105330 published Sep. 11,
1987, and in
Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981).
[0121] Removal of carbohydrate moieties present on the soluble Toso protein
may be
accomplished chemically or enzymatically or by mutational substitution of
codons encoding
for amino acid residues that serve as targets for glycosylation. Chemical
deglycosylation
techniques are known in the art and described, for instance, by Hakimuddin, et
al., Arch.
Biochem. Biophys., 259:52 (1987) and by Edge, et al., Anal. Biochem.,
118:131(1981).
Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by
the use
of a variety of endo-and exo-glycosidases as described by Thotakura, et al.,
Meth.
Enzymol., 138:350 (1987).
[0122] The soluble Toso protein of the present invention may also be modified
in a way
to form chimeric molecules comprising the protein fused to another,
heterologous
polypeptide or amino acid sequence. In one embodiment, such a chimeric
molecule
comprises a fusion of a soluble Toso polypeptide with a tag polypeptide which
provides an
epitope to which an anti-tag antibody can selectively bind. The epitope tag is
generally
placed at the amino-or carboxyl-terminus of the Toso polypeptide. The presence
of such
epitope-tagged forms of a Toso polypeptide can be detected using an antibody
against the
tag polypeptide. Also, provision of the epitope tag enables the Toso
polypeptide to be
readily purified by affinity purification using an anti-tag antibody or
another type of affinity
matrix that binds to the epitope tag. In an alternative embodiment, the
chimeric molecule
may comprise a fusion of a Toso polypeptide with an immunoglobulin or a
particular region
of an immunoglobulin. For a bivalent form of the chimeric molecule, such a
fusion could be
to the Fc region of an IgG molecule or GST fusions.
29
CA 2867444 2017-08-23
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
[0123] Various tag polypeptides and their respective antibodies are well known
in the
art. Examples include poly-histidine (poly-his) or poly-histidine-glycine
(poly-his-gly) tags;
the flu HA tag polypeptide and its antibody 12CA5 [Field, et al., Mol. Cell
Biol., 8:2159-
2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7, and 9E10
antibodies thereto
[Evan, et al., Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the
Herpes Simplex
virus glycoprotein D (go) tag and its antibody [Paborsky, et al., Protein
Engineering,
3(6):547-553 (1990)]. Other tag polypeptides include the Flag-peptide [Hopp,
et al.,
BioTechnology, 6:1204-1210 (1988)]; the KT3 epitope peptide [Martin, et al.,
Science,
255:192-194 (1992)]; tubulin epitope peptide [Skinner, et al., J. Biol. Chem.,
266:15163-
15166 (1991)]; and the 17 gene 10 protein peptide tag [Lutz-Freyermuth, et
al., Proc. Natl.
Acad. Sci. USA, 87;6393-6397 (1990)].
[0124] In further embodiments and in accordance with any of the above, a
soluble Toso
protein of the invention is fused with a cell penetrating peptide.
[0125] In further aspects, the present invention encompasses nucleic acids
encoding
one or more soluble Toso proteins as well as host cells comprising such
nucleic acids. In
certain embodiments, host cells used in accordance with the present invention
include
without limitation HEK293F, HEK298T, Cos7, HeLa, and CHO-DHFR deficient cells.
In
still further embodiments, soluble Toso proteins of the invention are stably
expressed in a
cell line that has been modified to grow in a serum-free suspension.
[0126] In further aspects, compositions of the invention may include any of
the soluble
Toso proteins discussed herein along with additives and pharmaceutically
acceptable
carriers. As used herein, "pharmaceutically acceptable carrier" includes any
material,
which when combined with the conjugate retains the conjugates' activity and is
non-
reactive with the subject's immune systems. Examples include, but are not
limited to, any
of the standard pharmaceutical carriers such as a phosphate buffered saline
solution,
water, emulsions such as oil/water emulsion, and various types of wetting
agents. Other
carriers may also include sterile solutions, tablets including coated tablets
and capsules.
Typically such carriers contain excipients such as starch, milk, sugar,
certain types of clay,
gelatin, stearic acid or salts thereof, magnesium or calcium stearate, talc,
vegetable fats or
oils, gums, glycols, or other known excipients. Such carriers may also include
flavor and
color additives or other ingredients. Compositions comprising such carriers
are formulated
by well known conventional methods.
ilL Antibodies to Toso
[0127] In one aspect, the present invention provides an antibody that binds to
the Toso
protein. In some embodiments, antibodies of the invention increase Toso
activity. In other
embodiments, antibodies of the invention decrease Toso activity.
[0128] Methods of preparing antibodies are generally known in the art. For
example,
United States Patent No. 6,727,350 discloses an antibody directed to Toso.
[0129] An antibody of the invention may be a polyclonal antibody, monoclonal
antibody,
chimeric antibody, humanized antibody or a derivative or fragment thereof as
defined
below. In one aspect, a fragment comprises, or alternatively consists
essentially of, or yet
further consists of the CDR of an antibody. In one aspect, an antibody of the
invention is
detectably labeled or further comprises a detectable label conjugated to it.
Also provided
is a hybridoma cell line that produces a monoclonal antibody of this
invention.
Compositions comprising one or more of the above embodiments are further
provided
herein.
[0130] Also provided is a composition comprising the antibody and a carrier.
Further
provided is a biologically active fragment of the antibody, or a composition
comprising the
antibody fragment. Suitable carriers are defined supra.
[0131] Further provided is an antibody-peptide complex comprising, or
alternatively
consisting essentially of, or yet alternatively consisting of, the antibody
and a polypeptide
specifically bound to the antibody. In one aspect, the polypeptide is the
chimeric
polypeptide against which the antibody is raised.
[0132] This invention also provides an antibody capable of specifically
forming a
complex with Toso, which are useful in the therapeutic methods of this
invention.
Antibodies of the invention include, but are not limited to mouse, rat, and
rabbit or human
antibodies. Antibodies can be produced in cell culture, in phage, or in
various animals,
including but not limited to cows, rabbits, goats, mice, rats, hamsters,
guinea pigs, sheep,
dogs, cats, monkeys, chimpanzees, apes, etc. The antibodies are also useful to
identify
and purify therapeutic polypeptides.
[0133] This invention also provides an antibody-peptide complex comprising, or
alternatively consisting essentially of, or yet alternatively consisting of,
antibodies
31
CA 2867444 2017-08-23
described above and a polypeptide specifically bound to the antibody. In one
aspect the
polypeptide is the polypeptide against which the antibody was raised. In one
aspect the
antibody-peptide complex is an isolated complex. In a further aspect, the
antibody of the
complex is, but not limited to, a polyclonal antibody, a monoclonal antibody,
a humanized
antibody or an antibody derivative described herein. Either or both of the
antibody or
peptide of the antibody-peptide complex can be detectably labeled or further
comprises a
detectable label conjugated to it. In one aspect, the antibody-peptide complex
of the
invention can be used as a control or reference sample in diagnostic or
screening assays.
[0134] Polyclonal antibodies of the invention can be generated using
conventional
techniques known in the art and are well-described in the literature. Several
methodologies exist for production of polyclonal antibodies. For example,
polyclonal
antibodies are typically produced by immunization of a suitable mammal such
as, but not
limited to, chickens, goats, guinea pigs, hamsters, horses, lhamas, mice,
rats, and rabbits.
An antigen is injected into the mammal, which induces the B-lymphocytes to
produce IgG
immunoglobulins specific for the antigen. This IgG is purified from the
mammal's serum.
Variations of this methodology include modification of adjuvants, routes and
site of
administration, injection volumes per site and the number of sites per animal
for optimal
production and humane treatment of the animal. For example, adjuvants
typically are
used to improve or enhance an immune response to antigens. Most adjuvants
provide for
an injection site antigen depot, which allows for a slow release of antigen
into draining
lymph nodes. Other adjuvants include surfactants which promote concentration
of protein
antigen molecules over a large surface area and immunostimulatory molecules.
Non-
limiting examples of adjuvants for polyclonal antibody generation include
Freund's
adjuvants, Ribi adjuvant system, and Titermax. Polyclonal antibodies can be
generated
using methods described in U.S. Patent Nos. 7,279,559; 7,119,179; 7,060,800;
6,709,659;
6,656,746; 6,322,788; 5,686,073; and 5,670,153.
[0135] The monoclonal antibodies of the invention can be generated using
conventional
hybridoma techniques known in the art and well-described in the literature.
For example, a
hybridoma is produced by fusing a suitable immortal cell line (e.g., a myeloma
cell line
such as, but not limited to, Sp2/0, Sp2/0-AG14, NSO, NS1, NS2, AE-1, L.5,
>243,
32
CA 2867444 2017-08-23
P3X63Ag8.653, Sp2 SA3, Sp2 MAI, Sp2 SS1, Sp2 SA5, U397, MLA 144, ACT IV,
MOLT4,
DA-1, JURKAT, WEHI, K-562, COS, RAJI, NIH 313, HL-60, MLA 144, NAMAIWA, NEURO
2A, CHO, PerC.6, YB2/0) or the like, or heteromyelomas, fusion products
thereof, or any
cell or fusion cell derived therefrom, or any other suitable cell line as
known in the art,
with antibody producing cells, such as, but not limited to, isolated or cloned
spleen,
peripheral blood, lymph, tonsil, or other immune or B cell containing cells,
or any other
cells expressing heavy or light chain constant or variable or framework or CDR
sequences,
either as endogenous or heterologous nucleic acid, as recombinant or
endogenous, viral,
bacterial, algal, prokaryotic, amphibian, insect, reptilian, fish, mammalian,
rodent, equine,
ovine, goat, sheep, primate, eukaryotic, genomic DNA, cDNA, rDNA,
mitochondrial DNA or
RNA, chloroplast DNA or RNA, hnRNA, mRNA, tRNA, single, double or triple
stranded,
hybridized, and the like or any combination thereof. Antibody producing cells
can also be
obtained from the peripheral blood or, preferably the spleen or lymph nodes,
of humans or
other suitable animals that have been immunized with the antigen of interest.
Any other
suitable host cell can also be used for expressing-heterologous or endogenous
nucleic
acid encoding an antibody, specified fragment or variant thereof, of the
present invention.
The fused cells (hybridomas) or recombinant cells can be isolated using
selective culture
conditions or other suitable known methods, and cloned by limiting dilution or
cell sorting,
or other known methods.
[0136] In one embodiment, the antibodies described herein can be generated
using a
Multiple Antigenic Peptide (MAP) system. The MAP system utilizes a peptidyl
core of
three or seven radially branched lysine residues, on to which the antigen
peptides of
interest can be built using standard solid-phase chemistry. The lysine core
yields the MAP
bearing about 4 to 8 copies of the peptide epitope depending on the inner core
that
generally accounts for less than 10% of total molecular weight. The MAP system
does not
require a carrier protein for conjugation. The high molar ratio and dense
packing of
multiple copies of the antigenic epitope in a MAP has been shown to produce
strong
immunogenic response. This method is described in U.S. Patent No. 5,229,490.
33
CA 2867444 2017-08-23
[0137] Other suitable methods of producing or isolating antibodies of the
requisite
specificity can be used, including, but not limited to, methods that select
recombinant
antibody from a peptide or protein library (e.g., but not limited to, a
bacteriophage,
ribosome, oligonucleotide, RNA, cDNA, or the like, display library; e.g., as
available from
various commercial vendors such as Cambridge Antibody Technologies
(Cambridgeshire,
UK), MorphoSys (Martinsreid/Planegg, Del.), Biovation (Aberdeen, Scotland, UK)
Biolnvent (Lund, Sweden), using methods known in the art. See U.S. Patent Nos.
4,704,692; 5,723,323; 5,763,192; 5,814,476; 5,817,483; 5,824,514; 5,976,862.
Alternative methods rely upon
immunization of transgenic animals (e.g., SCID mice, Nguyen et al. (1997)
Microbiol.
lmmunol. 41:901-907; Sandhu et al. (1996) Crit. Rev. Biotechnol. 16:95-118;
Eren et al.
(1998) lmmunol. 93:154-161 that are capable of producing a repertoire of human
antibodies, as known in the art and/or as described herein. Such techniques,
include, but
are not limited to, ribosome display (Hanes et al. (1997) Proc. Nat Acad. Sci.
USA
94:4937-4942; Hanes et al. (1998) Proc. Natl. Acad. Sci. USA 95:14130-14135);
single cell
antibody producing technologies (e.g., selected lymphocyte antibody method
("SLAM")
(U.S. Patent No. 5,627,052, Wen et al. (1987) J. lmmunol. 17:887-892; Babcook
et al.
(1996) Proc. Natl. Acad. Sci. USA 93:7843-7848); gel microdroplet and flow
cytometry
(Powell et al. (1990) Biotechnol. 8:333-337; One Cell Systems, (Cambridge,
Mass); Gray
et al. (1995) J. Imm. Meth. 182:155-163; and Kenny et al. (1995) Bio. Technol.
13:787-
790); B-cell selection (Steenbakkers et al. (1994) Molec. Biol. Reports 19:125-
134.
[0138] Antibody derivatives of the present invention can also be prepared by
delivering a
polynucleotide encoding an antibody of this invention to a suitable host such
as to provide
transgenic animals or mammals, such as goats, cows, horses, sheep, and the
like, that
produce such antibodies in their milk. These methods are known in the art and
are
described for example in U.S. Patent Nos. 5,827,690; 5,849,992; 4,873,316;
5,849,992;
5,994,616; 5,565,362; and 5,304,489.
34
CA 2867444 2017-08-23
[0139] The term "antibody derivative" includes post-translational modification
to linear
polypeptide sequence of the antibody or fragment. For example, U.S. Patent No.
6,602,684 B1, describes a method for
the generation of modified glycol-forms of antibodies, including whole
antibody molecules,
antibody fragments, or fusion proteins that include a region equivalent to the
Fc region of
an immunoglobulin, having enhanced Fc-mediated cellular toxicity, and
glycoproteins so
generated.
[0140] Antibody derivatives also can be prepared by delivering a
polynucleotide of this
invention to provide transgenic plants and cultured plant cells (e.g., but not
limited to
tobacco, maize, and duckweed) that produce such antibodies, specified portions
or
variants in the plant parts or in cells cultured therefrom. For example,
Cramer et al.
(1999) Curr. Top. Microbol. Immunol. 240:95-118 and references cited therein,
describe
the production of transgenic tobacco leaves expressing large amounts of
recombinant
proteins, e.g., using an inducible promoter. Transgenic maize have been used
to express
mammalian proteins at commercial production levels, with biological activities
equivalent to
those produced in other recombinant systems or purified from natural sources.
See, e.g.,
Hood et al. (1999) Adv. Exp. Med. Biol. 464:127-147 and references cited
therein.
Antibody derivatives have also been produced in large amounts from transgenic
plant
seeds including antibody fragments, such as single chain antibodies (scFv's),
including
tobacco seeds and potato tubers. See, e.g., Conrad et al. (1998) Plant Mol.
Biol. 38:101-
109 and reference cited therein. Thus, antibodies of the present invention can
also be
produced using transgenic plants, according to know methods.
[0141] Antibody derivatives also can be produced, for example, by adding
exogenous
sequences to modify immunogenicity or reduce, enhance or modify binding,
affinity, on-
rate, off-rate, avidity, specificity, half-life, or any other suitable
characteristic. Generally
part or all of the non-human or human CDR sequences are maintained while the
non-
human sequences of the variable and constant regions are replaced with human
or other
amino acids.
[0142] In general, the CDR residues (an example of an antibody fragment) are
directly
and most substantially involved in influencing antigen binding. Humanization
or
engineering of antibodies of the present invention can be performed using any
known
CA 2867444 2017-08-23
method such as, but not limited to, those described in U.S. Patent Nos.
5,723,323;
5,976,862; 5,824,514; 5,817,483; 5,814,476; 5,763,192; 5,723,323; 5,766,886;
5,714,352;
6,204,023; 6,180,370; 5,693,762; 5,530,101; 5,585,089; 5,225,539; and
4,816,567.
[0143] Techniques for making partially to fully human antibodies are known in
the art
and any such techniques can be used. According to one embodiment, fully human
antibody sequences are made in a transgenic mouse which has been engineered to
express human heavy and light chain antibody genes. Multiple strains of such
transgenic
mice have been made which can produce different classes of antibodies. B cells
from
transgenic mice which are producing a desirable antibody can be fused to make
hybridoma cell lines for continuous production of the desired antibody. (See
for example,
Russel et al. (2000) Infection and Immunity 68(4)1820-1826; Gallo et al.
(2000) European
J. of Immun. 30:534-540; Green (1999) J. of Immun. Methods 231:11-23; Yang et
al.
(1999A) J. of Leukocyte Biology 66:401-410; Yang (1999B) Cancer Research
59(6):1236-
1243; Jakobovits (1998) Advanced Drug Delivery Reviews 31:33-42; Green &
Jakobovits
(1998) J. Exp. Med. 188(3):483-495; Jakobovits (1998) Exp. Opin. Invest. Drugs
7(4):607-
614; Tsuda et al. (1997) Genomics 42:413-421; Sherman-Gold (1997) Genetic
Engineering News 17(14); Mendez et al. (1997) Nature Genetics 15:146-156;
Jakobovits
(1996) Weir's Handbook of Experimental Immunology, The Integrated Immune
System
Vol. IV, 194.1-194.7; Jakobovits (1995) Current Opinion in Biotechnology 6:561-
566;
Mendez et al. (1995) Genomics 26:294-307; Jakobovits (1994) Current Biology
4(8):761-
763; Arbones et al. (1994) Immunity 1(4):247-260; Jakobovits (1993) Nature
362(6417):255-258; Jakobovits et al. (1993) Proc. Natl. Acad. Sci. USA
90(6):2551-2555;
and U.S. Patent No. 6,075,181.)
[0144] The antibodies of this invention also can be modified to create
chimeric
antibodies. Chimeric antibodies are those in which the various domains of the
antibodies'
heavy and light chains are coded for by DNA from more than one species. See,
e.g., U.S.
Patent No. 4,816,567.
[0145] Alternatively, the antibodies of this invention can also be modified to
create
veneered antibodies. Veneered antibodies are those in which the exterior amino
acid
residues of the antibody of one species are judiciously replaced or 'Veneered"
with those
36
CA 2867444 2017-08-23
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
of a second species so that the antibodies of the first species will not be
immunogenic in
the second species thereby reducing the immunogenicity of the antibody. Since
the
antigenicity of a protein is primarily dependent on the nature of its surface,
the
immunogenicity of an antibody could be reduced by replacing the exposed
residues which
differ from those usually found in another mammalian species antibodies. This
judicious
replacement of exterior residues should have little, or no, effect on the
interior domains, or
on the interdomain contacts. Thus, ligand binding properties should be
unaffected as a
consequence of alterations which are limited to the variable region framework
residues.
The process is referred to as "veneering" since only the outer surface or skin
of the
antibody is altered, the supporting residues remain undisturbed.
[0146] The procedure for "veneering" makes use of the available sequence data
for
human antibody variable domains compiled by Kabat et al. (1987) Sequences of
Proteins
of Immunological Interest, 4th ed., Bethesda, Md., National Institutes of
Health, updates to
this database, and other accessible U.S. and foreign databases (both nucleic
acid and
protein). Non-limiting examples of the methods used to generate veneered
antibodies
include EP 519596; U.S. Patent No. 6,797,492; and described in PadIan et al.
(1991) Mol.
lmmunol. 28(4-5):489-498.
[0147] The term "antibody derivative" also includes "diabodies" which are
small antibody
fragments with two antigen-binding sites, wherein fragments comprise a heavy
chain
variable domain (VH) connected to a light chain variable domain (VL) in the
same
polypeptide chain. (See for example, EP 404,097; WO 93/11161; and Hollinger et
al.
(1993) Proc. Natl. Acad. Sci. USA 90:6444-6448.) By using a linker that is too
short to
allow pairing between the two domains on the same chain, the domains are
forced to pair
with the complementary domains of another chain and create two antigen-binding
sites.
(See also, U.S. Patent No. 6,632,926 to Chen et al. which discloses antibody
variants that
have one or more amino acids inserted into a hypervariable region of the
parent antibody
and a binding affinity for a target antigen which is at least about two fold
stronger than the
binding affinity of the parent antibody for the antigen.)
[0148] The term "antibody derivative" further includes "linear antibodies".
The procedure
for making linear antibodies is known in the art and described in Zapata et
al. (1995)
Protein Eng. 8(10):1057-1062. Briefly, these antibodies comprise a pair of
tandem Fd
37
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
segments (VH -CH 1-VH -CHI) which form a pair of antigen binding regions.
Linear
antibodies can be bispecific or monospecific.
[0149] The antibodies of this invention can be recovered and purified from
recombinant
cell cultures by known methods including, but not limited to, protein A
purification,
ammonium sulfate or ethanol precipitation, acid extraction, anion or cation
exchange
chromatography, phosphocellulose chromatography, hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite chromatography and
lectin
chromatography. High performance liquid chromatography ("HPLC") can also be
used for
purification.
[0150] Antibodies of the present invention include naturally purified
products, products of
chemical synthetic procedures, and products produced by recombinant techniques
from a
eukaryotic host, including, for example, yeast, higher plant, insect and
mammalian cells, or
alternatively from a prokaryotic cells as described above.
[0151] If a monoclonal antibody being tested binds with protein or
polypeptide, then the
antibody being tested and the antibodies provided by the hybridomas of this
invention are
equivalent. It also is possible to determine without undue experimentation,
whether an
antibody has the same specificity as the monoclonal antibody of this invention
by
determining whether the antibody being tested prevents a monoclonal antibody
of this
invention from binding the protein or polypeptide with which the monoclonal
antibody is
normally reactive. If the antibody being tested competes with the monoclonal
antibody of
the invention as shown by a decrease in binding by the monoclonal antibody of
this
invention, then it is likely that the two antibodies bind to the same or a
closely related
epitope. Alternatively, one can pre-incubate the monoclonal antibody of this
invention with
a protein with which it is normally reactive, and determine if the monoclonal
antibody being
tested is inhibited in its ability to bind the antigen. If the monoclonal
antibody being tested
is inhibited then, in all likelihood, it has the same, or a closely related,
epitopic specificity
as the monoclonal antibody of this invention.
[0152] The term "antibody" also is intended to include antibodies of all
isotypes.
Particular isotypes of a monoclonal antibody can be prepared either directly
by selecting
from the initial fusion, or prepared secondarily, from a parental hybridoma
secreting a
monoclonal antibody of different isotype by using the sib selection technique
to isolate
38
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
class switch variants using the procedure described in Steplewski et al.
(1985) Proc. Natl.
Acad. Sci. USA 82:8653 or Spira et al. (1984) J. Immunol. Methods 74:307.
[0153] The isolation of other hybridomas secreting monoclonal antibodies with
the
specificity of the monoclonal antibodies of the invention can also be
accomplished by one
of ordinary skill in the art by producing anti-idiotypic antibodies. Herlyn et
al. (1986)
Science 232:100. An anti-idiotypic antibody is an antibody which recognizes
unique
determinants present on the monoclonal antibody produced by the hybridoma of
interest.
[0154] ldiotypic identity between monoclonal antibodies of two hybridomas
demonstrates that the two monoclonal antibodies are the same with respect to
their
recognition of the same epitopic determinant. Thus, by using antibodies to the
epitopic
determinants on a monoclonal antibody it is possible to identify other
hybridomas
expressing monoclonal antibodies of the same epitopic specificity.
[0155] It is also possible to use the anti-idiotype technology to produce
monoclonal
antibodies which mimic an epitope. For example, an anti-idiotypic monoclonal
antibody
made to a first monoclonal antibody will have a binding domain in the
hypervariable region
which is the mirror image of the epitope bound by the first monoclonal
antibody. Thus, in
this instance, the anti-idiotypic monoclonal antibody could be used for
immunization for
production of these antibodies.
[0156] In some aspects of this invention, it will be useful to detectably or
therapeutically
label the antibody. Methods for conjugating antibodies to these agents are
known in the
art. For the purpose of illustration only, antibodies can be labeled with a
detectable moiety
such as a radioactive atom, a chromophore, a fluorophore, or the like. Such
labeled
antibodies can be used for diagnostic techniques, either in vivo, or in an
isolated test
sample.
[0157] The coupling of antibodies to low molecular weight haptens can increase
the
sensitivity of the antibody in an assay. The haptens can then be specifically
detected by
means of a second reaction. For example, it is common to use haptens such as
biotin,
which reacts avidin, or dinitrophenol, pyridoxal, and fluorescein, which can
react with
specific anti-hapten antibodies. See, Harlow & Lane (1988) supra.
[0158] The antibodies of the invention also can be bound to many different
carriers.
Thus, this invention also provides compositions containing the antibodies and
another
substance, active or inert. Examples of well-known carriers include glass,
polystyrene,
39
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
polypropylene, polyethylene, dextran, nylon, amylases, natural and modified
celluloses,
polyacrylamides, agaroses and magnetite. The nature of the carrier can be
either soluble
or insoluble for purposes of the invention. Those skilled in the art will know
of other
suitable carriers for binding monoclonal antibodies, or will be able to
ascertain such, using
routine experimentation.
[0159] In certain embodiments, antibodies of the invention include mutations
in the
constant region that improve pharmacokinetic properties of the antibodies as
compared to
antibodies without such mutations. Such antibodies will in certain embodiments
include an
Fc domain that is derived from human IgG1 at the C-terminus, which in yet
further
embodiments include mutations that diminish or ablate antibody-dependent and
complement dependent cytotoxicity. In a still further embodiment, such
mutations include
one or more of the following mutations singly or in any combination: E233P;
L234V;
L235A; AG236; A327G; A330S; P331S. In a yet further embodiment, the Fc domain
comprises a sequence according to SEQ ID NO: 3, which is shown in FIG. 10. In
a still
further embodiment, the Fc domain comprises a sequence with a sequence
identity of
about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%
and 100% identity to SEQ ID NO: 3.
[0160] In further embodiments, one or more amino acid modifications are made
in one
or more of the CDRs of the antibody. In general, only 1 or 2 or 3 amino acids
are
substituted in any single CDR, and generally no more than from 4, 5, 6, 7, 8 9
or 10
changes are made within a set of CDRs. However, it should be appreciated that
any
combination of no substitutions, 1, 2 or 3 substitutions in any CDR can be
independently
and optionally combined with any other substitution.
[0161] In some cases, amino acid modifications in the CDRs are referred to as
"affinity
maturation". An "affinity matured" antibody is one having one or more
alteration(s) in one
or more CDRs which results in an improvement in the affinity of the antibody
for antigen,
compared to a parent antibody which does not possess those alteration(s). In
some cases,
although rare, it may be desirable to decrease the affinity of an antibody to
its antigen, but
this is generally not preferred.
[0162] Affinity maturation can be conducted to increase the binding affinity
of the
antibody for the antigen by at least about 10% to 50-100-150% or more, or from
1 to 5 fold
as compared to the "parent" antibody. Preferred affinity matured antibodies
will have
nanomolar or even picomolar affinities for the target antigen. Affinity
matured antibodies
are produced by known procedures. See, for example, Marks et al., 1992,
Biotechnology
10:779-783 that describes affinity maturation by variable heavy chain (VH) and
variable
light chain (VL) domain shuffling. Random mutagenesis of CDR and/or framework
residues
is described in: Barbas, et al. 1994, Proc. Nat. Acad. Sci, USA 91:3809-3813;
Shier et al.,
1995, Gene 169:147-155; YeIton et al., 1995, J. lmmunol. 155:1994-2004;
Jackson et al.,
1995, J. lmmunol. 154(7):3310-9; and Hawkins et al, 1992, J. Mol. Biol.
226:889-896, for
example.
[0163] Alternatively, amino acid modifications can be made in one or more of
the CDRs
of the antibodies of the invention that are "silent", e.g. that do not
significantly alter the
affinity of the antibody for the antigen. These can be made for a number of
reasons,
including optimizing expression (as can be done for the nucleic acids encoding
the
antibodies of the invention).
[0164] Thus, included within the definition of the CDRs and antibodies of the
invention
are variant CDRs and antibodies; that is, the antibodies of the invention can
include amino
acid modifications in one or more of the CDRs of Ab79 and Ab19. In addition,
as outlined
below, amino acid modifications can also independently and optionally be made
in any
region outside the CDRs, including framework and constant regions.
[0165] In some embodiments, the antibodies of the invention are conjugated
with drugs
to form antibody-drug conjugates (ADCs). In general, ADCs are used in oncology
applications, where the use of antibody-drug conjugates for the local delivery
of cytotoxic
or cytostatic agents allows for the targeted delivery of the drug moiety to
tumors, which can
allow higher efficacy, lower toxicity, etc. An overview of this technology is
provided in
Ducry et al., Bioconjugate Chem., 21:5-13(2010), Carter et al., Cancer J.
14(3):154 (2008)
and Senter, Current Opin. Chem. Biol. 13:235-244 (2009).
[0166] Thus, in some embodiments, the invention provides Toso antibodies
conjugated
to drugs. Generally, conjugation is done by covalent attachment to the
antibody and
generally relies on a linker, often a peptide linkage (which, as is known in
the art, may be
designed to be sensitive to cleavage by proteases at the target site or not).
In addition, as
described above, linkage of the linker-drug unit (LU-D) can be done by
attachment to
41
CA 2867444 2017-08-23
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
cysteines within the antibody. As will be appreciated by those in the art, the
number of
drug moieties per antibody can change, depending on the conditions of the
reaction, and
can vary from 1:1 to 10:1 drug:antibody. As will be appreciated by those in
the art, the
actual number is an average.
[0167] The drug of the ADC can be any number of agents, including but not
limited to
cytotoxic agents such as chemotherapeutic agents, growth inhibitory agents,
toxins (for
example, an enzymatically active toxin of bacterial, fungal, plant, or animal
origin, or
fragments thereof), or a radioactive isotope (that is, a radioconjugate) are
provided. In
other embodiments, the invention further provides methods of using the ADCs.
[0168] Drugs for use in antibody-drug conjugates of the present invention
include
cytotoxic drugs, particularly those which are used for cancer therapy. Such
drugs include,
in general, DNA damaging agents, anti-metabolites, natural products and their
analogs.
Exemplary classes of cytotoxic agents include the enzyme inhibitors such as
dihydrofolate
reductase inhibitors, and thymidylate synthase inhibitors, DNA intercalators,
DNA cleavers,
topoisomerase inhibitors, the anthracycline family of drugs, the vinca drugs,
the
mitomycins, the bleomycins, the cytotoxic nucleosides, the pteridine family of
drugs,
diynenes, the podophyllotoxins, dolastatins, maytansinoids, differentiation
inducers, and
taxols.
[0169] Members of these classes include, for example, methotrexate,
methopterin,
dichloromethotrexate, 5-fluorouracil, 6-mercaptopurine, cytosine arabinoside,
melphalan,
leurosine, leurosideine, actinomycin, daunorubicin, doxorubicin, mitomycin C,
mitomycin A,
caminomycin, aminopterin, tallysomycin, podophyllotoxin and podophyllotoxin
derivatives
such as etoposide or etoposide phosphate, vinblastine, vincristine, vindesine,
taxanes
including taxol, taxotere retinoic acid, butyric acid, N8-acetyl spermidine,
camptothecin,
calicheamicin, esperamicin, ene-diynes, duocarmycin A, duocarmycin SA,
calicheamicin,
camptothecin, maytansinoids (including DM1), monomethylauristatin E (MMAE),
monomethylauristatin F (MMAF), and maytansinoids (DM4) and their analogues.
[0170] Toxins may be used as antibody-toxin conjugates and include bacterial
toxins
such as diphtheria toxin, plant toxins such as ricin, small molecule toxins
such as
geldanamycin (Mandler et al (2000) J. Nat. Cancer Inst. 92(19):1573-1581;
Mandler et al
(2000) Bioorganic & Med. Chem. Letters 10:1025-1028; Mandler et al (2002)
Bioconjugate
Chem. 13:786-791), maytansinoids (EP 1391213; Liu et al., (1996) Proc. Natl.
Acad. Sci.
42
USA 93:8618-8623), and calicheamicin (Lode et al (1998) Cancer Res. 58:2928;
Hinman
et 81 (1993) Cancer Res. 53:3336-3342). Toxins may exert their cytotoxic and
cytostatic
effects by mechanisms including tubulin binding, DNA binding, or topoisomerase
inhibition.
[0171] Conjugates of a Toso antibody and one or more small molecule toxins,
such as a
maytansinoids, dolastatins, auristatins, a trichothecene, calicheamicin, and
CC1065, and
the derivatives of these toxins that have toxin activity, are contemplated.
[0172] In accordance with any of the above, another type of modification that
can be
made to antibodies of the invention is alterations in glycosylafion. In
another embodiment,
the antibodies disclosed herein can be modified to include one or more
engineered
glycoforms. By "engineered glycoform" as used herein is meant a carbohydrate
composition that is covalently attached to the antibody, wherein said
carbohydrate
composition differs chemically from that of a parent antibody. Engineered
glycoforms may
be useful for a variety of purposes, including but not limited to enhancing or
reducing
effector function. An exemplary form of engineered glycoform is afucosylation,
which has
been shown to be correlated to an increase in ADCC function, presumably
through tighter
binding to the FcyRIlla receptor. In this context, "afucosylation" means that
the majority of
the antibody produced in the host cells is substantially devoid of fucose,
e.g. 90-95-98% of
the generated antibodies do not have appreciable fucose as a component of the
carbohydrate moiety of the antibody (generally attached at N297 in the Fc
region). Defined
functionally, afucosylated antibodies generally exhibit at least a 50% or
higher affinity to
the FcyRIlla receptor.
[0173] Engineered glycoforms may be generated by a variety of methods known in
the
art (Umana et al., 1999, Nat Biotechnol 17:176-180; Davies et al., 2001,
Biotechnol Bioeng
74:288-294; Shields et al., 2002, J Biol Chem 277:26733-26740; Shinkawa et
al., 2003, J
Biol Chem 278:3466-3473; U.S. Pat. No. 6,602,684; U.S. Ser. No. 10/277,370;
U.S. Ser.
No. 10/113,929; PCT WO 00/61739A1; PCT WO 01/29246A1; PCT WO 02/31140A1; PCT
WO 02/30954A1. Many of these techniques
are based on controlling the level of fucosylated and/or bisecting
oligosaccharides that are
covalently attached to the Fc region, for example by expressing an IgG in
various
organisms or cell lines, engineered or otherwise (for example Lec-13 CHO cells
or rat
hybridoma YB2/0 cells, by regulating enzymes involved in the glycosylation
pathway (for
43
CA 2867444 2017-08-23
example FUT8 [a1,6-fucosyltransferase] and/or (31-4-N-
acetylglucosaminyltransferase III
[GnTIII]), or by modifying carbohydrate(s) after the IgG has been expressed.
For example,
the "sugar engineered antibody" or "SEA technology" of Seattle Genetics
functions by
adding modified saccharides that inhibit fucosylation during production; see
for example
20090317869. Engineered glycoform
typically refers to the different carbohydrate or oligosaccharide; thus an
antibody can
include an engineered glycoform.
[0174] Alternatively, engineered glycoform may refer to a variant that
comprises the
different carbohydrate or oligosaccharide. As is known in the art,
glycosylation patterns
can depend on both the sequence of the protein (e.g., the presence or absence
of
particular glycosylation amino acid residues, discussed below), or the host
cell or organism
in which the protein is produced. Particular expression systems are known in
the art and
discussed herein.
[0175] Glycosylation of polypeptides is typically either N-linked or 0-linked.
N-linked
refers to the attachment of the carbohydrate moiety to the side chain of an
asparagine
residue. The tri-peptide sequences asparagine-X-serine and asparagine-X-
threonine,
where X is any amino acid except proline, are the recognition sequences for
enzymatic
attachment of the carbohydrate moiety to the asparagine side chain. Thus, the
presence of
either of these tri-peptide sequences in a polypeptide creates a potential
glycosylation site.
0-linked glycosylation refers to the attachment of one of the sugars N-
acetylgalactosamine, galactose, or xylose, to a hydroxyamino acid, most
commonly serine
or threonine, although 6-hydroxyproline or 5-hydroxylysine may also be used.
[0176] Addition of glycosylation sites to an antibody (or to any other
polypeptide, such
as the soluble Toso protein discussed above) is conveniently accomplished by
altering the
amino acid sequence such that it contains one or more of the above-described
tri-peptide
sequences (for N-linked glycosylation sites). The alteration may also be made
by the
addition of, or substitution by, one or more serine or threonine residues to
the starting
sequence (for 0-linked glycosylation sites). For ease, the antibody amino acid
sequence is
preferably altered through changes at the DNA level, particularly by mutating
the DNA
encoding the target polypeptide at preselected bases such that codons are
generated that
will translate into the desired amino acids.
44
CA 2867444 2017-08-23
[0177] Another means of increasing the number of carbohydrate moieties on an
antibody or another protein is by chemical or enzymatic coupling of glycosides
to the
protein. These procedures are advantageous in that they do not require
production of the
protein in a host cell that has glycosylation capabilities for N- and 0-linked
glycosylation.
Depending on the coupling mode used, the sugar(s) may be attached to (a)
arginine and
histidine, (b) free carboxyl groups, (c) free sulfhydryl groups such as those
of cysteine, (d)
free hydroxyl groups such as those of serine, threonine, or hydroxyproline,
(e) aromatic
residues such as those of phenylalanine, tyrosine, or tryptophan, or (f) the
amide group of
glutamine. These methods are described in WO 87/05330 and in Aplin and
Wriston, 1981,
CRC Crit. Rev. Biochem., pp. 259-306.
[0178] Removal of carbohydrate moieties present on the starting antibody (e.g.
post-
translationally) may be accomplished chemically or enzymatically. Chemical
deglycosylation requires exposure of the protein to the compound
trifluoromethanesulfonic
acid, or an equivalent compound. This treatment results in the cleavage of
most or all
sugars except the linking sugar (N-acetylglucosamine or N-
acetylgalactosamine), while
leaving the polypeptide intact Chemical deglycosylation is described by
Hakimuddin et al.,
1987, Arch. Biochem. Biophys. 259:52 and by Edge et al., 1981, Anal. Biochem.
118:131.
Enzymatic cleavage of carbohydrate moieties on
polypeptides can be achieved by the use of a variety of endo- and exo-
glycosidases as
described by Thotakura et al., 1987, Meth. Enzymol. 138:350.
Glycosylation at potential glycosylation sites may be prevented by the use of
the
compound tunicamycin as described by Duskin et al., 1982, J. Biol. Chem.
257:3105.
Tunicamycin blocks the formation of protein-N-glycoside linkages.
[0179] Another type of covalent modification of the antibody comprises linking
the
antibody to various nonproteinaceous polymers, including, but not limited to,
various
polyols such as polyethylene glycol, polypropylene glycol or polyoxyalkylenes,
in the
manner set forth in, for example, 2005-2006 PEG Catalog from Nektar
Therapeutics
(available at the Nektar website) U.S. Pat. Nos. 4,640,835; 4,496,689;
4,301,144;
4,670,417; 4,791,192 or 4,179,337.
CA 2867444 2017-08-23
In addition, as is
known in the art, amino acid substitutions may be made in various positions
within the
antibody to facilitate the addition of polymers such as PEG. See for example,
U.S.
Publication No. 2005/0114037M.
[0180] The present invention further includes the nucleic acids encoding the
Toso
antibodies of the invention. In the case where both a heavy and light chain
constant
domains are included in the antibody, generally these are made using nucleic
acids
encoding each, that are combined into standard host cells (e.g. CHO cells,
etc.) to produce
the tetrameric structure of the antibody. If only one constant domain is being
made, only a
single nucleic acid will be used.
[0181] Formulations of the antibodies used in accordance with the present
invention can
be prepared for storage by mixing an antibody having the desired degree of
purity with
optional pharmaceutically acceptable carriers, excipients or stabilizers
(Remington's
Pharmaceutical Sciences 16th edition, Osol, A. Ed. [1980]), in the form of
lyophilized
formulations or aqueous solutions. Acceptable carriers, excipients, or
stabilizers are
nontoxic to recipients at the dosages and concentrations employed, and include
buffers
such as phosphate, citrate, and other organic acids; antioxidants including
ascorbic acid
and mettlionine; preservatives (such as octadecyldimethylbenzyl ammonium
chloride;
hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol,
butyl or
benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol;
resorcinol;
cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about
10
residues) polypeptides; proteins, such as serum albumin, gelatin, or
immunoglobulins;
hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as
glycine, glutamine,
asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides,
and other
carbohydrates including glucose, mannose, or dextrins; chelating agents such
as EDTA;
sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-
ions such as
sodium; metal complexes (e.g. Zn-protein complexes); and/or non-ionic
surfactants such
as TINEEN TM PLURONICS-rm or polyethylene glycol (PEG).
[0182] The formulations of the invention may also contain more than one active
compound as necessary for the particular indication being treated, preferably
those with
complementary activities that do not adversely affect each other. For example,
it may be
desirable to provide antibodies with other specificities. Alternatively, or in
addition, the
as
CA 2867444 2017-08-23
CA 02867444 2014-09-15
WO 2013/136193
PCT/1B2013/001179
composition may comprise a cytotoxic agent, cytokine, growth inhibitory agent
and/or small
molecule antagonist. Such molecules are suitably present in combination in
amounts that
are effective for the purpose intended.
[0183] The active ingredients may also be entrapped in microcapsules prepared,
for
example, by coacervation techniques or by interfacial polymerization, for
example,
hydroxymethylcellulose or gelatin-microcapsules and poly-(methylmethacylate)
microcapsules, respectively, in colloidal drug delivery systems (for example,
liposomes,
albumin microspheres, microemulsions, nano-particles and nanocapsules) or in
macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical
Sciences
16th edition, Osol, A. Ed. (1980).
[0184] The formulations to be used for in vivo administration should be
sterile, or nearly
so. This is readily accomplished by filtration through sterile filtration
membranes.
[0185] Sustained-release preparations may be prepared. Suitable examples of
sustained-release preparations include semipermeable matrices of solid
hydrophobic
polymers containing the antibody, which matrices are in the form of shaped
articles, e.g.
films, or microcapsules. Examples of sustained-release matrices include
polyesters,
hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or
poly(vinylalcohol)),
polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and
.gamma ethyl-L-
glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-
glycolic acid
copolymers such as the LUPRON DEPOT (injectable microspheres composed of
lactic
acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-
hydroxybutyric acid.
While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid
enable release
of molecules for over 100 days, certain hydrogels release proteins for shorter
time periods.
[0186] When
encapsulated antibodies remain in the body for a long time, they may
denature or aggregate as a result of exposure to moisture at 37 C, resulting
in a loss of
biological activity and possible changes in immunogenicity. Rational
strategies can be
devised for stabilization depending on the mechanism involved. For example, if
the
aggregation mechanism has been shown to be intermolecular S--S bond formation
through
thio-disulfide interchange, stabilization may be achieved by modifying
sulfhydryl residues,
lyophilizing from acidic solutions, controlling moisture content, using
appropriate additives,
and developing specific polymer matrix compositions.
47
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
IV. Methods of modulating Toso activity
[0187] In one aspect, the present invention is directed to methods of
modulating Toso
activity. In one embodiment, methods of modulating Toso activity comprise
inhibiting Toso
activity. In other embodiments, methods of modulating Toso activity comprise
increasing
Toso activity.
[0188] In some embodiments, methods of the present invention involve directly
modulating Toso activity. In an exemplary embodiment, such methods include
applying an
agent that binds to Toso, such as an antibody.
[0189] In other embodiments, Toso activity is modulated indirectly, for
example by
binding cognate ligands of Toso. In an exemplary embodiment, Toso activity is
modulated
by administering a soluble Toso protein.
[0190] In further embodiments, Toso activity is modulated by a combination of
mechanisms, for example by administering a composition comprising an agent
that binds
to Toso in combination with a composition comprising an agent that binds to
cognate
ligands of Toso. In an exemplary embodiment, such a combination may include
without
limitation a Toso antibody and a soluble Toso protein.
[0191] As will be appreciated, methods of modulating Toso activity can include
the use
of any of the compositions described herein in any combination, including any
one or more
of SEQ ID NOs. 1-25 as well as any variants or modifications thereof as
described herein.
V. Methods of treating disorders
[0192] In one aspect and in accordance with any of the above, the present
invention
provides methods of treating disorders by treating subjects in need thereof
with a
composition that modulates Toso activity, including without limitation a
soluble Toso
protein or an antibody to Toso.
[0193] In a specific embodiment and in accordance with any of the above, the
present
invention provides methods of treating disorders by treating subjects in need
thereof with a
composition that includes a soluble Toso protein. Without being limited by
theory, one
potential mechanism by which the soluble Toso protein is an effective
treatment for these
disorders is through modulating Toso activity. In certain embodiments, methods
of treating
disorders in accordance with the present invention includes administering a
therapeutically
effective amount of any of the soluble Toso proteins described herein,
including soluble
48
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
Toso proteins comprising any one or more of SEQ ID NOs: 1-25 or any variants
thereof.
In further embodiments, the soluble Toso proteins used to treat disorders,
including
diabetes, multiple sclerosis, asthma, and cancer inlcude a polypeptide with
about 70%,
75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to
any
one of SEQ ID NOs: 1-25. such polypeptides may further be modified in
accordance with
the methods described herein, including chemical modifications, for the
treatment of any of
the disorders described herein.
[0194] In further aspects, the present invention is directed to methods of
treating
disorders and diseases by administering a soluble Toso protein (or a variant
thereof) to a
subject. Soluble Toso proteins of the invention can be used to treat subjects
suffering from
without limitation: an autoimmune disorder (including without limitation Type
1 diabetes,
multiple sclerosis, or rheumatoid arthritis), Type 2 diabetes, asthma, allergy
chronic
obstructive pulmonary disease ("COPD"), hyper-IgM syndrome, lupus, cancer, or
a
neutrophilia-associated disorder (including without limitation neutropenia,
severe
congenital neutropenia, cyclical neutropenia, antibody mediated neutropenia,
reticular
dysgenesis, leukocyte adhesion deficiency, familiar myeloproliferative
disease, chronic
myelogenous leukemia, familiar cold urticaria and leukocytosis, and chronic
granulomatous disease). As will be appreciated, any of the soluble Toso
proteins
described herein, singly or in any combination, can be used to treat any of
these disorders
or diseases.
[0195] In further embodiments, a pharmaceutically acceptable amount of a
soluble Toso
protein is administered to a subject in need thereof to treat any of the
disorders discussed
herein. In some embodiments, the soluble Toso protein administered to the
subject
includes an extracellular Toso domain and/or an Fc domain and/or a signal
sequence
and/or a flexible linker. In still further embodiments, the soluble Toso
protein comprises a
sequence according to any one of SEQ ID NOs: 1-25. Combinations of any one of
SEQ ID
NOs.:1-25 may also be used, either as separate polypeptides or together as
fusion
proteins, to treat any of the disorders discussed herein. Such polypeptides
may also be
further modified, including chemically modified, in accordance with the
description herein
to treat such disorders. In still further embodiments, the soluble Toso
protein used to treat
any of the disorders described herein has a sequence comprising SEQ ID NO: 5,
which is
shown in FIG. 8. In yet further embodiments, the soluble Toso protein
administered to a
49
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
subject for the treatment of any of the disorders discussed herein has a
sequence with at
least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%,
99% identity to SEQ ID NO. 5. In further embodiments, the soluble Toso protein
administered to a subject for the treatment of any of the disorders discussed
herein has a
sequence with about 75-99%, 80-98%, 85-97%, 90-96%, 91-99%, 92-98%, 93-97%, 94-
96% identity to SEQ ID NO: 5. In still further embodiments, the soluble Toso
protein
administered to the subject for the treatment of any of the disorders
discussed herein
comprises SEQ ID NO. 5 with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19,
or 20 amino acid substitutions. In yet further embodiments, the soluble Toso
protein
administered to the subject for the treatment of diabetes comprises SEQ ID NO:
5 with 1-
30, 2-25, 3-20, 4-15, 5-10, 6-9, 7-8 amino acid substitutions. In further
exemplary
embodiments, about 12.1, 12.2, 12.3, 12.4, 12.5, 12.6, 12.7, 12.8, 12.9, 13.1,
13.2, 13.3,
13.4, 13.5, 13.6, 13.7, 13.8, 13.9, 14 mg of the soluble Toso protein is
administered to the
subject for a therapeutic effect. As will be appreciated, the amount of
soluble Toso protein
can be ascertained based on animal studies using the widely accepted Body
Surface Area
(BSA) normalization method used for the conversion of dosages from
experimental
animals to humans. (see Reagan-Shaw, S., Nihal, M., and Admad, N. Dose
translation
from animal to human studies revisited. 2007. The Faseb Journal).
[0196] In specific embodiments, methods and compositions of the invention are
used to
treat subjects at risk for or that have Type 1 or Type 2 diabetes. In further
embodiments, a
pharmaceutically acceptable amount of a soluble Toso protein is administered
to a subject
in need thereof. In some embodiments, the soluble Toso protein administered to
the
subject to treat diabetes includes an extracellular Toso domain and/or an Fc
domain
and/or a signal sequence and/or a linker. In still further embodiments, the
soluble Toso
protein comprises a sequence according to any one of SEQ ID NOs: 1-25 or any
of the
variants of SEQ ID NOs: 1-25 discussed herein. In yet further embodiments, the
soluble
Toso protein administered to a subject for the treatment of diabetes includes
a sequence
with at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%,
97%,
98%, 99% identity to any one of SEQ ID NOs: 1-25. Combinations of any one of
SEQ ID
NOs.:1-25 may also be used, either as separate polypeptides or together as
fusion
proteins, to treat diabetes. Such polypeptides may also be further modified,
including
chemically modified, in accordance with the description herein to treat
diabetes. In still
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
further embodiments, the soluble Toso protein used to treat a subject for
diabetes has a
sequence comprising SEQ ID NO: 5, which is shown in FIG. 8. In yet further
embodiments, the soluble Toso protein administered to a subject for the
treatment of
diabetes has a sequence with at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%,
93%,
94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO. 5. In further embodiments,
the
soluble Toso protein administered to a subject for the treatment of diabetes
has a
sequence with about 75-99%, 80-98%, 85-97%, 90-96%, 91-99%, 92-98%, 93-97%, 94-
96% identity to SEQ ID NO: 5. In still further embodiments, the soluble Toso
protein
administered to the subject for the treatment of diabetes comprises SEQ ID NO.
5 with 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino
acid substitutions. In
yet further embodiments, the soluble Toso protein administered to the subject
for the
treatment of diabetes comprises SEQ ID NO: 5 with 1-30, 2-25, 3-20, 4-15, 5-
10, 6-9, 7-8
amino acid substitutions. In still further embodiments, treatment with a
soluble Toso protein
in accordance with any of the compositions described herein serves to improve
glucose
tolerance in a subject, and thereby treat diabetes. In exemplary embodiments,
about 10-
20, 11-19, 12-18, 13-17, 14-16 mg of the soluble Toso protein is administered
to the
subject for a therapeutic effect. In further exemplary embodiments, about 10,
10.1, 10.2,
10.3, 10.4, 10.5, 10.6, 10.7, 10.8, 10.9, 11, 11.1, 11.2, 11.3, 11.4, 11.5,
11.6, 11.7, 11.8,
11.9, 12, 12.1, 12.2, 12.3, 12.4, 12.5, 12.6, 12.7, 12.8, 12.9, 13.1, 13.2,
13.3, 13.4, 13.5,
13.6, 13.7, 13.8, 13.9, 14, 14.1, 14.2, 14.3, 14.4, 14.5, 14.6, 14.7, 14.8,
14.9, 15, 15.1,
15.2, 15.3, 15.4, 15.5, 15.6, 15.7, 15.8, 15.9, 16 mg of the soluble Toso
protein is
administered to the subject for a therapeutic effect. As will be appreciated,
the amount of
soluble Toso protein can be ascertained based on animal studies using the
widely
accepted Body Surface Area (BSA) normalization method used for the conversion
of
dosages from experimental animals to humans. (see Reagan-Shaw, S., Nihal, M.,
and
Admad, N. Dose translation from animal to human studies revisited. 2007. The
Faseb
Journal). For the experiments described in further detail herein, 50 pg doses
were used in
the disease models, which would approximately be 2.5 mg/kg in a 20 g mouse.
Using the
BSA conversion, this would be 0.2027 mg/kg or 7.5 mg/m2, or approximately 12.2
mg for a
60 kg adult.
[0197] In other embodiments, methods and compositions of the invention are
used to
treat subjects at risk for or that have multiple sclerosis. In further
embodiments, a
51
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
pharmaceutically acceptable amount of a soluble Toso protein is administered
to a subject
in need thereof for the treatment or amelioration of multiple sclerosis. In
some
embodiments, the soluble Toso protein administered to the subject includes and
Fc
domain and/or a flexible linker. In some embodiments, the soluble Toso protein
administered to the subject includes an extracellular Toso domain and/or an Fc
domain
and/or a signal sequence and/or a linker. In still further embodiments, the
soluble Toso
protein comprises a sequence according to any one of SEQ ID NOs: 1-24.
Combinations
of any one of SEQ ID NOs.:1-25 may also be used, either as separate
polypeptides or
together as fusion proteins, to treat multiple sclerosis. Such polypeptides
may also be
further modified, including chemically modified, in accordance with the
description herein
to treat multiple sclerosis. In still further embodiments, the soluble Toso
protein has a
sequence comprising SEQ ID NO: 5, which is shown in FIG. 8. In yet further
embodiments, the soluble Toso protein administered to a subject for the
treatment of
multiple sclerosis has a sequence with at least about 70%, 75%, 80%, 85%, 90%,
91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO. 5. In further
embodiments, the soluble Toso protein administered to a subject for the
treatment of
multiple sclerosis has a sequence with about 75-99%, 80-98%, 85-97%, 90-96%,
91-99%,
92-98%, 93-97%, 94-96% identity to SEQ ID NO: 5. In still further embodiments,
the
soluble Toso protein administered to the subject for the treatment of multiple
sclerosis
comprises SEQ ID NO. 5 with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19,
or 20 amino acid substitutions. In yet further embodiments, the soluble Toso
protein
administered to the subject for the treatment of multiple sclerosis comprises
SEQ ID NO: 5
with 1-30, 2-25, 3-20, 4-15, 5-10, 6-9, 7-8 amino acid substitutions. In still
further
embodiments, treatment with a soluble Toso protein in accordance with any of
the
compositions described herein serves to delay the progression of multiple
sclerosis. In
exemplary embodiments, about 10-20, 11-19, 12-18, 13-17, 14-16 mg of the
soluble Toso
protein is administered to the subject for a therapeutic effect. In further
exemplary
embodiments, about 10, 10.1, 10.2, 10.3, 10.4, 10.5, 10.6, 10.7, 10.8, 10.9,
11, 11.1, 11.2,
11.3, 11.4, 11.5, 11.6, 11.7, 11.8, 11.9, 12, 12.1, 12.2, 12.3, 12.4, 12.5,
12.6, 12.7, 12.8,
12.9, 13.1, 13.2, 13.3, 13.4, 13.5, 13.6, 13.7, 13.8, 13.9, 14, 14.1, 14.2,
14.3, 14.4, 14.5,
14.6, 14.7, 14.8, 14.9, 15, 15.1, 15.2, 15.3, 15.4, 15.5, 15.6, 15.7, 15.8,
15.9, 16 mg of the
soluble Toso protein is administered to the subject for a therapeutic effect.
As will be
52
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
appreciated, the amount of soluble Toso protein can be ascertained based on
animal
studies using the widely accepted Body Surface Area (BSA) normalization method
used
for the conversion of dosages from experimental animals to humans. (see Reagan-
Shaw,
S., Nihal, M., and Admad, N. Dose translation from animal to human studies
revisited.
2007. The Faseb Journal). For the experiments described in further detail
herein, 50 pg
doses were used in the disease models, which would approximately be 2.5 mg/kg
in a 20 g
mouse. Using the BSA conversion, this would be 0.2027 mg/kg or 7.5 mg/m2, or
approximately 12.2 mg for a 60 kg adult.
[0198] In other embodiments, methods and compositions of the invention are
used to
treat subjects at risk for or that have arthritis. In further embodiments, a
pharmaceutically
acceptable amount of a soluble Toso protein is administered to a subject in
need thereof
for the treatment or prevention of arthritis. In some embodiments, the soluble
Toso protein
administered to the subject includes and Fc domain and/or a linker. In some
embodiments, the soluble Toso protein administered to the subject includes an
extracellular Toso domain and/or an Fc domain and/or a signal sequence and/or
a linker.
In still further embodiments, the soluble Toso protein comprises a sequence
according to
any one of SEQ ID NOs: 1-25 Combinations of any one of SEQ ID NOs:1-25 may
also be
used, either as separate polypeptides or together as fusion proteins, to treat
arthritis. Such
polypeptides may also be further modified, including chemically modified, in
accordance
with the description herein to treat arthritis. In still further embodiments,
the soluble Toso
protein has a sequence comprising SEQ ID NO: 5, which is shown in FIG. 8. In
yet further
embodiments, the soluble Toso protein administered to a subject for the
treatment of
arthritis has a sequence with at least about 70%, 75%, 80%, 85%, 90%, 91%,
92%, 93%,
94%, 95%, 96%, 97%, 98%, 99% identity to SEQ ID NO. 5. In further embodiments,
the
soluble Toso protein administered to a subject for the treatment of arthritis
has a sequence
with about 75-99%, 80-98%, 85-97%, 90-96%, 91-99%, 92-98%, 93-97%, 94-96%
identity
to SEQ ID NO: 5. In still further embodiments, the soluble Toso protein
administered to the
subject for the treatment of arthritis comprises SEQ ID NO. 5 with 1, 2, 3, 4,
5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid substitutions. In yet
further
embodiments, the soluble Toso protein administered to the subject for the
treatment of
arthritis comprises SEQ ID NO: 5 with 1-30, 2-25, 3-20, 4-15, 5-10, 6-9, 7-8
amino acid
substitutions. In still further embodiments, treatment with a soluble Toso
protein in
53
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
accordance with any of the compositions described herein serves to prevent the
incidence
of arthritis or protect against the severity of arthritis.
[0199] In specific embodiments, methods and compositions of the invention are
used to
treat subjects at risk for or that have asthma. In further embodiments, a
pharmaceutically
acceptable amount of a soluble Toso protein is administered to a subject in
need thereof.
In some embodiments, the soluble Toso protein administered to the subject to
treat
asthma includes an extracellular Toso domain and/or an Fc domain and/or a
signal
sequence and/or a linker. In still further embodiments, the soluble Toso
protein comprises
a sequence according to any one of SEQ ID NOs: 1-25 or any of the variants of
SEQ ID
NOs: 1-25 discussed herein. In yet further embodiments, the soluble Toso
protein
administered to a subject for the treatment of asthma includes a sequence with
at least
about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%
identity to any one of SEQ ID NOs: 1-25. Combinations of any one of SEQ ID
NOs.:1-25
may also be used, either as separate polypeptides or together as fusion
proteins, to treat
asthma. Such polypeptides may also be further modified, including chemically
modified, in
accordance with the description herein to treat asthma. In still further
embodiments, the
soluble Toso protein used to treat a subject for asthma has a sequence
comprising SEQ
ID NO: 5, which is shown in FIG. 8. In yet further embodiments, the soluble
Toso protein
administered to a subject for the treatment of asthma has a sequence with at
least about
70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity
to
SEQ ID NO. 5. In further embodiments, the soluble Toso protein administered to
a subject
for the treatment of asthma has a sequence with about 75-99%, 80-98%, 85-97%,
90-96%,
91-99%, 92-98%, 93-97%, 94-96% identity to SEQ ID NO: 5. In still further
embodiments,
the soluble Toso protein administered to the subject for the treatment of
asthma comprises
SEQ ID NO. 5 with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,15, 16, 17,
18, 19, 0r20
amino acid substitutions. In yet further embodiments, the soluble Toso protein
administered to the subject for the treatment of asthma comprises SEQ ID NO: 5
with 1-
30, 2-25, 3-20, 4-15, 5-10, 6-9, 7-8 amino acid substitutions. In still
further embodiments,
treatment with a soluble Toso protein in accordance with any of the
compositions
described herein serves to improve glucose tolerance in a subject, and thereby
treat
asthma. In exemplary embodiments, about 10-20, 11-19, 12-18, 13-17, 14-16 mg
of the
soluble Toso protein is administered to the subject for a therapeutic effect.
In further
54
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
exemplary embodiments, about 10, 10.1, 10.2, 10.3, 10.4,10.5, 10.6, 10.7,
10.8, 10.9, 11,
11.1, 11.2, 11.3, 11.4, 11.5, 11.6, 11.7, 11.8, 11.9, 12, 12.1, 12.2, 12.3,
12.4, 12.5, 12.6,
12.7, 12.8, 12.9, 13.1, 13.2, 13.3, 13.4, 13.5, 13.6, 13.7, 13.8, 13.9, 14,
14.1, 14.2, 14.3,
14.4, 14.5, 14.6, 14.7, 14.8, 14.9, 15, 15.1, 15.2, 15.3, 15.4, 15.5, 15.6,
15.7, 15.8, 15.9,
16 mg of the soluble Toso protein is administered to the subject for a
therapeutic effect.
As will be appreciated, the amount of soluble Toso protein can be ascertained
based on
animal studies using the widely accepted Body Surface Area (BSA) normalization
method
used for the conversion of dosages from experimental animals to humans. (see
Reagan-
Shaw, S., Nihal, M., and Admad, N. Dose translation from animal to human
studies
revisited. 2007. The Faseb Journal). For the experiments described in further
detail
herein, 50 pg doses were used in the disease models, which would approximately
be 2.5
mg/kg in a 20 g mouse. Using the BSA conversion, this would be 0.2027 mg/kg or
7.5
mg/m2, or approximately 12.2 mg for a 60 kg adult.
[0200] In further embodiments, the soluble Toso proteins described herein,
including the
soluble Toso proteins comprising any one or more of the polypeptides of SEQ ID
NOs. 1-
25, is in the form for use as a medicament. In further embodiments, the
present invention
provides a soluble Toso protein comprising any one or more (or a portion of
any one or
more) of the polypeptides of SEQ ID NOs. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15,
16, 17,18 19,20 ,21, 22, 23, 24, or 25 for use as a medicament. In still
further
embodiments, the present invention provides methods for the use of a soluble
Toso
protein comprising any one or more of the polypeptides of SEQ ID NOs. 1-25 for
treating
any one of the following disorders: an autoimmune disorder (including without
limitation
Type 1 or Type 2 diabetes, multiple sclerosis, or rheumatoid arthritis),
asthma, allergy
chronic obstructive pulmonary disease ("COPD"), hyper-IgM syndrome, lupus,
cancer, or a
neutrophilia-associated disorder (including without limitation neutropenia,
severe
congenital neutropenia, cyclical neutropenia, antibody mediated neutropenia,
reticular
dysgenesis, leukocyte adhesion deficiency, familiar myeloproliferative
disease, chronic
myelogenous leukemia, familiar cold urticaria and leukocytosis, and chronic
granulomatous disease).
[0201] As discussed above, in some embodiments, soluble Toso proteins of the
invention are used to treat cancer. In further embodiments, methods of
treating cancer in
accordance with the invention include methods of inhibiting tumor invasion
and/or
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
metastasis by modulating Toso activity. In exemplary embodiments, compositions
of the
invention are used to treat any one of the group of an adenocarcinoma, a
leukemia, a
lymphoma, a melanoma, a myeloma, a sarcoma or a teratocarcinoma in subjects in
need
thereof. In further embodiments, compositions of the invention are used to
treat subjects
suffering from a cancer in one or more of adrenal gland, bladder, bone, bone
marrow,
brain, breast, cervix, gall bladder, ganglia, gastrointestinal tract, heart,
kidney, liver, lung,
muscle, ovary, pancreas, parathyroid, penis, prostate, salivary glands, skin,
spleen, testis,
thymus, thyroid or uterus.
Example 1: Toso plays a role in the pathogenesis of arthritis
[0202] Toso-1- and wild type mice were injected with Type II chicken collagen
in
Complete Freund's adjuvant subcutaneously and monitored the disease
progression over
time. Animals exposed to Type II collagen develop disease that has similar
immunologic,
pathologic and histological features as human Rheumatoid Arthritis (RA). Joint
inflammation, as measured by the change in ankle thickness using a digital
caliper, was
significantly reduced in Toso-/- mice (FIG. 1A). In addition, disease severity
was scored
from 0-4 for each joint based on visible swelling and mobility. Toso-/- mice
had drastically
reduced clinical scores compared to wild type controls (FIG. 1B). Flow
cytometric analysis
of lymphocyte populations in the draining lymph node showed a significant
reduction in
B220+ B cells (FIG. 1C). These data suggest that Toso has a significant role
in the
pathogenesis of arthritis.
Example 2: Treatment with Toso-Fc protects against arthritis
[0203] This example shows that treatment with Toso-Fc (SEQ ID NO: 5) protects
against arthritis. Arthritis susceptible mice, DBA1, were pre-dosed with 50
lig Toso-Fc I.P,
immunized with Type II collagen in Complete Freund's Adjuvant to induce
disease, and
then treated with Toso-Fc three times per week over the course of the
experiment. Toso-
Fc treated mice were protected against both the severity and incidence of
disease,
suggesting that Toso-Fc administration may be useful in the management of
arthritis. For
example, FIG. 24A shows that the additive arthritis score was negligible in
the Toso-Fc
treated mice as compared to the control mice (treated only with the vehicle).
Similarly,
FIG. 24B also shows that the percent incidence of arthritis was negligible in
the Toso-Fc
56
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
treated mice as compared to control. Clinical symptoms of arthritis were
assessed as
follows; 0 = normal, 1 = slight swelling and/or erythema, 2 = pronounced
swelling, 3 =
ankylosis. The individual limb scores for each mouse were added, giving a
maximum
disease score of 12. Incidence of disease was noted when mice were observed to
have a
disease score of 1 in a limb.
[0204] FIG. 25 provides further data showing the recall response
(proliferation) of
splenocytes from Toso-Fc and vehicle treated mice stimulated with Collagen. As
shown in
the figure, splenocytes from mice treated with Toso-Fc show a reduced
proliferative
response than splenocytes from vehicle treated controls.
Example 3: Toso-Fc is effective against arthritis once the disease is
established
[0205] As shown above, prophylactic administration of Toso-Fc ameliorated
disease
symptoms in a murine model of rheumatoid arthritis. This example shows that
the
administration of the Toso-Fc is also effective in a therapeutic context
(i.e., when disease
is already established.
[0206] Female DBA.1 mice (6 to 8 weeks of age) were randomly assigned into 2
groups,
one to receive vehicle treatment, and the other to receive Toso-Fc when
disease was
observed. All mice were inoculated with Collagen to induce disease. Initiation
of disease
symptoms were observed on day 43 after immunization. The animals were treated
with
vehicle control or Toso-Fc on day 52, as indicated by the arrow on the plots
(FIG. 26).
After day 57, therapeutic administration of Toso-Fc dramatically reduced total
disease
score and arthritis incidence (see FIG. 26). These data indicate that Toso-Fc
can
effectively manage arthritis symptoms when disease has already been
established, and
can thus be effective in a therapeutic as well as a prophylactic context.
Example 4: Toso plays a role in the development of asthma
[0207] Asthma is an allergic disorder characterized by aberrant TH2
activation, IgE
production, bronchial hyperreactivity, and leukocyte extravasation into the
bronchial
mucosa. Eosinophillia is a hallmark of allergic asthma and is thought to be a
critical player
in inflammation. The pathologic manifestations of asthma cause the lungs to
constrict,
leading to wheezing, shortness of breath, chest tightness, and coughing.
57
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
[0208] An OVA induced asthma model was conducted on Toso-/- and wild type mice
(FIG. 2A). OVA (10 mg/kg) were delivered intraperitoneally on days 0, 7, and
14. Mice
then received aerosolled OVA (1 mg/ml) for 30 minutes on days 21, 22, and 23,
and
sacrificed 2 days later. Toso-/- mice had a drastic reduction in eosinophil
migration into
the broncheoalveolar space as assessed by DifQuik staining (FIG. 2B). Based on
morphology, eosinophils were quantified by counting at least 200 leukocytes
per slide
(FIG. 2C).
[0209] Asthma and other allergic diseases are typified by the preferential
differentiation
of naive T cells into TH2 cells. The presence TH2 relevant cytokines and
chemokines in
Broncheoalveolar lavage fluid (BALF) was assessed. Toso-/- mice had a
significant
reduction in OVA induced TH2 cytokines IL-4, IL-5 and IL-13 in BALF as
assessed by
ELISA (FIG. 3A-C). Consistent with the depressed eosinophil migration into the
lung,
Toso-/- mice had significantly reduced Eotaxin, an eosinophil attracting C-C
chemokine, in
the BALF (FIG. 3D). Bronchial smooth muscle cells are known to produce eotaxin
in
response to TNFa. Since Toso is known to be expressed in the lung, and Toso
deficiency
renders mice refractory to TNF, the inventors sought to address whether the
effect of Toso
on eotaxin levels was lung intrinsic. Cultured Toso-/- bronchial smooth muscle
cells had
significantly reduced levels of Eotaxin produced in response to INFa treatment
(FIG. 3E).
Taken together, these data suggest that Toso deficiency impinges on OVA
induced TH2
cytokine, and eotaxin levels in the lung.
[0210] A hallmark of allergic asthma is the overproduction of IgE. Antibody
producing B
cells are induced to produce IgE by TH2 cytokines such as IL-4 (Oettgen, H.C.
and R.S.
Geha, IgE regulation and roles in asthma pathogenesis. J Allergy Clin Immunol,
2001.
107(3): p. 429-40). OVA induced total IgE and OVA specific IgE levels in the
serum were
significantly depressed in the Toso-/- mice (FIG. 4A and B), while OVA-
specific IgG1 were
similar between wild type and knockout (FIG. 4C). These data suggest that
genetic
ablation of Toso, or perhaps therapeutic blockade, could decrease the
production of IgE.
[0211] The inflammatory events that typify allergic asthma culminate in airway
remodeling that cause restrictive airflow to the lung. Therefore, whether Toso
deficiency
affected OVA induced airway hyper-responsiveness was assessed by measuring
enhanced pause (Penh) in response to increasing doses of methacholine using
whole
body plethysmography. Toso-/- mice were significantly protected from OVA
induced
58
airway hyper-responsiveness as indicated by the significant reduction in Penh
values
compared to wild type controls (FIG. 5). These data are suggestive of Toso
blocking being
an efficient strategy for mitigating airway reactivity in allergic asthma.
Example 5: Toso ablation affects dendritic cell activity
[0212] Toso ablation has wide-scale effects on the onset of allergic and
inflammatory
diseases. One possible non-limiting mechanism is that Toso regulates these
disease
processes at a global level, perhaps through the function of dendritic cells
(DCs) to present
antigen to naïve T cells.
[0213] In order to test the functional relevance of Toso dendritic cells in
the onset of
disease or in the activation of T cells, the inventors determined whether the
transfer of
antigen loaded Toso-/- DCs elicited disease processes similar to wild type
counterparts.
[0214] Wild type and Tose- bone marrow derived DCs were made through culture
with
GM-CSF (see Lutz, M.B., et al., An advanced culture method for generating
large
quantities of highly pure dendritic cells from mouse bone marrow. J Immunol
Methods,
1999. 223(1): p. 77-92). Similar
to the protocol of Lambrecht et al, the DCs in the present experiments were
loaded with
OVA. The antigen loaded DCs were instilled into the trachea of C57BL6 animals
(see
Lambrecht, B.N., et al., Myeloid dendritic cells induce Th2 responses to
inhaled antigen,
leading to eosinophilic airway inflammation. J Clin Invest, 2000. 106(4): p.
551-9).
One week later, the animal were treated with aerosolled OVA as per the
asthma studies for three consecutive days. Strikingly, OVA loaded Tose-
dendritic cells
were significantly reduced in their capacity to induce TH2 cytokine production
into the
BALF as compared to wild type controls (FIG. 7A). The 2d2 TCR transgenic
strain
contains T cells that are specific for the M0G35-55 peptide used to elicit EAE
(Bettelli, E.,
et al., Myelin oligodendrocyte glycoprotein-specific T cell receptor
transgenic mice develop
spontaneous autoimmune optic neuritis. J Exp Med, 2003. 197(9): p. 1073-81). T
cells
derived from 2d2 mice failed to proliferate when co-cultured with M0G35-55
loaded Toso-
/- DCs (FIG. 7B). Mice expressing the major glycoprotein (GP) from lymphocytic
chorio
meningitis virus (LCMV) under control of the rat insulin promoter (RIP)
develop diabetes as
59
CA 2867444 2017-08-23
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
assessed by increased levels of serum glucose. Similarly, RIP-GP receiving GP
peptide
loaded DCs also develop disease. Toso-/- DCs show an impairment in their
ability to elicit
disease compared to wild type controls, and RIP-GP mice receiving peptide
loaded Toso-!-
DCs survive significantly better than those mice receiving peptide loaded wild
type DCs
(FIG. 7C). Taken together, these results suggest that Toso is necessary for
the ability of
Dendritic Cells to activate T cells and induce disease.
Example 6: Administration of a soluble Toso protein abrogates asthma disease
metrics
[0215] To generate a soluble receptor, the extracellular domain of Toso from
human
spleen cDNA library was amplified and then cloned in-frame with an Fc domain
derived
from human IgG1 at the C-terminus into pFuse-hIgG1e3-Fc2 downstream of an IL2
signal
sequence, allowing for optimal secretion into the culture supernatant (FIG. 8A
¨ signal
sequence indicated by a box, and Fc domain indicated with the underline). In
addition, the
Fc region contained several mutations
(E233P/L234V/L235A/AG236/A327G/A330S/P331S) that have been shown to ablate
antibody dependent-, and complement dependent-cytotoxicity. These mutations
can
enhance the half-life of the protein and confer a favorable pharmacokinetic
profile when
administered in vivo. This Toso-Fc construct, as well as an empty vector
control, were
transfected into 3 x 108 293F cells in 400 ml of serum free media cells using
the Freestyle
expression system. Two days later, the supernatant was collected and the cells
were
resuspended in a further 400 ml of media. After 2 more the days of culture,
the second
supernatant was collected and combined with the first supernatant. The
secretion of Toso-
Fc soluble receptor was confirmed using ELISA (FIG. 8B), purified by Protein G
chromatography, and eluted with 100 mM Glycine pH 2.3. 1 ml eluant fractions
were
collected into 60 I of neutralization buffer (1M Tris pH 9.5) and confirmed
by western blot
with an antibody directed at the Fc region (FIG. 8Ci) and Coomassie Blue
staining (FIG.
8Cii).
[0216] Binding of the soluble receptor was tested on murine splenocytes.
Approximately
106 cells were incubated with indicated amounts of Toso-Fc in 100 pl of FACS
staining
buffer (PBS+1%BSA+0.05% NaN3) for 2 hours on ice. Cells were washed in FACS
buffer
and incubated with a FITC conjugated anti-human FC g F(ab')2 fragment for 30
minutes
on ice, and acquired on a FACS Canto flow cytometer. Approximately 10% of
splenocytes
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
bound to the soluble receptor at 10 p,g (FIG. 8D). A purified Fc protein alone
did not show
significant binding to splenocytes, suggesting that Toso-Fc binding was
specific. A further
detailed analysis indicated that Toso-Fc bound most significantly to
CD11c+MHChi mature
dendritic cells or CD11c+B220+ plasmacytoid DCs in the spleen (FIG. 8E). These
data
illustrate that the Toso-Fc soluble receptor is functional, and that the
ligand for Toso may
be expressed on mature dendritic cells.
[0217] The therapeutic utility of Toso-Fc administration was assessed in a
murine model
of OVA induced asthma. Disease was elicited as described above with slight
modifications. Female BALB/c mice were treated as described except that 50 pg
of Toso-
Fc was administered intraperitoneally for 3 consecutive days before aerosolled
OVA
challenge (FIG. 9A). Severity of disease was assessed by evaluating Th2
cytokines in the
BALF (FIG. 9B), cellularity in the BALF (FIG. 90). Pretreatment with Toso-Fc
significantly
abrogated disease metrics, suggesting that administration of Toso-Fc may be a
useful
treatment paradigm in the management of asthma.
Example 7: Toso is a potential target for treatment of multiple sclerosis
[0218] Experimental Autoimmune Encephalitis (EAE) is a useful mouse model for
human MS. This system involves the antigen dependent activation of 004+
TH1/TH17
cells, and perivascular accumulation of monocytic cells leading to
demyelination, and hind
limb paralysis. In the C57BL/6 background, EAE is deemed chronic progressive,
as
disease increases with time and is elicited through the injection of Myelin
Oligodendrocyte
Glycoprotein peptide, M0G35-55, with Pertussis toxin in Complete Freund's
Adjuvant.
Disease severity is scored from 0 to 5 daily for approximately 1 month (where
0 = no sign
of disease, 1 = limp tail or hind limb weakness but not both, 2 = limp tail
and hind limb
weakness, 3 = partial hind limb paralysis, 4 = complete hind limb paralysis, 5
= moribund
state or death by EAE).
[0219] In the aforementioned MOG-induced model, Toso-/- mice were markedly
protected from the onset of EAE compared to wild type controls (FIG. 6). These
data
suggest that blocking Toso function may represent a novel treatment strategy
for MS.
61
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
Example 8: Treatment with Toso-Fc delays the onset of EAE
[0220] This example demonstrates that treatment with Toso-Fc (SEQ ID NO: 5)
delays
the onset of EAE. As discussed above, the EAE mouse model is a useful model
for human
MS. For the experiments pictured in FIG. 23A, C57BL/6 mice were pretreated
with Toso-
Fc before immunization with the disease-inducing MOG peptide. After
immunization, mice
were treated with 50 pg Toso-Fc (or PBS for the control mice)
intraperitoneally three times
per week for 30 days. As shown in FIG. 23B, Toso-Fc delayed the progression of
EAE,
showing a modifying effect of Toso-Fc in Multiple Sclerosis.
Example 9: Toso diminishes innate antibacterial immune response
[0221] This example demonstrates that granulocytes are activated early in Toso
deficient mice after bacterial infection and are essential for the control of
pathogens. Toso
deficient granulocytes demonstrated enhanced expression of CD11b and CD18 and
displayed a lowered activation threshold. In line with these results, Toso
deficient
granulocytes showed reduced effector function at the sites of inflammation in
peripheral
tissue. As a result of the altered granulocyte function, Toso deficient mice
failed to clear
systemic listeria infection leading to fast death of Toso deficient mice.
Therefore, Toso
influences activation threshold and effector function of granulocytes, and
thus critically
diminishes innate anti bacterial immune response.
Materials and Methods
[0222] Mice: Short sequences were obtained by sequencing the library isolated
genomic DNA fragments using a series of oligomers derived from the mouse Toso
cDNA
sequence. A 6.5kbp fragment was isolated from the 5' end using BglIl
restriction digestion
enzyme and was used as a long arm for the knockout construct. A 650bp short
arm was
produced by polymerase chain reaction using oligomers derived from the
sequence of the
3' end of the gene (5' GTGAATACGTGAGCTTGGGCTACC 3' SEQ ID NO: 1 and
5'CAAGTGATGG GGGATTACAGTGAA3' SEQ ID NO: 2). The long and short arm were
ligated on either end of a Neomycin resistance cassette in the same
orientation as the
Toso translation sense. The site specific insertion of this knockout construct
into embryonic
stem (ES) cell genomic DNA was first screened by polymerase chain reaction
(PCR) using
primers designed in the 3' end of Neo and in the genomic DNA flanking region
downstream of the 3' end of the short arm. The mice were screened using three
primers. A
62
common primer (5' TGTTTAATATGATGTGTCAGGCTG 3' SEQ ID NO: 3) was located in
the short arm region and the two other primers were from either the 3' region
of Neo (5'
AGGGCCAGCTCATTCCTCCCACTCAT 3' SEQ ID NO: 4) or the 3' region of DNA that
was excised by the knockout construct (5' AACTCTGCCCCTGCTCCTTCATTTCC 3' SEQ
ID NO: 5). In doing so the band obtained from the rearranged allele was of
400bp and that
of the native gene was 450bp. 03 ES cells were electroporated with knockout
construct
and grown in the presence of 300pg/m1G418. Positive ES clones were then
injected into
E3.5 C57/BL6 derived blastocysts Chimeric off springs were screened for the
presence of
the rearranged allele and backcrossed to C57BLI6 background. CD1 11)4- mice
were
derived from Jackson on a C57BL/6 background.
[0223] Bone marrow chimeric mice: Mice were lethally irradiated with 1050rad
and
reconstituted either with 107 CD45.1 WT bone marrow cells, or 107 CD45.2 Tose-
bone
marrow cells or 5 x 106 CD45.1 WT bone marrow cells plus 5 x 106 CD45.2 Tose-
bone
marrow cells. All mice used in this study were maintained on the C57BU6
genetic
background. All experiments were performed in single ventilated cages.
[0224] Listeria infection: Listeria was grown in heart infusion agar. If not
differently
indicated, mice were infected intravenously with 2x104 CFU.
[0225] Granulocyte activation and FACS analysis after cytokine stimulation:
FACS
staining and analysis were performed as described (Lang, P.A., et al.
Aggravation of viral
hepatitis by platelet-derived serotonin. Nat Med 14, 756-761 (2008)).
Recombinant mouse TNF-a was from R+D
systems, LPS was from Sigma and GM-CSF was obtained from X630 cell
supernatants.
fMLP from Sigma was used at the indicated concentrations. For activation
studies 10 pl
blood was incubated in 100p1 medium containing different cytokines in addition
to anti Grl
(eBiosciences), Dihydrorhdamin (Alexis) and CD1lb (eBiosciences, if
indicated). After 30
minutes or 45 minutes of incubation (at 37 C if not differently indicated)
granulocytes were
fixed and red cells were lysed using erythrocyte lysis buffer (BD Biociences).
For naive
expression of CD11a, CD11 b and CD18 blood was fixed with 2% Formalin for 10
minutes,
and then stained with anti Grl and the according antibodies at 4 C. Toso
antibody was
generated according to Nguyen, et al., (Blood, 2011, Jul 21, 118(3):598-608).
63
CA 2867444 2017-08-23
[0226] For priming studies granulocytes were incubated with different
cytokines for 30
minutes followed by 15 minutes of fMLP incubation.
[0227] Histology: Histological analysis was performed on snap frozen or
formalin fixed
tissue as described in Lang, K.S., et al. Immunoprivileged status of the liver
is controlled
by Toll-like receptor 3 signaling. J Clin Invest 116, 2456-2463 (2006).
[0228] MPO ELISA: MPO ELISA was derived from Hycult biotech and performed
according to the manufacturer's instructions.
[0229] mRNA gene-profiling by quantitative RT-PCR: RNA extraction and cDNA
synthesis was performed using Trizol. Gene expression analysis of was
performed using
Toso (Faim3) kit Mm01302388_ml from Applied Biosystems. For analysis, the
expression
levels of all target genes were normalized against 18sRNA (ACt). Gene
expression values
are expressed as ACt.
[0230] Statistical analysis: Data are expressed as mean S.E.M. Statistically
significant differences between two different groups were analyzed using
Student's t-test. If
not differently mentioned unpaired two way. Analysis including several groups
were
performed using one-way ANOVA with additional Bonferroni or Dunnett test.
Statistically
significant differences between experimental groups over multiple timepoints
were
calculated using two-way ANOVA (repeated measurements). p values < 0.05 were
considered as statistically significant.
TOSO is expressed on granulocytes but is not essential for leukocyte
differentiation
[0231] To analyze the functional relevance of Toso in vivo the inventors
generated a
Toso deficient mouse as described in material and methods. Toso deficient mice
were
backcrossed to C57BU6 background and then analyzed for expression of Toso RNA.
RT-
PCR analysis from Toso - mice showed lack of Toso, suggesting that indeed Toso
was
not expressed in Toso - mice (FIG. 12a). Next Toso protein was analyzed on
lymphocytes using a Toso specific antibody. It was found that naïve B cells
but not T cells
expressed Toso (FIG. 12b) in keeping with published literature. Next, the
inventors
analyzed expression of Toso on granulocytes. The inventors found that
granulocytes both
in blood and spleen expressed Toso on the cell surface (FIG. 12c). To analyze
if Toso
64
CA 2867444 2017-08-23
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
influenced lymphocyte or granulocyte development, the inventors analyzed these
cell
populations in peripheral blood of Toso - mice. Toso - mice did not show any
striking
difference in the blood granulocytes (FIG. 12d). There was a slightly
significant reduction
of blood lymphocyte numbers in Toso deficient mice which was attributed to a
reduced B
cell number (FIG. 12d&e). The spleen size of Toso - mice was normal and spleen
lymphocytes showed a normal distribution (FIG. 12f&g) suggesting that there is
no major
role of Toso on the development of immune cells.
3. Threshold for activation is reduced in granulocytes of TOSO
deficient
mice
[0232] Granulocytes from Toso - and wildtype mice were activated with the
granulocyte
activator N-Formylmethionyl-Lencyl-Phenylalanine (fMLP). fMLP activates the
fMLP
receptor on granulocytes, which mimics pathogen contact. In pre-activated
granulocytes
contact with fMLP leads to strong production of reactive oxygen species (ROS)
and
degranulation. In contrast granulocytes which are not pre-activated by
cytokines show
limited response to fMLP. Only 10% of wildtype granulocytes were activated
upon
treatment with fMLP when analyzed by production of ROS and degranulation (FIG.
13a). In
contrast, treatment with fMLP activated 50% of Toso - granulocytes (FIG. 13a).
[0233] Next ROS production and degranulation of Toso - granulocytes was
analyzed
following treatment with TNF-a, which usually only primes granulocytes, but
does not lead
to ROS production. Treatment with TNF-a led to virtually absent ROS production
in WT
granulocytes (FIG. 13b). In contrast, Toso - granulocytes showed significant
ROS
producing/de-granulated granulocytes after TNF-a treatment, suggesting that
Toso
influences the threshold of granulocyte activation (FIG. 13b). Treatment with
LPS and GM-
CSF, which are also known to prime granulocytes did not activate ROS neither
in wildtype
nor Toso-l- granulocytes (FIG. 13c&d). These results show that Toso -
granulocytes had
a lowered activation threshold for both fMLP and TNF-a. Co-treatment with GM-
CSF or
LPS together with fMLP increased the percentage of ROS producing wildtype
granulocytes
by 10 fold in WT granulocytes (FIG. 13e). The percentage of ROS producing
granulocytes
was also increased in either LPS or GM-CSF primed fMLP co-treated Toso -
granulocytes
(FIG. 13e). These data show that Toso - granulocytes displayed a lowered
activation
threshold also in the setting of granulocyte priming with GM-CSF or LPS. This
suggests
that Toso - granulocytes had a reduced activation threshold in general.
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
[0234] Cellular stress can activate granulocytes, which might significantly
contribute to
(auto)inflammatory disease. To analyze if Toso - granulocytes are more prone
to such
activation, wildtype (WT) and Toso - granulocytes were incubated at different
temperatures. Temperature reduction induced degranulation in 30% of Toso
granulocytes, a condition where wildtype granulocytes did not show any
response (FIG.
13f). The difference in the activation threshold could be explained by a
difference in the life
span between WT and Toso' - granulocytes. Granulocytes usually have a very
limited life
span which is underlined by spontaneous apoptosis within 24 hours after in
vitro culture.
Granulocyte activation is usually coupled to prolonged lifespan and decreased
apoptosis.
However, there was no difference in spontaneous apoptosis between Toso - and
WT
granulocytes (FIG. 17). Treatment with GM-CSF reduced apoptosis in
granulocytes a
process which did not depend on Toso (FIG. 17). The data demonstrate that
expression of
Toso protein kept granulocytes in a resting non-activated state when
encountering
inflammatory or stress signals.
Activation threshold in granulocytes is regulated intrinsically
[0235] Granulocytes derived from Toso - mice had a lowered threshold for
differentiation into an effector phenotype when compared to wildtype
granulocytes.
Besides their intrinsic regulation, granulocyte activation is influenced by
several extrinsic
humoral factors (like: cytokines, antibodies, complement factors) as well as
the activation
state of surrounding cells such as B cells, T cells, endothelial cells or
platelets. To gain
more insights into the mechanisms of lowered activation threshold of
granulocytes derived
from Toso - mice, the mixed bone marrow chimeras were analyzed. 057BL/6 mice
were
irradiated and then reconstituted with either WT, Toso - or mixed WT/Tose-
(ratio 1:1)
bone marrow. WT bone marrow could be tracked separately in chimeric mice by
expression of the CD45.1 isoform (FIG. 14a). This mixed bone marrow chimeras
allowed
analysis of the activation threshold of WT and Toso - granulocyte derived from
the same
mouse. Observed differences in the activation threshold (especially those in
the mixed
chimeric mice) would suggest that Toso regulates activation of granulocytes
intrinsically.
Analysis of bone marrow chimeras 30 days after bone marrow transplantation
showed that
Toso - granulocytes reconstituted in the same number as WT granulocytes
suggesting
again that there was no major role of Toso in the development of granulocytes
(FIG. 14b).
In the mixed chimeras total granulocytes (WT and Toso) were comparable to the
mice
66
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
receiving bone marrow from a single mouse strain (FIG. 14b). There was not a
striking
advantage of WT versus Toso - granulocytes in the competitive setting of the
mixed bone
marrow chimera (FIG. 14b).
[0236] Next the activation threshold of WT versus Toso - granulocytes in the
chimeric
mice were analyzed. Treatment with fMLP activated more granulocytes in mice
which
received bone marrow transplantation (FIG. 14a versus FIG. 13a), which may,
without
being limited to this potential mechanism, be due to different cytokine levels
in mice
receiving bone marrow transplantation. Comparable to the data derived from the
Toso
mice, the C57BL/6 mice, reconstituted with Toso - bone marrow, showed a
lowered
activation threshold (FIG. 14c). This was also seen in the mixed bone marrow
chimeras
(FIG. 14c). This suggests that Toso influenced the activation threshold of
granulocytes
intrinsically.
[0237] In order to determine if Toso in addition influenced the strength of
effector
function, the amount of ROS production of activated WT and activated Toso
granulocytes was determined. Activated WT granulocytes showed significantly
more ROS
production than activated Toso - granulocytes (FIG. 14d). These data show that
Toso
enhanced the activation threshold of granulocytes. Once granulocytes were
activated, they
showed enhanced effector function in the presence of Toso.
Impaired control of Listeria in Toso deficient mice
[0238] The effect of the lack of Toso in granulocytes on bacterial control in
vivo was
assessed. Infection with gram-positive Listeria monocytogenes is in particular
strongly
dependent on the fast activation of granulocytes. Infection with a sublethal
dose of Listeria
led to increased death in Toso - mice (FIG. 15a), suggesting that Toso was
essential for
the control of bacteria. Blood granulocytes in Toso - mice showed enhanced
degranulation and ROS production two days after Listeria inoculation (FIG.
15b). This
correlated with enhanced release of Myeloperoxidase in serum of Toso - mice
(FIG. 15c).
[0239] One possibility was that Toso - granulocytes were rapidly activated in
the blood,
but may have failed to exert their full blown effector function in the
infected organ. To
analyze this hypothesis, the infected wildtype or Toso - mice were infected
with 2 x 106
CFU of Listeria and histology was analyzed after 20 hours. Granulomas were
found in both
WT and Toso - mice the (FIG. 15d), suggesting that Toso was not involved in
granuloma
67
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
formation. Staining for Listeria showed enhanced bacteria in the granuloma
(FIG. 15d),
suggesting that the effector function in the granuloma was effected by Toso.
[0240] Analysis of granulocytes one day after infection in the organ, showed
reduced
effector function (FIG. 15e) and Listeria growth was significantly enhanced in
liver and
spleen of Toso mice mice (FIG. 15f). This was associated with spread of
Listeria into the
blood (FIG. 18) and finally also to the brain, which was probably the reason
for death of
Listeria infected Toso - mice (FIG. 15f). These data show that Toso - mice
showed
enhanced susceptibility to Listeria infection. This correlated with enhanced
granulocytes
activation in the blood, reduced effector function in the liver and spleen and
spread of
Listeria to the brain.
Toso regulates surface CD11b and CD18 expression on granulocytes
[0241] Toso deficient granulocytes display enhanced activation in the blood
but reduced
effector function of granulocytes in the tissue. This phenotype would fit well
to a different
expression and/or different signaling of integrins. CD1 1 a, CDllb and CD18
are important
integrins for granulocyte activation. Therefore the expression of CD11a, CD11
b and CD18
was compared in WT and Toso - granulocytes. There was a significantly enhanced
expression of CD1 lb and CD18 on naïve Toso deficient granulocytes (FIG. 16a).
Expression of CD1 1 a was not significantly different between WT and Toso
granulocytes
granulocytes
(FIG. 16a). Upon activation with GM-CSF or LPS, CD1 1 b expression was up-
regulated in
both WT and Toso - granulocytes, however the difference of expression was
decreasing
with increasing LPS and GM-CSF concentrations (FIG. 16b). LPS and GM-CSF
reduced
the activation threshold of granulocytes upon fMLP. Therefore the difference
in the CDllb
expression between WT and Toso-/- granulocytes could likely explain the
different
activation threshold. To see if indeed CD1 lb expression is involved in
regulation of the
activation threshold, the inventors analyzed the role of CD1 lb in the system.
As expected,
lack of CD1 1 b led to reduced expression of CD18 (FIG. 16c). Cd//b-/-
granulocytes
showed reduced activation and ROS production upon treatment with fMLP together
with
GM-CSF (FIG. 16d). These data show that Toso - granulocytes showed enhanced
basal
expression of CD11b, an integrin which influences the activation threshold of
granulocytes.
Those findings linked the enhanced CD1 lb expression in Toso - granulocytes
with the
reduced activation threshold in the absence of Toso.
68
CA 02867444 2014-09-15
WO 2013/136193
PCT/1B2013/001179
Example 10: Toso plays a role in glucose tolerance and insulin sensitivity
[0242] This example demonstrates that Toso plays a role in glucose tolerance
and
insulin sensitivity. FIG. 19 shows that Toso-/- mice have normal food intake
and body
weight after initiation of a high fat diet. For the experiments in FIG. 19A,
body weights of
WT and Toso-1- male mice were monitored since the initiation of high fat diet
(starting at 5
weeks of age). For FIG. 19B, food intake was measured at 14 weeks post high
fat diet.
Food intake was measured by housing animals singly, with determinations of the
differences in food weight at the beginning and end of a 2-day period.
[0243] As shown in FIG. 20, Toso mice mice had enhanced glucose tolerance and
insulin
sensitivity compared to wildtype mice after being on a high fat diet for 10-13
weeks.
Glucose Tolerance test was performed with wildtype and Toso-/- mice that were
fed with
high fat diet for 10-13 weeks since 5 weeks of age (note that similar results
were obtained
with female mice groups). The Insulin Tolerance test was performed with
wildtype and
Toso-/- mice that were fed with high fat diet for 10-13 weeks since 5 weeks of
age.
[0244] Glucose tolerance tests were performed on overnight-fasted animals
between
9:30 and 11:30 a.m., utilizing a glucose dose of 1 g/kg of body weight
injected
intraperitoneally (i.p.) and measurements of glucose levels at 0, 15, 30, 60,
and 120 min
after the injection.
[0245] Insulin
tolerance tests were performed on overnight-fasted animals between
9:30 and 11:30 a.m. or 4.5-hour fasted animals between 1:00-3 p.m., utilizing
human
regular insulin (Humalog) at a dose of 0.5 U/kg body weight, and blood glucose
levels
were measured at 0, 15, 30, 45, and 60 min after the injection.
[0246] In contrast to the mice fed a high fat diet, FIG. 21 shows that Toso
had similar
glucose tolerance and insulin sensitivity to wildtype mice fed when both sets
of mice were
regular chow for 10-13 weeks. Glucose Tolerance test was performed with
wildtype and
Toso-/- male mice that were fed with regular chow (15-18 weeks old). Insulin
Tolerance test
was performed with wildtype and Toso-/- male mice that were fed with regular
chow (15-18
weeks old). FIG. 21 suggests, without being limited by theory, that the
protective effect of
Toso-deficiency requires a high fat diet. Glucose tolerance tests were
performed on
overnight-fasted animals between 9:30 and 11:30 a.m., utilizing a glucose dose
of 1 g/kg
of body weight injected intraperitoneally (i.p.) and measurements of glucose
levels at 0, 15,
30, 60, and 120 min after the injection. Insulin tolerance tests were
performed on
69
CA 02867444 2014-09-15
WO 2013/136193 PCT/1B2013/001179
overnight-fasted animals between 9:30 and 11:30 a.m. or 4.5-hour fasted
animals between
1:00-3 p.m., utilizing human regular insulin (Humalog) at a dose of 0.5 U/kg
body weight,
and blood glucose levels were measured at 0, 15, 30, 45, and 60 min after the
injection.
Example 11: Treatment with soluble Toso improves glucose tolerance in wildtype
mice
fed with a high fat diet
[0247] This example demonstrates that treatment with a soluble Toso protein
(SEQ ID
NO: 5) improved glucose tolerance in wildtype mice fed with a high fat diet
for 14 weeks.
FIG. 22A shows data from wildtype male mice before soluble Toso treatment. The
glucose tolerance test was done with fasted wildtype mice fed with high fat
diet (60% fat
calories) for 14 weeks since 5 weeks of age. FIG. 22B shows data from wildtype
mice
after soluble Toso treatment. The mice (high fat diet for 14 weeks) were
treated with
soluble Toso-hIgG at a dose of 50 pg intraperitoneally on day 0, 2, 5, 7, 9,
and 12.
Glucose tolerance test was performed on day 14 after overnight fasting. During
the course
of the soluble Toso protein treatment, the mice were continued with the high
fat diet.
Glucose tolerance tests were performed on overnight-fasted animals between
9:30 and
11:30 a.m., utilizing a glucose dose of 1 g/kg of body weight injected
intraperitoneally (i.p.)
and measurements of glucose levels at 0, 15, 30, 60, and 120 min after the
injection.
Example 12: Generation of stable cell lines secreting human and mouse Toso-Fc
[0248] Toso-Fc encoding cDNAs were transfected into adherent HEK293T cells
using
Lipofectamine 2000. Single clones were selected in DMEM media supplemented
with
10% Fetal Bovine serum and 0.2 mg/ml Zeocin. High expressing clones were
expanded to
15 cm dishes, and split 1:2 at confluence. At each split, stable transfectants
were cultured
in media with successively more serum free Freestyle media, and successively
less
DMEM /FBS media to condition the cells for serum free growth. (e.g.- 90%
DMEM/FBS
10% Freestyle at split 14 100% Freestyle at split 10). Stable transfectants
conditioned to
grow in serum free media grew in suspension in an orbital shaker incubator (37
C, 8%
CO2, 125 rpm) without a loss in viability.
[0249] The present specification provides a complete description of the
methodologies,
systems and/or structures and uses thereof in example aspects of the presently-
described
technology. Although various aspects of this technology have been described
above with
,
a certain degree of particularity, or with reference to one or more individual
aspects, those
skilled in the art could make numerous alterations to the disclosed aspects
without
departing from the spirit or scope of the technology hereof. Since many
aspects can be
made without departing from the spirit and scope of the presently described
technology,
the appropriate scope resides in the claims hereinafter appended. Other
aspects are
therefore contemplated. Furthermore, it should be understood that any
operations may be
performed in any order, unless explicitly claimed otherwise or a specific
order is inherently
necessitated by the claim language. It is intended that all matter contained
in the above
description and shown in the accompanying drawings shall be interpreted as
illustrative
only of particular aspects and are not limiting to the embodiments shown.
Unless
otherwise clear from the context or expressly stated, any concentration values
provided
herein are generally given in terms of admixture values or percentages without
regard to
any conversion that occurs upon or following addition of the particular
component of the
mixture. Changes in detail or structure may be made without
departing from the basic elements of the present technology as defined in the
following
claims.
71
CA 2867444 2017-08-23
