Note: Descriptions are shown in the official language in which they were submitted.
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
COMPOSITIONS AND METHODS FOR INCREASING THE EXPRESSION AND
SIGNALLING OF PROTEINS ON CELL SURFACES
STATEMENT OF GOVERNMENTAL INTEREST
This invention was made with U.S. government support under grant no.
ROODK081610. The U.S. government has certain rights in the invention.
FIELD OF THE INVENTION
The present invention relates to the field of protein expression. More
specifically, the
present invention provides compositions and methods for increasing the
expression and
signaling of proteins on cell surfaces.
INCORPORATION-BY-REFERENCE OF MATERIAL SUBMITTED
ELECTRONICALLY
This application contains a sequence listing. It has been submitted
electronically via
EFS-Web as an ASCII text file entitled "P12081-02_Sequence_Listing.txt." The
sequence
listing is 4,079 bytes in size, and was created on September 19, 2013. It is
hereby
incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
Olfactory receptors (ORs) are seven transmembrane domain G protein-coupled
receptors (GPCRs) that govern the sense of smell in the olfactory epithelium,
and comprise
the largest gene family in the genome (-1000 OR genes in mice [1] and ¨300 [2]
in
humans). Although this family was first identified over 20 years ago [3], the
majority of
ORs remain orphan receptors, with no known ligand. This is due, in large part,
to the fact
that OR deorphanization is typically attempted using in vitro ligand screening
assays in
heterologous cell systems which require surface expression of the OR as a
prerequisite for
the assay (i.e., HEK293T cells or Xenopus oocytes) [4-7]. Unfortunately, many
ORs do not
traffic to the cell surface in heterologous cell systems; rather, they are
retained in the ER and
degraded [8-10], making ligand assignment impossible. To combat this problem,
studies
have utilized the co-expression of various accessory proteins and/or the
addition of N-
terminal tags [11-14]. For example, the addition of the first 20 amino acids
of rhodopsin
onto the N-terminus of ORs (Rho tag) enhances OR surface expression for a
number of ORs
[15]. Similarly, receptor transporting protein (RTP), originally identified as
a potential
chaperone for ORs [16,17], also enhances expression of multiple ORs. A recent
study
showed that the best surface expression was achieved [18] by co-expressing the
short form
1
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
of RTP (RTP1S) [19], Ric8b (a putative GEF) [20] and Golf (the G protein that
couples to
ORs in the olfactory epithelium) [21] with Rho-tagged ORs. While these tools
have been
beneficial to the field [5,15,16,18,20,22-24] and are the most reliable
enhancers of OR
surface expression available to date, their effects are not universal. Despite
these
developments, many ORs are still unable to reach the cell surface when
heterologously
expressed, and thus remain as orphan receptors.
As membrane proteins, ORs enter the biosynthetic pathway upon translocation
into
the endoplasmic reticulum (ER). Typically, this is accomplished co-
translationally where a
signal peptide serves to mediate ER translocation through the heterotrimeric
Sec61 complex
that forms a channel in the ER membrane [25]. While most GPCRs use one of
their
transmembrane domains (TMD) as a signal anchor sequence, a small subset of
GPCRs and
other TMD proteins (and all secretory proteins) have cleavable signal peptides
which are
found at the extreme N-terminus of the immature protein [26,27]. As their name
implies,
these cleavable signal peptides are not incorporated into the mature protein;
rather they are
cleaved off in the ER membrane upon translocation. While cleavable signal
peptides do not
have a conserved sequence, they do share characteristic features including a
hydrophobic
region flanked by polar amino acids [25,26].
Recently, the single-spanning membrane protein, Leucine Rich Repeat Containing
32
(LRRC32) was found to possess a leucine-rich 17-amino acid cleavable signal
peptide
(MRPQILLLLALLTLGLA) which is required for proper ER translocation and surface
expression in both T regulatory cells (where it is natively expressed) as well
as in HEK293T
cells [28]. Because the addition of other cleavable signal peptides has been
shown to
enhance surface expression for some GPCRs in cell culture [29,30], we
hypothesized that the
addition the LRRC32 signal peptide may promote surface expression of ORs.
Importantly,
as signal peptides are cleaved off in the ER, the addition of such a tag would
not affect the
mature protein, preventing any potential alteration or interference with
ligand binding. To
assay whether the addition of a cleavable signal peptide could aid in OR
surface expression,
we added the 17 amino acid signal peptide from LRRC32 (which we named "Lucy,"
for its
leucine repeats) to the N-terminus of 15 diverse ORs (murine ORs from both
Class I and
Class II, representing 11 different subfamilies, as well as 2 human ORs) and
assayed for
surface expression. We also combined our Lucy tag with both the Rho tag and
the best
practice in OR trafficking (co-expression with accessory proteins RTP1S, Ric8b
and Gaolf
[18]) in order to assess the universal effects of this tag. Here we report
that the Lucy tag, in
2
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
combination with the Rho tag and the accessory proteins, promotes surface
expression of all
ORs tested, raising the possibility for wide-spread deorphanization.
SUMMARY OF THE INVENTION
The present invention is based, at least in part, on the discovery of an N-
terminal tag
sequence which aids in olfactory receptor trafficking. When expressed
exogenously in
mammalian cells, olfactory receptors (ORs) fail to traffic to the cell
surface. This is a
problem in the field as receptor ligands cannot be assayed unless the receptor
is present on
the cell surface. Either alone or in combination with chaperone proteins, this
novel tag
allows all ORs assayed thus far to reach the cell surface.
Accordingly, in one aspect, the present invention provides nucleic
acids/polynucleotide and amino acid/polypeptide sequences useful for
improving/increasing
protein expression on the cell surface. In several embodiments, the sequences
are operably
linked to the N-terminal end of the protein of interest. The nucleic acid
sequence encoding
the sequence tag and the protein comprise part of an expression vector. The
protein is
expressed with the N-terminal sequence tag. In certain embodiments, the
sequences of the
present invention can be used in conjunction with one or more chaperone or
accessory
proteins. In particular embodiments, the one or more chaperone/accessory
proteins are
encoded by the same vector or separate vectors. In other embodiments, the
chaperone/accessory proteins are encoded the same vector that encodes the
protein of
interest.
Using the compositions and methods of the present invention, numerous proteins
can
be expressed on the surface of a host cell. Such proteins can be receptor
proteins. In several
embodiments, the receptor proteins are olfactory receptors. Olfactory
receptors can include,
but are not limited to, 01fr78, Olfr51E2, mOREG (01fr73), 01f145, Olfr691,
0lfr52B2,
01fr99, 0lfi-693, 01fr805, O1fi-1392, 0lfr1393, O1fr90, O1fr545, 01fr985, and
0lfr894.
In another embodiment, the present invention provides composition encoding a
cleavable signal peptide linked to the N-terminus of a protein of interest,
i.e., a cell surface-
expressed protein. In a specific embodiment, the cleavable signal peptide
comprises the Lucy
tag described herein. In a more specific embodiment, the Lucy tag comprises
SEQ ID NO:3.
In another embodiment, the Lucy tag can further comprise a Rho tag. In yet
another
embodiment, the Lucy tag can further comprise a Flag tag. In certain
embodiments, the Lucy
tag further comprises a Rho tag and a Flag tag. The tags (Lucy, Rho, Flag,
and/or the like)
can be linked (or not) with a linker. Thus, a composition that is linked to
the N-terminus of a
protein of interest may comprise SEQ ID NO:1, SEQ ID NO:2 or SEQ ID NO:3.
3
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
The protein of interest can be any surface expressed protein. In certain
embodiments,
the protein of interest is an olfactory receptor. Such a protein can include,
but is not limited
to, 01fr78, Olfr51E2, mOREG (01fr73), 01fl45, 0lfr691, Olfr52B2, 01fr99,
0lfr693,
01fr805, 01fr1392, 01fr1393, 01fr90, 01fr545, 01fr985, and 01fr894.
The present invention can be used to increase expression, trafficking, and/or
signaling
of the protein of interest to the cell surface. In particular embodiments, the
present invention
can be utilized with olfactory receptor proteins and used in assays by
perfume, fragrance,
flavor or food companies. The system or assay can further utilize one or more
chaperone/accessory proteins to assist in the expression, trafficking, and/or
signaling of the
protein of interest to the cell surface. Examples of such proteins include,
but are not limited
to, RTPL1, RTP1S, RTP2, REEP, P-adrenergic receptor, heat shock protein 70,
Ric8b, and
Gaolf.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1. The Lucy tag aids in surface expression of some ORs in the absence of
accessory proteins or the Rho tag. ORs were cloned and expressed in HEK293T
cells
without Rho or Lucy tags (OR), with a Rho tag (Rho-OR), with the Lucy tag
(Lucy-OR) or
with both the Lucy and Rho tags (Lucy-Rho-OR). The cells were then surface
labeled with a
Flag antibody to detect membrane- associated OR. Images were taken for each OR
at equal
exposure for all conditions. To assess OR surface expression, the entirety of
each coverslip
was systematically scanned and scored based on detectable surface
immunofluorescence. A
`+' was scored for those ORs whose surface expression was detectable in >90%
of all fields
of view while ORs received an '4" if surface expression was found in <50% of
all fields of
view. A complete lack of detectable surface expression was scored as a `-`.
Results for 6
representative ORs are shown in FIG. 1 and the results for all ORs tested are
summarized in
Table 1.
FIG. 2. The Lucy tag works synergistically with accessory proteins and tags to
promote surface expression of ORs.
FIG. 3. The Lucy tag is a cleavable signal peptide. HA-Flag-Rho-Olfr691 (A
and B) or HA-Lucy-Flag-Rho-Olfr691 (C and D) constructs were expressed in
HEK293T
cells along with RTP1S. Cells were fixed and stained with both an HA and Flag
antibody
(A and C) to detect total tagged OR or surface labeled with the HA and Flag
antibodies
(B and D) to detect surface-associated OR. HA surface stain is observed only
in the
absence of the Lucy tag, indicating a functional Lucy cleavage site.
4
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
FIG. 4. The Lucy tag increases OR protein levels. (A) Rho-tagged and Lucy-Rho-
tagged ORs (L-OR) were immunoprecipitated from HEK293T cells using monoclonal
M2
Flag beads. Bound (B) lysates were immunoblotted with the Flag antibody to
detect total OR
levels. The arrow indicates the mature OR product at 39 kb. The input was also
immunoblotted with the Flag antibody and then stripped and reprobed for 13-
actin to ensure
equal loading. (B) An ELISA was performed for HEK293T cells expressing either
Rho-
tagged ORs or Lucy-Rho-tagged ORs to detect total OR levels using a monoclonal
Flag
antibody. Total protein levels are graphed as absorbance in arbitrary units.
The dashed line
indicates the background as measured by a non-transfected (NT) control. All
measurements
were performed in quadruplicate and the error bars indicate the SEM. An *
represents
significance as measured by the student T-test (Rho- OR vs. Lucy-OR) with P <
0.005 and a
+ represents significance with a P < 0.05. The Lucy tag increased total OR
expression of
ORs, as shown in both (A) and (B).
FIG. 5. The Lucy tag does not alter OR signaling. (A) A luciferase reporter
assay
was performed for both Rho-0lfr691(R-691) and Lucy-Rho-01fr691 (L-R-691) with
and
without RTP1S. Cells expressing the O1fr691 constructs were grown in a 96-well
plate
and exposed to the known Olfr691 ligand, isovaleric acid (0-5 mM). Error bars
represent the
SEM. By ANOVA and Student- Newman-Keuls, no concentrations of isovaleric acid
activated R-691 (n/s = no significance). For R-691 + RTP1S, L-691, and L-691 +
RTP1S, P
< 0.05 for 0 mM vs. all doses of isovaleric acid (marked by an *). In
addition, for R-691 +
RTP1S, P < 0.05 for 5 vs. 0.5, 0.25 and 0.1, 1 vs. 0.25 and 0.1, 0.5 vs. 0.1.
For L-691, P <
0.05 for 5 vs. 0.1, 0.25 and 0.5. For L-691 + RTP1S, P <0.05 for 5 vs. 0.5,
0.25 and 0.1, 1
vs. 0.5, 0.25 and 0.1, 0.5 vs. 0.1. (B) A luciferase reporter assay was
performed for mOREG
(EG), Rho-mOREG (R- EG), Lucy-mOREG (L-EG) and Lucy-Rho-mOREG (L-R-EG), all
in the absence of RTP1S. Cells expressing the mOREG constructs were grown in a
96-well
plate and exposed to the known mOREG ligand, eugenol (100-300 M). Error bars
represent
the SEM. By ANOVA and Student-Newman-Keuls, all concentrations of eugenol
significantly activated (P < 0.05) e.g., R-EG, L-EG and L-R-EG as compared to
0 M
(marked by an *). In addition, 100 and 300 M eugenol were significant from
each other (P
< 0.05) for both L-EG and L-R-EG. In both A and B, the Firefly: Renilla ratio
was measured
and compared to the non-treated control. An increase in the ratio indicates OR
activation.
Both Lucy-Rho-691 and Lucy-tagged mOREG constructs were activated with their
ligands
indicating that the Lucy tag does not alter OR signaling.
5
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
FIG. 6. The Lucy tag promotes detectable surface expression of olfactory
receptors
in the absence of accessory proteins. (A and B) HEK293T cells were transfected
for 24 h
with Rho-tagged or Lucy-Rho-tagged 01fr691 (A) or its human homologue, hOR52B2
(B).
Cells were surface labeled with a polyclonal Flag antibody to detect surface-
associated OR (a
and b) and then fixed, permeabilized and stained with a monoclonal Flag
antibody to detect
the internal OR population (c and d). Both Olfr691 and hOR52B2 traffic to the
surface with
but not without the Lucy tag.
FIG. 7. The Lucy tag and accessory proteins increase the amount of Olfr691
detected on the cell surface. Surface-labeled Olfr691 was quantitated by
measuring the
mean fluorescence intensity for each image. This graph represents the mean
fluorescence
intensity normalized to the corresponding binary nuclear image for the same
field of view
(surface/nuclear). Error bars represent the SEM, and `+ chaperones' indicates
the presence
of RTP1S, Ric8b and Gaolf. Representative images corresponding to each
condition are
pictured below the graph showing the increased surface expression. For all
conditions that
promoted surface expression (Flag-Rho-691 + chaperones, Lucy-Flag-Rho-691 and
Lucy-
Flag-Rho-691 + chaperones), there was a significant increase in the
surface/nuclear ratio as
compared to Flag- Rho-691 (*P < 0.01 as measured by ANOVA and Student- Newman
Keuls). In addition, the fluorescence for Lucy-Flag- Rho-691 + chaperones was
significantly
increased as compared to both Lucy-Flag-Rho-691 and Flag-Rho-691 + chaperones
(P <
0.001).
FIG. 8. HEK293T cells do not natively express RTP. HEK293T and whole kidney
RNA was reverse transcribed with (+) or without (-) reverse transcriptase and
PCR was
performed using primers for both the long and short form of RTP. Amplified RTP
had an
expected size of 548 bp. RTP was amplified from kidney cDNA but not from
HEK293T
cDNA.
FIG. 9 shows the nucleotide (SEQ ID NO:1) and amino acid (SEQ ID NO:2)
sequence of Lucy tag+Flag tag+Rho tag.
DETAILED DESCRIPTION OF THE INVENTION
It is understood that the present invention is not limited to the particular
methods and
components, etc., described herein, as these may vary. It is also to be
understood that the
terminology used herein is used for the purpose of describing particular
embodiments only,
and is not intended to limit the scope of the present invention. It must be
noted that as used
herein and in the appended claims, the singular forms "a," "an," and "the"
include the plural
6
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
reference unless the context clearly dictates otherwise. Thus, for example, a
reference to a
"protein" is a reference to one or more proteins, and includes equivalents
thereof known to
those skilled in the art and so forth.
Unless defined otherwise, all technical and scientific terms used herein have
the same
meaning as commonly understood by one of ordinary skill in the art to which
this invention
belongs. Specific methods, devices, and materials are described, although any
methods and
materials similar or equivalent to those described herein can be used in the
practice or testing
of the present invention.
All publications cited herein are hereby incorporated by reference including
all
journal articles, books, manuals, published patent applications, and issued
patents. In
addition, the meaning of certain terms and phrases employed in the
specification, examples,
and appended claims are provided. The definitions are not meant to be limiting
in nature and
serve to provide a clearer understanding of certain aspects of the present
invention.
The term "nucleic acid" or "polynucleotide" refers to a polymeric form of
nucleotides
of any length, either ribonucleotides and/or deoxyribonucleotides. These terms
include a
single-, double- or triple-stranded DNA, genomic DNA, cDNA, RNA, DNA-RNA
hybrid, or
a polymer comprising purine and pyrimidine bases, or other natural,
chemically,
biochemically modified, non-natural or derivatized nucleotide bases. The
backbone of the
nucleic acid can comprise sugars and phosphate groups (as may typically be
found in RNA or
DNA), or modified or substituted sugar or phosphate groups. Alternatively, the
backbone of
the nucleic acid can comprise a polymer of synthetic subunits such as
phosphoramidates and
thus can be an oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed
phosphoramidate-
phosphodiester oligomer. In addition, a double-stranded nucleic acid can be
obtained from
the single stranded nucleic acid product of chemical synthesis either by
synthesizing the
complementary strand and annealing the strands under appropriate conditions,
or by
synthesizing the complementary strand de novo using a DNA polymerase with an
appropriate
primer.
The following are non-limiting examples of nucleic acids: a gene or gene
fragment,
exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant nucleic acids,
branched nucleic acids, plasmids, vectors, isolated DNA of any sequence,
isolated RNA of
any sequence, nucleic acid probes, and primers. A nucleic acid may comprise
modified
nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl,
other sugars and
linking groups such as fluororibose and thioate, and nucleotide branches. The
sequence of
nucleotides may be interrupted by non-nucleotide components. A nucleic acid
may be further
7
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
modified after polymerization, such as by conjugation with a labeling
component. Other
types of modifications included in this definition are caps, substitution of
one or more of the
naturally occurring nucleotides with an analog, and introduction of means for
attaching the
nucleic acid to proteins, metal ions, labeling components, other nucleic
acids, or a solid
support.
The terms "isolated," "purified," or "biologically pure" refer to material
that is free to
varying degrees from components which normally accompany it as found in its
native state.
Various levels of purity may be applied as needed according to this invention
in the different
methodologies set forth herein; the customary purity standards known in the
art may be used
if no standard is otherwise specified.
By "isolated nucleic acid (or polynucleotide) molecule" is meant a nucleic
acid (e.g.,
a DNA, RNA, or analog thereof) that is free of the genes which, in the
naturally occurring
genome of the organism from which the nucleic acid molecule of the present
invention is
derived, flank the gene. The term therefore includes, for example, a
recombinant DNA that is
incorporated into a vector, into an autonomously replicating plasmid or virus;
or into the
genomic DNA of a prokaryote or eukaryote; or that exists as a separate
molecule (for
example, a cDNA or a genomic or cDNA fragment produced by PCR or restriction
endonuclease digestion) independent of other sequences. In addition, the term
includes an
RNA molecule which is transcribed from a DNA molecule, as well as a
recombinant DNA
which is part of a hybrid gene encoding additional polypeptide sequence.
As used herein, the term "operably linked" means that nucleic acid sequences
or
proteins are operably linked when placed into a functional relationship with
another nucleic
acid sequence or protein. For example, a promoter sequence is operably linked
to a coding
sequence if the promoter promotes transcription of the coding sequence. As a
further
example, a repressor protein and a nucleic acid sequence are operably linked
if the repressor
protein binds to the nucleic acid sequence. Additionally, a protein may be
operably linked to
a first and a second nucleic acid sequence if the protein binds to the first
nucleic acid
sequence and so influences transcription of the second, separate nucleic acid
sequence.
Generally, "operably linked" means that the DNA sequences being linked are
contiguous,
although they need not be, and that a gene and a regulatory sequence or
sequences (e.g., a
promoter) are connected in such a way as to permit gene expression when the
appropriate
molecules (e.g., transcriptional activator proteins--transcription factors--or
proteins which
include transcriptional activator domains) are bound to the regulatory
sequence or sequences.
The term "amino acid" refers to naturally occurring and synthetic amino acids,
as well
8
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
as amino acid analogs and amino acid mimetics that function in a manner
similar to the
naturally occurring amino acids. Naturally occurring amino acids are those
encoded by the
genetic code, as well as those amino acids that are later modified, for
example,
hydroxyproline, gamma-carboxyglutamate, and 0-phosphoserine, phosphothreonine.
An "amino acid analog" refers to a compound that has the same basic chemical
structure as a naturally occurring amino acid, i.e., a carbon that is bound to
a hydrogen, a
carboxyl group, an amino group, and an R group (e.g., homoserine, norleucine,
methionine
sulfoxide, methionine methyl sulfonium), but that contains some alteration not
found in a
naturally occurring amino acid (e.g., a modified side chain). The term "amino
acid mimetic"
refers to chemical compounds that have a structure that is different from the
general chemical
structure of an amino acid, but that function in a manner similar to a
naturally occurring
amino acid. Amino acid analogs may have modified R groups (for example,
norleucine) or
modified peptide backbones, but retain the same basic chemical structure as a
naturally
occurring amino acid. In one embodiment, an amino acid analog is a D-amino
acid, a beta-
amino acid, or an N-methyl amino acid.
Amino acids and analogs are well known in the art. Amino acids may be referred
to
herein by either their commonly known three letter symbols or by the one-
letter symbols
recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides,
likewise, may be referred to by their commonly accepted single-letter codes.
The terms "polypeptide," "protein," and "peptide" are used herein
interchangeably to
refer to amino acid chains in which the amino acid residues are linked by
peptide bonds or
modified peptide bonds. The amino acid chains can be of any length of greater
than two
amino acids. Unless otherwise specified, the terms "polypeptide," "protein,"
and "peptide"
also encompass various modified forms thereof. Such modified forms may be
naturally
occurring modified forms or chemically modified forms. Examples of modified
forms
include, but are not limited to, glycosylated forms, phosphorylated forms,
myristoylated
forms, palmitoylated forms, ribosylated forms, acetylated forms, etc.
Modifications also
include intra-molecular crosslinking and covalent attachment to various
moieties such as
lipids, flavin, biotin, polyethylene glycol or derivatives thereof, etc. In
addition,
modifications may also include cyclization, branching and cross-linking.
Further, amino
acids other than the conventional twenty amino acids encoded by genes may also
be included
in a polypeptide.
An "expression vector" or "vector" is a nucleic acid construct, generated
recombinantly or synthetically, bearing a series of specified nucleic acid
elements that enable
9
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
transcription of a particular gene in a host cell. A vector is typically
designed for
transduction/transfection of one or more cell types. Typically, gene
expression is placed
under the control of certain regulatory elements, including constitutive or
inducible
promoters, tissue-preferred regulatory elements, and enhancers.
A "host cell" is any prokaryotic or eukaryotic cell that contains either a
cloning vector
or an expression vector. This term also includes those prokaryotic or
eukaryotic cells that
have been genetically engineered to contain the cloned gene(s) in the
chromosome or genome
of the host cell. In certain embodiments, a "host cell" or "transformed cell"
refers to a cell
into which (or into an ancestor of which) has been introduced, by means of
recombinant
DNA techniques, a polynucleotide molecule encoding (as used herein) a protein
of the
present invention.
By "fragment" is meant a portion (e.g., at least about 5, 10, 25, 50, 100,
125, 150,
200, 250, 300, 350, 400, or 500 amino acids or nucleic acids) of a protein or
nucleic acid
molecule that is substantially identical to a reference protein or nucleic
acid and retains at
least one biological activity of the reference. In some embodiments the
portion retains at least
50%, 75%, or 80%, or more preferably 90%, 95%, or even 99% of the biological
activity of
the reference protein or nucleic acid described herein.
By "substantially identical" is meant a protein or nucleic acid molecule
exhibiting at
least 50% identity to a reference amino acid sequence (for example, any one of
the amino
acid sequences described herein) or nucleic acid sequence (for example, any
one of the
nucleic acid sequences described herein). Preferably, such a sequence is at
least 60%, more
preferably 80% or 85%, and most preferably 90%, 95% or even 99% identical at
the amino
acid level or nucleic acid to the sequence used for comparison.
Sequence identity is typically measured using sequence analysis software (for
example, Sequence Analysis Software Package of the Genetics Computer Group,
University
of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis.
53705,
BLAST, BESTFIT, GAP, or PILEUP/PRETTYBOX programs). Such software matches
identical or similar sequences by assigning degrees of homology to various
substitutions,
deletions, and/or other modifications. Conservative substitutions typically
include
substitutions within the following groups: glycine, alanine; valine,
isoleucine, leucine;
aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine;
lysine, arginine; and
phenylalanine, tyrosine. In an exemplary approach to determining the degree of
identity, a
BLAST program may be used, with a probability score between e-3 and e-100
indicating a
closely related sequence.
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
The present invention is based, at least in part, on the discovery of an N-
terminal tag
sequence which aids in olfactory receptor trafficking. When expressed
exogenously in
mammalian cells, olfactory receptors (ORs) fail to traffic to the cell
surface. This is a
problem in the field as receptor ligands cannot be assayed unless the receptor
is present on
the cell surface. Either alone or in combination with chaperone proteins, this
novel tag
allows all ORs assayed thus far to reach the cell surface.
The present inventors believe that this tag has never before been used on an
OR or
any other exogenously expressed receptor construct. This tag, either alone
(for some ORs) or
in combination with previously identified chaperones (for other ORs) is able
to successfully
traffic all ORs assayed to the cell surface. This tag is cleaved off of the
protein during
protein processing. Because ORs on the cell surface will then be used to assay
function of
the OR (to screen for potential ligands), adding an N-terminal tag in many
cases is not ideal
as it may alter the structure of the protein. However, this tag succeeds in
getting the OR out
of the endoplasmic reticulum and Golgi, but is cleaved off before the OR
reaches the cell
surface. This is a unique feature, and this allows scientists to assay a
surface-expressed OR
that no longer has the tag (and therefore the tag cannot interfere with or
modify ligand
binding).
By allowing ORs to traffic to the cell surface, the present invention, in
certain
embodiments, greatly speeds the rate at which odorants and ligands are
identified. This can
help basic science researchers to identify ligands for receptors, and can also
help
fragrance/flavor companies as they seek to develop new perfumes, etc.
Accordingly, in one aspect, the present invention provides nucleic
acids/polynucleotide and amino acid/polypeptide sequences useful for
improving/increasing
protein expression on the cell surface. In several embodiments, the sequences
are operably
linked to the N-terminal end of the protein of interest. The nucleic acid
sequence encoding
the sequence tag and the protein comprise part of an expression vector. The
protein is
expressed with the N-terminal sequence tag. In certain embodiments, the
sequences of the
present invention can be used in conjunction with one or more chaperone or
accessory
proteins. In particular embodiments, the one or more chaperone/accessory
proteins are
encoded by the same vector or separate vectors. In other embodiments, the
chaperone/accessory proteins are encoded the same vector that encodes the
protein of
interest.
Using the compositions and methods of the present invention, numerous proteins
can
be expressed on the surface of a host cell. Such proteins can be receptor
proteins. In several
11
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
embodiments, the receptor proteins are olfactory receptors. Olfactory
receptors can include,
but are not limited to, 01fr78, Olfr51E2, mOREG (01fr73), 01f145, 01fr691,
Olfr52B2,
01fr99, 01fr693, 01fr805, 01fr1392, 01fr1393, 01fr90, 01fr545, 01fr985, and
01fr894.
In a specific embodiment, the present invention provides the nucleotide
sequence set
forth in SEQ ID NO: 1. In another embodiment, a nucleotide sequence encodes
the amino
acid sequence of SEQ ID NO:2. In yet another embodiment, the present invention
provides
an amino acid sequence set forth in SEQ ID NO:2.
The present invention also provides an N-terminal amino acid sequence useful
in
trafficking proteins to the cell surface comprising SEQ ID NO:3. In certain
embodiments,
SEQ ID NO:3 can be referred to as the "Lucy tag." In another embodiment, the
sequence
further comprises a Flag tag. The Flag tag can comprise SEQ ID NO:6. In a
specific
embodiment, the sequence further comprises a Rho tag. The Rho tag can comprise
SEQ ID
NO:10. In a further embodiment, the sequence further comprises a Flag tag and
a Rho tag.
The sequence can further comprise a linker between the Flag tag and the Rho
tag. The linker
can be any linker that allows/promotes/increases surface expression of a
protein of interest
can include, for example, a 3 amino acid linker. In one embodiment, the linker
comprises
SEQ ID NO:8. In certain embodiments, the Lucy tag is upstream of the Flag tag,
followed by
the linker and the Rho tag.
The present invention also provides an N-terminal amino acid sequence useful
in
trafficking proteins to the cell surface comprising an amino acid sequence
substantially
identical to SEQ ID NO:3. In one embodiment, the sequence has at least about
85% identity
to SEQ ID NO:3. In other embodiments, the sequence has at least about 88%, at
least about
90%, at least about 91%, at least about 92%, at least about 93%, at least
about 94%, or at
least about 95% identity to SEQ ID NO:3 (Lucy tag). Indeed, the present
invention
contemplates one or more amino acid substitutions to the Lucy tag. Such
substitutions can be
conservative substitutions. One of ordinary skill in the art can substitute
amino acids based
on similar side chain polarity (e.g., alanine and cysteine are both non-polar)
and/or side chain
charge (e.g., isoleucine and leucine are both neutral). In most embodiments,
the Lucy tag
retains its leucine rich nature.
In another embodiment, the N-terminal amino acid sequence useful in
trafficking
proteins to the cell surface further comprises a Flag tag. In another
embodiment, the
sequence further comprises a Rho tag. In a further embodiment, the sequence
further
comprises a Flag tag and a Rho tag. In a specific embodiment, the sequence
further
comprises a linker between the Flag tag and the Rho tag.
12
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
In another aspect, the present invention provides systems for increasing
surface
expression of proteins. In one embodiment, the system comprises: (a) a vector
comprising (i)
a nucleotide sequence described herein or (ii) a nucleotide sequence encoding
an amino acid
sequence described herein; and (b) a vector encoding a chaperone protein that
aids in
expression, signaling and/or trafficking of the protein to the cell surface.
In particular
embodiments, the protein is an olfactory receptor. The system can be used to
clone in the
sequence encoding a protein of interest into the vector of step (a). In
specific embodiments,
the chaperone protein is a receptor trafficking protein. The receptor
trafficking protein can be
selected from the group consisting of RTPL1, RTP1S, and RTP2. In another
embodiment,
the chaperone protein is Receptor Expressing Enhancing Protein (REEP). In yet
another
embodiment, the chaperone protein is 0-adrenergic receptor. The can also be
heat shock
protein 70 homo log. In a specific embodiment, the chaperone protein is
Resistance to
Inhibitors of Cholinesterase 8 homolog B (Ric8b). The chaperone protein can
also be
Olfactory G-protein (Gaolf). The system can utilize any combination of the
foregoing
including, but not limited to, RTP1S, Ric8b and Gaolf. A vector can encode one
or more
chaperon proteins or multiple vectors can be used. In certain embodiments, the
system
further comprises a cell line. In a specific embodiment, the cell line may
comprise HEK293T
cells.
The present invention further provides a system for increasing surface
expression of
proteins comprising: (a) a vector comprising a nucleotide sequence encoding
SEQ ID NO:3;
(b) a vector encoding RTP1S; (c) a vector encoding Ric8b; and (d) a vector
encoding Gaolf.
It is understood that the nucleotide sequence encoding the protein of interest
can be cloned
into the vector of step (a). In particular embodiments, the Lucy tag is
operably linked to the
N-terminal end of the protein of interest. Alternatively, a vector can encode
one or more
chaperone/accessory proteins. Further, a single vector can be used to encode
SEQ ID NO:3,
the protein of interest and one or more chaperone/accessory proteins. In an
alternative
embodiment, the vector of step (a) further comprises a nucleotide sequence
encoding a Flag
tag. In another embodiment, the vector of step (a) further comprises a
nucleotide sequence
encoding Rho tag. In yet another embodiment, the vector of step (a) further
comprises a
nucleotide sequence encoding a Flag tag and a Rho tag. Further, the vector of
step (a) can
comprise a linker between the Flag tag and the Rho tag.
The present invention also provides a system for increasing surface expression
of
proteins comprising: (a) a vector comprising a nucleotide sequence encoding
SEQ ID NO:2;
(b) a vector encoding RTP1S; (c) a vector encoding Ric8b; and (d) a vector
encoding Gaolf.
13
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
The nucleotide sequence encoding the protein of interest can be cloned into
the vector of step
(a). In another embodiment, a system for increasing surface expression of
olfactory receptors
comprises: (a) a vector comprising a nucleotide sequence encoding SEQ ID NO:2;
(b) a
vector encoding RTP1S; (c) a vector encoding Ric8b; and (d) a vector encoding
Gaolf. the
nucleotide sequence encoding the olfactory receptor can be cloned into the
vector of step (a).
In particular embodiments, the Lucy tag is operably linked to the N-terminal
end of the
protein of interest/olfactory receptor.
Without further elaboration, it is believed that one skilled in the art, using
the
preceding description, can utilize the present invention to the fullest
extent. The following
examples are illustrative only, and not limiting of the remainder of the
disclosure in any way
whatsoever.
EXAMPLES
The following examples are put forth so as to provide those of ordinary skill
in the art
with a complete disclosure and description of how the compounds, compositions,
articles,
devices, and/or methods described and claimed herein are made and evaluated,
and are
intended to be purely illustrative and are not intended to limit the scope of
what the inventors
regard as their invention. Efforts have been made to ensure accuracy with
respect to numbers
(e.g., amounts, temperature, etc.) but some errors and deviations should be
accounted for
herein. Unless indicated otherwise, parts are parts by weight, temperature is
in degrees
Celsius or is at ambient temperature, and pressure is at or near atmospheric.
There are
numerous variations and combinations of reaction conditions, e.g., component
concentrations, desired solvents, solvent mixtures, temperatures, pressures
and other reaction
ranges and conditions that can be used to optimize the product purity and
yield obtained from
the described process. Only reasonable and routine experimentation will be
required to
optimize such process conditions.
Olfactory receptors (ORs) are G protein-coupled receptors that detect odorants
in the
olfactory epithelium, and comprise the largest gene family in the genome.
Identification of
OR ligands typically requires OR surface expression in heterologous cells;
however, ORs
rarely traffic to the cell surface when exogenously expressed. Therefore, most
ORs are
orphan receptors with no known ligands. To date, studies have utilized non-
cleavable
rhodopsin (Rho) tags and/or chaperones (i.e., Receptor Transporting Protein,
RTP1S, Ric8b
and Gaolf) to improve surface expression. However, even with these tools, many
ORs still
fail to reach the cell surface. We used a test set of fifteen ORs to examine
the effect of a
cleavable leucine-rich signal peptide sequence (Lucy tag) on OR surface
expression in
14
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
HEK293T cells. We report here that the addition of the Lucy tag to the N-
terminus increases
the number of ORs reaching the cell surface to 7 of the 15 ORs (as compared to
3/15 without
Rho or Lucy tags). Moreover, when ORs tagged with both Lucy and Rho were co-
expressed
with previously reported chaperones (RTP1S, Ric8b and Gaolf), we observed
surface
expression for all 15 receptors examined. In fact, two-thirds of Lucy-tagged
ORs are able to
reach the cell surface synergistically with chaperones even when the Rho tag
is removed
(10/15 ORs), allowing for the potential assessment of OR function with only an
8-amino acid
Flag tag on the mature protein. As expected for a signal peptide, the Lucy tag
was cleaved
from the mature protein and did not alter OR-ligand binding and signaling. Our
studies
demonstrate that widespread surface expression of ORs can be achieved in
HEK293T cells,
providing promise for future large-scale deorphanization studies.
Materials and Methods
Reagents and Antibodies. Polyclonal (F7425) and M2 monoclonal (F1804) Flag
antibodies and M2 Flag beads were purchased from Sigma (St. Louis, MO). The
monoclonal
HA antibody (3F10) was purchased from Roche (Indianapolis, IN) and the 13-
actin antibody
was purchased from Abcam (Cambridge, MA). Alexa- conjugated fluorescent
secondary
antibodies were purchased from Invitrogen (Carlsbad, CA). HRP-conjugated
secondary
antibodies were purchased from Jackson ImmunoResearch Labs (West Grove, PA).
The
Dual-Luciferase Reporter Assay kit was purchased from Promega (Madison, WI).
The
odorants used in this study, isovaleric acid and eugenol, were also purchased
from Sigma.
OR Constructs and Cloning. The mOR-EG full-length construct, containing N-
terminal Flag/Rho tags, was a kind gift from Kazushige Touhara (Univ. of
Toyko) [22]. To
clone the full-length sequences of the other ORs tested into the "Rho-OR"
vector, the
sequence encoding mOR-EG was excised from its parent vector (pME18S) and PCR
products containing the full-length sequence of other ORs of interest were
ligated into the
corresponding sites in this vector. ORs were ligated in frame with an upstream
start site,
such that they incorporated sequences encoding N-terminal Flag and Rho tags.
Full-length
human OR51E2 and OR52B2 were amplified by PCR from human DNA (using primers
which added appropriate restriction sites), taking advantage of the fact that
ORs do not
contain introns. The constructs containing murine 0108 (MOR18-2), Olfr90
(MOR256-
21), O1fr1392 (MOR256-25), 0lfr1393 (MOR256-24) and mOR-EG have been
previously
described [31]. The other full-length ORs were amplified using primers which
added
appropriate restriction sites from either mouse genomic DNA or from kidney RNA
after
performing RT (01fr145 (MOR161-6, K21), 0lfr99 (M0R156-1), O1fr394 (M0R135-8),
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
01fr545 (M0R42-1, S50), 01fr691 (MOR31-6), 01fr693 (M0R283-8), 01fr805 (MOR110-
4), and 01fr985 (MOR171-4)). All constructs used in this study contain a Flag
tag for
detection purposes but will be referenced based on their other N-terminal tags
for
simplicity. All constructs were sequenced to confirm identity.
The Lucy tag (atgagaccccagatectgctgctectggccctgctgaccctaggcctggct) (SEQ ID
NO:4)
was added to the original (Rho-OR) vector for 01fr691 using overlap-extension
PCR [32] to
obtain a Lucy-Rho-OR. Subsequently, 0lfr691 was excised from the Lucy-Rho
vector, and
the other ORs were excised from the original parent vector (Rho-OR) using the
same
restriction sites. The other ORs were then subcloned into the Lucy-Rho vector
by ligation.
The Rho tag was deleted from both the Rho-01fr78 and Lucy-Rho-0lfr78
constructs
to obtain the OR or Lucy- OR constructs using PCR-mediated deletion [33].
Subsequently,
0108 was excised from the vectors, and the other ORs were excised from the
original parent
vector (Rho-OR) using the same restriction sites and then subcloned into the
OR and
Lucy- OR vectors by ligation.
To assay Lucy cleavage, an HA tag was added to the extreme N-terminus of the
Lucy-Rho construct for Olfr691 using overlap-extension PCR [32], yielding an
HA-Lucy-
Flag- Rho-0lfr691 construct. As a control, an HA tag was also added to the
extreme N-
terminus of the Rho construct for O1fr691, yielding an HA-Flag-Rho-Olfr691
construct.
Immunofluorescence. HEK293T cells were seeded onto 18-mm coverslips coated
with poly-L-lysine and transfected with OR constructs with or without
accessory proteins
(Lipofectamine 2000, Invitrogen). Flag-tagged OR trafficking was assayed using
surface
immunocytochemistry, as previously described [5]. Briefly, live, non-
permeabilized cells at
4 C were exposed to a rabbit polyclonal anti-Flag antibody in PBS with 0.1%
BSA.
Subsequently, cells were washed, fixed with 4% paraformaldehyde, permeabilized
(0.3%
Triton X-100) and then exposed to a mouse monoclonal (M2) anti-Flag antibody.
As the
external Flag epitope (surface Flag) epitope is 'blocked' after binding to the
polyclonal
Flag antibody, the monoclonal Flag antibody detects only the internal
population of ORs.
Control experiments where the cells were surface labeled with the polyclonal
Flag antibody
followed by another surface label with the monoclonal Flag antibody confirmed
that 100% of
the external Flag epitopes were bound by the polyclonal antibody, as no
subsequent labeling
was seen with the second surface label. Fluorescent secondary antibodies
reported the
localization of the polyclonal and monoclonal Flag-tags. Cells were visualized
for
epifluorescence using a Zeiss Axiophot microscope (Thomwood, NY). Images were
taken
16
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
with a CoolSnap Digita Camera (Photometrics, Tuscon, AZ) and IP Labs software
(Biovision, Exton, PA). For some experiments, a total of 0.8 jig of accessory
plasmids
(pcDNA3-RTP1S (modified from RTP1L, kind gift from S. Firestein, Columbia
Univ.),
pCMV Sport6-Ric8b (purchased from Open Bioystems), and pcDNA3.1-Gaolf
(subcloned
from a pGEMHE2 Gaolf construct, kind gift from S. Firestein, Columbia Univ.))
or 0.8 jig
of an empty pcDNA4.1 vector (OR alone) were co-transfected along with 0.8 jig
of the OR.
In FIG.s 1 and 2, the immunofluorescent images shown in each row (OR, Rho-OR,
Lucy-
OR and Lucy-Rho- OR with and without accessory proteins) were transfected and
processed
simultaneously and image exposures remained constant for each OR. Images
represent
representative fields of view from at least 4 independent experiments. To
assess OR surface
expression, the entirety of each coverslip was systematically scanned and
scored based on
detectable surface immunofluorescence. A `+' was scored for those ORs whose
surface
expression was detectable in >90% of all fields of view while ORs received an
"" if
surface expression was found in <50% of all fields of view. A complete lack of
detectable
surface expression was scored as a `-`. To quantitate cell surface expression
using ImageJ
(FIG. 7), the background was subtracted from the surface labeled O1fr691
images and the
mean fluorescence intensity was measured. The mean intensity was normalized to
the mean
intensity of the corresponding binary nuclear image, to control for cell
number.
ORs were cloned and co-expressed in HEK293T cells without Rho or Lucy tags
(OR), with a Rho tag (Rho-OR), with the Lucy tag (Lucy-OR) or with both the
Lucy and Rho
tags (Lucy-Rho-OR) along with (or without) the chaperone proteins, RTP1S,
Ric8b and
Gaolf. The cells were then surface labeled with a Flag antibody to detect
membrane-
associated OR. Images were taken for each OR at equal exposure for all
conditions. To
assess OR surface expression, the entirety of each coverslip was
systematically scanned and
scored based on detectable surface immunofluorescence. A `+' was scored for
those ORs
whose surface expression was detectable in >90% of all fields of view while
ORs received
an `*' if surface expression was found in <50% of all fields of view. A
complete lack of
detectable surface expression was scored as a `-`. Results for 6
representative ORs are shown
in FIG. 2 and the results for all ORs tested are summarized in Table 1.
Enzyme-Linked Immunosorbent Assay (ELISA). ELISA measurements in HEK 293T
cells transfected with various constructs were performed as previously
described [5,34].
Wells for ELISA were assayed in quadruplicate. Briefly, transfected cells
seeded in a 96
well plate were fixed and permeabilized. OR-expressing cells were probed with
the
17
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
polyclonal Flag antibody and detected with anti-rabbit HRP- conjugated
secondary antibody.
HRP levels were detected with 1-Step Ultra TMB (3,3',5,5'-
tetramethylbenzidine) (Thermo
Scientific, Rockville, IL).
Immunoprecipitation and Western Blotting. HEIC293T cells in 35-mm dishes were
transfected for 24 h with either the Rho- OR or Lucy-Rho- OR constructs and
lysed in lysis
buffer containing 1% NP-40, 150 mM NaC1, 50 mM Tris and 1 mM EDTA on ice for
30
min. The lysate was cleared by centrifugation at 16,000 x g for 30 min at 40C
and 10% of
the lysate was collected in Laemmli sample buffer for later analysis. Flag-
tagged ORs were
then inununoprecipitated from the remaining lysate using M2 monoclonal Flag
beads.
Both the immunoprecipitated fraction (B) and unbound fractions (UB) were lysed
in
Laernmli sample buffer and equal amounts were loaded on a gel along with the
input lysate.
Proteins were transferred to a nitrocellulose membrane and immunoblotted with
the
polyclonal Flag antibody using standard procedures. The input lysate membrane
was
stripped and reprobed for 13- actin to ensure equal loading.
Luciferase Assay. The luciferase assay was performed as previously described
[5].
Briefly, ORs were transfected into HEK293T cells along with constructs
encoding for
CREB-dependent luciferase (Firefly) and a constitutively expressed luciferase
(Renilla). OR
activation leads to a rise in cAMP which drives an increase in Firefly
luciferase expression.
Firefly activity is normalized to the activity of the Renilla luciferase to
control for variation
in cell number and transfection efficiency. Data were collected using a
FLUOstar Omega
automated platereader (BMG LabTech, Cary, NC). For some experiments, RTP1S was
also
transfected.
Statistical Analysis. One-way ANOVA analysis followed by the Student-Newman
Keuls test was performed on the luciferase reporter assay to compare the doses
of isovaleric
acid (0.1-5 mM) or eugenol (100-300 ,M) to the non-treated control (0 M). As
each
condition was performed in triplicate, the analyses were done with an n=3, and
P values <
0.05 were deemed significant. One-way ANOVE followed by Student-Newman Keuls
was
also used to analyze the surface expression data in FIG. 7. A Student T-Test
was performed
on the ELISA to assess the significance of the increased protein expression
(Control
construct vs. Lucy construct for each OR, n=4 for each condition). P values <
0.05 were
deemed significant. In both the luciferase reporter assay and the ELISA, the
error bars
represent the SEM.
18
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
Results
Surface Expression of OR with and without Rhodopsin tags. Many ORs remain
orphan receptors due to their inability to traffic in in vitro assays. To
establish the trafficking
ability of a varied group of ORs, we cloned 15 diverse ORs, the majority of
which are orphan
receptors which have not been previously reported to reach the cell surface.
Live, non-
permeabilized HEK 293T cells were surface labeled with a Flag antibody to
detect
membrane associated receptor and OR surface expression was scored based on
detectable
surface immunofluorescence. A `+' was scored for those ORs whose surface
expression was
detectable in >90% of all fields of view, while ORs received an "" if surface
expression
was found in <50% of all fields of view (n=4). A complete lack of detectable
surface
expression was scored as a `-`(Table 1). Examples of OR surface expression (or
absence)
can be found in FIG. 1, and the results for all ORs are summarized in Table 1
(Columns 1, 3,
5, and 7). ORs were cloned both with and without a 22-amino acid Rho tag (an N-
terminal
tag often used to aid in surface trafficking of ORs in vitro [15]). A small
number of ORs
were detected on the cell surface even in the absence of the Rho tag (Table 1,
column 1).
Surprisingly, the addition of the Rho tag (Table 1, column 3) had little
effect on the number
of ORs which reached the cell surface. Importantly, 'internal' Flag staining
was consistently
seen for every construct (as shown in FIG. 6 for Rho-01fr691 and Rho-h0R52B2).
Table 1. Trafficking of olfactory receptors in the absence and presence of
RTP1S, Ric8b and
Gaolf (accessory factors).
Columns 1 2 3 4 5 6 7 8
Flag-tagged OR Rho-OR Lucy- Lucy-
Olfactory OR Rho-OR
Receptors
Chaperones? None RTP1S, Ric8b, None RTP1S, Ric8b, None RTP1S, Ric8b, None
RTP1S, Ric8b,
Gaolf Gaolf Gaolf Gaolf
01fr78 + + + + + + + +
hOR51E2 + + + + + + + +
mOREG + + + + + + -+ +
O1fr145 * + + + + + IF +
O1fr691 - + - + + + + +
hOR52B2 - - - - + + + +
_
01fr99 - - - - + + + +
01fr693 - - - + - - +
01fr805 - - - - - - * +
01fr1392 - - - + - + +
01fr1393 - - - + - + +
Olfr90 - - - + - + +
01fr545 - - - - - +
01fr985 - - - - - +
01fr394 - - - - - - *
-: No detectable OR surface expression
19
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
+: OR surface expression detected in the majority of fields of view (>90% of
all fields of
view)
*: OR surface expression detected in a minority of fields of view (<50% of all
fields of view)
A cleavable signal peptide enhances olfactory receptor surface expression.
Recently,
a 17-amino acid N-terminal signal peptide on Leucine Rich Repeat Containing 32
(LRRC32)
was found to be required for proper cell surface expression of LRRC32 in
regulatory T cells
and HEK293T cells. This sequence (MRPQILLLLALLTLGLA) (SEQ ID NO:3) represents
a classic cleavable signal peptide that serves to mediate the integration of
proteins into the
ER membrane [28]. We hypothesized that the addition of this cleavable peptide,
known here
as "Lucy" for its leucine rich repeat regions, could also promote surface
expression of
olfactory receptors; the use of a cleavable signal sequence would be
advantageous, as it
would potentially aid in trafficking without adding additional amino acids to
the mature OR
protein. To determine whether the Lucy tag can promote OR surface trafficking,
we added
the Lucy sequence to the N- terminus of the 15 ORs and found that a total of 7
ORs were
able to reach the cell surface (Table 1, column 5). To determine if the Lucy
and Rho tags
may have an additive effect, we assayed for the surface expression of ORs
tagged with both
Lucy and Rho and found that 8 ORs reached the cell surface (Table 1, column
7).
Lucy works synergistically with RTP1s and other accessory proteins to promote
OR
surface expression. Previously, studies have found that the Rho tag works in
synergism with
RTP1S, Ric8b and Gaolf to induce the greatest functional expression of ORs to
date [18].
Therefore, we wondered if the Lucy tag could also work synergistically with
these accessory
proteins. To test for this, OR constructs (both with and without the Rho and
Lucy tags) were
co-transfected into cells along with RTP1S, Ric8b, Gaolf and assayed for
detectable surface
expression. Examples can be seen in FIG. 2 and the results for all ORs are
summarized in
Table 1 (Columns 2, 4, 6, and 8). For the untagged ORs, co-expression of the
accessory
proteins allowed for surface expression of 5 ORs (Table 1, column 2). When Rho-
tagged
ORs were co- expressed with accessory proteins (currently the best practice
for achieving
OR surface expression [18]), 9 ORs were found on the cell surface (Table 1,
column 4).
When Lucy-tagged ORs were co-expressed with the accessory proteins, 10 ORs
were found
on the cell surface (Table 1, column 6). These data confirm that the Rho tag
can work
synergistically with accessory proteins to promote proper expression [18], and
demonstrate
that the same is true for the Lucy tag (Table 1). Importantly, when we used
Lucy-Rho-
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
tagged ORs together with known chaperones (RTP1S/Ric8b/Gaolf), all 15 ORs were
detected on the cell surface (Table 1, Column 8).
It is worth noting that although the Rho tag, the Lucy tag, and OR chaperones
all
promote surface expression of some (but not all) ORs tested, they seem to
promote
expression of different populations of ORs. For example, 01fr99 and hOR52B2
require the
Lucy tag for surface expression, but not the combination of accessory proteins
or the Rho tag
(Table 1). On the other hand, 01fr1393, 1392 and 90 are found on the cell
surface only when
co-expressed with RTP1S, Ric8b and Gaolf and one of the N-terminal tags (Lucy
or Rho).
Still, other ORs (i.e., Olfr691) properly traffic with either the Lucy tag or
the accessory
proteins (but not the Rho tag alone). Ideally, one would prefer to achieve
surface expression
with the minimal amount of modification to the OR protein itself. Importantly,
as a classic
signal peptide, the Lucy tag contains a putative cleavage site. As such, it is
not present on
the mature protein which reaches the plasma membrane (as demonstrated below,
FIG. 3).
Using the cleavable Lucy tag (in the absence of the 22-amino acid Rho tag), we
are able to
achieve surface expression of 10/15 ORs tested (Table 1, Column 6). This will
allow for
functional characterization of these ORs with only an 8-amino acid flag tag on
the plasma
membrane protein (previously, only 5 ORs reached the cell surface with a Flag
tag alone,
Table 1, Column 2).
Finally, although our goal was to achieve surface expression for ORs which did
not
previously reach the cell surface at all, we noted that some ORs appeared to
have enhanced
surface expression when both the Lucy tag and the accessory proteins were
present (for
example, Olfr78 and Olfr691 as seen in FIG.s 1 and 2). The increase in surface
expression
was confirmed when the fluorescent surface images were quantitated for O1fr691
(FIG. 7).
The Lucy tag is cleaved. The Lucy tag is a putative cleavable signal peptide
found on
the N-terminus of LRRC32, and has been previously shown to be cleaved from the
mature
LRRC32 protein [28]. To determine whether the Lucy tag is also cleaved from
the olfactory
receptor constructs, we added an HA tag to the extreme N-terminus of both Rho-
01fr691
(FIG. 3A,B) and Lucy-Rho-01fr691 (FIG. 3C,D). These constructs were then
expressed in
HEK293T cells along with RTP1S, which allows for Rho-tagged Olfr691 surface
expression.
The cells were stained in parallel with both an HA and Flag antibody to detect
either the total
OR population for both tags (FIG. 3A, C), or, on a separate coverslip, the
cell surface
membrane-associated receptor only for both tags (FIG. 3B, D). If the Lucy tag
is cleaved,
the HA tag should be removed (along with the Lucy tag) early on in the
biosynthetic pathway
21
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
and should not be detectable at the cell surface. When cells expressing HA-
Flag-Rho-691
were stained, both Flag and HA antibodies could detect surface- associated
(FIG. 3A) and
intracellular receptor (FIG. 3B), indicating that both tags were present on
the mature protein.
However, when HA-Lucy-Flag-Rho-691 was surface labeled, the HA epitope was no
longer
present on the cell surface, although surface-associated receptor was still
detectable via the
Flag tag (FIG. 3D). In addition, while there was abundant intracellular Flag
staining, there
was only weak HA staining (FIG. 3C). Taken together, these results indicate
that the Lucy
tag acts as a functional, cleavable signal peptide when added to the N-
terminus of ORs and is
likely removed early on in the biosynthetic pathway.
The Lucy tag increases total protein levels of all ORs. When staining HEK293T
cells
expressing either Rho-ORs or Lucy-Rho-ORs, we noted that there was
consistently more
surface and intracellular Flag staining with the Lucy tagged constructs (FIG.
6). Since Lucy
is an ER signal peptide, it is possible that it stabilizes the protein, and
thus, increases
expression. To examine total protein levels, we transfected HEK293T cells with
either Rho-
OR or Lucy-Rho- OR constructs, lysed the cells, and immunoprecipitated the OR
using M2
Flag beads. An aliquot of the original lysate (input) and the
immunoprecipitated ORs were
then immunoblotted with a Flag antibody and a subset of ORs are shown in FIG.
4A.
Typically, ORs are detected as a complex of high- molecular weight bands,
likely due to
aggregation, degradation and other modifications [8,16], as seen in the whole
cell extract
(FIG. 4A input); immunoprecipitation (FIG. 4A IP: Flag) allows for improved
resolution.
Both the high molecular weight bands and a prominent band at 39 kDa (the
predicted size of
tagged ORs) were completely recovered in the bound lysate (no bands were
detected in the
unbound fraction). In both the immunoprecipitate and input lysate, the
presence of the Lucy
tag appears to increase total OR protein expression (FIG. 4A). To ensure equal
loading,
the immunoblot was stripped and reprobed for 0-actin. To quantitate the
increase in OR
protein, we performed an ELISA to detect total Flag protein levels. As seen in
FIG. 4B,
levels of Rho-ORs were elevated just slightly above background (nontransfected
control;
dashed line). However, when the Lucy tag was added, protein levels of all ORs
tested were
increased (1.5-2 fold increase n = 4, P < 0.005), suggesting that the Lucy tag
may stabilize
the expressed ORs (FIG. 4B).
Lucy does not alter OR-ligand specificity. OR surface expression in
heterologous cell
systems is a prerequisite for further functional studies, including OR
deorphanization. Since
Lucy is a cleaved signal peptide, it is not incorporated into the mature
protein and thus,
should not interfere with OR-ligand specificity or downstream signaling.
22
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
However, some data have suggested that ORs require a "co- receptor" (RTP1S) to
signal properly [19]. To determine whether Lucy-tagged ORs expressed on the
cell
surface can still respond to their ligands in the absence of RTP1S, and to
ensure that the
Lucy tag is not altering ligand binding or detection, we assayed for a
functional ligand
response using a luciferase reporter assay [5]. In this assay, OR-ligand
binding leads to an
increase in cAMP which drives the expression of a CRE luciferase. An increase
in the
Firefly (CRE-dependent luciferase): Renilla (constitutively activated
luciferase) ratio
indicates OR activation. Previously, it was determined that Olfr691 responds
to isovaleric
acid [16]. Here, Rho-01fr691 and Lucy-Rho-01fr691 were expressed in HEK293T
cells with
or without RTP1S and exposed to 0.1-5 mM isovaleric acid. By itself, Rho-
01fr691 was not
significantly activated at any concentration (FIG. 5A), confirming the lack of
detectable
surface expression as seen by immunofluorescence (FIG. 1). When Rho-01fr691
was co-
expressed with RTP1S, we observed a dose-dependent increase in the Firefly:
Renilla ratio (P
< 0.002 for all doses compared to 0 mM), confirming the previous findings
(FIG. 5A). Lucy-
Rho-01fr691 also responded to isovaleric acid in a dose-dependent manner with
and without
the addition of RTP1S (P < 0.007 for all doses compared to 0 mM) confirming
that the
surface expression observed in FIG.s 1 and 2 represents functional protein. As
seen in FIG.
5A, we found that OR constructs with higher surface expression (whether due to
the Lucy
tag, Rho tag, or chaperones) tended to have a higher Firefly/Renilla ratio at
baseline (non-
treated, NT) in the luciferase reporter assay. This often corresponded to a
higher ratio with
stimulation as well, implying that the increased baseline may indicate a low
level of basal
signaling in the absence of ligand.
To confirm that the Lucy tag does not interfere with OR- ligand binding and
downstream signaling and that RTP1S is not required for proper activation, we
also
performed the luciferase reporter assay on mOREG (FIG. 5B). mOREG is a well-
characterized OR known to respond to eugenol (hence its name). As mOREG is one
of the
ORs that reach the cell surface under every condition tested, we expressed the
OR with
and without the Lucy and Rho tags and assessed its response to eugenol. Every
permeation
of the mOREG construct resulted in a dose-dependent activation with eugenol (P
< 0.05, 300
M vs. tM), once again suggesting that the cleavable Lucy tag does not
interfere with OR-
ligand binding and that properly trafficked ORs likely do not require a co-
receptor for
function
23
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
Discussion
The limiting factor in OR deorphanization has been the ability¨or, often, the
inability¨to heterologously express ORs on the cell surface. Here, we report
that the addition
of a leucine rich cleavable signal peptide (Lucy tag) onto the N-terminus of
ORs significantly
improves detectable surface expression, as well as total protein expression.
When combined
with RTP1S, Ric8b and Gaolf, we found that all 15 of the Lucy-ORs that we
examined
successfully trafficked to the surface, providing promise for future
deorphanization and other
functional studies.
What is the mechanism of the Lucy tag? Cleavable signal peptides are natively
found
on secreted proteins and subsets of TMD proteins (including some GPCRs)
[25,26].
Recognition of these cleavable peptides at the extreme N-terminus of the
protein by the
Signal Recognition Particle (SRP) promotes co-translational ER translocation
and ensures
that the complete mature protein is translated in the lumen of the ER (as
opposed to the
cytosol) [25,26]. When TMD proteins do not contain a cleavable signal peptide,
one of the
TMDs (usually the first) takes its place and acts as a signal anchor sequence.
Therefore, a
signal peptide at the N-terminus of proteins is not required for proper ER
translocation and
only 5-10% of GPCRs possess a classic signal peptide [26]. Typically,
receptors that utilize
a signal peptide have long N- terminal tails that can rapidly fold, preventing
post-
translational translocation across the ER membrane [26]. ORs do not have
unusually long N-
terminal tails, and it is possible that the co- translational ER entry via the
Lucy tag helps to
stabilize the receptor or prevents misfolding. In support of this, our
preliminary studies
showed that mRNA levels of Lucy and non- Lucy-tagged constructs were similar,
despite the
fact that total protein expression for all ORs was enhanced by the addition of
the Lucy tag
(FIG. 4). However, in addition to increasing total protein levels, the Lucy
tag by itself
promoted surface expression of some ORs (FIG. 1). This indicates that the Lucy
tag has
roles beyond protein translation and may be promoting some of the later steps
of protein
trafficking or ER exit. ORs do not natively possess signal peptides, but they
are not retained
in the ER when natively expressed in the olfactory epithelium (OE); thus, the
Lucy tag must
be helping ORs to overcome ER processing problems that are unique to
heterologous
expression. Although the Lucy tag does increase total expression, this
increase does not
appear to account for the increase in surface expression. In preliminary
studies, we found
that simply transfecting more of a Rho-tagged OR (in g), did not correlate
with increased
24
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
surface expression. Therefore, the increase in both total and surface
expression for Lucy-
tagged ORs is unique to the tag itself.
It should be noted that the Lucy tag may be dependent on the immediate
upstream
sequence of the mature protein. Mutational studies have shown that signal
peptides and their
adjacent N-terminal sequences act as a "functional unit" and deletion of this
upstream
domain negatively affects ER translocation [26,35]. As our Lucy-tagged
constructs
contained a Flag tag (for detection purposes) following the cleavable peptide,
the presence of
this tag may be required for proper function and cleavage. Preliminary studies
found that
deletion of the Flag tag from a Lucy-Flag-OR construct prevented the OR from
responding to
its ligand, suggesting impaired surface expression (without the Flag tag,
surface expression
could not be assayed independently in this construct). It appears, then, that
like other N-
terminal sequences [26,35], the 'context' of the Lucy tag may be important for
its function.
Multiple Blockage Steps for OR Trafficking. Studies have shown that ORs are
retained in the ER when expressed in heterologous cells where they undergo ER-
associated
degradation [8,13,36,37]. However, as demonstrated by Wu, et al [19], the ER-
Golgi
transition step is not the only point of retention. This is evidenced in our
work by the fact
that, under the same conditions, some ORs are more efficiently trafficked to
the cell surface
than others, despite taking what is presumed to be a common route to the
plasma membrane.
For example, in this study 01fr78, hOR51E2 and mOREG trafficked to the cell
surface
even in the absence of the Rho tag. While the surface expression was
relatively weak,
mOREG does respond its ligand in the absence of the Rho tag (FIG. 5B). Others,
however,
required much more assistance to make it to the plasma membrane. Olfr545,
O1fr985 and
Olfr394 required both the Lucy and Rho tags as well as the co- transfection of
RTP1S, Ric8b
and Gaolf for proper surface expression. What can account for these
differences? It is likely
that some ORs are retained at multiple cellular checkpoints and each of these
tags and
accessory proteins function at one (or more than one) of these points. Further
studies are
clearly required to fully understand OR trafficking and the Lucy tag could
prove to be a
valuable tool to answer these questions.
What is the function of RTP1S?. The current "gold standard" in OR trafficking
was
found to be the combination of a Rho tag with RTP1S, Ric8b and Golf [18]. Of
these three
accessory proteins, RTP1S is thought to be the most crucial as it can promote
OR surface
expression even in the absence of the other two compounds for some ORs
[5,15,16,22-24].
Indeed, we have found that RTP1S is often required for cell surface
expression. By contrast,
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
Gaolf is typically not required, and Ric8b is only occasionally necessary.
RTP1S is natively
expressed in the olfactory epithelium, and thus, it has been speculated that
it is necessary for
OR expression in both heterologous cells as well as the OE [16,18]. Recently,
Wu et al
performed a series of mutations and substitutions to RTP1S in order to
elucidate the
mechanism(s) of this important protein [19]. From this study, it was concluded
that RTP1S
and olfactory receptors (in this case 01fr599) interact throughout the
biosynthetic pathway,
and that individual domains of RTP1S are required for different stages of OR
trafficking.
It was also speculated that RTP1S may function as a co-receptor as the
localization of both
the OR and RTP1S to lipid raft domains was required for OR activation [19].
Indeed,
much of our data is consistent with this study. Many of the ORs that we
examined required
RTP1S (with Ric8b and Gaolf) for proper surface expression (i.e., O1fr693,
01fr1392,
Olfr1393, Olfr90 and 01fr545). However, we also found that O1fr78, hOR51E2 and
mOREG
(Fig 5B) were able to respond to their ligand even in the absence of RTP1S. To
ensure that
RTP is not natively expressed in HEK 293T cells, we performed RT-PCR using
primers
that could detect both the long and short form of RTP but did not detect any
band in
HEK293T cells (a positive control performed simultaneously gave a band of the
expected
size; Fig. S3). In addition, Olfr691 was functionally expressed on the cell
surface (with the
Lucy tag) in the absence of RTP1S, and retained a normal ligand response (Fig.
5A). While
RTP1S is clearly playing important roles in the early trafficking steps and
folding of
olfactory receptors, it is not required for OR activation or surface
expression and therefore is
not an obligate co-receptor. Use of the Lucy tag can help shed new light on
the functions of
RTP15, as OR function can now be assayed both with and without RTP1S (FIG. 5).
Potential for deorphanization. OR deorphanization has been greatly hampered by
the
inability to functionally express ORs in heterologous cell systems. To date,
the addition of
N-terminal tags or the co- expression of chaperone proteins has been crucial
for surface
expression of many receptors, but has not allowed for widespread OR
deorphanization. In
this study, we examined the trafficking of 15 diverse ORs with the Lucy tag,
many of which
are orphan receptors. Because the Lucy tag is cleaved prior to surface
expression, this tag
does not interfere with or alter ligand binding. In fact, for many ORs, the
addition of the
cleavable Lucy tag allowed surface expression even in the absence of the 22-
amino acid Rho
tag (FIG.s 1 and 2), allowing for the potential of OR deorphanization with
only an 8 amino
acid Flag tag on the mature protein. The identification of ligands for ORs is
becoming
increasingly important and has implications beyond olfaction. It has recently
been
26
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
demonstrated that ORs are expressed in multiple tissues outside of the OE
[31,38-43],
where they play functional roles in processes as varied as muscle cell
migration, renal
function, and sperm chemotaxis. In order to understand the roles that ORs are
playing both
in the OE and in other tissues, ligand assignment is imperative. The addition
of the Lucy tag
represents a distinct improvement in the trafficking of heterologously
expressed ORs which
we hope will lead to future wide scale deorphanization studies.
References
1. Godfrey PA, Malnic B, Buck LB (2004) The mouse olfactory receptor gene
family. Proc Natl Acad Sci USA 101: 2156-2161.
2. Malnic B, Godfrey PA, Buck LB (2004) The human olfactory receptor gene
family. Proc Natl Acad Sci USA 101: 2584-2589.
3. Buck L, Axel R (1991) A novel multigene family may encode odorant
receptors: a molecular basis for odor recognition. Cell 65: 175-187.
4. Katada S, Nakagawa T, Kataoka H, Touhara K (2003) Odorant response
assays for a heterologously expressed olfactory receptor. Biochem Biophys Res
Commun
305: 964-969.
5. Zhuang H, Matsunami H (2008) Evaluating cell-surface expression and
measuring activation of mammalian odorant receptors in heterologous cells. Nat
Protoc 3:
1402-1413.
6. Touhara K (2007) Deorphanizing vertebrate olfactory receptors: recent
advances in odorant-response assays. Neurochem Int 51: 132-139.
7. Wetzel CH, Oles M, Wellerdieck C, Kuczkowiak M, Gisselmann G et al.
(1999) Specificity and sensitivity of a human olfactory receptor functionally
expressed in
human embryonic kidney 293 cells and Xenopus Laevis oocytes. J Neurosci 19:
7426-7433.
8. Lu M, Echeverri F, Moyer BD (2003) Endoplasmic reticulum retention,
degradation, and aggregation of olfactory G-protein coupled receptors. Traffic
4: 416-433.
9. McClintock TS, Sammeta N (2003) Trafficking prerogatives of olfactory
receptors. Neuroreport 14: 1547-1552.
10. Mombaerts P (2004) Genes and ligands for odorant, vomeronasal and taste
receptors. Nat Rev Neurosci 5: 263-278.
11. Gaillard I, Rouquier S, Pin JP, Mollard P, Richard S et al. (2002) A
single
olfactory receptor specifically binds a set of odorant molecules. Eur J
Neurosci 15: 409-418.
27
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
12. Hague C, Uberti MA, Chen Z, Bush CF, Jones SV et al. (2004) Olfactory
receptor surface expression is driven by association with the beta2-adrenergic
receptor. Proc
Natl Acad Sci USA 101: 13672-13676.
13. Lu M, Staszewski L, Echeverri F, Xu H, Moyer BD (2004) Endoplasmic
reticulum degradation impedes olfactory G-protein coupled receptor functional
expression.
BMC Cell Biol 5: 34.
14. Hall RA (2009) Olfactory receptor interactions with other receptors.
Ann. N Y
Acad Sci 1170: 147-149.
15. Krautwurst D, Yau KW, Reed RR (1998) Identification of ligands for
olfactory receptors by functional expression of a receptor library. Cell 95:
917-926.
16. Saito H, Kubota M, Roberts RW, Chi Q, Matsunami H (2004) RTP
family members induce functional expression of mammalian odorant receptors.
Cell 119:
679-691.
17. Matsunami H, Mainland JD, Dey S (2009) Trafficking of mammalian
chemosensory receptors by receptor-transporting proteins. Ann NY Acad Sci
1170: 153-
156.
18. Zhuang H, Matsunami H (2007) Synergism of accessory factors in
functional expression of mammalian odorant receptors. J Biol Chem 282: 15284-
15293.
19. Wu L, Pan Y, Chen GQ, Matsunami H, Zhuang H (2012) Receptor-
transporting protein 1 short (RTP1S) mediates translocation and activation of
odorant
receptors by acting through multiple steps. J Biol Chem 287: 22287-22294.
20. Von Dannecker LE, Mercadante AF, Malnic B (2006) Ric-8B promotes
functional expression of odorant receptors. Proc Natl Acad Sci USA 103: 9310-
9314.
21. Belluscio L, Gold GH, Nemes A, Axel R (1998) Mice deficient in G(olf)
are anosmic. Neuron 20: 69-81.
22. Kajiya K, Inaki K, Tanaka M, Haga T, Kataoka H et al. (2001) Molecular
bases of odor discrimination: Reconstitution of olfactory receptors that
recognize overlapping
sets of odorants. J Neurosci 21: 6018-6025.
23. Nara K, Saraiva LR, Ye X, Buck LB (2011) A large-scale analysis of odor
coding in the olfactory epithelium. J Neurosci 31: 9179-9191.
24. Saito H, Chi Q, Zhuang H, Matsunami H, Mainland JD (2009) Odor
coding by a Mammalian receptor repertoire. Sci Signal 2: ra9.
25. Zimmermann R, Eyrisch S, Ahmad M, Helms V (2011) Protein
translocation across the ER membrane. Biochim Biophys Acta 1808: 912-924.
28
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
26. Schulein R, Westendorf C, Krause G, Rosenthal W (2012) Functional
significance of cleavable signal peptides of G protein-coupled receptors. Eur
J Cell Biol 91:
294-299.
27. Zampatis DE, Rutz C, Furkert J, Schmidt A, Wustenhagen D et al. (2012)
The protease-activated receptor 1 possesses a functional and cleavable signal
peptide which
is necessary for receptor expression. FEBS Lett 586: 2351-2359.
28. Chan DV, Somani AK, Young AB, Massari JV, Ohtola J et al. (2011)
Signal peptide cleavage is essential for surface expression of a regulatory T
cell surface
protein, leucine rich repeat containing 32 (LRRC32). BMC Biochem 12: 27: 1471-
2091
29. Dunham JH, Hall RA (2009) Enhancement of the surface expression of G
protein-coupled receptors. Trends Biotechnol 27: 541-545.
30. Guan XM, Kobilka TS, Kobilka BK (1992) Enhancement of membrane
insertion and function in a type Mb membrane protein following introduction of
a cleavable
signal peptide. J Biol Chem 267: 21995-21998.
31. Pluznick JL, Zou DJ, Zhang X, Yan Q, Rodriguez-Gil DJ et al. (2009)
Functional expression of the olfactory signaling system in the kidney. Proc
Natl Acad Sci
USA 106: 2059-2064.
32. Bryksin AV, Matsumura 1(2010) Overlap extension PCR cloning: a
simple and reliable way to create recombinant plasmids. BioTechniques 48: 463-
465.
33. Hansson MD, Rzeznicka K, Rosenback M, Hansson M, Sirijovski N
(2008) PCR-mediated deletion of plasmid DNA. Anal Biochem 375: 373-375.
34. Chapin HC, Rajendran V, Capasso A, Caplan MJ (2009) Detecting the
surface localization and cytoplasmic cleavage of membrane-bound proteins.
Methods Cell
Biol 94: 223-239.
35. Bush CF, Hall RA (2008) Olfactory receptor trafficking to the plasma
membrane. Cell Mol Life Sci 65: 2289-2295.
36. Alken M, Schmidt A, Rutz C, Furkert J, Kleinau G et al. (2009) The
sequence after the signal peptide of the G protein-coupled endothelin B
receptor is required
for efficient translocon gating at the endoplasmic reticulum membrane. Mol
Pharmacol 75:
801-811.
37. Jacquier V, Prummer M, Segura JM, Pick H, Vogel H (2006) Visualizing
odorant receptor trafficking in living cells down to the single-molecule
level. Proc Natl Acad
Sci USA 103: 14325-14330.
29
CA 02884462 2015-03-09
WO 2014/037800
PCT/1B2013/002242
38. Griffin CA, Kafadar KA, Pavlath GK (2009) M0R23 promotes muscle
regeneration and regulates cell adhesion and migration. Dev Cell 17: 649-661.
39. Pavlath GK (2010) A new function for odorant receptors: M0R23 is
necessary for normal tissue repair in skeletal muscle. Cell Adh Migr 4: 502-
506.
40. Spehr M, Gisselmann G, Poplawski A, Riffell JA, Wetzel CH et al.
(2003)
Identification of a testicular odorant receptor mediating human sperm
chemotaxis. Science
299: 2054-2058.
41. Spehr M, Schwane K, Riffell JA, Zimmer RK, Hatt H (2006) Odorant
receptors and olfactory-like signaling mechanisms in mammalian sperm. Mol Cell
Endocrinol 250: 128-136.
42. Zhang X, Rogers M, Tian H, Zhang X, Zou DJ et al. (2004) High-
throughput microarray detection of olfactory receptor gene expression in the
mouse. Proc
Natl Acad Sci USA 101: 14168-14173.
43. Zhang X, De la Cruz 0, Pinto JM, Nicolae D, Firestein S et al. (2007)
Characterizing the expression of the human olfactory receptor gene family
using a novel
DNA microarray. Genome Biol 8: R86.
