Note: Descriptions are shown in the official language in which they were submitted.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
1
USE OF MASITINIB FOR TREATMENT OF CANCER IN PATIENT SUBPOPULATIONS
IDENTIFIED USING PREDICTOR FACTORS
The present invention relates to a method for treating patients afflicted with
cancer, wherein
said patients are treated with a tyrosine kinase inhibitor, mast cell
inhibitor or c-Kit inhibitor,
in particular masitinib, optionally in combination with at least one
antineoplastic agent. The
tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, and the
optional at least one
antineoplastic agent, are administered in a dosage regimen that comprises a
therapeutically
effective amount. The present invention also relates to methods for predicting
therapeutic
response to said treatment in a given patient and therefore identification of
applicable patient
subpopulations based upon these predictor factors; sometimes referred to as
predictive
biomarkers. One method is based upon the clinical marker of pain intensity.
The second
method is based upon gene expression predictive biomarkers assessed via RNA
expression
in peripheral blood cell samples collected prior to treatment with a compound
of the invention
(i.e. a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor,
especially masitinib).
Advantageously, the present invention relates to a method for treating
patients afflicted with
pancreatic cancer wherein said patients are treated with a tyrosine kinase
inhibitor, mast cell
inhibitor or c-Kit inhibitor, and in particular masitinib, optionally in
combination with at least
one antineoplastic agent, and in particular gemcitabine.
BACKGROUND OF THE INVENTION
The role of mast cells in tumor microenvironment, tumorigenesis, and cancer
pain
Throughout the process of tumorigenesis, disease progression, and metastasis,
the
microenvironment of the local host tissue is an active participant and
determines the extent
of cancer cell proliferation, angiogenesis, invasion, and survival. The role
of mast cells in the
tumorigenesis of cancers is not well understood, however it is hypothetically
possible that
mast cell activation facilitates the growth and spread of some cancers by
producing
molecules that enhance tumor invasiveness. For example, mast cells have been
directly
linked to the development of pancreatic cancer tumorigenesis in mouse models,
showing
that high levels of mast cell infiltration into the tumor microenvironment was
predictive of
poor clinical outcome, although the exact mechanism by which mast cells
contribute to
pancreatic cancer development was not clear [Chang DZ et al., Olin Cancer Res
2011;17:7015-7023]. Hence, inhibition of mast cell function may prove to be of
therapeutic
benefit in restraining the growth of cancers for which there is sufficient
mast cell involvement.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
2
Exactly which cancers would benefit from targeting mast cell activity is
however largely
unknown or controversial. There exists conflicting data about whether mast
cells benefit or
hinder tumorigenesis, depending on the local stromal conditions and if the
mediators
released facilitate the proliferation of tumor cells or induce the apoptosis
of malignant cells
[(Theoharides TO, et al., Trends Immunol 2004;25:235-41); (Samoszuk M, et al.,
BMC
Cancer 2005;21:121); (Almholt K, et al., Recent Results Cancer Res 2003;162:31-
42);
(Gooch JL, et al., Cancer Res 1998; 15:4199-205)]. Moreover, consistent with
the dual roles
of mast cells in inhibiting or promoting tumor growth, high mast cell numbers
have been
shown to represent a good prognostic indicator in breast cancer, non¨small
cell lung
carcinoma, and ovarian cancer [(Galinsky DS, et al. Crit Rev Oncol Hematol
2008;68:115-
30); (Ribatti D, et al., Int Rev Cell Mol Biol 2009;275:89-131)], but they are
associated with
poor prognosis in skin cancer (both melanoma and nonmelanoma and Merkel cell
tumors)
[Grimbaldeston MA, et al., Br J Dermatol 2004;150:895-903); (Grimbaldeston MA,
et al., J
Invest Dermatol 2000;115:317-20)], oral squamous cell carcinoma, several types
of
lymphoma, and prostate cancer [(Galinsky DS, et al., Crit Rev Oncol Hematol
2008;68:115-
30); (Ribatti D, et al., Int Rev Cell Mol Biol 2009;275:89-131)]. It also
remains unclear
whether mast cell density or the degree of mast cell activation represents the
key
consideration in mast cell related symptoms, these two aspects not necessarily
correlating
with one another [Hermine 0, et al., PLoS ONE. 2008;3:e2266].
Mast cells are associated with diverse disease related pain and are emerging
as having a
role in cancer pain. Mast cells have been linked to the pathogenesis of pain
in conditions for
which pain is a predominant symptom but is considered to be out of proportion
to the
objective pathological findings, i.e. indicating that anatomical abnormalities
cannot alone
account for the pain; examples include chronic pancreatitis, interstitial
cystitis, and irritable
bowel syndrome. Each of these conditions has been associated with an increased
number of
mast cells in the pancreas, bladder, or colon, respectively, as compared with
those patients
without disease related pain. Although the etiology of cancer pain remains
unclear, the
current understanding indicates that within the cancer microenvironment,
cancer and
immune cells produce and secrete mediators that activate and sensitize primary
afferent
nociceptors. Schmidt at al. reviewed the mechanisms of cancer pain [Schmidt
BL, et al., Mol
Interv. 2010 Jun;10(3):164-78], summarizing the symptoms experienced by the
cancer
patient as being a consequence of cellular, tissue, and systemic changes that
occur during
proliferation, invasion, and metastasis, with the responding immune system
also having a
clear role in cancer pain.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
3
Thus, although there is evidence for diverse, indirect mast cell involvement
in tumorigenesis
(i.e. as opposed to mast cells themselves being the proliferating cancer cell)
and also cancer
pain, its heterogeneous and disparate nature precludes any clear approach as
to how
targeting mast cell activity could have a therapeutic impact for cancer
patients; one
preferably manifested as an augmentation of survival time. This is equally
true for those
cancers having an established association with increased mast cell
involvement, such as
pancreatic cancer.
Cancer pain and pharmacotherapy pain control
The etiology of cancer pain is complex and remains poorly understood. Cancer
pain can be
severe and debilitating, drastically reducing quality-of-life in patients who
already have an
attenuated life expectancy. Considering in particular pancreatic cancer,
abdominal and back
pain is a significant complication with nearly 75% of unresectable pancreatic
cancer patients
suffering from pain at the time of diagnosis, increasing to more than 90% of
patients in
advanced disease [Hameed M, et al., Cancers 2011, 3, 43-60]. Pain in
pancreatic cancer
may be visceral, somatic, or neuropathic in origin and is produced by tissue
damage,
inflammation, ductal obstruction, and infiltration. Visceral nociceptive pain
is caused by
damage to the upper abdominal viscera, structures that are particularly
sensitive to stretch,
ischemia and inflammation, which typically produces a poorly localized,
diffuse pain. Somatic
and neuropathic pain may arise from tumor extension into the surrounding
peritoneum,
retroperitoneum, bones and in the latter case, nerves such as the lumbosacral
plexus.
Opioid analgesics are commonly used to manage cancer pain, their mechanism of
action
being to act directly on the central nervous system. However, this can also
lead to unwanted
side effects, such as constipation, drowsiness, dizziness, breathing problems,
and physical
or mental dependence. The World Health Organization (WHO) has published a
standardized
approach for analgesic drug regimens administered for the control of chronic
cancer pain in
the form of an "analgesic ladder" [Available online:
www.who.int/cancer/palliative/painladderien/ (accessed on 13 March 2012)].
This model
recommends that if pain occurs, there should be prompt oral administration of
drugs in the
following order: "nonopioids such as paracetamol for mild pain; then, as
necessary, mild
opioids such as codeine for mild to moderate pain; then strong opioids such as
morphine for
moderate to severe pain, until the patient is free of pain. To calm fears and
anxiety,
adjuvants drugs should be used. To maintain freedom from pain drugs should be
administered on regular schedule, that is every 3-6 hours rather than on-
demand". This
stepwise approach is based on the severity of pain and less on the
pathophysiologic process
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
4
of pain, although it has been recommended that to increase the efficacy of
available
therapeutic modalities, the multiple types of pain generating processes in
cancer (visceral,
somatic, and neuropathic) should also be taken into consideration [Hameed M,
et al.,
Cancers 2011, 3, 43-60].
Assessment of cancer pain and quality-of-life in cancer patients
In order to assess and record cancer pain the clinician must select
appropriate assessment
instruments and procedures. However, there is currently no universally
accepted cancer pain
assessment tool or consensus even on what such a tool should assess. As a
consequence
there is great diversity of dimensions and items used in the existing tools,
which can affect
the validity of pain assessment in general and also makes comparisons between
studies
difficult. Pain assessment tools may be unidimensional or multidimensional.
Based upon
literature reviews and expert working groups' opinions, it is generally agreed
that single item
unidimensional tools are among the most frequently used pain assessment tools
in cancer
patients. Moreover, for simple assessment of changes in pain intensity and for
assessment
of pain intensity in clinical settings, Visual Analogue Scale (VAS) based
tools have been
proven to be psychometrically satisfactory [Jensen, MP, et al., J Pain
2003;4(1): 2e21].
Unidimensional pain assessment tools include the numeric rating scale (0 is
"no pain" and 10
is "worst pain imaginable"); a verbal descriptor scale ("no pain," "mild
pain," "moderate pain,"
"severe pain"); or a visual analogue scale (a 100 mm line with anchors such as
"no pain" on
the left and "worst pain imaginable" on the right) on which the patient
indicates the place on
the line that best represents the intensity of pain). Each scale has its
strengths and
weaknesses; however, most self-report measures of pain intensity are strongly
related to
one another and can be used interchangeably in many situations, especially
when clear
instructions and an opportunity for practice has been given.
Subjective pain can be categorized into at least four specific factors: pain
intensity, pain
affect, pain relief, and pain quality [Jensen, MP, et al., In: Chapman CR,
Foley KM, eds.:
Current and Emerging Issues in Cancer Pain: Research and Practice. New York,
NY: Raven
Press, 1993, pp. 193-218]. Pain intensity reflects how much a person hurts,
and is the most
important factor of pain for the purpose of describing the present invention.
For a patient, the
rating of pain intensity is a magnitude estimation task. Patients are usually
able to provide
pain intensity estimates relatively quickly, and measures of pain intensity
tend to be closely
related to one another statistically. Pain intensity can therefore be viewed
as a fairly
homogeneous dimension that is relatively easy for most people to gauge. The
three most
commonly used methods for assessing pain intensity are the Verbal Rating
Scale, the Visual
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
Analogue Scale (VAS), and the Numerical Rating Scale. Less commonly used
measures
include the Behavior Rating Scale, the Picture Scale, the Box Scale, and the
Descriptor
Differential nScale [Jensen, MP, et al., In: Chapman CR, Foley KM, eds.:
Current and
Emerging Issues in Cancer Pain: Research and Practice. New York, NY: Raven
Press,
1993, pp. 193-218].
Visual Analogue Scales are probably the most frequently used instrument for
assessment of
pain intensity in the setting of treatment related outcome research. VASs
consist of a line,
usually 10 cm long, whose ends are labeled as the extremes of pain (for
example, "no pain"
to "pain as bad as it could be"). If a VAS has specific points along the line
that are labeled
with intensity-denoting adjectives or numbers, it is referred to as a Graphic
Rating Scale of
Pain Intensity. Patients are simply asked to indicate which point along the
line best
represents their pain intensity. Usually, the pain assessor allows the patient
to practice using
the measure to be sure that the assessment task is understood. The distance
from the no
pain end to the mark made by the patient is that patient's pain intensity
score. There is much
evidence supporting the validity of VASs of pain intensity. VASs are directly
correlated with
other self-report measures of pain intensity, as well as to observed pain
behavior [see
Jensen, 1993 and references contained therein]. Because VASs are usually
measured in
millimeters they have a large number of response categories, i.e. the scale
can be
considered as having 101 points, making it potentially more sensitive to
changes in pain
intensity than measures with limited numbers of response categories. Research
indicates
that VASs of pain intensity are usually (but not always) more sensitive to
treatment change
than are 4- or 5-point Verbal Rating Scale.
Multidimensional pain assessment tools (also sometimes referred to as pain
assessment
questionnaires) provide a measure of clinical pain that captures its sensory,
affective and
other qualitative components that extends beyond the basic measure of pain
intensity.
Theoretically, multidimensional tools should be more reliable and therefore
potentially more
sensitive for detecting changes in pain associated with time or with
treatment; however, they
are more complex and lengthy to complete than unidimensional tools.
Furthermore, because
multidimensional pain or quality-of-life (QOL) assessment tools were generally
designed to
evaluate change of health related QOL in a clinical trial setting, their
scores are only
informative when used in a comparative setting, i.e. comparing treatment arms,
and
therefore, a single individual score is not considered to be informative.
Examples of the main
multidimensional pain or quality-of-life (QOL) assessment tools used in cancer
pain
assessment include: the European Organization for Research and Treatment of
Cancer 30-
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
6
item core quality-of-life questionnaire (EORTC QLQ C-30); the Brief Pain
Inventory (BPI);
and the McGill Pain Questionnaire.
Considering pancreatic cancer in particular, then the EORTC multidimensional
tool is
arguably the most applicable, although this has yet to be proven in practice.
The EORTC
QLQ 0-30 is a 30-item self-reporting questionnaire developed to assess the
quality-of-life of
cancer patients [Aaronson, NK et al., J Natl Cancer lnst 85(5): 365-76, 1993].
Importantly, it
is supplemented by disease specific modules, including a module specific to
pancreatic
cancer (QLQ-PAN26), which includes 26 items related to disease symptoms,
treatment side-
effects and emotional issues. The QLQ-C30 questionnaire has been validated but
the QLQ-
PAN26 module is not yet validated as it still needs to undergo psychometric
testing in a large
international group of patients.
In general, the added complexity and patient burden associated with
implementation of
multidimensional tools outweigh its advantages when the objective is to
measure cancer
pain intensity or classify patients according to this parameter. Hence,
unidimensional tools
remain the most appropriate pain assessment option available for the purpose
of describing
pain in the present invention.
Gene expression profiling and identification of treatment subpopulations
Alterations in the genome that lead to a variety of chromosomal aberrations
are a
characteristic of all malignant tumors. In addition to gene mutations, tumor
growth is also
sustained by an altered level of gene expression. Gene expression profiling is
the
measurement of the expression (i.e. activity) of thousands of genes
simultaneously, to
create a global picture of cellular function or a genetic 'fingerprint' of a
particular
physiological/pathological sample. In the context of cancer, gene expression
profiling has
been used to more accurately classify tumors; furthermore, comparison of
expression
profiles can identify subpopulations in which genes are consistently up-
regulated or down-
regulated. Hence, the information derived from gene expression profiling has
the potential to
make an objective diagnosis, to identify genes that correlate with survival,
to provide risk
assessment of premalignant lesions, and to predict responses to certain
treatments. In the
latter example, one can answer questions of direct clinical significance such
as the
probability of a patient to respond to a drug given said patient's genetic
fingerprint.
Pancreatic cancer overview
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
7
The pancreas contains exocrine cells (involved in the production of enzymes
important for
food digestion) and endocrine cells (that produce hormones such as insulin).
Both exocrine
and endocrine cells can form tumors, but those formed by the exocrine pancreas
are far
more common and are associated with a very poor prognosis. The vast majority
of exocrine
pancreatic tumors are adenocarcinomas. Tumors of the endocrine pancreas (also
known as
islet cell tumors) are far less common and mostly benign in nature.
Cancer of the exocrine pancreas (referred to hereafter as pancreatic cancer)
is a seriously
life threatening condition. In most cases, early stages of the disease are
asymptomatic and
less than 20% of pancreatic cancers are amenable to surgery. Of those patients
undergoing
tumor resection, only 20% will survive 5 years. Early diagnosis of pancreatic
cancer is
difficult because symptoms vary and are nonspecific. Symptoms are primarily
caused by
mass effect rather than disruption of exocrine or endocrine functions and
depend on the
tumor's size and location, as well as the presence of metastases. Cancers that
begin in the
head of the pancreas are near the common bile duct. These cancers can compress
the duct
while they are still fairly small, which may possibly lead to jaundice and
allow these tumors to
be found in an earlier stage. Cancers that begin in the body or tail of the
pancreas do not
compress the duct until they have spread through the pancreas. By this time,
the cancer
may have also spread beyond the pancreas, frequently the liver, which also
leads to
jaundice. All symptoms commonly associated to pancreatic cancer can have
multiple other
causes, further complicating diagnosis with the consequence that pancreatic
cancer is
frequently diagnosed at an advanced stage. Moreover, invasive and metastatic
pancreatic
cancers respond poorly to existing treatments in chemotherapy and
radiotherapy, with high
levels of carbohydrate antigen 19-9 (CA 19-9), and an Eastern Cooperative
Oncology Group
(ECOG) status 2 also being associated with a poor prognosis. Mortality rate
remains
obstinately high over the past few decades, with patients receiving standard
treatment
having a median survival after diagnosis of respectively, 3-6 months and 9-12
months for
patients with metastatic and locally advanced disease. The overall 5-year
survival rate is
below 5%.
Treatment of adenocarcinoma pancreatic cancer
Treatment of pancreatic cancer depends on the stage of the cancer, as
described in Table 1.
When the disease is confined to the pancreas and clearly separated from
surrounding blood
vessels (i.e. it is local and resectable), the treatment of choice is surgery
with postoperative
chemotherapy and/or radiation. When the disease encases or compresses
surrounding
blood vessels or has extended into adjacent structures (i.e., locally advanced
and
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
8
unresectable), chemotherapy and/or radiation is proposed. In rare cases, when
the patient
responds well to treatment, the tumor may subsequently be surgically resected.
When the
disease has spread to distant organs (i.e., metastatic), chemotherapy is
proposed. In most
cases, these treatments do not represent a cure.
Table 1: Staging and treatment of pancreatic cancer
Pancreatic
Median
Stage Description cancer Treatment options
survival
cases
Disease is confined to
Surgery; postoperative
the pancreas and is 15%
Local or chemotherapy and/or 11-18
clearly separated
resectable radiation may also be months
from surrounding
offered
blood vessels
Chemotherapy (most
Disease encases or commonly gemcitabine-
compresses based) and/or radiation.
Locally
surrounding blood 40% In very rare instances, 10-12
advanced or
vessels, or has cancers that respond well months
unresectable
directly extended into to initial treatment may
adjacent structures subsequently be
surgically resected.
Evidence of
Chemotherapy (most
extrapancreatic 45% commonly gemcitabine- 5-7
Metastatic spread to distant
organs (liver, lungs, based); investigational months
trials
etc.)
Chemotherapy may be used in patients with advanced unresectable cancer
(locally
advanced or metastatic) and in patients with localized disease after surgery
or even as a
neoadjuvant treatment to shrink the tumor before surgery. For decades, 5-
fluorouracil (5-FU)
was the most widely used chemotherapeutic agent in metastatic pancreatic
cancer until a
randomized study showed symptom benefit and prolongation of survival of
gemcitabine
(Gemzar , Lilly France), over 5-Fluorouracil (5-FU). Gemcitabine, a nucleoside
analogue of
cytidine, is now established as the standard systemic treatment for patients
with locally
advanced, unresectable, or metastatic pancreatic adenocarcinoma. However, the
efficacy of
gemcitabine as a single agent remains modest, with a median survival of
approximately 6
months in randomized trials and a 12-month survival of approximately 20%. The
antimetabolite gemcitabine (CAS number 95058-81-4; (4-amino-1-[3,3-difluoro-4-
hydroxy-5-
(hydroxymethyl) tetrahydrofuran-2-yI]- 1H-pyrimidin- 2-one) replaces cytidine
during DNA
replication resulting in apoptosis in cancer cells. Gemcitabine has the
following formula:
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
9
NH2
NO
HO
HO
To date, numerous clinical trials have explored the combination of gemcitabine
with either
cytotoxic and/or biological targeted compounds, however results have almost
universally
been disappointing, showing little or no benefit compared with gemcitabine
monotherapy.
The causes of pancreatic cancer are not well understood but as differences
between
pancreatic cancer cells and normal cells are uncovered, newer drugs are trying
to exploit
these differences by attacking only specific targets. Thus, attention is
increasingly being
directed towards the role of growth factors. Several growth factors and their
receptors are
overexpressed during the progression of pancreatic cancer, such as epithelial
growth factor
(EGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF),
and vascular
endothelial growth factor (VEGF). Deregulated expression of cytoplasmic
tyrosine kinases
has also been associated with poor prognosis and chemoresistance. In
particular,
gemcitabine resistance in pancreatic cancer is often associated with high
expression of focal
adhesion kinase (FAK), a protein involved in metastasis; and elevated
expression and
activity of Src Family Kinases (SFK), including SRC and Lyn, have also been
reported in
numerous human cancer cell lines and tumor tissues. Moreover, evidence
indicates that
recruitment of inflammatory cells, including infiltration by mast cells,
facilitates the growth
and spread of cancer via the production of molecules that enhance tumor
invasiveness.
The epidermal growth factor receptor (EGFR) is the target of several drugs
under
development, including erlotinib (Tarcevae), the combination of which with
gemcitabine has
been approved as first-line treatment for patients with unresectable
pancreatic cancer. This
combination was found to modestly extend survival in a clinical trial, with a
median OS (6.24
months) 2 weeks longer than for gemcitabine monotherapy (5.91 months), and 1-
year
survival rate of 23% (c.f. 17% for gemcitabine monotherapy treatment arm;
p=0.023) [Moore
MJ, et al., J Olin Oncol. 2007 May 20;25(15):1960-6].
A phase 2/3 multicenter randomized trial was carried out to determine the
efficacy and safety
of a four drug combination chemotherapy regimen (FOLFIRINOX) (consisting of
leucovorin
calcium, fluorouracil, irinotecan hydrochloride and oxaliplatin) compared with
gemcitabine as
first-line therapy in patients with metastatic pancreatic cancer [Conroy T, et
al., N Engl J
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
Med. 2011 May 12;364(19):1817-25]. Each of the drugs in this combination is
approved by
the FDA to treat cancer or conditions related to cancer. Patients who received
the Folfirinox
regimen lived approximately 4 months longer than patients treated with the
current standard
of care, gemcitabine (11.1 months compared with 6.8 months). The objective
response rate
was 31.6% in patients treated with Folfirinox versus 9.4% in patients treated
with
gemcitabine. Globally, Folfirinox was associated with a survival advantage but
also with
notable increased toxicity. Moreover, there exist a number of possible
population biases to
this study design, as well as possible confounding effects from the study
design not being
blinded. For example, the study design selected only those patients with a
good performance
status (ECOG status score of 0 or 1), and because of an increased risk of
irinotecan-induced
toxicity those patients with a high bilirubin level (typically manifested as
jaundice and a
common diagnostic sign in patients with pancreatic cancer in the head of the
pancreas) were
excluded. The implication of these treatment management restrictions and the
greater
toxicity of Folfirinox, as compared with gemcitabine, are to effectively
preclude the use
Folfirinox for a sizeable proportion of the global pancreatic cancer
population, including those
with the poorest prognosis who cannot tolerate this regimen. As such,
Folfirinox is
appropriate as a first-line option for patients with metastatic pancreatic
cancer who are
younger than 76 years and who have a good performance status, no cardiac
ischemia, and
normal or nearly normal bilirubin levels.
Masitinib in vitro (re)sensitization of pancreatic cancer cells to gemcitabine
We previously discovered that the combination of masitinib and gemcitabine
(Gemzar , Eli
Lilly and Company), a nucleoside analog, inhibits the growth of human
pancreatic
adenocarcinoma. Our in vitro and in vivo studies have shown that masitinib:
= Sensitized various cancer cell lines to gemcitabine [Thamm DH, et al.
2011 The
Veterinary Journal, doi:10.1016/j.tvj1.2011.01.0011.
= Sensitized gemcitabine-refractory pancreatic cancer cell lines [Humbert
M, et al. (2010)
PLoS ONE 5(3): e9430. doi:10.1371/journal.pone.0009430].
= Demonstrated antiproliferative activity of the masitinib plus gemcitabine
combination in a
Nog-SCID mouse model of human pancreatic cancer [Humbert M, et al. (2010) PLoS
ONE 5(3): e9430. doi:10.1371/journal.pone.0009430].
These results supported a hypothesis that masitinib can enhance the
antiproliferative activity
of gemcitabine in vivo, possibly through chemosensitization. This theory was
further
reinforced by results from a human phase 2 study, in which patients with
advanced
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
11
pancreatic cancer who received a combination of masitinib (9 mg/kg/day) plus
gemcitabine
showed improved median time to progression compared with patients treated with
gemcitabine alone for the overall population [Mitry E, et al, 2010. Cancer
Chemotherapy and
Pharmacology 66, 395].
AIMS OF THE INVENTION
The invention aims to solve the technical problem of providing an active
ingredient for the
treatment of cancer.
The invention also aims to solve the technical problem of providing an active
ingredient that
improves prior art methods for the treatment of cancer.
The invention aims to provide an efficient treatment for cancer at an
appropriate dose, route
of administration, and daily intake.
The invention aims to solve the technical problem of how to predict
therapeutic response to
said treatment in a given patient and therefore identify applicable patient
subpopulations
based upon these predictor factors.
One such predictor factor is based upon the clinical marker of pain intensity.
Thus, the
invention aims to solve the technical problem of providing an active
ingredient that improves
prior art methods for the treatment of cancer that is associated with pain or
the requirement
of opioid analgesics for the treatment of disease related pain.
Another predictor factor is based upon gene expression profiling via analysis
of RNA
expression in peripheral blood cell samples. Thus, the invention aims to solve
the technical
problem of providing an active ingredient that improves prior art methods for
the treatment of
cancer in patients harboring a specific gene or gene expression combinations
(i.e. a
genetic/transcriptomic fingerprint).
Despite attempts to develop combination chemotherapy regimens based upon
gemcitabine,
pancreatic cancer remains a chemoresistant and highly aggressive tumor. The
treatment of
advanced pancreatic cancer continues to be a major challenge in terms of
chemotherapy-
induced palliative effect on disease related symptoms and survival time. The
Folfirinox
regimen offers an alternative backbone to develop combination therapies but
high toxicity will
probably limit its use for the majority of patients. The continuing poor
prognosis and lack of
12
effective treatments for pancreatic cancer, and especially pancreatic cancer
that is
associated with pain, highlights an unmet medical need for more efficient
treatment
strategies that improve the clinical management of patients afflicted with
pancreatic cancer
without significantly increasing toxicity. Considering the limited life-
expectancy of patients
suffering from pancreatic cancer, improvements in either survival time or
quality-of-life are
highly meaningful goals. Moreover, a treatment capable of simultaneously
improving both of
these aspects would be of particular worth.
Thus, the invention aims to solve the technical problem of providing an active
ingredient that
improves prior art methods for the treatment of advanced adenocarcinoma
pancreatic
cancer.
The invention aims to solve the technical problem of providing an active
ingredient that
improves prior art methods for the treatment of advanced adenocarcinoma
pancreatic
cancer that is associated with pain or the requirement of opioid analgesics
for the treatment
of disease related pain.
The invention aims to solve the technical problem of providing an active
ingredient that
improves prior art methods for the treatment of advanced adenocarcinoma
pancreatic
cancer in patients harboring a specific gene or gene expression predictor
factors (i.e. a
genetic/transcriptomic fingerprint).
SUMMARY OF THE INVENTION
The present invention relates to a method for the treatment of cancer in a
human patient,
wherein said method comprises administering to a human patient in need
thereof, a tyrosine
kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib
or a pharmaceutically
acceptable salt thereof, optionally combined with at least one antineoplastic
agent.
By "antineoplastic agent", it is referred herein to a medicament for the
treatment of cancers.
For example, the compounds as depicted in: Actualite Pharmaceutiques n 302
(Oct 1992)
on pages 38 to 39 and 41 to 43; or in the United States Food and Drug
Administration
(USFDA) list of approved drugs for oncology; or in the National Institute for
Occupational
Safety and Health (NIOSH) List of Antineoplastic and Other Hazardous Drugs in
Healthcare
Settings 2012 (DHHS Publication Number 2012-150); the content of which
is selected from, an alkylating agent, an antimitotic agent, an antimetabolic
CA 2886979 2020-03-04
13
agent, an anti-topoisomerase I agent, a platinum analog, an antibiotic agent,
a hormonal
agent, an anti-angiogenic agent, a genotoxic agent, a cytotoxic agent, a
biologic agent, or an
additional tyrosine kinase inhibitor.
In particular, said antineoplastic agents include, but are not restricted to:
abarelix,
abiraterone acetate, aldesleu kin, altretamine, anastrozole, arsenic trioxide,
asparaginase,
axitinib, azacitidine, bendamustine hydrochloride, bevacizumab, bexarotene,
bicalutamide,
leomycin, bortezomib, brentuximab vedotin, busulfan, cabazitaxel, CampathT,m
Camptosaii,m
capecitabine, carboplatin, carfilzomib, carmustine, cetuximab, chlorambucil,
cisplatin,
cladribine (2CDA), clofarabine, crizotinib, cyclophosphamide, cytarabine (ARA-
C), cytosine
arabinoside, dacarbazine, dactinomycin, dasatinib, daunorubicin, decitibine,
degarelix,
denileukin, docetaxel, doxorubicin, epirubicin, eribulin mesylate, erlotinib,
estramustine
phosphate, etoposide, everolimus, exemestane, floxuridine, fludarabine, fluoro-
5-uracile (5
fluorouracil), fluorouridine-desoxyribose, flutamide, fulvestrant, gefitinib,
gemcitabine,
gemtuzumab ozogamicin, hydroxyurea, ibritumomab tiuxetan, idarubicin,
ifosfamide,
imatinib, ipilimumab, irinotecan, ixabepilone, lapatinib, letrozole,
leucovorin, leuprolide
acetate, lomustine, mechlorethamine, megestrol, melphalan, mercaptopurine,
methotrexate,
TM
mitomycin, mitotane, mitoxantrone, nelarabine, nilotinib, nilutamide,
Nolvadex, ofatumumab,
oxaliplatin, paclitaxel, panitumumab, pazopanib, pegaspargase, peginterferon
alfa-2b,
pemetrexed, pentostatin, pertuzumab, plerixafor, pralatrexate, procarbazine,
Proleukinr,m
romidepsin, sapacitabine, sipuleucel-T, sorafenib, streptozocin, sunitinib,
tamoxifen,
temozolomide, temsirolimus, teniposide, testolactone, tezacitabine,
thioguanine, thiotepa,
topotecan, toremifene citrate, trastuzumab, triptorelin, troxacitabine,
valrubicin, Valstar,
vandetanib, vemurafenib, vinblastine, vincristine sulfate, vinorelbine,
vismodegib, vorinostat,
xeloda, ziv-aflibercept, zoledronic acid, FOLFOX (oxaliplatin + 5 fluorouracil
+ folinic acid),
FOLFIRI (irinotecan + 5 fluorouracil + folinic acid), FOLFIRINOX (oxaliplatin
+ irinotecan + 5
fluorouracil + folinic acid), and any combination of these antineoplastic
agent.
By "treatment of cancer", it is referred herein as patients in need of
treatment for cancer
selected from, but not restricted to: acute lymphocytic leukemia (ALL), acute
myelogenous
leukemia (AML), adrenocortical carcinoma, anal cancer, B cell lymphoma, basal
cell
carcinoma, bile duct cancer, bladder cancer, bone cancer, brainstem glioma,
brain tumor,
breast cancer, cervical cancer, chronic lymphocytic leukemia (CLL), chronic
myelogenous
leukemia (CML), colorectal cancer (CRC), endometrial cancer, esophageal
cancer, eye
cancer, gallbladder cancer, gastric (stomach) cancer, gastrointestinal stromal
tumor (GIST),
glioblastoma multiforme (GBM), hairy cell leukemia, head and neck cancer,
heart cancer,
hepatocellular (liver) carcinoma (HCC), Hodgkin's lymphoma and non-Hodgkin's
lymphomas,
CA 2886979 2020-03-04
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
14
Kaposi sarcoma, laryngeal cancer, mastocytosis, melanoma, myelofibrosis,
myelodysplastic
syndrome (MDS), multiple myeloma, non-small-cell lung carcinoma (NSCLC), lung
cancer
(small cell), melanoma, nasopharyngeal carcinoma, neuroendocrine tumors,
neuroblastoma,
oral cancer, oropharyngeal cancer, ovarian cancer, pancreatic cancer,
paranasal sinus and
nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer,
pituitary
adenoma, prostate cancer, rectal cancer, renal cell (kidney) carcinoma (RCC),
salivary gland
cancer, skin cancer (nonmelanoma), small intestine cancer, small lymphocytic
lymphoma
(SSL), soft tissue sarcoma, squamous-cell carcinoma, T cell lymphoma,
testicular cancer,
throat cancer, thyroid cancer, triple negative breast cancer, urethral cancer,
and uterine
cancer.
In one embodiment, the present invention relates to the method as defined
above wherein a
tyrosine kinase inhibitor or a mast cell inhibitor is an inhibitor of kinase
activity selected from
the tyrosine kinases of: c-Kit, PDGFR, Lyn, Fyn, and DDR1.
In a particular embodiment, the tyrosine kinase inhibitor, mast cell inhibitor
or c-Kit inhibitor is
masitinib or a pharmaceutical acceptable salt thereof, in particular the
mesilate salt.
By "predictor factor" or "biomarker", it is referred herein as a single
characteristic or group of
characteristics that is evaluated as an indicator of normal biologic
processes, pathogenic
processes, or pharmacologic responses to a therapeutic intervention. In
relation to the
present invention, the term "predictor factor" or "biomarker" refers also to
the terms,
predicative biomarker, prognostic biomarker, molecular marker, genetic marker,
gene
predictor set, genetic fingerprint, transcriptional fingerprint, genetic
print, genetic signature,
tumor marker, cancer marker, biological marker, biochemical marker, and
biological
indicator.
According to one embodiment, the present invention relates to the method as
defined above,
wherein said patient is initially selected for treatment based upon the
predictor factor of pain
intensity.
Thus, in one embodiment, the present invention relates to a method of
treatment of cancer
that is associated with pain or that requires administration of opioid
analgesics for treatment
of disease related pain, in human patient, wherein a tyrosine kinase
inhibitor, mast cell
inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically
acceptable salt thereof,
is administered to patient in need thereof, optionally combined with at least
one
antineoplastic agent.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
In another embodiment, the present invention relates to the method as defined
above
wherein said patient is afflicted by cancer that is associated with pain or
that requires
administration of opioid analgesics for treatment of disease related pain, and
wherein 'pain'
is defined as at least one reported occurrence of a non-zero pain intensity,
as determined
using an (appropriate) pain intensity assessment tool. It is implicit
therefore, that according
to the predictor factor of pain intensity, and in the absence of any other
independent
predictor factor, said treatment of patient afflicted by cancer that is not
associated with pain
or the requirement of opioid analgesics for the treatment of disease related
pain is
inadvisable.
In yet another embodiment, the present invention relates to the method as
defined above
wherein said patients is afflicted by cancer that is associated with pain or
that requires
administration of opioid analgesics for treatment of disease related pain, and
wherein 'pain'
is defined as above according to an (appropriate) pain intensity assessment
tool, including
but not limited to: the Verbal Rating Scale, the Visual Analogue Scale, the
Numerical Rating
Scale, the Behavior Rating Scale, the Picture Scale, the Box Scale, the
Descriptor
Differential nScale, the European Organization for Research and Treatment of
Cancer
quality-of-life questionnaire for pancreatic cancer (EORTC QLQ-PAN26), the
Brief Pain
Inventory (BPI), or the McGill Pain Questionnaire.
In one embodiment, the present invention relates to the method as defined
above wherein
said patient is afflicted by cancer that is associated with pain that requires
administration of
opioid analgesics for treatment of disease related pain, and wherein 'pain' is
defined as at
least one reported occurrence of a Visual Analogue Scale (VAS) pain intensity
score of
greater than 5 (e.g. VAS >5 mm as measured on a 100 mm scale, or 5%); or a VAS
pain
intensity score of greater than 10 (e.g. VAS >10 mm as measured on a 100 mm
scale, or
10%); or even a VAS pain intensity score of greater than 20 (e.g. VAS >20 mm
as measured
on a 100 mm scale, or 20%).
In another embodiment, the present invention relates to the method as defined
above
wherein said patient is afflicted by cancer that is associated with pain or
that requires
administration of opioid analgesics for treatment of disease related pain, and
wherein 'pain'
is defined as at least one reported occurrence of an equivalent measure of
said VAS pain
intensity threshold, or at least one reported occurrence of moderate to
intolerable pain
according to a multidimensional or categorical pain assessment tool pain
intensity rating.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
16
In another embodiment the present invention relates to the method as defined
above
wherein said patient is afflicted by pancreatic cancer that is associated with
pain or the
requires the administration of opioid analgesics for treatment of disease
related pain, and
wherein pain is defined as at least one reported occurrence of a Visual
Analogue Scale
(VAS) pain intensity score of greater than 20 (e.g. VAS >20 mm as measured on
a 100 mm
scale, or 20%).
According to one embodiment, the present invention relates to the method as
defined above,
wherein said patient is initially selected for treatment based upon gene
expression predictor
factors.
According to one embodiment, said gene expression predictor factors are
derived from a
blood sample of a patient, preferably on a whole peripheral blood sample of
said patient.
Peripheral blood is blood that circulates through the heart, arteries,
capillaries and veins. The
terms "whole blood" are used as opposed to a fraction of blood, obtained
through separation
of particular components of blood. An example of fraction is peripheral blood
mononuclear
cells. Hence, in one particular embodiment said gene expression predictor
factors are
derived from peripheral blood cell samples collected prior to treatment with
said tyrosine
kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib
or a pharmaceutically
acceptable salt thereof.
Thus, in one embodiment, the present invention relates to a method of
treatment of cancer,
wherein a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor,
especially masitinib or
a pharmaceutically acceptable salt thereof, optionally combined with at least
one
antineoplastic agent, is administered to a patient in need thereof, wherein
said patient has a
peripheral blood up-regulation or down-regulation of at least one of the
following genes:
ACOX-1, INFRSFS10B, RPS23, ABCC3, LYN, HIF1ALPHA, ABCC1, IGJ, UBE2H, or
PARP-2, or homologous thereof.
The up-regulation or down-regulation of a given gene in a given patient is
quantified in terms
of a Delta Cycle Threshold (DCt) value, which is the gene expression level
with respect to
one or more reference genes. Such reference genes, or housekeeping genes, are
characterized by a constant level of expression and therefore serve as an
internal control.
DCt values are inversely proportional to the level of gene expression;
therefore, in the case
of up-regulated genes a lower DCt value indicates a greater level of
expression, whilst in the
case of down-regulated genes a higher DCt value indicates a lower level of
expression. It is
understood that slight modifications to the defined Delta Cycle Threshold cut-
offs are implicit,
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
17
for example in the range of 10% or even 25%, reflecting the fact that the
optimal threshold
may be located in proximity to those cut-offs tested and that the patient
population studied
was only a representative cohort of the general cancer population.
The term "homologous" is defined as a polynucleotide sequence having a degree
of identity
of at least 80%, preferably 85%, more preferably 90%, and even more preferably
99% of the
gene sequence (full length). The degree of identity refers to sequence
identity between two
sequences. Identity can be determined by comparing a position in each sequence
which
may be aligned for purposes of comparison. When an equivalent position in the
compared
sequences is occupied by the same base, then the molecules are identical at
that position.
Various alignment algorithms and/or programs may be used for determining the
homology of
two sequences, including FASTA and BLAST.
In another embodiment, the present invention relates to the method as defined
above,
wherein said patient has a concomitant up-regulation or down-regulation of at
least two
genes selected from: ACOX-1, TNFRSFS10B, RP523, ABCC3, LYN, HIF1A, ABCC1, IGJ,
UBE2H, and PARP-2. For example, dual-gene combinations include, but are not
restricted
to: the concomitant up-regulation of genes ACOX-1 and TNFRSF10B; the
concomitant
down-regulation of gene RP523 and up-regulation of gene ACOX-1; the
concomitant up-
regulation of genes ABCC3 and LYN; the concomitant up-regulation of genes
HIF1A and
INFRSF10B; the concomitant down-regulation of genes ABCC1 and IGJ; the
concomitant
down-regulation of genes UBE2H and PARP-2. Individually, these pairs of
regulated genes
are referred to as 'gene expression predictor factors', and collectively they
are referred to as
the 'genetic fingerprint' or 'transcriptional fingerprint'. Six pairs of
regulated genes compose
the `genetic/transcriptional fingerprint'. Patients identified as having at
least one gene
expression predictor factor are considered to be harboring the
'genetic/transcriptional
fingerprint'. It is implicit that in the absence of any other independent
predictor factor, said
treatment of any patient lacking said genetic/transcriptional fingerprint is
inadvisable.
In one embodiment, the concomitant up-regulation of genes ACOX-1 and TNFRSF1OB
corresponds to patient Delta Cycle Threshold values of less than or equal to
3.81 for ACOX-
1 and less than or equal to 7.63 for TNFRSF10B; more preferably to patient
Delta Cycle
Threshold values of less than or equal to 3.36 for ACOX-1 and less than or
equal to 6.71 for
INFRSF10B;and even more preferably to patient Delta Cycle Threshold values of
less than
or equal to 3.05 for ACOX-1 and less than or equal to 6.1 for TNFRSF10B.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
18
In one embodiment, the concomitant down-regulation of gene RPS23 and up-
regulation of
gene ACOX-1 corresponds to patient Delta Cycle Threshold values of greater
than 0.26 for
RPS23 and less than or equal to 3.81 for ACOX-1; more preferably to patient
Delta Cycle
Threshold values of greater than 0.32 for RPS23 and less than or equal to 3.36
for ACOX-1;
and even more preferably to patient Delta Cycle Threshold values of greater
than 0.35 for
RPS23 and less than or equal to 3.05 for ACOX-1.
In one embodiment, the concomitant up-regulation of genes ABCC3 and LYN
corresponds
to patient Delta Cycle Threshold values of less than or equal to 5.38 for
ABCC3 and less
than or equal to 2.06 for LYN; more preferably to patient Delta Cycle
Threshold values of
less than or equal to 4.73 for ABCC3 and less than or equal to 1.82 for LYN;
and even more
preferably to patient Delta Cycle Threshold values of less than or equal to
4.3 for ABCC3
and less than or equal to 1.65 for LYN.
In one embodiment, the concomitant up-regulation of genes HIF1A and TNFRSF1OB
corresponds to patient Delta Cycle Threshold values of less than or equal to
4.94 for HIFI A
and less than or equal to 7.06 for TNFRSF10B; more preferably to patient Delta
Cycle
Threshold values of less than or equal to 4.35 for HIFI A and less than or
equal to 6.22 for
INFRSF10B; and even more preferably to patient Delta Cycle Threshold values of
less than
or equal to 3.95 for HIFI A and less than or equal to 5.65 for TNFRSF10B.
In one embodiment, the concomitant down-regulation of genes ABCC1 and IGJ
corresponds
to patient Delta Cycle Threshold values of greater than 2.63 for ABCC1 and
less than or
equal to 5.29 for IGJ; more preferably to patient Delta Cycle Threshold values
of greater
than 3.15 for ABCC1 and less than or equal to 6.35 for IGJ; and even more
preferably to
patient Delta Cycle Threshold values of greater than 3.5 for ABCC1 and less
than or equal to
7.05 for IGJ.
In one embodiment, the concomitant down-regulation of genes UBE2H and PARP-2
corresponds to patient Delta Cycle Threshold values of greater than 2.78 for
UBE2H and
greater than 5.33 for PARP-2; more preferably to patient Delta Cycle Threshold
values of
greater than 3.33 for UBE2H and greater than 6.39 for PARP-2; and even more
preferably to
patient Delta Cycle Threshold values of greater than 3.7 for UBE2H and greater
than 7.1 for
PARP-2.
In another embodiment, the present invention relates to a method of treatment
of cancer,
wherein a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor,
especially masitinib or
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
19
a pharmaceutically acceptable salt thereof, optionally combined with at least
one
antineoplastic agent, is administered to a patient in need thereof, wherein
said patient has a
peripheral blood up-regulation of the gene ACOX-1, or homologous thereof.
In one embodiment, the up-regulation of gene ACOX-1 corresponds to patient
Delta Cycle
Threshold value of less than or equal to 3.81; more preferably of less than or
equal to 3.36;
and even more preferably of less than or equal to 3.05.
In one embodiment, the present invention relates to the method as defined
above wherein
masitinib is administered at a daily dose of 4.5 to 12.0 mg/kg/day, with the
preferred
embodiment for patients with cancer being a starting daily dose of 6.0 to 7.5
mg/kg/day.
In one embodiment, the present invention relates to the method as defined
above wherein
masitinib is dose escalated by increments of 1.5 mg/kg/day to reach a maximum
of 12.0
mg/kg/day.
In one embodiment, the present invention relates to the method as defined
above wherein
said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor,
especially masitinib or a
pharmaceutically acceptable salt thereof, is administered orally.
In one embodiment, the present invention relates to the method as defined
above wherein
said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor,
especially masitinib or a
pharmaceutically acceptable salt thereof, is administered twice a day.
In one embodiment, the present invention relates to the method as defined
above
comprising a long term administration of an effective amount of said tyrosine
kinase inhibitor,
mast cell inhibitor or c-Kit inhibitor, especially masitinib or a
pharmaceutically acceptable salt
thereof, over more than 3 months.
In one embodiment, the present invention relates to the method as defined
above, wherein
said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor,
especially masitinib or a
pharmaceutically acceptable salt thereof, is administered in combination with
the at least one
antineoplastic agent, as a neoadjuvant, adjuvant, concomitant, or concurrent
regimen.
In one embodiment, the present invention relates to the method as defined
above wherein
said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor,
especially masitinib or a
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
pharmaceutically acceptable salt thereof, and the at least one antineoplastic
agent are
administered separately, simultaneously or sequentially in time.
In one embodiment, the present invention relates to the method as defined
above, for
treatment of pancreatic cancer, wherein said tyrosine kinase inhibitor, mast
cell inhibitor or c-
Kit inhibitor is administered in combination with at least one antineoplastic
agent selected
from marketing medicaments for the treatment of cancer.
In one embodiment, the present invention relates to the method as defined
above, wherein
said patient suffers from unresectable adenocarcinoma pancreatic cancer or
metastatic
adenocarcinoma pancreatic cancer.
In one embodiment, the present invention relates to the method as defined
above, wherein
said pancreatic cancer patient is in need thereof, as defined by either the
defined gene
expression predictor factor or pain intensity predictor factor, and wherein
said at least one
antineoplastic agent is selected from: gemcitabine (Gemzar ; Lilly), erlotinib
(Tarceva ;
Roche), paclitaxel (Taxol , Abraxane ; Bristol-Myers Squibb), Folfirinox, 5-
fluorouracil (5-
FU), capecitabine, cisplatin, oxaliplatin, irinotecan, leucovorin, and any
combination of these
antineoplastic agents.
In one embodiment, said at least one antineoplastic agent is gemcitabine.
In one preferred embodiment, the present invention relates to the method as
defined above,
wherein a product consisting of gemcitabine and masitinib or a
pharmaceutically acceptable
salt or hydrate thereof is used.
In one preferred embodiment, the present invention relates to the method as
defined above,
wherein masitinib is administered daily at a starting dose of 6.0 1.5
mg/kg/day with a
maximum allowable dose of 9.0 mg/kg/day, and gemcitabine is administered at a
weekly
dose of 1000 250 mg/m2 of patient surface area for up to seven consecutive
weeks as a
start, followed by a week off-treatment, followed by cycles of weekly dose of
1000 250
mg/m2 for 3 weeks, every 28 days
According to another embodiment, the present invention relates to a tyrosine
kinase
inhibitor, mast cell inhibitor or c-Kit inhibitor for use in a method for the
treatment of a cancer
as defined above, optionally in combination with at least one antineoplastic
agent.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
21
According to another embodiment, the present invention relates to a
pharmaceutical
composition or kit comprising a tyrosine kinase inhibitor, mast cell inhibitor
or c-Kit inhibitor
for use in a method for the treatment of a cancer as defined above, optionally
in combination
with at least one antineoplastic agent.
According to another embodiment, the present invention relates to the use of a
tyrosine
kinase inhibitor, mast cell inhibitor or c-Kit inhibitor for the preparation
of a medicament, or a
pharmaceutical composition, for the treatment of a cancer as defined above,
optionally in
combination with at least one antineoplastic agent.
According to another aspect, the invention relates to a therapeutic management
plan for the
treatment of cancer, in particular of pancreatic cancer in a human patient,
wherein said
management plan comprises the identification of treatable patients based upon
the defined
predictor factor of gene expression.
In one embodiment, the gene expression therapeutic management plan mentioned
above is
applied to patients with pancreatic cancer; wherein, if a patient harbors at
least one gene
expression predictor factor, and is therefore classified as belonging to the
defined 'genetic/
transcriptional fingerprint' subpopulation, then said patient is treated with
at least one
tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, and
especially masitinib,
optionally in combination with at least one nucleoside analogue, in particular
a cytidine
analogue, and especially gemcitabine. If a patient does not harbor at least
one gene
expression predictor factor, and is therefore classified as belonging to the
defined 'non
genetic/ transcriptional fingerprint' subpopulation, then said patient is
treated with at least
one nucleoside analogue, in particular a cytidine analogue, and especially
gemcitabine.
In another embodiment, the gene expression therapeutic management plan
mentioned
above is applied to patients with cancer other than pancreatic cancer;
wherein, if a patient
harbors at least one gene expression predictor factor then said patient is
treated with at least
one tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, and
especially masitinib,
optionally in combination with at least one antineoplastic agent. If a patient
does not harbor
at least one gene expression predictor factor then said patient is treated
with at least one
antineoplastic agent.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
22
According to another aspect, the invention relates to a therapeutic management
plan for the
treatment of cancer, in particular of pancreatic cancer in a human patient,
based upon the
defined predictor factor of pain intensity, wherein said management plan
comprises:
a) determining if said patient is afflicted by cancer that is associated with
pain or
requires administration of at least one opioid analgesic for treatment of
disease
related pain, with pain intensity preferably defined as a reported occurrence
of a
Visual Analogue Scale (VAS) score higher than 5 mm on a 100 mm scale; and
optionally
b) determining if said disease related pain is defined as a reported
occurrence of a
Visual Analogue Scale (VAS) pain intensity score higher than a predetermined
value
for said cancer on a 100 mm scale, and in particular for pancreatic cancer a
Visual
Analogue Scale (VAS) pain intensity score higher than 20 mm on a 100 mm scale.
In one embodiment said predetermined value for said disease related pain is 20
mm on a
100 mm scale.
In one embodiment, the pain intensity therapeutic management plan mentioned
above is
applied to patients with pancreatic cancer; wherein, if the result of step (a)
is negative, then
the patient is treated with at least one nucleoside analogue, in particular a
cytidine analogue,
and especially gemcitabine. If the result of step (a) is positive and the
result of step (b) is
negative, then the patient is treated with at least one drug targeting
epidermal growth factor
receptor (EGFR), and particularly erlotinib, in combination with at least one
nucleoside
analogue, in particular a cytidine analogue, and especially gemcitabine; or
with at least one
mitotic inhibitor, and particularly paclitaxel, in combination with at least
one nucleoside
analogue, in particular a cytidine analogue, and especially gemcitabine; or
with at least one
combination of drugs including fluorouracil, leucovorin, irinotecan, or
oxaliplatin, and
particularly Folfirinox. If the result of step (a) is positive and the result
of step (b) is positive,
then the patient is treated with at least one tyrosine kinase inhibitor, mast
cell inhibitor or c-
Kit inhibitor, and especially masitinib, optionally in combination with at
least one nucleoside
analogue, in particular a cytidine analogue, and especially gemcitabine.
In another embodiment, the pain intensity therapeutic management plan
mentioned above is
applied to patients with cancer other than pancreatic cancer; wherein, if the
result of step (a)
is negative, then the patient is treated with at least one antineoplastic
agent. If the result of
step (a) is positive and the result of step (b) is negative, then the patient
is treated with at
least one antineoplastic agent. If the result of step (a) is positive and the
result of step (b) is
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
23
positive, then the patient is treated with at least one tyrosine kinase
inhibitor, mast cell
inhibitor or c-Kit inhibitor, and especially masitinib, optionally in
combination with at least one
antineoplastic agent.
According to another aspect, the invention relates to a global therapeutic
management plan
for the treatment of cancer, in particular of pancreatic cancer in a human
patient, wherein
said management plan comprises the identification of treatable patients based
upon
sequential application of the gene expression therapeutic management plan and
pain
intensity therapeutic management plan. Thus, in the pain intensity therapeutic
management
plan mentioned above, step (a) can be preceded by step (a') consisting in the
identification
of patients that harbor at least one gene expression predictor factor, as
described above.
In one embodiment, the global therapeutic management plan mentioned above is
applied to
pancreatic cancer, wherein: if the result of step (a') is positive, then the
patient is treated with
at least one tyrosine kinase inhibitor, mast cell inhibitor or c-Kit
inhibitor, and especially
masitinib, optionally in combination with at least one nucleoside analogue, in
particular a
cytidine analogue, and especially gemcitabine; if the result of step (a') is
negative, then step
(a) of the pain intensity therapeutic management plan for pancreatic cancer is
invoked.
Specifically, said management plan comprises:
a) determining if said patient is afflicted by pancreatic cancer that is
associated with pain
or requires administration of at least one opioid analgesic for treatment of
disease
related pain, with pain intensity preferably defined as a reported occurrence
of a
Visual Analogue Scale (VAS) score higher than 5 mm on a 100 mm scale; and
optionally
b) determining if said disease related pain is defined as a reported
occurrence of a
Visual Analogue Scale (VAS) pain intensity score higher than 20 mm on a 100 mm
scale.
- If the result of step (a) is negative, then the patient is treated with
at least one nucleoside
analogue, in particular a cytidine analogue, and especially gemcitabine.
- If the result of step (a) is positive and the result of step (b) is
negative, then the patient is
treated with at least one drug targeting epidermal growth factor receptor
(EGFR), and
particularly erlotinib, in combination with at least one nucleoside analogue,
in particular a
cytidine analogue, and especially gemcitabine; or with at least one mitotic
inhibitor, and
particularly paclitaxel, in combination with at least one nucleoside analogue,
in particular
a cytidine analogue, and especially gemcitabine; or with at least one
combination of
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
24
drugs including fluorouracil, leucovorin, irinotecan, or oxaliplatin, and
particularly
Folfirinox.
- If the result of step (a) is positive and the result of step (b) is
positive, then the patient is
treated with at least one tyrosine kinase inhibitor, mast cell inhibitor or c-
Kit inhibitor, and
especially masitinib, optionally in combination with at least one nucleoside
analogue, in
particular a cytidine analogue, and especially gemcitabine.
In another embodiment, the global therapeutic management plan mentioned above
is
applied to patients with cancer other than pancreatic cancer; wherein, if the
result of step (a')
is positive, then the patient is treated with at least one tyrosine kinase
inhibitor, mast cell
inhibitor or c-Kit inhibitor, and especially masitinib, optionally in
combination with at least one
antineoplastic agent. If the result of step (a') is negative, then step (a) of
the pain intensity
therapeutic management plan for cancer is invoked. Specifically, said
management plan
comprises:
a) determining if said patient is afflicted by cancer that is associated with
pain or
requires administration of at least one opioid analgesic for treatment of
disease
related pain, with pain intensity preferably defined as a reported occurrence
of a
Visual Analogue Scale (VAS) score higher than 5 mm on a 100 mm scale; and
optionally
b) determining if said disease related pain is defined as a reported
occurrence of a
Visual Analogue Scale (VAS) pain intensity score higher than a predetermined
value
for said cancer on a 100 mm scale.
- If the result of step (a) is negative, then the patient is treated with
at least one
antineoplastic agent.
- If the result of step (a) is positive and the result of step (b) is
negative, then the patient is
treated with at least one antineoplastic agent.
- If the result of step (a) is positive and the result of step (b) is
positive, then the patient is
treated with at least one tyrosine kinase inhibitor, mast cell inhibitor or c-
Kit inhibitor, and
especially masitinib, optionally in combination with at least one
antineoplastic agent.
Figure 3 illustrates the treatment management plans associated with the
individual predictor
factors of pain intensity and gene expression for pancreatic cancer patients,
as well as a
global treatment management plan that takes both predictor factors into
consideration.
DESCRIPTION OF THE INVENTION
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
Tyrosine kinases are receptor type or non-receptor type proteins, which
transfer the terminal
phosphate of ATP to tyrosine residues of proteins thereby activating or
inactivating signal
transduction pathways. These proteins are known to be involved in many
cellular
mechanisms, which in case of disruption, lead to disorders such as abnormal
cell
proliferation and migration as well as inflammation. A tyrosine kinase
inhibitor is a drug that
inhibits tyrosine kinases, thereby interfering with signaling processes within
cells. Blocking
such processes can stop the cell growing and dividing.
In one embodiment, the tyrosine kinase inhibitor of the invention has the
following formula
[A]:
NN
R3
(R2)HN
CO
(Ri)rni
[A]
wherein R1 and R2, are selected independently from hydrogen, halogen, a linear
or branched
alkyl, cycloalkyl group containing from 1 to 10 carbon atoms, trifluoromethyl,
alkoxy, cyano,
dialkylamino, and a solubilizing group,
m is 0-5 and n is 0-4;
the group R3 is one of the following:
(i) an aryl group such as phenyl or a substituted variant thereof bearing any
combination, at
any one ring position, of one or more substituents such as halogen, alkyl
groups containing
from 1 to 10 carbon atoms, trifluoromethyl, cyano and alkoxy;
(ii) a heteroaryl group such as 2, 3, or 4-pyridyl group, which may
additionally bear any
combination of one or more substituents such as halogen, alkyl groups
containing from 1 to
10 carbon atoms, trifluoromethyl and alkoxy;
(iii) a five-membered ring aromatic heterocyclic group such as for example 2-
thienyl, 3-
thienyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, which may additionally bear
any combination of
one or more substituents such as halogen, an alkyl group containing from 1 to
10 carbon
atoms, trifluoromethyl, and alkoxy;
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
26
or a pharmaceutically acceptable salt or solvate thereof.
Tyrosine kinase inhibitors of formula [A] can preferably be used as c-Kit
inhibitors.
Unless otherwise specified, the below terms used herein are defined as
follows:
As used herein, the term an "aryl group" means a monocyclic or polycyclic-
aromatic radical
comprising carbon and hydrogen atoms. Examples of suitable aryl groups
include, but are
not limited to, phenyl, tolyl, anthracenyl, fluorenyl, indenyl, azulenyl, and
naphthyl, as well as
benzo-f used carbocyclic moieties such as 5,6,7,8-tetrahydronaphthyl. An aryl
group can be
unsubstituted or substituted with one or more substituents. In one embodiment,
the aryl
group is a monocyclic ring, wherein the ring comprises 6 carbon atoms,
referred to herein as
"(06)aryl".
As used herein, the term "alkyl group" means a saturated straight chain or
branched non-
cyclic hydrocarbon having from 1 to 10 carbon atoms. Representative saturated
straight
chain alkyls include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, n-
heptyl, n-octyl, n-
nonyl and n-decyl; while saturated branched alkyls include isopropyl, sec-
butyl, isobutyl, tert-
butyl, isopentyl, 2-methylbutyl, 3-methylbutyl, 2-methylpentyl, 3-
methylpentyl, 4-methylpentyl,
2-methylhexyl, 3-methylhexyl, 4-methylhexyl, 5-methylhexyl, 2,3-dimethylbutyl,
2,3-
dimethylpentyl, 2,4-dimethylpentyl, 2,3-dimethylhexyl, 2,4-dimethylhexyl, 2,5-
dimethylhexyl,
2,2-dimethylpentyl, 2,2-dimethylhexyl, 3,3-dimtheylpentyl,
3,3-dimethylhexyl, 4,4-
dimethylhexyl, 2-ethylpentyl, 3-ethylpentyl, 2-ethylhexyl, 3-ethylhexyl, 4-
ethylhexyl, 2-methyl-
2-ethylpentyl, 2-methyl-3-ethylpentyl, 2-methyl-4-ethylpentyl, 2-methyl-2-
ethylhexyl, 2-
methy1-3-ethylhexyl, 2-methyl-4-ethylhexyl, 2,2-diethylpentyl, 3,3-
diethylhexyl, 2,2-
diethylhexyl, 3,3-diethylhexyl and the like. Alkyl groups included in
compounds of this
invention may be optionally substituted with one or more substituents.
As used herein, the term "alkoxy" refers to an alkyl group which is attached
to another
moiety by an oxygen atom. Examples of alkoxy groups include methoxy,
isopropoxy, ethoxy,
tert-butoxy, and the like. Alkoxy groups may be optionally substituted with
one or more
substituents.
As used herein, the term "heteroaryl" or like terms means a monocyclic or
polycyclic
heteroaromatic ring comprising carbon atom ring members and one or more
heteroatom ring
members (such as, for example, oxygen, sulfur or nitrogen). Typically, a
heteroaryl group
has from 1 to about 5 heteroatom ring members and from 1 to about 14 carbon
atom ring
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
27
members. Representative heteroaryl groups include pyridyl, 1-oxo-pyridyl,
furanyl,
benzo[1,3]dioxolyl, benzo[1,4]dioxinyl, thienyl, pyrrolyl, oxazolyl,
imidazolyl, thiazolyl,
isoxazolyl, quinolinyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl,
pyrazinyl, triazinyl,
triazolyl, thiadiazolyl, isoquinolinyl, indazolyl, benzoxazolyl, benzofuryl,
indolizinyl,
imidazopyridyl, tetrazolyl, benzimidazolyl, benzothiazolyl, benzothiadiazolyl,
benzoxadiazolyl,
indolyl, tetrahydroindolyl, azaindolyl, imidazopyridyl,
quinazolinyl, purinyl,
pyrrolo[2,3]pyrimidinyl, pyrazolo[3,4]pyrimidinyl, imidazo[1,2-a]pyridyl, and
benzo(b)thienyl. A
heteroatom may be substituted with a protecting group known to those of
ordinary skill in the
art, for example, the hydrogen on a nitrogen may be substituted with a tert-
butoxycarbonyl
group. Heteroaryl groups may be optionally substituted with one or more
substituents. In
addition, nitrogen or sulfur heteroatom ring members may be oxidized. In one
embodiment,
the heteroaromatic ring is selected from 5-8 membered monocyclic heteroaryl
rings. The
point of attachment of a heteroaromatic or heteroaryl ring to another group
may be at either
a carbon atom or a heteroatom of the heteroaromatic or heteroaryl rings.
The term "heterocycle" as used herein, refers collectively to heterocycloalkyl
groups and
heteroaryl groups.
As used herein, the term "heterocycloalkyl" means a monocyclic or polycyclic
group having
at least one heteroatom selected from 0, N or S, and which has 2-11 carbon
atoms, which
may be saturated or unsaturated, but is not aromatic. Examples of
heterocycloalkyl groups
include (but are not limited to): piperidinyl, piperazinyl, 2-oxopiperazinyl,
2-oxopiperidinyl, 2-
oxopyrrolidinyl, 4-piperidonyl, pyrrolidinyl, hydantoinyl, valerolactamyl,
oxiranyl, oxetanyl,
tetrahydropyranyl, tetrahydrothiopyranyl,
tetrahydropyrindinyl, tetrahydropyrimidinyl,
tetrahydrothiopyranyl sulfone, tetrahydrothiopyranyl sulfoxide, morpholinyl,
thiomorpholinyl,
thiomorpholinyl sulfoxide, thiomorpholinyl sulfone, 1 ,3-
dioxolane, tetrahydrofuranyl,
dihydrofu rany1-2-one, tetrahydrothienyl, and
tetrahydro-1 ,1 -dioxothienyl. Typically,
monocyclic heterocycloalkyl groups have 3 to 7 members. Preferred 3 to 7
membered
monocyclic heterocycloalkyl groups are those having 5 or 6 ring atoms. A
heteroatom may
be substituted with a protecting group known to those of ordinary skill in the
art, for example,
the hydrogen on a nitrogen may be substituted with a tert-butoxycarbonyl
group.
Furthermore, heterocycloalkyl groups may be optionally substituted with one or
more
substituents. In addition, the point of attachment of a heterocyclic ring to
another group may
be at either a carbon atom or a heteroatom of a heterocyclic ring. Only stable
isomers of
such substituted heterocyclic groups are contemplated in this definition.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
28
As used herein the term "substituent" or "substituted" means that a hydrogen
radical on a
compound or group is replaced with any desired group that is substantially
stable to reaction
conditions in an unprotected form or when protected using a protecting group.
Examples of
preferred substituents are those found in the exemplary compounds and
embodiments
disclosed herein, as well as halogen (chloro, iodo, bromo, or fluoro); alkyl;
alkenyl; alkynyl;
hydroxy; alkoxy; nitro; thiol; thioether; imine; cyano; amido; phosphonato;
phosphine;
carboxyl; thiocarbonyl; sulfonyl; sulfonamide; ketone; aldehyde; ester; oxygen
(-0); haloalkyl
(e.g., trifluoromethyl); cycloalkyl, which may be monocyclic or fused or non-
fused polycyclic
(e.g., cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl), or a
heterocycloalkyl, which may be
monocyclic or fused or non-fused polycyclic (e.g., pyrrolidinyl, piperidinyl,
piperazinyl,
morpholinyl, or thiazinyl), monocyclic or fused or non-fused polycyclic aryl
or heteroaryl (e.g.,
phenyl, naphthyl, pyrrolyl, indolyl, furanyl, thiophenyl, imidazolyl,
oxazolyl, isoxazolyl,
thiazolyl, triazolyl, tetrazolyl, pyrazolyl, pyridyl, quinolinyl,
isoquinolinyl, acridinyl, pyrazinyl,
pyridazinyl, pyrimidinyl, benzimidazolyl, benzothiophenyl, or benzofuranyl);
amino (primary,
secondary, or tertiary); CO2CH3; CONH2; OCH200NH2; NH2; SO2NH2; OCHF2; CF3;
OCF3;
and such moieties may also be optionally substituted by a fused-ring structure
or bridge, for
example -OCH20-. These substituents may optionally be further substituted with
a
substituent selected from such groups. In certain embodiments, the term
"substituent" or the
adjective "substituted" refers to a substituent selected from the group
consisting of an alkyl,
an alkenyl, an alkynyl, an cycloalkyl, an cycloalkenyl, a heterocycloalkyl, an
aryl, a
heteroaryl, an aralkyl, a heteraralkyl, a haloalkyl, -C(0)NR11 R12, -
NR13C(0)R14, a halo, -0R13,
cyano, nitro, a haloalkoxy, -C(0)R13, -SR13, -
C(0)0R13, -0C(0)R13, -
NR13C(0)NR11 R12, -0C(0)NR1 R12, -NR13C(0)0R14, -S(0)rR13, -NR13S(0)rR14, -
0S(0)rF114,
S(0)rNR11l=i12, -0, -S, and -N-R13, wherein r is 1 or 2; R11 and R12, for each
occurrence are,
independently, H, an optionally substituted alkyl, an optionally substituted
alkenyl, an
optionally substituted alkynyl, an optionally substituted cycloalkyl, an
optionally substituted
cycloalkenyl, an optionally substituted heterocycloalkyl, an optionally
substituted aryl, an
optionally substituted heteroaryl, an optionally substituted aralkyl, or an
optionally substituted
heteraralkyl; or R11 and R12 taken together with the nitrogen to which they
are attached is
optionally substituted heterocycloalkyl or optionally substituted heteroaryl;
and R13 and R14
for each occurrence are, independently, H, an optionally substituted alkyl, an
optionally
substituted alkenyl, an optionally substituted alkynyl, an optionally
substituted cycloalkyl, an
optionally substituted cycloalkenyl, an optionally substituted
heterocycloalkyl, an optionally
substituted aryl, an optionally substituted heteroaryl, an optionally
substituted aralkyl, or an
optionally substituted heteraralkyl.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
29
In certain embodiments, the term "substituent" or the adjective "substituted"
refers to a
solubilizing group.
The term "solubilizing group" means any group which can be substantially
ionized and that
enables the compound to be soluble in a desired solvent, such as, for example,
water or
water-containing solvent. Furthermore, the solubilizing group can be one that
increases the
compound or complex's lipophilicity. Typically, the solubilizing group is
selected from alkyl
group substituted with one or more heteroatoms such as N, 0, S, each
optionally substituted
with alkyl group substituted independently with alkoxy, amino, alkylamino,
dialkylamino,
carboxyl, cyano, or substituted with cycloheteroalkyl or heteroaryl, or a
phosphate, or a
sulfate, or a carboxylic acid. For example, by "solubilizing group" it is
referred herein to one
of the following:
- an alkyl, cycloalkyl, aryl, heretoaryl group comprising either at least one
nitrogen or oxygen
heteroatom or which group is substituted by at least one amino group or oxo
group;
- an amino group which may be a saturated cyclic amino group which may be
substituted by
a group consisting of alkyl, alkoxycarbonyl, halogen, haloalkyl, hydroxyalkyl,
amino,
monoalkylamino, dialkylamino, carbamoyl, monoalkylcarbamoyl and
dialkylcarbamoyl;
- one of the structures a) to i) shown below, wherein the wavy line and the
arrow line
correspond to the point of attachment to core structure of Formula [A]:
a
H2Ny 0
S02
r,N 0 0 N
N)
The term "cycloalkyl" means a saturated cyclic alkyl radical having from 3 to
10 carbon
atoms. Representative cycloalkyls include cyclopropyl, 1-methylcyclopropyl,
cyclobutyl,
cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, and cyclodecyl.
Cycloalkyl groups
can be optionally substituted with one or more substituents.
The term "halogen" means -F, -Cl, -Br or -I.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
In a particular embodiment the tyrosine kinase inhibitor of the invention has
general formula
[B],
N N
HN
S
(R1)rn
0
[B]
wherein:
R1 is selected independently from hydrogen, halogen, a linear or branched
alkyl, cycloalkyl
group containing from 1 to 10 carbon atoms, trifluoromethyl, alkoxy, amino,
alkylamino,
dialkylamino, solubilizing group, and m is 0-5.
In one embodiment, the tyrosine kinase inhibitor, mast cell inhibitor or c-Kit
inhibitor is
masitinib or a pharmaceutically acceptable salt thereof, more preferably
masitinib mesilate.
Masitinib is a c-Kit / PDGFR inhibitor with a potent anti mast cell action.
New potent and selective c-Kit, platelet derived growth factor receptor
(PDGFR) inhibitors
are 2-(3-aminoaryl)amino-4-aryl-thiazoles described in AB Science's PCT
application WO
2004/014903.
Masitinib is a small molecule drug, selectively inhibiting specific tyrosine
kinases such as c-
Kit, PDGFR, Lyn, Fyn, and DDR1 without inhibiting, at therapeutic doses,
kinases associated
with known toxicities (i.e. those tyrosine kinases or tyrosine kinase
receptors attributed to
possible tyrosine kinase inhibitor cardiac toxicity, including ABL, KDR and
Src) [Dubreuil et
al., 2009, PLoS ONE 2009.4(9):e7258; Davis et al., Nat Biotechnol 2011,
29(11): 1046-51].
The chemical name for masitinib is 4-(4-methylpiperazin-1-ylmethyl)-N-[4-
methyl-3-(4-
pyridin-3y1thiaz01-2-ylamino) phenyl]benzamide - CAS number 790299-79-5, and
the
structure is shown below. Masitinib was first described in US 7,423,055 and
EP1525200B1.
A detailed procedure for the synthesis of masitinib mesilate is given in
W02008/098949.
N 0
I A
N
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
31
Masitinib's main kinase target is c-Kit, for which it has been shown to exert
a strong inhibitory
effect on wild-type and juxtamembrane-mutated c-Kit receptors, resulting in
cell cycle arrest
and apoptosis of cell lines dependent on c-Kit signaling [Dubreuil et al.,
2009, PLoS ONE,
4(9):e7258]. In vitro, masitinib demonstrated high activity and selectivity
against c-Kit,
inhibiting recombinant human wild-type c-Kit with an half inhibitory
concentration (I050) of
200 40 nM and blocking stem cell factor-induced proliferation and c-Kit
tyrosine
phosphorylation with an IC50 of 150 80 nM in Ba/F3 cells expressing human or
mouse
wild-type c-Kit. In addition to its anti-proliferative properties, masitinib
can also regulate the
activation of mast cells through its targeting of Lyn and Fyn, key components
of the
transduction pathway leading to IgE induced degranulation [(Gilfillan et al.,
2006, Nat Rev
Immunol, 6:218-230); (Gilfillan et al., 2009, Immunological Reviews, 228:149-
169)]. This can
be observed in the inhibition of FccRI-mediated degranulation of human cord
blood mast
cells [Dubreuil et al., 2009, PLoS ONE;4(9):e7258]. Masitinib is also an
inhibitor of PDGFR a
and 13 receptors. Recombinant assays show that masitinib inhibits the in vitro
protein kinase
activity of PDGFR-a and 13 with I050 values of 540 60 nM and 800 120 nM.
In Ba/F3
cells expressing PDGFR-a, masitinib inhibited PDGF-BB-stimulated proliferation
and
PDGFR-a tyrosine phosphorylation with an I050 of 300 5 nM. Furthermore,
masitinib
strongly interacts with the discoidin domain receptor family member 1 (DDR1)
kinase,
leading to a pronounced inhibition of DDR1 autophosphorylation. Although the
physiological
functions of DDR1 are not fully understood, DDR1 signaling seems to be
involved in cell
interactions with the extracellular matrix, and to control adhesion and cell
motility, which are
both essential characteristics of cancer cells. The deregulation of these
capabilities is
associated with tumor progression and poor prognosis in a number of human
cancers.
Masitinib has been shown to strongly bond to the DDR1 receptor and inhibit its
activity [Davis
et al., Nat Biotechnol 2011, 29(11): 1046-51]. Masitinib could therefore slow
down the
homing and colonization of tumor cells.
The present invention relates to a method for the treatment of cancer in a
human patient,
wherein said method comprises administering to a human patient in need
thereof, a tyrosine
kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially masitinib
or a pharmaceutically
acceptable salt thereof, optionally combined with at least one antineoplastic
agent.
In relation to the present invention, the term "treatment" (and its various
grammatical forms)
refers to preventing, curing, reversing, attenuating, alleviating, minimizing,
suppressing or
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
32
halting the deleterious effects of a disease state, disease progression,
disease causative
agent (e.g., bacteria or viruses) or other abnormal condition. For example,
treatment may
involve alleviating a symptom (i.e., not necessary all symptoms) of a disease
or attenuating
the progression of a disease.
The inventors have surprisingly shown that the combination of masitinib plus
gemcitabine
provides therapeutic benefit to a highly distinct subpopulation of pancreatic
cancer patients
with pain intensity serving as an independent predictor factor.
A randomized placebo-controlled phase 3 study (AB07012) was conducted based on
the
aforementioned in vitro and preliminary in vivo data to determine the efficacy
and safety of a
masitinib in combination with gemcitabine compared with gemcitabine alone as
first-line
therapy in patients with advanced/metastatic pancreatic cancer (see Example
1). It was
strongly predicted that the principal mechanism of action responsible for any
improvement in
masitinib treated patient survival would be a masitinib-induced sensitization
of pancreatic
cancer cells to gemcitabine. It follows therefore, that the patient population
to benefit from
the masitinib plus gemcitabine combination would closely mirror that for
gemcitabine
treatment, regardless of subpopulation variables such as patient performance
status, age, or
tumor localization etc.; i.e. all patients with locally advanced (unresectable
Stage ll or Stage
III) or metastatic (Stage IV) adenocarcinoma of the pancreas.
Results from study AB07012 revealed that in the modified intent to treat
(mITT) population
there was no survival advantage in patients treated with the masitinib plus
gemcitabine
combination compared with patients receiving gemcitabine plus placebo, i.e.
gemcitabine as
a single agent (see Example 1). Unexpectedly, secondary exploratory analyses
on overall
survival, stratified according to pain intensity, revealed that the
combination of masitinib plus
gemcitabine had improved survival compared with gemcitabine as a single agent,
in a
subpopulation of patients having pancreatic cancer that was associated with
pain or the
requirement of opioid analgesics for the treatment of disease related pain.
These data also
showed, without precedent, that pain intensity was the predominant prognostic
factor for
overall survival in pancreatic cancer patients receiving gemcitabine as a
single agent (the
current standard of treatment). Specifically, data revealed that for patients
receiving
gemcitabine as a single agent (i.e. the placebo plus gemcitabine treatment
arm), there was a
difference in survival time of 10.0 months between those patients presenting
with disease
related pain at baseline and those without disease related pain or the
requirement of opioid
analgesics for treatment of disease related pain (median OS of 5.4 versus 15.4
months,
respectively) (see Example 1). Moreover, by following the evolution of the
hazard ratio of
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
33
overall survival according to pain intensity it was revealed that the
probability of survival
improved with increasing pain intensity for patients receiving masitinib plus
gemcitabine as
compared with patients receiving placebo plus gemcitabine. This relationship
is shown in the
curve of hazard ratio for death, defined as the probability of death under
masitinib plus
gemcitabine over the probability of death under placebo plus gemcitabine,
versus the VAS
score (Figure 1). The hazard ratio for death tended to decrease with
increasing VAS score
until reaching a plateau (or horizontal asymptote) from the VAS score of 20
mm. At a VAS
score of 55 mm, the number of patients was dramatically reduced and hazard
ratio was
therefore not appropriate for further analysis. These results supported the
choice to divide
the overall population into three VAS pain intensity subpopulations: VAS [0;
5], VAS 15; 20],
and VAS >20 (see Example 1).
These findings are without precedent and considered as important because the
predictive
therapeutic significance of pain intensity in cancer patients was previously
unknown. Indeed,
a previous study evaluating erlobinib (Tarceva , an inhibitor of the EGFR
growth factor) plus
gemcitabine in pancreatic cancer showed that for the equivalent 'pain'
subpopulation there
was no survival benefit [Moore MJ, et al., J Clin Oncol. 2007 May
20;25(15)1960-6]. This is
in direct contrast to the findings for the masitinib plus gemcitabine
combination. Data also
indicated that the mechanisms of action responsible for the observed
therapeutic benefits of
the combination therapy have a relatively slow on-set, therefore necessitating
a minimum
exposure time for optimal therapeutic benefits to be attained.
This outcome could not have been predicted from knowledge acquired prior to
study
AB07012 or from or the general scientific literature. Moreover, these findings
are highly
contradictory to our initial understanding of the primary mechanism of action
for the masitinib
plus gemcitabine combination in pancreatic cancer, i.e. a masitinib-induced
sensitization of
pancreatic cancer cells to gemcitabine [Humbert M, et al. (2010) PLoS ONE
5(3): e9430.
doi:10.1371/journal.pone.0009430]. These data effectively show that for the in
vivo clinical
setting of pancreatic cancer treatment, sensitization of pancreatic cancer
cells cannot be the
primary mechanism of masitinib's action because: (i) there should be no
heterogeneity in
response according to patients' disease related pain intensity; and (ii) such
an effect would
be expected have a relatively rapid on-set and therefore manifest itself in an
improved
progression free survival, which was not the case.
Data from study AB07012 (see Example 1) have led to the surprising discovery
that a highly
distinct subpopulation of pancreatic cancer patients respond to the masitinib
plus
gemcitabine combination, with a distinction being made according to the degree
(intensity) of
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
34
disease related pain. Also that contrary to expectations, the onset of this
response in efficacy
was relatively slow as compared with surrogate measures of disease
progression; its effects
manifested in the long term survival (i.e. overall survival) rather than the
short term time to
disease progression (i.e. progression free survival). All these findings point
towards
secondary mechanisms of action being responsible for the observed therapeutic
benefits
(referred to as secondary because they do not act directly on the cancer cells
themselves
but on cells and signaling pathways that the tumor cells rely upon to
proliferate and
metastasize), or more likely an aggregate effect of numerous secondary
mechanisms of
action.
In connection with the present invention, it would seem, without wishing to be
bound by the
theory, that masitinib optionally administered in combination with at least
one antineoplastic
agent promotes survival in the subpopulation of patients with cancer that is
associated with
pain or the requirement of opioid analgesics for the treatment of disease
related pain via, but
not limited to: controlling tumor proliferation via modulation of the tumor
microenvironment
and in particular through modulation of mast cell activity; modulation of
immunostimulation-
mediated anticancer effects; and antimetastatic effects. There exists direct
or putative
evidence linking masitinib's effect to each of these secondary mechanisms of
action.
Of particular relevance is the fact that masitinib, through its inhibition of
c-Kit, exerts a direct
anti-proliferative and pro-apoptotic action on mast cells and indirectly
therefore, reduces the
array of pro-inflammatory and pro-angiogenic cytokines and chemokines that are
important
in tumor growth and tumor invasiveness. In addition to its antiproliferative
properties,
masitinib can also regulate the activation of mast cells through its targeting
of Lyn and Fyn,
key components of the transduction pathway leading to IgE induced mast cell
degranulation
[Gilfillan, 2006; Gilfillan, 2009]. This can be observed in the inhibition of
FcERI-mediated
degranulation of human cord blood mast cells [Dubreuil et al., 2009].
Masitinib also strongly
interacts with the DDR1, a kinase the deregulation capabilities of which are
associated with
tumor progression and poor prognosis in a number of human cancer [Davis et
al., Nat
Biotechnol 2011, 29(11): 1046-51]. Masitinib could therefore slow down the
homing and
colonization of tumor cells.
Evidence indicates that recruitment of inflammatory cells, especially
infiltration by mast cells,
facilitates the growth and spread of some cancers by producing molecules that
enhance
tumor invasiveness. Therefore, inhibition of mast cell function may prove to
be of therapeutic
benefit in restraining the growth of cancer, including pancreatic cancer.
Furthermore, there is
a known association between inflammation and pancreatic cancer development,
with mast
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
cells having an essential role in the immunopathological mechanisms of chronic
inflammatory diseases. Indeed, mast cells have been directly linked to the
development of
pancreatic cancer tumorigenesis in mouse models, showing that high levels of
mast cell
infiltration into the tumor microenvironment was predictive of poor clinical
outcome, although
the exact mechanism by which mast cells contribute to pancreatic cancer
development was
not clear [Chang DZ et al., Clin Cancer Res 2011;17:7015-7023].
Throughout the process of tumorigenesis, disease progression, and metastasis,
the
microenvironment of the local host tissue is an active participant and
determines the extent
of cancer cell proliferation, angiogenesis, invasion, and survival. The role
of mast cells in the
tumorigenesis of cancers is not well understood however, and there is
conflicting data about
their benefit or detriment to tumorigenesis, depending on the local stromal
conditions and
whether the mediators released facilitate the proliferation of tumor cells or
induce the
apoptosis of malignant cells [(Theoharides TC, et al., Trends Immunol
2004;25:235-41);
(Samoszuk M, et at., BMC Cancer 2005;21:121); (Almholt K, et al., Recent
Results Cancer
Res 2003;162:31-42); (Gooch JL, et al., Cancer Res 1998; 15:4199-205)].
The body of scientific evidence regarding the role of mast cells in tumor
progression and
invasion in pancreatic cancer, as well as the emerging role of mast cells in
cancer pain lends
credence to our findings from study AB07012. Moreover, without wishing to be
bound to the
theory, data from study AB07012 indicate that a previously unrecognized
connection exists
between mast cell activation, pancreatic cancer pathogenesis, and pancreatic
cancer pain.
That is to say, there is a correlation of mast cell activity with poor
clinical outcome in
pancreatic cancer, a correlation of cancer pain with poor clinical outcome,
and a correlation
of mast cell activity with cancer pain. Thus, the onset of disease related
pain in pancreatic
cancer can serve as a marker of mast cell activity, which in turn signals a
more aggressive
stage in the cancer's pathogenesis. In this scenario, we consider that to some
degree the
disease related pain of cancer patients, and in particular pancreatic cancer
patients, is a
cancer-induced neuropathologic by-product of changes in the tumor
microenvironment;
changes that are responsible for driving disease progression and metastasis,
and which
involve recruitment of mast cells or an increase in mast cell activation.
In connection with the present invention, the timing and severity of disease
related pain can
be considered as a marker of the cancer's pathogenesis, with increased mast
cell activity
being responsible in part for both tumor progression and disease related pain.
Therefore,
inhibition of mast cell activity is a plausible therapeutic target for the
subpopulation of cancer
patients presenting with disease related pain or the requirement of opioid
analgesics for
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
36
treatment of disease related pain. This is evident from the unexpected finding
that masitinib
administered in combination with gemcitabine increased overall survival in the
subpopulation
of pancreatic cancer patients with disease related pain. Additionally, data
from study
AB07012 showed that masitinib plus gemcitabine decreased overall survival in
the
subpopulation of pancreatic cancer patients with no disease related pain and
no requirement
of opioid analgesics for treatment of disease related pain. Hence, according
to the predictor
factor of pain intensity, and in the absence of any other independent
predictor factor, it is
inadvisable to treat patients from this latter subpopulation with masitinib.
Thus, a highly distinct subpopulation from the general pancreatic cancer
population has
been shown to benefit from the use of at least one compound of the invention
(i.e. a tyrosine
kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially
masitinib) administered in
combination with at least one antineoplastic agent (especially gemcitabine).
This
subpopulation can be identified via assessment of disease related pain
intensity; for
example, but not restricted to, at least one occurrence of a non-zero Visual
Analogue Scale
(VAS) pain intensity score (especially with a cut-off at VAS >20, e.g. higher
than 20 mm on a
100 mm scale), or equivalent measure of this pain intensity threshold. This
subpopulation
defines one embodiment of patients relevant to the present invention.
A number of biochemical markers are associated with pain, one or more of which
may serve
as surrogate markers to objectively support the pain intensity predictor
factor described
above. Such biochemical markers include, but are not restricted to, nerve
growth factor
(NGF), bradykinin, tryptase, histamine, neurotrophin-3 (NT-3), and brain-
derived
neurotrophic factor (BDNF). However, biochemical markers of pain are known to
be variable
and to date there is no conclusive evidence that they can quantitatively
identify cancer
patients experiencing disease related pain. Similarly, the known in vivo
biochemical markers
of mast cells, such as, but not restricted to, absolute mast cell count or
tryptase levels, have
been shown to poorly correlate with mast cell activation [Hermine 0, et al.,
PLoS ONE.
2008;3:e2266]. Thus, in the absence of reliable surrogate biochemical markers
for mast cell
activation or disease related pain, unidimensional tools remain the most
appropriate pain
assessment option available, even if this represents a relatively subjective
measure of pain
intensity or indirect evidence of mast cell involvement.
In connection with the present invention, it is possible to generalize upon
the discovery (i.e.
the concomitant increase in mast cell activity, poor clinical outcome in
cancer, and disease
related pain) to other cancers that involve recruitment of mast cells or an
increase in mast
cell activation. Explicitly, the onset of disease related pain serves as a
marker of mast cell
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
37
activity, which in turn signals changes in the tumor microenvironment that are
responsible for
driving disease progression and metastasis. However, the current absence of
knowledge
concerning in vivo mast cell mediated tumorigenesis and metastasis accompanied
by onset
of disease related pain for any given cancer, precludes any person skilled in
the arts
applying the principle of targeting mast cell activity for treatment of cancer
that is associated
with pain beyond that of heuristic 'trial and error'.
The main findings from study AB07012 regarding treatment of a patient
subpopulation
defined via a pain intensity predictor factor are summarized below (see also
Example 1).
The subpopulation having pancreatic cancer that is associated with 'pain' was
defined in this
study as those patients with a baseline Visual Analogue Scale (VAS) pain
intensity score of
greater than 20 (i.e. VAS >20 mm as measured on a 100 mm scale). This linear
scale
provides a visual representation of pain amplitude as perceived by the patient
(Figure 2).
The amplitude was represented by a 100 mm long line having no reference marks.
One
extremity indicated an absence of pain (0 value) and the other the worst
imaginable pain
(100 value). At baseline each patient was asked to indicate the level of pain
intensity they
were experiencing by drawing a vertical line on the VAS scale. It was
considered that a
patient with no pain, or negligible pain, would locate a vertical line between
0 and 5 on the
VAS scale.
Any VAS score indicated herein refers to the absolute amplitude on a linear
scale or
equivalently a percentage; for example, a VAS pain intensity score of 20
corresponds to an
indicated level of pain at 20 mm on a 100 mm scale, or alternatively at 20% of
said scale. In
connection with the present invention, any equivalent measure of this pain
intensity threshold
would be valid; for example, but not limited to, a unidimensional pain
intensity assessment
tool score of >20%, a criteria-based pain categorization of at least moderate
pain; or a
multidimensional pain assessment tool rating of at least moderate pain.
Another interpretation of this pain intensity threshold is that said cancer
patients have a
disease related pain of at least moderate intensity. The pain intensity
predictor factor, in the
embodiment as described above, was defined based upon the reasons: (1) this
threshold
was approximately (rounding to the nearest ten) the study population's median
pain intensity
(50% of the population); (2) a VAS pain intensity of 20 mm coincided with the
emergence of
a plateau (or horizontal asymptote) in the hazard ratio for death (see Figure
1); (3) this
threshold has been previously cited in the literature as a pain intensity cut-
off.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
38
For the subpopulation with VAS pain intensity VAS >20, or equivalent measure
of pain
intensity (referred to hereafter as the "pain subpopulation"), gemcitabine
works best when
administered in combination with masitinib. A statistically significant
benefit, in terms of
median overall survival and hazard ratio for death, was observed for
combination masitinib
plus gemcitabine treatment in patients with pancreatic cancer that is
associated with pain at
VAS >20.
For the subpopulation with VAS pain intensity <5, or equivalent measure of
pain intensity,
and with no need for opioid analgesics to manage disease related pain
(referred to hereafter
as the "no pain, no morphine subpopulation"), gemcitabine works best by
itself; indicating
that in the absence of any other independent predictor factor, treatment of
this subpopulation
with masitinib plus gemcitabine is inadvisable. Negative therapeutic benefit,
in terms of
median overall survival and hazard ratio for death, was observed for
combination masitinib
plus gemcitabine treatment in patients from the 'no pain, no morphine'
subpopulation.
For the subpopulation with VAS pain intensity 5< VAS <20, or equivalent
measure of pain
intensity (referred to hereafter as the "below median pain subpopulation"),
there was a
statistically significant benefit in the hazard ratio, however, no difference
was observed in
terms of median overall survival. For this pain intensity subpopulation, there
does not appear
to be any increased harm or benefit in terms of survival due to the
combination of masitinib
with gemcitabine, indicating that this subpopulation is neutral (i.e. no harm
will be done if
masitinib is administered).
The frequency of deaths due to adverse events in the 'pain' subpopulation was
reduced (two
times lower) in the masitinib plus gemcitabine treatment arm than in the
placebo plus
gemcitabine arm (10.9% versus 21.9%, respectively). Toxicity of the masitinib
plus
gemcitabine combination were consistent with the known safety profile of
masitinib and are
all manageable, any risk of life threatening adverse events being greatly
mitigated by
anticipating their occurrence and implementing appropriate protocols,
especially for severe
neutropenia.
In one possible embodiment of the present invention, the use of at least one
compound of
the invention for the treatment of pancreatic cancer would depend upon,
although not be
restricted to, the following guidelines:
= Treatment is indicated if the patient meets the 'pain' subpopulation
criterion of VAS pain
intensity >20, or equivalent measure of pain intensity, on at least one
occasion.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
39
= At least one question could be asked to eliminate pain that is not
relevant to pancreatic
cancer, for example, the patient might be asked to indicate the localization
of their pain.
= Strict adherence to the rule of not treating the subpopulation of no
pain, no morphine', in
the absence of any other independent predictor factor, would protect those
patients for
whom the masitinib plus gemcitabine combination has been shown to be
detrimental.
These guidelines are similar to those employed to diagnose the chronic pain
condition of
fibromyalgia, the established diagnostic criteria being to first exclude other
underlying
conditions that might be causing the pain related symptoms, then to assess the
patient's
pain (via patient questionnaire and physical examination).
The neutral subpopulation of patients ('below median pain', VAS or
equivalent measure
of pain intensity), for whom there was a statistically non-significant benefit
in hazard ratio,
provides a large buffer between the indicated treatment subpopulation and the
subpopulation
for whom said treatment is inadvisable. The diagnostic decision in terms of
harm / no harm
due to treatment effectively becomes a 'binary' indicator, with the condition
of 'no pain, no
morphine' being highly distinguishable from 'pain' (VAS >20). In the event of
wrongly treating
a patient who belongs to the 'below median pain' subpopulation, then there is
no detriment to
survival, with the only increased risk being due to manageable toxicity.
In connection with the present invention, effective treatment options for
pancreatic cancer
patients in the subpopulation of 'pain' (VAS >20) are nonexistent. The
credibility of this
statement is underscored by data from study AB07012 showing a pain intensity
related
discrepancy in survival time for patients receiving gemcitabine as a single
agent, with an
observed difference in survival time of 10.0 months between the 'pain' and 'no
pain, no
morphine' subpopulations (i.e. patients from the 'pain' subpopulation had a
shorter survival
time) (see Example 1). Moreover, in a study assessing erlobinib plus
gemcitabine, no
survival benefit for the equivalent 'pain' subpopulation was reported whereas
benefit was
apparent for patients with VAS pain intensity of <20. Finally, the benefit of
Folfirinox for the
subpopulation of pancreatic cancer with 'pain' (VAS >20) is at best unknown
because pain
was not factored into that study's analysis, an omission that given the
significant influence
pain intensity has on pancreatic cancer patient survival (as revealed by study
AB07012
findings) would very likely impact negatively on the Folfirinox survival data.
Considering further the safety analysis from study AB07012, the overall
frequency of
adverse events (AE) were similar in both treatment arms, whilst the frequency
of serious and
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
severe AEs were higher in the masitinib plus gemcitabine treatment arm than in
the placebo
plus gemcitabine arm. Discontinuations, temporary interruptions and dose
reductions
occurred more frequently in the masitinib plus gemcitabine treatment arm as
compared with
the placebo plus gemcitabine arm. Adverse events leading to permanent
discontinuations
occurred in 42% vs. 27% of patients, respectively (p-value = 0.002). Of these,
non-severe
AEs accounted for 32% of discontinuations from the masitinib plus gemcitabine
treatment
arm with only 16% of masitinib plus gemcitabine treated patients reporting a
dose reduction.
It is likely that discontinuations due to non-severe AE may partially be
avoided by a more
frequent use of masitinib dose reductions or by lowering the masitinib
starting dose. By
consequence, exposure to the study drug was significantly lower in the
masitinib plus
gemcitabine treatment arm (p=0.001). In the overall population, patient
exposure to
gemcitabine in the masitinib plus gemcitabine treatment arm was decreased by
approximately 35% compared with the placebo plus gemcitabine treatment arm,
with similar
trends observed in the various pain intensity subpopulations. Taken together
these
observations on safety and drug exposure indicate that the administered
masitinib dose of 9
mg/kg/day was not optimal for good patient compliance, in part due to
additional toxicity
associated with the combination. Considering also new insights regarding
masitinib's inferred
mechanisms of action, a masitinib dose of 6 mg/kg/day is considered to be the
optimal
starting dose, with dose escalation permitted in patients with an inadequate
response in the
absence of limiting toxicities.
The inventors also showed that gene expression is an independent predictor
factor for
improved survival in pancreatic cancer patients treated with masitinib plus
gemcitabine.
Thus, the present invention also relates to a method for the treatment of
cancer in a human
patient, wherein said method comprises administering to a human patient in
need thereof, a
tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially
masitinib or a
pharmaceutically acceptable salt thereof, optionally combined with at least
one antineoplastic
agent, wherein said patient is initially selected for treatment based upon
gene expression
predictor factors.
An ancillary pharmacogenomic analysis of RNA expression in peripheral blood
cell samples
collected prior to treatment with masitinib was carried out in parallel to
study AB07012 with
an aim to identify gene expression patterns predictive for overall survival
and treatment
efficacy. Genomic analyses (carried-out by Skuldtech, Montpellier, France)
consisted of
global transcriptome analysis of RNA expression using the high throughput
method of Next
Generation Sequencing (performed independently in triplicate). This analysis
simultaneously
measured the expression level of large numbers of genes in blood samples drawn
from a
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
41
subpopulation of patients randomized to study AB07012. Analyses were first
carried out on
the study's overall population whatever the treatment administered, followed
by an analysis
on each treatment arm i.e. masitinib or placebo arm, to determine possible
genetic trends
according to the treatment. The objectives of this ancillary study were to
reveal biomarkers
predictive of extended survival (i.e. increased OS) for masitinib treated
patients as compared
with placebo treated patients.
In particular, RNA blood samples were collected and analyzed, resulting in
isolation of a
gene expression profile indicative of aggressive disease progression, present
in 55% of
patients, which was highly predictive for overall survival and furthermore
interacted with the
treatment. This ancillary pharmacogenomic database contained blood RNA samples
from
119 patients randomized to study AB07012 (1:1 ratio according to treatment
arm) in order to
detect gene expressions that correlated with treatment effect. In a first step
the full human
genome (-27,000 genes) was analyzed in terms of a possible correlation between
RNA
expression levels and overall survival, with respect to treatment type. RNA
blood samples
were collected using the PAXgene Blood RNA System and three independent
Digital Gene
Expression (DGE) libraries were constructed for four pooled RNA samples
falling into the
following patient profiles:
Patients in the masitinib plus gemcitabine treatment arm who survived s 4
months
Patients in the placebo plus gemcitabine treatment arm who survived s 4 months
Patients in the masitinib plus gemcitabine treatment arm who survived > 15
months
Patients in the placebo plus gemcitabine treatment arm who survived > 15
months
The resultant genomic database contained 119 modified intent-to-treat patients
from which
169 genes were identified through differential expression analysis using the
edgeR method
with a 1.5-fold change and a false discovery rate adjusted p-value criterion
of < 10%.
In a second step, real time quantitative PCR (real time quantitative
polymerase chain
reaction or qPCR) was performed, which allows one to determine the Cycle
threshold (Ct)
value of a gene, said value being normalized with respect to the expression
level of a
housekeeping or reference gene to give a Delta Ct (DCt) value. Housekeeping
genes are
genes that are expressed in all the cells of an organism under normal and
pathophysiological
conditions. These genes are usually expressed at relatively constant levels.
Preferably, the
normalization is based on the expression level of two housekeeping genes, and
in particular,
based on the expression level of genes B2M and GAPDH. Thus, when two
housekeeping
genes (for example, genes B2M and GAPDH) are used to normalize the Ct value of
a given
gene, the DCt of said gene is calculated as follows: DCt = Ct (gene) - [Ct
(B2M) + Ct
(GAPDH)]/2.High DCt values corresponded to a relatively lower level of gene
expression.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
42
The main methodological aspects of the ancillary pharmacogenomic study of
trial AB07012
and subsequent results regarding treatment of a patient subpopulation defined
via gene
expression predictor factors, are summarized below (see also Example 2 for
additional
details).
Regarding measurement of gene expression, in one embodiment, the expression
level of a
gene is measured as the level of the protein of said gene. In that case, the
level of the
protein is preferably measured by employing antibody-based detection methods
such as
immunochemistry or western-blot analysis.
In another embodiment, the expression level of a gene is measured as the level
of the RNA
transcript or the cDNA of said genes. In that case, the level of RNA
transcript(s) or the cDNA
is measured by employing nucleic acid based detection methods such as
microarrays,
quantitative PCR, DNA chips, hybridization with labeled probes, or lateral
flow
immunoassays, in particular lateral flow dipstick tests. Preferably, the
expression level of the
gene is measured by real time quantitative PCR performed on the RNA transcript
or the
cDNA of said gene. A real time quantitative PCR is a PCR wherein the amplified
DNA is
detected as the reaction progresses in real time. This detection is made
through the
accumulation of a fluorescent signal. The Ct (cycle threshold) is defined as
the number of
PCR cycles required for the fluorescent signal to cross the threshold (i.e.
exceed
background level). Thus, a forward and a reverse primer, and a reporter,
preferably a DNA
fluorescent intercalant, are used in a qPCR. Advantageously, primers that are
specific for
hybridizing within the gene coding regions are used.
Below is a summary of the methodology and analytical processes used to define
a set of
gene expression predictor factors, and therefore, a patient subpopulation for
which masitinib
is most probable to be of therapeutic benefit.
- This analysis simultaneously measured the expression level of large
numbers of genes in
peripheral blood cell samples drawn from a total of 119 patients randomized to
the study
AB07012 (1:1 ratio of masitinib and placebo treated patients).
- Analyzed samples were taken once only at week 0 (baseline).
- The PAXgeneTM Blood RNA System was used to collect a patient's blood
sample, and
the RNA extracted using PAXgene Blood RNA Kit V.2 (PreAnalitix) according to
the
manufacturer's recommendations. Control of RNA integrity was performed with
the 2100
Bioanalyzer (Agilent Technologies, Palo Alto, USA) using Eukaryotic Total RNA
6000
Nano Chip (Agilent Technologies). RNA quantity was controlled using NanoDrop
ND-
1000 spectrophotometer. Purified RNAs were conserved at -80 C
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
43
- Digital Gene Expression (DGE) experiments were performed to select set of
putative
biomarkers. Biomarker validation was done using Real-Time PCR on COBAS
platform
(L0480, ROCHE Diagnostics) and appropriate biostatistical approaches have been
used
to filter best biomarkers.
- RNAs were reverse transcripted according the Roche Diagnostics' protocol.
Gene
expression levels of putative biomarkers were investigated by Real-Time PCR.
- DGE analysis resulted in the selection of 169 genes, taken from a genomic
database of
119 modified intent-to-treat patients.
- For each gene three cut-offs with respect to DCt were specified: median,
01 (first
quartile, P25) and Q3 (third quartile, P75). By "median DCt", it is meant the
median of the
DCt of all of the tested patients. For each cut-off (less than cut-off/more
than cut-off) a
multivariate model was used to explain differences in overall survival between
treatment
arms. If the effect of treatment arm was significant (p <5%) then it can be
concluded that
the gene under investigation has a different effect on survival depending on
the
treatment arm, and that gene was retained for further analysis. Because of the
importance of gene KIT, this gene was selected whatever its level of
significance.
- Multivariate analysis subsequently refined the gene selection down to a
total of 64
genes with associated cut-off values.
- All possible dual-gene combinations from these 64 genes and their
respective cut-off
values were subjected once again to the multivariate model.
- Each combination was classified according to the discriminatory power of
the
combination measured by p-value of the Chi-squared test provided in the Cox
model. An
additional criterion for retaining a given dual-gene combination was that the
subpopulation refined should contain at least 40 patients (1/3 of the total
sample).
- The ten individual genes found in the six identified gene expression
predictor factors
(i.e. pairs of regulated genes with p-values <0.00001) were: ACOX-1,
TNFRSFS10B,
RPS23, ABCC3, LYN, HIF1ALPHA, ABCC1, IGJ, UBE2H, and PARP-2.
The expression level of these genes was measured by real time quantitative PCR
(real time
quantitative polymerase chain reaction or qPCR) using primers that were
specific for
hybridizing within the gene coding regions.
= In the case of the ACOX-1 gene, the primers amplify a sequence located on
chromosome 17 between nucleotide 73,938,893 and nucleotide 73,939,007
(Assembly
Feb. 2009 GRch37/hg19, UCSC source).
= In the case of the TNFRSF1OB gene, the primers amplify a sequence located
on
chromosome 8 between nucleotide 22,877,657 and nucleotide 22,877,728 (Assembly
Feb. 2009 GRch37/hg19, UCSC source).
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
44
= In the case of the RPS23 gene, the primers amplify a sequence located on
chromosome
between nucleotide 81,571,951 and nucleotide 81,572,049 (Assembly Feb. 2009
GRch37/hg19, UCSC source).
= In the case of the ABCC3 gene, the primers amplify a sequence located on
chromosome
17 between nucleotide 48,762,132 and nucleotide 48,762,221 (Assembly Feb. 2009
GRch37/hg19, UCSC source).
= In the case of the LYN gene, the primers amplify a sequence located on
chromosome 8
between nucleotide 56,854,522 and nucleotide 56,860,210 (Assembly Feb. 2009
GRch37/hg19, UCSC source).
= In the case of the HIFI A gene, the primers amplify a sequence located on
chromosome
chromosome 14 between nucleotide 62,214,901 and nucleotide 62,214,976
(Assembly
Feb. 2009 GRch37/hg19, UCSC source).
= In the case of the ABCC1 gene, the primers amplify a sequence located on
chromosome
16 between the nucleotide 16,177,368 and nucleotide 16,180,772 (Assembly Feb.
2009
GRch37/hg19, UCSC source).
= In the case of the IGJ gene, the primers amplify a sequence located on
chromosome 4
between the nucleotide 71,521,360 and nucleotide 71,521,432 (Assembly Feb.
2009
GRch37/hg19, UCSC source).
= In the case of the UBE2H gene, the primers amplify a sequence located on
chromosome
7 between the nucleotide 129,470,836 and nucleotide 129,470,925 (Assembly Feb.
2009
GRch37/hg19, UCSC source).
= In the case of the PARP-2 gene, the primers amplify a sequence located on
chromosome 14 between the nucleotide 20,825,213 and nucleotide 20,825,283
(Assembly Feb. 2009 GRch37/hg19, UCSC source).
In one embodiment, the following primers can be used to perform the real time
quantitative
PCR:
= GAPDH
o primer forward:
ATGGGGAAGGTGAAGGTCG (SEQ ID NO:1)
o primer reverse:
GGGGTCATTGATGGCAACAATA (SEQ ID NO:2)
= B2M
o primer forward:
GCTCAGTAAAGACACAACCATCC (SEQ ID NO:3)
o primer reverse:
CATCTGTGGATTCAGCAAACC (SEQ ID NO:4)
= ABCC1
o primer forward:
CCAGTGGGGATCGGACAGA (SEQ ID NO:5)
o primer reverse:
AGGGGATCATCGAAGAGGTAAAT (SEQ ID NO:6)
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
= ACOX1
o primer forward:
TTTCTTCACTGCAGGGCTTT (SEQ ID NO:7)
o primer reverse:
GGAAAGGAGGGATTTTGAGC (SEQ ID NO:8)
= HIF1A
o primer forward:
TTTTGCTCTTTGTGGTTGGA (SEQ ID NO:9)
o primer reverse:
CCTGGTCCACAGAAGATGTTT (SEQ ID NO:10)
= IGJ
o primer forward:
GGACATAACAGACTTGGAAGCA (SEQ ID NO:11)
o primer reverse:
TGGCAATTTCTTACACTAACCTGA (SEQ ID NO:12)
= TNFRSF1OB
o primer forward:
GGTTTCATATTTAATTTGGTCATGG (SEQ ID NO:13)
o primer reverse:
CAAACAAGGAAGCACATTGTGTA (SEQ ID NO:14)
= RPS23
o primer forward:
GATTTGGTCGCAAAGGTCAT (SEQ ID NO:15)
o primer reverse:
TGCCTTTGTATAGGGCCAAA (SEQ ID NO:16)
= ABCC3
o primer forward:
GGAGGACATTTGGTGGGCTTT (SEQ ID NO:17)
o primer reverse:
CCCTCTGAGCACTGGAAGTC (SEQ ID NO:18)
= LYN
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
46
O primer forward:
ATCCAACGTCCAATAAAGAGCA (SEQ ID NO:19)
o primer reverse:
AAGGCTACCACAATGTCTOCT (SEC ID NO:20)
= PARP2
o primer forward:
GGGAAAGGAATCTACTTTGCTG (SEQ ID NO:21)
O primer reverse:
TTCTTTAGGCGAGAGGOAAA (SEQ ID NO:22)
= LJBE2H
o primer forward:
CGCAGGTTTTCCACTCATCT (SEQ ID NO:23)
o primer reverse:
ATGGCCATTTCTTCCCAAG (SEQ ID NO:24)
Name Description Gene identifiant Example of mRNA
1
Sequence Id. sequences
(Ensembl) Sequence Id. (Genbank)
ACOX1 Acyl-CoA oxidase 1, paimitoyl ENSG00000161533 NM
001185039.1 (SEQ ID
(SEQ ID NO 25) NO:35)
NM_004035.6 (SEQ ID NO:36)
i
NM 007292.5 (SEQ ID NO:37)
--1-NFRSF1OB Tumor necrosis factor receptor¨ ENSG00000120889 NM 003842.4
(SEQ ID NO:38)
superfamily, member 10b (SEQ ID NO 26) NM 147187.2(SEQ ID
NO:39)
ABCC1 ATP-binding cassette, sub-family C ENSG00000103222 NM_004996.3
(SEQ ID NO:40)
(CFTR/MRP), member 1 (SEQ ID NO 27)
ABCC3 ATP-binding cassette, sub-family C ENSG00000108846
NM_001144070.1(SEQ ID NO:41)
(CFTR/MRP), member 3 (SEQ ID NO 28) NM 003786.3 (SEQ ID
NO:42)
HIF1A Hypoxia inducible factor 1, alpha ENSG00000100644
NM_001243084.1(SEQ ID NO:43)
subunit (SEQ ID NO 29) NM_001530.3 (SEQ ID
NO:44)
rIlYN V-yes-1 Yamaguchi sarcoma viral ENSG00000254087
NM_001111097.2(SEQ ID NO:45)
related oncogene homolog (SEQ ID NO 34) NM 002350.3 (SEQ ID
NO:46)
IGJ lmmunoglobulin J polypeptide, ENSG00000132465
NM_144646.3 (SEQ ID NO:47)
linker protein for immunoglobulin (SEQ ID NO 30)
atpha and mu polypeptides
UBE2H bbiquitin-conjugating enzyme E2H ENSG00000186591 NM 001202498.1
(SEQ ID
(SEQ ID NO 31) NO:48)
NM 003344.3 JSEQ ID NO:49)
PARP2 Poly (ADP-ribose) polymerase 2 ENSG00000129484
NM_001042618.1(SEQ ID NO:50)
(SEQ ID NO 32) NM 005484.3(SEQ ID
NO:51)
; RPS23 Ribosomal protein S23 EN5G00000186468 NM_001025.4(SEQ ID
NO:52)
(SEQ ID NO 33)
GAPDH glyceraldehyde-3-phosphate ENSG00000111640 NM_002046 (SEQ ID
NO:53)
dehydrogenase NM_001256799 (SEQ ID
NO:54)
; B2M beta-2 microglobulin ENSG00000166710 NM 004048.2 (SEQ ID
NO:55)
_____________________________________________________________________________
1
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
47
The two housekeeping genes used were B2M and GAPDH. In the case of the B2M
gene,
the amplified sequence is located on chromosome 15 between nucleotides
45,010,919 and
nucleotides 45,010,990 (Assembly Feb. 2009 GRch37/hg19, UCSC source).
In the case of the GAPDH gene, the amplified sequence is located on chromosome
12
between nucleotides 6,643,999 and nucleotides 6,645,738 (Assembly Feb. 2009
GRch37/hg19, UCSC source).
Advantageously, for performing the real-time quantitative FOR, primers, size
(preferably
between 80 and 150 nucleotides), Tm (melting temperature, preferably 60 C 1
C), GC%
(percentage of G or C nucleotide, preferably -60% in 3'), 3' and 5' self -
complementarity and
stability (preferably inferior to 4 nucleotides), product size ranges and
thermodynamic
parameters (secondary structure evolution according primer Tm and sodium salt
concentration) are selected to allow a simultaneous detection.
- Having identified these ten genes and six gene expression predictor
factors, a pooling
strategy was finally implemented to identify the most common/specific gene
expression
profile and discard individual variations or outliers (e.g. due to sample
manipulation
error). Sample pooling is a method frequently used in epidemiology when
individual
studies are too small to allow any definite conclusion.
- Hence, the most significant dual-gene combination was chosen first (and
then the
following information was recorded: number of patients in the subpopulation,
Hazard
Ratio (HR); p-value of the Cox model. Next, the second most significant dual-
gene
combination was added in order to increase the sample size and also the power
of
analyses. The same information as above was recorded. The process of selection
was
stopped when no (or few) additional patients were added to the sample size
following
addition of a new combination, with the condition also that Hazard Ratio
and/or p-value
were maintained (see Example 2, Table 5).
- The process was stopped after six combinations (66 patients in total)
with the final
selection of dual-gene combinations (referred to hereafter individually as the
"gene
expression predictor factors" or collectively as the "genetic/transcriptional
fingerprint")
being:
= The concomitant up-regulation of genes ACOX-1 and TNFRSF1OB with patient
Delta Cycle Threshold values of less than or equal to 3.05 for ACOX-1 and less
than or equal to 6.1 for TNFRSF10B; (HR = 0.19, p-value = 0.0091).
= The concomitant down-regulation of gene RPS23 and up-regulation of gene
ACOX-1 with patient Delta Cycle Threshold values of greater than 0.35 for
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
48
RPS23 and less than or equal to 3.05 for ACOX-1; (HR = 0.20, p-value =
0.00046).
= The concomitant up-regulation of genes ABCC3 and LYN with patient Delta
Cycle
Threshold values of less than or equal to 4.3 for ABCC3 and less than or equal
to
1.65 for LYN; (HR = 0.19, p-value = 0.00025).
= The concomitant up-regulation of genes HIF1A and TNFRSF1OB with patient
Delta Cycle Threshold values of less than or equal to 3.95 for HIF1A and less
than or equal to 5.65 for TNFRSF10B; (HR = 0.19, p-value = 0.00013).
= The concomitant down-regulation of gene ABCC1 and up-regulation of gene
IGJ
with patient Delta Cycle Threshold values of greater than 3.5 for ABCC1 and
less
than or equal to 7.05 for IGJ; (HR = 0.19, p-value = 0.000011).
= The concomitant down-regulation of genes UBE2H and PARP-2 with patient
Delta Cycle Threshold values of greater than 3.7 for UBE2H and greater than
7.1
for PARP-2; (HR = 0.192, p-value = 0.000004).
Note, it is understood that slight modifications to the above defined cut-offs
are
encompassed herein (for example, 10% or even 25% of the stated cut-offs) to
reflect the
fact that the optimal threshold may be located in proximity to those cut-offs
tested and that
the patient cohort is only representative of a general cancer population.
OS was analyzed in the subpopulation identified as harboring at least one of
the gene
expression predictor factors, referred to hereafter as the "genetic
fingerprint" or
"transcriptional fingerprint" subpopulation (65 patients), and in its
counterpart, i.e. patients
that did not present any of the gene expression predictor factors, referred to
hereafter as the
"non genetic fingerprint" or "non transcriptional fingerprint" subpopulation
(53 patients).
Analysis of the 'genetic fingerprint' subpopulation showed that patients in
the masitinib plus
gemcitabine treatment arm had a median OS of 12.9 months as compared with 4.7
months
in patients receiving placebo plus gemcitabine (multivariate analysis). After
adjustment for
differences in baseline characteristics, the difference in median OS proved to
be statistically
significant (p-value <0.000001) with a hazard ratio for death (defined as the
probability of
death under masitinib plus gemcitabine over the probability of death under
placebo plus
gemcitabine) of 0.17 with a 95% confidence interval of [0.09;0.34]. Thus,
patients harboring
at least one of the aforementioned gene expression predictor factors, and
therefore
identified as belonging to the defined 'genetic fingerprint' subpopulation,
have a 83%
decrease in risk of death when treated with the combination of masitinib plus
gemcitabine as
compared with gemcitabine alone. Considering a worst case scenario of the
higher
confidence interval boundary, i.eØ34, the risk of death for patients in the
'genetic fingerprint'
subpopulation was still reduced by 66% when treated with masitinib plus
gemcitabine. The
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
49
Kaplan-Meier estimates for the 'genetic fingerprint' subpopulation clearly
showed that
survival probability is consistently higher and that survival rates from 6 to
24 months were
favorable for masitinib plus gemcitabine treatment as compared with
gemcitabine treatment
alone (see Example 2, Figure 7).
By contrast, analysis of the 'non genetic fingerprint' subpopulation showed a
median OS of
5.6 months for masitinib plus gemcitabine treatment as compared with 13.2
months in
patients receiving placebo plus gemcitabine (multivariate analysis). The
difference in median
OS was statistically significant (p-value =0.000036) with a hazard ratio for
death (defined as
the probability of death under masitinib plus gemcitabine over the probability
of death under
placebo plus gemcitabine) of 4.24 with a 95% confidence interval of
[2.11;8.52] in the
multivariate model (see Example 2, Figure 8). Thus, the risk of death for
patients not
harboring at least one of the aforementioned gene expression predictor factors
is higher
when treated with the combination of masitinib plus gemcitabine as compared
with
gemcitabine alone. Therefore, said treatment of any patient in the 'non
genetic fingerprint'
subpopulation, and in the absence of any other positive predictor factor, is
inadvisable.
It was observed that there was no correlation between the genomic data and
baseline VAS
pain intensity status, i.e. with respect to the pain intensity predictor
factor. This was true for
the overall genomic population (119 patients), for the 'genetic fingerprint'
and 'non genetic
fingerprint' subpopulations. In connection with the present invention, it
would therefore seem
likely, without wishing to be bound by the theory, that the predictor factors
of pain intensity
and gene expression are associated with independent mechanisms of disease
progression.
Therefore, treatment of masitinib is of therapeutic benefit to a patient who
is positive for one
predictor factor but negative for another; i.e., no contradiction exists.
Considering gene expression as an independent predictor factor, the treatment
management
plan is simply a binary choice between administering masitinib, optionally
combined with at
least one antineoplastic agent, to those patients identified as having the
appropriate genetic
fingerprint, and not administering masitinib to patients lacking said genetic
fingerprint. The
treatment management plan for the pain intensity predictor factor is more
complex and must
take into consideration different thresholds for pain intensity and existing
treatment
regimens. Thus, in one embodiment of the invention, the discovery of specific
and
independent predictor factors leads us to propose a new therapeutic management
plan in
pancreatic cancer patients according to the scheme presented in Figure 3.
Thus, in a first embodiment, the invention relates to a method of treatment of
cancer in
human patients, wherein a tyrosine kinase inhibitor, mast cell inhibitor or c-
Kit inhibitor,
especially masitinib or a pharmaceutically acceptable salt thereof, is
administered in a
patient in need thereof, optionally combined with at least one antineoplastic
agent.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
The compound of the invention and the at least one optional antineoplastic
agent may be
administered separately, simultaneously or sequentially in time.
According to a particular embodiment, said tyrosine kinase inhibitor, mast
cell inhibitor or c-
Kit inhibitor, especially masitinib or a pharmaceutically acceptable salt
thereof, is
administered in combination with at least one antineoplastic agent for the
treatment of
cancer, wherein said patient is either naïve to said at least one
antineoplastic agent or
responding to treatment with said at least one antineoplastic agent.
In another embodiment, said tyrosine kinase inhibitor, mast cell inhibitor or
c-Kit inhibitor,
especially masitinib or a pharmaceutically acceptable salt thereof, is
administered in
combination with at least one antineoplastic agent for the treatment of
cancer, wherein said
patient is refractory or resistant to said at least one antineoplastic agent.
The invention also relates to a tyrosine kinase inhibitor, mast cell inhibitor
or c-Kit inhibitor,
notably as defined above, especially masitinib, optionally combined with at
least one
antineoplastic agent, for use as a medicament or in a pharmaceutical
composition for a
method as defined in the description.
The invention also relates to a kit comprising at least a tyrosine kinase
inhibitor, mast cell
inhibitor or c-Kit inhibitor, notably as defined above, especially masitinib,
optionally with at
least one antineoplastic agent, for use in a method for the treatment of a
cancer as defined
in the present description and examples.
In one embodiment the present invention relates to the method as defined above
wherein a
tyrosine kinase inhibitor or a mast cell inhibitor is an inhibitor of kinase
activity selected from
the tyrosine kinases of: c-Kit, PDGFR, Lyn, Fyn and DDR1.
According to one embodiment the present invention relates to the method as
defined above,
wherein said patient is initially selected for treatment based upon the
predictor factor of pain
intensity.
Thus, in one embodiment the present invention relates to a method of treatment
of cancer
that is associated with pain or that requires administration of opioid
analgesics for treatment
of disease related pain, in a human patient, wherein a tyrosine kinase
inhibitor, mast cell
inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically
acceptable salt thereof,
is administered to a patient in need thereof, optionally combined with at
least one
antineoplastic agent.
In one embodiment, said patient is considered to be in the indicated treatment
subpopulation
if on at least one occasion said patient presents with disease related pain
defined as a non-
zero Visual Analogue Scale (VAS) pain intensity score, or equivalent measure
of pain
intensity.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
51
In other embodiments, said patient is considered to be in the indicated
treatment
subpopulation if on at least one occasion said patient presents with disease
related pain
defined as a VAS pain intensity score of greater than 5 (e.g. VAS >5 mm as
measured on a
100 mm scale, or 5%); or a VAS pain intensity score of greater than 10 (e.g.
VAS >10 mm
as measured on a 100 mm scale, or 10%); or even a VAS pain intensity score of
greater
than 20 (e.g. VAS >20 mm as measured on a 100 mm scale, or 20%).
In another embodiment, said patient is considered to be in the indicated
treatment
subpopulation if on at least one occasion said patient presents with disease
related pain
defined by an equivalent measure of said VAS >20 pain intensity threshold.
Said patients is
also considered to be in the indicated treatment subpopulation if on at least
one occasion
said patient presents with disease related pain intensity classified as being
moderate to
intolerable pain.
In one embodiment, individual disease related pain intensity is defined and
assessed as
disclosed above.
In another embodiment the present invention relates to the method as defined
above
wherein said patient is afflicted by pancreatic cancer that is associated with
pain or that
requires administration of opioid analgesics for treatment of disease related
pain, and
wherein 'pain' is defined as at least one reported occurrence of a Visual
Analogue Scale
(VAS) pain intensity score of greater than 20 (e.g. VAS >20 mm as measured on
a 100 mm
scale, or 20%).
In one embodiment, treatment of said patient is considered to be inadvisable
if, in the
absence of any other independent predictor factor, said patient presents no
disease related
pain and no requirement of opioid analgesics for treatment of disease related
pain.
According to one embodiment the present invention relates to the method as
defined above,
wherein said patient is initially selected for treatment based upon gene
expression predictor
factors.
According to one embodiment, said gene expression predictor factors are
derived from
analysis of RNA expression in peripheral blood cell samples collected prior to
treatment with
said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor,
especially masitinib or a
pharmaceutically acceptable salt thereof.
According to an embodiment, said patient is considered to be in the indicated
treatment
subpopulation if the gene expression in peripheral blood cell samples
collected prior to
administration of the compound of the invention shows a concomitant up-
regulation or down-
regualtion of at least two genes selected from: ACOX-1, TNFRSFS-10B, RP523,
ABCC3,
LYN, HIF-1A, ABCC1, IGJ, UBE-2H, or PARP-2. For example, dual-gene
combinations
include, but are not restricted to: the concomitant up-regulation of genes
ACOX-1 and
TNFRSF10B; the concomitant down-regulation of gene RPS23 and up-regulation of
gene
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
52
ACOX-1; the concomitant up-regulation of genes ABCC3 and LYN; the concomitant
up-
regulation of genes HIF1A and TNFRSF1OB; the concomitant down-regulation of
genes
ABCC1 and IGJ; the concomitant down-regulation of genes UBE2H and PARP-2.
In one embodiment, the concomitant up-regulation of genes ACOX-1 and TNFRSF1OB
corresponds to patient Delta Cycle Threshold values of less than or equal to
3.81 for ACOX-
1 and less than or equal to 7.63 for TNFRSF1OB; more preferably to patient
Delta Cycle
Threshold values of less than or equal to 3.36 for ACOX-1 and less than or
equal to 6.71 for
INFRSF10B;and even more preferably to patient Delta Cycle Threshold values of
less than
or equal to 3.05 for ACOX-1 and less than or equal to 6.1 for TNFRSF1OB.
In one embodiment, the concomitant down-regulation of gene RPS23 and up-
regulation of
gene ACOX-1 corresponds to patient Delta Cycle Threshold values of greater
than 0.26 for
RPS23 and less than or equal to 3.81 for ACOX-1; more preferably to patient
Delta Cycle
Threshold values of greater than 0.32 for RPS23 and less than or equal to 3.36
for ACOX-1;
and even more preferably to patient Delta Cycle Threshold values of greater
than 0.35 for
RPS23 and less than or equal to 3.05 for ACOX-1.
In one embodiment, the concomitant up-regulation of genes ABCC3 and LYN
corresponds
to patient Delta Cycle Threshold values of less than or equal to 5.38 for
ABCC3 and less
than or equal to 2.06 for LYN; more preferably to patient Delta Cycle
Threshold values of
less than or equal to 4.73 for ABCC3 and less than or equal to 1.82 for LYN;
and even more
preferably to patient Delta Cycle Threshold values of less than or equal to
4.3 for ABCC3
and less than or equal to 1.65 for LYN.
In one embodiment, the concomitant up-regulation of genes HIF1A and TNFRSF1OB
corresponds to patient Delta Cycle Threshold values of less than or equal to
4.94 for HIF1A
and less than or equal to 7.06 for TNFRSF1OB; more preferably to patient Delta
Cycle
Threshold values of less than or equal to 4.35 for HIF1A and less than or
equal to 6.22 for
TNFRSF1OB; and even more preferably to patient Delta Cycle Threshold values of
less than
or equal to 3.95 for HIF1A and less than or equal to 5.65 for TNFRSF1OB.
In one embodiment, the concomitant down-regulation of genes ABCC1 and IGJ
corresponds
to patient Delta Cycle Threshold values of greater than 2.63 for ABCC1 and
less than or
equal to 5.29 for IGJ; more preferably to patient Delta Cycle Threshold values
of greater
than 3.15 for ABCC1 and less than or equal to 6.35 for IGJ; and even more
preferably to
patient Delta Cycle Threshold values of greater than 3.5 for ABCC1 and less
than or equal to
7.05 for IGJ.
In one embodiment, the concomitant down-regulation of genes UBE2H and PARP-2
corresponds to patient Delta Cycle Threshold values of greater than 2.78 for
UBE2H and
greater than 5.33 for PARP-2; more preferably to patient Delta Cycle Threshold
values of
greater than 3.33 for UBE2H and greater than 6.39 for PARP-2; and even more
preferably to
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
53
patient Delta Cycle Threshold values of greater than 3.7 for UBE2H and greater
than 7.1 for
PARP-2.
In another embodiment, the present invention relates to a method of treatment
of cancer,
wherein a tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor,
especially masitinib or
a pharmaceutically acceptable salt thereof, optionally combined with at least
one
antineoplastic agent, is administered to a patient in need thereof, wherein
said patient has a
peripheral blood up-regulation of the gene ACOX-1, or homologous thereof.
In one embodiment, the up-regulation of gene ACOX-1 corresponds to patient
Delta Cycle
Threshold value of less than or equal to 3.81; more preferably of less than or
equal to 3.36;
and even more preferably of less than or equal to 3.05.
A preferred salt of masitinib is masitinib mesilate.
According to another embodiment, a compound of the invention is to be
administered at a
daily dose of 4.5 to 12.0 mg/kg/day, with the preferred starting daily dose of
6.0 to 7.5
mg/kg/day.
Optionally, a compound of the invention is dose escalated by increments of 1.5
mg/kg/day to
reach a maximum of 12.0 mg/kg/day.
Optionally, a compound of the invention is dose reduced by increments of 1.5
mg/kg/day to
reach a minimum of 4.5 mg/kg/day.
Dose adjustment can be considered a dynamic process, with a patient undergoing
multiple
increases and/or decreases to optimize the balance between response and
toxicity
throughout treatment, both of which are likely to vary over time and duration
of drug
exposure. If dose escalation is undertaken, it is suggested that the starting
dose of 6.0
mg/kg/day be incremented by 1 to 2 mg/kg/day up to a maximum dose of 12.0
mg/kg/day,
over a period which depends upon clinical observations. For example, a single
dose
escalation of said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit
inhibitor, especially
masitinib or a pharmaceutically acceptable salt thereof, and preferably
masitinib mesilate,
may take from 1 to 2 months. It is also contemplated herein that to fully
obtain the
therapeutic benefits of a patient-optimized dose of said tyrosine kinase
inhibitor, mast cell
inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically
acceptable salt thereof,
dose increments smaller than 1 to 2 mg/kg/day could be implemented. Dose
reduction is to
be considered to reduce toxicity in appropriate cases.
Any dose indicated herein refers to the amount of active ingredient as such,
not to its salt
form.
Given that the masitinib dose in mg/kg/day used in the described dose regimens
refers to
the amount of active ingredient masitinib, compositional variations of a
pharmaceutically
acceptable salt of masitinib mesilate will not change the said dose regimens.
Said compound of the invention is preferably administered orally.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
54
Said compound of the invention is preferably administered twice a day.
Advantageously, the use or method comprises a long term administration of an
effective
amount of said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit
inhibitor, especially
masitinib or a pharmaceutically acceptable salt thereof, over more than 3
months, preferably
more than 6 months.
In one preferred embodiment the present invention relates to the method as
defined above,
wherein said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit
inhibitor, especially masitinib
or a pharmaceutically acceptable salt thereof, is administered for the
treatment of
unresectable advanced or metastatic adenocarcinoma pancreatic cancer,
optionally
combined with at least one antineoplastic agent, and wherein said patient is
in need thereof,
as defined by the predictor factor of either gene expression or pain
intensity.
The at least one antineoplastic agent can be a medicament for the treatment of
cancers, and
is preferably selected from the group consisting of gemcitabine (Gemzar ;
Lilly), erlotinib
(Tarcevag); Roche), paclitaxel (Taxol , Abraxanee; Bristol-Myers Squibb),
Folfirinox, 5-
fluorouracil (5-FU), capecitabine, cisplatin, oxaliplatin, irinotecan,
leucovorin, and any
combination of these antineoplastic agents.
According to a particular embodiment, the invention also relates to a method
of treatment of
pancreatic cancer, wherein a tyrosine kinase inhibitor, mast cell inhibitor or
c-Kit inhibitor,
especially masitinib or a pharmaceutically acceptable salt thereof, is
administered optionally
in combination with gemcitabine.
Regarding best dosage regimen, depending on age, individual condition, mode of
administration, and the clinical setting, effective doses of said tyrosine
kinase inhibitor, mast
cell inhibitor or c-Kit inhibitor, especially masitinib or a pharmaceutically
acceptable salt
thereof, in human patients with pancreatic cancer are 4.5 to 9.0 mg/kg/day per
os, preferably
in two daily intakes. For adult human patients with pancreatic cancer a
starting dose of said
tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor, especially
masitinib or a
pharmaceutically acceptable salt thereof, of 6.0 to 7.5 mg/kg/day has been
found to be the
preferred embodiment according to the invention. For patients with an
inadequate response
after an assessment of response to therapy and in the absence of limiting
toxicities, dose
escalation of said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit
inhibitor, especially
masitinib or a pharmaceutically acceptable salt thereof, to a maximum of 9.0
mg/kg/day can
be safely considered and patients may be treated as long as they benefit from
treatment and
in the absence of limiting toxicities. For patients experiencing treatment
related toxicity, dose
of said tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor,
especially masitinib or a
pharmaceutically acceptable salt thereof, can be reduced by increments of 1.5
mg/kg/day to
reach a minimum of 4.5 mg/kg/day in intolerant patients, as long as they
benefit from
treatment and in the absence of limiting toxicities at said dose.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
In another embodiment, said tyrosine kinase inhibitor, mast cell inhibitor or
c-Kit inhibitor,
especially masitinib or a pharmaceutically acceptable salt thereof, is
administered at a
starting daily dose of 6.0 to 7.5 mg/kg/day, and gemcitabine is administered
at a weekly
dose of 1000 250 mg/m2 of patient surface area for up to seven consecutive
weeks as a
start (from 3 to 7 weeks), followed by a week off-treatment, followed by
cycles of weekly
dose of 1000 250 mg/m2 for 3 weeks, every 28 days. For gemcitabine, it shall
be
understood that slight modification of the above dosage regimen is encompassed
herein. For
example, every 28 days means that one cycle is 3 weeks under treatment and 1
week off-
treatment.
According to a particular embodiment, the composition of the invention is an
oral
composition.
As is known to the person skilled in the art, various forms of excipients can
be used adapted
to the mode of administration and some of them can promote the effectiveness
of the active
molecule, e.g. by promoting a release profile rendering this active molecule
overall more
effective for the treatment desired.
The pharmaceutical compositions of the invention are thus able to be
administered in various
forms, more specially for example in an injectable, pulverizable or ingestible
form, for
example via the intramuscular, intravenous, subcutaneous, intradermal, oral,
topical, rectal,
vaginal, ophthalmic, nasal, transdermal or parenteral route. A preferred route
is oral
administration. The present invention notably covers the use of a compound
according to the
present invention for the manufacture of pharmaceutical composition.
Such medicament can take the form of a pharmaceutical composition adapted for
oral
administration, which can be formulated using pharmaceutically acceptable
carriers well
known in the art in suitable dosages. Such carriers enable the pharmaceutical
compositions
to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups,
slurries,
suspensions, and the like, for ingestion by the patient. In addition to the
active ingredients,
these pharmaceutical compositions may contain suitable pharmaceutically-
acceptable
carriers comprising excipients and auxiliaries which facilitate processing of
the active
compounds into preparations which can be used pharmaceutically. Further
details on
techniques for formulation and administration may be found in the latest
edition of
Remington's Pharmaceutical Sciences (Maack Publishing Co., Easton, Pa.).
In the Drawings:
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
56
Figure 1: Hazard ratio for death versus VAS score in the multivariate
analysis;
Figure 2: Example of VAS scale and user instructions.
Figure 3: Treatment management plan based upon predictor factors of pain
intensity and
gene expression;
Figure 4: Survival probability estimates for the 'pain' subpopulation
(multivariate analysis)
Figure 5: Survival probability for 'no pain, no morphine' subpopulation
(multivariate analysis)
Figure 6: Kaplan-Meier estimates for survival probability for 'below median
pain'
subpopulation (multivariate analysis)
Figure 7 - Survival probability for 'genetic fingerprint' subpopulation
(multivariate analysis)
Figure 8 - Survival probability for the 'non genetic fingerprint'
subpopulation (multivariate
analysis)
The present invention is further illustrated by means of the following
examples.
The data presented in these examples, and also in parts of the patent
Description, are in
part taken from preliminary analysis and as such represent a close
approximation to the
final, validated dataset.
EXAMPLE 1: Randomized, placebo controlled, phase 3 study to evaluate efficacy
and
safety of masitinib in combination with gemcitabine for treatment of patients
with
advanced/metastatic pancreatic cancer
The development plan in pancreatic cancer carried out by AB Science to
evaluate efficacy
and safety of masitinib in combination treatment with gemcitabine in this
indication was
based on the following clinical study: Study AB07012 "A prospective,
multicenter,
randomized, double-blind, placebo-controlled, 2-parallel group, phase 3 study
to compare
efficacy and safety of masitinib at 9 mg/kg/day in combination with
gemcitabine, to placebo
in combination with gemcitabine, in treatment of patients with
advanced/metastatic
pancreatic cancer". The cut-off date for efficacy and safety analyses was
March 1st, 2012
corresponding to the date of unblinding.
Description of the AB07012 study population
The intent-to-treat (ITT) population was defined as all randomized patients
whether they had
received the study treatment or not. The mITT (modified Intent-To-Treat)
population included
all ITT patients except for patients withdrawn prematurely from the study for
a well-
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
57
documented non treatment-related cause. The ITT population of study AB07012
consisted of
353 patients, enrolled from 11 November 2008 to 6 July 2010 (last patient
included): 175
patients in the masitinib plus gemcitabine treatment arm and 178 patients in
the placebo plus
gemcitabine treatment arm. Clinical efficacy was analyzed on the mITT
population, defined
as the ITT population excluding five patients. Two patients from the masitinib
plus
gemcitabine treatment arm received neither masitinib nor gemcitabine. Of the
two patients
from the placebo plus gemcitabine treatment arm, one was treated with neither
placebo nor
gemcitabine, and the other received gemcitabine but no placebo. The fifth
patient to be
excluded was allocated to the placebo plus gemcitabine treatment arm but did
not have
pancreatic cancer.
Thus, the m ITT population consisted of 348 patients:
173 patients treated with masitinib plus gemcitabine
175 patients treated with placebo plus gemcitabine
Description of populations analyzed for clinical efficacy according to the
predictor factor of
pain intensity
Three subpopulations have emerged from the analysis of baseline
characteristics, treatment
type, and efficacy, and were defined as follows:
'Pain': patients with disease related pain defined as visual analogue scale
(VAS) pain
intensity score >20 (N=137: 64 and 73 in the masitinib plus gemcitabine, and
placebo
plus gemcitabine treatment arms, respectively).
'No pain, no morphine': patients with disease related pain defined as VAS [0-
5] and
with no need for opioid analgesics (N=68: 34 patients each in the masitinib
plus
gemcitabine, and placebo plus gemcitabine treatment arms).
'Below median pain': all other patients not belonging to the 'pain' and `no
pain, no
morphine' subpopulations (N=107: 57 and 50 patients in the masitinib plus
gemcitabine, and placebo plus gemcitabine treatment arms, respectively).
The `pain' subpopulation, as described above, was defined based upon the
reasons:
From multivariate analysis on overall survival in study AB07012, pain
intensity was
identified as a main factor (variable) impacting overall survival. In
addition, interactions
were found between the variable of pain intensity and the combination
treatment
administered to patients.
Results obtained from study AB07012 on overall survival showed that masitinib
plus
gemcitabine significantly increased overall survival of patients with
pancreatic cancer
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
58
that was associated with pain intensity of VAS >20 mm, compared with placebo
plus
gemcitabine.
- Results on overall survival showed that OS decreased in the placebo plus
gemcitabine
treatment arm with increasing pain intensity.
- A VAS pain intensity of 20 mm coincided with the emergence of a plateau (or
horizontal asymptote) in the hazard ratio for death.
- In a similar study on pancreatic cancer therapy by Moore et al. a VAS of
20 mm was
reported as the VAS pain assessment cut-off. In that study, a erlotinib plus
gemcitabine combination did not demonstrate any additional benefit on overall
survival
as compared with patients receiving placebo plus gemcitabine for patients with
VAS
>20; hazard ratio of 1.00 (95 /0C1 [0.78; 1.27]) [Moore MJ, et al., J Olin
Oncol. 2007
May 20;25(15)1 960-6].
- In the scientific literature several other publications reported clinical
results including
VAS scores with a cut-off at 20 mm [(Marineo G. J Pancreas 2003; 4(1):1-10);
(Zaza
C, et al., J Pain Symptom Manage, 2002;24:526-542)].
Clinical efficacy was evaluated through the analysis of overall survival (OS)
in the overall
population and in the three pain intensity subpopulations as defined above.
Pain intensity
was evaluated using the visual analogue scale, a linear scale that provides a
visual
representation of pain amplitude as perceived by the patient. The amplitude
was represented
by a 100 mm long line having no reference marks. One extremity indicated an
absence of
pain (0 value) and the other the worst imaginable pain (100 value). In
practice, prior to
receiving the investigational treatment (i.e. at baseline) each patient was
asked to indicate
the level of pain sensation they were experiencing by drawing a vertical line
on the VAS
scale. It was considered that a patient with no pain, or negligible pain, at
baseline would
locate a vertical line between 0 and 5 on the VAS scale.
Overall survival efficacy analysis for study AB07012
Overall survival was the primary endpoint of this study. OS was measured from
the date of
randomization to the date of documented death. If death was not observed, data
on OS were
censored at the last date the patient was known to be alive. OS was
investigated at each
baseline characteristic through a univariate analysis in patients having
received the placebo
plus gemcitabine treatment, to determine variables that may impact overall
survival
independently from the treatment. The main differences in OS results
(statistical significance
at 5%, data not shown) were observed in the baseline characteristics of: VAS
scale for pain
intensity; locally advanced/metastatic cancer; albumin level (normal /
abnormal); and
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
59
localization of primary tumor in the body of the pancreas. The parameter with
the greatest
impact on overall survival was pain intensity. While disease related pain has
previously been
associated with overall survival, it has never been demonstrated that pain
intensity is the
most important factor for overall survival. The impact of pain intensity on
the overall survival
of patients with pancreatic cancer is thus considered as a major discovery.
Because these
variables, and in particular pain intensity, clearly showed an impact on
overall survival in
patients treated with the placebo plus gemcitabine combination treatment, it
was expected
that any differences in baseline characteristics between both combination
treatment arms
would also impact overall survival. A univariate model is not suitable, even
when stratified on
two variables (here, country and metastases! locally advanced), and was
therefore replaced
by a multivariate Cox model in order to identify the effect of the combination
treatment on
overall survival. Results obtained from the multivariate Cox analysis on
overall survival are
presented below in the overall population, and in the three VAS pain intensity
subpopulations
(pain'; no pain, no morphine'; and 'below median pain').
Multivariate overall survival analyses for determination of the pain intensity
predictor factor
The impact of each variable on overall survival and treatment efficacy was
investigated via
construction of a multivariate model, in which variables were selected through
a stepwise
procedure using 5% thresholds for both entry and maintenance of the variables.
The final
multivariate model included the following factors:
- Treatment arm whatever its level of significance
- Factors selected with the "stepwise" multivariate model: locally
advanced/metastatic
cancer, localization of primary tumor in the body of the pancreas, albumin
level (normal/
abnormal), and VAS pain assessment assigned to three VAS pain intensity
subpopulations (as defined above).
- Interactions were validated graphically via Kaplan-Meier estimates (by
treatment arm and
by factor modality).
Table 2 summarizes the statistically significant variables identified by the
multivariate
analysis Cox model for the overall population.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
Table 2: Analysis and development of a multivariate Cox model including
treatment arm in
the overall population
Final
Multivariate
Multivariate
Univariate stepwise
Overall Survival Cox model
Cox model 5% selection
with treatment
Cox model
arm
Hazard ratio X2 X2 P-value Hazard ratio X2
[95% CI] p-value [95% Cl] p-value
Treatment arm 1.01 0.922 Not selected 0.89 [0.70;
0.344
(masitinib/Placebo) [0.81;1.26] 1.13]
Sex (Female/Male) 0.79 [0.63;
0.040 Not selected
0.99]
Age (>65years 1.01 [0.81;
0.928 Not selected
Yes/No) 1.27]
Metastatic/Locally 1.55 [1.11;
0.010 0.018 1.55 [1.09;
0.016
Advanced 2.17] 2.22]
ECOG (1/0) 1.60 [1.27;
<0.001 Not selected
2.02]
Country (France 0.74 0.011 Not selected
Yes/No) [0.59;0.94]
Pain VAS (mm) - 1.01 [1.00;
0.001 Not selected
continuous 1.01]
1.69 2.00 [1.50;
Pain VAS - by class [1.29;2.23]
<0.001 <0.001 2.66]
<0.001*
([0;5];]5;20]; >20) (>20 versus (>20 versus
[0;5]) [0;5])
Clinically significant 1.19 [0.91;
0.196 Not selected
CA 19-9 (Yes/No) 1.55]
Liver Metastases 1.35 [1.06;
0.013 Not selected
(Yes/No) 1.72]
Metastases Lymph 1.39 [1.05; 0.022 Not selected
Nodes (Yes/No) 1.83]
Weight (>65kg 1.03 [0.83;
0.790 Not selected
Yes/No) 1.29]
Localization Head 0.99 [0.79;
0.903 Not selected
(Yes/No) 1.23]
Localization Body 0.84 [0.66; 0.148 0.026 0.74 [0.57;
0.021
(es/No) 1.06] 0.96]
Localization Tail 1.10 [0.87; 0.424 Not selected
(yes/No) 1.41]
BMI (kg/m2) - 1.00 [0.98;
0.959 Not selected
continuous 1.02]
Gamma GT 0.69 [0.53;
0.007 Not selected
(Normal/Abnormal) 0.91]
Albumin 0.29 [0.20;
<0.001 <0.001 0.29 [0.20 ;
<0.001*
(Normal/Abnormal) 0.42] 0.44]
* Significant interaction with treatment: p=0.008
Results obtained from this multivariate model showed no effect on survival of
the
combination treatment in the overall population, but revealed a significant
impact from four
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
61
variables: pain intensity (p <0.001), the albumin level (p <0.001), the tumor
classification as
metastatic or locally advanced (p = 0.016), and the localization of the
primary tumor in the
body of the pancreas (p = 0.021). These variables were therefore retained in
the multivariate
model for OS. Surprisingly, these data led to a discovery that pain intensity
according to the
defined VAS subpopulations at baseline is a critical variable with a
significant impact on OS
of patients with pancreatic cancer. A multivariate analysis was therefore
performed in
subpopulations according to the baseline VAS pain intensity subpopulations,
following the
same procedure as previously done on the overall population. Table 3
summarizes results of
the multivariate analysis on OS in the overall population, and in each of the
three VAS pain
intensity subpopulations.
Results from the multivariate analysis confirmed that patients treated with
masitinib plus
gemcitabine had no statistically significant survival advantage over the
placebo plus
gemcitabine treatment arm for the overall population. Based upon our findings
that the
baseline pain intensity correlated strongly with OS, this parameter was
further investigated to
determine whether there existed any interaction between this variable, the
combination
treatment type, and overall survival; i.e. OS as a function of VAS pain
intensity score was
analyzed for both treatment arms (masitinib versus placebo). Similar curves
would
correspond to no interaction between the two variables, whereas separated
curves would
indicate an interaction. A significant and strong interaction between the VAS
scale evaluating
pain intensity and the combination treatment used was revealed, as evidenced
by a p-value
of 0.010 for the `pain' subpopulation and 0.041 for the `no pain, no morphine'
subpopulation
(Table 3). The graphical validation of interactions showed that median OS in
patients
VAS>20 was lower in the placebo plus gemcitabine treatment arm as compared
with the
masitinib plus gemcitabine treatment arm; hazard ratio of 0.61 (95%Cl [0.42;
0.88]) (Figure
4). On the contrary, median OS in patients with a VAS [0;5] (i.e. the `no
pain, no morphine'
subpopulation) was higher in the placebo plus gemcitabine treatment arm
compared with the
masitinib plus gemcitabine treatment arm; hazard ratio of 1.63 (95%Cl [0.94 ;
2.85]) (Figure
5). This highlights the key importance of the variable pain intensity for
analysis of OS in
patients with cancer.
In the overall population, multivariate analysis on overall survival showed no
significant
impact of the combination treatment on OS with a p-value of 0.740 and a hazard
ratio for
death with its 95% confidence interval of 0.90 (95%C1[0.71; 1.14]). Median OS
was 7.7
months (95%Cl [6.1; 10.6]) in patients treated with the masitinib plus
gemcitabine
combination treatment and 7.0 months (95%Cl [5.8; 9.6]) receiving placebo plus
gemcitabine, respectively. OS rates at 6, 12, 18, and 24 months were
respectively, 59.2%,
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
62
32.1%, 17.3%, and 9.5% for masitinib plus gemcitabine, versus 56.0%, 28.5%,
14.5%, and
7.5% for placebo plus gemcitabine.
Table 3: Results on overall survival after multivariate analysis in the
overall population and in
each VAS pain intensity subpopulation
-
P Hazard Median OS rates (months) [95%Cl]
Treatment N ratio OS
value* [95 /0C1] (months) M6 M12 M18 M24
59.2 32.1 17.3 9.5
M+G 173 7.7 [6.1'= 0.90 10.6] [51.2;69.3 [24.1;43.4
[11.2;27.3 [5.2;17.7]
,
Overall I l l
0.740 [0.71;1.14
population 56.0 28.5 14.5 7.5
9.6
P+G 175 ] 7.0 [5.8; [47.9;66.4 [21.0;39.5 [9.1;23.7] [3.9;14.8]
]
] l
58.2 32.2 18.2
M+G 64 8.1 0.61 [5.9; [48.5;71.7 [22.2;47.9 [10.4'.32.9
11.5] , , 17.3]
'Pain' 0.010 [0.42; 1 l 1
43.9 17.8 7.8
PQ 73 0.88] 5.4 [4.5; [33.7;58.7 [10.5;31.3 [3.6;18.0] 2.0* [0.5;
8.0] 8.2]
] l
71.1 46.9 24.5 12.5
1
'Ni, .n M+G 34 11.4 [7.2,= [56.5;89.8 [30.2;74.4 [11.4;56.6
[4.0;43.9]
o pa 22.2] ] I
no 0.041 1'63 [0.94
; 2.85] 15.4 81.1 62.7 41.8 27.2
morphine p+G 34 [11.4; NA [69.8;94.3 [46.9;84.4 [25.4;71.1
[13.2;60.0
I ] l l 1
57.3 22.8 8.5 6.3
6.7
'Below
M+G 57 [45.5;74.4 [12.9;41.4 [3.2;23.4] [2.0;20.1]
median 0.976 095 [0.63 [5.6;10.3] ] l
; 1.41] 55.6 21.0 7.4 5.4
pain'
P+G 50 6.4
610 [44.0;73.3 [11.7;39.7 [2.6;22.5]
[1.6;19.4]
.0]
[5. ,
I l
M+G: masitinib plus gemcitabine; P+G: placebo plus gemcitabine. * Log-rank p-
value.
In the 'pain' subpopulation, (patients with disease related pain defined as
VAS>20), the
masitinib plus gemcitabine combination significantly increased overall
survival of patients
with pancreatic cancer and with a pain intensity VAS score >20 compared with
placebo plus
gemcitabine, as evidenced by a p-value of 0.01. The hazard ratio for death
(defined as the
probability of death under masitinib plus gemcitabine over the probability of
death under
placebo plus gemcitabine) was 0.61 (95%Cl [0.42; 0.88]), meaning that the risk
for death in
patients treated with masitinib plus gemcitabine was significantly decreased
by 39%
compared with patients treated with placebo plus gemcitabine. Considering a
worst case
scenario of the higher confidence interval boundary, i.e. 0.88, the risk of
death for patients in
the 'pain' subpopulation was still reduced by 12% when treated with masitinib
plus
gemcitabine. Median OS in the masitinib plus gemcitabine treatment arm was 8.1
months
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
63
whereas it was only 5.4 months in the placebo plus gemcitabine treatment arm.
Survival
rates at 6, 12, 18, and 24 months were respectively, 58.2%, 32.2%, 17.2%, and
56.4 /0 in the
masitinib plus gemcitabine treatment arm, versus 43.9%, 17.8%, 7.8%, and 2.0%
in the
placebo plus gemcitabine treatment arm. The Kaplan-Meier estimates for the
multivariate
model of this subpopulation are shown in Figure 4. The therapeutic advantage
of the
masitinib plus gemcitabine treatment over placebo plus gemcitabine is clearly
seen in the
multivariate model, in which the masitinib plus gemcitabine survival
probability is consistently
higher.
In the 'no pain, no morphine' subpopulation (patients with disease related
pain defined as
VAS [0-5] and with no need for opioid analgesics for treatment of disease
related pain) the
placebo plus gemcitabine treatment arm was shown to significantly increased
overall survival
of patients with pancreatic cancer as compared with the masitinib plus
gemcitabine arm, as
evidenced by a p-value of 0.041 and a hazard ratio for death of 1.63 (95%Cl
[0.94; 2.85]).
This multivariate analysis supported the conclusion that, in the absence of
any other
independent predictor factors, administration of masitinib plus gemcitabine
for treatment of
patients afflicted by pancreatic cancer that is not associated with pain or
the requirement of
opioid analgesics for the treatment of disease related pain is inadvisable.
The Kaplan-Meier estimates for the multivariate model of this subpopulation
are shown in
Figure 5.
In the subpopulation 'below median pain' (i.e. patients with disease related
pain defined as
5< VAS <20) the treatment was not identified through the multivariate Cox
model as having
a significant impact on overall survival with a p-value of 0.976 and a hazard
ratio for death of
0.95 (95%Cl [0.63; 1.41]). This subpopulation was therefore considered as
neutral. The
Kaplan-Meier estimates for the multivariate model of this subpopulation are
shown in Figure
6. From this Kaplan-Meier plot it is evident that the two curves representing
survival
probability are almost identical, and therefore, the 'below median pain'
subpopulation is
neutral towards masitinib plus gemcitabine treatment. This is important when
taking into
consideration that treatment of the 'no pain, no morphine' subpopulation with
masitinib plus
gemcitabine is inadvisable, the 'below median pain' subpopulation therefore
effectively
representing a large buffer between the thresholds for treatment and non-
treatment, which
greatly mitigates any risk of a patient receiving treatment that would be of
detriment to their
survival.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
64
Additionally, it is noted that patients with disease related pain defined as
VAS >20 might
ultimately require opioid analgesics to manage their pain and subsequently
their pain might
be reduced to a VAS score 5 mm. However, this subpopulation of patients,
defined as "no
pain but a requirement for opioid analgesics", was also shown to be a neutral
subpopulation
(data not shown).
Safety analysis for study AB07012
In the subpopulation of patients with `pain' (VAS >20), the frequency of
adverse events (AE)
was similar in both treatment arms (100%). The frequencies of serious AEs and
severe AEs
were higher in the masitinib treatment arm (68.8% and 85.9% of patients,
respectively) than
in the placebo treatment arm (56.2% and 71.2%, respectively). AEs leading to
gemcitabine
discontinuation or interruption were more frequent in the masitinib plus
gemcitabine
treatment arm than in the placebo plus gemcitabine arm. These trends were
repeated in the
overall population; i.e. frequency of AEs was similar in both treatment arms
and the
frequency of serious and severe AEs, as well as discontinuation or
interruption of
gemcitabine treatment, were higher in the masitinib plus gemcitabine treatment
arm than in
the placebo plus gemcitabine arm.
The exposure to gemcitabine in the masitinib plus gemcitabine treatment arm as
compared
with the placebo plus gemcitabine treatment arm was decreased by
approximately: 35% in
the overall population; 30% in the 'pain' subpopulation; 30% in the 'below
median pain'
subpopulation; and 45% in the 'no pain, no morphine' subpopulation. Overall,
patients from
the masitinib plus gemcitabine treatment arm received masitinib for a mean of
3.0 months
while patients from the placebo plus gemcitabine arm received placebo for a
mean of 4.3
months. Therefore, exposure to the study drug was significantly lower in the
masitinib plus
gemcitabine arm (p=0.001). This lower exposure to the study drug was
highlighted by the
intensity of the drug dose received by patients during the study: 34.7% of
patients from the
masitinib plus gemcitabine arm receiving less than 80% of the initially
planned dose versus
17.1% of patients from the placebo plus gemcitabine arm.
Taken together these observations on adverse events and drug exposure indicate
that the
administered masitinib dose of 9 mg/kg/day is not optimal for patient
compliance, in part due
to additional toxicity associated with the combination. Considering also new
insights
regarding masitinib's inferred mechanisms of action, a masitinib dose of 6
mg/kg/day is
considered to be the optimal starting dose, with dose escalation permitted in
patients with
inadequate response and in the absence of limiting toxicities.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
Study AB07012 efficacy conclusions according to the predictor factor of pain
intensity
One objective of study AB07012 was to compare the efficacy of masitinib plus
gemcitabine,
with that of placebo plus gemcitabine in treatment of patients with
unresectable locally
advanced and/or metastatic pancreatic cancer. In the overall population,
masitinib plus
gemcitabine treatment did not show statistically significant improvements in
the median
overall survival of patients. However, multivariate analysis on different
baseline
characteristics identified pain intensity as the single most important factor
with predictive
power for overall survival. Three subpopulations have emerged according to the
following
criteria:
'Pain': VAS >20
'No pain, no morphine': VAS <5
'Below median pain': VAS = 15-20]
Stratification according to these subpopulations showed that for patients
receiving placebo
plus gemcitabine (i.e. gemcitabine as a single agent) the median OS was 15.4
months in the
'no pain, no morphine' subpopulation compared with 5.4 months in the 'pain'
subpopulation,
corresponding to a difference of 10.0 months in median OS between these two
subpopulations. In contrast, masitinib plus gemcitabine treatment was shown to
significantly
prolong median overall survival in the 'pain' subpopulation with a median OS
of 8.1 months,
and a hazard ratio of 0.61 (95%Cl [0.42;0.88]), meaning that the risk of death
is decreased
by 39% in the masitinib plus gemcitabine treatment arm compared with the
placebo plus
gemcitabine treatment arm (p-value = 0.01). The hazard ratio was inverted in
the 'no pain,
no morphine' subpopulation, being 1.63 (95 /0C1 [0.94; 2.85]) with a p-value
of 0.041.
Therefore, according to the predictor factor of pain intensity, and in the
absence of any other
independent predictor factor, said treatment of patients in the 'no pain, no
morphine'
subpopulation is inadvisable.
To summarize, our analysis has led to the discovery of pain intensity being
strongly
predictive for overall survival in pancreatic cancer patients. The combination
of masitinib plus
gemcitabine treatment has proven efficacious in the subpopulation defined by
at least one
reported occurrence of a Visual Analogue Scale (VAS) pain intensity score of
greater than
20 (e.g. VAS >20 mm as measured on a 100 mm scale, or 20%). This subpopulation
has the
poorest prognosis in overall survival and hence a very high unmet medical
need. In the 'pain'
subpopulation, accounting for approximately 43.9% of patients, median OS was
5.4 months
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
66
with placebo plus gemcitabine, whereas it was 15.4 months in the `no pain, no
morphine'
subpopulation and 6.4 months in the 'below median pain' population. Masitinib
plus
gemcitabine treatment significantly improved overall survival in the 'pain'
population: median
OS was 8.1 months as compared with 5.4 months in the placebo plus gemcitabine
treatment
arm (p-value = 0.010). The hazard ratio was 0.61 (95% Cl of [0.42; 0.88]),
showing that the
risk of death was decreased by 39% with masitinib plus gemcitabine as compared
with the
control treatment arm. Overall survival rates at 12, 18, and 24 months were
respectively,
32%, 18% and 6.4% as compared with 18%, 8% and 2.0% in the placebo plus
gemcitabine treatment arm.
EXAMPLE 2: Genomic analyses of study AB07012 to investigate predictive
criteria of
efficacy
An ancillary pharmacogenomic study was performed to define predictive criteria
of efficacy
from genomic data. That is to say, identification of genes that were down-
regulated or up-
regulated in a randomized subset of pancreatic cancer patients taken from
study AB07012,
and that could be correlated to overall survival and clinical benefit of the
investigational
treatment. The main findings from this ancillary study regarding treatment of
a patient
subpopulation defined via gene expression predictor factors are presented
above in the
section: 'Description of the Invention'. Here, additional or supplemental
details on the
techniques used are provided.
Skuldtech protocol for gene expression analysis
Genomic analyses consisting of global transcriptome analysis of peripheral
blood cell
samples collected prior to treatment with masitinib using high throughput
method and Next
Generation Sequencing (performed independently in triplicate) was performed by
Skuldtech
(Montpellier, France). The identification of genes whose expression correlated
with overall
survival and treatment type relied on a multistep process. Presented below are
extracts
taken from the Skuldtech protocol (steps 1 to 7), followed by general
discussion on certain
methodological aspects for differential gene expression.
1. Sample collection and handling:
- Total blood samples from patients in PAXgene tubes in ice dry (shipper:
LabConnect,
USA) were received and stored at -80 C.
- Collected tubes belong to 119 patients before treatment, and are named
Week 0.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
67
- Total RNA was extracted from the blood samples of 119 patients before
treatment,
and named week 0. The transcriptome analysis (biomarker investigation) was
conducted only on this time point.
- All of the 119 RNA samples were analyzed. If some samples received were
not
eligible for analysis due to insufficient quality material, they were not
used.
- Digital Gene Expression (DGE) experiments were carried out to select a
set of
putative biomarkers.
- Biomarker validation was done using Real-Time PCR on COBAS platform
(LC480,
ROCHE Diagnostics) and appropriate biostatistical approaches have been used to
filter for best biomarkers.
2. RNA Samples:
- 119 blood RNA samples corresponding to baseline blood samples, were
extracted
from blood (PAXgene Blood collection tubes, BD) using PAXgene Blood RNA Kit
V.2
(PreAnalitix) according to manufacturer's recommendations.
- Control of RNA integrity was performed with the 2100 Bioanalyzer (Agilent
Technologies, Palo Alto, USA) using Eukaryotic Total RNA 6000 Nano Chip
(Agilent
Technologies). RNA quantity was controlled using NanoDrop ND-1000
spectrophotometer. Purified RNAs were conserved at -80 C
3. DGE library construction and tag-to-gene mapping:
Twelve Digital Gene Expression (DGE) libraries were constructed from pooled
blood RNA
samples of patients. For each of the four treatment groups (i.e.
Placebo/Gemcitabine P or
Masitinib + Gemcitabine M & dead before month 4, M4, or alive after month 15,
M15), three
DGE libraries were constructed using the same pooled blood RNA samples (three
technical
replicates). The libraries were constructed with IIlumina's DGE Tag Profiling
kit according to
the manufacturer's protocol (version 2.1B), using 5 pg of total RNA (equal
amounts of RNA
in the pool between each RNA sample). Sequencing analysis and base calling
were carried
out using the IIlumina Pipeline, and sequence tags were obtained after purity
filtering. The
platform used is MGX (Montpellier, France). Data from each DGE library were
analyzed with
BIOTAG software (Skuldtech, Montpellier, France) for tag detection, tag
counting and for
assessing DGE library quality (Piquemal D, et al., Genomics. 2002
Sep;80(3):361-71).
4. Tag annotation and selection:
A local database compiling homo sapiens sequences and related information from
well-
annotated sequences of UniGene clusters (Built#232, March 2012, NCB!) was
generated.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
68
For each sequence of this database, the expected DGE tag (canonical tag)
located
upstream the 3'-nearest NIalll restriction site (CATG) of the sequence (R1),
as well as
putative tags located in inner positions (labeled as R2, R3 and R4 starting
from the 3' end of
the transcript), were extracted (Piquemal D, et al., Genomics. 2002
Sep;80(3):361-71).
Experimental tags obtained from DGE libraries were matched and annotated
(exact matches
for the 17bp) using this collection of virtual tags. Firstly, a correspondence
for each
experimental tag with the virtual canonical tags (R1) was looked for. Then,
unmatched
experimental tags with the R2 tags, then with R3, and R4 were annotated. The
analyses of
the DGE experiments were carried out using edgeR Method (version 2.6.9,
Bioconductor).
5. cDNA synthesis for Real-Time PCR:
Reverse transcriptions were carried out for each of the 119 RNA in 20 I final
reaction
volume with 300 ng of total RNA using 200 units of SuperScript ll enzyme (M-
MLV PT Type,
Invitrogen) and 250 ng of random primers according to manufacturer's
instructions (25 C for
min, 42 C for 50 min, 70 C for 15 min), the sameday with the same pipettor set
and the
same manipulator.
6. Real-Time FOR:
The validation of targeted genes was done on Real-Time PCR (qPCR) platform
from Roche
Diagnostics. The qPCR experiments were carried out using LightCycler 1536 DNA
Green
Master Kit and RealTime ready DNA Probes Master Kit (Roche Diagnostics) on
Roche
Diagnostics LightCycler1536 qPCR apparatus according to manufacturer's
instructions.
For Sybr Green assays, the reaction mixture was prepared in a final volume of
2 I as
follows: 0.4 I of LightCycler 1536 DNA Green Master 5X (Roche), 0.1 I of
Bright Green
20X (Roche), 0.1 I of Setup Control 20X (Roche), 0.04 I of 50 M primers
couple
(Eurogentec), 0.361.tL of DNAse RNAse free water and 1 I of cDNA matrix (1/50
final
dilution). For probes assays, the reaction mixture was prepared in a final
volume of 2 1,11 as
follows: 0.4 I of Real Time Ready DNA Probe Master 5X (Roche), 0.1 I of
Control Setup
20X, 0.1 I of 4 M Forward primer (Eurogentec), 0.1 I of 4 M Reverse primer
(Eurogentec), 0.1 I of 4 LIM FAM/TAMRA Probe (Eurogentec), 0.2 I of DNAse
RNAse free
water and 1 I of cDNA matrix (1/50 final dilution). All pipetting steps were
carried out with
Agilent Bravo Automated Liquid Handling Platform. FOR program consists in a
first pre-
incubation step at 95 C for 1 min following by 50 RR cycles (95 C for 2 sec,
60 C for 30
sec). To discriminate specific from non-specific products and primer dimers, a
melting curve
was obtained by gradual increase in temperature from 60 to 95 C. The qPCR data
were
analyzed using the Delta.Ct (DCt) method (Livak KJ and Schmittgen TD. Methods.
2001
Dec;25(4):402-8). The DCt values were determined for all target genes by
subtracting the Ct
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
69
values from the mean of the Ct values of the two reference genes
(housekeeping). The two
housekeeping genes were B2M (NM 009735, Mus musculus beta-2 microglobulin,
mRNA)
and GAPDH (NM 002046, glyceraldehyde-3-phosphate dehydrogenase, transcript
variant 1,
m RNA + NM 001256799 Homo sapiens glyceraldehyde-3-phosphate dehydrogenase,
transcript variant 2, m RNA).
7. Transcriptomic profiles:
Using the Digital Gene Expression (DGE) method, the transcriptomic profiles of
total blood of
patients was carried out and 169 genes have been selected with edgeR Method as
genes
differentially expressed between good- and bad- masitinib responders. The
analyzed genes
have been selected according to (i) mathematic filters with the highest
differential Fold
Change (>1.5), FDR adjusted p-value criterion (<10%) based on the type I
(a=5%) error and
(ii) biological filters with involvement of targeted genes in specific
processes and known
metabolic pathways. In a real time PCR assay, a positive reaction is detected
by
accumulation of a fluorescent signal. The Ct (cycle threshold) is defined as
the number of
cycles required for the fluorescent signal to cross the threshold (i.e.
exceeds background
level). Ct values are inversely proportional to the amount of target nucleic
acid in the sample
(i.e. the lower the Ct value, the greater the amount of target nucleic acid in
the sample).
Methodology for identification of gene expression predictor factors of overall
survival
The objectives of this ancillary study were to reveal: (i) biomarkers
predictive of extended
survival (i.e. increased OS) for masitinib plus gemcitabine treated patients
as compared with
placebo plus gemcitabine treated patients; (ii) biomarkers predictive of early
death (i.e.
decreased OS) for masitinib plus gemcitabine treated patients as compared with
placebo
plus gemcitabine treated patients. This analysis simultaneously measured the
expression
level of large numbers of genes in peripheral blood cell samples collected
prior to treatment
with masitinib from 119 patients of study AB07012 (1:1 ratio of masitinib plus
gemcitabine
and placebo plus gemcitabine treated patients).The PAXgeneTM Blood RNA System
was
used to collect a patient's blood sample and isolate RNA (ribonucleic acid),
packed in dry-ice
for shipping and stored at -80 C. The PAXgene tubes are FDA approved (i.d.
K042613).
Analyzed samples were taken once only at week 0 (baseline).
In general, differential gene expression presents several challenges in terms
of
reproducibility and detection of truly novel gene expression patterns. For
example, analysis
from Blood RNA samples is subject to various errors due to experimental and
interindividual
variability. Also, pre-selection of genes of interest could be hampered by the
need of pre-
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
existing knowledge of the transcriptome. The following measures were adopted
by Skuldtech
to address these problems and to ensure optimal reproducibility:
- The usage of PAXgeneTM Blood RNA collection system avoids degradation of
the
RNA and differences in sample quality due to different collection standards
among sites.
- Inherent gene-specific and interindividual expression variability were
taken into
account through edgeR Bioconductor analysis and pooling of RNA samples.
- The DGE methodology does not rely on a pre-existing knowledge of the
transcriptome of interest and can therefore be applied to any patient group of
interest.
- For the qPCR experiment, the current state of the art platform was used,
which
complies with industry and research standards.
The first analytical step involved a complete DGE analysis, performed using
the
methodology of edgeR
[http://www.bioconductor.org/packages/2.9/bioc/html/edgeR.html]. In
a second analytical step, a 2-cicici (2exp ¨ Delta Delta Cycle Threshold)
analysis was
performed using R package ddCt on the Real-Time PCR experiment,
[www.bioconductor.org/packages/2.9/bioc/htmliddahtml]. This analysis was used
to set the
differential cut-off to assess if a selected gene will fulfill the classic
clinical and technical
properties. In this study, each gene of interest was amplified by qPCR and a
resulting
parameter named the Delta Cycle Threshold (DCt) was assessed after individual
normalization for each gene and for each patient, thereby providing the
expression level of a
given gene in a given patient. Normalizing of Ct values was achieved using two
reference
(housekeeping) genes (B2M, GAPDH), which showed stable expression in the DGE
analysis
throughout the blood RNA samples. DCt are defined for each gene under
investigation by
subtracting the Cycle Threshold (Ct) values from the geometric mean of the Ct
values of the
reference genes. DCt values are inversely proportional to the level of gene
expression;
therefore, in the case of up-regulated genes a lower DCt value indicates a
greater level of
expression, whilst in the case of down-regulated genes a higher DCt value
indicates a lower
level of expression.
The DGE (Digital Gene Expression) method used in this study is a high
throughput
sequencing approach for transcriptomic analysis. This approach provides a
digital measure
of RNA abundance represented by the sequence read counts in a region of
interest as
opposed to an indirect, analog signal from microarrays. In addition, it has a
broader dynamic
range, and is not dependent on having pre-existing knowledge about the
transcriptome
under study. This approach therefore has the ability to comprehensively detect
novel
transcripts and mRNA variants resulting from alternative promoter usages,
splice sites, and
polyadenylation.
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
71
DGE libraries were generated with mRNA isolated using poly-A selection from
total RNA.
The subsequent construction of libraries was performed with IIlumina's DGE Tag
Profiling kit
(San Diego, USA.) according to the manufacturer's protocol (version 2.1B).
Briefly, the RNAs
were randomly primed for reverse transcription followed by second-strand
synthesis to
create double-stranded cDNA fragments. Specific 21 bp-tags for each of the
RNAs were then
extracted. The tags were isolated, specific adaptors were ligated and then
followed by PCR
amplification. Libraries were sequenced by IIlumina's DNA sequencing platform
(San Diego,
USA). Because DGE provides absolute values and does not require any
calibration with
arbitrary standards, results can be compared with other data generated by
independent
laboratories.
For discard biases due to human manipulations and heaviness of cell
purification, Skuldtech
opted for a direct read from whole blood. Hence, selection and identification
of biomarkers
with the DGE approach during the first steps of this project were performed on
whole blood.
Finally, a pooling strategy was implemented, a method frequently used in
epidemiology
when individual studies are too small to allow any definite conclusion. The
main advantage of
sample pooling is its ability to identify the most common/specific gene
expression profile and
discard individual variations.
RNAs were reverse transcribed according to the Roche Diagnostics' protocol.
Gene
expression levels of putative biomarkers were investigated by Real-Time PCR,
using the
LightCycler 480. Expression of reference genes was quantified in each Real-
Time PCR plate
in order to assess the technical efficiency of the Real-Time FOR experiments.
Variations in
Ct values associated to each Real-Time FOR experiment were evaluated among the
reference genes. The DCt values were determined for all target genes by
subtracting the Ct
values from the geometric mean of the Ct values of the reference genes. Thus,
a data matrix
was constructed based upon the DCt values obtained from all Real-Time PCR
dynamic
arrays, which was subsequently used for all hypothesis tests.
Selection of genes of interest and identification of gene expression predictor
factors
DGE analysis resulted in the selection of 169 genes, taken from a genomic
database of 119
modified intent-to-treat patients. The selection of these genes was based on
the impact of
genes on overall survival, e.g. genes associated with a correlation of overall
survival with
masitinib plus gemcitabine treatment. Each of the selected genes was amplified
by
quantitative Polymerase Chain Reaction (qPCR) and the expression level of a
given gene in
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
72
a given patient was evaluated after individual normalization. Analysis was
based upon
variations in Ct values associated to each qPCR experiment with respect to a
set of
reference genes (B2M, GAPDH). Delta Ct values (DCt) were defined for each gene
under
investigation by subtracting the Ct values from the geometric mean of the Ct
values of these
reference genes. For each gene three cut-offs were specified: median, Q1
(first quartile,
P25) and 03 (third quartile, P75). For each cut-off (less than cut-off/more
than cut-off) the
multivariate model used for primary criteria calculated Hazard-Ratio, Chi-
squared statistic
and p-value of the Cox model (one per gene) in order to explain OS, used the
factors of:
treatment arm, tumor status, tumor localization, and albumin level at
baseline.
Hence, for each gene seven different Cox models were run:
- No cut-off raw DCt values in the model
- DCt values <median
- DCt values >median
- DCt values <01
- DCt values >01
- DCt values <03
- DCt values >Q3
If the effect of treatment arm was significant (p <5%) then it can be
concluded that the gene
under investigation has a different effect on survival depending on the
treatment arm. The
gene under investigation was selected for the next step if p <5%. A total of
37 genes/cut-off
combinations were selected consisting of 17 different genes.
For each of the 17 genes selected from the above steps, the same multivariate
model was
used for each combination and each cut-off. Hence, for each gene seven
different Cox
models were run. The rule applied was that the subpopulation created by the
combination
should contain more than 40 patients (1/3 of the total sample):
These different combinations were classified according to the discriminatory
power of the
combination measured by p-value of the Chi-squared test provided in the Cox
model. The six
most significant (p-values<0.01) combinations are listed in Table 4.
Table 4. Selected dual-gene combinations of interest and cut-offs
Population
(1) ACOX1<=3.05 and TNFRSF10B<=6.1
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
73
(2) RPS23>0.35 and ACOX1<=3.05
(3) ABCC3<=4.3 and LYN<=1.65
(4) H IF1A<=3.95 and TNFRSF10B<=5.65
(5) ABCC1>3.5 and IGJ>7.05
(6) UBE2H >3.7 and PARP2>7.1
In order to finalize the most inclusive overall genetic fingerprint, the most
significant dual-
gene combination was chosen first and then the following information was
recorded: number
of patients in the subpopulation, Hazard Ratio; p-value of the Cox model.
Next, another dual-
gene combination was added in order to increase the sample size and also the
power of
analyses. The same information as above was recorded. The process of selection
was
stopped when no (or few) additional patients were added to the sample size
following
addition of a new combination, with the precondition that Hazard Ratio and/or
p-value were
maintained. Table 5 summarizes the selection process.
Table 5. Dual-gene combinations with statistically significant impact on OS
with respect to
treatment arm. Shown in bold are the most discriminatory dual-gene
combinations
corresponding to six gene expression predictor factors and collectively
referred to as the
'genetic fingerprint' subpopulation.
Population N HR p-value
(1) ACOX1<=3.05 and TNFRSF10B<=6.1 31 0.19 <0.01
(2) RPS23>0.35 and ACOX1<=3.05 35 0.20 <0.001
(3) ABCC3<=4.3 and LYN<=1.65 37 0.19 <0.001
(4) H IF1A<=3.95 and TNFRSF10B<=5.65 40 0.19 <0.001
(5) ABCC1>3.5 and la.J>7.05 52 0.19 <0.0001
(6) UBE2H >3.7 and PARP2>7.1 56 0.192 <0.00001
The process was stopped after six combinations. Among patients identified as
harboring the
GBM, some were flagged in both replicates (45 patients), some were flagged in
duplicate 1
but not flagged in duplicate 2 (11 patients), some were flagged in duplicate 2
but not flagged
in duplicate 1 (10 patients).Thus the final subpopulation comprises a total of
66 patients (=
45+11+10). The final selection of dual-gene combinations constituting a set of
"gene
expression predictor factors" (collectively referred to as the "genetic
fingerprint"). These
gene expression predictor factors are: ACOX1<=3.05 and TNFRSF10B<=6.1;
RP523>0.35
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
74
and ACOX1<=3.05; ABCC3<=4.3 and LYN<=1.65; HIFI A<=3.95 and TNFRSF10B<=5.65;
ABCC1>3.5 and IGJ>7.05; UBE2H >3.7 and PARP2>7.1
The DCt thresholds as defined above represent the most inclusive overall
genetic fingerprint
for distinguishing a target subpopulation. It is possible however, that
optimal thresholds are
found in proximity to these cut-offs, for example at 55% rather than the
median.
Furthermore, the thresholds as defined above are taken from a particular
patient cohort (n =
119) that can be considered as representative of a general cancer population,
however, it
should be expected that given a different cohort the optimal cut-offs will
vary slightly as this
is also just a representative sample of the overall population. Thus, for
definition of cut-offs
related to these gene expression predictor factors it shall be understood that
slight
modifications are encompassed herein; for example, 10% of the stated cut-
offs, or even
25% of the stated cut-offs.
Taken together, these six gene expression predictor factors define a patient
subpopulation
that has a higher probability of positive therapeutic response to masitinib
treatment in terms
of extended survival. This subpopulation can be generally interpreted as the
'genetic
fingerprint' subpopulation for masitinib treatment in cancer. Hence, all
analyses (baseline,
efficacy and safety) were performed on the 'genetic fingerprint' subpopulation
(i.e. those
patients identified as having at least one of the positive gene expression
predictor factors).
Additionally, efficacy analysis was also performed on the subpopulation that
was negative for
gene expression predictor factors (i.e. the 'non genetic fingerprint'
subpopulation).
Assessing clinical efficacy of study AB07012 according to gene expression
predictor factors
Considering the full cohort of patients with genomic information available (n
= 119; 60
masitinib and 59 placebo patients), the median OS was 7.7 months in both
treatment arms
and the hazard ratio for death was 0.89 [0.60; 1.31] with a p-value of 0.55.
Therefore, no
conclusions could be drawn regarding the beneficial or detrimental effects of
masitinib
treatment in this subpopulation without additional analyses according to gene
expression.
OS was analyzed in the subpopulation identified as harboring at least one of
the gene
expression predictor factors, referred to hereafter as the "genetic
fingerprint" or
"transcriptional fingerprint" subpopulation (66 patients), and in its
counterpart, i.e. patients
that do not present any of the gene expression predictor factors, referred to
hereafter as the
"non genetic fingerprint" or "non transcriptional fingerprint" subpopulation
(53 patients).
CA 02886979 2015-04-02
WO 2014/053650
PCT/EP2013/070741
Table 6 shows the median OS and survival rate estimates as calculated via
univariate and
multivariate analyses for the 'genetic fingerprint' subpopulation according to
treatment arm.
Table 6 - OS results in 'genetic fingerprint' subpopulation
Hazard ratio Median OS OS rates [95% CI] (%)
Treatment arm N p-value*
[95%Cl] [95% Cl] (months) M6 M12 M18
M24
Univari ate analysis
11.7 78.8 48.6 15.8 10.6
M+G 34
0.22 [8.6;17.1] [ 66.7;93.2 ] [ 32.8;74.8 ] [ 7.1;45.4]
[4.1; 39.01
0 0000019
[0.12; 0.40] 5.3 36.7 7.5 0.7 0.3
P+G 32
[3.9; 8.6] [21.7; 67.4] [2.6; 35.8] [0.1;
19.1] [0.0; 16.3]
Multivariate analysis
12.9 78.7 52.5 18.3 12.6
M+G 34
0.0000005 0.17 [8.7;17.1] [67.5; 93.5]
[38.0;76.8] [9.1;44.8] [5.7;36.9]
6 [0.09; 0.33] 4.7 31.8 7.4 0.8 0.3
P+G 32
[3.7; 8.3] [19.0; 61.8] [3.1; 30.7] [0.1;
20.6] [0.0; 17.8]
M+G: masitinib plus gemcitabine; P+G: placebo plus gemcitabine; NR: not
reached;
*log-rank
In the univariate model, patients in the masitinib plus gemcitabine treatment
arm had a
median OS of 11.7 months versus 5.3 months in patients receiving placebo plus
gemcitabine.
This difference was even more pronounced in the multivariate model, with a
median OS of
12.9 versus 4.7 months, respectively. After adjustment for differences in
baseline
characteristics, the difference in median OS proved to be statistically
significant (p-value
<0.00001) with a hazard ratio for death (defined as the probability of death
under masitinib
plus gemcitabine over the probability of death under placebo plus gemcitabine)
of 0.22with a
95% confidence interval of [0.12;0.40]. Thus, patients in the 'genetic
fingerprint'
subpopulation have a 78% decrease in risk of death when treated with the
combination of
masitinib plus gemcitabine as compared with gemcitabine alone. Considering a
worst case
scenario of the higher confidence interval boundary, i.e. 0.40, the risk of
death for patients in
the 'genetic fingerprint' subpopulation was still reduced by 60% when treated
with masitinib
plus gemcitabine. The Kaplan-Meier estimates for patients presenting with the
'genetic
fingerprint' identified are shown in Figure 7. The therapeutic advantage of
the masitinib plus
gemcitabine treatment over placebo plus gemcitabine is clearly seen in the
multivariate
model, in which the masitinib plus gemcitabine survival probability is
consistently higher.
CA 02886979 2015-04-02
WO 2014/053650
PCT/EP2013/070741
76
Table 7 shows the estimated median OS and survival rate for the 'non genetic
fingerprint'
subpopulation. Kaplan-Meier estimates for patients presenting without the
'genetic
fingerprint' identified are shown in Figure 8.
Table 7 - OS results in 'non genetic fingerprint' subpopulation
Hazard ratio Median OS OS rates [95% CI] (%)
Treatment arm N p-value*
[95 % CI] [95% CI] (months) M6 MI2 M18
M24
Univariate analysis
4.8 40.0 10.8 3.3
M+0 26
5.00 [4.2; 14.4] [25.0; 76.3] [3.6;53.0] [0.6;42.1]
[0.0; 35.9]
----------- 0.0000082
[2.44; 10.25] 14.4 81.0 53.0 34.7
P+G 27
[8.8; 23.3] [68.0;97.0] [38.1;86.8]
[20.0;73.3] [3.3; 46.21
Multivariate analysis
5.6 45.2 12.5 3.6
M+G 26
4.24 [4.3; 11.5] [29.3; 76.21 [4.4; 46.3] 10.7; 30.51
[0.0; 20.4]
----------- 0.000036
[2.11; 8.52] 13.2 79.6 53.8 33.0
P+G 27
[8.4; 23.0] [68.3; 96.6] 137.4;
85.0] [18.5; 70.2] [2.3; 38.1]
M+G: masitinib plus gemcitabine; P+G: placebo plus gemcitabine; NR: not
reached;
*log-rank
In the univariate model, patients in the masitinib plus gemcitabine treatment
arm had a
median OS of 4.8 months as compared with 14.4 months in patients receiving
placebo plus
gemcitabine. In the multivariate model, the median OS was 5.6 and 13.2 months,
respectively. The difference in median OS was statistically significant (p-
value = 0.00001)
with a hazard ratio for death (defined as the probability of death under
masitinib plus
gemcitabine over the probability of death under placebo plus gemcitabine) of
4.24 with a
95% confidence interval of [2.11;8.52] in the multivariate model. Thus, the
risk of death for
patients not belonging to the 'genetic fingerprint' subpopulation, i.e. not
harboring at least
one gene expression predictor factor, is higher when treated with the
combination of
masitinib plus gemcitabine as compared with gemcitabine alone. Therefore, in
the absence
of any other positive predictor factor, said treatment of patients in the 'non
genetic
fingerprint' subpopulation is inadvisable.
Finally, it was noted that no correlation existed within the patient cohort
with genomic data
with their baseline VAS pain intensity status, i.e. with respect to the pain
intensity predictor
factor. This was true for the full genomic cohort (overall population), as
well as for the
'genetic fingerprint' and 'non genetic fingerprint' subpopulations. In
connection with the
present invention, it would seem, without wishing to be bound by the theory,
that this is due
either to the parameter of pain intensity requiring a larger population sample
size to be
CA 02886979 2015-04-02
WO 2014/053650 PCT/EP2013/070741
77
statistically distinguishable or because the predictor factors of pain
intensity and gene
expression act through independent mechanisms of disease progression. In this
latter case,
it is quite feasible for a given patient to be positive for one predictor
factor but negative for
another and for the treatment of masitinib to still be of therapeutic benefit;
there is no
apparent contradiction.
Thus, in the 'genetic fingerprint' subpopulation, accounting for approximately
55.5% of
patients, median OS was 4.7 months with placebo plus gemcitabine, whereas it
was 13.2
months in the 'non genetic fingerprint' subpopulation. Thus, to date, patients
with the defined
'genetic fingerprint' at baseline are those with the worst prognosis in terms
of overall survival
when receiving the standard treatment for pancreatic cancer of gemcitabine
monotherapy,
and hence have the highest unmet medical need. Masitinib plus gemcitabine
treatment
significantly improved overall survival in the 'genetic fingerprint'
subpopulation: median OS
was 12.9 months as compared with 4.7 months in the placebo plus gemcitabine
treatment
arm (p-value = 0.00000056). Overall survival rates at 12, 18 and 24 months
were
respectively, 52.5%, 18.3%, and 12.6% in patients receiving masitinib plus
gemcitabine
versus 7.4%, 0.8%, and 0.3% in patients treated with placebo plus gemcitabine.
The hazard
ratio was 0.17 (95% Cl of [0.09;0.33]), suggesting that the risk for death was
decreased by
83% for patients receiving masitinib plus gemcitabine as compared with the
control
treatment arm of placebo plus gemcitabine.
In conclusion, the above defined predictor factors of pain intensity and gene
expression were
shown to be independent factors for poor overall survival in cancer patients,
and in particular
pancreatic cancer in human patients, underscoring the high unmet medical need
in the
patient subpopulations of 'pain' and 'genetic fingerprint', as defined above.
These two
predictor factors identify patients who are suitable for treatment with the
combination of at
least one tyrosine kinase inhibitor, mast cell inhibitor or c-Kit inhibitor,
especially masitinib or
a pharmaceutically acceptable salt thereof, optionally combined with at least
one
antineoplastic agent.
