Note: Descriptions are shown in the official language in which they were submitted.
1
OLIGONUCLEOTIDE CONJUGATES
FIELD OF INVENTION
The invention relates to the field of oligonucleotide therapeutics, and in
particular to the use
of a conjugate, a targeting group or blocking group to enhance the properties
of the
oligonucleotides, for example to improve the therapeutic index.
BACKGROUND
Oligonucleotide conjugates have been extensively evaluated for use in siRNAs,
where
they are considered essential in order to obtain sufficient in vivo potency.
For example, see
W02004/044141 refers to modified oligomeric compounds that modulate gene
expression
via an RNA interference pathway. The oligomeric compounds Include one or more
conjugate
moieties that can modify or enhance the pharmacokinetic and pharmacodynamic
properties
of the attached oligomeric compound.
In contrast, single stranded antisense oligonucleotides are typically
administered
therapeutically without conjugation or formulation. The main target tissues
for antisense
oligonucleotides are the liver and the kidney, although a wide range of other
tissues are also
accessible by the antisense modality, including lymph node, spleen, bone
marrow.
W02008/113832 discloses LNA phosphorothioate gapmer oligonucleotides where the
flanking regions comprise at least one phosphodiester between or adjacent to a
LNA
nucleoside. The oligomers were preferentially targeted to the kidney.
W02004/087931 refers to oligonucleotides comprising an acid cleavable
hydrophilic
polymer (PEG) conjugate.
WO 2005/086775 refers to targeted delivery of therapeutic agents to specific
organs
using a therapeutic chemical moiety, a cleavable linker and a labeling domain.
The
cleavable linker may be, for example, a disulfide group, a peptide or a
restriction enzyme
cleavable oligonucleotide domain.
WO 2009/126933 refers to specific delivery of si RNA nucleic acids by
combining
targeting ligands with endosomolytic components.
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
2
WO 2011/126937 refers to targeted intracellular delivery of oligonucleotides
via
conjugation with small molecule ligands.
W02009/025669 refers to polymeric (polyethylene glycol) linkers containing
pyridyl
disulphide moieties. See also Zhao et al., Bioconjugate Chem. 2005 16 758 ¨
766.
Chaltin etal., Bioconjugate Chem. 2005 16 827 - 836 reports on cholesterol
modified
mono- di- and tetrameric oligonucleotides used to incorporate antisense
oligonucleotides
into cationic liposomes, to produce a dendrimeric delivery system. Cholesterol
is conjugated
to the oligonucleotides via a lysine linker.
Other non-cleavable cholesterol conjugates have been used to target siRNAs and
antagomirs to the liver¨ see for example, Soutscheck etal., Nature 2004 vol.
432 173¨ 178
and Krutzfeldt et al., Nature 2005 vol 438, 685¨ 689. For the partially
phosphorothiolated
siRNAs and antagomirs, the use of cholesterol as a liver targeting entity was
found to be
essential for in vivo activity.
The present invention is based upon the discovery that highly effective
targeted
delivery of oligonucleotides is achieved by the use of a homing device linked
to the
oligonucleotide by means of a short region of nuclease labile nucleosides,
such as
phosphodiester linked DNA or RNA nucleosides.
SUMMARY OF INVENTION
The invention provides for an oligomeric compound comprising three regions:
i) a first region (region A), which comprises 7 ¨ 26 contiguous
nucleotides;
ii) a second region (region B) which comprises between 1 ¨ 10 nucleotides,
which
is covalently linked to the 5' or 3' nucleotide of the first region, such as
via a
internucleoside linkage group such as a phosphodiester linkage, wherein either
a. the internucleoside linkage between the first and second region is a
phosphodiester linkage and the nucleoside of the second region [such as
immediately] adjacent to the first region is either DNA or RNA; and/or
b. at least 1 nucleoside of the second region is a phosphodiester linked DNA
or RNA nucleoside;
iii) a third region (C) which comprises a conjugate moiety, a targeting
moiety, a
reactive group, an activation group, or a blocking moiety, wherein the third
region is covalent linked to the second region.
In some embodiments, region A and region B form a single contiguous nucleotide
sequence of 8 ¨ 35 nucleotides in length.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
3
In some aspects the internucleoside linkage between the first and second
regions may
be considered part of the second region.
In some embodiments, there is a phosphorus containing linkage group between
the
second and third region. The phosphorus linkage group, may, for example, be a
phosphate
.. (phosphodiester), a phosphorothioate, a phosphorodithioate or a
boranophosphate group.
In some embodiments, this phosphorus containing linkage group is positioned
between the
second region and a linker region which is attached to the third region. In
some
embodiments, the phosphate group is a phosphodiester.
Therefore, in some aspects the oligomeric compound comprises at least two
phosphodiester groups, wherein at least one is as according to the above
statement of
invention, and the other is positioned between the second and third regions,
optionally
between a linker group and the second region.
In some embodiments, the third region is an activation group, such as an
activation
group for use in conjugation. In this respect, the invention also provides
activated oligomers
.. comprising region A and B and an activation group, e.g. an intermediate
which is suitable for
subsequent linking to the third region, such as suitable for conjugation.
In some embodiments, the third region is a reactive group, such as a reactive
group
for use in conjugation. In this respect, the invention also provides oligomers
comprising
region A and B and a reactive group, e.g. an intermediate which is suitable
for subsequent
.. linking to the third region, such as suitable for conjugation. The reactive
group may, in some
embodiments comprise an amine of alcohol group, such as an amine group.
In some embodiments region A comprises at least one, such as 2, 3, 4, 5, 6, 7,
8, 9,
10,11, 12,13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 internucleoside
linkages other
than phosphodiester, such as internucleoside linkages which are (optionally
independently]
selected from the group consisting of phosphorothioate, phosphorodithioate,
and
boranophosphate, and methylphosphonate, such as phosphorothioate. In some
embodiments region A comprises at least one phosphorothioate linkage. In some
embodiments at least 50%, such as at least 75%, such as at least 90% of the
internucleoside linkages, such as all the internucleoside linkages within
region A are other
.. than phosphodiester, for example are phosphorothioate linkages. In some
embodiments, all
the internucleoside linkages in region A are other than phosphodiester.
In some embodiments, the oligomeric compound comprises an antisense
oligonucleotide, such as an antisense oligonucleotide conjugate. The antisense
oligonucleotide may be or may comprise the first region, and optionally the
second region.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
4
In this respect, in some embodiments, region B may form part of a contiguous
nucleobase
sequence which is complementary to the (nucleic acid) target. In other
embodiments, region
B may lack complementarity to the target.
Alternatively stated, in some embodiments, the invention provides a non-
phosphodiester linked, such as a phosphorothioate linked, oligonucleotide
(e.g. an antisense
oligonucleotide) which has at least one terminal (5' and/or 3') DNA or RNA
nucleoside linked
to the adjacent nucleoside of the oligonucleotide via a phosphodiester
linkage, wherein the
terminal DNA or RNA nucleoside is further covalently linked to a conjugate
moiety, a
targeting moiety or a blocking moiety, optionally via a linker moiety.
The invention provides for a pharmaceutical composition comprising the
oligomeric
compound of the invention and a pharmaceutically acceptable diluent, carrier,
salt or
adjuvant.
The invention provides for the oligomeric compound according to the invention
for use
in the inhibition of a nucleic acid target in a cell. In some embodiments the
use is in vitro. In
some embodiments the use is in vivo.
The invention provides for the oligomeric compound of the invention for use in
medicine, such as for use as a medicament.
The invention provides for the oligomeric compound of the invention for use in
the
treatment of a medical disease or disorder.
The invention provides for the use of the oligomeric compound of the invention
for the
preparation of a medicament for the treatment of a disease or disorder, such
as a metabolic
disease or disorder.
The invention provides for a method of synthesizing (or manufacture) of an
oligomeric
compound, such as the oligomeric compound of the invention, said method
comprising
either:
a) a step of providing a [solid phase] oligonucleotide synthesis support to
which one
of the following is attached [third region]:
i) optionally a linker group (-Y-)
ii) a group X comprising a group selected from the group consisting of a
conjugate, a targeting group, a blocking group, a reactive group [e.g. an
amine or an alcohol] or an activation group(X-), or an an -Y ¨ X group
and
b) a step of [sequential] oligonucleotide synthesis of region B followed by
region A,
and / or:
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
c) a step of [sequential] oligonucleotide synthesis of a first region (A) and
a second
region (B), wherein the synthesis step is followed by
d) a step of adding a third region [phosphoramidite comprising]
i) optionally a linker group (-Y-)
5 ii) a group X comprising a group selected from the group
consisting of a
conjugate, a targeting group, a blocking group, a reactive group [e.g. an
amine or an alcohol] or an activation group (X-) or optionally an -Y ¨ X
group
followed by
e) the cleavage of the oligomeric compound from the [solid phase] support
wherein, optionally said method further comprises a further step selected
from:
f) wherein the third group is an activation group, the step of activating the
activation
group to produce a reactive group, followed by adding a conjugate, a blocking,
or
targeting group to the reactive group, optionally via a linker group (Y);
g) wherein the third region is a reactive group, the step of adding a
conjugate, a
blocking, or targeting group to the reactive group, optionally via a linker
group
00.
h) wherein the third region is a linker group (Y), the step of adding a
conjugate, a
blocking, or targeting group to the linker group (Y)
wherein steps f), g) or h) are performed either prior to or subsequent to
cleavage of the
oligomeric compound from the oligonucleotide synthesis support. In some
embodiments,
the method may be performed using standard phosphoramidite chemistry, and as
such the
region X and/or region X or region X and Y may be provided, prior to
incorporation into the
oligomer, as a phosphoramidite. Please see figures 5¨ 10 which illustrate non-
limiting
aspects of the method of the invention.
The invention provides for a method of synthesizing (or manufacture) of an
oligomeric
compound, such as the oligomeric compound of the invention, said method
comprising
a step of [sequential] oligonucleotide synthesis of a first region (A) and
optionally a second
region (B), wherein the synthesis step is followed by a step of adding a third
region
[phosphoramidite comprising] region X (also referred to as region C), or Y
such as a region
comprising a group selected from the group consisting of a conjugate, a
targeting group, a
blocking group, a functional group, a reactive group [e.g. an amine or an
alcohol] or an
activation group (X), or an -Y ¨ X group followed by the cleavage of the
oligomeric
compound from the [solid phase] support.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
6
It is however recognized that the region X or X-Y may be added after the
cleavage from the
solid support. Alternatively, the method of synthesis may comprise the steps
of synthesizing
a first (A), and optionally second region (B), followed by the cleavage of the
oligomer from
the support, with a subsequent step of adding a third region , such as X or X-
Y group to the
oligomer. The addition of the third region may be achieved, by example, by
adding an
amino phosphoramidite unit in the final step of oligomer synthesis (on the
support), which
can, after cleavage from the support, be used to join to the X or X-Y group,
optionally via an
activation group on the X or Y (when present) group. In the embodiments where
the
cleavable linker is not a nucleotide region, region B may be a non-nucleotide
cleavable linker
.. for example a peptide linker, which may form part of region X (also
referred to as region C)
or be region Y (or part thereof).
In some embodiments of the method, region X (such as C) or (X-Y), such as the
conjugate
(e.g. a GaINAc conjugate) comprises an activation group, (an activated
functional group)
and in the method of synthesis the activated conjugate (or region x, or X-Y)
is added to the
.. first and second regions, such as an amino linked oligomer. The amino group
may be
added to the oligomer by standard phosphoramidite chemistry, for example as
the final step
of oligomer synthesis (which typically will result in amino group at the 5'
end of the oligomer).
For example during the last step of the oligonucleotide synthesis a protected
amino-alkyl
phosphoramidite is used, for example a TFA-aminoC6 phosphoramidite (6-
.. (Trifluoroacetylamino)-hexyl-(2-cyanoethyl)-(N,N-diisopropyl)-
phosphoramidite).
Region X (or region C as referred to herein), such as the conjugate (e.g. a
GalNac
conjugate) may be activated via NHS ester method and then the aminolinked
oligomer is
added. For example a N-hydroxysuccinimide (NHS) may be used as activating
group for
region X (or region C, such as a conjugate, such as a GalNac conjugate moiety.
The invention provides an oligomer prepared by the method of the invention.
In some embodiments, region X and/or region X or region X and Y may be
covalently joined (linked) to region B via a phosphate nucleoside linkage,
such as those
described herein, including phosphodiester or phosphorothioate, or via an
alternative group,
such as a triazol group.
The invention provides for a method of treatment of a disease or disorder in a
subject
in need of treatment, said method comprising the steps of administering a
pharmaceutical
composition comprising the oligomeric compound of the invention to said
subject in a
therapeutically effective amount.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
7
The invention provides for a method of inhibiting the expression of a target
gene in a
cell, said method comprising administering the oligomeric compound according
to the
invention to a cell which is expressing said target gene, suitably in an
amount effective to
reduce the expression of the target gene in said cell. In some embodiments the
method is in
vitro (.e. not in an organism, but may be in a (e.g. ex-vivo) cell or tissue).
In some
embodiments the method is in vivo.
The invention also provides for an LNA oligomer, comprising a contiguous
region of 8
¨ 24 phosphorothioate linked nucleosides, and further comprising between 1 and
6 DNA
nucleosides which are contiguous with the LNA oligomer, wherein the
internucleoside
linkages between the DNA, and/or adjacent to the DNA nucleoside(s), is
physiologically
labile, such as is / are phosphodiester linkages. Such an LNA oligomer may be
in the form of
a conjugate, as described herein, or may, for example be an intermediate to be
used in a
subsequent conjugation step. When conjugated, the conjugate may, for example
be or
comprise a sterol, such as cholesterol or tocopherol, or may be or comprise a
(non-
nucleotide) carbohydrate, such as a GalNac conjugate, such as a GalNac
cluster, e.g.
triGalNac, or another conjugate as described herein.
The invention provides for an LNA antisense oligomer (which may be referred to
as
region A herein) comprising an antisense oligomer and an asialoglycoprotein
receptor
targeting moiety conjugate moiety, such as a GaINAc moiety, which may form
part of a
.. further region (referred to as region C). The LNA antisense oligomer may be
7 ¨ 30, such as
8 ¨ 26 nucleosides in length and it comprises at least one LNA unit
(nucleoside).
The invention provides for an LNA antisense oligomer covalently joined to
(e.g. linked
to) a (non-nucleoside) carbohydrate moiety, such as a carbohydrate conjugate
moiety. In
some embodiments the carbohydrate moiety is not a linear carbohydrate polymer.
The
carbohydrate moiety may however be multi-valent, such as, for example 2, 3, 4
or 4 identical
or non-identical carbohydrate moieties may be covalently joined to the
oligomer, optionally
via a linker or linkers.
The invention provides for an LNA antisense oligomer (conjugate) comprising an
antisense oligomer and a conjugate moiety which comprises a carbohydrate, such
as a
carbohydrate conjugate moiety.
The invention provides for a pharmaceutical composition comprising the LNA
oligomeric compound of the invention and a pharmaceutically acceptable
diluent, carrier, salt
or adjuvant.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
8
The invention provides for the oligomeric compound according to the invention
for use
in the inhibition of a nucleic acid target in a cell. In some embodiments the
use is in vitro. In
some embodiments the use is in vivo.
The invention provides for the oligomeric compound of the invention for use in
.. medicine, such as for use as a medicament.
The invention provides for the oligomeric compound of the invention for use in
the
treatment of a medical disease or disorder.
The invention provides for the use of the oligomeric compound of the invention
for the
preparation of a medicament for the treatment of a disease or disorder, such
as a metabolic
disease or disorder.
BRIEF DESCRIPTION OF FIGURES
Figure 1: Non-limiting illustration of oligomers of the invention attached to
an activation
group (i.e. a protected reactive group ¨ as the third region). The
internucleoside linkage L
may be, for example phosphodiester, phosphorothioate, phosphorodithioate,
boranophosphate or methylphosphonate, such as phosphodiester. PO is a
phosphodiester
linkage. Compound a) has a region B with a single DNA or RNA, the linkage
between the
second and the first region is PO. Compound b) has two DNA/RNA (such as DNA)
nucleosides linked by a phosphodiester linkage. Compound c) has three DNA/RNA
(such
as DNA) nucleosides linked by a phosphodiester linkages. In some embodiments,
Region B
may be further extended by further phosphodiester DNA/RNA (such as DNA
nucleosides).
The activation group is illustrated on the left side of each compound, and
may, optionally be
linked to the terminal nucleoside of region B via a phosphorus nucleoside
linkage group,
such as phosphodiester, phosphorothioate, phosphorodithioate, boranophosphate
or
methylphosphonate, or in some embodiments a triazole linkage. Compounds d),
e), & f)
further comprise a linker (Y) between region B and the activation group, and
region Y may
be linked to region B via, for example, a phosphorus nucleoside linkage group,
such as
phosphodiester, phosphorothioate, phosphorodithioate, boranophosphate or
methylphosphonate, or in some embodiments a triazole linkage.
Figure 2: Equivalent compounds as shown in figure 1; however a reactive group
is used in
place of the activation group. The reactive group may, in some embodiments be
the result
of activation of the activation group (e.g. deprotection). The reactive group
may, in non-
limiting examples, be an amine or alcohol.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
9
Figure 3: Non-limiting Illustration of compounds of the invention. Same
nomenclature as
Figure 1. X may in some embodiments be a conjugate, such as a lipophilic
conjugate such
as cholesterol, or another conjugate such as those described herein. In
addition, or
alternatively X may be a targeting group or a blocking group. In some aspects
X may be an
activation group (see Figure 1), or a reactive group (see figure 2). X may be
covalently
attached to region B via a phosphorus nucleoside linkage group, such as
phosphodiester,
phosphorothioate, phosphorodithioate, boranophosphate or methylphosphonate, or
may be
linked via an alternative linkage, e.g. a triazol linkage (see L in compounds
d), e), and f)).
Figure 4. Non-limiting Illustration of compounds of the invention, where the
compounds
comprise the optional linker between the third region (X) and the second
region (region B).
Same nomenclature as Figure 1. Suitable linkers are disclosed herein, and
include, for
example alkyl linkers, for example C6 linkers. In compounds A, B and C, the
linker between
X and region B is attached to region B via a phosphorus nucleoside linkage
group, such as
phosphodiester, phosphorothioate, phosphorodithioate, boranophosphate or
methylphosphonate, or may be linked via an alternative linkage e.g. a triazol
linkage (Li). In
these compounds Lii represents the internucleoside linkage between the first
(A) and second
regions (B).
Figure 5a and b. 5b shows a non-limiting example of a method of synthesis of
compounds
of the invention. US represent a oligonucleotide synthesis support, which may
be a solid
support. X is the third region, such as a conjugate, a targeting group, a
blocking group etc.
In an optional pre-step, X is added to the oligonucleotide synthesis support.
Otherwise the
support with X already attached may be obtained (i). In a first step, region B
is synthesized
(ii), followed by region A (iii), and subsequently the cleavage of the
oligomeric compound of
the invention from the oligonucleotide synthesis support (iv). In an
alternative method the
pre-step involves the provision of a oligonucleotide synthesis support with a
region X and a
linker group (Y) attached (see Figure 5a). . In some embodiments, either X or
Y (if present)
is attached to region B via a phosphorus nucleoside linkage group, such as
phosphodiester,
phosphorothioate, phosphorodithioate, boranophosphate or methylphosphonate, or
an
alternative linkage, such as a triazol linkage.
Figure 6. A non-limiting example of a method of synthesis of compounds of the
invention
which comprise a linker (Y) between the third region (X) and the second region
(B). US
represents a oligonucleotide synthesis support, which may be a solid support.
X is the third
region, such as a conjugate, a targeting group, a blocking group etc. In an
optional pre-step,
Y is added to the oligonucleotide synthesis support. Otherwise the support
with Y already
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
attached may be obtained (i). In a first step, region B is synthesized (ii),
followed by region
A (iii), and subsequently the cleavage of the oligomeric compound of the
invention from the
oligonucleotide synthesis support (iv). In some embodiments (as shown), region
X may be
added to the linker (Y) after the cleavage step (v). In some embodiments, Y is
attached to
5 region B via a phosphorus nucleoside linkage group, such as
phosphodiester,
phosphorothioate, phosphorodithioate, boranophosphate or methylphosphonate, or
an
alternative linkage, such as a triazol linkage.
Figure 7. A non-limiting example of a method of synthesis of compounds of the
invention
which utilize an activation group. In an optional pre-step, the activation
group is attached the
10 oligonucleotide synthesis support (i), or the oligonucleotide synthesis
support with activation
group is otherwise obtained. In step ii) region B is synthesized followed by
region A (iii).
The oligomer is then cleaved from the oligonucleotide synthesis support (iv).
The
intermediate oligomer (comprising an activation group) may then be activated
(VI) or (viii)
and a third region (X) added (vi), optionally via a linker (Y) (ix). In some
embodiments, X (or
Y when present) is attached to region B via a phosphorus nucleoside linkage
group, such as
phosphodiester, phosphorothioate, phosphorodithioate, boranophosphate or
methylphosphonate, or an alternative linkage, such as a triazol linkage. .
Figure 8. A non-limiting example of a method of synthesis of compounds of the
invention,
wherein a bifunctional oligonucleotide synthesis support is used (i). In such
a method, either
the oligonucleotide is synthesized in an initial series of steps (ii) ¨ (iii),
followed by the
attachment of the third region (optionally via a linker group Y), the
oligomeric compound of
the invention may then be cleaved (v). Alternatively, as shown in steps (vi) ¨
(ix), the third
region (optionally with a linker group (Y) is attached to the oligonucleotide
synthesis support
(this may be an optional pre-step) ¨ or an oligonucleotide synthesis support
with the third
region (optionally with Y) is otherwise provided, the oligonucleotide is then
synthesized (vii ¨
viii). The oligomeric compound of the invention may then be cleaved (ix). In
some
embodiments, X (or Y when present) is attached to region B via a phosphorus
nucleoside
linkage group, such as phosphodiester, phosphorothioate, phosphorodithioate,
boranophosphate or methylphosphonate, or an alternative linkage, such as a
triazol linkage.
The US may in some embodiment, prior to the method (such as the pre-step)
comprise a
step of adding a bidirectional (bifunctional) group which allows the
independent synthesis of
the oligonucleotide and the covalent attachment of group X, Y (or X and Y) to
support (as
shown) ¨ this may for example be achieved using a triazol or of nucleoside
group. The
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
11
bidirectional (bifunctional) group, with the oligomer attached, may then be
cleaved from the
support.
Figure 9. A non-limiting example of a method of synthesis of compounds of the
invention:
In an initial step, the first region (A) is synthesized (ii), followed by
region B. In some
embodiments the third region is then attached to region B (iii), optionally
via a phosphate
nucleoside linkage (or e.g. a trialzol linkage). The oligomeric compound of
the invention
may then be cleaved (iv). When a linker(Y) is used, in some embodiments the
steps (v) ¨
(viii) may be followed: after synthesis of region B, the linker group (Y) is
added, and then
either attached to (Y) or in a subsequent step, region X is added (vi). The
oligomeric
compound of the invention may then be cleaved (vii). In some embodiments, X
(or Y when
present) is attached to region B via a phosphorus nucleoside linkage group,
such as
phosphodiester, phosphorothioate, phosphorodithioate, boranophosphate or
methylphosphonate, or an alternative linkage, such as a triazol linkage.
Figure 10. A non-limiting example of a method of synthesis of compounds of the
invention:
In this method an activation group is used: Steps (i) ¨ (iii) are as per
Figure 9. However
after the oligonucleotide synthesis (step iii), an activation group (or a
reactive group) is
added to region B, optionally via a phosphate nucleoside linkage. The
oligonucleotide is
then cleaved from the support (v). The activation group may be subsequently
activated to
produce a reactive group, and then the third region (X), such as the
conjugate, blocking
group or targeting group, is added to the reactive group (which may be the
activated
activation group or the reactive group), to produce the oligomer (vi). As
shown in (vii) ¨ (viii),
after cleavage, a linker group (Y) is added (vii), and then either attached to
(Y) or in a
subsequent step, region X is added to produce the oligomer (viii). It should
be recognized
that in an alternative all of the steps (ii) ¨ (viii) may be performed on the
oligonucleotide
synthesis support, and in such instances a final step of cleaving the oligomer
from the
support may be performed. In some embodiments, the reactive group or
activation group is
attached to region B via a phosphorus nucleoside linkage group, such as
phosphodiester,
phosphorothioate, phosphorodithioate, boranophosphate or methylphosphonate, or
an
alternative linkage, such as a triazol linkage.
Figure 11. Silencing of ApoB mRNA with Cholesterol-conjugates in vivo. Mice
were injected
with a single dose of 1 mg/kg unconjugated LNA-antisense oligonucleotide
(#3833) or
equimolar amounts of LNA antisense oligonucleotides conjugated to Cholesterol
with
different linkers (Tab. 3) and sacrificed at days 1, 3, 7 and 10 after dosing.
RNA was isolated
from liver and kidney and subjected to ApoB specific RT-qPCR A. Quantification
of ApoB
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
12
mRNA from liver samples normalized to GAPDH and shown as percentage of the
average of
equivalent saline controls B. Quantification of ApoB mRNA from kidney samples
normalized
to GAPDH and shown as percentage of the average of equivalent saline controls.
Figure 12. Shows the cholesterol 06 conjugate which may be used as X-Y- in
compounds
of the invention, as well as specific compounds used in the examples, include
specific
compounds of the invention.
Figure 13. Examples of cholesterol, trivalent GalNac, FAM, folic acid,
monovalent GalNac
and tocopherol conjugates used in the experiments (e.g. compounds of Figure
12).
Figure 14. Silencing of ApoB mRNA with cholesterol-conjugates in vivo. Mice
were injected
with a single dose of 1 mg/kg unconjugated LNA-antisense oligonucleotide
(#3833) or
equimolar amounts of LNA antisense oligonucleotides conjugated to Cholesterol
with
different linkers (Tab. 3) and sacrificed at days 1, 3, 7, 10, 13 and 16 after
dosing. RNA was
isolated from liver and kidney and subjected to ApoB specific RT-qPCR A.
Quantification of
ApoB mRNA from liver samples normalized to GAPDH and shown as percentage of
the
average of equivalent saline controls B. Quantification of ApoB mRNA from
kidney samples
normalized to GAPDH and shown as percentage of the average of equivalent
saline
controls.
Figure 15. Content of the specific LNA oligonucleotide in liver and kidney in
vivo. Mice were
injected with a single dose of 1 mg/kg unconjugated LNA-antisense
oligonucleotide (#1) or
.. equimolar amounts of LNA antisense oligonucleotides conjugated to
Cholesterol with
different linkers (Tab. 4) and sacrificed at days 1, 3, 7, 10, 13 and 16 after
dosing. LNA
oligonucleotide content was measured using LNA based sandwich ELISA method.
Figure 16. Silencing of PCSK9 mRNA with cholesterol-conjugates in vivo. Mice
were
injected with a single dose of 10 mg/kg unconjugated LNA-antisense
oligonucleotide (#7) or
equimolar amounts of LNA antisense oligonucleotides conjugated to Cholesterol
with
different linkers (Tab. 5) and sacrificed at days 1, 3, 7 and 10 after dosing.
RNA was isolated
from liver and kidney and subjected to PCSK9 specific RT-qPCR A.
Quantification of PCSK9
mRNA from liver samples normalized to BACT and shown as percentage of the
average of
equivalent saline controls B. Quantification of PCSK9 mRNA from kidney samples
normalized to BACT and shown as percentage of the average of equivalent saline
controls.
Figure 17 Examples of tri-GalNac conjugates which may be used. Conjugates 1 ¨
4
illustrate 4 suitable GalNac conjugate moieties, and conjugates la ¨ 4a refer
to the same
conjugates with an additional linker moiety (Y) which is used to link the
conjugate to the
oligomer (region A or to a biocleavable linker, such as region B). The wavy
line represents
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
13
the covalent link to the oligomer. Also shown are examples of cholesterol and
tocopherol
conjugate moieties (5a and 6a). The wavy line represents the covalent link to
the oligomer.
Figure 18: Example 7a: FVII serum protein levels
Figure 19: Example 7a: FVII mRNA levels in liver day 4
Figure 20: Example 7a: Oligonucleotide content in liver and kidney day 4
Figure 21: Example 7b - FVII serum protein levels
Figure 22: FVII mRNA levels in liver day 24
Figure 23: Oligonucleotide content in liver and kidney day 4
Figure 24. In vivo silencing of ApoB mRNA with different conjugates and PO-
linker.
Mice were treated with 1 mg/kg of ASO with different conjugates either without
biocleavable
linker, with Dithio-linker (SS) or with DNA/PO-linker (PO). RNA was isolated
from liver (A)
and kidney samples (B) and analyzed for ApoB mRNA knock down. Data is shown
compared to Saline (=1).
Figure 25. In vitro silencing of Target X mRNA with looped LNA ASO with PO-
linker.
Neuro 2a cells were treated with looped LNA ASOs with or without PO-linker,
respectively.
After 6 days gymnosis mRNA was extracted and analyzed for target X mRNA knock
down.
mRNA expression is shown as percentage of mock treated samples.
DESCRIPTION OF THE INVENTION
The invention relates to oligomeric compounds, such as antisense
oligonucleotides, which
are covalently linked to a conjugate group, a targeting group, a reactive
group, an activation
group, or a blocking group, via a short region comprising (e.g. 1 ¨ 10) of
phosphodiester
linked DNA or RNA nucleoside(s).
The Oligomer
The present invention employs oligomeric compounds (also referred herein as
oligomers) for use in modulating, such as inhibiting a target nucleic acid in
a cell. The
oligomers may have a length of 8 ¨ 35 contiguous nucleotides and comprise a
first region of
7 ¨25 contiguous nucleotides, and a second region of 1 ¨ 10 contiguous
nucleotides,
wherein, for example, either the intern ucleoside linkage between the first
and second region
is a phosphodiester linked to the first (or only) DNA or RNA nucleoside of the
second region,
or region B comprises at least one phosphodiester linked DNA or RNA
nucleoside..
The second region may, in some embodiments, comprise further DNA or RNA
nucleosides which may be phosphodiester linked. The second region is further
covalently
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
14
linked to a third region which may, for example, be a conjugate, a targeting
group a reactive
group, and/or a blocking group.
In some aspects, the present invention is based upon the provision of a labile
region,
the second region, linking the first region, e.g. an antisense
oligonucleotide, and a conjugate
or functional group, e.g. a targeting or blocking group. The labile region
comprises at least
one phosphodiester linked nucleoside, such as a DNA or RNA nucleoside, such as
1, 2, 3,
4, 5, 6, 7, 8,9 or 10 phosphodiester linked nucleosides, such as DNA or RNA.
In some
embodiments, the oligomeric compound comprises a cleavable (labile) linker. In
this respect
the cleavable linker is preferably present in region B (or in some
embodiments, between
region A and B).
The term "oligomer" in the context of the present invention, refers to a
molecule
formed by covalent linkage of two or more nucleotides (i.e. an
oligonucleotide). Herein, a
single nucleotide (unit) may also be referred to as a monomer or unit. In some
embodiments, the terms "nucleoside", "nucleotide", "unit" and "monomer" are
used
interchangeably. It will be recognized that when referring to a sequence of
nucleotides or
monomers, what is referred to is the sequence of bases, such as A, T, G, C or
U.
The oligomer consists or comprises of a contiguous nucleotide sequence of from
8 ¨
25, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
nucleotides in
length, such as 10 ¨ 20 nucleotides in length.
In various embodiments, the compound of the invention does not comprise RNA
(units). In some embodiments, the compound according to the invention, the
first region, or
the first and second regions together (e.g. as a single contiguous sequence),
is a linear
molecule or is synthesized as a linear molecule. The oligomer may therefore be
single
stranded molecule. In some embodiments, the oligomer does not comprise short
regions of,
for example, at least 3, 4 or 5 contiguous nucleotides, which are
complementary to
equivalent regions within the same oligomer (i.e. duplexes). The oligomer, in
some
embodiments, may be not (essentially) double stranded. In some embodiments,
the
oligomer is essentially not double stranded, such as is not a siRNA.
In some embodiments, the oligomer may comprise a first region which does not
comprise short regions of, for example, at least 3, 4 or 5 contiguous
nucleotides, which are
complementary to regions within the same first region (i.e. intra-region
duplexes). In this
respect, the first oligomer may, in some embodiments not form a hybridization
with a non-
covalently linked complementary strand, e.g. does not form part of an siRNA.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
For example, in some embodiments, the oligomeric compound does comprise a
region
of complementarity, e.g. when the first region forms part of an siRNA, or for
example, when
the third region comprises an aptamer or a blocking oligonucleotide, the
oligomeric
compound of the invention may, in some embodiments comprise regions of double
stranded
5 nucleic acid. In such embodiments, regions of double stranded nucleic
acid, for example
forming a duplex of at least 3, such as at least, 4, such as at least 5, such
as at least 6
nucleotides in length, may be within the third region, or between the third
region and for
example the first region, or in some embodiments, the second region, or a
region across the
first and second regions (e.g. when the third region comprises a
oligonucleotide blocking
10 region).
In some embodiments, the oligomeric compound is not in the form of a duplex
with a
(substantially) complementary oligonucleotide ¨ e.g. is not an siRNA.
In some embodiments, the oligomeric compound is a LNA oligomer, for example an
LNA antisense oligomer, (which may be referred to as region A herein)
comprising an
15 .. antisense oligomer, region B as defined herein, and a carbohydrate
conjugate (which may
be referred to as region C). The LNA antisense oligomer may be 7 ¨ 30, such as
8 ¨ 26
nucleosides in length and it comprises at least one LNA unit (nucleoside). In
some
embodiments the carbohydrate moiety is not a linear carbohydrate polymer.
In some embodiments, the oligomeric compound is a LNA oligomer, for example an
LNA antisense oligomer, (which may be referred to as region A herein)
comprising an
antisense oligomer, region B as defined herein, and an asialoglycoprotein
receptor targeting
moiety conjugate moiety, such as a GaINAc moiety (which may be referred to as
region C).
The carbohydrate moiety may be multi-valent, such as, for example 2, 3, 4 or 4
identical or
non-identical carbohydrate moieties may be covalently joined to the oligomer,
optionally via
a linker or linkers (such as region Y).
The First Region
In some embodiments, the first region may comprise a nucleic acid based
oligomer,
such as an antisense oligonucleotide. In some embodiments, the first region
comprises or
consists of a phosphorothioate linked oligonucleotide, such as an antisense
oligonucleotide,
of 7 ¨ 25 nucleotides in length. The first region may comprise at least one
modified
nucleoside (a nucleoside analogue), such as at least one bicyclic nucleoside
(e.g. LNA) or
2'substituted nucleoside. In some embodiments, some or all of the nucleosides
of the first
region may be modified nucleosides, also referred to as nucleoside analogues
herein. In
16
some embodiments, the modified nucleosides are sugar-modified (e.g. comprise a
sugar or
sugar surrogate moiety other than ribose or deoxyribose).
In some embodiments, the first region is an antisense oligomer (antisense
oligonucleotide),
such as a single stranded oligomer which comprises a sequence which is
complementary to
a nucleic acid target.
In some embodiments the first region comprises or is a gapmer. In some
embodiments the first region comprises or is a mixmer. In some embodiments the
first
region comprises or is a totalmer.
In some embodiments, the first region comprises at least one, such as at least
2, at
least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least
9, at least 10, at least
11, at least 12, at least 13, at least 14, at least 15, at least 16, at least
17, at least 18, at
least 19, at least 20, at least 21, at least 22, at least 23, at least 24 or
25 nucleoside
analogues. In some embodiments the nucleoside analogues are (optionally
independently
selected from the group consisting of bicyclic nucleoside analogues (such as
LNA), and/or 2'
substituted nucleoside analogues, such as (optionally independently) selected
from the
group consisting of 2'-0-alkyl-RNA units, 2'-0Me-RNA units, 2'-amino-DNA
units, 2'-AP, 2'-
FANA, 2'-(3-hydroxy)propyl, and 2'-fluoro-DNA units, and/or other (optionally)
sugar
modified nucleoside analogues such as morpholino, peptide nucleic acid (PNA),
CeNA,
unlinked nucleic acid (UNA), hexitol nucleoic acid (HNA). bicyclo-HNA (see
e.g.
W02009/100320), In some embodiments, the nucleoside analogues increase the
affinity of
the first region for its target nucleic acid (or a complementary DNA or RNA
sequence).
Various nucleoside analogues are disclosed in Freier & Altmann; Nucl. Acid
Res., 1997, 25,
4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-
213.
In some embodiments, the oligomer, such as the first region thereof, such as
the
gapmer, mixmer or totalmer comprise at least one bicyclic nucleotide analogue,
such as
LNA. In some embodiments, the first region comprises of at least one bicyclic
nucleoside
analogues (e.g. LNA) and/or 2'substituted nucleoside analogues. In some
embodiments, the
nucleoside analogues present in the first region all comprise the same sugar
modification.
In some embodiments, at least one nucleoside analogue present in the first
region is a
bicyclic nucleoside analogue, such as at least 2, at least 3, at least 4, at
least 5, at least 6, at
least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at
least 13, at least 14, at
least 15, at least 16, for example all nucleoside analogues (or in a totalmer
all nucleosides)
bicyclic nucleoside analogues, such as LNA, e.g. beta-D-X-LNA or alpha-L-X-LNA
(wherein
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
17
X is oxy, amino or thio), or other LNAs disclosed herein including, but not
limited to,(R/S)
cET, cM0E or 5'-Me-LNA. In some embodiments, the oligomer, or first region
thereof,
comprises of DNA and sugar modified nucleoside analogues, such as bicyclic
nucleoside
analogues and/or 2'substituted nucleoside analogues. In some embodiments, the
oligomer
or first region thereof, comprises of DNA and LNA nucleoside analogues.
W005013901, W007/027775, W007027894 refers to filly 2'substituted oligomers,
such
as fully 2'-0-M0E. In some embodiments, the first region of the oligomer may
comprise of 2'
substituted nucleosides. W007/027775 also refers to MOE, LNA, DNA mixmers for
use in
targeting microRNAs.
In some embodiments, the first region, or the first and second region combined
to not
comprise a region of more than 4 or 5 consecutive DNA units. Such first
regions may be
(essentially) unable to recruit RNAseH.
The first region is covalently linked to the second region, such as via a 5'
terminal or 3'
terminal internucleoside linkage, such as a phosphodiester linkage. The
phosphodiester
linkage may therefore be positioned between the 5' most nucleoside of region A
and the 3'
most nucleoside of region B, and/or between the 3' most nucleoside of region A
and the 5'
most nucleoside of region B. In this respect, in some embodiments, there may
be two
region B covalently joined to region A, one at the 5' terminus of region A and
one at the 3'
terminus of region A. The two region Bs may be the same or different, and they
may be
covalently linked to the same or different third regions, optionally and
independently via a
linker (Y).
In some embodiments, some or all of the nucleosides of the first region may be
modified nucleosides, also referred to as nucleoside analogues herein, such as
sugar
modified nucleoside analogues, for example bicyclic nucleoside analogues (e.g.
LNA) and/or
2'substituted nucleoside analogues. In some embodiments, the nucleoside
analogues
present in the first region all comprise the same sugar modification, for
example are all
bicyclic nucleoside analogues, such as LNA, e.g. beta-D-X-LNA or alpha-L-X-LNA
(wherein
X is oxy, amino or thio), or other LNAs disclosed herein including, but not
limited to,(R/S)
cET, cM0E or 5'-Me-LNA.
In some embodiments, the internucleoside linkages of the first region comprise
at least
one internucleoside linkage other than phosphodiester, such as at least one,
such as at least
50%, such as at least 75%, such as at least 90%, such as 100% of the
internucleoside
linkages in region A are other than phosphodiester. In some embodiments, the
internucleoside linkages other than phosphodiester are sulphur containing
internucleoside
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
18
linkages, such as phosphorothioate, phosphorodithioate and boranophosphate,
such as
phosphorothioate.
The Second Region (region B)
The second region may comprise or consists of at least one DNA or RNA
nucleosides
linked to the first region via a phosphodiester linkage. In some aspects, the
internucleoside
linkage between the first and second region is considered as part of region B.
In some embodiments, the second region comprises or consists of at least
between 1
and 10 linked nucleosides, such as 1, 2, 3,4, 5, 6, 7, 8, 9 or 10 linked DNA
or RNA
nucleotides. Whilst a region of DNA/RNA phosphodiester is considered important
in the
provision of a cleavable linker, it is possible that region B also comprises
sugar-modified
nucleoside analogues, such as those referred to under the first region above.
However in
some embodiments, the nucleosides of region B are (optionally independently)
selected
from the group consisting of DNA and RNA. It will be recognized that the
nucleosides of
region B may comprise naturally occurring or non-naturally occurring
nucleobases. Region
B comprises at least one phosphodiester linked DNA or RNA nucleoside (which
may, in
some embodiments. be the first nucleoside adjacent to region A). If region B
comprises
other nucleosides, region B may also comprise of other nucleoside linkages
other than
phosphodiester, such as (optionally independently) phosphorothioate,
phosphodithioate,
boranophosphate or methyl phosphonate. However, in other embodiments, all the
internucleoside linkages in region B are phosphorothioate. In some
embodiments, all the
nucleosides of region B comprise (optionally independently) either a 2'-OH
ribose sugar
(RNA) or a 2'-H sugar - i.e. RNA or DNA.
In some embodiments, the second region comprises or consists of at least
between 1
and 10 (e.g. phosphodiester) linked DNA or RNA nucleosides, such as 1, 2, 3,
4, 5, 6, 7, 8, 9
or 10 (e.g. phosphodiester) linked DNA or RNA nucleotides.
In some embodiments, region B comprises no more than 3 or no more than 4
consecutive DNA or RNA nucleosides (such as DNA nucleosides. As such region B
may be
so short as it does not recruit RNAseH, an aspect which may be important when
region B
does not form a part of a single contiguous nucleobase sequence which is
complementary to
the target. Shorter region Bs, e.g. of 1 ¨ 4nts in length may also be
preferable in some
embodiments, as they are unlikely to be the target of sequence specific
restriction enzymes.
As such it is possible to vary the susceptibility of the region B to
endonuclease cleavage,
and thereby fine-tune the rate of activation of the active oligomer in vivo,
or even intra-
cellular. Suitably, if very rapid activation is required, longer region Bs may
be employed
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
19
and/or region Bs which comprise the recognition sites of (e.g. cell or tissue
specific or
differentially expressed) restriction enzymes.
As illustrated in the examples, region B may be conjugated to the conjugate,
targeting
reactive group, an activation group, or blocking group (X) via a linker group
which may, for
example, comprise a phosphodiester linkage, and/or optionally a suitable
linker group, such
as those provided herein. For example a phosphate nucleoside linkage (e.g.
phosphodiester, phosphorothioate, phosphodithioate, boranophosphate or
methylphosphonate) or a triazol group. In some aspects, the linkage group is
the same as
the linkage group between regions A and B, and as such may be a phosphodiester
linkage.
In some aspects, the linkage group is a phosphorothioate linkage.
In some embodiments the DNA or RNA nucleotides of the second region are
independently selected from DNA and RNA nucleotides. In some embodiments the
DNA or
RNA nucleotides of the second region are DNA nucleotides. In some embodiments
the DNA
or RNA nucleotides of the second region are RNA nucleotides.
In the context of the second region, the term DNA and RNA nucleoside may
comprise
a naturally occurring or non-naturally occurring base (also referred to as a
base analogue or
modified base).
It will be recognized that, in some embodiments, the second region may further
comprise other nucleotides or nucleotide analogues. In some embodiments, the
second
region comprises only DNA or RNA nucleosides. In some embodiments, when the
second
region comprises more than one nucleoside, the internucleoside linkages in the
second
region comprise phosphodiester linkages. In some embodiments, when the second
region
comprises more than one nucleoside, all the internucleoside linkages in the
second region
comprise phosphodiester linkages.
In some embodiments, at least two consecutive nucleosides of the second region
are
DNA nucleosides (such as at least 3 or 4 or 5 consecutive DNA nucleotides). In
some
embodiments the at least two consecutive nucleosides of the second region are
RNA
nucleosides (such as at least 3 or 4 or 5 consecutive RNA nucleotides). In
some
embodiments the at least two consecutive nucleosides of the second region are
at least one
DNA and at least one RNA nucleoside. The internucleoside linkage between
region A and
region B is a phosphodiester linkage. In some embodiments, when region B
comprises
more than one nucleoside, at least one further internucleoside linkage is
phosphodiester ¨
such as the linkage group(s) between the 2 (or 3 or 4 or 5) nucleosides
adjacent to region A.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
The second region is flanked on one side (either 5' or 3') by the first
region, e.g. an
antisense oligonucleotide, and on the other side (either 3' or 5'
respectfully, via a conjugate
moiety or similar group (e.g. a blocking moiety/group, a targeting
moiety/group or therapeutic
small molecule moiety), optionally via a linker group (i.e. between the second
region and the
5 conjugate/blocking group etc. moiety).
In such an embodiment, the oligonucleotide of the invention may be described
according to the following formula:
5'-A-PO-B [Y)X- 3' or 3'-A-PO-B [Y)X- 5'
wherein A is region A, PO is a phosphodiester linkage, B is region B, Y is an
optional
10 linkage group, and X is a conjugate, a targeting, a blocking group or a
reactive or activation
group.
In some embodiments, region B comprises 3' ¨ 5' or 5'-3': i) a phosphodiester
linkage
to the 5' nucleoside of region A, ii) a DNA or RNA nucleoside, such as a DNA
nucleoside,
and iii) a further phosphodiester linkage
15 5'-A-PO-B ¨ PO- 3' or 3'-A-PO-B ¨ PO- 5'
The further phosphodiester linkage link the region B nucleoside with one or
more
further nucleoside, such as one or more DNA or RNA nucleosides, or may link to
X (is a
conjugate, a targeting or a blocking group or a reactive or activation group)
optionally via a
linkage group (Y).
20 In some embodiments, region B comprises 3' ¨ 5' or 5'-3': i) a
phosphodiester linkage
to the 5' nucleoside of region A, ii) between 2 - 10 DNA or RNA phosphodiester
linked
nucleosides, such as a DNA nucleoside, and optionally iii) a further
phosphodiester linkage:
5'-A-[PO-B]n ¨ [Y]-X 3' or 3'-A-[PO-B]n ¨[Y]-X 5'
5'-A-[PO-B]n ¨ PO-[Y]-X 3' or 3'-A-[PO-B]n ¨ PO-[Y]-X 5'
Wherein A represent region A, [PO-B]n represents region B, wherein n is 1 ¨
10, such
as 1, 2, 3,4, 5, 6, 7, 8, 9 or 10, PO is an optional phosphodiester linkage
group between
region B and X (or Y if present).
In some embodiments the invention provides compounds according to (or
comprising)
one of the following formula:
5' [Region A] ¨ PO ¨ [region B] 3' ¨Y ¨ X
5' [Region A] ¨ PO ¨ [region B] ¨PO 3' ¨Y ¨ X
5' [Region A] ¨ PO ¨ [region B] 3' ¨ X
5' [Region A] ¨ PO ¨ [region B] ¨PO 3' ¨ X
3' [Region A] ¨ PO ¨ [region B] 5' ¨Y ¨ X
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
21
3' [Region A] ¨ PO ¨ [region B] ¨PO 5' ¨Y ¨ X
3' [Region A] ¨ PO ¨ [region B] 5' ¨ X
3' [Region A] ¨ PO ¨ [region B] ¨PO 5' ¨ X
Region B, may for example comprise or consist of:
5' DNA3'
3' DNA 5'
5' DNA-PO-DNA-3'
3' DNA-PO-DNA-5'
5' DNA-PO-DNA-PO-DNA 3'
3' DNA-PO-DNA-PO-DNA 5'
5' DNA-PO-DNA-PO-DNA-PO-DNA 3'
3' DNA-PO-DNA-PO-DNA-PO-DNA 5'
5' DNA-PO-DNA-PO-DNA-PO-DNA-PO-DNA 3'
3' DNA-PO-DNA-PO-DNA-PO-DNA-PO-DNA 5'
Sequence selection in the second region:
In some embodiments, region B does not form a complementary sequence when the
oligonucleotide region A and B is aligned to the complementary target
sequence.
In some embodiments, region B does form a complementary sequence when the
oligonucleotide region A and B is aligned to the complementary target
sequence. In this
respect region A and B together may form a single contiguous sequence which is
complementary to the target sequence.
In some embodiments, the sequence of bases in region B is selected to provide
an
optimal endonuclease cleavage site, based upon the predominant endonuclease
cleavage
enzymes present in the target tissue or cell or sub-cellular compartment. In
this respect, by
isolating cell extracts from target tissues and non-target tissues,
endonuclease cleavage
sequences for use in region B may be selected based upon a preferential
cleavage activity
in the desired target cell (e.g. liver/hepatocytes) as compared to a non-
target cell (e.g.
kidney). In this respect, the potency of the compound for target down-
regulation may be
optimized for the desired tissue/cell.
In some embodiments region B comprises a dinucleotide of sequence AA, AT, AC,
AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein C may be 5-
mthylcytosine, and/or T may be replaced with U. In some embodiments region B
comprises
a trinucleotide of sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT,
ACC,
ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAC, TAG, TTA, TTT, TTC, TAG, TCA, TCT,
TCC,
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
22
TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT,
CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA,
GCT, GCC, GCG, GGA, GGT, GGC, and GGG wherein C may be 5-mthylcytosine and/or
T
may be replaced with U. In some embodiments region B comprises a trinucleotide
of
sequence AAAX, AATX, AACX, AAGX, ATAX, ATTX, ATCX, ATGX, ACAX, ACTX, ACCX,
ACGX, AGAX, AGTX, AGCX, AGGX, TAAX, TATX, TACX, TAGX, TTAX, TTTX, TTCX,
TAGX, TCAX, TCTX, TCCX, TCGX, TGAX, TGTX, TGCX, TGGX, CAAX, CATX, CACX,
CAGX, CTAX, CTGX, CTCX, CTTX, CCAX, CCTX, CCCX, CCGX, CGAX, CGTX, CGCX,
CGGX, GAAX, GATX, GACX, CAGX, GTAX, GTTX, GTCX, GTGX, GCAX, GCTX, GCCX,
GCGX, GGAX, GGTX, GGCX, and GGGX, wherein X may be selected from the group
consisting of A, T, U, G, C and analogues thereof, wherein C may be 5-
mthylcytosine and/or
T may be replaced with U. It will be recognized that when referring to
(naturally occurring)
nucleobases A, T, U, G, C, these may be substituted with nucleobase analogues
which
function as the equivalent natural nucleobase (e.g. base pair with the
complementary
nucleoside).
In some embodiments, the compound of the invention may comprise more than one
conjugate group (or more than one functional group X ¨ such as a conjugate,
targeting,
blocking or activated group or a reactive or activation group), such as 2 or 3
such groups. In
some embodiments, region B is covalently linked, optionally via a [e.g. non-
nucleotide] linker
group), to at least one functional group, such as two or three functional
groups. In some
embodiments, the first region may be covalently linked (e.g. via
internucleoside linkages,
such as phosphodiester linkages), to two region Bs, for example, one 5' and
one 3' to the
first region, wherein each region B may be (optionally independently) selected
from the
region B described herein. In this respect one region B may have one or more
functional
groups, and the second region B may have one or more function groups, wherein
the
functional groups of each region B may be independently selected from a
conjugate, a
targeting group, a blocking group or a reactive/activation group.
Poly oligomeric compounds
The invention provides for a poly oligomeric compound which may comprise the
first region
(region A), the second region (region B) and the third region (region C),
wherein the first
region is covalently linked to at least one further oligomeric compound
(region A'), wherein
the first region (region A) and region A' are covalently linked via a
biocleavable linker (region
B'), which may be, by way of example, as according to the second region as
disclosed here,
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
23
for example a region of at least one phosphodiester linked DNA or RNA (such as
DNA),
such as two, three, four or five phosphodiester linked DNA or RNA nucleosides
(such as
DNA nucleosides). Regions B and B' may, in some embodiments have the same
structure,
e.g. the same number of DNA/RNA nucleosides and phosphodiester linkages and/or
the
same nucleobase sequence. In other embodiments Regions B and B' may be
different. By
way of example such poly oligomeric compounds may have a structure such as:
(5' ¨ 3' or
3' ¨ 5') Conjugate-P0-0N-P0'-ON', wherein conjugate is region C, PO is region
B, PO' is
region B', and ON 1 is region A, and ON' is region A'
It should be understood that region A' may, in some embodiments, comprise
multiple further
oligomeric compounds (such as a further 2 or 3 oligomeric compounds) linked in
series (or in
parallel) via biocleavable linkers, for example: Conjugate PO ON PO ON' PO"-
ON", or
Conjugate-P0-ON[PO-0Nin, wherein n may, for example be 1, 2 or 3, and each ON'
may
be the same or different, and if different may have the same or different
targets.
Multi conjugate oligomeric compounds
In some embodiments, the oligomeric compound may be conjugated to more than
one
conjugate region (region C), which may be the same or different. For example
the
oligomeric compound of the invention may have a structure as follows: (5' ¨ 3'
or 3' ¨ 5')
ON-P0'-Conj1-P0"-Conj2 wherein Conj1 and conj2 are the two conjugate groups,
at least
one or both of PO or PO" are as according to region B herein, and ON is region
A. Conj1
and Conj2 may be the same or may be different. For example, in some
embodiments, one
of Conj1 and Conj2 are a carbohydrate or sterol conjugates and the other is a
lipophilic
conjugate, e.g. 5'-3' or 3' ¨ 5':ON-P0'-Palmitoyl-P0"-Chol or ON-P0'-Palmitoyl-
P0"-
GaINac
The carbohydrate conjugate moiety (represented by GalNac in the preceding
formulas (e.g.
when used as conj1 or conj2) may for example be selected from the group
consisting of
galactose, galactosamine, N-formyl-galactosamine, Nacetylgalactosamine, N-
propionyl-
galactosamine, N-n-butanoyl-galactosamine, and N-isobutanoylgalactose-amine.
The
lipophilic conjugate (e.g. when used as conj1 or conj2, and represented as
palmotoyl in the
preceding formulas) may be a hydrophobic group, such as a C16-20 hydrophobic
group, a
sterol, cholesterol. Other carbohydrate and lipophilic groups which may be
used are, for
example, disclosed herein.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
24
The Target
In some embodiment, for a non-limiting example, the oligomer of the invention
is for
use in modulating a nucleic acid (i.e. targets) selected from the group
consisting of a mRNA,
a microRNA, a IncRNA (long non-coding RNA), a snRNA, snoRNA, and a viral RNA.
Exemplary, but not limiting mRNA and microRNA targets include for example:
The genes indicated in cancer, such as Hif1-alpha, survivin, BcI2, Mc11, Her2,
androgen receptor, beta-catenin, human transforming growth factor TGF-beta2,
ras, TNF-
alpha, c-RAF, HSPs e.g. Hsp27, elF-4E (e.g. ISIS-EIF4ERõ) STAT3 (e.g. ISIS-
STAT3Rx),
clusterin (e.g. OGX-011), AurkB, AurkA, PBK, miR-155, miR-21, miR-10b, mir-34
(see
W02011088309), miR-199a, miR-182,
The mRNAs of genes involved in inflammation, e.g. ICAM-1 (e.g. Alicoforsen),
CD49d,
VLA-4 osteopontin, miR-21 (psoriasis),
Other medically relevant mRNA targets include CTGF (local fibrosis) and c-Raf-
kinase
(ocular disease). miR-29 (cardiac fibrosis), Factor XI (clotting), factor VII
(clotting) miR15
miR-159 (post-MI modeling (post-MI modeling), miR-138 (bone-loss), mir-21 (see
W012148952) and mir214 (fibrosis) ¨ see W02012012716.
Metabolic disease or disorders targets, such as Apo-B (high LDL cholesterol,
ACS),
ApoCIII (high serum TG, diabetes), Apo(a) (cardiovascular disease), FGFR4
(obesity),
GCCR (T2 diabetes), GCGR (T2 diabetes), PTP1B (12 diabetes), DGAT2 (NASH),
PCSK9
(hyperlipidaemia and related disorders), MtGPAT (obesity and NAFLD), miR-122
(high
cholesterol), miR-33 (metabolic syndrome, atherosclerosis), miR-208 (chronic
heart failure),
miR-499 (chronic heart failure), miR-378 (cardio metabolic disease), mir-143
(vascular
disease), miR-145 (vascular disease), miR-92 (peripheral arterial disease),
miR-375
(diabetes), miR-27b (diabetes), miR-34a (diabetes), miR-199a, miR-27a (heart
disease,
ischemia), miR-338 (diabetes).
Metabolic diseases include, for examples, metabolic syndrome, obesity,
hyperlipidemia, HDL/LDL cholesterol imbalance, dyslipidemias, e.g., familial
combined
hyperlipidemia (FCHL), acquired hyperlipidemia, statin-resistant
hypercholesterolemia,
coronary artery disease (CAD), and coronary heart disease (CHD).,
atherosclerosis, heart
disease, diabetes (I and/or II), NASH, acute coronary syndrome (ACS),
Viral diseases: miR-451(polycythemia), miR-122 (HCV), HBV, HCV, BKV, etc.
Severe
and rare diseases include SMN2 (spinal muscular atrophy), TTR (TTR
amyloidosis), GHr
(acromegaly), AAT (AATD associated liver disease), Dystophin (Duchennes
muscular
dystrophy).
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
In some embodiments, the oligomer of the invention targets a liver expressed
nucleic acid,
such as a liver expressed mRNA, such as PCSK9, ApoB, or MtGPAT. In some
embodiments, the oligomer of the invention targets PCSK9 mRNA. In some
embodiments,
the oligomer of the invention targets ApoB mRNA. In some embodiments, the
oligomer of
5 the invention targets a liver expressed microRNA, such as miR-122.
In some embodiments, the oligomer of the invention is capable of down-
regulating
(e.g. reducing or removing) expression of the target (e.g. target nucleic
acid). In this regards,
the oligomer of the invention can affect the inhibition of the target. In some
embodiments,
the oligomers of the invention bind to the target nucleic acid and affect
inhibition of
10 expression of at least 10% or 20% compared to the normal expression
level, more
preferably at least a 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% inhibition
compared to
the normal expression level (such as the expression level in the absence of
the oligomer(s)
or conjugate(s)). In some embodiments, such modulation is seen when using from
0.04 and
25nM, such as from 0.8 and 20nM concentration of the compound of the
invention. In the
15 same or a different embodiment, the inhibition of expression is less
than 100%, such as less
than 98% inhibition, less than 95% inhibition, less than 90% inhibition, less
than 80%
inhibition, such as less than 70% inhibition. Modulation of expression level
may be
determined by measuring protein levels, e.g. by the methods such as SDS-PAGE
followed
by western blotting using suitable antibodies raised against the target
protein. Alternatively,
20 modulation of expression levels can be determined by measuring levels of
mRNA, e.g. by
northern blotting or quantitative RT-PCR. When measuring via mRNA levels, the
level of
down-regulation when using an appropriate dosage, such as from 0.04 and 25nM,
such as
from 0.8 and 20nM concentration, is, In some embodiments, typically to a level
of from 10-
20% the normal levels in the absence of the compound, conjugate or composition
of the
25 invention.
The invention therefore provides a method of down-regulating or inhibiting the
expression of the target in a cell which is expressing the target, said method
comprising
administering the oligomer or conjugate according to the invention to said
cell to down-
regulating or inhibiting the expression of the target in said cell. Suitably
the cell is a
mammalian cell such as a human cell. The administration may occur, in some
embodiments, in vitro. The administration may occur, in some embodiments, in
vivo.
Compounds of the invention, such as the oligomers and conjugates thereof, may
be targeted
to different targets, such as mRNA or microRNA or other nucleic acid targets
which are
expressed in the liver (references to NCB! Genbank/Gene IDs are given as
examples of
26
sequences which may be targeted by the compounds of the invention).
ApoB
In some embodiments, the first region (or first and second region) forms a
single contiguous
nucleobase sequence which is complementary, to a corresponding region of an
ApoB
mRNA target (i.e. targets) ApoB-100 (NCB' Genbank ID NM_000384.2 Cl:
105990531).
Compounds of the invention which target ApoB may be used in the treatment of
acute
coronary syndrome (see W020100076248). The invention therefore provides for
the
oligomer according to the invention which targets ApoB100 for use in the
treatment of acute
coronary syndrome. The invention further provides for a method of treatment of
acute
coronary syndrome, wherein said method comprises the administration of the
oligomer of
the invention to a subject in need to said treatment.
Compounds of the invention which target ApoB may be used in the treatment
atherosclerosis. The invention therefore provides for the oligomer according
to the invention
which targets ApoB100 for use in the treatment of atherosclerosis. The
invention further
provides for a method of treatment of atherosclerosis, wherein said method
comprises the
administration of the oligomer of the invention to a subject in need to said
treatment.
Compounds of the invention which target ApoB may be used in the treatment
hypercholesterolemia or hyperlipidaemia. The invention therefore provides for
the oligomer
according to the invention which targets ApoB100 for use in the treatment of
hypercholesterolemia or hyperlipidaemia. The invention further provides for a
method of
treatment of hypercholesterolemia or hyperlipidaemia, wherein said method
comprises the
administration of the oligomer of the invention to a subject in need to said
treatment.
The invention provides for an in vivo or in vitro method for the inhibition of
ApoB in a
cell which is expressing ApoB, said method comprising administering an
oligomer or
conjugate or pharmaceutical composition according to the invention to said
cell so as to
inhibit ApoB in said cell.
Examples of LNA oligomers which may be used as the first region in the
oligomers/conjugates of the invention include, for example those disclosed in
W02007/031081, W02008/113830, W02007131238, and W02010142805.
Specific preferred compounds include the following:
5'- GsmCsaststsgsgstsastsTsmCsA -3' (SEQ ID NO 1)
5'- GsTstsgsascsascstsgsTsmC -3' (SEQ ID NO 53)
CA 2889596 2019-02-06
Av
27
Wherein capital letters are beta-D-oxy LNA units (nucleosides), lower case
letters are DNA
units, subscript s is a phosphorothioate linkage, and a superscript m before
the capital C
illustrates that all LNA cytosines are 5-methyl cytosine. Compounds of the
invention
targeting ApoB may be conjugated to a conjugate which targets the oligomer to
the liver, as
disclosed herein, such as a carbohydrate or lipophilic conjugate, such as a
GalNac
conjugate or a sterol conjugate (e.g. cholesterol or tocopherol). The
conjugate may be, for
example, at the 5' end or the 3' end of the oligomer compound (suitably via
region B). Other
oligomers which target ApoB are disclosed in W003/011887, W004/044181,
W02006/020676, W02007/131238, W02007/031081, and W02010142805.
PCSK9
In some embodiments, the first region (or first and second region) forms a
single contiguous
nucleobase sequence which is complementary, to a corresponding region of a
PCSK9
mRNA target (i.e. targets), such as the human PCSK9 mRNA: NCBI Genbank ID
NM_174936.3 GI:299523249.
The invention provides for an oligomer according to the invention which
targets
PCSK9, for use as a medicament, such as for the treatment of
hypercholesterolemia or
related disorder, such as a disorder selected from the group consisting of
atherosclerosis,
hyperlipidaemia, hypercholesterolemia, familiar hypercholesterolemia e.g. gain
of function
mutations in PCSK9, HDL/LDL cholesterol imbalance, dyslipidemias, e.g.,
familial
hyperlipidaemia (FCHL), acquired hyperlipidaemia, statin-resistant
hypercholesterolemia,
coronary artery disease (CAD), and coronary heart disease (CHD).
The invention provides for the use of an oligomer of the invention which
targets
PCSK9, for the manufacture of a medicament for the treatment of
hypercholesterolemia or a
related disorder, such as a disorder selected from the group consisting of
atherosclerosis,
hyperlipidaemia, hypercholesterolemia, familiar hypercholesterolemia e.g. gain
of function
mutations in PCSK9, HDL/LDL cholesterol imbalance, dyslipidemias, e.g.,
familial
hyperlipidaemia (FCHL), acquired hyperlipidaemia, statin-resistant
hypercholesterolemia,
coronary artery disease (CAD), and coronary heart disease (CHD).
The invention provides for a method of treating hypercholesterolemia or a
related
disorder, such as a disorder selected from the group consisting
atherosclerosis,
hyperlipidaemia, hypercholesterolemia, familiar hypercholesterolemia e.g. gain
of function
mutations in PCSK9, HDL/LDL cholesterol imbalance, dyslipidemias, e.g.,
familial
hyperlipidaemia (FCHL), acquired hyperlipidaemia, statin-resistant
hypercholesterolemia,
coronary artery disease (CAD), and coronary heart disease (CHD), said method
comprising
CA 2889596 2019-02-06
28
administering an effective amount of an oligomer according to the invention
which targets
PCSK9, to a patient suffering from, or likely to suffer from
hypercholesterolemia or a related
disorder.
The invention provides for an in vivo or in vitro method for the inhibition of
PCSK9 in a
cell which is expressing PCSK9, said method comprising administering an
oligomer
according to the invention which targets PCSK9 to said cell so as to inhibit
PCSK9 in said
cell.
The following is an oligomer which targets the human PCSK9 mRNA, and may be
used as
region A in the compounds of the invention.
.. 5'- T5G5mC5t5a5c5a5asasasc5mC5mCsA-3' (SEO ID NO 37)
Wherein capital letters are beta-D-oxy LNA units (nucleosides), lower case
letters are DNA
units, subscript s is a phosphorothioate linkage, and a superscript m before
the capital C
illustrates that all LNA cytosines are 5-methyl cytosine. Compounds of the
invention
targeting PCSK9 may be conjugated to a conjugate which targets the oligomer to
the liver,
as disclosed herein, such as a carbohydrate or lipophilic conjugate, such as a
GalNac
conjugate or a sterol conjugate (e.g. cholesterol or tocopherol). The
conjugate may be, for
example, at the 5' end or the 3' end of the oligomer compound (suitably via
region B).
Other oligomers which target PCSK9 are disclosed as the SEQ ID NO 36 ¨ 52, and
others
are disclosed in W02008/043753, W02011/009697, W008/066776, W007/090071,
W007/146511, W007/143315, W009/148605, W011/123621, and W011133871.
miR-122
In some embodiments, the first region (or first and second region) form a
single contiguous
nucleobase sequence which is complementary, to a corresponding region of a
microRNA-
122 such as miR-122a (i.e. targets), such as the has-miR-122 sequences
(miRBase release
20: MI0000442), such as:
>hsa-mir-122 MIC000442
CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCAAACGCCAUUAUCACACUAAAUAGCU
ACUGCUAGGC
>hsa-miR-122-5p MIMATC000421
UGGAGUGUGACAAUGGUGUUUG
miR-122 has been indicated in HCV infection, where it is an essential host
factor required for
maintenance of the infection. Inhibitors of miR-122 may therefore be used in
the treatment
of hepatitis C infection.
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
29
Compounds of the invention which target miR-122 may be used in the treatment
of HCV
infection. The invention therefore provides for the oligomer according to the
invention which
targets miR-122 for use in the treatment of HCV infection. The invention
further provides for
a method of treatment of HCV infection, wherein said method comprises the
administration
of the oligomer of the invention to a subject in need to said treatment.
The invention provides for the use of an oligomer of the invention which
targets miR-
122, for the manufacture of a medicament for the treatment of HCV infection.
The invention provides for a method of treating HCV infection, said method
comprising administering an effective amount of an oligomer according to the
invention
which targets miR-122, to a patient suffering from HCV infection.
The invention provides for an in vivo or in vitro method for the inhibition of
miR-122 in
a cell which is expressing miR-122, such as an HCV infected cell or a HCV
replicon
expressing cell, said method comprising administering an oligomer or conjugate
or
pharmaceutical composition according to the invention to said cell so as to
inhibit miR-122 in
said cell.
miR-122 has also been indicated in cholesterol metabolism, and it has been
suggested that inhibition of miR-122 may be used for a treatment to reduce
plasma
cholesterol levels (Esau, Cell Metab. 2006 Feb;3(2):87-98.)
Inhibitors of miR-122 may therefore be used in a treatment to reduce plasma
cholesterol
levels, or in the treatment of a metabolic disease associated with elevated
levels of
cholesterol (related disorders), such as indications selected from the group
consisting of
atherosclerosis, hyperlipidaemia, hypercholesterolemia, familiar
hypercholesterolemia,
dyslipidemias, coronary artery disease (CAD), and coronary heart disease (CHD)
Compounds of the invention which target miR-122 may be used in the treatment
of elevated
cholesterol levels or related disorders. The invention therefore provides for
the oligomer
according to the invention which targets miR-122 for use in the treatment of
elevated
cholesterol levels or related disorders. The invention further provides for a
method of
treatment of elevated cholesterol levels or related disorders, wherein said
method comprises
the administration of the oligomer of the invention to a subject in need to
said treatment.
The invention provides for the use of an oligomer of the invention which
targets miR-
122, for the manufacture of a medicament for the treatment of elevated
cholesterol levels or
related disorders.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
The invention provides for a method of treating elevated cholesterol levels or
related
disorders, said method comprising administering an effective amount of an
oligomer
according to the invention which targets miR-122, to a patient suffering from
said disorder.
The invention provides for an in vivo or in vitro method for the inhibition of
miR-122 in
5 a cell which is expressing miR-122, such as an HCV infected cell or a HCV
replicon
expressing cell, said method comprising administering an oligomer or conjugate
or
pharmaceutical composition according to the invention to said cell so as to
inhibit miR-122 in
said cell.
Oligomer's targeting miR-122 are disclosed in W02007/112754, W02007/112753,
10 W02009/043353, and may be mixmers, such as SP03649, also referred to as
miravirsen
see below, or a tiny LNA, such as those disclosed in W02009/043353 (e.g. 5'-
ACACTCC-
3', 5'-CACACTCC-3', 5'-TCACACTCC-3', where capital letters are beta-D_oxy LNA,
fully
phosphorothioate and LNA C are 5-methyl cytosine). In some embodiments, the
miR-122
targeting oligomers have a length of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or
18 (or 19, 20, 21,
15 22 or 23 nucleotides) in length. In some embodiments, the miR-122
targeting oligomers a
sequence which is fully complementary to miR-122 as measured across the length
of the
oligomer, and preferably include the sequence 5'-CACACTCC-3'. In some
embodiments,
the oligomer targeting a microRNA such as miR-122, is complementary to a
corresponding
region of the microRNA accorss the length of the oligomer and in some
embodiments the 3'
20 nucleoside of the oligomer is compelmentary to (i.e. aligns to) the
first, second, third or
fourth 5' nucleotides of the microRNA, such as miR-122, such as the second 5'
nucleotide of
the microRNA, such as miR-122.
The following is an oligomers which targets the has-miR-122 (human miR-122),
and may be
used as region A in the compounds of the invention.
25 Miravirsen: 5'- mCscsAststsGsTscsasmC.asmCstsmCsmC -3'
Other miR-122 targeting compounds which may be used in the context of the
present
invention (region A) are disclosed in W02007/027894, W02007/027775.
MtGPAT: (NCBI gene ID 57678 - Chromosome:
10;NC_000010.10(113907971..113975153, complement) Mitochondrial glycerol-3-
30 phosphate acyltransferase 1 (EC 2.3.1.15, also known as GPAT1, mtGPAT1,
GPAM,
mtGPAM) plays a major role in hepatic triglyceride formation, where high
levels of mtGPAT1
activity results in fatty liver (hepatosteatosis) whereas the absence of
mtGPAT1 results in
low levels of liver triglycerides and stimulated fatty acid oxidation (see
W02010/000656
which discloses oligomers which target mtGPAT. Compounds of the invention
which target
31
MtGPAT may be used to treat conditions such as being overweight, obesity,
fatty liver,
hepatosteatosis, non alcoholic fatty liver disease (NAFLD), non alcoholic
steatohepatitis
(NASH), insulin resistance, diabetes such as non insulin dependent diabetes
mellitus
(NIDDM)
FactorVII (NCBI Gene ID 2155, NCBI J02933.1 GI:180333, or EU557239.1
GI:182257998). The oligomer or conjugate of the invention may target
FactorVII, and
thereby inhibit the production of Factor VII, a key component of the tissue
factor coagulation
pathway. Compounds of the invention which target FactorVII may be used for the
treatment
or prevention of thrombotic diseases (typically without causing bleeding) and
as heart attack,
.. stroke and blood clots, or inflammatory conditions. WO 2013/119979 and WO
2012/174154
disclose oligonucleotide compounds which target FVII
which may be incorporated into the conjugates of the present invention.
Factor XI (NCBI Genbank BC122863.1 GI:114108211)- Factor XI, a clotting factor
that is
produced in the liver. High levels of Factor XI are linked to heart attack,
stroke and blood
clots. WO 2013/070771 discloses oligonucleotide
compounds which target XI which may be incorporated into the conjugates of the
present
invention. Compounds of the invention which target FactorXI may be used for
the treatment
or prevention of thrombotic diseases, and as heart attack, stroke and blood
clots, or
inflammatory conditions such as arthritis and colitis.
ApoCIII (NCB' Genbank B0027977.1 GI:20379764) a protein that regulates
triglyceride
metabolism in blood. High levels of apoC-III are linked to inflammation, high
triglycerides,
atherosclerosis and metabolic syndrome. Compounds of the invention which
target ApoCIII
may be used to reduce serum triglyceride levels or in the treatment of e.g.
familial
chylomicronemia syndrome and severely high triglycerides either as a single
agent or in
.. combination with other triglyceride-lowering agents. W011085271
discloses oligonucleotide compounds which target ApoCIII which may be
incorporated into the conjugates of the present invention.
Apo(a) (NCBI Genbank NM_005577.2 GI:116292749) inhibits the production of
apo(a) in
the liver and is designed to offer a direct approach to reducing Lp(a), an
independent risk
factor for cardiovascular disease. High levels of Lp(a) are associated with an
increased risk
of atherosclerosis, coronary heart disease, heart attack and stroke. Lp(a)
promotes
premature plaque buildup, or atherosclerosis, in arteries. Compounds of the
invention which
target Apo(a) may be used in the treatment of e.g. atherosclerosis and
coronary heart
CA 2889596 2019-02-06
32
disease. W005000201 and W003014307 discloses
oligonucleotide compounds which target apolipoprotein (a) which may be
incorporated into
the conjugates of the present invention.
Hepatitis B (HBV) (see for example NCB! D23684.1 0I:560092; D23683.1 GI:
560087;
D23682.1 GI: 560082; D23681.1 GI: 560077; D23680.1 GI: 560072; D23679.1 GI:
560067;
D23678.1 GI: 560062; D23677.1 01: 560057).
Oligomers which target HBV are well known in the art, for example see,
W096/03152,
W097/03211, W02011/052911, W02012/145674, W02012/145697, W02013/003520 and
W02013/159109.
Compounds of the invention which target HBV may be used in the treatment HBV
infection.
The invention therefore provides for the oligomer according to the invention
which targets
HBV for use in the treatment of HBV. The invention further provides for a
method of
treatment of HBV infection, wherein said method comprises the administration
of the
oligomer of the invention to a subject in need to said treatment.
The invention provides for the oligomer or conjugate of the invention which
targets hepatitis
B (HBV) for use as a medicament, such as for the treatment hepatitis B
infection or a related
disorder.
The invention provides for the use of an oligomer or conjugate or
pharmaceutical
composition according to the invention which targets hepatitis B (HBV), for
the manufacture
of a medicament for the treatment of hepatitis B infection or a related
disorder.
The invention provides for a method of treating treatment hepatitis B
infection or a related
disorder, saki method comprising administering an effective amount of an
oligomer or
conjugate of the invention which targets HBV, to a patient infected with
Hepatitis B virus.
The invention provides for an in vivo or in vitro method for the inhibition of
HBV replication in
a cell infected with HBV, said method comprising administering an oligomer or
conjugate of
the invention which targets HBV to said cell so as to inhibit HBV replication.
An example of
an LNA oligomer which target's HBV is (as is disclosed in W02011/47312) which
may be
used as the oligomer (region A) of the invention 5'-
GsAsGsGscsastses9scsesgsmCsAsGsG ¨3'.
Further compounds are disclosed in table 1 of W02011/47312, and in
W02011/052911,
W02012/145674, W02012/145697, W02013/003520 and W02013/159109.
RG-101 is a compound which targets miR-122 and comprises a GalNac conjugate,
and is
being developed for treatment of HCV by Regulus Therapeutics.
CA 2889596 2019-02-06
114ft
33
ANGPTL3, (e.g. NCB, BC007059.1 GI: 14712025 or B0058287.1 GI: 34849466)
ANGIOPOIETIN-LIKE 3 - a protein that regulates lipid, glucose and energy
metabolism.
Humans with elevated levels of ANGPTL3 have hyperlipidemia associated with an
increased
risk of premature heart attacks, increased arterial wall thickness as well as
multiple
.. metabolic abnormalities, such as insulin resistance. In contrast, humans
with lower levels of
ANGPTL3 have lower LDL-C and triglyceride levels and a lower risk of
cardiovascular
disease. Compounds of the invention which target ANGPTL3 may be used in the
treatment
of e.g. hyperlipidemia and related disorders, metabolic disorder,
atherosclerosis, coronary
heart disease or insulin resistance. W011085271
discloses oligonucleotide compounds which target ANGPTL3 which may be
incorporated
into the conjugates of the present invention.
Glucagon receptor, or GCGR (8C112041.1 GI: 85567507; L20316.1 GI: 405189):
Glucagon is a hormone that opposes the action of insulin and stimulates the
liver to produce
glucose, particularly in type 2 diabetes. In patients with advanced diabetes,
uncontrolled
glucagon action leads to a significant increase in blood glucose levels.
Therefore,
attenuating glucagon action may have a significant glucose lowering effect in
patients with
severe diabetes. In addition, reducing GCGR produces more active glucagon-like
peptide, or
GLP-1, a hormone that preserves pancreatic function and enhances insulin
secretion.
Compounds of the invention which target GCGR may be used in the treatment of
e.g. or
insulin resistance, hyperglycemia, diabetes, such as type 1 or 2 diabetes,
preservation of
pancreatic function, and to control of blood glucose levels. W02007/134014
discloses
oligonucleotide compounds which target GCGR which may be incorporated into the
conjugates of the present invention.
Fibroblast growth factor receptor 4, or FGFR4. (NCBI Gene 2264 - NC_000005.9
(176513906..176525143) FGFR4 is expressed in the liver and fat tissues, and is
indicated in
decreasing the body's ability to store fat while simultaneously increasing fat
burning and
energy expenditure. Many anti-obesity drugs act in the brain to suppress
appetite, commonly
resulting in CNS side effects. Compounds of the invention which target FGFR4
may be
used in the treatment of e.g. or insulin resistance, hyperglycemia, diabetes,
such as type 1
or 2 diabetes, preservation of obesity (e.g. when used in combination with an
appetite-
suppressing drug), reducing body weight, and improvement in insulin
sensitivity, diabetes,
such as type 1 or 2 diabetes and to control of blood glucose levels.
W009046141 and
CA 2889596 2019-02-06
34
W012174476 disclose oligonucleotide compounds which
target FGFR4 which may be incorporated into the conjugates of the present
invention.
Diacylglycerol acyltransferase-2, or DGAT-2 (NCB' GENE ID 84649): A key
component in
the synthesis of triglycerides. The inhibition of DGAT may reduce liver fat in
patients with
Nonalcoholic Steatohepatitis (NASH), and may also be used to treat type 2
diabetes and
insulin resistance. Compounds of the invention which target DGAT-2 may be used
to treat
NASH, to reduce liver fat, to treat diabetes, such as type 2 diabetes, and
treat insulin
resistance. W005019418 and W02007136989 disclose
oligonucleotide compounds which target DGAT-2 which may be incorporated into
the
conjugates of the present invention.
Glucocorticold receptor, or GCCR (BC150257.1 GI: 152013043): Glucocorticoid
hormones affect a variety of processes throughout the body, and excessive
levels of
glucocorticoid hormones can have a detrimental effect on many of the tissues
and organs in
the body. Cushing's Syndrome is an orphan disease caused by prolonged exposure
to high
levels of glucocorticoids. If untreated, patients with Cushing's Syndrome can
develop
hypertension, diabetes and impaired immune functions and have an increased
risk of early
death. Although there are approved treatments for Cushing's Syndrome, current
medicines
are associated with significant side effects, such as hypertension and
diabetes, and there
remains a high unmet medical need for new therapies for these patients.
Compounds of the
invention which target GCCR-2 may be used to treat Cushing's Syndrome and
associated
conditions (such as those listed above). W007035759 and W02007136988
disclose oligonucleotide compounds which target GCCR
which may be incorporated into the conjugates of the present invention.
Complement component C5 (M57729.1 GI: 179982): The complement system plays a
central role in immunity as a protective mechanism for host defense, but its
dysregulation
results in serious, life-threatening complications in a broad range of human
diseases
including paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic-uremic
syndrome
(aHUS), myasthenia gravis, neuromyelitis optica, amongst others. Compounds of
the
invention which target complement component C5 may be used to treat one or
more of
these disorders. C5 is a genetically and clinically validated target; loss of
function human
mutations are associated with an attenuated immune defense against certain
infections and
intravenously administered anti-05 monoclonal antibody therapy has
demonstrated clinical
activity and tolerability in a number of complement-mediated diseases.
transmembrane
CA 2889596 2019-02-06
35
protease, serine 6 (Tmerss6) for the treatment of beta-thalassemia and iron-
overload
disorders.
Alpha-1 antitrypsin (AAT): (M11465.1 GI: 177826) Liver disease associated with
-
W013142514 disclose oligonucleotide
compounds which target MT which may be incorporated into the oligomers or
conjugates of
the present invention. Compounds of the invention which target AAT may be used
in
methods for decreasing AIAT mRNA and protein expression and treating,
ameliorating,
preventing, slowing progression, or stopping progression of fibrosis, such as,
AIATD
associated liver disease, and pulmonary disease, such as, AIATD associated
pulmonary
disease in an individual in need thereof.
Transthyretin ¨ TTR (BC005310.1 GI: 13529049) : The oligomers of the invention
which
target TTR may be used to treat transthyretin amyloidosis, or TTR amyloidosis,
a severe and
rare genetic disease in which the patient inherits a mutant gene that produces
a misfolded
form of TTR, which progressively accumulates in tissues. In patients with TTR
amyloidosis,
both the mutant and normal forms of TTR can build up as fibrils in tissues,
including heart,
peripheral nerves, and the gastrointestinal tract. The presence of TTR fibrils
interferes with
the normal functions of these tissues, and as the TTR protein fibrils enlarge
more tissue
damage occurs and the disease worsens. TTR is a carrier protein that
transports a thyroid
hormone and retinol in the blood. In patients with TTR amyloidosis, both the
mutant and
normal forms of TTR can build up as fibrils in tissue. The compounds of the
invention may
be used to treat TTR amyloidosis. See Benson et al., Amyloid. 2010
Jun;17(2):43-9, and
Ackermann et al., Amyloid. 2012 Jun;19 Suppl 1:43-4.). Antisense compounds
targeting
TTR which may be used in the oligomers or conjugates of the invention are
disclosed in
US8101743, W011139917 and W010017509.
AmInolevuIlnate synthase-1 (ALAS-1) (80011798.2 GI: 33877783; AK312566.1 GI:
164690365; NM 199166.2 GI: 362999012; NM 000688.5 GI: 362999011). ALAS1 is a
validated target for the treatment of porphyria, such as the treatment of
hepatic porphyrias
including acute intermittent porphyria (AIP). ,Compounds of the invention
which target
ALAS-1 may be used in the treatment of these disorders.
Vascular endothelial growth factor, or VEGF (GENE ID 7422, human Sequence:
Chromosome: 6; NC_000006.11 (43737946..43754224)). VEGF is indicated in
cancers.
Compounds of the invention which target VEGF may be used in the treatment of
hyperproliferative disorders, such as cancer, such as liver cancer.
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
36
Table 1 provides for a group of liver targets which may be targeted by the
compounds of the
invention, as well as the medical indication / disorder for which such
compounds may be
used to treat (such as a person suffering from the associated disorder) (See
Sehgal et al.,
Liver as a target for oligonucleotide therapeutics, J. of Hepatology 2013, In
Press).
Table 1
The compound of the invention may target a
For the treatment of a disease or
nucleic acid (e.g. mRNA encoding, or miRNA)
disorder such as
selected from the group consisting of
AA T AAT-LivD
ALDH2 Alcohol dependence
HAMP pathway Anemia or inflammation /CKD
miR-33 Atherosclerosis
Apo(a) Atherosclerosis/high Lp(a)
miR-7 Liver cancer
miR-378 Card iometabolic diseases
miR-21 Liver cancer
Myc Liver cancer
miR-122 HCV
5'UTR HCV
5'UTR & NS5B HCV
NS3 HCV
TMPRSS6 Hemochromatosis
Antithrombin III Hemophilia A, B
ApoC/1/ Hypertriglyceridemia
ANGPLT3 Hyperlipidemia
MTP Hyperlipidemia
DGA T2 NASH
ALAS1 Porphyria
Antithrombin III Rare Bleeding disorders
Serum amyloid A SAA-amyloidosis
Factor VII Thrombosis
Growth hormone receptor Acromegaly
miR-122 Hepatitis C virus
ApoB-100 Hypercholesterolemia
ApoCIII Hypertriglyceridemia
PCSK9 Hypercholesterolemia
CRP Inflammatory disorders
KSP or VEGF Liver cancer
PLK1 Liver cancer
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
37
miR-34 Liver cancer
FGFR4 Obesity
Factor IXa Thrombosis
Factor XI Thrombosis
TTR TTR amyloidosis
GCCR Type 2 diabetes
PTP-1B Type 2 diabetes
GCGR Cushing's Syndrome
Hepatic Glucose 6-Phosphate glucose homeostasis, diabetes,
type
Transporter-1 2 diabetes
Sequences
In some embodiments, the oligomers, or first region thereof, comprise a
contiguous
nucleotide sequence which corresponds to the reverse complement of a
nucleotide
sequence present in the target nucleic acid (i.e. the sequence which the
oligomer
targets).Table 3 provides a group of mRNA and miRNA targets which are in pre-
clinical or
clinical development using oligonucleotide compounds for the associated
indication, and are
therefore suitable for targeting with the compounds of the present invention.
In some embodiments the target is selected from the group consisting of: miR-
122
,ApoB-100 ,ApoCIII ,PCSK9 ,CRP ,KSP, VEGF ,PLK1 ,miR-34 ,FGFR4 ,Factor IXa
,Factor
XI ,TTR ,GCCR ,PTP-1B ,GCGR, AAT ,ALDH2 ,HAMP pathway,miR-33 ,Apo(a) ,miR-7
,miR-378 ,miR-21 ,Myc ,miR-122 , the HCV genome such as the HCV 5'UTR or HCV
NS5B
RNA or NS3 RNA ,TMPRSS6 ,Antithrombin III ,ApoCIII ,ANGPLT3 ,MTP ,DGAT2 ,ALAS1
,Antithrombin III ,Serum amyloid A and Factor VII.
In some embodiments, the contiguous nucleotide sequence comprises no more than
a
single mismatch when hybridizing to the target sequence.
In determining the degree of "complementarity" between oligomers of the
invention (or
regions thereof) and the target region of the nucleic acid, such as those
disclosed herein, the
degree of "complementarity" (also, "homology" or "identity") is expressed as
the percentage
identity (or percentage homology) between the sequence of the oligomer (or
region thereof)
and the sequence of the target region (or the reverse complement of the target
region) that
best aligns therewith. The percentage is calculated by counting the number of
aligned
bases that are identical between the 2 sequences, dividing by the total number
of contiguous
monomers in the oligomer, and multiplying by 100. In such a comparison, if
gaps exist, it is
preferable that such gaps are merely mismatches rather than areas where the
number of
monomers within the gap differs between the oligomer of the invention and the
target region.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
38
As used herein, the terms "homologous" and "homology" are interchangeable with
the
terms "identity" and "identical".
The terms "corresponding to" and "corresponds to" refer to the comparison
between
the nucleotide sequence of the oligomer (i.e. the nucleobase or base sequence)
or
contiguous nucleotide sequence (a first region) and the equivalent contiguous
nucleotide
sequence of a further sequence selected from either i) a sub-sequence of the
reverse
complement of the nucleic acid target. Nucleotide analogues are compared
directly to their
equivalent or corresponding nucleotides. A first sequence which corresponds to
a further
sequence under i) or ii) typically is identical to that sequence over the
length of the first
sequence (such as the contiguous nucleotide sequence) or, as described herein
may, in
some embodiments, is at least 80% homologous to a corresponding sequence, such
as at
least 85%, at least 90%, at least 91%, at least 92%at least 93%, at least 94%,
at least 95%,
at least 96% homologous, such as 100% homologous (identical).
The terms "corresponding nucleotide analogue" and "corresponding nucleotide"
are
intended to indicate that the nucleotide in the nucleotide analogue and the
naturally
occurring nucleotide are identical. For example, when the 2-deoxyribose unit
of the
nucleotide is linked to an adenine, the "corresponding nucleotide analogue"
contains a
pentose unit (different from 2-deoxyribose) linked to an adenine.
The terms "reverse complement", "reverse complementary" and "reverse
complementarity" as used herein are interchangeable with the terms
"complement",
"complementary" and "complementarity".
The contiguous nucleobase sequence of the oligomer (first region or first and
second
region) may therefore be complementary to a target, such as those referred to
herein.
In some embodiments, the first region or first and second region form a single
contiguous nucleobase sequence which is complementary to a region of a mRNA
target,
such as those referred to herein, including, for example, ApoB-100
(NM_000384.2
GI:105990531 or PCSK9 (NM 174936.3 GI:299523249).
Length
The oligomers may comprise or consist of a contiguous nucleotide sequence of a
total
of 8, 9, 10,11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26,
27, 28, 29, 30, 31,
32, 33, 34 and 35 contiguous nucleotides in length.
In some embodiments, the oligomers comprise or consist of a contiguous
nucleotide
sequence of a total of from 10- 22, such as 12- 18, such as 13- 17 or 12- 16,
such as
13, 14, 15, 16 contiguous nucleotides in length.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
39
In some embodiments, the oligomers comprise or consist of a contiguous
nucleotide
sequence of a total of 10, 11, 12, 13, or 14 contiguous nucleotides in length.
In some embodiments, the oligomer according to the invention consists of no
more
than 22 nucleotides, such as no more than 20 nucleotides, such as no more than
18
.. nucleotides, such as 15, 16 or 17 nucleotides. In some embodiments the
oligomer of the
invention comprises less than 20 nucleotides. It should be understood that
when a range is
given for an oligomer, or contiguous nucleotide sequence length it includes
the lower an
upper lengths provided in the range, for example from (or between) 10 ¨ 30,
includes both
and 30.
10 Nucleosides and Nucleoside analogues
The term "nucleotide" as used herein, refers to a glycoside comprising a sugar
moiety
(or analogue thereof), a base moiety and a covalently linked group (linkage
group), such as
a phosphate or phosphorothioate internucleotide linkage group, and covers both
naturally
occurring nucleotides, such as DNA or RNA, and non-naturally occurring
nucleotides
comprising modified sugar and/or base moieties, which are also referred to as
"nucleotide
analogues" herein. Herein, a single nucleotide (unit) may also be referred to
as a monomer
or nucleic acid unit.
It will be recognized that in the context of the present invention the term
nucleoside
and nucleotide are used to refer to both naturally occurring
nucleotides/sides, such as DNA
.. and RNA, as well as nucleotide/side analogues.
In field of biochemistry, the term "nucleoside" is commonly used to refer to a
glycoside
comprising a sugar moiety and a base moiety, and may therefore be used when
referring to
the nucleotide units, which are covalently linked by the intemucleoside
linkages between the
nucleotides of the oligomer. In the field of biotechnology, the term
"nucleotide" is often used
to refer to a nucleic acid monomer or unit, and as such in the context of an
oligonucleotide
may refer to the base ¨ such as the "nucleotide sequence", typically refer to
the nucleobase
sequence (i.e. the presence of the sugar backbone and intemucleoside linkages
are
implicit). Likewise, particularly in the case of oligonucleotides where one or
more of the
internucleoside linkage groups are modified, the term "nucleotide" may refer
to a
"nucleoside" for example the term "nucleotide" may be used, even when
specifying the
presence or nature of the linkages between the nucleosides.
As one of ordinary skill in the art would recognize, the 5' terminal
nucleotide of an
oligonucleotide does not comprise a 5' intemucleoside linkage group, although
may or may
not comprise a 5' terminal group.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
Non-naturally occurring nucleotides include nucleotides which have modified
sugar
moieties, such as bicyclic nucleotides or 2' modified nucleotides, such as 2'
substituted
nucleotides.
"Nucleotide analogues" are variants of natural nucleotides, such as DNA or RNA
5 nucleotides, by virtue of modifications in the sugar and/or base
moieties. Analogues could
in principle be merely "silent" or "equivalent" to the natural nucleotides in
the context of the
oligonucleotide, i.e. have no functional effect on the way the oligonucleotide
works to inhibit
target gene expression. Such "equivalent" analogues may nevertheless be useful
if, for
example, they are easier or cheaper to manufacture, or are more stable to
storage or
10 manufacturing conditions, or represent a tag or label. Preferably,
however, the analogues
will have a functional effect on the way in which the oligomer works to
inhibit expression; for
example by producing increased binding affinity to the target and/or increased
resistance to
intracellular nucleases and/or increased ease of transport into the cell.
Specific examples of
nucleoside analogues are described by e.g. Freier & Altmann; Nucl. Acid Res.,
1997, 25,
15 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2),
293-213, and in
Scheme 1:
bB
0 B 0-131 0 -11H3
o-\ 0 \t
O'S- 0=p-0- 01-0. 0 0 -
Phosphorthioate 2-0-Methyl T-MOE 2'-Pluoro
0 1,13
0
,5107,..\71-9 r5,074.- 0
N
01-0- \Th
N/I2
2-AT HNA CeNA PNA
0¨ B
,B
0=P¨N
0-P-0-
Morpholino 613
24-ANA 3'-Phosphoramidate
2'-(3-hydroxy)propyl
B
0
0=P¨BF13-
Boranophosphates
Scheme
41
The oligomer may thus comprise or consist of a simple sequence of natural
occurring
nucleotides ¨ preferably 2'-deoxynucleotides (referred here generally as
"DNA"), but also
possibly ribonucleotides (referred here generally as "RNA"), or a combination
of such
naturally occurring nucleotides and one or more non-naturally occurring
nucleotides, i.e.
nucleotide analogues. Such nucleotide analogues may suitably enhance the
affinity of the
oligomer for the target sequence.
Examples of suitable and preferred nucleotide analogues are provided by
W02007/031091 or are referenced therein. Other nucleotide analogues which may
be used
in the oligomer of the invention include tricyclic nucleic acids, for example
please see
W02013154798 and W02013154798.
Incorporation of affinity-enhancing nucleotide analogues in the oligomer, such
as LNA
or 2'-substituted sugars, can allow the size of the specifically binding
oligomer to be
reduced, and may also reduce the upper limit to the size of the oligomer
before non-specific
or aberrant binding takes place.
Oligomeric compounds, such as antisense oligonucleotides, such as the
compounds
referred to herein, including region A, and in some optional embodiments,
region B, may
contain one or more nucleosides wherein the sugar group has been modified.
Such sugar
modified nucleosides (nucleoside analogues) may impart enhanced nuclease
stability,
increased binding affinity, or some other beneficial biological property to
the antisense
compounds. In some embodiments, nucleosides comprise a chemically modified
ribofiiranose ring moiety.
In some embodiments, the oligomer, or first region thereof, comprises at least
one,
such as at least 2, at least 3, at least 4, at least 5, at least 6, at least
7, at least 8, at least 9,
at least 10, at least 11, at least 12, at least 13, at least 14, at least 15,
at least 16, at least
17, at least 18, at least 19, at least 20, at least 21, at least 22, at least
23, at least 24 or 25
nucleoside analogues, such as sugar modified nucleoside analogues.
Bicyclic nucleoside analogues include nucleoside analogues which comprise a
bridge
(or biradical) linking the second and forth carbon of the ribose ring, (04*-
02* bridge or
biradical). The presence of the biradical between the 2"d and 4`h carbon locks
the ribose into
a 3' endo- (north) confirmation, and as such bicyclic nucleoside analogues
with a C2*-C4"
biradical are often referred to as Locked nucleic acid (LNA). In some
embodiments the
nucleoside analogues are (optionally independently selected from the group
consisting of
bicyclic nucleoside analogues (such as LNA), and/or 2' substituted nucleoside
analogues,
such as (optionally independently) selected from the group consisting of 2'-0-
alkyl-RNA
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195
PCT/EP2013/073858
42
units, 2'-0Me-RNA units, 2'-amino-DNA units, 2'-AP, 2'-FANA, 2'-(3-
hydroxy)propyl, and 2'-
fluoro-DNA units, and/or other (optionally) sugar modified nucleoside
analogues such as
morpholino, peptide nucleic acid (PNA), CeNA, unlinked nucleic acid (UNA),
hexitol nucleoic
acid (HNA). bicyclo-HNA (see e.g. W02009/100320), In some embodiments, the
nucleoside
analogues increase the affinity of the first region for its target nucleic
acid (or a
complementary DNA or RNA sequence).
In some embodiments, the oligomer comprises at least one bicyclic nucleotide
analogue, such as LNA. In some embodiments, the first region comprises of at
least one
bicyclic nucleoside analogues (e.g. LNA) and/or 2'substituted nucleoside
analogues. In
some embodiments, the nucleoside analogues present in the oligomer all
comprise the
same sugar modification. In some embodiments, at least one nucleoside analogue
present
in the first region is a bicyclic nucleoside analogue, such as at least 2, at
least 3, at least 4,
at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at
least 11, at least 12, at
least 13, at least 14, at least 15, at least 16, for example all nucleoside
analogues (except
the DNA and or RNA nucleosides of region B) are sugar modified nucleoside
analogues,
such as such as bicyclic nucleoside analogues, such as LNA, e.g. beta-D-X-LNA
or alpha-L-
X-LNA (wherein X is oxy, amino or thio), or other LNAs disclosed herein
including, but not
limited to,(R/S) cET, cM0E or 5'-Me-LNA.
Examples of chemically modified ribofiiranose rings include, without
limitation, addition
of substituent groups (including 5' and 2' substituent groups); bridging of
non-geminal ring
atoms to form bicyclic nucleic acids (BNA); replacement of the ribosyl ring
oxygen atom with
S, N(R), or C(R1)(R2) (R = H, Ci -02 alkyl or a protecting group); and
combinations thereof.
Examples of chemically modified sugars include, 2'-F-5'-methyl substituted
nucleoside (see,
PCT International Application WO 2008/101157, published on 8/21/08 for other
disclosed 5',
2'-bis substituted nucleosides), replacement of the ribosyl ring oxygen atom
with S with
further substitution at the 2'-position (see, published U.S. Patent
Application
U52005/0130923, published on June 16, 2005), or, alternatively, 5'-
substitution of a BNA
(see, PCT International Application WO 2007/134181, published on 11/22/07,
wherein LNA
is substituted with, for example, a 5'-methyl or a 5'-vinyl group).
Examples of nucleosides having modified sugar moieties include, without
limitation,
nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH3, and
2'-0(0H2)2 0
CH3 substituent groups. The substituent at the 2' position can also be
selected from allyl,
amino, azido, thio, 0-allyl, 0-01-010 alkyl, 00F3, 0 (0H2)2S0H3, 0 (0H2)2- 0 -
N(Rm)(Rn),
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
43
and 0 -0H2-C(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H or
substituted
or unsubstituted 01-010 alkyl.
As used herein, "bicyclic nucleosides" refer to modified nucleosides
comprising a
bicyclic sugar moiety. Examples of bicyclic nucleosides include, without
limitation,
nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms.
In some
embodiments, compounds provided herein include one or more bicyclic
nucleosides wherein
the bridge comprises a 4' to 2' bicyclic nucleoside. Examples of such 4' to 2'
bicyclic
nucleosides, include, but are not limited to, one of the formulae: 4'-(CH2)- 0
-2' (LNA); 4'-
(CH2)-S-2'; 4'-(CH2)2- 0 -2' (ENA); 4'-CH(CH3)- 0 -2' and 4'-CH(CH20CH3)-0-2*,
and
analogs thereof (see, U.S. Patent 7,399,845, issued on July 15, 2008); 4'-
C(0H3)(0H3)-0-2',
and analogs thereof (see, published PCT International Application
W02009/006478,
published January 8, 2009); 4'-0H2-N(OCH3)-2', and analogs thereof (see,
published PCT
International Application W02008/150729, published December 11, 2008); 4'-CH2-
0-
N(CH3)-2' (see, published U.S. Patent Application U52004/0171570, published
September
2, 2004); 4'-CH2-N(R)- 0 -2', wherein R is H, 01-010 alkyl, or a protecting
group (see, U.S.
Patent 7,427,672, issued on September 23, 2008); 4'-0H2-C(H)(CH3)-2' (see,
Chattopadhyaya, et at, J. Org. Chem.,2009, 74, 118-134); and 4'-CH2-C(=CH2)-
2', and
analogs thereof (see, published PCT International Application WO 2008/154401,
published
on December 8, 2008). Also see, for example: Singh et al., Chem. Commun.,
1998, 4, 455-
456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al.,
Proc. Natl. Acad.
Sci. U. S. A., 2000, 97, 5633-5638; Kumar et at., Bioorg. Med. Chem. Lett.,
1998, 8, 2219-
2222; Singh et at., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al.,
J. Am. Chem.
Soc, 129(26) 8362-8379 (Jul. 4,2007); Elayadi et al., Curr. Opinion Invens.
Drugs, 2001,2,
558-561; Braasch et al., Chem. Biol, 2001, 8, 1-7; Oram et at, Curr. Opinion
Mol. Ther.,
2001, 3, 239-243; U.S. Patent Nos U.S. 6,670,461, 7,053,207, 6,268,490,
6,770,748,
6,794,499, 7,034,133, 6,525,191, 7,399,845; published PCT International
applications WO
2004/106356, WO 94/14226, WO 2005/021570, and WO 2007/134181; U.S. Patent
Publication Nos. U52004/0171570, U52007/0287831, and U52008/0039618; and U.S.
Patent Serial Nos. 12/129,154, 60/989,574, 61/026,995, 61/026,998, 61/056,564,
61/086,231, 61/097,787, and 61/099,844; and PCT International Application Nos.
PCT/US2008/064591, PCT/US2008/066154, and PCT/US2008/068922. Each of the
foregoing bicyclic nucleosides can be prepared having one or more
stereochemical sugar
configurations including for example a-L-ribofuranose and beta -D-ribofuranose
(see PCT
international application PCT DK98/00393, published on March 25, 1999 as WO
99/14226).
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
44
In some embodiments, bicyclic sugar moieties of BNA nucleosides include, but
are not
limited to, compounds having at least one bridge between the 4' and the 2'
position of the
pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or
from 2 to 4
linked groups independently selected from - [CiRaX1Rb)]õ-, -C(Ra)=C(Rb), -
C(Ra)=N-, -
C(=NRa)-, -C(=0)-, -C(=S)-, -0-, -Si(Ra)2-, -S(=0)x-, and -N(Ra)-; wherein:
xis 0, 1, or 2; n
is 1, 2, 3, or 4; each Ra and Rb is, independently, H, a protecting group,
hydroxyl, C1-012
alkyl, substituted C1-C12 alkyl, C2-0i2 alkenyl, substituted C2-012 alkenyl,
02-Ci2 alkynyl,
substituted 02-012 alkynyl, 05-020 aryl, substituted 05-C20 aryl, heterocycle
radical,
substituted heterocycle radical, heteroaryl, substituted heteroaryl, 05-07
alicyclic radical,
substituted C5-C7 alicyclic radical, halogen, 0J1, NJ1J2, SJi, N3, COOJi, acyl
(C(=0)- H),
substituted acyl, CN, sulfonyl (S(=0)2-J1), or sulfoxyl (S(=0)-J1); and each
J1 and J2 is,
independently, H, 01-C6 alkyl, substituted 01-C12alkyl, 02-012 alkenyl,
substituted C2-012
alkenyl, 02-012 alkynyl, substituted 02-C12 alkynyl, 05-020 aryl, substituted
05-C2o aryl, acyl
(C(=0)- H), substituted acyl, a heterocycle radical, a substituted heterocycle
radical, 01-012
aminoalkyl, substituted 01-012 aminoalkyl, or a protecting group.
In some embodiments, the bridge of a bicyclic sugar moiety is, -[C(Ra)(RID)]n-
, -
[C(Ra)(Rb)ln- 0 -, -C(RaRb)-N(R)- 0 - or, -C(RaRb)- 0 -N(R)-. In some
embodiments, the
bridge is 4'-CH2-2', 4'-(CH2)2-2', 4'- (CH2)3-2', 4'-CH2- 0 -2', 4*-(CH2)2- 0 -
2', 4'-CH2- 0 -
N(R)-2', and 4'-0H2-N(R)- 0 -2'-, wherein each R is, independently, H, a
protecting group, or
01-012 alkyl.
In some embodiments, bicyclic nucleosides are further defined by isomeric
configuration. For example, a nucleoside comprising a 4'-2' methylene-oxy
bridge, may be in
the a-L configuration or in the beta - D configuration. Previously, a-L-
methyleneoxy (4'-CH2-
0-2') BNA's have been incorporated into antisense oligonucleotides that showed
antisense
activity (Frieden et al, Nucleic Acids Research, 2003, 21, 6365- 6372).
In some embodiments, bicyclic nucleosides include, but are not limited to, (A)
a-L-
Methyleneoxy (4'-0H2-0-2') BNA, (B) beta -D-Methyleneoxy (4'-CH2-0-2') BNA,
(C)
Ethyleneoxy (4'-(CH2)2-0-2') BNA, (D) Aminooxy (4'-0H2-0-N(R)-2') BNA, (E)
Oxyamino (4'-
CH2-N(R)-0-2') BNA, (F), Methyl(methyleneoxy) (4'-CH(CH3)-0-2') BNA, (G)
methylene-thio
(4'-CH2-S-2') BNA, (H) methylene- amino (4'-CH2-N(R)-2') BNA, (I) methyl
carbocyclic (4'-
CH2-CH(CH3)-2') BNA, and (J) propylene carbocyclic (4'-(CH2)3-2') BNA as
depicted below.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
1-40jBx iRcair 13X
., icTO
,0-- Bx
0 Bx
..-.s
(11) N
..:0 Bx i¨X.C4iNex
"-' (G) . \R
i 1713
(I)
i 0 Bx
l'*v (3)
wherein Bx is the base moiety and R is, independently, H, a protecting group
or C1-C2 alkyl.
odiments, bicyclic nucleoside having Formula I:
In certain einb(
Ta-0 Bx
0
Q--,-..
a..õ,,,,..Qe
0 Qb
I
Tb 1
5
wherein:
Bx is a heterocyclic base moiety;
-QS-Qb-QC- is ¨CH2-N(Rc)-CH2-, -C(=0)-N(R,)-CH2-, -CH2-0-N(Rc)-, -CH2-N(Rc)-0-
, or -
N(Rc)-0-CH2;
10 Rc is C1-Ci2 alkyl or an amino protecting group; and
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
46
Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugate
group, a
reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a
support
medium.
In some embodiments, bicyclic nucleoside having Formula II:
Ta-0 0 Bx
Za 0
Tb IIwherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugate
group, a
reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a
support
medium; Za is 01-06 alkyl, C2-06 alkenyl, 02-C6 alkynyl, substituted C1-06
alkyl, substituted
02-06alkenyl, substituted 02-06alkynyl, acyl, substituted acyl, substituted
amide, thiol, or
substituted thio.
In some embodiments, each of the substituted groups is, independently, mono or
poly
substituted with substituent groups independently selected from halogen, oxo,
hydroxyl, OJc,
NJ d, SJc, N3, OC(=X)Jc, and NJeC(=X)NJcJd, wherein each Jc, acl, and Je is,
independently,
H, C1-C6 alkyl, or substituted 01-C6alkyl and X is 0 or NJc.
In some embodiments, bicyclic nucleoside having Formula III:
1_11. R1,601 4.4.41.1.111. 4.'1 I l.l.t.),A4,11-3
Ta
0
o B
Zb x
9 `"-(2)
wherein:
Bx is a heterocyclic base moiety;
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
47
Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugate
group, a
reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a
support
medium;
Rd is C1-06 alkyl, C2-06 alkenyl, C2-C6 alkynyl, substituted C1-06 alkyl,
substituted C2-06
alkenyl, substituted 02-C6 alkynyl, or substituted acyl (C(=0)-).
In some embodiments, bicyclic nucleoside having Formula IV:
qa qb
Ta-0 0 Bx
--Tb
qc
qd
IV
ORd
wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently H, a hydroxyl protecting group, a conjugate
group, a
reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a
support
medium;
Rd is Ci-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6
alkenyl, C2-C6
alkynyl, substituted C2-C6 alkynyl; each qb, qb and qd is, independently, H,
halogen, 01-C6
alkyl, substituted C1-C6 alkyl, C2-Ce alkenyl, substituted C2-C6 alkenyl, C2-
C6 alkynyl, or
substituted C2-C6 alkynyl, C1-C6 alkoxyl, substituted Q- C6 alkoxyl, acyl,
substituted acyl, C1-
06 aminoalkyl, or substituted 01-C6 aminoalkyl;
In some embodiments, bicyclic nucleoside having Formula V:
qa qb rõ
Ta -0 Bx
0¨Tb
qe
qf
0
V
wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugate
group, a
reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a
support
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
48
medium; qa, qh, q, and qf are each, independently, hydrogen, halogen, 01-C12
alkyl,
substituted 01-012 alkyl, 02- 012 alkenyl, substituted 02-C12 alkenyl, 02-012
alkynyl,
substituted C2-012 alkynyl, 01-012 alkoxy, substituted C1-C12 alkoxy, OJ, SJ,
SOJi, S024
NJ,Jk, N3, CN, C(=0)0JJ, C(=0)NJ,Jk, C(=0)JJ, 0-C(=0)NJ,Jk, N(H)C(=NH)NJ,Jk,
N(H)C(=0)NJ;Jk or N(H)C(=S)N4k; or qe and qf together are =C(q9)(qh); q9 and
qh are each,
independently, H, halogen, Cr 012 alkyl, or substituted C1-C12 alkyl.
The synthesis and preparation of the methyleneoxy (4'-CH2-0-2') BNA monomers
adenine,
cytosine, guanine, 5-methyl-cytosine, thymine, and uracil, along with their
oligomerization,
and nucleic acid recognition properties have been described (see, e.g.,
Koshkin et al.,
Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also
described in WO
98/39352 and WO 99/14226.
Analogs of methyleneoxy (4'-0H2-0-2') BNA, methyleneoxy (4'-0H2-0-2') BNA, and
2'-thio-
BNAs, have also been prepared {see, e.g., Kumar et al., Bioorg. Med. Chem.
Lett., 1998, 8,
2219-2222). Preparation of locked nucleoside analogs comprising
oligodeoxyribonucleotide
duplexes as substrates for nucleic acid polymerases has also been described
(see, e.g.,
Wengel et al., WO 99/14226). Furthermore, synthesis of 2'-amino-BNA, a novel
comformationally restricted high-affinity oligonucleotide analog, has been
described in the
art (see, e.g., Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In
addition, 2'- amino-
and 2'-methylamino-BNA's have been prepared and the thermal stability of their
duplexes
with complementary RNA and DNA strands has been previously reported.
In some embodiments, the bicyclic nucleoside has Formula VI:
In certain embodiments, bicyc
0
'Fa-0 Bx
0¨Tb
qi
qi VI
qk ql
wherein:
Bx is a heterocyclic base moiety;
Ta and Tb are each, independently, H, a hydroxyl protecting group, a conjugate
group, a
reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a
support
medium; each qj, qj, qk and ql is, independently, H, halogen, 01-012 alkyl,
substituted 01-012
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
49
alkyl, C2-012 alkenyl, substituted 02-012 alkenyl, 02-C12alkynyl, substituted
02-C12 alkynyl,
01-012 alkoxyl, substituted 02- Ci2 alkoxyl, OJ, SJJ, SOJJ, S024, NJ;Jk, N3,
ON, C(=0)04
C(=0)NJiJk, C(=0)J1, 0-C(=0)NJ;Jk, N(H)C(=NH)NJiJk, N(H)C(=0)NJ;Jk, or
(H)C(=S)NJiJk;
and qi and q, or ql and qk together are =C(q9)(qh), wherein qg and qh are
each,
independently, H, halogen, 01-012 alkyl, or substituted 01-06 alkyl.
One carbocyclic bicyclic nucleoside having a 4'-(CH2)3-2' bridge and the
alkenyl analog,
bridge 4'- CH=CH-0H2-2', have been described (see, e.g., Freier et al, Nucleic
Acids
Research, 1997, 25(22), 4429- 4443 and Albaek et al, J. Org. Chem., 2006, 71,
7731-77
'40). The synthesis and preparation of carbocyclic bicyclic nucleosides along
with their
oligomerization and biochemical studies have also been described (see, e.g.,
Srivastava et
al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
As used herein, "4'-2' bicyclic nucleoside" or "4' to 2' bicyclic nucleoside"
refers to a bicyclic
nucleoside comprising a furanose ring comprising a bridge connecting the 2'
carbon atom
and the 4' carbon atom.
As used herein, "monocylic nucleosides" refer to nucleosides comprising
modified sugar
moieties that are not bicyclic sugar moieties. In some embodiments, the sugar
moiety, or
sugar moiety analogue, of a nucleoside may be modified or substituted at any
position.
As used herein, "2'-modified sugar" means a furanosyl sugar modified at the 2'
position. In
some embodiments, such modifications include substituents selected from: a
halide,
including, but not limited to substituted and unsubstituted alkoxy,
substituted and
unsubstituted thioalkyl, substituted and unsubstituted amino alkyl,
substituted and
unsubstituted alkyl, substituted and unsubstituted ally!, and substituted and
unsubstituted
alkynyl. In some embodiments, 2' modifications are selected from substituents
including, but
not limited to: 0[(C1-12)nO1mCI-13, 0(CH2)õNH2, 0(CH2)õ0H3, 0(CH2),,ONF12,
OCH2C(=0)N(H)0H3, and 0(CH2)hON[(CH2)CH3]2, where n and m are from 1 to about
10.
Other 2'- substituent groups can also be selected from: 01-012 alkyl;
substituted alkyl;
alkenyl; alkynyl; alkaryl; aralkyl; 0-alkaryl or 0-aralkyl; SH; 50H3; OCN; Cl;
Br; ON; CF3;
00F3; SOCH3; 5020H3; 0NO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl;
aminoalkylamino; polyalkylamino; substituted silyl; an R; a cleaving group; a
reporter group;
an intercalator; a group for improving pharmacokinetic properties; and a group
for improving
the pharmacodynamic properties of an antisense compound, and other
substituents having
similar properties. In some embodiments, modified nucleosides comprise a 2'-
MOE side
chain {see, e.g., Baker et al., J. Biol. Chem., 1997, 272, 1 1944-12000). Such
2'-MOE
substitution have been described as having improved binding affinity compared
to
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
unmodified nucleosides and to other modified nucleosides, such as 2'- 0-
methyl, 0-propyl,
and 0-aminopropyl. Oligonucleotides having the 2 -MOE substituent also have
been shown
to be antisense inhibitors of gene expression with promising features for in
vivo use {see,
e.g., Martin, P., He/v. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia,
1996, 50, 168-
5 .. 176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann
et al.,
Nucleosides Nucleotides, 1997, 16, 917-926).
As used herein, a "modified tetrahydropyran nucleoside" or "modified THP
nucleoside"
means a nucleoside having a six-membered tetrahydropyran "sugar" substituted
in for the
pentofuranosyl residue in normal nucleosides (a sugar surrogate). Modified
?THP
10 nucleosides include, but are not limited to, what is referred to in the
art as hexitol nucleic
acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) {see
Leumann, CJ. Bioorg.
and Med. Chem. (2002) 10:841-854), fluoro HNA (F-HNA), or those compounds
having
Formula X:
Formula
ql Cl2
13-0 C13
0
C17 C14
C16 Bx
0
Ri R2 C15
T
15 4
X wherein independently for each of said at least one tetrahydropyran
nucleoside analog of
Formula X:
Bx is a heterocyclic base moiety;
T3 and T4 are each, independently, an internucleoside linking group linking
the
20 tetrahydropyran nucleoside analog to the antisense compound or one of T3
and T4 is an
internucleoside linking group linking the tetrahydropyran nucleoside analog to
the antisense
compound and the other of T3 and T4 is H, a hydroxyl protecting group, a
linked conjugate
group, or a 5' or 3'-terminal group; g1 g2 g3 g4 g5, g6 and g7 are each,
independently, H, C1-C6
alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-
C6 alkynyl, or
25 substituted 02-06 alkynyl; and one of R1 and R2 is hydrogen and the
other is selected from
halogen, substituted or unsubstituted alkoxy, NJ,J2, SJõ N3, OC(=X)Ji,
OC(=X)NJ1J2,
NJ3C(=X) NJ1J2, and CN, wherein X is 0, S, or NJi and each J1, J2, and J3 is,
independently,
H or 01-06 alkyl.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
51
In some embodiments, the modified THP nucleosides of Formula X are provided
wherein qm,
qn, qp, qr, qs, qt, and qn are each H. In some embodiments, at least one of
qm, qn, qp, qr, qs, qt
and qõ is other than H. In some embodiments, at least one of q,õ qn, qp, qr,
q3, qtand qõ is
methyl. In some embodiments, THP nucleosides of Formula X are provided wherein
one of
R1 and R2 is F. In some embodiments, Riis fluor and R2 is H, R1 is methoxy
and R2 is H,
and R1 is methoxyethoxy and R2 is H.
As used herein, "2'-modified" or "2'-substituted" refers to a nucleoside
comprising a
sugar comprising a substituent at the 2' position other than H or OH. 2'-
modified
nucleosides, include, but are not limited to nucleosides with non-bridging
2'substituents,
such as ally!, amino, azido, thio, 0-allyl, 0-C1-C10 alkyl, -0CF3, 0-(CH2)2-0-
CH3, 2'-
0(CH2)2SCH3, 0-(CH2)2-0- N(Rm)(Rn), or 0-CH2-C(=0)-N(Rm)(Rn), where each Rm
and Rõ is,
independently, H or substituted or unsubstituted C1-C10 alkyl. 2'-modifed
nucleosides may
further comprise other modifications, for example, at other positions of the
sugar and/or at
the nucleobase.
As used herein, "2'-F" refers to a sugar comprising a fluoro group at the 2'
position.
As used herein, "2'-0Me" or "2'-OCH3" or "2'-0-methyl" each refers to a
nucleoside
comprising a sugar comprising an -OCH3 group at the 2' position of the sugar
ring.
As used herein, "oligonucleotide" refers to a compound comprising a plurality
of linked
nucleosides.
In some embodiments, one or more of the plurality of nucleosides is modified.
In some
embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA)
and/or
deoxyribonucleosides (DNA).
Many other bicyclo and tricyclo sugar surrogate ring systems are also known in
the art
that can be used to modify nucleosides for incorporation into antisense
compounds {see,
e.g., review article: Leumann, J. C, Bioorganic and Medicinal Chemistry, 2002,
10, 841-854).
Such ring systems can undergo various additional substitutions to enhance
activity. Methods
for the preparations of modified sugars are well known to those skilled in the
art. In
nucleotides having modified sugar moieties, the nucleobase moieties (natural,
modified, or a
combination thereof) are maintained for hybridization with an appropriate
nucleic acid target.
In some embodiments, antisense compounds comprise one or more nucleotides
having modified sugar moieties. In some embodiments, the modified sugar moiety
is 2'-
MOE. In some embodiments, the 2'-MOE modified nucleotides are arranged in a
gapmer
motif. In some embodiments, the modified sugar moiety is a cEt. In some
embodiments, the
cEt modified nucleotides are arranged throughout the wings of a gapmer motif.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
52
In some embodiments, in the BNA (LNA), R4* and R2* together designate the
biradical
¨0-CH(CH2OCH3)- (2'0-methoxyethyl bicyclic nucleic acid - Seth at at., 2010,
J. Org. Chem)
¨ in either the R- or S- configuration.
In some embodiments, in the BNA (LNA), R4* and R2* together designate the
biradical
¨0-CH(CH2CH3)- (2'0-ethyl bicyclic nucleic acid - Seth at at., 2010, J. Org.
Chem). ¨ in
either the R- or S- configuration.
In some embodiments, in the BNA (LNA), R4* and R2* together designate the
biradical
¨0-CH(CH3)-. ¨ in either the R- or S- configuration. In some embodiments, R4*
and R2*
together designate the biradical ¨0-CH2-0-CH2- - (Seth at at., 2010, J. Org.
Chem).
In some embodiments, in the BNA (LNA), R4* and R2* together designate the
biradical
¨0-NR-CH3-- (Seth at al., 2010, J. Org. Chem) .
In some embodiments, the LNA units have a structure selected from the
following
group:
13
H3SCI0
C-1
;
0. I -LNA
(R,SLIVOE
The oligomer may thus comprise or consist of a simple sequence of natural
occurring
nucleotides ¨ preferably 2'-deoxynucleotides (referred to here generally as
"DNA"), but also
possibly ribonucleotides (referred to here generally as "RNA"), or a
combination of such
naturally occurring nucleotides and one or more non-naturally occurring
nucleotides, i.e.
nucleotide analogues. Such nucleotide analogues may suitably enhance the
affinity of the
oligomer for the target sequence.
Incorporation of affinity-enhancing nucleotide analogues in the oligomer, such
as BNA,
(e.g.) LNA or 2'-substituted sugars, can allow the size of the specifically
binding oligomer to
be reduced, and may also reduce the upper limit to the size of the oligomer
before non-
specific or aberrant binding takes place.
In some embodiments, the oligomer comprises at least 1 nucleoside analogue. In
some embodiments the oligomer comprises at least 2 nucleotide analogues. In
some
embodiments, the oligomer comprises from 3-8 nucleotide analogues, e.g. 6 or 7
nucleotide
analogues. In the by far most preferred embodiments, at least one of said
nucleotide
53
analogues is a BNA, such as locked nucleic acid (LNA); for example at least 3
or at least 4,
or at least 5, or at least 6, or at least 7, or 8, of the nucleotide analogues
may be BNA, such
as LNA. In some embodiments all the nucleotides analogues may be BNA, such as
LNA.
It will be recognized that when referring to a preferred nucleotide sequence
motif or
nucleotide sequence, which consists of only nucleotides, the oligomers of the
invention
which are defined by that sequence may comprise a corresponding nucleotide
analogue in
place of one or more of the nucleotides present in said sequence, such as BNA
units or
other nucleotide analogues, which raise the duplex stability/Trn of the
oligomer/target duplex
(i.e. affinity enhancing nucleotide analogues).
A preferred nucleotide analogue is LNA, such as oxy-LNA (such as beta-D-oxy-
LNA,
and alpha-L-oxy-LNA), and/or amino-LNA (such as beta-D-amino-LNA and alpha-L-
amino-
LNA) and/or thio-LNA (such as beta-D-thio-LNA and alpha-L-thio-LNA) and/or ENA
(such as
beta-D-ENA and alpha-L-ENA). Most preferred is beta-D-oxy-LNA.
In some embodiments the nucleotide analogues present within the oligomer of
the
invention are independently selected from, for example: 2'-0-alkyl-RNA units,
2'-amino-DNA
units, 2'-fluoro-DNA units, BNA units, e.g. LNA units, arabino nucleic acid
(ANA) units, 2'-
fluoro-ANA units, HNA units, INA (intercalating nucleic acid -Christensen,
2002. Nucl. Acids.
Res. 2002 30: 4918-4925.) units and 2'MOE units. In
some embodiments there is only one of the above types of nucleotide analogues
present in
the oligomer of the invention, such as the first region, or contiguous
nucleotide sequence
thereof.
In some embodiments the nucleotide analogues are 2'-0-methoxyethyl-RNA
(2'MOE),
2'-fluoro-DNA monomers or LNA nucleotide analogues, and as such the
oligonucleotide of
the invention may comprise nucleotide analogues which are independently
selected from
these three types of analogue, or may comprise only one type of analogue
selected from the
three types. In some embodiments at least one of said nucleotide analogues is
2'-M0E-
RNA, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2'-M0E-RNA nucleotide units. In some
embodiments at least one of said nucleotide analogues is 2'-fluoro DNA, such
as 2, 3, 4, 5,
6, 7, 8, 9 or 10 2'-fluoro-DNA nucleotide units.
In some embodiments, the oligomer according to the invention comprises at
least one
BNA, e.g. Locked Nucleic Acid (LNA) unit, such as 1, 2, 3, 4, 5, 6, 7, or 8
BNA/LNA units,
such as from 3 - 7 or 4 to 8 BNA/ LNA units, or 3, 4, 5, 6 or 7 BNA/LNA units.
In some
embodiments, all the nucleotide analogues are BNA, such as LNA. In some
embodiments,
the oligomer may comprise both beta-D-oxy-LNA, and one or more of the
following LNA
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
54
units: thio-LNA, amino-LNA, oxy-LNA, and/or ENA in either the beta-D or alpha-
L
configurations or combinations thereof. In some embodiments all BNA, such as
LNA,
cytosine units are 5'methyl-Cytosine. In some embodiments of the invention,
the oligomer
(such as the first and optionally second regions) may comprise both BNA and
LNA and DNA
units. In some embodiments, the combined total of LNA and DNA units is 10-25,
such as 10
¨24, preferably 10-20, such as 10¨ 18, such as 12-16. In some embodiments of
the
invention, the nucleotide sequence of the oligomer, of first region thereof,
such as the
contiguous nucleotide sequence consists of at least one BNA, e.g. LNA and the
remaining
nucleotide units are DNA units. In some embodiments the oligomer, or first
region thereof,
comprises only BNA, e.g. LNA, nucleotide analogues and naturally occurring
nucleotides
(such as RNA or DNA, most preferably DNA nucleotides), optionally with
modified
internucleotide linkages such as phosphorothioate.
The term "nucleobase" refers to the base moiety of a nucleotide and covers
both
naturally occurring a well as non-naturally occurring variants. Thus,
"nucleobase" covers not
only the known purine and pyrimidine heterocycles but also heterocyclic
analogues and
tautomeres thereof. It will be recognized that the DNA or RNA nucleosides of
region B may
have a naturally occurring and/or non-naturally occurring nucleobase(s).
Examples of nucleobases include, but are not limited to adenine, guanine,
cytosine,
thymidine, uracil, xanthine, hypoxanthine, 5-methylcytosine, isocytosine,
pseudoisocytosine,
5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine,
diaminopurine, and
2-chloro-6-aminopurine. In some embodiments the nucleobases may be
independently
selected from the group consisting of adenine, guanine, cytosine, thymidine,
uracil, 5-
methylcytosine. In some embodiments the nucleobases may be independently
selected
from the group consisting of adenine, guanine, cytosine, thymidine, and 5-
methylcytosine.
In some embodiments, at least one of the nucleobases present in the oligomer
is a
modified nucleobase selected from the group consisting of 5-methylcytosine,
isocytosine,
pseudoisocytosine, 5-bromouracil, 5-propynyluracil, 6-aminopurine, 2-
aminopurine, inosine,
diaminopurine, and 2-chloro-6-aminopurine.
LNA
The term "LNA" refers to a bicyclic nucleoside analogue which comprises a C2* -
C4*
biradical (a bridge), and is known as "Locked Nucleic Acid". It may refer to
an LNA
monomer, or, when used in the context of an "LNA oligonucleotide", LNA refers
to an
oligonucleotide containing one or more such bicyclic nucleotide analogues. In
some aspects
bicyclic nucleoside analogues are LNA nucleotides, and these terms may
therefore be used
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
interchangeably, and is such embodiments, both are be characterized by the
presence of a
linker group (such as a bridge) between 02' and 04' of the ribose sugar ring.
In some embodiments the LNA used in the oligonucleotide compounds of the
invention
preferably has the structure of the general formula II:
*Z
R' Rd
Rb
0
5 Y Formula II
wherein Y is selected from the group consisting of-O-, -CH20-, -S-, -NH-,
N(Re) and/or ¨
CH2-; Z and Z* are independently selected among an internucleotide linkage,
RH, a terminal
group or a protecting group; B constitutes a natural or non-natural nucleotide
base moiety
(nucleobase), and RH is selected from hydrogen and 014-alkyl; Ra, Rb
K Rd and Re are,
10 optionally independently, selected from the group consisting of
hydrogen, optionally
substituted 01_12-alkyl, optionally substituted 02_12-alkenyl, optionally
substituted 02_12-alkynyl,
hydroxy, 01_12-alkoxy, C2_12-alkoxyalkyl, 02_12-alkenyloxy, carboxy, 01_12-
alkoxycarbonyl, C1-12-
alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl,
heteroaryl, heteroaryloxy-
carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(01_6-
alkyl)amino,
15 carbamoyl, mono- and di(C1_6-alkyl)-amino-carbonyl, amino-01_6-alkyl-
aminocarbonyl, mono-
and di(01_6-alkyl)amino-01_6-alkyl-aminocarbonyl, C1_6-alkyl-carbonylamino,
carbamido, 01_6-
alkanoyloxy, sulphono, 01_6-alkylsulphonyloxy, nitro, azido, sulphanyl, 01_6-
alkylthio, halogen,
DNA intercalators, photochemically active groups, thermochemically active
groups, chelating
groups, reporter groups, and ligands, where aryl and heteroaryl may be
optionally
20 .. substituted and where two geminal substituents Ra and Rb together may
designate optionally
substituted methylene (=CH2); and RH is selected from hydrogen and 014-alkyl.
In some
embodiments Ra, Rb R', Rd and Re are, optionally independently, selected from
the group
consisting of hydrogen and 01_6 alkyl, such as methyl. For all chiral centers,
asymmetric
groups may be found in either R or S orientation, for example, two exemplary
25 .. stereochemical isomers include the beta-D and alpha-L isoforms, which
may be illustrated
as follows:
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
56
*Z
¨0
0
Specific exemplary LNA units are shown below:
Z* _____________________________________________________ 0 B
__________________ , z*
0
a-L-Oxy-LNA
(3-D-oxy-LNA
Z*, Z*
N,
-o- \
</
/
I3-D-thio-LNA
I3-D-ENA
2 NRe
13-D-amino-LNA
The term "thio-LNA" comprises a locked nucleotide in which Y in the general
formula
above is selected from S or -CH2-S-. Thio-LNA can be in both beta-D and alpha-
L-
configuration.
The term "amino-LNA" comprises a locked nucleotide in which Y in the general
formula above is selected from -N(H)-, N(R)-, CH2-N(H)-, and -CH2-N(R)- where
R is
selected from hydrogen and 014-alkyl. Amino-LNA can be in both beta-D and
alpha-L-
configuration.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
57
The term "oxy-LNA" comprises a locked nucleotide in which Y in the general
formula
above represents ¨0-. Oxy-LNA can be in both beta-D and alpha-L-configuration.
The term "ENA" comprises a locked nucleotide in which Y in the general formula
above is -CH2-0- (where the oxygen atom of ¨CH2-0- is attached to the 2'-
position relative
to the base B). Re is hydrogen or methyl.
In some exemplary embodiments LNA is selected from beta-D-oxy-LNA, alpha-L-oxy-
LNA,
beta-D-amino-LNA and beta-D-thio-LNA, in particular beta-D-oxy-LNA.
RNAse recruitment
It is recognized that an oligomeric compound may function via non RNase
mediated
degradation of target mRNA, such as by steric hindrance of translation, or
other methods, In
some embodiments, the oligomers of the invention are capable of recruiting an
endoribonuclease (RNase), such as RNase H.
It is preferable such oligomers, such as region A, or contiguous nucleotide
sequence,
comprises of a region of at least 6, such as at least 7 consecutive nucleotide
units, such as
at least 8 or at least 9 consecutive nucleotide units (residues), including 7,
8, 9, 10, 11, 12,
13, 14, 15 or 16 consecutive nucleotides, which, when formed in a duplex with
the
complementary target RNA is capable of recruiting RNase. The contiguous
sequence which
is capable of recruiting RNAse may be region Y' as referred to in the context
of a gapmer as
described herein. In some embodiments the size of the contiguous sequence
which is
capable of recruiting RNAse, such as region Y', may be higher, such as 10, 11,
12, 13, 14,
15, 16, 17, 18, 19 or 20 nucleotide units.
EP 1 222 309 provides in vitro methods for determining RNaseH activity, which
may
be used to determine the ability to recruit RNaseH. A oligomer is deemed
capable of
recruiting RNase H if, when provided with the complementary RNA target, it has
an initial
rate, as measured in pmol/l/min, of at least 1 %, such as at least 5%, such as
at least 10%
or ,more than 20% of the of the initial rate determined using DNA only
oligonucleotide,
having the same base sequence but containing only DNA monomers, with no 2'
substitutions, with phosphorothioate linkage groups between all monomers in
the
oligonucleotide, using the methodology provided by Example 91 - 95 of EP 1 222
309.
In some embodiments, an oligomer is deemed essentially incapable of recruiting
RNaseH if, when provided with the complementary RNA target, and RNaseH, the
RNaseH
initial rate, as measured in pmol/l/min, is less than 1%, such as less than
5`)/0,such as less
than 10% or less than 20% of the initial rate determined using the equivalent
DNA only
oligonucleotide, with no 2' substitutions, with phosphorothioate linkage
groups between all
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
58
nucleotides in the oligonucleotide, using the methodology provided by Example
91 - 95 of
EP 1 222 309.
In other embodiments, an oligomer is deemed capable of recruiting RNaseH if,
when
provided with the complementary RNA target, and RNaseH, the RNaseH initial
rate, as
measured in pmol/l/min, is at least 20%, such as at least 40 %, such as at
least 60 %, such
as at least 80 % of the initial rate determined using the equivalent DNA only
oligonucleotide,
with no 2' substitutions, with phosphorothioate linkage groups between all
nucleotides in the
oligonucleotide, using the methodology provided by Example 91 - 95 of EP 1 222
309.
Typically the region of the oligomer which forms the consecutive nucleotide
units
which, when formed in a duplex with the complementary target RNA is capable of
recruiting
RNase consists of nucleotide units which form a DNA/RNA like duplex with the
RNA target.
The oligomer of the invention, such as the first region, may comprise a
nucleotide sequence
which comprises both nucleotides and nucleotide analogues, and may be e.g. in
the form of
a gapmer, a headmer or a mixmer.
A "headmer" is defined as an oligomer that comprises a region X' and a region
Y' that
is contiguous thereto, with the 5'-most monomer of region Y' linked to the 3'-
most monomer
of region X'. Region X' comprises a contiguous stretch of non-RNase recruiting
nucleoside
analogues and region Y' comprises a contiguous stretch (such as at least 7
contiguous
monomers) of DNA monomers or nucleoside analogue monomers recognizable and
cleavable by the RNase.
A "tailmer" is defined as an oligomer that comprises a region X' and a region
Y' that is
contiguous thereto, with the 5'-most monomer of region Y' linked to the 3'-
most monomer of
the region X'. Region X' comprises a contiguous stretch (such as at least 7
contiguous
monomers) of DNA monomers or nucleoside analogue monomers recognizable and
cleavable by the RNase, and region X' comprises a contiguous stretch of non-
RNase
recruiting nucleoside analogues.
Other "chimeric" oligomers, called "mixmers", consist of an alternating
composition of
(i) DNA monomers or nucleoside analogue monomers recognizable and cleavable by
RNase, and (ii) non-RNase recruiting nucleoside analogue monomers.
In some embodiments, in addition to enhancing affinity of the oligomer for the
target
region, some nucleoside analogues also mediate RNase (e.g., RNaseH) binding
and
cleavage. Since a-L-LNA (BNA) monomers recruit RNaseH activity to a certain
extent, in
some embodiments, gap regions (e.g., region Y' as referred to herein) of
oligomers
59
containing a-L-LNA monomers consist of fewer monomers recognizable and
cleavable by
the RNaseH, and more flexibility in the mixmer construction is introduced.
Gapmer Design
In some embodiments, the oligomer of the invention, such as the first region,
comprises or is a gapmer. A gapmer oligomer is an oligomer which comprises a
contiguous
stretch of nucleotides which is capable of recruiting an RNAse, such as
RNAseH, such as a
region of at least 6 or 7 DNA nucleotides, referred to herein in as region Y'
(Y'), wherein
region Y' is flanked both 5' and 3' by regions of affinity enhancing
nucleotide analogues,
such as from 1 ¨ 6 nucleotide analogues 5' and 3' to the contiguous stretch of
nucleotides
which is capable of recruiting RNAse ¨ these regions are referred to as
regions X' (X') and Z'
(Z') respectively. Examples of gapmers are disclosed in W02004/046160,
W02008/113832, and W02007/146511.
In some embodiments, the monomers which are capable of recruiting RNAse are
selected from the group consisting of DNA monomers, alpha-L-LNA monomers, C4'
alkylayted DNA monomers (see PCT/EP2009/050349 and Vester et al., Bioorg. Med.
Chem.
Lett. 18 (2008) 2296 ¨ 2300 ), and UNA
(unlinked nucleic
acid) nucleotides (see Fluiter et al., Mol. Biosyst., 2009, 10, 1039).
UNA is unlocked nucleic acid, typically where the C2 ¨ C3 C-C bond of the
ribose has been removed, forming an unlocked "sugar" residue. Preferably the
gapmer
comprises a (poly)nucleotide sequence of formula (5' to 3'), X'-Y'-Z',
wherein; region X' (X')
(5' region) consists or comprises of at least one nucleotide analogue, such as
at least one
BNA (e.g. LNA) unit, such as from 1-6 nucleotide analogues, such as BNA (e.g.
LNA) units,
and; region Y (Y') consists or comprises of at least five consecutive
nucleotides which are
capable of recruiting RNAse (when formed in a duplex with a complementary RNA
molecule,
such as the mRNA target), such as DNA nucleotides, and; region Z' (Z')
(3'region) consists
or comprises of at least one nucleotide analogue, such as at least one BNA
(e.gLNA unit),
such as from 1-6 nucleotide analogues, such as BNA (e.g. LNA) units.
In some embodiments, region X' consists of 1, 2, 3, 4, 5 or 6 nucleotide
analogues,
such as BNA (e.g. LNA) units, such as from 2-5 nucleotide analogues, such as 2-
5 LNA
units, such as 3 or 4 nucleotide analogues, such as 3 or 4 LNA units; and/or
region Z'
consists of 1, 2, 3, 4, 5 or 6 nucleotide analogues, such as BNA (e.g. LNA)
units, such as
from 2-5 nucleotide analogues, such as 2-5 BNA (e.g. LNA units), such as 3 or
4 nucleotide
analogues, such as 3 or 4 BNA (e.g. LNA) units.
CA 2889596 2019-02-06
60
In some embodiments Y' consists or comprises of 5, 6, 7, 8, 9, 10, 11 or 12
consecutive nucleotides which are capable of recruiting RNAse, or from 6-10,
or from 7-9,
such as 8 consecutive nucleotides which are capable of recruiting RNAse. In
some
embodiments region Y' consists or comprises at least one DNA nucleotide unit,
such as 1-12
DNA units, preferably from 4-12 DNA units, more preferably from 6-10 DNA
units, such as
from 7-10 DNA units, most preferably 8, 9 or 10 DNA units.
In some embodiments region X' consist of 3 or 4 nucleotide analogues, such as
BNA
(e.g. LNA), region X' consists of 7, 8. 9 or 10 DNA units, and region Z'
consists of 3 or 4
nucleotide analogues, such as BNA (e.g. LNA). Such designs include (X'-Y'-Z')
3-10-3, 3-
10-4, 4-10-3, 3-9-3, 3-9-4, 4-9-3, 3-8-3, 3-8-4, 4-8-3, 3-7-3, 3-7-4, 4-7-3.
Further gapmer designs are disclosed in W020041046160.
W02008/113832
refers to `shortmer' gapmer
oligomers. In some embodiments, oligomers presented here may be such shortmer
gapmers.
In some embodiments the oligomer, e.g. region X', is consisting of a
contiguous
nucleotide sequence of a total of 10, 11, 12, 13 or 14 nucleotide units,
wherein the
contiguous nucleotide sequence comprises or is of formula (5' - 3'), X'-Y'-Z
wherein; X'
consists of 1, 2 or 3 nucleotide analogue units, such as BNA (e.g. LNA) units;
Y' consists of
7, 8 or 9 contiguous nucleotide units which are capable of recruiting RNAse
when formed in
a duplex with a complementary RNA molecule (such as a mRNA target); and Z'
consists of
1, 2 or 3 nucleotide analogue units, such as BNA (e.g. LNA) units.
In some embodiments X' consists of 1 BNA (e.g. LNA) unit. In some embodiments
X'
consists of 2 BNA (e.g. LNA) units. In some embodiments X' consists of 3 BNA
(e.g. LNA)
units. In some embodiments Z' consists of 1 BNA (e.g. LNA) units. In some
embodiments
Z' consists of 2 BNA (e.g. LNA) units. In some embodiments Z' consists of 3
BNA (e.g.
LNA) units. In some embodiments Y' consists of 7 nucleotide units. In some
embodiments Y'
consists of 8 nucleotide units. In some embodiments Y' consists of 9
nucleotide units. . In
certain embodiments, region Y' consists of 10 nucleoside monomers. In certain
embodiments, region Y consists or comprises 1 - 10 DNA monomers. In some
embodiments Y' comprises of from 1 - 9 DNA units, such as 2, 3, 4, 5, 6, 7 , 8
or 9 DNA
units. In some embodiments Y' consists of DNA units. In some embodiments Y'
comprises
of at least one BNA unit which is in the alpha-L configuration, such as 2, 3,
4, 5, 6, 7, 8 or 9
LNA units in the alpha-L-configuration. In some embodiments Y' comprises of at
least one
CA 2889596 2019-02-06
61
alpha-L-oxy BNA/LNA unit or wherein all the LNA units in the alpha-L-
configuration are
alpha-L-oxy LNA units. In some embodiments the number of nucleotides present
in X'-Y'-Z'
are selected from the group consisting of (nucleotide analogue units - region
Y' - nucleotide
analogue units): 1-8-1, 1-8-2, 2-8-1, 2-8-2, 3-8-3, 2-8-3, 3-8-2, 4-8-1, 4-8-
2, 1-8-4, 2-8-4,
or;1-9-1, 1-9-2, 2-9-1, 2-9-2, 2-9-3, 3-9-2, 1-9-3, 3-9-1, 4-9-1, 1-9-4, or; 1-
10-1, 1-10-2, 2-10-
1, 2-10-2, 1-10-3, 3-10-1. In some embodiments the number of nucleotides in X'-
Y'-Z' are
selected from the group consisting of: 2-7-1, 1-7-2, 2-7-2, 3-7-3, 2-7-3, 3-7-
2, 3-7-4, and 4-7-
3. In certain embodiments, each of regions X' and Y' consists of three BNA
(e.g. LNA)
monomers, and region Y' consists of 8 or 9 or 10 nucleoside monomers,
preferably DNA
monomers. In some embodiments both X' and Z' consists of two BNA (e.g. LNA)
units each,
and Y' consists of 8 or 9 nucleotide units, preferably DNA units. In various
embodiments,
other gapmer designs include those where regions X' and/or Z' consists of 3,
4, 5 or 6
nucleoside analogues, such as monomers containing a 2'-0-methoxyethyl-ribose
sugar (2'-
MOE) or monomers containing a 2'-fluoro-deoxyribose sugar, and region Y'
consists of 8, 9,
10, 11 or 12 nucleosides, such as DNA monomers, where regions X'-Y'-Z' have 3-
9-3, 3-10-
3, 5-10-5 or 4-12-4 monomers. Further gapmer designs are disclosed in WO
2007/146511A2.
Splice switching oligomers
In some embodiments, the antisense oligonucleotide is a splice switching
oligomer -
i.e. an oligomer which targets the pre-mRNA causing an alternative splicing of
the pre-
mRNA.
Targets for the splice switching oligomer may include TNF receptor, for
example the
SSO may be one or more of the TNFR SSOs disclosed in W02007/058894, W008051306
Al and PCT/EP2007/061211
Splice switching oligomers are typically(essentially) not capable of
recruiting RNaseH
and as such gapmer, tailmer or headmer designs are generally not desirable.
However,
mixmer and totalmers designs are suitable designs for SSOs.
Spice switching oligomers have also been used to target dystrophin deficiency
in Duchenne
muscular dystrophy.
Mixmers
Most antisense oligonucleotides are compounds which are designed to recruit
RNase
enzymes (such as RNaseH) to degrade their intended target. Such compounds
include
DNA phosphorothioate oligonucleotides and gapmer, headmers and tailmers. These
CA 2889596 2019-02-06
62
compounds typically comprise a region of at least 5 or 6 DNA nucleotides, and
in the case of
gapmers are flanked on either side by affinity enhancing nucleotide analogues.
The oligomers of the present invention may operate via an RNase (such as
RNaseH)
independent mechanism. Examples of oligomers which operate via a non-RNaseH
(or non-
RNase) mechanism are mixmers and totalmers.
The term mixmer refers to oligomers which comprise both naturally and non-
naturally
occurring nucleotides, where, as opposed to gapmers, tailmers, and headmers
there is no
contiguous sequence of more than 5, and in some embodiments no more than 4
consecutive, such as no more than three consecutive, naturally occurring
nucleotides, such
as DNA units. In some embodiments, the mixmer does not comprise more than 5
consecutive nucleoside analogues, such as BNA (LNA), and in some embodiments
no more
than 4 consecutive, such as no more than three consecutive, consecutive
nucleoside
analogues, such as BNA (LNA). In such mixmers the remaining nucleosides may,
for
example by DNA nucleosides, and/or in non-bicyclic nucleoside analogues, such
as those
referred to herein, for example, 2' substituted nucleoside analogues, such as
2'-0-MOE and
or 2'fluoro.
The oligomer according to the invention maybe mixmers ¨ indeed various mixmer
designs are highly effective as oligomer or first region thereof, particularly
when targeting
microRNA (antimiRs), microRNA binding sites on mRNAs (Blockmirs) or as splice
switching
oligomers (SS0s). See for example W02007/112754 (LNA-AntimiRsr"),
W02008/131807
(LNA splice switching oligos),
In some embodiments, the oligomer or mixmer may comprise of BNA and 2'
substituted nucleoside analogues, optionally with DNA nucleosides ¨ see for
example see
W007027894 and W02007/112754. Specific
examples include oligomers or first regions which comprise LNA, 2'-0-MOE and
DNA, LNA,
2'fluoro and 2'-0-M0E, 2'-0-MOE and 2'fluoro, 2'-0-MOE and 2'fluoro and LNA,
or LNA and
2'-0-MOE and LNA and DNA.
In some embodiments, the oligomer or mixmer comprises or consists of a
contiguous
nucleotide sequence of repeating pattern of nucleotide analogue and naturally
occurring
nucleotides, or one type of nucleotide analogue and a second type of
nucleotide analogues.
The repeating pattern, may, for instance be every second or every third
nucleotide is a
nucleotide analogue, such as BNA (LNA), and the remaining nucleotides are
naturally
occurring nucleotides, such as DNA, or are a 2'substituted nucleotide analogue
such as
2'MOE of 2'fluoro analogues as referred to herein, or, in some embodiments
selected form
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
63
the groups of nucleotide analogues referred to herein. It is recognized that
the repeating
pattern of nucleotide analogues, such as LNA units, may be combined with
nucleotide
analogues at fixed positions ¨ e.g. at the 5' or 3' termini.
In some embodiments the first nucleotide of the oligomer or mixmer, counting
from the
3' end, is a nucleotide analogue, such as an LNA nucleotide.
In some embodiments, which maybe the same or different, the second nucleotide
of
oligomer or mixmer, counting from the 3' end, is a nucleotide analogue, such
as an LNA
nucleotide.
In some embodiments, which maybe the same or different, the seventh and/or
eighth
nucleotide of oligomer or mixmer, counting from the 3' end, are nucleotide
analogues, such
as LNA nucleotides.
In some embodiments, which maybe the same or different, the ninth and/or the
tenth
nucleotides of the first and/or second oligomer, counting from the 3' end, are
nucleotide
analogues, such as LNA nucleotides.
In some embodiments, which maybe the same or different, the 5' terminal of
oligomer
or mixmer is a nucleotide analogue, such as an LNA nucleotide.
The above design features may, in some embodiments be incorporated into the
mixmer design, such as antimiR mixmers.
In some embodiments, the oligomer or mixmer does not comprise a region of more
than 4 consecutive DNA nucleotide units or 3 consecutive DNA nucleotide units.
In some
embodiments, the mixmer does not comprise a region of more than 2 consecutive
DNA
nucleotide units.
In some embodiments, the oligomer or mixmer comprises at least a region
consisting
of at least two consecutive nucleotide analogue units, such as at least two
consecutive LNA
units.
In some embodiments, the oligomer or mixmer comprises at least a region
consisting
of at least three consecutive nucleotide analogue units, such as at least
three consecutive
LNA units.
In some embodiments, the oligomer or mixmer of the invention does not comprise
a
region of more than 7 consecutive nucleotide analogue units, such as LNA
units. In some
embodiments, the oligomer or mixmer of the invention does not comprise a
region of more
than 6 consecutive nucleotide analogue units, such as LNA units. In some
embodiments, the
oligomer or mixmer of the invention does not comprise a region of more than 5
consecutive
nucleotide analogue units, such as LNA units In some embodiments, the oligomer
or
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
64
mixmer of the invention does not comprise a region of more than 4 consecutive
nucleotide
analogue units, such as LNA units. In some embodiments, the oligomer or mixmer
of the
invention does not comprise a region of more than 3 consecutive nucleotide
analogue units,
such as LNA units. In some embodiments, the oligomer or mixmer of the
invention does not
comprise a region of more than 2 consecutive nucleotide analogue units, such
as LNA units
A mixmer is a oligomer which may comprise one or more short regions of DNA of
no more
than 4 consecutive DNA nucleotides, and typically comprises alternating
regions of a
nucleotide analogue (such as LNA units) and DNA nucleotides, optionally
regions of other
nucleotide analogues (e.g. non-LNA nucleotide analogues). Totalmers comprise
of no DNA
or RNA nucleotides (although may comprise analogues or derivatives of DNA and
RNA).
In some embodiments, the oligomer (e.g. region A) of the invention may, in
some
embodiments, comprise of no more than 4 consecutive DNA nucleotides, or no
more than 3
consecutive DNA nucleotides.
The following embodiments may apply to mixmers or totalmer oligomers (e.g. as
region A):
The oligomer (e.g. region A) of the invention may, in some embodiments,
comprise of at
least two alternating regions of LNA and non-LNA nucleotides (such as DNA or
2'
substituted nucleotide analogues).
The oligomer of the invention may, in some embodiments, comprise a contiguous
sequence
of formula: 5' ([LNA nucleotides]1_5 and [non-LNA nucleotides]142-12. 3'.
In some embodiments, the 5' nucleotide of the contiguous nucleotide sequence
(or the
oligomer) is an LNA nucleotide.
In some embodiments, the 3' nucleotide of the contiguous nucleotide sequence
is a
nucleotide analogue, such as LNA, or the 2, 3, 4, 5 3' nucleotides are
nucleotide analogues,
such as LNA nucleotides, or other nucleotide analogues which confer enhanced
serum
stability to the oligomer.
In some embodiments, the contiguous nucleotide sequence of the oligomer has a
formula 5'
([I-NA nucleotides]1_5- [non-LNA nucleotides]142_11- [LNA nucleotides]1-5 3'.
In some embodiments, the contiguous nucleotide sequence of the oligomer has 2,
3 or 4
contiguous regions of LNA and non-LNA nucleotides ¨ e.g. comprises formula 5'
([LNA
nucleotides]1_5 and [non-LNA nucleotides]142_3, optionally with a further 3'
LNA region [LNA
nucleotides]1-5.
In some embodiments, the contiguous nucleotide sequence of the oligomer
comprises 5'
([LNA nucleotides]1_3 and [non-LNA nucleotides]1_3)2_5, optionally with a
further 3' LNA
region [LNA nucleotides]1_3.
65
In some embodiments, the contiguous nucleotide sequence of the oligomer
comprises 5'
([LNA nuc1eotidesb.3 and [non-LNA nucleotides]1..3)3, optionally with a
further 3' LNA region
[LNA nucleotides[1-3.
In some embodiments the non-LNA nucleotides are all DNA nucleotides.
In some embodiments, the non-LNA nucleotides are independently or dependently
selected
from the group consisting of DNA units, RNA units, 2'-0-alkyl-RNA units, 2'-
0Me-RNA units,
2'-amino-DNA units, and 2'-fluoro-DNA units.
In some embodiments the non-LNA nucleotides are (optionally independently
selected from
the group consisting of 2' substituted nucleoside analogues, such as
(optionally
independently) selected from the group consisting of 2'-0-alkyl-RNA units, 2'-
0Me-RNA
units, 2'-amino-DNA units, 2'-AP, 2'-FANA, 2'-(3-hydroxy)propyl, and 2'-fluoro-
DNA units,
and/or other (optionally) sugar modified nucleoside analogues such as
morpholino, peptide
nucleic acid (PNA), CeNA, unlinked nucleic acid (UNA), hexitol nucleoic acid
(HNA). bicyclo-
HNA (see e.g. W02009/100320), In some embodiments, the nucleoside analogues
increase the affinity of the first region for its target nucleic acid (or a
complementary DNA or
RNA sequence). Various nucleoside analogues are disclosed in Freier & Altmann;
Nucl.
Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development,
2000,
3(2), 293-213.
In some embodiments, the non-LNA nucleotides are DNA nucleotides. In some
embodiments, the oligomer or contiguous nucleotide sequence comprises of LNA
nucleotides and optionally other nucleotide analogues (such as the nucleotide
analogues
listed under non-LNA nucleotides) which may be affinity enhancing nucleotide
analogues
and/or nucleotide analogues which enhance serum stability.
In some embodiments, the oligomer or contiguous nucleotide sequence thereof
consists of a
contiguous nucleotide sequence of said nucleotide analogues.
In some embodiments, the oligomer or contiguous nucleotide sequence thereof
consists of a
contiguous nucleotide sequence of LNA nucleotides.
In some embodiments, the oligomer or contiguous nucleotide sequence is 8 ¨ 12,
such as 8
¨10, or 10 ¨ 20, such as 12¨ 18 or 14 ¨ 16 nts in length.
In some embodiments, the oligomer or contiguous nucleotide sequence is capable
of
forming a duplex with a complementary single stranded RNA nucleic acid
molecule with
phosphodiester internucleoside linkages, wherein the duplex has a Tm of at
least about
60 C, such as at least 65 C.
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
66
Example of a Tm Assay: The oligonucleotide: Oligonucleotide and RNA target
(PO)
duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml
2x Tm
buffer (200mM NaCI, 0.2mM EDTA, 20mM Naphosphate, pH 7.0). The solution is
heated to
95 C for 3 min and then allowed to anneal in room temperature for 30 min. The
duplex
melting temperatures (Tm) is measured on a Lambda 40 UVNIS Spectrophotometer
equipped with a Peltier temperature programmer PTP6 using PE Templab software
(Perkin
Elmer). The temperature is ramped up from 20 C to 95 C and then down to 25 C,
recording
absorption at 260 nm. First derivative and the local maximums of both the
melting and
annealing are used to assess the duplex Tm.
Total mers
A totalmer is a single stranded oligomer which only comprises non-naturally
occurring
nucleosides, such as sugar-modified nucleoside analogues.
The first region according to the invention maybe totalmers ¨ indeed various
totalmer
designs are highly effective as oligomers or first region thereof, e.g.
particularly when
targeting microRNA (antimiRs) or as splice switching oligomers (SS0s). In some
embodiments, the totalmer comprises or consists of at least one XYX or YXY
sequence
motif, such as a repeated sequence XYX or YXY, wherein X is LNA and Y is an
alternative
(i.e. non LNA) nucleotide analogue, such as a 2'-0-MOE RNA unit and 2'-fluoro
DNA unit.
The above sequence motif may, in some embodiments, be XXY, XYX, YXY or YYX for
example.
In some embodiments, the totalmer may comprise or consist of a contiguous
nucleotide sequence of between 7 and 16 nucleotides, such as 9, 10, 11, 12,
13, 14, or 15
nucleotides, such as between 7 and 12 nucleotides.
In some embodiments, the contiguous nucleotide sequence of the totalmer
comprises
of at least 30%, such as at least 40%, such as at least 50%, such as at least
60%, such as
at least 70%, such as at least 80%, such as at least 90%, such as 95%, such as
100% BNA
(LNA) units. The remaining units may be selected from the non-LNA nucleotide
analogues
referred to herein in, such those selected from the group consisting of 2'-
0_alkyl-RNA unit,
2'-0Me-RNA unit, 2'-amino-DNA unit, 2'-fluoro-DNA unit, LNA unit, PNA unit,
HNA unit, INA
unit, and a 2'MOE RNA unit, or the group 2'-0Me RNA unit and 2'-fluoro DNA
unit.
In some embodiments the totalmer consist or comprises of a contiguous
nucleotide
sequence which consists only of LNA units. In some embodiments, the totalmer,
such as
the LNA totalmer, is between 7 ¨ 12 nucleoside units in length. In some
embodiments, the
67
totalmer (as the oligomer or first region thereof) may be targeted against a
microRNA (i.e. be
antimiRs) ¨ as referred to W02009/043353 .
In some embodiments, the oligomer or contiguous nucleotide sequence comprises
of LNA
nucleotides and optionally other nucleotide analogues which may be affinity
enhancing
nucleotide analogues and/or nucleotide analogues which enhance serum
stability.
In some embodiments, the oligomer or contiguous nucleotide sequence thereof
consists of a
contiguous nucleotide sequence of said nucleotide analogues.
In some embodiments, the oligomer or contiguous nucleotide sequence thereof
consists of a
contiguous nucleotide sequence of LNA nucleotides.
MicroRNA modulation via the oligomer or first region thereof.
In some embodiments, the oligomer or first region thereof is an antimiR, which
comprises or consists of a contiguous nucleotide sequence which is corresponds
to or is
fully complementary to the entire mature microRNA. The use of the present
invention in
controlling the in vivo activity of microRNA is considered of primary
importance due to the
fact that microRNAs typically regulate numerous mRNAs in the subject. The
ability to
inactivate therapeutic antimiRs is therefore very desirable.
Numerous microRNAs are related to a number of diseases. For example:non-
limiting
examples of therapeutic indications which may be treated by the pharmaceutical
compositions of the invention:
microRNA Possible medical indications
miR-1 Cardiac arythmia
miR-21 Glioblastoma, breast cancer, hepatocellular carcinoma,
colorectal '
cancer, sensitization of gliomas to cytotoxic drugs, cardiac
hypertrophy
miR-21, miR- Response to chemotherapy and regulation of
cholangiocarcinoma
200b and miR- growth
141
miR-122 hypercholesterolemia, hepatitis C infection,
hemochromatosis
miR-19b lymphoma and other tumour types
miR-26a Osteoblast differentiation of human stem cells
miR-155 lymphoma, pancreatic tumor development, breast and lung
cancer
miR-203 Psoriasis
miR-375 diabetes, metabolic disorders, glucose-induced insulin
secretion from
pancreatic endocrine cells
miR-181 myoblast differentiation, auto immune disorders
miR-10b Breast cancer cell invasion and metastasis
miR-125b-1 Breast, lung, ovarian and cervical cancer
miR-221 and 222 Prostate carcinoma, human thyroid papillary car, human
hepatocellular carcinoma
miRNA-372 and - testicular germ cell tumors.
CA 2889596 2019-02-06
68
373
miR-142 B-cell leukemia
miR-17 ¨ 19b B-cell lymphomas, lung cancer, hepatocellular carcinoma
cluster
Tumor suppressor gene tropomysin 1 (TPM1) mRNA has been indicated as a target
of
miR-21. Myotrophin (mtpn) mRNA has been indicated as a target of miR 375.
The oligomer or first region thereof may therefore be an antimir which targets
(i.e. comprises
or consists of a contiguous nucleotide sequence which is fully complementary
to (a
corresponding region of) one of the microRNAs listed above or comprises of no
more than a
single mismatch thereto.
Hence, some aspects of the invention relates to the treatment of a disease
associated
with the expression of microRNAs selected from the group consisting of
infectious diseases
such as viral diseases such as hepatitis C virus and HIV, fragile X mental
retardation,
.. inflammatory diseases, cancer, such as chronic lymphocytic leukemia, breast
cancer, lung
cancer and colon cancer.
MicroRNAs (miRNAs) are an abundant class of short endogenous RNAs that act as
post-transcriptional regulators of gene expression by base-pairing with their
target mRNAs.
The mature miRNAs are processed sequentially from longer hairpin transcripts
by the
RNAse III ribonucleases Drosha. Mature microRNAs (miRs) typically between 20
and 25
contiguous RNA nucleotides. It is now widely established that several
microRNAs are
associated with medical conditions and disease, and several companies are
developing
therapeutics based on oligomers which either mimic microRNAs or specifically
hybridse to
specific microRNAs associated with disease phenotypes ¨ such oligomers are
referred to,
.. herein, as microRNA mimics and antimiRs respectfully, and the oligomer or
first region
thereof, in some embodiments may be such microRNA modulating oligomers.
In some embodiments the oligomer or first region thereof according to the
invention,
consists or comprises of a contiguous nucleotide sequence which corresponds to
or is fully
complementary to a microRNA sequence, such as a mature microRNA sequence, such
as
the human microRNAs published in miRBase .
In some embodiment the microRNA is a viral
microRNA. At the time of writing, in miRbase 19, there are 1600 precursors and
2042
mature human miRNA sequences in miRBase ,
including the mature microRNA sequence of each human microRNA. Other
human microRNAs which may be targeted by the oligomer or first region thereof
include
those disclosed in W008040355A In some
embodiments
CA 2889596 2019-02-06
69
the oligomer or first region thereof according to the invention, consists or
comprises of a
contiguous nucleotide sequence which corresponds to or is fully complementary
to a
microRNA sequence selected from the group consisting of hsa-miR19b, hsa-miR21,
hsa-
miR 122, hsa-miR 142 a7b, hsa-miR 155, and hsa-miR 375. In some embodiments
the
-- oligomer or first region thereof according to the invention, consists or
comprises of a
contiguous nucleotide sequence which corresponds to or is fully complementary
to a
microRNA sequence selected from the group consisting of hsa-miR221 and hsa-
miR222.
In some embodiments the oligomer or first region thereof according to the
invention, consists
or comprises of a contiguous nucleotide sequence which corresponds to or is
fully
-- complementary to hsa-miR122 (NR_029667.1 GI:262205241), such as the mature
has-
miR-122.
In some embodiments when the oligomer or first region thereof targets miR-122,
the
oligomer is for the use in the treatment of hepatitis C infection.
AntimiR oligomers
Preferred oligomer or first region thereof antimiR designs and oligomers are
disclosed
in W02007/112754, W02007/112753, PCT/DK2008/000344 and US provisional
applications 601979217 and 61/028062. In
some embodiments, the oligomer or first region thereof is an antimiR which is
a mixmer or a
totalmer.
AntimiR oligomers are oligomers which consist or comprise of a contiguous
nucleotide
sequence which is fully complementary to, or essentially complementary to
(i.e. may
comprise one or two mismatches), to a microRNA sequence, or a corresponding
sub-
sequence thereof. In this regards it is considered that the antimiR may be
comprise a
contiguous nucleotide sequence which is complementary or essentially
complementary to
-- the entire mature microRNA, or the antimiR may be comprise a contiguous
nucleotide
sequence which is complementary or essentially complementary to a sub-sequence
of the
mature microRNA or pre-microRNA ¨ such a sub-sequence (and therefore the
corresponding contiguous nucleotide sequence) is typically at least 8
nucleotides in length,
such as between 8 and 25 nucleotides, such as 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20,
-- 21, 22, 23, 24 nucleotides in length, such as between 10-17 or 10-16
nucleotides, such as
between 12¨ 15 nucleotides.
Numerous designs of AntimiRs have been suggested, and typically antimiRs for
therapeutic use, such as the contiguous nucleotide sequence thereof comprise
one or more
nucleotide analogues units.
CA 2889596 2019-02-06
70
In some embodiments the antimiR may have a gapmer structure as herein
described.
However, as explained in W02007/112754 and W02007/112753, other designs may be
preferable, such as mixmers, or totalmers.
W02007/112754 and W02007/112753
provide antimiR oligomers and antimiR oligomer designs where the oligomers
which are
complementary to mature microRNA
In some embodiments, a subsequence of the antimiR corresponds to the miRNA
seed
region. in some embodiments, the first or second 3 nucleobase of the oligomer
corresponds to the
second 5' nucleotide of the microRNA sequence.
In some antimiR embodiments, nucleobase units 1 to 6 (inclusive) of the
oligomer as
measured from the 3' end the region of the oligomer are complementary to the
microRNA
seed region sequence.
In some antimiR embodiments, nucleobase units 1 to 7 (inclusive) of the
oligomer as
measured from the 3' end the region of the oligomer are complementary to the
microRNA
seed region sequence.
In some e antimiR embodiments, nucleobase units 2 to 7 (inclusive) of the
oligomer as
measured from the 3' end the region of the oligomer are complementary to the
microRNA
seed region sequence.
In some embodiments, the antimiR oligomer comprises at least one nucleotide
analogue unit, such as at least one LNA unit, in a position which is within
the region
complementary to the miRNA seed region. The antimiR oligomer may, in some
embodiments comprise at between one and 6 or between 1 and 7 nucleotide
analogue units,
such as between 1 and 6 and 1 and 7 LNA units, in a position which is within
the region
complementary to the miRNA seed region.
In some embodiments, the antimiR of the invention is 7, 8 or 9 nucleotides
long, and
comprises a contiguous nucleotide sequence which is complementary to a seed
region of a
human or viral microRNA, and wherein at least 80 cro, such as 85%, such as
90%, such as
95%, such as 100% of the nucleotides are LNA.
In some embodiments, the antimiR of the invention is 7, 8 or 9 nucleotides
long, and
comprises a contiguous nucleotide sequence which is complementary to a seed
region of a
human or viral microRNA, and wherein at least 80 % of the nucleotides are LNA,
and
wherein at least 80%, such as 85%, such as 90%, such as 95%, such as 100% of
the
internucleotide bonds are phosphorothioate bonds.
CA 2889596 2019-02-06
71
In some embodiments, the antimiR comprises one or two LNA units in positions
three
to eight, counting from the 3' end. This is considered advantageous for the
stability of the A-
helix formed by the oligonucleotide:microRNA duplex, a duplex resembling an
RNA:RNA
duplex in structure.
The table on pages 48 line 15 to page 51, line 9 of W02007/112754 provides
examples of anti microRNA oligomers (i.e. antimiRs which may be the oligomer
or first
region thereof).
MicroRNA mimics
In some embodiments the oligomer or first region thereof is in the form of a
miRNA mimic
which can be introduced into a cell to repress the expression of one or more
mRNA
target(s). miRNA mimics are typically fully complementary to the full length
miRNA
sequence. miRNA mimics are compounds comprising a contiguous nucleotide
sequence
which are homologous to a corresponding region of one, or more, of the miRNA
sequences
provided or referenced to herein. The use of miRNA mimics or antimiRs can be
used to
.. (optionally) further repress the mRNA targets, or to silence (down-
regulate) the miRNA,
thereby inhibiting the function of the endogenous miRNA, causing derepression
and
increased expression of the mRNA target.
Apta mers
In some embodiments the oligomer or first region thereof may be a therapeutic
aptamer, a
spiegelmer. Please note that aptamers may also be ligands, such as receptor
ligands, and
may therefore be used as a targeting moiety (i.e. region 3). Aptamers (also
referred to as
Spiegeliners) in the context of the present invention as nucleic acids of
between 20 and 50
nucleotides in length, which have been selected on the basis of their
conformational
structure rather than the sequence of nucleotides ¨ they elicit their
therapeutic effect by
binding with a target protein directly in vivo and they do not, therefore,
comprise of the
reverse complement of their target ¨ indeed their target is not a nucleic acid
but a protein.
Specific aptamers which may be the oligomer or first region thereof include
Macugen (OSI
Pharmaceuticals) or ARC1779, (Archemix, Cambridge, MA). In some embodiments,
the
oligomer or first region thereof is not an aptamer. In some embodiments the
oligomer or first
region thereof is not an aptamer or a spiegelmer.
siRNA Complexes
In some embodiments, the oligomer or first region thereof may be part of a
siRNA
complex ¨ i.e. the antisense or passenger strand of the siRNA complex. An
siRNA complex
is capable of mediating RNA interference.
CA 2889596 2019-02-06
72
In some embodiments the siRNA complex comprises two single stranded oligomers
of
between 17 ¨ 25 nts in length, such as 18, 19, 20, 21, 22, 23, 24 nucleotides
in length, such
as between 21-23 nucleotides in length. In some embodiments, the sense and/or
antisense
strand of the siRNA may comprise a 3 overhang, typically of 1, 2 or 3
nucleotides. Suitably,
the sense and or antisense strand may comprise one or more nucleotide
analogues.
In some embodiments the siRNA complex is a siLNA, such as the siRNA designs
described in W02004/000192, W02005/073378, W02007/085485.
An siLNA is a siRNA which comprises at least one LNA unit.
In some embodiments, the siRNA complex is a sisiLNA, such as those described
in
W02007/107162 . In some embodiments, the oligomer
or first region thereof, of the invention is the sense strand of the siRNA,
and as such may be
non-complementary to the target (indeed, may be homologous to the intended
target).
In some embodiments, the oligomer or compound of the invention is not a siRNA
or a
siLNA.
.. Internucleofide Linkages
The nucleoside monomers of the oligomers (e.g. first and second regions)
described
herein are coupled together via finternucleoside] linkage groups. Suitably,
each monomer is
linked to the 3' adjacent monomer via a linkage group.
The person having ordinary skill in the art would understand that, in the
context of the
present invention, the 5' monomer at the end of an oligomer does not comprise
a 5' linkage
group, although it may or may not comprise a 5' terminal group.
The terms "linkage group" or "internucleotide linkage" are intended to mean a
group
capable of covalently coupling together two nucleotides. Specific and
preferred examples
include phosphate groups and phosphorothioate groups.
The nucleotides of the oligomer of the invention or contiguous nucleotides
sequence
thereof are coupled together via linkage groups. Suitably each nucleotide is
linked to the 3'
adjacent nucleotide via a linkage group.
Suitable internucleotide linkages include those listed within W02007/031091,
for
example the internucleotide linkages listed on the first paragraph of page 34
of
W02007/031091,
It is, in some embodiments, other than the phosphodiester linkage(s) or region
B, the
preferred to modify the internucleotide linkage from its normal phosphodiester
to one that is
more resistant to nuclease attack, such as phosphorothioate or boranophosphate
¨ these
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
73
two, being cleavable by RNase H, also allow that route of antisense inhibition
in reducing the
expression of the target gene.
Suitable sulphur (S) containing internucleotide linkages as provided herein
may be
preferred, such as phosphorothioate or phosphodithioate. Phosphorothioate
internucleotide
linkages are also preferred, particularly for the first region, such as in
gapmers, mixmers,
antimirs splice switching oligomers, and totalmers.
For gapmers, the internucleotide linkages in the oligomer may, for example be
phosphorothioate or boranophosphate so as to allow RNase H cleavage of
targeted RNA.
Phosphorothioate is preferred, for improved nuclease resistance and other
reasons, such as
ease of manufacture.
In one aspect, with the exception of the phosphodiester linkage between the
first and
second region, and optionally within region B, the remaining internucleoside
linkages of the
oligomer of the invention, the nucleotides and/or nucleotide analogues are
linked to each
other by means of phosphorothioate groups. In some embodiments, at least 50%,
such as at
least 70%, such as at least 80%, such as at least 90% such as all the
internucleoside
linkages between nucleosides in the first region are other than phosphodiester
(phosphate),
such as are selected from the group consisting of phosphorothioate
phosphorodithioate, or
boranophosphate. In some embodiments, at least 50%, such as at least 70%, such
as at
least 80%, such as at least 90% such as all the internucleoside linkages
between
nucleosides in the first region are phosphorothioate.
W009124238 refers to oligomeric compounds having at least one bicyclic
nucleoside
attached to the 3' or 5' termini by a neutral internucleoside linkage. The
oligomers of the
invention may therefore have at least one bicyclic nucleoside attached to the
3' or 5' termini
by a neutral internucleoside linkage, such as one or more phosphotriester,
methylphosphonate, MMI, amide-3, formacetal or thioformacetal. The remaining
linkages
may be phosphorothioate.
Conjugates, targeting moieties and blocking groups
The term "conjugate" is intended to indicate a heterogenous molecule formed by
the
covalent attachment ("conjugation") of the oligomer as described herein to one
or more non-
nucleotide, or non-polynucleotide moieties. Examples of non-nucleotide or non-
polynucleotide moieties include macromolecular agents such as proteins, fatty
acid chains,
sugar residues, glycoproteins, polymers, or combinations thereof. Typically
proteins may be
antibodies for a target protein. Typical polymers may be polyethylene glycol.
74
Therefore, in various embodiments, the oligomer of the invention may comprise
both a
polynucleotide region which typically consists of a contiguous sequence of
nucleotides, and
a further non-nucleotide region. When referring to the oligomer of the
invention consisting of
a contiguous nucleotide sequence, the compound may comprise non-nucleotide
components, such as a conjugate component.
In various embodiments of the invention the oligomeric compound is linked to
ligands/conjugates, which may be used, e.g. to increase the cellular uptake of
oligomeric
compounds. W02007/031091 provides suitable ligands and conjugates.
In various embodiments where the compound of the invention consists of a
specified
nucleic acid or nucleotide sequence, as herein disclosed, the compound may
also comprise
at least one non-nucleotide or non-polynucleotide moiety (e.g. not comprising
one or more
nucleotides or nucleotide analogues) covalently attached to said compound.
In some embodiments, the conjugate may be a lipophilic conjugate or a proteins
(e.g.,
antibodies, enzymes, serum proteins); peptides; vitamins (water-soluble or
lipid-soluble);
polymers (water-soluble or lipid-soluble); small molecules including drugs,
toxins, reporter
molecules, and receptor ligands; carbohydrate complexes; nucleic acid cleaving
complexes;
metal chelators (e.g., porphyrins, texaphyrins, crown ethers, etc.);
intercalators including
hybrid photonuclease/intercalators; crosslinking agents (e.g., photoactive,
redox active), and
combinations and derivatives thereof. Numerous suitable conjugate moieties,
their
preparation and linkage to oligomeric compounds are provided, for example, in
WO
93/07883 and U.S. Pat. No. 6,395,492.
. Oligonucleotide conjugates and their syntheses are also reported in
comprehensive reviews by Manoharan in Antisense Drug Technology, Principles,
Strategies,
and Applications, S.T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and
Manoharan,
Antisense and Nucleic Acid Drug Development, 2002, 12, 103.
[0034]
Conjugation (to a conjugate moiety) may enhance the activity, cellular
distribution or
cellular uptake of the oligomer of the invention. Such moieties include, but
are not limited to,
antibodies, polypeptides, lipid moieties such as a cholesterol moiety, cholic
acid, a thioether,
e.g. Hexyl-s-tritylthiol, a thiocholesterol, an aliphatic chain, e.g.,
dodecandiol or undecyl
residues, a phospholipids, e.g., di-hexadecyl-rac-glycerol or triethylammonium
1,2-di-o-
hexadecyl-rac-glycero-3-h-phosphonate, a polyamine or a polyethylene glycol
chain, an
CA 2889596 2019-02-06
'46
adamantane acetic acid, a palmityl moiety, an octadecylamine or hexylamino-
carbonyl-
oxycholesterol moiety.
The oligomers of the invention may also be conjugated to active drug
substances, for
example, aspirin, ibuprofen, a sulfa drug, an antidiabetic, an antibacterial
or an antibiotic.
5 In certain embodiments the conjugated moiety is a sterol, such as
cholesterol.
In various embodiments, the conjugated moiety comprises or consists of a
positively
charged polymer, such as a positively charged peptides of, for example from 1 -
50, such as
2 ¨ 20 such as 3 ¨ 10 amino acid residues in length, and/or polyalkylene oxide
such as
polyethylglycol(PEG) or polypropylene glycol ¨ see WO 2008/034123.
The use of a conjugate is often associated with enhanced pharmacokinetic or
pharmeodynamic dynamic properties. However, the presence of a conjugate group
may
interfere with the activity of the oligonucleotide against its intended
target, for example via
steric hindrance preventing hybridization or nuclease recruitment (e.g. RNAseH
or RISC
recruitment). The use of a DNA and/or RNA phosphodiester region (region B)
between the
oligonucleotide (region A)and the conjugate moiety (X), as according to the
present
invention, allows for the improved properties due to the presence of the
conjugate group,
whilst ensuring that once at the target tissue, the conjugate group does not
prevent effective
activity of the oligonucleotide.
The oligonucleotide of the invention is, in some embodiments, covalently
attached to
one or more conjugate group, optionally through one or more linkers. The
resulting
conjugate compounds may, for example have modified enhanced properties, such
as
modified or enhanced pharmacokinetic, pharmeodynamic, and other properties
compared
with non-conjugated oligomeric compounds. A conjugate moiety that can modify
or enhance
the pharmacokinetic properties of an oligomeric compound can improve cellular
distribution,
bioavailability, metabolism, excretion, permeability, and/or cellular uptake
of the oligomeric
compound. A conjugate moiety that can modify or enhance pharmacodynamic
properties of
an oligomeric compound can improve activity, resistance to degradation,
sequence-specific
hybridization, uptake, and the like. In some embodiments, the conjugate group
may reduce
or prevent in appropriate activity of the oligonucleotide, e.g. off target
activity or activity in
non-target tissues or organs. This may be achieved by use of a blocking
moiety, which may
for example be a conjugate, the presence of the blocking group covalently
attached to the
oligonucleotide (optionally via a linker), may prevent or hinder
oligonucleotide hybridization
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
76
and/or activity. The cleavage of the DNA/RNA phosphodiester region (e.g.at the
intended
target site), removes the blocking group, allowing delivery of the active
oligonucleotide at the
intended site.
In some embodiments, the compound of the invention comprises a conjugate
group.
It will be recognized that one conjugate group may be used, for example for
targeting to a
specific tissue, for example a lipophilic group for targeting to the liver,
and a second
conjugate group may be used to provide a further benefit, for example a
blocking group or a
further therapeutic entity. Suitable one or both of the conjugates/moieties
may be linked to
the oligonucleotide via the DNA/RNA phosphodiester region according to the
present
invention. In some embodiments, the conjugate is covalently bound to the
oligonucleotide,
optionally via a linker, at the 5' and/or 3' termini of the oligonucleotide.
In this respect, if two
conjugate/moiety groups are used, one may be linked to the 5' termini and one
to the 3'
termini.
Carbohydrate conjugates
In some embodiments, the conjugate group is selected from the group consisting
of a
carbohydrate, a lipophilic moiety, a polymer, a protein or peptide, a label or
dye, a small
molecule, such as a small molecule therapeutic moiety, a cell surface receptor
ligand.
In some embodiments, the conjugate is or may comprise a carbohydrate or
comprises
a carbohydrate group. In some embodiments, the carbohydrate is selected from
the group
consisting of galactose, lactose, n-acetylgalactosamine, mannose, and mannose-
6-
phosphate. In some embodiments, the conjugate group is or may comprise mannose
or
mannose-6-phosphate. Carbohydrate conjugates may be used to enhance delivery
or
activity in a range of tissues, such as liver and/or muscle. See, for example,
EP1495769,
W099/65925, Yang et al., Bioconjug Chem (2009) 20(2): 213-21. Zatsepin &
Oretskaya
Chem Biodivers. (2004) 1(10): 1401-17.
In some embodiments, the conjugate group is a carbohydrate moiety. In
addition, the
oligomer may further comprise one or more additional conjugate moieties, of
which lipophilic
or hydrophobic moieties are particularly interesting. These may for example,
act as
pharmacokinetic modulators, and may be covalently linked to either the
carbohydrate
conjugate, a linker linking the carbohydrate conjugate to the oligomer or a
linker linking
multiple carbohydrate conjugates (multi-valent) conjugates, or to the
oligomer, optionally via
a linker, such as a bio cleavable linker. I
77
In some embodiments, the conjugate is or may comprise a carbohydrate or
comprises
a carbohydrate group. In some embodiments, the carbohydrate is selected from
the group
consisting of galactose, lactose, n-acetylgalactosamine, mannose, and mannose-
6-
phosphate. In some embodiments, the conjugate group is or may comprise mannose
or
mannose-6-phosphate. Carbohydrate conjugates may be used to enhance delivery
or
activity in a range of tissues, such as liver and/or muscle. See, for example,
EP1495769,
W099/65925, Yang et al., Bioconjug Chem (2009) 20(2): 213-21. Zatsepin &
Oretskaya
Chem Biodivers. (2004) 1(10): 1401-17.
GaINAc Conjugates
The invention also provides oligonucleotides, such as LNA antisense oligomers,
which
are conjugated to an asialoglycoprotein receptor targeting moiety. In some
embodiments,
the conjugate moiety (such as the third region or region C) comprises an
asialoglycoprotein
receptor targeting moiety, such as galactose, galactosamine, N-formyl-
galactosamine,
Nacetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine,
and N-
isobutanoylgalactos-amine. In some embodiments the conjugate comprises a
galactose
cluster, such as N-acetylgalactosamine trimer. In some embodiments, the
conjugate moiety
comprises a GaINAc (N-acetylgalactosamine), such as a mono-valent, di-valent,
tri-valent of
tetra-valent GaINAc. Trivalent GaINAc conjugates may be used to target the
compound to
the liver. GaINAc conjugates have been used with methylphosphonate and PNA
antisense
oligonucleotides (e.g. US 5,994517 and Hangeland etal., Bioconjug Chem. 1995
Nov-
Dec;6(6):695-701) and siRNAs (e.g. W02009/126933, W02012/089352 &
W02012/083046).
W02012/083046 discloses siRNAs with GaINAc
conjugate moieties which comprise cleavable pharmacokinetic modulators, which
are
suitable for use in the present invention, the preferred pharmacokinetic
modulators are C16
hydrophobic groups such as palmitoyl, hexadec-8-enoyl, oleyl, (9E, 12E)-
octadeca-9,12-
dienoyl, dioctanoyl, and C16-C20 acyl. The '046 cleavable pharmacokinetic
modulators may
also be cholesterol.
The 'targeting moieties (conjugate moieties) may be selected from the group
consisting of: galactose, galactosamine, N-formyl-galactosamine, N-
acetylgalactosamine,
Npropionyl- galactosamine, N-n-butanoyl-galactosamine, N-iso-butanoylgalactos-
amine,
galactose cluster, and N-acetylgalactosamine trimer and may have a
pharmacokinetic
modulator selected from the group consisting of: hydrophobic group having 16
or more
carbon atoms, hydrophobic group having 16-20 carbon atoms, palnnitoyl, hexadec-
8-enoyl,
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
78
oleyl, (9E,12E)-octadeca-9,12dienoyl, dioctanoyl, and C16-C20 acyl, and
cholesterol.
Certain GalNac clusters disclosed in '046 include: (E)-hexadec-8-enoyl (C16),
oleyl (C18),
(9,E,12E)-octadeca-9,12-dienoyl (C18), octanoyl (C8), dodececanoyl (C12), C-20
acyl, C24
acyl, dioctanoyl (2xC8). The targeting moiety-pharmacokinetic modulator
targeting moiety
may be linked to the polynucleotide via a physiologically labile bond or, e.g.
a disulfide bond,
or a PEG linker. The invention also relates to the use of phospodiester
linkers between the
oligomer and the conjugate group (these are referred to as region B herein,
and suitably are
positioned between the LNA oligomer and the carbohydrate conjugate group).
For targeting hepatocytes in liver, a preferred targeting ligand is a
galactose cluster.
A galactose cluster comprises a molecule having e.g. comprising two to four
terminal
galactose derivatives. As used herein, the term galactose derivative includes
both galactose
and derivatives of galactose having affinity for the asialoglycoprotein
receptor equal to or
greater than that of galactose. A terminal galactose derivative is attached to
a molecule
through its C-I carbon. The asialoglycoprotein receptor (ASGPr) is unique to
hepatocytes
and binds branched galactose-terminal glycoproteins. A preferred galactose
cluster has
three terminal galactosamines or galactosamine derivatives each having
affinity for the
asialoglycoprotein receptor. A more preferred galactose cluster has three
terminal N-acetyl-
galactosamines. Other terms common in the art include tri-antennary galactose,
tri-valent
galactose and galactose trimer. It is known that tri-antennary galactose
derivative clusters
are bound to the ASGPr with greater affinity than bi-antennary or mono-
antennary galactose
derivative structures (Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly
et al., 1982,1.
Biol. Chern., 257,939-945). Multivalency is required to achieve nM affinity.
According to WO
2012/083046 the attachment of a single galactose derivative having affinity
for the
asialoglycoprotein receptor does not enable functional delivery of the RNAi
polynucleotide to
hepatocytes in vivo when co-administered with the delivery polymer.
A galactose cluster may comprise two or preferably three galactose derivatives
each
linked to a central branch point. The galactose derivatives are attached to
the central branch
point through the C-I carbons of the saccharides. The galactose derivative is
preferably
linked to the branch point via linkers or spacers (which may be region Y). A
preferred spacer
is a flexible hydrophilic spacer (U.S. Patent 5885968; Biessen et al. J. Med.
Chern. 1995
Vol. 39 p. 1538-1546). A preferred flexible hydrophilic spacer is a PEG
spacer. A preferred
PEG spacer is a PEG3 spacer. The branch point can be any small molecule which
permits
attachment of the three galactose derivatives and further permits attachment
of the branch
point to the oligomer. An exemplary branch point group is a di-lysine. A di-
lysine molecule
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
79
contains three amine groups through which three galactose derivatives may be
attached and
a carboxyl reactive group through which the di-lysine may be attached to the
oligomer.
Attachment of the branch point to oligomer may occur through a linker or
spacer. A preferred
spacer is a flexible hydrophilic spacer. A preferred flexible hydrophilic
spacer is a PEG
.. spacer. A preferred PEG spacer is a PEG3 spacer (three ethylene units). The
galactose
cluster may be attached to the 3' or 5' end of the oligomer using methods
known in the art.
A preferred galactose derivative is an N-acetyl-galactosamine (GaINAc). Other
saccharides having affinity for the asialoglycoprotein receptor may be
selected from the list
comprising: galactosamine, N-n-butanoylgalactosamine, and N-iso-
butanoylgalactosamine.
.. The affinities of numerous galactose derivatives for the asialoglycoprotein
receptor have
been studied (see for example: Jobst, S.T. and Drickamer, K. JB.C.
1996,271,6686) or are
readily determined using methods typical in the art.
OH
1-10.43.
0-Nr0
0
r,OH
HO
N OH
0
0
OH
HO o."-o^irN
0
110 N
0
One embodiment of a Galactose cluster
CA 02889596 2015-04-24
WO 2014/076195
PCT/EP2013/073858
Jr..7
HO
syN
0 N
jfelH
HO 0
H:::1=1.1)"*0
N 6 o o OH
0 n
OH
H 0 ..b. 0 ......"=0 ..-.1rN
Ore" 0 0
HO N
-'O
Galactose clater with PEG spacer between branch point and nucleic acid
A GalNac conjugate is illustrated in figure 1. Further examples of the
conjugate of the
invention are illustrated below:
5
"3"4,44
Ho... ... c)
<
f Y
140, ?
0 H 0
...**, -A.....,,,,,,..0 "...,_,...A.,
6 sii a
m c
uo.....õ.. II
B A
Foe'-' ,=="",.." ',,, '''''.0".",..}11===
C
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
81
14";1/4.---=CH o
t. ...," --
MH
c
1404õ,),0
0 V
4.,
--......a.A.,.....".Ø--......-00.jc 'ILN¨c
H 8 ) H 0
0
I
9
3 A
C
OH
140j0
OH
tic ..." '`.. ==========.,As..e."*0,"`".....A...." NH
c
1 y ¨ HI .1
HO 0 1 1
0
_AIH c
HO,,, I
B A
tioe- --... ..."..õ..Ø...õ.."..v".......)1s.."- 1
c
Region A may, for example, be a LNA antisense oligonucleotide.
As described herein, a carbohydrate conjugate (e.g. GaINAc) may therefore be
linked to the
oligomer via a biocleavable linker, such as region B as defined herein, and
optionally region
Y, which is illustrated as a di-lysine in the above diagrams.
Where at the hydrophobic or lipophilic (or further conjugate) moiety (i.e.
pharmacokinetic
modulator) in the above GalNac cluster conjugates is, when using BNA or LNA
oligomers,
such as LNA antisense oligonucleotides, optional.
CA 02889596 2015-04-24
WO 2014/076195
PCT/EP2013/073858
82
See the figures for specific GalNac clusters used in the present study, Conj
1, 2, 3, 4 and
Conj1a, 2a, 3a and 4a (which are shown with an optional 06 linker which joins
the GalNac
cluster to the oligomer¨ See Figures 12 and 17).
Each carbohydrate moiety of a GalNac cluster (e.g. GaINAc) may therefore be
joined to the
oligomer via a spacer, such as (poly)ethylene glycol linker (PEG), such as a
di, tri, tetra,
penta, hexa-ethylene glycol linker. As is shown above the PEG moiety forms a
spacer
between the galactose sugar moiety and a peptide (trilysine is shown) linker.
In some embodiments, the GalNac cluster comprises a peptide linker, e.g. a Tyr-
Asp(Asp)
tripeptide or Asp(Asp) dipeptide, which is attached to the oligomer (or to
region Y or region
B) via a biradical linker, for example the GalNac cluster may comprise the
following biradical
linkers:
HO HO 0
11HAc 171HAc
OH NH
0 0 H:i....NH 0 . OH
0 NH R
,ky..
0 ...\
0 0 0 0 r-
R1
HO" NH HO
NH NH
21-----n
NHA\-c¨\\¨\--\ r-NH HO NHAC¨\\----\¨\ r-NH 0 HO 0
0 NH r HN--"ks HN--k\ 0 NH
0 0
OH Oz,,
OH ,---/
H0kj:0 _...\_ J¨NH
0
HO 0
HO NHAc HO -NHAc
R1 is a biradical preferably selected from -C2I-14-, -C3I-16-, -C41-I8-, -05I-
110-, -C6I-112-, 1,4-
cyclohexyl (-06H10-), 1,4-phenyl (-061--14-), -021-14002H4-, -02H4(0C2H4)2- or
-C21-14(0C2H4)3- =
In addition, the carbohydrate conjugate (e.g. GaINAc), or carbohydrate-linker
moiety (e.g.
carbohydrate-PEG moiety) may be covalently joined (linked) to the oligomer (or
region B) via
a branch point group such as, an amino acid, or peptide, which suitably
comprises two or
more amino groups (such as 3, 4, 0r5), such as lysine, di-lysine or tri-lysine
or tetra-lysine.
A tri-lysine molecule contains four amine groups through which three
carbohydrate
conjugate groups, such as galactose & derivatives (e.g. GaINAc) and a further
conjugate
such as a hydrophobic or lipophilic moiety/group may be attached and a
carboxyl reactive
group through which the tri-lysine may be attached to the oligomer. The
further conjugate,
such as lipophilic/hydrophobic moiety may be attached to the lysine residue
that is attached
to the oligomer. In some embodiments, the conjugate (C) is not a monovalent
GalNac.
83
The invention also provides LNA antisense oligonucleotides which are
conjugated to an
asialoglycoprotein receptor targeting moiety. In some embodiments, the
conjugate moiety
(such as the third region or region C) comprises an asialoglycoprotein
receptor targeting
moiety, such as galactose, galactosamine, N-formyl-galactosamine,
Nacetylgalactosamine,
N-propionyl-galactosamine, N-n-butanoyl-galactosamine, and N-
isobutanoylgalactos-amine.
In some embodiments the conjugate comprises a galactose cluster, such as N-
acetylgalactosamine timer. In some embodiments, the conjugate moiety comprises
a
GalNac (N-acetylgalactosamine), such as a mono-valent, di-valent, tri-valent
of tetra-valent
GalNac. Trivalent GalNac conjugates may be used to target the compound to the
liver.
GalNac conjugates have been used with methylphosphonate and PNA antisense
oligonucleotides (e.g. US 5,994517 and Hangeland etal., Bioconjug Chem. 1995
Nov-
Dec;6(6):695-701) and siRNAs (e.g. W02009/126933, W02012/089352 &
W02012/083046).
W02012/083046 discloses GalNac conjugate moieties
which comprise cleavable pharmacokinetic modulators, the preferred
pharmacokinetic
modulators are C16 hydrophobic groups such as palmitoyl, hexadec-8-enoyl,
oleyl, (9E,
12E)-octadeca-9,12-dienoyl, dioctanoyl, and C16-C20 acyl. The '046 cleavable
pharmacokinetic modulators may also be cholesterol. The '046 targeting
moieties may be
selected from the group consisting of: galactose, galactosamine, N-formyl-
galactosamine, N-
acetylgalactosamine, Npropionyl- galactosamine, N-n-butanoyl-galactosamine, N-
iso-
butanoylgalactos-amine, galactose cluster, and N-acetylgalactosamine trimer
and may have
a pharmacokinetic modulator selected from the group consisting of: hydrophobic
group
having 16 or more carbon atoms, hydrophobic group having 16-20 carbon atoms,
palmitoyl,
hexadec-8-enoyl, oleyl, (9E,12E)-octadeca-9,12dienoyl, dioctanoyl, and C16-C20
acyl, and
cholesterol. Certain GalNac clusters disclosed in '046 include: (E)-hexadec-8-
enoyi (C16),
oleyl (C18), (9,E,12E)-octadeca-9,12-dienoyl (C18), octanoyl (C8),
dodececanoyl (C12), C-
20 acyl, C24 acyl, dioctanoyl (2xC8). According to '046, the targeting moiety-
pharmacokinetic modulator targeting moiety may be linked to the polynucleotide
via a
physiologically labile bond or, e.g. a disulfide bond, or a PEG linker.
Other conjugate moieties can include, for example, oligosaccharides and
carbohydrate
clusters such as Tyr-Glu-Glu-(aminohexyl GaINAc)3 (YEE(ahGaINAc)3; a
glycotripeptide
that binds to Gal/GaINAc receptors on hepatocytes, see, e.g., Duff, et al.,
Methods Enzymol,
2000, 313, 297); lysine-based galactose clusters (e.g., L3G4; Biessen, et al.,
Cardovasc.
Med., 1999, 214); and cholane-based galactose clusters (e.g., carbohydrate
recognition
CA 2889596 2019-02-06
84
motif for asialoglycoprotein receptor). Further suitable conjugates can
include
oligosaccharides that can bind to carbohydrate recognition domains (CRD) found
on the
asiologlycoprotein-receptor (ASGP-R). Example conjugate moieties containing
oligosaccharides and/or carbohydrate complexes are provided in U.S. Pat. No.
6,525,031.
Pharmacokinetic Modulators
The compound of the invention may further comprise one or more additional
conjugate
moieties, of which lipophilic or hydrophobic moieties are particularly
interesting, such as
when the conjugate group is a carbohydrate moiety. Such lipophilic or
hydrophobic moieties
may act as pharmacokinetic modulators, and may be covalently linked to either
the
carbohydrate conjugate, a linker linking the carbohydrate conjugate to the
oligomer or a
linker linking multiple carbohydrate conjugates (multi-valent) conjugates, or
to the oligomer,
optionally via a linker, such as a bio cleavable linker.
The oligomer or conjugate moiety may therefore comprise a pharmacokinetic
modulator, such as a lipophilic or hydrophobic moieties. Such moieties are
disclosed within
the context of siRNA conjugates in W02012/082046. The hydrophobic moiety may
comprise a C8 ¨ 036 fatty acid, which may be saturated or un-saturated. in
some
embodiments, C10, C12, C14, C16, C18, 020, C22, C24, C26, C28, C30, 032 and
034 fatty
acids may be used. The hydrophobic group may have 16 or more carbon atoms.
Exemplary
suitable hydrophobic groups may be selected from the group comprising: sterol,
cholesterol,
palmitoyl, hexadec-8-enoyl, oleyl, (9E, 12E)-octadeca-9,12-dienoyl,
dioctanoyl, and 016-
020 acyl. According to WO'346, hydrophobic groups having fewer than 16 carbon
atoms
are less effective in enhancing polynucleotide targeting, but they may be used
in multiple
copies (e.g. 2x, such as 2x 08 or 010, 012 or C14) to enhance efficacy.
Pharmacokinetic
modulators useful as polynucleotide targeting moieties may be selected from
the group
consisting of: cholesterol, alkyl group, alkenyl group, alkynyl group, aryl
group, aralkyl group,
aralkenyl group, and aralkynyl group, each of which may be linear, branched,
or cyclic.
Pharmacokinetic modulators are preferably hydrocarbons, containing only carbon
and
hydrogen atoms. However, substitutions or heteroatoms which maintain
hydrophobicity, for
example fluorine, may be permitted.
Surprisingly, the present inventors have found that GaiNac conjugates for use
with LNA
oligomers do not require a pharmacokinetic modulator, and as such, in some
embodiments,
the GalNac conjugate is not covalently linked to a lipophilic or hydrophobic
moiety, such as
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195
PCT/EP2013/073858
those described here in, e.g. do not comprise a C8 ¨ C36 fatty acid or a
sterol. The
invention therefore also provides for LNA oligomer GalNac conjugates which do
not
comprise a lipophilic or hydrophobic pharmacokinetic modulator or conjugate
moiety/group.
Lipophilic conjugates
5 The
compounds of the invention may be conjugates comprising of the oligomer (A)
and a lipophilic conjugate (C). The biocleavable linker (B) has found to be
particularly
effective in maintaining or enhancing the activity of such oligomer
conjugates. In some
embodiments the conjugate group (C) and or linker group (Y) comprises a
lipophilic group.
Representative conjugate moieties can include lipophilic molecules (aromatic
and non-
10 aromatic) including sterol and steroid molecules. Lipophilic conjugate
moieties can be used,
for example, to counter the hydrophilic nature of an oligomeric compound and
enhance
cellular penetration. Lipophilic moieties include, for example, steroids and
related
compounds such as cholesterol (U.S. Pat. No. 4,958,013 and Letsinger et al.,
Proc. Natl.
Acad. Sci. USA, 1989, 86, 6553), thiocholesterol (Oberhauser et al, Nucl Acids
Res., 1992,
15 20, 533), lanosterol, coprostanol, stigmasterol, ergosterol, calciferol,
cholic acid, deoxycholic
acid, estrone, estradiol, estratriol, progesterone, stilbestrol, testosterone,
and rosterone,
deoxycorticosterone, cortisone, 17-hydroxycorticosterone, their derivatives,
and the like.
Other lipophilic conjugate moieties include aliphatic groups, such as, for
example,
straight chain, branched, and cyclic alkyls, alkenyls, and alkynyls. The
aliphatic groups can
20 have, for example, 5 to about 50, 6 to about 50, 8 to about 50, or 10 to
about 50 carbon
atoms. Example aliphatic groups include undecyl, dodecyl, hexadecyl,
heptadecyl,
octadecyl, nonadecyl, terpenes, bornyl, adamantyl, derivatives thereof and the
like. In some
embodiments, one or more carbon atoms in the aliphatic group can be replaced
by a
heteroatom such as 0, S, or N (e.g., geranyloxyhexyl). Further suitable
lipophilic conjugate
25 moieties include aliphatic derivatives of glycerols such as
alkylglycerols, bis(alkyl)glycerols,
tris(alkyl)glycerols, monoglycerides, diglycerides, and triglycerides. In some
embodiments,
the lipophilic conjugate is di-hexyldecyl-rac-glycerol or 1,2-di-0- hexyldecyl-
rac-glycerol
(Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea, et al., Nuc. Acids
Res., 1990,
18, 3777) or phosphonates thereof. Saturated and unsaturated fatty
functionalities, such as,
30 for example, fatty acids, fatty alcohols, fatty esters, and fatty
amines, can also serve as
lipophilic conjugate moieties. In some embodiments, the fatty functionalities
can contain from
about 6 carbons to about 30 or about 8 to about 22 carbons. Example fatty
acids include,
capric, caprylic, lauric, palmitic, myristic, stearic, oleic, linoleic,
linolenic, arachidonic,
eicosenoic acids and the like.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
86
In further embodiments, lipophilic conjugate groups can be polycyclic aromatic
groups
having from 6 to about 50, 10 to about 50, or 14 to about 40 carbon atoms.
Example
polycyclic aromatic groups include pyrenes, purines, acridines, xanthenes,
fluorenes,
phenanthrenes, anthracenes, quinolines, isoquinolines, naphthalenes,
derivatives thereof
and the like. [0037] Other suitable lipophilic conjugate moieties include
menthols, trityls (e.g.,
dimethoxytrityl (DMT)), phenoxazines, lipoic acid, phospholipids, ethers,
thioethers (e.g.,
hexyl-S-tritylthiol), derivatives thereof and the like. Preparation of
lipophilic conjugates of
oligomeric compounds are well-described in the art, such as in, for example,
Saison-
Behmoaras et al, EMBO J., 1991, 10, 1111; Kabanov et al., FEBSLett., 1990,
259, 327;
.. Svinarchuk et al, Biochimie, 1993, 75, 49; (Mishra et al., Biochim.
Biophys. Acta, 1995,
1264, 229, and Manoharan et al., Tetrahedron Lett., 1995, 36, 3651.
Oligomeric compounds containing conjugate moieties with affinity for low
density
lipoprotein (LDL) can help provide an effective targeted delivery system. High
expression
levels of receptors for LDL on tumor cells makes LDL an attractive carrier for
selective
delivery of drugs to these cells (Rump, et al., Bioconjugate Chem., 1998, 9,
341; Firestone,
Bioconjugate Chem., 1994, 5, 105; Mishra, et al., Biochim. Biophys. Acta,
1995, 1264, 229).
Moieties having affinity for LDL include many lipophilic groups such as
steroids (e.g.,
cholesterol), fatty acids, derivatives thereof and combinations thereof. In
some
embodiments, conjugate moieties having LDL affinity can be dioleyl esters of
cholic acids
such as chenodeoxycholic acid and lithocholic acid.
In some embodiments, the conjugate group is or may comprise a lipophilic
moiety,
such as a sterol (for example, cholesterol, cholesteryl, cholestanol,
stigmasterol, cholanic
acid and ergosterol). In some embodiments, the conjugate is or may comprise
cholesterol.
See for example, Soutschek et al., Nature (2004) 432, 173; Krutzfeldt Nature
2005, NAR
2007.
In some embodiments, the conjugate is, or may comprise a lipid, a phospholipid
or a
lipophilic alcohol, such as a cationic lipids, a neutral lipids,
sphingolipids, and fatty acids
such as stearic, oleic, elaidic, linoleic, linoleaidic, linolenic, and
myristic acids. In some
embodiments the fatty acid comprises a C4 ¨ C30 saturated or unsaturated alkyl
chain. The
alkyl chain may be linear or branched.
In some embodiments, the lipophilic conjugates may be or may comprise biotin.
In
some embodiments, the lipophilic conjugate may be or may comprise a glyceride
or
glyceride ester.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
87
Lipophilic conjugates, such as cholesterol or as disclosed herein, may be used
to
enhance delivery of the oligonucleotide to, for example, the liver (typically
hepatocytes).
The following references refer to the use of lipophilic conjugates: Kobylanska
et al.,
Acta Biochim Pol. (1999); 46(3): 679 ¨ 91. Felber et al,. Biomaterials (2012)
33(25): 599-65);
Grijalvo et al., J Org Chem (2010) 75(20): 6806¨ 13. Koufaki et al., Curr Med
Chem (2009)
16(35): 4728-42. Godeau et al J. Med. Chem. (2008) 51(15): 4374-6.
Polymer conjugates
Conjugate moieties can also include polymers. Polymers can provide added bulk
and
various functional groups to affect permeation, cellular transport, and
localization of the
conjugated oligomeric compound. For example, increased hydrodynamic radius
caused by
conjugation of an oligomeric compound with a polymer can help prevent entry
into the
nucleus and encourage localization in the cytoplasm. In some embodiments, the
polymer
does not substantially reduce cellular uptake or interfere with hybridization
to a
complementary strand or other target. In further embodiments, the conjugate
polymer moiety
has, for example, a molecular weight of less than about 40, less than about
30, or less than
about 20 kDa. Additionally, polymer conjugate moieties can be water-soluble
and optionally
further comprise other conjugate moieties such as peptides, carbohydrates,
drugs, reporter
groups, or further conjugate moieties.
In some embodiments, polymer conjugates include polyethylene glycol (PEG) and
copolymers and derivatives thereof. Conjugation to PEG has been shown to
increase
nuclease stability of an oligomeric compound. PEG conjugate moieties can be of
any
molecular weight including for example, about 100, about 500, about 1000,
about 2000,
about 5000, about 10,000 and higher. In some embodiments, the PEG conjugate
moieties
contains at least 4, at least 5, at least 6, at least 7, at least 8, at least
9, at least 10, at least
15, at least 20, or at least 25 ethylene glycol residues. In further
embodiments, the PEG
conjugate moiety contains from about 4 to about 10, about 4 to about 8, about
5 to about 7,
or about 6 ethylene glycol residues. The PEG conjugate moiety can also be
modified such
that a terminal hydroxyl is replaced by alkoxy, carboxy, acyl, amido, or other
functionality.
Other conjugate moieties, such as reporter groups including, for example,
biotin or
fluorescein can also be attached to a PEG conjugate moiety. Copolymers of PEG
are also
suitable as conjugate moieties. [0047] Preparation and biological activity of
polyethylene
glycol conjugates of oligonucleotides are described, for example, in Bonora,
et al.,
Nucleosides Nucleotides, 1999, 18, 1723; Bonora, et al., Farmaco, 1998, 53,
634; Efimov,
Bioorg. Khim. 1993, 19, 800; and Jaschke, et al, Nucleic Acids Res., 1994, 22,
4810. Further
400
88
example PEG conjugate moieties and preparation of corresponding conjugated
oligomeric
compounds is described in, for example, U.S. Pat. Nos. 4,904,582 and 5,672,662
.
Oligomeric compounds conjugated
to one or more PEG moieties are available commercially.
Other polymers suitable as conjugate moieties include polyamines,
polypeptides,
polymethaorylates (e.g., hydroxylpropyl methaorylate (HP MA)), poly(L-
lactide), poly(DL
lactide-co-glycolide (PGLA), polyacrylic acids, polyethylenimines (PEI),
polyalkylacrylic
acids, polyurethanes, polyacrylamides, N- alkylacrylamides, polyspermine
(PSP),
polyethers, cyclodextrins, derivatives thereof and co-polymers thereof. Many
polymers, such
as PEG and polyamines have receptors present in certain cells, thereby
facilitating cellular
uptake. Polyamines and other amine-containing polymers can exist in protonated
form at
physiological pH, effectively countering an anionic backbone of some
oligomeric
compounds, effectively enhancing cellular permeation. Some example polyamines
include
polypeptides (e.g., polylysine, polyornithine, polyhistadine, polyarginine,
and copolymers
thereof), triethylenetetraamine, spermine, polyspermine, spermidine,
synnorspermidine, C-
branched spermidine, and derivatives thereof. Preparation and biological
activity of
polyamine conjugates are described, for example, in Guzaev, et al, Bioorg.
Med. Chem.
Lett., 1998, 8,3671; Corey, et al, J Am. Chem. Soc, 1995, 117, 9373; and
Prakash, et al,
Bioorg. Med. Chem. Lett. 1994, 4, 1733. Example polypeptide conjugates of
oligonucleotides are provided in, for example, Wei, et al., Nucleic Acids
Res., 1996, 24, 655
and Zhu, et al., Antisense Res. Dev., 1993, 3, 265. Dendrimeric polymers can
also be used
as conjugate moieties, such as described in U.S. Pat. No. 5,714,166.
[0049] As discussed above for polyamines and related
polymers, other amine-containing moieties can also serve as suitable conjugate
moieties
due to, for example, the formation of cationic species at physiological
conditions. Example
amine-containing moieties include 3-aminopropyl, 3-(N,N-dimethylamino)propyl,
2-(2-(N,N-
dimethylamino)ethoxy)ethyl, 2-(N-(2-aminoethyl)-N- methylaminooxy)ethyl, 2-(l-
imidazolyl)ethyl, and the like. The G-clamp moiety can also serve as an amine-
containing
conjugate moiety (Lin, et al., J. Am. Chem. Soc, 1998, 120, 8531).
In some embodiments, the conjugate may be, or may comprise a polymer, such as
a
polymer selected from the group consisting of polyethyleneglycol (PEG),
polyamidoamine
(PAA), polyethylene oxide and polyethylenimine (PEI). Galactose, lactose, n-
acetylgalactosamine, mannose, mannose-6-phosphate n some embodiments, the
polymer is
a polycationic polymer. In some embodiments, conjugate moieties can be, or
based on
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
89
(include) cationic polymers. Numerous studies have demonstrated that cationic
polymers
such as cationic albumin can greatly enhance delivery to particular cell types
and/or tissues
(e.g. brain delivery, see Lu, W. et. al. (2005) J of Control Release 107:428-
448). Given the
benefits of these molecules, the conjugate moieties can be cationic polymers
such as
polyethyleneimine, dendrimers, poly(alkylpyridinium) salts, or cationic
albumin. In some
embodiments is a hydrophilic polymer. In some embodiments, the polymer is
Poly(vinylpyrrolidone) (PVP). In some embodiments, the polymer is a polyamine
or
polyamide (e.g. US7,816,337 & US5525465. For polymer conjugates see for
example, Zhao
et al., Bioconjugate Chem 2005, 16, 758-766); Kim et al., J. Control Release
(2006) 116;
123. Pettit et al., Ther. Deliv. (2011) 2(7): 907-17. Yang et al., Bioconjug
Chem (2009) 20(2):
213-21. Winkler et al (2009) Eur J Med Chem 44(2): 670-7. Zelikin et al,
Biomacromolecules (2007) 8(9): 2950-3. See also W012092373 which refers to
enzyme
cleavable polynucleotide delivery conjugates.
Protein and peptide conjugates
Other conjugate moieties can include proteins, subunits, or fragments thereof.
Proteins
include, for example, enzymes, reporter enzymes, antibodies, receptors, and
the like. In
some embodiments, protein conjugate moieties can be antibodies or fragments
thereof
(Kuijpers, et al, Bioconjugate Chem., 1993, 4, 94). Antibodies can be designed
to bind to
desired targets such as tumor and other disease-related antigens. In further
embodiments,
protein conjugate moieties can be serum proteins such as HAS or glycoproteins
such as
asialoglycoprotein (Rajur, et al., Bioconjugate Chem., 1997, 6, 935). In yet
further
embodiments, oligomeric compounds can be conjugated to RNAi-related proteins,
RNAi-
related protein complexes, subunits, and fragments thereof. For example,
oligomeric
compounds can be conjugated to Dicer or RISC. [0067] lntercalators and minor
groove
binders (MGBs) can also be suitable as conjugate moieties. In some
embodiments, the MGB
can contain repeating DPI (1,2-dihydro-3H-pyrrolo(2,3-e)indole-7-carboxylate)
subunits or
derivatives thereof (Lukhtanov, et al., Bioconjugate Chem., 1996, 7, 564 and
Afonina, et al.,
Proc. Natl. Acad. Sci. USA, 1996, 93, 3199). Suitable intercalators include,
for example,
polycyclic aromatics such as naphthalene, perylene, phenanthridine,
benzophenanthridine,
phenazine, anthraquinone, acridine, and derivatives thereof. Hybrid
intercalator/ligands
include the photonuclease/intercalator ligand 6-[[[9-[[6- (4-
nitrobenzamido)hexyl]amino]acridin-4-yl]carbonyl]amino]hexan oyl-
pentafluorophenyl ester.
This compound is both an acridine moiety that is an intercalator and a p-nitro
benzamido
group that is a photonuclease. [0069] In further embodiments, cleaving agents
can serve as
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
conjugate moieties. Cleaving agents can facilitate degradation of target, such
as target
nucleic acids, by hydrolytic or redox cleavage mechanisms. Cleaving groups
that can be
suitable as conjugate moieties include, for example, metallocomplexes,
peptides, amines,
enzymes, and constructs containing constituents of the active sites of
nucleases such as
5 imidazole, guanidinium, carboxyl, amino groups, etc.). Example
metallocomplexes include,
for example, Cu-terpyridyl complexes, Fe-porphyrin complexes, Ru-complexes,
and
lanthanide complexes such as various Eu(III) complexes (Hall, et al., Chem.
Biol, 1994, 1,
185; Huang, et al., J. Biol. lnorg. Chem., 2000, 5, 85; and Baker, et al,
Nucleic Acids Res.,
1999, 27, 1547). Other metallocomplexes with cleaving properties include
metalloporphyrins
10 and derivatives thereof. Example peptides with target cleaving
properties include zinc fingers
(U.S. Pat. No. 6,365,379; Lima, et al., Proc. Natl. Acad. Sci. USA, 1999, 96,
10010).
Example constructs containing nuclease active site constituents include
bisimiazole and
histamine.
Conjugate moieties can also include peptides. Suitable peptides can have from
2 to
15 about 30,2 to about 20,2 to about 15, or 2 to about 10 amino acid
residues. Amino acid
residues can be naturally or non-naturally occurring, including both D and L
isomers. In
some embodiments, peptide conjugate moieties are pH sensitive peptides such as
fusogenic
peptides. Fusogenic peptides can facilitate endosomal release of agents such
as oligomeric
compounds to the cytoplasm. It is believed that fusogenic peptides change
conformation in
20 acidic pH, effectively destabilizing the endosomal membrane thereby
enhancing cytoplasmic
delivery of endosomal contents. Example fusogenic peptides include peptides
derived from
polymyxin B, influenza HA2, GALA, KALA, EALA, melittin-derived peptide, a-
helical peptide
or Alzheimer beta -amyloid peptide, and the like. Preparation and biological
activity of
oligonucleotides conjugated to fusogenic peptides are described in, for
example, Bongartz,
25 et al., Nucleic Acids Res., 1994, 22, 4681 and U.S. Pat. Nos. 6,559,279
and 6,344,436.
Other peptides that can serve as conjugate moieties include delivery peptides
which have
the ability to transport relatively large, polar molecules (including
peptides, oligonucleotides,
and proteins) across cell membranes. Example delivery peptides include Tat
peptide from
HIV Tat protein and Ant peptide from Drosophila antenna protein. Conjugation
of Tat and
30 Ant with oligonucleotides is described in, for example, Astriab-Fisher,
et al., Biochem.
Pharmacol, 2000, 60, 83. These and other delivery peptides that can be used as
conjugate
moieties are provided below in Table I:
Conjugated delivery peptides can help control localization of oligomeric
compounds to
specific regions of a cell, including, for example, the cytoplasm, nucleus,
nucleolus, and
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
91
endoplasmic reticulum (ER). Nuclear localization can be effected by
conjugation of a nuclear
localization signal (NLS). In contrast, cytoplasmic localization can be
facilitated by
conjugation of a nuclear export signal (NES). [0054] Peptides suitable for
localization of
conjugated oligomeric compounds in the nucleus include, for example, N,N-
dipalmitylglycyl-
.. apo E peptide or N,N- dipalmitylglycyl-apolipoprotein E peptide (dpGapoE)
(Liu, et al,
Arterioscler. Thromb. Vasc. Biol, 1999, 19, 2207; Chaloin, et al., Biochem.
Biophys. Res.
Commun., 1998, 243, 601). Nucleus or nucleolar localization can also be
facilitated by
peptides having arginine and/or lysine rich motifs, such as in HIV-1 Tat,
FXR2P, and
angiogenin derived peptides (Lixin, et al, Biochem. Biophys. Res. Commun.,
2001, 284,
185). Additionally, the nuclear localization signal (NLS) peptide derived from
SV40 antigen T
(Branden, et al., Nature Biotech, 1999, 17, 784) can be used to deliver
conjugated
oligomeric compounds to the nucleus of a cell. Other suitable peptides with
nuclear or
nucleolar localization properties are described in, for example, Antopolsky,
et al.,
Bioconjugate Chem., 1999, 10, 598; Zanta, et at., Proc. Natl. Acad. Sci. USA,
1999 (simian
virus 40 large tumor antigen); Hum. Mol. Genetics, 2000, 9, 1487; and
FEBSLett., 2002,
532, 36).
In some embodiments, the delivery peptide for nucleus or nucleolar
localization
comprises at least three consecutive arginine residues or at least four
consecutive arginine
residues. Nuclear localization can also be facilitated by peptide conjugates
containing RS,
RE, or RD repeat motifs (Cazalla, et al., Mol Cell. Biol, 2002, 22, 6871). In
some
embodiments, the peptide conjugate contains at least two RS, RE, or RD motifs.
Localization of oligomeric compounds to the ER can be effected by, for
example,
conjugation to the signal peptide KDEL (SEQ ID NO: 18) (Arar, et al.,
Bioconjugate Chem.,
1995, 6, 573; Pichon, et al., Mol. Pharmacol. 1997, 57, 431). [0057]
Cytoplasmic localization
of oligomeric compounds can be facilitated by conjugation to peptides having,
for example, a
nuclear export signal (NES) (Meunier, et al., Nucleic Acids Res., 1999, 27,
2730). NES
peptides include the leucine-rich NES peptides derived from HIV-1 Rev
(Henderson, et al.,
Exp. Cell Res., 2000, 256, 213), transcription factor III A, MAPKK, PKI-alpha,
cyclin B1, and
actin (Wada, et at., EMBO J., 1998, 17, 1635) and related proteins.
Antimicrobial peptides,
such as dermaseptin derivatives, can also facilitate cytoplasmic localization
(Hariton-Gazal,
et al., Biochemistry, 2002, 41, 9208). Peptides containing RG and/or KS repeat
motifs can
also be suitable for directing oligomeric compounds to the cytoplasm. In some
embodiments,
the peptide conjugate moieties contain at least two RG motifs, at least two KS
motifs, or at
least one RG and one KS motif. [0058] As used throughout, "peptide" includes
not only the
t..7
92
specific molecule or sequence recited herein (if present), but also includes
fragments thereof
and molecules comprising all or part of the recited sequence, where desired
functionality is
retained. In some embodiments, peptide fragments contain no fewer than 6 amino
acids.
Peptides can also contain conservative amino acid substitutions that do not
substantially
change its functional characteristics. Conservative substitution can be made
among the
following sets of functionally similar amino acids: neutral- weakly
hydrophobic (A, G, P, S,
T), hydrophilic-acid amine (N, D, Q, E), hydrophilic-basic (I, M, L, V), and
hydrophobic-
aromatic (F, W, Y). Peptides also include homologous peptides. Homology can be
measured
according to percent identify using, for example, the BLAST algorithm (default
parameters
for short sequences). For example, homologous peptides can have greater than
50, 60, 70,
80, 90, 95, or 99 percent identity. Methods for conjugating peptides to
oligomeric
compounds such as oligonucleotides is described in, for example, U.S. Pat. No.
6,559,279.
In some embodiments, the conjugate moiety is or comprises a protein or
peptide. In
some embodiments the peptide is a cell penetrating peptides, e.g. Penetratin,
transportan,
Peptaibol (e.g. trichorovin-Xlla (TV-Xlla)), TAT peptide (HIV). In some
embodiments, the
peptide is polyarginine (e.g. stearyl-(RxR)(4)). In some embodiments the
peptide is N-(2-
hydroxypropyl) methacrylamide (I-IPMA) containing tetrapeptide Gly-Phe-Leu-Gly
(GFLG).
In some embodiments, the peptide is a beta-amyloid peptide. In some
embodiments the
protein or peptide in an antibody or antigen binding site containing fragment
thereof (epitope
binding site). In some embodiments the conjugate is or comprises M6P-HPMA-GFLG
(see
Yang et al 2009). In some embodiments, the conjugate is or comprises arginine
rich
peptides (W02005/115479) ¨ see also W009005793 RGD peptides. In some
embodiments, the conjugate is or comprises a protein carrier (e.g. albumin,
albumin-PEG
conjugate - RGD-PEG-albumin) (Kang et al) see also W009045536. In some
embodiments,
the conjugate is or comprises histidylated oligolysine (e.g. W00032764). In
some
embodiments, the conjugate is or comprises Glycoproteins: transferrin-
polycation (e.g.
US5354844, W09217210, W09213570). In some embodiments, the conjugate is or
comprises asialoglycoprotein (US5346696). In some embodiments, the conjugate
is or
comprises a polycationic protein (e.g. US603095). In some embodiments, the
conjugate is
or comprises poly-pseudo-lysine conjugates (e.g. W007113531).
Reporter and dye conjugate groups
Reporter groups that are suitable as conjugate moieties include any moiety
that can be
detected by, for example, spectroscopic means. Example reporter groups include
dyes,
CA 2889596 2019-02-06
93
flurophores, phosphors, radiolabels, and the like. In some embodiments, the
reporter group
is biotin, flourescein, rhodamine, coumarin, or related compounds. Reporter
groups can also
be attached to other conjugate moieties. In some embodiments, the conjugate is
or
comprises a label or dye, such as a fluorophore, such as FAM
(Carboxyfluorescein).
Cross-linking agents can also serve as conjugate moieties. Cross- linking
agents
facilitate the covalent linkage of the conjugated oligomeric compounds with
other
compounds. In some embodiments, cross-linking agents can covalently link
double-stranded
nucleic acids, effectively increasing duplex stability and modulating
pharmacokinetic
properties. In some embodiments, cross-linking agents can be photoactive or
redox active.
Example cross-linking agents include psoralens which can facilitate
interstrand cross-linking
of nucleic acids by photoactivation (Lin, et al, Faseb J, 1995,9, 1371). Other
cross-linking
agents include, for example, mitomycin C and analogs thereof (Maruenda, et
al.,
Bioconjugate Chem., 1996, 7, 541; Maruenda, et al., Anti-Cancer Drug Des.,
1997, 12, 473;
and Huh, et al, Bioconjugate Chem., 1996, 7, 659). Cross-linking mediated by
mitomycin C
can be effected by reductive activation, such as, for example, with biological
reductants
(e.g., NADPH-cytochrome c reductase/NADPH system). Further photo-crosslinking
agents
include aryl azides such as, for example, N-hydroxysucciniimidy1-4-
azidobenzoate (HSAB)
and N-succinimidy1-6(-4'-azido-2'-nitrophenyl- amino)hexanoate (SANPAH). Aryl
azides
conjugated to oligonucleotides effect crosslinking with nucleic acids and
proteins upon
irradiation. They can also crosslink with earner proteins (such as KLH or
BSA).
Various functional conjugate groups
Other suitable conjugate moieties include, for example, polyboranes,
carboranes, metallopolyboranes, metallocarborane, derivatives thereof and the
like (see,
e.g., U.S. Pat. No. 5,272,250).
Many drugs, receptor ligands, toxins, reporter molecules, and other small
molecules can serve as conjugate moieties. Small molecule conjugate moieties
often have
specific interactions with certain receptors or other biomolecules, thereby
allowing targeting
of conjugated oligomeric compounds to specific cells or tissues. Example small
molecule
conjugate moieties include mycophenolic acid (inhibitor of inosine-5'-
monophosphate
dihydrogenase; useful for treating psoriasis and other skin disorders),
curcumin (has
therapeutic applications to psoriasis, cancer, bacterial and viral diseases).
In further
embodiments, small molecule conjugate moieties can be ligands of serum
proteins such as
human serum albumin (HSA). Numerous ligands of HSA are known and include, for
example, arylpropionic acids, ibuprofen, warfarin, phenylbutazone, suprofen,
carprofen,
CA 2889596 2019-02-06
94
fenfufen, ketoprofen, aspirin, indomethacin, (S)-(+)-pranoprofen,
dansylsarcosine, 2,3,5-
triiodobenzoic acid, flufenamic acid, folinic acid, benzothiadiazide,
chlorothiazide,
diazepines, indomethicin, barbituates, cephalosporins, sulfa drugs,
antibacterials, antibiotics
(e.g., puromycin and pamamycin), and the like. Oligonucleotide-drug conjugates
and their
preparation are described in, for example, WO 00/76554.
In some embodiments, the conjugate may be or comprise a small molecule,
such as a small molecule drug or pro-drug. Certain drugs are highly effective
at targeting
specific target tissue or cells, and as such they may be used to target an
oligonucleotide to
its intended site of action. Furthermore, the small molecule may in itself
have a therapeutic
activity, typically once cleaved from the oligonucleotide component of the
conjugate.
Examples include bisphosphonates (widely used for the treatment of
osteoporosis and
effective in targeting bone tissues), anti-cancer drugs and chemotherapeutic
agents (e.g.
doxorubicin or mitomycein C ¨ see US5776907). In some embodiments, the drug
may be a
nucleoside analogue, such as a nucleoside polymerase inhibitor.
In yet further embodiments, small molecule conjugates can target or bind
certain receptors or cells. T-cells are known to have exposed amino groups
that can form
Schiff base complexes with appropriate molecules. Thus, small molecules
containing
functional groups such as aldehydes that can interact or react with exposed
amino groups
can also be suitable conjugate moieties. Tucaresol and related compounds can
be
conjugated to oligomeric compounds in such a way as to leave the aldehyde free
to interact
with T-cell targets. Interaction of tucaresol with 1-cells in believed to
result in therapeutic
potentiation of the immune system by Schiff-base formation (Rhodes, et al.,
Nature, 1995,
377, 6544).
In some embodiments, the conjugate is or comprises a (e.g. cell surface)
receptor ligand. In some embodiments the conjugate is or comprises a folate
receptor
ligand, such as a folic acid group ¨ see for example, EP1572067 or
W02005/069994,
W02010/045584). Other cell surface receptor ligands include antibodies and
fragments
thereof, prostate-specific membrane antigen, neuron surface antigens (see
W02011/131693) .
In some embodiments, the conjugate moieties are ligands for receptors or can
associate with molecules that (in turn) associate with receptors. Included in
this class are
bile acids, small molecule drug ligands, vitamins, aptamers, carbohydrates,
peptides
(including but not limited to hormones, proteins, protein fragments,
antibodies or antibody
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
fragments), viral proteins (e.g. capsids), toxins (e.g. bacterial toxins), and
more. Also
included in this class are conjugates that are steroidal in nature e.g.
cholesterol, cholestanol,
cholanic acid, stigmasterols, pregnolones, progesterones, corticosterones,
aldosterones,
testosterones, estradiols, ergosterols, and more), Preferred conjugate
moieties of the
5 disclosure are cholesterol (CHOL), cholestanol (CHLN), cholanic acid
(CHLA), stigmasterol
(STIG), and ergosterol (ERGO). In certain preferred embodiments, the conjugate
moiety is
cholesterol.
In some embodiments the conjugate comprises a sterol ,such as cholesterol or
tocopherol, optionally including a linker, such as a fatty acid linker, e.g. a
06 linker. In some
10 embodiments the conjugates comprise Conj5a or Conj 6a.
1:1
Coal 5a=
OW 6a=
EL
=ty,
Conjugate moieties can also include vitamins. Vitamins are known to be
transported into cells by numerous cellular transport systems. Typically,
vitamins can be
classified as water soluble or lipid soluble. Water soluble vitamins include
thiamine,
15 riboflavin, nicotinic acid or niacin, the vitamin B6 pyridoxal group,
pantothenic acid, biotin,
folic acid, the B]2 cobamide coenzymes, inositol, choline and ascorbic acid.
Lipid soluble
vitamins include the vitamin A family, vitamin D, the vitamin E tocopherol
family and vitamin
K (and phytols). Related compounds include retinoid derivatives such as
tazarotene and
etretinate. [0040] In some embodiments, the conjugate moiety includes folic
acid folate)
20 and/or one or more of its various forms, such as dihydrofolic acid,
tetrahydrofolic acid, folinic
acid, pteropolyglutamic acid, dihydrofolates, tetrahydrofolates,
tetrahydropterins, 1-deaza, 3-
deaza, 5-deaza, 8-deaza, 10-deaza, 1,5-dideaza, 5,10-dideaza, 8,10-dideaza and
5,8-
dideaza folate analogs, and antifolates. Folate is involved in the
biosynthesis of nucleic acids
and therefore impacts the survival and proliferation of cells. Folate
cofactors play a role in
25 the one-carbon transfers that are needed for the biosynthesis of
pyrimidine nucleosides.
96
Cells therefore have a system of transporting folates into the cytoplasm.
Folate receptors
also tend to be overexpressed in many human cancer cells, and folate- mediated
targeting
of oligonucleotides to ovarian cancer cells has been reported (Li, et al,
Pharm. Res. 1998,
15, 1540). Preparation
of folic acid
conjugates of nucleic acids are described in, for example, U.S. Pat. No.
6,528,631 .
Vitamin conjugate moieties include, for example, vitamin A (retinol) and/or
related compounds. The vitamin A family (retinoids), including retinoic acid
and retinol, are
typically absorbed and transported to target tissues through their interaction
with specific
proteins such as cytosol retinol-binding protein type II (CRBP-11), retinol-
binding protein
(RBP), and cellular retinol-binding protein (CRBP). The vitamin A family of
compounds can
be attached to oligomeric compounds via acid or alcohol functionalities found
in the various
family members. For example, conjugation of an N-hydroxy succinimide ester of
an acid
moiety of retinoic acid to an amine function on a linker pendant to an
oligonucleotide can
result in linkage of vitamin A compound to the oligomeric compound via an
amide bond.
Also, retinol can be converted to its phosphoramidite, which is useful for 5'
conjugation.
alpha-Tocopherol (vitamin E) and the other tocopherois (beta through zeta) can
be
conjugated to oligomeric compounds to enhance uptake because of their
lipophilic
character. Also, vitamin D, and its ergosterol precursors, can be conjugated
to oligomeric
compounds through their hydroxyl groups by first activating the hydroxyl
groups to, for
example, hemisuccinate esters. Conjugation can then be effected directly to
the oligomeric
compound or to an arninolinker pendant from the oligomeric compound. Other
vitamins that
can be conjugated to oligomeric compounds in a similar manner on include
thiamine,
riboflavin, pyridoxine, pyridoxamine, pyridoxal, deoxypyridoxine. Lipid
soluble vitamin K's
and related guinone-containing compounds can be conjugated via carbonyl groups
on the
guinone ring. The phytol moiety of vitamin K can also serve to enhance binding
of the
oligomeric compounds to cells.
Other functional groups which may be used as conjugates in compounds of the
invention, include imidazole conjugate - RNase A catalytic center mimics
(polyamine-
imidazole conjugates) ¨ see Guemiou et al Nucleic Acids Res (2007); 35 (20):
6778-87.
Conjugates are typically non-nucleotide moieties. However, in the context of
blocking
groups or targeting groups, or nucleotide analog small therapeutics, it is
recognized that the
oligonucleotide may be covalently linked to a nucleotide moiety via the
DNA/RNA
phosphodiester region of the invention. Suitably, a nucleic acid group, as
used in the
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
97
context of the invention may, in some embodiments, lack complementarity to the
target of
the oligonucleotide (region A).
In some embodiments, the blocking or targeting moiety is an aptamer (see e.g.
Meng
et al., PLoS One (2012) 7(4): e33434, W02005/111238 & W012078637).
A blocking group may also be or comprise a oligonucleotide region which is
complementary to, e.g. part of, the antisense oligonucleotide. In this regard
the blocking
oligonucleotide is covalently bound to an antisense oligonucleotide via the
DNA/RNA
phosphodiester region (region b), and optionally a linker. The blocking
oligonucleotide is, in
some embodiments, therefore able to form a duplex with the antisense
oligonucleotide.
Suitably the blocking nucleotide sequence (as third region or region C) is a
short
oligonucleotide sequence of e.g. 3-10 nucleotides in length which forms a
duplex (i.e. is
complementary to) with an equivalent length of the first region. In some
embodiments a
linker is used between the second region and the blocking region.
Like delivery peptides, nucleic acids can also serve as conjugate like
moieties that can
affect localization of conjugated oligomeric compounds in a cell. For example,
nucleic acid
conjugate moieties can contain poly A, a motif recognized by poly A binding
protein (PABP),
which can localize poly A-containing molecules in the cytoplasm (Gorlach, et
al., Exp. Cell
Res., 1994, 211, 400. In some embodiments, the nucleic acid conjugate moiety
contains at
least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least
9, at least 10, at least
15, at least 20, and at least 25 consecutive A bases. The nucleic acid
conjugate moiety can
also contain one or more AU-rich sequence elements (AREs). AREs are recognized
by
ELAV family proteins which can facilitate localization to the cytoplasm
(Bollig, et al, Biochem.
Bioophys. Res. Commun., 2003, 301, 665). Example AREs include UUAUUUAUU and
sequences containing multiple repeats of this motif. In other embodiments, the
nucleic acid
conjugate moiety contains two or more AU or AUU motifs. Similarly, the nucleic
acid
conjugate moiety can also contain one or more CU-rich sequence elements (CREs)
(Wein,
et al, Eur. J. Biochem., 2003, 270, 350) which can bind to proteins HuD and/or
HuR of the
ELAV family of proteins. As with AREs, CREs can help localize conjugated
oligomeric
compounds to the cytoplasm. In some embodiments, the nucleic acid conjugate
moiety
contains the motif (CUUU)n, wherein, for example, n can be 1 to about 20, 1 to
about 15, or
1 to about 11. The (CUUU)n motif can optionally be followed or preceded by one
or more U.
In some embodiments, n is about 9 to about 12 or about 11. The nucleic acid
conjugate
moiety can also include substrates of hnRNP proteins (heterogeneous nuclear
ribonucleoprotein), some of which are involved in shuttling nucleic acids
between the
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
98
nucleus and cytoplasm, (e.g., nhRNP Al and nhRNP K; see, e.g., Mill, et al,
Mol. Cell Biol,
2001, 21, 7307). Some example hnRNP substrates include nucleic acids
containing the
sequence UAGGA/U or (GG)ACUAGC(A). Other nucleic acid conjugate moieties can
include Y strings or other tracts that can bind to, for example, linRNP I. In
some
embodiments, the nucleic acid conjugate can contain at least 3, at least 4, at
least 5, at least
6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20,
and at least 25
consecutive pyrimidine bases. In other embodiments the nucleic acid conjugate
can contain
greater than 50, greater than 60, greater than 70, greater than 80, greater
than 90, or
greater than 95 percent pyrimidine bases.
Other nucleic acid conjugate-like moieties can include pumilio (puf protein)
recognition
sequences such as described in Wang, et al., Cell, 2002, 110, 501. Example
pumilio
recognition sequences can include UGUANAUR, where N can be any base and R can
be a
purine base. Localization to the cytoplasm can be facilitated by nucleic acid
conjugate
moieties containing AREs and/or CREs. Nucleic acid conjugate-like moieties
serving as
substrates of hnRNPs can facilitate localization of conjugated oligomeric
compounds to the
cytoplasm (e.g., hnRNP Al or K) or nucleus (e.g., hnRNP l). Additionally,
nucleus localization
can be facilitated by nucleic acid conjugate-like moieties containing
polypyrimidine tracts.
A reactive group
A reactive group is a group which is used in chemical synthesis, which in the
context of the
present invention may be used "conjugate" the oligonucleotide, or otherwise
covalently link
the oligonucleotide to the third region (X), such as the conjugate, blocking
group or targeting
group, or optionally the linker (Y). An example of a reactive group is a
phosphoramidite,
which is widely used in oligonucleotide synthesis.
An activation group
An activation group is a group which may be activated to form a reactive
group. In this
respect, an activation group may be considered as a protected reactive group,
which may be
deprotected prior to enable use of the reactive group, for example in the
methods of
synthesis/manufacture disclosed herein.
Linkage group
A nucleoside linkage is the linkage group either between nucleosides in the
oligonucleotide,
or, when present, may also describe the group which attaches the third region
(X or C) or
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
99
the linker (Y) to region B - for example this linker may be a phosphate
(containing) linkage
group or a triazol group.
Blocker group (also referred to as a blocking/blocker moiety)
In some aspects, the third region is a blocking region. A blocker is typically
a conjugate or
an oligonucleotide (typically not complementary to the target region), which,
for example (but
not limited to) either through steric hindrance, or through hybridization to
the first region (or
first and second regions), prevents or reduces activity of the oligomer. The
(blocked) activity
may be against its intended target (the target) or in some embodiments
unintended targets
(off-targets).
The oligomeric compound of the invention may therefore comprise a first
region, such as a
gapmer or LNA gaper oligonucleotide (such as a gapmer of formula X'Y'Z), a
second region
which is a biocleavable linker, such as region B as described herein, and a
third region,
region C, which comprises a region of at least 2 consecutive nucleosides, such
as 3, 4, 5, 6,
7, 8, 9, 10,11, 12, 13, 14, 15, 16 nucleotides which are complementary to a
corresponding
part of the first region. In some embodiments at least 2 nucleosides of region
C, such as 3,
4, 5, 6, 7, 8, 9, or 10 nucleosides are high affinity nucleoside analogues,
such as LNA (BNA)
- in some embodiments, these may form the distal part of region C. The high
affinity
nucleoside analogues of region C may form a contiguous sequence of high
affinity
nucleoside analogues, which may be flanked by other nucleosides, such as DNA
nucleosides (also part of region C, referred to as the proximal part of region
C). In some
embodiments, region C comprises between 2 - 8 (such as 3, 4, 5, 6, & 7 LNA
(BNA)
nucleotides, and in the same or in a different embodiment a region of between
2 - 16 DNA
nucleotides (such as 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15). In some
embodiments, the
distal part of region B comprises a contiguous region of high affinity
nucleotide analogues,
for example a contiguous region of 2, 3, 4, 5, 6, 7, or 8 LNA nucleotides. The
proximal
region may comprise a contiguous region of non-LNA nucleotides, such as those
referred to
herein, such as DNA nucleotides, such as a region of 2 - 16 non-LNA
nucleotides. It is
however also understood that the proximal region may comprise high affinity
nucleotide
analogues including LNA, but as contiguous regions of LNA can restrict the
conformational
flexibility of the proximal region (which is thought to act as a loop) it may,
in some
embodiments be useful to limit the use of long stretches of LNA in the
proximal (or loop
forming part), such as no more than 4 consecutive LNAs, such as no more than 3
consecutive LNAs, or no more than 2 consecutive LNAs.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
100
In some embodiments, the region of other nucleotides in region C (such as DNA
nucleotides) forms a contiguous sequence with region B, i.e. is proximal to
the terminal
nucleotide of region B), so that the region of high affinity nucleotides is
distal to region B. In
such an embodiment, region B and the proximal part of region C (e.g. the
region comprising
DNA nucleotides) may form a flexible loop, which allows the distal part of
region C to
hybridize with the first region. The proximal part of region C may or may not
be
complementary to a corresponding part of region A. In some embodiments, the
distal part of
region C is complementary to nucleotides which form a region which is capable
of recruiting
RNaseH, such as the gap region of a gapmer (referred to herein region Y'). In
such an
embodiment, the blocking region (region C) forms a duplex with the gap region,
or part
thereof, thereby blocking the availability of the central region of the gapmer
to interact with
other molecules or the target or off-targets. The invention therefore provides
a solution to
the inherent toxicity of DNA phosphorothioate oligonucleotides (which are
typically used for
the gap region of gapmers), as it allows for the controlled activation of
gapmer oligomers
(region A) within the target tissue or cells. In this respect, the use of a
blocking region can
act as a pro-drug. It is recognized that the blocking region (region C or
distal part thereof),
may also be directed towards other regions of an oligomer, including a mixmer
or totalmer
oligomer, or the flanking regions of a gapmer, or across the wing region and
the gap region
of a gapmer. In such an embodiment, the hybridization or region C (or distal
part thereof) to
region A (or part of region A), prevents the hybridization of the
corresponding part of region
A to biomolecules, and may therefore also be used to prevent unintended
interaction with
other biomolecules, enhancing specificity, tissue specific activity, and
diminishing the risk of
toxicity. The internucleoside linkages between the nucleotides of region C may
be other
than phosphodiester, such as may be phosphorothioate.
Targeting group (also referred to as a targeting moiety)
A targeting moiety is a group whose presence on the oligomeric compound causes
a
differential pattern of biodistribution and/or cellular uptake of the
oligomeric compound.
Targeting groups may be, for example, receptor ligands, antibodies, hormones
or hormone
analogues, aptamers etc. The examples show the use of cholesterol as a
targeting group ¨
cholesterol is recognized by the LDL receptor in the surface of hepatocytes,
resulting in the
preferential uptake of cholesterol conjugated oligonucleotides into the liver.
The examples
also illustrate the use of GalNac, tocopherol, and folic acid as targeting
groups.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
101
Oligomer linked biocleavable conjugates
The oligomeric compound may optionally, comprise a second region (region B)
which is
positioned between the oligomer (referred to as region A) and the conjugate
(referred to as
region C). Region B may be a linker such as a cleavable linker (also referred
to as a
physiologically labile linkage).
In some embodiments, the compound of the invention comprises a biocleavable
linker (also
referred to as the physiologically labile linker, Nuclease Susceptible
Physiological Labile
Linkages, or nuclease susceptible linker), for example the phosphate
nucleotide linker (such
as region B) or a peptide linker, which joins the oligomer (or contiguous
nucleotide sequence
or region A), to a conjugate moiety (or region C).
Biocleavable linkers according to the present invention refers to linkers
which are
susceptible to cleavage in a target tissue (i.e. physiologically labile), for
example liver and/or
kidney. It is preferred that the cleavage rate seen in the target tissue is
greater than that
found in blood serum. Suitable methods for determining the level ( /0) of
cleavage in tissue
(e.g. liver or kidney) and in serum are found in example 6. In some
embodiments, the
biocleavable linker (also referred to as the physiologically labile linker, or
nuclease
susceptible linker), such as region B, in a compound of the invention, are at
least about 20%
cleaved, such as at least about 30% cleaved, such as at least about 40%
cleaved, such as
at least about 50% cleaved, such as at least about 60% cleaved, such as at
least about 70%
cleaved, such as at least about 75% cleaved, in the the liver or kidney
homogenate assay of
Example 6. In some embodiments, the cleavage (%) in serum, as used in the
assay in
Example 6, is less than about 20%, such as less than about 10%, such as less
than 5%,
scuh as less than about 1%.
Biocleavable linkers according to the present invention refers to linkers
which are
susceptible to cleavage in a target tissue (i.e. physiologically labile), for
example liver and/or
kidney. It is preferred that the cleavage rate seen in the target tissue is
greater than that
found in blood serum. Suitable methods for determining the level (%) of
cleavage in tissue
(e.g. liver or kidney) and in serum are found in example 6. In some
embodiments, the
biocleavable linker (also referred to as the physiologically labile linker, or
nuclease
susceptible linker), such as region B, in a compound of the invention, are at
least about 20%
cleaved, such as at least about 30% cleaved, such as at least about 40%
cleaved, such as
at least about 50% cleaved, such as at least about 60% cleaved, such as at
least about 70%
cleaved, such as at least about 75% cleaved, in the liver or kidney homogenate
assay of
Example 6. In some embodiments, the cleavage ( /0) in serum, as used in the
assay in
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
102
Example 6, is less than about 30%, is less than about 20%, such as less than
about 10%,
such as less than 5%, such as less than about 1%.
In some embodiments, which may be the same of different, the biocleavable
linker (also
referred to as the physiologically labile linker, or nuclease susceptible
linker), such as region
B, in a compound of the invention, are susceptible to Si nuclease cleavage.
Susceptibility
to Si cleavage may be evaluated using the Si nuclease assay shown in Example
6. In
some embodiments, the biocleavable linker (also referred to as the
physiologically labile
linker, or nuclease susceptible linker), such as region B, in a compound of
the invention, are
at least about 30% cleaved, such as at least about 40% cleaved, such as at
least about 50%
cleaved, such as at least about 60% cleaved, such as at least about 70%
cleaved, such as
at least about 80% cleaved, such as at least about 90% cleaved, such as at
least 95%
cleaved after 120min incubation with Si nuclease according to the assay used
in Example
6.
Nuclease Susceptible Physiological Labile Linkages: In some embodiments, the
oligomer
(also referred to as oligomeric compound) of the invention (or conjugate)
comprises three
regions:
i) a first region (region A), which comprises 10 ¨ 18 contiguous
nucleotides;
ii) a second region (region B) which comprises a biocleavable linker
iii) a third region (C) which comprises a conjugate moiety, a targeting
moiety, an
activation moiety, wherein the third region is covalent linked to the second
region.
In some embodiments, region B may be a phosphate nucleotide linker. For
example such
linkers may be used when the conjugate is a lipophilic conjugate, such as a
lipid, a fatty acid,
sterol, such as cholesterol or tocopherol. Phosphate nucleotide linkers may
also be used for
other conjugates, for example carbohydrate conjugates, such as GalNac.
Peptide and other Linkers
In some embodiments, the biocleavable linker (region B) is a peptide, such as
a trilysine
peptide linker which may be used in a polyGalNac conjugate, such a triGalNac
conjugate.
Other linkers known in the art which may be used, including disulfide linkers
(also referred to
as dithio or disulphide herein). Other peptide linkers include , e.g. a Tyr-
Asp(Asp) tripeptide
or Asp(Asp) dipeptide.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
103
Phosphate nucleotide linkers
In some embodiments, region B comprises between 1¨ 6 nucleotides, which is
covalently
linked to the 5' or 3' nucleotide of the first region, such as via a
internucleoside linkage group
such as a phosphodiester linkage, wherein either
a. the internucleoside linkage between the first and second region is a
phosphodiester linkage and the nucleoside of the second region [such as
immediately] adjacent to the first region is either DNA or RNA; and/or
b. at least 1 nucleoside of the second region is a phosphodiester
linked DNA or
RNA nucleoside;
In some embodiments, region A and region B form a single contiguous nucleotide
sequence of 10 ¨22, such as 12 - 20 nucleotides in length.
In some aspects the internucleoside linkage between the first and second
regions may
be considered part of the second region.
Linkers
A linkage or linker is a connection between two atoms that links one chemical
group or
segment of interest to another chemical group or segment of interest via one
or more
covalent bonds. Conjugate moieties (or targeting or blocking moieties) can be
attached to
the oligomeric compound directly or through a linking moiety (linker or
tether) ¨ a linker.
Linkers are bifunctional moieties that serve to covalently connect a third
region, e.g. a
.. conjugate moiety, to an oligomeric compound (such as to region B). In some
embodiments,
the linker comprises a chain structure or an oligomer of repeating units such
as ethylene
glyol or amino acid units. The linker can have at least two functionalities,
one for attaching to
the oligomeric compound and the other for attaching to the conjugate moiety.
Example linker
functionalities can be electrophilic for reacting with nucleophilic groups on
the oligomer or
conjugate moiety, or nucleophilic for reacting with electrophilic groups. In
some
embodiments, linker functionalities include amino, hydroxyl, carboxylic acid,
thiol,
phosphoramidate, phophate, phosphite, unsaturations (e.g., double or triple
bonds), and the
like. Some example linkers include 8-amino-3,6-dioxaoctanoic acid (ADO),
succinimidyl 4-
(N-maleimidomethyl)cyclohexane-l-carboxylate (SMCC), 6- aminohexanoic acid
(AHEX or
AHA), 6-aminohexyloxy, 4-aminobutyric acid, 4- aminocyclohexylcarboxylic acid,
succinimidyl 4-(N-maleimidomethyl)cyclohexane- l-carboxy-(6-amido-caproate)
(LCSMCC),
succinimidyl m-maleimido-benzoylate (MBS), succinimidyl N-e-maleimido-
caproylate
(EMCS), succinimidyl 6-(beta - maleimido-propionamido) hexanoate (SMPH),
succinimidyl
N-(a-maleimido acetate) (AMAS), succinimidyl 4-(p-maleimidophenyl)butyrate
(SMPB), beta
104
-alanine (beta -ALA), phenylglycine (PHG), 4-aminocyclohexanoic acid (ACHC),
beta -
(cyclopropyl) alanine (beta -CYPR), amino dodecanoic acid (ADC), alylene
diols,
polyethylene glycols, amino acids, and the like.
A wide variety of further linker groups are known in the art that can be
useful in the
attachment of conjugate moieties to oligomeric compounds. A review of many of
the useful
linker groups can be found in, for example, Antisense Research and
Applications, S. T.
Crooke and B. Lebleu, Eds., CRC Press, Boca Raton, Fla., 1993, p. 303-350. A
disulfide
linkage has been used to link the 3' terminus of an oligonucleotide to a
peptide (Corey, et al.,
Science 1987, 238, 1401; Zuckernriann, et al, J Am. Chem. Soc. 1988, 110,
1614; and
Corey, et al., J Am. Chem. Soc. 1989, 111,8524). Nelson, et al., Nuc. Acids
Res. 1989, 17,
7187 describe a linking reagent for attaching biotin to the 3'-terminus of an
oligonucleotide.
This reagent, N-Fmoc-0- DMT-3 -amino- 1,2-propanediol is commercially
available from
Clontech Laboratories (Palo Alto, Calif.) under the name 3'-Amine. It is also
commercially
available under the name 3'-Amino-Modifier reagent from Glen Research
Corporation
(Sterling, Va.). This reagent was also utilized to link a peptide to an
oligonucleotide as
reported by Judy, et al., Tetrahedron Letters 1991, 32, 879. A similar
commercial reagent for
linking to the 5 '-terminus of an oligonucleotide is 5'- Amino-Modifier C6.
These reagents are
available from Glen Research Corporation (Sterling, Va.). These compounds or
similar ones
were utilized by Krieg, et al, Antisense Research and Development 1991, 1, 161
to link
fluorescein to the 5'- terminus of an oligonucleotide. Other compounds such as
acridine
have been attached to the 3 '-terminal phosphate group of an oligonucleotide
via a
polymethylene linkage (Asseline, et al., Proc. Natl. Acad. Sci. USA 1984, 81,
3297). [0074]
Any of the above groups can be used as a single linker or in combination with
one or more
further linkers.
Linkers and their use in preparation of conjugates of oligomeric compounds are
provided throughout the art such as in WO 96/11205 and WO 98/52614 and U.S.
Pat. Nos.
4,948,882; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,580,731; 5,486,603;
5,608,046;
4,587,044; 4,667,025; 5,254,469; 5,245,022; 5,112,963; 5,391,723; 5,510475;
5,512,667;
5,574,142; 5,684,142; 5,770,716; 6,096,875; 6,335,432; and 6,335,437.
As used herein, a physiologically labile bond is a labile bond that is
cleavable under
conditions normally encountered or analogous to those encountered within a
mammalian
body (also referred to as a cleavable linker). Physiologically labile linkage
groups are
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
105
selected such that they undergo a chemical transformation (e.g., cleavage)
when present in
certain physiological conditions. Mammalian intracellular conditions include
chemical
conditions such as pH, temperature, oxidative or reductive conditions or
agents, and salt
concentration found in or analogous to those encountered in mammalian cells.
Mammalian
intracellular conditions also include the presence of enzymatic activity
normally present in a
mammalian cell such as from proteolytic or hydrolytic enzymes. In some
embodiments, the
cleavable linker is susceptible to nuclease(s) which may for example, be
expressed in the
target cell ¨ and as such, as detailed herein, the linker may be a short
region (e.g. 1 ¨ 10)
phosphodiester linked nucleosides, such as DNA nucleosides,
Chemical transformation (cleavage of the labile bond) may be initiated by the
addition
of a pharmaceutically acceptable agent to the cell or may occur spontaneously
when a
molecule containing the labile bond reaches an appropriate intra-and/or extra-
cellular
environment. For example, a pH labile bond may be cleaved when the molecule
enters an
acidified endosome. Thus, a pH labile bond may be considered to be an
endosomal
cleavable bond. Enzyme cleavable bonds may be cleaved when exposed to enzymes
such
as those present in an endosome or lysosome or in the cytoplasm. A disulfide
bond may be
cleaved when the molecule enters the more reducing environment of the cell
cytoplasm.
Thus, a disulfide may be considered to be a cytoplasmic cleavable bond. As
used herein, a
pH-labile bond is a labile bond that is selectively broken under acidic
conditions (pH<7).
Such bonds may also be termed endosomally labile bonds, since cell endosomes
and
lysosomes have a pH less than 7.
Activated oligomers
In some embodiments, the invention provides an activated oligomer¨ i.e. an
intermediate used in the synthesis of the oligomer of the invention ¨ e.g. the
conjugated
oligomer. In this respect, the oligomer of the invention may, in some
embodiments comprise
region A and region B as described herein, and region B in covalently linked
to an activation
(or reactive) group, suitable for use in conjugation of the oligomer.
The term "activated oligomer," as used herein, refers to an oligomer of the
invention
that is covalently linked (i.e., functionalized) to at least one functional
moiety that permits
covalent linkage of the oligomer to one or more conjugated moieties, i.e.,
moieties that are
not themselves nucleic acids or monomers, to form the conjugates herein
described.
Typically, a functional moiety will comprise a chemical group that is capable
of covalently
bonding to the oligomer via, e.g., a 3'-hydroxyl group or the exocyclic NH2
group of the
adenine base, a spacer that is preferably hydrophilic and a terminal group
that is capable of
=
1.06
binding to a conjugated moiety (e.g., an amino, sulfhydryl or hydroxyl group).
In some
embodiments, this terminal group is not protected, e.g., is an NH2 group. In
other
embodiments, the terminal group is protected, for example, by any suitable
protecting group
such as those described in "Protective Groups in Organic Synthesis" by
Theodora W
Greene and Peter G M Wuts, 3rd edition (John Wiley & Sons, 1999). Examples of
suitable
hydroxyl protecting groups include esters such as acetate ester, aralkyl
groups such as
benzyl, diphenylmethyl, or triphenylmethyl, and tetrahydropyranyl. Examples of
suitable
amino protecting groups include benzyl, alpha-methylbenzyl, diphenylmethyl,
triphenylmethyl, benzyloxycarbonyl, tert-butoxycarbonyl, and acyl groups such
as
trichloroacetyl or trifluoroacetyl. In some embodiments, the functional moiety
is self-
cleaving. In other embodiments, the functional moiety is biodegradable. See
e.g., U.S.
Patent No. 7,087,229.
In some embodiments, oligomers of the invention are functionalized at the 5'
end in
order to allow covalent attachment of the conjugated moiety to the 5' end of
the oligomer. In
.. other embodiments, oligomers of the invention can be functionalized at the
3' end. In still
other embodiments, oligomers of the invention can be functionalized along the
backbone or
on the heterocyclic base moiety. In yet other embodiments, oligomers of the
invention can
be functionalized at more than one position independently selected from the 5'
end, the 3'
end, the backbone and the base.
In some embodiments, activated oligomers of the invention are synthesized by
incorporating during the synthesis one or more monomers that is covalently
attached to a
functional moiety. In other embodiments, activated oligomers of the invention
are
synthesized with monomers that have not been functionalized, and the oligomer
is
functionalized upon completion of synthesis. In some embodiments, the
oligomers are
functionalized with a hindered ester containing an aminoalkyl linker, wherein
the alkyl portion
has the formula (CH,), wherein w is an integer ranging from 1 to 10,
preferably about 6,
wherein the alkyl portion of the alkylamino group can be straight chain or
branched chain,
and wherein the functional group is attached to the oligomer via an ester
group (-0-C(0)-
(CH2)NH).
In other embodiments, the oligomers are functionalized with a hindered ester
containing a (CH2),,-sulfhydryl (SH) linker, wherein w is an integer ranging
from 1 to 10,
preferably about 6, wherein the alkyl portion of the alkylamino group can be
straight chain or
branched chain, and wherein the functional group attached to the oligomer via
an ester
group (-0-C(0)-(CH2)SH)
CA 2889596 2019-02-06
107
In some embodiments, sulfhydryl-activated oligonucleotides are conjugated with
polymer moieties such as polyethylene glycol or peptides (via formation of a
disulfide bond).
Activated oligomers containing hindered esters as described above can be
synthesized by any method known in the art, and in particular by methods
disclosed in PCT
Publication No. WO 2008/034122 and the examples therein.
In still other embodiments, the oligomers of the invention are functionalized
by
introducing sulfhydryl, amino or hydroxyl groups into the oligomer by means of
a
functionalizing reagent substantially as described in U.S. Patent Nos.
4,962,029 and
4,914,210, i.e., a substantially linear reagent having a phosphoramidite at
one end linked
through a hydrophilic spacer chain to the opposing end which comprises a
protected or
unprotected sulfhydryl, amino or hydroxyl group. Such reagents primarily react
with hydroxyl
groups of the oligomer. In some embodiments, such activated oligomers have a
functionalizing reagent coupled to a 5'-hydroxyl group of the oligomer. In
other
embodiments, the activated oligomers have a functionalizing reagent coupled to
a 3'-
hydroxyl group. In still other embodiments, the activated oligomers of the
invention have a
functionalizing reagent coupled to a hydroxyl group on the backbone of the
oligomer. In yet
further embodiments, the oligomer of the invention is functionalized with more
than one of
the functionalizing reagents as described in U.S. Patent Nos. 4,962,029 and
4,914,210 .
Methods of synthesizing such
functionalizing reagents and incorporating them into monomers or oligomers are
disclosed in
U.S. Patent Nos. 4,962,029 and 4,914,210.
In some embodiments, the 5'-terminus of a solid-phase bound oligomer is
functionalized with a dienyl phosphoramidite derivative, followed by
conjugation of the
deprotected oligomer with, e.g., an amino acid or peptide via a Diels-Alder
cycloaddition
reaction.
In various embodiments, the incorporation of monomers containing 2'-sugar
modifications, such as a 2'-carbamate substituted sugar or a 2'-(0-pentyl-N-
phthalimido)-
deoxyribose sugar into the oligomer facilitates covalent attachment of
conjugated moieties to
the sugars of the oligomer. In other embodiments, an oligomer with an amino-
containing
linker at the 2'-position of one or more monomers is prepared using a reagent
such as, for
example, 5'-dimethoxytrity1-2'-0-(e-phthalimidylaminopenty1)-2'-deoxyadenosine-
3'-- N,N-
diisopropyl-cyanoethoxy phosphoramidite. See, e.g., Manoharan, et al.,
Tetrahedron Letters,
1991, 34, 7171.
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
108
In still further embodiments, the oligomers of the invention may have amine-
containing
functional moieties on the nucleobase, including on the N6 purine amino
groups, on the
exocyclic N2 of guanine, or on the N4 or 5 positions of cytosine. In various
embodiments,
such functionalization may be achieved by using a commercial reagent that is
already
functionalized in the oligomer synthesis.
Some functional moieties are commercially available, for example,
heterobifunctional
and homobifunctional linking moieties are available from the Pierce Co.
(Rockford, Ill.).
Other commercially available linking groups are 5'-Amino-Modifier C6 and 3'-
Amino-Modifier
reagents, both available from Glen Research Corporation (Sterling, Va.). 5'-
Amino-Modifier
C6 is also available from ABI (Applied Biosystems Inc., Foster City, Calif.)
as Aminolink-2,
and 3'-Amino-Modifier is also available from Clontech Laboratories Inc. (Palo
Alto, Calif.).
Methods of synthesis and manufacture
The invention also provides methods of synthesis or manufacture of the
oligomer of
the invention. The oligomer may be made using standard oligonucleotide
synthesis, which
is typically performed on a solid support, such as a universal support. As
illustrated in
Figures 5 ¨ 10, the oligomer of the invention may be synthesized, for example,
by the
sequential synthesis of the first region and the second region, followed by
the addition (e.g.
conjugation) of the third region (X) optionally via a linker (Y). Region Y,
when present may
be joined to the region B, and region X subsequently added to region Y, or
region Y and X
may be added to region B in a single reaction step.
Alternatively, the oligomer synthesis my occur via the initial coupling of
region X, or
region X and Y to the oligonucleotide support column, followed by sequential
oligonucleotide
synthesis of region B and then region A.
Alternatively, the use of a cleavable bidirectional group attached to the
oligonucleotide
synthesis support (in an initial or pre-step), allows for a method where the
oligonucleotide
regions B and A are synthesized on one reactive group of the bifunctional
group, and region
X or region X and Y are synthesized on a second reactive group of the
bifunctional group,
wherein the oligonucleotide synthesis or addition of X (or X and Y) to the
support may occur
in any order or even together. The cleavage of the bifunctional group from the
support then
produces the oligomer of the invention. The bifunctional group may for example
be a
nucleoside, where one entity (e.g. region B or X or X-Y-) is attached to a
phosphate
containing group on the nucleoside (e.g. a 5' or 3' group), and the other
(e.g. region B or X
or X-Y-), is attached, for example to an reactive group present on the
nucleobase.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
109
Alternatively region X or X-Y may be joined to the oligomer (region B) after
oligonucleotide synthesis, such as after the cleavage step. The invention
therefore also
relates to the intermediate oligomer, which comprises regions A and B, and a
reactive or
activation group attached to region B, which is subsequently used to join
region X or regions
X and Y to region B.
Region Y or region X may be linked to region B as a phosphoramidite, for
example ¨
allowing for the formation of the oligomer in a single oligonucleotide
synthesis, followed by
cleavage of the oligomer from the oligonucleotide synthesis support (US). In
this regard, in
some embodiments, the linkage group between region B and region X or Y may be
a
phosphate containing group, such as a nucleoside linkage, such as
phosphodiester,
phosphorothioate, phosphorodithioate, boranophosphate, methylphosphonate or
others,
such as those referred to herein. Alternatively other chemical linkages may be
used such as
a triazol group.
In some embodiments, the third region (X) or X-Y- may be linked to region B
via a
group other than a 5' or 3' phosphate, for example via a reactive group at
another position,
for example a reactive group, such as an amine on the base of a nucleoside in
region B.
Oligonucleotide synthesis may occur in the 5 ¨ 3' direction, or, as is typical
of most
oligonucleotide synthesis, in the 3' ¨ 5' direction.
In some non-limiting examples, the oligonucleotide-conjugate construct can be
.. assembled in different ways, e.g.
A) The B -Apart of the construct can be made on an
oligonucleotide synthesis machine capable of synthesizing both
phosphorothioate
and phosphorodiester linkages. B - A can then optionally be elongated by
standard
phosphoramidite chemistry using a building block X-A-P (conjugate moiety with
linker
attached) to create X-A-B-A or with building block X-P (conjugate moiety with
no
linker) to create X-B-A
N _______________ ( (
X-A-O-P X-O-P
\
CN \
CN
X-A-P X-P
B) The B-A part of the construct can be made on an oligonucleotide
synthesis machine capable of synthesizing both phosphorthioate and
110
phosphordiester linkages. B-A can then optionally be sequentially elongated by
standard phosphoramidite chemistry using a building block DMTrO-A-P followed
by
building block X-P to create X-A-B-A with a PO or PS linkage between the X and
A
part.
N (DMTrO-A-0-P
CN
DiviTrO-A-P
The B-A part of the construct can be made on an oligonucleotide synthesis
machine
capable of synthesizing both phosphorthioate and phosphordiester linkages. B-A
can then
optionally be sequentially elongated by standard phosphoramidite chemistry
using a building
block PGN-A-P to create H2N-A-B-A. After cleavage and deprotection of the
oligonucleotide the free amine of the oligonucleotide can be conjugated with
moiety X in
which a functional group of X has been activated in order to react with the
terminal primary
amine of the oligonucleotide.
Compositions
The oligomer of the invention may be used in pharmaceutical formulations and
compositions. Suitably, such compositions comprise a pharmaceutically
acceptable diluent,
carrier, salt or adjuvant. W02007/031091 provides suitable and preferred
pharmaceutically
acceptable diluent, carrier and adjuvants .
Suitable dosages, formulations, administration routes, compositions, dosage
forms,
combinations with other therapeutic agents, pro-drug formulations are also
provided in
W02007/031091.
Antisense oligonucleotides may be admixed with pharmaceutically acceptable
active
or inert substances for the preparation of pharmaceutical compositions or
formulations.
Compositions and methods for the formulation of pharmaceutical compositions
are
dependent upon a number of criteria, including, but not limited to, route of
administration,
extent of disease, or dose to be administered.
An antisense compound can be utilized in pharmaceutical compositions by
combining
the antisense compound with a suitable pharmaceutically acceptable diluent or
carrier. A
pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS).
PBS is a
diluent suitable for use in compositions to be delivered parenterally.
CA 2889596 2019-02-06
CA 02889596 2015-04-24
WO 2014/076195
PCT/EP2013/073858
111
Pharmaceutical compositions comprising antisense compounds encompass any
pharmaceutically acceptable salts, esters, or salts of such esters, or any
other
oligonucleotide which, upon administration to an animal, including a human, is
capable of
providing (directly or indirectly) the biologically active metabolite or
residue thereof.
Accordingly, for example, the disclosure is also drawn to pharmaceutically
acceptable salts
of antisense compounds, prodrugs, pharmaceutically acceptable salts of such
prodrugs, and
other bioequivalents. Suitable pharmaceutically acceptable salts include, but
are not limited
to, sodium and potassium salts. A prodrug can include the incorporation of
additional
nucleosides at one or both ends of an antisense compound which are cleaved by
endogenous nucleases within the body, to form the active antisense compound.
In this
regard the prodrug may comprise region B and a conjugate, targeting or
blocking moiety as
according to the present invention. In some embodiments, the oligomer of the
invention is a
pro-drug.
The use of lipophilic conjugates according to the invention allows for the
incorporation
of the oligomer of the invention into lipidoids or liposomes, e.g. cationic
liposomes (e.g.
cationic liposome SNALPs (stable nucleic acid lipid particle), which are
particularly useful for
delivery of oligomers e.g. to the liver, e.g. siRNAs.
Applications
The oligomers of the invention may be utilized as research reagents for, for
example,
diagnostics, therapeutics and prophylaxis.
In research, in some embodiments, such oligomers may be used to specifically
inhibit
the synthesis of protein (typically by degrading or inhibiting the mRNA and
thereby prevent
protein formation) in cells and experimental animals thereby facilitating
functional analysis of
the target or an appraisal of its usefulness as a target for therapeutic
intervention.
For therapeutics, an animal or a human, suspected of having a disease or
disorder,
which can be treated by modulating the expression of the target is treated by
administering
oligomeric compounds in accordance with this invention. Further provided are
methods of
treating a mammal, such as treating a human, suspected of having or being
prone to a
disease or condition, associated with expression of the target by
administering a
therapeutically or prophylactically effective amount of one or more of the
oligomers or
compositions of the invention. The oligomer, a conjugate or a pharmaceutical
composition
according to the invention is typically administered in an effective amount.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
112
The invention also provides for the use of the compound or conjugate of the
invention
as described for the manufacture of a medicament for the treatment of a
disorder as referred
to herein, or for a method of the treatment of as a disorder as referred to
herein.
The invention also provides for a method for treating a disorder as referred
to herein
said method comprising administering a compound according to the invention as
herein
described, and/or a conjugate according to the invention, and/or a
pharmaceutical
composition according to the invention to a patient in need thereof.
Medical Indications
In some embodiments, the disease is cancer. In some embodiments, the disease
is
an inflammatory disease. In some embodiments, the disease is a cardiovascular
disease,
such as
In some embodiments the disease or disorder is myocardial infarction (MI).
In some embodiments, the disease or disorder is, or results in or is
associated with
fibrosis, such as liver-fibrosis, cardiac fibrosis or local fibrosis.
In some embodiments, the disease or disorder is blood clotting disorder.
In some embodiments the disease or disorder is or comprises (results in or is
associated with) bone-lose.
In some embodiments, the disease or disorder is a liver disease or disorder.
In some embodiments the disease or disorder is a metabolic disorder, which may
for
example be a liver disease or disorder, and/or in some aspects a
cardiovascular disease or
disorder).
Cardiovascular/Metabolic diseases include, for examples, metabolic syndrome,
obesity, hyperlipidemia, HDL/LDL cholesterol imbalance, dyslipidemias, e.g.,
familial
combined hyperlipidemia (FCHL), acquired hyperlipidemia, statin-resistant,
hypercholesterolemia, coronary artery disease (CAD), and coronary heart
disease (CHD).,
atherosclerosis, heart disease, diabetes (I and/or II), NASH, acute coronary
syndrome
(ACS), NASH, chronic heart failure, cardiovascular disease, cardio metabolic
disease,
hyperlipidaemia and related disorders, metabolic syndrome, atherosclerosis,
chronic heart
failure, vascular disease, peripheral arterial disease, heart disease,
ischemia, type 2
diabetes, type 1 diabetes,
In some embodiments, the disease or disorder is selected from the group
consisting of
metabolic syndrome, obesity, hyperlipidemia , atherosclerosis, HDL/LDL
cholesterol
imbalance, dyslipidemias, e.g., familial combined hyperlipidemia (FCHL),
acquired
CA 02889596 2015-04-24
WO 2014/076195
PCT/EP2013/073858
113
hyperlipidemia, statin-resistant, hypercholesterolemia, coronary artery
disease (CAD), and
coronary heart disease (CHD).
In some embodiments, the disease or disorder is selected from the group
consisting
of chronic heart failure, cardiovascular disease, cardio metabolic disease,
chronic heart
failure, vascular disease, peripheral arterial disease, heart disease,
ischemia, acute
coronary syndrome (ACS).
In some embodiments, the disease or disorder is type 2 diabetes, type 1
diabetes,
In some embodiments, the disease or disorder is a viral disease, such as
polycythemia, hepatitis C, hepatitis B, BKV, HIV.
In some embodiments, the disease or disorder is a severe and rare diseases (or
genetic disorder).
The invention further provides use of a compound of the invention in the
manufacture
of a medicament for the treatment of a disease, disorder or condition, such as
those as
referred to herein.
Generally stated, some aspects of the invention is directed to a method of
treating a
mammal suffering from or susceptible to conditions associated with abnormal
levels of the
target, comprising administering to the mammal and therapeutically effective
amount of an
oligomer targeted to the target that comprises one or more LNA units. The
oligomer, a
conjugate or a pharmaceutical composition according to the invention is
typically
administered in an effective amount.
An interesting aspect of the invention is directed to the use of the compound
as
defined herein for the preparation of a medicament for the treatment of a
disease, disorder
or condition as referred to herein.
Moreover, the invention relates to a method of treating a subject suffering
from a
disease or condition such as those referred to herein.
A patient who is in need of treatment is a patient suffering from or likely to
suffer from
the disease or disorder.
In some embodiments, the term 'treatment' as used herein refers to both
treatment of
an existing disease (e.g. a disease or disorder as herein referred to), or
prevention of a
disease, i.e. prophylaxis. It will therefore be recognized that treatment as
referred to herein
may, in some embodiments, be prophylactic.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
114
EXAMPLES
Oligonucleotide List
In the following list, Capital letters represent LNA nucleosides, such as beta-
D-oxy LNA,
lower case letters represent DNA nucleosides. Capital L is a LNA, such as beta-
D-oxy, and
lower case d is a DNA nucleoside. LNA cytosines are optionally 5'methyl
cytosine. The
internucleosides within region A are phosphorothioate, and within region B are
phosphodiester (as shown). The internucleoside linkage between region A and B
is
phoshodiester, but where region B is >1 DNA nucleotide, may optionally be
other than
phosphodiester (e.g. may be phosphorothioate). There is, optionally a further
linker (Y),
between region B and region C, such as a C6 linker. # refers to SEQ ID No.
ApoB Targeting Compounds
# Seq (5'-3') (Region A) Cleavable Linker
Region C ¨
(Region B)
Conjugate
1 GCattggtatTCA no no
2 GCattggtatTCA no Cholesterol
3 GCattggtatTCA SS Cholesterol
4 GCattggtatTCA 3P0-DNA (5'tca3') Cholesterol
5 GCattggtatTCA 2P0-DNA (5'ca3') Cholesterol
6 GCattggtatTCA 1PO-DNA (5'a3') Cholesterol
PCSK9 - Mouse specific compounds
# Seq (5'-3') (A) Cleavable Linker (B)
Conjugate (C)
7 GTctgtggaaGCG no no
8 GTctgtggaaGCG no Cholesterol
9 GTctgtggaaGCG 2P0-DNA (5'ca3') Cholesterol
10 GTctgtggaaGCG 2P0-DNA (5'ct3') Cholesterol
FVII (Mouse FVII)
# Seq (5'-3') Cleavable linker (B)
Conjugate (C)
11 LLddddddddLLL no no
12 LLddddddddLLL GaINAc cluster
13 LLddddddddLLL 2P0 (ca) GaINAc cluster
14 LLddddddddLLL SS Cholesterol
15 LLddddddddLLL 2P0 (ca) Cholesterol
ApoB Targeting Compounds with FAM label conjugates
# Seq (5'-3') Cleavable linker (B)
Conjugate (C)
16 GCattggtatTCA 3P0-DNA (5'tca3') FAM
17 GCattggtatTCA 2P0-DNA (5'ca3') FAM
18 GCattggtatTCA 1P0-DNA (5'a3') FAM
19 GCattggtatTCA 3P0-DNA (5'gac3') FAM
GCattggtatTCA no FAM
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
115
Target X compounds (A human therapeutic target)
# Seq (5'-3') Cleavable Linker (B) Region C (in 3'-end)
21 LLLdddddddddLLL 3P0-DNA (5't9c3') 5'-dddddLLLL-3'
22 LLLdddddddddLLL 5'-ddddddddLLLL-3'
23 LLLdddddddddLLL 3P0-DNA (5'tgc3') 5'-dddddLLLL-3'
24 LLLdddddddddLLL 5'-ddddddddLLLL-3'
In the above compounds, region C comprises the complement to the Seq (Region
A) so that
the 3' nucleotide of region C aligns (forms a base pair) with the 81h
nucleotide of region A
from the 5' end. Region C therefore loops back and forms an 8 base
hybridization with
region A across the 3' wing of the gapmer and 5 bases of the DNA gap region,
thereby
creating a "pro-drug" which is inactive until the linker region (B) is
cleaved.
ApoB Targeting Compounds
# Seq (5'-3') Cleavable Linker (B) Conjugate
25 GCattggtatTCA no Folic acid
26 GCattggtatTCA SS Folic acid
27 GCattggtatTCA 2P0-DNA (5'ca3') Folic acid
28 GCattggtatTCA no monoGaINAc
29 GCattggtatTCA SS monoGaINAc
30 GCattggtatTCA 2P0-DNA (5'ca3') monoGaINAc
31 GCattggtatTCA no FAM
32 GCattggtatTCA SS FAM
33 GCattggtatTCA 2P0-DNA (5'ca3') FAM
34 GCattggtatTCA no Tocopherol
35 GCattggtatTCA SS Tocopherol
36 GCattggtatTCA 2P0-DNA (5'ca3') Tocopherol
PCSK9 Compounds
# Seq (5'-3') linker Conjugate
37 TGCtacaaaacCCA no
38 AATgctacaaaaCCCA no
39 AATgctacaaaacCCA no
40 GCtgtgtgagcttGG no
41 TGctgtgtgagctTGG no
42 TGCtgtgtgagctTGG no
43 TCCtggtctgtgtTCC no
44 TCCtggtctgtgttCC no
45 TGCtacaaaacCCA 2P0-DNA (5'ca3') Cholesterol
46 AATgctacaaaaCCCA 2P0-DNA (5'ca3') Cholesterol
47 AATgctacaaaacCCA 2P0-DNA (5'ca3') Cholesterol
48 GCtgtgtgagcttGG 2P0-DNA (5'ca3') Cholesterol
49 TGctgtgtgagctTGG 2P0-DNA (5'ca3') Cholesterol
50 TGCtgtgtgagctTGG 2P0-DNA (5'ca3') Cholesterol
51 TCCtggtctgtgtTCC 2P0-DNA (5'ca3') Cholesterol
52 TCCtggtctgtgttCC 2P0-DNA (5'ca3') Cholesterol
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
116
Monkey Study Compounds ApoB
53 GTtg acactgTC No no
GCattggtatTCA 2P0-DNA (5'ca3') Cholesterol
54 GTtg aca ctgTC 2P0-DNA (5'ca3') Cholesterol
46 AATgctacaaaaCCCA 2P0-DNA (5'ca3') Cholesterol
49 TGctgtgtgagctTGG 2P0-DNA (5'ca3') Cholesterol
SEQ ID NO 53 is provided as the parent compound of SEQ ID NO 54.
5 Mouse Experiments: Unless otherwise specified, the mouse experiments may
be
performed as follows:
Dose administration and sampling:
7-10 week old C57616-N mice were used, animals were age and sex matched
(females for
study 1, 2 and 4, males in study 3). Compounds were injected i.v. into the
tail vein. For
.. intermediate serum sampling, 2-3 drops of blood were collected by puncture
of the vena
facialis, final bleeds were taken from the vena cava inferior. Serum was
collected in gel-
containing serum-separation tubes (Greiner) and kept frozen until analysis.
C57BL6 mice were dosed i.v. with a single dose of 1mg/kg ASO (or amount shown)
formulated in saline or saline alone according to the information shown.
Animals were
sacrificed at e.g. day 4 or 7 (or time shown) after dosing and liver and
kidney were sampled.
RNA isolation and mRNA analysis: mRNA analysis from tissue was performed using
the
Qantigene mRNA quantification kit ("bDNA-assay", Panomics/Affimetrix),
following the
manufacturers protocol. For tissue lysates, 50-80 mg of tissue was lysed by
sonication in 1
ml lysis-buffer containing Proteinase K. Lysates were used directly for bDNA-
assay without
RNA extraction. Probesets for the target and GAPDH were obtained custom
designed from
Panomics. For analysis, luminescence units obtained for target genes were
normalized to
the housekeeper GAPDH.
Serum analysis for ALT, AST and cholesterol was performed on the "Cobas
INTEGRA 400
plus" clinical chemistry platform (Roche Diagnostics), using 10p1 of serum.
For quantification of Factor VII serum levels, the BIOPHEN FVII enzyme
activity kit
(#221304, Hyphen BioMed) was used according to the manufacturer's protocol.
For oligonucleotide quantification, a fluorescently-labeled PNA probe is
hybridized to the
oligo of interest in the tissue lysate. The same lysates are used as for bDNA-
assays, just
with exactly weighted amounts of tissue. The heteroduplex is quantified using
AEX-HPLC
and fluorescent detection.
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
117
Example 1: Synthesis of compounds SEQ ID NO 1, SEQ ID NO 2, SEQ ID NO 3, SEQ
ID
NO 4 and SEQ ID NO 5
Oligonucleotides were synthesized on uridine universal supports using the
phosphoramidite
approach on an Expedite 8900/MOSS synthesizer (Multiple Oligonucleotide
Synthesis
System) or equivalent at 4 pmol scale. At the end of the synthesis, the
oligonucleotides were
cleaved from the solid support using aqueous ammonia for 1-2 hours at room
temperature,
and further deprotected for 16 hours at 65 C. The oligonucleotides were
purified by reverse
phase HPLC (RP-HPLC) and characterized by UPLC, and the molecular mass was
further
confirmed by ESI-MS. See below for more details.
Elongation of the oligonucleotide
The coupling ofI3-cyanoethyl- phosphoramidites (DNA-A(Bz), DNA- G(ibu), DNA-
C(Bz),
DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA- G(dmf), LNA-T or C6-S-S linker) is
performed by using a solution of 0.1 M of the 5'-0-DMT-protected amidite in
acetonitrile and
DCI (4,5¨dicyanoimidazole) in acetonitrile (0.25 M) as activator. For the
final cycle a
commercially available C6-linked cholesterol phosphoramidite was used at 0.1M
in DCM.
Thiolation for introduction of phosphorthioate linkages is carried out by
using xanthane
hydride (0.01 M in acetonitrile/pyridine 9:1). Phosphordiester linkages are
introduced using
0.02 M iodine in THF/Pyridine/water 7:2:1. The rest of the reagents are the
ones typically
used for oligonucleotide synthesis.
Purification by RP-HPLC:
The crude compounds were purified by preparative RP-HPLC on a Phenomenex
Jupiter
C18 10p 150x10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile was
used as
buffers at a flowrate of 5 mL/min. The collected fractions were lyophilized to
give the purified
compound typically as a white solid.
Abbreviations:
DCI: 4,5-Dicyanoimidazole
DCM: Dichloromethane
DMF: Dimethylformamide
DMT: 4,4'-Dimethoxytrityl
THF: Tetrahydrofurane
Bz: Benzoyl
Ibu: Isobutyryl
RP-HPLC: Reverse phase high performance liquid chromatography
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
118
Example 2: Design of LNA antisense oligonucleotides
Oligomers used in the examples and figures. The SEQ# is an identifier used
throughout the
examples and figures
Table 2 ¨
SEQ Compound Sequence Comment
ID
NO
#1 5' G C attgg at
0 m 0 m A 0 3' Mother compound without
- t C -
s S SS S S SS SS T S S conjugated
Cholesterol
#2 0 m 0 o m o Choi-3833
5'-CHOLG C attggtatT C A -3'
S S SS S S SS SS S S
#3 0 m 0 o m 0 Chol-SS-3833
5'-CholC6C6SSC6G C at tg gt at T C A -
S s sss s ss ss s s
3'
#4 0 10 0 0 M 0 0 Chol-3P0-3833
5'- Chol C6 t c a Gs Cs as ts ts gs gs ts as ts Ts Cs
A-3
#5 0 m 0 0 M 0 0 Chol-2P0-3833
5'CholC6caG C att g at at T C A 3'
S s sss s'ss ss s s
#6 5'- Chol C6 a Gs n C, T ts T Ts mC, A -3'
Chol-1P0-3833
#7 5'- Gs Tso c, t, g, t, g, g, a, a, Gso mC,o Go -3' Mother
compound without
conjugate
148 5'- Chol C6 G, T, c, t, g, t, g, g, a, a, G, 'C, G -3' Choi-
4061
#9 5'- Chol C6 c a G, T, c, 1, g, 1, g, g, a, a, G, mC, G -3'
Chol-2P0(ca)-4061
#10 5'- Chol C6 c t 0, Ts cs gs as a, Gs 'Cs Chol-2P0(ct)-4061
Example 3. Knock down of ApoB mRNA with Cholesterol-conjugates in vivo.
057BL6/J mice were injected with a single dose saline or 1 mg/kg unconjugated
LNA-
antisense oligonucleotide (SEQ ID #1)or equimolar amounts of LNA antisense
oligonucleotides conjugated to Cholesterol with different linkers and
sacrificed at days 1-10
according to Tab. 3.
RNA was isolated from liver and kidney and subjected to qPCR with ApoB
specific primers
and probe to analyze for ApoB mRNA knockdown.
Conclusions: Cholesterol conjugated to an ApoB LNA antisense oligonucleotide
with a
linker composed of 2 or 3 DNA with Phophodiester-backbone (Seq#4 and 5) showed
a
preference for liver specific knock down of ApoB (Fig. 11). This means
increases efficiency
and duration of ApoB mRNA knock down in liver tissue compared to the
unconjugated
compound (Seq #1),as well as compared to Cholesterol conjugates with stable
linker
CA 02889596 2015-04-24
WO 2014/076195
PCT/EP2013/073858
119
(Seq#2) and with disulphide linker (Seq.#3) and concomitant less knock down
activity of
Seq#4 and #5 in kidney tissue.
Materials and Methods:
Experimental design:
Table 3:
No. of Animal Animal strain/ gender/ Compound
Conc. at
Body
Gr. no. anima Dose level dose vol. 10 Sacrifice
ID no. weight
Is feed per day ml/kg
C57BL/6J- Day -1, 7
Day 10
1 1-4 4 NaC10.9% -
-Chow and 10
C57BL/6J- SEQ ID NO
2 5-8 4 y- Chow 1 0.1 mg/ml Day -1, 7
Day 10
and 10
1 mg/kg
C57BL/6J- SEQ ID NO
3 9-12 4 y- Chow 2 0.12mg/m1 Day -1, 7
Day 10
and 10
1,2 mg/kg
A C57BL/6J- SEQ ID NO
4 13-16 4 y- Chow 3 0.12mg/m1 Day -1, 7
D
and 10 ay 10
1,2 mg/kg
C57BL/6J- SEQ ID NO
5 17-20 4 y- Chow 4 0.13mg/m1 Day -1, 7
Day 10
and 10
1,3 mg/kg
C57BL/6J- SEQ ID NO
6 21-24 4 ?-Chow 5 0.13mg/m1 Day -1, 7
Day 10
and 10
1,3 mg/kg
C57BL/6J-
7 25-28 4 y- Chow NaC10.9% - Day -1, 7 Day 7
C578L/6J- SEQ ID NO
8 29-32 4 y- Chow 1 0.1 mg/m1 Day -1, 7 Day 7
1 mg/kg
C57BL/6J- SEQ ID NO
9 33-36 4 y- Chow 2 0.12mg/m1 Day-I, 7 Day 7
B 1,2 mg/kg
C57BL/6J- SEQ ID NO
37-40 4 y- Chow 3 0.12mg/m1 Day-I, 7 Day 7
1,2 mg/kg
C57BL/6J- SEQ ID NO
11 41-44 4 y- Chow 4 0.13mg/m1 Day -1, 7 Day 7
1,3mg/kg
C57BL/6J- SEQ ID NO
12 45-48 4 y- Chow 5 0.13mg/m1 Day -1, 7 Day 7
1,3mg/kg
C57BL/6J-
13 49-52 4 y- Chow NaC10.9% - Day 0, 3 Day 3
C57BL/6J- SEQ ID NO
14 53-56 4 y- Chow 1 0.1 mg/m1 Day 0, 3 Day 3
C 1 mg/kg
C57BL/6J- SEQ ID NO
57-60 4 y- Chow 2 0.12mg/m1 Day 0, 3 Day 3
1,2 mg/kg
C57BL/6J- SEQ ID NO
16 61-64 4 ?-Chow 3 0.12mg/m1 Day 0,3 Day 3
1,2 mg/kg
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
120
Animal
No: of Compound Conc. at
Animal strain/ Body
Gr. no. anima Dose level dose vol. 10 Sacrifice
ID no. gender/ weight
Is feed per day ml/kg
C57BL/6J- SEQ ID NO
17 65-68 4 y- Chow 4 0.13mg/m1 Day 0, 3 Day 3
1,3mg/kg
C57BL/6J- SEQ ID NO
18 69-72 4 y- Chow 5 0.13mg/m1 Day 0, 3 Day 3
1,3mg/kg
C57BL/6J-
19 73-76 4 y- Chow NaC10.9% Day-I, 1
Day 1
C57BL/6J- SEQ ID NO
20 77-80 4 y- Chow 1 0.1 mg/ml Day -1, 1 Day 1
1 mg/kg
C57BL/6J- SEQ ID NO
21 81-84 4 n- Chow 2 0.12mg/m1 Day -1, 1 Day 1
1,2mg/kg
C57BL/6J- SEQ ID NO
22 85-88 4 ?-Chow 3 0.12mg/m1 Day -1, 1 Day 1
1,2 mg/kg
C57BL/6J- SEQ ID NO
23 89-92 4 0- Chow 4 0.13mg/m1 Day -1, 1 Day 1
1,3mg/kg
C57BL/6J- SEQ ID NO
24 93-96 4 y- Chow 5 0.13mg/m1 Day -1, 1 Day 1
1,3mg/kg
Dose administration. C57BL/6JBom female animals, app. 20 g at arrival, were
dosed with 10
ml per kg BW (according to day 0 bodyweight) i.v. of the compound formulated
in saline or
saline alone according to table 3.
Sampling of liver and kidney tissue._ The animals were anaesthetized with 70%
CO2-30% 02
and sacrificed by cervical dislocation according to Table 3. One half of the
large liver lobe
and one kidney were minced and submerged in RNAlater.
Total RNA Isolation and First strand synthesis. Total RNA was extracted from
maximum 30
mg of tissue homogenized by bead-milling in the presence of RLT-Lysis buffer
using the
Qiagen RNeasy kit (Qiagen cat. no. 74106) according to the manufacturer's
instructions.
First strand synthesis was performed using Reverse Transcriptase reagents from
Ambion
according to the manufacturer's instructions.
For each sample 0.5 pg total RNA was adjusted to (10.8 pl) with RNase free H20
and mixed
with 2 pl random decamers (50 pM) and 4 pl dNTP mix (2.5 mM each dNTP) and
heated to
70 C for 3 min after which the samples were rapidly cooled on ice. 2 pl 10x
Buffer RT, 1 pl
MMLV Reverse Transcriptase (100 U/pl) and 0.25 pl RNase inhibitor (10 U/pl)
were added
to each sample, followed by incubation at 42 C for 60 min, heat inactivation
of the enzyme
at 95 C for 10 min and then the sample was cooled to 4 C. cDNA samples were
diluted 1: 5
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
121
and subjected to RT-QPCR using Taq man Fast Universal PCR Master Mix 2x
(Applied
Biosystems Cat #4364103) and Taqman gene expression assay (mApoB,
Mn01545150_m1
and mGAPDH #4352339E) following the manufacturers protocol and processed in an
Applied Biosystems RT-qPCR instrument (7500/7900 or ViiA7) in fast mode.
Example 4. Knock down of ApoB mRNA with Cholesterol-conjugates in vivo and LNA
distribution to liver and kidney.
057BL6/J mice were injected with a single dose saline or 1 mg/kg unconjugated
LNA-
antisense oligonucleotide (SEQ ID #1)or equimolar amounts of LNA antisense
oligonucleotides conjugated to Cholesterol with different linkers and
sacrificed at days 1-16
according to Tab. 4. RNA was isolated from liver and kidney and subjected to
qPCR with
ApoB specific primers and probe to analyze for ApoB mRNA knockdown.
The LNA oligonucleotide content was measured in liver and kidney using LNA
based
sandwich ELISA method.
Conclusions: Cholesterol conjugated to an ApoB LNA antisense oligonucleotide
with a
linker composed of 1, 2 or 3 DNA with Phophodiester-backbone (Seq#4, #5 and
#6) showed
a preference for liver specific knock down of ApoB (Fig. 14). This means
increased efficiency
and duration of ApoB mRNA knock down in liver tissue compared to the
unconjugated
compound (Seq #1), and concomitant less knock down activity of Seq#4, #5 and
#6 in
kidney tissue. The Cholesterol conjugated LNA antisense oligonucleotides have
a much
higher uptake in the liver and much lover uptake in the kidney as compared to
the
unconjugated LNA oligonucleotide (Fig. 15).
Materials and Methods:
Experimental design:
Table 4:
Part Group Animal No. of Animal strain/ Compound
Conc. at dose Adm. Dosing Body Sacrifice
no. id no. Animals gender/feed Dose level vol.
10 ml/kg Route day weight day
per day day
A 1 1-3 3 C57BL/6J/WChow Saline iv 0 0, 1 1
2 4-6 3 C57BL/6/Chow SEQ ID NO 1 0.1 mg/ml iv 0
0, 1 1
lmg/kg
3 7-9 3 C5781/63/ /Chow SEQ ID NO 4 0.135 mg/ml iv 0
0, 1 1
equimolar
1.35mg/kg
4 10-12 3 C57BL/6J/WChow SEQ ID NO 5 0.128 mg/m1 iv 0
0, 1 1
equimolar
1.28mg/kg
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
122
Part Group Animal No. of Animal strain/ Compound Conc.
at dose Adm. Dosing Body Sacrifice
no. id no. Animals gender/feed Dose level vol. 10
ml/kg Route day weight day
per day day
13-15 3 C57BL/6./Chow SEQ ID NO 6 0.121 mg/ml iv 0 0,
1 1
equimolar
1.21mg/kg
B 6 16-18 3 C57BL/6J/WChow Saline - iv 0 0, 3 3
7 19-21 3 C57BL/6/Chow SEQ ID NO 1 0.1 mg/ml iv 0 0, 3
3
lmg/kg
8 22-24 3 C57BL/6/Chow SEQ ID NO 4 0.135 mg/ml iv 0 0, 3
3
equimolar
1.35mg/kg
9 25-27 3 C57BL/6J/WChow SEQ ID NO 5 0.128 mg/ml iv 0 0, 3
3
equimolar
1.28mg/kg
28-30 3 C57BL/6/Chow SEQ ID NO 6 0.121 mg/ml iv 0 0, 3 3
equimolar
1.21mg/kg
¨r7-
C 11 31-33 3 C57BL/6J/WChow Saline - iv 0
0, 3 3
12 34-36 3 C57BL/6./Chow SEQ ID NO 1 0.1 mg/m1 iv 0 0, 7
7
lmg/kg
13 37-39 3 C57131/61/ /Chow SEQ ID NO 4 0.135 mg/ml iv 0 0,
7 7
equimolar
1.35mg/kg
14 40-42 3 C57BL/6/Chow SEQ ID NO 5 0.128 mg/ml iv 0 0, 7
7
equimolar
1.28mg/kg
43-45 3 C57BL/61//Chow SEQ ID NO 6 0.121 mg/ml iv 0 0, 7 7
equimolar
1.21mg/kg
D 16 46-48 3 C57BL/6/Chow Saline iv 0 0,7,10 10
17 49-51 3 C57BL/6./Chow SEQ ID NO 1 0.1 mg/m1 iv
0 0,7,10 10
lmg/kg
18 52-54 3 C5713L/6J//Chow SEQ ID NO 4 0.135 mg/ml iv
0 0,7,10 10
equimolar
1.35mg/kg
19 55-57 3 C57BL/6/Chow SEQ ID NO 5 0.128 mg/ml iv 0 0,7,10
10
equimolar
1.28mg/kg
58-60 3 C5713L/6J//Chow SEQ ID NO 6 0.121 mg/ml iv 0
0,7,10 10
equimolar
1.21mg/kg
E 21 61-63 3 C57BL/6./Chow Saline - iv 0 0,7,13 13
22 64-66 3 C57BL/6./Chow SEQ ID NO 1 0.1 mg/ml iv 0
0,7,13 13
lmg/kg
23 67-69 3 C57BL/6J//Chow SEQ ID NO 4 0.135 mg/ml iv
0 0,7,13 13
equimolar
1.35mg/kg
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
123
Part Group Animal No. of Animal strain/ Compound
Conc. at dose Adm. Dosing Body Sacrifice
no. id no. Animals gender/feed Dose level vol.
10 ml/kg Route day weight day
per day day
24 70-72 3 C57BL/6J//Chow SEQ
ID NO 5 0.128 mg/ml iv 0 0,7,13 13
equimolar
1.28mg/kg
25 73-75 3 C57BL/6J/WChow SEQ
ID NO 6 0.121 mg/ml iv .. 0 .. 0,7,13 .. 13
equimolar
1.21mg/kg
F 26 76-78 3 C57BL/6J//Chow Saline iv 0
0,7,14,16 16
27 79-81 3 C5713L/61//Chow SEQ ID NO 1 0.1 mg/ml
iv 0 0,7,14,16 16
lmg/kg
28 82-84 3 C57BL/6J/WChow SEQ
ID NO 4 0.135 mg/ml iv 0 0,7,14,16 16
equimolar
1.35mg/kg
29 85-87 3 C57BL/6/Chow SEQ ID
NO 5 0.128 mg/ml iv 0 0,7,14,16 16
equimolar
1.28mg/kg
30 88-90 3 C57BL/6J/WChow SEQ
ID NO 6 0.121 mg/ml iv 0 0,7,14,16 16
equimolar
1.21mg/kg
Dose administration. C57BL/6JBorn female animals, app. 20 g at arrival, were
dosed with 10
ml per kg BW (according to day 0 bodyweight) i.v. of the compound formulated
in saline or
saline alone according to Table 4.
Sampling of liver and kidney tissue. The animals were anaesthetized with 70%
CO2-30% 02
and sacrificed by cervical dislocation according to Table 4. One half of the
large liver lobe
and one kidney were minced and submerged in RNAlater.
Total RNA Isolation and First strand synthesis. Total RNA was extracted from
maximum 30
mg of tissue homogenized by bead-milling in the presence of RLT-Lysis buffer
using the
Qiagen RNeasy kit (Qiagen cat. no. 74106) according to the manufacturer's
instructions.
First strand synthesis was performed using Reverse Transcriptase reagents from
Ambion
according to the manufacturer's instructions.
For each sample 0.5 pg total RNA was adjusted to (10.8 pl) with RNase free H20
and mixed
with 2 pl random decamers (50 pM) and 4 pl dNTP mix (2.5 mM each dNTP) and
heated to
70 C for 3 min after which the samples were rapidly cooled on ice. 2 pl 10x
Buffer RT, 1 pl
.. MMLV Reverse Transcriptase (100 U/pl) and 0.25 pl RNase inhibitor (10 U/pl)
were added
to each sample, followed by incubation at 42 C for 60 min, heat inactivation
of the enzyme
at 95 C for 10 min and then the sample was cooled to 4 C. cDNA samples were
diluted 1: 5
and subjected to RT-QPCR using Taq man Fast Universal PCR Master Mix 2x
(Applied
Biosystems Cat #4364103) and Taqman gene expression assay (mApoB,
Mn01545150_m1
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
124
and mGAPDH #4352339E) following the manufacturers protocol and processed in an
Applied Biosystems RT-qPCR instrument (7500/7900 or ViiA7) in fast mode.
Oligo content sandwich EL1SA: Liver and kidney samples (100 mg) were collected
in tubes
at different times after dosing. The samples were added buffer, (pH 8.0 100 mM
NaCI, 25
mM EDTA, 0.25 mM Tris), protease k (1 %, Sigma P4850-5) and 2 Tungsten Carbide
Beads
(3 mm) (Qiagen) and homogenized for 8 min (Retsch MM300, 25 Hz Ws]) and
incubated the
homogenate at 37 C over night. The samples are spun at 14000 g for 15 minutes
before
use.
Standards 1-100 pg/g of LNA oligonucleotides in kidney and liver were prepared
and treated
as above. Standards and samples were diluted to (100 ¨5000 ng/L) into 150 pl
of a 35 nM
solution of a biotinylated and digoxigenin modified capture and detection
probe (5 x SSCT
buffer [(750 mM NaCI, and 75 mM sodium citrate, containing 0.05 % (v/v) Tween-
20 pH 7.0)]
and mixed for an hour. Streptavidin-coated (Nunc Immobilizer Streptavidin F96
CLEAR
module plate Nunc Cat. No. 436014) were washed three times (5 x SSCT buffer,
300
pL).The samples 100 pL was transferred to the streptavidin coated plates and
incubated for
one hour under gentle shaking. The wells were aspirated and washed three times
with 300
pl of 2 x SSCT buffer (300 mM NaCI + 30 mM sodium citrate containing 0.05 %
(v/v) Tween-
20, pH 7.0). One hundred microliters of anti-Dig-AP Fab fragments (Roche
Applied Science,
Cat. No. 11 093 274 910) diluted 1:4000 in PBST (Phosphate buffered saline, pH
7.2) were
added to the wells and incubated for 1 hour at room temperature under gentle
agitation. The
wells were aspirated and washed three times with 300 pl of 2 x SSCT buffer.
One hundred
microliters of substrate solution (KPL BluePhos Microwell Phosphatase
substrate system 50-
88-00) were added to each well. The intensity of the color development was
measured
spectrophotometrically at 615 nm every 5 minutes after shaking. The test
samples were
referenced against the standard samples.
Example 5: Knock down of PCSK9 mRNA with cholesterol conjugates in vivo
NMRI mice were injected with a single dose saline or 10 mg/kg unconjugated LNA-
antisense
oligonucleotide (SEQ ID 7) or equimolar amounts of LNA antisense
oligonucleotides
conjugated to Cholesterol with different linkers and sacrificed at days 1-10
according to Tab.
5.
RNA was isolated from liver and kidney and subjected to qPCR with PCSK9
specific primers
and probe to analyze for PCSK9 mRNA knockdown.
Conclusions: Cholesterol conjugated to an PCSK9 LNA antisense oligonucleotide
with a
linker composed of 2 DNA with Phophodiester-backbone (Seq#9 and #10) showed an
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
125
enhanced liver knock down of PCSK9 (Fig. 16) compared to the unconjugated
compound
(Seq #7),as well as compared to Cholesterol conjugates with stable linker
(Seq#8).
Materials and Methods:
Experimental design:
Table 5:
Compound Conc. at Body
Group Animal No. of Animal strain/ Adm. Dosing Sacrifice
Part Dose level dose vol.
weight
no. id no. Animals gender/feed Route day day
per day 10 ml/kg day
1 1-3 3 NMRI//Chow Saline - iv 0 0, 1
1
SEQ ID NO 7
2 4-6 3 NMRI//Chow 1 mg/ml iv 0 0, 1
1
10mg/kg
SEQ ID NO 8
3 7-9 3 NMRI//Chow equimolar 1,13 mg/ml iv
0 0, 1 1
A 11,3mg/kg
SEQ ID NO 9
5 13-15 3 NMRI//Chow equimolar 1,27 mg/ml
iv 0 0, 1 1
12,7mg/kg
SEQ ID NO 10
6 16-18 3 NMRI//Chow equimolar 1,27 mg/ml
iv 0 0, 1 1
12,7mg/kg
7 19-21 3 NMRI//Chow Saline - iv 0
0, 3 3
SEQ ID NO 7
8 22-24 3 NMRI//Chow 1 mg/ml iv 0
0, 3 3
10mg/kg
SEQ ID NO 8
9 25-27 3 NMRI//Chow equimolar 1,13 mg/ml
iv 0 0, 3 3
B 11,3mg/kg
SEQ ID NO 9
11 31-33 3 NMRI//Chow equimolar 1,27 mg/ml
iv 0 0, 3 3
12,7mg/kg
SEQ ID NO 10
12 34-36 3 NMRI//Chow equimolar 1,27 mg/ml
iv 0 0, 3 3
12,7mg/kg
13 37-39 3 NMRI//Chow Saline - iv 0
0, 7 7
SEQ ID NO 7
14 40-42 3 NMRI//Chow 1 mg/ml iv 0
0, 7 7
10mg/kg
SEQ ID NO 8
43-45 3 NMRI//Chow equimolar 1,13 mg/ml iv 0 0,
7 7
11,3mg/kg
C
SEQ ID NO 9
17 49-51 3 NMRI//Chow equimolar 1,27 mg/ml
iv 0 0, 7 7
12,7mg/kg
SEQ ID NO 10
18 52-54 3 NMRI//Chow equimolar 1,27 mg/ml
iv 0 0, 7 7
12,7mg/kg
19 55-57 3 NMRI//Chow Saline - iv 0
0, 7, 10 10
D SEQ ID NO 7
58-60 3 NMRI//Chow 1 mg/1-n' iv 0 0, 7, 10
10
10mg/kg
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
126
Compound Conc. at Body
Group Animal No. of Animal strain/ Adm. Dosing Sacrifice
Part Dose level dose vol.
weight
no. id no. Animals gender/feed Route day day
per day 10 ml/kg day
SEQ ID NO 8
21 61-63 3 NMRI//Chow equimolar 1,13 mg/ml iv
0 0, 7, 10 10
11,3mg/kg
SEQ ID NO 10
24 70-72 3 NMRI//Chow equimolar 1,27 mg/ml iv
0 0, 7, 10 10
12,7mg/kg
A 25 73-75 3 NMRI//Chow Saline iv 0 0,
1 1
Dose administration. NMRI female animals, app. 20 g at arrival, were dosed
with 10 ml per
kg BW (according to day 0 bodyweight)i.v. of the compound formulated in saline
or saline
alone according to Table 5.
Sampling of liver and kidney tissue._ The animals were anaesthetized with 70%
CO2-30% 02
and sacrificed by cervical dislocation according to Table 4. One half of the
large liver lobe
and one kidney were minced and submerged in RNAlater.
Total RNA was extracted from maximum 10 mg of tissue homogenized by bead-
milling in
the presence of MagNA Pure LC RNA Isolation Tissue buffer (Roche cat.no 03 604
721 001)
using the MagNa Pure 96 Cellular RNA Large Volume Kit (Roche cat no.
5467535001),
according to the manufacturer's instructions. First strand synthesis was
performed using
Reverse Transcriptase reagents from Ambion according to the manufacturer's
instructions.
For each sample 0.5 pg total RNA was adjusted to (10.8 pl) with RNase free H20
and mixed
with 2 pl random decamers (50 pM) and 4 pl dNTP mix (2.5 mM each dNTP) and
heated to
70 C for 3 min after which the samples were rapidly cooled on ice. 2 pl 10x
Buffer RT, 1 pl
MMLV Reverse Transcriptase (100 U/pl) and 0.25 pl RNase inhibitor (10 U/pl)
were added
to each sample, followed by incubation at 42 C for 60 min, heat inactivation
of the enzyme
at 95 C for 10 min and then the sample was cooled to 4 0. cDNA samples were
diluted 1: 5
and subjected to RT-QPCR using Taqman Fast Universal PCR Master Mix 2x
(Applied
Biosystems Cat #4364103) and Taqman gene expression assay (mPCSK9,
Mn00463738_m1 and mActin #4352341E) following the manufacturers protocol and
processed in an Applied Biosystems RT-qPCR instrument (7500/7900 or ViiA7) in
fast
mode.
Example 6. In vitro cleavage of different DNA/PO-linkers
FAM-labeled ASOs with different DNA/PO-linkers (PO linkers) were subjected to
in vitro
cleavage either in S1 nuclease extract (Fig. 6A), Liver or kidney homogenates
or Serum
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
127
PAM-labeled ASOs 100 pM with different DNA/PO-linkers were subjected to in
vitro
cleavage by Si nuclease in nuclease buffer (60 U pr. 100 pL) for 20 and 120
minutes (A).
The enzymatic activity was stopped by adding EDTA to the buffer solution. The
solutions
were then subjected to AIE HPLC analyses on a Dionex Ultimate 3000 using an
Dionex
DNApac p-100 column and a gradient ranging from 10mM ¨ 1 M sodium perchlorate
at pH
7.5. The content of cleaved and non cleaved oligonucleotide were determinded
against a
standard using both a fluoresense detector at 615 nm and a uv detector at 260
nm.
SEQ ID NO Linker sequence `)/0 cleaved after 20min 51 % cleaved
after 120min
Si
20 2 5
18 a 29.1 100
17 ca 40.8 100
16 tca 74.2 100
19 gac 22.9 n.d
Conclusion: The PO linkers (or region B as referred to herein) results in the
conjugate (or
group C) being cleaved off, and both the length and/or the sequence
composition of the
linker can be used tomodulate susceptibility to nucleolytic cleavage of region
B. The
Sequence of DNA/PO-linkers can modulate the cleavage rate as seen after 20 min
in
Nuclease Si extract Sequence selection for region B (e.g.for the DNA/PO-
linker) can
therefore also be used to modulate the level of cleavage in serum and in cells
of target
tissues.
Liver, kidney and Serum (B) were spiked with oligonucleotide SEQ ID NO 16 to
concentrations of 200 pg/g tissue. Liver and kidney samples collected from
NMRI mice were
homogenized in a homogenisation buffer (0,5% lgepal CA-630, 25 mM Tris pH 8.0,
100 mM
NaCI, pH 8.0 (adjusted with 1 N Na0H). The homogenates were incubated for 24
hours at
37 and thereafter the homogenates were extracted with phenol - chloroform.
The content of
cleaved and non cleaved oligonucleotide in the extract from liver and kidney
and from the
serum were determinded against a standard using the above HPLC method.
Seq ID Linker % cleaved after % cleaved after `)/0 cleaved
after
Sequence 24h rs liver 24hrs kidney 24hours in
homogenate homogenate serum
16 tca 83 95 0
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
128
Conclusion: The PO linkers (or region B as referred to herein) results in
cleavage of the
conjugate (or group C) from the oligonucleotide, in liver or kidney
homogenate, but not in
serum.
Note: cleavage in the above assays refers to the cleavage of the cleavable
linker, the
oligomer or region A should remain functionally intact. The susceptibility to
cleavage in the
above assays can be used to determine whether a linker is biocleavable or
physiologically
labile.
Example 7a: In vivo inhibition of FVII (1 mg/kg)
An in vivo mouse study was prepared using a total of 6 groups of mice (n=3).
Each mouse
was administered a single i.v. dose of LNA compound targeting FVII mRNA, at
1mg/kg or
equimolar compared to SEQ ID #12. A saline control group was included. The
mice were
pre-bled 1 day before administration, and subsequent bleeds were taken at day
1 and 2 after
administration. The mice were sacrificed at days 4, liver, kidney, and blood
samples were
taken. See table 7 for study setup.
Factor VII serum levels, mRNA levels, and oligonucleotide tissue content were
measured
using standard assay techniques.
Conclusions: The DNA/PO-linker (PO) improves the FVII protein down regulation
in serum
(Figure 18) for FVII mRNA targeting LNA oligonucleotides with cholesterol
conjugates when
comparing to the widely used dithio linker (disulphide) (PO linker SEQ ID # 15
compare to
SS linker SEQ ID #14). Using GaINAc as conjugate it is apparent that the PO
linker
improves the down regulation of FVII protein when compared to the aminolinked
conjugated
LNA oligonucleotide (PO linker SEQ ID #13 compare to amino linked SEQ ID #12).
The
GalNac conjugate is known to be biocleavable (possibly due to the peptide
linker), and as
such it appears that the PO linker further enhances the release of active and
potent
.. compound in the target cell. These data corresponds to the mRNA expression
data (Figure
19). The tissue content of oligonucleotide in kidney and liver shows how the
conjugates
change the distribution (Figure 20). It is seen that the two cholesterol
conjugated compounds
gives similar distribution (compare SEQ ID #14 and #15) so with the enhanced
mRNA and
FVII protein down regulation of the PO linker compound (SEQ ID #15) it is seen
how the PO
linker enhances the activity of the FVII targeting LNA oligonucleotide when
comparing to
SEQ ID #14..
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
129
Materials and Methods:
Experimental design:
Table 7:
group compound termination group dose
time point size (dO)
post dose mg/kg
1 saline d4 3 none
2 SEQ ID #11 d4 3 1
3 SEQ ID #12 d4 3 1
4 SEQ ID #13 d4 3 1
SEQ ID #14 d4 3 1
6 SEQ ID #15 d4 3 1
Female mice were administered iv and liver, kidney, and blood were sampled at
sacrifice on
5 day 4, Additional blood draws were made before dosing and also on day 1
and 2 after
dosing.
Example 7b: In vivo inhibition of FVII (0,1 and 0,25mg/kg)
An in vivo mouse study was prepared using a total of 7 groups of mice (n=3).
Each mouse
was administered a single i.v. dose of LNA compound targeting FVII mRNA, at
either
0,1mg/kg or 0,25mg/kg in equimolar amount compared to SEQ ID #12. A saline
control
group was included. The mice were pre-bled 1 day before administration, and
subsequent
bleeds were taken at days 4,7,11,14, and 18 after administration. The mice
were sacrificed
at days 24, liver, kidney, and blood samples were taken. See table 8 for study
setup.
Factor VII serum levels, mRNA levels, and oligonucleotide tissue content were
measured
using standard assay techniques
Conclusions: The DNA/PO-linker (PO) improves the FVII protein down regulation
(Figure
21) for FVII mRNA targeting LNA oligonucleotides with cholesterol conjugates
when
comparing to the widely used dithio linker (PO linker SEQ ID # 15 compare to
SS linker SEQ
ID #14) at both 0,1mg/kg and 0,25mg/kg. Using GaINAc as conjugate mRNA data
(Figure
22) suggest that the PO linker improves the down regulation when compared to
the
aminolinked conjugated LNA oligonucleotide (PO linker SEQ ID #13 compare to
amino
linked SEQ ID #12). The mRNA expression data (Figure 22) supports the improved
activity
of the PO linker compound (SEQ ID #15) compared to the dithio linked conjugate
(SEQ ID
#14). The tissue content of oligonucleotide in kidney and liver shows how the
conjugates
change the distribution (Figure 23). Data suggest that the PO linker enhances
the uptake
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
130
both in liver and kidney at these dose ranges for both Cholesterol conjugate
and GaINAc
conjugate (compare SEQ ID #14 and #15 and compare SEQ ID #13 to #12)
Materials and Methods:
Experimental design:
Table 8:
group compound termination group dose
time point size (d0)
post dose mg/kg
1 Saline d24 3 none
2 SEQ ID #12 d24 3 0,1
3 SEQ ID #13 d24 3 0,1
4 SEQ ID #14 d24 3 0,1
5 SEQ ID #14 d24 3 0,25
6 SEQ ID #15 d24 3 0,1
7 SEQ ID #15 d24 3 0,25
Male mice were administered iv and liver, kidney, and blood were sampled at
sacrifice on
day 24, Additional blood draws were made before dosing and also on day
4,7,11,14, and 18
after dosing.
Example 8. In vivo silencing of ApoB mRNA with different conjugates and PO-
linker.
To explore the impact of the biocleavable DNA/PO-linker on additional
conjugates C57BL61
mice were treated i.v. with saline control or with a single dose of 1 mg/kg kg
for parent
compound #1 or equimolarly of ASO conjugated to Mono-GaINAc, Folic acid, Earn
or
Tocopherol, either without biocleavable linker, with Dithio-linker (SS) or
with DNA/PO-linker
(PO). After 7 days animals were sacrificed and RNA was isolated from liver and
kidney
samples and analyzed for ApoB mRNA expression (Fig.24)
Conclusions:
For all 4 conjugates the DNA/PO-linker improves ApoB knock down in the liver
compared to
the widely used dithio-linker (compare #27 with #26, #30 with #29, #33 with
#32 and #36
with #35) . For mono-GaINAc and Tocopherol the DNA/PO-linker improves knock
down of
ApoB in the liver even compared to unconjugated compound (compare #30 and #36
with
#1). Tocopherol combined with a DNA/PO-linker shows capability of redirecting
a compound
from kidney to liver (compare A and B, #36 with #1)
Materials and Methods:
Experimental design:
CA 02889596 2015-04-24
WO 2014/076195
PCT/EP2013/073858
131
Table 9:
Animal Compound
G Animal strain/ Seq ID, Adm. Dosing Sacrifice
r. no.
ID no. gender/ dose Route Day Day
feed 1 mg/kg
NMRI
1-5 1 iv. 0 7
Chow
NMRI y-
2 5-10 28 iv. 0 7
Chow
NMRI y-
3 11-15 Chow 29 iv. 0 7
NMRI y-
4 16-20 Chow 30 iv.. 0 7
NMRI y-
21-25 Chow 25 iv. 0 7
NMRI y-
6 26-30 Chow 26 iv. 0 7
NMRI Q-
7 31-35 Chow 27 iv. 0 7
NMRI y-
8 36-40 Chow NaCI 0.9% iv. 0 7
Animal Compound
Animal strain/ Seq ID, Adm. Dosing Sacrifice
Gr. no.
ID no. gender/ dose Route Day Day
feed 1 mg/kg
y-
1 1-5 NMRI 1 iv. 0 7
Chow
5-10 NMRI 31 iv. 0 7
Chow
NMRI y-
3 11-15 Chow 32 i.v. 0 7
NMRI y-
4 16-20 Chow 33 V. 0 7
NMRI y-
5 21-25 Chow 34 iv. 0 7
NMRI
6 26-30 Chow 35 iv. 0 7
NMRI y-
7 31-35 Chow 36 iv. 0 7
NMRI y-
8 36-40 Chow NaCI 0.9% iv. 0 7
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
132
Dose administration and sampling. 057BL6 mice were dosed i.v. with a single
dose of
lmg/kg ASO formulated in saline or saline alone according to the above table.
Animals were
sacrificed at day7 after dosing and liver and kidney were sampled.
RNA isolation and mRNA analysis. Total RNA was extracted from liver and kidney
samples
and ApoB mRNA levels were analyzed using a branched DNA assay.
Example 9. In vitro silencing of Target X mRNA with looped LNA ASO with PO-
linker
Blocker groups might be beneficial regarding tolerability, specificity or
reduced off-target
effect of ASOs but challenging in terms of preserving the activity of the
original, unblocked
ASO. As an example for a blocker group we used a complementary sequence which
is
connected to the oligonucleotide by a non-complementary nucleotide stretch
generating a
hairpin loop. The unpaired bases in the loop where either 3 DNA nucleotides
with
Phophodiester-backbone (PO-linker) or the same DNA nucleotides with
Phosphorothioate-
backbone. To test the activity of the looped LNA-ASOs Neuro 2a cells were
treated with
1pM ASO in a gymnosis assay and RNA was extracted and subjected to RT-QPCR to
analyze for target X mRNA knock down (Fig.25).
Conclusion: Looped ASOs with PO-linker (Seq ID #21 and #23) showed improved
target X
mRNA knock down compared to the same ASO sequence without PO-linker (Seq ID
#22
and #24).
Materials and Methods:
Gymnosis assay in N2a cells:
Neuro 2a (mouse neuroblastoma) cells were seeded in 24we11 plates with 1.8x104
cells/well
and treated with 1pM looped LNA ASOs with and without PO-linker, respectively
in
DMEM+Glutamax (gibco-life, #61965-026), 2mM Glutamine, 10% FBS, 1mM Sodium
Pyruvate, 25pg/m1 Gentamicin.
Total RNA Isolation and First strand synthesis. Total RNA was extracted after
6 days
gymnosis using the Qiagen RNeasy kit (Qiagen cat. no. 74106) according to the
manufacturer's instructions. First strand synthesis was performed using
Reverse
Transcriptase reagents from Ambion according to the manufacturer's
instructions.
For each sample 0.5 pg total RNA was mixed with 2 pl random decamers (50 pM)
and 4 pl
dNTP mix (2.5 mM each dNTP) and heated to 70 C for 3 min after which the
samples were
rapidly cooled on ice. 2 pl 10x Buffer RT, 1 pl MMLV Reverse Transcriptase
(100 U/pl) and
0.25 pl RNase inhibitor (10 U/pl) were added to each sample, followed by
incubation at 42
C for 60 min, heat inactivation of the enzyme at 95 C for 10 min and then the
sample was
cooled to 4 C. cDNA samples were diluted 1: 5 and subjected to RT-QPCR using
Taqman
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
133
Fast Universal PCR Master Mix 2x (Applied Biosystems Cat #4364103) and Taqman
gene
expression assay against target X following the manufacturers protocol and
processed in an
Applied Biosystems RT-qPCR instrument (ViiA7) in fast mode. Target X mRNA
expression
was normalized to Beta actin mRNA expression (mBACT # 4352341E) and compared
to
.. mock mRNA levels.
Example 10: Non-Human Primate Study
The primary objective for this study is to investigate selected lipid markers
over 7 weeks
after a single slow bolus injection of anti-PCSK9 and anti-ApoB LNA conjugated
compounds
to cynomolgus monkeys and assess the potential toxicity of compounds in
monkey. The
compounds used in this study are SEQ ID NOs 46 and 49, 5 and 54, which were
prepared in
sterile saline (0.9%) at an initial concentration of 0.625 and 2.5 mg/ml).
Male (PCSK9) or female monkeys (ApoB) monkeys of at least 24 months old are
used, and
given free access to tap water and 180g of MWM(E) SQC SHORT expanded diet
(Dietex
France, SDS, Saint Gratien, France) will be distributed daily per animal. The
total quantity of
food distributed in each cage will be calculated according to the number of
animals in the
cage on that day. In addition, fruit or vegetables will be given daily to each
animal. The
animals will be acclimated to the study conditions for a period of at least 14
days before the
beginning of the treatment period. During this period, pre-treatment
investigations will be
performed. The animals are dosed i.v. at a dose if, for example, 0.25 mg/kg or
1 mg/kg.
The dose volume will be 0.4 mL/kg. 2 animals are used per group. After three
weeks, the
data will be analyzed and a second group of animals using a higher or lower
dosing regimen
may be initiated ¨ preliminary dose setting is 0.5 mg/kg and 1 mg/kg, or lower
than that
based on the first data set.
The dose formulations will be administered once on Day 1. Animals will be
observed for a
period of 7 weeks following treatment, and will be released from the study on
Day 51. Day 1
corresponds to the first day of the treatment period. Clinical observations
and body weight
and food intake (per group) will be recorded prior to and during the study.
Blood is sampled and analysis at the following time points:
Study Day Parameters
-8 RCP, L, Apo-B, PCSK9*, OA
-1 L, Apo-B, PCSK9*, PK, OA
1 Dosing
4 LSB, L, Apo-B, PCSK9*, OA
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
134
8 LSB, L, Apo-B, PCSK9*, PK, OA
15 RCP, L, Apo-B, PCSK9* PK, OA
22 LSB, L, Apo-B, PCSK9* PK, OA
29 L, Apo-B, PCSK9* PK, OA
36 LSB, L, Apo-B, PCSK9* PK, OA
43 L, PK, Apo-B, PCSK9* PK, OA
50 RCP, L, Apo-B, PCSK9* PK, OA
RCP 0 routine clinical pathology, LSB = liver safety biochemistry, PK =
pharmacokinetics,
OA = other analysis, L = Lipids.
Blood biochemistry
The following parameters will be determined for all surviving animals at the
occasions
indicated below:
= full biochemistry panel (complete list below) - on Days -8, 15 and 50,
= liver Safety (ASAT, ALP, ALAT, TBIL and GGT only) - on Days 4, 8, 22 and
36,
= lipid profile (Total cholesterol, HDL-C, LDL-C and Triglycerides) and Apo-
B only -
on Days -1, 4, 8, 22, 29, 36, and 43.
Blood (approximately 1.0 mL) is taken into lithium heparin tubes (using the
ADVIA 1650
blood biochemistry analyzer): Apo-B, sodium, potassium, chloride, calcium,
inorganic
phosphorus, glucose, HDL-C, LDL-C, urea, creatinine, total bilirubin (TBIL),
total cholesterol,
triglycerides, alkaline phosphatase (ALP), alanine aminotransferase (ALAT),
aspartate
aminotransferase (ASAT), creatine kinase, gamma-glutamyl transferase (GGT),
lactate
dehydrogenase, total protein, albumin, albumin/globulin ratio.
Analysis of blood: Blood samples for PCSK9 analysis will be collected from
Group 16
animals only on Days -8, -1, 4, 8, 15, 22, 29, 36, 43 and 50.
Venous blood (approximately 2 mL) will be collected from an appropriate vein
in each animal
into a Serum Separating Tube (SST) and allowed to clot for at least 60 30
minutes at room
temperature. Blood will be centrifuged at 1000 g for 10 minutes under
refrigerated conditions
(set to maintain +4 C). The serum will be transferred into 3 individual tubes
and stored
at -80 C until analyzed at CitoxLAB France using an ELISA method (Circulex
Human
PCSK9 ELISA kit, CY-8079, validated for samples from cynomolgus monkey).
Other Analysis: W02011009697 & W02010142805 provides the methods for the
following
analysis: qPCR, PCSK9 / ApoB mRNA analysis, Other analysis includes PCSK9 /
ApoB
protein ELISA, serum Lp(a) analysis with ELISA (Mercodia No. 10-1106-01),
tissue and
CA 02889596 2015-04-24
WO 2014/076195 PCT/EP2013/073858
135
plasma oligonucleotide analysis (drug content), Extraction of samples,
standard - and QC-
samples, Oligonucleotide content determination by ELISA.
Example 11: Liver and Kidney toxicity Assessment in Rat.
Compounds of the invention can be evaluated for their toxicity profile in
rodents, such as in
mice or rats. By way of example the following protocol may be used: Wistar Han
Crl:WI(Han) are used at an age of approximately 8 weeks old. At this age, the
males should
weigh approximately 250 g. All animals have free access to SSNIFF R/M-H
pelleted
maintenance diet (SSNIFF Spezialdiaten GmbH, Soest, Germany) and to tap water
(filtered
with a 0.22 pm filter) contained in bottles. The dose level of 10 and
40mg/kg/dose is used
(sub-cutaneous administration) and dosed on days 1 and 8. The animals are
euthanized on
Day 15. Urine and blood samples are collected on day 7 and 14. A clinical
pathology
assessment is made on day 14. Body weight is determined prior to the study, on
the first
day of administration, and 1 week prior to necropsy. Food consumption per
group will be
assessed daily. Blood samples are taken via the tail vein after 6 hours of
fasting. The
following blood serum analysis is performed: erythrocyte count mean cell
volume packed
cell volume hemoglobin mean cell hemoglobin concentration mean cell hemoglobin
thrombocyte count leucocyte count differential white cell count with cell
morphology
reticulocyte count, sodium potassium chloride calcium inorganic phosphorus
glucose
urea creatinine total bilirubin total cholesterol triglycerides alkaline
phosphatase alanine
aminotransferase aspartate aminotransferase total protein albumin
albumin/globulin ratio.
Urinalysis are performed a-GST, 13-2 Microglobulin, Calbindin, Clusterin,
Cystatin C, KIM-
1,0steopontin, TIMP-1, VEGF,and NGAL. Seven analytes (Calbindin, Clusterin,
GST-a,
KIM-1, Osteopontin, TIMP-1, VEGF) will be quantified under Panel 1 (MILLIPLEX
MAP Rat
Kidney Toxicity Magnetic Bead Panel 1, RKTX1MAG-37K). Three analytes (13-2
Microglobulin, Cystatin C, Lipocalin-2/NGAL) will be quantified under Panel 2
(MILLIPLEX
MAP Rat Kidney Toxicity Magnetic Bead Panel 2, RKTX2MAG-37K). The assay for
the
determination of these biomarkers' concentration in rat urines is based on the
Luminex
xMAP technology. Microspheres coated with anti- a-GST /13-2 microglobulin /
calbindin /
clusterin / cystacin C / KIM-1 / osteopontin / TIMP-1 / VEGF / NGAL antibodies
are color-
coded with two different fluorescent dyes.The following parameters are
determined (Urine
using the ADVIA 1650): Urine protein, urine creatinine. Quantitative
parameters: volume, pH
(using 10-Multistix SG test strips/Clinitek 500 urine analyzer), specific
gravity (using a
refractometer). Semi-quantitative parameters (using 10-Multistix SG test
strips/Clinitek 500
urine analyzer): proteins, glucose, ketones, bilirubin, nitrites, blood,
urobilinogen, cytology of
CA 02889596 2015-04-24
WO 2014/076195
PCT/EP2013/073858
136
sediment (by microscopic examination ).Qualitative parameters: Appearance,
color. After
sacrifice, the body weight and kidney, liver and spleen weight are determined
and organ to
body weight ratio calculated. Kidney and liver samples will be taken and
either frozen or
stored in formalin. Microscopic analysis is performed.
