Note: Descriptions are shown in the official language in which they were submitted.
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
Composition and Method for Stabilizing Nucleic Acids in Biological Samples
FIELD OF THE INVENTION
The present application pertains to the field of stabilizing nucleic acids in
biological samples.
More particularly, the present invention relates to methods and compositions
for stabilizing
both human and microbial deoxyribonucleic acid (DNA) present in complex
biological
samples, such as feces.
BACKGROUND
Feces has long been classified a potentially infectious waste product from an
animal's
digestive tract which is collected to test for parasites, such as pinworms
and/or their eggs or
to detect pathogenic bacteria and fungi in symptomatic animals and humans.
Recently,
however, with the rise in personalized medicine and wide-scale
commercialization of pre-
and pro-biotics, the diagnostic and, in particular, the prognostic value of
this "waste" product
has escalated. Simply a change in dietary habit has been shown to affect the
microbiota or
microbial community composition in feces (Walker et al, 2011; Wu et al, 2011)
which, in turn,
can impact health and reduce the incidence of certain diseases.
Colonization of the gastro-intestinal (GI) tract begins at birth, and the
microbial community
that develops over time is shaped by many influences, including the
individual's genetic
make-up, age, sex, nutrition, antibiotic use and other pharmaceuticals
consumed, disease
state, lifestyle, geographical location/environment, chemical exposure,
surgical interventions
and more. A diverse microbial community colonizes the intestine consisting of
approximately
100 trillion bacteria which play a significant role in human health, in
particular, the digestion
of food, host energy metabolism, synthesis of essential vitamins, epithelium
maturation,
degradation of bile salts, metabolism of drugs and dietary carcinogens, as
well as protecting
the gut from pathogen colonization.
The 'gut microbiome' is the term given to describe this vast collection of
symbiotic
microorganisms in the human GI system and their collective interacting
genomes. However,
the understanding of these functional interactions between the gut microbiota
and host
physiology is in its infancy. The Human Microbiome Project revealed that the
gut microbiome
is approximately 150 times larger than the human genome, consisting of
somewhere
between 300 and 1000 bacterial species and more than 7000 strains. In most
mammals, the
gut microbiome is dominated by four bacterial phyla: Firmicutes,
Bacteroidetes,
Actinobacteria and Proteobacteria (Ley et al., 2007). A new area of work
relates to the
analysis of the interaction of the gut microbiome with gut parasites, viruses,
yeasts, and
1
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
numerous fungi, such as Candida, Saccharomyces, Aspergillus, and Penicillium.
Some
experts have suggested that the total information encoded by the human genome
alone is
not enough to carry out all of the body's biological functions (Lee and
Mazmanian, 2010) and
point to symbiosis between bacteria and humans as an explanation. With only
around 10
percent of a human's cells being actually human, with microbes making up the
remaining 90
percent, humans can be thought of as hosts for our microbe guests or super-
organisms.
For many decades, intestinal microbes have been implicated in the initiation
of colon cancer
(Aries et al., 1969; Moore and Moore, 1995). More recently, Helicobacter
pylori infection has
been identified as a major cause of gastric (stomach) cancer, gastric
lymphoma, and peptic
ulcer disease (Parsonnet et al., 1991). It turns out, however, that gut
microbes have more
influence on how we feel and behave than we know. Due to increasing evidence
that
communication exists between the gut and the brain, the gut has been dubbed
the 'second
brain.' Evidence suggests that numerous diseases, such as cardiovascular
disease,
diabetes, stress/anxiety, autism, Crohn's disease, Irritable Bowel Disease
(IBD), allergic
disorders, metabolic syndrome, and neurologic inflammation may result from
dysregulation
of the gut microbiome. However, researchers are just beginning to decipher
what is now
termed the `microbiome-gut-brain axis', i.e., how microorganisms colonizing
the GI tract can
influence biological functions beyond the gut, in particular, the molecular
mechanisms or
crosstalk by which the gut microbiome impacts immunological, endocrine and
neurological
diseases in its host (Grenham et al., 2011; Kinross et al., 2011). For
instance, many
microbes produce neurometabolites that are either neurotransmitters or
modulators of
neurotransmission, including GABA, noradrenaline, serotonin, dopamine, and
acetylcholine,
which act directly on nerve terminals in the gut or via enterochromaffin cells
present
throughout the GI tract. Carbohydrates from dietary fibre are also broken down
by microbes,
resulting in the production of neuroactive chemicals, such as, n-butyrate,
acetate, hydrogen
sulphide and propionate. In addition, microbes shed metabolites, such as
proteins,
carbohydrates, and other molecules, which can leave the gut and play a role in
signalling
disease throughout the body.
In both healthy and diseased individuals, as well as identifying the hundreds
of different
species making up the gut microbial community, it is critical to gain an
understanding of the
functionality of the consortia of bacteria as a whole. For instance, the
composition of the
microbiota determines competition for dietary ingredients as growth
substrates, conversion
of sugar into inhibitory fermentation products, production of growth
substrates, release of
bacteriocins (molecules toxic to other bacterial species), stimulation of the
innate immune
system, competition against microbes colonizing the gut wall and gut-barrier
function, and
more. Unfortunately, traditional microbiological culture techniques have
proven largely
2
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
unsuccessful in helping to determine the identity and function of members of
the gut
microbiome, due to significant limitations stemming from their reliance on
appropriate growth
nutrients and complex conditions for the entire intestinal microflora to
flourish in vitro.
Estimates indicate that only 20-40% (Apajalahti et al., 2003) of the total
intestinal microflora
can be cultivated by standard culture techniques, so the vast majority of
microbial
biodiversity has been missed by cultivation-based methods. This factor is
further
compounded by the need to ensure viability of the intestinal microflora in
vitro, many of
which are anaerobic (O'Sullivan, 2000).
Numerous culture media inherently select against some bacteria, in particular,
ones that
require extra or selective agents or bacteria in a physiological state which
is not conducive to
culturing directly from feces or intestinal material. Also, traditional
morphological examination
and biochemical tests for identifying and characterizing intestinal microflora
are extremely
labour-intensive, time-consuming, and lack precision, thus limiting their
effectiveness for
analyzing specimens from a large number of individuals and comparing the
relatedness
between bacterial species from different individuals. Therefore, quick methods
to capture
and stabilize or "snap-shot" the microbiome at the point of collection, in
conjunction with
culture-independent molecular tools, such as 16S ribosomal RNA gene-based
approaches,
TaqMan probes, digital and LATE PCR, and metagenomic sequencing, are needed to
overcome these limitations and biases, so a true and detailed picture of this
rich ecosystem
can be revealed.
Today, approximately 1 out of every 20 hospitalized patients will contract a
hospital-acquired
infection (HAI). While most types of HAls are declining, outbreaks caused by
Clostridium
difficile, a known pathobiont, are a growing problem afflicting patients in
hospitals and long-
term healthcare facilities. C. difficile infection (CD!) is believed to result
from gastrointestinal
dysbiosis, i.e., the disruption of the resident microbiota. Antibiotics
treatment kills most
bacteria in the GI tract that usually control C. difficile. In this altered
environment, C. difficile
replicate and produce toxins that attack the lining of the intestine, causing
symptoms ranging
from diarrhea to life-threatening inflammation and bleeding of the lining of
the colon.
According to the Centers for Disease Control and Prevention (CDC), C.
difficile alone is
linked to the deaths of 14,000 people a year in the United States. In
hospitals, C. difficile
spores shed in feces are transferred to patients and surfaces mainly via the
hands of
healthcare personnel who have touched a contaminated surface or item. An
effective
treatment against recurrent C. difficile infection is not widely available.
Paradoxically, the
primary treatment for C. difficile infection is the administration of more
antibiotics, with about
20% of patients having recurrences within a month, and many of those have
repeated
attacks.
3
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
An unorthodox, alternate procedure, fecal microbiota transplantation (FMT), in
which feces
from one "donor" is infused into a patient's intestines, is proving to be far
more effective than
antibiotics at treating recurrent GI infections. By restoring disturbances to
the microbial
equilibrium, an infusion of feces from healthy donors appears to keep harmful
bacteria, such
as C. difficile, at bay, eradicating illness even in patients who have
suffered repeated,
debilitating bouts. In a small Dutch study at the University of Amsterdam, 15
of 16 patients
with recurrent C. difficile infection were cured with duodenal infusion of
donor feces,
compared to only 27% of patients given a 2-week regimen of the antibiotic
vancomycin (van
Nood, Els et al. (2013)). It was shown that infusion of donor feces resulted
in improvement in
the microbial diversity in the patient's GI tract and this diversity persisted
over time.
Recently, Song et al. (2013) confirmed previous reports that a reduction in
microbiota
diversity and richness in fecal samples from recurrent C. difficile infection
(ROD!) patients
was restored after FMT to become similar to that of a healthy donor. In this
longitudinal
study, FMT predominantly affected Firmicutes and Proteobacteria, and the fecal
microbiota
continued to change in post-FMT patients for at least 16 weeks.
Importantly, the exact mechanism of action responsible for the success of FMT
to treat RCDI
remains unknown and there is no clinically validated set of parameters to
define a suitable
donor or ideal donor microbiota. An easy and effective means to collect feces
samples in the
field and snap-shot the sampled microbiome in a composition at ambient
temperature from
large numbers of individuals, both healthy donors and RCDI patients, at
multiple time points
is needed to map the 'core' microbiome found in the GI tract of healthy
individuals in a
population, upon which can be overlaid the changing microbiome of ROD!
patients.
Ultimately, RCDI patients in the future will be treated, not with antibiotics,
but with
customized probiotics (a preparation/supplement containing live bacteria that
is taken orally
to restore beneficial bacteria to the body) and prebiotics (non-digestible
food components,
such as oligosaccharides, that promote the activity of target selected groups
of the GI
microflora) or synbiotics (synergistic combinations of probiotics and
prebiotics) to return their
microbiome to a healthy state.
To avoid the risk of introducing unidentified, potentially harmful microbes,
some hospitals are
starting to build self-banking systems. A patient's feces can be banked to use
in the future as
an antidote against possible infection with hospital-acquired "super bugs."
Using the patient's
own feces for transplantation greatly reduces the risk of introducing harmful
microbes and
avoids time-consuming and costly screening of feces from unrelated donors for
transmissible
diseases. Unfortunately, it appears the "ecosystem" of certain people,
however, makes them
more susceptible to illness than others. Hence, a possible drawback associated
with
reintroducing a patient's own feces is that it may only provide short-term
benefits and not
4
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
cure them of detrimental microbes, such as C. difficile. In time, microbiome
research may
lead to the identification of 'core' or 'keystone' bacterial species that help
to define human
health and then develop personalized "bacteriotherapy," consisting of fully
characterized,
beneficial bacterial "cocktails," to supplant this crude method of
transplanting "raw" feces. In
fact, probiotics therapies have now been proposed for a large variety of gut-
related disorders
such as IBD and inflammatory bowel syndrome. Fundamentally, researchers and
clinicians
attempting to characterize all species of a donor's microbiota, identify
diagnostic markers to
predict susceptibility to disease, and ultimately provide 'personalized'
health care, need to be
confident that the fecal samples being tested provide a true representation or
"snap-shot" of
the donor's microbiome in vivo, not a 'degraded' or artificial representation
of the microbial
community. Hence, an effective means to immediately capture and stabilize or
snap-shot the
microbiome of feces at the point of collection is critical.
Colorectal cancer (CRC) has the highest cancer mortality rates in Europe and
the United
States. It is known that CRC is highly curable (>90%) if detected in its early
stages, making
early cancer screening a valuable asset. A number of sensitive examination
methods have
been devised over the years to detect cancer, such as double-contrast barium
enema,
colonoscopy, and flexible sigmoidoscopy. However, the financial costs,
infrastructure, and
manpower requirements associated with these procedures present formidable
obstacles, not
to mention being uncomfortable and invasive for the patient. In addition to
costs, the low-
throughput nature of these examination methods impedes their implementation
for
nationwide primary screening.
Presently, another method to screen for colorectal cancer is the fecal occult
blood test
(FOBT). This test detects the presence of haemoglobin in feces samples to
determine the
presence or absence of bleeding in GI tract, as an indirect predictor of CRC.
While this test
is not expensive, its sensitivity and positive predictive value is very low
and the incidence of
false-positives is high. Therefore, a sensitive, reliable, cost-effective,
scalable method is in
great need for both diagnosis of disease in at-risk and/or symptomatic
individuals, as well as
for routine diagnostic screening of the asymptomatic population. Ideally, an
individual would
routinely collect and stabilize a portion of their feces in the privacy of
their home and then
mail it to a testing facility to be screened for CRC and other diseases.
It is already accepted that direct detection and examination of tumour cells
sloughed into the
colonic lumen and recovered from feces is a more positive predictor of
colorectal cancer
than occult blood. However, the "target" or mutant human DNA, indicative of
cancer or other
diseases, is usually present in the biological sample at low frequency (e.g.
1% of total
human DNA for CRC), often against a high background of wild-type DNA (e.g.
bacterial DNA
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
and human DNA from normal colon cells), and exposed to endogenous human DNases
(e.g.
deoxyribonuclease I) and/or bacterial nucleases (e.g. Micrococcal nuclease).
In this complex
specimen, what little "target" human DNA that exists in a fecal sample may be
rapidly
degraded by nucleases and environmental conditions before it even reaches the
laboratory,
negatively impacting clinical sensitivity of diagnostic tests. In addition to
the abundance of
nucleases, anaerobic bacteria, constituting over 99% of bacteria in the gut,
become exposed
to air as soon as feces are eliminated from the digestive tract. Air,
specifically oxygen, is a
toxic environment to anaerobic bacteria killing 50% within 4-5 minutes and 95-
97% of
anaerobes after only 20 minutes (Brusa et al., 1989). Again, acquiring a
representative view
or "snap-shot" of the entire microbiome and human DNA in feces is a challenge
considering
most fecal samples are collected at home, not in a laboratory or healthcare
facility.
It is imperative to stabilize total nucleic acid in biological samples such
that it does not
degrade during sample handling, transport and storage. To minimize degradation
of nucleic
acid in biological samples, it is standard practice to transport whole samples
or portions
thereof on dry ice (-78 C) to centralized testing facilities where it is
either thawed and
processed immediately or kept frozen in storage (-80 C to -20 C). The costs,
logistics and
infrastructure needed to ensure collected samples are frozen immediately, kept
frozen
during transport to testing facilities, and stored under optimal conditions
prior to analysis,
poses significant challenges and risks, especially in large-scale and
population-based
screening applications. It can be even more challenging to provide
'representative' samples
for decentralized sample analysis and still retain maximum sample integrity.
It is highly
desirable to develop a more robust and standardized sample-handling method and
composition that captures and maintains a true representation of each sample's
nucleic acid
profile.
The study of the relationship between the microbiome and its human host in
health and
disease relies on the identification and monitoring the microbial communities
over a period of
time. Recent discoveries demonstrate the utility of these microbial profiles
as biomarkers
with prognostic and diagnostic value. It is becoming evident in the literature
that due to the
dynamic nature of the gut microbiome, repeated sampling of large populations
over time is
essential to the development of such biomarkers. These studies, known as
Microbiome-
Wide Association Studies (MWAS) are challenged by low donor compliance,
unreliable self-
collection of biological samples, high cost and cumbersome shipping and
handling
procedures.
Current methods for feces sampling and microbiota analysis involve the
transport of
specimens under conditions that have the potential to expose samples to
temperatures
6
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
incompatible with microbiome stabilization. Failure to properly stabilize the
microbiome
during sample collection, transport, processing and analysis risks obscuring
the biological
and clinical meaning of the microbiome profile. Consequently, proper pre-
analytical
procedures are necessary to ensure the best possible representation of the in
vivo
microbiome profile.
There is a need for compositions and methods for stabilizing nucleic acids, in
particular both
human and microbial DNA, in complex biological samples such as feces, during
transport
and storage at ambient temperatures.
This background information is provided for the purpose of making known
information
believed by the applicant to be of possible relevance to the present
invention. No admission
is necessarily intended, nor should be construed, that any of the preceding
information
constitutes prior art against the present invention.
SUMMARY OF THE INVENTION
An object of the present invention is to provide a composition, method, and
kit for stabilizing
nucleic acid contained in a biological sample at ambient temperature.
In one aspect, there is provided a method of stabilizing nucleic acid
contained in a biological
sample at ambient temperature comprising the steps of: a) obtaining a
biological sample; b)
contacting the biological sample with an aqueous composition comprising a
chelating agent,
wherein the chelating agent is present at a concentration of at least about
150 mM, and
wherein the composition has a pH of at least about 9.5, to form a mixture; c)
homogenizing
the mixture of (b) to form a homogeneous mixture; and d) storing the
homogeneous mixture
at ambient temperature.
In another aspect, there is provided an aqueous composition for stabilizing
nucleic acid
contained in a biological sample at ambient temperature, comprising a
chelating agent
wherein the chelating agent is present at a concentration of at least about
150 mM, wherein
the composition has a pH of at least about 9.5.
In still another aspect, there is provided a kit for stabilizing nucleic acid
contained in a
biological sample at ambient temperature, the kit comprising: a) a sample
container having
a resealable closure; b) an aqueous composition comprising a chelating agent
wherein the
chelating agent is present at a concentration of at least about 150 mM,
wherein the
composition has a pH of at least about 9.5, wherein said composition is
optionally contained
within the sample container; c) a homogenization means, optionally contained
within the
7
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
sample container; d) a means to transfer the biological sample, or a portion
thereof, into the
sample container; and d) instructions for use.
In one embodiment, the nucleic acid is deoxyribonucleic acid (DNA).
In another embodiment, the biological sample is selected from a fecal sample,
a soil sample,
a sewage sample, a wastewater sample, or a water sample. In another
embodiment, the
biological sample is a fecal sample. In another embodiment, the fecal sample
is obtained
from a mammal. In yet another embodiment, the mammal is a human.
In another embodiment, the chelating agent is selected from 1,2-
cyclohexanediamine
tetraacetic acid (CDTA), diethylenetriamine pentaacetic acid (DTPA),
tetraazacyclododecanetetraacetic acid (DOTA),
tetraazacyclotetradecanetetraacetic acid
(TETA), desferioximine, or chelator analogs thereof. In another embodiment,
the chelating
agent is CDTA.
In another embodiment, the concentration of the chelating agent is from about
150 mM to
about 500 mM, or from about 250 mM to about 350 mM. In still another
embodiment, the
concentration of the chelating agent is about 300 mM.
In yet another embodiment, the composition has a pH of from about 9.5 to about
11.5, or
from about 10.5 to about 11.5. In another embodiment, the composition has a pH
of about
11.
In still yet another embodiment, the composition further comprises at least
one buffering
agent capable of buffering in the pH range 9.5 to 11.5. In another embodiment,
the buffering
agent is beta-alanine.
In still another embodiment, the composition further comprises a water-soluble
organic
solvent, such as a Ci-C6 alkanol. In another embodiment, the water-soluble
organic solvent
is ethanol. In yet another embodiment, the ethanol is present in the
composition at a
concentration of less than about 30% by volume. In still yet another
embodiment, the
ethanol is present in the composition at a concentration of less than about
24% by volume.
In another embodiment, the composition further comprises a detergent, such as
sodium
dodecylsulfate. In yet another embodiment, the composition further comprises
an
antifoaming agent, such as Antifoam A. In still yet another embodiment, the
composition
further comprises an antimicrobial agent, such as Triclosan or Proclin.
In yet another embodiment, the nucleic acid is microbial DNA.
8
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
In still another embodiment, the nucleic acid is microbial DNA and the method
stabilizes a
microbiome profile of the biological sample. In yet another embodiment, the
method renders
the microbiome profile of the biological sample stable for at least 7 days, at
least 14 days, at
least 30 days, or at least 60 days at room temperature; at least 7 days, or at
least 14 days at
a temperature of from about 37 C to about 50 C; and/or at least 30 days at -20
C.
In still another embodiment, the nucleic acid is microbial DNA and the
composition/kit is for
stabilizing a microbiome profile of the biological sample.
In still another embodiment, the nucleic acid is human DNA. In yet another
embodiment, the
method renders the human DNA stable for: at least 7 days, at least 14 days, at
least 30
days, or at least 60 days at room temperature; at least 7 days, or at least 14
days at a
temperature of from about 37 C to about 50 C; and/or at least 30 days at -20
C.
In still yet another embodiment, the method comprises homogenizing the mixture
of the
biological sample and the aqueous composition using a homogenization means.
In another embodiment, the homogenization means of the above-described method
and kit
is at least one mixing ball. In yet another embodiment, the at least one
mixing ball is a
stainless steel mixing ball or a tungsten carbide mixing ball. In still
another embodiment, the
at least one mixing ball is a stainless steel mixing ball having a diameter of
about 5.6-11.1
mm and a density of at least about 7.6 g/cm3. In still yet another embodiment,
the stainless
steel mixing ball has a diameter of about 7.1 ¨ 8.7 mm and the sample
container is a round-
bottom tube having an internal diameter of about 12.9 mm.
In another embodiment, the method comprises forming the mixture of the
biological sample
and the aqueous composition in a sample container containing the at least one
mixing ball,
sealing the sample container, and homogenizing the mixture by shaking the
mixture in the
presence of the at least one mixing ball. In yet another embodiment, the
shaking is done by
hand.
In other embodiments, stabilizing the nucleic acid comprises preserving the
relative
abundance of the nucleic acid contained in the biological sample during
storage at ambient
temperature.
In still another embodiment, there is provided a method of stabilizing DNA
contained in a
fecal sample at ambient temperature comprising the steps of: a) obtaining a
fecal sample
from a mammal; b) contacting the fecal sample with an aqueous composition
having a pH of
from about 10.5 to about 11.5 and wherein the composition comprises, consists
essentially
9
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
of, or consists of: CDTA in an amount of from about 250 mM to about 350 mM; p-
alanine in
an amount of from about 30 mM to about 70 mM; ethanol in an amount of from
about 21.5%
to about 23.5% by volume; sodium dodecyl sulfate in an amount of from about 0
to about 1%
(w/v); and Antifoam A in an amount of from about 0 to about 0.2% (v/v); c)
homogenizing
the mixture of (b) to form a homogeneous mixture; and d) storing the
homogeneous mixture
at ambient temperature. In yet another embodiment, the aqueous composition has
a pH of
about 11, and comprises, consists essentially of, or consists of: CDTA in
an amount of
about 300 mM; p-alanine in an amount of about 50 mM; ethanol in an amount of
about
23.5% by volume; sodium dodecyl sulfate in an amount of about 0.5% (w/v); and
Antifoam
in an amount of about 0.1% (v/v). In yet another embodiment, the method
comprises
forming the mixture of the fecal sample and the aqueous composition in a round-
bottom tube
having an internal diameter of about 12.9 mm and containing at least one
stainless steel
mixing ball having a diameter of about 5.6-11.1 mm and a density of at least
about 7.6
g/cm3, sealing the round-bottom tube, and homogenizing the mixture by shaking
the mixture
by hand in the presence of the at least one stainless steel mixing ball. In
another
embodiment, the DNA is microbial DNA, and the method stabilizes a microbiome
profile of
the fecal sample.
In still another embodiment, there is provided an aqueous composition for
stabilizing DNA
contained in a fecal sample at ambient temperature, wherein the fecal sample
is obtained
from a mammal, wherein the composition has a pH of from about 10.5 to about
11.5, and
comprises, consists essentially of, or consists of: CDTA in an amount of from
about 250 mM
to about 350 mM; p-alanine in an amount of from about 30 mM to about 70 mM;
ethanol in
an amount of from about 21.5% to about 23.5% by volume; sodium dodecyl sulfate
in an
amount of from about 0 to about 1% (w/v); and Antifoam A in an amount of from
about 0 to
about 0.2% (v/v). In yet another embodiment, the aqueous composition has a pH
of about
11, and comprises, consists essentially of, or consists of: CDTA in an amount
of about 300
mM; p-alanine in an amount of about 50 mM; ethanol in an amount of about 23.5%
by
volume; sodium dodecyl sulfate in an amount of about 0.5% (w/v); and Antifoam
A in an
amount of about 0.1% (v/v). In another embodiment, the DNA is microbial DNA,
and the
composition is for stabilizing a microbiome profile of the fecal sample.
In still yet another embodiment, there is provided a kit for stabilizing
nucleic acid contained in
a biological sample at ambient temperature, the kit comprising: a) a sample
container having
a resealable closure; b) an aqueous composition having a pH of from about 10.5
to about
11.5, and comprising, consisting essentially of, or consisting of: CDTA in an
amount of from
about 250 mM to about 350 mM; f3-alanine in an amount of from about 30 mM to
about 70
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
mM; ethanol in an amount of from about 21.5% to about 23.5% by volume; sodium
dodecyl
sulfate in an amount of from about 0 to about 1% (w/v); and Antifoam A in an
amount of from
about 0 to about 0.2% (v/v), wherein said composition is optionally contained
within the
sample container; c) a homogenization means, optionally contained within the
sample
container; d) a means to transfer the biological sample, or a portion thereof,
into the sample
container; and d) instructions for use. In another embodiment, the aqueous
composition has
a pH of about 11, and comprises, consists essentially of, or consists of: CDTA
in an amount
of about 300 mM; 13-alanine in an amount of about 50 mM; ethanol in an amount
of about
23.5% by volume; sodium dodecyl sulfate in an amount of about 0.5% (w/v); and
Antifoam A
in an amount of about 0.1% (v/v). In still another embodiment, the nucleic
acid is microbial
DNA and the kit is for stabilizing a microbiome profile of the biological
sample. In still yet
another embodiment, the homogenization means is at least one stainless steel
mixing ball
having a diameter of about 5.6-11.1 mm and a density of at least about 7.6
g/cm3, and the
sample container is a round-bottom tube having an internal diameter of about
12.9 mm.
BRIEF DESCRIPTION OF THE FIGURES
For a better understanding of the present invention, as well as other aspects
and further
features thereof, reference is made to the following description which is to
be used in
conjunction with the accompanying drawings, where:
Figure 1 graphically depicts differences in the microbiome profile of fecal
samples from 2
donors (PCR-DGGE analysis);
Figure 2 shows an agarose gel demonstrating the quality of high molecular
weight DNA in
fecal samples at T=0 and following 14 days at room temperature in 1)
compositions
containing different concentrations of CDTA (150-500 mM), 2) compositions
containing
different concentrations of EDTA (150-500 mM), and 3) feces stored without
stabilizing
solution (unstabilized);
Figure 3 graphically depicts the dependence of microbiome profile stability on
sample
homogenization and pH of the present composition;
Figure 4 shows DGGE analysis of fecal samples stored in various compositions
for 14 days
at room temperature;
Figure 5 shows DGGE analysis of fecal samples stored in different compositions
for 4 days
at room temperature;
11
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
Figure 6 shows an agarose gel demonstrating the quality of high molecular
weight DNA in
fecal samples stored in compositions at different pH values for 9 days at room
temperature;
Figure 7 shows an agarose gel demonstrating results from mixing fecal samples
with (A)
multiple glass beads and (B) stainless steel ball in the present composition;
Figure 8 depicts agarose gels showing DNA quality upon storage in the present
composition
at room temperature at (A) day 0, (B) day 6, (C) day 7, (D) day 14, (E) one
month, and (F) 2
months;
Figure 9 shows DGGE gels of triplicate fecal sample aliquots from the same
donor's
specimen stored in the present composition;
Figure 10 shows a representative DGGE gel and % similarity (bottom of gel) of
microbiome
profile of fecal samples stored in the present composition for (A) 14 days at
room
temperature, and (B) 7 days and 2 months at room temperature;
Figures 11A and 11B show agarose gels of fecal samples from 2 donors stored at
37 C in
the present compositions;
Figures 12A and 12B show DGGE analysis of fecal samples from 2 donors stored
at 37 C in
the present compositions;
Figures 13A-E show agarose gels of fecal samples from 3 donors stored in the
present
composition at -20 C, room temperature, and 50 C;
Figures 14A-D show agarose gel electrophoresis of fecal samples from 3 donors
stored in
the present compositions at 50 C and -20 C;
Figures 15A-B show DGGE analysis of fecal samples from 2 donors stored in the
present
compositions at 50 C for 14 days;
Figures 16A-B show DGGE analysis of fecal samples from 2 donors stored in the
present
composition at -20 C for 11 days;
Figure 17 shows agarose gel of fecal samples in the present composition and
exposed to 5
freeze/thaw cycles;
Figure 18 shows DGGE analysis of fecal samples in the present composition and
exposed to
freeze/thaw cycles;
12
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
Figure 19 shows principal coordinate analysis (PCoA) that demonstrates that
samples stored
in stabilization solution over various temperatures and time (3 and 14 days)
exhibit a high
level of similarity in OTU abundance; and
Figure 20 shows family level proportional abundance of samples stored with and
without
stabilization solution over various temperatures and time (3 and 14 days).
Figure 21 shows Bray-Curtis dissimilarity distances within and between fresh
and 104B pH
11 stabilized samples. Mann-Whitney test showed comparable dissimilarity in
all conditions,
no statistical difference was observed.
Figure 22 illustrates that 104B pH 11 stabilized samples preserves richness.
Richness was
assessed by assigning presence/absence to individual OTUs and compared using
Shannon-
Index. Mann-Whitney test showed no significant differences between fresh and
104B pH 11
samples.
Figure 23 illustrates that 104B pH 11 samples render highly reproducible
microbiome
profiles. Mann-Whitney tests on Bray-Curtis distances showed comparable
dissimilarity in
triplicate samples.
Figure 24 shows Bray-Curtis distance dissimilarity between unstabilized and
104B pH 11(14
days at 23 C) and frozen (14 days at -80 C) fecal samples when compared with
fresh
samples. Significant dissimilarity was assessed using Mann-Whitney (*P.A.05).
Figure 25 shows a dendrogram of microbiome weighted Unifrac % similarity of a
representative donor. Extractions from three biological replicates were
performed for each
condition. Low % similarity to fresh sample indicates changes in the
microbiome profile over
time.
Figure 26 illustrates DNA integrity of 104B pH 11 samples subjected to
simulated transport
conditions. Representative donors' samples were stored at 23 C for 14 days, 50
C for 1 day,
37 C for 3 days or exposed to multiple freeze-thaw cycles. Fresh samples were
also stored
at -80 C for 14 days as a control.
Figure 27 illustrates Bray-Curtis distance dissimilarity of 104B pH 11 samples
exposed to
simulated shipping conditions. Mann-Whitney test showed no differences between
104B pH
11 samples stored at various temperatures and those stored at -80 C.
Significant
dissimilarity was observed in unstabilized samples held at 37 C or subjected
to freeze-thaw
(Err) conditions when compared to paired -80 C samples (P).05 and Ps0.01,
respectively).
13
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
Figure 28 shows DGGE analysis of the bacterial community profile of a fecal
sample from 2
donors treated with the present composition containing varied concentrations
of CDTA, and
with a composition containing no CDTA, for 5 days at 40 C.
Figure 29 shows DGGE analysis of the bacterial community profiles of fecal
samples from 2
donors treated with the present composition "104B pH 11" or TEN buffer for 21
days at
ambient temperature.
DETAILED DESCRIPTION
It should be noted that the role of the compositions for stabilizing nucleic
acid described
herein is to stabilize nucleic acid and 'snap-shot' total DNA profiles in
biological samples,
such as fecal samples, at ambient temperature for prolonged periods of time.
Extraction and
isolation of nucleic acid, such as DNA, is carried out in subsequent steps
using commercially
available extraction kits following stabilization of the nucleic acids
contained in fecal samples
using the compositions described herein. Preferably, the compositions for
stabilizing nucleic
acid described herein do not contain chaotropic salts (e.g. guanidinium salts
such as
guanidinium thiocyanate (GuSCN) or guanidinium hydrochloride (GuHCI)), urea,
fixatives
(e.g. formalin, paraformaldehyde, etc.), reducing agents, polycations (such as
polylysine or
polyacrylamide), phenol or chloroform. Enzymes such as proteases (e.g.
proteinase K),
lysozyme, etc. are not needed to effect stabilization of the nucleic acids
contained in fecal
samples using the compositions described herein and are therefore preferably
not included
in the compositions described herein. Thus, the present compositions and
methods of
stabilizing nucleic acid avoid the use of costly and/or toxic compounds which
often require
special storage and transport conditions.
Unless defined otherwise, all technical and scientific terms used herein have
the same
meaning as commonly understood by one of ordinary skill in the art to which
this invention
belongs.
As used in the specification and claims, the singular forms "a", "an" and
"the" include plural
references unless the context clearly dictates otherwise.
The term "comprising" as used herein will be understood to mean that the list
following is
non-exhaustive and may or may not include any other additional suitable items,
for example
one or more further feature(s), component(s) and/or ingredient(s) as
appropriate.
The term "sample" as used herein will be understood to mean any specimen that
potentially
contains a substance of interest, in particular a nucleic acid, and optionally
a protein or other
14
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
biomolecules of interest. The term "sample" can encompass a solution, such as
an aqueous
solution, cell, tissue, biopsy, powder, or population of one or more of the
same. The sample
can be a biological sample, such as saliva, sputum, buccal swab sample, serum,
plasma,
blood, buffy coat, pharyngeal, nasal/nasal pharyngeal or sinus swabs or
secretions, throat
swabs or scrapings, urine, mucous, feces/stool/excrement, rectal swabs, lesion
swabs,
chyme, vomit, gastric juices, pancreatic juices, gastrointestinal (GI) tract
fluids or solids,
semen/sperm, urethral swabs and secretions, cerebral spinal fluid, products of
lactation or
menstruation, egg yolk, amniotic fluid, aqueous humour, vitreous humour,
cervical secretions
or swabs, vaginal fluid/secretions/swabs or scrapings, bone marrow samples and
aspirates,
pleural fluid and effusions, sweat, pus, tears, lymph, bronchial or lung
lavage or aspirates,
peritoneal effusions, cell cultures and cell suspensions, connective tissue,
epithelium,
epithelial swabs and smears, mucosal membrane, muscle tissue, placental
tissue, biopsies,
exudates, organ tissue, nerve tissue, hair, skin, or nails, wherein samples of
the foregoing
may be obtained from for example, a vertebrate, including a mammal. A mammal
can be,
for example, a human, a non-human primate, cattle (such as cow, goat, or
sheep), as well as
a dog, cat, horse, etc.
In one embodiment, the biological sample is a fecal sample and the subject is
a mammal. In
another embodiment, the biological sample is a fecal sample and the subject is
a human.
Other types of biological samples include plants, plant extracts, algae, soil
samples, sewage,
wastewater, water, environmental samples, foodstuff, cattle feed, fish feed,
animal feed,
swabs of contaminated or potentially infectious surfaces or equipment (e.g.
meat processing
surfaces), swabs from 'touch' surfaces in hospitals, nursing homes, outpatient
facilities,
medical institutions, or the like. In still other embodiments, the biological
sample is selected
from a soil sample, a sewage sample, a wastewater sample, or a water sample,
any of which
may be contaminated with feces.
The term "microorganism" or "microbe" as used herein, will be understood to
mean any
microscopic organisms and spores, including all of the prokaryotes, namely the
eubacteria
and archaeabacteria, and various forms of eukaryote, comprising the protozoa,
fungi (e.g.,
yeast),
algae, and animals such as rotifers and planarians. For example, the groups of
bacteria
most frequently detected in human feces using 16S rRNA gene sequencing include
Firmicutes, Bacteroidetes, Spirochaetes, Fusobacteria, Deltaproteobacteria,
Epsilon proteobacteria, Alpha proteobacteria, Betaproteobacteria,
Gammaproteobacteria,
Euryarchaeota, Eukarya, Desulfothiovibrio, Tm7, Cyanobacteria, Actinobacteria,
Verrucomicrobia and Lentisphaerae.
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
The term "virus" or "virions" as used herein will be understood to mean any
small infectious
agent that replicates only inside the living cells of other organisms. Viruses
can infect all
types of life forms, from animals and plants to bacteria and archaea, and live
in almost every
ecosystem. Currently, there are 21 families of viruses known to cause disease
in humans:
Adenoviridae, Herpesviridae, Papillomaviridae, Polyomaviridae, Poxviridae,
Hepadnaviridae,
Parvoviridae, Astroviridae, Caliciviridae, Picomaviridae, Coronaviridae,
Flaviviridae,
Togaviridae, Hepeviridae, Retroviridae, Orthomyxoviridae, Arenaviridae,
Bunyaviridae,
Filoviridae, Paramyxoviridae, Rhabdoviridae, Reoviridae (and Hepatitis D,
currently
unassigned). The genetic material in a virus can be either deoxyribonucleic
acid (DNA) or
ribonucleic acid (RNA).
The nucleic acid to be stabilized by the compositions described herein can be
DNA or RNA,
including mRNA or viral RNA. In one embodiment, the nucleic acid is DNA. In
another
embodiment, the DNA is of human, viral, and microbial origin. In yet another
embodiment,
the nucleic acid to be stabilized by the compositions described herein
comprises human
DNA and microbial DNA.
The term "ambient temperature" as used herein refers to a range of
temperatures that could
be encountered by the mixture of a biological sample (e.g. fecal sample) and
the nucleic acid
stabilizing compositions described herein from the point of collection, during
transport (which
can involve relatively extreme temperatures, albeit usually for shorter
periods of time (e.g. <
days)), as well as during prolonged storage prior to analysis. In one
embodiment, the
temperature is ambient temperature ranging from about -20 C to about 60 C. In
another
embodiment, the ambient temperature is room temperature and ranges from about
15 C to
about 30 C.
The step of contacting the fecal sample with the aqueous compositions
described herein to
form a mixture should be carried out as soon as possible following voiding of
the feces, and
the homogenizing of the mixture to form a homogeneous mixture should be
carried out as
soon as possible, preferably immediately, in order to stabilize the nucleic
acids contained
within the fecal sample.
In general, chemical stabilization of DNA and RNA in a biological sample, such
as saliva,
blood, sputum, feces/stool, and urine, is achieved through the use of buffers
to maintain an
appropriate pH, as well as the use of chelating agents to prevent the
phenomenon of metal
redox cycling or the binding of metal ions to the phosphate backbone of
nucleic acids. The
term "chelator" or "chelating agent" as used herein will be understood to mean
a chemical
16
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
that will form a soluble, stable complex with certain metal ions (e.g., Ca2+
and Mg2+),
sequestering the ions so that they cannot normally react with other
components, such as
deoxyribonucleases (DNase) or endonucleases (e.g. type I, II and III
restriction
endonucleases) and exonucleases (e.g. 3' to 5' exonuclease), enzymes which are
abundant
in the GI tract. The main source of DNase in the GI tract is secretions of the
pancreas, as
well as the resident microorganisms. In the present composition, chelating
agent(s)
participates in the inhibition of DNase and microbial growth in biological
samples. A chelator
can be, for example, ethylene glycol tetraacetic acid (EGTA), (2-
hydroxyethyDethylenediaminetriacetic acid (HEDTA), diethylene triamine
pentaacetic acid
(DTPA), nitrilotriacetic acid (NTA), ethylenediaminetriacetic acid (EDTA), 1,2-
cyclohexanediaminetetraacetic acid (CDTA), N,N-bis(carboxymethyl)glycine,
triethylenetetraamine (TETA), tetraazacyclododecanetetraacetic acid (DOTA),
desferioximine, citrate anhydrous, sodium citrate, calcium citrate, ammonium
citrate,
ammonium bicitrate, citric acid, diammonium citrate, ferric ammonium citrate,
and lithium
citrate. These chelating agents may be used singly or in combination of two or
more thereof.
In a preferred embodiment, desirable are chelators stronger than EDTA (i.e.,
chelators with a
higher dissociation constant than EDTA when bound to a metal), used alone or
in
combination, that include, but are not limited to, CDTA, DTPA, DOTA, TETA, and
desferioximine, or chelator analogs thereof, in an amount from about 150 mM to
about 600
mM, preferably in an amount from about 150 mM to about 500 mM, still more
preferably in
an amount from about 250 mM to about 350 mM, and most preferably in an amount
of about
300 mM. Most desirably, the chelating agent in the present composition is
CDTA.
EDTA is a chemical that is widely used in industry, laboratories, cosmetics,
medicine and in
some food products. Its utility is based on its ability to thelate' metal
ions, particularly
bivalent and higher valences. CDTA is less commonly used in these fields, but
it shares with
EDTA an ability to chelate metal ions. Importantly, the affinity of both
chelators for different
metal ions varies considerably. Ki, a measure of affinity expressed on a log
scale is shown
in Table 1 (below). The first 5 chelators listed have different numbers and
configurations of
carboxylate (R-000-) groups attached to nitrogen groups. In Table 1, OPT is
presented for
comparison as a chelator based only on nitrogen groups.
A comparison of CDTA and EDTA in Table 1 shows they are very different. The
differences
in log Ki values are 2.3 (Mg2+); 2.6 (Ca2+); 2.4 (Mn2+); approximately 3
(Fe3+); 3.6 (Co2+); 0.8
(Cu2+); 2.9 (Zn2+). That is, CDTA binds most metals 200 to 4,000 times more
tightly than
EDTA.
17
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
Table 1. Affinity of chelators for different metal ions
Ki at pH 7.0 (logio of stability constants)1
Short Chemical name Mg Ca Mn Fe Co Ni Cu Zn
name
CDTA Diaminocyclohexane- 11.0 13.2 17.4 28.1 19.6 19.4 22.0 19.3
tetraacetatic acid [Fe(III)]
DTPA Diethylaminetriamine- 9.3 10.6 15.1 28.6 19.0 20.2 21.1 18.7
pentaacetic acid [Fe(III)]
EDTA Ethylenediamine- 8.7 10.6 14.0 23.8- 16.0 18.6 18.8 16.4
tetraacetic acid 25.2
[Fe(III)]
(ref. 2)
EGTA (Ethylenedioxy)diethlylene 5.2 11.0 12.1 11.8 12.3 11.8 17.7 12.9
dinitrilo-tetraacetic acid
NTA Nitrilo-triacetic acid 5.5 6.5 7.4 15.9 10.8 11.5 13.3
10.4
[Fe(III)]
OPT 1,10-phenanthroline 1.5 0.5 3.9 5.8 7.3 8.6 6.3 6.4
Taken from:
1. Data for Biochemical Research, RMC Dawson, DC Elliot, WH Elliot and KM
Jones,
3rd edition, 1986, Claredon Press, Oxford (see pg 400-405).
2. Stability Constants for Metal-ion Complexes, LG &lien and AE Martell,
Supplement
No.1, Special Publication No. 25, The Chemical Society, Burlington House,
London
(1971).
One consequence of this stronger ability of CDTA to complex metals is that the
concentration of any free metal ion will be lower in the presence of equal
concentrations of
CDTA or EDTA. More importantly, however, the amount of metal ion that may be
complexed
to biomolecules, such as nucleic acids or proteins, will be appreciably lower.
Nucleic acids in
solution are known to bind metal ions and removing such metals is likely to
improve their
chemical stability. This may be particularly important for transition metals
such as Mn, Fe,
Co and Cu, which can exist in different oxidation states by gaining or losing
electrons from
species, such as bimolecular oxygen, superoxide anion and hydrogen peroxide.
Finally, the
stronger ability of CDTA to complex metals is highly beneficial in
compositions developed to
18
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
suppress the degradation of nucleic acid in biological samples, such as feces,
known to
naturally contain large amounts of DNase which require Ca2+ and Mg2+ to
stabilize their
active conformation.
Table 2: pK values for CDTA and EDTA
pKa values
k2 k3 k4
CDTA 2.4 3.8 6.1 12.4
EDTA 2.0 2.7 6.2 10.3
Other differences between CDTA and EDTA exist that have practical consequences
in a
laboratory or research setting. Possibly because of the lower ki and k2 pKa
values of EDTA
(see Table 2 above), it is appreciably more difficult to prepare the disodium
form at pH 7.0
(starting with the acid form). More concentrated solutions of CDTA than EDTA
can be
prepared. Finally, the disodium form of CDTA is highly soluble in ethanol,
compared to the
limited solubility of the disodium form of EDTA. These differences make CDTA
the best
choice of chelator from a manufacturing perspective.
In general, the pH of the present composition can be maintained in the desired
alkaline
range using one or more appropriate buffers; wherein the composition is
buffered to maintain
the pH of the biological sample at a suitable pH, and said composition
stabilizes said nucleic
acid at ambient temperature. In accordance with one embodiment, the
composition
comprises one, two, or more buffering agents (non-limiting examples provided,
see Table 3)
with pKa values, logarithmic acid dissociation constants, at 25 C ranging from
8.0 to 12.5 to
maintain the pH within the preferred range of about 9.5 to about 11.5. An acid
dissociation
constant, Ka, is a quantitative measure of the strength of an acid in
solution. The larger the
Ka value, the more dissociation of the molecules in solution and thus the
stronger the acid.
Due to the many orders of magnitude spanned by Ka values, a logarithmic
measure of the
acid dissociation constant, pKa, is more commonly used in practice. The larger
the value of
pKa, the smaller the extent of dissociation at any given pH, i.e., the weaker
the acid.
In living organisms, acid-base homeostasis and enzyme kinetics are dependent
on the pKa
values of many acids and bases present in the cell and in the body. In
chemistry, knowledge
of pKa values is necessary for the preparation of buffer solutions and is also
a prerequisite
for a quantitative understanding of the interaction between acids or bases and
metal ions to
form complexes. One skilled in the art will understand that a given
compound/buffer can
buffer the pH of a solution only when its concentration is sufficient and when
the pH of the
solution is close (within about one pH unit) to its pKa. In one embodiment,
the pH of the
19
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
present composition is in the range of about 9.5 to about 11.5. In a preferred
embodiment,
the pH of the composition is in the range of about 10.5 to about 11.5, and
preferably the pH
is about 11. The amount of buffering agent(s) can be between about 1 mM and
about 1 M,
for example.
In accordance with certain embodiments, the composition comprises beta-alanine
as the
principal buffering agent to maintain the pH within the desired range of about
9.5 to about
11.5. To maintain the pH at about 11 a buffer can be selected from Table 3
with a pKa in the
range of 10-12. It is worth noting that carboxylate chelating agents, such as
CDTA and
EDTA, can also contribute to buffering capacity in this range. However, the
pK, (Ica) values of
CDTA and EDTA (Table 2) differ significantly. The lower pKa (k4) value of EDTA
(Table 2)
makes it potentially useful to help maintain the present composition at the
lower end of the
desired pH range. However, the higher pKa (1(4) value of CDTA makes it better
suited to
strengthen the buffering capacity of beta-alanine (or other buffers listed in
Table 3) at the
upper end of the desired range (i.e. pH 11).
Table 3. Suitable buffers of the present composition
pKa (25 C) Suitable buffers
8.00 EPPS, HEPPS
8.05 Tricine
8.06 Trizma, Tris
8.20 Gly-Gly (Glycylglycine)
8.26 Bicine
8.30 HEPBS
8.40 TAPS
8.80 RMPD
8.90 TABS
9.00 AMPSO
9.06 Taurine (RES)
9.23 (pKi) Boric acid
9.49 CHES (2-(Cyclohexylamino)ethanesulfonic acid)
9.50 Ethanolamine
9.54 Ephedrine
9.60 CAPSO
9.66 Hydroxyproline
9.70 AMP (2-Amino-2-methyl-1-propanol)
9.74 Leucine
9.78 Glycine
9.80 Histamine
9.80 Trimethylamine
9.80 TETA
9.80 Nitrilotriacetic acid
9.87 Alpha-Alanine
9.93 Ethylenediamine
10.00 Aspartic acid
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
pK, (25 C) Suitable buffers
10.22 Beta-alanine
10.24 Alanine
10.30 EDTA
10.33 (pK2) Carbonic acid, Carbonate
10.40 DTPA
10.40 Tyrosine
10.40 CAPS (3-(Cyclohexylamino)-1-propanesulfonic acid)
10.55 Cysteine
10.56 gamma-Aminobutyric acid or 4-aminobutanoic acid
10.57 n-Propylamine
10.62 Methylamine
10.63 Ethylamine
10.64 n-Butylamine
10.68 Proline
10.70 Ornithine
10.70 CABS (4-(Cyclohexylamino)-1-butanesulfonic acid)
10.72 Triethylamine
10.72 Lysine
10.77 Dimethylamine
10.93 Hexamethylenediamine
10.93 Diethylamine
11.12 Piperidine
8-alanine is a particularly suitable buffer for the compositions of the
present application. In
one embodiment, the pH of the composition is from about 10.5 to about 11.5,
and the 8-
alanine is present in an amount of from about 10 mM to about 100 mM, or from
about 30 mM
to about 70 mM, and most preferably in an amount of about 50 mM.
The term "water-soluble" or "water-miscible organic solvent" as used herein
will be
understood to mean any carbon-containing substance or compound, commonly a
liquid, that
dissolves a solute, a chemically different liquid, solid or gas. A water-
soluble organic solvent
can be, for example, one or more short-chain (e.g. Ci-C6) alkanols that can be
straight-chain
or branched, such as methanol, ethanol, propanol, isopropanol, butanol, n-
butanol, pentanol,
hexanol, or any combination thereof. In one embodiment of the present
composition, the
preferred alcohol is ethanol. In another embodiment, the water-soluble organic
solvent (e.g.
ethanol) is present in the composition at a concentration of less than about
30% by volume,
preferably less than about 24% by volume, such as from about 21.5% to about
23.5% by
volume, most preferably about 23.5% by volume. In other embodiments, the water-
miscible
organic solvent can be absent.
Generally, in the art, it is known that more than 30% ethanol is required to
denature most
proteins. Over 60% ethanol or 50% isopropanol is needed to precipitate DNA
from solution.
21
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
Absolute ethanol or methanol is commonly used as a fixative in histology,
pathology and cell
biology to terminate biochemical reactions. Some proteins can be precipitated
by the
addition of water-miscible organic solvents, such as ethanol and acetone, in
the range of 20-
50% (vol./vol.). Ethanol causes dehydration of proteins or a reduction in
water activity,
followed by electrostatic attraction between proteins, aggregation and
insolubilization. While
wishing to not be bound by theory, the inventors believe the relatively small
percentage of
water-miscible organic solvents in the present composition has little to no
fixative properties,
but rather facilitates mixing and dispersion of the biological (e.g. fecal)
sample and improves
the solubility of other chemical compounds which may be included in the
present
composition. In addition, for shipping/transport of flammable liquids, it is
desirable to keep
organic solvents, such as ethanol, below 24% by volume in solutions for
exemption from
Transport of Dangerous Goods (TDG) regulations (United Nations (UN) number
1170);
otherwise a solution with >24% ethanol is classified as class 3 (flammable
liquids), special
packaging is mandated, and transport complexity and costs increase.
The term "detergent" or "surfactant" as used herein will be understood to mean
any organic
compound that is amphiphilic, can disrupt non-covalent bonds in proteins,
denaturing them,
and causing molecules to lose their native secondary, tertiary and/or
quaternary structures.
A suitable detergent can be, for example, an anionic detergent, (such as, for
example,
sodium dodecyl sulfate (SDS), lithium dodecyl sulphate, sodium lauryl sulfate
(SLS),
ammonium lauryl sulfate), a cationic detergent (quaternary ammonium salts,
such as, for
example, cetrimonium bromide/cetyltrimethylammonium bromide/hexadecyl-
trimethyl-
ammonium bromide or CTAB, cetyltrimethylammonium chloride (CTAC),
cetylpyridinium
chloride (CPC), benzalkonium chloride (BAC)), a zwitterionic surfactant (for
example,
betaines, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS),
lecithin)
or a nonionic detergent (such as, for example, Tween, Triton X, or Brij).
CTAB, however, is
less ideal when working with DNA. Detergents can inhibit the action of DNase
by destroying
the complex structure of these enzymes, facilitate dispersion of the
biological sample in the
present composition, and help solubilize a variety of chemical species. In
certain
embodiments of the present composition, the detergent is SDS. In other
embodiments, the
detergent (e.g. SDS) can be present in the aqueous composition in an amount of
from about
0-4% (w/v), preferably about 0-1% (w/v), most preferably about 0.5% (w/v).
The term "antifoaming agent" or "defoamer" as used herein will be understood
to mean a
chemical additive that reduces or hinders the formation of foam. The inventors
observed the
formation of foam during the vigorous shaking needed to rapidly and fully
disperse some
biological samples, in particular feces, in a tube containing certain
embodiments of the
22
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
present composition, comprising a detergent. Said foam hindered and, in some
samples,
prevented complete mixing, with and without a homogenization means.
Antifoaming agents,
such as Antifoam A Concentrate (Sigma-Aldrich; Cat. No. A-5633), an active
silicone
polymer, significantly reduced the formation of foam during said mixing of
biological sample
and the present composition. Thus, antifoaming agent should preferably be
included in
compositions containing detergent in order to minimize the formation of foam.
Other
examples of appropriate antifoaming agents which may be used singly or in
combination of
two or more include insoluble oils, polydimethylsiloxanes and other silicones,
certain
alcohols, stearates and glycols. In other embodiments, the antifoaming agent
(e.g.
Antifoam A) can be present in the aqueous composition in an amount of from
about 0-1%
(v/v), preferably about 0-0.2% (v/v).
The term "antimicrobial agent" as used herein will be understood to mean a
substance or
group of substances which reduces the rate of growth of an organism, compared
to the rate
of growth of the organism in their absence. A reduction in the rate of growth
of an organism
may be by at least 5%, more desirably, by at least 10%, even more desirably,
by at least
20%, 50%, or 75%, and most desirably, by 90% or more. The definition also
extends to
substances which affect the viability, virulence, or pathogenicity of an
organism. An
antimicrobial agent can be natural (e.g., derived from bacteria), synthetic,
or recombinant.
An antimicrobial agent can be bacteriostatic, bactericidal, or both. An
antimicrobial agent is
bacteriostatic if it inhibits cell division, without affecting the viability
of the inhibited cell. An
antimicrobial agent is bactericidal if it causes cell death. Cell death is
commonly detected by
the absence of cell growth in liquid growth medium (e.g., absence of
turbidity) or on a solid
surface (e.g., absence of colony formation on agar). Those of skill in the art
know that a
substance or group of substances which is bacteriostatic at a given
concentration may be
bactericidal at a higher concentration. Common antimicrobial agents known in
the art,
include certain alcohols, Triclosan or lrgasan, and Proclin 950. Optionally,
the present
composition may include an antimicrobial agent such as Triclosan. In other
embodiments,
the antimicrobial agent (e.g. Triclosan) can be present in the aqueous
composition in an
amount of from about 0-2% (w/v), preferably about 0-0.5% (w/v).
The compositions described herein, when mixed with a biological sample, in
particular a
fecal sample, stabilize nucleic acids contained therein at ambient temperature
such that the
nucleic acids are stabilized upon storage of the homogenized mixture for
extended periods
of time.
In one embodiment, the biological sample is a fecal sample obtained from a
human subject,
and the nucleic acid is DNA.
23
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
Those of skill in the art will appreciate that the presence of high molecular
weight DNA in a
sample can give a general indication of DNA stabilization within the sample
under the
storage conditions. This can be assessed by agarose gel electrophoresis, which
can
provide an indication of the quality of the high molecular weight DNA (e.g.
crisp band versus
smearing) as well as a quantitative measure of the amount of high molecular
weight DNA (by
densitometry analysis).
In addition to stabilizing high molecular weight DNA, the compositions
described herein,
when mixed with a biological sample, in particular a fecal sample, stabilize
nucleic acids
contained therein at ambient temperature such that the relative abundance of
microbial
and/or human nucleic acids is maintained upon storage of the homogenized
mixture for
extended periods of time. A number of techniques known to those of skill in
the art can be
used to determine whether the relative abundance of microbial and/or human
nucleic acids
is maintained, for instance techniques that utilize amplification or
hybridization of nucleic
acids. Another technique that can be used to assess whether the relative
abundance of
microbial and/or human nucleic acids is maintained upon storage of the
homogenized
mixture for extended periods of time is PCR-DGGE analysis, described in
further detail
below. Targeted 16S profiles (to determine the relative abundance of
operational taxonomic
units (OTU's)) as well as whole-metagenomic shotgun sequencing of genomic DNA
(WMS;
to determine the relative abundance of microbial genes / nucleic acids) can
also be used.
In one exemplary embodiment, stabilization of human DNA in particular can be
assessed by
determining whether DNA obtained from biological samples, such as fecal
samples,
incubated with the compositions and according to the methods described herein
for a period
of time (tstorage) retains the ability to support PCR amplification of a
target human gene into a
detectable product, and more particularly whether the level of amplification
of PCR product is
similar to that of DNA extracted and purified from the same homogenous mixture
or other
control mixture at time zero. As further described in the Examples below,
human DNA
purified from fecal samples incubated with the compositions and according to
the methods
described herein at T=0 and T= tstorage can be amplified in real-time,
quantitative PCR
(qPCR) using primers targeting a human gene, and the change in Ct values (ACt)
resulting
from T=0 and T= tstorage purified DNA aliquots can provide a quantitative
measure of human
DNA stability. A ACt value of less than about 2 indicates that the human DNA
has been
rendered stable over the storage time period. A ACt value of less than about 1
is indicative
of excellent stabilization.
In one embodiment, human DNA contained in a fecal sample incubated with the
compositions and according to the methods described herein is rendered stable
at room
24
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
temperature for at least 7 days, at least 14 days, at least 21 days, at least
30 days, or at
least 60 days. In another embodiment, human DNA contained in a fecal sample
incubated
with the compositions and according to the methods described herein is
rendered stable at
elevated temperatures such as 37 C or 50 C for at least 7 days, or at least 14
days. In yet
another embodiment, human DNA contained in a fecal sample incubated with the
compositions and according to the methods described herein is rendered stable
at -20 C for
at least one month (i.e. 30 days).
In another embodiment, the nucleic acid is microbial DNA and the method
stabilizes a
microbiome profile of the biological sample (e.g. fecal sample). As used
herein, the term
"microbiome profile" generally refers to the total microbial community and
biomolecules
within a defined environment, and their relative amounts.
As described in further detail below, stability of a microbiome profile can be
determined, for
instance, by carrying out PCR on DNA that has been extracted and purified from
homogeneous mixtures of the biological sample and compositions described
herein following
storage of the homogeneous mixtures at ambient temperature for a particular
time period
(tstorage), using primer pairs targeting bacterial 16S rRNA genes and
Denaturing Gradient Gel
Electrophoresis (DGGE) analysis. Those of skill in the art will appreciate
that other bacterial
genes with variable and non-variable regions can be targeted, provided that
there is a
difference between species of interest. The resulting PCR-DGGE profile is then
compared
to that obtained by carrying out PCR-DGGE analysis in the same manner on DNA
that has
been extracted and purified from the same homogeneous mixture or other control
mixture of
the biological sample and compositions at time zero. In one embodiment, a
microbiome
profile of a biological sample such as a fecal sample can be considered to
have been
stabilized at ambient temperature for a certain period of time 0 õstorage) if
the PCR-DGGE
profile after (t õstorage) at ambient temperature exhibits at least 75 %
similarity to the PCR-
DGGE profile at T=0, and most preferably at least 82 % similarity to the PCR-
DGGE profile
at T=0.
In another embodiment, stability of a microbiome profile can be determined,
for instance, by
amplifying and sequencing a variable region of the bacterial 16S rRNA gene
(such as the V4
hypervariable region) from DNA that has been extracted and purified from
homogeneous
mixtures of the biological sample and compositions described herein following
storage of the
homogeneous mixtures at ambient temperature for a particular time period. The
resulting
sequencing information is then compared to that obtained by carrying out
amplification and
sequencing of the variable region of the bacterial 16S rRNA gene in the same
manner on
DNA that has been extracted and purified from the same homogeneous mixture at
time zero
CA 02941764 2016-09-07
WO 2015/131291 PCT/CA2015/050173
or other control. Various forms of bioinformatics analysis of the obtained
sequencing data
known to those of skill in the art can be used to assess stability of the
microbiome under the
storage conditions, as further detailed in the Examples.
In one embodiment, the microbiome profile of a fecal sample incubated with the
compositions and according to the methods described herein is rendered stable
at room
temperature for at least 7 days, at least 14 days, at least 21 days, at least
30 days, or at
least 60 days. In another embodiment, the microbiome profile of a fecal sample
incubated
with the compositions and according to the methods described herein is
rendered stable at
elevated temperatures such as 37 C or 50 C for at least 7 days, or at least 14
days. In yet
another embodiment, the microbiome profile of a fecal sample incubated with
the
compositions and according to the methods described herein is rendered stable
at -20 C for
at least one month (i.e. 30 days).
The inventors have surprisingly found that extraordinarily high concentrations
of a less
commonly used chelating agent, CDTA, buffered to alkaline pH (pH preferably
pH 11),
can be used to rapidly and effectively capture and stabilize nucleic acid and
'snap-shot' total
DNA profiles in biological samples at ambient temperature for prolonged
periods.
In particular, the inventors have surprisingly found that compositions
buffered to a stronger
alkaline pH (about pH 10.5-11.5, preferably about pH 11) show an improved
stability of
microbiome DNA relative to stabilizing compositions buffered to lower pH
values. This could
not have been predicted, and in fact was unexpected in view of the following.
It is generally
known that at the higher pH, deamination of cytosine will be accelerated. DNA
is also known
to more readily denature at the higher pH. Apurinic sites in the DNA (that
occur with low
frequency) will also be cleaved more readily. Thus, it is surprising that the
inventors have
observed that DNA/microbiome profiles appear to be more stable, based on
agarose gel
electrophoresis, bacterial 16S rRNA gene sequencing and DGGE, at the higher pH
values.
Without being bound by theory, it is thought that the reason for the apparent
improved
stability is not purely "chemical". That is, the stronger alkaline pH shows an
improved
stability of microbiome DNA for perhaps a combination of reasons, some of
which are
suggested below.
It has been observed that CDTA works much better than EDTA in the compositions
described herein for DNA/microbiome stabilization. The 4 pKa's for EDTA and
CDTA are
shown in Table 2 above. Based on these values, this means that, at alkaline
pH, CDTA will
have 3 negative charges, while EDTA will have 4 negative charges as the pH
approaches
26
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
11. Again, without being bound by theory, it is thought that perhaps the
reason for the much
better performance of CDTA, compared to EDTA, is due to the lower negative
charge.
The objective in a Microbiome study is to stabilize, and eventually release
DNA from, all cells
in equal proportion, preferably 100% of the DNA from 100% of the cells.
Stability of the
'profile' of the released DNA may be better at the higher pH because this may
come closer
to reaching this objective. In other words, a greater extent of the bacterial
DNA may be
stabilized and eventually released at pH 11, compared to pH 9.5.
Once DNA is released, it needs to be protected from degradation by DNase in
fecal
samples. Some DNase require metal ions as co-factors; others do not. Again,
without being
bound by theory, it is possible that the higher pH may be more effective at
inhibiting the
second class of DNase.
Unknown factors (e.g. inhibitors) in feces may bind to DNA and either
sequester it or block
PCR amplification. It is possible that higher pH may alleviate either or both
of these
possibilities.
Finally, growth of bacteria must be prevented after collection of feces
samples into stabilizing
compositions. Otherwise, the 'profile' of DNA/microbiome will change. Higher
pH may be
more effective at inhibiting growth of some microbial species than lower pH
(9.5).
For complex, highly variable, solid and semi-solid sample types, such as
feces, it is also
necessary to provide a mechanical or physical means of immediately mixing the
samples
with the composition at the point of collection. Rapid homogenization and
complete
disruption of freshly collected biological sample in the present composition
ensures the
stabilization of a representative snap-shot of total DNA profiles in the
sample for prolonged
periods of time at ambient temperature. As illustrated in the Examples below,
if the present
composition is added to a collected solid feces sample, but not adequately
mixed, the quality
of the DNA is compromised relative to those samples that are mixed to
homogeneity.
Proper mixing of the samples is therefore crucial in order to stabilize the
DNA such that it is
representative of the in vivo (T=0) state. For instance, DNA extracted from
such samples,
followed by agarose gel electrophoresis, may show degradation of high
molecular weight
DNA in samples from some donors. Also, as seen in the Examples below,
inadequate mixing
of feces samples from some donors leads to detrimental changes to the
microbiome profile,
as measured with bacterial 16S rRNA PCR and DGGE analysis.
In many instances, biological sample collection, in particular feces
collection, is best done by
donors in the privacy of their own home. In this setting, the donor is more
comfortable, and if
27
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
provided instruction and an appropriate biological sample collection device or
kit containing a
stabilization chemistry or solution, the donor can immediately collect and
stabilize fresh
biological samples. Collecting samples in this manner helps ensure the best
quality nucleic
acid for subsequent extraction and analysis, with DNA profiles matching as
close as possible
the in vivo state. However, in order to collect and stabilize a biological
sample at home or
remote field collection site, the donor must be provided a simple, safe and
intuitive, but
highly effective, means to manually or physically mix their collected sample
with stabilizing
solution themselves. Preferably, this mixing means is inexpensive and requires
no electricity,
equipment or specialized training.
DNA can rapidly degrade in biological samples (e.g. feces) upon exposure to
air, if not mixed
with a stabilization solution, or when not immediately frozen on dry ice at
the point of
collection. With homogenous, liquid biological samples, such as blood and
urine, mixing is
not a significant issue; however, disruption of solid and semi-solid, non-
homogeneous
biological samples, such as feces, in a limited amount of solution and time
can be
exceedingly problematic. Through much experimentation with numerous mixing
means (e.g.
glass/silica particles 1 mm; 2.65 g/cm3), glass/silica beads (2-4 mm; 2.65
g/cm3), marbles
(12.7 mm), alumina oxide balls (7.9 mm; 3.95 g/cm3), and silicon nitride balls
(7.1-7.9 mm;
3.21 g/cm3), the inventors discovered that complete disruption and
homogenization of all
feces samples types (1-7 on the Bristol Stool scale), collected in standard,
commercially-
available laboratory or transport tubes (e.g. 10 mL round-bottom tube (92 x
15.3 mm), Cat.
No. 60.610; Sarstedt) containing the present composition, can be attained by
simple hand
mixing with the inclusion in the tube of at least one large (5.6-11.1 mm,
preferably 7.9 mm)
dense (7.6-15.63 g/cm3) metal ball sized smaller than the inner diameter of
the tube (e.g.
12.9 mm).
The inventors determined the optimal selection of a homogenization means for a
standard,
commercially-available laboratory tube, includes: 1) matching the shape of the
tube (e.g.
bottom or base inside the tube) with the shape of the homogenization means
(e.g. round-
bottom tube for a homogenization means that is at least one mixing ball, such
as a stainless
steel mixing ball) to prevent compaction and/or entrapment of solid material
in hard to reach
areas of the tube or container; 2) selection of the most dense material
possible for the
homogenization means (e.g. tungsten carbide (15.63 g/cm3), stainless steel
(7.6-8.0 g/cm3);
3) selection of a homogenization means with an outside diameter slightly
smaller than the
internal diameter of the tube or container (for example, when the
homogenization means is a
mixing ball, the mixing ball would have a diameter of about 4-6 mm, preferably
about 4-5
mm, and most preferably about 5 mm less than the internal diameter of the
mixing tube); and
28
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
4) selection of a tube or container with `headspace' above the sample and
stabilizing solution
to allow the homogenization means to gain momentum during shaking by hand. It
should be
noted that the mixing ball can be of regular or irregular shape (e.g. could
have nubs, spikes,
etc. and need not be perfectly spherical), and as noted above preferably has a
density of at
least 5.0 g/cm3, most preferably at least 7.6 g/cm3.
Should the homogenization means/ball be too small with respect to the tube,
sample passes
around the homogenization means/ball without being dispersed in the
stabilizing solution. In
contrast, should the homogenization means/ball be too large (e.g., >11.1 mm)
with respect
to the tube (12.9 mm internal diameter), sample is not dispersed or 'crushed'
between the
homogenization means/ball and the walls of the tube, the homogenization
means/ball does
not gain sufficient momentum, and sample becomes compacted at one or both ends
of the
tube. Ideally, when the outside diameter of the homogenization means (e.g. 7.9
mm
tungsten carbide or stainless steel ball) just clears the inner vertical walls
of the tube (e.g. 10
mL Sarstedt tube having internal diameter of 12.9 mm, above) by about 5 mm
(2.5 mm on
either side of the ball), the homogenization means effectively functions as a
homogenizer,
rapidly breaking down or disrupting solid and semi-solid feces sample (e.g.
400 mg; type 1-
7), collected into the present composition (e.g. 2 mL), to form a homogeneous
liquid sample
which can be readily pipetted or manipulated and processed in the laboratory.
This
homogenization means ensures the collected biological sample, even solid
feces, is rapidly
and completely disrupted, and, in doing so, quickly exposed to the present
composition.
Importantly, the inventors determined that the density of the homogenization
means, not just
its diameter, compared to the tube/container, was critical for achieving
complete disruption of
the sample in a timely manner (20-30 seconds) simply with shaking the tube by
hand. Due to
the often sticky, malleable nature of feces (e.g. type 4), complete
homogenization of this
sample was difficult to achieve in flat-bottomed or conical-bottomed tubes
when utilizing a
spherical homogenization means. Hence, a round-bottomed tube for a spherical
homogenization means performed the best.
The present invention provides a novel, universally-applicable method and
composition for
stabilizing total DNA in particularly complex, non-homogeneous biological
samples at
ambient temperature for subsequent use in human and animal medical diagnostics
and
clinical research (e.g. diagnosis of disease and infection, role of microbes
in human health,
population genomics to study microorganism evolution, virulence, drug-
resistance, and
epidemiology), food safety (food/meat processing plants), soil and waste water
sampling
(environment testing), biosecurity or biodefence (biological weapons), animal
feed testing,
plant and animal science/industry, etc.). A new and rapidly expanding focus of
both
29
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
researchers and clinicians is the intestinal microbiota or gut microbiome. How
does the
profile of microbes in feces from healthy donors differ from that of diseased
individuals? Can
manipulation of the human gut microbiome benefit health? For research,
environmental, and
economic reasons, there is also immense interest in the analysis of the
thousands of
different microorganisms in the rumen of many livestock, especially those
animals which are
reared for meat and dairy products.
The present invention simplifies and expedites biological sample collection
and preparation,
providing quality samples for the subsequent detection of human, animal and
microbial DNA,
without the need to maintain the cold-chain during transport or storage. The
invention can be
used in a) central laboratories or testing facilities with high-throughput or
automated
systems, b) rural or mobile clinics with minimal laboratory infrastructure and
equipment, and
c) remote locations with no electricity. In addition, sick and potentially
infectious individuals
do not have to travel to clinics or hospitals to provide a biological sample,
minimizing the
spread of infectious disease, facilitating outbreak control and surveillance,
and enabling
rapid assessment and monitoring of a patient's response to treatment.
The closed collection and homogenization system/kit as herein described is
inexpensive to
manufacture and no additional laboratory equipment (e.g. vortex) need be
purchased. Most
importantly, manual shaking of the capped tube containing the present
composition, one or
more homogenization balls, and even hard feces (type 1-2, Bristol Stool scale)
sample, can
achieve complete disruption of the sample in seconds, resulting in a
homogeneous mixture.
Donor self-collection reduces the spread of infection and potential cross-
contamination with
other donor's samples. Notably, this sample collection and homogenization
process can be
performed by the lay person, having no laboratory or clinical experience, in
the privacy of
their own home, greatly improving donor participation and compliance.
Important for the
quality of downstream test results, the present invention allows the safe
collection and
stabilization of "fresh" biological samples, drastically reducing the
degradation observed
during the transit of raw or untreated biological samples to testing
facilities and/or variable
storage conditions.
Critically, the present invention will provide researchers and clinicians with
desperately
needed stabilized, representative biological samples from which unbiased DNA
can be
extracted. Unbiased DNA input, i.e., a representative snap-shot of the gut
microbiome at
point of sample collection, will enhance the quality and accuracy of
downstream analyses,
enable more accurate comparative assessments of inter- and intra-subject
differences, as
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
well as inter-study differences, for studying variations in human intestinal
microbial
communities, in health and disease. Intact, unbiased, rich high molecular
weight DNA is
critical for metagenomic library construction and the characterization of
intact genetic
pathways either by sequence-based or functional screening-based approaches. In
addition,
excessive degradation of DNA in biological samples reduces the efficiency of
shotgun
sequencing.
Only in the last few years has significant attention been paid to the
phylogenetic composition
of DNA extracted from feces, in relation to the bacterial community in fresh
feces. It is
common practice, mainly for practical reasons, to freeze feces samples after
collection and,
after a highly variable period of time, extract DNA for downstream analysis,
such as
sequencing or quantitative PCR (qPCR). Critically, however, between and within
published
studies there appears to be considerable variability in: 1) the period of time
between
defecation and freezing of 'fresh' feces; 2) transport conditions and
duration; 3) length of
time feces was frozen before analysis; 4) length of time and temperature
employed to thaw
frozen feces; and 5) variable time from collection before the first aliquot is
isolated and
processed for DNA. In these studies, 1=0 represents the moment these
collected, frozen,
and often stored, samples have been thawed for processing, not the time of
defecation.
In metagenomic studies of the human microbiota, however, studies have clearly
shown that
storage conditions of feces samples may adversely affect the inferred
community
composition. For example, Bahl et al. (2012), demonstrated using qPCR and 6
different
primer pairs targeting 165 rRNA genes of significant bacterial groups, that
freezing feces
samples at -20 C for 53 5 days prior to extraction affected the ratio between
the two most
predominant phyla, namely the Firmicutes and the Bacteroidetes, a frequently
used
biomarker in gut microbiology. Specifically, the Firmicutes to Bacteroidetes
165 rRNA gene
ratio was significantly higher in fecal samples that had been frozen, compared
to identical
samples that had not. Desperately needed is a means to capture or snap-shot at
least three
key aspects of the original or in vivo microbial community in collected feces
samples,
stabilizing i) the abundance of each microbe, ii) the richness of the entire
community, and iii)
total microbial DNA profiles.
Efficient and nonbiased stabilization (and extraction) of total genomic
bacterial DNA from
complex fecal samples is a crucial first step for molecular-based studies of
the bacterial
community within the gut, e.g. generating microbiome profiles that represent
the in vivo state
of the donor. In particular, the study of the microbial communities requires
capturing a
"snapshot" of the microbiota profile immediately after collection. It is clear
current field
31
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
collection of fecal samples is impractical, expensive and not scalable
(McInnes & Cutting,
2010). It is also well known in the field that problems related with sample
collection cause
inconsistent results and low reproducibility. Furthermore, handling of solid
samples poses a
challenge for automation, increasing the cost and limiting the size of
longitudinal studies.
To eliminate strong biases between and within studies across laboratories,
there is a need to
develop and implement a standardized or universal method for the collection
and
stabilization of biological samples at the point of collection, prior to being
subjected to
unfavourable, often extreme temperatures during transport and prolonged
storage. The
present method of homogenizing biological samples, in particular, highly
variable in type,
complex, non-homogeneous samples, ranging from liquids to hard solids, in an
effective
DNA-stabilizing composition at the point of sample collection, ensures the
maximal integrity
of DNA in the entire sample, representing as close as possible the in vivo
state.
Presently, many studies recruit donors to collect feces samples and provide
either no
stabilizing means or require the use of ice packs during transport. The Human
Microbiome
Project (HMP), a program initiated under the National Institutes of Health
(NIH) Roadmap,
sponsors studies to characterize the human microbiome and analyze its role in
human
health and disease. All members participating in the HMP Core Microbiome
Sampling study
must follow the Manual of Procedures (McInnes & Cutting, 2010) outlining,
among other
things, specimen collection from the GI tract (see section 7.3.3). Subjects
are provided a
feces collection kit and required to collect feces specimens within a 24-hour
period before
bringing the specimens back to the clinic. HMP kits include two feces
collection containers
(one is for back-up) resembling large margarine tubs, a Thermosafe shipping
container (a
large Styrofoam box inside a cardboard box), 8-10 polar packs for transport of
specimen (at
about 4 C), instructions, labels, and other packing materials. Before
collecting a specimen,
subjects must place the gel packs in their freezer for at least 12 hours.
Feces is deposited
directly into the collection container, the lid is applied, and the entire
container is sealed in a
Ziplock bag, prior to packaging in the Styrofoam box, completely surrounded by
8-10 frozen
gel packs. The Styrofoam box is closed, sealed inside a cardboard box, and the
subject
transports this bulky package to the clinical lab.
The existing cold-chain requirements to ship fresh specimens packed on ice or
dry ice,
sealed in bulky Styrofoam and cardboard containers/coolers, is very costly,
even prohibitive
for researchers conducting studies requiring moderate to large numbers of
donors. Simply,
the shipment of a commercially-available feces collection container,
surrounded by frozen
ice packs, in a Styrofoam container, within a cardboard shipping box or over-
pack (16x13x14
inches), costs approximately $175 each using UPS Next Day delivery service
within the
32
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
United States. This estimate does not take into account the cost of the feces
collection
container and any shipping materials. Also, many testing facilities require
biological samples
be shipped on dry ice which adds considerable cost to this shipping estimate.
Once the lab
receives these large shipping containers, staff must immediately unpack and
quickly process
the biological samples or place the collection containers into large storage
freezers until
batch processing can be performed. In contrast, the present invention
alleviates most of the
current shipping cost and inconvenience, and, most importantly, ensures the
DNA in
collected biological samples is stabilized at the point of collection at
ambient temperature.
From the donor's perspective, the biological sample is collected in the
privacy of their home,
a small portion of the specimen is transferred to a familiar tube or container
already
containing stabilization solution, a cap is applied to the tube and shaken by
hand to mix, the
tube is sealed in a biohazard bag, and mailed to the testing facility in a
bubble envelope or
small box at a fraction of current costs.
EXAMPLES
MATERIALS AND METHODS
The following general materials and methods are used in the Examples that
follow, except
where different conditions are specified therein.
Collection of Feces Samples
Healthy donors were each given the following supplies for a collection: a) a
feces collection
container (sits on the toilet); b) a syringe for volumetric feces collection
of about 400 mg (i.e.
3 mL syringe with tip cut off, plunger adjusted to 400 mg collection volume);
c) a round-
bottom Sarstedt tube (10 mL round-bottom tube (92 x 15.3 mm), Cat. No. 60.610;
Sarstedt)
containing the present composition (2 mL), and various homogenization means
(e.g. 7.9 mm
stainless steel ball bearing, 420/440 SS Grade 25, Aimark Travers LTD, or
others as noted
below); and d) feces collection instructions. Tubes were weighed pre- and post-
collection to
determine the actual amount of feces sample collected. Each donor was asked to
fill the tip
of the syringe with feces to the marked volume (400 mg) and transfer the feces
sample to
tube. For complete homogenization of samples, tubes were shaken by hand for 20-
30
seconds.
DNA Extraction from Feces Samples in the Present Composition
Unless stated otherwise, 400 mg feces was transferred to a Sarstedt tube (10
mL round-
bottom tube (92 x 15.3 mm), Cat. No. 60.610; Sarstedt) containing 2 mL of the
present
33
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
composition (specified in Examples below) and a 7.9 mm stainless steel ball
bearing. DNA
was readily extracted from 250 1.. aliquots of feces samples collected and
stored in the
present composition utilizing several commercially-available DNA isolation
kits. Feces
samples in the present compositions were found to be compatible with PowerSoil
DNA
Isolation Kit (MO BIO Laboratories, Inc., Cat. No.12888-100), PowerFecalTm DNA
Isolation
Kit (MO BIO Laboratories, Inc., Cat. No. 12830-50), Zymo Research Fecal DNA
MiniPrep
incorporating bead-beating (Zymo Research, Cat. No. D6010), QIAamp DNA Feces
Mini Kit
(Qiagen, Cat. No. 51504) and PSP Spin Feces DNA Plus Kit (lnvitek, Cat. No.
1038110200).
As per PowerFecal DNA Isolation Kit Instructions, the following procedure was
followed
[Note: 65 C heating step was eliminated]:
1. To the PowerBead tube provided, 750 tL of bead solution and 250 1.11_ of
feces
sample in present composition were added. The tube was gently vortexed to mix.
2. 60 p,L of Solution Cl was added and the tube was inverted several times or
vortexed
briefly.
3. PowerBead tube was secured on the vortex adapter and vortexed for 10
minutes at
maximum speed.
4. PowerBead tube was centrifuged at 10,000 x g for 30 seconds.
5. The supernatant was transferred to a clean 2 mL collection tube (provided).
6. 2504_ of Solution C2 was added and the tube was vortexed for 5 seconds,
then
incubated at 4 C for 5 minutes.
7. The collection tube was centrifuged at room temperature for 1 minute at
13,000 x g.
8. Avoiding the pellet, up to, but no more than, 600 pit. of supernatant was
transferred to
a clean 2 mL tube.
9. 2001.1L of Solution 03 was added and the tube was vortexed briefly, then
incubated
at 4 C for 5 minutes.
10. The tube was centrifuged at room temperature for 1 minute at 13,000 x g.
11. Avoiding the pellet, up to, but no more than, 750 j.tL of supernatant was
transferred
into a clean 2 mL tube.
34
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
12. Solution C4 was mixed before use. 1200 L of Solution C4 was added to the
supernatant and the tube was vortexed for 5 seconds.
13. 6751..LL was loaded onto a Spin Filter and centrifuged at 13,000 x g for 1
minute. The
flow through was discarded and an additional 675 pi_ of supernatant was added
to
the Spin Filter and centrifuged at 13,000 x g for 1 minute. The remaining
supernatant
was loaded onto the Spin Filter and centrifuged at 13,000 x g for 1 minute.
14. 500 L of Solution C5 was added onto the Spin Filter and centrifuged at
room
temperature for 30 seconds at 13,000 x g. The flow through was discarded.
15. Centrifuging was carried out again at room temperature for 1 minute at
13,000 x g.
16. The spin filter was carefully placed in a clean 2 mL collection tube
(provided).
17. 1001.1L of Solution C6 was added to the center of the white filter
membrane.
18. The tube was centrifuged at room temperature for 30 seconds at 13,000 x g.
19. DNA was stored frozen (-20 to -80 C).
Determination of DNA Concentration in Purified Samples
A. Absorbance Determination of DNA Concentration
Measurement of absorbance at 260 nm (Amonm) is commonly used for quantifying
DNA. An
absorbance of 1.0 at 260 nm corresponds to a concentration of 50 ng./ L for
pure double-
stranded DNA. DNA yields from purified feces samples, treated with or without
the present
compositions under various conditions, were determined using a NanoDrop 2000c
spectrophotometer (Thermo Fisher Scientific Inc.). A 2 pL volume of each DNA
sample was
placed on the pedestal and scanned from 220 nm to 350 nm with absorbencies
measured at
230 nm, 260 nm and 280 nm. Sample DNA concentration (ng/pL), A260/A280 ratio,
and
A260/A230 ratio were reported by the NanoDrop 2000c software. The total DNA
yield per
sample was calculated by multiplying the sample concentration by the
respective DNA
elution volume.
B. Fluorometric Determination of DNA Concentration
Disadvantages of using Amonm include (i) insensitivity of the assay and (ii)
interference by
non-DNA components, such as RNA, particularly in samples that are not highly
purified.
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
DNA yields from purified samples were also quantified using PicoGreen0
Fluorescent dye
(200x; Invitrogen, Cat. No. P7581); Lambda DNA (lnvitrogen, Cat. No.25250-010)
was used
to generate a standard curve [in triplicate; 0-50 ng/pL]. PicoGreene is a
fluorescent double-
stranded DNA-binding dye (485 nm Excitation/535 nm Emission) that enables
sensitive
quantitation of sub-nanogram amounts of double-stranded DNA (dsDNA).
Triplicate aliquots
of each purified sample and Lambda DNA standards were processed in a black
flat-
bottomed 96 well microplate (Greiner Bio-One, Cat. No. 655209) and
fluorescence was
measured using an Infinite M200 microplate reader (TECAN).
Integrity of DNA in Samples Stored in Stabilizing Compositions
An aliquot of each purified sample was diluted to 10 ng/pL, based upon
concentration
determined by PicoGreen (above). To assess DNA integrity, approximately 80 ng
from each
diluted, purified feces sample was separated on a 1% agarose gel by
electrophoresis for 30
minutes at 100 volts. The gel was stained in 1 pg/mL ethidium bromide (EtBr)
in distilled
water for 15 minutes at room temperature, rinsed and photographed on a UV
transilluminator
using a DigiDoc-ITTm imaging system (UVP LLC). DNA was determined to be
stabilized and
intact when the stained band on the gel was sharp and >23Kb, compared to the
DNA ladder.
1Kb+ DNA Ladder (Life Technologies, Cat. No. 10787-018) or Lambda DNA/Hind III
fragments (Life Technologies, Cat. No. 15612-013) were used as size
references.
a. 1% agarose gel was prepared (80 mL 1xTAC + 0.8 g agarose).
b. 2 fit of 5x loading buffer was added to 8 1._ of 10 ng/pt of purified
sample.
c. Into wells of a prepared 1% agarose gel was loaded 10 pL prepared sample
(step b);
pL Lambda DNA/Hind III fragments and/or 5 L iKb DNA ladder.
d. Gel was run at 100 V for 30 minutes.
e. Gel was stained in EtBr (500 viL 1 mg/mL EtBr + 500 mL water) for 15
minutes.
f. Gel was destained in water for 5 minutes.
g. Images were taken under UV.
36
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
Denaturing Gradient Gel Electrophoresis (DGGE)
To accurately and reproducibly evaluate the stability of various microbiomes
(feces, saliva,
sputum, skin, etc.) in the present composition, a new method called Denaturing
Gradient Gel
Electrophoresis (DGGE) was utilized. This method is based on the idea that if
one takes a
variable region of the bacterial 16S rRNA gene (in this case the V3 region)
and amplifies it
using PCR and primers on the flanking conserved region, that amplicons will
have a melting
point unique to the species of bacteria (even nucleotide differences will
affect the melt and
thus give a different profile).
When this method is applied to a sample containing multiple species of
bacteria, the
amplification using conserved primers will result in an array of amplicons,
all of which are
roughly the same length, but have a different nucleotide make-up in the non-
conserved area.
Next, these amplicons are run on a gel which contains a gradient of denaturing
solution
(urea and formamide). The amplicons will denature at different stages on the
gel, depending
on their nucleotide make-up, thus giving a resolution of all the species that
were present in
the sample.
In order for the DNA amplicons to not denature to single-stranded form, a -30
nucleotide CG
clamp was added to the forward primer which retards the migration of the
amplicons on the
gel once the variable section has denatured. In general, a 40%-60% denaturing
gradient on
the gel provides good resolution of the bands, while capturing most of the gut
species. The
gel is run at a constant 60 C in order to facilitate denaturing of the
amplicons and also keep
the gel at equal temperature throughout the run.
DGGE gel images were analyzed using the Syngene GeneTools software (version
4.03.00,
Syngene). The image background was subtracted using rolling disc method with a
radius of
30 pixels. Lanes were manually detected and set. Rf start and end location and
angle was
set to manual to adjust for "smiling" in the gel. Bands for analysis were
automatically
detected for each lane; peak detection was set under default (minimum width of
7 pixels,
minimum peak height of 3, and minimum peak volume of 1%). The profiles were
matched
using the "profile" type under the matching parameters menu with a set
tolerance of 1 /0.
Profile comparison resulted in an automatically generated similarity matrix,
with similarity
values ranging from 0 to 100. Generally speaking, for % similarity, this
refers to any changes
between 2 profiles, usually differences in band intensities. Thus, %
similarity provides a
measure of the difference in abundance of species. When a band is absent
between
profiles, the impact on % similarity is higher than when that band is just
decreased in
intensity.
37
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
The DGGE gel shown in Figure 1 illustrates how different the microbiome
profile of feces
samples from two different donors can appear; only 22% similarity exists
between the first
feces sample (Donor A) and the second (Donor B) sample.
PCR-DGGE was carried out according to the procedure described below.
PCR Amplification for DGGE (using 16S Primers with 5'clamp on forward primer)
a. 2 L of 10 ng/IAL DNA was added into 12-strip PCR tubes.
b. Master Mix was prepared (98 H.L/reaction): 76.7 41._ water, 10 pi_ 10xPCR
Buffer, 4
50 mIVI MgCl2, 2.5 pL 10 mM dNTPs, 2 pt. 10 pmol Rev Primer (PPUN518R, 5'-
ATTACCGCGGCTGCTGG -3), 2 pl. 10 pmol Fwd Primer (PRBA338F, 5"-
CGCCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCA
GCAG-3'), and 0.8 1AL 5 U/41_ Taq.
c. 98 pLL master mix was added to each tube.
d. PCR was run on conventional PCR machine: 1 cycle at 92 C for 2 minutes; 28
cycles
at 92 C for 60 seconds, 55 C for 30 seconds, 72 C for 60 seconds; followed by
1 cycle at
72 C for 6 minutes.
DGGE of PCR Amplicons
a. Stock solutions were prepared for an 8% Acrylamide/Bis gel in 40% and 60%
denaturing solutions:
40% 60%
40% Acrylamide/Bis 20 mL 20 mL
50x TAE Buffer 2 mL 2 mL
Formamide (deionized) 16 mL 24 mL
Urea 16,8g 25.2g
ddH20 Up to 100 mL Up to 100 mL
38
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
b. The glass plates and spacers were assembled according to the instruction
booklet for
the DCode system (Bio-Rad).
c. To prepare and pour an 8% Acrylamide/Bis gel with a parallel gradient using
40% and
60% denaturing solutions, the following procedure was used:
= 20 mL of 40% and 60% denaturing solutions were measured into 2 separate
beakers labeled "low density" and "high density," respectively;
= 200 xL of 10% ammonium persulfate (APS) was added to each solution;
= 201.1L of TEMED was added to each solution;
= The solutions were mixed well by swirling;
= Each solution was filled into a separate 20 mL syringe;
= The syringes were attached to the gel loading apparatus where specified
"low
density" or "high density" for top filling;
= Note: The volume adjustment settings for a 16 x 16 cm gel with 1.0 mm
spacers
was 18.5 mL;
= The Y tubing was attached to each of the syringes, with a needle on the
other
end of the tubing;
= The needle was placed between the glass plates;
= The gel was poured slowly and consistently by turning the wheel so that
the
gradient had time to even out;
= The gel was allowed to polymerize for a few hours;
= The Y tubing was flushed out with water.
d. The gel running system was pre-heated with 1xTAE buffer to 55 C.
e. 8 vt,L of Fermentas 6x loading dye was added to 42 tiLL of PCR product.
f. The gel was run for 5 minutes at 200 V before turning on the recirculation
pump in
order to get the samples out of the wells and into the gel.
g. The gel was run for 14 hours at 70 V with the recirculation pump on.
h. The gel was stained in lx Sybr Gold for 30 minutes (250 mL 1xTAE + 25 [IL
10,000x
SybrGold).
I. The gel was destained in 1xTAE for 5 minutes.
j. Images were taken under UV.
39
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
165 rRNA PCR was performed using universal primers (V3 region) followed by
DGGE using
the DCode Universal Mutation Detection System (Bio-Rad).
165 rRNA Sequencing
16S rRNA sequencing library preparation, sequencing and bioinformatics were
conducted.
V4 hypervariable region paired-end amplicon sequencing was performed using the
IIlumina
MiSeq (250 cycles). Using QIIME and custom scripts, sequences were quality
filtered.
Paired-end reads were assembled and searched against the Greengenes reference
database, clustered at 97% by UCLUST. After data normalization, sample-to-
sample
distance was measured using Weighted Unifrac on OTU (operational taxonomic
units)
abundance data (utilizes taxon abundance differences across samples, employing
a pair-
wise normalization by dividing the sum of differences by the sum of all
abundances) and
unweighted Unifrac incidence data (considers only the presence/absence of
taxa).
Amplification of Human DNA from Purified Feces Samples Stored in the Present
Composition
The stability of human DNA in feces samples collected into the present
composition (detailed
below) and stored at room temperature for 2 weeks, prior to total DNA
extraction (MoBio
PowerSoil or PowerFecal DNA Isolation Kit), was evaluated in real-time or
quantitative PCR
(qPCR) using primers targeting the single copy human thymidylate synthase gene
(TYMS
locus; NM001071.2). For each reaction, 50 ng of purified DNA was amplified in
a 25 pL
volume containing: lx PCR Buffer (20 mM Tris, 50 mM KCI), 2 mM MgCl2, 200 pM
dNTPs
(Invitrogen), 50 pg/mL BSA (Sigma Aldrich), 1 pM SYTO9 dye (Invitrogen), 0.4
pM each of
Primer hTSm143F (5'-GCCCTCTGCCAGTTCTA-3') and hTSm143R (5'-
TTCAGGCCCGTGATGT-3'; Invitrogen), 1U Taq polymerase (Invitrogen). The
amplification
conditions for the T5143 target were: 1 cycle at 95 C for 5 minutes; 35 cycles
at 95 C for 20
seconds, 55 C for 20 seconds, 72 C for 30 seconds; followed by 1 cycle at 72`C
for 10
minutes. A melt curve program was included and consisted of: 1 cycle at 95 C
for 30
seconds at a ramp rate of 4.4 C/second (no acquisition), 72 C for 10 minutes
at a ramp rate
of 2.2 C/second (no acquisition), 95 C at a ramp rate of 0.11 C/second
(continuous
acquisition). DNA samples were run in triplicate in a Corbett Rotorgene RG-
6000 and Ct
values for each sample calculated using the Rotorgene 6000 series software
1.7. The Ct
value refers to the fractional cycle number at the point where the
amplification curve crosses
a threshold of detection. By setting a threshold line and calculating the
intersection with
each of the sample curves, the Ct values for each sample are established. The
threshold
line is set in the exponential phase of the run, significantly above the
background level to
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
avoid noise and below the onset of signal plateau in later cycles. Generally,
the Ct value is
inversely proportional to the amount of DNA in the sample.ACt, represents the
difference in
Ct values resulting from two aliquots taken from the same sample at different
times, e.g.,
T=0 and T=14 days post sample collection.
EXAMPLE 1 - Comparison of Different Chelating Agents in Compositions for
Stabilizing DNA in Fecal Samples
Due to the vast amounts of nucleases in feces, mostly bacterial in origin, the
inventors
experimented with different chelating agents, and concentrations thereof,
during
development of the present composition.
The compositions described in the current Example contained 23.5% ethanol,
0.5% SDS,
and 0.1% Antifoam A, along with EDTA or CDTA in varying amounts, buffered to
pH 11 with
50 mM 13-alanine. Percentages of ethanol and Antifoam A are (%v/v) in this and
subsequent
Examples, and percentages of other components (SDS, triclosan) are in (%w/v).
Referring to Figure 2, feces was collected by a healthy donor and 400 mg
samples were
homogenized in various stabilization solutions or stored in the absence of
stabilization buffer
(unstabilized) for 14 days at room temperature (RT, 19-23 C) prior to DNA
extraction with a
commercially-available kit (PowerSoil or PowerFecal DNA Isolation Kit, MoBio).
Comparing
the quality or integrity of purified DNA at 1=0 and 1=14 days, the agarose gel
clearly shows
that high molecular weight DNA in untreated feces degrades significantly
during storage at
RT (control, last 2 lanes of agarose gel), forming a smear on the gel. Samples
(400 mg) from
the same donor's feces were also homogenized in: 1) the present composition,
including
increasing amounts of CDTA (150, 300, 500 mM); and 2) the present composition
in which
CDTA was replaced with EDTA (150, 300, 500 mM).
Surprisingly, at all concentrations tested (150, 300, 500 mM) with fecal
samples, CDTA
performed significantly better than EDTA for stabilizing high molecular weight
DNA in both
freshly collected samples (1=0) and after RT exposure for 14 days (Figure 2).
In fact, EDTA,
but not CDTA, was unexpectedly detrimental to stabilization (and extraction)
of high
molecular weight DNA at concentrations over 150 mM.
In addition, a comparison of higher concentrations (150, 300 and 500 mM) of
EDTA and
CDTA (Table 4), supports the surprising discovery that CDTA is superior to
EDTA for
stabilizing microbiome profiles, as exemplified via PCR of bacterial 16S rRNA
gene and
DGGE analysis of the amplicons, as described in the Materials and Methods
section above.
Following 14 and 30 days at RT, DNA from fecal samples stored in the present
composition
41
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
with CDTA maintained high percent similarities to control samples processed at
T=0. In
contract, the microbiome profile of DNA from the same feces stored in the
present
composition substituted with EDTA showed increasing dissimilarity with time at
RT,
compared to controls samples (processed at T=0; Table 4).
Table 4. Microbiome stability of feces stored in compositions with increasing
concentrations
of chelating agents.
Days at room temperature Days at room temperature
14 30 14 30
[EDTA] % similarity in microbiome profile [CDTA]
% similarity in microbiome profile
compared to T=0 control compared to T=0 control
0 81 57 0 81 57
150 86 79 150 94 86
300 89 74 300 93 84
500 86 62 500 95 88
Hence, CDTA surprisingly out performed EDTA in its ability to stabilize
intact, high quality,
high molecular weight DNA and snap shot the microbiome profile in complex, non-
homogenous feces. Thus, chelators such as CDTA, with a dissociation constant
higher than
EDTA, provide the best stabilization of DNA in biological samples, such as
fecal samples,
and are particularly preferred for use in the compositions described herein.
This ability to
stabilize samples at the point of sample collection will help eliminate strong
biases currently
seen between and within studies across laboratories.
EXAMPLE 2 - Role of pH and Chelating Agents in Fecal Sample Stability in the
Present
Composition
The complex relationships between fecal sample mixing, pH, and chelating agent
concentration were investigated for their effects on microbiome profile
stability as
exemplified via PCR of bacterial 16S rRNA gene and DGGE analysis of the
amplicons.
In the first of four experiments, a healthy donor collected feces and
transferred 400 mg of
feces into four tubes each containing a single 7.9 mm stainless steel ball and
2 mL of either
composition "104B pH 9.5" (300 mM CDTA, 23.5% ethanol, 0.5% SDS, 0.1% Antifoam
A,
42
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
pH 9.5) or "104B pH 11" (300 mM CDTA, 50 mM 13-alanine, 23.5% ethanol, 0.5%
SDS, 0.1%
Antifoam A, pH 11). Samples in the tubes were left undisturbed (no mix) or
homogenized
with hand shaking (mix) and then returned to the lab under ambient temperature
conditions.
Within 3-4 hours of sample collection, a 250 1.1,L aliquot was removed from
each tube for
DNA extraction (T=0) and then samples were stressed by storing at 30 C for 24
hours,
followed by -20 C for 11 days (T=11), prior to DNA extraction from a second
aliquot. Purified
DNA was quantified and then resolved as bacterial community profiles or
fingerprints using
DGGE to separate 16S rRNA gene PCR amplicons. Percent similarity between
samples
(lanes on DGGE gel), compared to the control sample at T=0 for each
composition, was
calculated separately using Syngene GeneTools software (see Materials and
Methods).
Figure 3 illustrates improved percent similarities or microbiome profile
stability between the
'11 day no mix' samples and 'day 0 mix' samples when the pH of the present
composition is
increased from 9.5 to 11, indicating that pH 11 offers additional DNA
stability than pH 9.5.
Also, 'day 11 mix' samples, in tubes using the present homogenization means, a
dense steel
ball, consistently led to improved microbiome profile stability compared to
'day 11 no mix'
samples, at both pH values tested, and, in particular, at pH 11.
In a second experiment, the relationship between pH and the concentration of
CDTA was
addressed. Aliquots (400 mg) from the feces of a healthy donor was transferred
into tubes
containing a 7.9 mm stainless steel metal ball and 2 mL of one of three
compositions: 1)
104B pH 9.5 (as above); 2) 50 mM CDTA, 50 mM13-alanine, 23.5% ethanol, 0.5%
SDS,
0.2% Triclosan, 0.1% Antifoam A, pH 11.5; and 3) 50 mM CDTA, 23.5% ethanol,
0.5% SDS,
0.2% Triclosan, 0.1% Antifoam A, pH 9.5. Samples were homogenized by hand
mixing and
returned to the lab under ambient temperature conditions where a T=0 aliquot
(250 ilL) was
collected and DNA extracted. Remainder of the samples were stored at room
temperature
for 4 and 14 days, with aliquots removed and DNA extracted at each time point.
Agarose gel electrophoresis revealed that the 300 mM CDTA composition at pH
9.5 (104B
pH 9.5) stabilized high molecular weight DNA for at least 14 days, and
exhibited superior
stabilization of high molecular weight DNA than did the other two compositions
containing 50
mM CDTA composition at either pH 9.5 or 11.5 (data not shown). However, the
presence of
intact, high molecular weight DNA does not reliably indicate that a snap-shot
of the
microbiome was achieved. In the absence of an effective stabilization
solution, bacterial
species can replicate or die off, without altering the total amount of DNA, as
well as its
quality. The microbiome profiles of the samples were therefore examined via
PCR of
43
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
bacterial 16S rRNA gene and DGGE analysis of the amplicons, as described in
the Materials
and Methods section above.
Referring to Figure 4 and Table 5, DGGE analysis revealed that the 300 mM CDTA
composition at pH 9.5 exhibited excellent stabilization of the microbiome
profile (94-96%
similarity compared to t=0 control) for at least 14 days at room temperature.
The
effectiveness of the 300 mM CDTA composition at pH 9.5 at stabilizing the
microbiome
profile was surprisingly superior to that of the 50 mM CDTA composition at pH
9.5, which
exhibited only 15% similarity compared to t=0 control after 14 days at room
temperature.
The pH 11.5 composition with 50 mM CDTA seemed to 'rescue' somewhat the
considerable
degradation of DNA per the microbiome profile seen in pH 9.5 composition with
50 mM
CDTA.
Hence, a combination of high concentration of CDTA and considerably alkaline
pH is
required to stabilize the microbiome profile of fecal samples.
Table 5: Microbiome profile analysis of fecal samples stored in various
compositions for 14
days at room temperature.
Test Composition Days at Room % similarity compared
[All compositions below also contained 23.5% Temperature .. to *pH 9.5,
300 mM
ethanol, 0.5% SDS, 0.2 % Triclosan and 0.1% CDTA at day 0
Antifoam A]
*pH 9.5, 300 mM CDTA 0 100
pH 9.5, 300 m M CDTA 4 96
pH 9.5, 300 mM CDTA 14 94
pH 11.5 (50 mM13-Alanine), 50 mM CDTA 4 87
pH 11.5 (50 mM13-Alanine), 50 mM CDTA 14 78
pH 9.5, 50 mM CDTA 4 91
pH 9.5, 50 mM CDTA 14 15
In a third experiment, the relationship between pH and the concentration of
CDTA in the
present composition was addressed further. Aliquots (400 mg) from the feces of
a healthy
donor was transferred into tubes containing a 7.9 mm stainless steel metal
ball and 2 mL of
one of two compositions: 1) 300 mM CDTA, 23.5% ethanol, 0.5% SDS, 0.2%
Triclosan,
44
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
0.1% Antifoam A, pH 9.5; and 2) 50 mM CDTA, 23.5% ethanol, 0.5% SDS, 0.2%
Triclosan,
0.1% Antifoam A, pH 7.4. Samples were homogenized by hand mixing and returned
to the
lab under ambient conditions where a T=0 aliquot (250 L) was collected and
DNA
extracted. Remainder of the samples were stored at room temperature for 4 days
before a
second aliquot was removed and processed.
Agarose gel electrophoresis revealed that 300 mM CDTA composition at pH 9.5
stabilized
intact high molecular weight DNA in feces to a greater extent than did the 50
mM CDTA
composition at pH 7.4 over 4 days at RT, and DGGE analysis indicated that this
composition
also exhibited superior stabilization of the fecal microbiome profile (97%
similarity to 1=0
versus 10% similarity to T=0, respectively ¨ see Figure 5 and Table 6). The
microbiome
profile stability of feces homogenized with the pH 7.4 composition (10%
similarity to T=0
after 4 days at RD was also considerably lower than the microbiome profile
stability of feces
homogenized with the 50 mM CDTA composition at pH 9.5 (91% similarity to T=0
after 4
days at RT, as noted above).
Table 6: Microbiome profile analysis of fecal samples stored in various
compositions for 4
days at room temperature.
Test Composition Days at Room % similarity of sample
[All compositions below also contained Temperature compared to control
23.5% ethanol, 0.5% SDS, 0.2 % sample do for each
Triclosan and 0.1% Antifoam A] composition
pH 9.5, 300 mM CDTA 0 100
pH 9.5, 300 m M CDTA 4 97
pH 7.4, 50 mM CDTA 0 100
pH 7.4, 50 mM CDTA 4 10
In a fourth experiment, the relationship between pH at a fixed, high
concentration of CDTA in
the present composition was addressed. Aliquots (400 mg) from the feces of a
healthy donor
were transferred into tubes containing a 7.9 mm stainless steel metal ball and
2 mL of one of
two compositions: 1) 300 mM CDTA, 23.5% ethanol, 0.5% SDS, 0.2% Triclosan,
0.1%
Antifoam A, pH 7.4; and 2) 300 mM CDTA, 23.5% ethanol, 0.5% SDS, 0.2%
Triclosan, 0.1%
Antifoam A, pH 9.5. Samples were homogenized by hand mixing and returned to
the lab
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
under ambient conditions where a T=0, 24 hours, and 9 days an aliquot (250
pi.) was
collected and DNA extracted.
Agarose gel electrophoresis demonstrated that fecal samples mixed with a
composition at
pH 9.5 exhibit superior stabilization of high molecular weight DNA as compared
to fecal
samples mixed with a composition at near neutral pH conditions (pH 7.4), even
in the
presence of high (300 mM) concentrations of CDTA (see Figure 6).
Taken together with the results shown in Example 1, these experiments indicate
that
optimal conditions for preserving intact, high molecular weight DNA and stable
microbiome
profiles during room temperature storage exist when the pH of the composition
is greater
than or equal to 9.5, preferably from about pH 10.5-11.5 or about pH 11, and
the
concentration of CDTA is greater than 50 mM, preferably at least about 150 mM,
most
preferably about 300 mM.
Example 3 ¨ Stabilization of Feces Following Mixing with Glass Beads and
Stainless
Steel Beads
Feces from a healthy donor was transferred in 400 mg aliquots into four tubes
containing: 1)
2 mL stabilizing solution 104B pH 9.5 (as defined above) and four 4 mm plus
ten 2 mm glass
beads; 2) 2 mL stabilizing solution 104B pH 11(as defined above) and four 4 mm
plus ten 2
mm glass beads; 3) 2 mL stabilizing solution 104B pH 9.5 and one 6 mm
stainless steel ball;
4) 2 mL stabilizing solution 104B pH 11 and one 6 mm stainless steel ball. All
four tubes
were shaken by the donor by hand until mixed and brought back to the lab under
ambient
conditions. Within 3-4 hours of sample collection, DNA was extracted,
quantified and 80 ng
of each purified sample was run on an agarose gel (see Materials and Methods,
and Figure
7). Glass bead samples were vortexed and steel ball-containing samples were
shaken prior
to removal of an aliquot.
This example demonstrates the benefit of using a stainless steel mixing ball
for stabilizing
intact, high molecular weight DNA (>23 Kb) in freshly collected feces at room
temperature.
Mixing feces samples in laboratory tubes containing the present compositions,
at both pH
9.5 and 11, and a single, dense stainless steel ball (Figure 7B) proved to be
superior to
mixing with multiple small glass beads of two sizes (Figure 7A) when comparing
the quality
of high molecular weight DNA on agarose gels. Hand mixing of feces with
multiple glass
beads and the present composition (104B pH 9.5) took significantly more time
than mixing
with a stainless steel ball, and the latter demonstrated a superior result in
terms of
preservation of intact, high molecular weight DNA. An improvement in DNA
integrity in
samples mixed with glass beads was surprisingly observed with an even more
alkaline (pH
46
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
11) composition, suggesting that both the mixing/homogenization means and the
pH of the
stabilizing solution is critical.
Example 4¨ Volume Tolerance of Present Composition
Feces is a non-homogeneous biological sample which can vary significantly in
appearance
or hardness, according to the state of the digestive system, diet and general
health.
Normally stool is semisolid, with a mucus coating. The Bristol stool scale or
chart is a
medical aid designed to classify the form of human feces into seven
categories, ranging from
type 1 (separate hard lumps, like nuts) to type 7 (entirely liquid, no solid
pieces, over 90%
water). In general, feces consist of about 70-80% water, 20-30% of solid
matter, but this
percentage varies according to sample type (1-7) or residence time of feces in
the intestine.
Variability between feces in hardness and water content pose a significant
challenge for
feces collection and consistent, complete mixing with a stabilizing solution.
Type 1-3
samples are particularly difficult to fully disperse in stabilizing solution
to produce a
homogenous liquid, without diluting the sample (and hence DNA) too far for
downstream
analysis. Also, type 1-3 samples have a greater tendency than other sample
types to slowly
absorb liquid, e.g. stabilizing solution, leading to a thick, semi-solid
suspension which can be
difficult to pipette in the laboratory. The higher water content of type 4-7
samples and softer
consistency make these samples easier to mix in stabilizing solution and
pipette. During
processing, variability can also be introduced by the method (or commercial
kit) used to
extract DNA from fecal samples.
Given the non-homogeneous nature of feces, the robustness of the present
composition to
stabilize total, intact, high molecular weight DNA was compared in the
following ratio
experiments. In two separate experiments, three healthy donors collected feces
samples
(400 mg) into tubes containing a 7.9 mm stainless steel ball and various
volumes of 104B pH
11 stabilizing solution (defined above), to achieve the following ratios of
feces: stabilizing
solution - 1:3, 1:4, 1:5, 1:6, 1:8 and 1:10. Note, both the "Actual ratio" and
targeted "Ratio" is
indicated on the gels, since it is very difficult to repeatedly collect
precisely 400 mg of feces
with a crude tool. Tubes were weighed before and after sample collection to
determine the
exact amount of feces collected per volume of composition. Tubes were shaken
by hand and
2501AL aliquots were removed at T=0 (Figure 8A) and following 6 days (Figure
8B), 7 days
(Figure 8C), 14 days (Figure 8D), 1 month (Figure 8E) and 2 months (Figure 8F)
at room
temperature. In some case, two aliquots were extracted to demonstrate
reproducibility of
replicates (Figure 8A, C-F). DNA was extracted and 80 ng was run on 1% agarose
gels
(Figures 8A-F). In lanes marked with an asterisk (*), less than 80 ng of DNA
was loaded due
to the fact that some samples had a DNA concentration less than 10 ng/l_ once
purified.
47
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
DGGE gels (Figure 10A and 10B) also were performed in these experiments and
percent
similarities analyzed to determine the stability of the microbiome profile in
these samples.
This example demonstrates that a wide range of feces: stabilizing solution
ratios resulted in
intact, high molecular weight DNA in samples from T=0 to at least 2 months
storage at room
temperature (Figures 8A-F). As little as 0.8 mL to as much as 5.4 mL of the
present
composition successfully stabilized DNA and microbiome profiles contained in
400 mg of
feces for at least 2 months under these conditions (Figures 8A-F and 10A-B).
This broad
`working' range gives the researcher comfort that donors can transfer highly
variable
amounts of fecal sample into tubes containing a fixed volume of stabilizing
solution and the
sample will be stable for at least 2 months at room temperature. Triplicate
sample aliquots
(Figure 9) analyzed using DGGE demonstrated that the microbiome profile
between aliquots
taken from the same feces specimen was very consistent (.?:. 97%). In
addition, analysis of
DGGE gels for the ratio experiments' samples showed that microbiome profiles
were highly
stabilized (_?. 88% at 7 days; ?. 91% at 14 days; ?.79% at 2 months) in a
broad range of
feces:stabilizing solution of the present composition (1 : 1.8 to 1 : 10.6)
for prolonged periods
at room temperature (Figure 10A and 10B).
Preferred ratios of feces:stabilizing solution can therefore range from about
1:1 to 1:20,
preferably 1:1 to 1:10, more preferably 1:3 to 1:8, and most preferably the
ratio of
feces:stabilizing solution is about 1:5.
The compositions described herein permit researchers to revolutionize how they
collect large
numbers of fecal samples. No longer do they need to limit studies due to the
costs and
logistics of shipping samples on dry ice or storing hundreds-thousands of
fecal samples in
freezers for months. Samples collected into tubes containing in the present
composition can
be shipped at ambient temperature in a bubble envelope and stored at room
temperature in
the lab for batch processing at the researcher's convenience.
Example 5 ¨ Stabilization of Samples in the Present Composition and Extreme
Temperatures
The various compositions described herein effectively and rapidly stabilize
high molecular
weight DNA and microbiome profiles in feces of human healthy donors at
'ambient'
temperature. As noted above, 'ambient' means typical exposure temperatures
observed
during the collection, transport, storage and processing of biological
samples. Depending
upon where in the world the biological sample is collected/transported/stored,
temperatures
can easily range from -20 C to 50 C, sometimes in a short period of time. It
is known in the
art that untreated biological samples degrade over these temperatures,
particularly elevated
48
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
temperatures. There is a need for a robust, universal biological sample
stabilizing solution to
maintain DNA in collected samples as close to the in vivo state as possible,
i.e., prevent
degradation of existing intact, high molecular weight DNA and/or prevent
further degradation
of partially degraded nucleic acid, such as human DNA in fecal samples, and
stabilize the
microbiome profile of fecal samples.
Table 7. Compositions tested.
Name Composition
104B 300 mM CDTA, 50 mM p-alanine, 23.5% ethanol, 0.5% SDS, 0.1% Antifoam
A, pH 11
CBE 300 mM CDTA, 50 mM P-alanine, 23.5% ethanol, pH 11
CB 300 mM CDTA, 50 mM 13-alanine, pH 11
CBS 300 mM CDTA, 50 mM 13-alanine, 0.5% SDS, pH 11
CBSA1 300 mM CDTA, 50 mM13-alanine, 0.5% SDS, 0.1% Antifoam A, pH 11
CBSA2 300 mM CDTA, 50 mM p-alanine, 0.5% SDS, 0.01% Antifoam A, pH11
The performance of 6 DNA stabilizing compositions (Table 7), developed by the
inventors,
was tested and compared over a broad range of ambient temperatures, e.g. -20
C, room
temperature (generally 19-23 C), 37 C, and 50 C, with complex, non-
homogeneous,
variable fecal samples. In the first experiment, 2 healthy donors each
transferred 400 mg
feces into 6 tubes containing 2 mL of the different compositions (Table 7) and
one 7.9 mm
stainless steel ball. Tubes were shaken by hand to homogenize the fecal
samples, an aliquot
(250 p,L) was immediately removed for DNA extraction (T=0) and then tubes were
stored at
37 C for 7 and 21 days.
Figures 11A and 11B demonstrate that all compositions tested stabilized
intact, high
molecular weight DNA for at least 3 weeks when fecal samples were stored at 37
C. After 21
days at 37 C, the concentration of DNA recovered from stool samples stored in
CBS,
CBSA1, and CBSA2 compositions was lower than samples in the other
compositions,
leading to fainter bands on the agarose gels for donor A and B (Figure 11A and
11B).
Surprisingly, DGGE analysis (Figure 12A and 12B) showed the microbiome profile
in these
samples was also stable for the first week at 37 C, an optimum temperature for
growth of
fecal bacteria, and started to change prior to the 21 day time point. In
addition to 300 mM
CDTA, buffered to pH 11, ethanol appears to be beneficial for stabilization or
recovery of
both high molecular weight DNA and microbiome profile.
In the second experiment, 3 healthy donors each transferred 400 mg feces into
3 tubes
containing 2 mL of 104B and one 7.9 mm stainless steel ball. Tubes were shaken
by hand to
49
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
homogenize the fecal samples, an aliquot (250 JAL) was immediately removed for
DNA
extraction (T=0), and then tubes were stored at 50 C for 3 and 5 days, room
temperature for
1 month, and -20 C for 1 month (Figures 13A-E). Figures 13A-E demonstrates
that 104B
stabilized high molecular weight DNA for at 5 days at 50 C (Figure 13B-C), 1
month at room
temperature (Figure 13D), and 1 month at -20 C (Figure 13E). Triplicate fecal
samples
collected by each donor all contained intact, high molecular weight DNA,
irrespective of
temperature or time period tested.
In the third experiment, 3 healthy donors each transferred 400 mg feces into 3
tubes; 2 tubes
contained 2 mL of 104B and CBE (Table 7) and one 7.9 mm stainless steel ball
each; the
third tube was empty (none). Tubes with stabilizing solution were shaken by
hand to
homogenize the fecal samples, an aliquot (250 IAL.. or 250 mg) was immediately
removed
from each tube for DNA extraction (T=0), and then tubes were stored at 50 C
for 5 and 14
days or -20 C for 11 days (Figure 14 A-D). Figures 14A-C demonstrates that
both 104B and
CBE maintained intact, high molecular weight DNA for at least 2 weeks at 50 C,
while
control (none) samples showed signs of degradation over time. Surprisingly,
DGGE analysis
(Figure 15A and 15B) showed the microbiome profile in these samples was also
stable for 2
weeks at 50 C, an extreme temperature for biomolecules like DNA.
Interestingly, the percent
similarities were higher in samples stored at 50 C for 5 days, not 14 days,
indicating that
prolonged exposure to such an extreme temperature may lead to some chemical
instability
of the DNA itself.
Figure 14D shows that both 104B and CBE maintained high molecular weight DNA
in -20 C
frozen (and subsequently thawed) samples for at least 11 days. However, in the
absence of
stabilizing solution, feces showed characteristic signs of DNA degradation at -
20 C. In donor
A (none) sample, the majority of high molecular weight DNA was degraded and
appeared as
a smear on the agarose gel. In contrast, a small amount of high molecular
weight DNA could
still be detected in donor B and C samples, indicating donor variability. DGGE
analysis of
samples without stabilizing solution confirmed the microbiome profile was not
stable at -
20 C; % similarity to the control T=0 was 52 and 69% for donor A and C,
respectively. In
contrast, the microbiome profile was stable in 104B and CBE for 11 days at -20
C, as
indicated by the high percent similarities to control (none) samples (Figure
16A and 16B).
Taken together these examples demonstrate that both 104B and CBE stabilize DNA
in fecal
samples stored at extreme temperatures for prolonged periods of time.
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
Example 6¨ Stability with Freeze/Thaw Cycling of Feces Samples Incubated in
Present Composition
As discussed above, the microbiome profile is known in the art to change when
feces is
exposed to just one round of freezing and thawing for storage or banking
purposes. This
degradation adds an unnecessary bias to all collected samples transported
and/or stored at
subzero temperatures. In the present example, feces was collected from 3
healthy donors
and 400 mg samples were transferred to empty tubes and tubes containing 2 mL
of the
present composition ("104B pH 9.5"; as defined above) with glass beads (four 4
mm and ten
2 mm beads). Tubes containing stabilizing solution and glass beads were
vigorously
vortexed until completely mixed. Following removal of a 250 mg or 1AL aliquot
for DNA
extraction at day 0, sample tubes were stored in a -20 C freezer and, over the
course of ten
days, cycled five times between the freezer and room temperature with 24 hours
at each
temperature. Sample tubes were thawed at 50 C for 3 hours, an industry
standard method.
Agarose gel analysis of day 0 aliquots demonstrates that each donor's feces
contained high
molecular weight DNA when collected into the present composition (Figure 17).
Surprisingly,
after 5 cycles of freeze/thaw (F/T) the DNA remained intact (Figure 17). DGGE
analysis
confirmed the microbiome profile of samples in the present composition
remained stable at
94% following 5 F/T cycles (Figure 18). In stark contrast, unprotected samples
showed
considerable degradation of the microbiome profile. After just one F/T cycle,
the profile was
only 52% similar to the profile of the day 0 'freshly collected' sample, prior
to -20 C
exposure. Hence, the present composition not only preserves intact, high
molecular weight
DNA with multiple rounds of freezing and thawing, it stabilizes the microbiome
profile as well,
dramatically reducing the bias associated with these storage conditions.
Example 7 ¨ Homogenization of Fecal Samples Collected in the Present
Composition
As described above, the inventors experimented with numerous different
materials which
could be used in a standard, commercially-available 10 mL laboratory and/or
transport tubes
(92 mm x 15.3 mm, internal diameter of about 12.9 mm) to completely and
reliably
homogenize fecal samples of all types (1-7, Bristol Stool Scale). It was
determined that the
mixing should be done by hand and in a relatively short period of time (within
180 seconds)
to ensure that donors will comply and consistently provide stabilized
biological samples. A
person skilled in the art will understand how to select an appropriate
homogenization means
for containers larger or smaller than the one used in the present Examples
(see Detailed
Description).
51
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
A standard, disposable 3 mL syringe was modified to collect and transfer a
small, volumetric
amount of feces into the collection tube above, containing the present
composition ("104B
pH 11"; defined above) and homogenization means. The tapered tip or fitting
for the needle
of the syringe was cut off to expose the barrel of uniform diameter. The
plunger was pre-set
to a position which facilitated the collection of a consistent amount of
feces, e.g. 400 mg,
when it was pushed into a container containing feces. A small vent hole was
drilled in the
barrel of the syringe for air to escape during fecal sample collection. The
syringe with loaded
sample was transferred to the opening of the tube and the plunger was
depressed,
depositing the 400 mg sample into the tube containing 2 mL of stabilizing
solution and the
homogenization means (e.g. homogenization ball, specified below). The tube was
capped
and shaken by hand for about 20-40 seconds, longer (1-3 minutes) for hard type
1 samples
(see below). After vigorously shaking the sample in a back and forth motion,
in the presence
of the homogenization means, the fecal sample was distributed in the
stabilizing solution.
When the selected container is a laboratory or transport tube/vial, a
homogenization "ball" or
"sphere" of the appropriate size, shape and density is critical for complete
dispersion of non-
homogeneous, complex samples in the present composition. Thorough
homogenization of
the collected sample at the time of collection is also critical for optimal
stabilization of human
and microbial DNA, as evidenced by the presence of intact, high molecular
weight DNA as
well as stabilization of the microbiome profile as exemplified via PCR of
bacterial 16S rRNA
gene and DGGE analysis of the amplicons. As described above, for a spherical
homogenization means, the bottom of the transport tube/vial should also be
round, mirroring
the shape of the homogenization means, to prevent solid matter from being
compacted into
dead spaces inside the tube. For instance, optimal homogenization of fecal
samples
(particularly type 1-3) with spherical homogenization means is very difficult
to achieve with
conical- or flat-bottomed tubes. A spherical homogenization means cannot make
direct
contact with the conical surface nor 90 degree angles where the vertical tube
walls intersect
the base, causing compaction of fecal matter in these dead spaces/areas.
The following Tables 8-10 illustrate some of the different commercially-
available materials
tested by the inventors to find the optimal homogenization means for a
standard
laboratory/transport tube (e.g. Cat. No. 60.610, Sarstedt).
52
CA 02941764 2016-09-07
WO 2015/131291 PCT/CA2015/050173
Table 8. Mixing time (seconds) for balls of different material, diameter and
number.
Alumina
Tungsten Carbide Oxide Silicon Nitride
Glass (2.65g/m3)
(15.63g/cm3) (3.95g/c (3.21g/cm3)
m3)
2.0mm
Feces
7.1mm 7.9mm 7.9mm 7.1mm 7.9mm 2mm 3.5 4mm 12.7mm &
Sampl
mm
4.0mm
e Type
_______________________________________________________________________
1 2 1 2 1 1 1 4 10 4 4 1
10 & 4
1 140 80 100 80 ' X X X X X X X
X X
2 40 30 40 40 X X X X X X X
X X
3 30 30 30 20 X X X X X X X
X X
4 15 10 10 10 ' 100 160 160 X X X X X
X
5 15 10 10 10 100 135 135 60 60 60 50 X 50
6 10 10 10 10 50 65 60 40 30 30 30 X 30
7 ND ND ND ND ND ' ND ND ND ND ND ND ND
ND
ND, not determined; X, >180 seconds
Table 9. Mixing time (seconds) for stainless steel balls of different
diameter.
Stainless Steel Ball (7.6-7.9g/cm3)
Feces 4.8mm 5.6mm 7.1mm 7.9mm 8.7mm 9.5mm 10.3mm 11.1mm
Sampl
2 4 6 1 2 1 2 1 2 1 2 1 2 1
1
e Type
18 18
1 X X X XX X X 145 60 X X 180 X
0 0
2 X ' 90 90 X 60 60 50
80 50 - 40 50 50 X - X 90 '
3 X 90 90
100 90 80 60 35 50 40 30 45 30 65 80
4 X 100 100 120 95 55 25 20 15 25 10 25 10 20
25
50 ' 60 50 50 40 50 20 20 20 20 10 15 10
10 15 '
6 30 30 30 30 20 20 10 20 10 20 10 10 10 10 20
7 ND ND ND ND ND ND ND ND ND ND ND ND ND ND
ND
_
ND, not determined; X, >180 seconds
53
CA 02941764 2016-09-07
WO 2015/131291 PCT/CA2015/050173
Table 10. Mixing time (seconds) for stainless steel balls of different
diameter and number.
Stainless Steel Ball (7.6-7.9g/cm3)
5.6mm 7.1mm 7.1mm 7.9mm 7.9mm
Feces
Sample
4.8mm 4.8mm 5.6mm 4.8mm 7.1mm
Type
1 each 1 each 1 each 1 each 1 each
1 X X X X X
2 60 60 60 50 50
3 70 70 70 60 40
4 100 60 60 50 25
30 30 20 20 20
6 30 30 20 20 10
7 ND ND ND ND ND
ND, not determined; X, >180 seconds
Feces of sample types 1 and 2 are very dense and contain little water, making
them
impenetrable for dispersion by hand in the present composition within a
reasonable period of
time (< 3 minutes), without a homogenization means. For softer feces (type 3-
6) a
homogenization means was still required and the duration of mixing the tube by
hand
reduced considerably with increasing sample type (Tables 8-10). A
homogenization means
was not essential to disperse sample type 7 or diarrhea with the present
composition. In this
context, the purpose of the "homogenizer" was to completely disrupt and
disperse a non-
homogeneous solid or semi-solid sample throughout the stabilization solution,
without the
use of electricity or batteries.
Important features of the homogenization means include 1) density of the
material, 2) size
with respect to the internal diameter of the container for the biological
sample, and 3) shape
with respect to the container. Glass (about 2.0-4.5 g/cm3)/poly(methyl
methacrylate or
PMMA (about 1.2 g/cm3)/silica (about 1.6-2.0 g/cm3)/zirconia (about 6.02
g/cm3)/cellulose
acetate (about 1.3 g/cm3)/polyethylene (about 0.9-1.3 g/cm3) particles (< 1.2
mm) and small
beads (L..4 mm) were not sized, nor dense enough, to function as a homogenizer
for type 1-4
feces within a standard laboratory tube having an internal diameter of 12.9 mm
(Table 8).
Importantly, even large 7.9 mm balls made from alumina oxide (3.95 g/cm3) or
7.1-7.9mm
silicon nitride (3.21 g/cm3) and 12.7 mm glass marbles were not able to
disperse type 1-3
feces samples (400 mg) in 2 mL of the present composition in less than 180
seconds (Table
54
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
8). Surprisingly, even after 180 seconds of shaking the tube hard, solid
matter remained
intact in the present composition. These experimental results led to the
testing of more
dense materials, i.e. densities > 3.95 g/cm3. Unfortunately, balls with
densities between 3.95
g/cm3 and 7.6 g/cm3 were not commercially available and therefore couldn't be
tested with
fecal samples.
Next, stainless steel (7.6-7.9 g/cm3, Tables 9 and 10) and tungsten carbide
balls (15.63
g/cm3, Table 8) were tested with 400 mg fecal samples in 2 mL of the present
composition
within a round bottom tube. Surprisingly, even hard nut-like type 1 fecal
samples were
homogenized by 7.1-7.9 mm tungsten carbide and 7.1-8.7 mm stainless steel
balls in 140
and __.180 seconds, respectively. Type 2 samples were homogenized by 7.1-7.9
mm
tungsten carbide and 7.1-8.7 mm stainless steel balls in 40 seconds and 80
seconds,
respectively. Tungsten carbide (7.1- 7.9 mm) and stainless steel balls (7.1-
8.7 mm)
homogenized type 3 samples in 30 and L.c. 80 seconds, type 4 samples in 15 and
55
seconds, type 5 samples in 15 and 50 seconds, and type 6 sample in 10 and 22
seconds, respectively.
Similarly, balls with densities between 7.9 9/cm3 to 15.63 g/cm3 could not be
sourced or
tested; however, one skilled in the art would expect such homogenization means
to disrupt
fecal samples certainly in less than 180 seconds in the 7.1-8.7 mm size range.
Solely for
cost and ease of sourcing, stainless steel balls were preferred to tungsten
carbide balls and
the optimal diameter was 7.1-8.7 mm in diameter. Addition of a second ball of
the same size
generally proved beneficial in reducing the mixing time (Tables 8 and 9). In
some instances,
combinations of balls of more than one size were beneficial for reducing the
time required to
homogenize fecal samples (Table 10).
Given that 7.1-8.7 mm balls performed the best in tubes with 12.9 mm internal
diameter,
about 2.1-2.9 mm clearance on either side of the ball provided the optimal fit
in the tube to
homogenize the sample in a short period of time. When the stainless steel
balls were 5.6
mm or 9.5 mm in diameter, the mixing time for hard type (1-4) fecal samples
increased.
Hence, given these results for fecal samples ranging in consistency from solid
to liquid, 7.9
mm stainless steel balls have been preferably employed as homogenization means
in
examples described herein, unless otherwise stated.
Example 8 ¨ Stabilization of the Gut Microbiota Profile Using the Present
Composition
Analysis of the gut microbiota has been of increasing interest to researchers
investigating
the beneficial and deleterious roles of microorganisms in human health. For
any analysis of
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
the gut microbiota, it is essential to accurately capture a "snap-shot" of the
microbiota profile
(i.e., ensuring the relative abundance of Operational Taxonomic Units [OTU]
remains
unchanged from the time of collection to time of sample processing and
analysis) that
represents the in vivo state; thus, sample stabilization at the time of
collection is of
paramount importance to such studies. Current methods for stool sample
collection and
microbiota analysis involve transport of samples at ambient temperature, 4 C
or frozen.
However, these methods have the potential to expose samples to temperatures
incompatible
with microbiome stabilization and freezing stool specimens has been shown
previously to
alter the Firmicutes to Bacteroides ratio (Bahl et al., (2012) FEMS Microbiol
Letters 329:
193-197).
In this example, the stability of the microbiome was assessed using a
sensitive,
commercially-available method, 16S rRNA sequencing of the V4 hypervariable
region. For
this study, four donors each collected one stool specimen and placed equal
amounts of
sample (400 mg) into three tubes without stabilizing solution and six tubes
with stabilizing
solution (300 mM CDTA, 0.5% SDS, 23.5% ethanol, 0.1% Antifoam A, 0.2%
Triclosan, pH
9.5) and a 7.9 mm stainless steel mixing ball. Donors transported the samples
to the lab at
ambient temperature where a T=0 aliquot (250 tL or 250 mg) was removed and DNA
extracted using the PowerFecalTM DNA Isolation Kit (MoBio Laboratories). One
sample per
donor per stabilization condition was stored at each of the test temperatures
(-20 C, 4 C,
23 C, 37 C ¨ in stabilization solution only) for 3 and 14 days, followed by
DNA extraction.
One sample in stabilization solution was exposed to five freeze-thaw cycles.
At the indicated time points, DNA from aliquots was extracted and sent for 16S
rRNA
sequencing library preparation, sequencing and bioinformatics. V4
hypervariable region
paired-end amplicon sequencing was performed using the IIlumina MiSeqe (250
cycles).
Figures 19 and 20 present data that indicates that samples fully preserved in
stabilization
solution have high degree of similarity in OTU abundance.
In Figure 19, principal coordinate analysis (PCoA) based on weighted unifrac
dissimilarity
values demonstrate in two donors (B and D) that samples stored in
stabilization solution over
various temperatures (-20 C, 4 C, ambient temperature, 37 C) and time (3 and
14 days)
exhibit a high level of similarity in OTU abundance as shown by tight
clustering on the PCoA
plot (samples stored in stabilization buffer have sample identification
numbers with a 4 - 9 as
the first digit, e.g. D4 and B4, and are grouped into the "With Stabilizer"
circles for each
donor). In contrast, samples stored without stabilization solution (samples
with identification
numbers with a 0 ¨ 3 as the first digit, e.g. D3-1 and B3-1, and grouped into
the "No
56
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
Stabilization" circles for each donor) demonstrated a loss of similarity in
OTU abundance as
shown by the greater distances between samples. Importantly, when assessing
presence or
absence of OTUs, there was a statistically significant difference between
stabilized samples
and those without stabilization solution in all four donors (p=0.002, 0.002,
0.002 and 0.009
respectively, Unifrac measurement). The greatest profile changes were observed
in samples
stored at -20 C without stabilization solution (samples B2-1, B2-2, D2-1 and
D2-2 on the
PCoA plots), which were significantly different from samples stored at -20 C
in stabilization
solution (p=0.028, Weighted Unifrac measurement); thereby demonstrating that
storing
samples in the novel stabilization solution can prevent changes in microbial
profile observed
in non-stabilized frozen samples (Figure 19).
In Figure 20, proportional abundance at the family-level demonstrates a change
in the
composition of samples stored without the present stabilization solution at
various
temperatures over time (3 and 14 days). In particular, an increase in the
Lachnospiraceae,
Ruminococcaceae and Prevotellaceae and a loss of Bacteroidaceae is observed in
donor
D's samples without stabilization solution compared to baseline. In contrast,
samples stored
with the stabilization solution over various temperatures and time maintained
the microbial
composition of the sample compared to baseline sample.
This data suggests that in order to robustly correlate changes in the gut
microbiota to the
phenotype of interest, it is important to have a reproducible way of
stabilizing the profile at
the point of collection, something that current temperature-based
stabilization methods are
not able to achieve effectively. The stabilization chemistry demonstrated here
has the ability
to maintain the in vivo profile of the gut microbiota (i.e. tight clustering
of OTUs) at various
transport temperatures, allowing researchers to improve data reliability and
inter-study
comparison. This stabilization chemistry will also increase the ease of
unsupervised self-
collection, and will uniquely enable large population studies that are
currently logistically
difficult.
Example 9 ¨ Stabilization of Human DNA in the Present Composition
See Materials and Methods section for further details on fecal sample
collection, extraction
and quantification of DNA, and amplification of human DNA.
Three healthy donors were provided instructions and materials to collect a
fecal sample at
home. After defecating into a large container attached to the toilet,
approximately 400 mg of
feces was immediately transferred into a 10 mL round-bottom tube containing 2
mL of the
present composition ("104B pH 11"; defined above) and one 7.9 mm stainless
steel ball.
After capping the tube, donors shook the sealed tube for about 20 seconds to
homogenize
57
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
the sample in the composition. Donors generally returned the homogenized
samples to the
lab at ambient temperature within 3-4 hours of collection. In the lab, a T=0
aliquot (250 L)
was removed from each tube and the remainder was stored at room temperature
(RT) for 14
days, at which time a second aliquot (250 4) was withdrawn.
DNA was purified from each aliquot using PowerFecal DNA Isolation Kit; DNA
yield was
quantified using PicoGreen fluorescent dye and a fluorometric method (see
Materials and
Methods). Human DNA purified from T=0 and 1=14 day fecal samples was amplified
in real-
time or quantitative PCR (qPCR) using primers targeting the single copy human
thymidylate
synthase gene. The change in Ct (AC) values, i.e., the difference in
triplicate Ct values
resulting from T=0 and T=14 day purified aliquots taken from the same sample,
is shown in
Table 11 below. For each donor, the amount of human DNA detected in purified
samples at
T=0 and T=14 days is equivalent. With less than one cycle difference in DNA
from fecal
samples processed immediately or stored for 2 weeks at RT, this example
demonstrates that
human DNA is stable in the present composition for all three donors.
Table 11. Change in Ct values for human DNA in fecal samples stored at room
temperature
for 14 days or processed at T=0.
ACt (CIA-Co)
Donor A 0.94
Donor B 0.11
Donor C 0.77
Example 10 ¨ The Present Composition Stabilizes the Microbiome Profile at Room
Temperature for 14 Days, and Under Simulated Transport Conditions
The present composition enables the easy self-collection and stabilization of
microbial DNA
from feces for gut microbiome profiling. It is uniquely able to take a
snapshot of the microbial
profile at the moment of collection, and maintain it for 14 days at room
temperature.
In this example, six healthy donors were provided instructions and materials
to collect a fecal
sample at home. After defecating into a large container attached to the
toilet, approximately
400 mg of feces was immediately transferred to a 10 mL round-bottom tube
containing 2 mL
of the present composition ("104B pH 11"; defined above) and one 7.9 mm
stainless steel
ball. After capping the tube, donors shook the sealed tube for about 20
seconds to
58
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
homogenize the sample in the composition. Each of 6 donors collected 3 samples
from the
same bulk fecal sample (n=18 total) into the present composition.
Additionally, 400 mg
aliquots of fresh feces were collected from the same bulk fecal sample by each
donor and
transported in empty 10 mL tubes in a styrofoam box with frozen cold packs as
per Human
Microbiome Project standard procedure (Manual of Procedures - Human Microbiome
Project, 2010).
Baseline DNA extractions were performed within 3 hours of collection. For
baseline analysis,
a 0.25 mL aliquot was taken from 104B pH11 samples and extracted using the
PowerFecal
DNA Isolation Kit (MO BIO Laboratories, Inc.). Each 0.25 mL sample contained
approximately 50 mg feces and 200 pL stabilizing liquid, 104B pH 11.
Equivalent amounts of
feces (approximately 50 mg) were extracted from fresh, unstabilized samples.
Remaining
104B pH 11 and fresh, unstabilized samples were aliquoted and stored at room
temperature
(23 3 C) for 14 days or exposed to simulated transport conditions (50 C for 1
day, 37 C for
3 days or 3 cycles of freeze thaw where one cycle consisted of a minimum of 3
hours at -
20 C and a minimum of 3 hours at 30 C). Additionally, an aliquot of fresh
stool from each
donor was stored at -80 C as a control. After the 14 day hold at room
temperature,
simulated transport conditions or -80 C, a second aliquot was extracted from
all samples
using the PowerFecal DNA Isolation Kit.
DNA concentration and yield were determined using the Quant-iTTm PicoGreen
reagent (Life
Technologies). DNA integrity and stability over time was evaluated by running
approximately
50 ng of purified DNA on a 0.8% agarose gel and staining with ethidium
bromide. A Lambda
Hind III ladder was used to determine the size of purified DNA.
16S rRNA sequencing library preparation, sequencing and bioinformatics were
conducted by
Metanome, Microbiome Discovery Service. V4 hypervariable region paired-end
amplicon
sequencing was performed using the IIlumina MiSeq . Using QIIME and custom
scripts,
sequences were quality filtered. Paired-end reads were assembled and compared
to the
Greengenes database, clustered at 96% by UCLUST. After data normalization,
sample-to-
sample distance was measured using weighted UniFrac on Operational Taxonomic
Unit
(OTU) abundance data (utilizes taxon abundance differences across samples,
employing a
pair-wise normalization by dividing the sum of differences by the sum of all
abundances).
Bray-Curtis distances were measured using pair-wise normalization by dividing
the sum of
differences by the sum of all detected OTU abundances. In all Bray-Curtis
measurements, a
donor matched fresh sample that had been extracted shortly after collection
was used as
one side of the pair-wise comparison. Analysis of the Shannon Index (SI) for
each
stabilization method was performed by measuring the proportion of each OTU
relative to the
59
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
total number of OTUs, and then multiplied by the natural logarithm of this
proportion.
Summation of the resulting product across all OTUs produced the SI for each
sample.
Sample collection methods were compared using the Mann-Whitney test.
Results
The present composition maintains microbiome profile neutrality at the point-
of-collection
The study of the microbiome requires that the profile generated represents the
in vivo
microbial communities present in the donor; thus, the collection and
stabilization method
should not introduce changes to the microbiome. The use of chemical
stabilization buffers
can potentially modify the microbial composition of the sample by accelerating
growth of
some microbes while allowing the decay of others. In ideal conditions, the
stabilization liquid
should be neutral (i.e., it should not introduce any bias to the microbiome).
Comparison of
the 16S rRNA microbiome profile from fresh and 104B pH 11-stabilized t=0
samples showed
that the present composition maintains a neutral profile and does not
introduce bias (Figure
21).
The study of relative OTU abundance by different statistical methods (e.g.,
Weighted
UniFrac) provides a valuable description of the microbial community; however,
it can
obscure the understanding of the microbial community by minimizing the
contribution of low
abundance microbes. Proper study of the microbiome profile requires the
preservation of the
"richness" of the microbial communities. Richness is defined as the
enumeration of microbial
species (OTUs) present in the sample and is highly susceptible to
environmental conditions,
including changes in temperature, pH, oxygen concentration and chemical
composition.
These and other factors can induce bacterial growth or decay, thereby altering
the number of
OTUs detected in the sample.
Fresh and 104B pH 11 stabilized samples from 6 donors were extracted shortly
after
collection. The microbial OTUs identified in 104B pH 11 samples were compared
with the
OTUs present in corresponding fresh samples. Shannon Index (SI) for diversity
was
calculated by converting OTU abundance data into presence/absence calls. Mann-
Whitney
test on the SI values showed no significant difference between 104B pH 11 and
fresh
samples, indicating that 104B pH 11 had no impact on the richness of the
samples (Figure
22).
Sources of variability in fecal sample collection
Bray-Curtis analysis showed systematic dissimilarity within replicates of
fresh and 104B pH
11 t=0 samples. To understand the sources of such dissimilarity, the
variability introduced
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
during collection and processing of fecal samples was evaluated. Biological
variability was
assessed by generating microbiome profiles from three fresh and three 104B pH
11 samples
collected from different sites within the same bulk sample. Technical
variability was
addressed using 104B pH 11 collected samples because this collection system
provides
homogenized liquid samples, reducing experimental errors during processing.
The profiles of
replicate DNA extractions from the same tube (extraction variability) and
replicate
PCR/sequencing from the same DNA (sequencing variability) were compared. Bray
Curtis
dissimilarity distances were generated within the replicate groups and are
shown in Figure
23.
Similar variability was observed in biological replicates of fresh and 104B pH
11 collected
samples (Bray-Curtis distances 0.14 0.01 and 0.11 0.01, respectively).
Analysis showed
that technical and biological variability introduce some dissimilarity to the
16S rRNA
microbiome profile (Bray-Curtis distances biological variability 0.11;
extraction variability 0.09
and sequencing variability 0.08). In conclusion, the source of dissimilarity
observed can be
explained by the technical or biological variability and that 104B pH 11 does
not introduce
any bias.
104B pH 11 effectively preserves microbiome profiles for at least 14 days at
room
temperature
In addition to maintaining profile neutrality, the study of the microbiome
requires the accurate
preservation of microbial community structure overtime. We evaluated the
capability of
104B pH 11 to stabilize samples during storage at 23 C for 14 days.
Paired 104B pH 11-stabilized and fresh samples were extracted at Time Zero
(TO) and
again after storage at room temperature (23 C) for 14 days. Fresh samples were
also
stored at -80 C for 14 days as a control. The similarity of the samples was
evaluated using
Bray-Curtis distances. Mann-Whitney analysis showed no significant differences
between
104B pH 11 samples at 23 C for 14 days and -80 C samples, when compared with
corresponding fresh samples (Figure 24). In contrast, unstabilized samples
showed
significant dissimilarity when compared either to -80 C control or 104B pH 11
stored at
room temperature.
In order to understand the reproducibility among replicates, a cluster
analysis of weighted
Unifrac was performed using fresh, 104B pH 11 collected samples (TO and T14
days) and
unstabilized samples (T14 days). The resulting dendrogram (Figure 25) shows
tight
clustering between fresh and 104B pH 11 stabilized samples, even after 14 days
(96%
similarity). Unstabilized samples clustered together with a high separation
from the fresh
61
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
profile (--63% similarity). Proper stabilization therefore has a large effect
on profile clustering
over time.
104B pH 11 effectively preserves the microbiome profile under simulated
transport
conditions
Samples are commonly exposed to undesirable conditions during transport from
the point of
collection to the processing laboratory. To simulate standard shipping
conditions,
unstabilized and 104B pH 11 stabilized samples were exposed to 50 C for 1 day,
37 C for 3
days or multiple freeze-thaw (FIT) cycles. 104B pH 11 preserved high molecular
weight DNA
bands whereas unstabilized samples showed various degrees of degradation,
particularly
when exposed to 50 C or freeze-thaw cycles (Figure 26).
Finally, 16S rRNA analysis confirmed that 104B pH 11 preserves the microbial
community
structure even at extreme temperatures. Mann-Whitney test comparing Bray-
Curtis
distances of 104B pH 11 samples subjected to common shipping temperatures and
paired
samples held at -80 C showed no significant differences. Conversely,
unstabilized samples
held at 37 C or subjected to freeze-thaw cycles showed significant differences
when
compared with samples held at -80 C (Figure 27).
Conclusions
Stabilization, in the context of Metagenomics, is a multi-dimensional
attribute that
encompasses: a) neutrality (ability to capture unbiased profiles), b)
reproducibility
(homogenous sample material from which highly concordant aliquots can be
taken), and c)
integrity (molecular weight), as measured over time. Based on tightly
controlled experiments
and rigorous analysis, 104B pH 11 effectively stabilized gut microbiota in
human feces
through real-life shipping and handling conditions. This is of utmost
importance to cost-
effective scaling of MWAS, as well as optimizing data quality for biomarker
discovery and
development.
Example 11 ¨ Further Studies on the Role of Chelating Agents in Sample
Stabilization
at Elevated Temperatures
The stability of the microbial profile within the sample is also sensitive to
elevated
temperatures. In these conditions not only may harmful nucleases potentially
be activated,
but also some species may begin to proliferate. The presence of a chelating
agent (CDTA)
is especially beneficial in this case in order to arrest the action of DNAses,
as well as
inhibiting bacterial growth.
62
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
In this experiment, healthy donors collected feces and transferred 400 mg of
feces into a
tube containing a single 7.9 mm stainless steel ball and 2 mL of the present
composition with
varied final concentrations of the chelating agent CDTA: a) 300 mM CDTA, 50 mM
lan in e, 23.5% ethanol, 0.5% SDS, 0.1% Antifoam A, pH 11 ("104B pH11"); b)
150 mM
CDTA, 50 mMI3-alanine, 23.5% ethanol, 0.5% SDS, 0.1% Antifoam A, pH 11, or c)
50 mM
13-alanine, 23.5% ethanol, 0.5% SDS, 0.1% Antifoam A, pH 11 (no chelating
agent). The
samples were homogenized with hand shaking (mix) and then returned to the lab
under
room temperature conditions. Within 24 hours of sample collection, a 250 41_
aliquot was
removed from each tube for DNA extraction (T=0). The collected samples were
then stored
at 40 C for 5 days (T=5) prior to DNA extraction from a second aliquot.
Purified DNA was
quantified and then resolved as bacterial community profiles or fingerprints
using DGGE to
separate 16S rRNA gene PCR amplicons. Percent similarity between samples
(lanes on
DGGE gel), compared to the control sample at T=0 for each composition, was
calculated
separately using Syngene GeneTools software (see Materials and Methods).
Figure 28 demonstrates superior percent similarities or microbiome profile
stability at
elevated temperatures between the 'day 5' samples and 'day 0' for the present
composition
when CDTA is present at a concentration of 150 mM or 300 mM as compared to the
composition without CDTA. This indicates that a chelating agent is required in
the present
composition in order to maintain the microbial profile stability at elevated
temperatures. For
the compositions with 300 mM and 150 mM CDTA, the microbial profiles at 'day
5' were 96%
and 95% similar, respectively, as compared to 'day 0' when feces samples were
stored at
40 C. In comparison, the microbial profile at 'day 5' in the composition with
no CDTA was
71%, as compared to 'day 0' when feces samples were stored at 40 C.
Example 12 ¨ Superior Stabilization of Samples in the Present Composition as
Compared to Prior Art Compositions
Nucleic acids in patient samples tend to degrade after they have been removed
from the
patient. This degradation can diminish the effectiveness of a nucleic acid
integrity assay
that scores a sample as diseased (e.g. cancerous) based on the presence of
intact nucleic
acids. AP Shuber and DH Whitney (US 2008/0124714) describe a method for
stabilizing
nucleic acids in tissue and body fluid samples whereby the stabilization
solution includes a
buffer, a salt, and a chelating agent (e.g. "TEN buffer").
In this experiment, healthy donors collected feces and transferred either 400
mg of feces
into a tube containing a single 7.9 mm stainless steel ball and 2 mL of the
present
composition (Composition 1; 300 mM CDTA, 50 mM f3-alanine, 23.5% ethanol, 0.5%
SDS,
63
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
0.1% Antifoam A, pH 11 ("104B pH 11")) or ii) approximately 400 mg of feces
into a tube
containing 2 mL of "TEN Buffer" (Composition 2; 10 mM Tris-HCI, 1 mM EDTA, 150
mM
NaCI, pH 8, US2008/0124714). The samples in both tubes were homogenized with
hand
shaking (mix) and then returned to the lab under room temperature conditions.
Within 24
hours of sample collection, a 2501AL aliquot was removed from each tube for
DNA extraction
(T=0) and then stored under room temperature conditions for 21 days (T=21)
prior to DNA
extraction from a second aliquot. Purified DNA was quantified and then
resolved as bacterial
community profiles or fingerprints using DGGE to separate 16S rRNA gene PCR
amplicons.
Percent similarity between samples (lanes on DGGE gel), compared to the
control sample at
T=0 for each composition, was calculated separately using Syngene GeneTools
software
(see Materials and Methods).
Figure 29 illustrates superior percent similarities or microbiome profile
stability between the
'day 21' samples and 'day 0' for the present composition as compared to the
TEN buffer
composition, indicating that the present composition offers improved DNA
stability over other
known compositions in the art. Donor A and B microbial profiles at 'day 21'
were 82% and
94% similar, respectively, as compared to 'day 0' when feces samples were
stored in the
present "104B pH 11" composition. In comparison, donor A and B microbial
profiles at 'day
21' were 70% and 50% similar, respectively, as compared to 'day 0' when feces
samples
were stored in the composition of US 2008/0124714.
US2008/0124714 also makes reference to a "stabilization buffer" consisting of
0.5 M Tris,
0.15M EDTA, and 10 mM NaCI (pH 9.0) in the Materials and Methods section at
[0059].
However, it is noted that the only stabilizing buffer/solution referenced with
specificity in the
subsequent Examples is the "TEN buffer" noted above, and the claims and
teaching of the
description around the stabilizing solution are also directed to embodiments
encompassing
the "TEN buffer". As such, it is not apparent that the "stabilization buffer"
was tested, or that
it would work in the methods taught in US2008/0124714. Nonetheless, a
comparative study
was conducted comparing the performance of the above "stabilization buffer" of
U52008/0124714 relative to the present composition containing 150 mM CDTA, 50
mM 13-
alanine, 23.5% ethanol, 0.5% SDS, 0.1% Antifoam A, pH 11, under the same
conditions as
described in Example 1.
During assessment of microbiome stability with composition and time,
amplification using
PCR of bacterial 16S rRNA gene and DGGE analysis of the amplicons showed that
the
present composition with 150 mM CDTA at pH 11 maintained a greater percent
similarity
(86%) to the control (T=0) after a 30-day incubation than did the
"stabilization buffer" of US
2008/0124714 containing 150 mM EDTA at pH 9.0 (79%).
64
CA 02941764 2016-09-07
WO 2015/131291
PCT/CA2015/050173
The compositions of the present application therefore provide superior
stabilization of
microbiome profiles in fecal samples relative to the compositions disclosed in
US
2008/0124714.
References
1. Lee YK and Mazmanian SK (2010) Has the microbiota played a critical role in
the
evolution of the adaptive immune system? Science 24: 1768-1773.
2. Aries V, Crowther JS, Drasar BS, Hill MJ, Williams REO (1969) Bacteria and
the
aetiology of cancer of the large bowel. Gut 10: 334-335.
3. Moore WEC and Moore LH (1995) Intestinal floras of populations that have a
high
risk of colon cancer. Applied Envir Microbiol 61(9): 3202-3207.
4. Parsonnet J, Friedman GD, Vandersteen DP, Chang Y, Vogelman JH, Orentreich
N,
Sibley RK (1991) Helicobacter pylori infection and the risk of gastric
carcinoma. N
Engl J Med 325: 1127-1131.
5. Grenham S, Clarke G, Cryan JF, Dinan TG (2011) Brain-gut-microbe
communication
in health and disease. Front Physio 2: 94.
6. Kinross JM, Darzi AW, Nicholson JK (2011) Gut microbiome-host interactions
in
health and disease. Genome Medicine 3:14.
7. Van Nood Els et al. (2013) Duodenal infusion of donor feces for recurrent
Clostridium
difficile. N Engl J Med 368 (5): 407-415.
8. Apajalahti JHA, Kettunen A, Nurminen PH, Jatila H, Holben WE (2003)
Selective
plating underestimates abundance and shows differential recovery of
Bifidobacterial
species from human feces. Appl Environ Microbiol 69(9): 5731-5735.
9. O'Sullivan D (2000) Methods for analysis of the intestinal microflora.
Current Issues
in Intestinal Microbiology 1(2): 39-50.
10. Walker AW, Ince J, Duncan SH, Webster LM, Holtrop G, Ze X, Brown D, Stares
MD,
Scott P, Bergerat A, Louis P, McIntosh F, Johnstone AM, Lobley GE, Parkhill J,
Flint
HJ (2011) International Society for Microbial Ecology Journal 5: 220-230.
11. Wu GD, Chen J, Hoffmann C, Bittinger K, Chen Y-Y, Keilbaugh SA, Bewtra M,
Knights D, Walters WA, Knight R, Sinha R, Gilroy E, Gupta K, Baldassano R,
Nesse!
L, Li H, Bushman FD, Lewis JD (2011) Linking long-term dietary patterns with
gut
microbial enterotypes. Science 334: 105-108.
12. Ley RE, Knight R, Gordon JI (2007) The human microbiome: eliminating the
biomedical/environmental dichotomy in microbial ecology. Environ Microbiol 9:
3-4.
13. Bahl MI, Bergstrom A, Licht TR (2012) Freezing fecal samples prior to DNA
extraction affects the Firmicutes to Bacteroidetes ratio determined by
downstream
quantitative PCR analysis. FEBS Microbial Left 329: 193-197.
14. Olson J, Whitney DH, Durkee K, Shuber AP (2005) DNA stabilization is
critical for
maximizing performance of fecal DNA-based colorectal cancer tests. Diagn Mol
Pathol 14(3): 183-191.
15. Song Y, Garg S, Girotra M, Maddox C, von Rosenvinge EC, Dutta A, Dutta S,
Fricke
WF (2013) Microbiota dynamics in patients treated with fecal microbiota
transplantation for recurrent Clostridium difficile infection. PLOS ONE 8(11):
1-11.
16. Van der Giessen JWB, Eger A, Haagsma J, Haring RM, Gaastra W, van der
Zeijst
BAM (1992) Amplification of 16S rRNA sequences to detect Mycobacterium
paratuberculosis. J Med Microbiol 36: 255-263.
17. Hurley SS, Splitter GA, Welch RA. Test for Johne's Disease. US 4,918,178
18. Kojima K. Process of extracting nucleic acid and process of simultaneously
carrying
out extraction and purification of nucleic acid. US 6,852,495
19. Ariefdjohan MW, Savaiano DA, Nakatsu CH (2010) Comparison of DNA
extraction
kits for PCR-DGGE analysis of human intestinal microbial communities from
fecal
specimens. Nutr J 9: 23.
20. Smith B, Li N, Andersen AS, Slotved HC, Krogfelt KA (2011) Optimising
bacterial
DNA extraction from faecal samples: comparison of three methods. Open
Microbiol J
5: 14-17.
21. McInnes P, Cutting M (2010) Manual of procedures for human microbiome
project.
Core Microbiome Sampling Protocol A; Protocol #07-001 (version 12.0)
22. Brusa T, Canzi E, Pacini N, Zancho R, Farrari A (1989) Oxygen tolerance of
anaerobic bacteria isolated from human feces. Curr Microbiol 19: 39-43.
23. US 2008/0124714 (A.P. Shuber and D.H. Whitney).
All publications, patents and patent applications mentioned in this
Specification are indicative
of the level of skill of those skilled in the art to which this invention
pertains.
The invention being thus described, it will be obvious that the same may be
varied in many
ways. Such variations are not to be regarded as a departure from the spirit
and scope of the
invention, and all such modifications as would be obvious to one skilled in
the art are
intended to be included within the scope of the following claims. The scope of
the claims
should not be limited to the preferred embodiments set for the description,
but should be
given the broadest interpretation consistent with the description as a whole.
66
LEGAL I 34036927.1
Date Recue/Date Received 2022-10-07
