CA 02947802 2016-11-08
Ailanthone and its derivatives for treatment of malignant tumors including
prostate cancer
TECHNICAL FIELD
The present invention relates to the technical field of medicine, in
particular to the
application of medicine monomer ailanthone in treating prostate cancer.
BACKGROUND
Prostate cancer (PCa) is the most common male cancer in many industrialized
countriesl'
2.PCa initially depends on androgen receptor (AR) signaling for growth and
survival. Androgen
ablation therapy causes a temporary reduction in PCa tumor burden, but the
tumor eventually
develops into castration resistant prostate cancer (CRPC) with the ability to
grow again in the
absence of androgens3. Mechanisms of CRPC progression include AR amplification
and
overexpression4' 5, AR gene rearrangement promoting synthesis of
constitutively-active truncated
AR splice variants (AR-Vs)6 and induction of intracrine androgen metabolic
enzymes3' 7. The
canonical human AR has 919 amino acids with a mass of 110 kDa, composed of
four structurally
and functionally distinct domains including the N-terminal domain (NTD, amino
acids 1-537),
DNA-binding domain (DBD, amino acids 537-625), hinge region (amino acids 625-
669) and
ligand binding domain (LBD, amino acids 669-919)8. When activated by
endogenous androgens,
AR translocates into the nucleus, associates with coregulatory factors, and
binds to specific
genomic DNA sequences in the regulatory regions of AR target genes9. Previous
clinical
research showed that targeting AR was a valid therapeutic strategy for
CRPC'(). Indeed, recent
clinical trials have shown that the AR antagonist MDV3100 (MDV)11 and
abiraterone, an
inhibitor targeting androgen synthesis12, are effective against CRPC. However,
recent studies
have reported that AR-Vs which lack the ligand binding domain (LBD) are
resistant to anti-
androgen therapy including MDV and abiraterone13' 14' 15' 16' 17. Since the
major AR-Vs identified
to date have an intact NTD and DBD, they display constitutive activity, which
underlies the
persistent AR signaling in CRPC expressing these variants6' 18' 19.2 .
Collectively, both ligand-
dependent full-length AR (AR-FL) and AR-Vs mediate distinct transcriptional
programs in
cRpci, 22, 23, but AR inhibitors currently in clinical use all target the LBD,
and thus would not
overcome cancer cell resistance driven by constitutively active AR-Vs.
AR is maintained in a ligand binding-competent state through its interaction
with the
foldosome, a protein complex consisting of the chaperones HSP40, HSP70 and
HSP90 together
with the co-chaperones HOP, p23 and the immunophilins FKBP51/52 and BAG-124.
Intriguingly,
some inhibitors of HSP90 such as AT13387 decrease the expression of several
HSP90 client
1
CA 02947802 2016-11-08
proteins including wild-type AR and AR-V7 (an AR splice variant), and also
disrupt nuclear
localization of the AR. A phase I/II clinical trial of AT13387 alone or in
combination with
abiraterone acetate in patients with mCRPC is in progress25. Other HSP90
inhibitors that target
the AR N-terminus including NVP-HSP990 and PF-04929113 have activity in
preclinical
studies26 27.The co-chaperone p23 is over-expressed in multiple types of
cancer, and protects
cancer cells from HSP90 inhibitors28. p23 over-expression is induced upon
treatment with either
androgens or anti-androgens and facilitates PCa cell motility; p23 knockdown
inhibits the
invasiveness of the PCa cell line LNCaP, suggesting an important role of p23
in PCa metastasis
independent of its role as an HSP90 co-chaperone29. The expression of p23
increases AR protein
level, AR ligand binding activity, and AR's target promoter-binding activity;
most importantly,
p23 functions to promote AR activity in an HSP90-independent mechanism
involving the direct
binding to AR30. p23 is also associated with an increased resistance to
etoposide and doxorubicin
in breast cancer cells31 along with elevated expression of a subset of
estrogen-responsive genes32.
p23 over-expression correlates with poor prognosis for breast cancer patients,
implicating p23's
role in breast cancer progression in addition to PCa, supporting the utility
of p23 as a potential
therapeutic target for cancer therapy.
To identify compounds that block the transcriptional activities of both ligand-
dependent
AR-FL and constitutively active AR-Vs, we used the MMTV-luciferase (MMTV-luc)
reporter
system containing AR-binding elements33 to screen approximately 100 compounds
from a
library of natural compounds (including about 1000 natural compounds extracted
from
Traditional Chinese Medicine) and identified a series of small-molecule
compounds termed
Formula (V) Ailanthone (AIL) and its derivatives, which are natural compounds
or derivatives 34'
this study, we find that AIL and its derivatives potently reduce the
transcriptional activities
of both AR-FL and AR-Vs.In addition, AIL and its derivatives decrease the
protein levels of not
only AR-FL but also constitutively active AR-Vs, resulting in cell growth
inhibition as well as
suppression of MDV3100-resistant CRPC metastasis, by binding to p23 protein.
Furthermore,
we evaluate the drug-like properties of AIL and its derivatives including
solubility,
pharmacokinetics, bioavailability, cytochrome P450 (CYP) inhibition and
toxicity. Overall, our
findings provide the first evidence that AIL is a promising lead compound
against CRPC and is
suitable for further pharmaceutical development.
SUMMARY OF THE INVENTION
The present invention provides a use of Formula (I) ailanthone and its
derivatives and
pharmaceutically acceptable salts, solvates, hydrates, polymorphs, co-crystal,
isotopically
2
CA 02947802 2016-11-08
labeled derivatives, and prodrugs thereof, in preparation of medicine for
treating malignant
tumor, such as prostate cancer.
OR3 4
R20, R
OR1
R5
0 leeR6
'0 0
Formula (I)
wherein
X is H; 0; S or NH;
R1, R2 and R3 is H; acyl; aliphatic; alkyl or alkenyl;
R4 and R5 is H; OH; =CH2; ; NH; acyl; aliphatic; alkyl or alkenyl;
when X is H; R6 is acyl; aliphatic; alkyl or alkenyl;
when X is 0, S or NH; R6 is H, acyl, aliphatic, alkyl or alkenyl;
The term "acyl" refers to a group having the general formula ¨C(=0)R7, -
C(=0)0127, -
C(=0)-0-C(=0)R7, -C(=0)SR7; -C(=0)N(R7)2, -C(=S)R7, -C(=S)N(R7)2, -C(=S)SR7, -
C(=NR7)R7, -C(=NR7)0R7, -C(=NR7)SR7, and -C(=NR7)N(R7)2, wherein R7 is
hydrogen;
halogen; substituted or unsubstituted hydroxyl; substituted or unsubstituted
thiol; substituted or
unsubstituted amino; substituted or unsubstituted acyl, cyclic or acyclic;
substituted or
unsubstituted, branched or unbranched aliphatic; cyclic or acyclic,
substituted or unsubstituted,
branched or unbranched heteroaliphatic; cyclic or acyclic, substituted or
unsubstituted, branched
or unbranched alkyl; cyclic or acyclic, substituted or unsubstituted, branched
or unbranched
alkenyl; cyclic or acyclic, substituted or unsubstituted, branched or
unbranched alkynyl;
substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl,
aliphaticoxy, hetero-
aliphaticoxy, alkyloxy, heteroalkyloxy,
aryloxy, heteroaryloxy, aliphaticthioxy,
heteroaliphatiethioxy, alkyloxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy.
The term "aliphatic" includes both saturated and unsaturated, nonaromatic,
straight chain,
branched, acyclic, and cyclic hydrocarbons, which are optionally substituted
with one or more
functional groups. As will be appreciated by one of ordinary skill in the art,
"aliphatic" is
intented herein to include, but is not limited to, alkyl, alkenyl, alkynyl,
cycloalkyl, cycloalkenyl,
and cycloalkynyl moieties. Aliphatic group substituents include, but are not
limited to any of the
substituents described herein, that result in the formation of a stable moiety
(e.g., aliphatic, alkyl,
alkenyl, alkynyl, heteroaliphatic, heterocyclic, aryl, heteroaryl, acyl, oxo,
imino, thiooxo, cyano,
isocyano, amino, azido, nitro, hydroxyl, thiol, halo, aliphaticamino,
heteroaliphaticamino,
3
CA 02947802 2016-11-08
alkylamino, heteroaliphaticamino, alkylamino, heteroalkylamino, arylamino,
heteroarylamino,
alkylaryl, arylalkyl, aliphaticoxy, heteroaliphaticoxy, alkyloxy,
heteroalkyloxy, aryloxy,
heteroaryloxy, aliphatictioxy, heteroaliphaticticoxy, alkylthioxy,
heteroalkylthioxy, arylthioxy,
heteroarylthioxy, acyloxy, and the like, each of which may or may not be
further substituted).
the term "alkyl" refers to saturated, straight- or branched-chain hydrocarbon
radicals
derived from a hydrocarbon moiety containing between one and twenty carbon
atoms by
removal of a single hydrogen atom. In some embodiments, the alkyl group
employed the
invention contains 1-20 carbon atoms. Examples of alkyl radicals include, but
are not limited to,
methyl, ethyl, propyl, n-propyl, isopropyl, butyl, n-butyl, iso-butyl, sec-
butyl, sec-pentyl, iso-
pentyl, tert-butyl, n-pentyl, neopentyl, n-hexyl, sec-hexyl, n-heptyl, n-
octyl, n-decyl, n-undecyl,
dodecyl, and the like, which may bear one or more substituents. Alkyl group
substituents include,
but are not limited to any of the substituents described herein, that result
in the formation of a
stable moiety (e.g., aliphatic, alkyl, alkenyl, alkynyl, heteroaliphatic,
heterocyclic, aryl,
heteroaryl, acyl, oxo, imino, thiooxo, cyano, isocyano, amino, azido, nitro,
hydroxyl, thiol, halo,
aliphaticamino, heteroaliphaticamino, alkylamino, heteroaliphaticamino,
alkylamino,
heteroalkylamino, arylamino, heteroarylamino, alkyl
aryl, arylalkyl, aliphaticoxy,
heteroaliphaticoxy, alkyloxy, heteroalkyloxy, aryloxy, heteroaryloxy,
aliphatictioxy,
heteroaliphaticticoxy, alkylthioxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy, acyloxy, and
the like, each of which may or may not be further substituted).
The term "alkenyl" denotes a monovalent group derived from a straight- or
branched-chain
hydrocarbon moiety having at least one carbon-carbon double bond by the
removal of single
hydrogen atom. In certain embodiments, the alkenyl group employed in the
invention contains 2-
20 carbon atoms. Alkenyl groups include, for example, ethenyl, propenyl,
butenyl, 1-methyl-2-
buten-1-yl, and the like, which may bear one or more substituents. Alkenyl
group substituents
include, but are not limited to, any of substituents described herein, that
result in the formation of
a stable moiety (e.g., aliphatic, alkyl, alkenyl, alkynyl, heteroaliphatic,
heterocyclic, aryl,
heteroaryl, acyl, oxo, imino, thiooxo, cyano, isocyano, amino, azido, nitro,
hydroxyl, thiol, halo,
aliphaticamino, heteroaliphaticamino, alkylamino, heteroaliphaticamino,
alkylamino,
heteroalkylamino, arylamino, heteroarylamino, alkylaryl, arylalkyl,
aliphaticoxy,
heteroaliphaticoxy, alkyloxy, heteroalkyloxy, aryloxy, heteroaryloxy,
aliphatictioxy,
heteroaliphaticticoxy, alkylthioxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy, acyloxy, and
the like, each of which may or may not be further substituted). In an alkenyl
group, a C=C
'`11.<Prij
double bond for which the stereochemistry is not specified (e.g. ¨CH=CHCH3,
4
CA 02947802 2016-11-08
or ) may be in the (E)- or (Z)-configuration.
In certain embodiments, in Formula (I), when X is H; R4 and R5 groups taken
together form
=CH2; the ailanthone and its derivatives are one of Formula (II);
OR3
R20, =
OR1
0 eip,,
o
and pharmaceutically acceptable salts, solvates, hydrates, polymorphs, co-
crystal, isotopically
labeled derivatives, and prodrugs thereof.
wherein,
RI, R2 and R3 is H; acyl; aliphatic; alkyl or alkenyl;
l'he term "acyl" refers to a group having the general formula ¨C(=0)R7, -
C(=0)0R7, -
C(=0)-0-C(=0)R7, -C(=0)S1t7; -C(=0)N(127)2, -C(=S)127, -C(=-S)N(127)2, -
C(=S)S127, -
C(=N127)R7, -C(=NR7)0R7, -C(-=NR7)SR7, and -C(=-NR7)N(R7)2, wherein R7 is
hydrogen;
halogen; substituted or unsubstituted hydroxyl; substituted or unsubstituted
thiol; substituted or
unsubstituted amino; substituted or unsubstituted acyl, cyclic or acyclic;
substituted or
unsubstituted, branched or unbranched aliphatic; cyclic or acyclic,
substituted or unsubstitutcd,
branched or unbranched heteroaliphatic; cyclic or acyclic, substituted or
unsubstituted, branched
or unbranched alkyl; cyclic or acyclic, substituted or unsubstituted, branched
or unbranched
alkenyl; cyclic or acyclic, substituted or unsubstituted, branched or
unbranched alkynyl;
substituted or unsubstituted aryl; substituted or unsubstituted hcteroaryl,
aliphaticoxy,
hctcroaliphaticoxy, alkyloxy, heteroalkyloxy, aryloxy, heteroaryloxy,
aliphaticthioxy,
heteroaliphaticthioxy, alkyloxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy.
The term "aliphatic" includes both saturated and unsaturated, nonaromatic,
straight chain,
branched, acyclic, and cyclic hydrocarbons, which are optionally substituted
with one or more
functional groups. As will be appreciated by one of ordinary skill in the art,
"aliphatic" is
intented herein to include, but is not limited to, alkyl, alkenyl, alkynyl,
cycloalkyl, cycloalkenyl,
and cycloalkynyl moieties. Aliphatic group substituents include, but are not
limited to any of the
substituents described herein, that result in the formation of a stable moiety
(e.g., aliphatic, alkyl,
alkenyl, alkynyl, heteroaliphatic, heterocyclic, aryl, heteroaryl, acyl, oxo,
imino, thiooxo, cyano,
isocyano, amino, azido, nitro, hydroxyl, thiol, halo, aliphaticamino,
heteroaliphaticamino,
alkylami no, heteroaliphaticamino, alkylamino, hetcroalkylamino, arylamino,
heteroarylamino,
5
CA 02947802 2016-11-08
alkylaryl, arylalkyl, aliphaticoxy, heteroaliphaticoxy, alkyloxy,
heteroalkyloxy, aryloxy,
heteroaryloxy, aliphatictioxy, heteroaliphaticticoxy, alkylthioxy,
heteroalkylthioxy, arylthioxy,
heteroarylthioxy, acyloxy, and the like, each of which may or may not be
further substituted).
The term "alkyl" refers to saturated, straight- or branched-chain hydrocarbon
radicals
derived from a hydrocarbon moiety containing between one and twenty carbon
atoms by
removal of a single hydrogen atom. In some embodiments, the alkyl group
employed the
invention contains 1-20 carbon atoms. Examples of alkyl radicals include, but
are not limited to,
methyl, ethyl, propyl, n-propyl, isopropyl, butyl, n-butyl, iso-butyl, sec-
butyl, sec-pentyl, iso-
pentyl, tert-butyl, n-pentyl, neopentyl, n-hexyl, sec-hexyl, n-heptyl, n-
octyl, n-decyl, n-undecyl,
dodecyl, and the like, which may bear one or more substituents. Alkyl group
substituents include,
but are not limited to any of the substituents described herein, that result
in the formation of a
stable moiety (e.g., aliphatic, alkyl, alkenyl, alkynyl, heteroaliphatic,
heterocyclic, aryl,
heteroaryl, acyl, oxo, imino, thiooxo, cyano, isocyano, amino, azido, nitro,
hydroxyl, thiol, halo,
aliphaticamino, heteroaliphaticamino, alkylamino, heteroaliphaticamino,
alkylamino,
heteroalkylamino, arylamino, heteroarylamino, alkylaryl, arylalkyl,
aliphaticoxy,
heteroaliphaticoxy, alkyl oxy, heteroalkyloxy,
aryloxy, heteroaryloxy, aliphatictioxy,
heteroaliphaticticoxy, alkylthioxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy, acyloxy, and
the like, each of which may or may not be further substituted).
The term "alkenyl" denotes a monovalent group derived from a straight- or
branched-chain
hydrocarbon moiety having at least one carbon-carbon double bond by the
removal of single
hydrogen atom. In certain embodiments, the alkenyl group employed in the
invention contains 2-
20 carbon atoms. Alkenyl groups include, for example, ethenyl, propenyl,
butenyl, 1-methyl-2-
buten-1-yl, and the like, which may hear one or more substituents. Alkenyl
group substituents
include, but are not limited to, any of substituents described herein, that
result in the formation of
a stable moiety (e.g., aliphatic, alkyl, alkenyl, alkynyl, heteroaliphatic,
heterocyclic, aryl,
heteroaryl, acyl, oxo, imino, thiooxo, cyano, isocyano, amino, azido, nitro,
hydroxyl, thiol, halo,
aliphaticamino, heteroaliphaticamino, alkylamino, heteroaliphaticamino,
alkylamino,
heteroalkylamino, arylamino, heteroarylamino, alkylaryl, arylalkyl,
aliphaticoxy,
heteroaliphaticoxy, alkyloxy, heteroalkyloxy,
aryloxy, heteroaryloxy, al iphatictioxy,
heteroaliphaticticoxy, alkylthioxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy, acyloxy, and
the like, each of which may or may not be further substituted). In an alkenyl
group, a C=C
double bond for which the stereochemistry is not specified (e.g. ¨CH=CHCH3,
or ) may be in the (E)- or (Z)-configuration.
6
CA 02947802 2016-11-08
In certain embodiments, in Formula (I), when X is H; R1, R2 and R3 is H; the
ailanthone and
its derivatives are one of Formula (III);
HQ OH
- R4
OH =R5
0 os.,
'0 0
and pharmaceutically acceptable salts, solvates, hydrates, polymorphs, co-
crystal, isotopically
labeled derivatives, and prodrugs thereof.
wherein
R4 and R5 is H; OH; =CH2; NH; acyl; aliphatic; alkyl or alkenyl;
The term "acyl" refers to a group having the general formula ¨C(=0)R7, -
C(=0)0R7, -
C(=0)-0-C(=0)R7, -C(=0)SR7; -C(=0)N(R7)2, -C(=S)127, -C(=S)N(127)2, -C(,S)SR7,
-
C(=NR7)R7, -C(=NR7)0R7, -C(=NR7)SR7, and -C(=NR7)N(R7)2, wherein R7 is
hydrogen;
halogen; substituted or unsubstituted hydroxyl; substituted or unsubstituted
thiol; substituted or
unsubstituted amino; substituted or unsubstituted acyl, cyclic or acyclic;
substituted or
unsubstituted, branched or unbranched aliphatic; cyclic or acyclic,
substituted or unsubstituted,
branched or unbranched heteroaliphatic; cyclic or acyclic, substituted or
unsubstituted, branched
or unbranched alkyl; cyclic or acyclic, substituted or unsubstituted, branched
or unbranched
alkenyl; cyclic or acyclic, substituted or unsubstituted, branched or
unbranched alkynyl;
substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl,
aliphaticoxy, hetero-
aliphaticoxy, alkyloxy, heteroalkyloxy,
aryloxy, heteroaryloxy, aliphaticthioxy,
heteroaliphaticthioxy, alkyloxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy.
The term "aliphatic" includes both saturated and unsaturated, nonaromatic,
straight chain,
branched, acyclic, and cyclic hydrocarbons, which are optionally substituted
with one or more
functional groups. As will be appreciated by one of ordinary skill in the art,
"aliphatic" is
intented herein to include, but is not limited to, alkyl, alkenyl, alkynyl,
cycloalkyl, cycloalkenyl,
and cycloalkynyl moieties. Aliphatic group substituents include, but are not
limited to any of the
substituents described herein, that result in the formation of a stable moiety
(e.g., aliphatic, alkyl,
alkenyl, alkynyl, heteroaliphatic, heterocyclic, aryl, heteroaryl, acyl, oxo,
imino, thiooxo, cyano,
isocyano, amino, azido, nitro, hydroxyl, thiol, halo, aliphaticamino,
heteroaliphaticamino,
alkylamino, heteroaliphaticamino, alkylamino, heteroalkylamino, arylamino,
heteroarylamino,
alkylaryl, arylalkyl, aliphaticoxy, heteroaliphaticoxy, alkyloxy,
heteroalkyloxy, aryloxy,
7
CA 02947802 2016-11-08
heteroaryloxy, aliphatictioxy, heteroaliphaticticoxy, alkylthioxy,
heteroalkylthioxy, arylthioxy,
heteroarylthioxy, acyloxy, and the like, each of which may or may not be
further substituted).
The term "alkyl" refers to saturated, straight- or branched-chain hydrocarbon
radicals
derived from a hydrocarbon moiety containing between one and twenty carbon
atoms by
removal of a single hydrogen atom. In some embodiments, the alkyl group
employed the
invention contains 1-20 carbon atoms. Examples of alkyl radicals include, but
are not limited to,
methyl, ethyl, propyl, n-propyl, isopropyl, butyl, n-butyl, iso-butyl, sec-
butyl, sec-pentyl, iso-
pentyl, tert-butyl, n-pentyl, neopentyl, n-hexyl, sec-hexyl, n-heptyl, n-
octyl, n-decyl, n-undecyl,
dodecyl, and the like, which may bear one or more substituents. Alkyl group
substituents include,
but are not limited to any of the substituents described herein, that result
in the formation of a
stable moiety (e.g., aliphatic, alkyl, alkenyl, alkynyl, heteroaliphatic,
heterocyclic, aryl,
heteroaryl, acyl, oxo, imino, thiooxo, cyano, isocyano, amino, azido, nitro,
hydroxyl, thiol, halo,
aliphaticamino, heteroaliphaticamino, alkylamino, hcteroaliphaticamino,
alkylamino,
heteroalkylamino, arylamino, heteroarylamino, alkylaryl, arylalkyl,
aliphaticoxy,
heteroaliphaticoxy, alkyloxy, heteroalkyloxy, aryloxy, heteroaryloxy,
aliphatictioxy,
heteroaliphaticticoxy, alkylthioxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy, acyloxy, and
the like, each of which may or may not be further substituted).
The term "alkenyl" denotes a monovalent group derived from a straight- or
branched-chain
hydrocarbon moiety having at least one carbon-carbon double bond by the
removal of single
hydrogen atom. In certain embodiments, the alkenyl group employed in the
invention contains 2-
20 carbon atoms. Alkenyl groups include, for example, ethenyl, propenyl,
butenyl, 1-methy1-2-
buten-1-yl, and the like, which may bear one or more substituents. Alkenyl
group substituents
include, but arc not limited to, any of substituents described herein, that
result in the formation of
a stable moiety (e.g., aliphatic, alkyl, alkenyl, alkynyl, heteroaliphatic,
heterocyclic, aryl,
heteroaryl, acyl, oxo, imino, thiooxo, cyano, isocyano, amino, azido, nitro,
hydroxyl, thiol, halo,
al iphaticam i no, heteroal iphaticami no,
alkylamino, heteroaliphaticamino, alkylamino,
heteroalkylamino, arylamino, heteroarylamino, alkylaryl, arylalkyl,
aliphaticoxy,
heteroaliphaticoxy, alkyloxy, heteroalkyloxy, aryloxy, heteroaryloxy,
aliphatictioxy,
heteroaliphaticticoxy, alkylthioxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy, acyloxy, and
the like, each of which may or may not be further substituted). In an alkenyl
group, a C=C
double bond for which the stereochemistry is not specified (e.g. ¨CR=CHCH3,
or ) may be in the (E)- or (Z)-configuration.
In certain embodiments, in Formula (1), when Ri, R2 and R3 is H; R4 and R5
groups taken
8
CA 02947802 2016-11-08
together form =CH2; the ailanthone and its derivatives are one of Formula
(IV);
OH
HO,,
OH
Rs
(IV)
and pharmaceutically acceptable salts, solvates, hydrates, polymorphs, co-
crystal, isotopically
labeled derivatives, and prodrugs thereof,
wherein,
X is H; 0; S or NH;
when X is H, R6 is acyl; aliphatic; alkyl or alkenyl;
when X is 0, S or NH; R6 is H, acyl, aliphatic, alkyl or alkenyl;
The term "acyl" refers to a group having the general formula ¨C(=0)R7, -
C(.0)0R7, -
C(.0)-0-C(=0)R7, -C(=0)SR7; -C(=0)N(R7)2, -C(=S)R7, -C(=S)N(R7)2, -C(=S)SR7, -
C(=NR7)R7, -C(=NR7)0R7, -C(=NR7)SR7, and -C(=NR7)N(R7)2, wherein R7 is
hydrogen;
halogen; substituted or unsubstituted hydroxyl; substituted or unsubstituted
thiol; substituted or
unsubstituted amino; substituted or unsubstituted acyl, cyclic or acyclic;
substituted or
unsubstituted, branched or unbranched aliphatic; cyclic or acyclic,
substituted or unsubstitutcd,
branched or unbranched heteroaliphatic; cyclic or acyclic, substituted or
unsubstituted, branched
or unbranched alkyl; cyclic or acyclic, substituted or unsubstituted, branched
or unbranched
alkenyl; cyclic or acyclic, substituted or unsubstituted, branched or
unbranched alkynyl;
substituted or unsubstituted aryl; substituted or unsubstituted heteroaryl,
aliphaticoxy, hetero-
aliphaticoxy, alkyloxy, heteroalkyloxy,
aryloxy, heteroaryloxy, aliphaticthioxy,
heteroaliphatiethioxy, alkyloxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy.
The term "aliphatic" includes both saturated and unsaturated, nonaromatic,
straight chain,
branched, acyclic, and cyclic hydrocarbons, which are optionally substituted
with one or more
functional groups. As will be appreciated by one of ordinary skill in the art,
"aliphatic" is
intented herein to include, but is not limited to, alkyl, alkenyl, alkynyl,
cycloalkyl, cycloalkenyl,
and cycloalkynyl moieties. Aliphatic group substituents include, but are not
limited to any of the
substituents described herein, that result in the formation of a stable moiety
(e.g., aliphatic, alkyl,
alkenyl, alkynyl, beteroaliphatic, heterocyclic, aryl, heteroaryl, acyl, oxo,
imino, thiooxo, cyano,
isocyano, amino, azido, nitro, hydroxyl, thiol, halo, aliphaticamino,
heteroaliphaticamino,
alkylamino, heteroaliphaticamino, alkylamino, heteroalkylamino, arylamino,
heteroarylamino,
alkylaryl, arylalkyl, aliphaticoxy, heteroaliphaticoxy, alkyloxy,
heteroalkyloxy, aryloxy,
heteroaryloxy, aliphatictioxy, heteroaliphaticticoxy, alkylthioxy,
heteroalkylthioxy, arylthioxy,
9
CA 02947802 2016-11-08
heteroarylthioxy, acyloxy, and the like, each of which may or may not be
further substituted).
The term "alkyl" refers to saturated, straight- or branched-chain hydrocarbon
radicals
derived from a hydrocarbon moiety containing between one and twenty carbon
atoms by
removal of a single hydrogen atom. In some embodiments, the alkyl group
employed the
invention contains 1-20 carbon atoms. Examples of alkyl radicals include, but
are not limited to,
methyl, ethyl, propyl, n-propyl, isopropyl, butyl, ii-butyl, iso-butyl, sec-
butyl, sec-pentyl, iso-
pentyl, tert-butyl, n-pentyl, neopentyl, n-hexyl, sec-hexyl, n-heptyl, n-
octyl, n-decyl, n-undecyl,
dodecyl, and the like, which may bear one or more substituents. Alkyl group
substituents include,
but are not limited to any of the substituents described herein, that result
in the formation of a
stable moiety (e.g., aliphatic, alkyl, alkenyl, alkynyl, heteroaliphatic,
heterocyclic, aryl,
heteroaryl, acyl, oxo, imino, thiooxo, cyano, isocyano, amino, azido, nitro,
hydroxyl, thiol, halo,
aliphaticamino, heteroaliphaticamino, alkylamino, heteroaliphaticamino,
alkylamino,
heteroalkylamino, arylamino, heteroarylamino, alkylaryl, arylalkyl,
aliphaticoxy,
heteroaliphaticoxy, alkyloxy, heteroalkyloxy, aryloxy, heteroaryloxy,
aliphatictioxy,
heteroaliphaticticoxy, alkylthioxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy, acyloxy, and
the like, each of which may or may not be further substituted).
The term "alkenyl" denotes a monovalent group derived from a straight- or
branched-chain
hydrocarbon moiety having at least one carbon-carbon double bond by the
removal of single
hydrogen atom. In certain embodiments, the alkenyl group employed in the
invention contains 2-
20 carbon atoms. Alkenyl groups include, for example, ethenyl, propenyl,
butenyl, 1-methyl-2-
buten-1-yl, and the like, which may bear one or more substituents. Alkenyl
group substituents
include, but are not limited to, any of substituents described herein, that
result in the formation of
a stable moiety (e.g., aliphatic, alkyl, alkenyl, alkynyl, heteroaliphatic,
heterocyclic, aryl,
heteroaryl, acyl, oxo, imino, thiooxo, cyano, isocyano, amino, azido, nitro,
hydroxyl, thiol, halo,
aliphaticamino, heteroaliphaticamino, alkylamino,
heteroaliphaticamino, alkyl am i no,
heteroalkylamino, arylamino, heteroarylamino, alkylaryl, arylalkyl,
aliphaticoxy,
heteroaliphaticoxy, alkyloxy, heteroalkyloxy, aryloxy, heteroaryloxy,
aliphatictioxy,
heteroaliphaticticoxy, alkylthioxy, heteroalkylthioxy, arylthioxy,
heteroarylthioxy, acyloxy, and
the like, each of which may or may not be further substituted). In an alkenyl
group, a C=C
double bond for which the stereochemistry is not specified (e.g. ¨CH=CHCH3,
or ) may be in the (E)- or (Z)-configuration.
In certain embodiments, in Formula (I), when X is H; R1, R2 and R3 is H; R4
and R5
roups taken together form =CH2; the ailanthone and its derivatives are one of
Formula (V)
CA 02947802 2016-11-08
OH
H2C = .õi0H
OH
0
171
CH3 (v)
Formula (V) ailanthone compounds is a kind of natural small molecular
compounds, also
known as ailanthone, its chemical name: 1113,20-Epoxy-lf3,11,12a-
trihydroxypicrasa-3,13(21)-
diene-2,16-dione; English name: Ailanthone; molecular formula: C20112407;
molecular weight:
376.405, CAS number: 981-15-7.
The present invention provides a use of ailanthone and its derivatives in
preparation of
medicine for treating prostate cancer, wherein said ailanthone and its
derivatives arc indicated as
Formula (I-V), said ailanthone inhibits the activity of androgen receptor,
thereby inhibits the
proliferation, metastasis, growth, cloning formation of prostate cancer cell,
promotes apoptosis
of prostate cancer cell, induces the cycle arrest of prostate cancer cell.
The present invention further provides a method of treating malignant tumor
comprising
administering a therapeutically effective amount of a composition comprises
the compound of
Formula (I-V), or hydrate, or a pharmaceutically acceptable salt thereof.
The method comprising administering a pharmaceutical composition comprising a
compound of Formula (I) and a pharmaceutically acceptable excipient, to a
subject in need
thereof.
In the method of the present invention, said malignant tumors is selected from
the group
consisting of prostate cancer, breast cancer, lung cancer, colon cancer, brain
cancer, skin cancer,
bladder cancer, and renal cell carcinoma.
In the method of the present invention, said ailanthone and its derivatives
inhibit the activity
of androgen receptor, thereby inhibits the proliferation, metastasis, growth,
cloning formation of
prostate cancer cell, promotes apoptosis of prostate cancer cell, induces the
cycle arrest of
prostate cancer cell.
In the method of the present invention, said prostate cancer is of abnormal
amplification
and/or mutation of androgen receptor.
In the method of the present invention, said prostate cancer is androgen
dependent prostate
cancer.
In the method of the present invention, said prostate cancer is castration-
resistant prostate
cancer.
In the method of the present invention, said prostate cancer is selected from
the group
11
CA 02947802 2016-11-08
consisting of 22RV1, VCaP LAPC4, C4-2B, LNCaP-MDV3100-R, PC3 and LNCaP.
In the method of the present invention, the therapeutically effective amount
of the
composition comprises 1.0 mg to 3.0 mg ailanthone or its derivatives, or
hydrate, or a
pharmaceutically acceptable salt thereof per kg body weight daily of a subject
in need thereof.
Preferably, in the method of the present invention, the therapeutically
effective amount of
the composition comprises 1.0 mg to 3.0 mg ailanthonc or its derivatives, or
hydrate, or a
pharmaceutically acceptable salt thereof per kg body weight daily of a subject
in need thereof for
a 21-day cycle.
Preferably, the method of the present invention, the therapeutically effective
amount of the
composition comprises 2.0 mg ailanthone or its derivatives, or hydrate, or a
pharmaceutically
acceptable salt thereof per kg body weight daily of a subject in need thereof
for a 21-day cycle.
In the method of the present invention, said ailanthone or its derivatives
induce androgcn
receptor ubiquitination by blocking the binding between the androgen receptor
and the heat
shock chaperones HSP90 complex, then decreases the androgen receptor
stability, resulting the
degradation of the androgen receptor by proteasome, thereby inhibits the
activity of androgen
receptor.
In the method of the present invention, the androgen receptor is
dihydrotestosterone DHT
induced androgen receptor or androgen receptor AR1-651 lacking of ligand
domain.
The present invention further provides a pharmaceutical composition, said
pharmaceutical
composition comprises a compound of Formula (I-V), or hydrate, or a
pharmaceutically
acceptable salt thereof.
The pharmaceutical composition of the present invention can be used to treat
malignant
tumor comprising administering a therapeutically effective amount of
pharmaceutical
composition. Wherein, said malignant tumors is selected from the group
consisting of prostate
cancer, breast cancer, lung cancer, colon cancer, brain cancer, skin cancer,
bladder cancer, and
renal cell carcinoma.
Wherein the therapeutically effective amount of the pharmaceutical composition
comprises
1.0 mg to 3.0 mg ailanthone or its derivatives, or hydrate, or a
pharmaceutically acceptable salt
thereof per kg body weight daily of a subject in need thereof.
Preferably, the therapeutically effective amount of the pharmaceutical
composition
comprises 1.0 mg to 3.0 mg ailanthone or its derivatives, or hydrate, or a
pharmaceutically
acceptable salt thereof per kg body weight daily of a subject in need thereof
for a 21-day cycle.
Preferably, the therapeutically effective amount of the pharmaceutical
composition comprises
2.0 mg ailanthone or its derivatives, or hydrate, or a pharmaceutically
acceptable salt thereof per
12
CA 02947802 2016-11-08
kg body weight daily of a subject in need thereof for a 21-day cycle.
In one embodiment, a prostate cancer patient weight 65kg, who was treated with
65mg-195mg ailanthone or its derivatives, or hydrate, or a pharmaceutically
acceptable salt
thereof for a 21-day cycle, and was finally cured. In another embodiment, a
prostate cancer
patient weight 75kg, who was treated with 75mg-225mg ailanthone or its
derivatives, or hydrate,
or a pharmaceutically acceptable salt thereof for a 21-day cycle, and was
finally cured.
The pharmaceutical composition of the present invention could inhibit the
activity of
androgen receptor, thereby inhibit the proliferation, metastasis, growth,
cloning formation of
prostate cancer cell, promote apoptosis of prostate cancer cell, induce the
cycle arrest of prostate
cancer cell.
Wherein, said prostate cancer is of abnormal amplification and/or mutation of
androgen
receptor, or androgen receptor dependent prostate cancer, or castration-
resistant prostate cancer.
Wherein said prostate cancer is selected from the group consisting of 22RV1
VCaP,
LAPC4, C4-2B, LNCaP-MDV3100-R, PC3 and LNCaP.
In the application of the present invention, Formula (I-V) ailanthone and its
derivatives
inhibit the proliferation, metastasis, growth and cloning formation of
prostate cancer cells,
promotes cell apoptosis of prostate cancer cell, induce cell cycle arrest of
prostate cancer cell,
and inhibit tumor growth and metastasis in CRPC animal models.
In the application of the present invention, Formula (I-V) ailanthone and its
derivatives
inhibit the transcriptional activity of androgen receptor. Formula (I) inhibit
proliferation of
androgen receptor mutated prostate cancer cells. It inhibits the proliferation
of androgen receptor
mutated 22RV1, VCaP, LAPC4, C4-2B, LNCaP-MDV3100-R and androgen dependent
LNCaP
prostate cancer cell in vitro and/or in vivo.
In the application of the present invention, Formula (I-V) ailanthone and its
derivatives
inhibit the androgen receptor activity and growth of prostate cancer cells;
wherein, said prostate
cancer cells are 22RV1, VCaP, LAPC4, C4-2B, LNCaP-MDV3100-R and LNCaP.
In the application of the present invention, Formula (I-V) ailanthone and its
derivatives
promote cell apotosis of androgen receptor mutated VCaP, LAPC4, C4-2B, LNCaP-
MDV3100-
R.
In the application of the present invention, Formula (I-V) ailanthone and its
derivatives
inhibit the androgen receptor protein expression significantly; Formula (I-V)
ailanthone and its
derivatives also inhibit the downstream gene expression of androgen receptor.
Formula (I-V)
ailanthone and its derivatives inhibit the proliferation and migration more
obviously on androgen
receptor positive prostate cancer cells; wherein, said androgen receptor
positive prostate cancer
13
CA 02947802 2016-11-08
cells are 22RV1, VCaP, LAPC4, c4-2b, LNCaP-MDV3100-R, LNCaP.
In the application of the present invention, Formula (I-V) ailanthone and its
derivatives
inhibit tumor growth and metastasis in CRPC animal models; wherein, said CRPC
prostate
cancer are LNCaP, 22RV1 and VCaP.
In the application of the present invention, Formula (I-V) ailanthone and its
derivatives
significantly inhibit prostate cancer cells proliferation and metastasis in
vitro at low
concentration (<111M); in animal models in mice, Formula (I-V) ailanthone and
its derivatives
inhibit the growth and metastasis of prostate cancer cells in vivo at the dose
of 2.0 mg/kg/d
effectively
The present invention also proposes Formula (I-V) ailanthone and its
derivatives inhibiting
proliferation of androgen receptor mutated prostate cancer cells. Formula (I-
V) ailanthone and its
derivatives suppress androgen receptor mutated 22RV1 and VCaP prostate cancer
which are
resistant to Bicalutamide or MDV3100 treatment. Formula(I-V) ailanthone and
its derivatives
also can inhibit proliferation of androgen dependent LNCaP prostate cancer
cell. Formula (I-V)
ailanthone and its derivatives inhibit the growth of castration resistant
prostate cancer cells in
mice animal model; wherein, said castration resistant prostate cancer cells
are 22RV1, VCaP,
LAPC4, C4-2b and LNCaP-MDV3100-R.
The present invention proposes the application and method of Formula (I-V)
ailanthone and
its derivatives inhibiting the migration or metastasis of prostate cancer
cells in vitro/ in vivo.
Formula (I-V) ailanthone and its derivatives migration of LNCaP in vitro and
22RV1 in vivo.
Formula (I-V) ailanthone and its derivatives inhibit the metastasis of
castration resistant prostate
cancer cells in mice animal model; wherein, said castration resistant prostate
cancer cells are
22RV.
The present invention proposes the application and method of Formula (I-V)
ailanthone and
its derivatives inhibiting the activity of androgen receptor and prostate
cancer growth. Formula
(I-V) ailanthone and its derivatives inhibit the dihydrotestosterone (DHT)
induced androgen
receptor activity and activity of androgen receptor splice variant lacking the
LBD. Formula (I-V)
ailanthone and its derivatives induce AR degradation by disrupting the
interaction of AR with its
chaperones HSP90 and HSP70, resulting in AR ubiquitination and degradation,
and then inhibit
the activity of androgen receptor and the growth of prostate cancer cells.
Formula (I-V)
ailanthone and its derivatives can also inhibit the growth of prostate cancer
cells including
22RV1, VCaP, LAPC4, c4-2b, LNCaP-MDV3100-R, LNCaP.
In present invention, Formula (I-V) ailanthone and its derivatives
significantly inhibit
prostate cancer cells proliferation and metastasis in vitro at low
concentration (<11aM); in animal
14
CA 02947802 2016-11-08
models in mice, Formula (I-V) ailanthone and its derivatives inhibit the
growth and metastasis of
prostate cancer cells in vivo at the dose of 2 mg/kg/d effectively
The present invention provides a use and/or a method of Formula (I-V)
ailanthone and its
derivatives inhibiting clony formation of prostate cancer cell. For colony
formation assay,
prostate cancer cells were incubated with indicated concentrations of AIL in
complete RPMI
1640 for two weeks and then cells were fixed with 4% paraformaldehyde and
stained with
crystalviolet. Colonies were visualized under a microscope, and all of the
fields were imaged and
counted. Colony formation as a % of vehicle control for each cell line is
presented. Wherein, said
prostate cancer cell is LNCaP or 22RV1.
The present invention provides a use and/or method of Formula (I-V) ailanthone
and its
derivatives promote apoptosis of prostate cancer cell. After treatment with
different
concentrations of AIL or its derivatives, cells were trypsinized, washed with
PBS and stained
with 20 1.1g/m1 propidium iodide (PI) solution and Anncxin V-FITC for 15 min
at room
temperature in the dark. The stained cells were analyzed using BD LSRII flow
cytometry (BD
Biosciences). Wherein said prostate cancer cell is LNCaP or 22RV1. Formula (I-
V) ailanthone
and its derivatives promote apoptosis of prostate cancer cell 22RV1 with
androgen receptor
mutation.
The present invention provides a use and/or a method of Formula (I-V)
ailanthone and its
derivatives inhibiting the activity of androgen receptor. For dual luciferase
screening assay,
prostate cancer cells were transfected with MMTV-luc, Renilla-luc (phRL-TK,
Promega), ARor
AR1-651(vector: pFLAG-CMV-1) plasmids (provided by Ddie-Min Wong)50 using
lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.
After transfection
for 24 hours, the transfected cells were treated with DHT (Sigma, cat. no.
A8380) or DHT with
compounds for 12 hours. Renilla and firefly activities were then determined by
luminometry
using the Dual-Luciferase Reporter Assay System (Promcga) and the ratio
calculated. Results
were expressed as the ratio of firefly to Rcnilla luciferase activity.
The present invention provides a use and/or a method of Formula (I-V)
ailanthone and its
derivatives inhibiting the activity of androgen receptor protein expression.
Cells were treated as
described in the corresponding section of Results and then lysed by boiling
for 10 min in sample
buffer (2% SDS, 10% glycerol, 10% 13-Mcrcaptoethanol, Bromphenol Blue and Tris-
HC1, pH
6.8). Lysates were fractionated on polyacrylamide gels and transferred to
nitrocellulose. The
blots were probed with specific antibodies followed by secondary antibody then
membranes
were examined using the LI-COR Odyssey infrared imaging system (LI-COR
Biotechnology,
Lincoln NE). The AR (N20, sc-816 and H280, sc-13062; 1:1000) antibodies were
purchased
CA 02947802 2016-11-08
from Santa Cruz Biotechnology (Santa Cruz, CA). The secondary antibody was
conjugated with
IRDye 680/800 (Millennium Science; 926-32221, 926-32210; 1:10000).
The present invention provides a use and/or a method of Formula (I-V)
ailanthone and its
derivatives inhibiting the downstream gene expression mediated by androgen
receptor. Cells
were cultured with RPM! 1640 with 5% charcoal dextran treated FBS for 5 days
prior to
treatment with R1881 (Sigma, cat. no. R0908) alone or R1881 and AIL for 12 h.
Total RNA was
extracted using TRIzol (Takara, Japan) according to the manufacturer's
instructions. 1 itg of total
RNA was used for cDNA synthesis using a cDNA reverse transcription kit
(Takara, Japan).
Real-time PCR was performed in triplicate using gene-specific primers on a
Stratagene
Mx3005P PCR system (Agilent Technologies) machine. The mRNA expression levels
were
normalized to f3-actin expression or GAPDH. All analysis was performed using
Microsoft Excel
2010 and GraphPad Prism 5 software. The gene-specific primers are listed in
Table 3.
The present invention provides a use and/or a method of Formula (I-V)
ailanthone and its
derivatives blocking the androgen receptor signaling pathway.
The present invention provides a use and/or a method of Formula (I-V)
ailanthone and its
derivatives treating early stageandrogen dependent prostate cancer, late stage
castration-resistant
prostate cancer, and metastatic prostate cancer (Subcutaneous tumor-burdened
experiments).
BALB/c-nude mice (6-8 weeks old, male) were purchased from the Sino-British
Sippr/BK Lab
Animal Co., Ltd (Shanghai, China) and maintained under pathogen-free
conditions. The animal
use protocol was approved by the Institutional Animal Care and Use Committee
of East China
Normal University. The 22RV1, LNCaP and VCaP xenograft tumor models were
developed by
injecting 3 x 106 22RV1 cells or 5 x 106LNCaPorVCaP cells in suspension into
the right flank
of a BALB/c-nude mouse; cells were suspended in 100 I PBS or 50% Matrigel
(LNCaP and
VCaP) respectively. Specifically for LNCaP and VCaP cells, continuous release
testosterone
pellets (15 mgtestosterone per pellet, Sigma-Aldrich) were implanted
subcutaneously to
stimulate the growth of LNCaP and VCaP xenografts. Tumor nodules were allowed
to grow to a
volume about 100 mm3 before initiating treatment. Tumor-bearing BALB/c-nude
mice were
randomly assigned to three groups and treated with the indicated compound or
drug. The tumor
volume and mouse body weight were measured twice a week. The tumor volume was
calculated
using the following equation: tumor volume (V) = length x width x width x
0.52,
(In situ tumor-burdened) For orthotopiccastration resistant prostate cancer
xenografts, male
BALB/c-nude mice (8-9 weeks of age) were anesthetized using 150mgke 2,2,2-
tribromethanol
plus 350mgketert-amyl alcohol and then 5 x 105 22RV1-luc cells suspended in 30
I 50%
Matrigel were surgically injected into the dorsolateral prostate lobes. One
week after injection,
16
CA 02947802 2016-11-08
the tumor-bearing mice were castrated and randomly assigned to three groups. A
week later,
animals were intraperitoneally injected with AIL (2 mgkg-1), MDV (10 mgkg-1)
or DMS0 (as
controls). Prostate tumor growth and local metastasis were monitored weekly
using the IVIS
Imaging System (Xenogen Corporation, Alameda, CA). Images and measurements of
bioluminescent signals were acquired and analyzed using LivingImage and
Xenogen software52.
The treatment is referred to inhibiting proliferation, metastasis, growth and
cloning
formation of prostate cancer cells, promoting cell apoptosis of prostate
cancer cell, inducing cell
cycle arrest of prostate cancer cell, and inhibiting tumor growth and
metastasis in CRPC animal
models.
The present invention provides the application and method of inhibiting the
androgen
receptor by Formula (I-V) ailanthone and its derivatives. Formula (I-V)
ailanthone and its
derivatives induce androgen receptor ubiquitination by blocking the binding
between the
androgen receptor and the heat shock chaperones HSP90 complex, then decreases
the androgen
receptor stability, resulting the degradation of the androgen receptor by
proteasome, and then
down-regulate the transcriptional activity and inhibit its downstream gene
expression.
The invention present screen out Formula (I-V) ailanthone and its derivatives
through
luciferase assay, which can inhibit the proliferation, growth and migration of
the prostate cancer
cell in vitro and in vivo strongly, and also block the androgen receptor
signal pathway effectively.
The present invention demonstrated the Formula (I-V) ailanthone and its
derivatives and
pharmaceutical composition containing said Formula (I-V) ailanthone and its
derivatives could
inhibit the proliferation, metastasis, growth, cloning formation of prostate
cancer cell, promote
apoptosis of prostate cancer cell, induce the cycle arrest of prostate cancer
cell. And further
demonstrates that prostate cancer cell expressing androgen receptor have high
sensitivity to (I-V)
ailanthone and its derivatives.
In the present invention, "castration-resistant prostate cancer (CRPC)" refers
to a condition in
which prostate cancer patients are relapsed after castration treatment
(testicular or chemical
castration), castration-refractory prostate cancer is called castration
Resistant prostate cancer, it
is the biggest killer of prostate cancer patients.
In the present invention, "androgen receptor (AR)" means that the androgen
receptor (AR)
belongs to a steroid receptor in the nuclear receptor superfamily. AR is
generally composed of
four domains: the N-terminal transcriptional activation domain (NTD), the DNA
binding domain
(DBD), the hinge domain and the ligand-binding domain (LBD). Androgen receptor
closely
related to the development and progression of prostate cancer. After androgen
such as
dihydrotestosterone (DHT) binding, androgen receptor enter to the nucleus and
activate the
17
CA 02947802 2016-11-08
downstream gene expression. Currently, androgen receptor antagonists used in
clinical such as
bicalutamide and MDV3100 (Enzalutamide) are both through binding to the ligand
binding
domain (LBD) of the androgen receptor and inhibit its transcriptional
activity.
In the present invention, "protein degradation" refers to a process in which
the protein is
degraded by the proteasome after being ubiquitinated.
In the present invention, "Luciferase assay" refers to a Luciferase
(Luciferase) system in
which a luciferin is used as a substrate to detect a firefly luciferase
(Luciferase) Activity of a
reporting system. Luciferase can catalyze the formation of fluorescent
luciferin (oxyluciferin), in
the process of fluorescein oxidation, will emit bioluminescence
(Bioluminescence). The
bioluminescence released during the oxidation of the fluorescein can then be
measured by a
fluorometer, also known as a Luminometer or a liquid scintillation counter.
Fluorescein and
luciferase, a bioluminescent system, is extremely sensitive and efficient
detection of gene
expression, which is a detection method that detecting the interaction of
transcription factor and
the target gene promoter region.
The invention adopts the androgen receptor luciferase assay to select
Ailanthone from a
plurality of Traditional Chinese Medicine Library. It is mainly found in the
seeds, root bark and
bark of Ailanthus altissima (Mill.) Swingle and its molecular weight is
376.405 and CAS number
is 981-15-7. Modern research shows that Ailanthus has anti-amoebic dysentery,
anti-malaria,
anti-ulcer and other effects. But so far there is not any research on its anti-
prostate cancer
effectiveness. The invention proves that the compound can effectively inhibit
the growth and
metastasis of the prostate cancer cell in vivo and in vitro.
Compared with Bicalutamide and MDV3100 that approved by the FDA, Ailanthone
has the
advantages that it has a wide range of sources because the ailanthus trees for
extracting the
compound are widespread in China. Ailanthone was included in the the "Chinese
Pharmacopoeia" for many years and used for many years in China, which has the
potential for
developing of proprietary Chinese medicines (compound) potential.
Second, the drugs in clinical are almost ineffective for androgen receptor
mutated prostate
cancer cells, and ailanthone still have good killing effects on MDV3100-
resistant prostate cancer
cells, which indicates that for MDV3100-resistant prostate cancer, the
application of the
invention is still valid.
In addition, the mechanism of the compound used in the application of the
present invention
is relatively clear. It is found that the compound inhibit the growth and
migration of prostate
cancer cells in low concentration (<111M) significantly; In mice model, 2mg /
kg/d of can inhibit
prostate cancer cells growth and metastasis in vivo. Experiments show that
Ailanthone inhibit
18
CA 02947802 2016-11-08
the androgen receptor activity by binding to p23 and suppress its binding with
molecular
chaperone Hsp90. These action induced androgen degradation and down-regulation
androgen
receptor protein levels, and then inhibit the downstream gene expression and
androgen receptor
signaling pathway.
In conclusion, we screened and characterized AIL, a novel compound with
excellent drug-
like characteristics that is able to overcome MDV3100-resistance in prostate
cancer cell lines.
ALL was efficacious in suppressing the growth and metastasis of CRPC via
targeting p23. As a
result, AIL can be considered a new potential drug candidate for prostate
cancer, and it is worthy
of further research and investigation.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. I. Inhibitory effects of AIL on AR activity and PCa cells proliferation.
(a,b) PCa
cells were treated with different concentrations of ALL for 12 hours and
luciferase activities were
measured. MMTV-luc reporter was stimulated by DHT (a) or exogenous AR1-6.51
(b).(e)LNCaP
cells were cultured in 5% c-FBS for 5 days and treated with 10 nM R1881 alone
or 0.2 aM AIL
with 10 nM R1881 for 12 hours. The genes expression was measured
byquantitative-PCR.(d)
PC3 cells were transfected with AR1_651, MMTV-luc, Renilla-lucand treated with
indicated
concentrations of bicalutamide (BIC), MDV3100 (MDV) and AIL. After 12 hours,
the MMTV-
luc activities were detected (Left panel). 22RV1 cells were stimulated with or
without 10 nM
R1881 and treated with 10 aM MDV or 0.2 aM AIL. After 12 hours, total RNA was
extracted
and PSA mRNA was measured by quantitative-PCR (Right panel).(e,f) The AR
negative cell
lines PC3 and DU145 (AR-), normal prostate cell lines RWPE-1 and WPMY-1 (N),
and AR
positive cell lines LNCaP, 22RV1, LAPC4 c4-2b,VcaP and LNCaP-MDV3100-R (AR+)
were
treated with different concentrations of AILfor 48 hours. Cell proliferation
was detected with the
SRB assay (e). AR negative cell lines PC3 and DU145, and positive cell lines
LNCaP, 22RV1
were treated with 0 or 0.1 M AIL for 7 days, and the cell colonies were
counted(f). Data was
expressed as mean s.d.of three independent assays; Two-way ANOVA followed by
Bonferroni
multiple comparison test; *** P<0.001.Scale bar, 200am. (g,h) Androgen-starved
LNCaP, c4-2h
and 22RV1 cells were treated with 10 j.tM BIC, 10 IVI MDV and 0.1, 0.2, 0.4
p.M AIL together
with 0.1 nM R1881 stimulation for 96 hours (g). MDV3100-resistant LNCaP cells
were treated
with the indicated concentrations of BIC, MDV or AIL for 72 hours (h). Cell
growth was
determined by SRB assay. In panda, b, c, d, g and h, data was expressed as
mean s.d.of three
independent assays; Student's t-tests were performed;* P <0.05, ** P <0.01,
*** P <0.001.
Fig. 2. Therapeutic effects of AIL on castration-resistant xenografts. (a-
c)22RV1 (a),
19
CA 02947802 2016-11-08
LNCaP (b) and VCaP (c)cells suspended in 0.1 ml PBS (22RV1) or matrigel
(LNCaP, VCaP)
were injected into the right flank of BALB/c-nude mice. Androgen containing
blocks were
subcutaneously inserted intoeach mouse in theLNCaP and VCaPxenograft models.
After the
volume of tumor nodules reached about 100 mm3, the mice were randomly assigned
to the
indicated groups and respectively i.p. injected with vehicle control, AIL, BIC
or MDV as
indicated. The control group was injected with DMSO. Tumor volume and the
mouse body
weight were measured twice per week.(d)Male BALB/c-nude mice were
anesthetized, and the
dorsolateral prostate was injected with 22RV1-luc cells in matrigel.After a
week, mice were
castrated and treatedi.p. with DMSO, 10 mgkg-1 MDV or 2 mgkg-1 AIL once per
day. Tumors
were imaged every week to determine local tumor growth and evidence of tumor
cell
dissemination. Representative images of 3 mice per group were illustrated (n =
5). (e) After 28
days, mice were sacrificed and local tumors and viscera of the mice were
imaged to determine
tumor growth and evidence of tumor cell dissemination. Representative images
of the dishes are
shown, and the number of mice which had metastatic tumors was counted (n = 5).
(f)The mouse
kidneys from the same experiment as panel d were histopathologically
evaluated. The number of
mice which had kidney injury was counted (n = 5).Scale bar, the black scale
bar is 0.5 cm (left)
and the white scale bar is100 ttm (right).Data represent the mean s.d. * P <
0.05, ** P < 0.01,
*** P <0.001 by one-way ANOVA followed by Bonferroni multiple comparison test.
Fig. 3. Down-regulation of AR protein levels in vitro and in vivo by AIL. (a)
LNCaP,
22RV1, LNCaP-MDV3100-R and VCaPcells were treated with indicated
concentrations of AIL
for 12, 24 and 36 hours. Then cells were lyscd and AR protein level was
measured by Western
blotting analysis. (b) LNCaP, 22RV1 and c4-2b cells were treated for 12 hours
with indicated
concentrations of AIL with or without R1881 and the AR protein level was
measured by Western
blotting analysis. (c) AR null PC3 cells were transfected with AR-GFP in serum-
free conditions
for 24 hours and treated with DMSO (control), R1881 (10 nM) or combined AIL
(0.4 M) and
R1881 (10 nM). AR-GFP images were taken at 2 hours or 10 hours after
treatment. Five pictures
were randomly selected and the GFP-AR fluorescence in cytoplasm and nucleuswas
quantitated
using Image-Pro Plus 4.5 software (Media Cybernetics, Silver Spring, USA).The
arrows indicate
the location of AR-GFP. Data was expressed asmean s.d.; Student's t-tests were
performed;* P
< 0.05, ** P < 0.01. Scale bars, 10 [tm.(d)LNCaP and 22RV1 cells were treated
with the
indicated concentrations of AIL for 12 and 24 hours. Cells were lysed and AR,
HSP90 and
HSP70 protein levels were measured by western blotting analysis.(e) Four
representative tumor
samples per group were lysed. AR, HSP90, HSP70 and HSP40 protein levels were
measured by
Western blotting analysis. (f) The mRNA levels of PSA, TMPRSS2, total AR and
AR-V7 were
CA 02947802 2016-11-08
measured by quantitative-PCR and normalized to GAPDH. The sequences of
quantitative-PCR
primers were listed in Table 3.Data was expressed as mean s.d.; Two-way ANOVA
followed by
Bonferroni multiple comparison test were performed; *** P <
0.001.(g)Photographs of
xenografts treated i.p. with DMSO (control group), 10 mgkg-1 MDV and 2 mgkg-1
AIL with
corresponding IHC for AR and Ki67. Scale bars, 20 pm.
Fig. 4. Reduction of AR protein stability by AIL. (a)LNCaP and 22RV1 cells
were
treated with cyclohcximide (CHX) with or without AIL for various lengths of
time. AR protein
level was measured by Western blotting analysis. (b)LNCaP cells were cultured
in c-FBS for 5
days and treated with AIL in the absence or presence of 10 nM R1881 for 12
hours. Total RNA
was extracted and quantitative-PCR was performed. The AR-V7 mRNA level was
detected in
22RV1 cells which were treated with the indicated concentrations of AIL for 12
hours. The
expression of AR, AR-V7 and PSA was normalized to fl-actin expression. Data
was expressed as
mean s.d.of three independent assays; Student's t-tests were performed; * P <
0.05.(c) LNCaP
and 22RV1 cells were treated with various concentrations of AIL with or
without MG132(10 M)
and AR protein level was measured by Western blotting analysis.
(d)Immunoprecipitation (IP)
was done using anti-AR and immunoblotting performed with an anti-ubiquitin
antibody. Input:
immunoblot of lysates probed with AR antibody. (e)22RV1 cells were treated
with or without
AIL in the presence of MG132. IP was done using anti-AR, anti-HSP90, and anti-
HSP70
antibodies and immunoblotting (TB) was done with anti-AR, anti-HSP90, anti-
HSP70 and anti-
HSP40 antibodies. (f) HSP9Oet activity was measured by fluorescence
polarization binding assay
using FITC-geldanamycin in the presence of AIL or 17-AAG (positive control).
Fig. 5. Interaction of AIL with p23 protein in vitro. (a)22RV1 cells were
treated with or
without 1 1.1M AIL for 12 hours. Anti-HSP90 IP was done and co-
immunoprecipitatcd proteins
were detected using indicated antibodies. (b)The interaction between p23
protein and AIL was
measured by ProteOn XPR36. (c) Mapping AIL binding site on p23. (d) Top:
Expression level
heatmap (log2 based) of AR1.651 induced genes which were inhibited by AIL.
LNCaP cells were
treated as described in Methods and the RNA samples of the indicated groups
were sent for
RNA-seq. First gene expression values (RPKM) were normalized (z-score
transformed) across
samples. Then the K-Means clustering method was used to portion all genes into
the clusters
with Pearson correlation as the metric of distance. In the heat map,
yellowmeans "higher"
expression and bluemeans "lower" expression. Refseq IDs were converted into
gene symbols
listed in Supplementary Data 1. Bottom: Gene Ontology (GO) analysis of the
AR1_651 target
genes which inhibited by AIL.(e) Schematic illustrating the mechanism of down-
regulating AR
protein level by AIL. When treating with ALL, the interaction of p23 and HSP90
is prevented
21
CA 02947802 2016-11-08
and the interaction between AR and the molecular-chaperones is decreased,
causing
ubiquitination of AR. Then, AR is degraded by the proteasome, which reduces
the expression of
AR target genes and inhibits PCa growth and metastasis.
Fig. 6. Pharmacokinetic studies of AIL. (a)22RV1 tumor-bearing mice were
treated
with p.o.AIL ori.p. AIL and the tumor volumes were measured every five days;
p.o.PBS served
as control. Images show tumors at harvest (30 days after treatment). Scale
bar, lcm. (b)The
concentration of AIL in plasma was determined by LC-MS/MS following the last
drug
administration of p.o.AIL or i.p. ALL in tumor bearing mice. (c) Effect of AIL
on the activities of
rat or human liver cytochrome P450 (CYP) enzymes in vitro. Rat liver
microsomes or human
liver microsomes were incubated with various concentrations of AIL and the
activities of
indicated CYP enzymes were measured. (d,e)The expression of CYP2C11, CYP3A1
and
CYP1A2 in representative livers of the mice treated with p.o.AIL ori.p.AIL or
vehicle
controlwas measured by Western blotting analysis (d) and the livers were
photographed and
stained with HE (e). Scale bar, the black scale bar is 1 cm (top) and the
white scale bar is5Ourn
(bottom).(f)The concentration of AIL in rat plasma was determined by LC-MS/MS
after
administration of p.o.AIL or i.v.AIL.(g)22RV1 tumor-bearing mice were treated
with p.o.AIL
ori.p. AIL and mouse body weight was measured every five days. (h) Intestines
and stomachs of
the mice were dissected and images were taken at the end of AIL
administration.Scalc bar,
1 cm.Data represent the mean s.d.; * P <0.05, ** P <0.01, *** P <0.001 by one-
way ANOVA
followed by Bonferroni multiple comparison test.
Fig. 7. AR positive prostate cancer cells are more sensitive to AIL. (a)
LNCaP, 22RV1,
LAPC4, c4-2b cells were treated with indicated concentrations of AIL for 48 h
or 72 h and cell
proliferation was detected with the SRB assay (n = 5). (b) Prostate normal
cell lines RWPE-1
and WPMY-1, AR negative cell line PC3 and positive cell line LNCaP were
treated with 0 or 0.1
M AIL for 48 hours. The cells were imaged and a cropped region from each image
is shown to
enable a closer view. Scale bar, 50 gm. (c) AR negative cell line PC3 and
positive cell line
LNCaP prostate cancer cells were treated with different concentrations of ALL
in Transwell
chambers for 18 hours and the migrated cells were imaged and counted. Scale
bar, 100 gm.
Data was expressed as mean s.d.; Student's t-tests were performed; * P < 0.05,
** P < 0.01,
Fig. 8. Inhibitory effects of AIL on proliferation of prostate cancer cells
and normal
prostate cell lines. Prostate cancer cells (LNCaP, 22RV1, PC3, DU145), human
prostate stromal
cells WPMY-1 and the human normal prostate epithelial cell line RWPE-1 cells
were treated
with indicated concentrations of ALL for 48 h and the cell proliferation was
detected with the
22
CA 02947802 2016-11-08
SRB assay (n = 5). Data was expressed as mean s.d.; Student's t-tests were
performed; P <
0.05, ** P <0.01, "' P <0.001.
Fig. 9. Cytoreduction of 22RV1 xenografts in vivo by ALL. 3x106 22RV1 cells
with 0.1
ml PBS were injected into the right flank of BALB/c-nude mice. After the
volume of tumor
nodules was about 100 mm3, the mice were randomly assigned to the indicated
groups and i.p.
injected daily with DMSO (control), lmg/kg AIL and 3mg/kg ALL, respectively.
Tumor volumes
and the mouse body weights were measured twice a week. The mice were
sacrificed after 35
days and the tumors from each group of mice were excised and images were
taken. Scale bar, 1
cm. Data represent the mean s.d. ** P <0.01, *** P < 0.001 by one-way ANOVA
followed by
Bonferroni multiple comparison test.
Fig. 10. Comparing the anti-tumor efficiency of ALL with AR antagonists in
different
xenograft models. (a-c) 22RV1 (a), LNCaP (b) and Vcap (c) cells were injected
with 0.1 ml
PBS (22RV1) or Matrigel (LNCaP, Vcap) into the right flank of BALB/c-nude.
After the volume
of tumor nodules reached about 100 mm3, the mice were randomly assigned to the
indicated
groups and i.p. injected daily with DMSO (control), ALL, BIC, or MDV as
indicated. Tumor
volume and the mouse body weight were measured once a week. The mice were
sacrificed after
28 days (22RV1), 49 days (LNCaP) or 32 days (Vcap) and the tumors from each
group of mice
were harvested and images were taken. Scale bar, 1 cm. Data represent the mean
s.d.
Fig. 11. Lp. delivery of AIL did not cause toxicity. (a,b) 3x106 22RV1 cells
were injected
with 0.1 ml PBS into the right flank of a nude mouse. After tumor nodules grew
to a volume
about 100 mm3, the mice were randomly assigned to three groups and
respectively i.p injected
with DMSO, 1 or 3 mg/kg/day AIL. After 35 days, mice were sacrificed and
organs were
removed. Photographs (a) and HE-staining (b) of the representative organs from
mice
administered daily with DMSO, 1 mg/kg AIL or 3 mg/kg AIL were illustrated.
Tissues shown in
Figure S3 were from the same animals. Scale bar, 1 cm in panel a and 100 gm in
panel b. (c)
3x 106 Vcap cells were injected with 0.1 ml matrigel into the right flank of a
nude mouse. After
tumor nodules grew to a volume about 100 mm3, the mice were randomly assigned
to three
groups and respectively i.p injected with DMSO, 10mg/kg MDV or 2mg/kg AIL.
After 35 days,
mice were sacrificed and prostate and seminal vesicle tissues were excised.
Photographs of the
representative organs from mice administered with DMSO, 10 mg/kg MDV or 2
mg,/kg AIL
were illustrated. The weight of seminal vesicles was measured (Right panel).
Tissues shown in
Figure 2c were from the same animals. Scale bar, 1cm.
Fig. 12. AIL inhibited tumor growth and metastasis in a CRPC animal model.
(a,b)
The dorsolateral prostate of male BALB/c-nude mice was injected with 1 x 106
22RV1-lue cells
23
CA 02947802 2016-11-08
in 30 IA matrigel. After a week, mice were castrated and injected i.p. with
DMSO, 10 mg/kg
MDV or 2 mg/kg AIL once a day. After 28 days, mice were sacrificed and the
local tumors were
removed and volumes and weight of the tumors were measured (a). The local
tumors and viscera
of the mice were imaged for counting metastatic tumors (b). Scale bar, 1 cm.
Data was
expressed as mean s.d.; Student's t-tests were performed; * P < 0.05.
Fig. 13. Effect of AIL on the protein levels of AR and molecular chaperones.
(a) VCaP
and LNCaP-MDV3100-R cells were treated for 12 hours with indicated
concentrations of AIL
with or without R1881 and the AR protein level was measured by Western
blotting analysis. (b,c)
AIL decreased the protein level of AR variants. Flag-AR-V567es (6) or Flag-AR-
V7 (c)
plasmids were transfected into PC3 cells. After 24 hours, cells were treated
with the indicated
concentrations of AIL for 12 hours and cells were lysed and AR-V7 and AR-
V567es protein
levels were measured by Western blot analysis using Flag antibody. (d) AIL
decreased the AR
protein level in both cytoplasm and nucleus. PC3 cells were transfected with
AR for 24 hours
and treated with or without 0.4 riM AIL in the presence of R1881 for the next
12 hours.
Nucleocytoplasmic separation was done and the protein level of AR in cytoplasm
and nucleus
was measured by Western blot analysis. HSP90 is a cytoplasm marker and PARP is
a nuclear
marker. (e) HSP90 and HSP70 proteins were induced by HSP90 inhibitor 17-AAG
rather than
AIL. LNCaP and 22RV1 cells were treated for 12 hours with the indicated
concentrations of AIL
or 17-AAG. Cells were lysed and AR, HSP90 and HSP70 protein levels were
measured by
Western blot analysis. (f) AIL down-regulates the protein level of HSP90
clients but not the
molecular chaperones. LNCaP and 22RV1 cells were treated for 24 hours with the
indicated
concentrations of AIL, cells were lysed and indicated protein levels were
measured by Western
blotting analysis. (g) Effect of AIL on the activities of androgen receptor
(AR), glucocorticoid
receptor (GR) or progesterone receptor (PR). PC3 cells transfected with or
without AR as
indicated were transiently transfected with MMTV-luc reporter plasmid and
Renilla-luc plasmid,
stimulated by 10 nM AR agonist DHT (left), or 10 nM PR agonist progesterone
(middle), 10 nM
GR agonist dexamethasone (right). Then cells were treated with different
concentrations of AIL
for 12 hours and the luciferase activities were measured and results were
expressed as the ratio
of luciferase activity. Data was expressed as mean s.d. of three independent
assays; Student's
t-tests were performed; * P <0.05, ** P <0.01, *** P <0.001.
Fig. 14. ALL induced Gl-phase arrest instead of apoptosis. (a) LNCaP and 22RV1
cells
were treated with the indicated concentrations of AIL for 24 hours. Then cells
were fixed with
70% ethanol and stained with PI and sent for cell cycle analysis with flow
cytometry. The
percentage of each phase is shown in the right panel. (b) LNCaP and 22RV1
cells were treated
24
CA 02947802 2016-11-08
with the indicated concentrations of AIL for 24 hours. Then cells were stained
with PI and
Annexin V-FITC and then subjected to flow cytometry analysis of cell
apoptosis.
Fig. 15. AIL binds to p23 but not HSP90. (a) HSP90 bound to 17-AAG but not ALL
in
vitro. The interaction between HSP9Ox protein and AIL (Right) or 17-AAG (Left)
were
measured by ProteOn XPR36. (b) Celastrol (CEL) interacted with p23 protein in
vitro. The
interaction between p23 protein and CEL was measured by ProteOn XPR36. (c)
Mapping AIL-
binding site on p23. The docking assay was performed as described in Materials
and Methods.
Fig. 16. AIL and a p23 inhibitor celastrol (CEL) showed the same effects on
the
protein level of AR, HSP90 and HSP70. (a) LNCaP and 22RV1 cells were treated
for 12
hours with the indicated concentrations of AIL or CEL (a p23 inhibitor). Cells
were lysed and
AR, HSP90 and HSP70 protein levels were measured by Western blot analysis. (b)
p23
knockdown abrogated ALL induction of cell growth arrest. 22RV1 cells with
transient
transfection of non-target control (si-NC), siRNA-AR or siRNA-p23 siRNAs were
treated with
indicated concentrations of AIL for 72 h and cell growth was detected with the
SRB assay (n =
5). Data was expressed as mean s.d.; Student's t-tests were performed; * P
<0.05, ** P <0.01,
*** P < 0.001. (c,d) Knockdown of AR-Vs decreased cell proliferation. VCap (c)
and 22RV1 (d)
cells were transfected with the AR-Vs specific siRNA pool or non-target
control and the cell
growth was detected with the SRB assay at the indicated times (n = 5). siRNAs
were transfected
every two days to maintain the knockdown efficiency. Data represent the mean
s.d. ** P < 0.01,
*** P < 0.001 by one-way ANOVA followed by Bonferroni multiple comparison
test. (e)
Overexpression of p23 rescued the AIL-mediated cell growth inhibition. 22RV1
cells were
transfected with empty vector or different doses of p23 plasmid in the
presence of 0.2 jiM AIL
for 72 hours and the cell growth was detected with the SRB assay (n = 5). Data
was expressed as
mean s.d.; Student's t-tests were performed; * P <0.05, ** P <0.01, *** P
<0.001.
Fig. 17. The effects of i.p. and p.o. administration of AIL on the. 3x106
22RV1 cells
were injected with 0.1 ml PBS into the right flank of nude mice. After tumor
nodules were
allowed to grow to a volume about 100 mm3, the tumor bearing mice were treated
with 2
mg/kg/day (i.p.) or 5 mg/kg/day (p.o.) or vehicle control (p.o.) for 30 days.
The tumor weight
was measured at the end of the experiment. Data was expressed as mean s.d.;
Student's t-tests
were performed; *** P <0.001.
Fig. 18. Characterization of LNCaP-MDV3100-R. (a) LNCaP and LNCaP-MDV3100-R
(resistant to MDV3100) were treated with indicated concentrations of MDV3100
for 72 hours
and the cell proliferation was detected with the SRB assay (n = 5). The half
maximal inhibitory
concentration (IC50) was calculated using GraphPad Prism 5.0 (GraphPad, San
Diego, CA). (b)
CA 02947802 2016-11-08
LNCaP-MDV3100-R cell line expresses a similar AR level as LNCaP. LNCaP and
LNCaP-
MDV3100-R cells were lysed and AR protein levels were measured by Western blot
analysis. 13-
actin serves as internal control. (c) LNCaP-MDV3100-R cells still respond to
androgen. LNCaP-
MDV3100-R cells were cultured in 5% c-FBS for 48 hours and treated with or
without 10 nM
DHT for 12 hours. DMSO was added as the control. Total RNA was extracted and
quantitative-
PCR was performed with the PSA and GAPDH specific primer. The PSA mRNA level
was
normalized to GAPDH. Data was expressed as mean + s.d. of three independent
assays;
Student's t-tests were performed; ** P <0.01.
PREFERRED EMBODIMENTS OF THE INVENTION
The following examples are given for further illustrating the specific
solutions of the
present invention
Results
Example 1 AIL and its derivatives suppresse the activities of AR-FL and AR-Vs
To identify compounds which inhibit the transcriptional activities of both AR-
FL and
constitutively active AR-Vs, we used a luciferase reporter assay to screen
about 100 compounds
from a library of natural compounds. 22RV1 PCa cells were either stimulated
with androgen
dihydrotestosterone (DHT) toactivateAR-FL or transfected withAR1-65ito
introduce the splice
variant of AR lacking the LBD. After incubation with these natural compounds
for 12 hours, the
transfected cells were harvested and AR transcriptional activity was detected
by dual luciferase
assay. We identified the small molecule Ailanthone(AIL) and its derivatives
which potently
reduced the transcriptional activities of both AR-FL and AR-Vs. The
physicochemical properties
of AIL are listed in Table 2.
To further test the bioactivity of AIL and its derivatives (structure shown in
Formula I-V),
luciferase reporter assays were performed in several PCa cell lines including
LNCaP, c4-2b,
22RV1 and AR-transfected PC3 cells. As shown in Fig. la and b, AIL dose-
dependently
inhibited the DHT-induced transcriptional activities of AR and constitutively
active truncated
AR1-651 at low concentrations (AR-FL IC50 = 69 nM, 95% confidence interval =
53-89 nM; ARi_
651 IC50 = 309 nM, 95% confidence interval = 236-687 nM in 22RV1 cells). The
AIL-mediated
repression of AR activity was also observed in PC3 cells co-transfected with
the AR expression
vector plasmid and reporters (Fig. 13g).
In order to examine whether AIL and its derivatives had an effect on AR-
dependent
endogenous gene expression, the levels of mRNA transcripts for numerous well-
characterized
AR-regulated genes were measured in LNCaP cells. As shown in Fig. lc, AIL or
its derivatives
26
CA 02947802 2016-11-08
decreased the androgen-dependent induction of endogenous PSA, TMPRSS2, FKBP5,
SLC45A3
and NDRG1 mRNA expression. Since AR-Vs lacking the LBD are resistant to AR
antagonists,
we next investigated whether AIL blocked its constitutive and androgen-
independent AR activity.
As shown in Fig. 1d, the constitutively active truncated AR1_651 lacking the
LBD was resistant to
the AR antagonists bicalutamide (BIC) and MDV, but its transcriptional
activity was also
blocked by AIL in a dose-dependent manner (Fig. id, left panel). Similarly, in
22RV1 cells
which naturally express AR-Vs, although MDV decreased the level of the AR
target gene PSA
in the presence of the synthetic androgen methyltrienolone (R1881), it had no
effect in the
absence of R1881. However, AIL down-regulated PSA not only in the presence but
also in the
absence of R1881 (Fig. id, right panel). Taken together, AIL inhibited the
activity of both
theandrogen inducible AR-FL and the constitutively active truncated AR lacking
the LBD.
Table 1. The pharmacokinetic parameters of AIL after oral administration or
intravenous
injection in rats (mean s.d.)
pharmacokinetic p.o. (5mg kg-I) i.v. (lmg kg-1)
parameters n=6 n=6
11/2 (min) 730.2 155.9 113.3 + 39.6
Tmax (min) 23.3 + 31.8
Cmax (ng mL-I) 87.0+ 16.4
Cmax (nM) 231.1 43.6
Co (ng mL-1) 1653.2 98.6
Co (nM) 4392.1 261.9
AUCo.t (min*ng mL-1) 67324.5 7405.3 57874.3 6871.1
AUC0.(min*ng m1.4-1) 79053.9 14616.6 61517.4
5986.2
Bioavailability 25.7%
Table 2. Calculation of physicochemical properties of AIL
Compound M.W NO. of NO. of TPSA R.B pKa LogP
HBD HBA
Ailanthone 376.4 3 7 113.29 0 12.2 -
0.77
(AIL) 1.0 0.62
M.W: molecular weight; TPSA: Topological molecular polar surface area; HBD:
Hydrogen Bond Donors; HBA: Hydrogen Bond Acceptors; R.B: Rotatable Bonds
27
CA 02947802 2016-11-08
Example 2 AIL and its derivatives inhibit the proliferation of PCa cells
We examined whether AIL and its derivatives affected the proliferation of AR
positive PCa
cells. Using the Sulforhodamine B colorimetric (SRB) assay, we confirmed that
AIL and its
derivatives potently inhibited the growth of several PCa cell lines including
LNCaP, c4-2b,
22RV1 and LAPC4 (Fig. 7a). In addition, AIL and its derivatives induced Gl-
phase arrest of
instead of apoptosis (Fig. 14a and b; Supplementary Methods). Interestingly,
AIL and its
derivatives more potently inhibited the growth of AR positive prostate cancer
cells than either
AR negative tumor cell lines or normal prostate cell lines (Fig. le, Fig. 7b
and Fig. 8). In the
colony formation experiments, AR positive cells were also more sensitive to
AIL and its
derivatives (Fig. 1f). Moreover, in the transwell chamber migration assay, AIL
and its
derivatives suppressed AR-positive LNCaP cellmigration more effectively than
that of AR-
negative PC3 cells (Fig. 7c).
To examine whether AIL and its derivatives could overcome the resistance to
androgen
antagonist therapy, LNCaP, c4-2b, and 22RV1 cells were tested using the SRB
assay (Fig. 1g).
Although C4-2b and 22Ry1 cells may be androgen-insensitive, these assays were
performed in
the presence of R1881. In androgen sensitive LNCaP cells, the well-known AR
antagonists BIC
and MDV effectively blocked cell growth as well as AIL and its derivatives
(Fig. 1g). However,
in the androgen-insensitive c4-2b line and the CRPC cell line 22RV I, 10 1,tM
BIC and 10 [tM
MDV could not significantly inhibit cell growth, but 0.1 f.tM AIL or its
derivatives remarkably
inhibited growth (Fig. 1g). Furthermore, LNCaP-MDV3100-R cells (a MDV3100-
resistant
LNCaP cell sublinewhich was chronically cultured in the presence of MDVand
ischaracterized
in Fig. 18) were totally resistant to BIC and MDV at a high concentration
(201rM), but 0.111M
AIL or its derivatives treatment still significantly induced cell growth
arrest (Fig. 1h).
Collectively, AIL or its derivatives inhibited both androgen-dependent and
androgen-
independent PCa cell growth and overcame resistance to AR antagonist therapy.
Example 3 ALL and its derivatives blocks tumor growth and metastasis of CRPC
We evaluated the efficacy of AIL or its derivatives in vivo by treating 22RV1
xenografts in
male BALB/c nude mice with AIL for 35 days. Administration of 1 and 3 mgkg-
lper day AIL
and its derivatives significantly inhibited the increase of tumor volume in
22RV1 xenografts (Fig.
9). AIL and its derivatives did not significantly affect the body weight of
mice and did not show
apparent toxicity as determined by pathological review of sections of lungs,
heart, liver, spleen
and kidneys harvested from mice receiving AIL (Fig. 11a,b). Additionally,
treatment with AIL
decreased the weight of seminal vesicle of the mice (Fig. 11c), indicating
that AIL blocked AR
28
CA 02947802 2016-11-08
signaling in the mice in vivo. Therefore, we selected the dose of 2 mgkg
lperdayAIL for further
experiments in animals.
We also compared the efficiency of AIL with the well-known AR-antagonist BIC
in both
LNCaP and 22RV1 xenografts. For androgen-sensitive LNCaP cells, treatment with
either 10 mg
kg-lper day BIC or 2 mg kg-Iper day AIL significantly reduced the tumor volume
(Fig.2b and Fig.
10b). In contrast, the CRPC 22RV1 xenografts were resistant to BIC
administration, but AIL
strongly inhibited tumor growth (Fig. 2a and Fig. 10a). Furthermore, we
compared the efficiency
of AIL with the next generation AR-antagonist MDV in another cell line,VCaP,
which expresses
AR-Vs but is still sensitive to androgen. As shown in Fig. 2c and Fig. 10c,
VCaPxenograftswere
more sensitive to AIL compared with MDV3100, although VCaPxenografts still
responded to
MDV3100.
To more closely mimic human disease, we further evaluated whether AIL
regressed CRPC
in vivo. Castrated mice bearing 22RV1-luc orthotopicxenografts were treated
with AIL. As
shown in Fig. 2d and Fig. 12a, AIL suppressed the 22RV1 orthotopicxenografts
in castrated mice,
whereas these CRPC xenografts were resistant to MDV. AIL administration
reduced the tumor
volume by 82% (95% confidence interval = 70-95%), whereas MDV treatment
reduced the
tumor volume by only 15% (95% confidence interval = 0-36%). In addition, AIL
inhibited tumor
metastasis and reduced kidney injury in this CRPC model. 80% of control mice
but only 20% of
AIL-treated mice had obvious metastasis (Fig. 2e and Fig. 12b) and kidney
injury (Fig. 20. In
summary, AIL not only inhibited the tumor growth and metastasis of MDV-
resistant 22RV1
cells, but also reduced kidney injury and metastases in orthotopicxenografts.
Example 4 AIL down-regulates AR protein level in vitro and in vivo
To investigate the mechanism of AR transcriptional activity inhibition by AIL,
we firstly
determined the AR protein level after AIL treatment in PCa cell lines. AIL
potently reduced AR
protein expression in a dose-dependent manner in LNCaP,22RV1, LNCaP-MDV3100-R,
and
VCaP cell lines (Fig. 3a). In AR positive PCa cell lines, AR was more stable
and had a higher
basal level in the presence of synthetic androgen R1881; we observed that AIL
reduced the AR
protein level both in the absence and in the presence of R1881 (Fig. 3b and
Fig. 13a). Notably,
AIL down-regulated the truncated splice variants of AR (Fig. 13b and 13c)
which were
continually active and resistant to AR antagonist therapy. Indeed, knockdown
of AR-Vs
decreased the proliferation of VCaP and 22RV1 cells which have high expression
of AR-Vs (Fig.
16c and d). Furthermore, we examined whether AIL prevented AR nuclear
translocation by
transfecting an AR-GFP fusion protein into PC3 cells. As expected, the nuclear
translocation of
AR-GFP induced by R1881 was decreased by AIL in PC3 cells (Fig. 3c and Fig.
13d). The
29
CA 02947802 2016-11-08
HSP90 complex plays a major role in stabilizing unliganded AR24. Therefore, we
examined
whether AIL affected the members of the HSP90 complex. Unexpectedly, AIL did
not down-
regulate the AR molecular chaperones HSP90 and HSP70 in PCa cells (Fig. 3d).
We further
confirmed this phenomenon in the AIL-treated 22RV1 orthotopicxenografts. As
demonstrated in
Fig. 3e and f, AIL reduced the expression of AR protein and its target genes
but had no effect on
the AR molecular chaperones HSP90, HSP70 and HSP40 in vivo. AR down-regulation
and
proliferation inhibition by AIL treatment in 22RV1 orthotopicxenografts were
also confirmed by
immunohistochemistry (Fig. 3g). Additionally, in an in vivo assay, treatment
with AIL decreased
the mRNA level of the AR-splice variant AR-V7 as well as total AR (Fig. 30,
which might be
caused by a secondary effect of long-term AIL treatment.
Example 5 Induction of AR degradation by AIL
To investigate why AIL reduced the expression of AR protein but not its
molecular
chaperones, we tested the effect of AIL on AR protein stability. Surprisingly,
AR protein
stability was significantly reduced under AIL treatment (Fig. 4a). However,
there was no
significant effect on AR and AR-V7 mRNA when treated with the same
concentration of AIL,
although the PSA mRNA level was decreased (Fig. 4b). To test whether AIL
induced AR
degradation through the proteasome pathway, we treated cells with the
proteasome inhibitor
MG-132, which resulted in a marked suppression of AIL-induced AR depletion
(Fig. 4c). More
importantly, treatment with AIL induced ubiquitination of AR (Fig. 4d).
Interestingly, while AIL
treatment decreased AR, AKT as well as Cdk4 protein levels, it did not
influence their
chaperones HSP90, HSP70 and HSP40 which were all essential for the HSP9O-HSP70
chaperone complex (Fig.13f). To further illustrate this mechanism, we
performed co-
immunoprecipitation and observed that AIL prevented the interaction of AR with
HSP90 and
HSP70 as well as HSP40 (Fig. 4c). Together with the decreased protein
stability, these data
suggested that AIL might induce AR degradation by disrupting the interaction
of AR with its
chaperones HSP90 and HSP70, resulting in AR ubiquitination and degradation. In
addition, AIL
treatment led to AKT and Cdk4 downregulation, potentially driving the
decreased proliferation
in AIL-treated cells.
Given that AIL disrupted the interaction of AR with its chaperone HSP90, we
then tested
whether AIL inhibited HSP90 activity. Using the geldanamycin-FITC fluorescence
polarization
assay, we found that AIL did not inhibit HSP90 activity (Fig. 41). We also
observed that 17-
AAG induced up-regulation of HSP90 and HSP70 protein but AIL did not influence
them (Fig.
13e), suggesting that AIL, unlike 17-AAG, was not an HSP90 inhibitor.
CA 02947802 2016-11-08
Example 6 Interaction of AIL with p23 in vitro
Foldosome complex assembly occurs through a series of steps, beginning with
HSP40 and
HSP70 binding to AR, followed by HSP90 and HOP, and then succeeded by ATP-
dependent
binding of p23, FKBP51 and FKBP52 which displace HSP40, HSP70, and HOP24.
Additional
foldosome proteins include cdc37 and HDAC636. Accordingly, we next determined
whether AIL
disturbed the interaction between these proteins and HSP90. AIL obviously
prevented the
interaction between p23 and HSP90, but had no significant influence on the
interaction of other
proteins with HSP90 (Fig. 5a). By Biacore assay, we confirmed that there was
no interaction
between AIL and HSP90 (Fig.I5a; Supplementary Methods). However, AIL
interacted directly
with p23 (KD = 1. 79 x10-06 M) (Fig. 5b). Celastrol (CEL) was used as a
positive control of p23
interaction (Fig. 15b). We also performed a molecular docking modeling
simulation using the x-
ray crystal structure of the p23 functional domain, and identified a potential
binding site on the
surface of p23 that could reasonably accommodate AIL binding (Fig. 5c and Fig.
15c). In
addition, both treatment with AIL and CEL down-regulated the protein level of
AR rather than
the chaperones HSP90 and HSP70 (Fig. 16a), indicating that AIL and CEL might
share a similar
mechanism. Furthermore, p23 knockdown ablated the ability of AIL treatment to
induce cell
growth arrest (Fig. 16b). Also, overexpression of p23 dose-dependently rescued
AIL-mediated
cell proliferation inhibition (Fig. 16e), suggesting that p23 might be a
critical target of AIL.
Besides, we found that AIL indeed suppressed the activities of both
glucocorticoid receptor (GR)
and progesterone receptor (PR) (Fig. 13g), suggesting that AIL is not specific
in targeting AR
since p23 has different client proteins. However, compared with AR, the
inhibition of GR and
PR by AIL is less sensitive. For example, 0.4 M AIL resulted in 70%
inhibition of AR-induced
reporter activities, but AIL just blocked the PR and GR-induced reporter
activities by about 30%
(Fig. 13g).
To investigate if AIL suppressed the functioning of continually active AR
lacking the LBD,
we performed RNA-seqafter treatingLNCaP cells with or without AIL in the
absence or presence
of AR1-651. Indeed, as shown in Fig. 5d (top) and Supplementary Data1, ALL
strongly suppressed
AR1_651-induced gene expression, supporting the potential therapeutic use of
ALL in CPRC.
Those genesnot only included the classic androgen-regulated genes e.g. KLK3,
FKBP5 and
NKX3.1 (indicated by red), but also involved other non-classic androgcn-
induced genes e.g.
MYCBP, WNT10A, CDK2 (indicated by black), indicating that AR mutations causing
LBD loss
might lead to extra transcriptional functions and contribute to drug
resistance. Gene Ontology
(GO) analysis (Fig. 5d, bottom; Supplementary Methods) demonstrated that
AR1.651-induced
genes were involved in cell cycle, proliferation and cell adhesion, suggesting
that AR lacking the
31
CA 02947802 2016-11-08
LBD has oncogenic functions.
To sum up, all these data indicate that AIL prevented the interaction of p23
and HSP90 and
decreased the interaction between AR and the chaperones, resulting in the
ubiquitination of AR.
Consequently, AR was degraded by the proteasome, AR target gene expression
declined and
PCa growth was blocked (Fig. 5e).
Example 7 Evaluation of AIL pharmacokinetics andCYP inhibition
Compounds with good absorption, distribution, metabolism, excretion, and
toxicity
(ADME/Tox) properties are likely to increase the odds of drug discovery
success. Since AIL was
pharmacologically potent against CRPC in animal models, weevaluatedthe drug-
like properties
of AIL. Both oral (p.o.) and intraperitoneal (i.p.) administration of AIL were
highly efficient in
animal models. As shown in Fig. 6a and Fig. 17, compared with the control
group,i.p.
administration (2 mg kg-1 per day AIL) and p.o.administration(5 mg kg-1 per
day AIL)
reducedthe tumor volume of MDV3100-resistant 22RV1 xenografts by 77.5%. We
noted a
modest decrease in mouse body weight in thep.o. treated group (Fig. 6g), which
was caused by
neither overdose nor liver toxicity (Fig. 6c), but rather by A1L-induced
stomach injury (Fig. 6h).
Next we determined the pharmacokinetics (PK) of AIL based on the
pharmacodynamic (PD)
efficiency of AIL in 22RV1 xenografts, because the PK-PD model of AIL could
confirm the dose
levels and drug exposures necessary for AIL to achieve potent antitumor
activity in vivo. The
concentration of AIL in nude mouse plasma was 1216.2 ngmL-1 at 10 min after
i.p.
administration. This concentration far exceeded its effective concentration in
vitro (IC50=69 nM,
25.94 ngmL-1), although the minimal effective concentration in vivo is
unknown. The period that
the concentrations of AIL in the plasma remained above the in vitro IC50
lasted for up to 2 hours
(44.83 ngmL-1) (Fig. 6b).
In the p.o. administration group, the plasma ALL concentration reached
203.9ngmL-1 at 15
min after administration (Fig. 61)). The period thatthe AIL plasma
concentration remained above
ICsoin vitro was about 6 hours because of the absorption process. Moreover,
thep.o. exposure
was lower than thei.p. exposure after dose normalization because of intestinal
absorption as well
as first-pass metabolism. Since the concentration of AIL remaining in the
plasma immediately
before the next administration was 1.43 ngmL-1 for thei.p. group and 1.84 ngmL-
1 for the p.o.
group, respectively, the efficacy of AIL in vivo might not last for the whole
24 hour treatment
interval time.
The preclinical pharmacokinetics of AIL were also evaluated in Sprague-Dawley
rats
(Supplementary Methods). Our previous studies have shown that the
pharmacokinetic profiles of
AIL in rats after intravenous (iv.) administration exhibit linear
pharmacokinetics37. Here we
32
CA 02947802 2016-11-08
found that AIL was absorbed quickly, eliminated rapidly and distributed widely
in tissues after
oral administration (Fig. 61 and Table 1). Moreover, the oral bioavailability
of AIL was 25.7%,
which waswell within the range of acceptable bioavailability (>20%),
suggesting that AIL could
be a potential drug candidate in clinical trials.
In addition, the effect of AIL on the activity of CYP enzymes was evaluated.
As shown in Fig. 6c,
AIL (1.25 uM to 100 p,M) had no significant inhibitory effects on the main CYP
isoforms
(CYP1A2, 2C9/11, 2D1/6, 2E1 and 3A1/2/4) in humans and rats. Finally, we
noticed that AIL
did not exert obvious hepatotoxicity or significant influence on the
expression of CYP2C11,
CYP3A1/2 and CYP1A2 in the livers of mice (Fig. 6d and e).
Discussion
AR mediates transcriptional programs in CRPC distinctly38. Current therapies
have
concentrated on the androgen-dependent activation of AR through its LBD, but
do not provide
a continuing clinical benefit for patients with CRPC and presumably fail due
to multiple
mechanisms including the expression of a constitutively active splice variant
AR lacking the
LBD. These AR-Vs can signal in the absence of ligand and are therefore
resistant to LBD-
targeting AR antagonists or agents that repress androgen biosynthesis13' 14'
39.
In this work, we identified a natural compound AIL which potently blocked the
activities of
ligand-induced full-length AR and constitutively active truncated AR which
lacks the LBD.
Moreover, this compound reduced the expression of both the full-length AR and
the truncated
AR in vitro and in vivo. Furthermore, AIL was able to inhibit MDV3100-
resistant AR-Vs
expressing PCa. Notably, not only i.p. administration but also p.o.
administration of AIL had
excellent efficiency forblocking the growth of CRPC xenografts. In
pharmacokinetic studies,
AIL exhibited good solubility in water andgood bioavailability (>20%). In
addition, AIL
effectively suppressed CRPC tumor growth, despite not reaching a steady state
of plasma drug
concentration during the course of treatment. The stomach injury we
observedmay be
attributable to gastrointestinal toxicity of AIL after oral administration,
which is likely to be
dosage dependent. Thus, we speculate that if we shorten the treatment time
interval or reduce the
dosage of AIL, it would become even more effective and less toxic. In
addition, weals
addressed some key safety issues of AIL, such as CYP inhibition and
hepatotoxicity. In vitro
CYP inhibition data are particularly important during drug discovery for
providing early warning
of potential safety issues and for planning human clinical studies. Hence, the
U.S. Food and
Drug Administration (FDA) recommended that CYP-associated metabolic studies in
vitro should
be performed. The current study showed that AIL had no obvious inhibitory
effects on the main
CYPs in humans and rats, including CYP1A2, CYP2C9 (human) / 2C11 (rat), CYP2D1
(rat) /
33
CA 02947802 2016-11-08
2D6 (human), CYP2E1 and CYP3A1/2 (rat) / 3A4 (human) isoforms. In addition,
AIL did not
influence the expression of CYP enzymes and had no significant hcpatotoxicity
after a 5-day
administration in the present study. Therefore, AIL would have a low potential
to cause possible
toxicity and drug-drug interactions involving CYP enzymes, suggesting a
sufficient safety
window for its putative use as a promising anticancer agent. Meanwhile,
various
physicochemical properties of AIL were calculated on the ACD/I-Lab and the
results showed
that the physiochemical parameters of the natural compound AIL met with
"Lipinski's Rule of
Five" (Supplementary Methods). Indeed, compounds possessing properties that
exceed the
Lipinski rules tend to have low oral bioavailability. Our results suggest
that, if potential
gastrointestinal toxicity can be overcome through dosage modulation, ALL can
be developed as
apotential drug candidate with various drug formulations because of its ideal
solubility and
bioavailability.
This study also explored the mechanism of AIL-induced AR degradation. We found
that
ALL disrupted the interaction between AR and the chaperones HSP90, HSP70 and
HSP40, and
consequently AR was ubiquitinated and degradated through the proteasome-
mediated pathway.
When not bound to ligand, AR resides in the cytosol bound to the foldosome, a
complex of heat
shock, chaperone and co-chaperone proteins including HSP90, HSP70, HSP40 and
p23, amongst
others24. The HSP90 dimer undergoes an ATP-driven reaction cycle. Various
cofactors
wereregulated in this cycle: CDC37, which delivers certain kinasc substrates
to HSP90 and
inhibits the ATPase activity; HOP, which reversibly links together the protein
chaperones Hsp70
and Hsp90; p23, which stabilizes the dimerized form of HSP90 before ATP
hydrolysis36; and
HDAC6, which mediates acetylation/deacetylation of HSP9040. Inhibiting the
chaperone HSP90
causes AR instability or blocks nuclear translocation41, 42,43 . Since AIL did
not bind to HSP90 or
affect chaperone expression, our results suggest that ALL is not an ATP
competitive inhibitor of
HSP90 like 17-AAG. However, AIL could bind to p23 protein which is very
important for the
stabilization of the HSP90-complex36 and AIL prevented the interaction of
HSP90 with p23.
Given that AIL was able to bind to p23 and knockdown of p23substantially
prevented AIL-
induced cell growth arrest (Fig. 5b and Fig. 16b; Supplementary Methods), we
propose that AIL
induces AR degradation through binding to p23 and disrupting the HSP90-client
complex.
Furthermore, constitutively active AR variant expression does not confer
resistance to ALL.
Indeed, recent papers have shown that constitutively active AR variants played
their roles
independently of the HSP90 chaperone but did not confer resistance to HSP90
inhibitors44' 45,
indicating that the mechanisms of ALL also include HSP90 complex inhibition.
Not surprisingly,
AIL also suppressed the activities of other nuclear receptors including
progesterone(PR) and
34
CA 02947802 2016-11-08
glucocorticoid receptor (GR)(Fig. 13g), indicating that repression of
glucocorticoid and
progesterone receptor signaling might contribute the therapeutic efficiencies
of AIL in CRPC.At
higher concentrations (up to 10 .M as well as 50 p.M), AIL also significantly
decreased the cell
growth of PC3 and DU145 (Fig.le and Fig. 8), which might be caused by the
degradation of
other p23 clients (AKT and Cdk4). Indeed, prostate cancer cells that express
AR showed greater
sensitivity to inhibition of growth by AILat lower concentration, suggesting
the degradation of
AR by AIL plays a major role in inhibiting cell growth of AR-positive prostate
cancer cells at
low concentrations of AIL. Alternatively, the degradation of AR and other
clients including
AKT and Cdk4 may have induced synthetic lethality by blocking multiple signal
pathways in
AR positive cells, rendering AR positive cell lines sensitive to AIL.
Knockdown of AR achieved
only about 30% growth inhibition, whereas p23 knockdown was more effective in
inhibiting
22Rv1 cell growth (Fig. 16b), suggesting that other downstream targets of ALL
mediated by the
inhibition of p23, such as AKT, Cdk4 or others are important for prostate
cancer cell growth
inhibition. Therefore, we conclude that targeting p23 is the major mechanism
of AIL. Meanwhile,
AIL-induced AR degradation is at least a critical mechanism of AIL-dependent
cell growth
inhibition in prostate cancer. Since overexpression of p23 could not totally
rescue the AIL-
induced cell growth inhibition (Fig. 16e), we conclude that p23 also has other
potential targets
including protein synthesis46.
In fact, how ALL regulates the molecular conformation of p23 and prevents the
interaction
of p23 with HSP90 remains undetermined in our work. Clarifying the mechanism
of AIL
remains to be further investigated.
P23 is able to increase the AR protein level and AR transcriptional activity
which is
independent of its role in the HSP90 foldosome complex30. Significantly, p23
expression is
implicated inresistance to HSP90 inhibitors28, and plays a role in PCa
metastasis. Consequently,
inhibition of p23 is likely to counteract CRPCs that have developed resistance
to HSP90
inhibitors, and AIL may serve to synergistically enhance the efficacy of HSP90
inhibition in
ablating CRPC in addition to its efficacy as a solitary agent against CRPC.
CELwhich effectively
inhibits prostate cancer cells47'48has been reported to inhibit p23 function
and to bind to three
cystine residues of p23: Cys-40, Cys-58, and Cys-7549. Importantly, our
molecular modeling
indicates that AIL binds to a different region of p23 (Figure 5c;
Supplementary Methods),
suggesting that AIL has the potential to synergize with CELin inhibiting p23.
Finally, p23 has
also been implicated in breast cancer lymph node metastasis and drug
resistance31, highlighting
the potential value of AIL in treating multiple cancer types.
In conclusion, we screened and characterized ALL, a novelcompound with
excellent drug-
CA 02947802 2016-11-08
like characteristics that is able to overcomeMDV3100-resistancein prostate
cancer cell lines.AIL
was efficacious in suppressing the growth and metastasis ofCRPC via targeting
p23. As a result,
AIL can be considereda new potential drug candidate forprostate cancer, and it
isworthy of
further research and investigation.
Methods
Cell culture
Prostate cancer cell lines c4-2b, LAPC4 and normal prostate epithelial cell
line RWPE-1
used in this study were kindly provided by Dr Ying-Hao Sun (Department of
Urology, Changhai
Hospital, Shanghai, China). Other human prostate cancer cell lines were
purchased from the Cell
bank of the Chinese Academy of Science. The cell lines were authenticated by
short tandem
repeat analysis and mycoplasma contamination wastested by the PCR Myeoplasma
Detection Set
(Takara, Otsu, Japan).293T cells were routinely maintained in DMEM (GBICO),
while prostate
cancer cells were cultured in RPMI 1640 (GBICO). Media were supplemented with
10% FBS
(BioWest, cat. no. S1580-500) and 1% penicillin/streptomycin unless otherwise
specified.
RWPE-1 was cultured in serum-free medium (Invitrogcn, Carlsbad, CA).
Dual luciferase screening assay
For dual luciferase screening assay,prostate cancer cells were transfected
with MMTV-Iuc,
Renilla-luc (phRL-TK, Promega), ARor AR1-651(vector: pFLAG-CMV-1) plasmids
(provided
by Dale-Min Wong)5() using lipofectamine 2000 (Invitrogen) according to the
manufacturer's
instructions. After transfection for 24 hours, the transfeeted cells were
treated with DHT (Sigma,
cat. no. A8380) or DHT with compounds for 12 hours. Renilla and firefly
activities were then
determined by luminometry using the Dual-Luciferase Reporter Assay System
(Promega) and
the ratio calculated. Results were expressed as the ratio of firefly to
Renilla luciferase activity.
Quantitative Real-Time PCR
Cells were cultured with RPMI 1640 with 5% charcoal dextran treated FBS for 5
days prior
to treatment with R1881 (Sigma, cat. no. R0908) alone or R1881 and AIL for 12
h. Total RNA
was extracted using TRIzol (Takara, Japan) according to the manufacturer's
instructions. 1 pig of
total RNA was used for cDNA synthesis using a cDNA reverse transcription kit
(Takara, Japan).
Real-time PCR was performed in triplicate using gene-specific primers on a
Stratagene Mx3005P PCR system (Agilent Technologies) machine. The mRNA
expression
levels were normalized to I3-actin expression or GAPDH. All analysis was
performed using
Microsoft Excel 2010 and GraphPad Prism 5 software. The gene-specific primers
are listed in
Table 3.
36
CA 02947802 2016-11-08
Table 3. Sequence of quantitative-PCR primers
Name of Gene Primer (5' to 3')
AR-F GGTGAGCAGAGTGCCCTATC
AR-R GAAGACCTTGCAGCTTCCAC
PSA-F CTTGTAGCCTCTCGTGGCAG
PSA-R GACCTTCATAGCATCCGTGAG
TMPRSS2-F CTGGTGGCTGATAG GG GATA
TMPRSS2-R GGACAAGGGGTTAGGGAGAG
NDRG 1-F CGAGACTTTACATGGCTCTGT
NDRG1-R TCCATGGAGGGGTACATGTA
FKBP5-F AGAACCAAACGGAAAGGAGA
FKBP5-R GCCACATCTCTGCAGTCAAA
SLC45A 3-F GCAGTGAGGACAG CCTGATG
SLC45A 3-R CGGAGACATCACAGGCAGAG
GAPDH-F ACCCAGAAGACTGTGGATGG
GAPDH-R TTCAGCTCAGGGATGACCTT
P-actin-F GTACGCCAACACAGTGCTG
P-actin-R CGTCATACTCCTGCTTGCTG
AR-v7-F AAAAGAGCCGCTGAAGGGAA
AR-v7-R CCAACCCGGAATTTTTCTCCC
Sulforhodamine B (SRB) assay
For sulforhodamine B (SRB) assay, cells were cultured in complete RPMI 1640
and
incubated with indicated concentrations of AIL or cells were maintained in
fresh phenol red-free
RPMI 1640 medium with 5% charcoal-stripped FBS (c-FBS; Wisent), 1 nM DHT and
indicated
compounds. After 48 h or 72 h the cells were then fixed and the cell growth
was detected with
the sulforhodamine B (SRB) assay51. Ailanthonc (AIL) was purchased from
Shanghai Zhanshu
Chemical Technology, Co., Ltd (Shanghai, China). Bicalutamide (BIC) and
MDV3100 (MDV)
were purchased Selleckchem.
Cell colony formation assay
For colony formation assay, prostate cancer cells were incubated with
indicated
concentrations of AIL in complete RPMI 1640 for two weeks and then cells were
fixed with 4%
paraformaldehyde and stained with crystalviolet. Colonies were visualized
under a microscope,
37
CA 02947802 2016-11-08
and all of the fields were imaged and counted. Colony formation as a % of
vehicle control for
each cell line is presented.
Western blotting
Cells were treated as described in the corresponding section of Results and
then lysed by
boiling for 10 min in sample buffer (2% SDS, 10% glycerol, 10% 13-
Mercaptoethanol,
Bromphenol Blue and Tris-HC1, pH 6.8). Lysates were fractionated on
polyacrylamide gels and
transferred to nitrocellulose. The blots were probed with specific antibodies
followed by
secondary antibody then membranes were examined using the LI-COR Odyssey
infrared
imaging system (LI-COR Biotechnology, Lincoln NE). The AR (N20, sc-816 and
H280, sc-
13062; 1:1000), HSP90 (sc-7947; 1:1000), and Cdk4 (sc-260; 1:1000) antibodies
were purchased
from Santa Cruz Biotechnology (Santa Cruz, CA). The HSP70 (1776-1; 1:5000),
HSP40 (3532-1;
1:1000), and Ubiquitin (1646-1; 1:1000) antibodies were purchased from
Epitomics (Burlingame,
CA). p23 (ab92503; 1:1000) andHop (ab126724; 1:1000) antibodies were purchased
from
Abeam (Cambridge, MA). Akt (4691; 1:1000) and HDAC6 (7558; 1:1000) antibodies
were
purchased from Cell Signaling Technology (Danvers, MA). CDC37 (4222S; 1:1000)
antibody
was purchased Biogot Biotechnology Co., Ltd (Shanghai, China). The 13-actin
antibody (1:10000)
was purchased from Sigma (St. Louis, MO). The secondary antibody was
conjugated with
IRDye 680/800 (Millennium Science; 926-32221, 926-32210; 1:10000). Uncropped
blots are
shown in Fig. 19.
Co-immunoprecipitation
22RV1 and LNCaP cells were treated with or without AIL in the presence of10
1tMMG132.
After 24 h, cells were washed with cold PBS and harvested in
immunoprecipitation buffer (0.1%
Triton X-100, 2 mgmliaprotinin, 100 mgml-1 PMSF, 100mM NaC1 in 50mM Tris¨HC1,
pH 7.2).
The lysate was lysed for 1 h at 4 C and centrifuged at 16000 g. The
supernatants were incubated
with 2pgantibody to AR (Santa cruz, H280), HSP90 (Santa cruz, sc-7947) or
HSP70 (Epitomics,
1776-1) with 20 id of protein A/G (Abmart) and rocked for 2.5 11 at 4 C. The
protein A/G beads
were pelleted and washed three times with immunoprecipitation wash buffer. The
precipitates
were resolved on SDS¨PAGE gel and subjected to Western blot analysis.
In viva subcutaneous tumor growth xenograft models
BALB/c-nude mice (6-8 week old, male) were purchased from the Sino-British
Sippr/BK
Lab Animal Co., Ltd (Shanghai, China) and maintained under pathogen-free
conditions. The
animal use protocol was approved by the Institutional Animal Care and Use
Committee of East
China Normal University. The 22RV1,LNCaP and VCaPxenograft tumor modelswere
developed
by injecting 3 x 106 22RV1 cells or 5 x 106LNCaPorVCaP cells in suspension
into the right
38
CA 02947802 2016-11-08
flank of a BALB/c-nude mouse;cells were suspended in 100 ul PBS or 50%
matrigel(LNCaP and
VCaP) respectively. Specifically for LNCaP and VCaP cells, continuous release
testosterone
pellets (15 mgtestosterone per pellet, Sigma-Aldrich) were implanted
subcutaneously to
stimulate the growth of LNCaPand VCaPxenografts. Tumor nodules were allowed to
grow to a
volume about 100 mm3 before initiating treatment. Tumor-bearing BALB/c-nude
mice were
randomly assigned to three groups and treated with the indicated compound or
drug. The tumor
volume and mouse body weight were measured twice a week. The tumor volume was
calculated
using the following equation: tumor volume (V) = length x width x width x
0.52.
Orthotopiccastration resistant prostate cancer model
For orthotopiccastration resistant prostate cancer xenografts, male BALB/c-
nude mice (8-9
weeks of age) were anesthetized using 150mgkg-1 2,2,2-tribromethanol plus
350mgketert-amyl
alcohol and then 5 x 105 22RV1-lue cells suspended in 30 I 50% matrigelwere
surgically
injected into the dorsolateral prostate lobes. One week after injection, the
tumor-bearing mice
were castrated and randomly assigned to three groups. A week later, animals
were
intraperitoneally injected with AIL (2 mgkg-1), MDV (10 mgkg-1) or DMSO (as
controls).
Prostate tumor growth and local metastasis were monitored weekly using the
IVIS Imaging
System (Xenogen Corporation, Alameda, CA). Images and measurements of
bioluminescent
signals were acquired and analyzed using LivingImage and Xenogen software52.
Histology and Immunohistochemistry (IHC)
Tumors or mouse tissue samples were immediately fixed in 10% neutral buffered
formaldehyde for 24 hours, progressively dehydrated in solutions containing an
increasing
percentage of ethanol (75, 85, 95 and 100%, v/v), and embedded into paraffin
blocks. For
immunohistochemical (IHC) staining, sections were cut from the paraffin blocks
and IHC was
carried out using anti-Ki-67 (1:250), and anti-AR (1:50; N-20) as primary
antibodies. Samples
were stained with hernatoxylin-eosin (HE) to indicate nucleus and cytoplasm,
respectively.
Geldanamycin-FITC fluorescence polarization assay
Fluorescence polarization assay53 measurement of binding affinities between
AIL and p23
as well as HSP90 was used to confirm whether AIL inhibited fluorescein-
conjugated
geldanamycin (FITC-GA) binding to the ATPase site of the HSP9Oce
isoform.Detailedly, FITC-
GA (invivogen, Cat.No.ant-fg1-1) was dispensed into wells containing AIL at a
final
concentration of 0.16 nM FITC-GA. HSP9Ou recombinant protein (BPS, cat. no.
50290) in
buffer (50 mMKC1, 5 mM MgC12, 20 mM HEPES, pH 7.3-7.5, 0.1% CHAPS (Sigma, cat.
no.
C5070), 0.1% bovine gamma-globulin (Sigma, cat. no. G7516), and 2
mMdithiothrcitol (Sigma,
cat. no. 646563) was then added to the well at final concentration of 30 nM.
For IC50
39
CA 02947802 2016-11-08
determination, 1001tM AIL was serially diluted l :4by transferring 20 Rlinto
60 RI of 100%
DMSO intosuccessive wells for a total of 10 final concentrations. As a
positive control, 10 M
17-AAG (Selleckchem, Cat. no. S1141) was serially diluted 1:10 by transferring
10 ill to 90 RI of
100% DMSO in the next well repeatedly for a total of 10 final concentrations.
The assay plate
was covered and incubated at 4 C overnight. Data were collected on Victor-3
with the setting
Ex480/Em535. mP values were converted to percent inhibition values. Percent
inhibition =
(sample RLU - min)/(max - min)x100%. "min" means the mP of no enzyme control
and "max"
means the mP of DMSO control. Data was graphed in MS Excel and the curves were
fitted by
XLFitExcel add-in version 4.3.1.
AIL-p23 docking studies
The protein structure of p23 was obtained from Protein Data Bank (PDB ID:
1EJF) and the
PDB file wasprocessed by removing water molecules and cationsfor the next
docking step.
Docking studies were performed by using AutodockVina 1.1.2, and all images
were generated in
UCSF Chimera 1.8. The protein structure of p23 was obtained from Protein Data
Bank (PDB ID:
lEJF) and the PDB file was processed byremoving water molecules and S042- for
the next
docking step. Docking studies were performed by using AutodockVina 1.1.2, and
all images
were generated in UCSF Chimera 1.8. The active site was similar to thereported
site' 54' 55. The
correlative parameters were listed in Table 4 and other parameters chosen
were: num_modes = 9
and exhaustiveness = 16. The lowest energy conformation was chosen for binding
model
analysis.
Table 4. Parameters of docking studies
X
Center 3.261 19.118 33.447
Size of Box 42 40 44
Pharmacokinetic studies and CYP-associated metabolic studies
Pharmacokinetic studies in vivo37 and CYP-associated metabolic studies in
vitro56 were
performed using the method reported previously in our laboratory.ln this
study, the effects of
Ailanthoneon CYP activities were investigated using rat and human liver
microsomes,
employing phenacetin (CYP1A2), tolbutamide (CYP2C9/11), dextromethorphan
(CYP2D1/6),
chlorzoxazone (CYP2E1) and testosterone (CYP3A2/4) as the probe substrates.
They
wereanalyzed on an Agilent 1260 series instrument with DAD detection and
separated by an
CA 02947802 2016-11-08
Agilent ZORBAX Eclipse XDB-C18 column (4.6 x 150 mm, Slim) with a guard column
in the
respective gradient elution procedure. The incubation system, sample
preparation and
chromatography conditions are as described previously56.
ALL treatmentof tumor-bearing BALB/c-nude mice
22RV 1 xenografts were performed as descripted in "In vivo subcutaneous tumor
growth
xenograft models" above. After the volume of a tumor nodule reached about 100
mm3, tumor-
bearing BALB/c-nude mice were randomly assigned to three groups and treated
with 2 mgkg-1
ALL (intraperitoneal injection, i.p) or 5 mgkg-1 (oral administration, p.o.)
and the control group
was orally treated with an equal volume ofPBS (p.o.). Since we found that AIL
was water
soluble, AIL was dissolved in PBS in this experiment. After 30 days of
treatment, all nude mice
were subjected to retroorbital bleeding to obtain blood samples, and then
sacrificed. Plasma
samples were collected at the indicated time points after the last
administration.
HPLC-MS/MS determinationof AIL concentrations
A simple and sensitive method for the determination of Ailanthonein plasma was
developed,
using high-performance liquid chromatography-tandem mass spectrometry (HPLC-
MS/MS).
Brusatol was used as an internal standard. Separation was achieved on an
Agilent Zorbax Eclipse
Plus C18 column (2.1 x 50 mm, 1.8 pm; USA) with gradient elution using water-
methanol as
mobile phase at a flow rate of 0.2 mLmin-1, and total run time was 7.0 min. A
triple quadrupole
mass spectrometer operating in the negative electrospray ionization mode with
multiple reaction
monitoring (MRM) was used to detect Ailanthoneand IS transitions of 375.2 ¨>
301.1 and 519.1
¨> 437.4, respectively. The details of this HPLC-MS/MS method and sample
preparation
aredescribed in our previous study37.
Statistical analysis
The statistical analysis was performed by SPSS 22.0 software. The differences
between
control group and experimental groups were determined by one-way ANOVA. Since
treatment
and time course was investigated, two-way ANOVA followed by post hoc test was
also applied.
Data was expressed as mean and standard deviation (s.d.) and P < 0.05 was
considered
significant. Pharmacokinetic parameters were calculated by WinNonlin software
version 5.2.1
(Pharsight Corporation, Mountain View, USA) based on noncompartmental
analysis.
AR siRNA and p23 siRNA assay
22RV1 cells were seeded in 6-well plates and transfected with AR-siRNA and p23-
siRNA
(synthesized by Biotend, Shanghai, China) the next day. Transfection was
performed using
HyliMax REAGENT according to the manufacturer's recommendations (Dojindo
Laboratories,
Japan). The effect of siRNA on AR and p23 silencing was examined by Western
blot 72 hours
41
after transfection. After transfection for 16 hours, cells were treated with
various
concentrations of AIL for 72 hours. The gene-specific siRNAs are listed in
Table 5.
Table 5. Sequence of si-RNA
Name of Gene si-RNA (5' to 3')
AR siRNA-1 GAAAUGAUUGCACUAUUGAUU
AR siRNA-2 CGUGCAGCCUAUUGCGAGAUU
AR-V1: GAGGGUGUUUGGAGUCUCAUU
AR-V3: AAGAGCCGCUGAAGGAUUUUU
AR-Vs pool
AR-V4: GAUGACUCUGGGAGGAUUUUU
AR-V7: GCAAUUGCAAGCAUCUCAAUU
p23 siRNA AGCUUAAUUGGCUUAGUGU(dTdT)
p23 siRNA ACACUAAGCCAAUUAAGCU(dTdT)
Nonsilencing control
AAUUCUCCGAACGUGUCACGU(dTdT)
siRNA
Cell cycle analysis
After treatment with different concentrations of AIL, cells were trypsinized,
washed with
PBS and fixed with cold 70% ethanol at 4 C overnight. Cells were then washed
with PBS,
treated with 50 RNase at 37 C for 20 min and stained with 20 jig/m1
propidium iodide
solution for 15 min at room temperature in the dark. The stained cells were
analyzed using BD
LSRII flow cytometry (BD Biosciences).
Cell apoptosis analysis
After treatment with different concentrations of AIL, cells were trypsinized,
washed with
PBS and stained with 20 jig/ml propidium iodide (P1) solution and Anncxin V-
FITC for 15 min
at room temperature in the dark. The stained cells were analyzed using BD
LSRII flow
cytometry (BD Biosciences).
RNA-seq
LNCaP cells were transfected with AR1-651or empty vector as control for 24
hours and cells
were treated with or without AIL for the next 12 hours. Total RNAs were
isolated from cells and
RNA was isolated using RNeasy Plus Mini Kit (Qiagen). High quality (Agilent
Bioanalyzer
RIN >7.0) total RNAs were employed for the preparation of sequencing libraries
using Illumina
TruSeq Stranded Total RNA/Ribo-Zero Sample Prep Kit. A total of 500-1,000 ng
of riboRNA-
depleted total RNA was fragmented by RNase III treatment at 37 C for 10-18 min
and RNase III
42
CA 2947802 2017-08-29
CA 02947802 2016-11-08
was inactivated at 65 C for 10 min. Size selection (50 to 150 bp fragments)
was performed using
the FlashPAGE denaturing PAGE-fractionator (Life Technologies) prior to
ethanol precipitation
overnight. The resulting RNA was directionally ligated, reverse-transcribed
and RNase H treated.
Samples were sequenced using the Illumina HiSeq2000 platform at The Beijing
Genomics
Institute (BGI) in Wuhan, China. Genome-wide coverage signals were represented
in BigWig
format to facilitate convenient visualization using the UCSC genome browser.
Gene expression
was measured using RPKM (Reads Per Kilo-base exon per Million mapped reads) as
described
previouslyl.
Gene Ontology (GO) analysis
Using DAVID Bioinformatics Resources v6.7, a web-based functional annotation
tool for
data analysis (http://david.abcc.ncifcrEgov/home.jsp), we performed gene
ontology (GO)
analysis for biological processes (GOTERM_BP_FAT) of the AR1-651-induced genes
inhibited
by AIL treatment.
ProteOn XPR36 protein interaction array (Biaeore assay)
To measurement of binding affinities between AIL and p23 as well as HSP90, p23
(Abeam,
cat, no. ab75542) and HSP90a (BPS, cat. no. 50290) were dissolved in PBS and
immobilized
onto separate erect channels of the sensor chip by general amine coupling. p23
was immobilized
to around 23300 RUs and HSP90 was 43100 RUs. After baselines were stable, AIL
was
dissolved in PBS-T buffer flowing through the chip horizontally. 17-AAG
(binding to HSP90)
and celastrol (binding to p23) were performed as positive controls. Data were
analyzed with
ProteOn managerTM software using the Langmuir model (A+B .f--> AB) for kinetic
data fitting.
Pharmacokinetic study of ailanthone in rats
Sprague-Dawley rats (purchased from Shanghai SLAC laboratory animal Co. Ltd.,
Shanghai, China) were fasted for 12 h with free access to water prior to the
pharmacokinetic
study. The rats were randomized into two groups for oral administration
(5mg/kg) and
intravenous injection (1mg/kg). Blood samples were collected from the orbital
plexus into
heparinized centrifuge tubes at fifteen different time points between 5 min to
36 h for the oral
administration group and nine time points between 5 min to 6 h for the
intravenous one. The
pharmacokinetic parameters were calculated by WinNonlin software version 5.2.1
based on
noncompartmental analysis. Oral bioavailability was calculated as F (%) =
AUCo_.(p.o.) / AUCo-
.(i.v.) x Dose (i.v.)/ Dose (p. o.).
Mapping the AIL-binding site on p23
In order to identify how AIL bound to p23, we applied the computational
docking modeling
process based on the reported literature2' 3,4 The docking process was shown
in the AIL-p23
43
CA 02947802 2016-11-08
Docking Studies. Though analysis of docking mode, these results showed that
the phenyl of
residue Trp-8, as well as the alkyl parts of Ser-100, Val-100, Lys-95 and Arg-
93 provided
hydrophobic interactions with AIL (Figure 5C and Supplementary Figure 9C). The
indol N-11 of
Trp-8, the carboxyl of Pro-87 and the NH2 of Arg-93 provided the hydrophilic
interactions with
AIL (Figure 5C and Supplementary Figure 9C). This binding mode provides the
possibility that
AIL could insert into the pocket on the surface of p23 which was formed by Ser-
100, Val-100,
Lys-95, Arg-93 and Trp-8.
Analysis of physicochemical properties of AIL
The various physicochemical properties were calculated for AIL using the ACD/I-
Lab
website (https://ilab.acdlabs.com/iLab2/index.php). The natural compound AIL
had favorable
results in physicochemical properties of partition coefficient of LogP
(ACD/Labs) and surface
area calculations of TPSA. According to molecular weight calculations, AIL was
below 400 Da
with a high oral absorption value. AIL had favorable physicochemical
properties as the pKa was
12.2 1Ø The detailed data was listed in the Table 1.
References
1. Siegel RL, Miller I(D, Jemal A. Cancer statistics, 2015. CA: a cancer
journal for
clinicians 65, 5-29 (2015).
2. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global
cancer
statistics, 2012. CA: a cancerjournal for clinicians 65, 87-108 (2015).
3. Dutt SS, Gao AC. Molecular mechanisms of castration-resistant prostate
cancer
progression. Future oncology (London, England) 5, 1403-1413 (2009).
4. Linja MJ, Savinainen KJ, Saramaki OR, Tammela TL, Vessella RL, Visakorpi T.
Amplification anti overexpression of androgen receptor gene in hormone-
refractory
prostate cancer. Cancer research 61, 3550-3555 (2001).
5. Chen CD, et al. Molecular determinants of resistance to antiandrogen
therapy. Nature
medicine 10, 33-39 (2004).
6. Sun S, et al. Castration resistance in human prostate cancer is conferred
by a
frequently occurring androgen receptor splice variant. The Journal of clinical
investigation
120, 2715-2730 (2010).
7. Scher HI, Sawyers CL. Biology of progressive, castration-resistant prostate
cancer:
44
CA 02947802 2016-11-08
directed therapies targeting the androgen-receptor signaling axis. Journal of
clinical
oncology : official journal of the Amen can Society of Clinical Oncology 23,
8253-8261 (2005).
8. Lonergan PE, Tindall DJ. Androgen receptor signaling in prostate cancer
development
and progression. Journal of carcinogenesis 10, 20 (2011).
9. Koochekpour S. Androgen receptor signaling and mutations in prostate
cancer. Asian
journal of andrology 12, 639-657 (2010).
10. Bishr M, Saad F. Overview of the latest treatments for castration-
resistant prostate
cancer. Nature reviews Urology 10, 522-528 (2013).
11. Scher HI, et al. Increased survival with enzalutamide in prostate cancer
after
chemotherapy. The New England journal of medicine 367, 1187-1197 (2012).
12. Fizazi K, et al. Abiraterone acetate for treatment of metastatic
castration-resistant
prostate cancer: final overall survival analysis of the COU-AA-301 randomised,
double-
blind, placebo-controlled phase 3 study. The Lancet Oncology 13, 983-992
(2012).
13. Mostaghel EA, et al. Resistance to CYP17A1 inhibition with abiraterone in
castration-
resistant prostate cancer: induction of steroidogenesis and androgen receptor
splice
variants. Clinical cancer research : an official journal of the American
Association for
Cancer Research 17, 5913-5925 (2011).
14. Li Y, Chan SC, Brand LJ, Hwang TH, Silverstein KA, Dehm SM. Androgen
receptor
splice variants mediate enzalutamide resistance in castration-resistant
prostate cancer cell
lines. Cancer research 73, 483-489 (2013).
15. Antonarakis ES, et al. AR-V7 and resistance to enzalutamide and
abiraterone in
prostate cancer. The New England journal of medicine 371, 1028-1038 (2014).
16. Francini E, Petrioli R, Roviello G No clear evidence of a clinical benefit
of a sequential
therapy regimen with abiraterone acetate and enzalutamide. Expert review of
anticancer
therapy 14, 1135-1140 (2014).
17. Claessens F, et al. Emerging mechanisms of enzalutamide resistance in
prostate cancer.
Nature reviews Urology 11, 712-716 (2014).
18. Dehm SM, Schmidt LJ, Heemers BY, Vessella RL, Tindall DJ. Splicing of a
novel
androgen receptor exon generates a constitutively active androgen receptor
that mediates
prostate cancer therapy resistance. Cancer research 68, 5469-5477 (2008).
19. Guo Z, et al. A novel androgen receptor splice variant is up-regulated
during prostate
cancer progression and promotes androgen depletion-resistant growth. Cancer
research 69,
2305-2313 (2009).
20. Hu R, et al. Ligand-independent androgen receptor variants derived from
splicing of
CA 02947802 2016-11-08
cryptic exons signify hormone-refractory prostate cancer. Cancer research 69,
16-22 (2009).
21. Hu R, et al. Distinct transcriptional programs mediated by the ligand-
dependent full-
length androgen receptor and its splice variants in castration-resistant
prostate cancer.
Cancer research 72, 3457-3462 (2012).
22. Yu Z, et al. Rapid induction of androgen receptor splice variants by
androgen
deprivation in prostate cancer. Clinical cancer research : an official journal
of the American
Association for Cancer Research 20, 1590-1600 (2014).
23. Chan SC, Li Y, Dehm SM. Androgen receptor splice variants activate
androgen
receptor target genes and support aberrant prostate cancer cell growth
independent of
canonical androgen receptor nuclear localization signal. The Journal of
biological chemistry
287, 19736-19749 (2012).
24. Cano LQ, Lavery DN, Bevan CL. Mini-review: Foldosome regulation of
androgen
receptor action in prostate cancer. Molecular and cellular endocrinology 369,
52-62 (2013).
25. Azad AA, Zoubeidi A, Gleave ME, Chi KN. Targeting heat shock proteins in
metastatic
castration-resistant prostate cancer. Nature reviews Urology 12, 26-36 (2015).
26. Kim YS, et al. Update on Hsp90 inhibitors in clinical trial. Current
topics in medicinal
chemistry 9, 1479-1492 (2009).
27. Neckers L, Workman P. Hsp90 molecular chaperone inhibitors: are we there
yet?
Clinical cancer research : an official journal of the American Association for
Cancer
Research 18, 64-76 (2012).
28. Forafonov F, Toogun OA, Grad I, Suslova E, Freeman BC, Picard D. p23/Sbalp
protects against Hsp90 inhibitors independently of its intrinsic chaperone
activity.
Molecular and cellular biology 28. 3446-3456 (2008).
29. Cano LQ, et al. The co-chaperone p23 promotes prostate cancer motility and
metastasis. Molecular oncology 9, 295-308 (2015).
30. Reebye V, et at. Role of the HSP90-associated cochaperone p23 in enhancing
activity of
the androgen receptor and significance for prostate cancer. Molecular
endocrinology
(Baltimore, Md) 26, 1694-1706 (2012).
31. Simpson NE, et al. High levels of Hsp90 cochaperone p23 promote tumor
progression
and poor prognosis in breast cancer by increasing lymph node metastases and
drug
resistance. Cancer research 70, 8446-8456 (2010).
32. Oxelmark E, Roth JM, Brooks PC, Braunstein SE, Schneider RJ, Garabedian
Mi. The
cochaperone p23 differentially regulates estrogen receptor target genes and
promotes
tumor cell adhesion and invasion. Molecular and cellular biology 26, 5205-5213
(2006).
46
CA 02947802 2016-11-08
33. Hartig PC, et al. Development of two androgen receptor assays using
adenoviral
transduction of MMTV-Iuc reporter and/or hAR for endocrine screening.
Toxicological
sciences : an official journal of the Society of Toxicology 66, 82-90 (2002).
34. Okunade AL, Bikoff RE, Casper SJ, Oksman A, Goldberg DE, Lewis WH.
Antiplasmodial activity of extracts and quassinoids isolated from seedlings of
Ailanthus
altissima (Simaroubaceae). Phytotherapy research : PTR 17, 675-677 (2003).
35. Rosati A, Quaranta E, Ammirante M, Turco MC, Leone A, De Feo V.
Quassinoids can
induce mitochondrial membrane depolarisation and caspase 3 activation in human
cells.
Cell death and differentiation 11 Suppl 2, S216-218 (2004).
36. Hartl FU, Bracher A, Hayer-Hartl M. Molecular chaperones in protein
folding and
proteostasis. Nature 475, 324-332 (2011).
37. Chen A, Qin X, Lu J, Yi Z, Liu M, Wang X. Development of a validated LC-
MS/MS
method for the determination of ailanthone in rat plasma with application to
pharmacokinetic study. Journal of pharmaceutical and biomedical analysis 102,
514-518
(2015).
38. Sharma NL, et al. The androgen receptor induces a distinct transcriptional
program in
castration-resistant prostate cancer in man. Cancer cell 23, 35-47 (2013).
39. Yuan X, Cal C, Chen S, Chen S, Yu Z, Balk SP. Androgen receptor functions
in
castration-resistant prostate cancer and mechanisms of resistance to new
agents targeting
the androgen axis. Oncogene 33, 2815-2825 (2014).
40. Gibbs A, Schwartzman J, Deng V, Alumkal J. Sulforaphane destabilizes the
androgen
receptor in prostate cancer cells by inactivating histone deacetylase 6.
Proceedings of the
National Academy of Sciences of the United States of America 106, 16663-16668
(2009).
41. Solit DB, et al. 17-Allylamino-17-demethoxygeldanamycin induces the
degradation of
androgen receptor and HER-2/neu and inhibits the growth of prostate cancer
xenografts.
Clinical cancer research : an official journal of the American Association for
Cancer
Research 8, 986-993 (2002).
42. De Leon JT, et al. Targeting the regulation of androgen receptor signaling
by the heat
shock protein 90 cochaperone FKBP52 in prostate cancer cells. Proceedings of
the National
Academy of Sciences of the United States of America 108, 11878-11883 (2011).
43. Hieronymus H, et al. Gene expression signature-based chemical genomic
prediction
identifies a novel class of HSP90 pathway modulators. Cancer cell 10, 321-330
(2006).
44. Shan AA, Cox MB, Weigel NL. Androgen receptor splice variants are
resistant to
inhibitors of Hsp90 and FKBP52, which alter androgen receptor activity and
expression.
47
CA 02947802 2016-11-08
Steroids 78, 548-554 (2013).
45. Gillis JL, et al. Constitutively-active androgen receptor variants
function
independently of the HSP90 chaperone but do not confer resistance to HSP90
inhibitors.
Oncotarget 4, 691-704 (2013).
46. Kato T, Suzumura Y, Fukushima M, Honda T, Nakanishi T, Noguchi T.
Antitumor
activity of novel ailanthone derivatives in vitro and in vivo. Anticancer
research 8, 573-579
(1988).
47. Shao L, et al. Celastrol suppresses tumor cell growth through targeting an
AR-ERG-
NF-kappaB pathway in TMPRSS2/ERG fusion gene expressing prostate cancer. PloS
one 8,
e58391 (2013).
48. Chiang KC, et al. Celastrol blocks interleukin-6 gene expression via
downregulation of
NF-kappaB in prostate carcinoma cells. PloS one 9, e93151 (2014).
49. Chadli A, et al. Celastrol inhibits Hsp90 chaperoning of steroid receptors
by inducing
fibrillization of the Co-chaperone p23. The Journal of biological chemistry
285, 4224-4231
(2010).
50. Fu J, et at. Deleted in breast cancer 1, a novel androgen receptor (AR)
coactivator that
promotes AR DNA-binding activity. The Journal of biological chemistry 284,
6832-6840
(2009).
51. Vichai V, Kirtikara K. Sulforhodamine B colorimetric assay for
cytotoxicity screening.
Nature protocols 1, 1112-1116 (2006).
52. Tsai CH, et al. Herbal extract of Wedelia chinensis attenuates androgen
receptor
activity and orthotopic growth of prostate cancer in nude mice. Clinical
cancer research :
an official journal of the American Association for Cancer Research 15, 5435-
5444 (2009).
53. Ernst JT, et al. Identification of novel HSP9Oalpha/beta isoform selective
inhibitors
using structure-based drug design. demonstration of potential utility in
treating CNS
disorders such as Huntington's disease. Journal of medicinal chemistry 57,
3382-3400 (2014).
54. Patwardhan CA, Fauq A, Peterson LB, Miller C, Blagg BS, Chadli A. Gedunin
inactivates the co-chaperone p23 protein causing cancer cell death by
apoptosis. The
Journal of biological chemistry 288, 7313-7325 (2013).
55. Martinez-Yamout MA, Venkitakrishnan RP, Preece NE, Kroon G, Wright PE,
Dyson
HJ. Localization of sites of interaction between p23 and Hsp90 in solution.
The Journal of
biological chemistry 281, 14457-14464 (2006).
56. Sun M, Tang Y, Ding T, Liu M, Wang X. Inhibitory effects of celastrol on
rat liver
cytochrome P450 1A2, 2C11, 2D6, 2E1 and 3A2 activity. Fitoterapia 92, 1-8
(2014).
48
