Note: Descriptions are shown in the official language in which they were submitted.
Device and method for detecting molecular interactions
The invention relates to devices and methods for detecting specific
interactions between target
and probe molecules.
Biomedical tests are often based on the detection of an interaction between a
molecule, which
is present in known amount and position (the molecular probe), and an unknown
molecule to
be detected or unknown molecules to be detected (the molecular target
molecules). In modern
tests, probes are laid out in the form of a substance library on supports, the
so-called
microarrays or chips, so that a sample can be analyzed simultaneously at
various probes in a
parallel manner (see, for example, J. Lockhart, E. A. Winzeler, Genomics, gene
expression
and DNA arrays; Nature 2000, 405, 827-836). The probes are herein usually
immobilized on
a suitable matrix, as is for example described in WO 00/12575 (see, for
example,
US 5,412,087, WO 98/36827), or synthetically produced (see, for example, US
5,143,854) in
a predetermined manner for the preparation of the microarrays.
It is a prerequisite for binding, for example, a target molecule labeled with
a fluorescence
group in the form of a DNA or RNA molecule to a nucleic acid probe of the
microarray, that
both target molecule and probe molecule are present in the form of a single-
stranded nucleic
acid. Efficient and specific hybridization can only occur between such
molecules. Single-
stranded nucleic acid target molecules and nucleic acid probe molecules can
normally be
obtained by means of heat denaturation and optimal selection of parameters
like temperature,
ionic strength, and concentration of helix-destabilizing molecules. Thus, it
is ensured that
only probes having virtually perfectly complementary, i.e. corresponding to
each other,
sequences remain paired with the target sequence (A.A. Leitch, T.
Schwarzacher, D. Jackson,
I. J. Leitch, 1994, In vitro Hybridisierung, Spektrum Akademischer Verlag,
Heidelberg / Berlin / Oxford).
A typical example for the use of microarrays in biological test methods is the
detection of
microorganisms in samples in biomedical diagnostics. Herein, it is taken
advantage of the fact
that the genes for ribosomal RNA (rRNA) are dispersed ubiquitously and have
sequence
portions, which are characteristic for the respective species. These species-
characteristic
MH:ro
CA 3041596 2019-04-29
- 2 -
sequences are applied onto a microarray in the form of single-stranded DNA
oligonucleotides.
The target DNA molecules to be examined are first isolated from the sample to
be examined
and are equipped with markers, for example fluorescent markers. Subsequently,
the labeled
target DNA molecules are incubated in a solution with the probes fixed on the
microarray;
unspecifically occurring interactions are removed by means of corresponding
washing steps
and specific interactions are detected by means of fluorescence-optical
evaluation. In this
manner, it is possible to detect, for example, several microorganisms
simultaneously in one
sample by means of one single test. In this test method, the number of
detectable
microorganisms theoretically only depends on the number of the specific
probes, which have
been applied onto the microarray.
A variety of methods and technical systems, some of which are also
commercially available,
are described for the detection of molecular interactions with the aid of
microarrays and probe
arrays, respectively, on solid surfaces.
Classical systems for the detection of molecular interactions are based on the
comparison of
the fluorescence intensities of spectrally excited target molecules labeled
with fluorophores.
Fluorescence is the capacity of particular molecules to emit their own light
when excited by
light of a particular wavelength. Herein, a characteristic absorption and
emission behavior
ensues. In analysis, a proportional increase of the fluorescence signal is
assumed as labeled
molecule density on the functionalized surface increases, for example, due to
increasing
efficiency of the molecular interaction between target and probe molecules.
In particular, quantitative detection of fluorescence signals is performed by
means of
modified methods of fluorescence microscopy. Herein, the light having the
absorption
wavelength is separated from the light having the emission wavelength by means
of filters or
dichroites and the measured signal is imaged on suitable detectors, like for
example two-
dimensional CCD arrays, by means of optical elements like objectives and
lenses. In general,
analysis is performed by means of digital image processing.
Hitherto known technical solutions vary regarding their optical setup and the
components
used. Problems and limitations can result from the signal noise (the
background), which is
basically determined by effects like bleaching and quenching of the dyes used,
CA 3041596 2019-04-29
- 3 -
autofluorescence of the media, assembling elements, and optical components as
well as by
dispersions, reflections, and secondary light sources within the optical
setup.
This leads to great technical effort for the setup of highly sensitive
fluorescence detectors for
the qualitative and quantitative comparison of probe arrays. In particular,
for screening with
medium and high throughputs, specially adapted detection systems are
necessary, which
exhibit a certain degree of automation.
For optimizing standard epifluorescence setups for reading out molecular
arrays, CCD-based
detectors are known, which implement the excitation of the fluorophores in the
dark field by
means of incident light or transmitted light for the discrimination of optical
effects like
dispersion and reflections (see, for example, C. E. Hooper et al.,
Quantitative Photon Imaging
in the Life Sciences Using Intensified CCD Cameras, Journal of Bioluminescence
and Chemi-
luminescence (1990), p. 337-344). Herein, imaging of the arrays is performed
either in
exposure or by means of rasterizing using higher resolution optics. The use of
multispectral
light sources allows a comparatively easy access to different fluorophores by
means of using
different excitation filters (combinations). However, it is a disadvantage
that autofluorescence
and system-related optical effects like the illumination homogeneity above the
array
necessitate complicated illumination optics and filter systems.
Further methods for the quantitative detection of fluorescence signals are
based on confocal
fluorescence microscopy. Confocal scanning systems, as for example described
in
US 5,304,810, are based on the selection of fluorescence signals along the
optical axis by
means of two pinholes. This results in a great adjustment effort for the
samples or establishing
an efficient autofocus system. Such systems are highly complex with respect to
their technical
solution. Required components like lasers, pinholes, optionally cooled
detectors, like for
example PMT, avalanche diodes, or CCD, complex and highly exact mechanical
translation
elements and optics have to be optimized and integrated with considerable
effort (see, for
example, US 5,459,325; US 5,192,980; US 5,834,758). Degree of miniaturization
and price
are limited by multiplicity and functionality of the components.
Currently, analyses based on probe arrays are normally read out fluorescence-
optically (see,
for example, A. Marshall and J. Hodgson, DNA Chips: An array of possibilities,
Nature
CA 3041596 2019-04-29
- 4 -
Biotechnology, 16, 1998, 27-31; G. Ramsay, DNA Chips: State of the Art, Nature
Biotechnology, 16, Jan. 1998, 40-44). However, the disadvantages of the above-
described
detection devices and methods are the high signal background leading to
limited precision, the
sometimes considerable technical effort, and the high costs in connection with
the detection
methods.
A variety of, in particular, confocal systems are known, which are suitable
for the detection of
small-scale integrated substance libraries in array format, which are
installed in fluidic
chambers (see, for example, US 5,324,633, US 6,027,880, US 5,585,639, WO
00/12759).
However, the above-described methods and systems can only be adapted in a very
limited
way for the detection of large-scale integrated molecular arrays, which are,
in particular,
installed in fluidic systems, in particular due to the dispersions,
reflections, and optical
aberrations occurring therein. Furthermore, in such large-scale integrated
arrays, great
demands are made concerning the spatial resolution, which could, however, up
to now
technically not be implemented.
Thus, there is a need for highly integrated arrays, wherein the interaction
between probes and
targets can be detected qualitatively and / or quantitatively with great
precision and with
comparatively little technical effort.
The increase in selectivity and the access to alternative components motivate
the
establishment of alternative imaging technologies like fluorescence
polarization and time-
resolved fluorescence for assays bound to solid bodies. The effect of twisting
the polarization
axis by means of fluorophores excited in a polarized manner is used for
quantification in
microtiter format. Furthermore, there are approaches to set up inexpensive
systems having a
high throughput (HTS systems) by means of using correspondingly modified
polymer foils as
polarization filters (see I. Gryczcynski et al., Polarisation sensing with
visual detection, Anal.
Chem. 1999, 71, 1241-1251).
More recent developments utilize the fluorescence of inorganic materials, like
lanthanides (M.
Kwiatowski et al., Solid-phase synthesis of chelate-labelled oligonucleotides:
application in
triple-color ligase-mediated gene analysis, Nucleic Acids Research, 1994, 22,
13) and
CA 3041596 2019-04-29
- 5 -
quantum dots (M. P. Bruchez et. al., Semiconductor nanocrystals as fluorescent
biological
labels, Science 1998, 281, 2013). Dyes exhibiting long emission time within a
range of
microseconds, like lanthanide chelates, necessitate a conversion of the dyes
to a mobile phase,
so that a locally resolved detection is not possible.
Optical setups for the detection of samples labeled by means of gold beads and
their
visualization by means of silver amplification are described in the
International Patent
Application WO 00/72018. The devices described therein are only suitable for
detection in
static measurement, however. In static measurement, subsequently to the
interaction of the
targets with the probes laid out on the probe array as well as subsequently to
the beginning of
the reaction leading to precipitation on those array elements, where an
interaction has
occurred, an image is recorded and assigned to the measured gray value
concentrations, which
depend on the degree of precipitation formation.
A method for the qualitative and / or quantitative detection of targets in a
sample by means of
molecular interactions between probes and targets on probe arrays was provided
in
WO 02/02810, wherein the time-dependent behavior of precipitation formation at
the array
elements is detected in the form of signal intensities, i.e. dynamic
measurement is performed.
On the basis of a curve function describing precipitation formation as a
function of time, a
value quantifying the interaction between probe and target on an array element
and therefore
the amount of targets bound is assigned to each array element.
Such dynamic measurement requires the recording of image series under, for
example,
particular thermal conditions or in a particular phase of a procedure, for
example in the
presence of specific solutions at the time of the recording. This requires
complex cooperation
of the individual components of a highly integrated array, in particular in
uses in the field of
genotyping.
Furthermore, in many tests in biomedical diagnostics, the problem arises that
the target
molecules are at first not present in an amount sufficient for detection and
therefore often first
have to be amplified from the sample before the actual test procedure.
Typically, the
amplification of DNA molecules is performed by means of the polymerase chain
reaction
(PCR). For the amplification of RNA, the RNA molecules have to be converted to
CA 3041596 2019-04-29
- 6 -
correspondingly complementary DNA (cDNA) by means of reverse transcription.
Said cDNA
can then also be amplified by means of PCR. PCR is a standard laboratory
method (like, for
example, in Sambrook et al. (2001) Molecular Cloning: A laboratory manual, 3rd
edition,
Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press).
The amplification of DNA by means of PCR is comparatively fast, allows a high
sample
throughput in small setup volumes by means of miniaturized methods, and is
efficient in
operation due to automation.
However, a characterization of nucleic acids by means of mere amplification is
not possible.
It is rather necessary to use analysis methods like nucleic acid sequence
determinations,
hybridization, and / or electrophoretic separation and isolation methods for
the
characterization of the PCR products subsequently to the amplification.
In general, devices and methods for the amplification of nucleic acids and
their detection
should be designed in such a way that as few experimenters' interventions as
possible are
required. The advantages of methods allowing multiplication of nucleic acids
and their
detection, and in the course of which the experimenter has to intervene only
minimally, are
obvious. On the one hand, contaminations are avoided. On the other hand, the
reproducibility
of such methods is substantially increased, as they are accessible to
automation. This is also
extremely important considering the legal admission of diagnostic methods.
At present, there are a multiplicity of methods for the amplification of
nucleic acids and their
detection, wherein first the target material is amplified by means of PCR
amplification and
subsequently the identity or the genetic state of the target sequences is
determined by means
of hybridization against a probe array. In general, amplification of the
nucleic acid molecules
or the target molecules to be detected is necessary in order to have at one's
disposal amounts
sufficient for a qualitative and quantitative detection within the scope of
the hybridization.
Both PCR amplification of nucleic acids and their detection by means of
hybridization are
subject to several elementary problems. This applies in the same manner to
methods
combining PCR amplification of nucleic acids and their detection by means of
hybridization.
CA 3041596 2019-04-29
- 7 -
If detectable markers, for example in the form of fluorescence labeled
primers, are inserted
into the nucleic acid molecules to be detected or target molecules to be
detected in a method,
which combines PCR amplification and its detection by means of hybridization,
a washing
step is usually performed before the actual detection. Such a washing step
serves the removal
of the non-converted primers, which are present in great abundance compared to
the
amplification product, as well as of such nucleotides equipped with a
fluorescence marker,
which do not participate in the detection reaction or do not specifically
hybridize with the
nucleic acid probes of the microarray. In this manner, the high-level signal
background
caused by these molecules is supposed to be reduced. However, such an
additional procedure
step considerably slows down the detection method. Furthermore, the detectable
signal is
considerably reduced also for those nucleic acids to be detected, which
specifically hybridize
with the nucleic acid probes of the microarray. The latter is largely based on
the fact that the
equilibrium between the targets bound by means of hybridization and the
dissolved targets
does not exist anymore after the washing step. Nucleic acids, which had
already hybridized
with the nucleic acid probes located on the array, are detached from the
binding site by
washing and are therefore washed away together with the dissolved molecules.
Altogether,
there only remains a detectable signal, if the washing or rinsing step of the
dissolved
molecules is performed faster than the detachment of the nucleic acids already
hybridized.
Therefore, there is a need for highly integrated arrays, wherein the
interaction between probes
and targets can be detected qualitatively and / or quantitatively with great
precision and with
comparatively little technical effort.
Furthermore, there is a need for devices which allow the performance of PCR
and analysis
reaction, like for example a hybridization reaction, in one reaction space.
It is therefore a problem underlying the present invention to overcome the
above-mentioned
problems of the art, which in particular arise due to the lack of
compatibility of the assay with
the test system.
In particular, it is a problem underlying the present invention to provide
methods and devices,
respectively, wherein molecular interactions between probes and targets on
probe arrays can
CA 3041596 2019-04-29
- 8 -
be qualitatively and / or quantitatively detected with great precision and
high sensitivity as
well as in an easy-to-do and cost-efficient manner.
Furthermore, it is a problem underlying the present invention to provide
methods and devices,
respectively, for the amplification and for the qualitative and quantitative
detection of nucleic
acids, wherein experimenters' interventions in the detection procedure can be
minimized.
It is a further problem underlying the present invention to provide methods
and devices,
respectively, for the qualitative and quantitative detection of nucleic acids,
wherein a high
signal-to-noise ratio in the detection of interactions on the microarray is
ensured without
impairing the interaction between the target molecules and the probe molecules
on the array.
It is a further problem underlying the present invention to provide devices
and methods,
respectively, by means of which a high dynamic resolution in detection is
achieved, i.e. the
detection of weak probe / target interactions among strong signals remains
ensured.
Furthermore, it is a problem underlying the present invention to provide
devices and methods,
respectively, which allow almost simultaneous amplification and
characterization of nucleic
acids at a high throughput rate.
These and further problems underlying the present invention are solved by
means of
providing the embodiments characterized in the patent claims.
According to the present invention, methods for the qualitative and / or
quantitative detection
of molecular interactions between probe molecules and target molecules are
provided,
wherein the replacement and / or the removal of solutions, i.e. in particular
washing or rinsing
steps, can be omitted.
Such methods according to the present invention in particular comprise the
following steps:
a) feeding a sample containing target molecules into a reaction chamber
having a
microarray, wherein the microarray comprises a substrate onto which probe
molecules are immobilized on array elements;
CA 3041596 2019-04-29
- 9 -
b) detecting an interaction between the target molecules and the probe
molecules
immobilized on the substrate,
wherein no replacement of solutions in the reaction chamber and / or removal
of solutions
from the reaction chamber is performed subsequently to feeding the sample
containing target
molecules as well as before and during the detection procedure.
Furthermore, devices are provided within the scope of the present invention,
which are
suitable for conducting such methods.
In particular, a device for the qualitative and / or quantitative detection of
molecular
interactions between probe and target molecules is provided within the scope
of the present
invention, comprising:
a) a microarray having a substrate, whereon probe molecules are immobilized on
array
elements, wherein the microarray is arranged on a first surface of the device;
and
b) a reaction chamber, which is formed between the first surface with the
microarray
arranged upon it and a second surface,
wherein the distance between the microarray and the second surface is
variable.
In particular, the variability of the distance between microarray and second
surface, which
usually forms the detection plane of the device according to the present
invention, allows that
the signal background, which is caused by labeled target molecules, which do
not have a
specific affinity to the probe molecules of the microarray and therefore do
not interact with
them, is considerably reduced or entirely avoided.
Furthermore, according to the present invention, a method for the qualitative
and / or
quantitative detection of molecular interactions between probe and target
molecules is
provided, which comprises the following steps:
a) feeding a sample solution comprising target molecules into a reaction
chamber of a
device according to the present invention as described above; and
b) detecting an interaction between the target molecules and the probe
molecules
immobilized on the substrate.
CA 3041596 2019-04-29
- 10 -
The methods and devices according to the present invention for detecting
target molecules are
designed in such a way, that as few experimenters' interventions in the
reaction chamber as
possible are required for performing the detection method and, optionally, an
amplification of
the target molecules. This offers the essential advantage that contaminations
are thereby
avoided. Furthermore, the reproducibility of the methods according to the
present invention is
considerably increased compared to conventional methods, as the method
according to the
present invention is accessible to automation due to the minimization of
external
interventions. The above-mentioned advantages play an important role in terms
of the
admission of diagnostic methods.
Furthermore, the following definitions are used, inter alia, for the
description of the present
invention:
Within the scope of the present invention, a probe or a probe molecule or a
molecular probe is
understood to denote a molecule, which is used for the detection of other
molecules due to a
particular characteristic binding behavior or a particular reactivity. Each
type of molecules,
which can be coupled to solid surfaces and have a specific affinity, can be
used as probes laid
out on the array. In a preferred embodiment, these are biopolymers, in
particular biopolymers
from the classes of peptides, proteins, antigens, antibodies, carbohydrates,
nucleic acids,
and / or analogs thereof and / or mixed polymers of the above-mentioned
biopolymers.
Particularly preferably, the probes are nucleic acids and / or nucleic acid
analogs.
In particular, nucleic acid molecules of defined and known sequence, which are
used for the
detection of target molecules in hybridization methods, are referred to as
probe. Both DNA
and RNA molecules can be used as nucleic acids. For example, the nucleic acid
probes or
oligonucleotide probes can be oligonucleotides having a length of 10 to 100
bases, preferably
of 15 to 50 bases, and particularly preferably of 20 to 30 bases. Typically,
according to the
present invention, the probes are single-stranded nucleic acid molecules or
molecules of
nucleic acid analogs, preferably single-stranded DNA molecules or RNA
molecules having at
least one sequence region, which is complementary to a sequence region of the
target
molecules. Depending on detection method and use, the probes can be
immobilized on a solid
support substrate, for example in the form of a microarray. Furthermore,
depending on the
CA 3041596 2019-04-29
- 11 -
detection method, they can be labeled radioactively or non-radioactively, so
that they are
detectable by means of detection methods conventional in the state of the art.
Within the scope of the present invention, a target or a target molecule is
understood to denote
a molecule to be detected by means of a molecular probe. In a preferred
embodiment of the
present invention, the targets to be detected are nucleic acids. However, the
probe array
according to the present invention can also be used in an analogous manner for
the detection
of peptide / probe interactions, protein / probe interactions, carbohydrate /
probe interactions,
antibody / probe interactions etc..
If, within the scope of the present invention, the targets are nucleic acids
or nucleic acid
molecules, which are detected by means of a hybridization against probes laid
out on a probe
array, said target molecules normally comprise sequences of a length of 40 to
10,000 bases,
preferably of 60 to 2,000 bases, also preferably of 60 to 1,000 bases,
particularly preferably of
60 to 500 bases and most preferably of 60 to 150 bases. Optionally, their
sequence comprises
the sequences of primers as well as the sequence regions of the template,
which are defined by
the primers. In particular, the target molecules can be single-stranded or
double-stranded
nucleic acid molecules, one or both strands of which are labeled radioactively
or non-
radioactively, so that they are detectable by means of a detection method
conventional in the
state of the art.
According to the present invention, a target sequence denotes the sequence
region of the
target, which is detected by means of hybridization with the probe. According
to the present
invention, this is also referred to as said region being addressed by the
probe.
Within the scope of the present invention, a substance library is understood
to denote a
multiplicity of different probe molecules, preferably at least two to
1,000,000 different
molecules, particularly preferably at least 10 to 10,000 different molecules,
and most
preferably between 100 to 1,000 different molecules. In special embodiments, a
substance
library can also comprise only at least 50 or less or at least 30,000
different molecules.
Preferably, the substance library is laid out in the form of an array on a
support inside the
reaction chamber of the device according to the present invention.
CA 3041596 2019-04-29
- 12 -
Within the scope of the present invention, a probe array is understood to
denote a layout of
molecular probes or a substance library on a support, wherein the position of
each probe is
defined separately. Preferably, the array comprises defined sites or
predetermined regions, so-
called array elements, which are particularly preferably laid out in a
particular pattern,
wherein each array element usually comprises only one species of probes.
Herein, the layout of the molecules or probes on the support can be generated
by means of
covalent or non-covalent interactions. Herein, the probes are laid out at the
side of the support
facing the reaction chamber. A position within the layout, i.e. within the
array, is usually
referred to as spot.
Within the scope of the present invention, an array element, or a
predetermined region, or a
spot, or an array spot is understood to denote an area, which is determined
for the deposition
of a molecular probe, on a surface; the entirety of all occupied array
elements is the probe
array.
Within the scope of the present invention, a support element, or support, or
substance library
support, or substrate is understood to denote a solid body, on which the probe
array is set up.
Support, usually also referred to as substrate or matrix, can for example
denote an object
support or a wafer or ceramic materials In a special embodiment, the probes
can also be
immobilized directly on the first surface, preferably on a partition of the
first surface.
The entirety of molecules laid out in array layout on the substrate or on the
detection surface,
or the substance library laid out in array layout on the substrate or the
detection surface and of
the support or substrate is also often referred to as "chip", "microarray",
"DNA chip", "probe
array" etc..
Within the scope of the present invention, a detection plane is understood to
denote the
second surface of the device according to the present invention. Preferably,
the probes laid out
on the microarray are substantially located in the detection plane during
detection of the
interaction between probes and target, in particular due to the fact that the
distance between
microarray and second surface is reduced to approximately zero.
CA 3041596 2019-04-29
- 13 -
Within the scope of the present invention, a chamber body is understood to
denote the solid
body forming the reaction chamber. The substance library support or the chip
is usually part
of the chamber body, wherein the substance library support can be made of a
different
material than the rest of the chamber body.
Within the scope of the present invention, a reaction chamber or a reaction
space is
understood to denote the space formed between microarray and second surface or
detection
plane and preferably designed as a variable capillary gap. The reaction space
is laterally
limited by side walls, which can, for example, be implemented as elastic
seals. The probes
immobilized on the microarray are located on the side facing the interior of
the reaction
chamber. The base of the reaction chamber or of the reaction space is defined
by the first
surface or the second surface of the array. In particular, the distance
between second surface
or detection plane and surface of the substrate or of the microarray is
referred to as thickness
of the reaction space or of the reaction chamber or of the capillary gap.
Within the scope of
the present invention, a reaction space usually has only a small thickness,
for example a
thickness of at most 1 cm, preferably of at most 5 mm, particularly preferably
of at most
3 mm and most preferably of at most 1 mm.
Within the scope of the present invention, the distance between the microarray
and the second
surface is understood to denote the distance between the surface of the
microarray substrate,
i.e. the side of the microarray facing the reaction space, and the side of the
second surface
facing the reaction space. If the distance between microarray and second
surface is
approximately zero, this means that the surface of the substrate rests evenly
on the second
surface.
Within the scope of the present invention, a capillary gap is understood to
denote a reaction
space, which can be filled by means of capillary forces acting between the
microarray and the
second surface. Usually, a capillary gap has a small thickness, for example of
at most 1 mm,
preferably of at most 750 gm and particularly preferably of at most 500 gm.
According to the
present invention, a thickness in the range of 10 gm to 300 gm, of 15 gm to
200 gm and! or
of 25 gm to 150 gm is preferred as thickness of the capillary gap. In special
embodiments of
the present invention, the capillary gap has a thickness of 50 gm, 60 gm, 70
gm, 80 gm or
90 gm. Within the scope of the present invention, if the reaction space or the
reaction
CA 3041596 2019-04-29
- 14 -
chamber has a thickness of more than 2 mm, the reaction space or reaction
chamber will not
be referred to as a capillary gap anymore.
Within the scope of the present invention, a cartridge or reaction cartridge
is understood to
denote the unit of the reaction chamber with a chamber body and a
corresponding casing.
Within the scope of the present invention, a confocal fluorescence detection
system is
understood to denote a fluorescence detection system, wherein the object is
illuminated in the
focal plane of the objective by means of a point light source. Herein, point
light source, object
and point light detector are located on exactly optically conjugated planes.
Examples for
confocal systems are described in A. Diaspro, Confocal and 2-photon-
microscopy:
Foundations, Applications and Advances, Wiley-Liss, 2002.
Within the scope of the present invention, a fluorescence optical system
imaging the entire
volume of the reaction chamber is understood to denote a non-confocal
fluorescence detection
system, i.e. a fluorescence detection system, wherein the illumination by
means of a point
light source is not limited to the object. Such a fluorescence detection
system therefore has no
focal limitation.
Conventional arrays or microarrays within the scope of the present invention
comprise about
50 to 10,000, preferably 150 to 2,000 different species of probe molecules on
a, preferably
square, surface of, for example, 1 mm to 4 mm x 1 mm to 4 mm, preferably of 2
mm x 2 mm.
In further embodiments within the scope of the present invention, microaffays
comprise about
50 to about 80,000, preferably about 100 to about 65,000, particularly
preferably about 1,000
to about 10,000 different species of probe molecules on a surface of several
mm2 to several
cm2, preferably about 1 mm2 to 10 cm2, particularly preferably 2 mm2 to 1 cm2,
and most
preferably about 4 mm2 to 6.25 mm2. For example, a conventional microarray has
100 to
65,000 different species of probe molecules on a surface of 2 mm x 2 mm.
Within the scope of the present invention, a label or a marker is understood
to denote a
detectable unit, for example a fluorophore or an anchor group, whereto a
detectable unit can
be coupled.
CA 3041596 2019-04-29
- 15 -
Within the scope of the present invention, an amplification reaction usually
comprises 10 to
50 or more amplification cycles, preferably about 25 to 45 cycles,
particularly preferably
about 40 cycles. Within the scope of the present invention, a cyclic
amplification reaction
preferably is a polymerase chain reaction (PCR).
Within the scope of the present invention, an amplification cycle denotes a
single enhancing
step of the cyclic amplification reaction. An enhancing step of the PCR is
also referred to as
PCR cycle.
Within the scope of the present invention, an amplification product denotes a
product
resulting from the enhancement or the copying or the amplification of the
nucleic acid
molecules to be amplified by means of the cyclic amplification reaction,
preferably by means
of the PCR. A nucleic acid molecule amplified by means of PCR is also referred
to as PCR
product.
Within the scope of the present invention, the denaturation temperature is
understood to
denote the temperature at which double-stranded DNA is separated in the
amplification cycle.
Usually, the denaturation temperature, in particular in a PCR, is higher than
90 C, preferably
about 95 C.
Within the scope of the present invention, the annealing temperature is
understood to denote
the temperature at which the primers hybridize to the nucleic acid to be
detected. Usually, the
annealing temperature, in particular in a PCR, lies in a range of 50 C to 65 C
and preferably
is about 60 C.
Within the scope of the present invention, the chain extension temperature or
extension
temperature is understood to denote the temperature at which the nucleic acid
is synthesized
by means of insertion of the monomer components. Usually, the extension
temperature, in
particular in a PCR, lies within a range of about 68 C to about 75 C and
preferably is about
72 C.
Within the scope of the present invention, an oligonucleotide primer or primer
denotes an
oligonucleotide, which binds or hybridizes the DNA to be detected, also
referred to as target
CA 3041596 2019-04-29
- 16 -
DNA, wherein the synthesis of the complementary strand of the DNA to be
detected in a
cyclic amplification reaction starts from the binding site. In particular,
primer denotes a short
DNA or RNA oligonucleotide having preferably about 12 to 30 bases, which is
complementary to a portion of a larger DNA or RNA molecule and has a free 3-0H
group at
its 3'-end. Due to said free 3'0H group, the primer can serve as substrate for
any optional
DNA or RNA polymerases, which synthesize nucleotides to the primer in 5'-3'-
direction.
Herein, the sequence of the newly synthesized nucleotides is predetermined by
that sequence
of the template hybridized with the primer, which lies beyond the free 3'0H
group of the
primer. Primers of conventional length comprise between 12 and 50 nucleotides,
preferably
between 15 and 30 nucleotides.
A double-stranded nucleic acid molecule or a nucleic acid strand serving as
template for the
synthesis of complementary nucleic acid strands is usually referred to as
template or template
strand.
Within the scope of the present invention, a molecular interaction or an
interaction is
understood to denote a specific, covalent or non-covalent bond between a
target molecule and
an immobilized probe molecule. In a preferred embodiment of the present
invention, the
interaction between probe and target molecules is a hybridization.
The formation of double-stranded nucleic acid molecules or duplex molecules
from
complementary single-stranded nucleic acid molecules is referred to as
hybridization. Herein,
the association preferably always occurs in pairs of A and T or G and C.
Within the scope of a
hybridization, for example DNA-DNA duplexes, DNA-RNA duplexes, or RNA-RNA
duplexes can be formed. By means of a hybridization, duplexes with nucleic
acid analogs can
also be formed, like for example DNA-PNA duplexes, RNA-PNA duplexes, DNA-LNA
duplexes, and RNA-LNA duplexes. Hybridization experiments are usually used for
detecting
the sequence complementarity and therefore the identity of two different
nucleic acid
molecules.
Within the scope of the present invention, processing is understood to denote
purification,
concentration, labeling, amplification, interaction, hybridization, and / or
washing and rinsing
CA 3041596 2019-04-29
- 17 -
steps as well as further method steps performed when detecting targets with
the aid of
substance libraries. Detection itself does not fall under the term processing.
Within the scope of the present invention, a sample or sample solution or
analyte or solution
is a liquid to be analyzed, which in particular contains the target molecules
to be detected and,
optionally, to be amplified. Furthermore, beside conventional additives such
as, for example,
buffers, such a solution can, inter alia, also contain substances required for
performing
amplification reactions, like primers.
Within the scope of the present invention, a replacement of solutions in the
reaction chamber
from the reaction chamber refers, in particular, to rinsing or washing steps.
A replacement of
solutions serves, for example, for removing molecules labeled with detectable
markers, which
do not specifically interact with probes on the microarray, by means of
replacing the sample
solution with a non-labeled solution subsequently to the completed
interaction. Molecules not
specifically interacting with probes on the microarray are, for example,
primers labeled with a
detectable marker, which have not been converted during the amplification
reaction, or target
molecules labeled with a detectable marker, which do not have a complementary
probe on the
array, which specifically interacts with said target molecule.
Within the scope of the present invention, a removal of solutions from the
reaction chamber is
understood to denote steps, by means of which molecules labeled with
detectable markers,
which do not specifically interact with probes on the microarray, are removed
from the
reaction chamber. Molecules not specifically interacting with probes on the
microarray are,
for example, primers labeled with a detectable marker, which have not been
converted during
the amplification reaction, or target molecules labeled with a detectable
marker, which do not
have a complementary probe on the array, which specifically interacts with
said target
molecule.
If, within the scope of the present invention, no replacement of solutions in
the reaction
chamber and / or removal of solutions from the reaction chamber is performed
between
feeding of the sample containing target molecules into a reaction chamber and
detecting the
interaction, it is, however, conceivable that during this time period
solutions can additionally
CA 3041596 2019-04-29
- 18 -
be fed into the reaction chamber without performing replacement or removal of
the solutions
already present in the reaction chamber.
Thus, a first object of the present invention comprises a method for
qualitatively and / or
quantitatively detecting molecular interactions between probes and target
molecules
comprising, in particular, the following steps:
a) feeding a sample containing target molecules into a reaction chamber
having a
microarray, wherein the microarray comprises a substrate onto which probe
molecules are immobilized on array elements;
b) detecting an interaction between the target molecules and the probe
molecules
immobilized on the substrate,
wherein subsequently to charging the sample containing target molecules and
before or during
detection no replacement of solutions in the reaction chamber and / or removal
of solutions
from the reaction chamber is performed.
In this aspect of the present invention, it is a substantial characteristic of
the method according
to the present invention that the detection of an interaction between the
target molecules to be
detected and the probe molecules immobilized on the substrate of the
microarray is performed
without replacing solutions in the reaction chamber or removing solutions from
the reaction
chamber. I.e., detecting the interaction between targets and probes can be
performed without
rinsing or washing steps being required subsequently to the interaction
reaction and / or
without molecules, which do not specifically interact with probes on the
microarray, being
removed from the reaction chamber subsequently to the interaction reaction.
In the method according to the present invention, this can, in particular, be
ensured by means
of foci-selective detection methods, like for example by means of confocal
techniques or by
means of the evanescent de-coupling of excitation light (TIRF) in the sample
substrate based
on the use of a depth-selective illumination due to, for example, total
reflection, or the use of
methods based on waveguides. Such foci-selective methods are to be
particularly preferred in
cases when a further exclusion of the background signals caused by the
fluorescence
molecules present in the liquid, i.e. not hybridized, in order to increase
sensitivity. With the
use of fluorescence-labeled target molecules, the specific interaction signals
can thus be
CA 3041596 2019-04-29
- 19 -
discriminated from the background fluorescence by the use of methods like
total internal
reflection fluorescence microscopy (TIRF) or confocal fluorescence microscopy.
Examples for this are CCD-based detectors, which implement the excitation of
the
fluorophores in the dark field by means of incident light or transmitted light
for the purpose of
discriminating optical effects like dispersion and reflections (see for
example C. E. Hooper et
al., Quantitative Photone Imaging in the Life Sciences Using Intensified CCD
Cameras,
Journal of Bioluminescence and Chemoluminescence (1990), 337-344). Further
alternatives
for fluorescence detection systems, which can be used in the method according
to the present
invention, are white light setups, like for example described in WO 00/12759,
WO 00/25113,
and WO 96/27025; confocal systems, like for example described in US 5,324,633,
US 6,027,880, US 5,585,639, and WO 00/12759; confocal excitation systems based
on
Nipkow discs in confocal imaging, as for example described in US 5,760,950;
systems based
on structured excitation distribution, as for example described in WO
98/57151; large-scale
integrated fluorescence detection systems using micro-optics, like for example
described in
WO 99/27140; and laser scanning systems, as for example described in WO
00/12759. A
general progression of fluorescence detection methods using such conventional
fluorescence
detection systems is, for example, described in US 5,324,633.
The devices described in WO 2004/087951, wherein the reaction chamber is
formed by a
capillary gap, are particularly suitable for performing a detection method
according to the
present invention without replacing solutions in the reaction chamber and / or
removing
solutions from the reaction chamber. The relevant contents of WO 2004/087951
are hereby
explicitly referred to.
In a further embodiment of this aspect of the present invention, replacing and
/ or removing
solutions from the reaction chamber is avoided by performing the detection by
means of
detecting the mass alteration on the array surface, as described, for example,
in WO
03/004699. The relevant contents of WO 03/004699 are hereby explicitly
referred to.
In a further embodiment of this aspect of the present invention, replacing and
/ or removing
solutions from the reaction chamber is avoided by performing the detection by
means of
CA 3041596 2019-04-29
- 20 -
detecting acoustic surface waves, as is described, for example, in Z.
Guttenberg et al., Lab
Chip. 2005; 5(3):308-17.
In a further embodiment of this aspect of the present invention, replacing and
/ or removing
solutions from the reaction chamber is avoided by performing the detection by
means of
electrochemical detection via electrodes on the surface of the array, like,
for example, by
means of measuring the alteration of redox potentials (see, for example, X.
Zhu et al., Lab
Chip. 2004; 4(6):581-7) or cyclic voltometry (see, for example, J. Liu et al.,
Anal Chem.
2005; 77(9):2756-2761; J. Wang, Anal Chem. 2003; 75(15):3941-5).
In a further embodiment of this aspect of the present invention, replacing and
/ or removing
solutions from the reaction chamber is avoided by performing the detection by
means of
electric detection via electrodes on the surface of the array, like, for
example, by means of
impedance measurement (see, inter alia, S.M. Radke et al., Biosens
Bioelectron. 2005;
20(8):1662-7).
In a further embodiment of this aspect of the present invention, replacing and
/ or removing
solutions from the reaction chamber is avoided by employing a microarray
having FRET
probes (FRET, fluorescence resonance energy transfer). The use of such FRET
probes is
based on the formation of fluorescence quencher pairs, so that a fluorescence
signal only
occurs, if a target molecule has bound to the complementary probe on the
surface. The use of
FRET probes is, for example, described in B. Liu et al., PNAS 2005, 102, 3,
589-593; K. Usui
et al., Mol Divers. 2004; 8(3):209-18; J.A. Cruz-Aguado et al., Anal Chem.
2004;
76(14):4182-8 and J. Szollosi et al., J Biotechnol. 2002;82(3):251-66.
In a further particularly preferred embodiment of this aspect of the present
invention,
replacing and / or removing solutions from the reaction chamber is avoided by
employing a
device according to the present invention, as is described in detail in the
following, for
qualitatively and / or quantitatively detecting molecular interactions between
probe and target
molecules, wherein said device comprises:
a) a microarray having a substrate, onto which probe molecules are immobilized
on array
elements, wherein the microarray is arranged on a first surface of the device;
and
CA 3041596 2019-04-29
-21 -
b) a reaction chamber formed between the first surface, whereon the microarray
is
arranged, and a second surface,
and wherein the distance between the microarray and the second surface is
variable.
A further object of the present invention relates to the use of FRET probe
molecules, as
described above, and / or detection methods selected from the group consisting
of total
internal reflection fluorescence microscopy (TIRF), as described above,
confocal fluorescence
microscopy, as described above, methods for detecting mass alterations, as
described above,
methods for detecting acoustic surface waves, as described above, methods for
the
electrochemical and / or electric detection, as described above, for avoiding
replacement of
solutions in a reaction chamber and / or removal of solutions from a reaction
chamber during
or after feeding a sample containing target molecules into the reaction
chamber and before or
during the detection in a method for qualitatively and / or quantitatively
detecting molecular
interactions between probe and target molecules, in particular comprising the
following steps:
a) feeding a sample containing target molecules into a reaction chamber
having a
microarray, wherein the microarray comprises a substrate, onto which probe
molecules are immobilized on array elements;
b) detecting an interaction between the target molecules and the probe
molecules
immobilized on the substrate.
A further object of the present invention is, in particular, a device for
qualitatively and / or
quantitatively detecting molecular interactions between probe and target
molecules,
comprising:
a) a microarray having a substrate, onto which probe molecules are immobilized
on array
elements, wherein the microarray is arranged on a first surface of the device;
and
b) a reaction chamber formed between the first surface, on which the
microarray is
arranged, and a second surface,
wherein the distance between the microarray and the second surface is
variable.
Subsequently to the completed interaction between probe molecules and target
molecules, an
undesired background is caused by the labeled molecules present in the sample
solution,
which do not interact with the probe molecules. In case the probe and / or
target molecules are
CA 3041596 2019-04-29
- 22 -
nucleic acids and / or nucleic acid analogs, said background is caused, in
particular, by the
labeled primers and / or labeled nucleic acids present in the sample solution,
which are not
hybridized with the probe molecules.
A known possibility of removing disturbing background signals is the
replacement of the
sample solution after completed interaction with a non-labeled, for example
non-fluorescent,
solution. However, this variant is generally lavish and prone to interference
owing to
corrosion, aging of the solutions and impermeability problems.
It is a substantial characteristic of the device according to the present
invention that the
distance between the microarray and the second surface is variable. Variable
distance between
microarray and second surface means that the reaction chamber of the device
according to the
present invention is compressible. In particular, the distance between
microarray and second
surface is variable in such a way that the microarray can rest evenly and / or
reversibly on the
second surface, or can be pressed onto said surface, with its active side,
i.e. the side, onto
which the nucleic acid probes are immobilized.
A compressible reaction chamber therefore allows displacement of sample
solution containing
labeled molecules, which do not interact with the probe molecules and
therefore constitute an
undesired background, by reducing the distance between microarray and
detection plane
before performing the detection. In this manner, a detection of interactions
between probe and
target molecules using any optical detection systems is possible without
replacing the sample
solution with a non-labeled solution before the detection. For example, simple
fluorescence-
microscopic imaging of the DNA chip for detecting the interaction signals by
means of the
device according to the present invention without replacing the sample
solution with a non-
labeled, in particular weakly fluorescent, liquid, is possible.
It is finally ensured, in particular by means of the embodiments of the device
according to the
present invention described in the following, that focusing of optical
detection systems is not
necessary anymore. Thus, the device according to the present invention allows,
for example,
the use of a simple fluorescence microscope device without autofocus function
as reading
device for the detection of the hybridization between targets and probes
without necessitating
liquid-handling steps like, in particular, washing steps, for removing target
molecules not
CA 3041596 2019-04-29
- 23 -
bound to the array, like for example non-hybridized target nucleic acids,
contrarily to the
fluorescence-optical detection systems hitherto used for the detection of
nucleic acids.
Despite multifunctional sample treatment and analysis, which is feasible by
means of the
device according to the present invention, a very cost-efficient system for
detecting and,
optionally, amplifying target molecules in a sample is provided. The devices
according to the
present invention, in particular in connection with an optical detection
system, are
furthermore robust to such an extent that they are also suitable for mobile
use.
By means of suitably selecting chip, processing protocols, and analysis
chemicals, the device
according to the present invention can be employed for the most different
types of gene
analyses, like for example predisposition diagnostics, germ diagnostics and
typing. Thus, a
complete genetic analysis is conductible with little equipment effort in the
device according to
the present invention, which can also be implemented as a disposable
cartridge. Therefore, the
device according to the present invention allows performing detection methods
on-site, for
example during blood donation. A measured result can be quickly obtained,
preferably within
0.5 to 2 hours. All the steps practicable with the device according to the
present invention,
like purification, processing, amplification of nucleic acids, and the actual
hybridization can
be conducted automatically. The operator only needs to be familiar with sample
withdrawal,
sample feeding into the device according to the present invention, and taking
notice of the
analysis results.
Preferably, the distance between the microarray and the second surface is
variable in a range
of about 0 to about 1 mm. Further preferred lower limits for the distance
between microarray
and second surface are about 0.1 1.1m, about 1 m, and about 10 m. Further
preferred upper
limits for the distance between microarray and second surface are about 0.01
mm, about
0.5 mm, about 1 mm and most preferably about 0.3 mm. Surprisingly, the
interaction
between probes and targets on the array surface is not even affected if the
distance between
substrate surface and second surface is approximately zero or about zero.
Preferably, the device according to the present invention further comprises a
detection system.
Herein, it is preferred that the detection system is an optical system.
Examples for systems
suitable within the scope of the present invention are detection systems based
on fluorescence,
CA 3041596 2019-04-29
- 24 -
optical absorption, resonance transfer, and the like. Preferably, the optical
detection system is
a fluorescence-optical system. Particularly preferably, the fluorescence-
optical system is a
fluorescence microscope without autofocus, for example a fluorescence
microscope with
fixed focus.
In a further embodiment, the detection system is connected with at least one
spacer, which
adjusts a distance between the detection system and the second surface when
resting upon the
second surface. If the distance between microarray and second surface is about
zero, the
spacer also determines the distance between the surface of the chip and the
optical system of
the detection device. It is thus possible to keep the variance of the distance
between optical
detection device and microarray surface very small. The variance only
comprises the
thickness variance of the second surface, in general a glass surface, the
deflection of the
second surface, and the thickness of a layer caused by possible impurities at
the pressing
surfaces between chip and detection plane or between spacer and detection
plane. This
renders re-focusing for bringing the optical system into focus unnecessary,
which
considerably simplifies the operation of the device and / or renders an
expensive autofocus
installation unnecessary.
In a further embodiment, laterally limiting compensation regions, which keep
the volume in
the reaction chamber basically constant when the distance between microarray
and second
surface is reduced, are provided for the reaction space formed between the
first and the
second surface.
Preferably, the reaction space formed between the first and the second surface
is furthermore
laterally limited by elastic seals. Particularly preferably, the elastic seals
are made of silicone
rubber.
In order to ensure the detection of interactions between probe and target
molecules, the
second surface is, in particular, made of an optically transparent material,
preferably glass.
In a further embodiment of the device according to the present invention, the
first surface is,
at least in the region below the microarray, developed in such a way that the
microarray can
CA 3041596 2019-04-29
- 25 -
be guided relatively to the second surface in such a way that the distance
between the
microarray and the second surface is variable.
Herein, the first surface can, at least in the region below the microarray, be
developed in such
a way that the microarray can be guided in the direction toward the second
surface so that the
distance between the microarray and the second surface can be reduced and / or
that the
microarray can be guided in a direction away from the second surface so that
the distance
between the microarray and the second surface can be increased.
In this embodiment, it is preferred that the first surface can, at least in
the region below the
microarray, be elastically deformed. Particularly preferably, the first
surface is made of an
elastic synthetic material, for example an elastic membrane.
It can further be preferred that the first surface is formed by two
superimposed layers, wherein
an outer layer of the two superimposed layers has a recess at least in the
region below the
microarray. In this embodiment, it is preferred that an inner layer of the two
superimposed
layers is formed by an elastic seal or a sealing membrane, which usually also
limits the
reaction space laterally (see Figure 6). The sealing membrane can be guided
toward the
second surface. The sealing membrane closes a recess in the outer layer, which
usually
corresponds to the lower side of the chamber body. During the performance of a
PCR in the
reaction chamber, an internal pressure, which renders the reaction chamber
pressure-resistant
despite the relatively labile sealing membrane, is generated due to the higher
temperatures
prevailing in a PCR. This embodiment thus corresponds to a self-closing valve.
In order to
ensure the elasticity of the sealing membrane, the membrane is preferably
provided with a
compensation fold (see Figure 6).
It can further be provided that the device comprises at least one means, by
means of which the
microarray can be guided relatively to the second surface. In the following,
said means will be
referred to as means for guiding the first surface. Said means for guiding the
first surface is
preferably selected from the group consisting of a rod, a pin, a tappet, and a
screw.
Herein, the device can comprise at least one means for guiding the first
surface, by means of
which the microarray can be guided toward the second surface in such a way
that the distance
CA 3041596 2019-04-29
- 26 -
between the microarray and the second surface can be reduced and / or by means
of which the
microarray can be guided away from the second surface in such a way that the
distance
between the microarray and the second surface can be increased.
Particularly preferably, the microarray can be guided relatively to the second
surface by
means of pressure and / or traction, which is exerted on the first surface by
the means.
Herein, the above-mentioned spacers resting on the second surface can serve as
holders for
the means for guiding the first surface.
It can further be preferred that the first surface can be caused to vibrate by
the means for
guiding the first surface, in particular to vibrate at a frequency of 10 to 30
Hz, particularly
preferably of about 20 Hz. In this manner, bubbles present above the chip,
which would
impede a detection, can be removed and / or the interaction speed, for example
the
hybridization speed, can be increased by a thorough mixing owing to the
vibration of the
means for guiding the first surface.
It can also be preferred that the second surface can be guided relatively to
the first surface in
such a way that the distance between the microarray and the second surface is
variable.
Herein, the second surface can be guided relatively to the first surface in
such a way that the
distance between the microarray and the second surface can be reduced and / or
that the
distance between the microarray and the second surface can be increased.
In particular, this can be ensured by the second surface being guidable
relatively to the first
surface by means of the spacer exerting pressure and / or traction on the
second surface, such
that the distance between the microarray and the second surface is variable.
In a further preferred embodiment of the device according to the present
invention, both the
first surface and the second surface can be guided in such a way that the
distance between the
microarray and the second surface is variable.
CA 3041596 2019-04-29
- 27 -
In a further embodiment, the device according to the present invention is
developed in such a
way that, already in the original state, the microarray mounted on the first
surface rests,
preferably evenly, on the second surface forming the detection plane. The
first surface can be
guided in such a way that the distance between the microarray and the second
surface can be
increased. Herein, the first surface is preferably made of an elastic
material.
In a further embodiment of the device according to the present invention, the
first surface is
developed in a pivotable manner around a rotation axis. The rotation axis
divides the first
surface into two sides. In this embodiment, the microarray is arranged on a
first flanking
portion of the first surface. Preferably, the rotation axis for the swiveling
motion runs through
the center of the first surface, i.e. the two flanking portions preferably are
of equal size. The
first surface is preferably made of an elastic material.
In a first position of the pivotable first surface, the first surface is
arranged basically parallel
to the second surface. In the first position, the surface of the microarray
contacts the second
surface basically evenly, i.e. the substrate surface with the probe molecules
immobilized
thereon is basically not moistened by the sample solution. In said first
position, a space, which
is also referred to as processing chamber in the following, is formed between
the second
flanking portion of the first surface and the second surface. Said processing
chamber can
serve as chamber for processing the sample solution.
In a second position of the pivotable first surface, the first surface is
arranged at an angle
other than 1800 in relation to the second surface. In said second position,
the surface of the
microarray does not contact the second surface, i.e. the probe molecules
immobilized on the
substrate of the microarray are freely accessible for the target molecules
present in the sample
solution and can therefore interact with the latter. In the second position,
the processing
chamber is compressed.
The pivotable first surface can preferably be swiveled by means of exerting
traction on the
first flanking portion of the first surface and / or by means of exerting
pressure on the second
flanking portion of the first surface. Pressure and! or traction can be
exerted by means of a
means for guiding the first surface, as described above.
CA 3041596 2019-04-29
- 28 -
The chip or the substrate or the first surface can preferably consist of
silicon, ceramic
materials like aluminum oxide ceramics, borofloat glasses, quartz glass,
single-crystal CaF2,
sapphire discs, topaz, PMMA, polycarbonate, and / or polystyrene. The
selection of the
materials is also to be made dependent on the intended use of the device or
the chip. If, for
example, the chip is used for characterizing PCR products, only those
materials may be used,
which can resist a temperature of 95 C.
Preferably, the chips are functionalized by means of nucleic acid molecules,
in particular by
means of DNA or RNA molecules. However, they can also be functionalized by
means of
peptides and / or proteins, like for example antibodies, receptor molecules,
pharmaceutically
active peptides, and / or hormones, carbohydrates and / or mixed polymers of
said
biopolymers.
In a further preferred embodiment, the molecular probes are immobilized on the
substrate
surface via a polymeric linker, for example a modified silane layer. Such a
polymeric linker
can serve for the derivative preparation of the substrate surface and
therefore for the
immobilization of the molecular probes. In the case of covalent binding of the
probes,
polymers, for example silanes, are used, which have been functionalized or
modified by
means of reactive functionalities like epoxides or aldehydes. Furthermore, the
person skilled
in the art is also familiar with the activation of a surface by means of
isothiocyanate,
succinimide, and imido esters. To this end, amino-functionalized surfaces are
often
correspondingly derivatized. Furthermore, the addition of coupling reagents,
like for example
dicyclohexylcarbodiimide, can ensure corresponding immobilizations of the
molecular probes
The chamber body of the reaction chamber preferably consists of materials like
glass,
synthetic material, and / or metals like high-grade steel, aluminum, and
brass. For its
manufacturing, for example synthetic materials suitable for injection molding
can be used.
Inter alia, synthetic materials like macrolon, nylon, PMMA, and teflon are
conceivable. In
special embodiments, electrically conductive synthetic materials like
polyamide with 5 to
30% carbon fibers, polycarbonate with 5 to 30% carbon fibers, polyamide with 2
to
20% stainless steel fibers, and PPS with 5 to 40% carbon fibers and, in
particular, 20 to
30% carbon fibers are preferred. Alternatively and / or in addition, the
reaction space between
first and second surface can be closed by means of septa, which, for example,
allow filling of
CA 3041596 2019-04-29
- 29 -
the reaction space by means of syringes. In a preferred embodiment, the
chamber body
consists of optically transparent materials like glass, PMMA, polycarbonate,
polystyrene,
and / or topaz. Herein, the selection of materials is to be adjusted to the
intended use of the
device. For example, the temperatures the device will be exposed to are to be
considered
when selecting the materials. If, for example, the device is to be used for
performing a PCR,
for example, only those synthetic materials may be used, which remain stable
for longer
periods at temperatures like 95 C.
In particular, the chamber body is developed in such a way that the microarray
can be pressed
against the second surface evenly and / or reversibly with its active side,
i.e. the side of the
array, whereon the nucleic acid probes are immobilized.
In a special embodiment, the device according to the present invention
comprises modules
selected from the group consisting of a chamber body, preferably made of a
synthetic
material, a septum or a seal sealing the reaction chamber, a DNA chip, and /
or a second
optically transparent surface, preferably a glass pane, wherein the second
surface can
optionally also serve as chip simultaneously (see Figure 2 and Figure 3). In
this embodiment,
chamber body and seal are developed elastically, so that the DNA chip can be
pressed evenly
and reversibly to the glass cover with its active side. Thereby, the labeled
analysis liquid
located between DNA chip and detection surface is entirely displaced (see
Figure 5 and
Figure 6). In this manner, a highly sensitive fluorescence detection, for
example a computer-
imaging fluorescence microscopy, can be conducted without being impaired by a
background
fluorescence of the sample solution,.
Preferably, the second surface of the chamber body consists of transparent
materials like glass
and / or optically permeable synthetic materials, for example PMMA,
polycarbonate,
polystyrene, or acryl.
Preferably, the reaction chamber is developed between the second surface and
the microarray
in the form of a capillary gap having variable thickness. By forming a
capillary gap between
chip and detection plane, capillary forces can be utilized for safely filling
the reaction
chamber. Said capillary forces already occur in the non-compressed state of
the reaction
CA 3041596 2019-04-29
- 30 -
chamber; they can, however, be increased by compressing the reaction chamber.
Particularly
preferably, the capillary gap has a thickness in the range of about 0 i_tm to
about 100
From the possibility of being able to compress the reaction space and
therefore to reduce the
width of the gap between microarray and detection plane, further possibilities
of handling the
liquid within the reaction chamber arise. Thus, in a further embodiment of the
present
invention, several sub-chambers are provided instead of one single chamber,
wherein the
partitions between said sub-chambers do not reach the height of the second
surface, so that a
fluid connection is generated between the sub-chambers in a non-compressed
state of the
reaction chamber. By compressing the reaction chamber, the chambers can be
separated.
Thus, by compressing, the partitions between the chambers can be operated like
valves.
A special embodiment of said sub-chambers separated by valves is the
subdivision of the
reaction space of the device according to the present invention into different
PCR chambers.
In each chamber, individual primers are presented. In the beginning, the sub-
chambers are
simultaneously filled with the analyte. Subsequently, the reaction space is
compressed. After
that, the reaction space is subjected to the temperature cycle for the PCR. As
each sub-
chamber is filled with different primers, a different amplification reaction
takes place in each
chamber. An exchange between the chambers does not occur.
After the PCR has been conducted, hybridization takes place. Herein, each sub-
chamber can
contain an individual chip region or an individual chip. However, it is also
possible to
facilitate a fluid connection between the sub-chambers by increasing the
distance between
microarray and second surface, so that the different substances to be
amplified mix and in this
manner hybridize to a chip surface.
The advantage of this embodiment having sub-chambers separated by valves is
the increase in
multiplexity of the PCR, i.e. the number of independent PCRs with one sample,
which is
limited for biochemical reasons in a one-stage reaction. Thus, it is possible
to adjust the
number of PCRs to the possible number of probes on the chip surface.
In a further embodiment of the present invention, the reaction chamber thus
comprises at least
two sub-chambers, wherein in a first non-compressed state the sub-chambers are
in fluid
CA 3041596 2019-04-29
- 31 -
connection and in a second compressed state there is no fluid connection
between the sub-
chambers.
Particularly preferably, each sub-chamber is assigned to a defined region of
the microarray.
In particular, the sub-chambers can be formed by equipping the microarray and
/ or the
second surface with cavities, which serve as walls between the sub-chambers.
Particularly preferably, the walls between the sub-chambers are formed by
elastic seals.
Of course, this embodiment of the process unit having sub-chambers separated
by valves can
arbitrarily be combined with any of the above-described compression
principles.
In a further embodiment of the device according to the present invention, the
first surface is
made of a partially deformable elastic material, for example an elastic
membrane. In that only
a part of the reaction space can be compressed, sub-chambers, wherein the chip
is guided
toward the second surface, sub-chambers, which cannot be separated from each
other, and
sub-chambers, which cannot be altered, can, inter alia, be generated. Thereby,
simple pump
systems, which can, for example, be used for pumping salts into the
hybridization chamber at
the end of an amplification reaction, can be implemented in the reaction
space. This can, for
example, be advantageous for optimizing the chemical hybridization conditions
of the PCR
buffer, wherein the PCR buffer is optimized only for the conduction of the
PCR.
When subdividing the reaction chamber into several sub-chambers, it is
preferred to use
several means for agitating. Usually, the means for agitating are identical
with the means for
guiding the first surface. Thereby, individual chambers can be specifically
agitated. This can,
for example, be appropriate for implementing separate amplification spaces and
/ or
hybridization spaces.
Of course, this embodiment of the device according to the present invention
having several
means for agitating can also be arbitrarily combined with any of the above-
described
compression principles.
CA 3041596 2019-04-29
- 32 -
The above-described components or modules of the device according to the
present invention
selected from the group consisting of a chamber body, seals laterally limiting
the reaction
space, micro-array, and detection plane form the so-called process unit of the
device
according to the present invention. In the process unit, PCR, hybridization
reactions, detection
and / or evaluation can be conducted. This is similarly true for probes and
targets being, for
example, antibodies and proteins to be detected, thus a PCR does not have to
be carried out.
However, the following explanations are particularly done with regard to
detection techniques
using nucleic acid targets and ¨probes. However, it is clear to the person
skilled in the art how
to modify the units described in the following to adapt them for other
applications.
Preferably, the process unit of the device according to the present invention
is constructed in a
modular manner. This means that the process unit can comprise any arbitrary
combination of
the modules. The modules can also be exchanged during analysis.
In a further preferred embodiment, the device according to the present
invention in addition
comprises a temperature controlling and / or regulating unit for controlling
and / or regulating
the temperature in the reaction chamber. Such a temperature controlling and /
or regulating
unit for controlling and / or regulating the temperature in the reaction
chamber in particular
comprises heating and / or cooling elements or temperature blocks. Herein, the
heating
and / or cooling elements or the temperature blocks can be arranged in such a
way that they
contact the first surface and / or the second surface. By means of contacting
both the first and
the second surface, particularly efficient temperature controlling and
regulating is ensured.
In this embodiment, the substrate of the microaiTay or the first surface and /
or the second
surface is connected with heating and / or cooling elements and / or
temperature blocks and
should then preferably consist of materials with good heat-conducting
properties. Such heat
conductive materials offer the considerable advantage of ensuring a homogenous
temperature
profile throughout the entire surface of the reaction space and therefore
allowing temperature-
dependent reactions, like for example a PCR, to be conducted homogenously
throughout the
entire reaction chamber, delivering high yields, and controllably or
regulatably with high
exactness.
CA 3041596 2019-04-29
- 33 -
Thus, in a preferred embodiment, the substrate of the microarray or the first
surface or the
second surface consist of materials having a good heat conductivity,
preferably having a heat
conductivity in a range of 15 to 500 Wm-IK-1, particularly preferably in a
range of 50 to
300 Wm-1K-1, and most preferably in a range of 100 to 200 Wm-1K-1, wherein the
materials
are usually not optically transparent. Examples for suitable heat conductive
materials are
silicon, ceramic materials like aluminum oxide ceramics, and / or metals like
high-grade steel,
aluminum, copper, or brass.
If the substrate of the microarray or the first surface or the second surface
of the device
according to the present invention substantially consists of ceramic
materials, the use of
aluminum oxide ceramics is preferred. Examples for such aluminum oxide
ceramics are the
ceramics A-473, A-476, and A-493 by Kyocera (Neuss, Germany).
Preferably, the substrate of the microarray or the first surface or the second
surface is
equipped with optionally miniaturized temperature sensors and / or electrodes
or has heater
structures on its back side, i.e. the side facing away from the reaction
chamber, so that
tempering the sample liquid and mixing the sample liquid by means of an
induced electro-
osmotic flow is possible.
The temperature sensors, for example, can be developed as nickel-chromium thin
film
resistance temperature sensors.
The electrodes, for example, can be developed as gold-titanium electrodes and,
in particular,
as quadrupole.
The heating and / or cooling elements can preferably be selected in such a way
that fast
heating and cooling of the liquid in the reaction chamber is possible. Herein,
fast heating and
cooling is understood to denote that temperature alterations in a range of 0.2
K / s to 30 K / s,
preferably of 0.5 K / s to 15 K / s, particularly preferably of 2 K / s to 15
K / s, and most
preferably of 8 K / s to 12 K / s or about 10 K / s can be mediated by the
heating and / or
cooling elements. Preferably, temperature alterations of 1 K / s to 10 K / s
can also be
mediated by the heating and / or cooling elements.
CA 3041596 2019-04-29
- 34 -
The heating and / or cooling elements, for example resistance heaters, can,
for example, be
developed as nickel-chromium thin film resistance heaters.
For further details on the specification and dimension of the temperature
sensors, heating
and / or cooling elements or means for increasing the temperature and of the
electrodes, it is
referred to the contents of the International Patent Application WO 01/02094.
In a preferred embodiment, tempering of the reaction chamber is ensured by
using a chamber
body consisting of electrically conductive material. Such an electrically
conductive material is
preferably an electrically conductive synthetic material, like for example
polyamide,
optionally having 5 to 30% carbon fibers, polycarbonate, optionally having 5
to 30% carbon
fibers, and / or polyamide, optionally having 2 to 20% stainless steel fibers.
Preferably, PPS
(polyphenylenesulfide) with 5 to 40% carbon fibers, particularly preferably 20
to 30% carbon
fibers, is used as electrically conductive synthetic material. It is further
preferred that the
chamber body is developed in such a way that it has swellings and tapers. Such
swellings or
tapers in the chamber body allow specific heating of the reaction chamber or
the
corresponding surfaces. Furthermore, the use of such volume conductors has the
advantage
that, also with optionally lower heat conductivity of the material used,
homogenous tempering
of the chamber or the corresponding surfaces is ensured, as heat is released
in each volume
element.
Coupling and educing heat into the reaction space can be conducted in
different ways. Inter
alia, it is intended to bring in heat via external microwave radiation,
internal or external
resistance heating, internal induction coils or surfaces, water cooling and
heating, friction,
irradiation with light, in particular with IR light, air cooling and / or
heating, friction,
temperature emitters, and peltier elements.
Measuring the temperature in the reaction space can be conducted in different
ways, for
example by means of integrated resistance sensors, semi-conductor sensors,
light waveguide
sensors, polychromatic dyes, polychromatic liquid crystals, external
pyrometers like IR
radiation and / or temperature sensors of all types, which are integrated in
the means for
guiding the microarray.
CA 3041596 2019-04-29
- 35 -
Measuring the temperature in the reaction chamber can furthermore be conducted
by means of
integrating a temperature sensor in the chamber body, for example by means of
injection in
the course of the production process of the chamber body, by means of non-
contact
measurement with the aid of a pyrometer, an IR sensor, and / or thermopiles,
by means of
contact measurement, for example with a thermal sensor integrated in the
device and
contacting a suitable surface or a suitable volume of the chamber body or the
chamber, by
means of measuring the temperature-dependent alteration of the refraction
index at the
detection plane, by means of measuring the temperature-dependent alteration of
the color of
specific molecules, for example in the solution, on the probe array, or in the
chamber seal,
and / or by means of measuring the temperature-dependent alteration of the pH-
value of the
solution used by means of measuring the color alteration of a pH-sensitive
indicator, for
example by means of measuring its absorption.
Furthermore, automatic limitation of temperature can occur due to a surge of
the resistance of
the heater, wherein the corresponding threshold temperature preferably lies in
a range of 95 C
to 110 C. When reaching the threshold temperature, the resistance of the
heater surges,
whereby virtually no current flows and therefore virtually no heat is emitted
anymore. In
particular, polymers, like electrically conductive polyamides, whose
resistance increases at
the threshold temperature due to the alteration of the matrix of the polymer
or a phase
alteration, can be used for such heaters.
In one embodiment, the temperature controlling and regulating unit can be
integrated in the
first surface and / or the second surface. In said embodiment, the process
unit is, in particular,
equipped with a heater (see Figure 4), which serves for implementing the
temperature
alterations in PCR and hybridization.
Preferably, the process unit has a low heat capacity, so that maximum
temperature alteration
speeds of, for example, at least 5 K / s are practicable at a low power
demand. In order to
ensure fast cooling of the process unit, another preferred embodiment intends
providing a
cooling system, for example an air cooling system.
Preferably, cooling of the process unit can also be achieved by means of
permanently
tempering the space surrounding the process unit to a lowered temperature and
thereby
CA 3041596 2019-04-29
- 36 -
passively cooling the cartridge. This renders active cooling of the reaction
cartridge
unnecessary.
In a further embodiment, the temperature controlling and regulating unit can
comprise
temperature blocks, which are each pre-heated to a defined temperature. In
said embodiment
the process unit, in particular, has no integrated heater. Owing to the
omission of an integrated
heating system, the process unit can be provided even more cost-efficiently.
Heat transfer between the temperature blocks of the temperature controlling
and regulating
unit is preferably ensured in that the temperature blocks contact the first
surface and / or
second surface of the device according to the present invention. Preferably,
the temperature
blocks can be arranged linearly or on a rotary disc and, for example, be
integrated in the
detection device in this manner. Figure 7 shows a rotary disc having several
temperature
blocks, each of which is adjusted to a defined temperature. By means of
exchanging the
temperature blocks below the process unit, the process unit is brought to a
specific
temperature defined by the temperature block. Preferably, the temperature
blocks are
manufactured in such a way, that they have a significantly higher heat
capacity than the
process unit, so that maximal temperature alteration speeds of, for example,
at least 5 K / s are
also practicable in this embodiment. Preferably, the temperature blocks are
only
thermostaticized instead of heated or cooled, so that the energy demand is
also minimal in this
case. In this embodiment, cooling or heating the process unit can be omitted.
In a further embodiment, the temperature controlling and regulating unit is
integrated in the
mean / s for guiding the first surface and / or in the mean / s for agitating,
and / or in the
spacer. In this embodiment, heat transfer is conducted by means of contacting
the means
and / or the spacer with the first surface and / or the second surface.
Preferably, the device additionally comprises a reprocessing unit for
purifying and / or re-
concentrating the sample solution and / or for controlling the loading and
unloading of the
reaction chamber with fluids. Within the scope of the present invention,
fluids are understood
to denote liquids and gases. Furthermore, the analysis solution can be re-
buffered in the
reprocessing unit. The reprocessing unit can finally also be used for
providing the necessary
CA 3041596 2019-04-29
- 37 -
analysis chemicals. The connection of the fluid containers with the reaction
chamber can, for
example, be developed as described in the International Patent Application WO
01 / 02094.
In this embodiment, the reaction chamber and the reprocessing unit are
particularly preferably
connected via two cannulas, wherein the cannulas are arranged in such a way
that a first
cannula ensures the feeding of fluids from the reprocessing unit into the
reaction chamber and
a second cannula ensures the escape of air dislocated by the fed fluids from
the reaction
chamber. A sample fed into the reprocessing unit can thus reach the reaction
chamber of the
process unit via the cannulas. To this end, the cannulas are arranged in such
a way that they
reach into the reaction chamber via the cannula guide.
The reprocessing unit can be developed in such a way that it can be separated
from the
process unit. After filling the reaction chamber with the sample solution and,
optionally, with
further reaction liquids, the reprocessing unit can thus be separated from the
process unit,
preferably be disengaged, and, optionally, be discarded.
In the following, embodiments of integrated or non-integrated units for
filling the reaction
chamber, which will also be referred to in the following as filling unit or
reprocessing unit,
will be described.
Conventionally, the reaction solution is brought into a specific opening of
the filling unit by
means of a suitable tool, for example, a pipette. The transport of liquids
into the device is
performed via the pressure exerted by the pipette or by means of another
pressure-generating
tool, like for example a syringe or an automated unit, which is, for example,
a functional
component of a processing automat.
Preferably, the filling unit is developed for manual operation in an
ergonomically suitable
way. Furthermore, it preferably has easily accessible additional openings at
the outsides for
feeding the reactive substances.
Preferably, a filling unit furthermore has a suitable fluid interface for
penetrating the seal of
the chamber body. To this end, specific cannulas are used, which, for example,
consist of
high-grade steel or polymers and usually have a diameter of 0.05 mm to 2 mm.
Preferably, at
CA 3041596 2019-04-29
- 38 -
least one or more cannulas are arranged, particularly preferably two, wherein
one can be used
for filling with a reactive liquid and another for ventilation of the reaction
space and for
taking up surplus fluids. Such cannulas can be connected with the filling unit
in a fixed or an
interchangeable manner, wherein preferably a connection, which cannot be
detached by the
operator, for implementing disposable filling items is implemented.
The filling unit can furthermore comprise a unit for covering the cannulas, so
that any
possible injury of the operator or contamination of the environment can be
avoided after
separation of the systems.
Preferably, the filling unit furthermore comprises a suitable mechanical
interface for snug-fit
contacting of the reaction cartridge. Said interface can be developed, for
example, in the form
of specific snaps. In this manner, penetration of the seal of the chamber body
at preferred sites
can be ensured.
When processing the reaction cartridge in corresponding processing automats,
suitable
mechanical measures are to be taken, which allow adjustment and accurate
positioning in the
devices. This particularly applies to the positioning for the replacement and
/ or the feeding of
liquids and the positioning of the reaction cartridge for detection of the
signals after
conduction of the reactions in the reaction chamber.
The device or the filling unit can furthermore comprise an integrated waste
container, which
serves for taking up surplus or dislocated gaseous or liquid media, like for
example protective
gas fillings or buffers. The waste container can, for example, be filled with
a further gaseous,
liquid, or solid medium, which binds the liquid or gaseous substances
reversibly or
irreversibly, like for example cellulose, filter materials, silica gels. In
addition, the waste
container can have a ventilation opening or can exhibit a negative pressure
for improving the
filling behavior of the entire unit.
Alternatively, the waste container can also be developed as separate module.
In this case, the
filling unit is equipped with corresponding fluid interfaces which can
correspond to
commercial standards, like for example LuerLock, and which lead to the
outside. Such
interfaces can have a form or force connection with continuing systems.
CA 3041596 2019-04-29
- 39 -
In a first special embodiment, filling is conducted by means of a detachable
filling unit having
an integrated waste container. In particular, the filling unit serves for non-
recurrent filling of
the reaction chamber. The filling unit is, for example, developed in such a
way that it is
plugged or temporarily attached to the cartridge, the samples are fed into the
reaction space,
and, after filling is completed, the filling unit is again separated from the
cartridge and is
discarded. In this special first embodiment, the filling unit further
comprises an integrated
waste container, which can be developed as described above. An example for
this
embodiment is shown in Figure 22. The procedure for filling a reaction
cartridge by means of
a modular filling unit is shown in Figure 23.
In a second special embodiment, filling is conducted by means of an integrated
filling unit.
Herein, the filling unit is an integrated component of the reaction cartridge
and is therefore
not separated from the latter; discarding the filling unit and the cartridge
is conducted
simultaneously. Herein, the filling unit is preferably used for non-recurrent
filling of the
reaction chamber and possibly for further process-internal fluid steps. In
this embodiment, the
filling unit furthermore preferably comprises a technical device, which
implements a
preferred position of the cannulas in the system, in particular for preventing
inadvertent
piercing of the cannulas into the seal of the chamber body. It is, however,
also conceivable
that the cannulas pierce the seal of the chamber body in said preferred
position. Said technical
device can, for example, be implemented by means of establishing springs,
elastic elements,
or specific recesses and bumps for implementing a catch. In this embodiment,
the filling unit
further comprises a filling and waste channel, which comprises corresponding
fluid interfaces,
which can also correspond to commercial standards, like for example LuerLock,
and which
lead to the outside. Such interfaces can have a positive or non-positive
interlocking with
continuing systems and serve for feeding and / or removing gaseous and / or
liquid media. An
example for this embodiment is shown in Figure 24. The procedure for filling a
reaction
cartridge having an integrated filling unit is shown in Figure 25.
In a third special embodiment, filling is conducted via an integrated filling
unit having an
integrated waste container. In said embodiment, the filling unit is an
integrated component of
the reaction cartridge and is therefore not separated from the latter; filling
unit and cartridge
CA 3041596 2019-04-29
- 40 -
are discarded simultaneously. Herein, the filling unit is preferably used for
non-recurrent
filling of the reaction chamber and possibly for further process-internal
fluid steps.
In this embodiment, the filling unit furthermore preferably also comprises a
technical device,
which implements a preferred position of the cannulas in the system,
preferably for
preventing inadvertent piercing of the cannulas into the seal of the chamber
body. It is,
however, also conceivable that the cannulas pierce the seal of the chamber
body in said
preferred position. Said technical device can, for example, be implemented by
means of
establishing springs, elastic elements, or specific recesses and bumps for
implementing a
catch. In this embodiment, the filling unit furthermore comprises an
integrated waste
container, which can be developed as described above. An example for this
embodiment is
shown in Figure 26. The procedure for filling a reaction cartridge with an
integrated filling
unit and integrated waste container can, for example, be conducted by means of
combining
the procedures described in Figures 23 and 25.
In the following, a special embodiment for arranging cannulas for pressure
balance during the
compression procedure will be described. The cannulas of a filling tool for
the cartridge can,
for example, be arranged in such a way that both filling in a non-compressed
state and
transfer of surplus reaction solutions during a compression of the reaction
space is possible.
This can preferably be achieved by means of adapted construction of the seal
and a cannula
arrangement, wherein the cannulas preferably pierce the compensation regions
within the
reaction chamber. Such an arrangement is particularly suitable, if the surplus
volume cannot
be taken up by means of a special seal design. An example for a possible
vertical cannula
arrangement with unaltered form of the seal is shown in Figure 27.
The device according to the present invention can further comprise a unit,
which is connected
to the detection system, for controlling the test procedure and / or for
processing the signals
recorded by means of the detection system. The controlling and / or processing
unit can be a
micro-controller or an industrial computer. This coupling of detection unit
and processing
unit, which ensures the conversion of the reaction results to the analysis
result, allows, inter
alia, the use of the device according to the present invention as hand-held
device, for example,
in medical diagnostics.
CA 3041596 2019-04-29
-41 -
In addition, the device according to the present invention furthermore
preferably has an
interface for external computers. Inter alia, this allows the transfer of data
for external storage.
In a further preferred embodiment, the device is equipped with a coding,
preferably a data
matrix and / or a bar code, containing information on the substance library
and / or the
conduction of the amplification and / or detection reaction. By means of such
an individual
identification number, the reading or detection device can automatically
recognize, which test
has been conducted. To this end, a data record containing information on the
substance
library, the conduction of the detection reaction, and the like is stored in a
database when
manufacturing the device according to the present invention. Thus, the data
record can, in
particular, contain information on the layout of the probes on the array and
information as to
how evaluation is to be conducted in the most advantageous manner. The data
record or the
data matrix can further contain information on the temperature-time regime of
a PCR to be
optionally conducted for amplifying the target molecules. The data record thus
obtained is
preferably given a number, which is attached to the holder in the form of the
data matrix. Via
the number recorded in the data matrix, the set data record can then
optionally be called when
reading out the substance library. Finally, the data matrix can be read out by
the temperature
controlling or regulating unit and other controllers, like for example a
control for filling and
unloading of the reaction chamber via the fluid containers, and an automatic
conduction of
amplification and detection reaction can thus be ensured.
The coding, like a data matrix, does not compellingly have to contain the
entire information.
It can also simply contain an identification or access number, by means of
which the
necessary data are then downloaded from a computer or a data carrier.
The device according to the present invention can be very easily manufactured.
In Figure 3 it
is shown that the process unit can consist of only four individual components,
which are
simply fit into one another. Figures 10 and 11 show embodiments, which can
also be easily
manufactured due to the construction according to the present invention,
although they consist
of several components. The geometric tolerances of the dimensions of the
individual
components can be very large with, for example, 1 / 10 to 2 / 10 mm, so that,
for example, the
large-scale injection molding of seal and chamber body can be conducted in a
very cost-
efficient manner. The low tolerances are facilitated by means of pressing the
chip against the
CA 3041596 2019-04-29
- 42 -
detection plane, as thereby the optical path to the detection microscope is
hardly influenced
by the components of the process unit. The only geometric quantities having a
low tolerance
are the x,y-position of the chip and the thickness of the detection plane. The
variance of the z-
position of the chip, however, only plays a subordinate part. Despite these
low technical
requirements, a focusing device at the optical system, for example a
fluorescence detection
microscope, is not required. These properties clearly show the suitability of
the device
according to the present invention for mobile on-site use.
In a further aspect of the present invention, a method for qualitatively and /
or quantitatively
detecting molecular interactions between probe and target molecules is
provided, which
comprises the following steps:
a) feeding a sample, preferably a sample solution comprising target molecules,
into a
reaction chamber of a device according to the present invention as described
above;
and
b) detecting an interaction between the target molecules and the probe
molecules
immobilized on the substrate.
The method according to the present invention allows the qualitative and / or
quantitative
detection of molecular interactions between probe and target molecules in a
reaction chamber,
without necessitating a replacement of the sample or reaction liquids in order
to remove a
disturbing background after the interaction is completed and before the
detection.
Within the scope of the present invention, the detection of an interaction
between the probe
and the target molecule is usually conducted as follows: Subsequently to
fixing the probe or
the probes to a specific matrix in the form of a microarray in a predetermined
manner or
subsequently to providing a microarray, the targets are contacted with the
probes in a solution
and are incubated under defined conditions. As a result of the incubation, a
specific
interaction or hybridization occurs between probe and target. The bond
occurring herein is
significantly more stable than the bond of target molecules to probes, which
are not specific
for the target molecule.
The detection of the specific interaction between a target and its probe can
be performed by
means of a variety of methods, which normally depend on the type of the
marker, which has
been inserted into target molecules before, during or after the interaction of
the target
CA 3041596 2019-04-29
- 43 -
molecule with the microarray. Typically, such markers are fluorescent groups,
so that specific
target / probe interactions can be read out fluorescence-optically with high
local resolution
and, compared to other conventional detection methods, in particular mass-
sensitive methods,
with little effort (see, for example, A. Marshall, J. Hodgson, DNA chips: An
array of
possibilities, Nature Biotechnology 1998, 16, 27-31; G. Ramsay, DNA Chips:
State of the art,
Nature Biotechnology 1998, 16, 40-44).
Depending on the substance library immobilized on the microarray and the
chemical nature of
the target molecules, interactions between nucleic acids and nucleic acids,
between proteins
and proteins, and between nucleic acids and proteins can be examined by means
of this test
principle (for survey see F. Lottspeich, H. Zorbas, 1998, Bioanalytik,
Spektrum
Akademischer Verlag, Heidelberg / Berlin, Germany).
Herein, antibody libraries, receptor libraries, peptide libraries, and nucleic
acid libraries are
considered as substance libraries, which can be immobilized on microarrays or
chips.
The nucleic acid libraries play the most important role by far. These are
microarrays, on
which deoxyribonucleic acid (DNA) molecules or ribonucleic acid (RNA)
molecules are
immobilized.
In a preferred embodiment of the method according to the present invention,
the distance
between microarray and second surface is kept in a position, which allows
processing of the
sample solution and / or the interaction between the target molecules and the
probe molecules
immobilized on the substrate, for example amplification of nucleic acids to be
detected
and / or hybridization between nucleic acids to be detected and the nucleic
acid probes
immobilized on the substrate, before detection in step b).
It is further preferred that in step b) the distance between the microarray
and the second
surface is altered, preferably reduced. I.e. the detection is preferably
conducted with a reduced
distance between microarray and detection plane. Particularly preferably, the
distance
between microarray and detection plane is about zero during detection.
CA 3041596 2019-04-29
- 44 -
In one embodiment, the microarray is guided toward the second surface in order
to reduce the
distance between microarray and second surface. Preferably, this is ensured by
means of
pushing the first surface by means of pressure exerted by at least one means
for guiding the
first surface, for example a tappet, a rod, a pin and / or a screw, wherein
the point of pressure
of the means is located, in particular, below the microarray.
Pressing the microarray against the second surface or the detection plane can
be facilitated in
that the first surface is elastically deformable at least in the region below
the microarray.
Alternatively, the first surface can be developed by means of two superimposed
layers,
wherein one outer layer of the two superimposed layers has a recess at least
in the region
below the microarray, and an inner layer of the two superimposed layers is
formed by an
elastic seal. Pressure is then exerted on the inner layer in the vicinity of
the recess by the
means for guiding the first surface.
The means for guiding the first surface, for example a pin, a rod, a tappet
and / or a screw,
cannot only serve for exerting a pressure on the first surface, however. In
the event that
bubbles should form on the DNA chip, which would impede the detection, these
bubbles can
be removed by means of agitation by the means for guiding the first surface,
for example by
means of a vibration frequency of about 20 Hz applied to the first surface, in
particular in the
form of an elastic membrane.
Furthermore, there is often the problem that the interaction, for example the
hybridization, at
the chip surface takes a very long time. Among other reasons, this is due to
the fact that the
speed of interaction or hybridization is determined by diffusion. Preferably,
the interaction or
hybridization speed can be increased by means of agitation via the means for
guiding the first
surface, for example by means of a vibration frequency of about 20 Hz applied
to the first
surface, in particular in the form of an elastic membrane, as the agitation or
vibration leads to
mixing in the reaction chamber.
In a further embodiment, the second surface is guided toward the first surface
in order to
reduce the distance between microarray and second surface. In particular, this
can be ensured
in that the second surface is guided toward the first surface by means of
pressure exerted on
the second surface by the spacer.
CA 3041596 2019-04-29
- 45 -
In a further embodiment, the first surface is guided toward the second surface
and the second
surface is guided toward the first surface in order to reduce the distance
between microaiTay
and second surface.
In the following, further embodiments for guiding the first surface relatively
to the second
surface or the second surface relatively to the first surface will be
described. Said
embodiments are not only suitable for positioning the first surface or the
probe array
relatively to the second surface or the detection surface, but can, in
particular, also be used for
moving the probe array relatively to the detection surface. By means of such a
motion, for
example an agitation of the solution in the reaction chamber can be achieved.
In one embodiment, the probe array is moved relatively to the detection
surface or moved
within the chamber by means of a magnetic field. The probe array and / or the
second surface,
for example, contains a magnetic material or contains a component, whereto a
magnetic
material has been added, and / or is mounted in a holder consisting of an
entirely or partially
magnetic material. It can further be preferred that the probe array and / or
the second surface
is moved passively by moving a magnetic body, which is arranged below the
respective
surface and is, for example, connected with said surface, by means of a
magnetic field.
In a further embodiment, the probe array is moved and / or positioned
relatively to the
detection surface by means of gravitational impact.
In a further embodiment, the probe array is moved and / or positioned
relatively to the
detection surface by means of a stream generated in the reaction chamber. To
this end, the
device can, for example, be developed in such a way that, in case the probe
array is
surrounded by a liquid stream, a negative pressure is generated at one side of
the reaction
chamber and a positive pressure is generated at the opposite side, which leads
to movement of
the probe array in the reaction chamber. Such a stream can, for example, be
implemented by
means of thermal convection, which is caused by local temperature differences
in the
chamber.
In a further embodiment, the probe array is moved and / or positioned
relatively to the
detection surface by means of impact of an electric field.
CA 3041596 2019-04-29
- 46 -
In a further embodiment, a gas bubble is generated below the probe array by
means of local
overheating, due to which the chip is moved in the chamber or is guided toward
the detection
surface.
By means of reducing the distance between microarray and second surface before
the
detection, the sample solution preferably is substantially entirely removed
from the region
between microarray and detection plane. Hereby, background signals, which are
caused by
labeled molecules, which are not bound to the array surface, for example by
labeled primers
and / or labeled target nucleic acids, which are not bound to the array
surface, are reduced.
Thus, in the detection of step b), the distance between the microarray and the
second surface
is preferably altered in such a way that the sample solution between the
microarray and the
second surface is essentially removed. The microarray is then essentially
located in the
detection plane and a disturbing background is virtually avoided.
In a further alternative embodiment, the microarray rests evenly on the second
surface
forming the detection plane already in the original state of the device and is
not only brought
into the detection plane by means of guiding the first surface toward the
second surface
and / or guiding the second surface toward the first surface. In this
embodiment, the
microarray is not moistened by the sample solution during the processing
steps. For
conducting the interaction reaction, for example a hybridization, the first
surface, which is
preferably made of an elastic material, for example an elastic membrane, is
guided away from
the detection surface. Thereby, the chip surface is moved away from the
detection surface and
is moistened by the sample solution. The interaction, for example a
hybridization, can take
place. For conducting the detection and further processing, the first surface,
for example in
the form of an elastic membrane, is released again, due to which it leaps back
to its originally
adjusted position, which can be accelerated by means of pressure exerted by a
means for
guiding the first surface, for example a pin, a rod, a screw and / or a
tappet. Thereby, the
microarray is pressed against the detection plane again and the detection can
be conducted
without a background.
CA 3041596 2019-04-29
- 47 -
In a further embodiment of the method according to the present invention, a
device according
to the present invention, as described above, is used, the first surface of
which is developed in
a pivotable manner around a rotation axis.
In a first position, which is also referred to as initial position, the
surface of the microarray
arranged on the first flanking portion rests essentially evenly on the second
surface, i.e. the
substrate surface with the probe molecules immobilized thereon is essentially
not moistened
by the sample solution. In the space formed in the first position between the
second flanking
portion of the first surface and the second surface, the processing chamber,
the processing of
the reaction solution is preferably conducted, i.e. in particular
purification, re-concentration,
washing and rinsing and / or amplification steps.
Subsequently, the pivotable first surface is brought to a second position,
wherein the first
surface is arranged relatively to the second surface at an angle other than
1800, preferably at
an angle of 45 . Preferably, this is conducted by means of traction exerted on
the first flanking
portion of the first surface and / or pressure exerted on the second flanking
portion of the first
surface by means of a means for guiding the first surface, as described above.
By means of
guiding the first surface to the second position, the microarray is guided
away from the
second surface and the sample solution penetrates the cavity forming between
microarray and
second surface. The probe molecules immobilized on the substrate of the
microarray are
freely accessible for the target molecules present in the sample solution, so
that an interaction
reaction between probe and target molecules can occur. In this embodiment of
the method
according to the present invention, pressure and / or traction exerted on the
first surface has
the advantage that, in this manner, the sample solution is moved and thus the
interaction
reaction can be accelerated.
For conducting the detection and, optionally, further processing, the
pivotable first surface is
guided back to the first position, for example by means of pressure exerted on
the first
flanking portion of the first surface and / or traction exerted on the second
flanking portion of
the first surface or, in the case of elastic development of the first surface,
by means of
releasing the first flanking portion. Now, the microarray again rests
essentially evenly on the
second surface, so that the sample solution between the second surface and the
microarray is
CA 3041596 2019-04-29
- 48 -
essentially displaced in this position and an essentially background-free
detection can take
place.
The targets to be examined can be present in any kind of sample, preferably in
a biological
sample.
Preferably, the targets are isolated, purified, copied, and / or amplified
before their detection
and quantification by means of the method according to the present invention.
The method according to the present invention further allows the amplification
and the
qualitative and / or quantitative detection of nucleic acids in a reaction
chamber, wherein the
detection of molecular interactions or hybridizations can be conducted after
completion of a
cyclic amplification reaction without necessitating replacement of the sample
or reaction
liquids. The method according to the present invention further also ensures a
cyclic detection
of hybridization events in an amplification, i.e. a detection of the
hybridization even during
the cyclic amplification reaction. Finally, with the aid of the method
according to the present
invention, the amplification products can be quantified during the
amplification reaction and
after completion of the amplification reaction.
Usually, the amplification is performed by means of conventional PCR methods
or by means
of a method for the parallel performance of amplification of the target
molecules to be
analyzed by means of PCR and detection by means of hybridization of the target
molecules
with the substance library support, as is described above..
In a further embodiment, the amplification is performed as a multiplex PCR in
a two-step
process (see also WO 97/45559). In a first step, a multiplex PCR is performed
by means of
using fusion primers, whose 3'-ends are gene specific and whose 5'-ends
represent a universal
region. The latter is the same in all forward and reverse primers used in the
multiplex
reaction. In this first stage, the amount of primer is limiting. Hereby, all
multiplex products
can be amplified until a uniform molar level is achieved, given that the
number of cycles is
adequate for reaching primer limitation for all products. In a second stage,
universal primers
identical to the 5'-regions of the fusion primers are present. Amplification
is performed until
the desired amount of DNA is obtained.
CA 3041596 2019-04-29
- 49 -
In a further preferred embodiment of the method according to the present
invention, detection
is performed during the cyclic amplification reaction and / or after
completion of the cyclic
amplification reaction. Preferably, detection is performed during the
amplification reaction, in
every amplification cycle. Alternatively, detection can also be determined in
every second
cycle or every third cycle or in any arbitrary intervals.
In the conduction of a linear amplification reaction, wherein the target
amount increases by a
certain amount with each step, or an exponential amplification reaction, for
example a PCR,
wherein the DNA target amount multiplies with each step, in the process unit,
the chip can
thus be pressed against the detection plane after every amplification step and
therefore the
detection can be conducted. It is thus possible to perform on-line
surveillance of the
amplification reaction. In particular in the case of non-linear amplification
reactions, it is
thereby possible to determine the initial concentration of the DNA target
amount.
In this manner, the number of amplification steps can furthermore be optimized
on-line. As
soon as the DNA target amount has reached a specific concentration, the
amplification is
discontinued. If the initial target concentration is low, the number of
amplification steps is
increased in order to be able to conduct an assured analysis of the products.
In the case of
reduced reaction time of positive controls, the analysis process can be
discontinued very
early.
The chemicals necessary for conducting an amplification reaction, like for
example
polymerase, buffer, magnesium chloride, primers, labeled, in particular
fluorescence-labeled
primers, dNTPs and the like, can be provided in the reaction chamber, for
example in freeze-
dried form.
Preferably, the cyclic amplification reaction is a PCR. In a PCR, three
temperatures for each
PCR cycle are usually passed through. Preferably, the hybridized nucleic acids
detach from
the microarray at the highest temperature, i.e. the denaturation temperature.
A preferred value
for the denaturation temperature is 95 C. Therefore, a hybridization signal,
which serves as
zero value or reference value for the nucleic acids detected in the respective
PCR cycle, can
be determined at this denaturation temperature.
CA 3041596 2019-04-29
- 50 -
At the temperature following in the PCR cycle, an annealing temperature of,
for example,
about 60 C, a hybridization between the nucleic acids to be detected and the
nucleic acids
immobilized on the substrate of the microarray is facilitated. Therefore, in
one embodiment of
the method according to the present invention, the detection of target nucleic
acids present in
a PCR cycle is performed at the annealing temperature.
In order to enhance the sensitivity of the method according to the present
invention, it can
further be advantageous to lower the temperature below the annealing
temperature, so that the
detection is preferably performed at a temperature below the annealing
temperature of an
amplification cycle. For example, the detection can be performed at a
temperature in a range
of 25 C to 50 C and preferably in a range of 30 C to 45 C.
In a further alternative embodiment of the method according to the present
invention, the
hybridization between nucleic acids to be detected and the nucleic acids
immobilized on the
substrate of the microaffay is at first performed at a low temperature, in
order to subsequently
raise the hybridization temperature. Such an embodiment has the advantage that
the
hybridization time is reduced compared to hybridizations at temperatures of
more than 50 C
without losing specificity in the interactions.
If the zero value or reference value determined at denaturation temperature is
subtracted from
the measured value determined at or below the annealing temperature, a
measured result free
of disturbances, in which fluctuation and drift are eliminated, can be
obtained.
Usually, the target molecules to be detected are equipped with a detectable
marker. In the
method according to the present invention, the detection is thus preferably
conducted by
means of equipping the bound targets with at least one label, which is
detected in step b).
As already mentioned above, the label coupled to the targets or probes
preferably is a
detectable unit or a detectable unit coupled to the targets or probes via an
anchor group. With
respect to the possibilities for detection or labeling, the method according
to the present
invention is very flexible. Thus, the method according to the present
invention is compatible
with a variety of physical, chemical, or biochemical detection methods. The
only prerequisite
CA 3041596 2019-04-29
-51 -
is that the unit or structure to be detected can directly be coupled or can be
linked via an
anchor group, which can be coupled with the oligonucleotide, to a probe or a
target, for
example an oligonucleotide.
The detection of the label can be based on fluorescence, magnetism, charge,
mass, affinity,
enzymatic activity, reactivity, a gold label, and the like. Thus, the label
can, for example, be
based on the use of fluorophore-labeled structures or components. In
connection with
fluorescence detection, the label can be an arbitrary dye, which can be
coupled to targets or
probes during or after their synthesis. Examples are Cy dyes (Amersham
Pharmacia Biotech,
Uppsala, Sweden), Alexa dyes, Texas Red, Fluorescein, Rhodamin (Molecular
Probes,
Eugene, Oregon, USA), lanthanides like samarium, ytterbium, and europium
(EG&G, Wallac,
Freiburg, Germany).
Particularly preferably, said detectable marker is a fluorescence marker. As
already mentioned
above, the use of the device according to the present invention in the method
according to the
present invention ensures the detection of the fluorescence markers by means
of a
fluorescence microscope without autofocus, for example a fluorescence
microscope with
fixed focus.
Beside fluorescence markers, luminescence markers, metal markers, enzyme
markers,
radioactive markers, and / or polymeric markers can also be used within the
scope of the
present invention as labeling and / or detection unit, which is coupled to the
targets or the
probes.
Likewise, a nucleic acid, which can be detected by means of hybridization with
a labeled
reporter (sandwich hybridization), can be used as label (tag). Diverse
molecular biological
detection reactions like primer extension, ligation, and RCA are used for the
detection of the
tag.
In an alternative embodiment of the method according to the present invention,
the detectable
unit is coupled with the targets or probes via an anchor group. Preferably
used anchor groups
are biotin, digoxigenin, and the like. In a subsequent reaction, the anchor
group is converted
by means of specifically binding components, for example streptavidin
conjugates or antibody
CA 3041596 2019-04-29
- 52 -
conjugates, which in turn are detectable or trigger a detectable reaction.
With the use of
anchor groups, the conversion of the anchor groups to detectable units can be
performed
before, during, or after the addition of the sample comprising the targets,
or, optionally,
before, during, or after the cleavage of a selectively cleavable bond in the
probes. Such
selectively cleavable bonds in the probes are, for example, described in the
International
Patent Application WO 03/018838, the relevant contents of which are hereby
explicitly
referred to.
According to the present invention, labeling can also be performed by means of
interaction of
a labeled molecule with the probe molecules. For example, labeling can be
performed by
means of hybridization of an oligonucleotide labeled as described above with
an
oligonucleotide probe or an oligonucleotide target.
Further labeling methods and detection systems suitable within the scope of
the present
invention are described, for example, in Lottspeich and Zorbas, Bioanalytik,
Spektrum
Akademischer Verlag, Heidelberg, Berlin, Germany 1998, chapter 23.3 and 23.4.
In a preferred embodiment of the method according to the present invention,
detection
methods are used, which in result yield an adduct having a particular
solubility product, which
leads to a precipitation. For labeling, in particular substrates or educts are
used, which can be
converted to a hardly soluble, usually stained product. In this labeling
reaction, for example,
enzymes can be used, which catalyze the conversion of a substrate to a hardly
soluble
product. Reactions suitable for leading to a precipitation at the array
elements as well as
possibilities for the detection of the precipitation are, for example,
described in the
International Patent Application WO 00/72018 and in the International Patent
Application
WO 02/02810, whose relevant contents are hereby explicitly referred to.
In a particularly preferred embodiment of the method according to the present
invention, the
bound targets are equipped with a label catalyzing the reaction of a soluble
substrate or educt
to form a hardly soluble precipitation at the array element, where a probe /
target interaction
has occurred or acting as a crystal nucleus for the conversion of a soluble
substrate or educt to
a hardly soluble precipitation at the array element, where a probe / target
interaction has
occurred.
CA 3041596 2019-04-29
- 53 -
In this manner, the use of the method according to the present invention
allows the
simultaneous qualitative and quantitative analysis of a variety of probe /
target interactions,
wherein individual array elements having a size of < 1000 pm, preferably of <
100 pm, and
particularly preferably of < 50 pm can be implemented.
The use of enzymatic labels is known in immunocytochemistry and in
immunological tests
based on microtiter plates (see E. Lidell and I. Weeks, Antibody Technology,
BIOS Scientific
Publishers Limited, 1995). Thus, for example, enzymes catalyze the conversion
of a substrate
to a hardly soluble, usually stained product.
Particularly preferably, the reaction leading to precipitation formation at
the array elements is
a conversion of a soluble substrate or educt to a hardly soluble product,
catalyzed by an
enzyme. In a special embodiment, the reaction leading to precipitation
formation at the array
elements is an oxidation of 3,3',5,5'-tetramethylbenzidine, catalyzed by a
peroxidase.
Preferably, horseradish peroxidase is used for the oxidation of 3,3',5,5'-
tetramethylbenzidine.
However, the person skilled in the art knows further peroxidases, which can be
used for the
oxidation of 3,3',5,5'-tetramethylbenzidine.
It is assumed that 3,3',5,5'-tetramethylbenzidine, under the catalytic impact
of a peroxidase, is
oxidized in a first step to form a blue-stained radical cation (see for
example Gallati and
Pracht, J. Clin. Chem. Clin. Biochem. 1985, 23, 8, 454). This blue-stained
radical cation is
precipitated in the form of a complex by means of a polyanion, like for
example dextran
sulfate. The precipitation reaction by means of peroxidase-catalyzed oxidation
of 3,3',5,5'-
tetramethylbenzidine is, for example, described in EP 0 456 782.
Without claiming to be complete, the following Table 1 offers a survey of
several reactions
possibly suitable for leading to a precipitation at array elements, where an
interaction between
target and probe has occurred:
Table I
CA 3041596 2019-04-29
- 54 -
catalyst or substrate or educt
crystal nucleus
horseradish peroxidase DAB (3,3`-diaminobenzidine)
4-CN (4-chloro-1-naphthol)
AEC (3-amino-9-ethylcarbazole)
HYR (p-phenylenediamine-HCl and
pyrocatechol)
TMB (3,3`,5,5`-tetramethylbenzidine)
naphthol / pyronin
alkaline phosphatase brom-chlor-indolyl-phosphate (BCIP) and
nitroblue tetrazolium (NBT)
glucose oxidase t-NBT and m-PMS
(nitroblue tetrazolium chloride and
phenazine methosulfate
gold particles silver nitrate
silver tartrate
The detection of probe / target interactions via insoluble precipitates is, in
particular,
described in WO 02/02810.
In the following, embodiments of the present invention are described, which
can serve for
overcoming problems usually likely to arise in the detection of molecular
interactions on solid
supports, like for example for preventing the possible formation of Newton's
rings between
detection plane and probe array.
The manifestation of Newton's rings is essentially determined by the type of
illumination, the
wavelength of the light used for detection, the distance between detection
plane and probe
array, and the refraction index of the solution located in the chamber. Such
Newton's rings
can, for example, be prevented by means of altering the wavelength of the
light used for
detection, using a solution having the same or a similar refraction index as
the detection plane
and / or the probe array, and / or using an immersion liquid between detection
plane and probe
array.
CA 3041596 2019-04-29
- 55 -
Furthermore, Newton's rings can be prevented by means of applying spacers on
the chip
and / or on the side of the detection plane facing the chip.
Furthermore, Newton's rings can be prevented by means of applying the probe
arrays onto a
rough support surface.
Furthermore, Newton's rings can be prevented by means of applying the probe
arrays onto a
light-absorbing surface.
It is a further possibility to permanently vary the contact pressure, by means
of which the chip
is guided relatively to the detection surface. Thus, the thickness of the gap
between chip and
detection surface, and therefore also the position of Newton's rings, is
altered. By means of
integrating the fluorescence signal to be detected over time, a distortion of
the measured
values of the spots in relation to each other is prevented in this manner.
It is a further particularly preferably possibility of preventing Newton's
rings to use several
light sources from different directions for illuminating and therefore
agitating the
fluorophores of the bound targets.
Background fluorescence, which has been caused by fluorophores of unbound
targets in the
displaced liquid, can lead to distortion of the signal detected. This can
preferably be prevented
by means of using a shade, which is, for example, mounted on the detection
surface or the
chip and / or around the chip or in the imaging optics, and is developed in
such a way that
only the surface of the probe array is illuminated or imaged.
With the use of corresponding light sources, like for example lasers, there
can arise
inhomogeneities in illumination due to coherence of the light. Such
inhomogeneities can be
reduced or prevented by means of using waveguides and / or combining filters
and / or light
of different wavelengths. Likewise, movement of the light source in order to
eliminate such
effects is also conceivable.
By means of using an organic or inorganic light-absorbing layer, which is non-
fluorescent in
the selected range of wavelengths, on the support of the probe array,
fluorescence background
CA 3041596 2019-04-29
- 56 -
signal, which is caused by the probe support and / or elements located behind
the latter, can
be reduced or prevented. Preferably, a black chromium layer is employed as
protective layer.
In all of the above-described embodiments of the method according to the
present invention, a
pre-amplification of the material to be analyzed is not required. From the
sample material
extracted from bacteria, blood, or other cells, specific partitions can be
amplified and
hybridized to the support with the aid of a PCR (polymerase chain reaction),
in particular in
the presence of the device according to the present invention or the substance
library support,
as is described in DE 102 53 966. This signifies a substantial reduction of
labor effort.
Thus, the method according to the present invention is particularly suitable
for parallel
performance of amplification of the target molecules to be analyzed by means
of PCR and the
detection by means of hybridization of the target molecules with the substance
library
support. Herein, the nucleic acid to be detected is first amplified by means
of a PCR, wherein
preferably at least one competitor inhibiting the formation of one of the two
template strands
amplified by means of the PCR is added to the reaction in the beginning. In
particular, a DNA
molecule, which competes against one of the primers used for the PCR
amplification of the
template for binding to the template and which can not be extended
enzymatically, is added to
the PCR. The single-stranded nucleic acid molecules amplified by means of the
PCR are then
detected by means of hybridization with a complementary probe. Alternatively,
the nucleic
acid to be detected is first amplified in single strand surplus by means of a
PCR and is
detected by means of a subsequent hybridization with a complementary probe,
wherein a
competitor, which is a DNA molecule or a molecule of a nucleic acid analog
capable of
hybridizing to one of the two strands of the template but not to the region
detected by means
of probe hybridization and which cannot be enzymatically extended, is added to
the PCR
reaction at the beginning.
Every molecule causing a preferred amplification of only one of the two
template strands
present in the PCR reaction can be used as competitor in the PCR. Thus,
according to the
present invention, competitors can be proteins, peptides, DNA ligands,
intercalators, nucleic
acids or analogs thereof. Proteins or peptides, which are capable of binding
single-stranded
nucleic acids with sequence specificity and which have the above-defined
properties, are
CA 3041596 2019-04-29
- 57 -
preferably used as competitors. Particularly preferably, nucleic acid
molecules and nucleic
acid analog molecules are used as secondary structure breakers.
The formation of one of the two template strands is substantially inhibited by
initial addition
of the competitor to the PCR during the amplification. "Substantially
inhibited" means that
within the scope of the PCR a single strand surplus and an amount of the other
template
strand is produced, which is sufficient to allow an efficient detection of the
amplified strand
by means of hybridization. Therefore, the amplification does not follow
exponential kinetics
of the form 2n (with n = number of cycles), but rather attenuated
amplification kinetics of the
form <2n.
The single strand surplus obtained by means of the PCR in relation to the non-
amplified
strand has the factor 1.1 to 1,000, preferably the factor 1.1 to 300, also
preferably the factor
1.1 to 100, particularly preferably the factor 1.5 to 100, also particularly
preferably the factor
1.5 to 50, in particular preferably the factor 1.5 to 20, and most preferably
the factor 1.5 to 10.
Typically, the function of a competitor will be to bind selectively to one of
the two template
strands and therefore to inhibit the amplification of the corresponding
complementary strand.
Therefore, competitors can be single-stranded DNA- or RNA-binding proteins
having
specificity for one of the two template strands to be amplified in a PCR. They
can also be
aptamers sequence-specifically binding only to specific regions of one of the
two template
strands to be amplified.
Nucleic acids or nucleic acid analogs are preferably used as competitors.
Conventionally, the
nucleic acids or nucleic acid analogs will act as competitors of the PCR by
either competing
against one of the primers used for the PCR for the primer binding site or by
being capable of
hybridizing with a region of a template strand to be detected due to a
sequence
complementarity. This region is not the sequence detected by the probe. Such
nucleic acid
competitors are enzymatically not extendable.
The nucleic acid analogs can, for example, be so-called peptide nucleic acids
(PNA).
However, nucleic acid analogs can also be nucleic acid molecules, in which the
nucleotides
are linked to one another via a phosphothioate bond instead of a phosphate
bond. They can
CA 3041596 2019-04-29
- 58 -
also be nucleic acid analogs, wherein the naturally occurring sugar components
ribose or
deoxyribose have been replaced with alternative sugars, like for example
arabinose or
trehalose or the like. Furthermore, the nucleic acid derivative can be "locked
nucleic acid"
(LNA). Further conventional nucleic acid analogs are known to the person
skilled in the art.
DNA or RNA molecules, in particular preferably DNA or RNA oligonucleotides or
their
analogs, are preferably used as competitors.
Depending on the sequence of the nucleic acid molecules or nucleic acid
analogs used as
competitors, the inhibition of the amplification of one of the two template
strands within the
scope of the PCR reaction is based on different mechanisms. By way of the
example of a
DNA molecule, this is discussed in the following.
If, for example, a DNA molecule is used as competitor, it can have a sequence,
which is at
least partially identical to the sequence of one of the primers used for the
PCR in such a way
that a specific hybridization of the DNA competitor molecule with the
corresponding template
strand is possible under stringent conditions. As, according to the present
invention, the DNA
molecule used for competition in this case is not extendable by means of a DNA
polymerase,
the DNA molecule competes for binding to the template against the respective
primer during
the PCR reaction. According to the ratio of the DNA competitor molecule and
the primer, the
amplification of the template strand defined by the primer can thus be
inhibited in such a way
that the production of this template strand is significantly reduced. Herein,
the PCR proceeds
according to exponential kinetics higher than would be expected with the
amounts of
competitors used. In this manner, a single strand surplus emerges in an
amount, which is
sufficient for the efficient detection of the amplified target molecules by
means of
hybridization.
In this embodiment, the nucleic acid molecules or nucleic acid analogs used
for competition
must not be enzymatically extendable. "Enzymatically not extendable" means
that the DNA
or RNA polymerase used for the amplification cannot use the nucleic acid
competitor as
primer, i.e. it is not capable of synthesizing the corresponding opposite
strand of the template
3' from the sequence defined by the competitor.
CA 3041596 2019-04-29
- 59 -
Alternatively to the above-depicted possibility, the DNA competitor molecule
can also have a
sequence complementary to a region of the template strand to be detected,
which is not
addressed by one of the primer sequences and which is enzymatically not
extendable. Within
the scope of the PCR, the DNA competitor molecule will then hybridize to this
template
strand and correspondingly block the amplification of this strand.
The person skilled in the art knows that the sequences of DNA competitor
molecules or, in
general, nucleic acid competitor molecules can be selected correspondingly. If
the nucleic
acid competitor molecules have a sequence, which is not substantially
identical to the
sequence of one of the primers used for the PCR, but is complementary to
another region of
the template strand to be detected, this sequence is to be selected in such a
way that it does not
fall within the region of the template sequence, which is detected with a
probe within the
scope of the hybridization. This is necessary because there does not have to
occur a
processing reaction between the PCR and the hybridization reaction. If a
nucleic acid
molecule, which falls within the region to be detected, were used as
competitor, it would
compete for binding to the probe against the single-stranded target molecule.
Such competitors preferably hybridize near the template sequence detected by
the probe.
Herein, according to the present invention, the position specification "near"
is to be
understood in the same way as given for secondary structure breakers. However,
the
competitors according to the present invention can also hybridize in the
immediate proximity
of the sequence to be detected, i.e. at exactly one nucleotide's distance from
the target
sequence to be detected.
If enzymatically not extendable nucleic acids or nucleic acid analogs are used
as competing
molecules, they are to be selected with respect to their sequence and
structure in such a way
that they cannot be enzymatically extended by DNA or RNA polymerases.
Preferably, the 3'-
end of a nucleic acid competitor is designed in such a way that it has no
complementarity to
the template and / or has at its 3'-end a substituent other than the 3-0H
group.
If the 3' end of the nucleic acid competitor has no complementarity to the
template, regardless
of whether the nucleic acid competitor binds to one of the primer binding
sites of the template
or to one of the sequences of the template to be amplified by means of the
PCR, the nucleic
CA 3041596 2019-04-29
- 60 -
acid competitor cannot be extended by the conventional DNA polymerases due to
the lack of
base complementarity at its 3'-end. This type of non-extensibility of nucleic
acid competitors
by DNA polymerases is known to the person skilled in the art. Preferably, the
nucleic acid
competitor has no complementarity to its target sequence at its 3'-end with
respect to the last
4 bases, particularly preferably to the last 3 bases, in particular preferably
to the last 2 bases,
and most preferably to the last base. In the mentioned positions, such
competitors can also
have non-natural bases, which do not allow hybridization.
Nucleic acid competitors, which are enzymatically not extendable, can also
have a 100%
complementarity to their target sequence, if they are modified in their
backbone or at their 3'-
end in such a way that they are enzymatically not extendable.
If the nucleic acid competitor has at its 3'-end a group other than the OH
group, these
substituents are preferably a phosphate group, a hydrogen atom
(dideoxynucleotide), a biotin
group, or an amino group. These groups cannot be extended by the conventional
polymerases.
The use of a DNA molecule, which competes for binding to the template against
one of the
two primers used for the PCR and which was equipped with an amino link at its
3'-end during
chemical synthesis, as a competitor in such a method is particularly
preferred. Such
competitors can have 100 % complementary tot heir target sequence.
However, nucleic acid analog competitors, like for example PNAs do not have to
have a
blocked 3'-OH group or a non-complementary base at their 3'-end as they are
not recognized
by the DNA polymerases because of the backbone modified by the peptide bond
and thus are
not extended. Other corresponding modifications of the phosphate group, which
are not
recognized by the DNA polymerases, are known to the person skilled in the art.
Among those
are, inter alia, nucleic acids having backbone modifications, like for example
2`-5` amide
bonds (Chan et al. (1999) J. Chem. Soc., Perkin Trans. 1, 315-320), sulfide
bonds (Kawai et
al. (1993) Nucleic Acids Res., 1 (6), 1473-1479), LNA (Sorensen et al. (2002)
J. Am. Chem.
Soc., 124 (10), 2164-2176) and TNA (Schoning et al. (2000) Science, 290
(5495), 1347-
1351).
CA 3041596 2019-04-29
- 61 -
Several competitors hybridizing to different regions of the template (for
example, inter alia,
the primer binding site) can also simultaneously be used in a PCR. The
efficiency of the
hybridization can additionally be increased, if the competitors have
properties of secondary
structure breakers.
In an alternative embodiment, the DNA competitor molecule can also have a
sequence
complementary to one of the primers. Depending on the ratio of antisense DNA
competitor
molecule and primer, such, for example, antisense DNA competitor molecules can
then be
used to titrate the primer in the PCR reaction, so that it will no longer
hybridize with the
corresponding template strand and, correspondingly, only the template strand
defined by the
other primer is amplified. The person skilled in the art is aware of the fact
that, in this
embodiment of the invention, the nucleic acid competitor can, but does not
have to, be
enzymatically extendable.
If, within the scope of the present invention, it is talked about nucleic acid
competitors, this
includes nucleic acid analog competitors, unless a different meaning arises
from the
respective context. The nucleic acid competitor can bind to the corresponding
strand of the
template reversibly or irreversibly. The bond can take place via covalent or
non-covalent
interactions.
Preferably, binding of the nucleic acid competitor takes place via non-
covalent interactions
and is reversible. In particular preferably, binding to the template takes
place via formation of
Watson-Crick base pairings.
The sequences of the nucleic acid competitors normally adapt to the sequence
of the template
strand to be detected. In the case of antisense primers, though, they adapt to
the primer
sequences to be titrated, which are in turn defined by the template sequences,
however.
PCR amplification of nucleic acids is a standard laboratory method, the
various possibilities
of variation and development of which are familiar to the person skilled in
the art. In
principle, a PCR is characterized in that the double-stranded nucleic acid
template, usually a
double-stranded DNA molecule, is first subjected to heat denaturation for 5
minutes at 95 C,
whereby the two strands are separated from each other. After cooling down to
the so-called
CA 3041596 2019-04-29
- 62 -
"annealing" temperature (defined by the primer with the lower melting
temperature), the
forward and reverse primers present in the reaction solution accumulate at
those sites in the
respective template strands, which are complementary to their own sequence.
Herein, the
"annealing" temperature of the primers adapts to the length and base
composition of the
primers. It can be calculated on the basis of theoretical considerations.
Information on the
calculation of "annealing" temperatures can be found, for example, in Sambrook
et al. (vide
supra).
Annealing of the primers, which is typically performed in a range of
temperatures between 40
to 75 C, preferably between 45 to 72 C and in particular preferably between 50
to 72 C, is
followed by an elongation step, wherein deoxyribonucleotides are linked with
the 3'-end of
the primers by the activity of the DNA polymerase present in the reaction
solution. Herein,
the identity of the inserted dNTPs depends on the sequence of the template
strand hybridized
with the primer. As normally thermostable DNA polymerases are used, the
elongation step
usually runs at between 68 to 72 C.
In a symmetrical PCR, an exponential amplification of the nucleic acid region
of the target
defined by the primer sequences is achieved by means of repeating the
described cycle of
denaturation, annealing and elongation of the primers. With respect to the
buffer conditions of
the PCR, the usable DNA polymerases, the production of double-stranded DNA
templates,
the design of primers, the selection of the annealing temperature, and
variations of the classic
PCR, the person skilled in the art has numerous works of literature at his
disposal.
The person skilled in the art is familiar with the fact that also, for
example, single-stranded
RNA, like for example mRNA, can be used as template. Usually, it is previously
transcribed
into a double-stranded cDNA by means of a reverse transcription.
In a preferred embodiment, a thermostable DNA-dependent polymerase is used as
polymerase. In a particularly preferred embodiment, a thermostable DNA-
dependent DNA
polymerase is used, which is selected from the group consisting of Taq-DNA
polymerase
(Eppendorf, Hamburg, Germany and Qiagen, Hilden, Germany), Pfu-DNA polymerase
(Stratagene, La Jolla, USA), Tth-DNA polymerase (Biozym Epicenter Technol.,
Madison,
CA 3041596 2019-04-29
- 63 -
USA), Vent-DNA polymerase, Deep Vent-DNA polymerase (New England Biolabs,
Beverly,
USA), Expand-DNA polymerase (Roche, Mannheim, Germany).
The use of polymerases, which have been optimized from naturally occurring
polymerases by
means of specific or evolutive alteration, is also preferred. When performing
the PCR in the
presence of the substance library support, the use of the Taq-polymerase by
Eppendorf
(Germany) and of the Advantage cDNA Polymerase Mix by Clontech (Palo Alto, CA,
USA)
is in particular preferred.
A further aspect of the present invention relates to the use of the device
according to the
present invention for performing microarray-based tests.
In the following, special embodiments of the device according to the present
invention or the
method according to the present invention are depicted.
In Figure 5 it is shown that the first surface, an elastic membrane herein, in
which preferably a
heating device is integrated, is deformed by means of a pin or a tappet and
the chip is thereby
pushed toward the detection plane. Furthermore, the detection plane is pushed
into the
reaction chamber by means of a spacer on the second surface and thus
approaches the DNA
chip from above until the liquid between DNA chip and detection plane is
almost entirely
dislocated. The elastic seals sealing the reaction chamber are compressed by
means of guiding
the detection surface toward the chip. The dislocated fluid deforms the seal
in such a way that
the air is compressed in air compensation chambers.
However, the process unit can also be developed in such a way that either only
the first
surface, for example in the form of an elastic membrane, is deformed or only
the detection
plane is pushed into the chamber.
In Figure 6, a further technical embodiment for compressing the process unit
is depicted. The
reaction chamber is enclosed by a sealing membrane, whereon a DNA chip is
fixed, laterally
and at the side opposite the detection plane. At the level of the DNA chip,
the sealing
membrane seals a hole in the lower side of the chamber body. The hole is
slightly smaller
than the DNA chip. When conducting a PCR in the reaction chamber, the hole is
tightly
CA 3041596 2019-04-29
- 64 -
sealed by the internal pressure forming due to the raised temperatures
connected with the
PCR. Therefore, despite the labile sealing membrane, the chamber is pressure-
proof (principle
of the self-closing valve). For detection, a pin or a tappet is pushed through
the lower side
hole. The sealing membrane is lifted and the DNA chip is pressed against the
detection plane.
In order to ensure the required elasticity of the sealing membrane, the
membrane can be
provided with a compensation fold. In this embodiment, the pressure
compensation chambers
are also compressed by the dislocated liquid.
The following examples serve the purpose of illustrating the invention and are
not to be
interpreted restrictively.
Examples
Example 1: Structure of a reaction cartridge having integrated heating
In Figures 8 and 9, an embodiment of a processing unit without integrated
heating and a
device for guiding the DNA chip toward the detection plane are depicted. The
DNA chip in
the device shown can be read out by means of a conventional fluorescence
microscope (for
example Axioskop, Zeiss, Jena, Germany).
Example 2: Structure of a reaction cartridge having a silicon heating
substrate
The variant of the processing unit of the device according to the present
invention, which is
shown in Figures 10 and 11, is a miniaturized reaction cartridge having an
integrated probe
array (DNA chip), a silicon heating substrate having an integrated temperature
sensor
("heating substrate") for adjusting distinctive temperatures in the reaction
chamber as well as
a circuit board optionally having an EPROM for electrically contacting the
heating substrate.
The individual components are embedded in two shells made of synthetic
material. The entire
unit is a spatially closed system, in which all required reactions (for
example PCR) can be
conducted in a temperature-controlled manner.
CA 3041596 2019-04-29
- 65 -
First, the circuit board is inserted into the provided shaft in the lower
shell (with the EPROM
facing downward). On the upper side of the circuit board, three electric
contact pads are
arranged, which ensure the electric connection with the subsequently inserted
heating
substrate, which in turn bears the contact pads. Said heating substrate has a
size of
8 mm x 6 mm and a thickness of about 0.6 mm. The heating substrate ensures
exact
adjustment of different temperatures (for example of 40 C to 95 C) within the
scope of the
examination conducted. Herein, measuring the temperature in the reaction
chamber can be
conducted either via the sensor integrated in the heating substrate or via an
external measuring
unit, which measures the temperature directly on the surface of the heating
substrate. In the
latter case, the integrated sensor in the heating substrate can be omitted.
The integrated
components used for heating and / or temperature measurement can, for example,
be diodes or
also transistors. The surface of the silicon heating substrate, which is
facing toward the
reaction space, contains no electric systems whatsoever and is coated with an
SiO2 passivating
layer.
The next component is an elastic seal, which laterally limits the reaction
space.
In the center of the reaction space, the DNA chip is attached in such a way
that the probe
array is facing toward the detection plane. After inserting the detection
plane in the form of a
glass surface, said surface still protrudes from the lower shell by 0.2 mm. By
subsequently
joining the upper shell, which is guided by means of locating pins, the glass
surface is pressed
against the seal and thus ensures optimal sealing of the reaction chamber.
Subsequently, the reaction chamber can be filled with reaction solution.
Herein, it is to be
noted that only the inner space containing the chip is filled, but not the
outer chambers. The
liquids required are injected into the reaction space with cannulas via the
provided cannula
guide.
Subsequently, biochemical reactions controlled via the silicon heating
substrate, like for
example PCR and / or hybridization, can be conducted in the reaction chamber.
For detecting the intermediate results or the final result, the detection
plane is pressed against
the DNA chip from above by means of the spacers of the detection unit, until
the distance
CA 3041596 2019-04-29
- 66 -
between detection plane and probe array is about zero. Herein, the surrounding
liquid is
dislocated into the outer chambers, where it compresses the local air. This
process is
reversible and can, for example, be conducted after each PCR cycle.
Due to its compact design and the internal circuit board having an EPROM and
the integrated
heating substrate, this variant of the device according to the present
invention is particularly
suitable for mobile use.
Example 3: Detection of the decrease of the background signal by dislocating
the analyte
All fluorescence measurements described in this Example were conducted by
means of a
fluorescence microscope (Zeiss, Jena, Germany). Excitation was conducted in
incident light
using a white light source and a filter set suitable for Cyanine 3. The
signals were recorded by
means of a CCD camera (PCO-Sensicam, Kehlheim, Germany). In the following, the
thickness of the gap denotes the distance between microarray and detection
plane.
a) Measuring the fluorescence signal of the analyte depending on the
thickness of the gap
Channel shells having defined channel depth (5 pm, 10 m, 28 pm) were cast of
Sylgard. The
channels had a width of 125 m. A glass chip was laid across the unequally
deep channels.
The channels were then filled with a 200 nM solution of a Cy3-labeled
oligonucleotide in
2 x SSC + 0.2 % SDS and the signal was measured with an exposure time of 1.5
s.
In Figure 12, the measured results are depicted. The signal increases linearly
as channel depth
rises. A straight regression line could be calculated (Equation 1)
(Equation 1) F(x) = 6.2468x + 50.016
With the aid of the regression equation obtained (Equation 1), the layer
thicknesses between
DNA chip and detection plane can now be determined by means of the background
fluorescence signal.
CA 3041596 2019-04-29
- 67 -
This was checked by means of stacking two glass surfaces (chips) having
structured marks on
their upper sides (crosses, numbers, and data matrix in Figure 14), which
could be focused.
The chips were stacked in such a way that the structured marks were oriented
toward each
other and were only separated by a thin liquid layer. A 200 nM solution of a
Cy3-labeled
oligonucleotide in 2 x SSC + 0.2 % SDS was used as liquid. With the aid of a
focusing device
of the microscope, which was equipped with a scale, the distance between the
marks and
therefore the layer thickness of the liquid film could be determined directly.
The intensity of
the background is 158 gray values with an exposure time of 0.75 s. The
thickness of the gap
measured at the fluorescence microscope is 40 tim. Assuming that the measured
gray values
behave linearly in relation to exposure time (see Figure 13), the resulting
thickness of the gap,
using Equation 1, is 42.6 m. The values for the thickness of the liquid layer
thus obtained are
well matched.
b) Experiments for reducing or eliminating the background fluorescence by
means of
compressing the process unit
In said experiments, the hybridization signal was measured depending on the
displacement of
the fluorescent analyte by means of pressure exerted by a tappet. The
experimental setup is
sketched in Figure 15. By means of pushing the tappet, the silicon chip (3.15
x 3.15 mm) was
pressed against a probe chip (DNA chip) and in this process the liquid located
between the
two surfaces was dislocated.
For conducting the experiment, the chamber was filled with a hybridization
solution, which is
a model system for the conditions in a PCR hybridization. The hybridization
solution
contained a Cy3-labeled oligonucleotide (final concentration 2 nM in 2 x SSC +
0.2 % SDS),
which had complementarity to the probe array. In addition, the hybridization
solution
contained a likewise Cy3-labeled oligonucleotide, which does not hybridize
with the probe
array and therefore only contributes to the fluorescence background signal in
the solution, but
not the specific signals at the spots.
Hybridization was conducted for 10 mm. For subsequently reading out the
hybridization
signals, a fixed exposure time of 1.5 s was selected. At the experimental
setup, the tappet was
CA 3041596 2019-04-29
- 68 -
pushed nearer toward the probe array (detection plane) after each recording,
so that the gap
between array and second surface, which is filled with hybridization solution,
was reduced.
Figure 16 shows a recording of the hybridization signal with a thickness of
the gap of 101.1M.
The measured results for background signal and hybridization signal at the
spots are depicted
in Figure 17. According to expectations, both signals behave linearly in
relation to the
thickness of the gap. Thus, the spot signal corrected by the background does
not change with
the thickness of the gap.
When a gray value of 255 is reached, the measuring instrument is overloaded.
I.e., with a
thickness of the gap of about 17 m, measuring the spot intensity is only
possible by means of
reducing exposure time. Therefore, measuring sensitivity is then reduced.
Thus, the dynamic measuring range is increased by reducing the thickness of
the gap. By
means of background adjustment of the spot signals (difference formation), the
thickness of
the gap can be varied in a broad range without influencing measurement and
measured
results. With very large thicknesses of the gap (>20 m), measurement is
strongly impaired
due to overload of the detector.
c) Amplification, hybridization and detection as one-stage reaction
Two process units having a structure according to Figure 15 were mounted and
numbered.
Two identical reaction setups having the following composition were prepared:
Reaction setup:
20 mM dNTPs .................................................... 0.5 I
1 M potassium acetate (Kaac) ................................... 3 1
25 mM Mg-acetate Eppendorf ..................................... 5 1
Clontech C-DNA PCR buffer ...................................... 5 I
Eppendorf Taq-polymerase ....................................... 3 I
M primer CMV_DP_Cy3 ........................................ 1 p.!
CA 3041596 2019-04-29
- 69 -
Cy3_5`TGAGGCTGGGAARCTGACA3`
M Primer CMV_UP_NH2 ........................................ 0.66 pl
5`GGGYGAGGAYAACGAAATC3` NH2
10 M primer CMV_UP ............................................ 0.33 1.11
5`GGGYGAGGAYAACGAAATC3`
10 IA primer Entero_DP_Cy3 .................................... 1 I
Cy3_5`CCCTGAATGCGGCTAAT3`
10 M primer Entero_UP_NH2 ..................................... 0.66 I
5`ATTGTCACCATAAGCAGCC3` NH2
10 M primer Entero_UP .................................... 0.33
5`ATTGTCACCATAAGCAGCC3` .......................................
10 !AM primer HSV l_DP_Cy3 ..................................... 1 1
Cy3_5`CTCGTAAAATGGCCCCTCC3`
10 M primer HSVl_UP_NH2 ....................................... 0.66 pl
5`CGGCCGTGTGACACTATCG3` NH2 ...................................
10 M primer HSVl_UP ........................................... 0.33 I
5`CGGCCGTGTGACACTATCG ..........................................
10 !AM primer HSV2_UP_Cy3 ...................................... 1 I
Cy3_5`CGCTCTCGTAAATGCTTCCCT3` ..................................
10 M primer HSV2_DP_NH2 ....................................... 0.66 I
5`TCTACCCACAACAGACCCACG3LNH2
10 M primer HSV2_DP ........................................... 0.33 pl
5`TCTACCCACAACAGACCCACG3`
10 M primer VZV_DP_Cy3 ........................................ 1 pl
Cy3_5`TCGCGTGCTGCGGC
10 M primer VZV_UP_NH2 ........................................ 0.66 I
5`CGGCATGGCCCGTCTAT3INH2
10 M primer VZV_UP ............................................ 0.33 I
5`CGGCATGGCCCGTCTAT
Template CMV ................................................... 1 I
PCR grade water ................................................ 22.5 p1
total .......................................................... 50 pi
CA 3041596 2019-04-29
- 70 -
The process units were each filled with 50 I reaction setup and processed
according to the
following temperature-time regime.
1 Denaturation ................................................. 95 C
Duration ....................................................... 300 s
2 Denaturation ................................................. 95 C
Duration ....................................................... 10 s
3 Annealing / Extension ........................................ 60 C
Duration ....................................................... 20 s
Repeating steps 2 to 3 ......................................... 35 times
4 Denaturation ................................................. 95 C
Duration ....................................................... 300 s
Hybridization ................................................ 40 C
Duration ....................................................... 3600 s
Subsequently, the two process units were subjected to different treatments. In
the first case
(process unit 1), the background fluorescence was reduced by means of
displacing the
analyte. This was ensured by means of pushing the tappet upward in the
direction of the
detection plane, so that the gap filled with reaction solution is reduced as
far as possible.
In the second case (process unit 2), the analyte was replaced by a non-
fluorescent solution.
The replacement of the solution was conducted with 2 x SSC buffer at a
fluctuation rate of
300 I / min and a rinsing volume of 900 1. This procedure corresponds to the
state of the
art.
Subsequently, both strategies for reducing background fluorescence were
compared. To this
end, the hybridization signals in both process units were detected with the
aid of the
fluorescence microscope camera setup described.
CA 3041596 2019-04-29
-71 -
Exposure time was 5 s (see Figure 18 and Figure 19). Comparing the spot
intensities was
conducted using the spot with the substance CMV_S_21-3
(5' -NH2TGTTGGGCAACCACCGCACTG-31). The location of the probes is indicated in
Figures 18 and 19.
In Figure 20, the result of the experiment is summarized. By means of rinsing
the reaction
chamber in the process unit 2, the hybridization signal is reduced compared to
the
displacement in process unit 1. It is assumed that bleeding of the probes is
responsible for
this.
Thus, the method of analyte displacement according to the method of the
present invention is
to be preferred to replacement of the solutions.
In order to obtain detection of amount and integrity of the amplification
product, 5 41 of each
reaction solution were additionally analyzed on a 2% agarose gel. The result
(ethidium
bromide-stained gel detected with an UV transilluminator) can be seen in
Figure 21.
Example 4: Device for processing and detecting reaction cartridges according
to the present
invention
A device for processing and detecting reaction cartridges according to the
present invention in
accordance with this Example is shown in Figure 28.
The device for conducting microarray-based tests with reaction cartridges
according to the
present invention usually consists of several components, which can be united
in one device
or can be assembled modularly from several partial devices. Herein, the device
can optionally
be activated via an integrated computer or via an interface with an external
computer. The
structure of the device is illustrated in Figure 28.
An exemplary procedure occurs as follows:
The fluid interface of the reaction cartridge is manually brought in the
filling position,
wherein the cannulas pierce the seal of the chamber body, by the operator.
Subsequently, the
CA 3041596 2019-04-29
- 72 -
operator feeds the reaction mixture into the reaction chamber by means of a
standard
laboratory pipette. Both steps can also be taken over by a correspondingly
developed device.
The fluid interface is then again brought in the initial position, wherein
said procedure can
also be conducted by a correspondingly developed device.
The reaction cartridge is then inserted into the device. A data matrix reader,
which is arranged
in the device, recognizes the biunique data matrix attached to the reaction
cartridge and, by
way of a data record transmitted by the user, loads the data characteristic
for the cartridge and
for the test to be conducted into the control computer. Said computer then
controls the
individual process steps, which can, for example, comprise an amplification
and
hybridization. Via the integrated pressure mechanism, the capillary gap in the
reaction
chamber is subsequently reduced for detection according to the present
invention.
Detection can be conducted with conventional fluorescence-optical imaging or
non-imaging
systems. The data obtained are subsequently transmitted to a control computer,
which
evaluates them and presents or stores them on an internal or external
interface.
The reaction cartridge can then be taken from the device and be discarded by
the operator.
Example 5: Reaction cartridge made of electrically conductive synthetic
material
A reaction cartridge as depicted in Figure 29 is prepared.
The lower shell (1) of the reaction cartridge consists of electrically
conductive synthetic
material forming the base of the reaction chamber (Conduct 2, RKT, Germany). A
foil PT-
100 temperature sensor is fixed to the lower side of the chamber base with the
aid of a
suitable adhesive, for example Loctite 401 (Loctite, Germany). Together with
the seal (3) and
the covering glass (4), the lower shell forms the reaction chamber of the
cartridge according
to the present invention.
CA 3041596 2019-04-29
- 73 -
The cartridge further has a threaded drill hole (2) for inserting screws for
electric contacting,
an upper shell (5) of the reaction cartridge, for example made of acryl, a
drill hole (6) for
attaching the upper shell, and a detection window (7) in the upper shell.
A standard PCR reaction mixture is prepared:
30.5 1 de-ionized water
I 10 x PCR buffer (for example 10 x cDNA PCR reaction buffer, Clontech,
Germany)
5 I Mg-acetate, 25 mM (for example Eppendorf, Germany)
0.5 il dNTP, 20 mM each
1 I 16sfD1 (5'-AGAGTTTGATCCTGGCTCAG-3'), 10 mM
1 116sRa (5'-TACCGTCACCATAAGGCTTCGTCCCTA-3'), 10 mM
3 I Taq DNA polymerase (for example Genaxxon, Germany)
I I template
By means of an insulin syringe (Becton Dickinson, Germany), the reaction
chamber is filled
with the reaction mixture. For ventilation during the filling procedure, a
second cannula is
pierced through the seal of the chamber body. After filling, ventilation
cannula and insulin
syringe are expertly discarded.
The chamber is then connected to a regulating unit (CLONDIAG chip technologies
GmbH,
Germany) via the two screws provided for this purpose. Likewise, the
temperature sensor is
connected to said regulating unit at the lower side of the lower shell. Said
regulating unit is
capable of regulating specific temperatures in the lower shell according to a
predefined
program.
In this manner, the following PCR program is conducted: 5 min 95 C, 30 x (30 s
95 C, 30 s
62 C, 50 s 72 C).
Figure 30 shows an image of the reaction cartridge recorded with a thermal
imaging camera at
a temperature of 95 C.
CA 3041596 2019-04-29
- 74 -
After completion of the program, the reaction product is removed from the
reaction chamber
by means of an insulin syringe. Analogously, a cannula is pierced through the
seal of the
chamber body for ventilation during the emptying of the reaction chamber.
The reaction product is now analyzed by means of agarose gel electrophoresis.
To this end,
p.1 of the reaction solution, together with a suitable buffer (for example 5
pl 250 mM in 50%
glycerin, bromphenol blue), are applied in the pocket of a 2% agarose gel and
electrophoresis
is conducted. The result is depicted in Figure 31.
As can clearly be seen, an amplification product of correct size and in an
amount comparable
to the positive control could be obtained in all cases.
CA 3041596 2019-04-29
- 75 -
Figures
Figure 1:
Survey of the device according to the present invention comprising a read out
device and the
process unit
Figure 2:
View of the process unit according to the present invention.
Figure 3:
Exploded view of the process unit according to the present invention,
comprising the
detection plane, seal, DNA chip, and chamber body. The chamber body has a
reversibly
deformable elastic membrane.
Figure 4:
View of the chamber body having a heating meander surrounded by injection-
molded
synthetic material in the elastic membrane.
Figure 5:
View of the state of the process unit according to the present invention in
the read out device
A) during the PCR, B) before the detection, and C) during the detection.
Figure 6:
View of the mode of function of the process unit according to the present
invention having
membrane seal, compensation fold, and lower side hole. In A), the process unit
can be seen in
normal position. In B), the process unit can be seen in compressed form,
wherein the
fluorescent solution between DNA chip and detection plane is displaced.
Figure 7:
View of a rotary disc, whereon four temperature blocks are installed. The
temperature blocks
are thermostaticized to one temperature each. By means of rotating the disc
and / or the
process unit, the temperature in the reaction chamber can be altered.
CA 3041596 2019-04-29
- 76 -
Figure 8:
View of an example of a milled and bolted process unit.
Figure 9:
View of an example of a compressing or crimping device for the process unit
according to the
present invention for detecting the hybridization signals in a conventional
fluorescence
microscope.
Figure 10:
View of a process unit according to the present invention having a circuit
board as electric
connection for heater and temperature sensor. The heater is developed as semi-
conductor
component.
Figure 11:
Exploded view of the process unit shown in Figure 10.
Figure 12:
View of the straight regression line for determining the width of a gap filled
with fluorophore.
Figure 13:
View of the linear progress of the fluorescence signal as exposure time
increases over the
measured region.
Figure 14:
Fluorescence recording of two superimposed chips, the gap between which is
filled with
200 nM Cy3 fluorophore. The intensity of the background is 158 gray values at
an exposure
time of 0.75 s. The thickness of the gap measured at the fluorescence
microscope is 40.00 tn.
Assuming that the measured gray values behave linearly in relation to exposure
time (see
Figure 13), the resulting thickness of the gap, using Equation 1, is 42.6 tm.
The values for the
thickness of the layer thus obtained are well matched..
Figure 15:
View of the experimental setup for detecting DNA arrays without rinsing.
CA 3041596 2019-04-29
- 77 -
Figure 16:
Fluorescence recording of an array with chip pressed against it. By the white
edges, the
background radiation of the displaced sample solution can be seen.
Figure 17:
Decrease of absolute intensities of signal and background when the thickness
of the gap is
reduced. The difference of both values is constant throughout the measured
region.
Figure 18.
Detection of the probe signals by means of displacing the background
fluorescence. At the
left edge, the non-displaced liquid can be seen.
Figure 19:
Detection of the probe signals of a DNA array, which was background-adjusted
by means of
rinsing.
Figure 20:
Summary of the measured results for experimental comparison of displacement
and
replacement of the analyte.
Figure 21:
Reference analytics of the PCR in a process unit by means of gel
electrophoresis.
Figure 22:
Diagrammatic view of a detachable filling unit for filling reaction cartridges
with reactive
substances or buffers. Herefor, the following reference numbers are used:
1 Filling unit
1.1 Mechanical interface filling unit - cartridge
2 Cartridge
2.1 Mechanical interface cartridge ¨ filling unit
2.2 Seal
2.3 Reaction chamber
CA 3041596 2019-04-29
- 78 -
2.4 Peferred opening in the cartridge for the cannulas
3 Filing channel
3.1 Fluidic and mechanical interface with sample-adding tools
3.2 Filling cannula
4 Waste channel with waste container
4.1 Ventilation hole
4.2 Waste cannula
Figure 23:
View of the procedure for filling a reaction cartridge by means of a modular
filling unit.
Figure 24:
Diagrammatic view of an integrated filling unit for filling reaction
cartridges with reactive
substances or buffers in the preferred position without penetration of the
seal of the chamber
body. Herefor, the following reference numbers are used:
1 Filling unit - cartridge
1.1 Mechanical interface cartridge ¨ filling unit
2 Reaction cartridge
2.1 Mechanical interface cartridge ¨ filling unit
2.2 Seal
2.3 Reaction space
2.4 Preferred opening for the cannulas in the cartridge casing
3 Filling channel
3.1 Fluidic and mechanical interface with sample-feeding tools
3.2 Filling cannula
4 Waste channel with waste container
4.1 Fluidic and mechanical interface with sample-deducting units
4.2 Waste cannula
Equipment for preferred position, here: spring
Figure 25:
View of the procedure for filling a reaction cartridge having an integrated
filling unit.
Figure 26:
CA 3041596 2019-04-29
- 79 -
Diagrammatic view of an integrated filling unit having an integrated waste
container for
filling reaction cartridges with reactive substances or buffers in the
preferred position without
penetration of the seal of the chamber body. Herefor, the following reference
numbers are
used in addition to the reference numbers of Figure 24:
4 Waste channel with waste container
4.1 Ventilation hole
Figure 27:
a) Filling of the reaction space when deducting the surplus liquid into a
waste container
or channel
b) Deduction of surplus liquid when reducing the reaction space for
detection
Herein, the following reference numbers are used:
1 Reaction chamber
2 Seal
3 Pressure mechanism
4 Fluid interface
4.1 Deducting cannula
4.2 Feeding cannula
Figure 28:
Device for processing and detecting reaction cartridges according to the
present invention in
accordance with Example 4. Herein, the following reference numbers are used:
1 Reaction cartridge
1.1 Reaction chamber with microarray
1.2 Fluid system interface
1.3 Seal of the chamber body
1.4 Electric connections for heating system, optionally also temperature
sensors
1.5 Chip
1.6 Position-securing system for implementing a preferred position and
guiding the
cannulas
1.7 Cannulas
2 Pressure mechanism
3 Identification system, for example bar code or data matrix
CA 3041596 2019-04-29
- 80 -
3.1 Identification optics, for example bar code or data matrix reader
4 Detection optics
Fluid connections
Figure 29:
Reaction cartridge according to Example 5.
Figure 30:
Recording of the reaction cartridge according to Example 5 recorded with a
thermal imaging
camera at a temperature of 95 C.
Figure 31:
Analysis of the reaction product according to Example 5 by means of agarose
gel
electrophoresis. Herein, the reference numbers indicate:
1, 5: Positive control from the thermocycler
2-4: Reaction products from the cartridges
6: 100 bp standard
CA 3041596 2019-04-29
