Note: Descriptions are shown in the official language in which they were submitted.
CA 03059288 2019-10-07
NOVEL COLORIMETRIC SENSING METHOD FOR DUAL PATHOGEN
FIELD
[0001] The present disclosure relates to the technical field of biological
detection, specifically
to a novel colorimetric sensing method for dual pathogen.
BACKGROUND
[0002] The traditional bacterial detection method is mainly based on the
physiological and
biochemical characteristics of bacteria. After the steps of pre-enrichment,
selective plate
separation and biochemical identification, it takes 5-7 days from sampling to
determination. The
detection period is long, the operation is cumbersome and the workload is
large. It has been more
than half a century since the specificity of the antigen-antibody reaction has
been used to identify
bacteria, but the screening of microbial antibodies is cumbersome and the
specificity of the final
detection is not high. The continuous improvement and development of molecular
biology
detection technology has overcome the problems of tedious and time-consuming
experimentation
of traditional detection methods and led to the rapid development of rapid
detection methods for
microorganisms, but the disadvantage of molecular biology methods is that the
results are not
visualized, making the results analysis not easy.
SUMMARY
[0003] The novel colorimetric sensing method established by the present
disclosure overcomes
the deficiencies of the existing detection technologies and realizes accurate,
rapid, simple and
- -
13826743.1
34273/52
CA 03059288 2019-10-07
efficient detection and analysis of microorganisms.
[0004] The present disclosure aims to provide a detection method, comprising
nucleic acid
amplification in vitro, wherein
the reaction system of the nucleic acid amplification in vitro comprises a
upstream primer
and a downstream primer, wherein
the upstream primer comprises a complementary sequence A, a linking arm, a
complementary sequence B, and a nucleotide sequence capable of specifically
amplifying a target
to be detected;
the linking arm is provided between the complementary sequence A and
complementary sequence B, and the nucleotide sequence capable of specifically
amplifying the
target to be detected is provided at 5' terminal or 3' terminal of the
upstream primer;
the nucleotide sequence of the complementary sequence A and the nucleotide
sequence of the complementary sequence B are complementary and/or reverse
complementary to
each other;
the linking arm comprises a moeity capable of inhibiting polymerase binding
and/or a moeity capable of inhibiting new strand extension during in vitro
nucleic acid
amplification; and
the downstream primer comprises the nucleotide sequence capable of
specifically
amplifying the target to be detected.
[0005] The A and B are only used to distinguish different complementary
sequences, and are
not used for sorting.
[0006] The complementation includes complementation or reverse complementation
as defined
by the conventional art or common general knowledge, and/or performing
complementation or
reverse complementation according to complementary principles as defined by
the conventional
art or common general knowledge.
[0007] The polymerase includes a polymerase that can be used for the in vitro
nucleic acid
amplification.
- 2 -
13718731.2
34273/52
CA 03059288 2019-10-07
[0008] The nucleotide sequence capable of specifically amplifying the target
to be detected
comprises a primer sequence designed according to a characteristic sequence of
the target to be
detected; the characteristic sequence comprises the characteristic sequence
defined by the
conventional art or common general knowledge; and the design comprises the
design method
recorded by the conventional art or common general knowledge.
[0009] Specifically, the method further comprising at least one of the
following 1) to 2):
1) the nucleic acid amplification in vitro includes ultra-rapid PCR, wherein
the reaction
process of the ultra-rapid PCR comprises: 90-98 C for 2-6s and 50-60 C for 2-
8s, for 20-40
cycles in total;
specifically, the reaction process of the ultra-rapid PCR reaction comprises:
95 C for 4s;
58 C for 6s; and a total of 30 cycles;
specifically, the concentration of the upstream primer and the downstream
primer in the
reaction system of the ultra-rapid PCR reaction is more than 10 times of the
concentration of the
regular PCR; specifically, the concentration is 20 times; the reaction system
of the ultra-rapid
PCR reaction further comprises a DNA polymerase, and the concentration of the
DNA
polymerase is more than 10 times of the concentration of the regular PCR, more
specifically, the
concentration is 60 times; and
2) the linking arm comprises a compound having a long-chain structure.
[0010] More specifically, the linking arm is oxyethyleneglycol, and the
chemical structure of
oxyethyleneglycol is:
0-P _____________________________________________________________ 0
(I)
[0011] Specifically, the method further comprising at least one of the
following 1) to 8):
1) the upstream primer includes a primer obtained by linking the nucleotide
sequences set
-3-
13718731.2
34273/52
CA 03059288 2019-10-07
forth in SEQ ID NO: 1 and SEQ ID NO: 2 via the linking arm;
2) the downstream primer includes the nucleotide sequence set forth in SEQ ID
NO: 3;
3) the upstream primer includes a primer obtained by linking, via the linking
arm, nucleotide
sequences which are modified from the nucleotide sequences set forth in SEQ ID
NO: 1 and/or
SEQ ID NO: 2 by substituting, adding and/or deleting one or more nucleotides
and have the same
function as the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID
NO: 2;
4) the downstream primer includes a nucleotide sequence which is modified from
the
nucleotide sequence set forth in SEQ ID NO: 3 by substituting, adding and/or
deleting one or
more nucleotides and has the same function as the nucleotide sequence set
forth in SEQ ID NO:
3;
5) the upstream primer includes a primer obtained by linking the nucleotide
sequences set
forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm;
6) the downstream primer includes the nucleotide sequence set forth in SEQ ID
NO: 6;
7) the upstream primer includes a primer obtained by linking, via the linking
arm, nucleotide
sequences which are modified from the nucleotide sequences set forth in SEQ ID
NO: 4 and/or
SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides
and have the same
function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID
NO: 5; and
8) the downstream primer includes a nucleotide sequence which is modified from
the
nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or
deleting one or
more nucleotides and has the same function as the nucleotide sequence set
forth in SEQ ID NO:
6.
[0012] The "function" refers to realizing specific amplification or detecting
the target to be
detected.
[0013] More specifically, the upstream primer is:
AGA GAGAGAGAGGGAAAGAGAGAG- ox yethyleneglycol-CTCTCTCTTTCCCTCTCT
CTCTCTTTITTGTGAAATTATCGCCACGTTCGGGCAA and/or
TGAGGTAGTAGGTTGTATAGTT-oxyethylenegl ycol-AACTATACAAC CTACTACCTCA
-4-
13718731.2
34273/52
CA 03059288 2019-10-07
AAAAAAAAAAAGCACATAACAAGCG.
[0014] The upstream primers can be synthesized commercially, and the
preparation method
thereof belongs to conventional art.
[0015] Another object of the present disclosure is to provide a detection
method, comprising a
color reaction based on nucleic acid self-assembly, wherein
the reaction system of the color reaction based on nucleic acid self-assembly
comprises a
hairpin sequence which comprises all or a part of a nucleotide sequence
containing a
G-quadruplex forming nucleotide sequence, a complementary sequence C, and a
complementary
sequence D, wherein
the all or a part of the nucleotide sequence containing a G-quadruplex forming
nucleotide sequence is provided at 5' terminal and/or 3' terminal of the
hairpin sequence;
the complementary sequence C and the complementary sequence C of the other
hairpin
sequence are complementary and/or reverse complementary to each other; and
the complementary sequence D and the target to be detected or the nucleotide
sequence
linked to the target to be detected are complementary and/or reverse
complementary.
[0016] The C and D are only used to distinguish different complementary
sequences, and are
not used for sorting.
[0017] The G-quadruplex forming nucleotide sequence comprises the G-quadruplex
forming
nucleotide sequence as defined by the conventional art or common general
knowledge.
Specifically, the G-quadruplex forming nucleotide sequence comprises the
sequence capable of
self-assembling to form a G-quadruplex structure having an activity similar to
horseradish
peroxidase, and the G-quadruplex structure, under the induction of hemin,
catalyzes ABTS2- and
H202 to form ABTS- , which makes the reaction solution blue-green.
[0018] Specifically, the hairpin sequence can cleave the G-quadruplex forming
nucleotide
sequence at a ratio of 25% and/or 75%, and the cleaved sequences are
respectively added at the 5'
terminal and/or the 3' terminal of the hairpin sequence; more specifically, a
T base is further
added after the cleaving; the T base is added at the 5' terminal and/or the 3'
terminal of the
cleaved sequence.
[0019] Specifically, the G-quadruplex forming nucleotide sequence includes the
nucleotide
-5-
13718731.2
34273/52
CA 03059288 2019-10-07
sequences set forth in SEQ ID NO: 7 and/or SEQ ID NO: 8.
[0020] Specifically, the complementary sequence D may be complementary and/or
reverse
complementary to the complementary sequence A and/or complementary sequence B
according
to the present disclosure.
[0021] More specifically, the hairpin sequence comprises at least one of the
following 1) to 4):
I) the nucleotide sequence set forth in SEQ ID NO: 9 and/or a nucleotide
sequence which is
modified from the nucleotide sequence set forth in SEQ II) NO: 9 by
substituting, adding and/or
deleting one or more nucleotides and has the same function as the nucleotide
sequence set forth in
SEQ ID NO: 9;
2) the nucleotide sequence set forth in SEQ ID NO: 10 and/or a nucleotide
sequence which is
modified from the nucleotide sequence set forth in SEQ ID NO: 10 by
substituting, adding and/or
deleting one or more nucleotides and has the same function as the nucleotide
sequence set forth in
SEQ ID NO: 10;
3) the nucleotide sequence set forth in SEQ ID NO: 11 and/or a nucleotide
sequence which is
.. modified from the nucleotide sequence set forth in SEQ ID NO: 11 by
substituting, adding and/or
deleting one or more nucleotides and has the same function as the nucleotide
sequence set forth in
SEQ ID NO: 11; and
4) the nucleotide sequence set forth in SEQ ID NO: 12 and/or a nucleotide
sequence which is
modified from the nucleotide sequence set forth in SEQ ID NO: 12 by
substituting, adding and/or
deleting one or more nucleotides and has the same function as the nucleotide
sequence set forth in
SEQ ID NO: 12.
[0022] More specifically, the color reaction based on nucleic acid self-
assembly further
comprises at least one of the following 1) to 2):
1) the reaction condition of the color reaction based on nucleic acid self-
assembly comprises
a step of incubating at 37 C for 20 mm; and
2) the final concentration of the hairpin sequence in the reaction system of
the color reaction
based on nucleic acid self-assembly is 2 M.
[0023] Another object of the present disclosure is to provide a detection
method, comprising
first amplifying the target to be detected by any of the methods according to
the present
- 6 -
13718731.2
34273/52
CA 03059288 2019-10-07
disclosure, and then detecting the target to be detected by any of the methods
according to present
disclosure.
[0024] Specifically, in the method, the complementary sequence D according to
the present
disclosure and the complementary sequence A and/or complementary sequence B
according to
the present disclosure are complementary or reverse complementary.
[0025] Specifically, the method further comprising at least one of the
following 1) to 4):
1) determining whether an object to be detected contains the target to be
detected by a color
change of final reaction system;
specifically, when the color of the reaction system changes, the object to be
detected is
determined to contain the target to be detected; more specifically, when the
color of the reaction
system turns blue-green, the object to be detected is determined to contain
the target to be
detected;
2) calculating the concentration of the target to be detected in the object by
a method of
plotting standard curve according to the color of the final reaction system;
3) amplifying the detection signal of the target to be detected by increasing
the type of
hairpin sequence in the reaction system;
specifically, for each additional hairpin sequence, the signal is amplified 2-
4 times;
4) achieving dual or multiple detection by increasing the type of upstream
primer or
downstream primer, and simultaneously increasing the type of hairpin sequence
in the reaction
system.
[0026] Specifically, when the detection is for dual or multiple detection, the
microarray method
can be used to determine whether the object to be detected contains the target
to be detected or
contains several targets to be detected. The microarray method comprises
separately placing the
different types of hairpin sequences in different wells to perform reactions,
and then determining
whether the sample contains the target to be detected or several targets to be
detected according to
the reaction results. When the color of the reaction liquid changes or turns
blue-green, it is
determined that the target to be detected is present; the total number of
wells in which the color
-7-
13718731.2
34273/52
CA 03059288 2019-10-07
change or the blue-green color is generated is the total number of targets
which are contained in
the sample to be detect.
[0027] The types of hairpin sequence: if the complementary sequence D is
complementary or
reverse complementary to the complementary sequence A and/or B in the same
upstream primer,
then they are the same type of hairpin sequence. Otherwise, the sequence is
different type of
hairpin sequence; and the upstream primers having identical nucleotide
sequences are the same
upstream primers.
[0028] The types of the upstream primer or the downstream primer: a primer
pair that can
amplify the same target to be detected are the same type of upstream primer or
downstream
primer; otherwise, the primer pair that can amplify different targets to be
detected are different
types of upstream primer or downstream primer.
[0029] Another object of the present disclosure is to provide a kit and/or a
biosensor, comprises
at least one of the following 1) to 2):
1) the upstream primer and the downstream primer,
the upstream primer comprises a complementary sequence A, a linking arm, a
complementary sequence B, and a nucleotide sequence capable of specifically
amplifying a target
to be detected, wherein
the linking arm is provided between the complementary sequence A and
complementary sequence B, and the nucleotide sequence capable of specifically
amplifying the
.. target to be detected is provided at 5' terminal or 3' terminal of the
upstream primer;
the nucleotide sequence of the complementary sequence A and the nucleotide
sequence
of the complementary sequence B are complementary and/or reverse complementary
to each
other;
the linking arm comprises a moeity capable of inhibiting polymerase binding
and/or a
.. moeity capable of inhibiting new strand extension during in vitro nucleic
acid amplification; and
the downstream primer comprises the nucleotide sequence capable of
specifically amplifying
the target to be detected; and
- 8 -
13718731.2
34273/52
CA 03059288 2019-10-07
2) a hairpin sequence comprising all or a part of a nucleotide sequence
containing a
G-quadruplex forming nucleotide sequence, a complementary sequence C, and a
complementary
sequence D, wherein
the all or a part of a nucleotide sequence containing a G-quadruplex forming
nucleotide
sequence is provided at 5' terminal and/or 3' terminal of the hairpin
sequence;
the complementary sequence C and the complementary sequence C of the other
hairpin
sequence are complementary and/or reverse complementary; and
the complementary sequence D and the target to be detected or the nucleotide
sequence
linked to the target to be detected are complementary and/or reverse
complementary.
[0030] The complementation includes complementation or reverse complementation
as defined
by the conventional art or common general knowledge, and/or performing
complementation or
reverse complementation according to complementary principles as defined by
the conventional
art or common general knowledge.
[0031] The polymerase includes a polymerase that can be used for the in vitro
nucleic acid
amplification.
[0032] The nucleotide sequence capable of specifically amplifying the target
to be detected
specifically comprises a primer sequence designed according to a
characteristic sequence of the
target to be detected; the characteristic sequence comprises the
characteristic sequence defined by
the conventional art or common general knowledge; and the design comprises the
design method
recorded by the conventional art or common general knowledge.
[0033] Specifically, the linking arm comprises a compound having a long-chain
structure.
[0034] More specifically, the linking arm is oxyethyleneglycol, and the
chemical structure of
oxyethyleneglycol is:
-9-
13718731.2
34273/52
CA 03059288 2019-10-07
o
OP -o-
0
[0035] Specifically, the upstream primer and the downstream primer comprise at
least one of
the following 1) to 8):
1) the upstream primer includes a primer obtained by linking the nucleotide
sequences set
forth in SEQ ID NO: 1 and SEQ ID NO: 2 via the linking arm;
2) the downstream primer includes the nucleotide sequence set forth in SEQ ID
NO: 3;
3) the upstream primer includes a primer obtained by linking, via the linking
arm, nucleotide
sequences which are modified from the nucleotide sequences set forth in SEQ ID
NO: 1 and/or
SEQ ID NO: 2 by substituting, adding and/or deleting one or more nucleotides
and have the same
function as the nucleotide sequences set forth in SEQ ID NO: 1 and/or SEQ ID
NO: 2;
4) the downstream primer includes a nucleotide sequence which is modified from
the
nucleotide sequence set forth in SEQ ID NO: 3 by substituting, adding and/or
deleting one or
more nucleotides and has the same function as the nucleotide sequence set
forth in SEQ ID NO:
3;
5) the upstream primer includes a primer obtained by linking the nucleotide
sequences set
forth in SEQ ID NO: 4 and SEQ ID NO: 5 via the linking arm;
6) the downstream primer includes the nucleotide sequence set forth in SEQ ID
NO: 6;
7) the upstream primer includes a primer obtained by linking, via the linking
arm, nucleotide
sequences which are modified from the nucleotide sequences set forth in SEQ ID
NO: 4 and/or
SEQ ID NO: 5 by substituting, adding and/or deleting one or more nucleotides
and have the same
function as the nucleotide sequences set forth in SEQ ID NO: 4 and/or SEQ ID
NO: 5; and
8) the downstream primer includes a nucleotide sequence which is modified from
the
nucleotide sequence set forth in SEQ ID NO: 6 by substituting, adding and/or
deleting one or
- 1 -
13718731.2
34273/52
CA 03059288 2019-10-07
more nucleotides and has the same function as the nucleotide sequence set
forth in SEQ ID NO:
6.
[0036] The "function" refers to realizing specific amplification or detecting
the target to be
detected.
[0037] More specifically, the upstream primer is:
AGAGAGAGAGAGGGAAAGAGAGAG-oxyethyleneglycol-CTCTCTCTTTCCCTCTCT
CTCTCTTTTTTGTGAAATTATCGCCACGTTCGGGCAA =
and/or TGAGGTAGTAGGTTGTATAGTT-oxyethyleneglycol-AACTATACAACC
TACTACCTCAAAAAAAAAAAAGCACATAACAAGCG.
[0038] The C and D are only used to distinguish different complementary
sequences, and are
not used for sorting.
[0039] The G-quadruplex forming nucleotide sequence comprises the G-quadruplex
forming
nucleotide sequence as defined by the conventional art or common general
knowledge.
Specifically, the G-quadruplex forming nucleotide sequence comprises the
sequence capable of
self-assembling to form a G-quadruplex structure having an activity similar to
horseradish
peroxidase, and the G-quadruplex structure, under the induction of hemin,
catalyzes ABTS2- and
H202 to form ABTS- , which makes the reaction solution blue-green.
[0040] Specifically, the hairpin sequence can cleave the G-quadruplex forming
nucleotide
sequence at a ratio of 25% and/or 75%, and the cleaved sequences are
respectively added at the 5'
terminal and/or the 3' terminal of the hairpin sequence; more specifically, a
T base is further
added after the cleaving; the T base is added at the 5' terminal and/or the 3'
terminal of the
cleaved sequence.
[0041] Specifically, the G-quadruplex forming nucleotide sequence includes the
nucleotide
sequences set forth in SEQ ID NO: 7 and/or SEQ ID NO: 8.
[0042] Specifically, the complementary sequence D is complementary or reverse
complementary to the complementary sequence A and/or B.
[0043] More specifically, the hairpin sequence comprises at least one of the
following 1) to 4):
1) the nucleotide sequence set forth in SEQ ID NO: 9 and/or a nucleotide
sequence which is
-11-
13718731.2
34273/52
CA 03059288 2019-10-07
modified from the nucleotide sequence set forth in SEQ ID NO: 9 by
substituting, adding and/or
deleting one or more nucleotides and has the same function as the nucleotide
sequence set forth in
SEQ ID NO: 9;
2) the nucleotide sequence set forth in SEQ ID NO: 10 and/or a nucleotide
sequence which
is modified from the nucleotide sequence set forth in SEQ ID NO: 10 by
substituting, adding
and/or deleting one or more nucleotides and has the same function as the
nucleotide sequence set
forth in SEQ ID NO: 10;
3) the nucleotide sequence set forth in SEQ ID NO: 11 and/or a nucleotide
sequence which
is modified from the nucleotide sequence set forth in SEQ ID NO: 11 by
substituting, adding
and/or deleting one or more nucleotides and has the same function as the
nucleotide sequence set
forth in SEQ ID NO: 11; and
4) the nucleotide sequence set forth in SEQ ID NO: 12 and/or a nucleotide
sequence which is
modified from the nucleotide sequence set forth in SEQ ID NO: 12 by
substituting, adding and/or
deleting one or more nucleotides and has the same function as the nucleotide
sequence set forth in
SEQ NO: 12.
[0044] Specifically, the kit and/or the biosensor comprises the following 1)
to 3):
1) AGAGAGAGAGAGGGAAAGAGAGAG-oxyethyleneglycol bridge - CTCTCT
CTTTCCCTCTCTCTCTCTTTTTTGTGAAATTATCGCCACGTTCGGGCAA
and/or
TGAGGTAGTAGGTTGTATAGTT-oxyethyleneglycol bridge - AACTATACAACCTACTA
CCTCAAAAAAAAAAAAGCACATAACA;
2) TCATCGCACCGTCAAAGGAACC and/or GATAAAGAAGAAACCAGCAG; and
3) at least one of the nucleotide sequences set forth in SEQ ID NO:9, SEQ ID
NO:10, SEQ
ID NO:11, and SEQ ID NO:12;
wherein, the chemical structure of oxyethyleneglycol is:
- 12 -
13718731.2
34273/52
CA 03059288 2019-10-07
0=-P ____________________________________________________________ 0
[0045] Another object of the present disclosure is to provide the use of any
one of the methods
according to the present disclosure, and any one of the kits and/or the
biosensors according to the
present disclosure.
[0046] Specifically, the use comprises at least one of the following 1) to 4):
1) detecting microorganisms;
2) preparing products for use in microorganism detection and/or related
products;
3) detection of dual or multiple microorganisms; and
4) preparing products for use in dual or multiple microbial detection and/or
related products.
to .. [0047] Specifically, the microorganisms include Salmonella and/or
Staphylococcus aureus.
[0048] Optionally, the use does not include the diagnosis and treatment of the
disease described
in Article 25 of the Chinese Patent Law.
[0049] A novel dual colorimetric sensing method based on ultra-rapid PCR is
established by the
present disclosure:
(1) this method establishes an ultra-rapid PCR reaction system that reduces
the traditional
PCR process, which takes about 3 hours, to 5 minutes, significantly reducing
the time spent on
PCR reactions;
(2) the ultra-rapid PCR reaction system is equipped with an enzyme-linked
color module
based on nucleic acid self-assembly, which not only amplifies the reaction
signal again to
facilitate the ultra-sensitive detection of pathogenic bacteria but also
solves the problem that the
traditional PCR results are difficult to visually detect; and
(3) color reaction system is set in wells and sorted by microarray to solve
the problem of
- 13 -
13718731.2
34273/52
CA 03059288 2019-10-07
dual detection for pathogenic bacteria.
[0050] In one embodiment of the present disclosure, amplification primers for
ultra-rapid
polymerase chain reaction (PCR) are designed based on virulence genes of
Salmonella and
Staphylococcus aureus, and a color module based on nucleic acid self-assembly
is combined to
integrate and establish a novel dual colorimetric sensing method based on
ultra-rapid PCR for
ultrasensitive detection of Salmonella and Staphylococcus aureus.
[0051] The present disclosure has the following beneficial technical effects:
1) the detection method and the biosensor established by the present
disclosure are faster and
more sensitive than the conventional method, and have the advantages of high
specificity, high
sensitivity, reliable detection results, etc., and can simplify the analysis
and detection steps,
shorten the analysis time, and more importantly make the online real-time
detection possible,
easy to carry and field work, and has very good application prospect in the
field of microbial
detection including food safety and rapid detection;
2) the detection method and the biosensor established by the present
disclosure can
simultaneously realize the dual specific detection of Salmonella and
Staphylococcus aureus, the
detection has good specificity, high sensitivity, reliable detection result,
can be discerned by the
naked eye, and the detection process is quick and convenient, which are of
great significance in
daily monitoring or market screening and other aspects. Specifically, the
detection sensitivity of
the detection method and the biosensor established by the present disclosure
for detecting
Salmonella and Staphylococcus aureus are 10 cfu/mL and 10 cfu/mL,
respectively; in addition,
the specificity experiment results show that the detection method and
biosensor established by the
present disclosure do not cross-react with Shigella and Escherichia coli, and
can realize dual
specific detection of Salmonella and Staphylococcus aureus at the same time;
and
3) the color module based on nucleic acid self-assembly according to the
present disclosure is
a non-enzymatic reaction, the reaction system component is simpler, the
reaction process is
simpler, the step of terminating the enzymatic reaction is reduced, and the
constant temperature
reaction simplifies the requirement for the enzymatic reaction temperature,
and the economic cost
is significantly reduced, the reaction time is shortened to help to meet the
requirements of fast and
simple detection.
- 14-
13718731.2
34273/52
BRIEF DESCRIPTION OF DRAWINGS
[00521 Figure 1 is a schematic diagram showing the structure of ultra-rapid
PCR device.
[0053] Figure 2 is the result of verification of the amplification effect of
the dual ultra-rapid
PCR reaction. Lane 1 is a negative control without product purification (a
dual ultra-rapid PCR
reaction system without the addition of genomic samples of Salmonella and
Staphylococcus
aureus); lane 2 is a positive sample with product purification (a dual ultra-
rapid PCR reaction
system with the addition of genomic samples of Salmonella and Staphylococcus
aureus); lane 3 is
a negative control with product purification (a dual ultra-rapid PCR reaction
system without the
addition of genomic samples of Salmonella and Staphylococcus aureus); and lane
4 is a positive
sample with product purification (a dual ultra-rapid PCR reaction system with
the addition of
genomic samples of Salmonella and Staphylococcus aureus).
[0054] Figure 3 is a standard curve for Salmonella.
[0055] Figure 4 is a standard curve for Staphylococcus aureus.
DETAILED DESCRIPTION
[0056] The experimental methods used in the following examples are
conventional methods
unless otherwise specified.
[0057] The molecular biology experimental methods not specifically described
in the following
examples are all carried out according to the specific methods listed in the
book "Molecular
Cloning: A Laboratory Manual" (third edition) by J. Sambrook, or carried out
according to the
instructions of kits and products.
[0058] The materials and reagents used in the following examples are
commercially available
unless otherwise specified.
Example 1: establishment of a dual colorimetric sensing method based on ultra-
rapid PCR for
- 15 -
16514131.1
34273/52
Date Recue/Date Received 2021-02-24
detecting Salmonella and Staphylococcus aureus
I. Experimental materials
[00591 The strain information used in this example is shown in Table 1, the
designed nucleotide
sequence of primers are shown in Table 2 and Sequence Listing.
Table 1
Bacteria name Latin name Strain number
Salmonella Salmonella spp. CGMCC 1.0090
Staphylococcus aureus Staphylococcus aureus ATCC 25923
Table 2
Primer Name Sequence (from 5' to 3')
AGAGAGAGAGAGGGAAAGAGAGAG-oxyethyleneglycol
Primer 1 bridge-CTCTCTCTTTCCCTCTCTCTCTCTTTTTTGTGAAATTATCGCCA
CGTTCGGGCAA
Primer 2 TCATCGCACCGTCAAAGGAACC
TGAGGTAGTAGGTTGTATAGTT-oxyethyleneglycol
Primer 3 bridge-AACTATACAACCTACTACCTCAAAAAAAAAAAAGCACATAAC
AAGCG
Primer 4 GATAAAGAAGAAACCAGCAG
AGGGCGGGTGGGTCTCTCTCTTTCCCTCTCTCTCTCTCGGCAGAGAGA
Hairpin 1
GAGAGGGAAAGT GGGT
TGGGTAGAGAGAGAGAGGGAAAGAGAGAGCTTTCCCTCTCTCT
Hairpin 2
CTCTGCCGTGGGTAGGGCGGG
AGGGCGGGTGGGTAGTAGGTTGTATAGTTCAAAGTAACTATACAACCT
Hairpin 3
ACTACCTCATGGGT
TGGGTACTTTGAACTATACAACCTACTTGAGGTAGTAGGTTGTATAGTT
Hairpin 4
TGGGTAGGGCGGG
[0060] In Table 2, the nucleotide sequence on the left side of the linking arm
(oxyethyleneglycol bridge) of the upstream Primer 1 is the nucleotide sequence
set forth in SEQ
ID NO: 1, and the nucleotide sequence on the right side of the linking arm is
the nucleotide
sequence set forth in SEQ ID NO: 2, and the chemical structure of the linking
arm is :
- 16 -
16514131.1
34273/52
Date Recue/Date Received 2021-02-24
)
0
0J-0-
100611 In Table 2, the nucleotide sequence of the downstream Primer 2 is the
nucleotide
sequence set forth in SEQ ID NO: 3.
[0062] In Table 2, the nucleotide sequence on the left side of the linking arm
(oxyethyleneglycol bridge) of the upstream Primer 3 is the nucleotide sequence
set forth in SEQ
ID NO: 4, and the nucleotide sequence on the right side of the linking arm is
the nucleotide
sequence set forth in SEQ ID NO: 5, and the chemical structure of the linking
arm is the same as
the chemical structure of the linking arm of Primer 1.
100631 In Table 2, the nucleotide sequence of the downstream Primer 4 is the
nucleotide
sequence set forth in SEQ ID NO: 6.
100641 In Table 2, each of the hairpin sequences 1 to 4 (Hairpin 1, Hairpin 2,
Hairpin 3, Hairpin
4) is a G-quadruplex sequence by cleaving two G-quadruplex forming nucleotide
sequences at a
ratio of 25% and/or 75% and respectively adding to two terminals of the
Hairpin Probe, and T
base is added to protect the cleaved G-quadruplex sequences. The two G-
quadruplex forming
nucleotide sequences are the nucleotide sequence AGGG CGGG TGGG TGGG set forth
in SEQ
ID NO: 7 and the nucleotide sequence TGGG TGGG TAGGG CGGG set forth in SEQ ID
NO: 8.
The "initiator" can promote nucleic acid self-assembly, so that the cleaved G-
quadruplex get
close to each other in distance, and under the induction of hemin, the G-
quadruplex functional
structure having an activity similar to horseradish peroxidase is formed to
catalyze the color
development of the reaction between ABTS2- and H202. Specifically, in Table 2,
the nucleotide
sequence of the hairpin sequence Hairpin 1 is the nucleotide sequence set
forth in SEQ ID NO: 9;
the nucleotide sequence of the hairpin sequence Hairpin 2 is the nucleotide
sequence set forth in
SEQ ID NO: 10; the nucleotide sequence of the hairpin sequence Hairpin 3 is
the nucleotide
sequence set forth in SEQ ID NO: 11; and the nucleotide sequence of the
hairpin sequence
- 17 -
16514131.1
34273/52
Date Recue/Date Received 2021-02-24
Hairpin 4 is the nucleotide sequence set forth in SEQ ID NO: 12.
100651 The sequences listed in Table 2 are all artificially synthesized.
100661 Ex Taq DNA polymerase, 10 X Ex Taq Buffer (20 mM Mg2+ Plus) and dNTP
Mixture
(2.5 mM) are purchased from TAKaRa. Hemin and 2, 2'-azino-bis
(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS2-) are
purchased from
Sigma-Aldrich Chemical Co. Experimental water is obtained from Milli-Q water
purification
system. All other reagents are purchased from China National Pharmaceutical
Group
Corporation.
II. Construction of ultra-rapid PCR device
[0067] The main structure of the ultra-rapid PCR device is shown in Figure 1.
The specific
structure, connection method, working principle and working process include:
Light Cycler model capillary (20 tL, 04 929 292 001, Roche) is used as a PCR
sample
chamber of the ultra-rapid PCR device, the samples are collected at one
terminal of each capillary
by rapid centrifugation, and the capillary with the sample is fixed to the
plastic holder after
centrifuging. The plastic holder is connected to a stepper motor (42JSF630A5-
1000, Just Motioin
Control) which drives the capillary sample chamber fixed on the plastic holder
to switch between
a high-temperature water bath at 95 C and a medium-temperature water bath at
58 C cyclically
to realize reaction temperature change and control during the ultra-rapid PCR
reaction. The
stepper motor is powered by a switching power supply (S-100-24, Elecall), and
the frequency or
time control of the above-mentioned cyclic conversion of the stepper motor is
realized by a DC
servo motor driver (YZ-ACSD60, Moving) and Labview (version 2014). Temperature
measurement is achieved by using a thermocouple encapsulated in a capillary.
The amplification
and linearization of the thermocouple signal are carried out using a
temperature transmitter
(SBWR-2260, K, Yuancheng) and processed using the Arduino UNO v1.0 chip. The
Arduino
UNO chip converts the received analog signal into a digital signal, which is
then subjected to
calculation by the Arduino IDE (version 1.8.1) module.
III. Dual ultra-rapid PCR reaction
- 18 -
16514131.1
34273/52
Date Recue/Date Received 2021-02-24
[0068] 1) Preparation of a dual ultra-rapid PCR reaction system, which is
shown in Table 3:
Table 3
Reaction component Final concentration
Template 0.05 [tM
Ex Taq DNA polymerase 1.5 U/mL
Primer-1 2 [tM
Primer-2 2 [tM
Primer-3 2 [tM
Primer-4 2 [tM
dNTP 250 [tM
10 xEx Taq Buffer 1 xEx Taq Buffer
ddH20 Up to 10 [tL
[0069] Salmonella and Staphylococcus aureus bacteria were cultured overnight
in LB medium
for activation, and genomic DNA of Salmonella and Staphylococcus aureus was
respectively
extracted from the culture by using bacterial genomic DNA extraction kit (New
Industry), and 1
[IL each of the extracted genomic DNA samples was taken to mix as a template
in Table 3.
Primers 1 to 4 (Primer 1, Primer 2, Primer 3, Primer 4) in Table 3 were
primers 1 to 4 (Primer 1,
Primer 2, Primer 3, Primer 4) listed in Table 2 above.
100701 2) Reaction process of the dual ultra-rapid PCR
According to Table 3, 10 [t1 of the reaction system was prepared on ice, and
it was quickly
placed in the ultra-rapid PCR reaction device constructed in part II for
temperature control. The
temperature control and cycle number are shown in Table 4:
Table 4
Reaction
Reaction time
temperature
95 C 4s
30 cycles, 5min in total
58 C 6s
[0071] 3) Verification of amplification results for dual ultra-rapid PCR
reactions
- 19 -
16514131.1
34273/52
Date Recue/Date Received 2021-02-24
After the completion of the above dual ultra-rapid PCR reaction, agarose gel
electrophoresis
with 2% ethidium bromide pre-staining was used to verify the amplification
result of the dual
ultra-rapid PCR reaction system.
Electrophoresiscondition: 130 V for 25 min
Photographing system: Molecular Imager Gel Doc XR (Bio-Rad).
PCR product purification kit (Sangon Biotech) was used to remove primer
dimers, unreacted
primers and reaction impurities.
[0072] The verification result of the amplification result of the dual ultra-
rapid PCR reaction is
shown in Figure 2. Figure 2 shows that the dual ultra-rapid PCR reaction
system achieves an
effective amplification of two types of pathogenic bacteria; and the
purification of the PCR
product purification kit effectively removes primer dimers, unreacted primers
and reaction
impurities.
IV. Establishment of color module based on nucleic acid self-assembly and
visual detection of
dual pathogen
100731 1) Sensitivity experiment
[0074] Standard curves of Salmonella and Staphylococcus aureus were plotted.
The four
hairpin probes listed in Table 2 above: Hairpin 1, Hairpin 2, Hairpin 3,
Hairpin 4 were dissolved
in ultrapure water to 100 [tM, heated at 95 C for 5 min, and then slowly
cooled down to room
temperature.
[0075] Salmonella and Staphylococcus aureus bacteria were cultured overnight
in LB medium
for activation. The culture was subjected to a gradient dilution and then
plate culture for counting.
Salmonella or Staphylococcus aureus broth at concentrations of 101 cfu/ml, 102
cfu/ml, 103
cfu/mL, 104 cfu/mL, and 105 cfu/mL were subjected to genomic DNA extraction by
using the
bacterial genomic DNA extraction kit (New Industry). The genomic DNA samples
extracted from
the same concentration of Salmonella broth and Staphylococcus aureus broth
were mixed
(according to a volume ratio of 1:1, i.e. 1 pL of each) as a template, and a
dual ultra-rapid PCR
reaction was carried out according to the dual ultra-rapid PCR reaction
described in the above
part III. The reaction system (10 Ill) after the completion of the reaction
was equally divided into
- 20 -
16514131.1
34273/52
Date Recue/Date Received 2021-02-24
2 portions: one of which was added with the ultrapure aqueous solutions of
Hairpin 1 and Hairpin
2 produced above, and the other was added with the ultrapure aqueous solutions
of Hairpin 3 and
Hairpin 4 produced above. Self-assembly buffer (8 mM Na2HPO4, 2.5 mM NaH2PO4,
0.15 M
NaCl, 2 mM MgCl2, pH 7.4) was added respectively to the above two portions,
and the final
concentration of each Hairpin Probe was 2 pM, and both reaction systems were
10 pl. Both
reaction systems were incubated at 37 C for 20 min, and the nucleic acid self-
assembly product
was obtained.
[0076] The color system based on nucleic acid self-assembly was established.
10 pL of nucleic
acid self-assembly reaction product was taken and added with 1 pL of hemin
stock solution (10
pM), 32 pL G-quadruplex inducing buffer (100 mM 2-(4-morpholine)
ethanesulfonic acid (IVIES),
40 mM KC1, with a volume percentage of 0.05% Triton X-100, pH 5.5), and 23 pL
of ultrapure
water, the mixture was incubated at 37 C for 20 min; 8 pL of ABTS2- stock
solution (20 mM)
and 8 pL of hydrogen peroxide (H202) stock solution (20 mM) were added to the
mixture and
then incubated at room temperature in the dark for 5 min. After the reaction
was completed, the
OD value of the reaction solution at 415 nm was measured by a
spectrophotometer, and the
respective standard curves of Salmonella and Staphylococcus aureus were
plotted, and the results
are shown in Figure 3 and Figure 4.
100771 According to the obtained standard curve and the 3a principle, the
detection limits of
Salmonella and Staphylococcus aureus were determined to be 10 cfu/mL and 10
cfu/mL,
indicating that the new detection method established by the present disclosure
has a high
sensitivity.
100781 The method of plotting the standard curve and determining the detection
limit were
carried out according to the method described in the literature Macdougall,
D., Crummett, W.B.,
1980. Anal. Chem. 52(14), 2242-2249.
[0079] 2) Accuracy experiment
[0080] Standard substance recovery test:
100811 The Salmonella broth with the concentration of 10 cfu/mL and the
Staphylococcus
aureus broth with the concentration of 10 cfu/mL were respectively detected by
a traditional plate
- 21 -
16514131.1
34273/52
Date Recue/Date Received 2021-02-24
detection method and the new method established by the present disclosure, and
the detection
results are shown in Table 5. The average number of colony detected by the new
detection
method established by the present disclosure (the detection process was
consistent with the
sensitivity experiment process described above, and the only difference was
that the extracted
genomic DNA samples were from Salmonella broth and Staphylococcus aureus broth
having a
concentration of 10 cfu/mL. After extraction, 1 [EL of each sample was taken
and mixed as the
template) was similar to the average number of colony detected by the
traditional plate detection,
indicating that the new detection method established by the present disclosure
has high accuracy.
Table 5
Plate detection New method
Bacteria name Average number of colony Average number of colonya+SDb
(cfu/mL) (cfu/mL)
Salmonella 9.70 10.30 1.33
Staphylococcus aureus 10.42 9.81 0. 87
100821 3) Specificity experiment
[0083] Salmonella, Staphylococcus aureus, Shigella and Escherichia coli were
cultured
overnight in LB medium for activation to prepare 10 cfu/mL of Salmonella
broth, 10 cfu/mL of
Staphylococcus aureus broth, 100 cfu/ mL of Shigella broth, and 100 cfu/mL of
Escherichia coli
broth, and genomic DNA samples were extracted from different broth by
bacterial genomic DNA
extraction kit (New Industry). Each of the genomic DNA samples extracted from
Salmonella
broth and Shigella broth was taken 1 [EL to mix as a template, which was
labeled as the reaction
system 1; each of the genomic DNA samples extracted from the Escherichia coli
broth and
Staphylococcus aureus broth was taken 1 [EL to mix as a template, which was
labeled as the
reaction system 2; and each of the genomic DNA samples extracted from the
Salmonella broth
and Staphylococcus aureus broth was taken 1 [IL to mix as a template, which
was labeled as the
reaction system 3. Dual ultra-rapid PCR reaction of the three reaction systems
was carried out
according to the dual ultra-rapid PCR reaction (all the same except the
template is replaced
accordingly) described above in the above part III.
- 22 -
16514131.1
34273/52
Date Recue/Date Received 2021-02-24
[0084] The four Hairpin Probes listed in Table 2 above: Hairpin 1, Hairpin 2,
Hairpin 3, and
Hairpin 4 were dissolved in ultrapure water to 100 [tM, heated at 95 C for 5
min, and then
slowly cooled to room temperature for later use.
[0085] The three reaction systems (10 pi) after the completion of the reaction
were equally
divided into 4 portions. The first portion of each reaction system was added
to three wells marked
as 1 (the ultrapure aqueous solutions of Hairpin 1 and Hairpin 2 were
dissolved in well 1 in
advance), and the second portion of each reaction system was added to three
wells marked as 2
(the ultrapure aqueous solutions of Hairpin 3 and Hairpin 4 were dissolved in
well 2 in advance).
The remaining two portions of each reaction system were added to three wells
marked as 3 and
three wells marked as 4 respectively (no Hairpin was placed in well 3 and well
4 as a negative
control). Then, the self-assembly buffer (8 mM Na2HPO4, 2.5 mM NaH2PO4, 0.15 M
NaCl, 2
mM MgCl2, pH 7.4) was added in each well, and the final concentration of each
hairpin probe
was 2 [tM, and each well was 10 [IL. All the wells were incubated at 37 C for
20 min, and the
nucleic acid self-assembly products was obtained.
100861 1 [IL of hemin stock solution (10 pM), 32 [IL of G-quadruplex inducing
buffer (100 mM
2-(4-morpholine) ethanesulfonic acid (IVIES), 40 mM KCl, with a volume
percentage of 0.05%
Triton X-100, pH 5.5), 23 [IL of ultrapure water were added to each well to
incubate at 37 C for
20 min; and 8 pt of ABTS2- stock solution (20 mM) and 8 [IL of hydrogen
peroxide (H202) stock
solution (20 mM) were added to the mixture and incubated at room temperature
for 5 min in the
dark.
[0087] The experimental results show that the detection method established by
the present
disclosure has no cross-reaction to Shigella and Escherichia colt, and can
simultaneously achieve
a dual specific detection of Salmonella and Staphylococcus aureus.
100881 The examples described above are only illustrative of the embodiments
of the present
disclosure, and the description thereof is more specific and detailed, but is
not to be construed as
limiting the scope of the present disclosure. However, any technical solution
obtained by using
equivalent replacement or equivalent transformation should fall within the
protection scope of the
present disclosure.
- 23 -
16514131.1
34273/52
Date Recue/Date Received 2021-02-24
