Note: Descriptions are shown in the official language in which they were submitted.
TGF- 13 receptor II isoform, fusion peptide, methods of treatment and methods
in
vitro
The present invention refers to an isoform of the TGF-13 receptor II,
codifying
polynucleotides, vectors, cells, transformed peptides, and fusion peptides,
method and
uses. More specifically, it refers to an isoform of the TGF-beta receptor ll
comprising a
sequence of about 80 amino acids and lacking a transmembrane domain;. The
isoform
comprises the amino acid sequence of SEQ ID No. 12. The isoform may have the
amino acid sequence set forth in SEQ ID No. 2 or sequences having at least 85
%
sequence identity to the sequence set forth in SEQ ID No. 2.
BACKGROUND
Transforming growth factor-beta (TGF-(3) is abundant in bone matrix and has
been shown to regulate the activity of osteoblasts and osteoclasts in vitro
and in vivo.
Human Adipose derived Mesenchymal Stromal Cells (ASC) are precursors of
osteoblasts, adipoblasts and chondroblasts. Thus, studies initially focused on
the
secretion of cytokines by ASC which have a profound effect in bone remodeling,
such
as Tgf-131, Osteoprotegerin (OPG) and Hepatocyte Growth Factor (HGF).
TGF-I31 concentrations are high in subchondral bone from humans with
osteoarthritis. High concentrations of TGF-131 induced formation of nestin-
positive
mesenchymal stem cell (MSC) clusters, leading to formation of marrow osteoid
islets
accompanied by high levels of angiogenesis (Zhen G, et al. (Nat Med. 19: 704-
12,
2013). It has been found that transgenic expression of active TGF-I31 in
osteoblastic
cells induced osteoarthritis, whereas inhibition of TGF-(3 activity, by means
of a Tr3R11
dominant negative receptor, in subchondral bone, attenuated the degeneration
of
articular cartilage leading to less development of osteoarthritis. It has also
been
reported that mice expressing a dominant negative type ll TGF-13 receptor
(TI3R1I-DN)
in osteoblasts, show decreased TGF-13 responsiveness in osteoblasts and
increased
CA 3060686 2019-10-25
bone volume, demonstrating that endogenous TGF-beta acts directly on
osteoblasts to
regulate bone remodeling, structure and biomechanical properties (Filvaroff,
E. et al.
Development, 126: 4267-4279, 1999). In addition, TGF-13 also regulates
osteoclastogenesis and osteoclast survival, in part through the induction of
osteoprotegerin (OPG), a protein known to inhibit osteoclast formation and
function
(Thirunavukkarasu K, et al. J. Biol. Chem. 276:36241-36250, 2001).
Transgenic mice that overexpress the dominant-negative type II TGF-13 receptor
(dnTgfbr2) in skeletal tissue exhibit progressive skeletal degeneration
(Buckwalter JA,
et al. Clin Orthop Re/at Res 423: 7-16, 2004). The articular chondrocytes in
the
superficial zone of cartilage tissue become hypertrophic with increased type X
collagen expression. Loss of proteoglycan and progressive degradation of
cartilage
tissue have been observed in 6-month-old mice which strongly resemble human
osteoarthritis (OA) (0A-like) (Serra R, et al. J Cell Biol 139: 541-552,
1997). TGF43
signaling plays a critical role not only in the regulation of chondrocyte
homeostasis
during cartilage destruction, but also in the manipulation of subchondral bone
cell
behavior during osteophyte formation, another feature of OA (van der Kraan PM,
et al.
Osteoarthr Cartilage 15: 237-244, 2007).
The role of the TGF-13. signaling pathway in osteophyte formation was further
explored by blocking studies using specific TGF-13 inhibitors. Several groups
demonstrated that ablation of endogenous TGF-13 activity, by intra-articular
overexpression of soluble TGF-13 type II receptor extracellular domain or
Smad7,
suppresses osteophyte formation in experimental murine OA models (Scharstuhl
A, et
al. J Immunol 169: 507-514, 2002). These observations clearly demonstrate that
ICE-
13 plays a dominant role in the induction of osteophytes, at least in murine
OA models.
In vivo, TGF-131 also induces angiogenesis (Madri JA, et al. J Cell Biol. 106:
1375-1384, 1988; Roberts AB, Proc Nat! Acad Sci USA. 83: 4167-4171, 1986; Yang
2
CA 3060686 2019-10-25
EY, et al. J Cell Biol. 111: 731-741, 1990.). In OA, high TGF-131 levels are
also
accompanied by high levels of angiogenesis. Hepatocyte growth factor (HGF) is
a
potent mitogen, morphogen, and motogen for a variety of cells, mainly
epithelial cells.
Increased expression of the HGF/HGF-receptor system in osteoarthritic
cartilage,
suggest a regulatory role in the homeostasis and pathogenesis of human joint
cartilage (Pfander D, et al. Osteoarthritis Cartilage. 7: 548-59, 1999).
Previous studies have shown that TGF-f3 can promote angiogenesis and tumor
invasion via stimulation of HGF expression (Chu SH, et al. J Neurooncol., 85:
33-38,
2007; Lewis MP, et al. Br J Cancer 90: 822-832, 2004)). Conversely, TGF-13 has
also
been shown to inhibit HGF transcription, potentially through binding of a TGF-
I3
inhibitory element located approximately 400 bp upstream of the HGF
transcription
start site (Liu Y, et. al. J Biol Chem., 269: 4152-4160, 1994; Plaschke-
Schlutter A, et
al. J Biol Chem., 270: 830-836, 1995), and abrogation of this effect leads to
cancer
development (Cheng N, et al. Cancer Res. 67: 4869-4877, 2007).
Quinolones (QNs) antibiotics such as Ciprofloxacin (CPFX) were widely used in
clinical practice owing to their wide spectrum antibacterial activity and high
degree of
bioavailability. They were not approved for use in children and adolescents
due their
toxic effects on joint cartilage of immature animals (Cuzzolin L, et at.
Expert Opin Drug
Saf 1: 319-24, 2002). Quinolones, administered systemically, caused
arthropathy and
tendinopathy when given during the growth phase (Sendzik J, et al. Int J
Antimicrob
Agents 33: 194-200, 2009.). It was reported that Ciprofloxacin decreased
thickness of
articular cartilage of the femoral condyle, inhibit proliferation of
cultivated chondrocytes
and secretion of soluble proteoglycans in a concentration- and time-dependant
manner in juvenile rats (Li, P. et al. Arch. PharmacoL Sin. 25: 1262-1266,
2004).
Chondrocyte cluster formation is a feature of all mechanical and chemical OA
models (Moriizumi T, et al. Virchows Arch B Cell Pathol Incl Mol Pathol., 51:
461-474,
3
CA 3060686 2019-10-25
1986; van der Kraan PM, et al. Am J Pathol., 135:1001-1014, 1989). Animals
with
quinolone arthropathy showed cavities in the middle zone of the articular
cartilage
containing necrotic chondrocytes. After 14 days, many of the lacunae in
defective
areas contained chondrocyte clusters. When treated for 14 days, and after a 14-
day
recovery period, territorial matrix had been deposited around individual
chondrocytes
within the clusters, indicating that in immature joints there is a certain
degree of
spontaneous repair by cluster cells (Sharpnack DD, et al. Lab Anim Sc., 44:
436-442,
1994). It has been shown that TGF431 is activated in the subchondral bone in
response to altered mechanical loading in an anterior cruciate ligament
transection
(ACLT) osteoarthritis mouse model (Zhen G, et al. Nat Med. 19: 704-12, 2013).
Additionally, CPFX was found to up-regulate TGF-131 production by HT-29 cells
and its
anti-proliferative effect was abolished when TGF-f31 was blocked (Bourikas LA,
et al.
Br J Pharmacol. 157: 362-70, 2009).
Adipose derived stem cells (hASCs) express cytokines such as IL-6, GM-CSF
and Flt3-ligand (Tholpady SS, et al. Clin Plast Surg 33: 55-62, 2006; Katz AJ,
et al.
Stem Cells. 23: 412-23, 2005; Schafer A, et al. Stem Cells 25: 818-827, 2007).
These
cytokines are regulated by TGF-131 either negatively (GM-CSF, SCF and Flt3-
ligand)
(Jacobsen SE, et al. J Immunol., 151: 4534-4544, 1993; Jacobsen SE, et al.
Blood 87:
5016-5026, 1996) or positively (IL-6, TPO) (Ramsfjell V, et al. J lmmunol.
158: 5169-
5177, 1997.). Recently, overexpression of a dominant negative mutant of the
human
T13R11 receptor (Ti3R11-DN) in mammalian cells has been shown to be very
effective in
blocking TGF-131 action. This mutant, based on the isoform A of the receptor,
is
capable to bind TGF-131 but signaling is disrupted due to the absence of a
serine/threonine kinase domain. Ti3RIIA-DN has been shown to disrupt TGF-131
mediated signaling allowing the study of the behavior of different cell types
in the
absence of either a paracrine or an autocrine effect of the cytokine (Fan X,
et al. The
4
CA 3060686 2019-10-25
Journal of Immunology 168: 755-762, 2002.).
Various documents disclosing different TGF-I31 receptors, chimerics, fusion
proteins, domains, are known, for example, EP0975771, WO 2008/157367, US
2006/0247198, US 6001969, and WO 94/09815.
SUMMARY OF THE INVENTION
A soluble isolated isoform of the TGF beta II receptor is provided comprising
a
sequence of about 80 amino acids and lacking the transmembrane domain; wherein
the isoform would be acting as a TG93-1 agonist. In a preferred embodiment,
the
amino acid sequence of the isoform has at least 85 %, 90 %, 95 %, or 99 %
identity
with the amino acid sequence set forth in SEQ ID No. 2. The isoform comprises
within
its sequence the peptide disclosed in SEQ ID No. 12.
A polynucleotide encoding a soluble isoform of the TGF beta II receptor is
provided, which in a preferred embodiment has at least 90 `1/0, 95 %, or 99 %
identity
with the nucleotide sequence of SEQ ID No. 1. In another preferred embodiment,
the
polynucleotide further comprises a Kozak sequence.
A fusion peptide is provided comprising an isoform of the TGF beta II receptor
fused to a ligand. In a preferred embodiment the isoform is an amino acid
sequence
having at least 85 % sequence identity to SEQ ID No. 2 and the ligand is the
Fc of an
immunoglobulin.
An antibody binding the soluble isoform of the TGF beta ll receptor is
provided.
In a preferred embodiment, the antibody binds the amino acid sequence shown in
SEQ ID No. 12.
A method of treating diseases associated to TGF-(3 dysregulation is provided,
comprising administering to a mammal in need thereof the soluble isoform of
the TGF
beta receptor.
A method of treating diseases associated to TGF-I3 dysregulation is provided,
CA 3060686 2019-10-25
comprising administering to a mammal in need thereof an antibody binding the
soluble
isoform of the TGF beta II receptor. In a preferred embodiment the antibody
recognizes and binds the amino acid sequence shown in SEQ ID No. 12. The
associated diseases may be selected from any disorder related to dysregulation
of
TGF-P signals, such as cancer, fibrosis, and cardiovascular diseases;
metabolic and
musculoskeletal defects, mutations in TPRII (TGFBR2 gene), for example, Loeys-
Dietz
syndrome (LDS), Marfan syndrome type 2 (MFS2), or different aneurisms (FTAAD).
DESCRIPTION OF THE DRAWINGS
Figure 1 shows a schematic diagram of the TI3RII receptor indicating the
extracellular (ECD), transmembrane (TMD) and intracellular (ICD) domains. FP
and
RP boxes indicate the forward and reverse primers used to amplify the TPRII
cDNA by
RT-PCR.
Figure 2 shows a gel with the results of recombinant plasmid digestion
containing the two already described human T13R11 (A and B) isoforms and the
newly
described by the present inventors, TpRII-SE, obtained by RT-PCR from human
lymphocytes.
Figure 3 shows the alignment of partial cDNA sequences of the two known
T13R11 (A and B) isoforms, and the one disclosed in the present application
(TPRII-SE);
cDNA sequences include the start codon (ATG) and the last nucleotide encoding
the
transmembrane domain (TMD); the dark grey bar indicates an additional deletion
found in exons II and III of TpRII-SE.
Figure 4 shows alignments of partial predicted protein sequences belonging to
the human TpRII isoforms A and B, and the Tf3R1I-SE; light grey boxes show
residues
involved in disulfide bridges critical for receptor-ligand bonding (C54-C71,
C61-C67);
dark grey boxes show residues which are fundamental for interaction with TGF-
f3
(D55, 176, E142).
6
CA 3060686 2019-10-25
Figure 5 shows the results of detection by RT-PCR of the different T6RII
isoforms (A, B and SE) in different human cell types; HT1080 (fibrosarcoma),
A549
(pulmonary adenocarcinoma), CaCo-2 (colorectal adenocarcinoma), Hep3B (hepatic
carcinoma), Jurkat (acute T-cell leukemia), 2931 (epithelial cells from
embryonic
kidney immortalized with the SV40 virus large 1-antigen), HEK-293 (epithelial
cells
from embryonic kidney immortalized with adenovirus), EBV-LCL (lymphoblastoid
cell
line immortalized with the Epstein-Barr virus), and hASC (stromal mesenchymal
cells
from human adipose tissue).
Figure 6 shows the results obtained by flow cytometry plots showing cell
purity
of monocytes (CD14+), B-cells (CD19+), and T-cells (CD3+) separated by immune
purification.
Figure 7 shows Tf3RII splicing variant mRNA profiles in human leukocyte
subsets, such as granulocytes, T-lymphocytes (CD3+), B lymphocytes (CD19+),
and
monocytes (CD14+).
Figure 8 shows lentiviral vectors encoding the newly described hT6R1I-SE
variant and a dominant negative (DN) mutant of the T6R1I-A receptor under the
action
of the CMV promoter; as a control, a lentiviral vector encoding eGFP under the
CMV
promoter was used. The complete names of the vectors are indicated at the left
side of
the diagram. The abbreviated names are shown on top of each vector.
Figure 9 shows overexpression of T6R1I-SE in A549 cells. A): results of a flow
cytometry analysis showing the percentage of eGFP expressing A549 cells
transduced
with a lentiviral vector encoding T6R1I-SE (Lt-T6R1I-SE) and control vectors;
B): results
of a RT-PCR showing overexpression of T6R11-SE at the mRNA level; C): results
of a
demonstration of the presence of T6R1I-SE only in the supernatant of cells
transduced
with Lt-T6R1I-SE as detected by Western blot with a T6R11 specific antibody
recognizing the extracellular domain.
7
CA 3060686 2019-10-25
Figure 10 shows the results of a proliferative MIT assay. A): A549 cells
untransduced (UT) and transduced with Lt-T6R1I-SE, Lt-TpRIIA-DN, and Lt-eGFP,
treated with 0.4 nM TGF6-1 and untreated. B): TGF6-1 curve in A549 cells
transduced
with a lentiviral vector encoding T6R1I-SE and untransduced (UT). *p<0.05;
**p<0.01,
***p<0.001.
Figure 11 shows: A) results of a flow cytometry analysis of hASC transduced
with lentiviral vectors encoding T6R1I-SE, T6RIIA-DN, and eGFP; and
untransduced
(UT), and B) representative histogram showing percentage of purity after cell
sorting.
Figure 12 shows the results of a RT-PCR analysis of hASC cells showing
overexpression of T6RIIA-DN and T6R1I-SE; GAPDH was used as reference gene.
Figure 13 shows relative mRNA levels of T6RII receptors (T6R1I-A, T6R1I-B and
T6R1I-SE) in untransduced hASCs (UT) and transduced with Lt.T6R1I-SE.
Figure 14 shows mRNA levels of 16R11 receptors in hASCs cells incubated with
and without exogenous TGF6-1.
Figure 15 shows mRNA levels of isoforms T6R1I-A and T6R1I-B in hASCs cells
transduced with lentiviral vectors (Lt) encoding 16R11-SE and control vectors
incubated
with and without TGF6-1.
Figure 16 shows X-ray images of rats treated with ciprofloxacin (CPFX) and
intra-articularly injected in the knees with Lt.coT6R1I-SE, Lt.eGFP, and
culture medium
(vehicle). White arrows indicate radiolucent images.
Figure 17 shows a graphic of serum level measurements for aspartate
transaminase (AST), in the same animals.
Figure 18 shows a cDNA alignment to compare changes made to the
recombinant T6R1I-SE. To obtain coT6R11-SE/Fc (underlined sequence), a Kozak
sequence (light gray box) was included in the TpRII-SE cDNA, to make
translation
initiation more efficient. Additionally, some nucleotides have been changed
(black
8
CA 3060686 2019-10-25
boxes with white letters) for codon optimization, to make translation more
efficient in
human cells. To allow fusion in frame of cDNA with the human IgG-Fc domain
cDNA,
the stop codon of Tf3R1I-SE was removed (italics) and replaced by a Bg/II
recognition
sequence in the new construct. Primers used for PCR-amplification of human
IgG1 Fc
coding sequences are shown in dark gray boxes.
Figure 19 shows protein alignment to compare changes made to the
recombinant TpRII-SE. coTpRII-Se was fused "in frame" to the human IgG1 Fc
domain. Asterisk: Stop Codon; Black Box: linker aminoacids; Grey box: Fc
domain.
Figure 20 shows a schematic diagram of the self-inactivating (SIN) bicistronic
lentiviral vector encoding the fusion cassette coTPRII-SE/Fc together with
ires eGFP,
under the control of an internal CMV promoter.
Figure 21 shows flow cytometry dot plots demonstrating the efficiency of
vector
transduction of Lt.coTpRII-SE/Fc.ires eGFP and the control vector Lt. eGFP.
Figure 22 shows the results of an agarose gel electrophoresis with RT-PCR
products, using primers for amplifying IgG1 Fc, from RNAm of Mock, Lt.eGFP,
and Lt.
coTPRII-SE/Fc transduced A549 cells.
Figure 23 shows the results of a Western blot of cell lysates (CL) and
supernatants (SN) from proteins of Mock, Lt.eGFP and Lt. coTpRII-SE/Fc
transduced
A549 cells.
Figure 24 shows the effect of TPRII-SE/Fc overexpression on gross appearance
of livers in CCI4-induced liver fibrosis in rats. Representative images of
livers
corresponding to animals treated with vehicle (A), 0014 (B) or Lv.TpRII-SE/Fc
+ CCI4
(C).
Figure 25 shows the effect of TpRII-SE/Fc overexpression on body weight and
in the liver to body weight ratio in C014-induced liver fibrosis in rats. A)
Body weight
gain (%) of animals in the different experimental groups. B) Liver to body
weight ratio
9
CA 3060686 2019-10-25
(`)/0) in the different experimental groups. *p<0.05: Vehicle vs CCI4;
#p<0.05: CCI4 vs
Lv.Tr3R1I-SE/Fc + CCI4.
Figure 26 shows the effect of TPRII-SE/Fc overexpression on serum liver
enzymes in CCI4-induced liver fibrosis in rats. Activity levels of serum liver
enzymes in
the different experimental groups: A) AST, B) ALT, C) ALP. Results are
expressed as
IU/L. *p<0.05: Vehicle vs CCI4; #p<0.05: CCI4 vs Lv.T8R1I-SE/Fc + CCI4. AST:
Aspartate aminotransferase. ALT: Alanine aminotransferase. ALP: Alkaline
Phosphatase. IU: International units.
Figure 27 shows the effect of T8R1I-SE/Fc overexpression on liver histology.
H&E staining. Representative images of liver histological sections stained
with H&E of
animals treated with vehicle (A), CCI4 (B) or Lv.T8R1I-SE/Fc + CCI4 (C).
Magnification
100x (upper panel) y 400x (lower panel).
Figure 28 shows the effect of T8R1I-SE/Fc overexpression on liver histology by
Sirius Red staining. A) Representative images of liver histological sections
stained with
Sirius Red of animals treated with vehicle (A), CCI4 (B) or Lv.T8R1I-SE/Fc +
CCI4 (C).
Magnification 40x. B) Quantification of liver fibrosis. Results are expressed
as mean
percentage (%) of Sirius Red-positive area. *p<0.05: Vehicle vs CCI4; #p<0.05:
CCI4vs
Lv.T8R1I-SE/Fc + CCI4.
Figure 29 shows the effect of T8R1I-SE/Fc overexpression on HSC activation.
Representative images showing a-SMA-positive areas in liver histological
sections
from animals treated with vehicle (A), CCI4 (B) or Lv.T8R1I-SE/Fc + CCI4 (C).
Magnification 40x.
Figure 30 shows the effect of T8R1I-SE/Fc overexpression on tumor growth in
vivo. Increased volumen of subcutaneous TN60 mammary carcinoma in syngenic CH3
mice after intratumoral injection with the lentiviral vector of the invention,
(1,5 x 106
tranduction units/tumor) encoding the recombinant fusion protein T8R1I-SE/Fc
CA 3060686 2019-10-25
(Lv.TpRII-SE/Fc) (N=7) (circles); the dominant negative mutant TpRII-DN
(Lv.TPRII-
DN) (N= 6) (squares); and vehicle (cell culture medium) (N= 6) (triangels).
*p<0,05;
**p<0,01.
Figure 31 shows flow cytometry evaluation of intracellular TpRII-SE in
neutrophils from Rheumatoid Arthritis (AR) patients. Flow cytometry plots of
lymphocytes (Top Panel) and neutrophils (Bottom Panel) from patients with low
(P07),
moderate (P02) and high (P03) disease activity, where 113R11-SE was detected
by
using the anti-TORII-SE monoclonal antibody of the invention conjugated with
ATT0647N. Left Panel shows lymphocytes from PBMC (Top) and neutrophils
(bottom)
taken to analyze the percentage of cells expressing TpRII-SE.
Figure 32 shows the correlation analysis between the percentage of neutrophils
evaluated by flow cytometry from 19 AR patients expressing TpRII-SE, and AR
disease activity measured by DAS28-ESR (Disease Activity Score ¨
erythrosedimentation rate) of the same patients. rs= Spearman's rank
correlation
coefficient.
Figure 33 shows the correlation analysis between TpRII-SE protein levels in
peripheral blood plastic adherent cells from 5 patients evaluated by In-cell
ELISA, and
DAS28-ESR of the same patients. rs= Spearman's rank correlation coefficient.
Figure 34 shows the experimental design and time schedule of CCI4 injection,
administration of the lentiviral vector of the invention, and sample
acquisition for
analysis. Animals were euthanized by CO2 inhalation after 72 hours of the last
CCI4
injection.
DETAILED DESCRIPTION OF THE INVENTION
A variant or isoform of the TGF beta receptor II is disclosed, which is
expressed
in human cells referred to herein as endogenous soluble TPRII (TPRII-SE) and
that
11
CA 3060686 2019-10-25
contrarily to other isoforms acts like a TGF-131 agonist.
By using specific primers, a region of the human TI3RII mRNA from T-
lymphocytes only encoding the extracellular (ECD) and the transmembrane (TMD)
domains and excluding the intracellular domain (ICD) was initially amplified
by RT-
PCR, (Figure 1).
After the PCR reaction, DNA products were cloned into the pGEM-T Easy
plasmid. Plasmids were digested with Agel and Sall and revealed in an agarose
gel
the presence of clones with inserts of three different sizes (Figure 2). Clone
2
contained an insert of 650 bp. In clones 3, 7, 8, 11, and 12 the insert size
was of 580
bp and in clone 10 the size reflected the presence of an insert of 430 bp.
DNA sequencing and BLAST alignment (NCBI) of all clones indicated that
clones 3, 7, 8, 11, and 12 (582 bp) were identical to human TGF 13 receptor II
variant A
(T13R11-A). Additionally, clone 2 (657 bp) showed 100 % identity with the
isoform TpRII-
B. Clone 10 (433 bp) was similar to the T13R1I-A sequence but with an
additional 149
bp deletion. In this clone, the last 62 bp encoded by exon II and the first 88
bp
encoded by exon III were absent, TI3R1I-SE (SEQ ID No. 1) (Figure 3).
The alignment of the predicted amino acid sequence of all three isoforms
(Figure 4) indicated that the deletion found in clone 10 generates a
frameshift starting
at amino acid 68, which adds a stop codon 13 amino acids after the deletion
generating a prematurely terminated 80 amino acids long isoform lacking the
transmembrane domain and this is the new isoform TI3R1I-SE (SEQ ID No. 2).
This isoform differs in 12 amino acids at the carboxyl end compared to the
membrane bound variants of T13R11 (isoforms A and B). Due to this, and
according to
the predicted amino acid sequence, the TI3R1I-SE isoform of clone 10 lacks
pivotal
sites for the productive action of TGF-I3 such as amino acid 176 of SEQ ID No.
3 that
contributes to the ligand-receptor binding through hydrophobic contact; amino
acid
12
CA 3060686 2019-10-25
E142 of SEQ ID No. 3 which forms hydrogen bonds with R25 of TGF-13 increased
affinity and determined binding specificity and amino acid C71 of SEQ ID No. 3
which
forms a disulfide bridge with C54 of the same receptor (see Figure 4)
necessary both
for binding to the ligand and for signaling (reference, Alain Guimond, et. al.
FEBS
Letters 515: 13-19, 2002). Thus, the TORII-SE isoform might not be able to
bind TGF-
131 with the same affinity than that of known isoforms. Additionally, due to
the
premature termination, the TORII-SE isoform lacks the amino acid sequence
belonging
to the transmembrane domain (TMD), showing the presence of a new endogenously
secreted soluble TORII isoform in human T-lymphocytes.
As previously mentioned, the new isoform is referred to as TORII Soluble
Endogenous (TORII-SE). The TORII-SE isoform is different from the secretable
genetically engineered TORII isoform. The latter is an artificial TORII
receptor with a
truncated TORII-A fused to the Fc region of human IgM and blocks the effects
of TGF-
13, thus acting as an antagonist (reference, R. J Akhurst. J. Clin. Invest.
109: 1533-
3610, 2002).
To determine the theoretical molecular weight of the TORII-SE isoform, post-
translational modifications (PTM) predicted from the amino acid sequence (SEQ
ID
No. 2) were established by using different computer programs (Table 1). In
this
analysis, three glycation sites at K46, K52 and K78 (NetGlycate program)
(Johansen,
M. B.; Glycobiology 16: 844-853, 2006); three phosphorylation sites at S31,
359 and
Y73 (NetPhos program) (Blom, N.; Journal of Molecular Biology 294: 1351-1362,
1999) and one site for sumoylation in K46 (SUMOplotTm program, ABGENT, CA,
USA)
were identified. On the other hand, sites for sulfonation, C-mannosylation, 0-
GaINAC
glycosilation, 0-glycosilation, N-glycosilation, myristoylation, and
palmitoylation were
not found in TORII-SE. In this study it was estimated that the molecular
weight of the
mature TORII-SE isoform was of about 18.4 kDa.
13
CA 3060686 2019-10-25
Table 1.
In silico analysis of the TORII-SE amino acid sequence showing predicted post-
translational modifications and molecular weight with and without
modifications.
Predicted p1/theoretical 9.64/9161.72
Mw
p1/Mw without a signal 9.05/6532.51 6,532.51 kDa
peptide
Secretion probability of 0.960 (first 12 aa) SignalP Program
the signal peptide
Clivage site Between pos. 23 SignalP Program
and 24
C-mannosylation No sites
GaINAc 0-glycosylation No sites
Glycations 3 sites (Lys 46, 52, NetGlycate 0.558 kDa
and 78) Program (0.186 kDa
each)
N-glycosylations No sites NetNGlyc
Program
0-Glycosylations No sites (OGPT Program)
0-(beta)-GIcNAc No sites
Myristoylation No sites
Palmitoylation No sites
Phosphorylation 3 sites (Ser 31 and NetPhos 0.285 kDa
59, Tyr 79) Program (0.095 Da each)
Sulfonations No sites
Addition of SUMO 1 site (Lys 46) SUMOplot 11 kDa
protein program
Final Mw with 18.4 kDa
modifications
To confirm whether TORII-SE mRNA was also present in human cells other than
lymphocytes, we amplified by RT-PCR using the same set of primers various
human
cell lines and primary cultures (Figure 5). It may be observed that human
solid tumor
derived cell lines, for example, HT1080 (fibrosarcoma), A549 (lung
adenocarcinoma),
CaCo-2 (colon cancer) and Hep 3B (hepatocellular carcinoma) only showed the
presence of mRNA of variants A and B, but not TORII-SE. Additionally, in
Jurkat cells
(acute lymphoid leukemia), 2931 cells (embryonic kidney cells immortalized
with the
SV40 1-antigen), HEK-293 cells (embryonic kidney cells immortalized with the
14
CA 3060686 2019-10-25
adenovirus El A protein, EBV-LCL (Lymphoblastoid Cell Line immortalized with
the
Epstein Barr Virus) and ASC (human adipose derived mesenchymal stem cells)
passage 6 primary culture, mRNA encoding for TORII-SE was present in all cases
(Figure 5). The presence of the TORII-SE isoform was further confirmed by DNA
sequencing.
To check whether TORII-SE is also present in leukocytes different from T-
lymphocytes, granulocytes, monocytes, B-cells and 1-cells were purified from
human
peripheral blood by density gradient and subsequent magnetic immune-
purification
with specific monoclonal antibodies, to high purity (Figure 6). RT-PCR
analysis
showed that TORII-SE is present in all leukocyte subsets but with different
expression
levels (Figure 7).
To determine whether TORII-SE may be secreted to the extra cellular medium,
TI3R1I-SE cDNA was cloned downstream from the ubiquitous promoter CMV in a
self-
inactivating (SIN) bicistronic lentiviral vector also expressing eGFP, as
described in the
examples, to generate the Lt-TORII-SE vector. As a control, two lentiviral
vectors were
used: one bicistronic encoding a dominant negative TORII mutant together with
eGFP
(Lt-TORIIA-DN) and another encoding eGFP alone (Lt-eGFP), also under the
action of
the CMV promoter (Figure 8).
With these lentiviral vectors, shown in Figure 8, A549 cells were transduced,
at
an MOI of 50. Seventytvvo hours after transduction, cell supernatants were
frozen for
further experiments and the percentage of eGFP expressing cells was measured
by
flow cytometry (Figure 9A). In cells transduced with Lt-TORII-SE and Lt-eGFP,
68.63
% and 65.27 % of the cells, respectively, showed integration of the lentiviral
vector as
demonstrated by eGFP expression. RT-PCR of Lt-TORII-SE transduced cells
revealed
the presence of a 433 bp band, indicating overexpression at the mRNA level of
the
TORII-SE isoform (Figure 9B). Cell supernatants were thawed, and Western
blotted as
CA 3060686 2019-10-25
described in the examples (Figure 9C). Only TpRII-SE was detected in the
supernatant of Lt-TpRII-SE transduced A549 cells cultured in the presence of
protease
inhibitors.
The molecular weight of 113R11-SE detected by Western blot is in agreement
with the predicted molecular weight, after the addition of post-translational
modifications (18 kDa) (Table 1). This is the first evidence ever that there
exists a new
secretable TpRII receptor variant or isoform in human cells.
To show the function of the TpRII-SE isoform, functional assays were carried
out wherein untransduced, expressing nearly undetectable levels of TpRII-SE,
transduced with lentiviral vectors encoding eGFP alone, or bicistronics
together with
either TpRII-SE or the dominant negative (DN) mutant of the TPRIIA variant
known to
work as a TGF-P1 antagonist, A549 cells were used.
Initially, MTT ((344,5-dimethylthiazol-2-y1]-2,5-diphenyltetrazolium bromide;
thiazolyl blue) assays were performed to evaluate if overexpression of TpRII-
SE
inhibits or not cell proliferation in the presence of 0.4 nM TGF13-1 (Figure
10A). As may
be noted, in the presence of TG193-1, TpRII-SE-transduced cells proliferate
significantly less than the same cells not treated with TGFP-1 and at levels
found in
control untransduced cells (UT) and Lt.eGFP-transduced cells.These results
indicated
that TPRII-SE is not a TGFP-1 antagonist.
Additionally, to check whether TPRII-SE acts as a TGF3-1 agonist, A459 cells
either overexpressing TORII-SE or not (untransduced cells or UT) were
incubated in
the presence of increasing concentrations of TGFP-1 (Figure 10B). These
results show
that in UT cells, proliferation started to decrease in the presence of 0.2 nM
TGFP-1
compared to the values obtained in the absence of TGF131. However, in cells
overexpressing TPRII-SE, proliferation started to decrease at a TGFp-1
concentration
of 0.1 nM compared to the same cell line without the addition of TGF-I31.
These results
16
CA 3060686 2019-10-25
indicate that in cells overexpressing TORII-SE, TGF3-1 achieved the same
effect than
in UT cells but at half concentration, which would suggest that the TORII-SE
isoform
may act as an agonist.
To further assess the agonistic role of the 113R11-SE isoform, hASCs were
transduced with Lt-TORII-SE, Lt-TORIIA-DN, and Lt.eGFP, at an MOI of 150 as
described in the examples. Seventy two hours after transduction the percentage
of
eGFP expressing cells was measured by flow cytometry (Figure 11A). For further
experiments with pure cell populations, transduced cells were expanded and
cell
sorted in a FACSAriall Cell Sorter (Becton Dickinson, San Jose, CA) to a
purity of
eGFP-expressing cells of more than 90 % (Figure 11B), indicating that most
cells
overexpress the new isoform.
RT-PCR performed on poly A+ mRNA from either transduced or untransduced
hASC cells showed the pattern of TORII isoforms expression depicted in Figure
12.
Cells overexpressing TORII-SE showed a strong band of 433 bp and a weak band
of
582 bp reflecting the fact that overexpression of TORII-SE downregulates TORII
isoform A expression. Similarly, when TORIIA-DN was overexpressed in hASC
cells,
TORII-SE expression (433bp) could not be detected. Finally, in hASC cells
transduced
with the lentivector encoding only the eGFP marker gene, a weak band
representing
expression of TORII-A was detected, suggesting that viral transduction "per
se"
downregulates TORII expression.
mRNA levels of all three isoforms of Type ll TGF-13 receptor were also
quantified by qRT-PCR (Figure 13). It was found that in untransduced cells
(UT),
membrane bound TBRII-A and B variants were the main molecules to be expressed
and TORII-SE expression was minimal, as expected. Contrarily, when the new
isoform
expression was increased in hASC cells, both TORII-A and B variants decreased
dramatically, due to a compensation effect which shows the agonistic effect of
the
17
CA 3060686 2019-10-25
T6R1I-SE isoform.
This compensation effect was also verified by addition of exogenous TGF-61
and analysis of mRNA levels of the T6R11 variants in hASCs cells (Figure 14).
It was
found that upon addition of TGF-131 , T6R11-A increased and TI3R1I-SE
decreased
compared to untreated cells, suggesting once again that the TpRII-SE isoform
acts as
a TGF-61 agonist.
According to this, it was also found that mRNA of both T6R1I-A and Ti3R1I-B
are
highly upregulated (40- and 50-fold increase, respectively) in cells
overexpressing Lt-
T6R11-SE in the presence of physiological concentrations of TGF-I31 compared
to
levels of mRNA produced in the absence of exogenous TGF-61, further confirming
the
role of Ti3R1I-SE acting as a TGF-131 agonist by increasing the expression of
membrane-bound receptors Ti3R11 and TI3R1I-B (Figure 15).
Furthermore, the effect of TI3R1I-SE recombinant isoform was measured on a
panel of 80 cytokines secreted by hASCs cells (Figure 16). Cells were
transduced with
either control Lt-GFP, the TGF461 inhibitor Lt. Ti3R1I-DN, or Lt-T6R1I-SE and
incubated
in the presence or absence of exogenous TGF-61. Collected supernatants were
used
to analyze the cytokines in a Cytokine Array G5 (Raybiotech, Inc. Norcross,
USA).
Table 2.
18
CA 3060686 2019-10-25
Pub:Kona 7G7-111 Paramine TC4-1(1 ape/sal)
III 711911-ON Ilt.763111-SE Imuutuced ;u.T3111I-SE
Hernatopmef feeetolones stenulobbeticaytokines ,
1..CSI _i I 4, _ 6-C66 ar lab, 4
M C Y T I UC 38-CSE abs
GIVI.tsf T ! -7 Guts, T RAI 4
11.6. UC , 1X 11.-6' IX UC
T (UM 1 4, 11.7 UC 1 _ 4 _
UF 1.1- 1 UC UF _ 73A1...g_a..- tic
ar3 1 FL13-1. UC- UC__.
SCF abs ' alb WI LC UC ,.
1
It. 3 T = 1/C ii 3 4 4. .
Om M UC ! .1. Onc M abs abs ,
An logerec tram** An4O98n.r cytoteses
11C3F t(045) - . 4(1,854 VEGF _ J(235) ; 1...0
Anrcgen.n LC LK Angogenon .3. (159) I (K ,
Ha 3.4181) Is (465) SIGF 4. t(416) _
(OF abs abs CGS 4
1161 Ur 4 111,1 4. 4. .
thane-tines C he rno4ones
GPO VC _ _ , LOC_ GPO tic 1 UC
eXCII)GRCR 1` (IC C XCL1 (C.90 abs - labs
CMOS (EN13., VC t 11.63 C5C15 ((NA- / (1,64) , OC
_ 0106(6CP. tX (IC SeCt6 (GCP. / (2,41) 4. .
8 OICLAM.83 _ 1K. 41461 76 (xas vt. al) IX 441.57a
cxcpitas,a (IC (IC . CXC19 (7-08G) 4 - -_. - 4.
CINI 10(11.1 tit-- - . (IC CX.C110OP 1, 4- - 4.
Ceal2(601 i" UC OK& 1/ iSOt tit - abs -
ClfC113(13LC abs ran CXCL13 i 81C 4. 4
CC1.1 (I. 309) T UC (CLIP-309) in abs õ
(C1.2 (MCP-1 IX ix Ca/ (MCP. 1 IX ! UC
CCI4IMP1b 1- '. UC CCIAIMPIO abs labs
CCL511413411 4(198) . 4(7,85) CC1.51PANTE 4(3.33) ', -5.(42q
CCL7 (mu,- 1 IX , LK Cal (MCP-1 IX / TAM_
E CCL8 (MCP. a 4.13,60) .i. E cctsimcp.; t 1 uc
CCM (Colas VC -, 4.42,31) CCL111Fo1a, IX IX
CCLITITARC UC / 1.1C CCU 7 1 TAIIC IX UC .
CCL1S (PARC 113.46) I 4. CCL181PARC 4 T 13,381
CCL2OEM.P3,abs abs ccul? (MT A_ UC vc
.(1.1-2'.1([0% =& _ . k _ _ CC124 (FotaNabs abs
CCL/61totatabs teb; Cale (Eota.abs _abs
(61-fl family TWA F anal
701-81 T 1E57/ ' 1== 1494/ TGF-41 I tIC i VC
10 tC4- i= Ma , ) t 4. (LW TGF-42 IX i 4.12.271
IONA. like Growth Factor Supertanot Insulin tete Growth Facto, Supwfarmi)
101.1 4. 1 161.1 as
*FP- 1 l= lIC I0111-1 its -
1G7BIT 3 4(11,88) 4 I0181.3 4 1: 4 ,
166111,11 at abs ttaFeR.4 VC , T .
Turner Necrosis ream Sumatra'', Yuma NOCTIAllof WO, SYDVI8Tily
9041,4 t ViTii 1 4' iNf.stplia ... UC__ 4.,___
1141-it tie 4.114151 1141.4 . 4. 1
lIGHT abs in LIGHT 4 I- 4 .
f throated Growth Pato, Parole Ilboblast Growth Factor family
FGF -7 VC 4. FC4-7 * ' -- = abs .
101.9 / . LC 101.9 I uc tic
bleutotthobas Neurotrophins ,
WOO T l uc SOW abs abs
NT 3 T 1 tX NT-3 Er .
4, _
141-4 EK UC 661,1 in abs .
we Inhibitor of Metalloprotemases Fat ue inthhitar of Metal lop ot einases
Fat
NW- 1 (IC I UC TOO- 1 1(226) 1 IX
THAV 2 IX ! IX 111/P-2 .7 (7-071 I
('(1.12)
Macrophage Actwatinp Factors Macro , Actvannii C a COM
Pail tIC i .4. 4811 y I y
MN (IC 1 t_tk9a MI4, (1,78) ' VC
= .,
R./ t 1 (IC ff.- 2 labs tabs
t -I
Bone Remodeling C/toh ines Bone beinedeltheCiottoes
Osteopaths abs abs Osteopootil 4. 4.
Osteoprotes t/C ! UC Oueoptote UC 4(8.32)
Hormones H0f1110MS
100tin I 4(E79) / .1 16PI1P I 441.12) 1 4. (ILU)
WU Farn.I 61:441 Farnrly
GONF i ur I it 14*0 Wig lob, :
ftnts=inflammatonf lotetletabls Anti snflemmatote Intsrls.km,
11.-10 t 1 14 11.10 1
11-13 I_ t stAiLl 4.
4Ø471 4 11.13 4. I 4. _
Pio otammatory Interleulorn= Pro..nllamrrtwor e ,nterle.tins=
IL-la C(8.11) t 4, '11,. 4. , .4.
IL. Li in t
,abs It-18 UC UC -
- IL-5 . (IC 1. 1E871 11. 5 _ t (541) .4,
..
It.12p211... 1 , Ix' _ 11.17pm õ.4, .. 4. .
11 15 in ,abs It-15 4, 4. _
The results obtained with cytokine arrays are shown in Table 2. Increase or
19
CA 3060686 2019-10-25
decrease of cytokines levels are referred to the levels secreted by cells
transduced
with the control vector Lt.eGFP either in the presence (paracrine) or absence
(autocrine) of exogenous TGF-131 . UC: unchanged levels with respect to cells
transduced with the control vector Lt.eGFP. Abs: absent in mock transducer
cells
control. Dark grey boxes: decreased to undetected levels or absent in the
supernatant
of cells transduced with control vector Lt.eGFP.
Light gray boxes: cytokines present.
It is shown that in ASC cells overexpressing Tr3R1I-DN with a high TGF-131
concentration, OPG secretion remains unchanged with respect to the values
obtained
in Lt.eGFP-transduced control cells, making cells insensitive to TGF-I31.
On the other hand, high TGF-131 concentrations caused a dramatic drop of OPG
secretion in Tf3R1I-SE overexpressing cells compared to control cells (Lt.eGFP-
transduced). The Tr3R1I-SE isoform acts oppositely to the TGF-131 inhibitor
(TPRII-DN)
and seems to favor osteoclastogenesis.
Table 3 summarizes the results obtained by other authors, and those compared
to the results disclosed in the present application regarding the cytokine
array and the
relationship with osteoarthritis (OA).
Results of the
MSC/Osteoblasts Disease Bone/cartilage remodeling Invention
Bone loss/increase of osteoclastic
Lower OPG
resorption TGF-131 agonist
High TGF-131 OA Increased PTG content
Higher HGF
High angiogenesis
TGF-131 agonist
Osteophyte outgrowth
Higher OPG
Decreased osteoclastic resorption
TGF-131
Decreased PTG
TGF-131 inhibition (TpRII-DN) antagonist
No
0A-like content/increased cartilage loss HGF
Angiogenesis TGF-131
Decreased osteophyte formation
antagonist
It is shown that in cells overexpressing T13R11-SE HGF secretion is highly
upregulated both in the presence (4.16 times) or absence (7.65 times) of
exogenous
CA 3060686 2019-10-25
TGF-131, whereas in cells overexpressing the dominant negative mutant TpRII-
DN,
HGF secretion decreases 1.81 times or is absent, in the absence and presence
of
exogenous TGF-P1 , respectively. These results show that the TpRII-SE isoform
is
involved in the positive regulation of HGF.
Increased TGF-131 acts differently in animals depending on whether injections
were applied in normal or osteoarthritic models. In normal animals, either TGF-
P1
protein or adenovirus TGF-131 injection generates increased synthesis and
content of
proteoglycan and osteophyte formation. On the other hand, in osteoarthritis
(OA)-
induced models, increases in the TGF pathway help to decrease cartilage
damage,
proteoglycan and osteophyte formation. Thus, the effect of the 11311-SE
isoform was
analyzed either in CPFX-treated juvenile rats (24 days old) or untreated rats,
by intra-
articular injections of lentiviral vectors encoding a recombinant protein of
the codon-
optimized (co) TPRII-SE fused to the constant fragment (Fc) of the human
immunoglobulin 1 (IgG1) (Lt.coTpRII-SE/Fc) or the enhanced green fluorescent
protein (Lt.eGFP).
Seven days after injecting the vector into rats treated with ciprofloxacin
(CPFX),
only articulations overexpressing the fusion peptide or a fused coTPRII-SE/Fc
isoform
showed radiolucent images with irregular borders in the femoral condyle,
consistent
with intraosteal geodes (Figure 16). It is shown that coTPRII.SE/Fc could
cause
osteolytic damage by bone resorption.
When compared to serum levels of urea, creatinine, total proteins, albumin,
alkaline phosphatase, alanine transaminase (ALT), and aspartate transaminase
(AST),
a statistically significant difference was only found for the latter. An
increase in
aspartate transaminase (AST) was only observed in serum of rats treated with
CPFX
and intra-articularly injected with Lt.coTpRII-SE (Figure 17). Mitochondrial
and
cytoplasmic forms of AST are found in all cells, so the increase of AST which
was only
21
CA 3060686 2019-10-25
observed in rats injected with Lt.coTpRII-SE/Fc in combination with CPFX show
that
coTi3R1I-SE enhance the effect of CPFX on tissue damage in muscle, tendons or
other
tissues.
In the present application, the generation of a new recombinant TPRII-SE
protein expressed in human cells is shown. It is known that in nature, the
concentration of soluble receptors is very low, thus, to increase the levels
of the
recombinant Tf3R1I-SE protein, the original coding sequence was codon
optimized, and
a Kozak sequence was included (Epoch Biolabs Inc., Texas, USA) referred to
herein
as coTPRII-SE (SEQ ID No. 4) and encoded by SEQ ID No. 5 (Figure 18).
Additionally,
to make the protein more stable in vivo, and for a more effective
purification, the
human IgG1 Fc region was cloned "in frame" downstream of the coding sequence
of
coTpRII-SE to obtain the fusion peptide coTpRII-Se/Fc, as previously mentioned
(SEQ
ID No. 6), encoded by SEQ ID No. 7 (Figures 18 and 19).
As can be observed, Figure 18 shows a cDNA alignment to compare changes
made to the recombinant TpRII-SE. To obtain the coTPRII-SE/Fc (underlined
sequence), a Kozak sequence (light gray box) was included in the TPRII-SE
cDNA, to
make the initiation of translation more efficient. Additionally, some
nucleotides have
been changed (black boxes and white letters) for codon optimization, in order
to make
translation more efficient. To allow fusion in frame of cDNA with the human
IgG-Fc
domain cDNA, the stop codon of TpRII-SE was removed (italics) and replaced by
a
Bg/II recognition sequence in the new construct. Primers used for PCR-
amplification of
human IgG1 Fc coding sequences are shown in dark gray boxes.
As can be observed, Figure 19 shows a protein alignment and allows for
comparing changes made to the recombinant TpRII-SE. coTpRII-Se was fused "in
frame" to the human IgG1 Fc domain. Asterisk: Stop Codon; Black Box: linker
aminoacids; Grey box: Fc domain.
22
CA 3060686 2019-10-25
Subsequently, the recombinant coT8R1I-SE/Fc cDNA was inserted between the
Agel and EcoRV sites of a SIN lentiviral vector (Figure 20).
To check recombinant protein production, A549 cells were transduced at an
M01=300 either with the control vector Lt.eGFP (93 % of eGFP expressing cells)
or
Lt.coT8RII.SE/Fc (47.53 % of eGFP expressing cells) and Mock transduced
(Figure
21).
To verify the presence of human IgG1 mRNA in Lt.coTPRII-SE/Fc transduced
cells, total mRNA of Mock transduced (vehicle), Lt.eGFP transduced and
Lt.coT8R1I-
SE/Fc transduced cells was extracted and RT-PCR assays were performed using
specific primers for human IgG1-Fc (Figure 22). As expected, human IgG1 Fc
domain
mRNA was only detected in Lt.coT8R1I-SE/Fc transduced A549 cells.
Additionally, to verify the presence of the TPRII-SE/Fc protein both in cell
lysates and supernatants, total proteins from Mock, Lt.eGFP and Lt.coT8R1I-
SE/Fc
transduced cells lysates and supernatants were western blotted (Figure 23)
using a
monoclonal antibody, capable of specifically detecting T8R11-SE. In this way,
a
predicted protein of circa 50 kD could be detected, which included 18 kD of
T8R11-SE
plus 35 kD of the human IgG1 Fc domain, both in cell supernatants and lysates
of
acoT8R11-SE/Fc-transduced cells only.
A method to treat liver fibrosis was developed employing the lentiviral vector
encoding the fusion protein T8R1I-SE/Fc of the invention.
To study the effect of T8R1I-SE/Fc expression on liver fibrogenesis, a rat
model
of carbon tetrachloride (CCL4) induced liver fibrosis was used. After animal
euthanasia, liver gross appearance was evaluated macroscopically. Figure 24
shows
that livers from group I (vehicle), exhibited a reddish color, a smooth
lustrous surface,
and a regular shape. As it was expected, in CCI4-treated animals livers looked
shrunken with irregular shape, an opaque color, and an unsmooth surface. Rat
livers
23
CA 3060686 2019-10-25
of the Lv.TORII-SE/Fc + CCI4 group had a more regular shape, were redder and
their
surfaces were smoother than liver surfaces of the CCI4-group. These results
suggest a
beneficial effect of TORII-SE/Fe expression at macroscopic level against 0CI4-
induced
fibrosis in rats.
Effect of TORII-SE/Fc expression on body weight and liver to body weight
ratio:
body weight was controlled in all rats throughout the experiment. It was
observed that
CCI4 treatment during eight weeks caused a growth retardation of rats,
evidenced by
the decrease of final body weight gain compared to rats of the vehicle group.
Injection
of Lv.TORII-SE/Fc partially reversed the BW loss induced by this hepatotoxic
agent.
This beneficial effect was more evident after 4 weeks of CCI4 administration
(Figure
25A). In addition, CCI4 administration induced an increase in the LW/BW ratio
respect
to the rats of the control group injected only with vehicle, suggesting liver
injury and
extracellular matrix protein accumulation. Injection of Lv.TORII-SE/Fc prior
to the
treatment with CCI4 led to a LW/BW ratio comparable to that found in the
Vehicle
group of rats, suggesting a beneficial effect of TORII-SE/FC expression
against liver
injury induced by CCI4 (Figure 25B).
Effect of TORII-SE/Fc expression on serum liver enzymes: to evaluate liver
iniurv, AST and ALT serum levels were determined. As it is shown in Figures
26A and
B, CCI4 administration significantly increased both transaminase levels
respect to
those found in the Vehicle group of rats. Conversely, injection of Lv.TORII-
SE/Fc
induced a significant decrease in AST and ALT levels. On the other hand, ALP
showed increased response to CCI4 administration, which was reversed as a
result of
the Lv.T13R1I-SE/Fc injection (Figure 26C). These data suggest that TORII-
SE/Fc
expression exerts a beneficial effect against liver injury induced by CCI4.
24
CA 3060686 2019-10-25
Effect of TORII-SE/Fc expression on liver architecture: histological sections
were stained with H&E to evaluate the general architecture of the liver. This
analysis
revealed that animals that received vehicle instead of CCI4, presented livers
with a
conserved architecture with cords of hepatocytes radiating from central veins
(Figure
27A). Conversely, CCI4 administration during 8 weeks led to a disrupted liver
architecture, extensive liver injury and prominent fibrosis (Figure 27B).
These
detrimental effects were clearly attenuated when animals were injected with
Lv.T13R11-
SE/Fc before the treatment with CCI4 (Figure 27C).
Effect of T13R1I-SE expression on liver fibrosis: collagen deposition was
evaluated by Sirius Red staining in liver sections from different experimental
group
rats. CCI4 administration induced extensive deposition of collagen fibers
evidenced by
the observation of bridging fibrosis. Figure 28A shows that Injection of
Lv.Tr3R11-SE/Fc
reduced liver fibrosis induced by CCI4 (Figure 28A). Quantification of Sirius
Red-
positive areas (SR+) demonstrated a significant increase in collagen
deposition in the
CCI4 group compared to the Vehicle group. However, Lv.113R11-SE/Fc
administration
significantly reduced SR+ areas, with reference to the CCI4 group (Figure
28B).
Moreover, a-SMA expression, a known marker of hepatic stellate cell (HSC)
activation,
was evaluated by immunohistochernistry. In comparison to rats only injected
with
vehicle, CCI4 treated animals showed a prominent increase of a-SMA-positive
areas.
However, HSC activation was markedly reduced in CCI4 rats treated with
Lv.T13R1I-
SE/Fc (Figure 29). These data demonstrates that TpRII-SE/Fc expression reduces
HSC activation, decreases pathological collagen fiber deposition, and limits
liver injury
induced by CCI4.
CA 3060686 2019-10-25
Use of the Lv.TpRII-SE/Fc vector to treat cancer: it was observed that
intratumoral TpRII-SE/Fc overexpression inhibits tumor growth (Figure 30),
compare to
controls.
Assays were conducted to determine rheumatoid arthritis (RA) disease activity
by
means of measuring TpRII-SE by flow cytometry, with the TpRII-SE monoclonal
antibody of the invention, conjugated with ATT0647N. The percentage of
neutrophils
expressing TpRII-SE (Figure 31, bottom panel) was quantified taking as basal
reference the highest 113R11-SE A110647N fluorescence value in the lymphocyte
population of each patient. (Figure 31, top panel).
When the percentage of neutrophils expressing TpRII-SE of each patient was
correlated with its matching disease activity score (DAS28-ESR) value, it
could be
observed a negative correlation (Spearman's rank correlation coefficient rs. -
0,69),
statistically significant (p= 0,0009), (Figure 32). These data suggested
variation in the
levels of this isoform in RA patients. In this sense, TpRII-SE might be used
as a
therapeutic target. Also, the results give evidence that the evaluation of
TpRII-SE in
neutrophils might represent an alternative assay to determine RA disease
activity in
patients.
Also, experiments were carry out to detect intracellular TpRII-SE
concentration by In-
cell ELISA in neutrophils from patients (N=5) with diferent RA activity
levels. (Table 4).
Table 4
Patient ID Number Relative TORII-SE levels
9 16,48
15,98
11 20,69
26
CA 3060686 2019-10-25
12 10,26
13 5
Relative intracellular TpRII-SE protein levels in neutrophils from RA patients
were
correlated with their matching DAS28-ESR score (Table 5).
Table 5
Patient ID Number Relative TORII-SE levels
9 2,76
10 3,09
11 4,22
12 4,31
13 6,24
When both sets of data were analyzed by the Spearman's Rank correlation test,
a
negative correlation was observed between Ti3R1I-SE levels and DAS28-ESR
(Figure
33), where 113R11-SE levels decreases while DAS28-ESR score increases (Disease
activity: (Low = 2.4 < DAS28 3.6, moderate = 3.6 < DAS28 5 5.5, High = DAS28>
5.5
(2).
This invention is better illustrated in the following examples, which should
not be
construed as limiting the scope thereof. On the contrary, it should be clearly
understood that other embodiments, modifications and equivalents thereof may
be
possible after reading the present description, which may be suggested to a
person of
skill without departing from the spirit of the present invention and/or the
scope of the
appended claims.
Examples:
Example 1: isolation, cloning and sequencing of the TPRII-SE isoform
Human adipose derived mesenchymal stromal cells (hASC) were obtained from
27
CA 3060686 2019-10-25
20 g subcutaneous fat following the protocol described by Zuk et al. (Zuk PA,
et al. Mol
Rio' Cell 13: 4279-95, 2002) and cultured in the presence of DMEM supplemented
with
% human serum and 1 % L-glutamine. Epstein Barr Virus immortalized
lymphoblastoid cells were generated from peripheral blood mononuclear cells as
described (Protocols in Immunology) and cultured with RPMI medium. Human A459
(lung adenocarcinoma), HT1080 (fibrosarcoma), Caco-2 (colorectal carcinoma),
Hep
3B (hepatocellular carcinoma), Jurkat (acute lymphoblastoid leukemia), HEK293
(human embryonic kydney), and 293T cell lines were cultured in DMEM
supplemented
with 10 % FCS and 1 % penicillin/streptomycin. The cells were cultured in a
humidified
5 % CO2 incubator at 37 C.
Purification of different leukocyte subpopulations
Granulocytes, lymphocytes and monocytes were isolated from heparinized
peripheral blood by Ficoll-PaqueTM PLUS (GE Healthcare Bio-Sciences AB)
gradient
centrifugation. After centrifugation two fractions were obtained, one
containing
granulocytes/erythrocytes and another with peripheral blood mononuclear cells
(PBMC). To obtain granulocytes, erythrocytes were lysed with KCI 0,6 M. PBMCs
were labelled with anti CD3+, CD14+, and CD19+ monoclonal antibodies
conjugated
with magnetic microbeads (Miltenyi Biotech) and separated using MS columns
(Miltenyi Biotech) in a MiniMACS magnet (Miltenyi Biotech). Viable cells were
determined by Trypan blue dye exclusion and counted in an hemocytometer. The
purity of B- and T-lymphocyte and monocyte sub-populations was determined by
flow
cytometric analysis using a FACSCalibur flow cytometer (BD Biosciences). Cell
sub-
populations homogenized in RNA Lysis Buffer (SV Total RNA Isolation System,
Promega) were stored at -80 C until RNA extraction.
Cloning and sequencing of PCR fragments
Tr3R11 PCR fragments were cloned by insertion into the pGEM-T Easy plasmid
28
CA 3060686 2019-10-25
(Promega Corporation WI, USA) under the conditions established by the
,
manufacturers and E. coli transformation.TORII PCR fragments were sequenced by
using M13 forward and direct primers in a DNA sequencer ABI 3130 (Applied
Biosystems Inc, CA, USA).
Example 2: Cloning of the codon optimized (co) TPRII-SE/Fc isoform
fusion construct
The TI3R1I-SE coding sequence containing an Agel site was codon optimized,
the stop codon was deleted and a Kozak sequence included (Epoch Biolabs Inc.
Texas, USA). The human IgG1 Fc coding sequence was obtained by RT-PCR from
total blood mRNA using specific oligonucleotides as primers (forward: 5'AGA
TCT
GAC AAA ACT CAC ACA TGC 3' (SEQ ID No. 8) and reverse: 5' GAT ATC TTT ACC
CGG AGA CAG G 3' (SEQ ID No. 9)), containing a Bg/II site (forward primer) and
EcoRV (reverse primer), to allow in frame fusion to Ti3R1I-SE and to the
lentiviral
vector, respectively. The fusion construct (coTI3R1I-SE/Fc) of 951 bp
Agel/EcoRV
comprises 258 bp of the coTi3R1I-SE fused in frame with 693 bp of the human
IgG1-
Fc.
Example 3: Lentiviral vectors
The cDNA encoding the three human TI3RII isoforms were cloned into the
pRRLsin18.cPPT.WPRE lentiviral vector, generating the transfer vectors
pRRLsin18.cPPT.CMV-Tr3R1I-SE.ireseGFP.WPRE,
pRRLsin18.cPPT.CMV-Ti3R11-
DN.ireseGFP.WPRE, and pRRLsin18.cPPT.CMV-coT3RII-SE/Fc.ireseGFP.WPRE.
Vesicular Stomatitis Virus G protein-pseudotyped lentiviruses (VSV-G) were
generated
by transient transfection of the transfer vectors together with the envelope
plasmid
(pCMV-VSVG), the packaging plasmid (pMDLg/pRRE) and Rev plasmid (pRSV-REV),
into the 293T cell line, as previously described (R. A. Dewey, et al.
Experimental
Hematology 34: 1163-1171, 2006). The supernatant was harvested once every 12
29
CA 3060686 2019-10-25
hours for 48 hours and frozen in aliquots. Viral titers were determined by
transducing
A549 cells (yielding 107 infectious particles per milliliter). The
pRRLsin18.cPPT.CMV-
eGFP.WPRE lentiviral vector was used as control.
Example 4: RT-PCR and RT-qPCR
Total RNA from different primary cultures and cell lines was isolated using
the
Absolutely RNA kit (Stratagene, La Jolla, CA, USA). First-strand cDNA was
synthesized by mixing 1 pg of DNA free total RNA, 50 pmol primer p(DT)15
(Roche
Diagnostics GmbH, Mannheim, Germany), 0.5 mM deoxyribonucleotide triphosphate,
mM dithiothreitol, and 1 U Expand Reverse Transcriptase (Roche Diagnostics
GmbH). cDNA corresponding to different isoforms of T6RII receptor was detected
by
PCR amplification in the presence of Expand High Fidelity polymerase (Roche
Diagnostics GmbH), 0,2 mM dNTPS, and 0,5 pM of each primer (forward:
5'ACCGGTATGGGTCGGGGGCTGCTC3" (SEQ ID No. 10) and reverse:
5"GTCGACTCAGTAG CAGTAGAAGATG3" (SEQ ID No. 11) for 35 cycles using the
following PCR conditions: 1 min. at 95 C, 1 min. at 55 C, and 1 min. at 95 C.
Quantitative RT-PCR was performed on diluted cDNA samples with FastStart
Universal SYBR Green Master (Rox) (Roche Applied Science) using the Mx3005PTM
Real-Time PCR Systems (Stratagene) under universal cycling conditions (95 C
for 10
min; 40 cycles of 95 C for 15 s; then 60 C for 1 min). All results were
normalized to
GAPDH mRNA levels and further the results were analyzed using the MxProTM QPCR
computer program and Infostat statistical computer program (Di Rienzo J.A., et
al.
InfoStet version 2010. Grupo InfoStet, FCA, National University of Cordoba,
Argentina.
URL, http://www.infostat.com.ar)
Example 5: In vitro bioassay for the TpRII-SE isoform and other isoforms
using the MTT proliferation assay
A549 cells were transduced with lentiviral vectors at a multiplicity of
infection
CA 3060686 2019-10-25
(M01) of 50 in the presence of 8 pg/ml polybrene. Percentage of eGFP positive
cells
was measured in a FACscalibur (Becton Dikinson) cytometer.
Cells were harvested, counted, and inoculated at the appropriate
concentrations
into 96-well plates using a multichannel pipette. After 24 hr, TGF-61 (10
ng/rnl and 20
ng/ml; Sigma) was added to the culture wells, and cultures were incubated for
24 hr
and 48 hr at 37 C, under an atmosphere of 5 c1/0 CO2. MIT (3-(4,5-
dimethylthiazol-2-
yI)-2,5-diphenyltetrazolium bromide) (Sigma) solution at a concentration of 5
mg/ml
was added to the media and the cells were further incubated for 4 hr. After
replacing
100 pl of supernatant with 100 pl of DMSO, the absorbance of each well was
determined at 540 nm with a SEAC (Sirio S) photometer (Italy). The percentage
of cell
survival was defined as the relative absorbance of treated versus untreated
cells.
Example 6: Transduction and flow cytometry
A549 and hASC cells were transduced at an MOI of 50 and 200 respectively,
with the different lentiviral constructs, in the presence of 8 pg/ml polybrene
(Sigma).
Forty-eight hours after transduction, cells were harvested, washed in
phosphate-
buffered saline (PBS) supplemented with 10 % fetal calf serum and the
percentage of
eGFP positive cells was analyzed by flow cytometry (FACscalibur, BD)
Example 7: Protein immunoblot (Western-blot)
For Western blot analysis, both 20 pl and 100 pl of cell supernatant were
loaded
on 10 % SDS-polyacrylamide gels, separated by electrophoresis and blotted onto
lmmovilon PVDF membranes (Millipore Corporation, Bedford, MA, USA). The
membrane was exposed to anti-T6RII monoclonal primary antibody (clone C-4)
(Santa
Cruz, Biotechnology) diluted 1/200, or the monoclonal antibody IM 0577
(unprotected)], capable of specifically detecting T6R11-SE, diluted 1/500.
Horseradish
peroxidase (HRP)-conjugated goat anti-mouse antibody (Becton Dickinson GmbH)
diluted 1/10000 was used as secondary antibody. Protein detection was
performed
31
CA 3060686 2019-10-25
with the Amersham ECL Plus Western blotting detection reagents (Amersham
Buchler
GmbH, Germany) in a Typhoon 9410, Variable Mode Imager (GE Healthcare Bio-
Sciences AB, Uppsala, Sweden).
Example 8: DNA and protein sequence analysis
cDNA sequences belonging to the different TORII isoforms were used and the
predicted protein sequences and statistics were obtained using the EditSeq
software
(DNAstar, Inc. Madison, WI, USA). Both the DNA and the predicted protein
sequences
belonging to the T8R1I-SE cDNA were aligned to known isoforms of the human
TPRII
receptor (A and B) using the MegAlign software (DNASTAR, Inc. Madison, WI,
USA).
Example 9: Analysis of cytokines and chemokines secreted by hASC cells
A cytokine/chemokine array kit G5 (Ray Biotech Inc., Norcross, GA) was used
to detect a panel of 80 secreted cytokines as recommended by the manufacturer.
hASCs P7 untransduced or transduced with lentiviral vectors were grown for 72h
in a
medium supplemented with 0,1 % BSA. Supernatants were collected, filtered and
frozen after collection. For densitometry analysis of the arrays, Typhoon 9410
Variable
mode Imager (GE Healthcare Life Sciences) was used, and signal intensity
values
were measured using the Image analysis software ImageQuant TL 7.0 (GE
Healthcare
Life Sciences). Microarray data were analyzed with RayBio Antibody Array
Analysis
Tool. Good data quality and adequate normalization were ensured using internal
control normalization without background. Any ?1.5-fold increase or 50.65-fold
decrease in signal intensity for a single analyte between samples or groups
may be
considered a measurable and significant difference in expression, provided
that both
sets of signals are well above background (Mean background + 3 standard
deviations,
accuracy 99%).
Example 10: Generation of monoclonal and polyclonal antibodies raised
against human TPRII-SE
32
CA 3060686 2019-10-25
Antibodies were generated by Rheabiotech, Campinas, Brazil. Immunization of
both rabbit (polyclonal antibody) or mice (monoclonal antibody), was performed
using
a Multiple Antigene Peptide System (MAPS) with 8 identical copies of a peptide
containing the 13 amino acids (FSKVHYEGKKKAW) (SEQ ID No. 12), which are only
found in Ti3R1I-SE and not in the other splicing variants of the receptor. The
monoclonal antibody IM-0577 was developed in mice and purified by protein G
affinity
chromatography.Antibodies specificity was assayed by indirect ELISA by
sensitization
with antigen at a concentration of 5 pg/ml in Carbonate Buffer 0,2 M, blocked
by
PBS/BSA and detected with serial dilutions (1:1000-1:64000) of the specific
antibody.
The ELISA test was developed with a Horseradish peroxidase (HRP)-conjugated
secondary antibody together with H202/0PD as chromogenic substrate, and
detected
by absorbance at 492 nM.
Example 11: In vivo study of articular cartilage damage by ciprofloxacin
(CPFX) and the TORII-SE isoform
Male 24-day-old Wistar rats were housed under controlled conditions at 21
1 C with 50 % 5 % relative humidity and a constant light-dark schedule
(light, 8 a.m.
to 8 p.m.). Food and tap water was provided ad libitum. The rats received
ciprofloxacin
hydrochloride on day 24 by oral administration of 200 mg/kg of body weight
during 10
days. The animals were examined for clinical abnormalities including motility
alterations and weighted during the treatment period.
On day 14 after ciprofloxacin treatment, 50 pl viral vectors were injected
intra-
articularly with either Lt.coTBRII-SE/Fc (2.35 x 106 transducing Units, TU) or
Lt.eGFP
(6 x 106 TU). Control animals without ciprofloxacin were treated in the same
manner.
Example 12: Method to treat liver fibrosis using a lentiviral vector
encoding TORII-SE/Fe fusion protein
Male Wistar rats weighting 150-200 g were housed at Mar del Plata National
33
CA 3060686 2019-10-25
University Laboratory Animal Unit at a mean constant temperature of 22 C with
a 12 h
light¨dark cycle, and free access to standard pellet chow and water. All
experiments
were performed according to the 'Guide for the Care and Use of Laboratory
Animals'
and approved by the Institutional Animal Care and Use Committee (CICUAL) of
Mar
del Plata National University. The experimental groups were designed as
follows (n= 7
per group): (I) Control group received intraperitoneal (ip) injection of
vehicle of CCI4;
(II) CCI4 group received ip injection of CCI4; (Ill) Lv.T8R1I-SE/Fc + CCI4
group received
intrahepatic (ih) injection of Lv.T8R1I-SE/Fc (week 0) before treatment with
CCI4.
In vivo liver transduction
Animals were ih injected with Lv.T8R1I-SE/Fc (5-lox 107 transduction units/ml)
a week before the induction of liver fibrosis (Figure 34). To employ this
route of
administration, a small incision was made in animals previously anesthetized
with
ketamine/xylazine (50 mg/5 mg/kg, ip injection). Livers were exposed and small
volumes of the lentiviral vector were injected with a 30G needle into several
liver sites.
Liver fibrosis induction
Liver fibrosis was induced by ip injection of carbon tetrachloride (CCI4) 1 ml
in
oil (1:1), per kg of body weight (BVV), twice a week, for 8 weeks (Figure 34),
according
to a well-established model (experimental groups II and III). Seventy-two
hours after
the last CCI4 injection, animals were euthanized by CO2 inhalation. Then,
livers were
obtained and fixed in 10% neutral buffered formalin for histological analysis.
Serum
was also collected from each animal to analyze biochemical parameters.
34
CA 3060686 2019-10-25
Body weight determinations
Body weight (BW) measurements were taken before each CCI4 ip injection, and
after completion of the experiment. These data were used to calculate BW gain,
which
was expressed as the percentage (%) of increase respect to the initial BW.
After
euthanasia, livers were harvested and weighted to calculate the liver to body
weight
ratio (LW/BW), also expressed as percentage.
Biochemical parameter determinations
Liver enzyme levels of aspartate aminotransferase (AST), alanine
aminotransferase (ALT), and alkaline phosphatase (ALP) were determine in serum
with an automatic analyzer BT300 plus (Biotecnica), according to the
manufacturer's
recommendations.
Histological analysis
Livers fixed in 10% neutral buffered formalin were embedded in paraffin. Liver
sections (5 pm) were stained with Hematoxylin and Eosin (H&E), for liver
architecture
visualization. For liver fibrosis assessment, sections were stained with 0.1
/.3 Sirius
Red. Quantification of Sirius Red-positive areas was performed in at least ten
microscopy fields per histological section using the software ImageJ. Results
were
expressed as mean percentage of Sirius Red-positive area per field.
CA 3060686 2019-10-25
lmmuhistochemichal analysis
For immunohistochemical analysis, 5 pm sections were dewaxed and rehydrated.
Endogenous peroxidase activity was blocked with 3 % H202 3% in methanol (10
min,
at room temperature). Antigen retrieval was performed using the heat induced
epitope
retrieval (HIER) method with 0.1 M citrate buffer, pH 6. Tissue sections were
then
incubated for 12 ¨ 16 h at 4 C with rabbit anti-a-smooth muscle actin (anti-a-
SMA,
1:500, Cell Signaling Technology, Danvers, MA). After two washes with PBS,
slides
were incubated with HiDef Detection amplifier Mouse and Rabbit (Cell Marque,
Rocklin, CA) for 10 min, at room temperature. Sections were further washed
with PBS
and incubated with HiDef Detection HRP Polymer Detector (Cell Marque, Rocklin,
CA)
for 10 min, at room temperature. Finally, sections were washed twice with PBS,
and
immunohistochennical staining was obtained using the DAB Chromogen kit (Cell
Marque, Rocklin, CA) by 5 min. incubation at room temperature, and
counterstained
with Hematoxylin. Dehydrated sections were mounted and imaged on a Nikon
Eclipse
E200 microscope.
Statistical analysis
Data were analyzed using two-way ANOVA followed by the Fisher's Least
Significant Difference (LSD) test. Statistical significance was set at < 0.05.
Results are
expressed as mean SD.
Example 13: Method to treat cancer with a lentiviral vector encoding TI3R1I-
SE/Fc fusion protein
36
CA 3060686 2019-10-25
TN60 murine mammary carcinoma cells were injected subcutaneously into
syngenic C3H/S mice (N= 6 - 7 per group), as it is described by Garcia M.
etal., 2015
Biological Rhythm Research 46: 573-578. Ten days after, 1,5 x 106 transduction
units
of a lentiviral vectors encoding T13R1I-SE/Fc (Lv.TI3R11-SE/Fc) (N=7), or the
control
vector Lv. TI3R1I-DN (dominant negative) (N=6) were intratumorally injected.
As an
additional control, mice were intratumorally injected with the same volume of
culture
medium (vehicle).
Tumor diameter was determine every 2-3 days by measuring the tumor
perimeter with a digital caliper, Tumor mean volume was determine by the
formula
V=4/3 (p x r3). Two weeks after tumor implantation, mice were euthanized by
cervical
dislocation.
Example 14: Method to determine rheumatoid arthritis disease activity by
TpRII-SE protein quantification in neutrophils by immune detection with the
anti
TpRII-SE monoclonal antibody.
Patients
Volunteers and samples
Peripheral blood was collected by venipuncture from 19 RA patients diagnosed
according to the ACR/EULAR 2010 criteria. All procedures were approved by CER
Medical Institute Research Ethics Committee, and the ComisiOn Coniunta de
Investiqacion en Salud, Department of Health, Buenos Aires Province,
Argentina,
registered under the number 2919/653/13. All procedures were performed after
signing off a voluntary informed consent, by the donors. Exclusion criteria
included
severe anaemia, autoimmune diseases different from RA, any other
disease/condition
able to increase ESR, treatment with biological drugs, treatment with disease-
37
CA 3060686 2019-10-25
modifying anti-rheumatic drugs (DMARDs) except methotrexate, and with drugs
with
known effect on the TGF-P signalling cascade (losartan).
Detection of TpRII-SE in neutrophils by Flow Cytometry: both neutrophils and
peripheral blool mononuclear cells (PBMC) were isolated by FicollPaqueTM PLUS
density gradient. Red blood cells were eliminated from the neutrophil fraction
by
incubation with a hypertonic buffer (0,15 M NI-14C1, 10 mM KHCO3, 0,1 mM
EDTA). To
determine the percentage of cells expressing TpRII-SE, 1 x 106 of both,
neutrophils
and PBMC were fixed and permeabilized with the Cytofix/Cytoperm Kit (BD
Biosciences, USA) Subsequently, cells were incubated with 0,5 tg of the anti-
TpRII-
SE monoclonal antibody of the invention conjugated with the fluorochrome ATTO
647N. Cells were resuspended in 100 pLI of PBS and were analyzed by Flow
Cytometry
in a FACSCalibur device (BD Biosciences, USA), using Flowjo software (BD
Biosciences, USA). The percentage of neutrophils expressing TpRII-SE was
determined by taking as cut off the fluorescence value obtained with
lymphocytes of
each patient, as reference. TpRII-SE fluorescence values in neutrophils were
correlated with DAS28-ESR disease activity scores by the Spearman's rank
correlation test of the OriginPro 8.5.1 software (Origin Lab Corporation,
Northampton,
MA, USA).
Example 15: Detection of TORII-SE in neutrophils by In-cell ELISA
To develop a method to quantify intracellular TpRII-SE in leukocytes by 1n-
cell
ELISA in RA pacientes, 2,6 x 106 celulas/cm2 , in saline solution+2 (0,9 %
NaCI, 1 mM
MgC12, 1 mM CaCl2), were incubated in 96 well plates for 20 minutes at room
temperature, to allow cell adherence to plastic. Subsequently, cells were
washed twice
with 1 X PBS, and fixed and permeabilized with 100 111_ of Fix/Perm solution
(BD
Cytofix/Cytoperm TM, USA) for 20 min. at 4 C. After two washes with 250 iiL
of 1 X BD
Perm/Wash buffer (BD Perm/Wash Tm, USA), adhered cells were incubated with the
38
CA 3060686 2019-10-25
anti-TI3R1I-SE antibody (10 1.19/mL in 50 tiL of BD Perm/Wash buffer) for 30
minutes to
16 hours at 4 C. As control, cells were also incubated without the above
mentioned
antibody. After two aditional washes with 250 1AL of 1 X BD Perm/Wash Buffer,
cells
were incuabated with 1 jAg/mL secondary antibody (Anti Mouse HRP conjugated -
Promega, USA), in 50 pt de 1 X BD Perm/Wash Buffer, for 90 minutes.
Subsequently,
cells were incubated with 100 tiL of quenching solution (10 % V/V H202 in 1 X
BD
Perm/Wash Buffer. After 3 washes with 250 IAL of 1 X BD Perm/Wash Buffer,
cells
were incubated with 100 pit of TMB substrate (Life Technologies, EEUU), in the
dark,
and 655 nm absorbance was determined every 5 minutes for 30 minutes, in a
microplate reader (Biotek, SYNERGYTM H1, USA). In addition, the number of
adhered
cells was determined by cristal violet staining, to be used as In-cell ELISA
normalizer.
To this end, each well was washed four times with 200 IAL 1 X PBS and cells
were
incubated with 50 pi crystal violet solution containing 2 g de crystal violet
(Sigma,
USA), 20 ml 95 % ethanol, 0,8 g amonium oxalate, and 80 ml distiled water, for
30
minutes at room temperature. After wahing the wells with abundant tap water,
cells
were incubated with 100 1.11._ of 1 % SDS for 60 minutes at room temperatura..
Finally,
absorbance at 595 nm was determined in a microplate reader (Biotek, SYNERGYTM
H1, USA).
Intracellular T13R1I-SE relative concentration values were determined as
follows:
AbsNn= Absn655/Absn595
AbsNT=AbsT655/AbsT595
Tf3RII-SE relative concentration= (AbsNT-AbsNn) *100
where:
AbsNT = normalized absorbance of the well containing Anti Ti3R1I-SE primary
antibody..
39
CA 3060686 2019-10-25
AbsT655 = Absorbance at 655 nm of the well containing Anti TI3R11-SE primary
antibody.
AbsT595 = Absorbance at 595 nm of the well containing Anti TI3R11-SE primary
antibody.
AbsNn = normalized absorbance of the well without primary antibody (negative).
Absn655 = Absorbance at 655 nm of the well without primary antibody
(negative).
Absn595: Absorbance at 595 nm of the well without primary antibody (negative).
Ti3R1I-SE relative concentration in plastic adhered leukocytes from RA
patients
was correlated with their matching DAS28-ESR value using the Spearman rank
correlation test of the OriginPro 8.5.1 software (Origin Lab Corporation,
Northampton,
MA, USA).
CA 3060686 2019-10-25
