POLYPEPTIDES HAVING LYSOZYME ACTIVITY, POLYNUCLEOTIDES ENCODING SAME AND USES AND COMPOSITIONS THEREOF

POLYPEPTIDES AYANT UNE ACTIVITE LYSOZYME, POLYNUCLEOTIDES CODANT POUR CEUX-CI ET UTILISATIONS ET COMPOSITIONS ASSOCIEES

English Abstract

Animal feed or animal feed additives comprising one or more polypeptides
having lysozyme activity. Polypeptides
having lysozyme activity, polynucleotides encoding the polypeptides nucleic
acid constructs, vectors, and host cells comprising the
polynucleotides as well as methods of producing and using the polypeptides.

French Abstract

L'invention concerne des aliments pour animaux ou des additifs pour aliments pour animaux comprenant un ou plusieurs polypeptides ayant une activité lysozyme. L'invention concerne des polynucléotides ayant une activité lysozyme, des polynucléotides codant pour les constructions d'acide nucléique de polypeptides, des vecteurs et des cellules hôtes comprenant les polynucléotides, ainsi que des méthodes de production et d'utilisation des polypeptides.

Claims

Claims
What is claimed is:
1. A composition comprising at least 0.01 mg of LYS polypeptide per
kilogram of
composition, wherein the polypeptide (a) has lysozyme activity and (b)
comprises one or
more LAD catalytic domains; wherein the LAD catalytic domain gives a domT
score of at
least 180 when queried using a Profile Hidden Markov Model (HMM) prepared
using
SEQ ID NOs: 46 to 187 and hmmbuild software program.
2. The composition of claim 1, wherein the polypeptide further comprises
one or more
lysozyme enhancing domains, wherein the lysozyme enhancing domain gives a domT

score of at least 100 when queried using a Profile Hidden Markov Model
prepared using
SEQ ID NOs: 188 to 316 and hmmbuild software program, and wherein the query is

carried out using the hmmscan software program.
3. The composition of any of claims 1 to 2, wherein the polypeptide is
selected from the
group consisting of:
(a) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 3;
(b) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 6;
(c) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 9;
(d) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 12;
(e) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 15;
(f) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 18;
(g) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 21;
(h) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 24;
(i) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 27;
212

(j) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 30;
(k) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 33;
(I) a polypeptide having at least 80% sequence identity to the
polypeptide of SEQ ID
NO: 36;
(m) a polypeptide having at least 80% sequence identity to the
polypeptide of SEQ ID
NO: 39;
(n) a polypeptide having at least 80% sequence identity to the
polypeptide of SEQ ID
NO: 42;
(o) a polypeptide having at least 80% sequence identity to the
polypeptide of SEQ ID
NO: 45;
(p) a variant of the polypeptide selected from the group consisting of
SEQ ID NO: 3,
SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18,
SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO:
33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42 and SEQ ID NO: 45,
wherein the variant has lysozyme activity and comprises one or more amino acid

substitutions, and/or one or more amino acid deletions, and/or one or more
amino
acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 positions;
(q) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e), (f),
(g), (h), (i), (j),
(k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal His-tag
and/or HQ-
tag;
(r) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e), (f),
(g), (h), (i), (j),
(k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal extension of
up to
amino acids, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; and
(s) a fragment of the polypeptide of (a), (b), (c), (d), (e), (f), (g), (h),
(i), (j), (k), (I), (m),
(n), (o) or (p) having lysozyme activity and having at least 90% of the length
of
the mature polypeptide.
4.
The composition of any of claims 1 to 3, wherein the LYS polypeptide comprises
one or
more motifs selected from the group consisting of
(a) motif I: AG[I/L]AT[A/G][I/L][1/V]ES (SEQ ID NO: 317);
(b) motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318); and
(c) motif III: [CGY][YF][VIL][ASTP][DG]X[YF[VIT]X[TS][GAN] (SEQ ID NO:
319).
213

5. The composition of any of claims 1 to 4, wheren the polypeptide is
obtained or obtainable
from the taxonomic phylum Ascomycota, preferably the taxonomic subphylum
Pezizomycotina.
6. A granule comprising the composition of any of claims 1 to 5.
7. The granule of claim 6 wherein the granule is coated.
8. An animal feed additive comprising the composition of any of claims 1 to
5 or the granule
of any of claims 6 to 7.
9. An animal feed comprising plant based material and the composition of
any of claims 1 to
5, the granule of any of claims 6 to 7 or the animal feed additive of claim 8.
10. A liquid formulation comprising the composition of any of claims 1 to 5,
wherein the LYS
polypeptide is dosed between 0.01% to 25% w/w of liquid formulation,
preferably 0.05% to
20% w/w LYS polypeptide, more preferably 0.2% to 15% w/w LYS polypeptide, more

preferably 0.5% to 15% w/w LYS polypeptide or most preferably 1.0% to 10% w/w
LYS
polypeptide.
11. The liquid formulation of claim 10, wherein the formulation further
comprises 20% to 80%
w/w of polyol.
12. A method of improving one or more performance parameters of an animal
comprising
administering to one or more animals the composition of any of claims 1 to 11.
13. A method of preparing an animal feed, comprising mixing the composition
of any of claims
1 to 11 with plant based material.
14. Use of composition of any of claims 1 to 11:
in animal feed;
in animal feed additives;
in the preparation of a composition for use in animal feed;
for improving the nutritional value of an animal feed;
for increasing digestibility of the animal feed; and/or
for improving one or more performance parameters in an animal.
214

15. An isolated polypeptide having lysozyme activity, selected from the group
consisting of:
(a) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 3;
(b) a polypeptide having at least 94% sequence identity to the polypeptide
of SEQ ID
NO: 6;
(c) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 9;
(d) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 12;
(e) a polypeptide having at least 87% sequence identity to the polypeptide
of SEQ ID
NO: 15;
(f) a polypeptide having at least 81% sequence identity to the polypeptide
of SEQ ID
NO: 18;
(g) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 21;
(h) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 24;
(i) a polypeptide having at least 87% sequence identity to the polypeptide
of SEQ ID
NO: 27;
(j) a polypeptide having at least 96.2% sequence identity to the
polypeptide of SEQ
ID NO: 30;
(k) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 33;
(I) a polypeptide having at least 80% sequence identity to the
polypeptide of SEQ ID
NO: 36;
(m) a polypeptide having at least 81% sequence identity to the polypeptide
of SEQ ID
NO: 39;
(n) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 42;
(o) a variant of the polypeptide of SEQ ID NO: 3, wherein the variant has
lysozyme
activity and comprises one or more amino acid substitutions, and/or one or
more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 positions;
(p) a variant of the polypeptide of SEQ ID NO: 6, wherein the variant has
lysozyme
activity and comprises one or more amino acid substitutions, and/or one or
more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13 positions;
215

(q) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 9
and SEQ ID NO: 36, wherein the variant has lysozyme activity and comprises
one or more amino acid substitutions, and/or one or more amino acid deletions,

and/or one or more amino acid insertions or any combination thereof in 1, 2,
3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44
positions;
(r) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 12,
SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 33 and SEQ ID NO: 42, wherein
the variant has lysozyme activity and comprises one or more amino acid
substitutions, and/or one or more amino acid deletions, and/or one or more
amino
acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 positions;
(s) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 15
and SEQ ID NO: 27, wherein the variant has lysozyme activity and comprises
one or more amino acid substitutions, and/or one or more amino acid deletions,

and/or one or more amino acid insertions or any combination thereof in 1, 2,
3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27,
28 or 29 positions;
(t) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 18
and SEQ ID NO: 39, wherein the variant has lysozyme activity and comprises
one or more amino acid substitutions, and/or one or more amino acid deletions,

and/or one or more amino acid insertions or any combination thereof in 1, 2,
3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 positions;
(u) a variant of the polypeptide of SEQ ID NO: 30, wherein the variant has
lysozyme
activity and comprises one or more amino acid substitutions, and/or one or
more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof in 1, 2, 3, 4, 5, 6, 7 or 8 positions;
(v) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o), (p), (q), (r), (s), (t) or (u) and a N-terminal
and/or C-terminal
His-tag and/or HQ-tag;
(w) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o), (p), (q), (r), (s), (t) or (u) and a N-terminal
and/or C-terminal
extension of up to 10 amino acids, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino
acids;
and
216

(x) a fragment of the polypeptide of (a), (b), (c), (d), (e), (f), (g),
(h), (i), (j), (k), (I), (m),
(n), (o), (p), (q), (r), (s), (t) or (u) having lysozyme activity and having
at least 90%
of the length of the mature polypeptide.
16. The polypeptide according to claim 15, wherein the polypeptide comprises
or consists of
amino acids 1 to 316 of SEQ ID NO: 2, amino acids 1 to 316 of SEQ ID NO: 3,
amino
acids 1 to 322 of SEQ ID NO: 4, amino acids 1 to 318 of SEQ ID NO: 6, amino
acids 1 to
318 of SEQ ID NO: 7, amino acids 1 to 326 of SEQ ID NO: 8, amino acids 1 to
316 of
SEQ ID NO: 10, amino acids 1 to 316 of SEQ ID NO: 11, amino acids 1 to 324 of
SEQ ID
NO: 12, amino acids 1 to 316 of SEQ ID NO: 14, amino acids 1 to 316 of SEQ ID
NO: 15,
amino acids 1 to 324 of SEQ ID NO: 16, amino acids 1 to 316 of SEQ ID NO: 18,
amino
acids 1 to 316 of SEQ ID NO: 19, amino acids 1 to 324 of SEQ ID NO: 20, amino
acids 1
to 316 of SEQ ID NO: 22, amino acids 1 to 316 of SEQ ID NO: 23, amino acids 1
to 324 of
SEQ ID NO: 24, amino acids 1 to 516 of SEQ ID NO: 26, amino acids 1 to 516 of
SEQ ID
NO: 27, amino acids 1 to 524 of SEQ ID NO: 28, amino acids 1 to 317 of SEQ ID
NO: 30,
amino acids 1 to 317 of SEQ ID NO: 31, amino acids 1 to 325 of SEQ ID NO: 32,
amino
acids 1 to 316 of SEQ ID NO: 34, amino acids 1 to 316 of SEQ ID NO: 35, amino
acids 1
to 324 of SEQ ID NO: 36, amino acids 1 to 316 of SEQ ID NO: 38, amino acids 1
to 316 of
SEQ ID NO: 39 or amino acids 1 to 324 of SEQ ID NO: 40.
17. A polynucleotide encoding the polypeptide of any of claims 15 to 16.
18. A nucleic acid construct or expression vector comprising the
polynucleotide of claim 17
operably linked to one or more control sequences that direct the production of
the
polypeptide in an expression host.
19. A recombinant host cell comprising the polynucleotide of claim 17 operably
linked to one
or more control sequences that direct the production of the polypeptide.
20. A method of producing the polypeptide of any of claims 15 to 16,
comprising:
(a) cultivating the recombinant host cell of claim 19 under conditions
conducive for
production of the polypeptide; and
(b) recovering the polypeptide.
217

Description

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
POLYPEPTIDES HAVING LYSOZYME ACTIVITY, POLYNUCLEOTIDES
ENCODING SAME AND USES AND COMPOSITIONS THEREOF
Reference to a Sequence Listing
This application contains a Sequence Listing in computer readable form, which
is
incorporated herein by reference.
Background of the Invention
Field of the Invention
The present invention relates to novel LYS polypeptides having lysozyme
activity,
polynucleotides encoding the polypeptides, nucleic acid constructs, vectors,
and host cells
comprising the polynucleotides as well as methods of producing the
polypeptides. The present
invention also relates to compositions, specifically animal feed, comporising
LYS polypeptides
and the use of the LYS polypeptide in animal feed.
Description of the Related Art
Lysozyme is an 0-glycosyl hydrolase produced as a defensive mechanism against
bacteria by many organisms. The enzyme causes the hydrolysis of bacterial cell
walls by
cleaving the glycosidic bonds of peptidoglycan; an important structural
molecule in bacteria.
After having their cell walls weakened by lysozyme action, bacterial cells
lyse as a result of
unbalanced osmotic pressure.
Lysozyme naturally occurs in many organisms such as viruses, plants, insects,
birds,
reptiles and mammals. In mammals, Lysozyme has been isolated from nasal
secretions, saliva,
tears, intestinal content, urine and milk. The enzyme cleaves the glycosidic
bond between
carbon number 1 of N-acetylmuramic acid and carbon number 4 of N-acetyl-D-
glucosamine. In
vivo, these two carbohydrates are polymerized to form the cell wall
polysaccharide of many
microorganisms.
Lysozyme has until now been classified into seven different glycoside
hydrolase (GH)
families (CAZy, www.cazy.org): GH18, GH19, hen egg-white lysozyme (GH22),
goose egg-
white lysozyme (GH23), bacteriophage T4 lysozyme (GH24), Sphingomonas
flagellar protein
(GH73) and Chalaropsis lysozymes (GH25).
Lysozyme extracted from hen egg white is the primary product available on the
commercial market, but does not cleave N,6-0-diacetylmuramic acid in e.g.
Staphylococcus
aureus cell walls and is thus unable to lyse this important human pathogen
among others
1

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(Masschalck B, Deckers D, Michiels OW (2002), "Lytic and nonlytic mechanism of
inactivation of
gram-positive bacteria by lysozyme under atmospheric and high hydrostatic
pressure", J Food
Prot. 65(12):1916-23).
Use of lysozyme has been suggested in animal feed (see for example WO 00/21381
and
WO 04/026334), in cheese production (see for example WO 05/080559), food
preservation
(Hughey and Johnson (1987) App! Environ Microbiol 53:2165), detergents (see
for example US
5,041,236 and EP 0425016), in oral care (see for example US 4,355,022, WO
04/017988 and
WO 08/124764), cosmetology and dermatology, contraception, urology, and
gynaecology (see
for example WO 08/124764).
Antimicrobial growth promoters (AGP's) have traditionally been used for growth
promotion in animals, and probably work by preventing low level infections by
pathogens such
as Clostridium perfringens. However, AGP's are increasingly being banned
worldwide and
therefore new solutions to promote animal growth but which are not AGP's are
of interest.
Summary of the Invention
The inventors have discovered a completely novel class of polypeptides having
lysozyme activity. As such, the invention relates to a composition comprising
at least 0.01 mg of
LYS polypeptide per kilogram of composition, wherein the polypeptide (a) has
lysozyme activity
and (b) comprises one or more LAD catalytic domains; wherein the LAD catalytic
domain gives
a domT score of at least 180 when queried using a Profile Hidden Markov Model
(HMM)
prepared using SEQ ID NOs: 46 to 187 and hmmbuild software program. Typically,
the query is
carried out using hmmscan software program by the Method of Determining the
LAD Catalytic
Domain by HMM.
The invention further relates to an isolated polypeptide having lysozyme
activity, selected from
the group consisting of:
(a) a polypeptide having at least 95% sequence identity to the polypeptide of
SEQ ID
NO: 3;
(b) a polypeptide having at least 94% sequence identity to the polypeptide
of SEQ ID
NO: 6;
(c) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 9;
(d) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 12;
(e) a polypeptide having at least 87% sequence identity to the polypeptide
of SEQ ID
NO: 15;
(f) a
polypeptide having at least 81% sequence identity to the polypeptide of SEQ ID
NO: 18;
2

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(g) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 21;
(h) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 24;
(i) a polypeptide having at least 87% sequence identity to the polypeptide
of SEQ ID
NO: 27;
(j) a polypeptide having at least 96.2% sequence identity to the
polypeptide of SEQ
ID NO: 30;
(k) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 33;
(I) a polypeptide having at least 80% sequence identity to the
polypeptide of SEQ ID
NO: 36;
(m) a polypeptide having at least 81% sequence identity to the
polypeptide of SEQ ID
NO: 39;
(n) a polypeptide having at least 80% sequence identity to the polypeptide of
SEQ ID
NO: 42;
(o) a variant of the polypeptide of SEQ ID NO: 3, wherein the variant has
lysozyme
activity and comprises one or more amino acid substitutions, and/or one or
more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof in 1,2, 3,4, 5,6, 7, 8, 9, 10 or 11 positions;
(p) a variant of the polypeptide of SEQ ID NO: 6, wherein the variant has
lysozyme
activity and comprises one or more amino acid substitutions, and/or one or
more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof in 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12 or 13 positions;
(q) a variant of the polypeptide selected from the group consisting of SEQ ID
NO: 9
and SEQ ID NO: 36, wherein the variant has lysozyme activity and comprises
one or more amino acid substitutions, and/or one or more amino acid deletions,

and/or one or more amino acid insertions or any combination thereof in 1, 2,
3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44
positions;
(r) a variant of the polypeptide selected from the group
consisting of SEQ ID NO: 12,
SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 33 and SEQ ID NO: 42, wherein
the variant has lysozyme activity and comprises one or more amino acid
substitutions, and/or one or more amino acid deletions, and/or one or more
amino
acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 positions;
3

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(s) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 15
and SEQ ID NO: 27, wherein the variant has lysozyme activity and comprises
one or more amino acid substitutions, and/or one or more amino acid deletions,

and/or one or more amino acid insertions or any combination thereof in 1, 2,
3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27,
28 or 29 positions;
(t) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 18
and SEQ ID NO: 39, wherein the variant has lysozyme activity and comprises
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or more amino acid insertions or any combination thereof in 1, 2,
3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 positions;
(u) a variant of the polypeptide of SEQ ID NO: 30, wherein the variant has
lysozyme
activity and comprises one or more amino acid substitutions, and/or one or
more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof in 1, 2, 3, 4, 5, 6, 7 or 8 positions;
(v) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o), (p), (q), (r), (s), (t) or (u) and a N-terminal
and/or C-terminal
His-tag and/or HQ-tag;
(w) a
polypeptide comprising the polypeptide of (a), (b), (c), (d), (e), (f), (g),
(h), (i), (j),
(k), (I), (m), (n), (o), (p), (q), (r), (s), (t) or (u) and a N-terminal
and/or C-terminal
extension of up to 10 amino acids, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino
acids;
and
(x)
a fragment of the polypeptide of (a), (b), (c), (d), (e), (f), (g), (h),
(i), (j), (k), (I), (m),
(n), (o), (p), (q), (r), (s), (t) or (u) having lysozyme activity and having
at least 90%
of the length of the mature polypeptide.
The invention also relates to animal feed additives or animal feed comprising
the LYS
polypeptide of the invention; use of the lysozyme of the LYS polypeptide in
animal feed, in
animal feed additives, in the preparation of a composition for use in animal
feed, and for
improving one or more performance parameters in an animal. The invention
further relates to
methods of improving performance parameters of an animal and for preparing an
animal feed;
isolated polynucleotides encoding the polypeptides of the invention, nucleic
acid constructs,
recombinant expression vectors, recombinant host cells and method of producing
the LYS
polypeptide of the invention. The invention is further directed to the use of
composition of of the
invention in animal feed; in animal feed additives; in the preparation of a
composition for use in
4

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
animal feed; for improving the nutritional value of an animal feed; for
increasing digestibility of
the animal feed; and/or for improving one or more performance parameters in an
animal.
Overview of Sequence Listing
SEQ ID NO: 1 is the cDNA sequence of a LYS polypeptide as isolated from
Peniciffium
simplicissimum.
SEQ ID NO: 2 is the amino acid sequence as deduced from SEQ ID NO: 1.
SEQ ID NO: 3 is the amino acid sequence of the mature LYS polypeptide from
Peniciffium simplicissimum.
SEQ ID NO: 4 is the cDNA sequence of a LYS polypeptide as isolated from
Peniciffium
vasconiae.
SEQ ID NO: 5 is the amino acid sequence as deduced from SEQ ID NO: 4.
SEQ ID NO: 6 is the amino acid sequence of the mature LYS polypeptide from
Peniciffium vasconiae.
SEQ ID NO: 7 is the cDNA sequence of a LYS polypeptide as isolated from
Talaromyces proteolyticus.
SEQ ID NO: 8 is the amino acid sequence as deduced from SEQ ID NO: 7.
SEQ ID NO: 9 is the amino acid sequence of the mature LYS polypeptide from
Talaromyces proteolyticus.
SEQ ID NO: 10 is the cDNA sequence of a LYS polypeptide as isolated from
AspergiHus
sp. XZ2668.
SEQ ID NO: 11 is the amino acid sequence as deduced from SEQ ID NO: 10.
SEQ ID NO: 12 is the amino acid sequence of the mature LYS polypeptide from
AspergiHus sp. XZ2668.
SEQ ID NO: 13 is the cDNA sequence of a LYS polypeptide as isolated from
Penicillium
antarcticum.
SEQ ID NO: 14 is the amino acid sequence as deduced from SEQ ID NO: 13.
SEQ ID NO: 15 is the amino acid sequence of the mature LYS polypeptide from
Peniciffium antarcticum.
SEQ ID NO: 16 is the cDNA sequence of a LYS polypeptide as isolated from
Ovatospora brasiliensis.
SEQ ID NO: 17 is the amino acid sequence as deduced from SEQ ID NO: 16.
SEQ ID NO: 18 is the amino acid sequence of the mature LYS polypeptide from
Ovatospora brasiliensis.
SEQ ID NO: 19 is the cDNA sequence of a LYS polypeptide as isolated from
Penicillium
wellingtonense.
5

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 20 is the amino acid sequence as deduced from SEQ ID NO: 19.
SEQ ID NO: 21 is the amino acid sequence of the mature LYS polypeptide from
Peniciffium weffingtonense.
SEQ ID NO: 22 is the cDNA sequence of a LYS polypeptide as isolated from
Peniciffium
roseopurpureum.
SEQ ID NO: 23 is the amino acid sequence as deduced from SEQ ID NO: 22.
SEQ ID NO: 24 is the amino acid sequence of the mature LYS polypeptide from
Peniciffium roseopurpureum.
SEQ ID NO: 25 is the cDNA sequence of a LYS polypeptide as isolated from
Peniciffium
virgatum.
SEQ ID NO: 26 is the amino acid sequence as deduced from SEQ ID NO: 25.
SEQ ID NO: 27 is the amino acid sequence of the mature LYS polypeptide from
Peniciffium virgatum.
SEQ ID NO: 28 is the cDNA sequence of a LYS polypeptide as isolated from
AspergiHus
niveus.
SEQ ID NO: 29 is the amino acid sequence as deduced from SEQ ID NO: 28.
SEQ ID NO: 30 is the amino acid sequence of the mature LYS polypeptide from
AspergiHus niveus.
SEQ ID NO: 31 is the cDNA sequence of a LYS polypeptide as isolated from
Chaetomium sp. ZY369.
SEQ ID NO: 32 is the amino acid sequence as deduced from SEQ ID NO: 31.
SEQ ID NO: 33 is the amino acid sequence of the mature LYS polypeptide from
Chaetomium sp. ZY369.
SEQ ID NO: 34 is the cDNA sequence of a LYS polypeptide as isolated from
Talaromyces atricola.
SEQ ID NO: 35 is the amino acid sequence as deduced from SEQ ID NO: 34.
SEQ ID NO: 36 is the amino acid sequence of the mature LYS polypeptide from
Talaromyces atricola.
SEQ ID NO: 37 is the cDNA sequence of a LYS polypeptide as isolated from
Trichocladium asperum.
SEQ ID NO: 38 is the amino acid sequence as deduced from SEQ ID NO: 37.
SEQ ID NO: 39 is the amino acid sequence of the mature LYS polypeptide from
Trichocladium asperum.
SEQ ID NO: 40 is the cDNA sequence of a LYS polypeptide as isolated from
Metarhizium cameum.
SEQ ID NO: 41 is the amino acid sequence as deduced from SEQ ID NO: 40.
6

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 42 is the amino acid sequence of the mature LYS polypeptide from
Metarhizium cameum.
SEQ ID NO: 43 is the cDNA sequence of a LYS polypeptide as isolated from
Thielavia
terrestris.
SEQ ID NO: 44 is the amino acid sequence as deduced from SEQ ID NO: 43.
SEQ ID NO: 45 is the amino acid sequence of the mature LYS polypeptide from
Thiela via terrestris.
SEQ ID NO: 46 is the amino acid sequence of the LAD domain of
SWISSPROT:A1C4L9 from Aspergillus clavatus.
SEQ ID NO: 47 is the amino acid sequence of the LAD domain of
SWISSPROT:A4X6S9 from Salinispora tropica.
SEQ ID NO: 48 is the amino acid sequence of the LAD domain of
SWISSPROT:A8M1H3 from Salinispora arenicola.
SEQ ID NO: 49 is the amino acid sequence of the LAD domain of
SWISSPROT:Q3L9Z6 from Rhodococcus erythropolis.
SEQ ID NO: 50 is the amino acid sequence of the LAD domain of
SWISSPROT:B5U576 from Mycobacterium phage Pacc40.
SEQ ID NO: 51 is the amino acid sequence of the LAD domain of
SWISSPROT:B6GZX8 from Penicillium rubens.
SEQ ID NO: 52 is the amino acid sequence of the LAD domain of
SWISSPROT:D156X5 from Micromonospora aurantiaca.
SEQ ID NO: 53 is the amino acid sequence of the LAD domain of
SWISSPROT:D158J3 from Micromonospora aurantiaca.
SEQ ID NO: 54 is the amino acid sequence of the LAD domain of
SWISSPROT:D1SH66 from Micromonospora aurantiaca.
SEQ ID NO: 55 is the amino acid sequence of the LAD domain of
SWISSPROT:D5GBHO from Tuber melanosporum.
SEQ ID NO: 56 is the amino acid sequence of the LAD domain of
SWISSPROT:G9P583 from Hypocrea atroviridis.
SEQ ID NO: 57 is the amino acid sequence of the LAD domain of
SWISSPROT:E9ED38 from Metarhizium acridum.
SEQ ID NO: 58 is the amino acid sequence of the LAD domain of
SWISSPROT:E9FAK9 from Metarhizium robertsii.
SEQ ID NO: 59 is the amino acid sequence of the LAD domain of
SWISSPROT:F4F8N8 from Verrucosispora marls.
SEQ ID NO: 60 is the amino acid sequence of the LAD domain of SWISSPROT:F4FI59
from Verrucosispora marls.
7

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 61 is the amino acid sequence of the LAD domain of
SWISSPROT:J4USU4 from Beauveria bassiana.
SEQ ID NO: 62 is the amino acid sequence of the LAD domain of
SWISSPROT:G2QV10 from Thiela via terrestris.
SEQ ID NO: 63 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C6W456 from Micromonospora peucetia.
SEQ ID NO: 64 is the amino acid sequence of the LAD domain of
SWISSPROT:H8E7TO from Microbacterium laevaniformans.
SEQ ID NO: 65 is the amino acid sequence of the LAD domain of SWISSPROT:10PF45
from Mycobacterium abscessus.
SEQ ID NO: 66 is the amino acid sequence of the LAD domain of
SWISSPROT:10L0M9 from Micromonospora lupini str Lupac.
SEQ ID NO: 67 is the amino acid sequence of the LAD domain of SWISSPROT:I0L3A4

from Micromonospora lupini str Lupac.
SEQ ID NO: 68 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0B2X541 from Metarhizium album.
SEQ ID NO: 69 is the amino acid sequence of the LAD domain of
SWISSP ROT:A0A168BM L7 from Aschersonia aleyrodis.
SEQ ID NO: 70 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0B2VVV75 from Metarhizium album.
SEQ ID NO: 71 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A167BVWV4 from Cordyceps brongniartii.
SEQ ID NO: 72 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A167ECQ5 from Metarhizium rileyi.
SEQ ID NO: 73 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A162JZ16 from Cordyceps con fragosa.
SEQ ID NO: 74 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A168DNP6 from Cordyceps con fragosa.
SEQ ID NO: 75 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A168DOL5 from Cordyceps con fragosa.
SEQ ID NO: 76 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A168BQC6 from lsaria fumosorosea.
SEQ ID NO: 77 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A167X055 from lsaria fumosorosea.
SEQ ID NO: 78 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A167NNI6 from lsaria fumosorosea.
8

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 79 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A179H6H8 from Purpureociffium lilacinum.
SEQ ID NO: 80 is the amino acid sequence of the LAD domain of
SWISSPROT:AOA 179FH 10 from Pochonia chlamydosporia.
SEQ ID NO: 81 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A179F665 from Pochonia chlamydosporia.
SEQ ID NO: 82 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A179F1Q1 from Pochonia chlamydosporia.
SEQ ID NO: 83 is the amino acid sequence of the LAD domain of
SWISSPROT:S7ZNE7 from PeniciHium oxalicum.
SEQ ID NO: 84 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0D9PBV5 from Metarhizium anisopliae.
SEQ ID NO: 85 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0D9NPP1 from Metarhizium anisopliae.
SEQ ID NO: 86 is the amino acid sequence of the LAD domain of
SWISSPROT:W6QNL2 from PeniciHium roqueforti.
SEQ ID NO: 87 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0U1MOW5 from Talaromyces islandicus.
SEQ ID NO: 88 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0A219P6 from PeniciHium expansum.
SEQ ID NO: 89 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A086T4C8 from Acremonium chrysogenum.
SEQ ID NO: 90 is the amino acid sequence of the LAD domain of
SWISSPROT:X8ERY9 from Mycobacterium chelonae.
SEQ ID NO: 91 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A081HTU5 from Mycobacterium sp TKK.
SEQ ID NO: 92 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0A1TMJ0 from TorrubieHa hemipterigena.
SEQ ID NO: 93 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0A1TNZ8 from TorrubieHa hemipterigena.
SEQ ID NO: 94 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0A1D149 from Arthrobacter sp PAMC.
SEQ ID NO: 95 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0A6UNI9 from Actinoplanes utahensis.
SEQ ID NO: 96 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0B4I0X1 from Metarhizium majus.
9

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 97 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0DOWU99 from Micromonospora carbonacea.
SEQ ID NO: 98 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0D1LTE6 from Mycobacterium immunogenum.
SEQ ID NO: 99 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0F8A5E8 from HirsuteHa minnesotensis.
SEQ ID NO: 100 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0F8A617 from Hirsute//a minnesotensis.
SEQ ID NO: 101 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0F7TVLO from Penicillium brasilianum.
SEQ ID NO: 102 is the amino acid sequence of the LAD domain of
SWISSPROT:A0AOLON1U6 from Tolypocladium ophioglossoides.
SEQ ID NO: 103 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0MOUGY1 from Madurella mycetomatis.
SEQ ID NO: 104 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0K8L1J1 from AspergiHus udagawae.
SEQ ID NO: 105 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0H5NX60 from Nocardia farcinica.
SEQ ID NO: 106 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0M2RBWO from Micromonospora sp HK10.
SEQ ID NO: 107 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0M2RKI6 from Micromonospora sp HK10.
SEQ ID NO: 108 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1F5LVD8 from Penicillium murcianum.
SEQ ID NO: 109 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0M8XNG9 from Micromonospora sp.
SEQ ID NO: 110 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0VV7WOM4 from Trichoderma gamsii.
SEQ ID NO: 111 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0Q9MHJ4 from Arthrobacter sp Soi1761.
SEQ ID NO: 112 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0Q9MU26 from Arthrobacter sp Soi1736.
SEQ ID NO: 113 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0PODUT5 from Microbacterium sp No 7.
SEQ ID NO: 114 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0Q9N9Z1 from Arthrobacter sp Soi1762.

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 115 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C6RVB7 from Micromonospora halophytica.
SEQ ID NO: 116 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C6SUA9 from Micromonospora nigra.
SEQ ID NO: 117 is the amino acid sequence of the LAD domain of
SWISSP ROT:AOA 135LM U8 from PeniciHium patulum.
SEQ ID NO: 118 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0S9BYR1 from Arthrobacter sp Lea169.
SEQ ID NO: 119 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0UOZSQ6 from Mycobacterium abscessus.
SEQ ID NO: 120 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A100WIQ1 from Mycobacterium canariasense.
SEQ ID NO: 121 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1091P50 from Micromonospora rifamycinica.
SEQ ID NO: 122 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A109IHN3 from Micromonospora rifamycinica.
SEQ ID NO: 123 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A0S2M353 from Arthrobacter alpinus.
SEQ ID NO: 124 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A134DEL4 from Microbacterium hominis.
SEQ ID NO: 125 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A142KAG2 from Gordonia phage Obliviate.
SEQ ID NO: 126 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A136PN50 from Micromonospora rosaria.
SEQ ID NO: 127 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A138A7X6 from Tsukamurella pseudospumae.
SEQ ID NO: 128 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A136PTZ6 from Micromonospora rosaria.
SEQ ID NO: 129 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A177U5Z0 from Tilletia walker.
SEQ ID NO: 130 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A177VGUO from TiHetia contro versa.
SEQ ID NO: 131 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A179G202 from Pochonia chlamydosporia 170.
SEQ ID NO: 132 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A179G 1N 9 from Pochonia chlamydosporia 170.
11

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 133 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A179FEB3 from Pochonia chlamydosporia 170.
SEQ ID NO: 134 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A179HTK7 from Purpureocillium lilacinum.
SEQ ID NO: 135 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1770655 from Paraphaeosphaeria sporulosa.
SEQ ID NO: 136 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A167GE76 from Cordyceps brongniartii RCEF 3172.
SEQ ID NO: 137 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A160DID3 from Gordonia phage Utz.
SEQ ID NO: 138 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A175J866 from Arthrobacter nicotinovorans.
SEQ ID NO: 139 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1A1X5E5 from Mycobacterium conceptionense.
SEQ ID NO: 140 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1A8ZCI7 from Micromonospora narathiwatensis.
SEQ ID NO: 141 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1A8Z6H4 from Micromonospora narathiwatensis.
SEQ ID NO: 142 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1A8Z6S5 from Micromonospora auratinigra.
SEQ ID NO: 143 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1A2MHG1 from Mycobacterium sp E1747.
SEQ ID NO: 144 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1A9BD29 from Micromonospora sediminicola.
SEQ ID NO: 145 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A196L8B1 from Microbacterium sp H83.
SEQ ID NO: 146 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C4X8A3 from Micromonospora coriariae.
SEQ ID NO: 147 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A106U2J5 from Micromonospora citrea.
SEQ ID NO: 148 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C6V2H5 from Micromonospora peucetia.
SEQ ID NO: 149 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C6VFJ6 from Micromonospora yangpuensis.
SEQ ID NO: 150 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C6S481 from Micromonospora rhizosphaerae.
12

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 151 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C5K5NO from Micromonospora echinaurantiaca.
SEQ ID NO: 152 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C5KON2 from Micromonospora inositola.
SEQ ID NO: 153 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C5JURO from Micromonospora inositola.
SEQ ID NO: 154 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C5JX99 from Micromonospora coxensis.
SEQ ID NO: 155 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C4ZAM5 from Micromonospora mirobrigensis.
SEQ ID NO: 156 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C4Z5B4 from Micromonospora viridifaciens.
SEQ ID NO: 157 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C4YQ99 from Micromonospora haikouensis.
SEQ ID NO: 158 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C6W5T7 from Micromonospora peucetia.
SEQ ID NO: 159 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C6W1B9 from Micromonospora citrea.
SEQ ID NO: 160 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C5A7S5 from Micromonospora saelicesensis.
SEQ ID NO: 161 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C5A2Q7 from Micromonospora echinospora.
SEQ ID NO: 162 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C4ZJ35 from Micromonospora purpureochromo genes.
SEQ ID NO: 163 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C5G758 from Micromonospora echinofusca.
SEQ ID NO: 164 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C5H5B2 from Micromonospora echinaurantiaca.
SEQ ID NO: 165 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C6TPW2 from Micromonospora citrea.
SEQ ID NO: 166 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C5IVI4 from Micromonospora echinaurantiaca.
SEQ ID NO: 167 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C6SECO from Micromonospora paHida.
SEQ ID NO: 168 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C6SF84 from Micromonospora rhizosphaerae.
13

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 169 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C6SQT8 from Micromonospora paHida.
SEQ ID NO: 170 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C3N2H1 from Micromonospora krabiensis.
SEQ ID NO: 171 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C3NOX1 from Micromonospora krabiensis.
SEQ ID NO: 172 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1C9EHM2 from Mycobacterium phage Tonenili.
SEQ ID NO: 173 is the amino acid sequence of the LAD domain of
SWISSP ROT:AOA 109 E H F6 from Mycobacterium phage Tonenili.
SEQ ID NO: 174 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1E41 B54 from Pseudonocardia sp SCN 72-86.
SEQ ID NO: 175 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1G8AK84 from Microbacterium pygmaeum.
SEQ ID NO: 176 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1E4NTZ4 from Pseudonocardia sp SCN 73-27.
SEQ ID NO: 177 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1JOMA43 from Mycobacterium phage Lukilu.
SEQ ID NO: 178 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1N6R300 from Micromonospora avicenniae.
SEQ ID NO: 179 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1NOVN N7 from Mycobacterium abscessus subsp abscessus.
SEQ ID NO: 180 is the amino acid sequence of the LAD domain of
SWISSP ROT:AOA 1N4 DH L3 from Mycobacterium abscessus subsp abscessus.
SEQ ID NO: 181 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1N4RVY0 from Mycobacterium abscessus subsp abscessus.
SEQ ID NO: 182 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1N6X5P6 from Micromonospora avicenniae.
SEQ ID NO: 183 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1N2VK68 from Mycobacterium abscessus subsp abscessus.
SEQ ID NO: 184 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1N1GK82 from Mycobacterium abscessus subsp abscessus.
SEQ ID NO: 185 is the amino acid sequence of the LAD domain of
SWISSPROT:AOA 1N 1EP78 from Mycobacterium abscessus subsp abscessus.
SEQ ID NO: 186 is the amino acid sequence of the LAD domain of
SWISSPROT:AOA 1N 1G9F3 from Mycobacterium abscessus subsp abscessus.
14

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 187 is the amino acid sequence of the LAD domain of
SWISSPROT:A0A1Q8LJS1 from Pseudonocardia sp Ae717 Ps2.
SEQ ID NO: 188 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:B2ASY2 from Podospora anserina.
SEQ ID NO: 189 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:B6GZX8 from PeniciHium chrysogenum.
SEQ ID NO: 190 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:C7ZQ22 from Nectria haematococca.
SEQ ID NO: 191 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:E9DSA6 from Metarhizium acridum.
SEQ ID NO: 192 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:E9F1Z9 from Metarhizium robertsii.
SEQ ID NO: 193 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:E9FC42 from Metarhizium robertsii.
SEQ ID NO: 194 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:F9F2K5 from Fusarium oxysporum.
SEQ ID NO: 195 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:F9GF09 from Fusarium oxysporum.
SEQ ID NO: 196 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:G2QV10 from Thiela via terrestris.
SEQ ID NO: 197 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:G2QV26 from Thiela via terrestris.
SEQ ID NO: 198 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:J5TH48 from Trichosporon asahll var. Asahii.
SEQ ID NO: 199 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:J4UH35 from Trichosporon asahll var. Asahii.
SEQ ID NO: 200 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:J9NQ28 from Fusarium oxysporum f. sp. Lycopersici.
SEQ ID NO: 201 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:J9NQW0 from Fusarium oxysporum f. sp. Lycopersici.
SEQ ID NO: 202 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:K1VMN5 from Trichosporon asahll var. Asahii.
SEQ ID NO: 203 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:K1WL46 from Trichosporon asahll var. Asahii.
SEQ ID NO: 204 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W9Z045 from Fusarium oxysporum f. sp. Melonis.

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 205 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:X0A5V9 from Fusarium oxysporum f. sp. Melonis.
SEQ ID NO: 206 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:N1S551 from Fusarium oxysporum f. sp. Cubense.
SEQ ID NO: 207 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:N4UD22 from Fusarium oxysporum f. sp. Cubense.
SEQ ID NO: 208 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:N4UT47 from Fusarium oxysporum f. sp. Cubense.
SEQ ID NO: 209 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W9KVWV4 from Fusarium oxysporum.
SEQ ID NO: 210 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:XOMM97 from Fusarium oxysporum f. sp. Vasinfectum.
SEQ ID NO: 211 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W7N5Q6 from Gibberella moniliformis.
SEQ ID NO: 212 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:XOBE07 from Fusarium oxysporum f. sp. Raphani.
SEQ ID NO: 213 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:X0B118 from Fusarium oxysporum.
SEQ ID NO: 214 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W9NW59 from Fusarium oxysporum f. sp. Pisi.
SEQ ID NO: 215 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W9NXR4 from Fusarium oxysporum f. sp. Pisi.
SEQ ID NO: 216 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:S7ZNE7 from Penicillium oxalicum.
SEQ ID NO: 217 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:57Z5Z6 from Penicillium oxalicum.
SEQ ID NO: 218 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W9LDDO from Fusarium oxysporum f. sp. Lycopersici.
SEQ ID NO: 219 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W9HEM8 from Fusarium oxysporum.
SEQ ID NO: 220 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W9JDH4 from Fusarium oxysporum.
SEQ ID NO: 221 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:SOEPI6 from Gibberella fujikuroi.
SEQ ID NO: 222 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W6QNL2 from PeniciHium roqueforti.
16

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 223 is the amino acid sequence of the lysozyme enhancing domain of
SWISSP ROT: U4LJ D9 from Pyronema omphalodes.
SEQ ID NO: 224 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:U4LG64 from Pyronema omphalodes.
SEQ ID NO: 225 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094AK50 from Pseudogymnoascus pannorum.
SEQ ID NO: 226 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W9JIH2 from Fusarium oxysporum.
SEQ ID NO: 227 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:XOFW82 from Fusarium oxysporum f. sp. radicis-lycopersici.
SEQ ID NO: 228 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A086TBY7 from Acremonium chrysogenum.
SEQ ID NO: 229 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A086T755 from Acremonium chrysogenum.
SEQ ID NO: 230 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A086T4C8 from Acremonium chrysogenum.
SEQ ID NO: 231 is the amino acid sequence of the lysozyme enhancing domain of
SWISSP ROT:A0A086 N N R4 from Metarhizium anisopliae.
SEQ ID NO: 232 is the amino acid sequence of the lysozyme enhancing domain of
SWISSP ROT:A0A086 N F K5 from Metarhizium anisopliae.
SEQ ID NO: 233 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094FY19 from Pseudogymnoascus pannorum.
SEQ ID NO: 234 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094G1NO from Pseudogymnoascus pannorum.
SEQ ID NO: 235 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094GEA0 from Pseudogymnoascus pannorum.
SEQ ID NO: 236 is the amino acid sequence of the lysozyme enhancing domain of
SWISSP ROT:A0A094GJ R5 from Pseudogymnoascus pannorum.
SEQ ID NO: 237 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094G660 from Pseudogymnoascus pannorum.
SEQ ID NO: 238 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A093YBN4 from Pseudogymnoascus pannorum.
SEQ ID NO: 239 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094FSZ5 from Pseudogymnoascus pannorum.
SEQ ID NO: 240 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094FBW1 from Pseudogymnoascus pannorum.
17

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 241 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094H0G2 from Pseudogymnoascus pannorum.
SEQ ID NO: 242 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094H7M1 from Pseudogymnoascus pannorum.
SEQ ID NO: 243 is the amino acid sequence of the lysozyme enhancing domain of
SWISS P ROT:A0A093Y8W3 from Pseudogymnoascus pannorum.
SEQ ID NO: 244 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094GYN9 from Pseudogymnoascus pannorum.
SEQ ID NO: 245 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A093XAD4 from Pseudogymnoascus pannorum.
SEQ ID NO: 246 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094H7J6 from Pseudogymnoascus pannorum.
SEQ ID NO: 247 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094E011 from Pseudogymnoascus pannorum.
SEQ ID NO: 248 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094CC50 from Pseudogymnoascus pannorum.
SEQ ID NO: 249 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A0941195 from Pseudogymnoascus pannorum.
SEQ ID NO: 250 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A0941AA0 from Pseudogymnoascus pannorum.
SEQ ID NO: 251 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A0941BCO from Pseudogymnoascus pannorum.
SEQ ID NO: 252 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094E946 from Pseudogymnoascus pannorum.
SEQ ID NO: 253 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094A3A0 from Pseudogymnoascus pannorum.
SEQ ID NO: 254 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A1C4L9 from AspergiHus clavatus.
SEQ ID NO: 255 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A1CBV9 from AspergiHus clavatus.
SEQ ID NO: 256 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A1DA80 from Neosartorya fischeri.
SEQ ID NO: 257 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A1DBW2 from Neosartorya fischeri.
SEQ ID NO: 258 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A1DDF2 from Neosartorya fischeri.
18

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 259 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:Q0CED1 from AspergiHus terreus.
SEQ ID NO: 260 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:Q0CED2 from AspergiHus terreus.
SEQ ID NO: 261 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:Q0CV85 from AspergiHus terreus.
SEQ ID NO: 262 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:Q2GND8 from Chaetomium globosum.
SEQ ID NO: 263 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:Q2GN D9 from Chaetomium globosum.
SEQ ID NO: 264 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:Q2H6VV7 from Chaetomium globosum.
SEQ ID NO: 265 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:Q4WAY2 from Neosartorya fumigata.
SEQ ID NO: 266 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:Q4WBR4 from Neosartorya fumigata.
SEQ ID NO: 267 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:Q4VVVY3 from Neosartorya fumigata.
SEQ ID NO: 268 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:B6H9X5 from PeniciHium chrysogenum.
SEQ ID NO: 269 is the amino acid sequence of the lysozyme enhancing domain of
SWISS PROT: B6 H R38 from Penicillium chrysogenum.
SEQ ID NO: 270 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:C7Z8W0 from Nectria haematococca.
SEQ ID NO: 271 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:C7ZQ20 from Nectria haematococca.
SEQ ID NO: 272 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:GORP87 from Hypocrea jecorina.
SEQ ID NO: 273 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:G2RG69 from Thiela via terrestris.
SEQ ID NO: 274 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:G2QNE9 from Thiela via heterothallica.
SEQ ID NO: 275 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:GORM22 from Hypocrea jecorina.
SEQ ID NO: 276 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:G05G36 from Chaetomium thermophilum var. Thermophilum.
19

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 277 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:GORZV3 from Chaetomium thermophilum var. Thermophilum.
SEQ ID NO: 278 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:J9NQV9 from Fusarium oxysporum f. sp. Lycopersici.
SEQ ID NO: 279 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:G2QD02 from Thiela via heterothallica.
SEQ ID NO: 280 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:G2QNFO from Thiela via heterothallica.
SEQ ID NO: 281 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:G9MHR1 from Hypocrea virens.
SEQ ID NO: 282 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:E9ELX9 from Metarhizium robertsii.
SEQ ID NO: 283 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:F9F2K4 from Fusarium oxysporum.
SEQ ID NO: 284 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:GORZV2 from Chaetomium thermophilum var. Thermophilum.
SEQ ID NO: 285 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:G2RG70 from Thiela via terrestris.
SEQ ID NO: 286 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W9Z992 from Fusarium oxysporum f. sp. Melonis.
SEQ ID NO: 287 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W9ZZW9 from Fusarium oxysporum f. sp. Melonis.
SEQ ID NO: 288 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W9ZAE8 from Fusarium oxysporum f. sp. Melonis.
SEQ ID NO: 289 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:N1RWA4 from Fusarium oxysporum f. sp. Cubense.
SEQ ID NO: 290 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:N4UKT7 from Fusarium oxysporum f. sp. Cubense.
SEQ ID NO: 291 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W9KX02 from Fusarium oxysporum.
SEQ ID NO: 292 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:X0B4J3 from Fusarium oxysporum f. sp. Raphani.
SEQ ID NO: 293 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W6QE02 from PeniciHium roqueforti.
SEQ ID NO: 294 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:W6R4X8 from PeniciHium roqueforti.

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 295 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A024S9B8 from Trichoderma reesei.
SEQ ID NO: 296 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A086NN36 from Metarhizium anisopliae.
SEQ ID NO: 297 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094GA03 from Pseudogymnoascus pannorum.
SEQ ID NO: 298 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094C8U1 from Pseudogymnoascus pannorum.
SEQ ID NO: 299 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A093Z6Z8 from Pseudogymnoascus pannorum.
SEQ ID NO: 300 is the amino acid sequence of the lysozyme enhancing domain of
SWISSP ROT:A0A094 I M L3 from Pseudogymnoascus pannorum.
SEQ ID NO: 301 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094GY79 from Pseudogymnoascus pannorum.
SEQ ID NO: 302 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A093XPZ7 from Pseudogymnoascus pannorum.
SEQ ID NO: 303 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A093XAS9 from Pseudogymnoascus pannorum.
SEQ ID NO: 304 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A09418J6 from Pseudogymnoascus pannorum.
SEQ ID NO: 305 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094FTLO from Pseudogymnoascus pannorum.
SEQ ID NO: 306 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094AT39 from Pseudogymnoascus pannorum.
SEQ ID NO: 307 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A093XSP5 from Pseudogymnoascus pannorum.
SEQ ID NO: 308 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094BAE6 from Pseudogymnoascus pannorum.
SEQ ID NO: 309 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A0941E25 from Pseudogymnoascus pannorum.
SEQ ID NO: 310 is the amino acid sequence of the lysozyme enhancing domain of
SWISSP ROT:A0A094 H NM 8 from Pseudogymnoascus pannorum.
SEQ ID NO: 311 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094ETJ5 from Pseudogymnoascus pannorum.
SEQ ID NO: 312 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094EPJ7 from Pseudogymnoascus pannorum.
21

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 313 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094E9W0 from Pseudogymnoascus pannorum.
SEQ ID NO: 314 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094BWD6 from Pseudogymnoascus pannorum.
SEQ ID NO: 315 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A094BTS1 from Pseudogymnoascus pannorum.
SEQ ID NO: 316 is the amino acid sequence of the lysozyme enhancing domain of
SWISSPROT:A0A093ZTZ8 from Pseudogymnoascus pannorum.
SEQ ID NO: 317 is conserved motif I AG[1/1401/4T[A/G][1/L][T/V]ES.
SEQ ID NO: 318 is conserved motif II V[G/A]XLCQXVQXSAYP.
SEQ ID NO: 319 is conserved motif III
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN].
SEQ ID NO: 320 is the synthetic DNA construct of plasmid pDAu770.
SEQ ID NO: 321 is the forward primer KK500972-F.
SEQ ID NO: 322 is the reverse primer KK500972-R.
SEQ ID NO: 323 is forward primer F1.
SEQ ID NO: 324 is reverse primer F1.
SEQ ID NO: 325 is forward primer F3.
SEQ ID NO: 326 is reverse primer F3.
SEQ ID NO: 327 Primer bind forward.
SEQ ID NO: 328 Primer bind reverse.
SEQ ID NO: 329 is the amino acid sequence of the truncated LYA polypeptide
from
Ovatospora brasiliensis.
Figures
Figure 1 represents the map of the different DNA features included on the
plasmid
pDAu770. The amy2 locus flanking regions (3' and 5') are indicated by white
boxes. Promoter
regions are indicated by green boxes for the promoter region of the pyrG, tef1
and tpi gene. The
purple boxes indicate the selection cassette (ampR for ampicillin resistance
and amdS for
acetamide selection). The terminator regions are indicated by blue boxes for
the terminator
region of the niaD and amg genes. The coding region of the FLPase (sFLP) and
the first exon of
the pyrG gene are indicated in orange. The 5' region of the pyrG intron is
indicated in grey. The
origin of replication of the plasmid is indicated by ORI.
Figure 2 is the schematic representation of transformation of the host strain
DAu785 by
the transforming DNA (either plasmid pDAu724 or derivatives or
OverlapExtension PCR
products.
Top panel represents the locus amy2 with the integration of the FLP landing
pad
composed of FRT-F and FRT-F3 the FLPase recognition site, as well as the amdS
(acetamide)
22

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
selection marker and the FLPase expression cassette. A split PyrG marker has
been used and
at the amy2 locus the 5' end of the pyrG marker is inserted.
Middle panel represents the transforming DNA, in particular the region that is
integrated
at the FLP landing pad by site specific recombination mediated by FLPase. The
palsmid or PCR
product must contain FRT-F and F3 sites as well as the remaining 3' part of
the pyrG marker.
Bottom panel represents the resulting amy2 locus after site specific
integration of the
transformaing DNA between the FRT sites. The amdS and FLP cassettes have been
exchanged with the GOI expression cassette and the 3' part of the pyrG marker
reconstituting a
fully functional selection marker.
Definitions
Animal: The term "animal" refers to any animal except humans. Examples of
animals
are monogastric animals, including but not limited to pigs or swine
(including, but not limited to,
piglets, growing pigs, and sows); poultry such as turkeys, ducks, quail,
guinea fowl, geese,
pigeons (including squabs) and chicken (including but not limited to broiler
chickens (referred to
herein as broiles), chicks, layer hens (referred to herein as layers)); horses
(including but not
limited to hotbloods, coldbloods and warm bloods) crustaceans (including but
not limited to
shrimps and prawns) and fish (including but not limited to amberjack,
arapaima, barb, bass,
bluefish, bocachico, bream, bullhead, cachama, carp, catfish, catla, chanos,
char, cichlid, cobia,
cod, crappie, dorada, drum, eel, goby, goldfish, gourami, grouper, guapote,
halibut, java, labeo,
lai, loach, mackerel, milkfish, mojarra, mudfish, mullet, paco, pearlspot,
pejerrey, perch, pike,
pompano, roach, salmon, sampa, sauger, sea bass, seabream, shiner, sleeper,
snakehead,
snapper, snook, sole, spinefoot, sturgeon, sunfish, sweetfish, tench, terror,
tilapia, trout, tuna,
turbot, vendace, walleye and whitefish).
Animal feed: The term "animal feed" refers to any compound, preparation, or
mixture
suitable for, or intended for intake by a monogastric animal. Animal feed for
a monogastric
animal typically comprises concentrates as well as vitamins, minerals,
enzymes, direct fed
microbial, amino acids and/or other feed ingredients (such as in a premix)..
Antimicrobial activity: The term "antimicrobial activity" is defined herein as
an activity
that kills or inhibits the growth of microorganisms, such as, algae, archea,
bacteria, fungi and/or
protozoans. The antimicrobial activity can, for example, be bactericidal
meaning the killing of
bacteria or bacteriostatic meaning the prevention of bacterial growth. The
antimicrobial activity
can include catalyzing the hydrolysis of 1,4-beta-linkages between N-
acetylmuramic acid and N-
acetyl-D-glucosamine residues in a peptidoglycan and between N-acetyl-D-
glucosamine
residues in chitodextrins. Antimicrobial activity can also include the LYS
polypeptide binding to
the surface of the microorganism and inhibiting its growth. The antimicrobial
effect can also
23

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
include the use of the LYS polypeptides of the present invention for
activation of bacterial
autolysins, as an immunostimulator, by inhibiting or reducing bacterial toxins
and by an opsonin
effect.
Body Weight Gain: The term "body weight gain" means an increase in live weight
of an
animal during a given period of time e.g. the increase in weight from day 1 to
day 21.
cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse
transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic
or prokaryotic
cell. cDNA lacks intron sequences that may be present in the corresponding
genomic DNA. The
initial, primary RNA transcript is a precursor to mRNA that is processed
through a series of
steps, including splicing, before appearing as mature spliced mRNA.
Coding sequence: The term "coding sequence" means a polynucleotide, which
directly
specifies the amino acid sequence of a polypeptide. The boundaries of the
coding sequence are
generally determined by an open reading frame, which begins with a start codon
such as ATG,
GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA. The coding
sequence
may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.
Concentrates: The term "concentrates" means feed with high protein and energy
concentrations, such as fish meal, molasses, oligosaccharides, sorghum, seeds
and grains
(either whole or prepared by crushing, milling, etc. from e.g. corn, oats,
rye, barley, wheat),
oilseed press cake (e.g. from cottonseed, safflower, sunflower, soybean (such
as soybean
meal), rapeseed/canola, peanut or groundnut), palm kernel cake, yeast derived
material and
distillers grains (such as wet distillers grains (WDS) and dried distillers
grains with solubles
(DDGS)).
Control sequences: The term "control sequences" means nucleic acid sequences
necessary for expression of a polynucleotide encoding a mature polypeptide of
the present
invention. Each control sequence may be native (i.e., from the same gene) or
foreign (i.e., from
a different gene) to the polynucleotide encoding the polypeptide or native or
foreign to each
other. Such control sequences include, but are not limited to, a leader,
polyadenylation
sequence, propeptide sequence, promoter, signal peptide sequence, and
transcription
terminator. At a minimum, the control sequences include a promoter, and
transcriptional and
translational stop signals. The control sequences may be provided with linkers
for the purpose
of introducing specific restriction sites facilitating ligation of the control
sequences with the
coding region of the polynucleotide encoding a polypeptide.
European Production Efficacy Factor (EPEF): The "European Production Efficacy
Factor" is a way of comparing the performance of animals. This single-figure
facilitates
comparison of performance within and among farms and can be used to assess
environmental,
climatic and managemental variables. The EPEF is calculated as [(liveability
(c/o) x Liveweight
(kg)) / (Age at depletion (days) x FOR)] x 100, wherein livability is the
percentage of animals
24

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
alive at slaughter, Liveweight is the average weight of the animals at
slaughter, age of depletion
is the age of the animals at slaughter and FOR is the feed conversion ratio at
slaughter.
Expression: The term "expression" includes any step involved in the production
of a
polypeptide including, but not limited to, transcription, post-transcriptional
modification,
translation, post-translational modification, and secretion.
Expression vector: The term "expression vector" means a linear or circular DNA
molecule that comprises a polynucleotide encoding a polypeptide and is
operably linked to
control sequences that provide for its expression.
Feed Conversion Ratio (FCR): FOR is a measure of an animal's efficiency in
converting feed mass into increases of the desired output. Animals raised for
meat ¨ such as
swine, poultry and fish ¨ the output is the mass gained by the animal.
Specifically, FOR is
calculated as feed intake divided by weight gain, all over a specified period.
Improvement in
FOR means reduction of the FOR value. A FOR improvement of 2% means that the
FOR was
reduced by 2%.
Feed efficiency: The term "feed efficiency" means the amount of weight gain
per unit of
feed when the animal is fed ad-libitum or a specified amount of food during a
period of time. By
"increased feed efficiency" it is meant that the use of a feed additive
composition according the
present invention in feed results in an increased weight gain per unit of feed
intake compared
with an animal fed without said feed additive composition being present.
Forage: The term "forage" as defined herein also includes roughage. Forage is
fresh
plant material such as hay and silage from forage plants, grass and other
forage plants,
seaweed, sprouted grains and legumes, or any combination thereof. Examples of
forage plants
are Alfalfa (lucerne), birdsfoot trefoil, brassica (e.g. kale, rapeseed
(canola), rutabaga (swede),
turnip), clover (e.g. alsike clover, red clover, subterranean clover, white
clover), grass (e.g.
Bermuda grass, brome, false oat grass, fescue, heath grass, meadow grasses,
orchard grass,
ryegrass, Timothy-grass), corn (maize), millet, barley, oats, rye, sorghum,
soybeans and wheat
and vegetables such as beets. Forage further includes crop residues from grain
production
(such as corn stover; straw from wheat, barley, oat, rye and other grains);
residues from
vegetables like beet tops; residues from oilseed production like stems and
leaves form soy
beans, rapeseed and other legumes; and fractions from the refining of grains
for animal or
human consumption or from fuel production or other industries.
Fragment: The term "fragment" means a LYS polypeptide having one or more
(e.g.,
several) amino acids absent from the amino and/or carboxyl terminus of a
mature polypeptide or
domain; wherein the fragment has lysozyme activity.
In one aspect, the fragment comprises at least 90% of the length of the mature
polypeptide, such as at least 203 amino acids of SEQ ID NO: 2, at least 203
amino acids of
SEQ ID NO: 3, at least 203 amino acids of SEQ ID NO: 5, at least 203 amino
acids of SEQ ID

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
NO: 6, at least 200 amino acids of SEQ ID NO: 8, at least 200 amino acids of
SEQ ID NO: 9, at
least 273 amino acids of SEQ ID NO: 11, at least 273 amino acids of SEQ ID NO:
12, at least
205 amino acids of SEQ ID NO: 14, at least 205 amino acids of SEQ ID NO: 15,
at least 207
amino acids of SEQ ID NO: 17, at least 207 amino acids of SEQ ID NO: 18, at
least 207 amino
acids of SEQ ID NO: 20, at least 207 amino acids of SEQ ID NO: 21, at least
208 amino acids
of SEQ ID NO: 23, at least 208 amino acids of SEQ ID NO: 24, at least 205
amino acids of SEQ
ID NO: 26, at least 205 amino acids of SEQ ID NO: 27, at least 205 amino acids
of SEQ ID NO:
29, at least 205 amino acids of SEQ ID NO: 30, at least 203 amino acids of SEQ
ID NO: 32, at
least 203 amino acids of SEQ ID NO: 33, at least 202 amino acids of SEQ ID NO:
35, at least
202 amino acids of SEQ ID NO: 36, at least 202 amino acids of SEQ ID NO: 38,
at least 202
amino acids of SEQ ID NO: 39, at least 273 amino acids of SEQ ID NO: 41, at
least 273 amino
acids of SEQ ID NO: 42, at least 204 amino acids of SEQ ID NO: 44, or at least
204 amino
acids of SEQ ID NO: 45.
In one aspect, the fragment comprises at least 92% of the length of the mature
polypeptide, such as at least 207 amino acids of SEQ ID NO: 2, at least 207
amino acids of
SEQ ID NO: 3, at least 207 amino acids of SEQ ID NO: 5, at least 207 amino
acids of SEQ ID
NO: 6, at least 205 amino acids of SEQ ID NO: 8, at least 205 amino acids of
SEQ ID NO: 9, at
least 279 amino acids of SEQ ID NO: 11, at least 279 amino acids of SEQ ID NO:
12, at least
209 amino acids of SEQ ID NO: 14, at least 209 amino acids of SEQ ID NO: 15,
at least 211
amino acids of SEQ ID NO: 17, at least 211 amino acids of SEQ ID NO: 18, at
least 211 amino
acids of SEQ ID NO: 20, at least 211 amino acids of SEQ ID NO: 21, at least
213 amino acids
of SEQ ID NO: 23, at least 213 amino acids of SEQ ID NO: 24, at least 209
amino acids of SEQ
ID NO: 26, at least 209 amino acids of SEQ ID NO: 27, at least 209 amino acids
of SEQ ID NO:
29, at least 209 amino acids of SEQ ID NO: 30, at least 207 amino acids of SEQ
ID NO: 32, at
least 207 amino acids of SEQ ID NO: 33, at least 207 amino acids of SEQ ID NO:
35, at least
207 amino acids of SEQ ID NO: 36, at least 207 amino acids of SEQ ID NO: 38,
at least 207
amino acids of SEQ ID NO: 39, at least 279 amino acids of SEQ ID NO: 41, at
least 279 amino
acids of SEQ ID NO: 42, at least 208 amino acids of SEQ ID NO: 44, or at least
208 amino
acids of SEQ ID NO: 45.
In one aspect, the fragment comprises at least 94% of the length of the mature
polypeptide, such as at least 212 amino acids of SEQ ID NO: 2, at least 212
amino acids of
SEQ ID NO: 3, at least 212 amino acids of SEQ ID NO: 5, at least 212 amino
acids of SEQ ID
NO: 6, at least 209 amino acids of SEQ ID NO: 8, at least 209 amino acids of
SEQ ID NO: 9, at
least 285 amino acids of SEQ ID NO: 11, at least 285 amino acids of SEQ ID NO:
12, at least
214 amino acids of SEQ ID NO: 14, at least 214 amino acids of SEQ ID NO: 15,
at least 216
amino acids of SEQ ID NO: 17, at least 216 amino acids of SEQ ID NO: 18, at
least 216 amino
acids of SEQ ID NO: 20, at least 216 amino acids of SEQ ID NO: 21, at least
218 amino acids
26

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
of SEQ ID NO: 23, at least 218 amino acids of SEQ ID NO: 24, at least 214
amino acids of SEQ
ID NO: 26, at least 214 amino acids of SEQ ID NO: 27, at least 214 amino acids
of SEQ ID NO:
29, at least 214 amino acids of SEQ ID NO: 30, at least 212 amino acids of SEQ
ID NO: 32, at
least 212 amino acids of SEQ ID NO: 33, at least 211 amino acids of SEQ ID NO:
35, at least
211 amino acids of SEQ ID NO: 36, at least 211 amino acids of SEQ ID NO: 38,
at least 211
amino acids of SEQ ID NO: 39, at least 285 amino acids of SEQ ID NO: 41, at
least 285 amino
acids of SEQ ID NO: 42, at least 213 amino acids of SEQ ID NO: 44, or at least
213 amino
acids of SEQ ID NO: 45.
In one aspect, the fragment comprises at least 96% of the length of the mature
polypeptide, such as at least 216 amino acids of SEQ ID NO: 2, at least 216
amino acids of
SEQ ID NO: 3, at least 216 amino acids of SEQ ID NO: 5, at least 216 amino
acids of SEQ ID
NO: 6, at least 214 amino acids of SEQ ID NO: 8, at least 214 amino acids of
SEQ ID NO: 9, at
least 291 amino acids of SEQ ID NO: 11, at least 291 amino acids of SEQ ID NO:
12, at least
218 amino acids of SEQ ID NO: 14, at least 218 amino acids of SEQ ID NO: 15,
at least 220
amino acids of SEQ ID NO: 17, at least 220 amino acids of SEQ ID NO: 18, at
least 220 amino
acids of SEQ ID NO: 20, at least 220 amino acids of SEQ ID NO: 21, at least
222 amino acids
of SEQ ID NO: 23, at least 222 amino acids of SEQ ID NO: 24, at least 218
amino acids of SEQ
ID NO: 26, at least 218 amino acids of SEQ ID NO: 27, at least 218 amino acids
of SEQ ID NO:
29, at least 218 amino acids of SEQ ID NO: 30, at least 216 amino acids of SEQ
ID NO: 32, at
least 216 amino acids of SEQ ID NO: 33, at least 216 amino acids of SEQ ID NO:
35, at least
216 amino acids of SEQ ID NO: 36, at least 216 amino acids of SEQ ID NO: 38,
at least 216
amino acids of SEQ ID NO: 39, at least 291 amino acids of SEQ ID NO: 41, at
least 291 amino
acids of SEQ ID NO: 42, at least 217 amino acids of SEQ ID NO: 44, or at least
217 amino
acids of SEQ ID NO: 45.
In one aspect, the fragment comprises at least 98% of the length of the mature
polypeptide, such as at least 221 amino acids of SEQ ID NO: 2, at least 221
amino acids of
SEQ ID NO: 3, at least 221 amino acids of SEQ ID NO: 5, at least 221 amino
acids of SEQ ID
NO: 6, at least 218 amino acids of SEQ ID NO: 8, at least 218 amino acids of
SEQ ID NO: 9, at
least 297 amino acids of SEQ ID NO: 11, at least 297 amino acids of SEQ ID NO:
12, at least
223 amino acids of SEQ ID NO: 14, at least 223 amino acids of SEQ ID NO: 15,
at least 225
amino acids of SEQ ID NO: 17, at least 225 amino acids of SEQ ID NO: 18, at
least 225 amino
acids of SEQ ID NO: 20, at least 225 amino acids of SEQ ID NO: 21, at least
227 amino acids
of SEQ ID NO: 23, at least 227 amino acids of SEQ ID NO: 24, at least 223
amino acids of SEQ
ID NO: 26, at least 223 amino acids of SEQ ID NO: 27, at least 223 amino acids
of SEQ ID NO:
29, at least 223 amino acids of SEQ ID NO: 30, at least 221 amino acids of SEQ
ID NO: 32, at
least 221 amino acids of SEQ ID NO: 33, at least 220 amino acids of SEQ ID NO:
35, at least
220 amino acids of SEQ ID NO: 36, at least 220 amino acids of SEQ ID NO: 38,
at least 220
27

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
amino acids of SEQ ID NO: 39, at least 297 amino acids of SEQ ID NO: 41, at
least 297 amino
acids of SEQ ID NO: 42, at least 222 amino acids of SEQ ID NO: 44, or at least
222 amino
acids of SEQ ID NO: 45.
In one aspect, the fragment comprises at least 99% of the length of the mature
polypeptide, such as at least 223 amino acids of SEQ ID NO: 2, at least 223
amino acids of
SEQ ID NO: 3, at least 223 amino acids of SEQ ID NO: 5, at least 223 amino
acids of SEQ ID
NO: 6, at least 220 amino acids of SEQ ID NO: 8, at least 220 amino acids of
SEQ ID NO: 9, at
least 300 amino acids of SEQ ID NO: 11, at least 300 amino acids of SEQ ID NO:
12, at least
225 amino acids of SEQ ID NO: 14, at least 225 amino acids of SEQ ID NO: 15,
at least 227
amino acids of SEQ ID NO: 17, at least 227 amino acids of SEQ ID NO: 18, at
least 227 amino
acids of SEQ ID NO: 20, at least 227 amino acids of SEQ ID NO: 21, at least
229 amino acids
of SEQ ID NO: 23, at least 229 amino acids of SEQ ID NO: 24, at least 225
amino acids of SEQ
ID NO: 26, at least 225 amino acids of SEQ ID NO: 27, at least 225 amino acids
of SEQ ID NO:
29, at least 225 amino acids of SEQ ID NO: 30, at least 223 amino acids of SEQ
ID NO: 32, at
least 223 amino acids of SEQ ID NO: 33, at least 222 amino acids of SEQ ID NO:
35, at least
222 amino acids of SEQ ID NO: 36, at least 222 amino acids of SEQ ID NO: 38,
at least 222
amino acids of SEQ ID NO: 39, at least 300 amino acids of SEQ ID NO: 41, at
least 300 amino
acids of SEQ ID NO: 42, at least 224 amino acids of SEQ ID NO: 44, or at least
224 amino
acids of SEQ ID NO: 45.
Fusion polypeptide: The term "fusion polypeptide" is a polypeptide in which
one
polypeptide is fused at the N-terminus or the C-terminus of the polypeptide of
the present
invention. A fusion polypeptide is produced by fusing a polynucleotide
encoding another
polypeptide to a polynucleotide of the present invention. Techniques for
producing fusion
polypeptides are known in the art, and include ligating the coding sequences
encoding the
polypeptides so that they are in frame and that expression of the fusion
polypeptide is under
control of the same promoter(s) and terminator. Fusion polypeptides may also
be constructed
using intein technology in which fusion polypeptides are created post-
translationally (Cooper et
al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779).
A fusion
polypeptide can further comprise a cleavage site between the two polypeptides.
Upon secretion
of the fusion protein, the site is cleaved releasing the two polypeptides.
Examples of cleavage
sites include, but are not limited to, the sites disclosed in Martin et al.,
2003, J. Ind. Microbiol.
Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 76: 245-251;
Rasmussen-VVilson et
al., 1997, App!. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995,
Biotechnology 13: 498-
503; and Contreras etal., 1991, Biotechnology 9: 378-381; Eaton etal., 1986,
Biochemistry 25:
505-512; Collins-Racie et al., 1995, Biotechnology 13: 982-987; Carter et al.,
1989, Proteins:
Structure, Function, and Genetics 6: 240-248; and Stevens, 2003, Drug
Discovery World 4: 35-
48.
28

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Host cell: The term "host cell" means any cell type that is susceptible to
transformation,
transfection, transduction, or the like with a nucleic acid construct or
expression vector
comprising a polynucleotide of the present invention. The term "host cell"
encompasses any
progeny of a parent cell that is not identical to the parent cell due to
mutations that occur during
replication.
Hybrid polypeptide: The term "hybrid polypeptide" means a polypeptide
comprising
domains from two or more polypeptides, e.g., a binding domain from one
polypeptide and a
catalytic domain from another polypeptide. The domains may be fused at the N-
terminus or the
C-terminus.
Isolated: The term "isolated" means a substance in a form that does not occur
in nature
or in an environment in which the substance does not occur in nature. Non-
limiting examples of
isolated substances include (1) any non-naturally occurring substance, (2) any
substance
including, but not limited to, any enzyme, variant, nucleic acid, protein,
peptide or cofactor, that
is at least partially removed from one or more or all of the naturally
occurring constituents with
which it is associated in nature; (3) any substance modified by the hand of
man relative to that
substance found in nature; or (4) any substance modified by increasing the
amount of the
substance relative to other components with which it is naturally associated
(e.g., recombinant
production in a host cell; multiple copies of a gene encoding the substance;
and use of a
stronger promoter than the promoter naturally associated with the gene
encoding the
substance).
Lysozyme activity: The term "lysozyme activity" means the hydrolysis of the
1,4-beta-
linkages between N-acetylmuramic acid and N-acetyl-D-glucosamine residues in a

peptidoglycan, resulting in bacteriolysis. Lysozyme belongs to the enzyme
class EC 3.2.1.17.
Lysozyme activity is typically measured by the lytic action of the lysozyme on
Micrococcus
luteus ATCC 4698. In appropriate experimental conditions these changes are
proportional to the
amount of lysozyme in the medium (c.f. INS 1105 of the Combined Compendium of
Food
Additive Specifications of the Food and Agriculture Organisation of the UN
(www.fao.org)). For
the purpose of the present invention, lysozyme activity is determined
according to the reducing-
ends assay described in Example 1 ("Determination of Lysozyme Activity using
reducing ends
assay"). The polypeptide has lysozyme activity if it shows activity against
Micrococcus luteus
ATCC 4698.
In one aspect, the polypeptides of the present invention have at least 50%,
e.g.,
preferably at least 60%, preferably at least 70%, more preferably at least
80%, more preferably
at least 90%, even more preferably at least 95% or most preferably at least
100% of the
lysozyme activity of SEQ ID NO: 12, preferably wherein lysozyme activity is
determined as
described in Example 1. In one aspect, the polypeptides of the present
invention have at least
50%, e.g., preferably at least 60%, preferably at least 70%, more preferably
at least 80%, more
29

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
preferably at least 90%, even more preferably at least 95% or most preferably
at least 100% of
the lysozyme activity of SEQ ID NO: 12 wherein lysozyme activity is determined
as follows: LYS
polypeptide (50 pL of 0.7 pg/mL LYS polypeptide in phosphate buffer (5 mM
citrate, 5 mM
K2HPO4, 0.01% TritonX-100, pH 5.0)) is mixed with Micrococcus lysodeikticus
solution (450 pL
of 1% lyophilized Micrococcus lysodeikticus ATCC No. 4698 in milli-Q water)
and incubated at
40 C with shaking (500 rpm) for 45 min; the sample is centrifuged (4000g, 5
min); supernatant
(100 pL) is mixed with HCI (50 pL 3.2M) and incubated at 95 C for 80 min; NaOH
(50 pL, 3.5 M)
is added and 150 pL of the sample is added to 4-hydroxybenzhydrazide in K-Na
tartrate/NaOH
buffer (75 pL of 50 g/L K-Na tartrate + 20 g/L NaOH); the mixture is incubated
at 95 C for 10
min; and the optical density is measured at 405 nm.
Mature polypeptide: The term "mature polypeptide" means a polypeptide in its
final
form following translation and any post-translational modifications, such as N-
terminal
processing, C-terminal truncation, glycosylation, phosphorylation, etc.
In one aspect, the mature polypeptide is amino acids 1 to 226 of SEQ ID NO: 2
and
amino acids -19 to -1 of SEQ ID NO: 2 are a signal peptide. In another aspect,
the mature
polypeptide is amino acids 1 to 226 of SEQ ID NO: 3. In one aspect, the mature
polypeptide is
amino acids 1 to 226 of SEQ ID NO: 5 and amino acids -19 to -1 of SEQ ID NO: 5
are a signal
peptide. In another aspect, the mature polypeptide is amino acids 1 to 226 of
SEQ ID NO: 6. In
one aspect, the mature polypeptide is amino acids 1 to 223 of SEQ ID NO: 8 and
amino acids -
20 to -1 of SEQ ID NO: 8 are a signal peptide. In another aspect, the mature
polypeptide is
amino acids 1 to 223 of SEQ ID NO: 9. In one aspect, the mature polypeptide is
amino acids 1
to 304 of SEQ ID NO: 11 and amino acids -20 to -1 of SEQ ID NO: 11 are a
signal peptide. In
another aspect, the mature polypeptide is amino acids 1 to 304 of SEQ ID NO:
12. In one
aspect, the mature polypeptide is amino acids 1 to 228 of SEQ ID NO: 14 and
amino acids -19
to -1 of SEQ ID NO: 14 are a signal peptide. In another aspect, the mature
polypeptide is amino
acids 1 to 228 of SEQ ID NO: 15. In one aspect, the mature polypeptide is
amino acids 1 to 230
of SEQ ID NO: 17 and amino acids -20 to -1 of SEQ ID NO: 17 are a signal
peptide. In another
aspect, the mature polypeptide is amino acids 1 to 230 of SEQ ID NO: 18. In
one aspect, the
mature polypeptide is amino acids 1 to 230 of SEQ ID NO: 20 and amino acids -
21 to -1 of SEQ
ID NO: 20 are a signal peptide. In another aspect, the mature polypeptide is
amino acids 1 to
230 of SEQ ID NO: 21. In one aspect, the mature polypeptide is amino acids 1
to 232 of SEQ ID
NO: 23 and amino acids -22 to -1 of SEQ ID NO: 23 are a signal peptide. In
another aspect, the
mature polypeptide is amino acids 1 to 232 of SEQ ID NO: 24. In one aspect,
the mature
polypeptide is amino acids 1 to 228 of SEQ ID NO: 26 and amino acids -20 to -1
of SEQ ID NO:
26 are a signal peptide. In another aspect, the mature polypeptide is amino
acids 1 to 228 of
SEQ ID NO: 27. In one aspect, the mature polypeptide is amino acids 1 to 228
of SEQ ID NO:
29 and amino acids -20 to -1 of SEQ ID NO: 29 are a signal peptide. In another
aspect, the

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
mature polypeptide is amino acids 1 to 228 of SEQ ID NO: 30. In one aspect,
the mature
polypeptide is amino acids 1 to 226 of SEQ ID NO: 32 and amino acids -19 to -1
of SEQ ID NO:
32 are a signal peptide. In another aspect, the mature polypeptide is amino
acids 1 to 226 of
SEQ ID NO: 33. In one aspect, the mature polypeptide is amino acids 1 to 225
of SEQ ID NO:
35 and amino acids -20 to -1 of SEQ ID NO: 35 are a signal peptide. In another
aspect, the
mature polypeptide is amino acids 1 to 225 of SEQ ID NO: 36. In one aspect,
the mature
polypeptide is amino acids 1 to 225 of SEQ ID NO: 38 and amino acids -19 to -1
of SEQ ID NO:
38 are a signal peptide. In another aspect, the mature polypeptide is amino
acids 1 to 225 of
SEQ ID NO: 39. In one aspect, the mature polypeptide is amino acids 1 to 304
of SEQ ID NO:
41 and amino acids -19 to -1 of SEQ ID NO: 41 are a signal peptide. In another
aspect, the
mature polypeptide is amino acids 1 to 304 of SEQ ID NO: 42. In one aspect,
the mature
polypeptide is amino acids 1 to 227 of SEQ ID NO: 44 and amino acids -19 to -1
of SEQ ID NO:
44 are a signal peptide. In another aspect, the mature polypeptide is amino
acids 1 to 227 of
SEQ ID NO: 45.
It is known in the art that a host cell may produce a mixture of two of more
different
mature polypeptides (i.e., with a different C-terminal and/or N-terminal amino
acid) expressed
by the same polynucleotide. It is also known in the art that different host
cells process
polypeptides differently, and thus, one host cell expressing a polynucleotide
may produce a
different mature polypeptide (e.g., having a different C-terminal and/or N-
terminal amino acid)
as compared to another host cell expressing the same polynucleotide.
Mature polypeptide coding sequence: The term "mature polypeptide coding
sequence" means a polynucleotide that encodes a mature polypeptide having
lysozyme activity.
Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid

molecule, either single- or double-stranded, which is isolated from a
naturally occurring gene or
is modified to contain segments of nucleic acids in a manner that would not
otherwise exist in
nature or which is synthetic, which comprises one or more control sequences.
Obtained or obtainable from: The term "obtained or obtainable from" means that
the
polypeptide may be found in an organism from a specific taxonomic rank. In one
embodiment,
the polypeptide is obtained or obtainable from the kingdom Fungi, wherein the
term kingdom is
the taxonomic rank. In a preferred embodiment, the polypeptide is obtained or
obtainable from
the phylum Ascomycota, wherein the term phylum is the taxonomic rank. In
another preferred
embodiment, the polypeptide is obtained or obtainable from the subphylum
Pezizomycotina,
wherein the term subphylum is the taxonomic rank.
If the taxonomic rank of a polypeptide is not known, it can easily be
determined by a
.. person skilled in the art by performing a BLASTP search of the polypeptide
(using e.g. the
National Center for Biotechnology Information (NCIB) website
http://www.ncbi.nlm.nih.gov/) and
comparing it to the closest homologues. An unknown polypeptide which is a
fragment of a
31

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
known polypeptide is considered to be of the same taxonomic species. An
unknown natural
polypeptide or artificial variant which comprises a substitution, deletion
and/or insertion in up to
positions is considered to be from the same taxonomic species as the known
polypeptide.
Operably linked: The term "operably linked" means a configuration in which a
control
5 sequence is placed at an appropriate position relative to the coding
sequence of a
polynucleotide such that the control sequence directs expression of the coding
sequence.
Roughage: The term "roughage" means dry plant material with high levels of
fiber, such
as fiber, bran, husks from seeds and grains and crop residues (such as stover,
copra, straw,
chaff, sugar beet waste).
10 Sequence identity: The relatedness between two amino acid sequences or
between
two nucleotide sequences is described by the parameter "sequence identity".
For purposes of the present invention, the sequence identity between two amino
acid
sequences is determined using the Needleman-Wunsch algorithm (Needleman and
Wunsch,
1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the
EMBOSS
package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et
al., 2000,
Trends Genet. 16: 276-277), preferably version 5Ø0 or later. The parameters
used are gap
open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS
version of
BLOSUM62) substitution matrix. The output of Needle labelled "longest
identity" (obtained using
the ¨nobrief option) is used as the percent identity and is calculated as
follows:
(Identical Residues x 100)/(Length of Alignment¨ Total Number of Gaps in
Alignment)
For purposes of the present invention, the sequence identity between two
deoxyribonucleotide sequences is determined using the Needleman-Wunsch
algorithm
(Needleman and Wunsch, 1970, supra) as implemented in the Needle program of
the EMBOSS
package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et
al., 2000,
supra), preferably version 5Ø0 or later. The parameters used are gap open
penalty of 10, gap
extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCB! NUC4.4)
substitution
matrix. The output of Needle labelled "longest identity" (obtained using the
¨nobrief option) is
used as the percent identity and is calculated as follows:
(Identical Deoxyribonucleotides x 100)/(Length of Alignment ¨ Total Number of
Gaps in
Alignment)
Subsequence: The term "subsequence" means a polynucleotide having one or more
(e.g., several) nucleotides absent from the 5' and/or 3' end of a mature
polypeptide coding
sequence; wherein the subsequence encodes a fragment having lysozyme activity.
Substantially pure polypeptide: The term "substantially pure polypeptide"
means a
preparation that contains at most 10%, at most 8%, at most 6%, at most 5%, at
most 4%, at
most 3%, at most 2%, at most 1%, and at most 0.5% by weight of other
polypeptide material
with which it is natively or recombinantly associated. Preferably, the
polypeptide is at least 92%
32

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
pure, e.g., at least 94% pure, at least 95% pure, at least 96% pure, at least
97% pure, at least
98% pure, at least 99%, at least 99.5% pure, and 100% pure by weight of the
total polypeptide
material present in the preparation. The polypeptides of the present invention
are preferably in a
substantially pure form. This can be accomplished, for example, by preparing
the polypeptide by
well known recombinant methods or by classical purification methods.
Variant: The term "variant" means a polypeptide having lysozyme activity
comprising an
alteration, i.e., a substitution, insertion, and/or deletion, of one or more
(several) amino acid
residues at one or more (e.g., several) positions. A substitution means
replacement of the
amino acid occupying a position with a different amino acid; a deletion means
removal of the
amino acid occupying a position; and an insertion means adding 1,2, 0r3 amino
acids adjacent
to and immediately following the amino acid occupying the position.
In one aspect, the variant according to the invention may comprise from 1 to
5; from 1 to
10; from 1 to 15; from 1 to 20; from 1 to 25; from 1 to 30; from 1 to 35; from
1 to 40; from 1 to
45; or from 1-50, i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23,
.. 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46, 47, 48,
49 or 50 alterations.
In one aspect, the variant of the present invention has at least 50%, e.g.,
preferably at
least 60%, preferably at least 70%, more preferably at least 80%, more
preferably at least 90%,
even more preferably at least 95% or most preferably at least 100% of the
lysozyme activity of
.. SEQ ID NO: 12, preferably wherein lysozyme activity is determined as
described in Example 1.
In one aspect, the variant of the present invention has at least 50%, e.g.,
preferably at least
60%, preferably at least 70%, more preferably at least 80%, more preferably at
least 90%, even
more preferably at least 95% or most preferably at least 100% of the lysozyme
activity of SEQ
ID NO: 12 wherein lysozyme activity is determined as follows: LYS polypeptide
(50 pL of 0.7
pg/mL LYS polypeptide in phosphate buffer (5 mM citrate, 5 mM K2HPO4, 0.01%
TritonX-100,
pH 5.0)) is mixed with Micrococcus lysodeikticus solution (450 pL of 1%
lyophilized Micrococcus
lysodeikticus ATCC No. 4698 in milli-Q water) and incubated at 40 C with
shaking (500 rpm) for
45 min; the sample is centrifuged (4000g, 5 min); supernatant (100 pL) is
mixed with HCI (50 pL
3.2M) and incubated at 95 C for 80 min; NaOH (50 pL, 3.5 M) is added and 150
pL of the
sample is added to 4-hydroxybenzhydrazide in K-Na tartrate/NaOH buffer (75 pL
of 50 g/L K-Na
tartrate + 20 g/L NaOH); the mixture is incubated at 95 C for 10 min; and the
optical density is
measured at 405 nm.
In one aspect, the variant according to the invention may comprise from 1 to
5; from 1 to
10; from 1 to 15; from 1 to 20; from 1 to 25; from 1 to 30; from 1 to 35; from
1 to 40; from 1 to
45; or from 1-50, i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22, 23,
24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42,
43, 44, 45, 46, 47, 48,
49 or 50 alterations and has at least 50%, e.g., preferably at least 60%,
preferably at least 70%,
33

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
more preferably at least 80%, more preferably at least 90%, even more
preferably at least 95%
or most preferably at least 100% of the lysozyme activity of SEQ ID NO: 12,
preferably wherein
lysozyme activity is determined as described in Example 1.
Nomenclature
For purposes of the present invention, the nomenclature [E/Q] means that the
amino
acid at this position may be a glutamic acid (Glu, E) or a glutamine (Gin, Q).
Likewise the
nomenclature [V/G/A/I] means that the amino acid at this position may be a
valine (Val, V),
glycine (Gly, G), alanine (Ala, A) or isoleucine (Ile, l), and so forth for
other combinations as
described herein. Unless otherwise limited further, the amino acid X is
defined such that it may
be any of the 20 natural amino acids.
Detailed Description of the Invention
The inventors have discovered a completely novel class of polypeptides having
lysozyme activity. Said polypeptides are structurally quite different from
known lysozymes. As
shown in the sequence identity matrix below, the polypeptides of the present
invention all have
a sequence identitly less than 45% to the prior art sequences disclosed in
W02013/076259,
suggesting that these novel polypeptides may have a different folding pattern
to known
lysozymes.
GH class SEQ3 SEQ2 SEQ4 SEQ6 SEQ8 HEWL
SEQ ID NO: 3 of
Not defined 100 27 33.3 43.8 23.3 30.93
present invention
SEQ ID NO: 2 of
GH23 27 100 27 33.3 32 21.3
W02013/076259
SEQ ID NO: 4 of
GH24 33.3 27 100 79 32.7 33.33
W02013/076259
SEQ ID NO: 6 of
GH25 43.8 33.3 79 100 34.1 44.78
W02013/076259
SEQ ID NO: 8 of
GH25 23.3 32 32.7 34.1 100 28.97
W02013/076259
Hen Egg White
GH22 30.9 21.3 33.3 44.8 29 100
(Swissprot P00698)
The polypeptides of the present invention demonstrate typical lysozyme
activity such as
activity in the traditional OD drop assay against Micrococcus lysodeikticus
(see example 14) or
a reducing ends assay using Micrococcus lysodeikticus as substrate (see
example 13).
34

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
The polypeptides of the invention having lysozyme activity are herein named
LYS
polypeptides and comprise one or more LAD (Lysozyme Active Domain) catalytic
domains and
optionally one or more lysozyme enhancing domains (LED).
Compositions comprising polypeptides having lysozyme activity
In the first aspect, the invention relates to a composition comprising at
least 0.01 mg of LYS
polypeptide per kilogram of composition, wherein the polypeptide (a) has
lysozyme activity and
(b) comprises one or more LAD catalytic domains; wherein the LAD catalytic
domain gives a
domT score of at least 180 when queried using a Profile Hidden Markov Model
(HMM) prepared
using SEQ ID NOs: 46 to 187 and hmmbuild software program, and wherein the
query is carried
out using hmmscan software program by the Method of Determining the LAD
Catalytic Domain
by HMM.
In an embodiment, the polypeptide further comprises one or more lysozyme
enhancing
domains (LED). Thus, the invention further relates to a composition comprising
at least 0.01 mg
of LYS polypeptide per kilogram of composition, wherein:
(a) the LYS polypeptide has lysozyme activity;
(b) the LYS polypeptide comprises one or more LAD catalytic domains; wherein
the
LAD catalytic domain gives a domT score of at least 180 when queried using a
Profile Hidden Markov Model (HMM) prepared using SEQ ID NOs: 46 to 187 and
hmmbuild software program, and wherein the query is carried out using
hmmscan software program by the Method of Determining the LAD Catalytic
Domain by HMM;
(c) the polypeptide comprises one or more LED domains, wherein the LED gives a
domT score of at least 100 when queried using a Profile Hidden Markov Model
prepared using SEQ ID NOs: 188 to 316 and hmmbuild software program, and
wherein the query is carried out using the hmmscan software program.
The theory behind Profile HMMs as described in Durbin et al. (Biological
sequence
analysis: probabilistic models of proteins and nucleic acids, Cambridge
University Press, 1998)
and Krogh etal. (1994 J. Mol. Biol. 235:1501- 1531), both incorporated herein
by reference, is
characterization of a set of proteins based on the probability of each amino
acid occurring at
each position in the alignment of the proteins of the set.
Specifically, profile HMMs are statistical models of multiple sequence
alignments, or
even of single sequences. They capture position-specific information about how
conserved each
column of the alignment is, and which residues are likely. All profile methods
are more or less
statistical descriptions of the consensus of a multiple sequence alignment.
They use position-
specific scores for amino acids or nucleotides (residues) and position
specific penalties for

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
opening and extending an insertion or deletion. Traditional pairwise alignment
(for example,
BLAST, FASTA or the Smith/Waterman algorithm) uses position-independent
scoring
parameters. This property of profiles captures important information about the
degree of
conservation at various positions in the multiple alignment, and the varying
degree to which
.. gaps and insertions are permitted.
The advantage of using HMMs is that HMMs have a formal probabilistic basis.
Probability theory is used to guide how all the scoring parameters should be
set. One of the
most important aspect is that HMMs have a consistent theory for setting
position-specific gap
and insertion scores. The methods are consistent and therefore highly
automatable, allowing
hundreds of profile HMMs to be applied to e.g. whole genome analysis. An
example of a protein
domain model database is Pfam (Sonnhammer et al., 1997, 'A comprehensive
database of
protein families based on seed alignments', Proteins, 28:405-420; Finn et al.,
2010, The Pfam
protein families database', Nucl. Acids Res., 38:D211¨D222), which is a
significant part of the
lnterpro protein domain annotation system. The construction and use of Pfam is
tightly tied to
the HMM ER software package (see https://en.wikipedia.org/wiki/H MM ER).
The LAD catalytic domain is defined in the following manner. SEQ ID NOs: 46 to
187,
which are partial sequences of the Uniprot entries as explained in the
'overview of sequence
listing' section herein, are aligned using the software program MUSCLE v3.8.31
with the default
settings. Using this alignment, a hidden Markov model (HMM) is built for the
LAD catalytic
domain. The HMM is constructed using the software program 'hmmbuild' from the
package
HMMER 3.0 (March 2010) (http://hmmer.org/) and the software is invoked using
the default
settings.
A LAD catalytic domain is defined to match the above mentioned HMM using the
software program 'hmmscan' from the package HMMER 3.0 (March 2010)
(http://hmmer.org/)
.. using the default settings if the domT score is at least 170. In a
preferred embodiment, the
domT score is at least 175, preferably at least 180, more preferably at least
185, even more
preferably at least 190, even more preferably at least 195, or most preferably
at least 200.
The HMM profile of the LAD catalytic domain as generated using SEQ ID NOs: 46
to
187 according to the procedure above is given in example 10. The HMM profile
can be copied
into a text file which is subsequently loaded into the software program
'hmmscan' so that other
polypeptides can be tested to see whether said polypeptide comprises one or
more LAD
catalytic domains.
The Lysozyme Enhancing Domain (LED) is defined in the following manner. SEQ ID

NOs: 188 to 316, which are partial sequences of the Uniprot entries as
explained in the
'overview of sequence listing' section herein, are aligned using the software
program MUSCLE
v3.8.31 with the default settings. Using this alignment, a hidden Markov model
(HMM) is built
for the LED. The HMM is constructed using the software program 'hmmbuild' from
the package
36

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
HMMER 3.0 (March 2010) (http://hmmer.org/) and the software is invoked using
the default
settings.
A LED is defined to match the above mentioned HMM using the software
program 'hmmscan' from the package HMMER 3.0 (March 2010) (http://hmmer.org/)
using the
default settings if the domT score is at least 100. In a preferred embodiment,
the domT score is
at least 103, preferably at least 106, more preferably at least 109, more
preferably at least 112,
more preferably at least 115, more preferably at least 118, even more
preferably at least 121, or
most preferably at least 124.
The HMM profile of the LED as generated using SEQ ID NOs: 188 to 316 according
to
the procedure above is given in example 11. The HMM profile can be copied into
a text file
which is subsequently loaded into the software program 'hmmscan' so that other
polypeptides
can be tested to see whether said polypeptide comprises one or more LED.
In an embodiment, the LAD catalytic domain gives a domT score of at least 175
and the
LED gives a domT score of at least 100. In an embodiment, the LAD catalytic
domain gives a
domT score of at least 180 and the LED gives a domT score of at least 100. In
an embodiment,
the LAD catalytic domain gives a domT score of at least 185 and the LED gives
a domT score
of at least 100. In an embodiment, the LAD catalytic domain gives a domT score
of at least 190
and the LED gives a domT score of at least 100. In an embodiment, the LAD
catalytic domain
gives a domT score of at least 195 and the LED gives a domT score of at least
100. In an
embodiment, the LAD catalytic domain gives a domT score of at least 200 and
the LED gives a
domT score of at least 100.
In an embodiment, the LAD catalytic domain gives a domT score of at least 175
and the
LED gives a domT score of at least 103. In an embodiment, the LAD catalytic
domain gives a
domT score of at least 180 and the LED gives a domT score of at least 103. In
an embodiment,
the LAD catalytic domain gives a domT score of at least 185 and the LED gives
a domT score
of at least 103. In an embodiment, the LAD catalytic domain gives a domT score
of at least 190
and the LED gives a domT score of at least 103. In an embodiment, the LAD
catalytic domain
gives a domT score of at least 195 and the LED gives a domT score of at least
103. In an
embodiment, the LAD catalytic domain gives a domT score of at least 200 and
the LED gives a
domT score of at least 103.
In an embodiment, the LAD catalytic domain gives a domT score of at least 175
and the
LED gives a domT score of at least 106. In an embodiment, the LAD catalytic
domain gives a
domT score of at least 180 and the LED gives a domT score of at least 106. In
an embodiment,
the LAD catalytic domain gives a domT score of at least 185 and the LED gives
a domT score
of at least 106. In an embodiment, the LAD catalytic domain gives a domT score
of at least 190
and the LED gives a domT score of at least 106. In an embodiment, the LAD
catalytic domain
37

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
gives a domT score of at least 195 and the LED gives a domT score of at least
106. In an
embodiment, the LAD catalytic domain gives a domT score of at least 200 and
the LED gives a
domT score of at least 106.
In an embodiment, the LAD catalytic domain gives a domT score of at least 175
and the
LED gives a domT score of at least 109. In an embodiment, the LAD catalytic
domain gives a
domT score of at least 180 and the LED gives a domT score of at least 109. In
an embodiment,
the LAD catalytic domain gives a domT score of at least 185 and the LED gives
a domT score
of at least 109. In an embodiment, the LAD catalytic domain gives a domT score
of at least 190
and the LED gives a domT score of at least 109. In an embodiment, the LAD
catalytic domain
gives a domT score of at least 195 and the LED gives a domT score of at least
109. In an
embodiment, the LAD catalytic domain gives a domT score of at least 200 and
the LED gives a
domT score of at least 109.
In an embodiment, the LAD catalytic domain gives a domT score of at least 175
and the
LED gives a domT score of at least 112. In an embodiment, the LAD catalytic
domain gives a
domT score of at least 180 and the LED gives a domT score of at least 112. In
an embodiment,
the LAD catalytic domain gives a domT score of at least 185 and the LED gives
a domT score
of at least 112. In an embodiment, the LAD catalytic domain gives a domT score
of at least 190
and the LED gives a domT score of at least 112. In an embodiment, the LAD
catalytic domain
gives a domT score of at least 195 and the LED gives a domT score of at least
112. In an
embodiment, the LAD catalytic domain gives a domT score of at least 200 and
the LED gives a
domT score of at least 112.
In an embodiment, the LAD catalytic domain gives a domT score of at least 175
and the
LED gives a domT score of at least 115. In an embodiment, the LAD catalytic
domain gives a
domT score of at least 180 and the LED gives a domT score of at least 115. In
an embodiment,
the LAD catalytic domain gives a domT score of at least 185 and the LED gives
a domT score
of at least 115. In an embodiment, the LAD catalytic domain gives a domT score
of at least 190
and the LED gives a domT score of at least 115. In an embodiment, the LAD
catalytic domain
gives a domT score of at least 195 and the LED gives a domT score of at least
115. In an
embodiment, the LAD catalytic domain gives a domT score of at least 200 and
the LED gives a
domT score of at least 115.
In an embodiment, the LAD catalytic domain gives a domT score of at least 175
and the
LED gives a domT score of at least 118. In an embodiment, the LAD catalytic
domain gives a
domT score of at least 180 and the LED gives a domT score of at least 118. In
an embodiment,
the LAD catalytic domain gives a domT score of at least 185 and the LED gives
a domT score
of at least 118. In an embodiment, the LAD catalytic domain gives a domT score
of at least 190
and the LED gives a domT score of at least 118. In an embodiment, the LAD
catalytic domain
gives a domT score of at least 195 and the LED gives a domT score of at least
118. In an
38

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
embodiment, the LAD catalytic domain gives a domT score of at least 200 and
the LED gives a
domT score of at least 118.
In an embodiment, the LAD catalytic domain comprises one or more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317). In an embodiment, the LAD
catalytic domain
comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318). In an
embodiment,
the LED comprises one or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN]
(SEQ ID NO: 319). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and one or more motif II
V[G/A]XLCQXVQXSAYP
(SEQ ID NO: 318). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and the LED comprises one or
more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID
NO:
318) and the LED comprises one or more motif
III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][T/V]ES
(SEQ ID NO:
317) and one or more motif ll V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318) and the LED
comprises one or more motif III: [CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN]
(SEQ ID NO:
319).
In one embodiment of the first aspect, the invention relates to a composition
comprising
one or more LYS polypeptides having lysozyme activity, wherein the polypeptide
is dosed at
least 0.01 mg of polypeptide per kilogram of composition and is selected from
the group
consisting of:
(a) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 3;
(b) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 6;
(c) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 21;
39

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 27;
(j) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at
least 90% or at least
95% sequence identity to the polypeptide of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, e.g., at least 85%, at
least 90% or at least
95% sequence identity to the polypeptide of SEQ ID NO: 36;
(m) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 42;
(o) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 45;
(p) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 3,
SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18,
SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO:
33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42 and SEQ ID NO: 45,
wherein the variant has lysozyme activity and comprises one or more amino acid

substitutions, and/or one or more amino acid deletions, and/or one or more
amino
acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 positions;
(q) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal His-tag
and/or HQ-
tag;
(r) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal extension of
up to
10 amino acids, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; and
(s) a fragment of the polypeptide of (a), (b), (c), (d), (e), (f), (g),
(h), (i), (j), (k), (I), (m),
(n), (o) or (p) having lysozyme activity and having at least 90% of the length
of
the mature polypeptide.
In one embodiment of the first aspect, the invention relates to a composition
comprising
one or more LYS polypeptides having lysozyme activity, wherein the LYS
polypeptide is dosed

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
at least 0.01 mg of polypeptide per kilogram of composition and comprises a
LAD catalytic
domain that is selected from the group consisting of:
(a) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 3;
(b) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 6;
(c) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 81 to 220 of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 161 to 304 of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 88 to 230 of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 87 to 230 of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 90 to 232 of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 27;
(j) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 83 to 222 of SEQ ID NO: 36;
(m) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 82 to 225 of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 161 to 303 of SEQ ID NO: 42; and
(o) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 85 to 227 of SEQ ID NO: 45.
In one embodiment of the first aspect, the invention relates to a composition
comprising
one or more LYS polypeptides having lysozyme activity, wherein the LYS
polypeptide is dosed
at least 0.01 mg of polypeptide per kilogram of composition and comprises a
LAD catalytic
domain that is selected from the group consisting of:
41

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(a) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 3;
(b) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 6;
(c) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 81 to 220 of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 161 to 304 of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 88 to 230 of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 87 to 230 of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 90 to 232 of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 27;
(j) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, e.g., at least 85%, at
least 90% or at least
95% sequence identity to amino acids 83 to 222 of SEQ ID NO: 36;
(m) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 82 to 225 of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 161 to 303 of SEQ ID NO: 42; and
(o) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 85 to 227 of SEQ ID NO: 45;
and wherein the LYS polypeptide comprises a LED domain that is selected from
the
group consisting of:
(a) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 3;
(b) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 6;
42

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(C) a polypeptide having at least 80%, e.g., at least 85%, at
least 90% or at least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 72 of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 27;
(j) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at
least 90% or at least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, e.g., at least 85%, at
least 90% or at least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 36;
(m) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 72 of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 42;
(o) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 45;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 96 to 167 of SEQ ID NO: 12; and
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 96 to 168 of SEQ ID NO: 42.
In one embodiment to any part of the first aspect, the LAD catalytic domain
comprises
one or more motif I: AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317). In an
embodiment, the LAD
catalytic domain comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO:
318). In
an embodiment, the LED comprises one or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][T/V]ES
(SEQ ID NO:
43

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
317) and one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318). In an
embodiment,
the LAD catalytic domain comprises one or more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID
NO: 317) and the LED comprises one or more
motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID
NO:
318) and the LED comprises one
or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][T/V]ES
(SEQ ID NO:
317) and one or more motif ll V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318) and the LED
comprises one or more motif III: [CGY][YFIIVILNASTPIIDGNYFIIVITV[TS][GAN] (SEQ
ID NO:
319).
In one embodiment to any part of the first aspect, the polypeptide is of
fungal origin. In
an embodiment, the polypeptide is obtained or obtainable from the taxonomic
phylum
Ascomycota, preferably the taxonomic subphylum Pezizomycotina.
In one embodiment to any part of the first aspect, the composition comprises
at least
0.01 mg of polypeptide (enzyme protein) per kilogram of composition, such as
at least 0.02 mg,
0.05 mg, 0.10 mg, 0.2 mg, 0.5 mg, 1.0 mg, 2 mg, 5 mg, 10 mg, 20 mg, 50mg, 100
mg, 200 mg,
500mg, 1.0 g, 2.5 g, 5 g, 7.5 g, 10 g, 25 g, 50 g, 75 g or 100 g per kilogram
of composition. In
one embodiment, the composition comprises at most 250g of polypeptide per
kilogram of
composition, such as at most 150 g, 100 g, 50 g, 40 g, 30 g, 20 g, 10 g, 7.5
g, 5 g, 2.5 g, 1.0 g,
750 mg, 500 mg, 250 mg, 100 mg, 50 mg, 25 mg, 10 mg, 5 mg, 2.5 mg or 1 mg per
kilogram of
composition. In one embodiment, the composition comprises between 0.01 mg and
250g of
polypeptide (enzyme protein) per kilogram of composition, such as between 0.02
mg, 0.05 mg,
0.10 mg, 0.2 mg, 0.5 mg, 1.0 mg, 2 mg, 5 mg, 10 mg, 20 mg, 50mg, 100 mg, 200
mg, 500mg,
1.0 g, 2.5 g, 5 g, 7.5 g, 10 g, 25 g, 50 g, 75 g or 100 g per kilogram of
composition and 150 g,
100 g, 50 g, 40 g, 30 g, 20 g, 10 g, 7.5 g, 5 g, 2.5 g, 1.0 g, 750 mg, 500 mg,
250 mg, 100 mg, 50
mg, 25 mg, 10 mg, 5 mg, 2.5 mg or 1 mg per kilogram of composition, or any
combination
thereof.
In one embodiment to any part of the first aspect, the composition comprises
one or
more formulating agents (such as those described herein), preferably a
formulating agent
selected from the list consisting of glycerol, ethylene glycol, 1, 2-propylene
glycol or 1, 3-
propylene glycol, sodium chloride, sodium benzoate, potassium sorbate, sodium
sulfate,
potassium sulfate, magnesium sulfate, sodium thiosulfate, calcium carbonate,
sodium citrate,
dextrin, glucose, sucrose, sorbitol, lactose, starch, kaolin, maltodextrin,
cyclodextrin, wheat,
PVA, acetate, phosphate and cellulose, preferably selected from the list
consisting of 1, 2-
44

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
propylene glycol, 1, 3-propylene glycol, sodium sulfate, dextrin, cellulose,
sodium thiosulfate,
kaolin and calcium carbonate.
In one embodiment to any part of the first aspect, the composition comprises
one or
more additional enzymes. The one or more additional enzymes is preferably
selected from the
group consisting of acetyl xylan esterase, alpha-amylase, beta-amylase,
arabinofuranosidase,
cellobiohydrolases, cell ulase, feruloyl esterase, galactanase, alpha-
galactosidase, beta-
galactosidase, beta-glucanase, beta-glucosidase, lipase, lysophospholipase,
lysozyme,
mannanase, alpha-mannosidase, beta-mannosidase, phytase, phospholipase Al,
phospholipase A2, phospholipase C, phospholipase D, protease, pullulanase,
pectinase, pectin
lyase, xylanase, beta-xylosidase or any combination thereof.
In one embodiment to any part of the first aspect, the composition comprises
one or
more probiotics. The one or more probiotics is preferably selected from the
group consisting of
Bacillus subtilis, Bacillus licheniformis, Bacillus amyloliquefaciens,
Bacillus cereus, Bacillus
pumilus, Bacillus polymyxa, Bacillus megaterium, Bacillus coagulans, Bacillus
circulans,
Bifidobacterium bifidum, Bifidobacterium animalis, Bifidobacterium sp.,
Camobacterium sp.,
Clostridium butyricum, Clostridium sp., Enterococcus faecium, Enterococcus
sp., Lactobacillus
sp., Lactobacillus acidophilus, Lactobacillus farciminus, Lactobacillus
rhamnosus, Lactobacillus
reuteri, Lactobacillus saliva rius, Lactococcus lactis, Lactococcus sp.,
Leuconostoc sp.,
Megasphaera elsdenii, Megasphaera sp., Pediococsus acidilactici, Pediococcus
sp.,
Propionibacterium thoenii, Propionibacterium sp. and Streptococcus sp. or any
combination
thereof.
Granules comprising polypeptides having lysozyme activity
In a second aspect, the invention relates to a granule comprising a LYS
polypeptide,
wherein the polypeptide (a) has lysozyme activity and (b) comprises one or
more LAD catalytic
domains; wherein the LAD catalytic domain gives a domT score of at least 180
when queried
using a Profile Hidden Markov Model (HMM) prepared using SEQ ID NOs: 46 to 187
and
hmmbuild software program, and wherein the query is carried out using hmmscan
software
program by the Method of Determining the LAD Catalytic Domain by HMM.In one
embodiment,
the granule comprises a core particle and one or more coatings. In a preferred
embodiment, the
coating comprises salt and/or wax and/or flour. Preferred formulations are
disclosed in the
formulation section below.
In an embodiment, the polypeptide further comprises one or more lysozyme
enhancing
domains (LED). Thus, the invention further relates to a granule comprising a
LYS polypeptide,
wherein:
(a) the LYS polypeptide has lysozyme activity;

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(b) the LYS polypeptide comprises one or more LAD catalytic domains, wherein
the
LAD catalytic domain gives a domT score of at least 170 when queried using a
Profile Hidden Markov Model prepared using SEQ ID NOs: 46 to 187 and
hmmbuild software program, and wherein the query is carried out using
hmmscan software program by the Method of Determining the LAD Catalytic
Domain by HMM;
(c) the polypeptide comprises one or more LED domains, wherein the LED gives a

domT score of at least 100 when queried using a Profile Hidden Markov Model
prepared using SEQ ID NOs: 188 to 316 and hmmbuild software program, and
typically wherein the query is carried out using the hmmscan software program
by the Method of Determining the Lysozyme Enhancing Domain by HMM.
In one embodiment, the granule comprises a core particle and one or more
coatings. In
a preferred embodiment, the coating comprises salt and/or wax and/or flour.
Preferred
formulations are disclosed in the formulation section below.
In an embodiment, the domT score of the LAD catalytic domain is at least 175,
preferably at least 180, more preferably at least 185, even more preferably at
least 190, even
more preferably at least 195, or most preferably at least 200. In an
embodiment, the domT
score of the LED is at least 103, preferably at least 106, more preferably at
least 109, more
preferably at least 112, more preferably at least 115, more preferably at
least 118, even more
preferably at least 121, or most preferably at least 124. Preferred
combinations of domT scores
are as disclosed in the first aspect of the invention.
In an embodiment, the LAD catalytic domain comprises one or more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317). In an embodiment, the LAD
catalytic domain
comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318). In an
embodiment,
the LED comprises one or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN]
(SEQ ID NO: 319). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and one or more motif II
V[G/A]XLCQXVQXSAYP
(SEQ ID NO: 318). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and the LED comprises one or
more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID
NO:
318) and the LED comprises one or more motif
III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][T/V]ES
(SEQ ID NO:
317) and one or more motif ll V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318) and the LED
comprises one or more motif III: [CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN]
(SEQ ID NO:
319).
46

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
In one embodiment of the second aspect, the invention relates to a granule
comprising
one or more LYS polypeptides having lysozyme activity, wherein the LYS
polypeptide is
selected from the group consisting of:
(a) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 3;
(b) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 6;
(c) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 27;
(j) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, e.g., at least 85%, at
least 90% or at least
95% sequence identity to the polypeptide of SEQ ID NO: 36;
(m) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 42;
(o) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to the polypeptide of SEQ ID NO: 45;
(p) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 3,
SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18,
SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO:
33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42 and SEQ ID NO: 45,
47

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
wherein the variant has lysozyme activity and comprises one or more amino acid

substitutions, and/or one or more amino acid deletions, and/or one or more
amino
acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 positions;
(q) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal His-tag
and/or HQ-
tag;
(r) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal extension of
up to
10 amino acids, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; and
(s) a fragment of the polypeptide of (a), (b), (c), (d), (e), (f), (g),
(h), (i), (j), (k), (I), (m),
(n), (o) or (p) having lysozyme activity and having at least 90% of the length
of
the mature polypeptide.
In one embodiment, the granule comprises a core particle and one or more
coatings. In
a preferred embodiment, the coating comprises salt and/or wax and/or flour.
Preferred
formulations are disclosed in the formulation section below.
In one embodiment of the second aspect, the invention relates to a granule
comprising
one or more LYS polypeptides having lysozyme activity, wherein the LYS
polypeptide
comprises a LAD catalytic domain that is selected from the group consisting
of:
(a) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 3;
(b) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 6;
(c) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 81 to 220 of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 161 to 304 of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 88 to 230 of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 87 to 230 of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 90 to 232 of SEQ ID NO: 24;
48

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(i) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 27;
(j) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, e.g., at least 85%, at
least 90% or at least
95% sequence identity to amino acids 83 to 222 of SEQ ID NO: 36;
(m) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 82 to 225 of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 161 to 303 of SEQ ID NO: 42; and
(o) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 85 to 227 of SEQ ID NO: 45.
In one embodiment of the second aspect, the invention relates to a granule
comprising
one or more LYS polypeptides having lysozyme activity, wherein the LYS
polypeptide
comprises a LAD catalytic domain that is selected from the group consisting
of:
(a) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 3;
(b) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 6;
(c) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 81 to 220 of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 161 to 304 of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 88 to 230 of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 87 to 230 of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 90 to 232 of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 27;
49

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(j) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 83 to 222 of SEQ ID NO: 36;
(m) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 82 to 225 of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 161 to 303 of SEQ ID NO: 42; and
(o) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 85 to 227 of SEQ ID NO: 45;
and wherein the LYS polypeptide comprises a LED domain that is selected from
the
group consisting of:
(a) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 3;
(b) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 6;
(c) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 72 of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 27;
(j) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 33;

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(I) a polypeptide having at least 80%, e.g., at least 85%, at least 90%
or at least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 36;
(m) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 72 of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 42;
(o) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 45;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 96 to 167 of SEQ ID NO: 12; and
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least
95% sequence identity to amino acids 96 to 168 of SEQ ID NO: 42.
In one embodiment, the granule comprises a core particle and one or more
coatings. In
a preferred embodiment, the coating comprises salt and/or wax and/or flour.
Preferred
formulations are disclosed in the formulation section below.
In one embodiment to any part of the second aspect, the LAD catalytic domain
comprises one or more motif I: AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317).
In an
embodiment, the LAD catalytic domain comprises one or more motif II
V[G/A]XLCQXVQXSAYP
(SEQ ID NO: 318). In an embodiment, the LED comprises one or more motif
III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][T/V]ES
(SEQ ID NO:
317) and one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318). In an
embodiment,
the LAD catalytic domain comprises one or more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID
NO: 317) and the LED comprises one or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID
NO:
318) and the LED comprises one
or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][T/V]ES
(SEQ ID NO:
317) and one or more motif ll V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318) and the LED
comprises one or more motif III: [CGY][YFIIVILNASTP][DG]X[YFIIVITV[TS][GAN]
(SEQ ID NO:
319).
In one embodiment to any part of the second aspect, the polypeptide is of
fungal origin.
In an embodiment, the polypeptide is obtained or obtainable from the taxonomic
phylum
Ascomycota, preferably the taxonomic subphylum Pezizomycotina.
51

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
In one embodiment to any part of the first aspect, the composition comprises
at least
0.01 mg of polypeptide (enzyme protein) per kilogram of composition, such as
at least 0.02 mg,
0.05 mg, 0.10 mg, 0.2 mg, 0.5 mg, 1.0 mg, 2 mg, 5 mg, 10 mg, 20 mg, 50mg, 100
mg, 200 mg,
500mg, 1.0 g, 2.5 g, 5 g, 7.5 g, 10 g, 25 g, 50 g, 75 g or 100 g per kilogram
of composition. In
one embodiment, the composition comprises at most 250g of polypeptide per
kilogram of
composition, such as at most 150 g, 100 g, 50 g, 40 g, 30 g, 20 g, 10 g, 7.5
g, 5 g, 2.5 g, 1.0 g,
750 mg, 500 mg, 250 mg, 100 mg, 50 mg, 25 mg, 10 mg, 5 mg, 2.5 mg or 1 mg per
kilogram of
composition. In one embodiment, the composition comprises between 0.01 mg and
250g of
polypeptide (enzyme protein) per kilogram of composition, such as between 0.02
mg, 0.05 mg,
0.10 mg, 0.2 mg, 0.5 mg, 1.0 mg, 2 mg, 5 mg, 10 mg, 20 mg, 50mg, 100 mg, 200
mg, 500mg,
1.0 g, 2.5 g, 5 g, 7.5 g, 10 g, 25 g, 50 g, 75 g or 100 g per kilogram of
composition and 150 g,
100 g, 50 g, 40 g, 30 g, 20 g, 10 g, 7.5 g, 5 g, 2.5 g, 1.0 g, 750 mg, 500 mg,
250 mg, 100 mg, 50
mg, 25 mg, 10 mg, 5 mg, 2.5 mg or 1 mg per kilogram of composition, or any
combination
thereof.
In one embodiment to any part of the second aspect, the granule comprises one
or more
formulating agents (such as those described herein), preferably a formulating
agent selected
from the list consisting of glycerol, ethylene glycol, 1, 2-propylene glycol
or 1, 3-propylene
glycol, sodium chloride, sodium benzoate, potassium sorbate, sodium sulfate,
potassium
sulfate, magnesium sulfate, sodium thiosulfate, calcium carbonate, sodium
citrate, dextrin,
glucose, sucrose, sorbitol, lactose, starch, kaolin, maltodextrin,
cyclodextrin, wheat, PVA,
acetate, phosphate and cellulose, preferably selected from the list consisting
of 1, 2-propylene
glycol, 1, 3-propylene glycol, sodium sulfate, dextrin, cellulose, sodium
thiosulfate, kaolin and
calcium carbonate.
In one embodiment to any part of the second aspect, the granule comprises a
core
particle and one or more coatings. In a preferred embodiment, the coating
comprises salt and/or
wax and/or flour. Preferred formulations are disclosed in the formulation
section below.
In one embodiment to any part of the second aspect, the granule comprises one
or more
additional enzymes. The one or more additional enzymes is preferably selected
from the group
consisting of acetyl xylan esterase, alpha-amylase, beta-amylase,
arabinofuranosidase,
cellobiohydrolases, cell ulase, feruloyl esterase, galactanase, alpha-
galactosidase, beta-
galactosidase, beta-glucanase, beta-glucosidase, lipase, lysophospholipase,
lysozyme,
mannanase, alpha-mannosidase, beta-mannosidase, phytase, phospholipase Al,
phospholipase A2, phospholipase C, phospholipase D, protease, pullulanase,
pectinase, pectin
lyase, xylanase, beta-xylosidase or any combination thereof.
In one embodiment to any part of the second aspect, the granule comprises one
or more
probiotics. The one or more probiotics is preferably selected from the group
consisting of
Bacillus subtilis, Bacillus licheniformis, Bacillus amyloliquefaciens,
Bacillus cereus, Bacillus
52

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
pumilus, Bacillus polymyxa, Bacillus megaterium, Bacillus coagulans, Bacillus
circulans,
Bifidobacterium bifidum, Bifidobacterium animalis, Bifidobacterium sp.,
Camobacterium sp.,
Clostridium butyricum, Clostridium sp., Enterococcus faecium, Enterococcus
sp., Lactobacillus
sp., Lactobacillus acidophilus, Lactobacillus farciminus, Lactobacillus
rhamnosus, Lactobacillus
reuteri, Lactobacillus saliva rius, Lactococcus lactis, Lactococcus sp.,
Leuconostoc sp.,
Megasphaera elsdenii, Megasphaera sp., Pediococsus acidilactici, Pediococcus
sp.,
Propionibacterium thoenii, Propionibacterium sp. and Streptococcus sp. or any
combination
thereof.
Liquid formulations comprising polypeptides having lysozyme activity
In a third aspect, the invention relates to liquid formulations, wherein the
liquid
formulation comprises:
(a) 0.01% to 25% w/w of LYS polypeptide wherein:
(i) the LYS polypeptide has lysozyme activity;
(ii) the LYS polypeptide comprises one or more LAD catalytic domains,
wherein the LAD catalytic domain gives a domT score of at least 170 when
queried using a Profile Hidden Markov Model prepared using SEQ ID NOs:
46 to 187 and hmmbuild software program, and wherein the query is
carried out using hmmscan software program by the Method of Determining
the LAD Catalytic Domain by HMM;
(b) 20% to 80% w/w of polyol;
(c) 0.01% to 2.0% w/w preservative; and
(d) water.
In an embodiment, the domT score of the LAD catalytic domain is at least 175,
preferably at least 180, more preferably at least 185, even more preferably at
least 190, even
more preferably at least 195, or most preferably at least 200. In an
embodiment, the domT
score of the LED is at least 103, preferably at least 106, more preferably at
least 109, more
preferably at least 112, more preferably at least 115, more preferably at
least 118, even more
preferably at least 121, or most preferably at least 124. Preferred
combinations of domT scores
are as disclosed in the first aspect of the invention.
In an embodiment, the polypeptide further comprises one or more lysozyme
enhancing
domains (LED). Thus, the invention further relates to a liquid formulation,
wherein the liquid
formulation comprises:
(a) 0.01% to 25% w/w of LYS polypeptide wherein:
(i) the LYS polypeptide has lysozyme activity;
(ii) the LYS polypeptide comprises one or more LAD catalytic domains,
wherein the LAD catalytic domain gives a domT score of at least 170 when
queried using a Profile Hidden Markov Model prepared using SEQ ID NOs:
53

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
46 to 187 and hmmbuild software program, and wherein the query is
carried out using hmmscan software program by the Method of Determining
the LAD Catalytic Domain by HMM;
(iii) the LYS polypeptide comprises one or more LED domains, wherein the
LED gives a domT score of at least 100 when queried using a Profile
Hidden Markov Model prepared using SEQ ID NOs: 188 to 316 and
hmmbuild software program, and wherein the query is carried out using the
hmmscan software program by the Method of Determining the Lysozyme
Enhancing Domain by HMM;
(b) 20% to 80% w/w of polyol;
(c) 0.01% to 2.0% w/w preservative; and
(d) water.
In an embodiment, the domT score of the LAD catalytic domain is at least 175,
preferably at least 180, more preferably at least 185, even more preferably at
least 190, even
more preferably at least 195, or most preferably at least 200. In an
embodiment, the domT
score of the LED is at least 103, preferably at least 106, more preferably at
least 109, more
preferably at least 112, more preferably at least 115, more preferably at
least 118, even more
preferably at least 121, or most preferably at least 124. Preferred
combinations of domT scores
are as disclosed in the first aspect of the invention.
In one embodiment of the third aspect, the invention relates to a liquid
formulation
comprising one or more LYS polypeptides having lysozyme activity, wherein the
liquid
formulation comprises:
(A) 0.01% to 25% w/w of LYS polypeptide wherein the LYS polypeptide is
selected
from the group consisting of:
(a) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to the polypeptide of SEQ ID NO: 3;
(b) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to the polypeptide of SEQ ID NO: 6;
(c) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to the polypeptide of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to the polypeptide of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to the polypeptide of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, e.g., at least 85%, at
least 90% or at
least 95% sequence identity to the polypeptide of SEQ ID NO: 18;
54

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to the polypeptide of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to the polypeptide of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to the polypeptide of SEQ ID NO: 27;
(j) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to the polypeptide of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to the polypeptide of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, e.g., at least 85%, at
least 90% or at
least 95% sequence identity to the polypeptide of SEQ ID NO: 36;
(m) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to the polypeptide of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to the polypeptide of SEQ ID NO: 42;
(o) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to the polypeptide of SEQ ID NO: 45;
(p) a variant of the polypeptide selected from the group consisting of SEQ ID
NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15,
SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID
NO: 30, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42
and SEQ ID NO: 45, wherein the variant has lysozyme activity and
comprises one or more amino acid substitutions, and/or one or more amino
acid deletions, and/or one or more amino acid insertions or any
combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17,
18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36,
37,
38, 39, 40, 41, 42, 43, 44 or 45 positions;
(q) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h),
(i), (j), (k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal
His-tag
and/or HQ-tag;
(r) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h),
(i), (j), (k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal
extension of up to 10 amino acids, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino
acids; and

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(s) a fragment of the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j), (k),
(I), (m), (n), (o) or (p) having lysozyme activity and having at least 90% of
the length of the mature polypeptide;
(B) 20% to 80% w/w of polyol;
(D) 0.01% to 2.0% w/w preservative; and
(D) water.
In one embodiment of the third aspect, the invention relates to a liquid
formulation
comprising one or more LYS polypeptides having lysozyme activity, wherein the
liquid
formulation comprises:
(A) 0.01% to 25% w/w of LYS polypeptide wherein the LYS polypeptide comprises
a
LAD catalytic domain that is selected from the group consisting of:
(a) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 3;
(b) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 6;
(c) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 81 to 220 of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 161 to 304 of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 88 to 230 of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 87 to 230 of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 90 to 232 of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 27;
(j) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 83 to 222 of SEQ ID NO: 36;
56

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(m) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 82 to 225 of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 161 to 303 of SEQ ID NO: 42;
and
(o) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 85 to 227 of SEQ ID NO: 45;
(B) 20% to 80% w/w of polyol;
(C) 0.01% to 2.0% w/w preservative; and
(D) water.
In one embodiment of the third aspect, the invention relates to a liquid
formulation
comprising one or more LYS polypeptides having lysozyme activity, wherein the
liquid
formulation comprises:
(A) 0.01% to 25% w/w of LYS polypeptide wherein the LYS polypeptide comprises
a
LAD catalytic domain that is selected from the group consisting of:
(a) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 3;
(b) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 6;
(c) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 81 to 220 of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 161 to 304 of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 88 to 230 of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 87 to 230 of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 90 to 232 of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 27;
(j) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 85 to 228 of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 84 to 226 of SEQ ID NO: 33;
57

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(I) a polypeptide having at least 80%, e.g., at least 85%, at
least 90% or at
least 95% sequence identity to amino acids 83 to 222 of SEQ ID NO: 36;
(m) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 82 to 225 of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 161 to 303 of SEQ ID NO: 42;
and
(o) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 85 to 227 of SEQ ID NO: 45;
(B) the LYS polypeptide comprises a LED domain selected from the group
consisting of:
(a) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 3;
(b) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 6;
(c) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 1 to 72 of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 27;
(j) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or
at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, e.g., at least 85%, at
least 90% or at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 36;
(m) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 1 to 72 of SEQ ID NO: 39;
58

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 42;
(o) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 1 to 73 of SEQ ID NO: 45;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 96 to 167 of SEQ ID NO: 12;
and
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 90% or at
least 95% sequence identity to amino acids 96 to 168 of SEQ ID NO: 42;
(C) 20% to 80% w/w of polyol;
(D) 0.01% to 2.0% w/w preservative; and
(E) water.
In one embodiment to any part of the third aspect, the LAD catalytic domain
comprises
one or more motif I: AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317). In an
embodiment, the LAD
catalytic domain comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO:
318). In
an embodiment, the LED comprises one or more
motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][T/V]ES
(SEQ ID NO:
317) and one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318). In an
embodiment,
the LAD catalytic domain comprises one or more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID
NO: 317) and the LED comprises one or more
motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID
NO:
318) and the LED comprises one
or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][T/V]ES
(SEQ ID NO:
317) and one or more motif ll V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318) and the LED
comprises one or more motif III: [CGY][YFIIVILNASTP][DG]X[YFIIVITV[TS][GAN]
(SEQ ID NO:
319).
In one embodiment to any part of the third aspect, the polypeptide is of
fungal origin. In
an embodiment, the polypeptide is obtained or obtainable from the taxonomic
phylum
Ascomycota, preferably the taxonomic subphylum Pezizomycotina.
In one embodiment to any part of the third aspect, the liquid formulation
comprises one
or more formulating agents (such as those described herein), preferably a
formulating agent
selected from the list consisting of glycerol, ethylene glycol, 1, 2-propylene
glycol or 1, 3-
propylene glycol, sodium chloride, sodium benzoate, potassium sorbate, sodium
sulfate,
potassium sulfate, magnesium sulfate, sodium thiosulfate, calcium carbonate,
sodium citrate,
59

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
dextrin, glucose, sucrose, sorbitol, lactose, starch, PVA, acetate and
phosphate, preferably
selected from the list consisting of 1, 2-propylene glycol, 1, 3-propylene
glycol, sodium sulfate,
dextrin, cellulose, sodium thiosulfate, kaolin and calcium carbonate.
In one embodiment to any part of the third aspect, the liquid formulation
comprises one
or more polyols, preferably a polyol selected from the group consisting of
glycerol, sorbitol,
propylene glycol (MPG), ethylene glycol, diethylene glycol, triethylene
glycol, 1, 2-propylene
glycol or 1, 3-propylene glycol, dipropylene glycol, polyethylene glycol (PEG)
having an average
molecular weight below about 600 and polypropylene glycol (PPG) having an
average
molecular weight below about 600, more preferably selected from the group
consisting of
glycerol, sorbitol and propylene glycol (MPG) or any combination thereof.
In one embodiment to any part of the third aspect, the liquid formulation
comprises 20%-
80% polyol (i.e. total amount of polyol), preferably 25%-75% polyol, more
preferably 30%-70%
polyol, more preferably 35%-65% polyol or most preferably 40%-60% polyol.
In one
embodiment to any part of the third aspect, the liquid formulation comprises
20%-80% polyol,
preferably 25%-75% polyol, more preferably 30%-70% polyol, more preferably 35%-
65% polyol
or most preferably 40%-60% polyol wherein the polyol is selected from the
group consisting of
glycerol, sorbitol, propylene glycol (MPG), ethylene glycol, diethylene
glycol, triethylene glycol,
1, 2-propylene glycol or 1, 3-propylene glycol, dipropylene glycol,
polyethylene glycol (PEG)
having an average molecular weight below about 600 and polypropylene glycol
(PPG) having
an average molecular weight below about 600. In one embodiment to any part of
the third
aspect, the liquid formulation comprises 20%-80% polyol (i.e. total amount of
polyol), preferably
25%-75% polyol, more preferably 30%-70% polyol, more preferably 35%-65% polyol
or most
preferably 40%-60% polyol wherein the polyol is selected from the group
consisting of glycerol,
sorbitol and propylene glycol (MPG).
In one embodiment to any part of the third aspect, the preservative is
selected from the
group consisting of sodium sorbate, potassium sorbate, sodium benzoate and
potassion
benzoate or any combination thereof. In one embodiment, the liquid formulation
comprises
0.02% to 1.5% w/w preservative, more preferably 0.05% to 1.0% w/w preservative
or most
preferably 0.1% to 0.5% w/w preservative. In one embodiment, the liquid
formulation comprises
0.01% to 2.0% w/w preservative (i.e. total amount of preservative), preferably
0.02% to 1.5%
w/w preservative, more preferably 0.05% to 1.0% w/w preservative or most
preferably 0.1% to
0.5% w/w preservative wherein the preservative is selected from the group
consisting of sodium
sorbate, potassium sorbate, sodium benzoate and potassion benzoate or any
combination
thereof.
In one embodiment to any part of the third aspect, the liquid formulation
comprises
0.05% to 20% w/w LYS polypeptide, more preferably 0.2% to 15% w/w LYS
polypeptide, more

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
preferably 0.5% to 15% w/w LYS polypeptide or most preferably 1.0% to 10% w/w
LYS
polypeptide.
In one embodiment to any part of the third aspect, the liquid formulation
comprises one
or more additional enzymes. The one or more additional enzymes is preferably
selected from
the group consisting of acetyl xylan esterase, alpha-amylase, beta-amylase,
arabinofuranosidase, cellobiohydrolases, cellulase, feruloyl esterase,
galactanase, alpha-
galactosidase, beta-galactosidase, beta-glucanase,
beta-glucosidase, lipase,
lysophospholipase, lysozyme, mannanase, alpha-mannosidase, beta-mannosidase,
phytase,
phospholipase Al, phospholipase A2, phospholipase C, phospholipase D,
protease,
pullulanase, pectinase, pectin lyase, xylanase, beta-xylosidase or any
combination thereof.
In one embodiment to any part of the third aspect, the liquid formulation
comprises one
or more probiotics. The one or more probiotics is preferably selected from the
group consisting
of Bacillus subtilis, Bacillus licheniformis, Bacillus amyloliquefaciens,
Bacillus cereus, Bacillus
pumilus, Bacillus polymyxa, Bacillus megaterium, Bacillus coagulans, Bacillus
circulans,
Bifidobacterium bifidum, Bifidobacterium animalis, Bifidobacterium sp.,
Camobacterium sp.,
Clostridium butyricum, Clostridium sp., Enterococcus faecium, Enterococcus
sp., Lactobacillus
sp., Lactobacillus acidophilus, Lactobacillus farciminus, Lactobacillus
rhamnosus, Lactobacillus
reuteri, Lactobacillus saliva rius, Lacto3coccus lactis, Lactococcus sp.,
Leuconostoc sp.,
Megasphaera elsdenii, Megasphaera sp., Pediococsus acidilactici, Pediococcus
sp.,
Propionibacterium thoenii, Propionibacterium sp. and Streptococcus sp. or any
combination
thereof.
Polypeptides Having Lysozyme Activity
In a fourth aspect, the invention relates to polypeptides having lysozyme
activity having
at least 95%, e.g., at least 96%, at least 97%, at least 98%, at least 99%, or
100% sequence
identity to the mature polypeptide of SEQ ID NO: 2. In one embodiment, the
polypeptides differ
by up to 11 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino
acids from the mature
polypeptide of SEQ ID NO: 2.
In a continuation of the fourth aspect, the invention relates to polypeptides
having
lysozyme activity having at least 95%, e.g., at least 96%, at least 97%, at
least 98%, at least
99%, or 100% sequence identity to SEQ ID NO: 3. In one embodiment, the
polypeptides differ
by up to 11 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 amino
acids from SEQ ID NO: 3.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 3 of at least 95% and wherein the
polypeptide has at
least 50%, such as at least 75%, at least 90%, at least 95% or at least 100%
of the lysozyme
activity of SEQ ID NO: 3. In one embodiment, lysozyme activity is determined
as described in
example 1.
61

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 2. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 3; comprises the amino acid sequence of SEQ
ID NO: 3
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 3 and a N-terminal and/or C-terminal extension of up to 10 amino
acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 3. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 226
of SEQ ID NO:
3. In one embodiment, the polypeptide has been isolated.
In a continuation of the fourth aspect, the invention relates to polypeptides
having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 1 of at least 95%, e.g., at least
96%, at least 97%,
at least 98%, at least 99%, or 100%. In a further embodiment, the polypeptide
has been
isolated.
In a continuation of the fourth aspect, the invention relates to variants of
SEQ ID NO: 3
having lysozyme activity comprising one or more amino acid substitutions,
and/or one or more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof at
one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 3 is not
more than 11,
e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11. In an embodiment, the number of
positions comprising one
or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or more
amino acid insertions or any combination thereof in SEQ ID NO: 3 is not more
than 10, e.g., 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10. In one embodiment, the number of substitutions
and/or deletions
and/or insertions in SEQ ID NO: 3 is not more than 10, e.g. 1, 2, 3, 4, 5, 6,
7, 8, 9, or 10. In a
further embodiment, the number of substitutions, preferably conservative
substitutions, in SEQ
ID NO: 3 is not more than 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.
In an embodiment of the fourth aspect, the variant has at least 50%, such as
at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 3. In
one embodiment, lysozyme activity is determined as described in example 1.
The amino acid changes may be of a minor nature, that is conservative amino
acid
substitutions or insertions that do not significantly affect the folding
and/or activity of the protein;
small deletions, typically of 1-30 amino acids; small amino- or carboxyl-
terminal extensions,
such as an amino-terminal methionine residue; a small linker peptide of up to
20-25 residues; or
a small extension that facilitates purification by changing net charge or
another function, such as
a poly-histidine tract, an antigenic epitope or a binding domain.
62

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Examples of conservative substitutions are within the groups of basic amino
acids
(arginine, lysine and histidine), acidic amino acids (glutamic acid and
aspartic acid), polar amino
acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine
and valine),
aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino
acids (glycine,
alanine, serine, threonine and methionine). Amino acid substitutions that do
not generally alter
specific activity are known in the art and are described, for example, by H.
Neurath and R.L. Hill,
1979, In, The Proteins, Academic Press, New York. Common substitutions are
Ala/Ser, Val/Ile,
Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe,
Ala/Pro, Lys/Arg,
Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, and Asp/Gly. Other examples of
conservative substitutions
are G to A; A to G, S; V to I, L, A, T, S; I to V, L, M; L to I, M, V; M to L,
I, V; P to A, S, N; F to Y,
W, H; Y to F, W, H; W to Y, F, H; R to K, E, D; K to R, E, D; H to Q, N, S; D
to N, E, K, R, Q; E
to Q, D, K, R, N; S to T, A; T to S, VA; C to S, T, A; N to D, Q, H, S; Q to
E, N, H, K, R.
Essential amino acids in a polypeptide can be identified according to
procedures known
in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis
(Cunningham
and Wells, 1989, Science 244: 1081-1085). In the latter technique, single
alanine mutations are
introduced at every residue in the molecule, and the resultant mutant
molecules are tested for
lysozyme activity to identify amino acid residues that are critical to the
activity of the molecule.
See also, Hilton etal., 1996, J. Biol. Chem. 271: 4699-4708. The active site
of the enzyme or
other biological interaction can also be determined by physical analysis of
structure, as
determined by such techniques as nuclear magnetic resonance, crystallography,
electron
diffraction, or photoaffinity labelling, in conjunction with mutation of
putative contact site amino
acids. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et
al., 1992, J. Mol.
Biol. 224: 899-904; VVIodaver et al., 1992, FEBS Lett. 309: 59-64. The
identity of essential
amino acids can also be inferred from an alignment with a related polypeptide.
Single or multiple amino acid substitutions, deletions, and/or insertions can
be made and
tested using known methods of mutagenesis, recombination, and/or shuffling,
followed by a
relevant screening procedure, such as those disclosed by Reidhaar-Olson and
Sauer, 1988,
Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-
2156;
WO 95/17413; or WO 95/22625. Other methods that can be used include error-
prone PCR,
phage display (e.g., Lowman et al., 1991, Biochemistry 30: 10832-10837; U.S.
Patent No.
5,223,409; WO 92/06204), and region-directed mutagenesis (Derbyshire et al.,
1986, Gene 46:
145; Ner etal., 1988, DNA7: 127).
Mutagenesis/shuffling methods can be combined with high-throughput, automated
screening methods to detect activity of cloned, mutagenized polypeptides
expressed by host
cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA
molecules that
encode active polypeptides can be recovered from the host cells and rapidly
sequenced using
63

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
standard methods in the art. These methods allow the rapid determination of
the importance of
individual amino acid residues in a polypeptide.
The polypeptide may be a hybrid polypeptide or a fusion polypeptide.
In a fifth aspect, the invention relates to polypeptides having lysozyme
activity having at
least 94%, e.g., at least 95%, at least 96%, at least 97%, at least 98%, at
least 99%, or 100%
sequence identity to the mature polypeptide of SEQ ID NO: 5. In one
embodiment, the
polypeptides differ by up to 13 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, or 13 amino
acids from the mature polypeptide of SEQ ID NO: 5.
In a continuation of the fifth aspect, the invention relates to polypeptides
having
lysozyme activity having at least 94%, e.g., at least 95%, at least 96%, at
least 97%, at least
98%, at least 99%, or 100% sequence identity to SEQ ID NO: 6. In one
embodiment, the
polypeptides differ by up to 13 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, or 13 amino
acids from SEQ ID NO: 6.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 6 of at least 94% and wherein the
polypeptide has at
least 50%, such as at least 75%, at least 90%, at least 95% or at least 100%
of the lysozyme
activity of SEQ ID NO: 6. In one embodiment, the invention relates to
polypeptides having
lysozyme activity and having a sequence identity to SEQ ID NO: 6 of at least
95% and wherein
the polypeptide has at least 50%, such as at least 75%, at least 90%, at least
95% or at least
100% of the lysozyme activity of SEQ ID NO: 6. In one embodiment, lysozyme
activity is
determined as described in example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 5. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 6; comprises the amino acid sequence of SEQ
ID NO: 6
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 6 and a N-terminal and/or C-terminal extension of up to 10 amino
acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 6. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 226
of SEQ ID NO:
6. In one embodiment, the polypeptide has been isolated.
In a continuation of the fifth aspect, the invention relates to polypeptides
having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 4 of at least 94%, e.g., at least
95%, at least 96%,
at least 97%, at least 98%, at least 99%, or 100%. In a further embodiment,
the polypeptide has
been isolated.
64

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
In a continuation of the fifth aspect, the invention relates to variants of
SEQ ID NO: 6
having lysozyme activity comprising one or more amino acid substitutions,
and/or one or more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof at
one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 6 is not
more than 13,
e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. In an embodiment, the
number of positions
comprising one or more amino acid substitutions, and/or one or more amino acid
deletions,
and/or one or more amino acid insertions or any combination thereof in SEQ ID
NO: 6 is not
.. more than 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In one embodiment, the
number of
substitutions and/or deletions and/or insertions in SEQ ID NO: 6 is not more
than 10, e.g. 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10. In a further embodiment, the number of
substitutions, preferably
conservative substitutions, in SEQ ID NO: 6 is not more than 10, e.g. 1, 2, 3,
4, 5, 6, 7, 8, 9, or
10. Examples of amino acid changes and conservative substitutions are
described in the fourth
aspect of the invention.
In an embodiment of the fifth aspect, the variant has at least 50%, such as at
least 75%,
at least 90%, at least 95% or at least 100% of the lysozyme activity of SEQ ID
NO: 6. In one
embodiment, lysozyme activity is determined as described in example 1.
In a sixth aspect, the invention relates to polypeptides having lysozyme
activity having at
least 80%, e.g., at least 81%, at least 82%, at least 83%, at least 84%, at
least 85%, at least
86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at
least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at
least 99%, or
100% sequence identity to the mature polypeptide of SEQ ID NO: 8. In one
embodiment, the
polypeptides differ by up to 44 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40,
41, 42, 43, 0r44 amino acids from the mature polypeptide of SEQ ID NO: 8.
In a continuation of the sixth aspect, the invention relates to polypeptides
having
lysozyme activity having at least 80%, e.g., at least 81%, at least 82%, at
least 83%, at least
84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at
least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least
98%, at least 99%, or 100% sequence identity to SEQ ID NO: 9. In one
embodiment, the
polypeptides differ by up to 44 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40,
41, 42, 43, 0r44 amino acids from SEQ ID NO: 9.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 9 of at least 80% and wherein the
polypeptide has at

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
least 50%, such as at least 75%, at least 90%, at least 95% or at least 100%
of the lysozyme
activity of SEQ ID NO: 9. In one embodiment, the invention relates to
polypeptides having
lysozyme activity and having a sequence identity to SEQ ID NO: 9 of at least
85% and wherein
the polypeptide has at least 50%, such as at least 75%, at least 90%, at least
95% or at least
100% of the lysozyme activity of SEQ ID NO: 9. In one embodiment, the
invention relates to
polypeptides having lysozyme activity and having a sequence identity to SEQ ID
NO: 9 of at
least 90% and wherein the polypeptide has at least 50%, such as at least 75%,
at least 90%, at
least 95% or at least 100% of the lysozyme activity of SEQ ID NO: 9. In one
embodiment, the
invention relates to polypeptides having lysozyme activity and having a
sequence identity to
SEQ ID NO: 9 of at least 95% and wherein the polypeptide has at least 50%,
such as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 9. In
one embodiment, lysozyme activity is determined as described in example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 8. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 9; comprises the amino acid sequence of SEQ
ID NO: 9
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 9 and a N-terminal and/or C-terminal extension of up to 10 amino
acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 9. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 223
of SEQ ID NO:
9. In one embodiment, the polypeptide has been isolated.
In a continuation of the sixth aspect, the invention relates to polypeptides
having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 7 of at least 80%, e.g., at least
81%, at least 82%,
at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least
88%, at least 89%,
at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least
95%, at least 96%,
at least 97%, at least 98%, at least 99%, or 100%. In a further embodiment,
the polypeptide has
been isolated.
In a continuation of the sixth aspect, the invention relates to variants of
SEQ ID NO: 9
having lysozyme activity comprising one or more amino acid substitutions,
and/or one or more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof at
one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 9 is not
more than 44,
e.g. 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, or 44. In an
embodiment, the
66

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
number of positions comprising one or more amino acid substitutions, and/or
one or more amino
acid deletions, and/or one or more amino acid insertions or any combination
thereof in SEQ ID
NO: 9 is not more than 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In one
embodiment, the number of
substitutions and/or deletions and/or insertions in SEQ ID NO: 9 is not more
than 10, e.g. 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10. In a further embodiment, the number of
substitutions, preferably
conservative substitutions, in SEQ ID NO: 9 is not more than 10, e.g. 1, 2, 3,
4, 5, 6, 7, 8, 9, or
10. Examples of amino acid changes and conservative substitutions are
described in the fourth
aspect of the invention.
In an embodiment of the sixth aspect, the variant has at least 50%, such as at
least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 9. In
one embodiment, lysozyme activity is determined as described in example 1.
In a seventh aspect, the invention relates to polypeptides having lysozyme
activity
having at least 80%, e.g., at least 81%, at least 82%, at least 83%, at least
84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least
91%, at least 92%,
at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, at least 99%,
or 100% sequence identity to the mature polypeptide of SEQ ID NO: 11. In one
embodiment,
the polypeptides differ by up to 50 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids from the mature
polypeptide of SEQ ID
NO: 11.
In a continuation of the seventh aspect, the invention relates to polypeptides
having
lysozyme activity having at least 80%, e.g., at least 81%, at least 82%, at
least 83%, at least
84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at
least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least
98%, at least 99%, or 100% sequence identity to SEQ ID NO: 12. In one
embodiment, the
polypeptides differ by up to 50 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids from SEQ ID NO: 12.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 12 of at least 80% and wherein the
polypeptide has
at least 50%, such as at least 75%, at least 90%, at least 95% or at least
100% of the lysozyme
activity of SEQ ID NO: 12. In one embodiment, the invention relates to
polypeptides having
lysozyme activity and having a sequence identity to SEQ ID NO: 12 of at least
85% and wherein
the polypeptide has at least 50%, such as at least 75%, at least 90%, at least
95% or at least
100% of the lysozyme activity of SEQ ID NO: 12. In one embodiment, the
invention relates to
polypeptides having lysozyme activity and having a sequence identity to SEQ ID
NO: 12 of at
67

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
least 90% and wherein the polypeptide has at least 50%, such as at least 75%,
at least 90%, at
least 95% or at least 100% of the lysozyme activity of SEQ ID NO: 12. In one
embodiment, the
invention relates to polypeptides having lysozyme activity and having a
sequence identity to
SEQ ID NO: 12 of at least 95% and wherein the polypeptide has at least 50%,
such as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 12. In
one embodiment, lysozyme activity is determined as described in example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 11. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 12; comprises the amino acid sequence of SEQ
ID NO: 12
.. and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the
amino acid sequence
of SEQ ID NO: 12 and a N-terminal and/or C-terminal extension of up to 10
amino acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 12. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 304
of SEQ ID NO:
12. In one embodiment, the polypeptide has been isolated.
In a continuation of the seventh aspect, the invention relates to polypeptides
having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 10 of at least 80%, e.g., at least
81%, at least
.. 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%,
at least 88%, at least
89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least
96%, at least 97%, at least 98%, at least 99%, or 100%. In a further
embodiment, the
polypeptide has been isolated.
In a continuation of the seventh aspect, the invention relates to variants of
SEQ ID NO:
12 having lysozyme activity comprising one or more amino acid substitutions,
and/or one or
more amino acid deletions, and/or one or more amino acid insertions or any
combination thereof
at one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 12 is not
more than 50,
e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,
47, 48, 49, or 50. In an
embodiment, the number of positions comprising one or more amino acid
substitutions, and/or
one or more amino acid deletions, and/or one or more amino acid insertions or
any combination
thereof in SEQ ID NO: 12 is not more than 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9
or 10. In one
embodiment, the number of substitutions and/or deletions and/or insertions in
SEQ ID NO: 12 is
not more than 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In a further
embodiment, the number of
substitutions, preferably conservative substitutions, in SEQ ID NO: 12 is not
more than 10, e.g.
68

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Examples of amino acid changes and
conservative substitutions
are described in the fourth aspect of the invention.
In an embodiment of the seventh aspect, the variant has at least 50%, such as
at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 12. In
one embodiment, lysozyme activity is determined as described in example 1.
In a eighth aspect, the invention relates to polypeptides having lysozyme
activity having
at least 87%, e.g., at least 88%, at least 89%, at least 90%, at least 91%, at
least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at
least 99%, or
100% sequence identity to the mature polypeptide of SEQ ID NO: 14. In one
embodiment, the
polypeptides differ by up to 29 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 amino acids from the
mature polypeptide
of SEQ ID NO: 14.
In a continuation of the eighth aspect, the invention relates to polypeptides
having
lysozyme activity having at least 87%, e.g., at least 88%, at least 89%, at
least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least
98%, at least 99%, or 100% sequence identity to SEQ ID NO: 15. In one
embodiment, the
polypeptides differ by up to 29 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 0r29 amino acids from SEQ
ID NO: 15.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 15 of at least 87% and wherein the
polypeptide has
at least 50%, such as at least 75%, at least 90%, at least 95% or at least
100% of the lysozyme
activity of SEQ ID NO: 15. In one embodiment, the invention relates to
polypeptides having
lysozyme activity and having a sequence identity to SEQ ID NO: 15 of at least
90% and wherein
the polypeptide has at least 50%, such as at least 75%, at least 90%, at least
95% or at least
100% of the lysozyme activity of SEQ ID NO: 15. In one embodiment, the
invention relates to
polypeptides having lysozyme activity and having a sequence identity to SEQ ID
NO: 15 of at
least 95% and wherein the polypeptide has at least 50%, such as at least 75%,
at least 90%, at
least 95% or at least 100% of the lysozyme activity of SEQ ID NO: 15. In one
embodiment,
.. lysozyme activity is determined as described in example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 14. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 15; comprises the amino acid sequence of SEQ
ID NO: 15
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 15 and a N-terminal and/or C-terminal extension of up to 10
amino acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
69

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 15. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 228
of SEQ ID NO:
15. In one embodiment, the polypeptide has been isolated.
In a continuation of the eighth aspect, the invention relates to polypeptides
having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 13 of at least 87%, e.g., at least
88%, at least
89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least
96%, at least 97%, at least 98%, at least 99%, or 100%. In a further
embodiment, the
polypeptide has been isolated.
In a continuation of the eighth aspect, the invention relates to variants of
SEQ ID NO: 15
having lysozyme activity comprising one or more amino acid substitutions,
and/or one or more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof at
one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 15 is not
more than 29,
e.g. 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27,
28, or 29. In an embodiment, the number of positions comprising one or more
amino acid
substitutions, and/or one or more amino acid deletions, and/or one or more
amino acid
insertions or any combination thereof in SEQ ID NO: 15 is not more than 10,
e.g., 1, 2, 3, 4, 5,
6, 7, 8, 9 or 10. In one embodiment, the number of substitutions and/or
deletions and/or
insertions in SEQ ID NO: 15 is not more than 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8,
9, or 10. In a further
embodiment, the number of substitutions, preferably conservative
substitutions, in SEQ ID NO:
15 is not more than 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Examples of
amino acid changes and
conservative substitutions are described in the fourth aspect of the
invention.
In an embodiment of the eighth aspect, the variant has at least 50%, such as
at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 15. In
one embodiment, lysozyme activity is determined as described in example 1.
In a ninth aspect, the invention relates to polypeptides having lysozyme
activity having at
least 81%, e.g., at least 82%, at least 83%, at least 84%, at least 85%, at
least 86%, at least
87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at
least 93%, at least
94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or
100% sequence
identity to the mature polypeptide of SEQ ID NO: 17. In one embodiment, the
polypeptides differ
by up to 43 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 0r43 amino
acids from the mature polypeptide of SEQ ID NO: 17.

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
In a continuation of the ninth aspect, the invention relates to polypeptides
having
lysozyme activity having at least 81%, e.g., at least 82%, at least 83%, at
least 84%, at least
85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at
least 91%, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, at least
99%, or 100% sequence identity to SEQ ID NO: 18. In one embodiment, the
polypeptides differ
by up to 43 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, 42, 0r43 amino
acids from SEQ ID NO: 18.
In a continuation of the ninth aspect, the invention relates to polypeptides
having
lysozyme activity having at least 81%, e.g., at least 82%, at least 83%, at
least 84%, at least
85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at
least 91%, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, at least
99%, or 100% sequence identity to SEQ ID NO: 18. In one embodiment, the
polypeptides differ
by up to 28 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27 0r28 amino acids from SEQ ID NO: 239.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 18 of at least 81% and wherein the
polypeptide has
at least 50%, such as at least 75%, at least 90%, at least 95% or at least
100% of the lysozyme
activity of SEQ ID NO: 18. In one embodiment, the invention relates to
polypeptides having
lysozyme activity and having a sequence identity to SEQ ID NO: 18 of at least
85% and wherein
the polypeptide has at least 50%, such as at least 75%, at least 90%, at least
95% or at least
100% of the lysozyme activity of SEQ ID NO: 18. In one embodiment, the
invention relates to
polypeptides having lysozyme activity and having a sequence identity to SEQ ID
NO: 18 of at
least 90% and wherein the polypeptide has at least 50%, such as at least 75%,
at least 90%, at
least 95% or at least 100% of the lysozyme activity of SEQ ID NO: 18. In one
embodiment, the
invention relates to polypeptides having lysozyme activity and having a
sequence identity to
SEQ ID NO: 18 of at least 95% and wherein the polypeptide has at least 50%,
such as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 18. In
one embodiment, lysozyme activity is determined as described in example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 17. In one embodiment, the polypeptide comprises or consists of the
mature
polypeptide of SEQ ID NO: 239. In one embodiment, the polypeptide preferably
comprises or
consists of the amino acid sequence of SEQ ID NO: 18; comprises the amino acid
sequence of
SEQ ID NO: 18 and a N-terminal and/or C-terminal His-tag and/or HQ-tag;
comprises the amino
acid sequence of SEQ ID NO: 18 and a N-terminal and/or C-terminal extension of
up to 10
amino acids, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a
fragment thereof having
lysozyme activity and having at least 90% such as at least 91%, at least 92%,
at least 93%, at
71

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least
99% of the length of
SEQ ID NO: 18. In one embodiment, the polypeptide comprises or consists of
amino acids 1 to
230 of SEQ ID NO: 18. In one embodiment, the polypeptide comprises or consists
of amino
acids 1 to 146 of SEQ ID NO: 18. In one embodiment, the polypeptide has been
isolated.
In a continuation of the ninth aspect, the invention relates to polypeptides
having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 16 of at least 81%, e.g., at least
82%, at least
83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at
least 89%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at
least 96%, at least
.. 97%, at least 98%, at least 99%, or 100%. In a further embodiment, the
polypeptide has been
isolated.
In a continuation of the ninth aspect, the invention relates to variants of
SEQ ID NO: 18
having lysozyme activity comprising one or more amino acid substitutions,
and/or one or more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof at
one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 18 is not
more than 43,
e.g. 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, or 43. In an
embodiment, the number
of positions comprising one or more amino acid substitutions, and/or one or
more amino acid
deletions, and/or one or more amino acid insertions or any combination thereof
in SEQ ID NO:
18 is not more than 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In one
embodiment, the number of
substitutions and/or deletions and/or insertions in SEQ ID NO: 18 is not more
than 10, e.g. 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10. In a further embodiment, the number of
substitutions, preferably
conservative substitutions, in SEQ ID NO: 18 is not more than 10, e.g. 1, 2,
3, 4, 5, 6, 7, 8, 9, or
10. Examples of amino acid changes and conservative substitutions are
described in the fourth
aspect of the invention.
In an embodiment of the ninth aspect, the variant has at least 50%, such as at
least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 18. In
one embodiment, lysozyme activity is determined as described in example 1.
In a tenth aspect, the invention relates to polypeptides having lysozyme
activity having at
least 80%, e.g., at least 81%, at least 82%, at least 83%, at least 84%, at
least 85%, at least
86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at
least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at
least 99%, or
100% sequence identity to the mature polypeptide of SEQ ID NO: 20. In one
embodiment, the
polypeptides differ by up to 45 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
72

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 0r45 amino acids from the mature polypeptide of SEQ ID NO: 20.
In a continuation of the tenth aspect, the invention relates to polypeptides
having
lysozyme activity having at least 80%, e.g., at least 81%, at least 82%, at
least 83%, at least
84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at
least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least
98%, at least 99%, or 100% sequence identity to SEQ ID NO: 21. In one
embodiment, the
polypeptides differ by up to 45 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 0r45 amino acids from SEQ ID NO: 21.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 21 of at least 80% and wherein the
polypeptide has
at least 50%, such as at least 75%, at least 90%, at least 95% or at least
100% of the lysozyme
activity of SEQ ID NO: 21. In one embodiment, the invention relates to
polypeptides having
lysozyme activity and having a sequence identity to SEQ ID NO: 21 of at least
85% and wherein
the polypeptide has at least 50%, such as at least 75%, at least 90%, at least
95% or at least
100% of the lysozyme activity of SEQ ID NO: 21. In one embodiment, the
invention relates to
polypeptides having lysozyme activity and having a sequence identity to SEQ ID
NO: 21 of at
least 90% and wherein the polypeptide has at least 50%, such as at least 75%,
at least 90%, at
least 95% or at least 100% of the lysozyme activity of SEQ ID NO: 21. In one
embodiment, the
invention relates to polypeptides having lysozyme activity and having a
sequence identity to
SEQ ID NO: 21 of at least 95% and wherein the polypeptide has at least 50%,
such as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 21. In
one embodiment, lysozyme activity is determined as described in example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 20. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 21; comprises the amino acid sequence of SEQ
ID NO: 21
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 21 and a N-terminal and/or C-terminal extension of up to 10
amino acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 21. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 230
of SEQ ID NO:
21. In one embodiment, the polypeptide has been isolated.
In a continuation of the tenth aspect, the invention relates to polypeptides
having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 19 of at least 80%, e.g., at least
81%, at least
73

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at
least 88%, at least
89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least
96%, at least 97%, at least 98%, at least 99%, or 100%. In a further
embodiment, the
polypeptide has been isolated.
In a continuation of the tenth aspect, the invention relates to variants of
SEQ ID NO: 21
having lysozyme activity comprising one or more amino acid substitutions,
and/or one or more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof at
one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 21 is not
more than 45,
e.g. 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45. In
an embodiment, the
number of positions comprising one or more amino acid substitutions, and/or
one or more amino
acid deletions, and/or one or more amino acid insertions or any combination
thereof in SEQ ID
NO: 21 is not more than 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In one
embodiment, the number
of substitutions and/or deletions and/or insertions in SEQ ID NO: 21 is not
more than 10, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9, or 10. In a further embodiment, the number of
substitutions, preferably
conservative substitutions, in SEQ ID NO: 21 is not more than 10, e.g. 1, 2,
3, 4, 5, 6, 7, 8, 9, or
10. Examples of amino acid changes and conservative substitutions are
described in the fourth
aspect of the invention.
In an embodiment of the tenth aspect, the variant has at least 50%, such as at
least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 21. In
one embodiment, lysozyme activity is determined as described in example 1.
In a eleventh aspect, the invention relates to polypeptides having lysozyme
activity
having at least 80%, e.g., at least 81%, at least 82%, at least 83%, at least
84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least
91%, at least 92%,
at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, at least 99%,
or 100% sequence identity to the mature polypeptide of SEQ ID NO: 23. In one
embodiment,
the polypeptides differ by up to 46 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, 45, 0r46 amino acids from the mature polypeptide of SEQ ID
NO: 23.
In a continuation of the eleventh aspect, the invention relates to
polypeptides having
lysozyme activity having at least 80%, e.g., at least 81%, at least 82%, at
least 83%, at least
84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at
least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least
98%, at least 99%, or 100% sequence identity to SEQ ID NO: 24. In one
embodiment, the
74

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
polypeptides differ by up to 46 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 0r46 amino acids from SEQ ID NO: 24.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 24 of at least 80% and wherein the
polypeptide has
at least 50%, such as at least 75%, at least 90%, at least 95% or at least
100% of the lysozyme
activity of SEQ ID NO: 24. In one embodiment, the invention relates to
polypeptides having
lysozyme activity and having a sequence identity to SEQ ID NO: 24 of at least
85% and wherein
the polypeptide has at least 50%, such as at least 75%, at least 90%, at least
95% or at least
100% of the lysozyme activity of SEQ ID NO: 24. In one embodiment, the
invention relates to
polypeptides having lysozyme activity and having a sequence identity to SEQ ID
NO: 24 of at
least 90% and wherein the polypeptide has at least 50%, such as at least 75%,
at least 90%, at
least 95% or at least 100% of the lysozyme activity of SEQ ID NO: 24. In one
embodiment, the
invention relates to polypeptides having lysozyme activity and having a
sequence identity to
SEQ ID NO: 24 of at least 95% and wherein the polypeptide has at least 50%,
such as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 24. In
one embodiment, lysozyme activity is determined as described in example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 23. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 24; comprises the amino acid sequence of SEQ
ID NO: 24
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 24 and a N-terminal and/or C-terminal extension of up to 10
amino acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 24. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 232
of SEQ ID NO:
24. In one embodiment, the polypeptide has been isolated.
In a continuation of the eleventh aspect, the invention relates to
polypeptides having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 22 of at least 80%, e.g., at least
81%, at least
82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at
least 88%, at least
89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least
96%, at least 97%, at least 98%, at least 99%, or 100%. In a further
embodiment, the
polypeptide has been isolated.
In a continuation of the eleventh aspect, the invention relates to variants of
SEQ ID NO:
24 having lysozyme activity comprising one or more amino acid substitutions,
and/or one or
more amino acid deletions, and/or one or more amino acid insertions or any
combination thereof

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
at one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 24 is not
more than 46,
e.g. 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, or 46.
In an embodiment,
the number of positions comprising one or more amino acid substitutions,
and/or one or more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof in
SEQ ID NO: 24 is not more than 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In
one embodiment, the
number of substitutions and/or deletions and/or insertions in SEQ ID NO: 24 is
not more than
10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In a further embodiment, the number
of substitutions,
preferably conservative substitutions, in SEQ ID NO: 24 is not more than 10,
e.g. 1,2, 3, 4, 5, 6,
7, 8, 9, or 10. Examples of amino acid changes and conservative substitutions
are described in
the fourth aspect of the invention.
In an embodiment of the eleventh aspect, the variant has at least 50%, such as
at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 24. In
one embodiment, lysozyme activity is determined as described in example 1.
In a twelfth aspect, the invention relates to polypeptides having lysozyme
activity having
at least 87%, e.g., at least 88%, at least 89%, at least 90%, at least 91%, at
least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at
least 99%, or
100% sequence identity to the mature polypeptide of SEQ ID NO: 26. In one
embodiment, the
polypeptides differ by up to 29 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 amino acids from the
mature polypeptide
of SEQ ID NO: 26.
In a continuation of the twelfth aspect, the invention relates to polypeptides
having
lysozyme activity having at least 87%, e.g., at least 88%, at least 89%, at
least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least
98%, at least 99%, or 100% sequence identity to SEQ ID NO: 27. In one
embodiment, the
polypeptides differ by up to 29 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 0r29 amino acids from SEQ
ID NO: 27.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 27 of at least 87% and wherein the
polypeptide has
at least 50%, such as at least 75%, at least 90%, at least 95% or at least
100% of the lysozyme
activity of SEQ ID NO: 27. In one embodiment, the invention relates to
polypeptides having
lysozyme activity and having a sequence identity to SEQ ID NO: 27 of at least
90% and wherein
the polypeptide has at least 50%, such as at least 75%, at least 90%, at least
95% or at least
100% of the lysozyme activity of SEQ ID NO: 27. In one embodiment, the
invention relates to
76

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
polypeptides having lysozyme activity and having a sequence identity to SEQ ID
NO: 27 of at
least 95% and wherein the polypeptide has at least 50%, such as at least 75%,
at least 90%, at
least 95% or at least 100% of the lysozyme activity of SEQ ID NO: 27. In one
embodiment,
lysozyme activity is determined as described in example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 26. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 27; comprises the amino acid sequence of SEQ
ID NO: 27
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 27 and a N-terminal and/or C-terminal extension of up to 10
amino acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 27. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 228
of SEQ ID NO:
27. In one embodiment, the polypeptide has been isolated.
In a continuation of the twelfth aspect, the invention relates to polypeptides
having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 25 of at least 87%, e.g., at least
88%, at least
89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least
96%, at least 97%, at least 98%, at least 99%, or 100%. In a further
embodiment, the
polypeptide has been isolated.
In a continuation of the twelfth aspect, the invention relates to variants of
SEQ ID NO: 27
having lysozyme activity comprising one or more amino acid substitutions,
and/or one or more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof at
one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 27 is not
more than 29,
e.g. 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27,
28, or 29. In an embodiment, the number of positions comprising one or more
amino acid
substitutions, and/or one or more amino acid deletions, and/or one or more
amino acid
insertions or any combination thereof in SEQ ID NO: 27 is not more than 10,
e.g., 1, 2, 3, 4, 5,
6, 7, 8, 9 or 10. In one embodiment, the number of substitutions and/or
deletions and/or
insertions in SEQ ID NO: 27 is not more than 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8,
9, or 10. In a further
embodiment, the number of substitutions, preferably conservative
substitutions, in SEQ ID NO:
27 is not more than 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Examples of
amino acid changes and
conservative substitutions are described in the fourth aspect of the
invention.
77

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
In an embodiment of the twelfth aspect, the variant has at least 50%, such as
at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 27. In
one embodiment, lysozyme activity is determined as described in example 1.
In a thirteenth aspect, the invention relates to polypeptides having lysozyme
activity
having at least 96%, e.g., at least 97%, at least 98%, at least 99%, or 100%
sequence identity
to the mature polypeptide of SEQ ID NO: 29. In one embodiment, the
polypeptides differ by up
to 8 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, or 8 amino acids from the mature
polypeptide of SEQ
ID NO: 29.
In a continuation of the thirteenth aspect, the invention relates to
polypeptides having
lysozyme activity having at least 96%, e.g., at least 97%, at least 98%, at
least 99%, or 100%
sequence identity to SEQ ID NO: 30. In one embodiment, the polypeptides differ
by up to 8
amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, or 8 amino acids from SEQ ID NO: 30.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 30 of at least 96% and wherein the
polypeptide has
at least 50%, such as at least 75%, at least 90%, at least 95% or at least
100% of the lysozyme
activity of SEQ ID NO: 30. In one embodiment, lysozyme activity is determined
as described in
example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 29. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 30; comprises the amino acid sequence of SEQ
ID NO: 30
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 30 and a N-terminal and/or C-terminal extension of up to 10
amino acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 30. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 228
of SEQ ID NO:
30. In one embodiment, the polypeptide has been isolated.
In a continuation of the thirteenth aspect, the invention relates to
polypeptides having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 28 of at least 96%, e.g., at least
97%, at least
98%, at least 99%, or 100%. In a further embodiment, the polypeptide has been
isolated.
In a continuation of the thirteenth aspect, the invention relates to variants
of SEQ ID NO:
30 having lysozyme activity comprising one or more amino acid substitutions,
and/or one or
more amino acid deletions, and/or one or more amino acid insertions or any
combination thereof
at one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
78

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 30 is not
more than 8,
e.g. 1, 2, 3, 4, 5, 6, 7, or 8. In one embodiment, the number of substitutions
and/or deletions
and/or insertions in SEQ ID NO: 30 is not more than 8, e.g. 1, 2, 3, 4, 5, 6,
7, or 8. In a further
embodiment, the number of substitutions, preferably conservative
substitutions, in SEQ ID NO:
30 is not more than 8, e.g. 1, 2, 3, 4, 5, 6, 7, or 8. Examples of amino acid
changes and
conservative substitutions are described in the fourth aspect of the
invention.
In an embodiment of the thirteenth aspect, the variant has at least 50%, such
as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 30. In
one embodiment, lysozyme activity is determined as described in example 1.
In a fourteenth aspect, the invention relates to polypeptides having lysozyme
activity
having at least 80%, e.g., at least 81%, at least 82%, at least 83%, at least
84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least
91%, at least 92%,
at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, at least 99%,
or 100% sequence identity to the mature polypeptide of SEQ ID NO: 32. In one
embodiment,
the polypeptides differ by up to 45 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, or 45 amino acids from the mature polypeptide of SEQ ID
NO: 32.
In a continuation of the fourteenth aspect, the invention relates to
polypeptides having
lysozyme activity having at least 80%, e.g., at least 81%, at least 82%, at
least 83%, at least
84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at
least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least
98%, at least 99%, or 100% sequence identity to SEQ ID NO: 33. In one
embodiment, the
polypeptides differ by up to 45 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 0r45 amino acids from SEQ ID NO: 33.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 33 of at least 80% and wherein the
polypeptide has
at least 50%, such as at least 75%, at least 90%, at least 95% or at least
100% of the lysozyme
activity of SEQ ID NO: 33. In one embodiment, the invention relates to
polypeptides having
lysozyme activity and having a sequence identity to SEQ ID NO: 33 of at least
85% and wherein
the polypeptide has at least 50%, such as at least 75%, at least 90%, at least
95% or at least
100% of the lysozyme activity of SEQ ID NO: 33. In one embodiment, the
invention relates to
polypeptides having lysozyme activity and having a sequence identity to SEQ ID
NO: 33 of at
least 90% and wherein the polypeptide has at least 50%, such as at least 75%,
at least 90%, at
least 95% or at least 100% of the lysozyme activity of SEQ ID NO: 33. In one
embodiment, the
79

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
invention relates to polypeptides having lysozyme activity and having a
sequence identity to
SEQ ID NO: 33 of at least 95% and wherein the polypeptide has at least 50%,
such as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 33. In
one embodiment, lysozyme activity is determined as described in example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 32. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 33; comprises the amino acid sequence of SEQ
ID NO: 33
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 33 and a N-terminal and/or C-terminal extension of up to 10
amino acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 33. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 226
of SEQ ID NO:
33. In one embodiment, the polypeptide has been isolated.
In a continuation of the fourteenth aspect, the invention relates to
polypeptides having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 31 of at least 80%, e.g., at least
81%, at least
82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at
least 88%, at least
89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least
96%, at least 97%, at least 98%, at least 99%, or 100%. In a further
embodiment, the
polypeptide has been isolated.
In a continuation of the fourteenth aspect, the invention relates to variants
of SEQ ID
NO: 33 having lysozyme activity comprising one or more amino acid
substitutions, and/or one or
more amino acid deletions, and/or one or more amino acid insertions or any
combination thereof
at one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 33 is not
more than 45,
e.g. 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45. In
an embodiment, the
number of positions comprising one or more amino acid substitutions, and/or
one or more amino
acid deletions, and/or one or more amino acid insertions or any combination
thereof in SEQ ID
NO: 33 is not more than 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In one
embodiment, the number
of substitutions and/or deletions and/or insertions in SEQ ID NO: 33 is not
more than 10, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9, or 10. In a further embodiment, the number of
substitutions, preferably
conservative substitutions, in SEQ ID NO: 33 is not more than 10, e.g. 1, 2,
3, 4, 5, 6, 7, 8, 9, or
10. Examples of amino acid changes and conservative substitutions are
described in the fourth
aspect of the invention.

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
In an embodiment of the fourteenth aspect, the variant has at least 50%, such
as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 33. In
one embodiment, lysozyme activity is determined as described in example 1.
In a fifteenth aspect, the invention relates to polypeptides having lysozyme
activity
having at least 80%, e.g., at least 81%, at least 82%, at least 83%, at least
84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least
91%, at least 92%,
at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, at least 99%,
or 100% sequence identity to the mature polypeptide of SEQ ID NO: 35. In one
embodiment,
the polypeptides differ by up to 44 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39,
40, 41, 42, 43, or 44 amino acids from the mature polypeptide of SEQ ID NO:
35.
In a continuation of the fifteenth aspect, the invention relates to
polypeptides having
lysozyme activity having at least 80%, e.g., at least 81%, at least 82%, at
least 83%, at least
84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at
least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least
98%, at least 99%, or 100% sequence identity to SEQ ID NO: 36. In one
embodiment, the
polypeptides differ by up to 44 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40,
41, 42, 43, 0r44 amino acids from SEQ ID NO: 36.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 36 of at least 80% and wherein the
polypeptide has
at least 50%, such as at least 75%, at least 90%, at least 95% or at least
100% of the lysozyme
activity of SEQ ID NO: 36. In one embodiment, the invention relates to
polypeptides having
lysozyme activity and having a sequence identity to SEQ ID NO: 36 of at least
85% and wherein
the polypeptide has at least 50%, such as at least 75%, at least 90%, at least
95% or at least
100% of the lysozyme activity of SEQ ID NO: 36. In one embodiment, the
invention relates to
polypeptides having lysozyme activity and having a sequence identity to SEQ ID
NO: 36 of at
least 90% and wherein the polypeptide has at least 50%, such as at least 75%,
at least 90%, at
least 95% or at least 100% of the lysozyme activity of SEQ ID NO: 36. In one
embodiment, the
invention relates to polypeptides having lysozyme activity and having a
sequence identity to
SEQ ID NO: 36 of at least 95% and wherein the polypeptide has at least 50%,
such as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 36. In
one embodiment, lysozyme activity is determined as described in example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 35. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 36; comprises the amino acid sequence of SEQ
ID NO: 36
81

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 36 and a N-terminal and/or C-terminal extension of up to 10
amino acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 36. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 225
of SEQ ID NO:
36. In one embodiment, the polypeptide has been isolated.
In a continuation of the fifteenth aspect, the invention relates to
polypeptides having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 34 of at least 80%, e.g., at least
81%, at least
82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at
least 88%, at least
89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least
96%, at least 97%, at least 98%, at least 99%, or 100%. In a further
embodiment, the
polypeptide has been isolated.
In a continuation of the fifteenth aspect, the invention relates to variants
of SEQ ID NO:
36 having lysozyme activity comprising one or more amino acid substitutions,
and/or one or
more amino acid deletions, and/or one or more amino acid insertions or any
combination thereof
at one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 36 is not
more than 44,
e.g. 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, or 44. In an
embodiment, the
number of positions comprising one or more amino acid substitutions, and/or
one or more amino
acid deletions, and/or one or more amino acid insertions or any combination
thereof in SEQ ID
NO: 36 is not more than 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In one
embodiment, the number
of substitutions and/or deletions and/or insertions in SEQ ID NO: 36 is not
more than 10, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9, or 10. In a further embodiment, the number of
substitutions, preferably
conservative substitutions, in SEQ ID NO: 36 is not more than 10, e.g. 1, 2,
3, 4, 5, 6, 7, 8, 9, or
10. Examples of amino acid changes and conservative substitutions are
described in the fourth
aspect of the invention.
In an embodiment of the fifteenth aspect, the variant has at least 50%, such
as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 36. In
one embodiment, lysozyme activity is determined as described in example 1.
In a sixteenth aspect, the invention relates to polypeptides having lysozyme
activity
having at least 81%, e.g., at least 82%, at least 83%, at least 84%, at least
85%, at least 86%,
at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least
92%, at least 93%,
82

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least
99%, or 100%
sequence identity to the mature polypeptide of SEQ ID NO: 38. In one
embodiment, the
polypeptides differ by up to 42 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40,
41, 0r42 amino acids from the mature polypeptide of SEQ ID NO: 38.
In a continuation of the sixteenth aspect, the invention relates to
polypeptides having
lysozyme activity having at least 81%, e.g., at least 82%, at least 83%, at
least 84%, at least
85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at
least 91%, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at
least 98%, at least
99%, or 100% sequence identity to SEQ ID NO: 39. In one embodiment, the
polypeptides differ
by up to 42 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20,
21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39,
40, 41, or 42 amino
acids from SEQ ID NO: 39.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 39 of at least 81% and wherein the
polypeptide has
at least 50%, such as at least 75%, at least 90%, at least 95% or at least
100% of the lysozyme
activity of SEQ ID NO: 39. In one embodiment, the invention relates to
polypeptides having
lysozyme activity and having a sequence identity to SEQ ID NO: 39 of at least
85% and wherein
the polypeptide has at least 50%, such as at least 75%, at least 90%, at least
95% or at least
100% of the lysozyme activity of SEQ ID NO: 39. In one embodiment, the
invention relates to
polypeptides having lysozyme activity and having a sequence identity to SEQ ID
NO: 39 of at
least 90% and wherein the polypeptide has at least 50%, such as at least 75%,
at least 90%, at
least 95% or at least 100% of the lysozyme activity of SEQ ID NO: 39. In one
embodiment, the
invention relates to polypeptides having lysozyme activity and having a
sequence identity to
SEQ ID NO: 39 of at least 95% and wherein the polypeptide has at least 50%,
such as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 39. In
one embodiment, lysozyme activity is determined as described in example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 38. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 39; comprises the amino acid sequence of SEQ
ID NO: 39
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 39 and a N-terminal and/or C-terminal extension of up to 10
amino acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 39. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 225
of SEQ ID NO:
39. In one embodiment, the polypeptide has been isolated.
83

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
In a continuation of the sixteenth aspect, the invention relates to
polypeptides having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 37 of at least 81%, e.g., at least
82%, at least
83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at
least 89%, at least
90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at
least 96%, at least
97%, at least 98%, at least 99%, or 100%. In a further embodiment, the
polypeptide has been
isolated.
In a continuation of the sixteenth aspect, the invention relates to variants
of SEQ ID NO:
39 having lysozyme activity comprising one or more amino acid substitutions,
and/or one or
more amino acid deletions, and/or one or more amino acid insertions or any
combination thereof
at one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 39 is not
more than 42,
e.g. 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42. In an
embodiment, the number of
positions comprising one or more amino acid substitutions, and/or one or more
amino acid
deletions, and/or one or more amino acid insertions or any combination thereof
in SEQ ID NO:
39 is not more than 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In one
embodiment, the number of
substitutions and/or deletions and/or insertions in SEQ ID NO: 39 is not more
than 10, e.g. 1, 2,
3, 4, 5, 6, 7, 8, 9, or 10. In a further embodiment, the number of
substitutions, preferably
conservative substitutions, in SEQ ID NO: 39 is not more than 10, e.g. 1, 2,
3, 4, 5, 6, 7, 8, 9, or
10. Examples of amino acid changes and conservative substitutions are
described in the fourth
aspect of the invention.
In an embodiment of the sixteenth aspect, the variant has at least 50%, such
as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 39. In
one embodiment, lysozyme activity is determined as described in example 1.
In a seventeenth aspect, the invention relates to polypeptides having lysozyme
activity
having at least 80%, e.g., at least 81%, at least 82%, at least 83%, at least
84%, at least 85%,
at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least
91%, at least 92%,
at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least
98%, at least 99%,
or 100% sequence identity to the mature polypeptide of SEQ ID NO: 41. In one
embodiment,
the polypeptides differ by up to 50 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8,
9, 10, 11, 12, 13, 14,
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33,
34, 35, 36, 37, 38, 39,
40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids from the mature
polypeptide of SEQ ID
NO: 41.
84

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
In a continuation of the seventeenth aspect, the invention relates to
polypeptides having
lysozyme activity having at least 80%, e.g., at least 81%, at least 82%, at
least 83%, at least
84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at
least 90%, at least
91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at
least 97%, at least
98%, at least 99%, or 100% sequence identity to SEQ ID NO: 42. In one
embodiment, the
polypeptides differ by up to 50 amino acids, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34,
35, 36, 37, 38, 39, 40,
41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acids from SEQ ID NO: 42.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 42 of at least 80% and wherein the
polypeptide has
at least 50%, such as at least 75%, at least 90%, at least 95% or at least
100% of the lysozyme
activity of SEQ ID NO: 42. In one embodiment, the invention relates to
polypeptides having
lysozyme activity and having a sequence identity to SEQ ID NO: 42 of at least
85% and wherein
the polypeptide has at least 50%, such as at least 75%, at least 90%, at least
95% or at least
100% of the lysozyme activity of SEQ ID NO: 42. In one embodiment, the
invention relates to
polypeptides having lysozyme activity and having a sequence identity to SEQ ID
NO: 42 of at
least 90% and wherein the polypeptide has at least 50%, such as at least 75%,
at least 90%, at
least 95% or at least 100% of the lysozyme activity of SEQ ID NO: 42. In one
embodiment, the
invention relates to polypeptides having lysozyme activity and having a
sequence identity to
SEQ ID NO: 42 of at least 95% and wherein the polypeptide has at least 50%,
such as at least
75%, at least 90%, at least 95% or at least 100% of the lysozyme activity of
SEQ ID NO: 42. In
one embodiment, lysozyme activity is determined as described in example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 41. In one embodiment, the polypeptide preferably comprises or
consists of the
amino acid sequence of SEQ ID NO: 42; comprises the amino acid sequence of SEQ
ID NO: 42
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 42 and a N-terminal and/or C-terminal extension of up to 10
amino acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 42. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 304
of SEQ ID NO:
42. In one embodiment, the polypeptide has been isolated.
In a continuation of the seventeenth aspect, the invention relates to
polypeptides having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 40 of at least 80%, e.g., at least
81%, at least
82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at
least 88%, at least
89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at
least 95%, at least

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
96%, at least 97%, at least 98%, at least 99%, or 100%. In a further
embodiment, the
polypeptide has been isolated.
In a continuation of the seventeenth aspect, the invention relates to variants
of SEQ ID
NO: 42 having lysozyme activity comprising one or more amino acid
substitutions, and/or one or
more amino acid deletions, and/or one or more amino acid insertions or any
combination thereof
at one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 42 is not
more than 50,
e.g. 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21,
22, 23, 24, 25, 26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46,
47, 48, 49, or 50. In an
embodiment, the number of positions comprising one or more amino acid
substitutions, and/or
one or more amino acid deletions, and/or one or more amino acid insertions or
any combination
thereof in SEQ ID NO: 42 is not more than 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9
or 10. In one
embodiment, the number of substitutions and/or deletions and/or insertions in
SEQ ID NO: 42 is
not more than 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In a further
embodiment, the number of
substitutions, preferably conservative substitutions, in SEQ ID NO: 42 is not
more than 10, e.g.
1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Examples of amino acid changes and
conservative substitutions
are described in the fourth aspect of the invention.
In an embodiment of the seventeenth aspect, the variant has at least 50%, such
as at
least 75%, at least 90%, at least 95% or at least 100% of the lysozyme
activity of SEQ ID NO:
42. In one embodiment, lysozyme activity is determined as described in example
1.
In a eighteenth aspect, the invention relates to polypeptides having lysozyme
activity
having at least 100%, e.g., or 100% sequence identity to the mature
polypeptide of SEQ ID NO:
44. In one embodiment, the polypeptides differ by up to 0 amino acids, e.g.,
or 1 amino acids
from the mature polypeptide of SEQ ID NO: 44.
In a continuation of the eighteenth aspect, the invention relates to
polypeptides having
lysozyme activity having at least 100%, e.g., or 100% sequence identity to SEQ
ID NO: 45. In
one embodiment, the polypeptides differ by up to 0 amino acids, e.g., or 1
amino acids from
SEQ ID NO: 45.
In one embodiment, the invention relates to polypeptides having lysozyme
activity and
having a sequence identity to SEQ ID NO: 45 of at least 100% and wherein the
polypeptide has
at least 50%, such as at least 75%, at least 90%, at least 95% or at least
100% of the lysozyme
activity of SEQ ID NO: 45. In one embodiment, lysozyme activity is determined
as described in
example 1.
In one embodiment, the polypeptide comprises or consists of the mature
polypeptide of
SEQ ID NO: 44. In one embodiment, the polypeptide preferably comprises or
consists of the
86

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
amino acid sequence of SEQ ID NO: 45; comprises the amino acid sequence of SEQ
ID NO: 45
and a N-terminal and/or C-terminal His-tag and/or HQ-tag; comprises the amino
acid sequence
of SEQ ID NO: 45 and a N-terminal and/or C-terminal extension of up to 10
amino acids, e.g. 1,
2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; or is a fragment thereof having
lysozyme activity and
having at least 90% such as at least 91%, at least 92%, at least 93%, at least
94%, at least
95%, at least 96%, at least 97%, at least 98% or at least 99% of the length of
SEQ ID NO: 45. In
one embodiment, the polypeptide comprises or consists of amino acids 1 to 227
of SEQ ID NO:
45. In one embodiment, the polypeptide has been isolated.
In a continuation of the eighteenth aspect, the invention relates to
polypeptides having
lysozyme activity encoded by a polynucleotide having a sequence identity to
the mature
polypeptide coding sequence of SEQ ID NO: 43 of at least 100%, e.g., or 100%.
In a further
embodiment, the polypeptide has been isolated.
In a continuation of the eighteenth aspect, the invention relates to variants
of SEQ ID
NO: 45 having lysozyme activity comprising one or more amino acid
substitutions, and/or one or
more amino acid deletions, and/or one or more amino acid insertions or any
combination thereof
at one or more (e.g., several) positions. In an embodiment, the number of
positions comprising
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or
more amino acid insertions or any combination thereof in SEQ ID NO: 45 is not
more than 0,
e.g. or 1. In one embodiment, the number of substitutions and/or deletions
and/or insertions in
SEQ ID NO: 45 is not more than 0, e.g. or 1. In a further embodiment, the
number of
substitutions, preferably conservative substitutions, in SEQ ID NO: 45 is not
more than 0, e.g. or
1. Examples of amino acid changes and conservative substitutions are described
in the fourth
aspect of the invention.
In an embodiment of the eighteenth aspect, the variant has at least 50%, such
as at
least 75%, at least 90%, at least 95% or at least 100% of the lysozyme
activity of SEQ ID NO:
45. In one embodiment, lysozyme activity is determined as described in example
1.
Taxonoimic and structural families
In an embodiment, the LAD catalytic domain comprises one or more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317). In an embodiment, the LAD
catalytic domain
comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318). In an
embodiment,
the LED comprises one or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN]
(SEQ ID NO: 319). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and one or more motif II
V[G/A]XLCQXVQXSAYP
(SEQ ID NO: 318). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and the LED comprises one or
more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
87

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
LAD catalytic domain comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID
NO:
318) and the LED comprises one or more motif
III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][T/V]ES
(SEQ ID NO:
317) and one or more motif ll V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318) and the LED
comprises one or more motif III: [CGY][YFIIVILNASTPIIDGNYFIIVITV[TS][GAN] (SEQ
ID NO:
319).
In one embodiment, the polypeptide having lysozyme activity is obtained or is
obtainable
from the taxonomic phylum Ascomycota, preferably the taxonomic subphylum
Pezizomycotina
and is preferably is selected from the group selected from SEQ ID NO: 3, SEQ
ID NO: 6, SEQ
ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID
NO: 24,
SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ
ID NO:
42 and SEQ ID NO: 45.
In one embodiment, the polypeptide having lysozyme activity is obtained or is
obtainable
from the taxonomic class Eurotiomycetes, preferably the taxonomic order
Eurotiales and is
more preferably selected from the group consisting of SEQ ID NO: 3, SEQ ID NO:
6, SEQ ID
NO:9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO:
27, SEQ
ID NO: 30 and SEQ ID NO: 36.
In one embodiment, the polypeptide having lysozyme activity is obtained or is
obtainable
from the taxonomic order Eurotiales, preferably the taxonomic family
Aspergillaceae and is
more preferably selected from the group consisting of SEQ ID NO: 3, SEQ ID NO:
6, SEQ ID
NO: 12, SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27 and SEQ ID
NO: 30.
In one embodiment, the polypeptide having lysozyme activity is obtained or is
obtainable
from the taxonomic order Eurotiales, preferably the taxonomic family
Trichocomaceae and is
more preferably selected from the group consisting of SEQ ID NO: 9 and SEQ ID
NO: 36.
In one embodiment, the polypeptide having lysozyme activity is obtained or is
obtainable
from the taxonomic class Sordariomycetes and is preferably selected from the
group selected
from SEQ ID NO: 18, SEQ ID NO: 33, SEQ ID NO: 39, SEQ ID NO: 42 and SEQ ID NO:
45.
In one embodiment, the polypeptide having lysozyme activity is obtained or is
obtainable
from the taxonomic order Sordariales, preferably the taxonomic family
Chaetomiaceae and is
more preferably selected from the group consisting of SEQ ID NO: 18, SEQ ID
NO: 33, SEQ ID
NO: 39 and SEQ ID NO: 45.
In one embodiment, the polypeptide having lysozyme activity is obtained or is
obtainable
from the taxonomic order Hypocreales, preferably the taxonomic family
Clavicipitaceae and is
more preferably selected from the group consisting of SEQ ID NO: 42.
88

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Sources of Polypeptides Having Lysozyme Activity
A polypeptide having lysozyme activity of the present invention may be
obtained from
microorganisms of any genus. For purposes of the present invention, the term
"obtained from"
as used herein in connection with a given source shall mean that the
polypeptide encoded by a
polynucleotide is produced by the source or by a strain in which the
polynucleotide from the
source has been inserted. In one aspect, the polypeptide obtained from a given
source is
secreted extracellularly.
The polypeptide may be a fungal polypeptide. In one aspect, the polypeptide is
a
polypeptide having lysozyme activity from a fungus of the class
Eurotiomycetes, such as from
the order Eurotiales, or from the family Aspergillaceae, or from the genus
Penicillium, or from
the species Penicillium simplicissimum, Penicillium vasconiae, Penicillium
antarcticum,
Penicillium wellingtonense, Penicillium roseopurpureum or Penicillium
virgatum.
The polypeptide may be a fungal polypeptide. In one aspect, the polypeptide is
a
polypeptide having lysozyme activity from a fungus of the class
Eurotiomycetes, such as from
the order Eurotiales, or from the family Aspergillaceae, or from the genus
Aspergillus, or from
the species AspergiHus sp. XZ2668 or Aspergillus niveus.
The polypeptide may be a fungal polypeptide. In one aspect, the polypeptide is
a
polypeptide having lysozyme activity from a fungus of the class
Eurotiomycetes, such as from
the order Eurotiales, or from the family Trichocomaceae, or from the genus
Talaromyces, or
from the species Talaromyces proteolyticus or Talaromyces atricola.
The polypeptide may be a fungal polypeptide. In one aspect, the polypeptide is
a
polypeptide having lysozyme activity from a fungus of the class
Sordariomycetes, such as from
the order Hypocreales, or from the family Clavicipitaceae, or from the genus
Metarhizium, or
from the species Metarhizium cameum.
The polypeptide may be a fungal polypeptide. In one aspect, the polypeptide is
a
polypeptide having lysozyme activity from a fungus of the class
Sordariomycetes, such as from
the order Sordariales, or from the family Chaetomiaceae, or from the genus
Ovatospora, or
from the species Ovatospora brasiliensis.
The polypeptide may be a fungal polypeptide. In one aspect, the polypeptide is
a
polypeptide having lysozyme activity from a fungus of the class
Sordariomycetes, such as from
the order Sordariales, or from the family Chaetomiaceae, or from the genus
Chaetomium, or
from the species Chaetomium sp. ZY369.
The polypeptide may be a fungal polypeptide. In one aspect, the polypeptide is
a
polypeptide having lysozyme activity from a fungus of the class
Sordariomycetes, such as from
the order Sordariales, or from the family Chaetomiaceae, or from the genus
Trichocladium, or
from the species Trichocladium asperum .
89

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
The polypeptide may be a fungal polypeptide. In one aspect, the polypeptide is
a
polypeptide having lysozyme activity from a fungus of the class
Sordariomycetes, such as from
the order Sordariales, or from the family Chaetomiaceae, or from the genus
Thielavia, or from
the species Thiela via terrestris.
It will be understood that for the aforementioned species, the invention
encompasses
both the perfect and imperfect states, and other taxonomic equivalents, e.g.,
anamorphs,
regardless of the species name by which they are known. Those skilled in the
art will readily
recognize the identity of appropriate equivalents.
Strains of these species are readily accessible to the public in a number of
culture
collections, such as the American Type Culture Collection (ATCC), Deutsche
Sammlung von
Mikroorganismen und Zellkulturen GmbH (DSMZ), Centraalbureau Voor
Schimmelcultures
(CBS), and Agricultural Research Service Patent Culture Collection, Northern
Regional
Research Center (NRRL).
The polypeptide may be identified and obtained from other sources including
microorganisms isolated from nature (e.g., soil, composts, water, etc.) or DNA
samples obtained
directly from natural materials (e.g., soil, composts, water, etc.) using the
above-mentioned
probes. Techniques for isolating microorganisms and DNA directly from natural
habitats are well
known in the art. A polynucleotide encoding the polypeptide may then be
obtained by similarly
screening a genomic DNA or cDNA library of another microorganism or mixed DNA
sample.
Once a polynucleotide encoding a polypeptide has been detected with the
probe(s), the
polynucleotide can be isolated or cloned by utilizing techniques that are
known to those of
ordinary skill in the art (see, e.g., Sambrook etal., 1989, supra).
Polynucleotides
The present invention also relates to polynucleotides encoding a polypeptide
of the
present invention, as described herein. In an embodiment, the polynucleotide
encoding the
polypeptide of the present invention has been isolated.
The techniques used to isolate or clone a polynucleotide are known in the art
and
include isolation from genomic DNA or cDNA, or a combination thereof. The
cloning of the
polynucleotides from genomic DNA can be effected, e.g., by using the well-
known polymerase
chain reaction (PCR) or antibody screening of expression libraries to detect
cloned DNA
fragments with shared structural features. See, e.g., Innis et al., 1990, PCR:
A Guide to
Methods and Application, Academic Press, New York. Other nucleic acid
amplification
procedures such as ligase chain reaction (LCR), ligation activated
transcription (LAT) and
polynucleotide-based amplification (NASBA) may be used. The polynucleotides
may be cloned
from a strain of Trichophaea or a strain of Trichoderma, or a related organism
and thus, for
example, may be an allelic or species variant of the polypeptide encoding
region of the
polynucleotide.

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Modification of a polynucleotide encoding a polypeptide of the present
invention may be
necessary for synthesizing polypeptides substantially similar to the
polypeptide. The term
"substantially similar" to the polypeptide refers to non-naturally occurring
forms of the
polypeptide.
Nucleic Acid Constructs
The present invention also relates to nucleic acid constructs comprising a
polynucleotide
of the present invention operably linked to one or more control sequences that
direct the
expression of the coding sequence in a suitable host cell under conditions
compatible with the
control sequences.
The polynucleotide may be manipulated in a variety of ways to provide for
expression of
the polypeptide. Manipulation of the polynucleotide prior to its insertion
into a vector may be
desirable or necessary depending on the expression vector. The techniques for
modifying
polynucleotides utilizing recombinant DNA methods are well known in the art.
The control sequence may be a promoter, a polynucleotide that is recognized by
a host
cell for expression of a polynucleotide encoding a polypeptide of the present
invention. The
promoter contains transcriptional control sequences that mediate the
expression of the
polypeptide. The promoter may be any polynucleotide that shows transcriptional
activity in the
host cell including mutant, truncated, and hybrid promoters, and may be
obtained from genes
encoding extracellular or intracellular polypeptides either homologous or
heterologous to the
host cell.
Examples of suitable promoters for directing transcription of the nucleic acid
constructs
of the present invention in a bacterial host cell are the promoters obtained
from the Bacillus
amyloliquefaciens alpha-amylase gene (amy0), Bacillus licheniformis alpha-
amylase gene
(amyL), Bacillus licheniformis penicillinase gene (penP), Bacillus
stearothermophilus maltogenic
amylase gene (amyM), Bacillus subtilis levansucrase gene (sacB), Bacillus
subtilis xylA and
xylB genes, Bacillus thuringiensis cryllIA gene (Agaisse and Lereclus, 1994,
Molecular
Microbiology 13: 97-107), E. coli lac operon, E. coli trc promoter (Egon et
al., 1988, Gene 69:
301-315), Streptomyces coelicolor agarase gene (dagA), and prokaryotic beta-
lactamase gene
(Villa-Kamaroff et al., 1978, Proc. Natl. Acad. Sci. USA 75: 3727-3731), as
well as the tac
promoter (DeBoer et al., 1983, Proc. Natl. Acad. Sci. USA 80: 21-25). Further
promoters are
described in "Useful proteins from recombinant bacteria" in Gilbert et al.,
1980, Scientific
American 242: 74-94; and in Sambrook et al., 1989, supra. Examples of tandem
promoters are
disclosed in WO 99/43835.
Examples of suitable promoters for directing transcription of the nucleic acid
constructs
of the present invention in a filamentous fungal host cell are promoters
obtained from the genes
for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase,
Aspergillus niger
acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori
glucoamylase (glaA),
91

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease,
Aspergillus oryzae
triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO
96/00787),
Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Dania
(WO
00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei lipase,
Rhizomucor
miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, Trichoderma
reesei
cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma
reesei endoglucanase
I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III,
Trichoderma
reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei
xylanase II,
Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and
Trichoderma reesei
translation elongation factor, as well as the NA2-tpi promoter (a modified
promoter from an
Aspergillus neutral alpha-amylase gene in which the untranslated leader has
been replaced by
an untranslated leader from an Aspergillus triose phosphate isomerase gene;
non-limiting
examples include modified promoters from an Aspergillus niger neutral alpha-
amylase gene in
which the untranslated leader has been replaced by an untranslated leader from
an Aspergillus
nidulans or Aspergillus oryzae triose phosphate isomerase gene); and mutant,
truncated, and
hybrid promoters thereof. Other promoters are described in U.S. Patent No.
6,011,147.
In a yeast host, useful promoters are obtained from the genes for
Saccharomyces
cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1),
Saccharomyces
cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase
(ADH1,
ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI),
Saccharomyces
cerevisiae metallothionein (CU P1), and Saccharomyces cerevisiae 3-
phosphoglycerate kinase.
Other useful promoters for yeast host cells are described by Romanos et al.,
1992, Yeast 8:
423-488.
The control sequence may also be a transcription terminator, which is
recognized by a
host cell to terminate transcription. The terminator is operably linked to the
3'-terminus of the
polynucleotide encoding the polypeptide. Any terminator that is functional in
the host cell may
be used in the present invention.
Preferred terminators for bacterial host cells are obtained from the genes for
Bacillus
clausii alkaline protease (aprH), Bacillus licheniformis alpha-amylase (amyL),
and Escherichia
co/i ribosomal RNA (rrnB).
Preferred terminators for filamentous fungal host cells are obtained from the
genes for
Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase,
Aspergillus niger
glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA
amylase,
Fusarium oxysporum trypsin-like protease, Trichoderma reesei beta-glucosidase,
Trichoderma
reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II,
Trichoderma reesei
endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei
endoglucanase III,
Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma
reesei
92

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-
xylosidase, and
Trichoderma reesei translation elongation factor.
Preferred terminators for yeast host cells are obtained from the genes for
Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C
(CYC1), and
Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other
useful
terminators for yeast host cells are described by Romanos et al., 1992, supra.
The control sequence may also be an mRNA stabilizer region downstream of a
promoter
and upstream of the coding sequence of a gene which increases expression of
the gene.
Examples of suitable mRNA stabilizer regions are obtained from a Bacillus
thuringiensis
cry//IA gene (WO 94/25612) and a Bacillus subtilis SP82 gene (Hue et al.,
1995, Journal of
Bacteriology 177: 3465-3471).
The control sequence may also be a leader, a nontranslated region of an mRNA
that is
important for translation by the host cell. The leader is operably linked to
the 5'-terminus of the
polynucleotide encoding the polypeptide. Any leader that is functional in the
host cell may be
used.
Preferred leaders for filamentous fungal host cells are obtained from the
genes for
AspergiHus oryzae TAKA amylase and AspergiHus nidulans triose phosphate
isomerase.
Suitable leaders for yeast host cells are obtained from the genes for
Saccharomyces
cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate
kinase,
Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol
dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).
The control sequence may also be a polyadenylation sequence, a sequence
operably
linked to the 3'-terminus of the polynucleotide and, when transcribed, is
recognized by the host
cell as a signal to add polyadenosine residues to transcribed mRNA. Any
polyadenylation
sequence that is functional in the host cell may be used.
Preferred polyadenylation sequences for filamentous fungal host cells are
obtained from
the genes for AspergiHus nidulans anthranilate synthase, AspergiHus niger
glucoamylase,
AspergiHus niger alpha-glucosidase AspergiHus oryzae TAKA amylase, and
Fusarium
oxysporum trypsin-like protease.
Useful polyadenylation sequences for yeast host cells are described by Guo and

Sherman, 1995, Mol. Cellular Biol. 15: 5983-5990.
The control sequence may also be a signal peptide coding region that encodes a
signal
peptide linked to the N-terminus of a polypeptide and directs the polypeptide
into the cell's
secretory pathway. The 5'-end of the coding sequence of the polynucleotide may
inherently
contain a signal peptide coding sequence naturally linked in translation
reading frame with the
segment of the coding sequence that encodes the polypeptide. Alternatively,
the 5'-end of the
coding sequence may contain a signal peptide coding sequence that is foreign
to the coding
93

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
sequence. A foreign signal peptide coding sequence may be required where the
coding
sequence does not naturally contain a signal peptide coding sequence.
Alternatively, a foreign
signal peptide coding sequence may simply replace the natural signal peptide
coding sequence
in order to enhance secretion of the polypeptide. However, any signal peptide
coding sequence
that directs the expressed polypeptide into the secretory pathway of a host
cell may be used.
Effective signal peptide coding sequences for bacterial host cells are the
signal peptide
coding sequences obtained from the genes for Bacillus NCIB 11837 maltogenic
amylase,
Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase,
Bacillus
stearothermophilus alpha-amylase, Bacillus stearothermophilus neutral
proteases (nprT, nprS,
nprM), and Bacillus subtilis prsA. Further signal peptides are described by
Simonen and PaIva,
1993, Microbiological Reviews 57: 109-137.
Effective signal peptide coding sequences for filamentous fungal host cells
are the signal
peptide coding sequences obtained from the genes for Aspergillus niger neutral
amylase,
Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola
insolens cellulase,
Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor
miehei
aspartic proteinase.
Useful signal peptides for yeast host cells are obtained from the genes for
Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase.
Other useful
signal peptide coding sequences are described by Romanos et al., 1992, supra.
The control sequence may also be a propeptide coding sequence that encodes a
propeptide positioned at the N-terminus of a polypeptide. The resultant
polypeptide is known as
a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide
is generally
inactive and can be converted to an active polypeptide by catalytic or
autocatalytic cleavage of
the propeptide from the propolypeptide. The propeptide coding sequence may be
obtained from
the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis
neutral protease (nprT),
Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic
proteinase,
and Saccharomyces cerevisiae alpha-factor.
Where both signal peptide and propeptide sequences are present, the propeptide

sequence is positioned next to the N-terminus of a polypeptide and the signal
peptide sequence
is positioned next to the N-terminus of the propeptide sequence.
It may also be desirable to add regulatory sequences that regulate expression
of the
polypeptide relative to the growth of the host cell. Examples of regulatory
sequences are those
that cause expression of the gene to be turned on or off in response to a
chemical or physical
stimulus, including the presence of a regulatory compound. Regulatory
sequences in
prokaryotic systems include the lac, tac, and trp operator systems. In yeast,
the ADH2 system
or GAL1 system may be used. In filamentous fungi, the Aspergillus niger
glucoamylase
promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus
oryzae
94

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and
Trichoderma
reesei cellobiohydrolase II promoter may be used. Other examples of regulatory
sequences are
those that allow for gene amplification. In eukaryotic systems, these
regulatory sequences
include the dihydrofolate reductase gene that is amplified in the presence of
methotrexate, and
the metallothionein genes that are amplified with heavy metals. In these
cases, the
polynucleotide encoding the polypeptide would be operably linked to the
regulatory sequence.
Expression Vectors
The present invention also relates to recombinant expression vectors
comprising a
polynucleotide of the present invention, a promoter, and transcriptional and
translational stop
signals. The various nucleotide and control sequences may be joined together
to produce a
recombinant expression vector that may include one or more convenient
restriction sites to
allow for insertion or substitution of the polynucleotide encoding the
polypeptide at such sites.
Alternatively, the polynucleotide may be expressed by inserting the
polynucleotide or a nucleic
acid construct comprising the polynucleotide into an appropriate vector for
expression. In
creating the expression vector, the coding sequence is located in the vector
so that the coding
sequence is operably linked with the appropriate control sequences for
expression.
The recombinant expression vector may be any vector (e.g., a plasmid or virus)
that can
be conveniently subjected to recombinant DNA procedures and can bring about
expression of
the polynucleotide. The choice of the vector will typically depend on the
compatibility of the
vector with the host cell into which the vector is to be introduced. The
vector may be a linear or
closed circular plasmid.
The vector may be an autonomously replicating vector, i.e., a vector that
exists as an
extrachromosomal entity, the replication of which is independent of
chromosomal replication,
e.g., a plasmid, an extrachromosomal element, a minichromosome, or an
artificial chromosome.
The vector may contain any means for assuring self-replication. Alternatively,
the vector may be
one that, when introduced into the host cell, is integrated into the genome
and replicated
together with the chromosome(s) into which it has been integrated.
Furthermore, a single vector
or plasmid or two or more vectors or plasmids that together contain the total
DNA to be
introduced into the genome of the host cell, or a transposon, may be used.
The vector preferably contains one or more selectable markers that permit easy
selection of transformed, transfected, transduced, or the like cells. A
selectable marker is a
gene the product of which provides for biocide or viral resistance, resistance
to heavy metals,
prototrophy to auxotrophs, and the like.
Examples of bacterial selectable markers are Bacillus licheniformis or
Bacillus subtilis
dal genes, or markers that confer antibiotic resistance such as ampicillin,
chloramphenicol,
kanamycin, neomycin, spectinomycin, or tetracycline resistance. Suitable
markers for yeast host
cells include, but are not limited to, ADE2, HI53, LEU2, LYS2, MET3, TRP1, and
URA3.

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Selectable markers for use in a filamentous fungal host cell include, but are
not limited to, adeA
(phosphoribosylaminoimidazole-succinocarboxamide synthase), adeB
(phosphoribosyl-
aminoimidazole synthase), amdS (acetamidase), argB (ornithine
carbamoyltransferase), bar
(phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase),
niaD (nitrate
reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate
adenyltransferase), and
trpC (anthranilate synthase), as well as equivalents thereof. Preferred for
use in an Aspergillus
cell are AspergiHus nidulans or AspergiHus oryzae amdS and pyrG genes and a
Streptomyces
hygroscopicus bar gene. Preferred for use in a Trichoderma cell are adeA,
adeB, amdS, hph,
and pyrG genes.
The selectable marker may be a dual selectable marker system as described in
WO
2010/039889. In one aspect, the dual selectable marker is an hph-tk dual
selectable marker
system.
The vector preferably contains an element(s) that permits integration of the
vector into
the host cell's genome or autonomous replication of the vector in the cell
independent of the
genome.
For integration into the host cell genome, the vector may rely on the
polynucleotide's
sequence encoding the polypeptide or any other element of the vector for
integration into the
genome by homologous or non-homologous recombination. Alternatively, the
vector may
contain additional polynucleotides for directing integration by homologous
recombination into
the genome of the host cell at a precise location(s) in the chromosome(s). To
increase the
likelihood of integration at a precise location, the integrational elements
should contain a
sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to
10,000 base pairs,
and 800 to 10,000 base pairs, which have a high degree of sequence identity to
the
corresponding target sequence to enhance the probability of homologous
recombination. The
integrational elements may be any sequence that is homologous with the target
sequence in the
genome of the host cell. Furthermore, the integrational elements may be non-
encoding or
encoding polynucleotides. On the other hand, the vector may be integrated into
the genome of
the host cell by non-homologous recombination.
For autonomous replication, the vector may further comprise an origin of
replication
enabling the vector to replicate autonomously in the host cell in question.
The origin of
replication may be any plasmid replicator mediating autonomous replication
that functions in a
cell. The term "origin of replication" or "plasmid replicator" means a
polynucleotide that enables
a plasmid or vector to replicate in vivo.
Examples of bacterial origins of replication are the origins of replication of
plasmids
pBR322, pUC19, pACYC177, and pACYC184 permitting replication in E. coli, and
pUB110,
pE194, pTA1060, and pAM111 permitting replication in Bacillus.
96

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Examples of origins of replication for use in a yeast host cell are the 2
micron origin of
replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination
of ARS4
and CEN6.
Examples of origins of replication useful in a filamentous fungal cell are
AMA1 and ANSI
(Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res.
15: 9163-9175;
WO 00/24883). Isolation of the AMA1 gene and construction of plasm ids or
vectors comprising
the gene can be accomplished according to the methods disclosed in WO
00/24883.
More than one copy of a polynucleotide of the present invention may be
inserted into a
host cell to increase production of a polypeptide. An increase in the copy
number of the
polynucleotide can be obtained by integrating at least one additional copy of
the sequence into
the host cell genome or by including an amplifiable selectable marker gene
with the
polynucleotide where cells containing amplified copies of the selectable
marker gene, and
thereby additional copies of the polynucleotide, can be selected for by
cultivating the cells in the
presence of the appropriate selectable agent.
The procedures used to ligate the elements described above to construct the
recombinant expression vectors of the present invention are well known to one
skilled in the art
(see, e.g., Sambrook et al., 1989, supra).
Host Cells
The present invention also relates to recombinant host cells, comprising a
polynucleotide
of the present invention operably linked to one or more control sequences that
direct the
production of a polypeptide of the present invention. A construct or vector
comprising a
polynucleotide is introduced into a host cell so that the construct or vector
is maintained as a
chromosomal integrant or as a self-replicating extra-chromosomal vector as
described earlier.
The term "host cell" encompasses any progeny of a parent cell that is not
identical to the parent
cell due to mutations that occur during replication. The choice of a host cell
will to a large extent
depend upon the gene encoding the polypeptide and its source.
In some embodiments, the polypeptide is heterologous to the recombinant host
cell.
In some embodiments, at least one of the one or more control sequences is
heterologous to the polynucleotide encoding the polypeptide.
In some embodiments, the recombinant host cell comprises at least two copies,
e.g.,
three, four, or five, of the polynucleotide of the present invention.
The host cell may be any cell useful in the recombinant production of a
polypeptide of
the present invention, e.g., a prokaryote or a eukaryote.
The prokaryotic host cell may be any Gram-positive or Gram-negative bacterium.
Gram-
positive bacteria include, but are not limited to, Bacillus, Clostridium,
Enterococcus, Geobacillus,
Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and

Streptomyces. Gram-negative bacteria include, but are not limited to,
Campylobacter, E. coli,
97

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Flavobacterium, Fusobacterium, Helicobacter, Ilyobacter, Neisseria,
Pseudomonas, Salmonella,
and Ureaplasma.
The bacterial host cell may be any Bacillus cell including, but not limited
to, Bacillus
alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans,
Bacillus clausii,
Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus,
Bacillus licheniformis,
Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus
subtilis, and
Bacillus thuringiensis cells.
The bacterial host cell may also be any Streptococcus cell including, but not
limited to,
Streptococcus equisimilis, Streptococcus pyo genes, Streptococcus uberis, and
Streptococcus
equi subsp. Zooepidemicus cells.
The bacterial host cell may also be any Streptomyces cell including, but not
limited to,
Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor,
Streptomyces
griseus, and Streptomyces lividans cells.
The introduction of DNA into a Bacillus cell may be effected by protoplast
transformation
(see, e.g., Chang and Cohen, 1979, MoL Gen. Genet. 168: 111-115), competent
cell
transformation (see, e.g., Young and Spizizen, 1961, J. BacterioL 81: 823-829,
or Dubnau and
Davidoff-Abelson, 1971, J. MoL Biol. 56: 209-221), electroporation (see, e.g.,
Shigekawa and
Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e.g., Koehler and
Thorne, 1987,
J. BacterioL 169: 5271-5278). The introduction of DNA into an E. coli cell may
be effected by
protoplast transformation (see, e.g., Hanahan, 1983, J. MoL Biol. 166: 557-
580) or
electroporation (see, e.g., Dower et al., 1988, Nucleic Acids Res. 16: 6127-
6145). The
introduction of DNA into a Streptomyces cell may be effected by protoplast
transformation,
electroporation (see, e.g., Gong et al., 2004, Folia MicrobioL (Praha) 49: 399-
405), conjugation
(see, e.g., Mazodier et al., 1989, J. Bacteriol. 171: 3583-3585), or
transduction (see, e.g., Burke
et al., 2001, Proc. Natl. Acad. Sci. USA 98: 6289-6294). The introduction of
DNA into a
Pseudomonas cell may be effected by electroporation (see, e.g., Choi et al.,
2006, J. MicrobioL
Methods 64: 391-397) or conjugation (see, e.g., Pinedo and Smets, 2005, Appl.
Environ.
MicrobioL 71: 51-57). The introduction of DNA into a Streptococcus cell may be
effected by
natural competence (see, e.g., Perry and Kuramitsu, 1981, Infect. Immun. 32:
1295-1297),
protoplast transformation (see, e.g., Catt and Jollick, 1991, Microbios 68:
189-207),
electroporation (see, e.g., Buckley et al., 1999, AppL Environ. MicrobioL 65:
3800-3804), or
conjugation (see, e.g., Clewell, 1981, MicrobioL Rev. 45: 409-436). However,
any method
known in the art for introducing DNA into a host cell can be used.
The host cell may also be a eukaryote, such as a mammalian, insect, plant, or
fungal
cell.
The host cell may be a fungal cell. "Fungi" as used herein includes the phyla
Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as the
Oomycota and
98

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and
Bisby's Dictionary of
The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge,
UK).
The fungal host cell may be a yeast cell. "Yeast" as used herein includes
ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast
belonging to
the Fungi lmperfecti (Blastomycetes). Since the classification of yeast may
change in the future,
for the purposes of this invention, yeast shall be defined as described in
Biology and Activities of
Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol.
Symposium Series No.
9, 1980).
The yeast host cell may be a Candida, Hansenula, Kluyveromyces, Pichia,
Saccharomyces, Schizosaccharomyces, or Yarrowia cell, such as a Kluyveromyces
lactis,
Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces
diastaticus,
Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis,
Saccharomyces oviformis, or Yarrowia lipolytica cell.
The fungal host cell may be a filamentous fungal cell. "Filamentous fungi"
include all
filamentous forms of the subdivision Eumycota and Oomycota (as defined by
Hawksworth eta,'.,
1995, supra). The filamentous fungi are generally characterized by a mycelial
wall composed of
chitin, cellulose, glucan, chitosan, mannan, and other complex
polysaccharides. Vegetative
growth is by hyphal elongation and carbon catabolism is obligately aerobic. In
contrast,
vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of
a unicellular
thallus and carbon catabolism may be fermentative.
The filamentous fungal host cell may be an Acremonium, Aspergillus,
Aureobasidium,
Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus,
Filibasidium,
Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix,
Neurospora,
Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus,
Schizophyllum,
Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma
cell.
For example, the filamentous fungal host cell may be an Aspergillus awamori,
Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus,
Aspergillus nidulans,
Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis
aneirina, Ceriporiopsis
caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis
rivulosa,
Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium ins,
Chrysosporium
keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium,
Chrysosporium
pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium
zonatum,
Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium
cerealis, Fusarium
crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum,
Fusarium
heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum,
Fusarium
roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides,
Fusarium
sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum,
Humicola
99

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila,
Neurospora crassa,
Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata,
Pleurotus eryngii,
Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma
harzianum,
Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or
Trichoderma viride
cell.
Fungal cells may be transformed by a process involving protoplast formation,
transformation of the protoplasts, and regeneration of the cell wall in a
manner known per se.
Suitable procedures for transformation of AspergiHus and Trichoderma host
cells are described
in EP 238023, YeIton etal., 1984, Proc. Natl. Acad. Sci. USA 81: 1470-1474,
and Christensen
etal., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming
Fusarium species
are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787.
Yeast may be
transformed using the procedures described by Becker and Guarente, In Abelson,
J.N. and
Simon, Ml., editors, Guide to Yeast Genetics and Molecular Biology, Methods in
Enzymology,
Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, J.
Bacteriol. 153:
163; and Hinnen etal., 1978, Proc. Natl. Acad. Sci. USA 75: 1920.
Methods of Production
The present invention also relates to methods of producing a polypeptide of
the present
invention, comprising (a) cultivating a cell, which in its wild-type form
produces the polypeptide,
under conditions conducive for production of the polypeptide; and optionally,
(b) recovering the
polypeptide.
In one aspect, the cell is a Penicillium simplicissimum cell. In one aspect,
the cell is a
Penicillium vasconiae cell. In one aspect, the cell is a Talaromyces
proteolyticus cell. In one
aspect, the cell is an Aspergillus sp. XZ2668 cell. In one aspect, the cell is
a Penicillium
antarcticum cell. In one aspect, the cell is a Ovatospora brasiliensis cell.
In one aspect, the cell
is a Penicillium wellingtonense cell. In one aspect, the cell is a Penicillium
roseopurpureum cell.
In one aspect, the cell is a Penicillium virgatum cell. In one aspect, the
cell is an AspergiHus
niveus cell. In one aspect, the cell is a Chaetomium sp. ZY369 cell. In one
aspect, the cell is a
Talaromyces atricola cell. In one aspect, the cell is a Trichocladium asperum
cell. In one aspect,
the cell is a Metarhizium cameum cell. In one aspect, the cell is a Thiela via
terrestris cell.
The present invention also relates to methods of producing a polypeptide of
the present
invention, comprising (a) cultivating a recombinant host cell of the present
invention under
conditions conducive for production of the polypeptide; and optionally, (b)
recovering the
polypeptide.
The host cells are cultivated in a nutrient medium suitable for production of
the
polypeptide using methods known in the art. For example, the cells may be
cultivated by shake
flask cultivation, or small-scale or large-scale fermentation (including
continuous, batch, fed-
batch, or solid state fermentations) in laboratory or industrial fermentors in
a suitable medium
100

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
and under conditions allowing the polypeptide to be expressed and/or isolated.
The cultivation
takes place in a suitable nutrient medium comprising carbon and nitrogen
sources and inorganic
salts, using procedures known in the art. Suitable media are available from
commercial
suppliers or may be prepared according to published compositions (e.g., in
catalogues of the
American Type Culture Collection). If the polypeptide is secreted into the
nutrient medium, the
polypeptide can be recovered directly from the medium. If the polypeptide is
not secreted, it can
be recovered from cell lysates.
The polypeptide may be detected using methods known in the art that are
specific for
the polypeptides. These detection methods include, but are not limited to, use
of specific
antibodies, formation of an enzyme product, or disappearance of an enzyme
substrate. For
example, an enzyme assay may be used to determine the activity of the
polypeptide.
The polypeptide may be recovered using methods known in the art. For example,
the
polypeptide may be recovered from the fermentation medium by conventional
procedures
including, but not limited to, collection, centrifugation, filtration,
extraction, spray-drying,
evaporation, or precipitation. In one aspect, a fermentation broth comprising
the polypeptide is
recovered.
The polypeptide may be purified by a variety of procedures known in the art
including,
but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic,
chromatofocusing,
and size exclusion), electrophoretic procedures (e.g., preparative isoelectric
focusing),
differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or
extraction (see, e.g.,
Protein Purification, Janson and Ryden, editors, VCH Publishers, New York,
1989) to obtain
substantially pure polypeptides.
Plants
The present invention also relates to isolated plants, e.g., a transgenic
plant, plant part,
or plant cell, comprising a polynucleotide of the present invention so as to
express and produce
a polypeptide or domain in recoverable quantities. The polypeptide or domain
may be recovered
from the plant or plant part. Alternatively, the plant or plant part
containing the polypeptide or
domain may be used as such for improving the quality of a food or feed, e.g.,
improving
nutritional value, palatability, and rheological properties, or to destroy an
antinutritive factor.
The transgenic plant can be dicotyledonous (a dicot) or monocotyledonous (a
monocot).
Examples of monocot plants are grasses, such as meadow grass (blue grass,
Poa), forage
grass such as Festuca, Lolium, temperate grass, such as Agrostis, and cereals,
e.g., wheat,
oats, rye, barley, rice, sorghum, and maize (corn).
Examples of dicot plants are tobacco, legumes, such as lupins, potato, sugar
beet, pea,
bean and soybean, and cruciferous plants (family Brassicaceae), such as
cauliflower, rape
seed, and the closely related model organism Arabidopsis thaliana.
101

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Examples of plant parts are stem, callus, leaves, root, fruits, seeds, and
tubers as well
as the individual tissues comprising these parts, e.g., epidermis, mesophyll,
parenchyme,
vascular tissues, meristems.
Plant cells and specific plant cell compartments, such as chloroplasts,
apoplasts,
mitochondria, vacuoles, peroxisomes and cytoplasm are also considered to be a
plant part.
Also included within the scope of the present invention are the progeny of
such plants,
plant parts, and plant cells.
The transgenic plant or plant cell expressing the polypeptide or domain may be

constructed in accordance with methods known in the art.
The present invention also relates to methods of producing a polypeptide or
domain of
the present invention comprising (a) cultivating a transgenic plant or a plant
cell comprising a
polynucleotide encoding the polypeptide or domain under conditions conducive
for production of
the polypeptide or domain; and (b) recovering the polypeptide or domain.
Fermentation Broth Formulations or Cell Compositions
The present invention also relates to a fermentation broth formulation or a
cell
composition comprising a polypeptide of the present invention. The
fermentation broth product
further comprises additional ingredients used in the fermentation process,
such as, for example,
cells (including, the host cells containing the gene encoding the polypeptide
of the present
invention which are used to produce the polypeptide of interest), cell debris,
biomass,
fermentation media and/or fermentation products. In some embodiments, the
composition is a
cell-killed whole broth containing organic acid(s), killed cells and/or cell
debris, and culture
medium.
The term "fermentation broth" as used herein refers to a preparation produced
by
cellular fermentation that undergoes no or minimal recovery and/or
purification. For example,
fermentation broths are produced when microbial cultures are grown to
saturation, incubated
under carbon-limiting conditions to allow protein synthesis (e.g., expression
of enzymes by host
cells) and secretion into cell culture medium. The fermentation broth can
contain unfractionated
or fractionated contents of the fermentation materials derived at the end of
the fermentation.
Typically, the fermentation broth is unfractionated and comprises the spent
culture medium and
cell debris present after the microbial cells (e.g., filamentous fungal cells)
are removed, e.g., by
centrifugation. In some embodiments, the fermentation broth contains spent
cell culture
medium, extracellular enzymes, and viable and/or nonviable microbial cells.
In some embodiments, the fermentation broth formulation and cell compositions
comprise a first organic acid component comprising at least one 1-5 carbon
organic acid and/or
a salt thereof and a second organic acid component comprising at least one 6
or more carbon
organic acid and/or a salt thereof. In some embodiments, the first organic
acid component is
acetic acid, formic acid, propionic acid, a salt thereof, or a mixture of two
or more of the
102

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
foregoing and the second organic acid component is benzoic acid,
cyclohexanecarboxylic acid,
4-methylvaleric acid, phenylacetic acid, a salt thereof, or a mixture of two
or more of the
foregoing.
In one aspect, the composition contains an organic acid(s), and optionally
further
contains killed cells and/or cell debris. In some embodiments, the killed
cells and/or cell debris
are removed from a cell-killed whole broth to provide a composition that is
free of these
components.
The fermentation broth formulations or cell compositions may further comprise
a
preservative and/or anti-microbial (e.g., bacteriostatic) agent, including,
but not limited to,
sorbitol, sodium chloride, potassium sorbate, and others known in the art.
The cell-killed whole broth or composition may contain the unfractionated
contents of the
fermentation materials derived at the end of the fermentation. Typically, the
cell-killed whole
broth or composition contains the spent culture medium and cell debris present
after the
microbial cells (e.g., filamentous fungal cells) are grown to saturation,
incubated under carbon-
limiting conditions to allow protein synthesis. In some embodiments, the cell-
killed whole broth
or composition contains the spent cell culture medium, extracellular enzymes,
and killed
filamentous fungal cells. In some embodiments, the microbial cells present in
the cell-killed
whole broth or composition can be permeabilized and/or lysed using methods
known in the art.
A whole broth or cell composition as described herein is typically a liquid,
but may
contain insoluble components, such as killed cells, cell debris, culture media
components,
and/or insoluble enzyme(s). In some embodiments, insoluble components may be
removed to
provide a clarified liquid composition.
The whole broth formulations and cell compositions of the present invention
may be
produced by a method described in WO 90/15861 or WO 2010/096673.
Enzyme Compositions
The present invention also relates to compositions comprising a polypeptide of
the
present invention. Preferably, the compositions are enriched in the
polypeptide of the invention.
The term "enriched" indicates that the lysozyme activity of the composition
has been increased,
e.g., with an enrichment factor of at least 1.1, such as at least 1.2, at
least 1.3, at least 1.4, at
least 1.5, at least 2.0, at least 3.0, at least 4.0, at least 5.0, at least
10.
In a preferred embodiment, the composition comprises one or more LYS
polypeptides
having lysozyme activity selected from the list consisting of SEQ ID NO: 3,
SEQ ID NO: 6, SEQ
ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 21, SEQ ID
NO: 24,
SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ
ID NO:
42 and SEQ ID NO: 45.
In an embodiment, the composition comprises the polypeptide of the invention
and one
or more formulating agents, as described below.
103

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
The compositions may further comprise multiple enzymatic activities, such as
one or
more (e.g., several) enzymes selected from the group consisting of phytase,
xylanase,
galactanase, alpha-galactosidase, beta-galactosidase, protease, phospholipase
Al,
phospholipase A2, lysophospholipase, phospholipase C, phospholipase D,
amylase, lysozyme,
arabinofuranosidase, beta-xylosidase, acetyl xylan esterase, feruloyl
esterase, cell ulase,
cellobiohydrolases, beta-glucosidase, pullulanase, and beta-glucanase or any
combination
thereof.
The compositions may further comprise one or more probiotics. In an
embodiment, the
probiotic is selected from the group consisting of Bacillus subtilis, Bacillus
licheniformis, Bacillus
amyloliquefaciens, Bacillus cereus, Bacillus pumilus, Bacillus polymyxa,
Bacillus megaterium,
Bacillus coagulans, Bacillus circulans, Bifidobacterium bifidum,
Bifidobacterium animalis,
Bifidobacterium sp., Camobacterium sp., Clostridium butyricum, Clostridium
sp., Enterococcus
faecium, Enterococcus sp., Lactobacillus sp., Lactobacillus acidophilus,
Lactobacillus
farciminus, Lactobacillus rhamnosus, Lactobacillus reuteri, Lactobacillus
salivarius, Lactococcus
lactis, Lactococcus sp., Leuconostoc sp., Megasphaera elsdenii, Megasphaera
sp.,
Pediococsus acidilactici, Pediococcus sp., Propionibacterium thoenii,
Propionibacterium sp. and
Streptococcus sp. or any combination thereof.
In an embodiment, the composition comprises one or more formulating agents as
disclosed herein, preferably one or more of the compounds selected from the
list consisting of
glycerol, ethylene glycol, 1, 2-propylene glycol or 1, 3-propylene glycol,
sodium chloride, sodium
benzoate, potassium sorbate, sodium sulfate, potassium sulfate, magnesium
sulfate, sodium
thiosulfate, calcium carbonate, sodium citrate, dextrin, glucose, sucrose,
sorbitol, lactose,
starch, kaolin, maltodextrin, cyclodextrin, wheat, PVA, acetate, phosphate,
kaolin and cellulose.
In an embodiment, the composition comprises one or more components selected
from
the list consisting of vitamins, minerals and amino acids.
Formulation
The enzyme of the invention may be formulated as a liquid or a solid. For a
liquid
formulation, the formulating agent may comprise a polyol (such as e.g.
glycerol, ethylene glycol
or propylene glycol), a salt (such as e.g. sodium chloride, sodium benzoate,
potassium sorbate)
or a sugar or sugar derivative (such as e.g. dextrin, glucose, sucrose, and
sorbitol). Thus in one
embodiment, the composition is a liquid composition comprising the polypeptide
of the invention
and one or more formulating agents selected from the list consisting of
glycerol, ethylene glycol,
1,2-propylene glycol, 1,3-propylene glycol, sodium chloride, sodium benzoate,
potassium
sorbate, dextrin, glucose, sucrose, and sorbitol. The liquid formulation may
be sprayed onto the
feed after it has been pelleted or may be added to drinking water given to the
animals.
For a solid formulation, the formulation may be for example as a granule,
spray dried
powder or agglomerate (e.g. as disclosed in W02000/70034). The formulating
agent may
104

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
comprise a salt (organic or inorganic zinc, sodium, potassium or calcium salts
such as e.g. such
as calcium acetate, calcium benzoate, calcium carbonate, calcium chloride,
calcium citrate,
calcium sorbate, calcium sulfate, potassium acetate, potassium benzoate,
potassium carbonate,
potassium chloride, potassium citrate, potassium sorbate, potassium sulfate,
sodium acetate,
sodium benzoate, sodium carbonate, sodium chloride, sodium citrate, sodium
sulfate, zinc
acetate, zinc benzoate, zinc carbonate, zinc chloride, zinc citrate, zinc
sorbate, zinc sulfate),
starch or a sugar or sugar derivative (such as e.g. sucrose, dextrin, glucose,
lactose, sorbitol).
In one embodiment, the composition is a solid composition, such as a spray
dried
composition, comprising the LYS polypeptideof the invention and one or more
formulating
agents selected from the list consisting of sodium chloride, sodium benzoate,
potassium
sorbate, sodium sulfate, potassium sulfate, magnesium sulfate, sodium
thiosulfate, calcium
carbonate, sodium citrate, dextrin, glucose, sucrose, sorbitol, lactose,
starch, kaolin,
maltodextrin, cyclodextrin, wheat, PVA, acetate, phosphate and cellulose. In a
preferred
embodiment, the formulating agent is selected from one or more of the
following compounds:
sodium sulfate, dextrin, cellulose, sodium thiosulfate, magnesium sulfate and
calcium
carbonate.
The present invention also relates to enzyme granules/particles comprising the
LYS
polypeptideof the invention optionally combined with one or more additional
enzymes. The
granule is composed of a core, and optionally one or more coatings (outer
layers) surrounding
the core.
Typically the granule/particle size, measured as equivalent spherical diameter
(volume
based average particle size), of the granule is 20-2000 pm, particularly 50-
1500 pm, 100-1500
pm or 250-1200 pm.
The core can be prepared by granulating a blend of the ingredients, e.g., by a
method
comprising granulation techniques such as crystallization, precipitation, pan-
coating, fluid bed
coating, fluid bed agglomeration, rotary atomization, extrusion, prilling,
spheronization, size
reduction methods, drum granulation, and/or high shear granulation.
Methods for preparing the core can be found in Handbook of Powder Technology;
Particle size enlargement by C. E. Capes; Volume 1; 1980; Elsevier.
Preparation methods
include known feed and granule formulation technologies, e.g.:
a) spray dried products, wherein a liquid enzyme-containing solution is
atomized in a
spray drying tower to form small droplets which during their way down the
drying tower dry to
form an enzyme-containing particulate material;
b) layered products, wherein the enzyme is coated as a layer around a pre-
formed inert
core particle, wherein an enzyme-containing solution is atomized, typically in
a fluid bed
apparatus wherein the pre-formed core particles are fluidized, and the enzyme-
containing
solution adheres to the core particles and dries up to leave a layer of dry
enzyme on the surface
105

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
of the core particle. Particles of a desired size can be obtained this way if
a useful core particle
of the desired size can be found. This type of product is described in, e.g.,
WO 97/23606;
c) absorbed core particles, wherein rather than coating the enzyme as a layer
around
the core, the enzyme is absorbed onto and/or into the surface of the core.
Such a process is
described in WO 97/39116.
d) extrusion or pelletized products, wherein an enzyme-containing paste is
pressed to
pellets or under pressure is extruded through a small opening and cut into
particles which are
subsequently dried. Such particles usually have a considerable size because of
the material in
which the extrusion opening is made (usually a plate with bore holes) sets a
limit on the
allowable pressure drop over the extrusion opening. Also, very high extrusion
pressures when
using a small opening increase heat generation in the enzyme paste, which is
harmful to the
enzyme;
e) prilled products, wherein an enzyme-containing powder is suspended in
molten wax
and the suspension is sprayed, e.g., through a rotating disk atomiser, into a
cooling chamber
where the droplets quickly solidify (Michael S. Showell (editor); Powdered
detergents;
Surfactant Science Series; 1998; vol. 71; page 140-142; Marcel Dekker). The
product obtained
is one wherein the enzyme is uniformly distributed throughout an inert
material instead of being
concentrated on its surface. Also US 4,016,040 and US 4,713,245 are documents
relating to
this technique;
f) mixer granulation products, wherein a liquid is added to a dry powder
composition of,
e.g., conventional granulating components, the enzyme being introduced either
via the liquid or
the powder or both. The liquid and the powder are mixed and as the moisture of
the liquid is
absorbed in the dry powder, the components of the dry powder will start to
adhere and
agglomerate and particles will build up, forming granulates comprising the
enzyme. Such a
process is described in US 4,106,991 and related documents EP 170360, EP
304332, EP
304331, WO 90/09440 and WO 90/09428. In a particular product of this process
wherein
various high-shear mixers can be used as granulators, granulates consisting of
enzyme as
enzyme, fillers and binders etc. are mixed with cellulose fibres to reinforce
the particles to give
the so-called T-granulate. Reinforced particles, being more robust, release
less enzymatic dust.
g) size reduction, wherein the cores are produced by milling or crushing of
larger
particles, pellets, tablets, briquettes etc. containing the enzyme. The wanted
core particle
fraction is obtained by sieving the milled or crushed product. Over and
undersized particles can
be recycled. Size reduction is described in (Martin Rhodes (editor);
Principles of Powder
Technology; 1990; Chapter 10; John VViley & Sons);
h) fluid bed granulation, which involves suspending particulates in an air
stream and
spraying a liquid onto the fluidized particles via nozzles. Particles hit by
spray droplets get
106

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
wetted and become tacky. The tacky particles collide with other particles and
adhere to them
and form a granule;
i) the cores may be subjected to drying, such as in a fluid bed drier. Other
known
methods for drying granules in the feed or detergent industry can be used by
the skilled person.
The drying preferably takes place at a product temperature of from 25 to 90 C.
For some
enzymes it is important the cores comprising the enzyme contain a low amount
of water before
coating. If water sensitive enzymes are coated before excessive water is
removed, it will be
trapped within the core and it may affect the activity of the enzyme
negatively. After drying, the
cores preferably contain 0.1-10 % w/w water.
The core may include additional materials such as fillers, fibre materials
(cellulose or
synthetic fibres), stabilizing agents, solubilizing agents, suspension agents,
viscosity regulating
agents, light spheres, plasticizers, salts, lubricants and fragrances.
The core may include a binder, such as synthetic polymer, wax, fat, or
carbohydrate.
The core may include a salt of a multivalent cation, a reducing agent, an
antioxidant, a
peroxide decomposing catalyst and/or an acidic buffer component, typically as
a homogenous
blend.
In one embodiment, the core comprises a material selected from the group
consisting of
salts (such as calcium acetate, calcium benzoate, calcium carbonate, calcium
chloride, calcium
citrate, calcium sorbate, calcium sulfate, potassium acetate, potassium
benzoate, potassium
carbonate, potassium chloride, potassium citrate, potassium sorbate, potassium
sulfate, sodium
acetate, sodium benzoate, sodium carbonate, sodium chloride, sodium citrate,
sodium sulfate,
zinc acetate, zinc benzoate, zinc carbonate, zinc chloride, zinc citrate, zinc
sorbate, zinc
sulfate), starch or a sugar or sugar derivative (such as e.g. sucrose,
dextrin, glucose, lactose,
sorbitol), sugar or sugar derivative (such as e.g. sucrose, dextrin, glucose,
lactose, sorbitol),
small organic molecules, starch, flour, cellulose and minerals and clay
minerals (also known as
hydrous aluminium phyllosilicates). In one embodiment, the core comprises a
clay mineral such
as kaolinite or kaolin.
The core may include an inert particle with the enzyme absorbed into it, or
applied onto
the surface, e.g., by fluid bed coating.
The core may have a diameter of 20-2000 pm, particularly 50-1500 pm, 100-1500
pm or
250-1200 pm.
The core may be surrounded by at least one coating, e.g., to improve the
storage
stability, to reduce dust formation during handling, or for coloring the
granule. The optional
coating(s) may include a salt and/or wax and/or flour coating, or other
suitable coating materials.
The coating may be applied in an amount of at least 0.1% by weight of the
core, e.g., at
least 0.5%, 1% or 5%. The amount may be at most 100%, 70%, 50%, 40% or 30%.
107

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
The coating is preferably at least 0.1 pm thick, particularly at least 0.5 pm,
at least 1 pm
or at least 5 pm. In some embodiments the thickness of the coating is below
100 pm, such as
below 60 pm, or below 40 pm.
The coating should encapsulate the core unit by forming a substantially
continuous
layer. A substantially continuous layer is to be understood as a coating
having few or no holes,
so that the core unit is encapsulated or enclosed with few or no uncoated
areas. The layer or
coating should in particular be homogeneous in thickness.
The coating can further contain other materials as known in the art, e.g.,
fillers,
antisticking agents, pigments, dyes, plasticizers and/or binders, such as
titanium dioxide, kaolin,
calcium carbonate or talc.
A salt coating may comprise at least 60% by weight of a salt, e.g., at least
65%, at least
70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or
at least 99% by
weight.
The salt may be added from a salt solution where the salt is completely
dissolved or
from a salt suspension wherein the fine particles are less than 50 pm, such as
less than 10 pm
or less than 5 pm.
The salt coating may comprise a single salt or a mixture of two or more salts.
The salt
may be water soluble, in particular having a solubility at least 0.1 g in 100
g of water at 20 C,
preferably at least 0.5 g per 100 g water, e.g., at least 1 g per 100 g water,
e.g., at least 5 g per
100 g water.
The salt may be an inorganic salt, e.g., salts of sulfate, sulfite, phosphate,
phosphonate,
nitrate, chloride or carbonate or salts of simple organic acids (less than 10
carbon atoms, e.g., 6
or less carbon atoms) such as citrate, malonate or acetate. Examples of
cations in these salts
are alkali or earth alkali metal ions, the ammonium ion or metal ions of the
first transition series,
such as sodium, potassium, magnesium, calcium, zinc or aluminium. Examples of
anions
include chloride, bromide, iodide, sulfate, sulfite, bisulfite, thiosulfate,
phosphate, monobasic
phosphate, dibasic phosphate, hypophosphite, dihydrogen pyrophosphate,
tetraborate, borate,
carbonate, bicarbonate, metasilicate, citrate, malate, maleate, malonate,
succinate, sorbate,
lactate, formate, acetate, butyrate, propionate, benzoate, tartrate, ascorbate
or gluconate. In
particular alkali- or earth alkali metal salts of sulfate, sulfite, phosphate,
phosphonate, nitrate,
chloride or carbonate or salts of simple organic acids such as citrate,
malonate or acetate may
be used.
The salt in the coating may have a constant humidity at 20 C above 60%,
particularly
above 70%, above 80% or above 85%, or it may be another hydrate form of such a
salt (e.g.,
anhydrate). The salt coating may be as described in W01997/05245,
W01998/54980,
W01998/55599, W02000/70034, W02006/034710, W02008/017661, W02008/017659,
W02000/020569, W02001/004279, W01997/05245, W02000/01793, W02003/059086,
108

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
W02003/059087, W02007/031483, W02007/031485, W02007/044968, W02013/192043,
W02014/014647 and W02015/197719 or polymer coating such as described in WO
2001/00042.
Specific examples of suitable salts are NaCI (CH20 C=76%), Na2003 (CH20
C=92%),
NaNO3 (CH20 C=73%), Na2HPO4 (CH20 C=95%), Na3PO4 (0H25 C=92%), NH4CI (CH20 C
= 79.5%), (NH4)2HPO4 (CH20 C = 93,0%), NH4H2PO4 (CH20 C = 93.1%), (NH4)2504
(CH20 C=81.1%), KCI (CH20 C=85%), K2HPO4 (CH20 C=92%), KH2PO4 (CH20 C=96.5%),
KNO3 (CH20 C=93.5%), Na2SO4 (CH20 C=93%), K2504 (CH20 C=98%), KHSO4
(CH20 C=86%), MgSO4 (CH20 C=90%), ZnSO4 (CH20 C=90%) and sodium citrate
(0H25 C=86%). Other examples include NaH2PO4, (NH4)H2PO4, CuSO4, Mg(NO3)2,
magnesium acetate, calcium acetate, calcium benzoate, calcium carbonate,
calcium chloride,
calcium citrate, calcium sorbate, calcium sulfate, potassium acetate,
potassium benzoate,
potassium carbonate, potassium chloride, potassium citrate, potassium sorbate,
sodium
acetate, sodium benzoate, sodium citrate, sodium sulfate, zinc acetate, zinc
benzoate, zinc
carbonate, zinc chloride, zinc citrate and zinc sorbate.
The salt may be in anhydrous form, or it may be a hydrated salt, i.e. a
crystalline salt
hydrate with bound water(s) of crystallization, such as described in WO
99/32595. Specific
examples include anhydrous sodium sulfate (Na2SO4), anhydrous magnesium
sulfate
(MgSO4), magnesium sulfate heptahydrate (MgSO4.7H20), zinc sulfate
heptahydrate
(ZnSO4.7H20), sodium phosphate dibasic heptahydrate (Na2HPO4.7H20), magnesium
nitrate
hexahydrate (Mg(NO3)2(6H20)), sodium citrate dihydrate and magnesium acetate
tetrahydrate.
Preferably the salt is applied as a solution of the salt, e.g., using a fluid
bed.
A wax coating may comprise at least 60% by weight of a wax, e.g., at least
65%, at least
70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or
at least 99% by
weight.
Specific examples of waxes are polyethylene glycols; polypropylenes; Carnauba
wax;
Candelilla wax; bees wax; hydrogenated plant oil or animal tallow such as
polyethylene glycol
(PEG), methyl hydroxy-propyl cellulose (MHPC), polyvinyl alcohol (PVA),
hydrogenated ox
tallow, hydrogenated palm oil, hydrogenated cotton seeds and/or hydrogenated
soy bean oil;
fatty acid alcohols; mono-glycerides and/or di-glycerides, such as glyceryl
stearate, wherein
stearate is a mixture of stearic and palmitic acid; micro-crystalline wax;
paraffin's; and fatty
acids, such as hydrogenated linear long chained fatty acids and derivatives
thereof. A preferred
wax is palm oil or hydrogenated palm oil.
The granule may comprise a core comprising the LYS polypeptideof the
invention, one
or more salt coatings and one or more wax coatings. Examples of enzyme
granules with
multiple coatings are shown in W01993/07263, W01997/23606 and W02016/149636.
109

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Non-dusting granulates may be produced, e.g., as disclosed in U.S. Patent Nos.

4,106,991 and 4,661,452 and may optionally be coated by methods known in the
art. The
coating materials can be waxy coating materials and film-forming coating
materials. Examples
of waxy coating materials are poly(ethylene oxide) products
(polyethyleneglycol, PEG) with
mean molar weights of 1000 to 20000; ethoxylated nonylphenols having from 16
to 50 ethylene
oxide units; ethoxylated fatty alcohols in which the alcohol contains from 12
to 20 carbon atoms
and in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty
acids; and mono- and
di- and triglycerides of fatty acids. Examples of film-forming coating
materials suitable for
application by fluid bed techniques are given in GB 1483591.
The granulate may further comprise one or more additional enzymes. Each enzyme
will
then be present in more granules securing a more uniform distribution of the
enzymes, and also
reduces the physical segregation of different enzymes due to different
particle sizes. Methods
for producing multi-enzyme co-granulates is disclosed in the ip.com disclosure

I P00M000200739D.
Another example of formulation of enzymes by the use of co-granulates is
disclosed in
WO 2013/188331.
The present invention also relates to protected enzymes prepared according to
the
method disclosed in EP 238,216.
Thus, in a further aspect, the present invention provides a granule, which
comprises:
(a) a core comprising a LYS polypeptide having lysozyme activity according to
the
invention, and
(b) a coating consisting of one or more layer(s) surrounding the core.
In one embodiment, the coating comprises a salt coating as described herein.
In one
embodiment, the coating comprises a wax coating as described herein. In one
embodiment, the
coating comprises a salt coating followed by a wax coating as described
herein.
Animal Feed Additives
The present invention also relates to animal feed additives comprising one or
more LYS
polypeptides having lysozyme activity. Thus, in one embodiment, the invention
relates to an
animal feed additive comprising a LYS polypeptide, wherein:
(a) the polypeptide has lysozyme activity;
(b) the polypeptide comprises one or more LAD catalytic domains; and
(c) the LAD catalytic domain gives a domT score of at least 170 when
queried using
a Profile Hidden Markov Model prepared using SEQ ID NOs: 46 to 187 and
hmmbuild software program, and wherein the query is carried out using
hmmscan software program by the Method of Determining the Lysozyme
Enhancing Domain by HMM.
110

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
In an embodiment, the polypeptide further comprises one or more lysozyme
enhancing
domains, wherein the lysozyme enhancing domain gives a domT score of at least
100 when
queried using a Profile Hidden Markov Model prepared using SEQ ID NOs: 188 to
316 and
hmmbuild software program, and wherein the query is carried out using the
hmmscan software
program.
In an embodiment, the domT score of the LAD catalytic domain is at least 175,
preferably at least 180, more preferably at least 185, even more preferably at
least 190, even
more preferably at least 195, or most preferably at least 200. In an
embodiment, the domT
score of the LED is at least 103, preferably at least 106, more preferably at
least 109, more
preferably at least 112, more preferably at least 115, more preferably at
least 118, even more
preferably at least 121, or most preferably at least 124. Preferred
combinations of domT scores
are as disclosed in the first aspect of the invention.
In an embodiment, the LAD catalytic domain comprises one or more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317). In an embodiment, the LAD
catalytic domain
comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318). In an
embodiment,
the LED comprises one or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN]
(SEQ ID NO: 319). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and one or more motif II
V[G/A]XLCQXVQXSAYP
(SEQ ID NO: 318). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and the LED comprises one or
more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID
NO:
318) and the LED comprises one or more motif
III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][T/V]ES
(SEQ ID NO:
317) and one or more motif ll V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318) and the LED
comprises one or more motif III: [CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN]
(SEQ ID NO:
319).
In another aspect, the invention relates to animal feed additives comprising
one or more
LYS polypeptides having lysozyme activity, wherein the polypeptide is selected
from the group
consisting of:
(a) a polypeptide having at least 80%, such as at least 85%, at least
90% or at least
95% sequence identity to the polypeptide of SEQ ID NO: 3;
(b) a polypeptide having at least 84%, such as at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 6;
111

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(C) a polypeptide having at least 80%, such as at least 85%, at
least 90% or at least
95% sequence identity to the polypeptide of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, such as at least 85%, at
least 90% or at least
95% sequence identity to the polypeptide of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, such as at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 27;
(j) a polypeptide having at least 84%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, such as at least 85%, at
least 90% or at least
95% sequence identity to the polypeptide of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, such as at least 85%, at
least 90% or at least
95% sequence identity to the polypeptide of SEQ ID NO: 36;
(m) a polypeptide having at least 84%, such as at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 42;
(o) a polypeptide having at least 80%, such as at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 45;
(p) a variant of the polypeptide selected from the group
consisting of SEQ ID NO: 3,
SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18,
SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO:
33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42 and SEQ ID NO: 45,
wherein the variant has lysozyme activity and comprises one or more amino acid

substitutions, and/or one or more amino acid deletions, and/or one or more
amino
acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 positions;
112

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(q) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal His-tag
and/or HQ-
tag;
(r) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal extension of
up to
amino acids, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; and
(s) a fragment of the polypeptide of (a), (b), (c), (d), (e), (f), (g),
(h), (i), (j), (k), (I), (m),
(n), (o) or (p) having lysozyme activity and having at least 90% of the length
of
the mature polypeptide.
In an embodiment, the LAD catalytic domain comprises one or more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317). In an embodiment, the LAD
catalytic domain
comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318). In an
embodiment,
the LED comprises one or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN]
(SEQ ID NO: 319). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and one or more motif II
V[G/A]XLCQXVQXSAYP
(SEQ ID NO: 318). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and the LED comprises one or
more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID
NO:
318) and the LED comprises one or more motif
III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][1/\/]ES
(SEQ ID NO:
317) and one or more motif ll V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318) and the LED
comprises one or more motif III: [CGY][YFIIVILNASTP][DG]X[YFIIVITV[TS][GAN]
(SEQ ID NO:
319).
In one embodiment, the polypeptide is of fungal origin. In an embodiment, the
polypeptide is obtained or obtainable from the taxonomic phylum Ascomycota,
preferably the
taxonomic subphylum Pezizomycotina.
In an embodiment, the amount of enzyme in the animal feed additive is between
0.001%
and 10% by weight of the composition.
In an embodiment, the animal feed additive comprises one or more formulating
agents,
preferably as described herein above.
In an embodiment, the animal feed additive comprises one or more additional
enzymes,
preferably as described herein below.
In an embodiment, the animal feed additive comprises one or more probiotics,
preferably
as described herein below.
113

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
In an embodiment, the animal feed additive comprises one or more vitamins,
preferably
as described herein below.
In an embodiment, the animal feed additive comprises one or more minerals,
preferably
as described herein below.
In an embodiment, the animal feed additive comprises one or more amino acids,
preferably as described herein below.
In an embodiment, the animal feed additive comprises one or more prebiotics,
preferably
as described herein below.
In an embodiment, the animal feed additive comprises one or more organic
acids,
preferably as described herein below.
In an embodiment, the animal feed additive comprises one or more phytogenics,
preferably as described herein below.
Animal Feed
The present invention also relates to animal feed compositions comprising one
or more
lysozymes of the invention. In one embodiment, the invention relates to an
animal feed
comprising the granule as described herein and plant based material. In one
embodiment, the
invention relates to an animal feed comprising the animal feed additive as
described herein and
plant based material.
Animal feed compositions or diets have a relatively high content of protein.
Poultry and
pig diets can be characterised as indicated in Table B of WO 01/58275, columns
2-3. Fish diets
can be characterised as indicated in column 4 of this Table B. Furthermore
such fish diets
usually have a crude fat content of 200-310 g/kg.
An animal feed composition according to the invention has a crude protein
content of 50-
800 g/kg, and furthermore comprises at least one polypeptide having lysozyme
activity as
claimed herein.
Furthermore, or in the alternative (to the crude protein content indicated
above), the
animal feed composition of the invention has a content of metabolisable energy
of 10-30 MJ/kg;
and/or a content of calcium of 0.1-200 g/kg; and/or a content of available
phosphorus of 0.1-200
g/kg; and/or a content of methionine of 0.1-100 g/kg; and/or a content of
methionine plus
cysteine of 0.1-150 g/kg; and/or a content of lysine of 0.5-50 g/kg.
In particular embodiments, the content of metabolisable energy, crude protein,
calcium,
phosphorus, methionine, methionine plus cysteine, and/or lysine is within any
one of ranges 2,
3, 4 or 5 in Table B of WO 01/58275 (R. 2-5).
Crude protein is calculated as nitrogen (N) multiplied by a factor 6.25, i.e.
Crude protein
(g/kg)= N (g/kg) x 6.25. The nitrogen content is determined by the Kjeldahl
method (A.O.A.C.,
1984, Official Methods of Analysis 14th ed., Association of Official
Analytical Chemists,
Washington DC).
114

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Metabolisable energy can be calculated on the basis of the NRC publication
Nutrient
requirements in swine, ninth revised edition 1988, subcommittee on swine
nutrition, committee
on animal nutrition, board of agriculture, national research council. National
Academy Press,
Washington, D.C., pp. 2-6, and the European Table of Energy Values for Poultry
Feed-stuffs,
Spelderholt centre for poultry research and extension, 7361 DA Beekbergen, The
Netherlands.
Grafisch bedrijf Ponsen & looijen by, Wageningen. ISBN 90-71463-12-5.
The dietary content of calcium, available phosphorus and amino acids in
complete
animal diets is calculated on the basis of feed tables such as Veevoedertabel
1997, gegevens
over chemische samenstelling, verteerbaarheid en voederwaarde van
voedermiddelen, Central
Veevoederbureau, Runderweg 6, 8219 pk Lelystad. ISBN 90-72839-13-7.
In a particular embodiment, the animal feed composition of the invention
contains at
least one vegetable protein as defined above.
The animal feed composition of the invention may also contain animal protein,
such as
Meat and Bone Meal, Feather meal, and/or Fish Meal, typically in an amount of
0-25%. The
animal feed composition of the invention may also comprise Dried Distillers
Grains with
Solubles (DDGS), typically in amounts of 0-30%.
In still further particular embodiments, the animal feed composition of the
invention
contains 0-80% maize; and/or 0-80% sorghum; and/or 0-70% wheat; and/or 0-70%
Barley;
and/or 0-30% oats; and/or 0-40% soybean meal; and/or 0-25% fish meal; and/or 0-
25% meat
and bone meal; and/or 0-20% whey.
The animal feed may comprise vegetable proteins. In particular embodiments,
the
protein content of the vegetable proteins is at least 10, 20, 30, 40, 50, 60,
70, 80, or 90% (w/w).
Vegetable proteins may be derived from vegetable protein sources, such as
legumes and
cereals, for example, materials from plants of the families Fabaceae
(Leguminosae),
Cruciferaceae, Chenopodiaceae, and Poaceae, such as soy bean meal, lupin meal,
rapeseed
meal, and combinations thereof.
In a particular embodiment, the vegetable protein source is material from one
or more
plants of the family Fabaceae, e.g., soybean, lupine, pea, or bean. In another
particular
embodiment, the vegetable protein source is material from one or more plants
of the family
Chenopodiaceae, e.g. beet, sugar beet, spinach or quinoa. Other examples of
vegetable
protein sources are rapeseed, and cabbage. In another particular embodiment,
soybean is a
preferred vegetable protein source. Other examples of vegetable protein
sources are cereals
such as barley, wheat, rye, oat, maize (corn), rice, and sorghum.
Animal diets can e.g. be manufactured as mash feed (non-pelleted) or pelleted
feed.
Typically, the milled feed-stuffs are mixed and sufficient amounts of
essential vitamins and
minerals are added according to the specifications for the species in
question. Enzymes can be
added as solid or liquid enzyme formulations. For example, for mash feed a
solid or liquid
115

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
enzyme formulation may be added before or during the ingredient mixing step.
For pelleted feed
the (liquid or solid) lysozyme/enzyme preparation may also be added before or
during the feed
ingredient step. Typically a liquid lysozyme/enzyme preparation comprises the
polypeptide
having lysozyme activity of the invention optionally with a polyol, such as
glycerol, ethylene
glycol or propylene glycol, and is added after the pelleting step, such as by
spraying the liquid
formulation onto the pellets. The enzyme may also be incorporated in a feed
additive or premix.
Alternatively, the polypeptide having lysozyme activity can be prepared by
freezing a
mixture of liquid enzyme solution with a bulking agent such as ground soybean
meal, and then
lyophilizing the mixture.
The final enzyme concentration in the diet is within the range of 0.01-200 mg
enzyme
protein per kg diet, preferably between 0.05-100 mg/kg diet, more preferably
0.1-50 mg, even
more preferably 0.2-20 mg enzyme protein per kg animal diet.
It is at present contemplated that the enzyme is administered in one or more
of the
following amounts (dosage ranges): 0.01-200; 0.05-100; 0.1-50; 0.2-20; 0.1-1;
0.2-2; 0.5-5; or 1-
10; ¨ all these ranges being in mg LYS polypeptide protein per kg feed (ppm).
For determining mg LYS polypeptide protein per kg feed, the LYS polypeptide is
purified
from the feed composition, and the specific activity of the purified LYS
polypeptide is determined
using a relevant assay (see under lysozyme activity). The lysozyme activity of
the feed
composition as such is also determined using the same assay, and on the basis
of these two
determinations, the dosage in mg lysozyme protein per kg feed is calculated.
In a particular embodiment, the animal feed additive of the invention is
intended for
being included (or prescribed as having to be included) in animal diets or
feed at levels of 0.01
to 10.0%; more particularly 0.05 to 5.0%; or 0.2 to 1.0% (c/o meaning g
additive per 100 g feed).
This is so in particular for premixes.
The same principles apply for determining mg LYS polypeptide protein in feed
additives.
Of course, if a sample is available of the LYS polypeptide used for preparing
the feed additive or
the feed, the specific activity is determined from this sample (no need to
purify the LYS
polypeptide from the feed composition or the additive).
Thus in a further aspect, the present invention also relates to an animal feed
comprising
one or more LYS polypeptides having lysozyme activity and plant based
material. In another
aspect, the present invention also relates to an animal feed comprising the
animal feed additive
of the invention (as described herein above) and plant based material.
In one embodiment, the invention relates to an animal feed comprising plant
based
material and a LYS polypeptide, wherein the polypeptide (a) has lysozyme
activity and (b)
comprises one or more LAD catalytic domains; wherein the LAD catalytic domain
gives a domT
score of at least 180 when queried using a Profile Hidden Markov Model (HMM)
prepared using
116

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NOs: 46 to 187 and hmmbuild software program, and wherein the query is
carried out
using hmmscan software program by the Method of Determining the LAD Catalytic
Domain by
HMM.
In an embodiment, the polypeptide further comprises one or more lysozyme
enhancing
domains, wherein the lysozyme enhancing domain gives a domT score of at least
100 when
queried using a Profile Hidden Markov Model prepared using SEQ ID NOs: 188 to
316 and
hmmbuild software program, and wherein the query is carried out using the
hmmscan software
program by the Method of Determining the Lysozyme .
In an embodiment, the domT score of the LAD catalytic domain is at least 175,
preferably at least 180, more preferably at least 185, even more preferably at
least 190, even
more preferably at least 195, or most preferably at least 200. In an
embodiment, the domT
score of the LED is at least 103, preferably at least 106, more preferably at
least 109, more
preferably at least 112, more preferably at least 115, more preferably at
least 118, even more
preferably at least 121, or most preferably at least 124. Preferred
combinations of domT scores
are as disclosed in the first aspect of the invention.
In an embodiment, the LAD catalytic domain comprises one or more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317). In an embodiment, the LAD
catalytic domain
comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318). In an
embodiment,
the LED comprises one or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN]
(SEQ ID NO: 319). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and one or more motif II
V[G/A]XLCQXVQXSAYP
(SEQ ID NO: 318). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and the LED comprises one or
more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID
NO:
318) and the LED comprises one or more motif
III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][T/V]ES
(SEQ ID NO:
317) and one or more motif ll V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318) and the LED
comprises one or more motif III: [CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN]
(SEQ ID NO:
319).
In another aspect, the invention relates to an animal feed comprising plant
based
material and one or more LYS polypeptides having lysozyme activity, wherein
the polypeptide is
selected from the group consisting of:
(a) a polypeptide having at least 80%, such as at least 85%, at least
90% or at least
95% sequence identity to the polypeptide of SEQ ID NO: 3;
117

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(b) a polypeptide having at least 84%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 6;
(c) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, such as at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 12;
(e) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 15;
(f) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 24;
(i) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 27;
(j) a polypeptide having at least 84%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, such as at least 85%, at
least 90% or at least
95% sequence identity to the polypeptide of SEQ ID NO: 36;
(m) a polypeptide having at least 84%, such as at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, such as at least 85%, at least 90% or
at least
95% sequence identity to the polypeptide of SEQ ID NO: 42;
(o) a polypeptide having at least 80%, such as at least 85%, at least 90%
or at least
95% sequence identity to the polypeptide of SEQ ID NO: 45;
(p) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 3,
SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18,
SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO:
33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42 and SEQ ID NO: 45,
wherein the variant has lysozyme activity and comprises one or more amino acid

substitutions, and/or one or more amino acid deletions, and/or one or more
amino
acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 positions;
118

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(q) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal His-tag
and/or HQ-
tag;
(r) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal extension of
up to
amino acids, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; and
(s) a fragment of the polypeptide of (a), (b), (c), (d), (e), (f), (g),
(h), (i), (j), (k), (I), (m),
(n), (o) or (p) having lysozyme activity and having at least 90% of the length
of
the mature polypeptide.
In an embodiment, the LAD catalytic domain comprises one or more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317). In an embodiment, the LAD
catalytic domain
comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318). In an
embodiment,
the LED comprises one or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN]
(SEQ ID NO: 319). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and one or more motif II
V[G/A]XLCQXVQXSAYP
(SEQ ID NO: 318). In an embodiment, the LAD catalytic domain comprises one or
more motif I:
AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317) and the LED comprises one or
more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif II V[G/A]XLCQXVQXSAYP (SEQ ID
NO:
318) and the LED comprises one or more motif
III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319). In an embodiment,
the
LAD catalytic domain comprises one or more motif I: AG[1/QAT[A/G][1/L][1/\/]ES
(SEQ ID NO:
317) and one or more motif ll V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318) and the LED
comprises one or more motif III: [CGY][YFIIVILNASTP][DG]X[YFIIVITV[TS][GAN]
(SEQ ID NO:
319).
In one embodiment, the polypeptide is of fungal origin. In an embodiment, the
polypeptide is obtained or obtainable from the taxonomic phylum Ascomycota,
preferably the
taxonomic subphylum Pezizomycotina.
In an embodiment, the plant based material is selected from the group
consisting of
legumes, cereals, oats, rye, barley, wheat, maize, corn, sorghum, switchgrass,
millet, pearl
millet, foxtail millet, soybean, wild soybean, beans, lupin, tepary bean,
scarlet runner bean,
slimjim bean, lima bean, French bean, Broad bean (fava bean), chickpea,
lentil, peanut,
Spanish peanut, canola, rapeseed (oilseed rape), rice, beet, cabbage, sugar
beet, spinach,
quinoa, or pea, in a processed form thereof (such as soybean meal, rapeseed
meal) or any
combination thereof.
119

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
In a further embodiment, the animal feed has been pelleted.
Additional Enzymes
In another embodiment, the compositions described herein optionally include
one or
more enzymes. Enzymes can be classified on the basis of the handbook Enzyme
Nomenclature
from NC-I U BM B, 1992), see also the ENZYME site
at the internet:
http://www.expasy.ch/enzyme/.
ENZYME is a repository of information relative to the
nomenclature of enzymes. It is primarily based on the recommendations of the
Nomenclature
Committee of the International Union of Biochemistry and Molecular Biology
(IUB-MB),
Academic Press, Inc., 1992, and it describes each type of characterized enzyme
for which an
EC (Enzyme Commission) number has been provided (Bairoch A. The ENZYME
database,
2000, Nucleic Acids Res 28:304-305). This IUB-MB Enzyme nomenclature is based
on their
substrate specificity and occasionally on their molecular mechanism; such a
classification does
not reflect the structural features of these enzymes.
Another classification of certain glycoside hydrolase enzymes, such as
endoglucanase,
xylanase, galactanase, mannanase, dextranase, lysozyme and galactosidase is
described in
Henrissat eta!, "The carbohydrate-active enzymes database (CAZy) in 2013",
Nucl. Acids Res.
(1 January 2014) 42 (D1): D490-D495; see also www.cazy.org.
Thus the composition of the invention may also comprise at least one other
enzyme
selected from the group comprising of phytase (EC 3.1.3.8 or 3.1.3.26);
xylanase (EC 3.2.1.8);
galactanase (EC 3.2.1.89); alpha-galactosidase (EC 3.2.1.22); protease (EC
3.4);
phospholipase Al (EC 3.1.1.32); phospholipase A2 (EC 3.1.1.4);
lysophospholipase (EC
3.1.1.5); phospholipase C (3.1.4.3); phospholipase D (EC 3.1.4.4); amylase
such as, for
example, alpha-amylase (EC 3.2.1.1); arabinofuranosidase (EC 3.2.1.55); beta-
xylosidase (EC
3.2.1.37); acetyl xylan esterase (EC 3.1.1.72); feruloyl esterase (EC
3.1.1.73); cellulase (EC
3.2.1.4); cellobiohydrolases (EC 3.2.1.91); beta-glucosidase (EC 3.2.1.21);
pullulanase (EC
3.2.1.41), alpha-mannosidase (EC 3.2.1.24), mannanase (EC 3.2.1.25) and beta-
glucanase (EC
3.2.1.4 or EC 3.2.1.6), or any mixture thereof.
In a particular embodiment, the composition of the invention comprises a
phytase (EC
3.1.3.8 or 3.1.3.26). Examples of commercially available phytases include
BioFeedTM Phytase
(Novozymes), Ronozymee P, Ronozymee NP and Ronozymee HiPhos (DSM Nutritional
Products), NatuphosTM (BASF), NatuphosTM E (BASF), Finasee and Quantum Blue
(AB
Enzymes), OptiPhos0 (Huvepharma), AveMix0 Phytase (Aveve Biochem), Phyzymee XP

(Verenium/DuPont) and Axtra0 PHY (DuPont). Other preferred phytases include
those
described in e.g. WO 98/28408, WO 00/43503, and WO 03/066847.
In a particular embodiment, the composition of the invention comprises a
xylanase (EC
3.2.1.8). Examples of commercially available xylanases include Ronozymee VVX
(DSM
120

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Nutritional Products), Econasee XT and Barley (AB Vista), Xylathine
(Verenium), Hostazyme X
(Huvepharma), Axtra0 XB (Xylanase/beta-glucanase, DuPont) and Axtra0 XAP
(Xylanase/amylase/protease, DuPont), AveMix XG 10 (xylanase/glucanase) and
AveMix 02
CS (xylanase/glucanase/pectinase, Aveve Biochem), and Naturgrain (BASF).
In a particular embodiment, the composition of the invention comprises a
protease (EC
3.4). Examples of commercially available proteases include Ronozymee ProAct
(DSM
Nutritional Products).
In a particular embodiment, the composition of the invention comprises an
alpha-
amylase (EC 3.2.1.1).
Examples of commercially available alpha-amylases include
Ronozymee A and RONOZYME0 RumiStarTM (DSM Nutritional Products).
In one embodiment, the composition of the invention comprises a multicomponent

enzyme product, such as FRAC, Octazyme (Framelco), Ronozymee G2, Ronozymee VP
and
Ronozymee MultiGrain (DSM Nutritional Products), Rovabio0 Excel or Rovabio0
Advance
(Adisseo).
Eubiotics
Eubiotics are compounds which are designed to give a healthy balance of the
micro-flora
in the gastrointestinal tract. Eubiotics cover a number of different feed
additives, such as
probiotics, prebiotics, phytogenics (essential oils) and organic acids which
are described in
more detail below.
Probiotics
In an embodiment, the animal feed composition further comprises one or more
additional
probiotic. In a particular embodiment, the animal feed composition further
comprises a
bacterium from one or more of the following genera: Lactobacillus,
Lactococcus, Streptococcus,
Bacillus, Pediococcus, Enterococcus, Leuconostoc, Carnobacterium,
Propionibacterium,
Bifidobacterium, Clostridium and Megasphaera or any combination thereof.
In a preferred embodiment, animal feed composition further comprises a
bacterium from
one or more of the following strains: Bacillus subtilis, Bacillus
licheniformis, Bacillus
amyloliquefaciens, Bacillus cereus, Bacillus pumilus, Bacillus polymyxa,
Bacillus megaterium,
Bacillus coagulans, Bacillus circulans, Enterococcus faecium, Enterococcus
spp, and
Pediococcus spp, Lactobacillus spp, Bifidobacterium spp, Lactobacillus
acidophilus,
Pediococsus acidilactici, Lactococcus lactis, Bifidobacterium bifidum,
Propionibacterium thoenii,
Lactobacillus farciminus, lactobacillus rhamnosus, Clostridium butyricum,
Bifidobacterium
animalis ssp. animalis, Lactobacillus reuteri, Lactobacillus salivarius ssp.
saliva rius,
Megasphaera elsdenii, Propionibacteria sp.
In a more preferred embodiment, composition, animal feed additive or animal
feed
further comprises a bacterium from one or more of the following strains of
Bacillus subtilis: 3A-
121

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
P4 (PTA-6506), 15A-P4 (PTA-6507), 220-P1 (PTA-6508), 2084 (NRRL B-500130),
LSSA01
(NRRL-B-50104), BS27 (NRRL B-501 05), BS 18 (NRRL B-50633), BS 278 (NRRL B-
50634),
DSM 29870, DSM 29871, DSM 32315, NRRL B-50136, NRRL B-50605, NRRL B-50606,
NRRL
B-50622 and PTA-7547.
In a more preferred embodiment, composition, animal feed additive or animal
feed
further comprises a bacterium from one or more of the following strains of
Bacillus pumilus:
NRRL B-50016, ATCC 700385, NRRL B-50885 or NRRL B-50886.
In a more preferred embodiment, composition, animal feed additive or animal
feed
further comprises a bacterium from one or more of the following strains of
Bacillus lichenformis:
NRRL B 50015, NRRL B-50621 or NRRL B-50623.
In a more preferred embodiment, composition, animal feed additive or animal
feed
further comprises a bacterium from one or more of the following strains of
Bacillus
amyloliquefaciens: DSM 29869, DSM 29869, NRRL B 50607, PTA-7543, PTA-7549,
NRRL B-
50349, NRRL B-50606, NRRL B-50013, NRRL B-50151, NRRL B-50141, NRRL B-50147 or
NRRL B-50888.
The bacterial count of each of the bacterial strains in the animal feed
composition is
between 1x104 and 1x1014 CFU/kg of dry matter, preferably between 1x106 and
1x1012 CFU/kg
of dry matter, and more preferably between 1x107 and 1x1011 CFU/kg of dry
matter. In a more
preferred embodiment the bacterial count of each of the bacterial strains in
the animal feed
.. composition is between 1x108 and 1x1019CFU/kg of dry matter.
The bacterial count of each of the bacterial strains in the animal feed
composition is
between 1x106 and 1x1016 CFU/animal/day, preferably between 1x107 and 1x1013
CFU/animal/day, and more preferably between 1x108 and 1x1012 CFU/animal/day.
In a more
preferred embodiment the bacterial count of each of the bacterial strains in
the animal feed
.. composition is between 1x109 and 1x1011 CFU/animal/day. In one embodiment,
the amount of
probiotics is 0.001% to 10% by weight of the composition.
In another embodiment, the one or more bacterial strains are present in the
form of a
stable spore.
Examples of commercial products are Cylactine (DSM Nutritional Products),
Alterion
(Adisseo), Enviva PRO (DuPont Animal Nutrition), Syncra0 (mix enzyme +
probiotic, DuPont
Animal Nutrition), Ecobiole and Fecinor0 (Norel/Evonik) and GutCare0 PY1
(Evonik).
Prebiotics
Prebiotics are substances that induce the growth or activity of microorganisms
(e.g.,
bacteria and fungi) that contribute to the well-being of their host.
Prebiotics are typically non-
.. digestible fiber compounds that pass undigested through the upper part of
the gastrointestinal
tract and stimulate the growth or activity of advantageous bacteria that
colonize the large bowel
122

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
by acting as substrate for them. Normally, prebiotics increase the number or
activity of
bifidobacteria and lactic acid bacteria in the GI tract.
Yeast derivatives (inactivated whole yeasts or yeast cell walls) can also be
considered
as prebiotics. They often comprise mannan-oligosaccharids, yeast beta-glucans
or protein
contents and are normally derived from the cell wall of the yeast,
Saccharomyces cerevisiae.
In one embodiment, the amount of prebiotics is 0.001% to 10% by weight of the
composition. Examples of yeast products are Yang and Agrimos (Lallemand
Animal Nutrition).
Phytogenics
Phytogenics are a group of natural growth promoters or non-antibiotic growth
promoters
used as feed additives, derived from herbs, spices or other plants.
Phytogenics can be single
substances prepared from essential oils/extracts, essential oils/extracts,
single plants and
mixture of plants (herbal products) or mixture of essential
oils/extracts/plants (specialized
products).
Examples of phytogenics are rosemary, sage, oregano, thyme, clove, and
lemongrass.
Examples of essential oils are thymol, eugenol, meta-cresol, vaniline,
salicylate, resorcine,
guajacol, gingerol, lavender oil, ionones, irone, eucalyptol, menthol,
peppermint oil, alpha-
pinene; limonene, anethol, linalool, methyl dihydrojasmonate, carvacrol,
propionic
acid/propionate, acetic acid/acetate, butyric acid/butyrate, rosemary oil,
clove oil, geraniol,
terpineol, citronellol, amyl and/or benzyl salicylate, cinnamaldehyde, plant
polyphenol (tannin),
turmeric and curcuma extract.
In one embodiment, the amount of phytogeneics is 0.001% to 10% by weight of
the
composition. Examples of commercial products are Crina (DSM Nutritional
Products);
CinergyTM, BiacidTM, ProHacidTM Classic and ProHacidTM AdvanceTM (all
Promivi/Cargill) and
Envivo EO (DuPont Animal Nutrition).
.. Organic Acids
Organic acids (C1¨C7) are widely distributed in nature as normal constituents
of plants
or animal tissues. They are also formed through microbial fermentation of
carbohydrates mainly
in the large intestine. They are often used in swine and poultry production as
a replacement of
antibiotic growth promoters since they have a preventive effect on the
intestinal problems like
necrotic enteritis in chickens and Escherichia coli infection in young pigs.
Organic acids can be
sold as mono component or mixtures of typically 2 or 3 different organic
acids. Examples of
organic acids are propionic acid, formic acid, citric acid, lactic acid,
sorbic acid, malic acid,
acetic acid, fumaric acid, benzoic acid, butyric acid and tartaric acid or
their salt (typically
sodium or potassium salt such as potassium diformate or sodium butyrate).
In one embodiment, the amount of organic acid is 0.001% to 10% by weight of
the
composition. Examples of commercial products are VevoVitali (DSM Nutritional
Products),
123

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Amasile, Luprisile, Lupro-Grain , Lupro-Cide, Lupro-Mix (BASF), n-Butyric
Acid AF (OXEA)
and Adimix Precision (Nutriad).
Premix
The incorporation of the composition of feed additives as exemplified herein
above to
animal feeds, for example poultry feeds, is in practice carried out using a
concentrate or a
premix. A premix designates a preferably uniform mixture of one or more
microingredients with
diluent and/or carrier. Premixes are used to facilitate uniform dispersion of
micro-ingredients in a
larger mix. A premix according to the invention can be added to feed
ingredients or to the
drinking water as solids (for example as water soluble powder) or liquids.
Amino Acids
The composition of the invention may further comprise one or more amino acids.

Examples of amino acids which are used in animal feed are lysine, alanine,
beta-alanine,
threonine, methionine and tryptophan. In one embodiment, the amount of amino
acid is 0.001%
to 10% by weight of the composition.
Vitamins and Minerals
In another embodiment, the animal feed may include one or more vitamins, such
as one
or more fat-soluble vitamins and/or one or more water-soluble vitamins. In
another embodiment,
the animal feed may optionally include one or more minerals, such as one or
more trace
minerals and/or one or more macro minerals.
Usually fat- and water-soluble vitamins, as well as trace minerals form part
of a so-called
premix intended for addition to the feed, whereas macro minerals are usually
separately added
to the feed.
Non-limiting examples of fat-soluble vitamins include vitamin A, vitamin D3,
vitamin E,
and vitamin K, e.g., vitamin K3.
Non-limiting examples of water-soluble vitamins include vitamin C, vitamin
B12, biotin
and choline, vitamin B1, vitamin B2, vitamin B6, niacin, folic acid and
panthothenate, e.g., Ca-D-
panthothenate.
Non-limiting examples of trace minerals include boron, cobalt, chloride,
chromium,
copper, fluoride, iodine, iron, manganese, molybdenum, iodine, selenium and
zinc.
Non-limiting examples of macro minerals include calcium, magnesium,
phosphorus,
potassium and sodium.
In one embodiment, the amount of vitamins is 0.001% to 10% by weight of the
composition. In one embodiment, the amount of minerals is 0.001% to 10% by
weight of the
composition.
124

CA 03062980 2019-11-08
WO 2018/206001 PCT/CN2018/086528
The nutritional requirements of these components (exemplified with poultry and

piglets/pigs) are listed in Table A of WO 01/58275. Nutritional requirement
means that these
components should be provided in the diet in the concentrations indicated.
In the alternative, the animal feed additive of the invention comprises at
least one of the
individual components specified in Table A of WO 01/58275. At least one means
either of, one
or more of, one, or two, or three, or four and so forth up to all thirteen, or
up to all fifteen
individual components. More specifically, this at least one individual
component is included in
the additive of the invention in such an amount as to provide an in-feed-
concentration within the
range indicated in column four, or column five, or column six of Table A.
In a still further embodiment, the animal feed additive of the invention
comprises at least
one of the below vitamins, preferably to provide an in-feed-concentration
within the ranges
specified in the below Table 1 (for piglet diets, and broiler diets,
respectively).
Table 1: Typical vitamin recommendations
Vitamin Piglet diet Broiler diet
Vitamin A 10,000-15,000 I U/kg feed 8-12,500 I U/kg feed
Vitamin D3 1800-2000 I U/kg feed 3000-5000 IU/kg feed
Vitamin E 60-100 mg/kg feed 150-240 mg/kg feed
Vitamin K3 2-4 mg/kg feed 2-4 mg/kg feed
Vitamin B1 2-4 mg/kg feed 2-3 mg/kg feed
Vitamin B2 6-10 mg/kg feed 7-9 mg/kg feed
Vitamin B6 4-8 mg/kg feed 3-6 mg/kg feed
Vitamin B12 0.03-0.05 mg/kg feed 0.015-0.04 mg/kg
feed
Niacin (Vitamin B3) 30-50 mg/kg feed 50-80
mg/kg feed
Pantothenic acid 20-40 mg/kg feed 10-18
mg/kg feed
Folic acid 1-2 mg/kg feed 1-2 mg/kg feed
Biotin 0.15-0.4 mg/kg feed 0.15-0.3 mg/kg feed
Choline chloride 200-400 mg/kg feed
300-600 mg/kg feed
Other feed ingredients
The composition of the invention may further comprise colouring agents,
stabilisers,
growth improving additives and aroma compounds/flavourings, polyunsaturated
fatty acids
125

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(PUFAs); reactive oxygen generating species, antioxidants, anti-microbial
peptides, anti-fungal
polypeptides and mycotoxin management compounds.
Examples of colouring agents are carotenoids such as beta-carotene,
astaxanthin, and
I utei n.
Examples of aroma compounds/flavourings are creosol, anethol, deca-, undeca-
and/or
dodeca-lactones, ionones, irone, gingerol, piperidine, propylidene phatalide,
butylidene
phatalide, capsaicin and tannin.
Examples of antimicrobial peptides (AMP's) are CAP18, Leucocin A, Tritrpticin,

Protegrin-1, Thanatin, Defensin, Lactoferrin, Lactoferricin, and Ovispirin
such as Novispirin
(Robert Lehrer, 2000), Plectasins, and Statins, including the compounds and
polypeptides
disclosed in WO 03/044049 and WO 03/048148, as well as variants or fragments
of the above
that retain antimicrobial activity.
Examples of antifungal polypeptides (AFP's) are the AspergiHus giganteus, and
AspergiHus niger peptides, as well as variants and fragments thereof which
retain antifungal
.. activity, as disclosed in WO 94/01459 and WO 02/090384.
Examples of polyunsaturated fatty acids are 018, 020 and 022 polyunsaturated
fatty
acids, such as arachidonic acid, docosohexaenoic acid, eicosapentaenoic acid
and gamma-
linoleic acid.
Examples of reactive oxygen generating species are chemicals such as
perborate,
persulphate, or percarbonate; and enzymes such as an oxidase, an oxygenase or
a syntethase.
Antioxidants can be used to limit the number of reactive oxygen species which
can be
generated such that the level of reactive oxygen species is in balance with
antioxidants.
Mycotoxins, such as deoxynivalenol, aflatoxin, zearalenone and fumonisin can
be found
in animal feed and can result in nmegative animal performance or illness.
Compounds which
.. can manage the levels of mycotoxin, such as via deactivation of the
mycotoxin or via binding of
the mycotoxin, can be added to the feed to ameliorate these negative effects.
Examples of
mycotoxin management compounds are Vitafix0, Vitafix Ultra (Nuscience),
Mycofix0, Mycofix0
Secure, FUMzymee, Biomine BBSH, Biomine MTV (Biomin), Mold-Nile, Toxy-Nile and

Unikee Plus (Nutriad).
Uses
Use in Animal Feed
A LYS polypeptide of the invention may also be used in animal feed, wherein
the term
"animal" refers to all animals except humans. Examples of animals are mono-
gastric animals,
e.g. pigs or swine (including, but not limited to, piglets, growing pigs, and
sows); poultry
(including but not limited to poultry, turkey, duck, quail, guinea fowl,
goose, pigeon, squab,
126

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
chicken, broiler, layer, pullet and chick); fish (including but not limited to
amberjack, arapaima,
barb, bass, bluefish, bocachico, bream, bullhead, cachama, carp, catfish,
catla, chanos, char,
cichlid, cobia, cod, crappie, dorada, drum, eel, goby, goldfish, gourami,
grouper, guapote,
halibut, java, labeo, lai, loach, mackerel, milkfish, mojarra, mudfish,
mullet, paco, pearlspot,
pejerrey, perch, pike, pompano, roach, salmon, sampa, sauger, sea bass,
seabream, shiner,
sleeper, snakehead, snapper, snook, sole, spinefoot, sturgeon, sunfish,
sweetfish, tench, terror,
tilapia, trout, tuna, turbot, vendace, walleye and whitefish); and crustaceans
(including but not
limited to shrimps and prawns).
In the use according to the invention the LYS polypeptide can be fed to the
animal
before, after, or simultaneously with the diet. The latter is preferred.
In a particular embodiment, the LYS polypeptide, in the form in which it is
added to the
feed, or when being included in a feed additive, is well-defined. Well-defined
means that the
LYS polypeptide preparation is at least 50% pure as determined by Size-
exclusion
chromatography (see Example 12 of WO 01/58275). In other particular
embodiments the LYS
polypeptide preparation is at least 60, 70, 80, 85, 88, 90, 92, 94, or at
least 95% pure as
determined by this method.
A well-defined LYS polypeptide preparation is advantageous. For instance, it
is much
easier to dose correctly to the feed a LYS polypeptide that is essentially
free from interfering or
contaminating other lysozymes. The term dose correctly refers in particular to
the objective of
obtaining consistent and constant results, and the capability of optimizing
dosage based upon
the desired effect.
For the use in animal feed, however, the LYS polypeptide need not be pure; it
may e.g.
include other enzymes, in which case it could be termed a LYS polypeptide
preparation.
The LYS polypeptide preparation can be (a) added directly to the feed, or (b)
it can be
used in the production of one or more intermediate compositions such as feed
additives or
premixes that is subsequently added to the feed (or used in a treatment
process). The degree of
purity described above refers to the purity of the original LYS polypeptide
preparation, whether
used according to (a) or (b) above.
Methods of Improving Animal Performance
In an embodiment, the present invention also relates to a method of improving
the
performance of an animal comprising administering to the animal the animal
feed or the animal
feed additive of the invention.
In a preferred embodiment, the method of improving the performance of an
animal
comprises administering to the animal the animal feed or the animal feed
additive comprising
the LYS polypeptide of the invention. In one embodiment, the LYS polypeptide
is selected from
the group consisting of SEQ ID NO: 3, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO:
12, SEQ ID
127

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
NO: 15, SEQ ID NO: 18, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO:
33,
SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42 and SEQ ID NO: 45.
In an embodiment, the present invention also relates to the use of the animal
feed or an
animal feed additive of the invention for improving the performance of an
animal. In another
embodiment, the invention relates to the use of one or more lysozymes of the
invention for
improving the performance of an animal.
In one embodiment, 'improving the performance of an animal' means that there
is an
increase in body weight gain. In another embodiment, 'improving the
performance of an animal'
means that there is an improved feed conversion ratio. In a further
embodiment, 'improving the
performance of an animal' means that there is an increased feed efficiency. In
a further
embodiment, 'improving the performance of an animal' means that there is an
increase in body
weight gain and/or an improved feed conversion ratio and/or an increased feed
efficiency.
In an embodiment, the the animal feed comprises plant based material selected
from the
group consisting of legumes, cereals, oats, rye, barley, wheat, maize, corn,
sorghum,
switchgrass, millet, pearl millet, foxtail millet, soybean, wild soybean,
beans, lupin, tepary bean,
scarlet runner bean, slimjim bean, lima bean, French bean, Broad bean (fava
bean), chickpea,
lentil, peanut, Spanish peanut, canola, rapeseed (oilseed rape), rice, beet,
cabbage, sugar beet,
spinach, quinoa, or pea, in a processed form thereof (such as soybean meal,
rapeseed meal) or
any combination thereof.
Methods of Preparing an Animal Feed
In an embodiment, the present invention provides a method for preparing an
animal feed
comprising adding one or more LYS polypeptide of the invention to one or more
animal feed
ingredients. Animal feed ingredients include, but are not limited to
concentrates (as defined
herein), forage (as defined herein), enzymes, probiotic, vitamins, minerals
and amino acids.
In a preferred embodiment, the method of preparing an animal feed comprises
mixing
plant based material with the LYS polypeptide of the invention. In one
embodiment, the LYS
polypeptide is selected from the group consisting of SEQ ID NO: 3, SEQ ID NO:
6, SEQ ID NO:
9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18, SEQ ID NO: 24, SEQ ID NO: 27,
SEQ ID
NO: 30, SEQ ID NO: 33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42 and SEQ ID
NO: 45.
In an embodiment, the plant based material is selected from the group
consisting of
legumes, cereals, oats, rye, barley, wheat, maize, corn, sorghum, switchgrass,
millet, pearl
millet, foxtail millet, soybean, wild soybean, beans, lupin, tepary bean,
scarlet runner bean,
slimjim bean, lima bean, French bean, Broad bean (fava bean), chickpea,
lentil, peanut,
Spanish peanut, canola, rapeseed (oilseed rape), rice, beet, cabbage, sugar
beet, spinach,
quinoa, or pea, in a processed form thereof (such as soybean meal, rapeseed
meal) or any
combination thereof.
128

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Preferred Embodiments
Herein follows a list of preferred embodiments of the invention.
1. A composition comprising at least 0.01 mg of LYS polypeptide per
kilogram of
composition, wherein the polypeptide (a) has lysozyme activity and (b)
comprises one or
more LAD catalytic domains; wherein the LAD catalytic domain gives a domT
score of at
least 180 when queried using a Profile Hidden Markov Model (HMM) prepared
using SEQ
ID NOs: 46 to 187 and hmmbuild software program, suitably wherein the query is
carried
out using hmmscan software program by the Method of Determining the LAD
Catalytic
Domain by HMM.
2. The composition of item 1, wherein the polypeptide further comprises one
or more
lysozyme enhancing domains, wherein the lysozyme enhancing domain gives a domT
score of at least 100 when queried using a Profile Hidden Markov Model
prepared using
SEQ ID NOs: 188 to 316 and hmmbuild software program, and wherein the query is

carried out using the hmmscan software program by the Method of Determining
the
Lysozyme Enhancing Domain.
3. The composition of any of items 1 to 2, wherein
(a) the LAD catalytic domain comprises one or more motif I:
AG[1/QAT[A/G][1/L][T/V]ES (SEQ ID NO: 317) and/or one or more motif ll
V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318); and/or
(b) the lysozyme enhancing domain comprises one or more motif III:
[CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID NO: 319).
4. A composition comprising one or more LYS polypeptides having lysozyme
activity,
wherein the polypeptide is dosed at least 0.01 mg of polypeptide per kilogram
of
composition and is selected from the group consisting of:
(a) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 3;
(b) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 6;
(c) a polypeptide having at least 80% sequence identity to the polypeptide of
SEQ ID
NO: 9;
129

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(d) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 12;
(e) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 15;
(f) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 18;
(g) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 21;
(h) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 24;
(i) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 27;
(j) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 30;
(k) a polypeptide having at least 80% sequence identity to the polypeptide of
SEQ ID
NO: 33;
(I) a polypeptide having at least 80% sequence identity to the
polypeptide of SEQ ID
NO: 36;
(m) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 39;
(n) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 42;
(o) a polypeptide having at least 80% sequence identity to the polypeptide
of SEQ ID
NO: 45;
(p) a variant of the polypeptide selected from the group consisting of SEQ ID
NO: 3,
SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18,
SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO:
33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42 and SEQ ID NO: 45,
wherein the variant has lysozyme activity and comprises one or more amino acid
substitutions, and/or one or more amino acid deletions, and/or one or more
amino
acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 positions;
(q) a polypeptide comprising the polypeptide of (a), (b), (c),
(d), (e), (f), (g), (h), (i), (j),
(k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal His-tag
and/or HQ-
tag;
130

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(r) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o) or (p) and a N-terminal and/or C-terminal extension of
up to
amino acids, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids; and
(s) a fragment of the polypeptide of (a), (b), (c), (d), (e), (f), (g),
(h), (i), (j), (k), (I), (m),
5 (n), (o) or (p) having lysozyme activity and having at least 90%
of the length of
the mature polypeptide.
5. The composition of item 4, wherein the polypeptide is selected from
the group consisting
of:
10 (a) a polypeptide having at least 85% sequence identity to the
polypeptide of SEQ ID
NO: 3;
(b) a polypeptide having at least 85% sequence identity to the polypeptide
of SEQ ID
NO: 6;
(c) a polypeptide having at least 85% sequence identity to the polypeptide
of SEQ ID
NO: 9;
(d) a polypeptide having at least 85% sequence identity to the polypeptide
of SEQ ID
NO: 12;
(e) a polypeptide having at least 85% sequence identity to the polypeptide
of SEQ ID
NO: 15;
(f) a polypeptide having at least 85% sequence identity to the polypeptide
of SEQ ID
NO: 18;
(g) a polypeptide having at least 85% sequence identity to the polypeptide
of SEQ ID
NO: 21;
(h) a polypeptide having at least 85% sequence identity to the polypeptide
of SEQ ID
NO: 24;
(i) a polypeptide having at least 85% sequence identity to the polypeptide
of SEQ ID
NO: 27;
(j) a polypeptide having at least 85% sequence identity to the polypeptide
of SEQ ID
NO: 30;
(k) a polypeptide having at least 85% sequence identity to the polypeptide of
SEQ ID
NO: 33;
(I) a polypeptide having at least 85% sequence identity to the
polypeptide of SEQ ID
NO: 36;
(m) a polypeptide having at least 85% sequence identity to the polypeptide
of SEQ ID
NO: 39;
(n) a polypeptide having at least 85% sequence identity to the polypeptide
of SEQ ID
NO: 42;
131

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(o) a polypeptide having at least 85% sequence identity to the polypeptide
of SEQ ID
NO: 45; and
(p) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 3,
SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18,
SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO:
33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42 and SEQ ID NO: 45,
wherein the variant has lysozyme activity and comprises one or more amino acid

substitutions, and/or one or more amino acid deletions, and/or one or more
amino
acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32
or 33
positions.
6.
The composition of item 4, wherein the polypeptide is selected from the
group consisting
of:
(a) a polypeptide having at least 90% sequence identity to the polypeptide of
SEQ ID
NO: 3;
(b) a polypeptide having at least 90% sequence identity to the polypeptide
of SEQ ID
NO: 6;
(c) a polypeptide having at least 90% sequence identity to the polypeptide
of SEQ ID
NO: 9;
(d) a polypeptide having at least 90% sequence identity to the polypeptide
of SEQ ID
NO: 12;
(e) a polypeptide having at least 90% sequence identity to the polypeptide
of SEQ ID
NO: 15;
(f) a
polypeptide having at least 90% sequence identity to the polypeptide of SEQ ID
NO: 18;
(g) a polypeptide having at least 90% sequence identity to the polypeptide
of SEQ ID
NO: 21;
(h) a polypeptide having at least 90% sequence identity to the polypeptide
of SEQ ID
NO: 24;
(i) a polypeptide having at least 90% sequence identity to the polypeptide
of SEQ ID
NO: 27;
(j) a polypeptide having at least 90% sequence identity to the polypeptide
of SEQ ID
NO: 30;
(k) a polypeptide having at least 90% sequence identity to the polypeptide of
SEQ ID
NO: 33;
132

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(I) a polypeptide having at least 90% sequence identity to the
polypeptide of SEQ ID
NO: 36;
(m) a polypeptide having at least 90% sequence identity to the
polypeptide of SEQ ID
NO: 39;
(n) a polypeptide having at least 90% sequence identity to the polypeptide of
SEQ ID
NO: 42;
(o) a polypeptide having at least 90% sequence identity to the polypeptide
of SEQ ID
NO: 45; and
(p) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 3,
SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18,
SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO:
33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42 and SEQ ID NO: 45,
wherein the variant has lysozyme activity and comprises one or more amino acid

substitutions, and/or one or more amino acid deletions, and/or one or more
amino
acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21 0r22 positions.
7.
The composition of item 4, wherein the polypeptide is selected from the
group consisting
of:
(a) a polypeptide having at least 95% sequence identity to the polypeptide of
SEQ ID
NO: 3;
(b) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 6;
(c) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 9;
(d) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 12;
(e) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 15;
(f) a
polypeptide having at least 95% sequence identity to the polypeptide of SEQ ID
NO: 18;
(g) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 21;
(h) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 24;
(i) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 27;
133

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(j) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 30;
(k) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 33;
(I) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 36;
(m) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 39;
(n) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 42;
(o) a polypeptide having at least 95% sequence identity to the polypeptide
of SEQ ID
NO: 45; and
(p) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 3,
SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 18,
SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO:
33, SEQ ID NO: 36, SEQ ID NO: 39, SEQ ID NO: 42 and SEQ ID NO: 45,
wherein the variant has lysozyme activity and comprises one or more amino acid

substitutions, and/or one or more amino acid deletions, and/or one or more
amino
acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or
11
positions.
8. The composition of any of items 4 to 7, wherein the LYS polypeptide
comprises one or
more motifs selected from the group consisting of
(a) motif I: AG[1/1401/4T[A/G][1/L][T/V]ES (SEQ ID NO: 317);
(b) motif II V[G/A]XLCQXVQXSAYP (SEQ ID NO: 318); and
(c) motif III: [CGY][YFIIVILNASTP][DG]X[YF][VITV[TS][GAN] (SEQ ID
NO: 319).
9. The composition of any of items 1 to 8, wherein the polypeptide is of
fungal origin.
10. The composition of any of items 1 to 9, wheren the polypeptide is obtained
or obtainable
from the taxonomic phylum Ascomycota, preferably the taxonomic subphylum
Pezizomycotina.
11. The composition of any of items 1 to 10, wheren the polypeptide comprises
or consists of
amino acids1 to 226 of SEQ ID NO: 2, amino acids 1 to 226 of SEQ ID NO: 3,
amino
acids 1 to 226 of SEQ ID NO: 5, amino acids 1 to 226 of SEQ ID NO: 6, amino
acids 1 to
223 of SEQ ID NO: 8, amino acids 1 to 223 of SEQ ID NO: 9, amino acids 1 to
304 of
134

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SEQ ID NO: 11, amino acids 1 to 304 of SEQ ID NO: 12, amino acids 1 to 228 of
SEQ ID
NO: 14, amino acids 1 to 228 of SEQ ID NO: 15, amino acids 1 to 230 of SEQ ID
NO: 17,
amino acids 1 to 230 of SEQ ID NO: 18, amino acids 1 to 230 of SEQ ID NO: 20,
amino
acids 1 to 230 of SEQ ID NO: 21, amino acids 1 to 232 of SEQ ID NO: 23, amino
acids 1
to 232 of SEQ ID NO: 24, amino acids 1 to 228 of SEQ ID NO: 26, amino acids 1
to 228 of
SEQ ID NO: 27, amino acids 1 to 228 of SEQ ID NO: 29, amino acids 1 to 228 of
SEQ ID
NO: 30, amino acids 1 to 226 of SEQ ID NO: 32, amino acids 1 to 226 of SEQ ID
NO: 33,
amino acids 1 to 225 of SEQ ID NO: 35, amino acids 1 to 225 of SEQ ID NO: 36,
amino
acids 1 to 225 of SEQ ID NO: 38, amino acids 1 to 225 of SEQ ID NO: 39, amino
acids 1
to 304 of SEQ ID NO: 41, amino acids 1 to 304 of SEQ ID NO: 42, amino acids 1
to 227 of
SEQ ID NO: 44, or amino acids 1 to 227 of SEQ ID NO: 45.
12. The composition of any of items 1 to 11 further comprising one or more
formulating
agents.
13. The composition of item 12, wherein the one or more formulating agent is
selected from
the group consisting of glycerol, ethylene glycol, 1, 2-propylene glycol or 1,
3-propylene
glycol, sodium chloride, sodium benzoate, potassium sorbate, sodium sulfate,
potassium
sulfate, magnesium sulfate, sodium thiosulfate, calcium carbonate, sodium
citrate, dextrin,
glucose, sucrose, sorbitol, lactose, starch, kaolin, maltodextrin,
cyclodextrin, wheat, PVA,
acetate, phosphate and cellulose or any combination thereof.
14. The composition of any of items 1 to 13 further comprising one or more
additional
enzymes.
15. The composition of item 14 wherein the one or more additional enzymes is
selected from
the group consisting of acetyl xylan esterase, alpha-amylase, beta-amylase,
arabinofuranosidase, cellobiohydrolases, cellulase, feruloyl esterase,
galactanase, alpha-
galactosidase, beta-galactosidase, beta-glucanase,
beta-glucosidase, lipase,
lysophospholipase, lysozyme, mannanase, alpha-mannosidase, beta-mannosidase,
phytase, phospholipase Al, phospholipase A2, phospholipase C, phospholipase D,

protease, pullulanase, pectinase, pectin lyase, xylanase, beta-xylosidase, or
any
combination thereof.
16. The composition of any of items 1 to 15 further comprising one or more
microbes.
135

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
17. The composition of item 16, wherein the one or more microbes is selected
from the group
consisting of Bacillus subtilis, Bacillus licheniformis, Bacillus
amyloliquefaciens, Bacillus
cereus, Bacillus pumilus, Bacillus polymyxa, Bacillus megaterium, Bacillus
coagulans,
Bacillus circulans, Bifidobacterium bifidum, Bifidobacterium animalis,
Bifidobacterium sp.,
Camobacterium sp., Clostridium butyricum, Clostridium sp., Enterococcus
faecium,
Enterococcus sp., Lactobacillus sp., Lactobacillus acidophilus, Lactobacillus
farciminus,
Lactobacillus rhamnosus, Lactobacillus reuteri, Lactobacillus salivarius,
Lactococcus
lactis, Lactococcus sp., Leuconostoc sp., Megasphaera elsdenii, Megasphaera
sp.,
Pediococsus acidilactici, Pediococcus sp., Propionibacterium thoenii,
Propionibacterium
sp. and Streptococcus sp. or any combination thereof.
18. The composition of any of items 1 to 17 further comprising one or more
components
selected from the list consisting of:
one or more vitamins;
one or more minerals;
one or more amino acids;
one or more phytogenics;
one or more prebiotics;
one or more organic acids; and
one or more other feed ingredients.
19. A granule comprising the composition of any of items 1 to 18.
20. The granule of item 19 wherein the granule is coated.
21. The granule of item 20 wherein the coating comprises a salt and/or wax
and/or a flour.
22. An animal feed additive comprising the composition of any of items 1 to 18
or the granule
of any of items 19 to 21.
23. An animal feed comprising plant based material and the composition of any
of items 1 to
18, the granule of any of items 19 to 21 or the animal feed additive of item
22.
24. The animal feed of item 23, wherein the plant based material is selected
from the group
consisting of legumes, cereals, oats, rye, barley, wheat, maize, corn,
sorghum,
switchgrass, millet, pearl millet, foxtail millet, soybean, wild soybean,
beans, lupin, tepary
bean, scarlet runner bean, slimjim bean, lima bean, French bean, Broad bean
(fava bean),
136

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
chickpea, lentil, peanut, Spanish peanut, canola, rapeseed (oilseed rape),
rice, beet,
cabbage, sugar beet, spinach, quinoa, or pea, in a processed form thereof
(such as
soybean meal, rapeseed meal) or any combination thereof.
25. A pelleted animal feed comprising plant based material and the composition
of any of
items 1 to 18, the granule of any of items 19 to 21 or the animal feed
additive of item 22.
26. The pelleted animal feed of item 25, wherein the plant based material is
selected from the
group consisting of legumes, cereals, oats, rye, barley, wheat, maize, corn,
sorghum,
switchgrass, millet, pearl millet, foxtail millet, soybean, wild soybean,
beans, lupin, tepary
bean, scarlet runner bean, slimjim bean, lima bean, French bean, Broad bean
(fava bean),
chickpea, lentil, peanut, Spanish peanut, canola, rapeseed (oilseed rape),
rice, beet,
cabbage, sugar beet, spinach, quinoa, or pea, in a processed form thereof
(such as
soybean meal, rapeseed meal) or any combination thereof.
27. A liquid formulation comprising the composition of any of items 1 to
18.
28. The liquid formulation of item 27, wherein the LYS polypeptide is dosed
between 0.01% to
25% w/w of liquid formulation, preferably 0.05% to 20% w/w LYS polypeptide,
more
preferably 0.2% to 15% w/w LYS polypeptide, more preferably 0.5% to 15% w/w
LYS
polypeptide or most preferably 1.0% to 10% w/w LYS polypeptide.
29. The liquid formulation of any of items 27 to 28, wherein the formulation
further comprises
20% to 80% w/w of polyol.
30. The liquid formulation of item 29, wherein the polyol is selected from the
group consisting
of glycerol, sorbitol, propylene glycol (MPG), ethylene glycol, diethylene
glycol, triethylene
glycol, 1, 2-propylene glycol or 1, 3-propylene glycol, dipropylene glycol,
polyethylene
glycol (PEG) having an average molecular weight below about 600 and
polypropylene
glycol (PPG) having an average molecular weight below about 600 or any
combination
thereof.
31. The liquid formulation of any of items 27 to 30, wherein the formulation
further comprises
0.01% to 2.0% w/w preservative.
137

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
32. The liquid formulation of item 31, wherein the preservative is selected
from the group
consisting of sodium sorbate, potassium sorbate, sodium benzoate and potassion

benzoate or any combination thereof.
33. The liquid formulation of any of items 27 to 32 further comprising one or
more components
selected from the list consisting of:
one or more enzymes;
one or more microbes;
one or more vitamins;
one or more minerals;
one or more amino acids;
one or more phytogenics;
one or more prebiotics;
one or more organic acids; and
one or more other feed ingredients.
34. A method of preparing an animal feed comprising applying the liquid
formulation of any of
items 27 to 33 onto plant based material.
35. The method of item 34, wherein the liquid formulation is applied via a
spray.
36. The method of any of items 34 to 35, wherein the plant based material is
selected from
the group consisting of legumes, cereals, oats, rye, barley, wheat, maize,
corn, sorghum,
switchgrass, millet, pearl millet, foxtail millet, soybean, wild soybean,
beans, lupin, tepary
bean, scarlet runner bean, slimjim bean, lima bean, French bean, Broad bean
(fava bean),
chickpea, lentil, peanut, Spanish peanut, canola, rapeseed (oilseed rape),
rice, beet,
cabbage, sugar beet, spinach, quinoa, or pea, in a processed form thereof
(such as
soybean meal, rapeseed meal) or any combination thereof.
37. The method of any of items 34 to 36, wherein the plant based material is
in pelleted form.
38. A pelleted animal feed prepared using the method of any of items 34 to
37.
39. A method of improving one or more performance parameters of an animal
comprising
administering to one or more animals the composition of any of items 1 to 18,
the granule
of any of items 19 to 21, the animal feed additive of item 22, the animal feed
of any of
138

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
items 23 to 24, the pelleted animal feed of any of items 25 to 26 or 38 or the
liquid
formulation of any of items 27 to 33.
40. The method of item 39 wherein the performance parameter is selected from
the list
consisting of body weight gain (BWG), European Production Efficiency Factor
(EPEF) and
Feed Conversion Ratio (FCR) or any combination thereof.
41. A method of preparing an animal feed, comprising mixing the composition of
any of items
1 to 18, the granule of any of items 19 to 21, the animal feed additive of
item 22, the
animal feed of any of items 23 to 24, the pelleted animal feed of any of items
25 to 26 or
38 or the liquid formulation of any of items 27 to 33 with plant based
material.
42. The method of item 41, wherein the plant based material is selected from
the group
consisting of legumes, cereals, oats, rye, barley, wheat, maize, corn,
sorghum,
switchgrass, millet, pearl millet, foxtail millet, soybean, wild soybean,
beans, lupin, tepary
bean, scarlet runner bean, slimjim bean, lima bean, French bean, Broad bean
(fava bean),
chickpea, lentil, peanut, Spanish peanut, canola, rapeseed (oilseed rape),
rice, beet,
cabbage, sugar beet, spinach, quinoa, or pea, in a processed form thereof
(such as
soybean meal, rapeseed meal) or any combination thereof.
43. Use of composition of any of items 1 to 18, the granule of any of items 19
to 21, the
animal feed additive of item 22, the animal feed of any of items 23 to 24, the
pelleted
animal feed of any of items 25 to 26 or 38 or the liquid formulation of any of
items 27 to
33:
in animal feed;
in animal feed additives;
in the preparation of a composition for use in animal feed;
for improving the nutritional value of an animal feed;
for increasing digestibility of the animal feed; and/or
for improving one or more performance parameters in an animal.
44. An isolated polypeptide having lysozyme activity, selected from the group
consisting of:
(a) a polypeptide having at least 95%, e.g., at least 96%, at least
97%, at least 98%,
at least 99%, or 100% sequence identity to the polypeptide of SEQ ID NO: 3;
(b) a polypeptide having at least 94%, e.g., at least 95%, at least 96%, at
least 97%,
at least 98%, at least 99%, or 100% sequence identity to the polypeptide of
SEQ
ID NO: 6;
139

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(C) a polypeptide having at least 80%, e.g., at least 85%, at
least 86%, at least 87%,
at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least
93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least
99%,
or 100% sequence identity to the polypeptide of SEQ ID NO: 9;
(d) a polypeptide having at least 80%, e.g., at least 85%, at least 86%, at
least 87%,
at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least
93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least
99%,
or 100% sequence identity to the polypeptide of SEQ ID NO: 12;
(e) a polypeptide having at least 87%, e.g., at least 88%, at least 89%, at
least 90%,
at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least
96%,
at least 97%, at least 98%, at least 99%, or 100% sequence identity to the
polypeptide of SEQ ID NO: 15;
(f) a polypeptide having at least 81%, e.g., at least 85%, at least 86%, at
least 87%,
at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least
93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least
99%,
or 100% sequence identity to the polypeptide of SEQ ID NO: 18;
(g) a polypeptide having at least 80%, e.g., at least 85%, at least 86%, at
least 87%,
at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least
93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least
99%,
or 100% sequence identity to the polypeptide of SEQ ID NO: 21;
(h) a polypeptide having at least 80%, e.g., at least 85%, at least 86%, at
least 87%,
at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least
93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least
99%,
or 100% sequence identity to the polypeptide of SEQ ID NO: 24;
(i) a polypeptide having at least 87%, e.g., at least 88%, at least 89%, at
least 90%,
at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least
96%,
at least 97%, at least 98%, at least 99%, or 100% sequence identity to the
polypeptide of SEQ ID NO: 27;
(j) a polypeptide having at least 96.2%, e.g., at least 97%, at least
97.5%, at least
98%, at least 98.5%, at least 99%, or 100% sequence identity to the
polypeptide
of SEQ ID NO: 30;
(k) a polypeptide having at least 80%, e.g., at least 85%, at least 86%, at
least 87%,
at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least
93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least
99%,
or 100% sequence identity to the polypeptide of SEQ ID NO: 33;
(I) a polypeptide having at least 80%, e.g., at least 85%, at
least 86%, at least 87%,
at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least
93%,
140

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least
99%,
or 100% sequence identity to the polypeptide of SEQ ID NO: 36;
(m) a polypeptide having at least 81%, e.g., at least 85%, at least 86%, at
least 87%,
at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least
93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least
99%,
or 100% sequence identity to the polypeptide of SEQ ID NO: 39;
(n) a polypeptide having at least 80%, e.g., at least 85%, at least 86%, at
least 87%,
at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least
93%,
at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least
99%,
or 100% sequence identity to the polypeptide of SEQ ID NO: 42;
(o) a variant of the polypeptide of SEQ ID NO: 3, wherein the variant has
lysozyme
activity and comprises one or more amino acid substitutions, and/or one or
more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof in 1,2, 3,4, 5,6, 7, 8, 9, 10 or 11 positions;
(p) a variant of the polypeptide of SEQ ID NO: 6, wherein the variant has
lysozyme
activity and comprises one or more amino acid substitutions, and/or one or
more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof in 1,2, 3,4, 5,6, 7, 8, 9, 10, 11, 12 or 13 positions;
(q) a variant of the polypeptide selected from the group
consisting of SEQ ID NO: 9
and SEQ ID NO: 36, wherein the variant has lysozyme activity and comprises
one or more amino acid substitutions, and/or one or more amino acid deletions,

and/or one or more amino acid insertions or any combination thereof in 1, 2,
3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44
positions;
(r) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 12,
SEQ ID NO: 21, SEQ ID NO: 24, SEQ ID NO: 33 and SEQ ID NO: 42, wherein
the variant has lysozyme activity and comprises one or more amino acid
substitutions, and/or one or more amino acid deletions, and/or one or more
amino
acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33,
34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44 or 45 positions;
(s) a variant of the polypeptide selected from the group
consisting of SEQ ID NO: 15
and SEQ ID NO: 27, wherein the variant has lysozyme activity and comprises
one or more amino acid substitutions, and/or one or more amino acid deletions,
and/or one or more amino acid insertions or any combination thereof in 1, 2,
3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27,
28 or 29 positions;
141

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
(t) a variant of the polypeptide selected from the group consisting of SEQ
ID NO: 18
and SEQ ID NO: 39, wherein the variant has lysozyme activity and comprises
one or more amino acid substitutions, and/or one or more amino acid deletions,

and/or one or more amino acid insertions or any combination thereof in 1, 2,
3, 4,
5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,
26, 27,
28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 positions;
(u) a variant of the polypeptide of SEQ ID NO: 30, wherein the variant has
lysozyme
activity and comprises one or more amino acid substitutions, and/or one or
more
amino acid deletions, and/or one or more amino acid insertions or any
combination thereof in 1,2, 3,4, 5,6, 7 or 8 positions;
(v) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o), (p), (q), (r), (s), (t) or (u) and a N-terminal
and/or C-terminal
His-tag and/or HQ-tag;
(w) a polypeptide comprising the polypeptide of (a), (b), (c), (d), (e),
(f), (g), (h), (i), (j),
(k), (I), (m), (n), (o), (p), (q), (r), (s), (t) or (u) and a N-terminal
and/or C-terminal
extension of up to 10 amino acids, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino
acids;
and
(x) a fragment of the polypeptide of (a), (b), (c), (d), (e), (f), (g),
(h), (i), (j), (k), (I), (m),
(n), (o), (p), (q), (r), (s), (t) or (u) having lysozyme activity and having
at least 90%
of the length of the mature polypeptide.
45. The polypeptide according to item 44, wherein the polypeptide comprises or
consists of
amino acids 1 to 316 of SEQ ID NO: 2, amino acids 1 to 316 of SEQ ID NO: 3,
amino
acids 1 to 322 of SEQ ID NO: 4, amino acids 1 to 318 of SEQ ID NO: 6, amino
acids 1 to
318 of SEQ ID NO: 7, amino acids 1 to 326 of SEQ ID NO: 8, amino acids 1 to
316 of
SEQ ID NO: 10, amino acids 1 to 316 of SEQ ID NO: 11, amino acids 1 to 324 of
SEQ ID
NO: 12, amino acids 1 to 316 of SEQ ID NO: 14, amino acids 1 to 316 of SEQ ID
NO: 15,
amino acids 1 to 324 of SEQ ID NO: 16, amino acids 1 to 316 of SEQ ID NO: 18,
amino
acids 1 to 316 of SEQ ID NO: 19, amino acids 1 to 324 of SEQ ID NO: 20, amino
acids 1
to 316 of SEQ ID NO: 22, amino acids 1 to 316 of SEQ ID NO: 23, amino acids 1
to 324 of
SEQ ID NO: 24, amino acids 1 to 516 of SEQ ID NO: 26, amino acids 1 to 516 of
SEQ ID
NO: 27, amino acids 1 to 524 of SEQ ID NO: 28, amino acids 1 to 317 of SEQ ID
NO: 30,
amino acids 1 to 317 of SEQ ID NO: 31, amino acids 1 to 325 of SEQ ID NO: 32,
amino
acids 1 to 316 of SEQ ID NO: 34, amino acids 1 to 316 of SEQ ID NO: 35, amino
acids 1
to 324 of SEQ ID NO: 36, amino acids 1 to 316 of SEQ ID NO: 38, amino acids 1
to 316 of
SEQ ID NO: 39 or amino acids 1 to 324 of SEQ ID NO: 40.
142

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
46. A polynucleotide encoding the polypeptide of any of items 44 to 45.
47. A nucleic acid construct or expression vector comprising the
polynucleotide of item 46
operably linked to one or more control sequences that direct the production of
the
polypeptide in an expression host.
48. A recombinant host cell comprising the polynucleotide of item 46 operably
linked to one or
more control sequences that direct the production of the polypeptide.
49. The recombinant host cell of item 48, wherein the host is a filamentous
fungus, such as
Aspergillus, Trichoderma or Fusarium, or a yeast, such as Pichia or
Saccharomyces.
50. The recombinant host cell of item 49, wherein the host is an AspergiHus,
such as AspergiHus
awamori, Aspergillus foetidus, AspergiHus japonicus, AspergiHus nidulans,
AspergiHus niger or
AspergiHus oryzae.
51. The recombinant host cell of item 49, wherein the host is a Trichoderma,
such as
Trichoderma harzianum, Trichoderma koningil, Trichoderma longibrachiatum,
Trichoderma
reesei or Trichoderma viride.
52. The recombinant host cell of item 48, wherein the host is a Bacillus such
as Bacillus
alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans,
Bacillus clausii,
Bacillus coagulans, Bacillus firmus, Geobacillus stearothermophilus, Bacillus
lautus, Bacillus
lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus,
Bacillus
stearothermophilus, Bacillus subtilis, or Bacillus thuringiensis.
53. A method of producing the polypeptide of any of items 44 to 45,
comprising:
(a) cultivating a cell, which in its wild-type form produces the
polypeptide, under
conditions conductive for production of the polypeptide; and
(b) recovering the polypeptide.
54. A method of producing the polypeptide of any of items 44 to 45,
comprising:
(a) cultivating the recombinant host cell of any of items 48 to 52 under
conditions
conducive for production of the polypeptide; and
(b) recovering the polypeptide.
143

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
55. A transgenic plant, plant part or plant cell transformed with a
polynucleotide encoding the
polypeptide of any of items 44 to 45.
56. A whole broth formulation or cell culture composition comprising a
polypeptide of any of
items 44 to 45.
The present invention is further described by the following examples that
should not be
construed as limiting the scope of the invention.
Examples
Strains
Escherichia coli Top-10 strain purchased from lnvitrogen (Life Technologies,
Carlsbad,
CA, USA) was used to propagate our expression vectors encoding for LYS
polypeptides.
AspergiHus oryzae strain MT3568 was used for heterologous expression of the
LYS
polypeptide encoding sequences. A. oryzae MT3568 is an amdS (acetamidase)
disrupted gene
derivative of AspergiHus oryzae JaL355 (WO 2002/40694) in which pyrG
auxotrophy was
restored by disrupting the A. oryzae acetamidase (amdS) gene with the pyrG
gene.
The fungal strain NN044175 was isolated from soil samples collected from
China, in
1998 by the dilution plate method with PDA medium, pH7, 25C. It was then
purified by
transferring a single conidium onto a PDA agar plate. The strain NN044175 was
identified as
Penicillium simplicissimum, based on both morphological characteristics and
ITS rDNA
sequence.
The fungal strain NN053742 was isolated from a soil sample collected from
Hubei
province, China, in 2011 by the dilution plate method with PDA medium, at pH3,
25C. It was
then purified by transferring a single conidium onto a PDA agar plate. The
strain NN053742 was
identified as Penicillium vasconiae, based on both morphological
characteristics and ITS rDNA
sequence.
The fungal strain NN058285 was isolated from soil samples collected from
Guizhou
Province, China, in 2014 by the dilution plate method with PDA medium pH3. It
was then
purified by transferring a single conidium onto a PDA agar plate. The strain
NN058285 was
identified as Talaromyces proteolyticus, based on both morphological
characteristics and ITS
rDNA sequence.
144

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
The fungal strain NN053333 was isolated from soil samples collected from Hunan

province, China, in 2010 by the dilution plate method with PDA medium, pH7,
25C. It was then
purified by transferring a single conidium onto a PDA agar plate. The strain
NN053333 was
identified as Aspergillus sp. XZ2668, based on both morphological
characteristics and ITS rDNA
sequence.
The fungal strain NN058605 was from CBS with access number as CB5100492. The
strain NN058605 was identified as Penicillium antarcticum, based on both
morphological
characteristics and ITS rDNA sequence.
The fungal strain NN047528 was isolated from soil samples collected from
China, in
1998 by the dilution plate method with YG medium, pH7, 37C. It was then
purified by
transferring a single conidium onto a PDA agar plate. The strain NN047528 was
identified as
Ovatospora brasiliensis, based on both morphological characteristics and ITS
rDNA sequence.
The fungal strain NN054749 was isolated from soil samples collected from
Tibet, China,
in 2012 by the dilution plate method with PDA medium, pH7, 10C. It was then
purified by
transferring a single conidium onto a PDA agar plate. The strain NN054749 was
identified as
Penicillium wellingtonense, based on both morphological characteristics and
ITS rDNA
sequence.
The fungal strain NN054129 was isolated from soil samples collected from
Gotland,
Sweden in 2011 by the dilution plate method with Water agar, 24C. It was then
purified by
transferring a single conidium onto a PDA agar plate. The strain NN054129 was
identified as
Penicillium roseopurpureum, based on both morphological characteristics and
ITS rDNA
sequence.
The fungal strain NN058650 was isolated from soil samples collected from
Guizhou
Province, China, in 2014 by the dilution plate method with PDA medium pH3. It
was then
purified by transferring a single conidium onto a PDA agar plate. The strain
NN058650 was
identified as Penicillium virgatum, based on both morphological
characteristics and ITS rDNA
sequence.
The fungal strain NN046949 was isolated from soil samples collected from
China, in
1998 by the dilution plate method with YG medium, pH7, 37C. It was then
purified by
.. transferring a single conidium onto a PDA agar plate. The strain NN046949
was identified as
Aspergillus niveus, based on both morphological characteristics and ITS rDNA
sequence.
The fungal strain NN057921 was obtained through a collaboration with Professor
Cai Lei
in lnstitude of Microbiology, CAS, in 2014. The strain was collected from
China. It was identified
as Chaetomium sp. ZY369, based on both morphological characteristics and ITS
rDNA
sequence.
The fungal strain NN058427 was isolated from soil samples collected from
Guizhou
Province, China, in 2014 by the dilution plate method with PDA medium pH3,
25C. It was then
145

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
purified by transferring a single conidium onto a PDA agar plate. The strain N
NN058427 was
identified as Talaromyces atricola, based on both morphological
characteristics and ITS rDNA
sequence.
The fungal strain NN053773 was obtained through a collaboration with lnstitude
of
Microbiology, CAS, in 2011. The strain was collected from China and isolated
by the dilution
plate method with PDA medium pH7, 10C. It was then purified by transferring a
single conidium
onto a PDA agar plate. The strain NN053773 was identified as Trichocladium
asperum, based
on both morphological characteristics and ITS rDNA sequence.
The fungal strain NN058086 was isolated from soil samples collected from
Guizhou
Province, China, in 2014 by the dilution plate method with PDA medium pH3,
25C. It was then
purified by transferring a single conidium onto a PDA agar plate. The strain
NN058086 was
identified as Metarhizium carneum, based on both morphological characteristics
and ITS rDNA
sequence.
Strain Thielavia terrestris strain NRRL 8126 was purchased ATCC, and
inoculated onto
a PDA plate and incubated for 7 days at 37 C in the darkness. Mycelia and
spores from the
plate were inoculated into 500 ml shake flasks containing 100 mls of YPG
medium. The flasks
were incubated for 6 days at 37 C with shaking at 150 rpm.
Media and Solutions
DAP4C-1 medium was composed of 0.5g yeast extract, 10g maltose, 20g dextrose,
11g
magnesium sulphate heptahydrate, 1g dipotassium phosphate, 2g citric acid
monohydrate, 5.2g
potassium phosphate tribasic monohydrate, 1mL Dowfax 63N10 (antifoaming
agent), 2.5g
calcium carbonate, supplemented with 1mL KU6 metal solution, and deionised
water to
1000mL.
KU6 metal solution was composed of 6.8g ZnCl2, 2.5g CuSO4.5H20, 0.13 g NiCl2,
13.9g
FeSO4.7H20, 8.45g MnSO4.H20, 3g C6H807.H20, and deionised water to 1000mL.
YP 2% glucose medium was composed of 10g yeast extract, 20g Bacto-peptone, 20g
glucose, and deionised water to 1000mL.
LB plates were composed of 10g of Bacto-tryptone, 5g of yeast extract, 10g of
sodium
chloride, 15g of Bacto-agar, and deionised water to 1000 mL.
LB medium was composed of 10g of Bacto-tryptone, 5g of yeast extract, and 10g
of
sodium chloride, and deionised water to 1000mL.
COVE-Sucrose-T plates were composed of 342g of sucrose, 20g of agar powder,
20mL
of COVE salt solution, and deionised water to 1000mL. The medium was
sterilized by
autoclaving at 15psi for 15 minutes (Bacteriological Analytical Manual, 8th
Edition, Revision A,
1998). The medium was cooled to 60 C and 10mM acetamide, Triton X-100 (50pL/
500mL)
were added.
146

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
COVE-N-Agar tubes were composed of 218g Sorbitol, 10g Dextrose, 2.02g KNO3,
25g
agar, 50mL Cove salt solution, and deionised water up to 1000mL.
COVE salt solution was composed of 26g of MgSO4.7H20, 26g of KCL, 26g of
KH2PO4,
50mL of COVE trace metal solution, and deionised water to 1000mL.
COVE trace metal solution was composed of 0.04g of Na2B407.10H20, 0.4g of
CuSO4.5H20, 1.2g of FeSO4.7H20, 0.7g of MnSO4.H20, 0.8g of Na2Mo04.2H20, 10g
of
ZnSO4.7H20, and deionised water to 1000mL.YPM medium contained 1% of Yeast
extract, 2%
of Peptone and 2% of Maltose.
Example 1: Determination of Lysozyme Activity using reducing ends assay
The LYS polypeptide was diluted in phosphate buffer (5 mM citrate, 5 mM
K2HPO4,
0.01% TritonX-100, pH 5.0) to 50 pg/mL in polypropylene tubes. The diluted LYS
polypeptide
was further diluted in a 96-well polypropylene microtiter plate to a
concentration of 5.0 or 0.7
pg/mL in phosphate buffer (5 mM citrate, 5 mM K2HPO4, 0.01% TritonX-100, pH
5.0). In a
polypropylene deepwell plate 50 pL of the LYS polypeptide dilution was mixed
with 450 pL 1%
Micrococcus lysodeikticus solution (lyophilized Micrococcus lysodeikticus ATCC
No. 4698
(Sigma M3770) in milli-Q water) and incubated at 40 C with shaking (500 rpm)
for 45 min. After
incubation the deepwell plate was centrifuged (4000g, 5 min) to pellet
insoluble material and
100 pL of the supernatant was mixed with 50 pL 3.2M HCI in a 96-well PCR plate
and incubated
at 95 C for 80 min. 50 pL of 3.5 M NaOH was added to each well of the PCR
plate, and 150 pL
of each sample was transferred to a new PCR plate containing 75 pL/well 4-
hydroxybenzhydrazide solution in K-Na tartrate/NaOH buffer (50 g/L K-Na
tartrate + 20 g/L
NaOH). The plate was incubated at 95 C for 10 min before 100 pL/sample was
transferred to a
clear flat-bottomed microtiter plate for optical density (OD) measurement at
405 nm. OD
.. measurements were performed on three times diluted samples (50 pL sample
diluted in100 pL
in Milli-Q water).
Example 2: Determination of Lysozyme Activity using OD drop assay
Freeze-dried Micrococcus lysodeikticus ATCC No. 4698 (Sigma) was washed and
suspended in 60mM KH2PO4 buffer at pH6.0 with final concentration of 1% (w/v)
as substrate
stock. The concentration of the strain was adjusted by adding citric acid-
Na2HPO4 buffer until
0D450 reach approximately 1.
Citric acid-Na2HPO4 pH4 buffer were prepared by adding 61.45m1 0.1M citric
acid and
38.55m1 0.2M Na2HPO4 for pH4. 20 pL enzyme at 50 pg/mL and 200 pL of diluted
bacterial
strain solution in citric acid-Na2HPO4 buffer at pH4 were added to a 96 well
plate, mixed and the
0D450 was read. Then the plate was incubated at 37 C, 300rpm for 1hour and the
0D450 was
147

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
read. The OD difference between the 1 hour time point to the initial read
showed the OD drop
activity for the LYS polypeptide. Blank was set by adding 20u1 MQ water or the
corresponding
buffer, and each sample was measured in triplicate.
.. Example 3: Genomic DNA extraction
Penicillium simplicissimum strain NN044175 was inoculated onto a PDA plate and

incubated for 7 days at 25 C in the darkness. Several mycelia-PDA plugs were
inoculated into
500 ml shake flasks containing 100 ml of YPG medium. The flasks were incubated
for 9 days at
25 C with shaking at 160 rpm.
Penicillium vasconiae strain NN053742 was inoculated onto a PDA plate and
incubated
for 7 days at 25 C in the darkness. Several mycelia-PDA plugs were inoculated
into 500 ml
shake flasks containing 100 ml of YPG medium. The flasks were incubated for 3
days at 25 C
with shaking at 160 rpm.
Talaromyces proteolyticus strain NN058285 was inoculated onto a PDA plate and
.. incubated for 7 days at 25 C in the darkness. Several mycelia-PDA plugs
were inoculated into
500 ml shake flasks containing 100 ml of YPG medium. The flasks were incubated
for 4 days at
C with shaking at 160 rpm.
AspergiHus sp. strain NN053333 was inoculated onto a PDA plate and incubated
for 7
days at 25 C in the darkness. Several mycelia-PDA plugs were inoculated into
500 ml shake
20 .. flasks containing 100 ml of YPG medium. The flasks were incubated for 5
days at 25 C with
shaking at 160 rpm.
Penicillium antarcticum strain NN058605 was inoculated onto a PDA plate and
incubated for 7 days at 25 C in the darkness. Several mycelia-PDA plugs were
inoculated into
500 ml shake flasks containing 100 ml of YPG medium. The flasks were incubated
for 4 days at
25 25 C with shaking at 160 rpm.
Ovatospora brasiliensis strain NN047528 was inoculated onto a PDA plate and
incubated for 7 days at 37 C in the darkness. Several mycelia-PDA plugs were
inoculated into
500 ml shake flasks containing 100 ml of YPG medium. The flasks were incubated
for 2 days at
37 C with shaking at 160 rpm.
Penicillium weHingtonense strain NN054749 was inoculated onto a PDA plate and
incubated for 7 days at 25 C in the darkness. Several mycelia-PDA plugs were
inoculated into
500 ml shake flasks containing 100 ml of YPG medium. The flasks were incubated
for 11 days
at 25 C with shaking at 160 rpm.
Penicillium roseopurpureum strain NN054129 was inoculated onto a PDA plate and
.. incubated for 7 days at 25 C in the darkness. Several mycelia-PDA plugs
were inoculated into
500 ml shake flasks containing 100 ml of YPG medium. The flasks were incubated
for 4 days at
25 C with shaking at 160 rpm.
148

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
PeniciHium virgatum strain NN058650 was inoculated onto a PDA plate and
incubated
for 7 days at 25 C in the darkness. Several mycelia-PDA plugs were inoculated
into 500 ml
shake flasks containing 100 ml of YPG medium. The flasks were incubated for 4
days at 25 C
with shaking at 160 rpm.
AspergiHus niveus strain NN046949 was inoculated onto a PDA plate and
incubated for
7 days at 25 C in the darkness. Several mycelia-PDA plugs were inoculated into
500 ml shake
flasks containing 100 ml of YPG medium. The flasks were incubated for 3 days
at 25 C with
shaking at 160 rpm.
Chaetomium sp. strain NN057921 were inoculated onto a PDA plate and incubated
for 7
days at 37 C in the darkness. Several mycelia-PDA plugs were inoculated into
500 ml shake
flasks containing 100 ml of YPG medium. The flasks were incubated for 8 days
at 37 C with
shaking at 160 rpm.
The mycelia of Penicillium antarcticum strain NN058605 were collected by
filtration
through MIRACLOTHO (Calbiochem, La Jolla, CA, USA) and frozen under liquid
nitrogen.
Frozen mycelia were ground, by a mortar and a pestle, to a fine powder, and
genomic DNA was
isolated using MP Fast DNA spin kit for soil (MP Biomedicals, Santa Ana,
California, USA)
following the manufacturer's instruction.
Talaromyces atricola strain NN058427 was inoculated onto a PDA plate and
incubated
for 7 days at 25 C in the darkness. Several mycelia-PDA plugs were inoculated
into 500 ml
shake flasks containing 100 ml of YPG medium. The flasks were incubated for 3
days at 25 C
with shaking at 160 rpm.
Trichocladium asperum strain NN053773 was inoculated onto a PDA plate and
incubated for 7 days at 15 C in the darkness. Several mycelia-PDA plugs were
inoculated into
500 ml shake flasks containing 100 ml of YPG medium. The flasks were incubated
for 4 days at
15 C with shaking at 160 rpm.
Metarhizium carneum strain NN058086 was inoculated onto a PDA plate and
incubated
for 7 days at 25 C in the darkness. Several mycelia-PDA plugs were inoculated
into 500 ml
shake flasks containing 100 ml of YPG medium. The flasks were incubated for 4
days at 25 C
with shaking at 160 rpm.
The mycelia of Thielavia terrestris were collected by filtration through
MIRACLOTHO
(Calbiochem, La Jolla, CA, USA) and frozen under liquid nitrogen. Frozen
mycelia were ground,
by a mortar and a pestle, to a fine powder, and genomic DNA was isolated using
DNeasy
Plant Maxi Kit (24) (QIAGEN GmbH, Hi!den, Germany) following the
manufacturer's
instructions.
The mycelia of all the other strains were collected by filtration through
MIRACLOTHO
and frozen under liquid nitrogen. Frozen mycelia were ground, by a mortar and
a pestle, to a
149

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
fine powder, and genomic DNA was isolated using DNeasy Plant Maxi Kit (24)
(QIAGEN
GmbH, Hi!den, Germany) following the manufacturer's instruction.
Example 4: Genome sequencing, assembly and annotation
The extracted genomic DNA samples of Peniciffium simplicissimum strain
NN044175
were delivered to Exiqon A/S (Denmark) for genome sequencing using an
ILLUMINAO MiSeq
System (IIlumina, Inc., San Diego, CA, USA). The raw reads were assembled at
Novozymes
Denmark using program ldba (Peng, Yu et al., 2010, Research in Computational
Molecular
Biology, 6044:426-440. Springer Berlin Heidelberg).
The extracted genomic DNA samples of Talaromyces proteolyticus strain
NN058285,
Penicillium antarcticum strain NN058605, Penicillium roseopurpureum strain
NN054129,
Penicillium virgatum strain NN058650, AspergiHus niveus strain NN046949,
Metarhizium
cameum strain NN058086 were delivered to Exiqon A/S for genome sequencing
using an
ILLUMINAO MiSeq System. The raw reads were assembled at Novozymes Denmark
using
program Spades (Anton Bankevich et al., 2012, Journal of Computational
Biology, 19(5): 455-
477).
The extracted genomic DNA samples of Penicillium vasconiae strain NN053742,
Ovatospora brasiliensis strain NN047528, Trichocladium asperum strain NN053773
were
delivered to Fastens (Switzerland) for genome sequencing using an ILLUMINAO
HiSeq 2000
System (IIlumina, Inc., San Diego, CA, USA). The raw reads were assembled at
Novozymes
Denmark using program ldba.
The extracted genomic DNA samples of AspergiHus sp. strain NN053333,
Chaetomium
sp. strain NN057921 and Talaromyces atricola strain NN058427 were delivered to
Novozymes
Davis (USA) for genome sequencing using an ILLUMINAO MiSeq System. The raw
reads were
assembled at Novozymes Denmark using program Spades.
The extracted genomic DNA samples of Penicillium weHingtonense strain NN054749
were delivered to Novozymes Davis for genome sequencing using an ILLUMINAO
MiSeq
System. The raw reads were assembled at Novozymes Denmark using program ldba.
The assembled sequences were analyzed using standard bioinformatics methods
for
gene identification and function prediction. GeneMark-ES fungal version (Ter-
Hovhannisyan V
et al., 2008, Genome Research 18(12): 1979-1990) was used for gene prediction.
Blastall
version 2.2.10 (Altschul et al., 1990, Journal of Molecular Biology. 215(3):
403-410,
ftp://ftp.ncbi.nlm.nih.gov/blast/executables/release/2.2.10/) and HMMER
version 2.1.1 (National
Center for Biotechnology Information (NCB!), Bethesda, MD, USA) were used to
predict function
based on structural homology. The NZ5 family was identified directly by
analysis of the Blast
results. The Agene program (Munch and Krogh, 2006, BMC Bioinformatics 7: 263)
and SignalP
program (Nielsen et al., 1997, Protein Engineering 10: 1-6) were used to
identify start codons.
150

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
SignalP program was further used to predict signal peptides. Pepstats (Rice et
al., 2000, Trends
in Genetics. 16(6): 276-277) was used to predict isoelectric points and
molecular weights.
Example 5: Cloning, expression and fermentation of fungal NZ5 genes (SEQ ID
NO: 1, 4,
7,10, 13, 16, 19, 22, 25, 28, 31, 34, 37 and 40)
Fourteen fungal LYS wild type genes, LYS_Pesi (SEQ ID NO:1), LYS_Pv (SEQ ID
NO:4), LYS_Tapr (SEQ ID NO:7), LYS_Asp2668 (SEQ ID NO:10), LYS_Pean (SEQ ID
NO:13),
LYS_chbr (SEQ ID NO:16), LYS_Pewe (SEQ ID NO:19), LYS_Pr (SEQ ID NO:22),
LYS_Pevir
(SEQ ID NO:25), LYS_asni (SEQ ID NO:28), LYS_ch369 (SEQ ID NO: 31), LYS_Taat
(SEQ ID
NO:34), LYS_Tras (SEQ ID NO: 37), LYS_Meca2 (SEQ ID NO:40) were cloned from
Penicillium
simplicissimum strain NN044175, Penicillium vasconiae strain NN053742,
Talaromyces
proteolyticus strain NN058285, Aspergillus sp. strain NN053333, Penicillium
antarcticum strain
NN058605, Ovatospora brasiliensis strain NN047528, PeniciHium weHingtonense
strain
NN054749, PeniciHium roseopurpureum strain NN054129, PeniciHium virgatum
strain
NN058650, AspergiHus niveus strain NN046949, Chaetomium sp. strain NN057921,
Talaromyces atricola strain NN058427, Trichocladium asperum strain NN053773,
Metarhizium
cameum strain NN058086 respectively.
The fungal LYS genes were cloned into an Aspergillus oryzae expression vector
pCaHj505 as described in W02013029496. The transcription of the LYS coding
sequence with
the native secretion signal was under the control of an AspergiHus oryzae
alpha-amylase gene
promoter.
The final expression plasmids, p505-LYS_Pesi, p505-LYS_Pv, p505-LYS_Tapr, p505-

LYS_Asp2668, p505-LYS_Pean, p505-LYS_chbr, p505-LYS_Pewe, p505-LYS_Pr, p505-
LYS_Pevir, p505-LYS_asni, p505-LYS_ch369, p505-LYS_Taat, p505-LYS_Tras and
p505-
LYS_Meca2, were individually transformed into an Aspergillus oryzae expression
host. The LYS
genes were integrated by homologous recombination into the Aspergillus oryzae
host genome
upon transformation. Four transformants of each transformation were selected
from the
selective media agar plate and inoculated to 3 ml of YPM or Dap4C medium in 24-
well plate and
incubated at 30 C, 150 rpm. After 3 days incubation, 20 pl of supernatant from
each
transformant were analyzed on NuPAGE Novex 4-12% Bis-Tris Gel w/MES according
to the
manufacturer's instructions. The resulting gel was stained with Instant Blue.
SDS-PAGE profiles
of the cultures showed that all genes were expressed with 1 protein band
detected at
approximately 28 kDa, 25 kDa, 25 kDa, 35 kDa, 25 kDa, 25 kDa, 25 kDa, 25 kDa,
25 kDa, 25
kDa, 25 kDa, 25kDa, 25kDa, 30kDa. The recombinant Aspergillus oryzae strains
with the
strongest protein band were selected for shaking flask culturing. The
recombinant strains were
inoculated on slant made of slant medium and incubated at 37C for 6-7 days.
When strains
were well grown to fully sporulated, they were inoculated to 2L shaking flasks
each containing
151

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
400m1 of YPM or DAP4C, 5-6 flasks for each strain. Flasks were shaking at
80rpm, 300.
Cultures were harvested on day 3 or day 4 and filtered using a 0.22 pm
DURAPORE Membrane
and were purified as described in example 9.
Example 6: Construction of the improved split-marker Aspergillus oryzae host
An improved AspergiHus oryzae host/vector system comparable to the one
described in
example 5 disclosed in WO 2016026938A1 was constructed. The improvement was
made to
reduce the size of the transforming DNA by moving the FLPase expression
cassette located on
PART-II of the plasmid pDAu724 (see page 34 in W02016/026938, figure 7 and SEQ
ID NO:30)
to the integration locus amy2 in the genome of the host strain. The cloning of
the FLPase
expression cassette into pDAu703 (W02016/026938 page 32 and Figure 6 and SEQ
ID:29) in
done by amplification of the FLPase expression cassette from pDAu724 and
cloning in between
FRT-F3 and the amdS selection marker of pDAu703 to give the plasmid pDAu770
(figure 1,
SEQ ID NO: 320). The same protocol as described in W02016/026938 page 33 was
used to
transform the linearized plasmid pDAu770 into protoplasts of A. oryzae strain
Ja11338
(disclosed in W02012/160097). Transformants were selected on AmdS selection
plates to
obtain strain DAu785. The resulting recombinant host strain DAu785 has a
modified amy2 locus
comparable to the one in DAU716 (W02016/026938) with the addition of the
FLPase
expression cassette (Figure 2, top panel). The host strain DAu785 is now
constitutively
expressing the FLPase site specific recombinase allowing the integration at
the FRT sites of the
transforming DNA in this case the PCR fragments obtained by Overlap Extension
PCR reaction
(Figure 2, middle and bottom panels) and described in Example 7.
Example 7: Overlap Extension PCR Cloning (SEQ ID NO: 43)
A PCR amplification of SEQ ID NO: 43 encoding the LYS polypeptide was carried
out
using Phusion High-Fidelity DNA polymerase (New England Biolabs, BioNordika
Denmark A/S,
Herlev, Denmark) in a 50pL volume reaction and the primers disclosed in table
2.
Table 2: PCR primers
Primer SEQ
Primer* Sequence
ID NO:
KK500972-F 321 5'-CTATATACACAACTGGGGATCCACC
ATGCAGCTCTCCCTCCTCGT
KK500972-R 322 5'-TAGAGTCGACCCAGCCGCGCCGGCCA
TTACAACCCACCAGCCTGGC
*-F ¨ forward primer; -R ¨ reverse primer; Bold letters represent coding
sequence.
152

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
The PCR reaction mix consisted of 10pL Phusion reaction buffer HF (5x); 1pL of
PCR
nucleotide Mix (10mM); 2pL forward cloning primers (2.5mM); 2pL reverse
cloning primers
(2.5mM); 1pL Phusion High-Fidelity DNA Polymerase #M0530L (2000U/mL); and PCR
grade
water up to 50pL. PCR reaction was incubated on a thermocycler T100 (Biorad,
Hercules,
California, USA) using the following program: initial denaturation of 2min at
98 C followed by 30
cycles of 10sec at 98 C, 2min at 72 C and ending up by a final elongation of
10min at 72 C.
The PCR amplicon was purified using AM Pure XP beads system kit (Agencourt,
Beverly,
Massachusetts, USA) adapted on a Biomek FXp Liquid handler (Beckman Coulter,
Brea,
California, USA).
pDAu724 plasmid was used as DNA template to amplify two PCR products (F1 and
F3)
in reactions composed of 10pL of KAPA polymerase buffer 5x, 1pL 10mM KAPA PCR
Nucleotide Mix, 1pL of 10pM of the appropriate forward primers (SEQ ID NO: 323
for F1 and
SEQ ID NO: 325 for F3, table 3), 1pL of 10pM of the appropriate reverse
primers (SEQ ID NO:
324 for F1 and SEQ ID NO: 326 for F3, table 3), 1 to 1Ong of pDAu724 plasmid,
1pL of KAPA
Biosystems polymerase KK2502 (1unit) and PCR-grade water up to 50pL.
PCR amplification reactions were carried out on a DYAD Dual-Block Thermal
Cycler
(MJ Research Inc., Waltham, MA, USA) programmed for 2min. at 98 C and followed
by 35
cycles of lOsec. at 98 C and 2min. at 72 C and one final cycle of 10min. at 72
C.
Five pl of the PCR reaction were analyzed by 1% agarose gel electrophoresis
using TAE
buffer where DNA bands of the appropriate size were observed. The remaining
PCR reactions
were purified using an ILLUSTRATm GFXTM PCR DNA and Gel Band Purification Kit
according
to the manufacturer's instructions.
Table 3: PCR primers
Primer SEQ
Primer Sequence
ID NO:
Forward 323 GAATTCGAGCTCGGTACCTTGAAGTTC
primer F1
Reverse 324 GGTGGATCCCCAGTTGTGTATATAGAGGATT
primer F1
Forward 325 TGCGCGGCGCGGCTGGGTCGACTCTA
primer F3
Reverse 326 TTCACACAGGAAACAGCTATGACCATG
primer F3
153

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Overlap Extension PCR reaction for cloning the LYS polypeptide gene amplified
from
Thielavia terrestris gDNA was composed of 10pL KAPA polymerase buffer (5X),
1pL 10mM
KAPA PCR Nucleotide Mix, 50ng of PCR fragment F1 and equimolar amounts of PCR
fragment
F3 and LYS polypeptide gene encoding for SEQ ID NO: 45, 1p1 KAPA Biosystems
polymerase
KK2502 (1unit) and PCR-grade water up to 48pL. Reaction was incubated on a
DYAD Dual-
Block Thermal Cycler (MJ Research Inc., Waltham, MA, USA) using a program
composed of
2min. at 98 C; followed by 5 cycles each composed of 10sec. at 98 C, 305ec. at
68 C, and
5min. at 72 C and completed by a final extension of 8min. at 72 C.
During the OE PCR reaction, annealing between fragment F1 and the LYS
polypeptide
gene encoding for SEQ ID NO: 45 was ensured by the overlap in SEQ ID NO: 327
included in
the forward cloning primer (KK500972-F) and annealing between fragment F3 and
the LYS
polypeptide gene encoding for SEQ ID NO: 45 was ensured by the overlapping SEQ
ID NO:
328 included in the reverse cloning primer (KK5C0972-R).
One pL of 10mM primer SEQ1 and 1pL of 10mM primer SEQ4 were added to the OE
PCR reaction and the reaction was incubated a second time on a DYAD Dual-
Block Thermal
Cycler (MJ Research Inc., Waltham, MA, USA) using a program composed of 2min
at 98 C;
followed by 25 cycles each composed of 10 sec. at 98 C, and 4 min. at 72 C and
completed by
a final extension of 10min. at 72 C.
Five pl of the PCR reaction was analysed by 1% agarose gel electrophoresis
using TAE
buffer where an DNA band of the appropriate size was observed. The remaining
PCR reaction
was up-concentrated to 20pL by heating the tube at 60 C. 10pL of this reaction
was used for
Aspergillus oryzae DAu785 protoplasts transformation.
Primer bind forward SEQ ID NO: 327: CTATATACACAACTGGGGATCCACC
Primer bind reverse SEQ ID NO: 328: TAGAGTCGACCCAGCCGCGCCGGCCA
Example 8: Preparation of Aspergillus protoplasts
Protoplasts of Aspergillus oryzae MT3568 were prepared according to WO
95/002043.
One hundred pl of protoplasts were mixed with OE PCR fragment KK5C0972 and
250pL of
60% PEG 4000 (Applichem, Darmstadt, Germany) (polyethylene glycol, molecular
weight
4,000), 10mM CaCl2, and 10mM Tris-HCI pH 7.5 and gently mixed. The mixtures
were
incubated at 37 C for 30 minutes and the protoplasts were spread onto COVE
plates for
selection. After incubation for 4-7 days at 37 C spores of four transformants
were inoculated
into 0.2mL of YP + 2% glucose or DAP4C-1 medium in 96 well microtiter plates.
After 4 days
cultivation at 30 C, the culture broths were analysed by SDS-PAGE to identify
transformants
producing the highest amounts of LYS polypeptide.
154

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Spores of the best transformant from the transformation were spread onto COVE
plates
containing 0.01% TRITON X-100 in order to isolate single colonies. The
spreading was
repeated twice in total on COVE plates containing 10mM sodium nitrate. Spores
were then
inoculated into 500mL shake flasks containing 100mL of YP + 2% glucose and
incubated for 4
days at 30 C with shaking at 100 rpm. Culture broths were harvested by
filtration using a 0.2pm
filter device and purified as described in Example 9.
Example 9: Purification of LYS polypeptides
Activity detection for purification procedure
Freeze-dried bacterial strains Micrococcus lysodeikticus ATCC No. 4698 (Sigma)
and
Exiguobacterium sp. (isolated from soil) were separately washed and suspended
in 60mM
KH2PO4 buffer at pH6.0 with final concentration of 1% (w/v) as substrate
stock. Before activity
detection, the concentration of substrate was diluted into 0.035% which
correlates to 0D450
about 0.7 by 60mM KH2PO4 buffer at pH6.0 or pH 4Ø 10u1 of polypeptide sample
(or 5u1 of
sample with 5 ul of MQ water if containing high concentration of salt) and
190u1 of 0.035%
substrate were added into 96-well plate, and then read 0D450. The plate was
incubated for 30
or 60 minutes, 300rpm at room temperature or 37 C in the thermomixer. The
plate was shaked
10 seconds and read 0D450 again. The OD drop showed lysozyme activity. Blank
is added 10
pl of 60 mM KH2PO4 at pH 6.0 or pH4.0 buffer, and each sample was measured in
duplicate if
necessary.
Purification of SEQ ID NO: 3
The culture supernatant was firstly precipitated with ammonium sulfate (80%
saturation),
then dialyzed with 20mM NaAc at pH4.5. The solution was filtered with 0.45um
filter and then
loaded into SP Fast Flow column (GE Healthcare) equilibrated with 20mM NaAc at
pH4.5. A
gradient increase of NaCI concentration was applied as elution buffer from
zero to 1M, and then
the elution fractions and flow-through fraction were collected to detect
lysozyme activity. The
fractions with lysozyme activity were analyzed by SDS-PAGE, and then
concentrated for further
evaluation. The protein concentration was determined by Qubit0 Protein Assay
Kit (Invitrogen,
cat Q33212).
Purification of SEQ ID NO: 6
The culture supernatant was firstly precipitated with ammonium sulfate (80%
saturation),
then the precipitation was added water to adjust conductance to about
140m5/cm. The solution
was filtered with 0.45um filter and then loaded into HIC High Performance
column (GE
155

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Healthcare) equilibrated with 20mM PBS at pH8.0 with 1.2M (NH4)2SO4 added. A
gradient
decrease of (NH4)2504 concentration was applied as elution buffer from 1.2M to
zero, and then
elution fractions and flow-through fraction were collected to detect lysozyme
activity.
The flow-through and Fractions from 1 to 15 were collected and conductance was
.. adjusted to 180mS/cm, then reloaded into HIC column equilibrated with 20mM
PBS at pH8.0
with 1.8M (NH4)2504 added. A gradient decrease of (NH4)2504 concentration was
applied as
elution buffer from 1.8M to zero, and then elution fractions and flow-through
fraction were
collected to detect lysozyme activity. The fractions with lysozyme activity
were analyzed by
SDS-PAGE, pooled together, and diafiltrated with 20mM PBS at pH6Ø The
protein
concentration was determined by Qubit0 Protein Assay Kit (Invitrogen, cat
Q33212).
Purification of SEQ ID NO: 9
The culture supernatant was firstly precipitated with ammonium sulfate (80%
saturation),
then the precipitation was added water to adjust conductance to about
170mS/cm. The solution
was filtered with 0.45um filter and then loaded into HIC High Performance
column (GE
Healthcare) equilibrated with 20mM PBS at pH7.0 with 1.5M (NH4)2504 added. A
gradient
decrease of (NH4)2504 concentration was applied as elution buffer from 1.5M to
zero, and then
elution fractions and flow-through fraction were collected to detect lysozyme
activity. The
fractions with lysozyme activity were analyzed by SDS-PAGE, pooled together,
and diafiltrated
with 20mM PBS at pH6Ø The protein concentration was determined by Qubit0
Protein Assay
Kit (Invitrogen, cat Q33212).
Purification of SEQ ID NO: 12
The culture supernatant was firstly precipitated with ammonium sulfate (80%
saturation),
then the precipitation was added water to adjust conductance to about
185m5/cm. The solution
was filtered with 0.45um filter and then loaded into HIC High Performance
column (GE
Healthcare) equilibrated with 20mM PBS at pH6.0 with 1.8M (NH4)2504 added. A
gradient
decrease of (NH4)2504 concentration was applied as elution buffer from 1.8M to
zero, and then
elution fractions and flow-through fraction were collected to detect lysozyme
activity. The
fractions with lysozyme activity were analyzed by SDS-PAGE, pooled together,
and diafiltrated
with 20mM Bis-Tris at pH6Ø
The sample was loaded into a Mono Q column (GE Healthcare) equilibrated with
20mM
Bis-Tris at pH6Ø A gradient increase of NaCI concentration was applied as
elution buffer from
zero to 1M, and then the elution fractions and flow-through fraction were
collected to detect
lysozyme activity. The fractions with lysozyme activity were analyzed by SDS-
PAGE, and then
156

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
concentrated for further evaluation. The protein concentration was determined
by Qubit0
Protein Assay Kit (Invitrogen, cat Q33212).
Purification of SEQ ID NO: 15
The culture supernatant was firstly precipitated with ammonium sulfate (80%
saturation),
then the precipitation was added water to adjust conductance to about
170m5/cm. The solution
was filtered with 0.45um filter and then loaded into Phenyl Fast Flow column
(GE Healthcare)
equilibrated with 20mM PBS at pH6.0 with 1.5M (NH4)2504 added. A gradient
decrease of
(NH4)2504 concentration was applied as elution buffer from 1.5M to zero, and
then elution
fractions and flow-through fraction were collected to detect lysozyme
activity.
The flow-through and Fractions with lysozyme activity were collected and
conductance
was adjusted to 190m5/cm, then reloaded into HIC column equilibrated with 20mM
PBS at
pH6.0 with 1.5M (NH4)2504 added again. A gradient decrease of (NH4)2504
concentration was
applied as elution buffer from 1.5M to zero, and then elution fractions and
flow-through fraction
were collected to detect lysozyme activity. The fractions with lysozyme
activity were analyzed by
SDS-PAGE, pooled together, and diafiltrated with 20mM PBS at pH6Ø The
protein
concentration was determined by Qubit0 Protein Assay Kit (Invitrogen, cat
Q33212).
Purification of SEQ ID NO: 18
The culture supernatant from the expression of LYS_chbr (SEQ ID NO:16) was
firstly
precipitated with ammonium sulfate (80% saturation), then the precipitation
was added water to
adjust conductance to about 170m5/cm. The solution was filtered with 0.45um
filter and then
loaded into Phenyl Sepharose High Performance column (GE Healthcare)
equilibrated with
20mM PBS at pH6.0 with 1.8M (NH4)2504 added. A gradient decrease of (NH4)2504
concentration was applied as elution buffer from 1.8M to zero, and then
elution fractions and
flow-through fraction were collected to detect lysozyme activity. The
fractions with lysozyme
activity were analyzed by SDS-PAGE, and fractions were pooled together, and
diafiltrated with
20mM PBS at pH6Ø The protein concentration was determined by Qubit0 Protein
Assay Kit
(Invitrogen, cat Q33212).
Analysis by intact molecular weight (MAXIS ll electrospray mass spectrometer
(Bruker
Daltonik GmbH, Bremen, DE)) showed that the major product corresponded to
amino acids 1 to
230 of SEQ ID NO: 18 (detected mass 24128.35Da, predicted mass 24128.21Da)
with a minor
product corresponded to amino acids 4 to 230 of SEQ ID NO: 18 (detected mass
23768.79Da,
predicted mass 23768.16Da).
157

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Purification of SEQ ID NO: 329
The culture supernatant from the expression of LYS_chbr (SEQ ID NO:16) was
firstly
precipitated with ammonium sulfate (80% saturation), then dialyzed with 20mM
PBS at pH6.5.
The solution was filtered with 0.45um filter and then loaded into Capto SP
column (GE
Healthcare) equilibrated with 20mM PBS at pH6.5. A gradient increase of NaCI
concentration
was applied as elution buffer from zero to 1M, and then the elution fractions
and flow-through
fraction were collected to detect lysozyme activity. The fractions with
lysozyme activity were
analyzed by SDS-PAGE, and then concentrated for further evaluation. The
protein
concentration was determined by Qubit0 Protein Assay Kit (Invitrogen, cat
Q33212).
Analysis by N-terminal sequencing (Applied Biosystems Precise Amino Acid
Sequencer
Model 494) and intact molecular weight (MAXIS ll electrospray mass
spectrometer (Bruker
Daltonik GmbH, Bremen, DE)) showed that the N-terminal LED domain had been
cleaved off
leaving the LAD catalytic domain and that the molecule had a heterogeneous N-
terminal (see
table 4). The major product corresponded to residues 85-230 which is disclosed
as SEQ ID
NO: 329.
Table 4: N-terminal and intact molecular weigh determination
Applied Biosystems Intact Molecular Weight
ID
N-terminal sequence Residues of M.Wt Calculated M.Wt. Observed
SEQ ID NO: 18
GNLPGLN 88-230 15167.31 Da 15167.92 Da
OK
GKGNLPG 86-230 15352.54 Da 15353.04 Da
OK
GGKGNLP 85-230 15409.59 Da 15410.06 Da
OK
Purification of SEQ ID NO: 21
The culture supernatant was firstly precipitated with ammonium sulfate (80%
saturation),
then the precipitation was added water to adjust conductance to about
140m5/cm. The solution
was filtered with 0.45um filter and then loaded into Phenyl Fast Flow column
(GE Healthcare)
equilibrated with 20mM NaAc at pH4.5 with 2M NaCI added. A gradient decrease
of NaCI
concentration was applied as elution buffer from 2M to zero, and then elution
fractions and flow-
through fraction were collected to detect lysozyme activity.
The flow-through and Fractions with lysozyme activity were collected and
conductance
was adjusted to 180m5/cm, then reloaded into HIC column equilibrated with 20mM
NaAc at
pH4.5 with 4M NaCI added again. A gradient decrease of NaCI concentration was
applied as
elution buffer from 4M to zero, and then elution fractions and flow-through
fraction were
collected to detect lysozyme activity. The fractions with lysozyme activity
and unbound sample
158

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
were analyzed by SDS-PAGE, pooled together, and concentrated. The protein
concentration
was determined by Qubit0 Protein Assay Kit (Invitrogen, cat Q33212).
Purification of SEQ ID NO: 24
The culture supernatant was firstly precipitated with ammonium sulfate (80%
saturation),
then the precipitation was added water to adjust conductance to about
170m5/cm. The solution
was filtered with 0.45um filter and then loaded into HIC High Performance
column (GE
Healthcare) equilibrated with 20mM PBS at pH6.0 with 4M NaCI added. A gradient
decrease of
NaCI concentration was applied as elution buffer from 4M to zero, and then
elution fractions and
flow-through fraction were collected to detect lysozyme activity.
The flow-through and unbound sample with lysozyme activity were collected and
conductance was adjusted to 190m5/cm, then reloaded into HIC column
equilibrated with
20mM PBS at pH6.0 with 1.8M (NH4)2504 added again. A gradient decrease of
(NH4)2504
concentration was applied as elution buffer from 1.8M to zero, and then
elution fractions and
flow-through fraction were collected to detect lysozyme activity. The
fractions with lysozyme
activity were analyzed by SDS-PAGE, pooled together, and diafiltrated with
20mM PBS at
pH6Ø The protein concentration was determined by Qubit0 Protein Assay Kit
(Invitrogen, cat
Q33212).
Purification of SEQ ID NO: 27
The culture supernatant was firstly precipitated with ammonium sulfate (80%
saturation),
then dialyzed with 20mM NaAc at pH5.5. The solution was filtered with 0.45um
filter and then
loaded into Capto SP column (GE Healthcare) equilibrated with 20mM NaAc at
pH5.5. A
gradient increase of NaCI concentration was applied as elution buffer from
zero to 1M, and then
the elution fractions and flow-through fraction were collected to detect
lysozyme activity. The
fractions with lysozyme activity were analyzed by SDS-PAGE. The fractions with
lysozyme
activity were pooled and concentrated, but degradation of sample was found.
The conductance of sample was adjusted to 200m5/cm, then reloaded into Phenyl
High
Performance column equilibrated with 20mM PBS at pH6.0 with 2.0M (NH4)2504
added again.
A gradient decrease of (NH4)2504 concentration was applied as elution buffer
from 2.0M to
zero, and then elution fractions and flow-through fraction were collected to
detect lysozyme
activity. The fractions with lysozyme activity were analyzed by SDS-PAGE,
pooled together, and
diafiltrated with 20mM PBS at pH6Ø The protein concentration was determined
by Qubit0
Protein Assay Kit (Invitrogen, cat Q33212).
159

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Purification of SEQ ID NO: 30
The culture supernatant was firstly precipitated with ammonium sulfate (80%
saturation),
then dialyzed with 20mM NaAc at pH4.5. The solution was filtered with 0.45um
filter and then
loaded into Capto SP column (GE Healthcare) equilibrated with 20mM NaAc at
pH4.5. A
.. gradient increase of NaCI concentration was applied as elution buffer from
zero to 1M, and then
the elution fractions and flow-through fraction were collected to detect
lysozyme activity. The
fractions with lysozyme activity were analyzed by SDS-PAGE, and then
concentrated for further
evaluation. The protein concentration was determined by Qubit0 Protein Assay
Kit (Invitrogen,
cat Q33212).
Purification of SEQ ID NO: 33
The culture supernatant of 033X73 was firstly precipitated with ammonium
sulfate (80%
saturation), then dialyzed with 20mM NaAc at pH4.5. The solution was filtered
with 0.45um filter
and then loaded into Capto SP column (GE Healthcare) equilibrated with 20mM
NaAc at pH4.5.
.. A gradient increase of NaCI concentration was applied as elution buffer
from zero to 1M, and
then the elution fractions and flow-through fraction were collected to detect
lysozyme activity.
The fractions with lysozyme activity were analyzed by SDS-PAGE, and then
concentrated for
further evaluation. The protein concentration was determined by Qubit0 Protein
Assay Kit
(Invitrogen, cat Q33212).
Purification of SEQ ID NO: 36
The culture supernatant was firstly precipitated with ammonium sulfate (80%
saturation),
then dialyzed with 20mM PBS at pH7Ø The solution was filtered with 0.45um
filter and then
loaded into Capto Q column (GE Healthcare) equilibrated with 20mM PBS at
pH7Ø A gradient
.. increase of NaCI concentration was applied as elution buffer from zero to
1M, and then the
elution fractions and flow-through fraction were collected to detect lysozyme
activity. The
fractions with lysozyme activity were analyzed by SDS-PAGE. The flow-through
fraction with
lysozyme activity was picked up for further purification.
The pH of flow-through fraction was adjusted to pH4.5, then reloaded into
Capto SP
column equilibrated with 20mM NaAC at pH4.5. A gradient increase of NaCI
concentration was
applied as elution buffer from zero to 1M, and then the elution fractions and
flow-through
fraction were collected to detect lysozyme activity. The fractions with
lysozyme activity were
analyzed by SDS-PAGE, and pooled together. The protein concentration was
determined by
Qubit0 Protein Assay Kit (Invitrogen, cat Q33212).
160

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Purification of SEQ ID NO: 39
The culture supernatant was firstly precipitated with ammonium sulfate (80%
saturation),
then the precipitation was added water to adjust conductance to about
170m5/cm. The solution
was filtered with 0.45um filter and then loaded into Phenyl Sepharose 6 Fast
Flow column (GE
Healthcare) equilibrated with 20mM PBS at pH6.0 with 1.5M (NH4)2504 added. A
gradient
decrease of (NH4)2504 concentration was applied as elution buffer from 1.5M to
zero, and then
elution fractions and flow-through fraction were collected to detect lysozyme
activity. The
lysozyme activity still was found in flow-through fraction and fractions 1 to
12, and they were
pooled together for further purification.
The conductance of samples with lysozyme activity was adjusted to 190m5/cm,
then
reloaded into Phenyl Sepharose High Performance column equilibrated with 20mM
PBS at
pH6.0 with 1.8M (NH4)2504 added again. A gradient decrease of (NH4)2504
concentration was
applied as elution buffer from 1.8M to zero, and then elution fractions and
flow-through fraction
were collected to detect lysozyme activity. The fractions with lysozyme
activity were analyzed by
SDS-PAGE, pooled together, and diafiltrated with 20mM PBS at pH6Ø The
protein
concentration was determined by Qubit0 Protein Assay Kit (Invitrogen, cat
Q33212).
Purification of SEQ ID NO: 42
The culture supernatant was firstly precipitated with ammonium sulfate (80%
saturation),
then the precipitation was added water to adjust conductance to about
170m5/cm. The solution
was filtered with 0.45um filter and then loaded into Phenyl Sepharose High
Performance column
(GE Healthcare) equilibrated with 20mM PBS at pH6.0 with 1.5M (NH4)2504 added.
A gradient
decrease of (NH4)2504 concentration was applied as elution buffer from 1.5M to
zero, and then
elution fractions and flow-through fraction were collected to detect lysozyme
activity. The
fractions with lysozyme activity were analyzed by SDS-PAGE, but with two bands
found. The
fractions with lysozyme activity were pooled together for further
purification.
The conductance of the fractions was adjusted to 140m5/cm, then reloaded into
Phenyl
Sepharose High Performance column equilibrated with 20mM PBS at pH6.0 with
1.2M
(NH4)2504 added again. A gradient decrease of (NH4)2504 concentration was
applied as elution
.. buffer from 1.2M to zero, and then elution fractions and flow-through
fraction were collected to
detect lysozyme activity. The fractions with lysozyme activity were analyzed
by SDS-PAGE.
Fractions 29 to 37 have lower molecular weight, were pooled together, and
diafiltrated with
20mM PBS at pH6Ø Fraction 43 to 45 have higher molecular weight, were pooled
together,
and diafiltrated with 20mM PBS at pH6Ø The protein concentration was
determined by Qubit0
.. Protein Assay Kit (Invitrogen, cat Q33212).
161

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Analysis by N-terminal sequencing (Applied Biosystems Precise Amino Acid
Sequencer
Model 494) showed that the product began with the N-terminal sequence YPIKDNN,

corresponmding to amino acids 1 to 7 of SEQ ID NO: 42.
Analysis by intact molecular weight (MAXIS ll electrospray mass spectrometer
(Bruker
Daltonik GmbH, Bremen, DE)) showed that the major product corresponded to
amino acids 1 to
304 of SEQ ID NO: 42 (detected mass 31755.59 Da, predicted mass 31754.97 Da).
There was
also a small amount of a secondary product corresponding to amino acids 76 to
304 of SEQ ID
NO: 42 (detected mass 23617.23 Da, predicted mass 23617.15 Da) due to the
first LED domain
being cleaved off the N-terminal.
Purification of SEQ ID NO: 45
The fermentation supernatant with the lysozyme was filtered through a Fast PES
Bottle
top filter with a 0.22 pm cut-off. 250 ml filtered fermentation samples was
diluted with 250 ml
MilliQ water and pH was adjusted to 4.5. The lysozyme containing solution was
purified by
chromatography on Capto S, approximately 30 ml in a XK16 column, using as
buffer A 50 mM
Na-acetate pH 4.5, and as buffer B 50 mM Na-acetate + 2 M NaCI pH 4.5 using a
0-100%
gradient over ca. 100V. The fractions from the column were pooled based on the
chromatogram
(absorption at 280 and 254 nm) and SDS-PAGE analysis.
The molecular weight was estimated to 25 kDa from SDS-PAGE and the purity was
>
90%.
Example 10: Method of Determining the LAD Catalytic Domain by HMM
SEQ ID NOs: 46 to 187 were aligned using the software program MUSCLE v3.8.31
with
the default settings. Using this alignment, the HMM was constructed using the
software
program 'hmmbuild' from the package HMMER 3.0 (March 2010) (http://hmmer.org/)
and the
software was invoked using the default settings by the command: hmmscan3 --
tblout output.dat
model.hmm sequences.fasta. The LAD catalytic domain HMM profile thereby
generated for
subsequent loading into the software program 'hmmscan' is given below.
HMMER3/b [3.0 I March 2010]
NAME LAD catalytic domain
LENG 136
ALPH amino
RF no
CS no
MAP yes
162

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
DATE Fri Apr 21 12:03:08 2017
NSEQ 142
EFFN 1.547058
CKSUM 201442427
STATS LOCAL MSV -10.1515 0.71110
STATS LOCAL VITERBI -10.6276 0.71110
STATS LOCAL FORWARD -4.1803 0.71110
HMM A CDEF GHIK L MN
P Q R S T V W Y
m->m m->i m->d i->m i->i d->m d->d
COMPO 2.28000 4.46955 2.96306 2.70047 3.44014 2.89264 3.73492 2.95902
2.72837 2.64684 3.53697 3.08243 3.38858 2.79348 2.98339 2.54635 2.85094
2.67860
4.50931 3.45344
2.68610 4.42256 2.77533 2.73152 3.46377 2.40496 3.72526 3.29372
2.67763 2.69331 4.24673 2.90332 2.73683 3.18173 2.89805 2.37875 2.77520
2.98532
4.58508 3.61512
0.86176 1.29948 1.18774 1.49367 0.25431 0.00000 *
1 2.70450 4.96091 2.44483 2.25748 4.38595 1.70411 3.76708 3.83155
2.65982 3.40989 4.23378 2.69810 3.83638 2.89968 3.15311 2.53822 2.77031
3.44613
5.62694 4.24971 17 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.02516 4.09093 4.81328 0.61958 0.77255 0.70021 0.68613
2 2.95798 4.37838 4.41979 3.85216 2.84679 4.06442 4.15724 2.49260
3.70306 1.06749 3.04032 4.02131 4.37743 3.87638 3.84752 3.36755 3.18313
2.46409
3.85059 2.85522 18 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.02269 4.19301 4.91535 0.61958 0.77255 0.78684 0.60749
3 2.64712 5.07695 2.31050 2.33245 4.40298 2.91636 3.64509 3.86596
2.37831 3.34917 4.16311 2.30868 3.81995 2.76486 2.86800 2.40011 2.43728
3.46575
5.56134 4.16658 19 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
163

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
0.02259 4.19722 4.91957 0.61958 0.77255 0.69335 0.69294
4 2.14335 5.06169 2.79203 2.15230 4.37029 3.13800 3.41689 3.83159
2.36004 3.35168 4.11530 2.86703 3.32033 2.51530 2.75969 2.34749 2.87496
3.40178
5.51777 4.12854 20 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.02150 4.24624 4.96858 0.61958 0.77255 0.57423 0.82813
5 2.32752 4.64440 3.12310 2.59357 3.83630 3.40168 3.74641 3.18648
2.50736 2.57706 3.73330 3.10307 3.85311 2.95065 2.73902 2.58368 2.21457
2.53579
5.18615 3.89627 21 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01979 4.32837 5.05072 0.61958 0.77255 0.64493 0.74380
6 2.80872 5.24372 2.92193 2.38964 4.59162 3.53977 3.72591 4.02013
2.14929 3.51532 4.32009 2.91909 3.77704 1.36571 2.64059 2.86001 3.11361
3.64412
5.64559 4.31503 22 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01973 4.33131 5.05366 0.61958 0.77255 0.64820 0.74021
7 2.62542 4.63457 2.55319 2.60028 3.82280 3.52902 3.75230 3.03815
2.62398 2.57975 2.90066 3.12772 3.91645 2.93691 3.05484 2.18187 2.58195
2.78875
5.17871 3.89049 23 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01973 4.33131 5.05366 0.61958 0.77255 0.62772 0.76315
8 2.35670 5.14104 2.59023 2.29666 4.47219 2.93010 3.62820 3.94710
2.04764 3.43912 4.18729 2.84545 3.83264 2.55019 2.41265 2.56554 2.74894
3.52457
5.58079 4.17986 24 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01956 4.34008 5.06243 0.61958 0.77255 0.52419 0.89657
164

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
9 2.70329 4.59946 3.33128 2.77671 3.58063 3.60472 2.72765 2.94006
2.73677 2.77463 3.69458 2.14343 3.98982 3.07351 3.13881 2.83571 2.93476
2.52531
5.01301 2.57944 25 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01861 4.38940 5.11175 0.61958 0.77255 0.57190 0.83115
0.58061 4.39851 3.89198 3.70803 4.66940 3.05741 4.71068 4.00280
3.76833 3.77981 4.64326 3.71756 3.68666 4.04155 4.00008 2.69179 3.01786
3.44176
10 6.02272 4.86740 26 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01861 4.38940 5.11175 0.61958 0.77255 0.57190 0.83115
11 2.28535 5.06565 2.88471 2.36748 4.19761 3.27471 3.62729 3.53322
2.10760 3.18026 4.11808 2.80247 3.71214 2.51474 2.31369 2.57926 2.86084
3.38794
5.52458 3.98224 27 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01861 4.38940 5.11175 0.61958 0.77255 0.55657 0.85138
12 1.95678 4.83280 2.92821 2.43631 4.06399 2.95241 3.71153 3.30570
2.47325 3.04114 3.90855 3.04375 3.89352 2.78279 2.87396 2.61802 2.53741
2.71961
5.34398 4.01659 28 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01849 4.39559 5.11794 0.61958 0.77255 0.56314 0.84262
13 2.65884 4.25606 4.53713 3.95931 3.05007 4.05376 4.40064 1.21113
3.82028 2.25497 3.31657 4.10649 4.40020 4.01626 3.95164 3.36535 2.97633
1.88140
4.97279 3.28929 29 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01849 4.39559 5.11794 0.61958 0.77255 0.56314 0.84262
165

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
14 3.09624 4.49244 5.08148 4.54556 3.69891 4.61127 5.10139 1.09511
4.43687 2.08328 3.22577 4.70341 4.88972 4.64468 4.57704 3.97183 3.20262
1.33503
5.56774 4.38580 30 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01849 4.39559 5.11794 0.61958 0.77255 0.56314 0.84262
1.87078 5.06861 2.67006 2.34424 4.37045 3.16553 3.65393 3.82623
2.28226 3.35531 4.12231 2.87229 3.85367 2.70349 2.62439 2.49490 2.76661
3.35529
10 5.19663 4.14646 31 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01849 4.39559 5.11794 0.61958 0.77255 0.44025 1.03248
15 16
2.43366 4.90407 3.07169 1.93881 4.14929 3.51322 3.71660 3.38468
2.44374 3.14212 3.97548 3.04089 3.90532 2.38664 2.91529 2.71114 2.76736
2.33204
5.40352 4.06677 32 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
17 1.69111 4.40326 3.80425 3.41677 4.37951 1.19800 4.42086 3.72489
3.41793 3.46042 4.30219 3.40956 3.96367 3.70234 3.73859 2.67449 2.74965
2.61793
5.75300 4.54416 33 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
18 2.67801 5.17603 3.05013 2.31240 4.51586 3.49631 3.67694 3.96645
1.74435 3.22387 4.22607 2.91297 3.91428 2.52932 2.01448 2.64975 2.92944
3.35475
5.59394 4.23259 34 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
166

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
19 2.48895 5.18440 2.65300 2.21077 4.52329 3.29253 3.65271 4.00175
1.95386 3.48470 4.12914 2.89759 3.86079 2.50491 2.18622 2.57065 2.85720
3.57201
5.61837 4.21554 35 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
20 2.43351 4.88117 2.77074 2.22081 4.11935 3.46932 3.71513 3.38326
2.42344 2.62406 2.69401 3.04226 3.90131 2.82540 2.62123 2.56251 2.91163
3.14773
5.38359 3.90443 36 - -
2.68618 4.42225 2.77517 2.73121 3.46348 2.40513 3.72495 3.29354
2.67741 2.69355 4.24690 2.90347 2.73740 3.18147 2.89801 2.37887 2.77520
2.98519
4.58477 3.61503
0.04246 3.32766 5.16884 0.48651 0.95390 0.48576 0.95510
21 2.69712 5.18519 2.72756 2.39570 4.51082 1.98188 3.08098 3.97672
2.20957 3.47648 4.23700 2.82477 3.89080 2.76334 2.37850 2.67797 2.96922
3.56665
5.62338 4.23301 38 - -
2.68633 4.42243 2.77509 2.73132 3.46372 2.40492 3.72439 3.29372
2.67759 2.69347 4.24708 2.90365 2.73730 3.18093 2.89819 2.37883 2.77537
2.98501
.. 4.58495 3.61521
0.10524 2.36234 5.16884 1.78389 0.18390 0.48576 0.95510
22 3.08450 4.42239 4.90061 4.32017 3.36955 4.33853 4.69926 1.58167
4.16773 1.61994 2.77727 4.43627 4.63435 4.05013 4.24780 3.66605 3.31710
1.41643
5.15040 3.90088 49 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
23 2.59988 4.75855 3.17066 2.72521 4.40766 2.14059 3.94805 3.84514
.. 2.77802 3.44012 4.23907 3.03326 2.07393 2.98757 3.22451 2.01551 2.47915
3.41576
5.65635 4.33552 50 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
167

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
24 2.39242 5.12137 2.88795 2.13091 4.33191 3.46970 3.57957 3.90215
2.31739 3.35239 4.03851 2.90526 2.72477 2.72379 2.19066 2.50080 2.91724
3.45054
5.57111 4.18029 51 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
25 2.71674 5.18303 2.94981 2.39383 4.38247 3.46358 3.04209 3.88509
1.96661 3.38118 4.23031 2.98468 3.89750 2.14189 2.03986 2.68912 2.96595
3.57326
5.60356 4.22936 52 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
26 1.71921 4.45728 3.85035 3.71589 4.87129 0.76439 4.79418 4.28684
3.88233 4.01035 4.83765 3.73888 4.01975 4.11397 4.12696 2.72115 3.06866
3.62581
6.18704 5.04378 53 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
27 2.59152 2.48781 4.45380 3.85081 3.15329 3.82710 4.15011 1.84112
3.67495 1.97419 3.00019 3.92506 4.19158 3.38567 3.69697 3.13011 2.91063
2.23021
3.68826 3.44124 54 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
28 2.65209 3.96839 3.84226 3.11334 3.36636 3.72249 4.00157 2.32334
3.11605 2.17547 3.29883 3.58242 4.09639 2.77690 3.22956 2.96075 2.67088
1.76667
4.85107 3.53972 55 - -
2.68619 4.42226 2.77521 2.73124 3.46355 2.40514 3.72495 3.29355
2.67742 2.69356 4.24691 2.90341 2.73735 3.18147 2.89802 2.37888 2.77521
2.98519
4.58478 3.61490
0.03420 3.57804 5.16884 0.73477 0.65319 0.48576 0.95510
168

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
29 2.07224 4.45423 4.82417 4.28807 3.72902 4.39122 4.89895 1.15537
4.18214 2.34671 3.58878 4.46949 4.73704 4.42219 4.36253 3.74086 3.24252
1.52460
5.49002 4.28913 59 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
30 1.15453 3.74267 3.77490 3.26721 3.89912 2.36201 4.18636 3.24727
3.21520 2.97973 3.85757 3.52789 3.99672 3.50932 3.54238 2.73423 2.92343
2.74165
5.32643 3.69760 60 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
31 2.84534 4.33315 4.79654 4.21517 3.00397 4.21925 4.58222 1.49254
4.06138 1.49784 3.23805 4.07937 4.54078 4.22140 4.14680 3.54186 3.21703
1.75514
5.07561 3.90804 61 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
32 1.19836 4.20261 3.80733 3.28440 3.79916 3.46684 4.16982 3.08236
3.21815 2.85747 2.79726 3.55364 4.02738 3.51320 3.53422 2.61082 2.45216
2.77505
5.24805 4.03169 62 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01756 4.44649 5.16884 0.61958 0.77255 0.48576 0.95510
33 2.67861 4.43286 3.96982 3.42894 3.65753 3.77789 4.27411 2.58096
3.33280 2.44008 3.15099 3.73934 4.23535 3.64118 3.63033 3.09698 1.23658
2.16899
5.22762 4.01619 63 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
169

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
34 1.44620 4.53665 3.43775 2.81280 3.93249 2.34265 3.97126 3.24629
2.88857 2.99055 3.71572 3.31646 3.97140 3.21318 3.28442 2.63939 2.78238
2.66627
5.31139 4.05101 64 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
35 3.04606 4.42292 4.75886 4.16570 2.88260 4.22029 4.49891 2.34117
4.00836 1.03933 2.20271 4.29137 4.51739 4.12726 4.08499 3.42153 3.27084
2.49510
4.93841 3.26659 65 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
36 2.71461 4.59963 3.37734 2.81076 3.81249 3.60715 3.88255 3.10147
2.75570 2.84474 3.60963 3.28475 4.01656 1.92884 3.13739 2.77826 2.55554
1.85209
5.20271 3.93973 66 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
37 3.23633 5.68513 2.52859 0.74729 4.98392 3.53491 4.03390 4.51339
2.90426 4.00099 4.88649 3.02799 4.14144 2.82546 3.36929 3.14048 3.51910
4.11671
6.12487 4.69016 67 - -
2.68619 4.42226 2.77521 2.73122 3.46355 2.40510 3.72496 3.29355
2.67742 2.69356 4.24691 2.90348 2.73741 3.18143 2.89802 2.37884 2.77521
2.98516
4.58478 3.61504
0.03910 3.42113 5.17311 0.68213 0.70429 0.48576 0.95510
38 2.39513 4.11214 3.35820 3.20332 4.42695 3.26670 4.28663 3.82011
3.21286 3.50054 4.32164 3.46375 3.94681 3.51782 3.58241 0.93820 2.31575
3.34233
5.75692 4.51511 71 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
170

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
39 2.58578 5.14774 2.75533 2.34338 4.46814 2.68238 3.67933 3.93571
2.37780 3.44618 4.20504 2.13940 3.68658 2.77456 2.84780 2.37578 2.39625
3.52717
5.60429 4.20804 72 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
40 3.20020 4.54721 4.96249 4.36943 2.96426 4.39636 4.64583 2.10604
4.20651 0.83885 2.83629 4.48315 4.65449 4.27813 4.25147 3.71872 3.42034
2.57150
3.89377 3.67606 73 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
41 2.69560 4.72458 3.22090 2.63257 3.92297 3.56535 3.56009 2.72958
2.13988 2.63336 3.74365 3.14689 3.95072 2.89799 2.30477 2.78249 2.47712
3.01102
5.25331 3.23392 74 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
42 2.72660 4.33347 3.80539 3.20123 3.45879 3.75585 4.04605 2.31867
3.16049 2.48505 1.91296 2.34384 4.13604 3.45213 3.45614 2.98531 2.96321
2.24154
4.95867 3.74251 75 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
43 3.27737 4.67049 4.55145 4.06069 2.47355 4.24815 3.04419 3.15657
3.89846 1.64280 3.78329 4.07582 4.58700 4.03579 4.02494 3.55869 3.50219
2.88245
3.33803 1.24804 76 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
171

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
44 0.51810 4.44568 4.02569 3.87596 4.67377 3.25002 4.83448 3.91947
3.91283 3.77914 4.70430 3.82610 4.05779 4.19265 4.11231 2.69966 3.08739
3.40908
6.08181 4.89612 77 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
45 2.82915 4.93329 2.91029 2.80758 4.72631 3.36731 4.23890 4.33583
3.16837 3.93241 4.78070 0.84802 4.06265 3.45665 3.58212 2.30119 3.25191
3.81189
6.00977 4.62640 78 - -
2.68627 4.42234 2.77499 2.73132 3.46363 2.40491 3.72503 3.29363
2.67750 2.69350 4.24699 2.90356 2.73748 3.18111 2.89793 2.37896 2.77514
2.98527
4.58486 3.61512
0.05713 2.99842 5.17311 1.58281 0.22991 0.48576 0.95510
46 2.44557 5.15547 2.81273 2.27429 4.48469 3.15265 3.59265 3.95947
2.21519 3.45385 3.88587 2.75206 3.27069 2.59201 2.49640 2.15937 2.87349
3.48110
5.59762 4.05507 89 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
47 2.13454 5.00394 2.91686 2.45903 4.28160 2.96306 3.68619 3.67500
2.15235 3.28140 3.87376 2.63736 3.88029 2.80019 2.83287 2.41440 2.70755
2.87275
5.48352 4.11976 90 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
48 2.72141 4.35240 2.87142 3.17074 3.46488 3.73995 3.73692 2.49287
3.11195 2.30200 3.45239 3.53638 4.11660 3.40062 3.42677 3.00245 2.95465
1.43634
4.95481 3.60798 91 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
172

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
49 2.12915 4.48324 3.64290 3.40938 4.58739 3.18867 4.50853 3.96004
3.46395 3.53103 4.54098 3.58182 0.86537 3.78586 3.75910 2.64147 3.03200
3.44121
5.94006 4.71598 92 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
50 2.01164 5.32733 2.29923 1.57851 4.64741 3.27623 3.76224 4.13187
2.55344 3.62677 4.39593 2.92867 3.92919 2.69728 3.09144 2.54063 3.07699
3.70865
5.77773 4.35069 93 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
51 2.71221 4.62091 3.84225 3.72618 4.73636 3.34639 4.79405 4.36144
3.84443 4.04592 4.94233 3.81925 4.13886 4.14747 4.08008 0.47186 3.24139
3.75589
6.06282 4.83690 94 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
52 2.66443 4.20422 4.02877 3.41213 2.99738 3.77235 4.00427 2.62502
3.33273 1.34843 2.95964 3.64909 4.14137 3.15046 3.37243 3.05142 2.90210
2.37881
4.80399 3.44902 95 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
53 2.47713 5.18116 2.61739 2.34620 4.51729 3.13019 3.65365 3.99682
2.04882 3.48212 4.16874 2.22347 3.85828 2.41978 2.72356 2.58280 2.82696
3.48795
5.61851 4.21297 96 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
173

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
54 2.73893 4.19220 4.24842 3.53966 2.57306 3.84157 3.74088 2.33976
3.46086 1.99185 3.21748 3.83249 4.20652 3.73421 3.63828 3.13341 2.97029
2.44433
4.64684 1.75323 97 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
55 2.71240 5.13365 2.69940 2.43599 4.41459 3.50972 3.49117 3.85066
2.43114 3.37180 4.22210 3.01430 1.47487 2.86242 2.98711 2.79453 3.04627
3.49615
5.61591 4.25331 98 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
56 3.01695 4.95117 3.34848 2.93690 2.87628 3.79607 1.23282 3.57422
2.90391 3.12848 4.07095 2.86681 4.20183 3.25586 3.28583 3.07855 3.25131
3.31857
4.61908 2.76108 99 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
57 3.18894 5.84895 1.02997 1.80049 5.12950 3.38073 3.98591 4.67160
3.00026 4.12922 4.96533 2.84549 4.07391 2.43811 3.61066 3.05626 3.47306
4.21602
6.27452 4.73944 100 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
58 1.87056 5.02650 2.84164 2.46171 4.33046 2.29263 3.72123 3.76686
2.39089 3.23960 4.11787 3.01321 3.90717 2.85149 2.40724 2.72437 2.95880
3.40262
5.52546 4.16743 101 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
174

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
59 2.87296 4.29463 4.42304 3.69558 3.46367 4.04793 4.40439 2.07618
3.67094 2.05941 3.34949 4.05306 4.40386 3.95876 3.89843 3.10391 3.01800
1.11333
5.06040 3.86470 102 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
60 2.52335 4.51129 3.62019 3.55772 4.90051 0.60958 4.75107 4.41575
3.82700 4.10403 4.93001 3.66459 4.02959 4.06543 4.08722 2.50971 3.10678
3.71678
6.21996 5.01896 103 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
61 2.56709 4.93698 2.98607 2.45383 4.19080 3.24189 3.51161 3.61622
2.39299 3.20196 4.00362 2.98136 3.89479 2.84277 2.59044 1.74729 2.79854
3.27778
4.06346 3.72954 104 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
62 3.38324 5.87953 0.59437 2.43450 5.16499 3.51089 4.19299 4.82683
3.33417 4.31592 5.25707 3.02299 4.19831 3.13634 3.96628 3.25372 3.71690
4.38903
6.38048 4.86658 105 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
63 2.28041 4.89681 3.06750 2.53375 4.06796 2.85605 1.87529 3.55546
2.53845 3.16132 3.98206 3.01976 3.93000 2.75092 2.95635 2.75641 2.95343
3.23664
5.39946 3.72687 106 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
175

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
64 2.73536 5.16994 1.55165 2.40682 4.24291 3.11994 3.71533 3.93310
2.40910 3.28038 4.23100 2.48568 3.90074 2.83461 2.94504 2.72540 2.98937
3.53862
5.62732 3.93150 107 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
65 2.62666 4.61256 3.39176 3.21148 4.63783 3.28182 4.41739 4.20282
3.32467 3.84412 4.67922 3.16840 4.02180 3.67404 3.51687 0.68426 3.10405
3.63275
5.95670 4.66134 108 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
66 3.28127 4.55225 5.16566 4.64383 3.79600 4.71020 5.24685 1.56503
4.54047 1.99718 3.60026 4.80975 4.98633 4.76535 4.69380 4.08383 3.11988
0.89374
5.70699 4.51592 109 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
67 2.83680 4.79292 3.36129 3.31483 4.92387 0.56396 4.64949 4.54776
3.68201 4.17787 5.03927 2.99221 4.16071 3.94307 4.00415 2.97866 3.33903
3.92368
6.16418 4.94755 110 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
68 2.70449 4.13848 4.32502 3.73159 3.13755 3.83631 4.15179 2.03453
3.58574 1.52919 3.00530 3.87723 3.62487 3.66752 3.71454 2.91360 2.87147
2.05586
4.75960 3.51144 111 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
176

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
69 2.73703 4.50887 4.57967 4.02838 1.13149 4.19889 4.29405 2.61213
3.88343 1.97359 2.83383 4.17612 4.52379 4.04901 4.01988 3.51275 3.32702
2.56914
4.71360 3.20993 112 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
70 3.52506 5.43753 3.46574 3.27167 4.68799 3.87734 4.41883 4.45892
3.05955 3.89409 4.94547 3.72159 4.46342 0.47963 3.31382 3.56707 3.84071
4.16117
5.86192 4.62247 113 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
71 3.02299 5.04929 3.40906 2.92277 4.01409 3.75171 3.94381 3.49511
2.54678 2.80533 3.66251 3.37318 4.18320 1.04133 2.83982 3.09078 3.26561
3.31350
5.42159 4.07886 114 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
72 3.23277 5.37526 3.60226 2.97446 4.85343 3.84765 3.82756 4.21956
2.11769 3.65014 4.51048 3.38477 4.13356 2.19382 0.97246 3.05467 3.41202
3.88371
5.68623 4.50401 115 - -
2.68625 4.42237 2.77523 2.73135 3.46365 2.40496 3.72506 3.29355
2.67750 2.69364 4.24690 2.90336 2.73708 3.18158 2.89804 2.37895 2.77531
2.98487
4.58431 3.61515
0.36967 1.63266 2.17482 0.89983 0.52195 0.48576 0.95510
73 1.76091 4.60585 3.22695 2.66138 3.81873 3.21041 3.77958 3.20393
2.63580 2.87005 3.72561 3.15358 3.75753 2.86242 3.08379 2.38691 2.78816
2.67495
5.18090 3.39722 123 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01963 4.33652 5.05887 0.61958 0.77255 0.39638 1.11703
177

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
74 2.36188 4.66636 3.23919 2.64903 3.85241 3.48742 3.78659 3.17689
2.61741 2.87246 3.42621 3.16440 2.54039 2.70411 3.07610 2.15587 2.83967
2.88009
3.85405 3.79583 124 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
75 2.61045 4.23100 3.89390 3.31670 3.10119 2.37718 3.92350 2.41741
3.11684 2.43089 3.34271 3.57347 4.03101 3.48884 3.48808 2.78635 2.90801
2.39128
2.56930 3.00068 125 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
76 4.23911 5.35111 5.11059 4.88905 2.16141 4.82451 3.72509 3.97319
4.62130 3.22244 4.51964 4.46153 5.12779 4.55830 4.58510 4.24512 4.45234
3.88962
0.95146 1.31009 126 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
77 2.54730 4.84000 3.12323 2.67492 4.36810 1.48789 3.89014 3.79317
2.30863 3.38625 4.19529 3.14795 3.09597 3.04853 3.05662 2.71985 2.63434
3.40162
5.60425 4.28424 127 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
78 2.66228 5.17663 2.18695 2.38019 4.51071 3.46112 3.72860 3.97811
2.49394 3.49608 4.26544 2.46913 3.53684 2.84670 3.01297 2.30433 1.95746
3.57076
5.66185 4.26183 128 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
178

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
79 2.62597 3.72459 4.74145 4.16976 3.49514 4.17644 4.57946 1.53523
4.02504 2.06669 3.43633 4.27639 4.52278 4.21862 4.13372 3.37728 2.96630
1.32915
5.12648 3.93497 129 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
80 1.71018 5.09500 2.91003 2.28837 4.39860 3.20819 3.68055 3.85185
2.18117 3.38129 4.15199 2.97202 3.82904 2.59376 2.69863 2.63050 2.91871
3.35040
5.55436 4.17589 130 - -
2.68618 4.42225 2.77520 2.73123 3.46354 2.40513 3.72495 3.29354
2.67741 2.69355 4.24690 2.90347 2.73740 3.18146 2.89797 2.37887 2.77520
2.98518
4.58477 3.61503
0.02663 3.88177 5.17311 0.56218 0.84389 0.48576 0.95510
81 2.48394 3.10163 2.25908 2.04705 4.39152 3.47485 3.67962 3.84650
2.44021 3.37821 4.14764 2.96397 3.87525 2.41597 2.88073 2.68095 2.61892
3.42222
5.55416 4.17129 132 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
82 2.68177 3.55032 2.55328 2.65458 3.90044 3.55585 3.77777 3.23585
2.63297 2.14245 3.79147 3.07691 3.94510 2.97547 2.27756 2.59681 2.81043
2.92572
5.24224 3.94809 133 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
83 3.55146 5.02464 4.74999 4.42776 3.62483 4.31991 5.02933 2.86859
4.15961 2.16114 0.58493 4.62225 4.81483 4.51696 4.28820 3.94221 3.88517
2.93677
5.51590 4.31836 134 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
179

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
84 2.78950 5.27104 1.60171 2.36299 4.59227 3.42284 3.72878 4.07088
2.40039 3.56687 4.33046 2.53375 3.91054 2.77186 2.80759 2.59881 2.49679
3.65129
5.71587 4.30134 135 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
85 1.77249 4.42802 3.73213 3.25700 4.00890 3.41128 4.22625 3.23512
3.21280 2.95449 3.94696 3.53063 1.56755 3.52335 3.54799 2.70627 2.96075
2.25370
5.43619 4.20828 136 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
86 1.87784 5.02782 2.72866 2.33198 4.31028 3.19386 3.53042 3.75421
2.37531 3.26556 3.94889 2.98159 3.87619 2.75751 2.76120 2.54384 2.55560
3.23490
5.50000 3.78285 137 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
87 2.67637 2.87529 3.70049 3.09589 3.25828 3.44585 3.90857 2.60314
2.80465 2.33125 3.42306 3.49082 4.06803 3.27375 2.53060 2.91907 2.80152
2.55072
4.90754 2.46622 138 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
88 1.79992 4.78437 3.03555 2.72524 4.41183 3.38379 3.98195 3.84389
2.83464 3.45092 4.26320 2.85725 3.94926 2.98839 3.27815 1.35854 2.96383
3.42785
5.67722 4.35764 139 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
180

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
89 0.80355 4.37389 3.94778 3.56894 4.36811 3.25124 4.50693 3.63938
3.52971 3.44162 4.30193 3.48702 3.98332 3.81712 3.81331 2.60473 2.39172
2.87424
5.76557 4.57199 140 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
90 2.25481 5.11116 2.94963 2.41107 4.42260 2.57292 3.24732 3.87706
2.30147 3.39764 4.16527 2.97537 3.88387 2.61155 2.07107 2.60293 2.93976
3.41342
5.56165 4.18457 141 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
91 2.25875 4.65512 3.27561 2.71191 3.71913 3.58308 3.80002 3.21470
2.22262 2.23688 2.92970 3.19070 3.96792 2.32664 3.05287 2.79258 2.92381
2.93018
5.19763 3.91802 142 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
92 4.10061 5.33819 5.05020 4.90417 0.39707 4.58135 4.27801 3.59955
4.80953 2.84635 4.25771 4.72981 5.04948 4.82350 4.78408 4.31507 4.41322
3.62708
4.41534 2.73487 143 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
93 3.73347 4.97315 5.03984 4.66909 1.28357 4.63286 3.84974 3.24734
4.49074 2.00016 3.89704 4.40634 4.92154 4.43197 4.47846 3.98159 3.95025
3.15737
3.99370 1.21085 144 - -
2.68638 4.42247 2.77536 2.73135 3.46369 2.40447 3.72497 3.29375
2.67759 2.69372 4.24711 2.90334 2.73680 3.18155 2.89812 2.37878 2.77536
2.98540
4.58498 3.61517
0.11081 2.31033 5.17311 1.90953 0.16035 0.48576 0.95510
181

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
94 2.36046 5.18606 2.46437 2.08364 4.52401 3.06141 3.65211 4.00557
2.21277 3.47210 4.22927 2.71281 3.71770 2.67965 2.50031 2.53113 2.72851
3.53705
5.62257 4.21483 156 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
95 2.02461 5.10851 2.83785 2.25064 4.41932 2.69662 3.66732 3.77266
2.22782 3.39937 4.16115 2.95643 3.86815 2.74425 2.55833 2.39296 2.92164
3.37408
5.56407 4.17669 157 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
96 3.77195 5.02078 5.51168 4.93411 3.22586 5.09901 5.36604 2.28434
4.77671 0.68399 1.90625 5.18303 5.15259 4.73558 4.79347 4.47651 3.97588
2.64824
5.44208 4.46890 158 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
97 2.27665 4.54429 3.31069 2.67276 3.77380 3.58986 3.81443 3.12693
2.13922 2.16378 3.62025 3.19158 3.97401 3.01825 2.81563 2.81424 2.79037
2.51297
5.15297 3.55805 159 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
98 2.49488 5.19607 2.45038 2.24856 4.53529 3.23631 3.65787 4.01546
1.90310 3.49690 4.24001 2.83925 3.86393 2.61300 2.31130 2.64491 2.75545
3.58392
5.62980 4.22437 160 - -
2.68620 4.42244 2.77520 2.73124 3.46373 2.40506 3.72514 3.29342
2.67743 2.69374 4.24709 2.90323 2.73741 3.18123 2.89767 2.37906 2.77520
2.98503
4.58496 3.61522
0.09568 2.45835 5.17311 1.90622 0.16092 0.48576 0.95510
182

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
99 2.64610 4.19287 4.51782 3.92763 2.77711 3.97094 4.30822 1.78813
3.57005 2.08485 3.28244 4.04333 4.32451 3.95582 3.66707 3.27791 3.03016
1.43763
4.87494 3.69158 175 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.02184 4.45077 4.61181 0.61958 0.77255 0.48576 0.95510
100 2.57644 5.19801 2.27538 2.38818 4.52814 3.35083 3.68719 4.00392
2.23129 3.50058 4.25504 2.58839 2.30709 2.79494 2.80539 2.41521 2.96353
3.58321
5.64771 4.24193 176 - -
2.68622 4.42229 2.77523 2.73127 3.46358 2.40516 3.72498 3.29358
2.67744 2.69359 4.24693 2.90350 2.73743 3.18150 2.89804 2.37890 2.77523
2.98522
4.58481 3.61363
0.19911 1.74384 5.16884 0.21958 1.62384 0.48146 0.96202
101 2.99688 5.49109 2.31693 2.31426 4.82026 1.50085 3.89510 4.31373
2.80362 3.81760 4.62442 1.94387 4.01089 2.75286 3.34734 2.82386 3.26700
3.89190
5.98283 4.52864 178 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
102 2.70284 4.52919 3.24032 2.96189 3.71775 3.56073 3.97139 3.17965
2.94172 2.87349 3.75897 3.21460 4.03711 3.27740 3.29933 2.53512 2.46622
2.91647
1.54333 3.85468 179 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.02978 4.45077 4.03581 0.61958 0.77255 0.48576 0.95510
103 2.61665 5.23073 2.48892 1.93564 4.56747 3.45738 3.61649 4.05178
2.24240 3.53134 4.27684 2.80050 3.64002 1.94619 2.84919 2.64239 2.89577
3.61752
5.66449 4.25113 180 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01770 4.43869 5.16104 0.61958 0.77255 0.50512 0.92491
183

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
104 2.50715 5.12699 2.77810 2.33590 4.44582 3.30582 3.61595 3.91337
2.30426 3.35320 4.17496 2.61050 3.85772 2.65896 2.39675 2.29108 2.36063
3.50352
5.57542 3.76373 181 - -
2.68618 4.42225 2.77515 2.73124 3.46354 2.40513 3.72495 3.29354
2.67741 2.69355 4.24690 2.90347 2.73740 3.18147 2.89801 2.37884 2.77520
2.98519
4.58477 3.61503
0.03088 3.70193 5.16104 0.63198 0.75831 0.47385 0.97446
105 2.60454 4.24739 3.87526 3.29633 3.36055 3.57144 3.72308 2.65342
3.19345 2.14470 1.84807 3.60313 4.10632 3.35860 3.01033 3.00275 2.85663
2.18919
4.84814 3.64240 184 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
106 2.39134 5.15060 2.35146 2.27357 4.47362 3.41528 3.68003 3.94208
2.43822 3.37742 4.20939 2.86965 2.78407 2.78921 2.79582 2.01297 2.86585
3.53191
5.60823 4.21105 185 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
107 2.62098 4.25013 3.87151 3.29482 3.36602 3.73620 3.93542 2.37557
2.91952 2.03620 3.23025 3.60470 2.54484 3.47456 3.42600 3.00516 2.82863
1.90641
4.85591 3.64926 186 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
108 2.06052 4.40686 3.81765 3.48760 4.63190 1.17260 4.52999 4.05972
3.52970 3.73232 4.53659 3.59957 3.80588 3.79688 3.84625 2.40774 1.76640
3.46864
5.96429 4.76728 187 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
184

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
109 2.30528 5.00504 2.79584 2.32132 4.28012 3.35093 3.68460 3.71938
2.30210 3.20302 4.06501 2.97029 3.87976 2.52168 2.83814 2.53315 2.26799
2.84934
4.56909 4.11805 188 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
110 1.74241 4.18228 4.15006 3.56681 3.06887 3.80169 3.83739 2.56132
3.44556 1.80992 3.28778 3.77234 4.16953 3.66514 3.62758 3.08801 2.93731
2.40159
3.19051 3.11867 189 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
111 1.15417 2.40052 3.43268 3.31342 3.94825 3.05617 4.23524 3.29134
3.27802 2.88728 3.90490 3.55144 3.99881 3.56368 3.59756 2.72050 2.93186
2.96489
5.37506 4.15892 190 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
112 3.26861 5.44238 2.97663 2.64398 4.75892 3.69012 4.06288 4.30148
2.66362 3.78982 4.71915 3.28643 4.23921 0.76296 2.96287 3.24618 3.53605
3.96409
5.86880 4.56259 191 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
113 1.91522 4.95047 2.97467 2.39757 4.20895 3.50202 3.70112 3.61309
2.14870 3.19155 3.18272 3.01748 3.89338 2.73359 2.84536 2.53242 2.55518
3.29391
5.43928 4.09037 192 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
185

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
114 3.29634 4.59962 5.14480 4.67781 3.93848 4.66858 5.40358 1.71382
4.56710 2.45181 3.72266 4.84032 5.02031 4.85191 4.75526 4.08284 3.33697
0.67655
5.91411 4.69288 193 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
115 3.15567 5.44348 2.80271 2.49407 4.78415 3.60247 3.94943 4.28979
2.58206 3.78846 4.65575 2.96667 4.14360 0.91366 2.91447 3.11238 3.41462
3.91870
5.87574 4.52658 194 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
116 2.71563 4.90409 3.12545 2.55928 4.14921 2.85289 3.44680 3.05862
2.22913 3.15932 3.97583 3.07155 3.92680 2.53911 2.16870 2.75050 2.94327
2.44686
5.39558 4.07226 195 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
117 2.19207 4.40484 3.86126 3.64147 4.76639 3.17370 4.68117 4.15367
3.70231 3.88127 4.70113 3.67352 3.97014 3.97418 3.96685 0.66193 2.77617
3.52234
6.10860 4.92572 196 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
118 1.23716 4.99590 2.82777 2.30137 4.34451 3.20483 3.85483 3.76823
2.68928 3.36557 4.18982 3.06501 3.97138 2.91804 3.03321 2.75915 3.06515
3.41893
5.59981 4.25545 197 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
186

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
119 2.63152 4.27604 4.03648 3.47068 1.69703 3.81555 3.85315 2.68413
3.36748 2.44928 3.39118 3.31828 4.18646 3.53607 3.59165 3.09668 2.86423
2.46901
4.64999 2.19303 198 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
120 3.10050 4.93865 3.89438 3.80685 5.08138 2.93213 4.95457 4.68524
3.99850 4.30514 5.22080 4.02495 0.41952 4.31180 4.23729 3.27299 3.60547
4.11129
6.18106 5.18331 199 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
121 2.63821 5.16765 1.71131 2.06185 4.48005 3.20764 3.58490 3.94854
2.45253 3.45931 4.22038 2.80491 3.88069 2.79852 2.94579 2.60137 2.82264
3.54145
4.92801 3.93756 200 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
122 1.86376 4.90237 3.28241 2.68163 4.15144 3.62338 3.62925 3.54290
2.36576 2.72221 3.98901 3.18063 4.00712 2.90768 1.74335 2.86644 3.03069
3.24561
5.38278 4.04754 201 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
123 4.19177 5.36263 4.97401 4.78151 2.11394 4.76326 3.76878 3.89368
4.60093 3.15403 4.48829 4.44462 5.10497 4.55202 4.59461 4.21077 4.43309
3.83039
3.88657 0.47676 202 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01749 4.45077 5.17311 0.61958 0.77255 0.48576 0.95510
187

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
124 1.79635 5.14532 2.26839 2.39026 4.45744 3.24099 3.34639 3.84057
2.35322 3.43625 4.19753 2.81236 3.87618 2.60394 2.87095 2.67589 2.92156
3.51869
5.59711 4.13300 203 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.02128 4.45077 4.66879 0.61958 0.77255 0.48576 0.95510
125 2.49141 5.20122 2.74864 2.18402 4.54180 3.39680 3.60493 4.01898
1.78979 3.49991 4.24589 2.89607 3.84714 2.16259 2.63607 2.67773 2.87195
3.59004
5.63139 4.23074 204 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.02321 4.44704 4.48894 0.61958 0.77255 0.49180 0.94553
126 2.70259 4.78288 3.10316 2.62084 3.23014 3.55717 2.77689 3.39328
2.58605 3.02278 3.86371 3.04868 3.94378 2.53415 2.11061 2.76991 2.93283
3.10180
3.35180 3.35576 205 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01765 4.44148 5.16383 0.61958 0.77255 0.50070 0.93168
127 2.64699 4.39217 3.56865 2.05763 3.29481 3.66295 3.91739 2.60538
2.95345 2.50897 2.59486 3.40402 4.04141 3.00636 3.30409 2.90867 2.78869
2.22561
4.97634 3.56924 206 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01765 4.44148 5.16383 0.61958 0.77255 0.50070 0.93168
128 2.15651 5.08647 2.66218 2.31635 4.38993 2.79836 3.66501 3.84743
2.38128 3.37411 4.13923 2.89371 2.92678 2.67029 2.83170 2.46722 2.70744
3.45474
4.50984 4.16121 207 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01765 4.44148 5.16383 0.61958 0.77255 0.50070 0.93168
188

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
129 2.47139 5.13557 2.73837 1.94974 4.45770 3.46490 3.60456 3.85623
2.21863 2.88369 4.18268 2.94198 3.82238 2.40411 2.53877 2.63956 2.79959
3.31420
5.58153 4.18624 208 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.01765 4.44148 5.16383 0.61958 0.77255 0.50070 0.93168
130 0.54170 4.41455 3.99487 3.83758 4.67181 3.21702 4.80217 3.94160
3.87765 3.78720 4.68767 3.78860 4.02574 4.15301 4.08310 2.61480 3.04914
3.40878
6.07441 4.88693 209 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.04858 4.44148 3.33421 0.61958 0.77255 0.50070 0.93168
131 2.47060 5.10222 2.92302 2.23845 4.41518 3.31163 3.65256 3.83300
2.30764 3.39268 4.15289 2.86002 3.85601 2.39911 2.32759 2.51827 2.29611
3.30596
5.55412 4.16668 210 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.03356 4.41110 3.86983 0.61958 0.77255 0.54715 0.86416
132 2.26873 5.14785 2.83342 2.18702 4.47827 3.38243 3.63990 3.95273
2.07133 3.41537 4.19342 2.78217 3.84499 2.33511 2.64759 2.45499 2.67363
3.49865
5.58841 4.18815 211 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.03225 4.39603 3.94192 0.61958 0.77255 0.56894 0.83500
133 3.29475 4.59909 5.27958 4.75843 3.67853 4.82300 5.34776 1.05587
4.65842 1.73667 3.38036 4.93089 5.04836 4.83561 4.78636 4.20753 3.60004
1.39603
5.69975 4.55067 212 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.19685 4.38251 1.79460 0.61958 0.77255 0.58780 0.81091
189

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
134 2.59525 2.26255 4.26037 3.68225 3.24006 3.81148 4.16702 2.18927
3.54565 2.25647 3.24248 3.85052 4.18879 3.76123 3.70265 3.11792 2.92528
1.72461
4.80046 2.95881 213 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.04263 4.20800 3.61724 0.61958 0.77255 0.77092 0.62099
135 2.12293 5.06795 2.53477 2.27785 4.37789 3.30834 3.61326 3.84072
2.22403 3.35911 4.12421 2.69439 3.80736 2.57158 2.81142 2.37052 2.76704
3.41396
5.52424 4.13208 214 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354
2.67741 2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519
2.98518
4.58477 3.61503
0.05033 4.19589 3.38058 0.61958 0.77255 0.78725 0.60714
136 1.41298 4.54007 3.16784 2.67479 3.96764 3.28514 3.85979 3.32496
2.60972 2.92660 3.87024 3.16231 3.88002 3.04176 3.09126 2.66015 2.58267
3.00986
5.31055 4.04058 215 - -
2.68596 4.42247 2.77539 2.73143 3.46365 2.40403 3.72516 3.29358
2.67762 2.69335 4.24680 2.90368 2.73761 3.18168 2.89806 2.37907 2.77541
2.98531
4.58498 3.61491
0.51189 0.91469 * 1.07030 0.41993 0.00000 *
'-
Example 11: Method of Determining the Lysozyme Enhancing Domain by HMM
SEQ ID NOs: 188 to 316 were aligned using the software program MUSCLE v3.8.31
with the default settings. Using this alignment, the HMM was constructed using
the software
program 'hmmbuild' from the package HMMER 3.0 (March 2010) (http://hmmer.org/)
and the
software was invoked using the default settings by the command: hmmscan3 --
tblout output.dat
model.hmm sequences.fasta. The lysozyme enhancing domain HMM profile thereby
generated
for subsequent loading into the software program 'hmmscan' is given below.
HMMER3/b [3.0 I March 2010]
NAME lysozyme_enhancing_domain
LENG 73
ALPH amino
RF no
CS no
190

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
MAP yes
DATE Tue Feb 3 15:29:152015
NSEQ 129
EFFN 1.263702
CKSUM 3302514446
STATS LOCAL MSV -9.1036 0.71868
STATS LOCAL VITERBI -9.7357 0.71868
STATS LOCAL FORWARD -3.7686 0.71868
HMM A CDEF GHIK L M N
10PQ R S T V WY
m->m m->i m->d i->m i->i d->m d->d
COMPO 2.64236 3.16005 2.87141 2.79417 3.60706 2.63596 3.86157 2.94229
2.65279 2.95816 3.97690 3.11757 3.46392 3.12498 3.11011 2.56828 2.58627
2.58086
4.17029 3.04296
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.17958 4.32413 1.88959 0.61958 0.77255 0.00000 *
1 3.80107 5.04040 4.67499 4.39045 1.81828 4.48873 3.56285 3.50991
4.23379 2.82560 4.11380 4.16131 4.81340 4.22617 4.28030 3.87997 4.03091
3.43577
3.70270 0.73371 1 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02327 4.16783 4.89017 0.61958 0.77255 0.67437 0.71228
2 2.33952 4.44593 3.23890 3.02979 4.35083 3.16321 4.20776 3.67603
3.02584 3.40031 4.31198 3.32021 1.10553 3.46227 3.39562 2.64660 2.86963
3.24503
5.70138 4.44714 2 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02327 4.16783 4.89017 0.61958 0.77255 0.58149 0.81886
3 2.99224 4.47028 5.00531 4.50059 3.72470 4.59877 5.18674 1.10701
4.40105 2.19903 3.51509 4.69439 4.89181 4.65354 4.58483 3.98375 3.44715
1.21838
5.67709 4.47722 3 - -
191

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02218 4.21548 4.93783 0.61958 0.77255 0.62351 0.76800
4 2.67119 4.76820 3.04982 2.54195 4.12069 3.43519 3.75916 3.51149
2.19874 3.13703 3.97428 2.96845 3.89558 2.93360 2.89915 2.57877 1.61288
3.10281
5.38435 4.08520 4 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02491 4.21548 4.62159 0.61958 0.77255 0.52151 0.90048
5 2.37234 5.08464 2.49824 2.21575 4.41120 1.99198 3.58111 3.86677
2.52882 3.41126 4.20120 2.81325 3.86140 2.84200 3.02691 2.42476 2.83819
3.48001
5.60144 4.21122 5 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02114 4.26301 4.98536 0.61958 0.77255 0.56183 0.84436
6 2.63301 5.17310 2.09015 2.17272 4.49463 3.27178 3.65545 3.97097
2.38584 3.47241 4.23433 2.52660 3.34330 2.76874 2.94084 2.41690 2.44683
3.55393
5.62559 4.21427 .. 6 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.07099 4.26555 2.90975 0.61958 0.77255 0.56422 0.84119
7 2.61111 4.85146 2.70126 2.41033 4.02944 2.66646 3.65077 3.52514
2.43178 3.11934 3.92649 2.77281 3.83428 2.77300 2.91547 2.42718 2.41739
2.79685
5.35415 3.75427 7 - -
2.68619 4.42226 2.77521 2.73124 3.46355 2.40511 3.72496 3.29355 2.67742
2.69356 4.24691 2.90348 2.73741 3.18147 2.89802 2.37888 2.77504 2.98519
4.58478
3.61504
0.09494 2.48394 4.93906 0.38374 1.14353 0.52245 0.89910
8 3.16563 4.52406 5.00410 4.47860 3.59477 4.61318 5.11093 1.75130
4.36399 1.66390 3.39589 4.68330 4.88103 4.58179 4.52924 3.98371 3.48258
0.98654
5.56065 4.39116 9 - -
192

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02108 4.26555 4.98790 0.61958 0.77255 0.56422 0.84119
9 2.74568 5.18103 2.62071 2.37499 4.50785 3.44148 3.43386 3.97009
2.14487 3.46738 4.24084 1.77122 3.86903 2.77625 2.44752 2.65464 2.97757
3.56615
5.60976 4.22640 10 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02108 4.26555 4.98790 0.61958 0.77255 0.43965 1.03356
10 3.21633 0.35479 4.79708 4.65548 4.57914 3.72194 5.20787 3.82938
4.49870 3.70850 4.85167 4.53077 4.45916 4.82584 4.53365 3.48556 3.72159
3.53505
5.86530 4.85631 11 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
11 3.30119 5.31389 3.73668 3.09114 4.51121 3.86969 3.13217 4.16018
2.10415 3.58751 4.49408 3.45992 4.26052 2.99924 0.83233 3.31264 3.47550
3.85705
5.50391 4.26079 12 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
12 2.24421 4.51545 3.30473 2.81428 4.39051 3.23670 4.14928 3.77491
3.04692 3.44962 4.27960 3.30747 3.89875 3.36729 3.42822 1.05895 2.51437
3.31859
5.70279 4.43964 13 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
13 2.69468 4.75034 2.89429 2.56341 4.66767 0.94912 4.20148 4.12822
3.15097 3.75743 4.60332 3.20872 3.96757 3.42394 3.55601 2.47312 3.12631
3.62410
5.94365 4.63448 14 - -
193

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
14 2.67424 4.69741 3.65691 3.53445 4.63811 3.40395 4.65858 4.09486
3.63150 3.77181 4.76683 3.75211 0.59051 3.99224 3.88152 2.99980 3.31792
3.64480
5.92609 4.77080 15 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
2.26323 4.51933 3.21961 2.94036 4.47411 1.38422 4.14822 3.91245
3.06085 3.54037 4.34588 2.97288 3.87499 3.35219 3.46854 1.96711 2.52323
3.40350
5.76384 4.49002 16 - -
15
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
16 2.20668 4.36145 3.82003 3.56662 4.41076 3.20360 4.55272 3.51597
3.53768 3.41304 4.35967 3.64187 3.96341 3.86648 3.78744 2.68079 0.81042
3.10831
5.83931 4.64399 17 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
17 2.61570 5.10849 2.62653 2.38205 4.43252 2.78078 3.60811 3.89018
2.47426 3.42628 4.20945 2.71231 3.87390 2.61734 2.99949 1.64993 2.94705
3.49936
5.60799 4.21799 18 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
18 2.58292 4.58689 3.02231 2.68583 3.00245 3.32285 2.97170 3.14564
2.67302 2.81683 3.67939 2.99852 3.79428 3.00246 3.09283 2.65865 2.82740
2.88473
5.11794 2.25478 19 - -
194

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
19 2.02971 5.05961 2.68453 2.36019 4.37471 3.26819 3.65420 3.83090
2.10672 3.36092 4.13132 2.92980 3.45060 2.77060 2.82369 2.16905 2.88648
3.43886
5.53518 4.15201 20 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
3.16684 4.47509 4.98151 4.48359 3.78153 4.52597 5.13073 1.23357
4.37208 2.38350 3.60515 4.64947 4.86068 4.63385 4.54770 3.62858 3.43521
1.03896
5.65865 4.43929 21 - -
15
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
21 2.67985 4.50015 3.40866 2.83947 3.66095 3.60615 3.61051 2.50038
20 2.12953 2.71143 3.59755 3.27678 3.98763 2.81347 3.06211 2.85030 2.83675
1.92294
5.06195 3.81377 22 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
22 2.57540 5.16214 3.25351 2.63376 4.54584 3.62294 3.69980 3.93939
1.30635 3.43432 4.24813 3.13299 4.00544 2.78831 2.11440 2.89381 2.74985
3.58326
5.55169 4.27942 23 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
23 2.54455 4.73655 3.02733 2.59505 4.05985 3.44683 3.70095 3.46466
2.60056 3.09418 3.92399 3.08417 3.89235 2.67009 3.04116 2.11836 1.78482
2.95974
5.35882 4.04770 24 - -
195

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
24 3.40982 4.75103 4.67192 4.22624 1.97308 4.35966 3.81417 3.04888
4.07862 2.38151 3.72579 4.16721 4.67838 4.14717 4.17038 3.68839 3.63576
2.47365
4.02768 0.99393 25 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
25 2.33607 5.05721 2.94517 2.24042 4.36369 3.44673 3.55543 3.81754
1.82729 3.31948 4.11325 2.80831 3.17764 2.75227 2.78214 2.58400 2.65726
3.32087
5.51479 4.13659 26 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
26 2.36555 5.04925 3.04993 2.35049 4.35720 3.51989 3.68369 3.71551
1.45376 3.06828 4.12214 3.00561 3.91721 2.74243 2.72409 2.73518 2.95391
3.42066
5.49677 4.16815 27 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
27 2.61202 4.80098 2.75023 2.62858 4.42906 1.32629 3.93435 3.86483
2.78346 3.46292 4.27988 3.09911 3.91159 3.10786 2.85440 2.43819 2.91018
3.44468
5.68001 4.35178 28 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
28 2.39518 5.06692 2.42469 2.35324 4.15968 3.22653 3.04826 3.83188
2.39351 3.35617 4.12096 2.82671 3.83411 2.52507 2.87979 2.43622 2.35726
3.41027
5.52582 4.13893 29 - -
196

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
29 2.56098 5.10975 1.84700 2.22610 4.41970 3.43432 3.64564 3.82090
2.31577 3.39892 4.16246 2.88269 3.84241 2.68525 2.69153 2.62766 2.81515
3.48193
5.56120 3.47482 30 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
30 2.71289 4.20867 4.05384 3.08944 3.32534 3.70711 4.11635 2.10460
3.37170 2.31376 3.31881 3.74286 4.18005 3.62760 3.59433 3.09939 2.94743
1.40821
4.85949 3.10435 31 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
31 2.56066 3.98356 2.83917 2.26935 4.26245 3.45019 3.65582 3.70207
1.96206 3.26063 4.04582 2.95679 3.84786 2.75603 2.89654 2.30158 2.29348
3.33728
5.46026 4.09624 32 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
32 2.98261 4.34033 4.74407 4.16222 2.74015 4.19374 4.48870 1.33722
4.00888 1.70186 3.16247 4.27271 4.50036 4.14592 4.09048 3.51345 3.21313
1.97755
4.93581 3.15765 33 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
33 2.50714 4.52249 3.32761 2.73441 3.99413 2.87824 3.93263 3.37611
2.83014 3.05077 3.89907 3.20556 3.90546 3.15647 3.23473 2.09891 1.66153
2.58887
5.34950 4.08041 34 - -
197

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
34 2.73372 0.86170 4.21080 3.82223 3.72250 3.51687 4.43487 3.14732
3.50989 2.93675 3.97687 3.88251 4.17078 3.93344 3.44432 2.99564 3.14856
2.89652
5.25169 3.70577 35 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
35 2.78221 4.93521 3.15849 2.72873 3.66991 3.61431 3.78500 3.57206
2.57323 3.13265 4.05241 3.20038 4.05162 1.36867 2.92156 2.93601 3.12692
3.29834
5.09768 2.57435 36 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
36 2.39232 4.68655 3.16574 2.46000 3.89951 3.51768 3.74742 2.86223
2.34831 2.93724 3.78511 3.11031 3.91433 2.90991 3.00803 2.69966 1.85059
2.95170
5.23226 3.93826 37 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
37 2.38712 4.95526 2.95139 2.14292 4.22581 3.30071 3.48757 3.66208
2.41922 3.22834 4.01725 2.96015 3.42523 2.64575 2.85382 2.40915 2.33462
3.08668
5.43599 3.59495 38 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
38 3.32493 5.03100 4.08842 4.05521 5.14287 0.28143 5.12256 4.87721
4.29611 4.46333 5.45951 4.25516 4.43330 4.58529 4.45932 3.51325 3.84001
4.31766
6.09414 5.26815 39 - -
198

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
39 2.77845 5.16916 2.50798 1.90461 4.47239 3.42576 3.73520 3.92893
2.55535 3.46812 4.26082 2.91770 3.47218 2.74953 3.05304 2.74879 1.68968
3.54385
5.65411 4.25701 40 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
40 2.55637 3.36322 2.86419 2.49420 4.07854 3.43147 3.53651 3.49427
2.36324 3.10007 3.91410 2.51497 3.86778 2.83786 2.95074 2.24490 2.43049
3.00556
5.34651 3.93774 41 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
41 3.32262 4.56891 5.24679 4.77118 3.84175 4.81012 5.48421 1.14831
4.68143 2.30177 3.60891 4.94823 5.08094 4.93596 4.85577 4.22682 3.58792
0.99460
5.88795 4.67682 42 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
42 2.65825 5.10541 2.72992 2.15627 3.98363 3.31023 3.53625 3.89170
2.18852 3.23731 4.15424 2.23857 3.82936 2.65748 2.86654 2.25743 2.79796
3.48165
5.55380 4.15800 43 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
43 2.61182 4.52680 3.60621 3.51889 4.78008 0.61583 4.68006 4.23876
3.72062 3.95294 4.83622 3.66170 4.02536 4.00392 3.97409 2.79132 2.85714
3.64017
6.05621 4.90618 44 - -
199

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
44 2.79049 5.22667 2.25221 2.33027 4.53369 3.27947 3.53614 4.00930
2.56097 3.52971 4.31450 1.59788 3.89352 2.86397 3.06987 2.39242 3.03945
3.49407
5.69864 4.13140 45 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
45 2.49378 3.36932 2.74714 2.42229 4.10830 3.46961 3.68039 3.52770
2.44255 3.12654 3.93602 2.51463 3.86384 2.82770 2.94369 2.19290 2.51568
3.13211
5.36588 3.76024 46 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
46 2.69732 4.16858 4.15640 3.57668 3.28068 3.80998 4.13366 1.64485
3.45403 1.84904 3.26899 3.79253 3.96991 3.68559 3.64246 2.81777 2.62992
2.15853
4.82146 3.52063 47 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
47 4.19233 5.38393 4.84605 4.67977 3.27817 4.29458 4.57157 4.26819
4.41284 3.57367 4.87507 4.74845 4.85287 4.77414 4.45256 4.39169 4.52083
4.16862
0.32020 3.26075 48 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
48 3.20149 5.67973 0.78816 2.34486 4.76934 3.43076 3.17601 4.55895
3.07436 4.04716 4.94146 2.92732 4.07402 3.21129 3.65781 3.08955 3.50632
4.14006
6.03658 4.51417 49 - -
200

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
49 2.76346 4.98544 3.15831 2.56957 4.01057 3.55403 3.68400 3.67589
1.47331 2.89158 4.05158 3.07047 3.93382 2.56322 2.45400 2.78078 2.98070
3.34485
5.41794 3.49426 50 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
50 2.64257 4.43619 3.56736 3.08202 3.77537 3.52079 4.05811 2.42620
3.00927 2.79176 3.72810 2.99222 4.03030 3.35753 3.34645 2.85418 1.35329
2.62966
5.23131 3.98292 51 - -
2.68619 4.42226 2.77521 2.73124 3.46340 2.40514 3.72496 3.29355 2.67742
2.69356 4.24691 2.90348 2.73741 3.18148 2.89802 2.37888 2.77521 2.98520
4.58478
3.61472
0.08832 2.54971 5.04648 0.37639 1.15942 0.48576 0.95510
51 2.52068 4.47414 3.35565 2.74391 3.33968 3.48613 3.81115 3.00228
2.76056 2.69538 3.20591 3.24034 3.68619 2.82417 3.12828 2.08694 2.32290
2.59916
4.31681 3.78415 53 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
52 2.77860 4.87789 1.42239 2.56155 3.13731 3.54366 3.74371 3.49507
2.67769 3.09585 3.97167 3.06454 3.97169 2.99708 3.12924 2.82286 3.01884
3.20614
4.04928 3.59798 54 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
53 2.94931 5.28328 2.08563 2.39481 4.84632 1.16425 4.00151 4.36230
3.01231 3.90219 4.74326 2.45548 3.99074 3.18038 3.56729 2.91382 3.29175
3.89959
6.06470 4.62009 55 - -
201

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68621 4.42228 2.77522 2.73126 3.46357 2.40509 3.72497 3.29357 2.67727
2.69358 4.24693 2.90346 2.73742 3.18149 2.89804 2.37878 2.77522 2.98521
4.58480
3.61506
0.08509 2.58845 5.04648 0.73284 0.65497 0.48576 0.95510
54 3.21633 0.35479 4.79708 4.65548 4.57914 3.72194 5.20787 3.82938
4.49870 3.70850 4.85167 4.53077 4.45916 4.82584 4.53365 3.48556 3.72159
3.53505
5.86530 4.85631 59 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
55 4.07603 5.22780 4.94333 4.71701 1.81696 4.70604 3.64405 3.73694
4.54415 3.00155 4.31962 4.34626 5.01267 4.44587 4.52415 4.10863 4.29875
3.67538
3.75731 0.60600 60 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
56 3.29932 4.57114 5.13914 4.65306 3.79025 4.73170 5.36042 1.62171
4.54191 2.21256 3.57888 4.84627 5.01963 4.80796 4.72647 4.13701 3.56571
0.76183
5.80720 4.58938 61 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
57 1.40302 4.31490 3.77731 3.44350 4.52474 3.10962 4.46137 3.90675
3.45708 3.61908 4.43729 3.53676 3.86941 3.73557 3.76041 1.18441 2.55005
3.34107
5.86901 4.67381 62 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
58 3.16638 5.52729 0.80512 2.42994 5.07620 2.30005 4.12607 4.65042
3.22647 4.16769 5.05164 2.99972 4.08759 3.32219 3.82773 3.09290 3.51563
4.17606
6.23444 4.80691 63 - -
202

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
59 3.11990 4.36544 4.32127 3.81191 2.17745 4.09367 3.78203 3.04592
3.23806 2.64903 3.67717 3.91110 4.44159 3.85035 3.84946 3.39383 3.34718
2.77912
3.74216 1.06936 64 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
60 3.51146 4.91649 4.45325 4.08004 2.02567 4.31163 3.69403 3.46524
3.96389 2.92976 4.07889 4.05659 4.68281 4.07537 4.10672 2.99801 3.75887
3.31559
3.91189 0.78971 65 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01987 4.32413 5.04648 0.61958 0.77255 0.48576 0.95510
61 2.72553 4.31253 4.16671 3.66674 3.67680 3.72642 4.41126 2.29394
3.56150 2.58708 3.60951 3.86666 4.24179 3.84789 3.80334 2.76599 2.38224
1.10833
5.25833 4.04936 66 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02985 4.32413 4.12501 0.61958 0.77255 0.48576 0.95510
62 2.51216 5.16569 2.33791 2.35923 4.49437 3.19374 3.66109 3.96480
1.64210 3.46558 4.22781 2.83561 3.85394 2.71011 2.84192 2.54559 2.88860
3.55105
5.61534 4.21583 67 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02007 4.31435 5.03670 0.61958 0.77255 0.49963 0.93333
63 2.49188 4.38955 3.59551 3.16295 4.09719 3.28177 4.17679 3.38911
3.04040 3.15453 4.02841 3.43067 3.92288 3.44894 3.44644 2.11805 1.20176
2.68117
5.48692 4.25411 68 - -
203

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02007 4.31435 5.03670 0.61958 0.77255 0.49963 0.93333
64 1.89508 4.31720 3.70048 3.48388 4.63634 0.95179 4.55159 4.00807
3.58485 3.73760 4.55934 3.55250 3.87506 3.84242 3.86415 2.56592 2.50453
3.40204
5.97883 4.79808 69 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.03953 4.31435 3.67355 0.61958 0.77255 0.49963 0.93333
65 2.63597 3.39258 3.14566 2.45530 3.91792 3.49097 3.54341 3.31288
2.40023 2.95698 3.79792 3.08785 3.89316 2.92081 3.00148 1.97899 2.29007
2.96915
5.24220 3.94276 70 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02046 4.29528 5.01763 0.61958 0.77255 0.52575 0.89432
66 2.59137 4.97540 2.68695 2.29850 4.05453 3.34590 3.64946 3.59380
2.42308 3.26160 4.04572 2.57932 3.83844 2.77492 2.90216 1.98570 2.44689
3.22530
5.46068 4.09334 71 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02046 4.29528 5.01763 0.61958 0.77255 0.52575 0.89432
67 2.36239 3.82492 3.07537 2.52645 4.05085 1.94430 3.77137 3.45853
2.53920 3.08721 3.91418 2.86394 3.87403 2.94691 3.05153 2.46988 2.65768
3.12923
5.35184 4.04208 72 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02046 4.29528 5.01763 0.61958 0.77255 0.52575 0.89432
68 2.51473 4.23017 3.73065 3.15738 2.96324 3.66009 3.93184 2.62617
3.08387 2.43082 2.74387 3.49391 3.33993 3.35931 3.14679 2.64784 2.86016
2.49302
4.81896 2.22311 73 - -
204

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02046 4.29528 5.01763 0.61958 0.77255 0.52575 0.89432
69 2.33893 4.26290 4.21737 3.66773 3.27773 3.87203 4.32579 2.12233
3.56960 2.41061 3.43058 3.89614 4.28394 3.82133 3.79298 2.87144 3.03565
1.21453
5.06701 3.86005 74 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02293 4.29528 4.70670 0.61958 0.77255 0.52575 0.89432
70 2.49593 4.60476 3.23381 2.52485 3.79749 3.53767 3.76569 3.14297
2.26081 2.40764 3.70182 3.15412 3.92810 2.98301 3.03430 2.76728 2.09050
2.55846
5.16115 3.88294 75 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02051 4.29287 5.01521 0.61958 0.77255 0.52898 0.88967
71 2.60687 5.12624 2.52016 2.23382 4.44833 2.55208 3.64005 3.91884
2.12896 3.37075 4.18386 2.86694 3.03933 2.74997 2.89501 2.33562 2.83629
3.50672
5.58015 4.17955 76 - -
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.02051 4.29287 5.01521 0.61958 0.77255 0.52898 0.88967
72 2.57816 5.12677 2.87095 2.24649 4.45454 3.41210 3.40077 3.91086
1.59193 3.41242 4.17909 2.90547 3.85681 2.60853 2.68264 2.65653 2.67555
3.50960
5.55782 4.18309 77 - -
2.68618 4.42225 2.77520 2.73117 3.46354 2.40513 3.72495 3.29354 2.67741
2.69355 4.24690 2.90347 2.73740 3.18147 2.89801 2.37887 2.77520 2.98519
4.58477
3.61503
0.09497 3.41028 2.85473 0.52137 0.90068 0.52898 0.88967
73 3.08258 0.42515 4.66004 4.49479 4.42412 3.61311 5.06351 3.64868
4.33208 3.53771 4.67608 4.38809 4.34603 4.66309 4.38494 3.35266 3.58099
3.36315
5.74041 4.70439 79 - -
205

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
2.68618 4.42225 2.77519 2.73123 3.46354 2.40513 3.72494 3.29354 2.67741
2.69355 4.24690 2.90347 2.73739 3.18146 2.89801 2.37887 2.77519 2.98518
4.58477
3.61503
0.01461 4.23357 * 0.61958 0.77255 0.00000 *
I/
Example 12: Determination of DomT scores
The DomT scores for the LAD domain and the LED domain of the LYS polypeptides
of
the invention were determined using the LAD Catalytic Domain HMM from Example
10 and the
Lysozyme Enhancing Domain HMM from Example 11 as described herein are
presented in
table 5 below.
206

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Table 5: DomT scores for LAD and LED domains
LAD domain LED domain
Sequence Amino acid Amino acid
DomT score DomT
score
numbers numbers
SEQ ID NO: 3 84 to 226 202.5 1 to 73
118.3
SEQ ID NO: 6 84 to 226 195.4 1 to 73
118.5
SEQ ID NO: 9 81 to 220 199.2 1 to 73
116.7
1 to 72
108.7
SEQ ID NO: 12 161 to 304 193.4
76t0 147
104.6
SEQ ID NO: 15 85 to 228 200.1 1 to 73
125.2
SEQ ID NO: 18 88 to 230 205.3 1 to 73
119.7
SEQ ID NO: 21 87 to 230 201.4 1 to 73
116.9
SEQ ID NO: 24 90 to 232 201.5 1 to 73
119.1
SEQ ID NO: 27 85 to 228 199.8 1 to 73 123
SEQ ID NO: 30 85 to 228 202.8 1 to 73
122.6
SEQ ID NO: 33 84 to 226 198.2 1 to 73
115.2
SEQ ID NO: 36 83 to 222 194.9 1 to 73
113.1
SEQ ID NO: 39 82 to 225 203.0 1 to 72
117.4
1 to 73
115.8
SEQ ID NO: 42 161 to 303 192.6
77 to 149
111.2
SEQ ID NO: 45 85 to 227 208.3 1 to 73
124.9
SEQ ID NO: 329 4t0 146 205.3 - -
All of the claimed LYS polypeptides have a LAD DomT score of at least 170,
indicating
good homology to the LAD HMM model. Likewise all claimed LYS polypeptides have
a LED,
had a LED DomT score of at least 100, indicating good homology to the LED HMM
model.
Example 13: Activity of LYS polypeptides as determined using reducing ends
assay
The LYS polypeptides of the invention were tested according to Example 1 at
two
enzyme concentrations and the results are shown in tables 6 to 8 below.
207

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Table 6: OD Drop of SEQ ID NO: 3
LYS polypeptide OD Drop OD Drop
(5.0 pg/m1)1 (0.7 pg/m1)1
SEQ ID NO: 3 5.4 2.4
1: enzyme concentration
Table 7: OD Drop of SEQ ID NO: 6 to 45
LYS polypeptide OD Drop OD Drop
(5.0 pg/m1)1 (0.7 pg/m1)1
SEQ ID NO: 6 4.4 2.0
SEQ ID NO: 9 5.2 2.7
SEQ ID NO: 12 2.4 1.4
SEQ ID NO: 15 6.7 3.2
SEQ ID NO: 21 3.9 2.2
SEQ ID NO: 24 3.1 1.8
SEQ ID NO: 27 7.8 4.6
SEQ ID NO: 30 8.7 6.0
SEQ ID NO: 33 8.6 5.7
SEQ ID NO: 36 5.4 2.9
SEQ ID NO: 39 7.8 4.8
SEQ ID NO: 42 5.1 3.1
SEQ ID NO: 45 8.5 3.9
SEQ ID NO: 329 5.0 2.3
1: enzyme concentration
As can be seen, the LYS polypeptides of the invention display lysozyme
activity as
determined using the reducing ends assay.
Example 14: Activity of LYS polypeptides as determined using OD drop assay
The LYA polyupeptides of the invention were tested according to Example 2 at
pH4 and
the results are shown in tables 8 and 9 below.
208

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
Table 8: OD Drop against M. luteus
LYS polypeptide OD Drop M. luteus
1 h, pH 4
SEQ ID NO: 3 0.116
SEQ ID NO: 6 0.151
SEQ ID NO: 9 0.121
SEQ ID NO: 12 0.177
SEQ ID NO: 15 0.125
SEQ ID NO: 21 0.113
SEQ ID NO: 24 0.121
SEQ ID NO: 27 0.071
SEQ ID NO: 30 0.081
SEQ ID NO: 33 0.052
SEQ ID NO: 36 0.171
SEQ ID NO: 39 0.154
SEQ ID NO: 42 0.162
Table 9: OD Drop against M. luteus
LYS polypeptide OD Drop M. luteus
1 h, pH 4
SEQ ID NO: 18 0.078
SEQ ID NO: 329 0.063
As can be seen, the LYS polypeptides of the invention display lysozyme
activity as
determined using the traditional OD drop assay against M luteus.
Example 19: Animal feed and animal feed additives comprising a LYS polypeptide
Animal Feed Additive
A formulation comprising the LYS polypeptide of the invention (e.g. SEQ ID NO:
3, 6, 9,
12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45 or 239) containing 0.01g to 10g
enzyme protein is
added to the following premix (per kilo of premix):
5000000 IE Vitamin A
1000000 IE Vitamin D3
13333 mg Vitamin E
1000 mg Vitamin K3
209

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
750 mg Vitamin B1
2500 mg Vitamin B2
1500 mg Vitamin B6
7666 mcg Vitamin B12
12333 mg Niacin
33333 mcg Biotin
300 mg Folic Acid
3000 mg Ca-D-Panthothenate
1666 mg Cu
16666 mg Fe
16666 mg Zn
23333 mg Mn
133 mg Co
66 mg I
66 mg Se
5.8 % Calcium
% Sodium
Animal Feed
20 This is an example of an animal feed (broiler feed) comprising the
animal feed additive
as described above:
62.55 % Maize
33.8% Soybean meal (50% crude protein)
1.0% Soybean oil
25 0.2% DL-Methionine
0.22% DCP (dicalcium phosphate)
0.76% CaCO3 (calcium carbonate)
0.32% Sand
0.15% NaCI (sodium chloride)
1 % of the above Premix
The ingredients are mixed, and the feed is pelleted at the desired
temperature, e.g. 60,
65, 75, 80, 85, 90 or even 95 C.
210

CA 03062980 2019-11-08
WO 2018/206001
PCT/CN2018/086528
The invention described and claimed herein is not to be limited in scope by
the specific
aspects herein disclosed, since these aspects are intended as illustrations of
several aspects of
the invention. Any equivalent aspects are intended to be within the scope of
this invention.
Indeed, various modifications of the invention in addition to those shown and
described herein
will become apparent to those skilled in the art from the foregoing
description. Such
modifications are also intended to fall within the scope of the appended
claims. In the case of
conflict, the present disclosure including definitions will control.
211