Note: Descriptions are shown in the official language in which they were submitted.
CD1D-RESTRICTED NKT CELLS AS A PLATFORM FOR OFF-THE-SHELF
CANCER IMMUNOTHERAPY
[0001] This application claims priority to EP Application No. 17185992.9,
filed August
11,2017,
TECHNICAL FIELD
[0002] The present disclosure concerns at least the fields of cell biology,
molecular
biology, immunology, and medicine.
BACKGROUND
[0003] Cancer immunotherapy with autologous tumor-specific T cells. The
strategy
of isolating and expanding tumor-specific T cells followed by infusion
(adoptive transfer) back
to patients is a promising modality of cancer treatment. Such treatment has
been successful in
some patients with melanoma, who can have complete and sustained tumor
regression following
infusion of autologous melanoma-specific T cells (1). As a treatment for other
less immunogenic
malignancies, however, T-cell therapy has been limited by the paucity of
molecularly-defined
tumor antigens capable of eliciting a robust T-cell response, and by the
difficulty of isolating
these T cells from a tumor-bearing host.
[0004] Cancer immunotherapy with CAR-redirected autologous T cells. The
genetic
modification of T cells with a chimeric antigen receptor (CAR) for re-directed
antigen specificity
is one strategy to generate effector cells for adoptive therapy that does not
rely on pre-existing
anti-tumor T-cell immunity. Recent clinical trials demonstrate that T cells
redirected to the CD19
antigen can induce sustained complete responses in patients with B-cell
leukemia and lymphoma
(2-7). However, T cells obtained from lymphoma patients have a reduced
proliferative capacity
because of the effects of disease and chemotherapy. The reduction in T-cell
expansion during
product manufacture means that only 25% of newly diagnosed and as few as 12.5%
of treated
pediatric lymphoma patients could be infused with autologous CD19 CAR T cells
(8). Similarly
to lymphoma patients, defects in T cell numbers and functions are common in
patients with
many types of cancer (9-12). One way to overcome this limitation is to use T
cells obtained from
healthy individuals that are modified with a tumor-specific CAR and ex vivo
expanded for
infusion to cancer patients. However, beyond a small fraction of patients
eligible for allogeneic
1
Date Recue/Date Received 2021-04-19
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
stem cell transplantation, HLA-mismatched T cells cannot be used because they
would cause
graft-vs-host disease (GvHD) and/or be rejected by patient's immune system.
[0005] Genetic deletion of TCR in T cells to avoid GvHD. One approach to
generate
GvHD-incapable CAR T cells from an unmatched healthy donor was demonstrated by
Qasim et
al. using gene editing to simultaneously introduce a CAR and disrupt TCR in T
cells (13). TCR
gene was deleted from T cell genome in that study using transcription
activator-like effector
nuclease (TALEN) technology, which introduced off-target genetic alterations
(13).
[0006] Natural Killer T cells (NKTs) have anti-tumor effector functions and
naturally avoid GvHD. NKTs arc an evolutionarily conserved subset of innate
lymphocytes that
are characterized by the expression of invariant TCR a-chain Voc24-Ja18 and by
reactivity to
glycolipids presented by the monomorphic HLA class-I-like molecule CD 1d (14-
17). NKTs have
numerous anti-tumor properties and their numbers have been reported to
correlate with good
outcome in several types of cancer (18). Heczey A. et al and Gian T. et al.
demonstrated that
NKTs can be isolated from peripheral blood, transduced with a CAR and expanded
to clinical
scale for adoptive cell therapy applications (19, 20). Several studies have
shown that donor-
derived NKTs do not mediate GvHD and even may suppress it (21, 22). Therefore,
allogeneic
healthy donor-derived CAR NKTs could be used to treat cancer patients without
a risk of GvHD
that, in contrast to T cells, does not require additional genetic
manipulation.
[0007] Elimination of allogeneic therapeutic cells by host immune system. All
normal
nucleated cells express HLA class 1 and therefore adoptively transferred
therapeutic cells from
HLA mismatched donors will be eliminated by the host immune system. T and NKT
cells can
also transiently express HLA class II when activated, and HLA class 11
mismatch triggers donor
cell elimination by host CD4 T cells. A common approach to delay such
rejection is to use of
immunosuppressive host conditioning to allow a therapeutic window for effector
cells to mediate
anti-tumor activity before recovery of the host immune system. However, such
approach is toxic
to patients and may not allow complete tumor control due to insufficient
persistence of the
therapeutic effector cells.
[0008] Expression of HLA class I molecules on cell surface depends on 132-
microglobulin (B2M). It is well established that in order to be expressed on
the cell surface
HLA class I molecules require B2M (23). Hence targeting B2M in donor-derived
effector cells
would disrupt HLA class I expression and prevent their recognition by host CD8
T cells.
2
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
However, HLA class I molecules also serve as inhibitory ligands for NK cells
and the loss of
B2M expression is expected to make donor cells susceptible to killing by host
NK cells (24). It is
unknown whether a certain level of B2M/HLA class I expression can be achieved
in donor cells
that would be sufficient to prevent activation of host CD8 T cells without
triggering host NK-cell
cytotoxicity. Finding such range of B2M expression in NKTs would enable a
prolonged
tolerance of cancer patients to therapeutic NKTs or CAR NKTs from HLA
unmatched healthy
donors that will allow lasting anti-tumor activity without a risk of GvHD.
[00091 Expression of HLA class II molecules on cell surface depends on HLA-DR
antigens-associated invariant chain (Ii, also referred to as CD74). The
invariant chain facilitates
MHC class Ifs export from the ER and is required for proper antigen loading
and surface
expression of MHC class II/antigen complexes. T cells are known to transiently
express MHC
class II on their cell surface upon activation, e.g. antigen recognition. The
disclosure describes
the finding that NKT cells also upregulate MHC class II expression on the cell
surface following
TCR stimulation (FIG. 3A). Therefore, the inventors sought to attenuate NKT
cell rejection by
host CD4 T cells via downregulation of MHC class II by targeting Ii
expression. Moreover, it
was characterized whether combined targeting of B2M and Ii in NKTs would
further prolong
tolerance of cancer patients to therapeutic NKTs or CAR NKTs from HLA
unmatched healthy
donors and maximize their anti-tumor activity without a risk of GvHD.
BRIEF SUMMARY
[0010] Embodiments of the disclosure include cells, such as from a donor, that
are
manipulated to be tolerated by a host, for example to avoid undesirable host
immune responses;
methods of use of the cells are also encompassed in the disclosure, including
as an
immunotherapy. In specific embodiments, the cells are for use in immunotherapy
and may be
considered to be utilized off-the-shelf. The cells are suitable for adoptive
therapy, in particular
embodiments. The cells avoid GvHD in a subject, in particular embodiments. The
cells may be
utilized in one or more hosts, including cells from the same plurality of
engineered cells for use
in one or more hosts. In particular cases, the cells to be provided to a
subject have had one
manipulation to achieve the ability to avoid host immune cells and, in some
cases, also to
provide tumor specificity for cell destruction. In some cases the disclosure
encompasses one-hit
generation of tumor-specific and universally tolerated NKT cells from healthy
donors for off-the-
shelf immunotherapy, including for cancer. In particular cases, cells
encompassed by the
3
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
disclosure are able to prevent activation of allogeneic CD8 T cells or CD4 T
cells including
without triggering killing by allogeneic NK cells. In such cases the cells are
NKT cells that are
engineered to express little or no HLA class I molecules, and these cells,
surprisingly, remain
resistant to killing by the host NK cells. The NKT cells as used herein may
include iNKT,
UTNKT, or natural killer T cells, for example. In some cases donor cells are
able to be utilized
for immunotherapy of HLA unmatched subject, including those with cancer. In
specific cases,
RNA interference is used with B2M-specific shRNAs, and a range of B2M and HLA
class I
expression can be found in NKT cells that would prevent activation of
allogeneic CD8 T cells
without triggering killing by allogeneic NK cells. In specific cases, RNA
interference is used
with Ii-specific shRNAs, and downregulation of Ii and HLA class II expression
can be found in
NKT cells that would prevent activation of allogeneic CD4 T cells. In some
specific cases,
B2M-specific shRNA, Ii-specific shRNA, or both and a tumor-specific CAR can be
engineered
to be expressed within a single retroviral construct for a one-hit generation
of tumor-specific and
universally tolerated healthy donor-derived NKT cells for immunotherapy of HLA
unmatched
cancer patients. In particular embodiments, the cells are not derived from
induced pluripotent
stem cells. The cells are resistant to elimination by NK cells, in specific
aspects.
[00111 In one embodiment of the disclosure, there is an isolated NKT cell or a
plurality
of cells thereof, having reduced expression of endogenous beta-2-microglobulin
(B2M) and/or
MHC class II-associated invariant chain (Ii), or both. The cells have reduced
expression of B2M
and/or Ii because of manipulation by the hand of man and are not located in
nature or similar to
cells in nature. The reduced expression may be further defined as a knockout
or a knockdown in
the cells. In specific embodiments, the cell or cells comprise one or more
agents that target the
B2M gene and/or Ii gene, such as one or more synthetic DNA or RNA that targets
the B2M gene
or Ii gene, for example the 3' end of the B2M or Ii gene. In certain cases,
the synthetic RNA is a
shRNA or a CRISPR guide RNA.
[00121 In particular embodiments of the disclosure, a cell or cells that have
reduced
expression of endogenous B2M and/or Ti comprise one or more engineered
receptors, such as a
chimeric antigen receptor or a T cell receptor. In some cases, the NKT cell or
cells
recombinantly express one or more cytokines and/or one or more cytokine
receptors, such as IL-
15, IL-15Ra, IL-7, IL-12, IL-18, IL-21, IL-27, IL-33, or a combination
thereof. In some cases,
the NKT cell or cells have reduced expression of a second endogenous gene. In
particular cases
the cell or cells are autologous or allogeneic in reference to a subject.
4
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
[0013] In one embodiment, there is a method of generating the NKT cell or
cells as
encompassed herein by exposing NKT cells to one or more agents that reduce
expression of
endogenous B2M and/or MHC class II-associated invariant chain (Ii) in the cell
or cells. The
agent may be of any kind, including without being limited to a DNA vector,
morpholinos, an
antisense RNA, antigomer RNA, siRNA, S-DNA, TALEN, Zinc finger nuclease (ZFN)
or a
CRISPR guide RNA. Said DNA vector encodes an agent that inactivates or reduces
expression
of one or more target gene. In some cases. the NKT cells are manipulated to
express one or more
entities other than manipulation to have reduced expression of endogenous B2M,
such as
manipulated to have one or more engineered receptors and/or one or more
cytokincs. In some
cases cells other than NKT cells are employed.
[0014] In some embodiments, there are a cell or cells as encompassed herein
for use in
the treatment of a medical condition in a subject, such as cancer. In some
cases, the cancer is of
the brain, lung, breast, prostate, pancreas, skin, kidney, liver, testes,
ovary, gall bladder, spleen,
endometrium, cervix, esophagus, thyroid, pituitary gland, stomach, colon,
anus, blood, bone,
bladder, bile duct, head and neck, oral cavity, salivary gland, small
intestine, and/or urethra, or
premalignant conditions, such as myelodysplastic syndrome (MDS).
[0015] In specific embodiments there is a composition comprising an allogeneic
cell or
allogeneic cells as encompassed herein for use in the treatment of a medical
condition, preferably
cancer or a premalignant condition, in a subject.
[0016] In some embodiments, there is a method of treating a medical condition
in a
subject by providing to the subject an effective amount of one or more cells
as encompassed
herein. The medical condition may or may not be cancer. In some cases the
cells are allogeneic
in reference to the subject, although in alternative cases they are autologous
to the subject. In
particular embodiments they arc NKT cells.
[00171 The foregoing has outlined rather broadly the features and technical
advantages of
the present invention in order that the detailed description of the invention
that follows may be
better understood. Additional features and advantages of the invention will be
described
hereinafter which form the subject of the claims of the invention. It should
be appreciated by
those skilled in the art that the conception and specific embodiment disclosed
may be readily
utilized as a basis for modifying or designing other structures for carrying
out the same purposes
of the present invention. It should also be realized by those skilled in the
art that such equivalent
constructions do not depart from the spirit and scope of the invention as set
forth in the appended
claims. The novel features which are believed to be characteristic of the
invention, both as to its
organization and method of operation, together with further objects and
advantages will be better
understood from the following description when considered in connection with
the
accompanying figures. It is to be expressly understood, however, that each of
the figures is
provided for the purpose of illustration and description only and is not
intended as a definition of
the limits of the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] For a more complete understanding of the present invention, reference
is now
made to the following descriptions taken in conjunction with the accompanying
drawing, in
which:
[0019] FIG. 1. NKT cells do not proliferate in the presence of allogeneic
PBMC.
Carboxyfluorescein succinimidyl ester (CFSE)-labeled NKT cells were co-
cultured at 5:1 ratio
with irradiated allogenic PBMC as stimulator cells. Autologous PBMC alone or
pulsed with
aGalCer served as a negative or a positive control, respectively. NKT cell
proliferation was
assessed by CFSE dilution as measured by flow cytometry on day 6. Results are
from a
representative of 4 experiments.
[0020] FIGS. 2A, 2B, and 2C. CRISPR/Cas9 knockout and shRNA knockdown of
02-microg1obulin (B2M) expression. (2A) Representative flow cytometry analysis
of B2M
expression (left) and HLA ABC expression (right) in NKT cells 96 h following
electroporation
with Cas9 only or Cas9/hB2M -sgRNA. (2B) A representative flow cytometry
analysis of B2M
and HLA ABC expression in NKT cells after further purification by depletion of
B2M positive
cells using Anti-APC MicroBeads (Miltenyi Biotec) following electroporation
with Cas9 only
or Cas9/hB2M -sgRNA (2C) A representative flow cytometry analysis of
Lentivirus-mediated
B2M shRNA causing downregulation of B2M (top) and HLA ABC (bottom) expression
in
NKT cells. Results are from a representative of 5 donors tested.
[0021] FIGS. 3A and 3B. Knockdown of ALA class II expression using Ii (C074)-
targeted shRNA. (3A) Representative flow cytometry analysis of HLA DP-DQ-DR
expression
in resting NKT cells (day 15 after stimulation) and activated NKT cells (day 2
after stimulation)
using Pacific Blue-conjugated anti-HLA DP-DQ-DR mAb. (3B) Representative flow
cytometry
6
Date Recue/Date Received 2021-04-19
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
analysis of lentivirus-mediated Ii shRNA causing downregulation of HLA DP-DQ-
DR on the
surface of transduced NKT cells. Results are from a representative of 5 donors
tested.
[0022] FIGS. 4A and 4B. B2M-targeting with CRISPR and shRNA are equally
effective in reducing NKT-cell stimulation of CD4+ and CD8+ T cells in an
allogeneic
mixed lymphocyte reaction (MLR) assay. (4A) CFSE-labeled T cells were co-
cultured at 5:1
ratio with WT, B2M"11(CRISPR), B2MI" (shRNA), or Ii1" (shRNA) NKTs.
Proliferation of
CD8+ and CD4+ T cells was assessed on day 5 after stimulation as measured by
CFSE dilution.
(4B) Results are from a representative of 3 donors tested. *P<0.05, **p<0.01
compared with WT
NKTs.
[0023] FIGS. 5A and 5B. B2M0uilil0W NKTs are minimally susceptible to alto NK-
cell
cytotoxicity. (5A) The healthy donor-derived WT, B2M"11(CRISPR) or B2M1"
(shRNA) NKT
cells were labeled with calcein-AM and incubated 4 hours with allogeneic NK
cells derived from
an unrelated healthy donor at effector-to-target ratios of 10:1, 5:1, and 1:1.
NK-sensitive K562
cells that naturally lack inhibitory HLA class I ligands were used as a
positive control. (5B)
Quantification of the mean percentage of specific lysis is shown. Data
represent mean SD.
N=3; *P<0.05, **p<0.01 compared with the control WT cells.
[0024] FIGS. 6A and 6B. Generation of retroviral vectors that express CAR and
shRNA. (6A) Schematic Diagram of CAR/shRNA constructs: U6 promoter and shRNA
are put
downstream of CAR with the opposite (1) or the same direction (2).
Additionally, U6 promoter
and shRNA are put upstream of EF1 promoter-driven CAR with the same (3) or the
opposite
direction (4). (6B) Flow cytometry analysis of CAR and B2M expression in NKT
cells. Results
are from a representative of 5 donors tested.
[0025] FIG. 7. Generation of CD19 CAR constructs expressing either CD28 or
41BB
co-stimulatory domains with or without IL15. Eight constructs were generated
based on two
domain architectures. The first group (39 and 84 constructs) encode the IgG4
hinge, IgGi CH3
spacer. CD28 TM, and either a CD28 or 4-1BB co-stimulatory domain, all with or
without 1L15.
The second group (28 and 41 constructs) encode the CD8a hinge and TM with
either the CD28
or 4-1BB co-stimulatory domain, all with or without 1L15. The 28 and 41
constructs were
generated by joining fragments containing either the CD28 or 41BB co-
stimulatory domain,
respectively, with the FMC63 scFv. The 2A and IL15 sequences were added to all
constructs
using the Gibson assembly method (New England Biosciences). LTR = long
terminal repeat,
7
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
scFv = single chain variable fragment, TM = transmembrane, 2A = 2A sequence
from equine
rhinitis A virus.
[0026] FIG. 8. Serial bioluminescence imaging of firefly luciferase (Ffluc)-
labeled
Daudi lymphoma cells in mice injected with CD19 CAR NKTs. NSG mice were
injected
intravenously with 2x105 Ffluc+ Daudi lymphoma cells followed three days later
by intravenous
injection of 5x106 NKTs transduced with indicated constructs or no construct
(non-transduced,
NT). Just prior to imaging, mice received 100 1.11, luciferin at 30 mg/mL via
intraperitoneal
injection and were imaged under a bioluminescent channel for 5 min.
Bioluminescent counts
scale 150 - 5000.
[0027] FIG. 9. Survival curves for Daudi lymphoma mice treated with CD19 CAR
NKTs in FIG. 8. Survival probability was analyzed by the Kaplan-Meier method
(eight mice per
group) and comparisons were calculated using the Log-rank (Mantel-Cox) test.
39 vs. 39.15 p =
0.0033,28 vs. 28.15p = 0.0003, 39.15 vs 28.15p = 0.0011, 84 vs. 84.15 p =
0.0039, 41 vs. 41.15
p = 0.1410.
[0028] FIG. 10. Generation of retroviral vectors that express CD19 CAR with
and
without B2M and Ii shRNA. The 28.15 construct was generated as described in
FIG. 7. For
shRNA-containing constructs, B2M and Ii shRNA sequences linked to individual
U6 promoters
(Sigma-Aldrich) were ligated individually or together to 28.15 downstream of
the CAR in the
opposite transcriptional direction by Gibson assembly. LTR = long terminal
repeat, scFv = single
chain variable fragment, TM = transmembrane, 2A = 2A sequence from equine
rhinitis A virus.
[0029] FIGS. 11A-11F. shRNA knockdown of B2M and Ii expression. (11A)
Representative flow cytometry analysis of CD19 CAR expression. NKTs were
transduced with
the indicated constructs four days after antigenic stimulation and stained
with Alexa 647-
conjugated anti-FMC63 mAb. Non-transduced (NT) NKTs served as control.
Representative
flow cytometry analyses of (11B) B2M, (11C) HLA ABC, (11D) II, and (11E) HLA
DP-DQ-DR
expression in NKT cells transduced with indicated constructs or NT NKTs. Cells
were stained
with anti-FMC63 mAb and 1) PE-conjugated anti-B2M antibody with FITC-
conjugated anti-
HLA ABC antibody or 2) PE-conjugated anti-Ii antibody with FITC-conjugated
anti-HLA DP-
DQ-DR antibody. Samples were gated on CAR positive cells. Results are from a
representative
of 3-5 donors tested. (11F) Quantification of indicated gene knockdown in CAR-
shRNA NKTs
versus CAR NKTs.
8
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
[0030] FIG. 12. B2M/Ii shRNAs do not impact CAR-directed in vitro cytotoxicity
of
CAR uTNKT cells. NKTs transduced with the indicated CD19 CAR-shRNA constructs
or non-
transduced (NT) were co-cultured for six hours with luciferase-positive Daudi
(CD19-positive)
target cells at the specified effector-to-target ratios. NKT cytotoxicity was
determined as a
function of target cell bioluminescence following co-culture.
[0031] FIG. 13A, 13B, and 13C. Unmatched CD8 and CD4 T cells show
diminished alloreactivity to CAR uTNKT cells in an allogeneic MLR assay. (13A)
Schematic of expected results for T cell in allogeneic MLR assay. Allogeneic
CD8+ or CD4+ T
cell recognition of MHC class I and MHC class II, respectively, on parental
NKTs will lead to T
cell proliferation. Downregulation of MHC class I via B2M knockdown or MHC
class II via Ii
knockdown in uTNKTs will lead to a relative decrease in allogeneic T cell
proliferation. (13B)
CFSE-labeled CD8 or (13C) CD4+ T cells were co-cultured with CAR uTNKT cells
expressing
indicated constructs or non-transduced (NT) NKT cells at a 1:5 (T:NKT) ratio.
T cell
proliferation was assessed five days after stimulation as measured by CFSE
dilution. Results are
from a representative of three donors tested.
[0032] FIGS. 14A and 14B. 'NKT cells are less susceptible to allogeneic T cell
cytotoxicity than parental NKTs. (14A) Schematic of expected results for NKT
and uTNKT
cells in T cell cytotoxicity assay. Allogeneic T cells will recognize MHC
molecules on parental
NKTs as foreign, leading to death of these NKT cells. Downregulation of MHC
molecules on
uTNKTs will allow these cells to evade T cell cytotoxicity better than
parental NKTs. (14B)
Allogeneic T cells were incubated with CAR uTNKTs or non-transduced (NT) NKTs
at a 1:1
ratio for four days. NKT cell counts were determined by flow cytometry using
counting beads
(Invitrogen). * p <0.05, ** p <0.01 compared with NT NKTs.
[0033] FIGS. 15A and 15B. uTNKT cells are minimally susceptible to NK cell
cytotoxicity. (15A) Schematic of expected results for NK cell cytotoxicity
assay. NK cells do
not kill parental NKTs that express MHC class I, but do usually kill target
cells lacking MHC 1.
uTNKTs will express enough MHC Ito evade killing by NK cells. (15B) NK cells
from healthy
donors were co-cultured for four hours with calcein AM-labeled uTNKTs at a 5:1
ratio. Target
cell lysis is shown as a function of retained calcein-AM fluorescence as
determined by flow
cytometry, mean SD, N=3; ** p <0.01. NS: not significant.
9
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
[0034] FIGS. 16A and 16B. Serial bioluminescence imaging of Ffluc-labeled
Daudi
lymphoma cells in mice injected with CAR.CD19 uTNKTs. (16A) NSG mice were
injected
intravenously with 2x105Ffluc+ Daudi lymphoma cells followed three days later
by intravenous
injection of 5x106 CAR.CD19 uTNKTs transduced with indicated constructs or no
construct
(non-transduced, NT). Just prior to imaging, mice received 100 pl., luciferin
at 30 mg/mL via
intraperitoneal injection and were imaged under a bioluminescent channel for 5
min (16B).
Bioluminescent counts scale 150¨ 5000.
[0035] FIG. 17. Survival curves for Daudi lymphoma mice treated with CAR.CD19
uTNKTs in FIG. 16. Survival probability was analyzed by the Kaplan-Meier
method (10 mice
per group) and comparisons were calculated using the Log-rank (Mantel-Cox)
test. **** p <
0.0001.detailed description
[0036] As used herein the specification, "a" or "an" may mean one or more. As
used
herein in the claim(s), when used in conjunction with the word "comprising",
the words "a" or
"an" may mean one or more than one. As used herein "another" may mean at least
a second or
more. In specific embodiments, aspects of the invention may "consist
essentially of" or "consist
of' one or more sequences of the invention, for example. Some embodiments of
the invention
may consist of or consist essentially of one or more elements, method steps,
and/or methods of
the invention. It is contemplated that any method or composition described
herein can be
implemented with respect to any other method or composition described herein.
The scope of
the present application is not intended to be limited to the particular
embodiments of the process,
machine, manufacture, composition of matter, means, methods and steps
described in the
specification.
[0037] The term "therapeutically effective amount" or "effective amount" as
used herein
refers to that amount which, when administered to a subject or patient for
treating a disease, is
sufficient to effect such treatment for the disease, including to ameliorate
at least one symptom
of the disease.
[0038] NKT cells having reduced expression of endogenous beta-2-microglobulin
(B2M)
and/or endogenous MHC class II-associated invariant chain (Ii) refers to cells
wherein the level
of endogenous beta-2-microglobulin (B2M) and/or endogenous MHC class II-
associated
invariant chain (II) expression is reduced when compared to unmodified NKT
cells. In one
embodiment, the level of endogenous beta-2-microglobulin (B2M) and/or
endogenous MHC
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
class II-associated invariant chain (Ii) expression is reduced by at least
50%, 55%. 60%, 65%,
70%, 75%, 80%, 85%, 90%, 95%. more preferably 100%.
[0039] The terms "downregulating", "downregulation" and the like refers to the
decrease,
reduction, elimination and/or inhibition of gene expression of one or more
genes. As such, the
term encompasses both terms "knockdown" and "knockout".
[0040] As used herein, the term "knockdown" refers to the decrease or
elimination of
gene expression of one or more genes.
[0041] The term "knockout" as used herein refers to the ablation of gene
expression of
one or more genes.
[0042] As used herein, the term "endogenous" refers to any material from or
produced
inside a cell, whereas the term "exogenous" refers to any material introduced
from or produced
outside an cell.
[0043] As used herein, the term "recombinantly engineered receptor" refers to
a cell
surface receptor that is generated by the hand of man using standard
techniques for genetic
recombination.
I. [0044] Modified NKTs according to the disclosure are resistant to allo-
NK cell
cytotoxicity
[0045] The present disclosure demonstrates that NKT cells can be isolated and
ex viva-
expanded from healthy donors to large numbers while preserving the phenotype
of highly
functional cells, providing a basis for producing NKT cell-based allogeneic
therapeutic products
for therapeutic applications, such as adoptive cancer immunotherapy.
[0046] Owing to the NKT TCR restriction by the monomorphic CD 1d, which is
identical
in all humans, the disclosure experimentally demonstrates that NKT cells do
not react to PBMC
from unrelated donors. These results indicate that unlike conventional T
cells, allogeneic NKTs
would not mediate GvHD when transferred to unrelated recipients.
[0047] Like any other cells, NKTs express HLA class I molecules and are
subject to
elimination by the immune system of HLA mismatched recipients, primarily by
HLA class 1-
restricted CD8 T cells. The existing knowledge in the field teaches that HLA
class I expression
can be eliminated or reduced by targeting B2M expression. However, it is also
known that HLA
11
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
class I molecules serve as inhibitory ligands for NK cells so that targeting
B2M expression is
expected to trigger NK-cell mediated killing. Thus, the existing state of the
art in the field
suggest that B2M elimination or downregulation in NKTs or any other type of
effector
lymphocytes used in cancer immunotherapy would subject the cells to allo-NK
cell cytotoxicity.
In this disclosure it is demonstrated for the first time that either complete
elimination of B2M
expression, such as via CRISPR-mediated gene deletion, or a graded
downregulation of B2M
expression, such as via shRNA-mediated RNA interference, are equally effective
in reducing
NKT-cell stimulation by allogencic CD8 and CD4 T cells.
[0048] Unexpectedly, as shown herein the majority of NKTs remained resistant
to allo-
NK cell cytotoxicity after CRISPR-mediated B2M knockout and even more so after
shRNA-
mediated B2M knockdown. Considering that shRNA-mediated B2M gene knockdown in
NKTs
is equally effective in reducing T-cell alloreactivity, but makes NKTs less
susceptible to allo-NK
cell cytotoxicity compared with CRISPR-mediated B2M gene knockout, in some
embodiments
shRNA is utilized for targeting B2M expression in NKTs and likely other
effector lymphocytes
(e.g. T, NK, y/8 T, MAIT, 1LCs, etc.) for adoptive cell therapy applications
in allogeneic
settings. Moreover, in contrast to CRISPR and similar genome-editing methods
(e.g., TALEN,
ZFN), shRNA does not cause permanent genetic changes in target cells,
providing a clinically
safer option in at least some cases.
[0049] Finally, it is demonstrated herein for the first time that a B2M-
specific shRNA
and a tumor-specific CAR can be engineered to be expressed within a single
retroviral construct
for a one-hit generation of tumor-specific and universally tolerated healthy
donor-derived NKT
cells for immunotherapy of HLA unmatched cancer patients.
IL [0050] Cells of the Disclosure
[0051] In particular embodiments, cells of the disclosure are cells that have
anti-tumor
effector functions and/or that are able to avoid graft-versus-host disease.
Although in particular
embodiments the cells are NKT cells, in other embodiments the cells are T, NK,
T, MAIT, or
ILCs. The cells are not derived from induced pluripotent stem cells, in at
least some cases. In
specific embodiments, the cells have reduced or no expression of HLA class I
and/or class II
molecules and/or of one or more HLA class II molecules. In specific
embodiments, the cells are
unable to be recognized by certain host T cells, such as host CD8 T cells
and/or host CD4 T
cells. In particular embodiments, the cells are manipulated to reduce or
eliminate expression of
12
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
B2M, for example so that expression of HLA class I molecules is reduced or
eliminated in the
cells. Additionally or alternatively, the cells are manipulated to reduce or
eliminate expression
of Ii, for example so that expression of HLA class II molecules is reduced or
eliminated in the
cells. In particular embodiments, the cells of the disclosure are designed
such that the host NK
cells are unable to kill the cells encompassed by the disclosure. In some
embodiments, the cells
of the disclosure are not allo-reactive with host stimulator cells, such as
host PBMCs and lack
the ability to mediate GvHD when adoptively transferred to allogeneic host. In
specific
embodiments, the cells arc resistant to elimination by NK cells.
[0052] In certain embodiments, the present disclosure concerns cells that have
reduced
expression of B2M. The cells that have reduced expression of B2M may have B2M
expression
that is undetectable by standard means in the art or that is detectable but
reduced in the level of
expression compared to cells that have not been manipulated by the hand of man
to have reduced
endogenous expression. The cells may be defined as having a B2M knockout or
knockdown in
expression. In doing so, the cells are HLA class I-negative, in specific
embodiments. In some
embodiments, the present disclosure concerns cells that have reduced
expression of Ii. The cells
that have reduced expression of Ii may have Ii expression that is undetectable
by standard means
in the art or that is detectable but reduced in the level of expression
compared to cells that have
not been manipulated by the hand of man to have reduced endogenous expression.
The cells
may be defined as having a Ii knockout or knockdown in expression. In doing
so, the cells are
HLA class II-negative, in specific embodiments.
[0053] In alternative cases, instead of a partial or complete reduction in the
level of
expression of B2M or Ii, the cell may be engineered to express a respective
non-functional
version. For example, the cell may be manipulated to express a B2M and/or li
that is a non-
functional fragment of its full-length or that is full-length but that has one
or more mutations
(point mutation, inversion, deletion, etc.) that impart an impairment of its
standard functionality.
An example of a B2M mutant is one with a defective MHC1 alpha 1 alpha 2 domain
interaction
(Hill etal., 2003).
[0054] In particular embodiments, there is one or more isolated human NKT
cells,
including a plurality of cells thereof, that have reduced or no detectable
expression of the
following: (a) endogenous beta-2-microglobulin (B2M); (b) endogenous MHC class
II-
associated invariant chain (II); or (c) both, wherein the cells are not
derived from induced
13
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
pluripotent stem cells, and wherein the cells are suitable for adoptive
therapy. In particular
embodiments, such characteristics are the direct or indirect reason for the
cells to be resistant to
elimination by NK cells.
[0055] In some cases, the cells are isolated from donors, including healthy
donors,
wherein the cells are selected for one or more certain traits. For example,
the cells may be
selected for the expression of one or more certain markers, such as surface
markers. In specific
embodiments, such marker(s) may be associated with specific beneficial
functions, such as an
increased ability for the cells to expand, persist in vivo after adoptive
transfer, and/or to resist
exhaustion after repeated rounds of tumor cell killing compared to cells that
lack the marker(s),
for example. In specific embodiments, the cells are selected to express a
biomarker selected from
the group consisting of CD62L, CD4, and a combination thereof, and/or to lack
expression or
have low expression of PD1, LAG3, TIM3, TIGIT, etc.
[0056] In specific embodiments, in addition to the cells having reduced
expression of
B2M and/or Ii, the cells may be engineered to express one or more other non-
natural entities,
such as one or more receptors. The receptor(s) may be of any type, and one
cell may have more
than one receptor in addition to having reduced expression of B2M and/or Ii.
In particular cases
the receptor(s) are recombinantly engineered receptors. For example, the
receptor may be a
chimeric antigen receptor (CAR), a chimeric cytokine receptor, T cell
receptors, and so forth. In
cases wherein the cell is modified to express one or more CARs, a single
CAR(s) may target one
or more antigens, including one or more tumor antigens. The tumor antigen
targeted by a
receptor may include 5T4, 8H9, cc,[36 integrin, BCMA, B7-H3, B7-H6, CAIX, CA9,
CD19,
CD20, CD22, CD30, CD33, CD38, CD44, CD44v6, CD44v7/8, CD70, CD123, CD138,
CD171,
CEA, CSPG4, EGFR, EGER family including ErbB2 (HER2), EGFRvIII, EGP2, EGP40õ
ERBB3, ERBB4, ErbB3/4, EPCAM, EphA2, EpCAM, FAP, FBP, fetal AchR, FRa, GD2,
GD3,
Glypican-3 (GPC3), HLA-Al+MAGEL HLA-A1+NY-ES0-1, IL-11Rcc, IL-13Ra2, Lambda,
Lewis-Y, Kappa, KDR, MCSP, Mesothelin, Mud, Muc16, NCAM, NKG2D Ligands, NY-ESO-
1, PRAME, PSC1, PSCA, PSMA, ROR1, SP17, Survivin, TAG72, TEMs,
carcinoembryonic
antigen, HMW-MAA, or VEGFR2, for example. A CAR may be first generation
(comprises
CD3 zeta chain), second generation (comprises CD3 zeta chain and one
intracellular signaling
co-stimulatory endodomain), third generation (comprises CD3 zeta chain and two
or more
intracellular signaling costimulatory endodomains), fourth generation
(inducibly release
recombinant immune modifiers), and so forth. In specific embodiments, the CAR
comprises co-
14
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
stimulatory endodomains selected from the group consisting of CD28, 0X40, 4-
1BB, ICOS,
CD40, CD30, CD27, or a combination thereof. Additionally or alternatively, the
cells may
express one or more recombinant T cell receptors (TCR). In some embodiments,
such TCR may
be modified to achieve high levels of cell surface. suppression as e.g.
described in
W02016170320A1. In some embodiments, such TCR comprises a recombinant
interehain
disulfide bond between extracellular constant domain residues as e.g.
described in
W02006000830A2. In specific embodiments, recombinant TCR expressing cells may
further be
engineered to inducibly release recombinant immune modifiers. Exemplary
recombinant immune
modifiers are antibodies, fragments thereof (such as e.g., scFvs), or antibody
derivatives, which
may e.g. target TNF alpha and/or PD-Ll.
[00571 In some embodiments, the cells are manipulated to express recombinantly
one or
more gene products that would be beneficial to the anti-tumor activity,
expansion, and/or growth
of the cells. Such gene products include one or more cytokines (including at
least, IL-15, IL-7,
IL-12, IL-18, IL-21, IL-27, IL-33, antibody fragments or derivatives such as
scFvs or bispecifics
(e.g., targeting cancer antigens and/or checkpoint inhibitors), or a
combination thereof), and/or
pro-survival cytokine receptors for example IL-7Ra or IL-15Ra. The NKT cells
selected to
express certain one or more gene products may or may not be modified to
express the gene
product(s) recombinantly also. In some embodiments, the cells are manipulated
to downregulate
expression of one or more gene products that target an inhibitory receptor in
the cell (e.g., PD1,
LAG3, TIM3, TIGIT, TGFbR1, IL-10R, etc.).
[00581 In cases wherein the cells are manipulated to express an entity in
addition to being
manipulated to have reduced expression of B2M and/or li, the entity may or may
not be
introduced into the cell by a vector. In some cases, the agent for reducing
expression of B2M
and/or Ii and the entity other than the agent (such as an engineered receptor)
are introduced into
the cell on the same vector, although in other cases they are on different
vectors. In some cases,
the cell may be manipulated to have reduced expression of B2M and/or Ii prior
to manipulation
of the cell to express an additional entity, although in some cases the cell
is manipulated to have
reduced expression of B2M and/or Ii subsequent to manipulation of the cell to
express an
additional entity. In cases wherein they are on the same vector, the agent for
reducing expression
of B2M and/or Ii and the additional entity may be on the same expression
construct and
regulated by the same or different gene regulatory sequence(s) or a different
expression construct
having different gene regulatory sequence(s). In cases where a single vector
is used, the agent
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
for reducing expression of B2M may be 5' or 3 'in a 5' to 3' direction in
relation to the additional
entity, or vice versa.
[0059] In cases wherein the cells are lymphocyte subsets that are not NKT
cells, one can
assess whether the level of B2M downregulation by shRNA is sufficient for
reducing
allogenecity without triggering allo-NK cell killing that could be used for
cancer
immunotherapy: T cells (which may also have deletion of TCR), y/5 T cells,
MAIT cells, NK
cells, and ILCs are examples. In cases wherein non-NKT cells are utilized, the
non-NKT cells
may be required to undergo manipulation not required by the NKT cells.
[0060] In sonic embodiments, in the cells the MHC class II-associated
invariant chain (Ii)
is targeted with an agent (such as shRNA or other standard methods) for
downregulation, thereby
affording downregulation of HLA class II expression in the cells and further
reducing alio-
reactivity mediated by CD4 T cells. In such cases the cells may also be
manipulated to express
recombinantly another entity such as an engineered receptor and/or one or more
cytokines, and
so forth. In specific embodiments the cell comprises a viral (for example,
retroviral) construct
that encodes a CAR with Ii shRNA, although in certain cases the CAR and the Ii
shRNA are on
separate constructs or vectors. In some cases the cells have downregulated Ii
expression but are
not manipulated to have downregulation of expression of B2M.
[00611 In some embodiments, a NKT cell line is provided which stably expresses
reduced levels of B2M and/or Ii or wherein expression of B2M and/or Ii is
stably inactivated.
[0062] In particular embodiments, the cells express constructs (for example,
retroviral
constructs) that have downregulation of both B2M and h. In such cells, there
may be expression
of a CAR and/or other gene product as well. In specific embodiments, the cells
express a CAR
and have downregulation of both B2M and Ii (for example, have both B2M and Ii
shRNAs). In
other specific embodiments, the cells express a recombinant TCR and have
downregulation of
both B2M and Ii (for example, have both B2M and Ii shRNAs).
[0063] In some embodiments, the cells express a complex CAR, e.g., a CAR
construct
and additionally one or more cytokines (e.g., IL-15, IL-7, IL-12, IL-18, IL-
21, IL-27, IL-33, a
combination thereof, etc.) and/or cytokine receptors (receptors for IL-15, IL-
7, IL-12, IL-18, IL-
21, IL-27, IL-33, a combination thereof). In preferred embodiments thereof,
the cells additionally
16
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
express and shRNA for B2M, Ii, or both (or one or more other agents that
target B2M, Ii, or both
other than shRNA).
[00641 In some embodiments, the cells express one or more recombinantly
engineered
receptors, a B2M and/or li shRNA, and a second shRNA targeting another gene.
In specific
embodiments, the cells express a CAR, a B2M and/or Ii shRNA, and another shRNA
targets a
gene encoding an inhibitory receptor in the cells (e.g., PD1, LAG3, TIM3,
TIGIT, TGFbR1, IL-
10R, etc.).
[00651 In specific embodiments, the cells comprise an inducible suicide gene
(such as
caspase-9 or thymidine kinase, for example).
[0066] In another aspect, vectors are provided for a one-hit generation of
tumor-specific
and allo-NK-cell resistant NKT cells for immunotherapy. A vector used to
manipulate the cells
of the disclosure may be of any kind, including a viral vector or a non-viral
vector. Non-viral
vectors include plasmids, and viral vectors include lentiviral, retroviral,
adenoviral, adeno-
associated viral vectors, herpes simplex vints, and so forth. Such vector
encodes for one or more
engineered receptor(s) as defined above together with an agent that reduces
expression of B2M
and/or E. Such agent may be selected from the group consisting of shRNA,
CRISPR system,
such as CRISPR guide RNA, morpholinos, siRNA, antisense RNA, antigomer RNA, S-
DNA,
ZFNs, and TALENs.
[00671 Particular embodiments include viral constructs (such as retroviral or
lentiviral)
that simultaneously encode a CAR and a shRNA in NKTs.
[00681 The allogenic cells that are modified to downregulate B2M and/or Ii may
be
obtained commercially. The allogenic cells may be obtained from a donor and
immediately
processed to have downregulation of B2M and/or Ii, or the allogenic cells may
be obtained from
a repository, including in a fresh or frozen state.
III. [0069] Methods of Producing the Cells
[0070] In particular embodiments, there are methods of generating cells
encompassed by
the disclosure, including cells that have downregulation of B2M, Ii, or both.
Such cells also may
express one or more types of engineered receptors.
17
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
[00711 In some cases the method of producing the cells includes the step of
obtaining
cells to be manipulated, although in other cases the obtaining step is not
included in the method.
The donor cells may be obtained from a healthy subject, including one that
does not have cancer,
for example. The cells may or may not be expanded prior to recombinant
manipulation to
downregulate B2M and/or Ii. In some methods, the cells may be selected to
express or lack
expression of a marker, for example whereupon such selection allows for
enhanced expansion of
the cells. For example, part of thc method of producing the cells may include
steps for selecting
for expression of CD62L, expression of CD4, and/or reduced or absent
expression of PD1.
[00721 Cells may be produced using any one or more agents to effect
downregulation of
expression of B2M, II, or both. Such agents may be of any kind, but in
specific embodiments the
agent is a shRNA, CRISPR system, such as CRISPR guide RNA, morpholinos, siRN
A, antisense
RNA, antigomer RNA, S-DNA, TALENs, ZFNs, and so forth. An example of a B2M
polynucleotide sequence to design nucleic acids that target B2M is in GenBank0
Accession No.
NM_004048. An example of an Ii polynucleotide to design nucleic acids that
target Ii (CD74) is
in the GenBank Accession No. NC 000005. Any shRNA used to generate cells of
the
disclosure may target any region of the target nucleic acid, including the 5'
end or 3' end, or a
region therein between, for example exon 1 or exon 2, etc.
[00731 In particular embodiments, cells of the disclosure are manipulated to
express an
entity other than the agent that downregulates B2M and/or Ti, and the entity
may be an
engineered receptor (in particular as defined above), a cytokine, or another
gene product. In
specific embodiments, the entity is a chimeric antigen receptor (CAR). In some
cases, the step
that renders the cell to downregulate B2M and/or Ii is a concomitant step that
renders the cells
capable of expressing the other entity, although in alternative cases these
are different steps. In
specific embodiments, when the cells are simultaneously engineered to
downregulate B2M
and/or li and to express a CAR (for example), it is because the agent that
downregulates B2M
and/or Ii and the CAR are expressed on the same vector. However, in other
cases the agent that
downregulates B2M and/or Ii and the CAR are expressed from different vectors.
[00741 Methods of the disclosure may or may not include steps of generating
vectors to
be introduced to the donor cells (or expanded progeny thereof). Production of
recombinant
vectors is well-known in the art, and a variety of vectors may be utilized,
including viral or non-
viral vectors. In cases where a single vector encompasses both an agent that
downregulates B2M
18
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
and/or Ii and an engineered receptor such as a CAR (for example), the skilled
artisan recognizes
that design of the vector will take size constraints (for example) for the
cells into consideration.
[0075] In cases wherein the cells to be manipulated are T cells, the
endogenous T cell
receptor of the cells may be downregulated or knocked out, such as using
routine methods in the
IV. [0076] Methods of Using the Cells
[00771 Embodiments of the disclosure include a cell or cells encompassed by
the
disclosure for use in the treatment of a medical condition, such as cancer or
a premalignant
condition, in a subject. The cells may be used for any type of cancer,
including neuroblastoma,
breast cancer, cervical cancer, ovary cancer, endometrial cancer, melanoma,
bladder cancer, lung
cancer, pancreatic cancer, colon cancer, prostate cancer, hematopoietic tumors
of lymphoid
lineage, leukemia, acute lymphocytic leukemia, chronic lymphocytic leukemia, B-
cell
lymphoma, Burkitt's lymphoma, multiple myeloma, Hodgkin's lymphoma, Non-
Hodgkin's
lymphoma, myeloid leukemia, acute myelogenous leukemia (AML), chronic
myelogenous
leukemia, thyroid cancer, thyroid follicular cancer, tumors of mesenehymal
origin, fibrosarcoma,
rhabdomyosarcomas, melanoma, uveal melanoma, teratocarcinoma, neuroblastoma,
glioma,
glioblastoma, benign tumor of the skin, renal cancer, anaplastic large-cell
lymphoma, esophageal
squamous cells carcinoma, hepatocellular carcinoma, follicular dendritic cell
carcinoma,
intestinal cancer, muscle-invasive cancer, seminal vesicle tumor, epidermal
carcinoma, spleen
cancer, bladder cancer, head and neck cancer, stomach cancer, liver cancer,
bone cancer, brain
cancer, cancer of the retina, biliary cancer, small bowel cancer, salivary
gland cancer, cancer of
uterus, cancer of testicles, cancer of connective tissue, prostatic
hypertrophy, myelodysplasia,
Waldenstrom's macroglobinaemia, nasopharyngeal, neuroendocrine cancer
myelodysplastic
syndrome, mesothelioma, angiosarcoma, Kaposi's sarcoma, carcinoid,
oesophagogastric,
fallopian tube cancer, peritoneal cancer, papillary serous mullerian cancer,
malignant ascites,
gastrointestinal stromal tumor (GIST), or a hereditary cancer syndrome
selected from Li-
Fraumeni syndrome and Von Hippel-Lindau syndrome (VHL). In specific
embodiments, the
premalignant condition is myelodysplastic syndrome (MDS).
[0078] In particular embodiments of the disclosure there are methods of
treating a disease
with cells encompassed in the disclosure. Although the disease may be of any
kind, in specific
embodiments the disease is cancer. Any type of cancer may be treated,
including neuroblastoma,
19
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
breast cancer, cervical cancer, ovary cancer, endometrial cancer, melanoma,
bladder cancer, lung
cancer, pancreatic cancer, colon cancer, prostate cancer, hematopoietic tumors
of lymphoid
lineage, leukemia, acute lymphocytic leukemia, chronic lymphocytic leukemia, B-
cell
lymphoma, Burkitt's lymphoma, multiple myeloma, Hodgkin's lymphoma, Non-
Hodgkin's
lymphoma, myeloid leukemia, acute myelogenous leukemia (AML), chronic
myelogenous
leukemia, thyroid cancer, thyroid follicular cancer, myelodysplastic syndrome
(MDS), tumors of
mesenchymal origin, fibrosarcoma. rhabdomyosarcomas, melanoma, uvcal melanoma,
teratocarcinoma, neuroblastoma, glioma, glioblastoma, benign tumor of the
skin, renal cancer,
anaplastic large-cell lymphoma, esophageal squamous cells carcinoma,
hepatocellular
carcinoma, follicular dendritic cell carcinoma, intestinal cancer, muscle-
invasive cancer, seminal
vesicle tumor, epidermal carcinoma, spleen cancer, bladder cancer, head and
neck cancer,
stomach cancer, liver cancer, bone cancer, brain cancer, cancer of the retina,
biliary cancer, small
bowel cancer, salivary gland cancer, cancer of uterus, cancer of testicles,
cancer of connective
tissue, prostatic hypertrophy, myelodysplasia, Waldenstrom's macroglobinaemia,
nasopharyngeal, neuroendocrine cancer myelodysplastic syndrome, mesothelioma,
angiosarcoma, Kaposi's sarcoma, carcinoid, oesophagogastric, fallopian tube
cancer, peritoneal
cancer, papillary serous mullerian cancer, malignant ascites, gastrointestinal
stromal tumor
(GIST), or a hereditary cancer syndrome selected from Li-Fraumeni syndrome and
Von Hippel-
Lindau syndrome (VHL). In specific embodiments, the disease is myelodysplastic
syndrome
(MDS).
[00791 An effective amount of cells of the disclosure having reduced
expression of B2M,
Ii, or both, are provided to a subject in need of therapy with the cells. The
amount may be of any
quantity as long as at least one symptom of the disease is ameliorated. In
specific embodiments,
the cells are provided in a range of at least from about 1 x106 to about 1
x109 cells, even more
desirably, from about 1 x]07 to about 1 x109 cells, although any suitable
amount can be utilized
either above, e.g., greater than lx109 cells, or below, e.g., less than 1x107
cells. In specific
embodiments, one or more doses of the cells are provided to the subject, and
subsequent doses
may be separated on the order of minutes, hours, days, weeks, months or years.
In some cases,
separate deliveries of the cells have different amounts of cells. For example,
an initial dose of
the cells may be greater or lower than one or more subsequent doses.
[0080] The individual being treated may be an adult, adolescent, child, infant
or animal.
The individual may be a mammal, including a human, dog, cat, horse, cow,
sheep, pig, and so
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
forth. The individual may be of any gender, race, genetic background, and so
forth. The
individual may or may not have a personal and/or family history of cancer. The
cells to be
manipulated for downregulation of expression of B2M and/or Ii may or may not
be obtained
from a family member. In cases wherein the individual has cancer, the cancer
may be of any
stage or grade, and the cancer may be primary, metastatic, recurrent,
sensitive, refractory, and so
forth.
[0081] In some cases, one or more therapies in addition to the immunotherapy
of the
disclosure may be provided to the subject, such as surgery, radiation, hormone
therapy, another,
nonidentical irnmunotherapy, chemotherapy, or a combination thereof.
[0082] In some cases, the cells are employed for prevention of cancer in a
subject,
including, for example, a subject with a personal and/or family history of
cancer.
[0083] Cells may be delivered to the subject in any suitable manner, including
by
injection, for example. It is in particular envisaged that the cells are
administered to the subject
via infusion or injection. Administration of the suitable compositions may be
effected by
different ways, e.g., by intravenous, subcutaneous, intraperitoneal,
intramuscular, topical,
parenteral, transdermal, intraluminal, intra-arterial, intrathecal or
intradermal administration.
The cells may be provided by direct injection into a cancer. Administration of
the cells may be
systemic or local.
[0084] The cells may or may not be targeted to a hypoxic environment
associated with
the cancer. In such cases, any regulatory element(s) to effect expression from
an expression
construct(s) in the cell may be effective in hypoxic environments.
[0085] In some embodiments, compositions comprising allogeneic NKTs as
described
herein for use in the treatment of a medical condition, such as cancer or a
premalignant condition
in an individual are provided. Such compositions are off-the shelf products
which can be
administered to any individual, regardless whether the HLA matches or not.
Such composition
has significant advantages for patients with regards to immediate
availability, safety and
therapeutic potential. Further to the cells described herein, said
compositions may comprise,
without being limited to, suspending agents, anti-oxidants, buffers,
bacteriostats and solutes.
21
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
V. [00861 Kits
[00871 Any of the cell compositions described herein and/or reagents to
produce and/or
use the cell compositions may be comprised in a kit. In a non-limiting
example, cells or reagents
to manipulate cells may be comprised in a kit. In certain embodiments, cells
that have reduced
expression of B2M and/or Ii, or a population of cells that comprises NKT cells
that have reduced
expression of B2M and /or Ii, may be comprised in a kit. Such a kit may or may
not have one or
more reagents for manipulation of cells. Such reagents include small
molecules, proteins,
nucleic acids, antibodies, buffers, primers, nucleotides, salts, and/or a
combination thereof, for
example. Nucleic acids (DNA or RNA) or other agents that are capable of
directly or indirectly
reducing expression of B2M and/or Ii may be included in the kit, such as shRNA
or CRISPR
guide RNA. Nucleic acids that encode one or more cytokines, or cytokines
themselves, may be
included in the kit. Proteins, such as cytokines or antibodies, including
agonistic monoclonal
antibodies, may be included in the kit. Substrates that comprise the
antibodies, or naked
substrates themselves, may be included in the kit. Cells that comprise antigen
presenting cell
activity or reagents to generate same may be included in the kit. Nucleotides
that encode
engineered receptors, such as chimeric antigen receptors or chimeric cytokine
receptors or
engineered T-cell receptors, may be included in the kit, including one or more
reagents to
generate same.
[00881 In particular aspects, the kit comprises the cell therapy of the
disclosure and also
another therapy for a particular medical condition, such as a cancer therapy.
In some cases, the
kit, in addition to the cell therapy embodiments, also includes a second
cancer therapy, such as
chemotherapy, hormone therapy, and/or immunotherapy, for example. The kit(s)
may be
tailored to a particular cancer for a subject and comprise respective second
cancer therapies for
the subject.
[00891 The kits may comprise suitably aliquoted compositions of the present
disclosure.
The components of the kits may be packaged either in aqueous media or in
lyophilized form.
The container means of the kits will generally include at least one vial, test
tube, flask, bottle,
syringe or other container means, into which a component may be placed, and
preferably,
suitably aliquoted. Where there are more than one component in the kit, the
kit also may
generally contain a second, third or other additional container into which the
additional
components may be separately placed. However, various combinations of
components may be
comprised in a vial. The kits of the present disclosure also will typically
include a means for
22
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
containing the composition and any other reagent containers in close
confinement for
commercial sale. Such containers may include injection or blow-molded plastic
containers into
which the desired vials are retained.
EXAMPLES
[00901 The following examples are included to demonstrate preferred
embodiments of
the invention. It should be appreciated by those of skill in the art that the
techniques disclosed in
the examples which follow represent techniques discovered by the inventor to
function well in
the practice of the invention, and thus can be considered to constitute
preferred modes for its
practice. However, those of skill in the art should, in light of the present
disclosure, appreciate
that many changes can be made in the specific embodiments which are disclosed
and still obtain
a like or similar result without departing from the spirit and scope of the
invention.
EXAMPLE 1
GENERATION OF TUMOR-SPECIFIC AND UNIVERSALLY TOLERATED NKT CELLS
FROM HEALTHY DONORS FOR OFF-THE-SHELF CANCER IMMUNOTHERAPY
[00911 Screen of healthy donors to select candidates with highly functional
NKTs.
[00921 Since NKT cell frequency in human PBMC varies from less than 0.01% to
more
than 1%, we first analyzed NKT cell frequency among PBMCs isolated from
prospective healthy
donors according to our IRB approved protocol. Next, we expanded NKTs for 12
days in culture
using developed in our lab protocol and quantified the rate of their expansion
and expression of
key surface markers, associated with functional potential: CD62L, CD4 and PD1.
We have
characterized 12 healthy donors. At least 3 donors (# 6, 7, 8) have very high
NKT-cell expansion
potential with good retention of CD62L and low PD1 expression (Table 1).
23
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
Donor ID PBNIC NKT day 0 Percentage NKT DAY
Expand CD62High P01 High CD62High CD4High
(Million) (Million) (%) 12 (Fold) (%) (%)
/PD1High (%)
(Million) ratio
1 .=:::.. ==BI'.):: =::.T.!!:.:: ::005=:::: ==!!.:..
0:i0B:::... =::=::::=::.36 ::=::::::: :120:.. =:=0::::.86.5V ;
,5B.act =:::M ..I.A6:::::.:: =,=:=:3.:4.0 =:=:...
:::ii.ii:::,:,....::::;:,:,:,:,:,:,:,:.:m:;:::::,:,:::,:::,:,..,..:.;=.,::;:::,
......õ.....,....,F.,:::::,:,:,:.::,:,..,:m::,:,:::::,:::,:,..,.,::;:,:,:
:,:,:.:,;:z::::,: .::.:..
2 50 0.08 0.16 60 750 85.33 47.60 1.79
56.00
iihig=ii*iiiiiiii,iii:
0X:iii48iiipi:?:iiiii,:,ii,iiie:ii4ilitf:iii:'%:Xiiiii,iii4kgatiVip?:iii=:iii,i
iiiiiiagligii,iii.,':iiiig:K..?:;ii':iii(t.Oripiiii,iiiiiilii8.4gliii:iii.:Z..:
ii;i0W:if.iiiii,iiiRfalii'::=iii:iik:li,IMiiiiatilMii,:iii
ii.:.i!i.i:ii:,:iii'MP:i!i.:.iNi;i::'.;ii..,=,::Mi;liVliai;';i::'.;i;:.i,,i:.*i
:aii;i::i;iMi.Wi5;i::'.iiiiiiiniii!VaiMMii'.iii:D*,:iO4;i:MiMiiiigi:;i;i;i::Pi.
i:M;:. i:.=i;:!:M.;i:,';i::'.;i;:.iii:
:Mi5iii'.iii:VM:ai;Pi:.i:iiinii'.ii;=::::.Nii
4 70 0.11 0.12 90 750 75.90 39.20 2.08
27.40
.:',i':::M4i':i.iiiiiiiiiiiii4...:=5:5i..iii:iiilo..i.:
iiii,.iiiii,ipiaqin.itp.4.'.:
iii:iiiii,i,xaktjairEiMAi,'..ii%:4010*iii,pxfti*KiroviMe.=*iii,imAtiwgi,i:m.Mim
40.Me.4i,iii,iii,x,...t.o*NW:*iii,80,i= = K,X,iii,
:iii:::..:..:-
..:::.??:s:K*X,:..,:...::pi.:!*?.i::::.:.:..,:::,:::::f:i.:i:i:::::::.W..:i.i.:
!*--.i.:.:,:::.::...-
i.:i.:i.:i.:i:i:zi:i:n:..i!.::..::::::..::.::::::::::,Mi.:i.::::::::!:%ii!:
.R.??.:.::.:iiiiiiiii:*:..]:..i!.ii.i.:!:
i:s...,:,:.,!::::::::iiiii:*:Mi:,.:...: =
::::W:::::::::::i!K::::::::.??:::]::::ii*Iiii:M::..i!.ii.:??.:.si.:iipi.:i.:i.:
i.i!K::*::::::,,:,:,.0iiii:i*:*
6 50 0.12 0.13 95 873 78.00 25.40 3.07
60.40
.........
....-õ.......
11117,Piliplillii:i01111ilbliiffioMplinilii:iiiiNip.i',hilleaSigaMiliiliillolot
triligililiiriioiff j.. 1. 0:1110:7#111:11EgooiROINSIA:48.H.:..:.
7:4;iiiiiiiiiii
.:::.iiiiiiiMi:.iiigi:iiiAiiiiiii?:VAiii:iiiiiiii!iiii:Aiii!iiiiiiiiiiiiiiii:4:
:::iiiiiii:iiiii.:iiiiigiiigiiiiiiiiii!iii!:ii:
iii!iiiii.:iiiiiiiiiiiMiiii:iiiiii!iiiiiiinii!iiiiiiiiiiii!iiikigi:iiiU...iiiai
iiiiiiiiiii!iiii... ::iiiiiiiiiithirn
::=Iii!iiiii.iiiiiii!iii?:iiAii$.iii?:iiiiiiiMMiiii0.iiii:=:'-
...:::?:ii!iiiii.ii
8 80 0.30 0.49 288 960 85.55 28.65 2.90
42.56
-:::':' .= ].:._..]:::.::i.:]: : -::]]::::]:.ig.......M]:]:-.a:
EN::]:.iij:....]0]Ws':" : 2]:]":_.. _;,.:__., .....:E:::]:.ii
.::::.:::::,...:"Ma :::::::E:::]:Ø...,,_L.ME] ' ::::,,__?:U:. ... :'
N:::]:.i.*õ _:: ..=_: :]:]"]:0]: : _õõ,M R . ]R].i',
...........':',.:::"
50 0.09 0.18 10 111 29.85 18.35 1.62 56.30
00,iaiiii,i'=ii,i.Z,,i,tiM,ii.i.i.ii.iiNgfqµ
Iii.iiinginiii.ii.'=ii',ZMAii.iiiinn.,,LWORPMUMiiiiHniiii.ii.OMMUL....:::MViii.
ii.'=i..:.:=: ::Mi.iiiNNM,..,.....ii.ii.gMalii.ii.Milpg
em.::::µ =44 410:100;%::.:.. !=Q:mi:!::::m4s!!:!:K..,:.4i: g!a$::. ;fog
:.=iiM!;-:Mi;fi'iAWN:ii.'i.V4M:gin::."Mi.r'''..0:0::ii=i=MONg=-
i,man'i.:Sii.9.U:=irani;fi'ig:WW.MR".::.:'::""iinignar
.:::::Wgii=i'...M::;::=ii''''E"Mi.'i.:::3'.e.',::gi':;=.:ij?
12 80 0.30 0.38 60 200 40.20 27.00 1.48
26.10
Table 1, NKT cell expansion from healthy donors. NKT cells were isolated and
expanded from
prospective healthy donors. iNKT cell frequency and the rate of expansion were
calculated at
days 0 and 12, respectively. The expression of CD621_, CD4 and PD1 was
quantified using
flow cytometry.
24
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
[0093] Testing allo-reactivitv NKT cells.
[0094] Since NKTs are restricted by the monomorphic CD 1d, they are not
expected to
react to allogeneic cells. To test this assumption, we performed one-way allo-
MLR cultures
using irradiated PBMC as stimulator cells and NKTs from unrelated donors as
responder cells.
Autologous PBMC served as a negative control and autologous PBMC pulsed with
NKT-cell
ligand aGalCer were used as a positive control. Proliferation of the responder
cells was analyzed
by assessing CFSE dilution. NKT cells were freshly isolated from buffy coat,
washed twice,
resuspended at lx 107 cells/ml in PBS, and incubated with 2.5 jiM
carboxyfluorescein
succinimidyl ester (CFSE; CellTrace"' CFSE Cell Proliferation Kit,
ThermoFisher Scientific)
for 5 min. Labeled cells were spun, resuspended in culture media at 106
cells/ml, and cultured in
the presence of irradiated PBMC. Cell proliferation was examined on days 6 by
measurement of
CFSE dilution using flow cytometry. FIG. 1 shows that NKTs could proliferate
only in response
to their specific ligand, aGalCer, but not to autologous or allogeneic PBMC
from 3 unmatched
donors. These results indicate that NKT cells are not allo-reactive.
[0095] Targeting B2M expression in NKTs.
[0096] In order to achieve full B2M gene knockout in NKTs, we used CRISPR/Cas9
technology (25). Single guide (sg)RNA sequences for B2M were identified using
the
CRISPRscan algorithm (http://www.crisprscan.org). sgRNA (10 jig) was incubated
with Cas9
protein, 10 jig (PNA Bio), for 10-15 min at room temperature and
electroporated into 3x106
NKT cells. The optimized electroporation condition for NKT cells was 1600V,
10ms and 3
pulses using a Neon transfection system (ThermoFisher Scientific). The sgRNA
sequence for
this experiment was GGCCACGGAGCGAGACATCT (SEQ ID NO:1). FIG. 2A shows that
B2M expression was lost in 88% of NKT cells. To further enrich B2M-negative
cells, we used
negative selection by depleting B2M-positive cells by MACS sorting using APC-
conjugated
anti-B2M mAb and anti-APC MicroBeads. The obtained negative fraction contained
>95%
B2M- and HLA class I (ABC)-negative NKT cells (FIG. 2B).
[0097] Next, we tested five B2M-targeting short hairpin (sh)RNA constructs to
achieve
different levels of B2M gene downregulation (knockdown). B2M-specific shRNA
expression
was achieved using the lentiviral expression system from Sigma Mission shRNA
service
(Sigma).
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
[0098] The following 5 shRNA sequences have been tested:
[0099]
1.GTACCGGAGGTTTGAAGATGCCGCATTTCTCGAGAAATGCGGCATCTTCAA
ACCTTTTTTTG (SEQ ID NO:2);
[0100]
2.CCGGCTGGTCTTTCTATCTCTTGTACTCGAGTACAAGAGATAGAAAGACCA
GTTTTTG (SEQ ID NO:3);
[0101]
3.CCGGCAGCAGAGAATGGAAAGTCAACTCGAGTTGACTTTCCATTCTCTGCT
GTTTTTG (SEQ ID NO:4);
[0102]
4.CGGTCCGACATTGAAGTTGACTTACTCGAGTAAGTCAACTTCAATGTCGGA
TTTTTG (SEQ ID NO:5); and
[0103]
5.CCGGCCCAAGATAGTTAAGTGGGATCTCGAGATCCCACTTAACTATCTTGG
GTTTTTG (SEQ ID NO:6).
[0104] Viral supernatant was made by co-transfecting HEK-293T cells with the
packaging vectors. These shRNA viral particles were transduced into NKT cells
with 8 fig/nil of
hexadimethrine bromide (Polybrene, H9268, Sigma-Aldrich, St. Louis, MO, USA).
B2M
knockdown was confirmed by FACS. We were able to knockdown B2M to various
degrees
ranging from 60% to 90% with the most effective construct that was tested (SEQ
ID NO:2)
shown in FIG. 2C. This shRNA targets exon-2 in human B2M coding sequence.
[0105] Targeting Ii expression in NKTs.
[0106] While it is known that T cell upregulate HLA class II expression upon
activation,
the status of HLA class II expression in human NKTs has not been examined to
our knowledge.
To answer this question, we performed flow cytometry analysis of HLA class II
expression on
resting NKT cells and then 2 days after their activation with a-
galactosylceramide. FIG. 3A
demonstrates that like T cells, NKTs do not express HLA class II in the
absence of stimulation
26
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
and readily upregulate surface expression of these molecules after antigenic
stimulation. Next,
we showed that HLA class II expression in activated NKTs can be effectively
downregulated
using an Ii-specific shRNA (FIG. 3B).
[0107] We tested five Ii-targeting short hairpin (sh)RNA constructs to achieve
different
levels of Ii gene downregulation (knockdown). Ii-specific shRNA expression was
achieved using
the lentiviral expression system from Sigma Mission shRNA service (Sigma).
[0108] The following 5 li shRNA sequences have been tested, as examples:
[0109]
1.CCGGGACCATAGACTGGAAGGTCTTCTCGAGAAGACCTTCCAGTCTATGGT
CTTTTT (SEQ ID NO:7);
[0110]
2.CCGGCCACCAAGTATGGCAACATGACTCGAGTCATGTTGCCATACTTGGTG
GTTTTT (SEQ ID NO:8);
[0111]
3.CCGGCGCGACCTTATCTCCAACAATCTCGAGATTGTTGGAGATAAGGTCGC
GTTTTT (SEQ ID NO:9);
[0112]
4.CCGGCCACACAGCTACAGCTTTCTTCTCGAGAAGAAAGCTGTAGCTGTGTG
GTTTTT (SEQ ID NO: 10); and
[0113]
5.CCGGGAGAACCTGAGACACCTTAAGCTCGAGCTTAAGGTGTCTCAGGTTCT
CTTTTTTG (SEQ ID NO:11).
[0114] Viral supernatant was made by co-transfecting HEK-293T cells with the
packaging vectors. These shRNA viral particles were transduced into NKT cells
with 8 pg/m1 of
hexadimethrine bromide (Polybrene, H9268, Sigma-Aldrich, St. Louis, MO, USA).
Ii
knockdown was confirmed by FACS. We were able to knockdown Ii to various
degrees ranging
from 51.2% to 75.6% with the most effective construct that was tested (SEQ ID
NO:7). This
shRNA targets CDS in human Ii coding sequence.
27
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
[01151 Testing allogenicitv of B2Mnult,B2Mbw, and lik"vNKTs.
[01161 To determine the effect of CRISPR-mediated B2M knockout and shRNA-
mediated B2M knockdown in NKTs on their ability to stimulate allo-reactive
responses, we
performed a one-way allo-MLR assay using irradiated NKTs as stimulator cells
and magnetically
sorted CD8 and CD4 T cells from unrelated donors as responder cells. T cells
in the absence of
allogeneic NKTs were used as a negative control. Allogeneic NKTs with wild
type (WT) B2M
were used as a positive control. In the experimental conditions, WT NKTs were
replaced with
CRISPR-induced B2M'Il or shRNA (SEQ ID NO:2)-induced B2MI0w NKTs as stimulator
cells.
We also generated El" NKTs using Ii-shRNA (SEQ ID NO:7). Proliferation of the
responder
cells was analyzed by assessing CFSE dilution by flow cytometry on day 5 of
culture. We also
stained cells for CD8 and CD4 markers to quantify proliferation of the
respective T cell
subsets. FIGS. 4A and 4B demonstrate that compared to WT B2M, B2M NKTs reduced
CD8
T cell proliferation from 74.1% to 38.5% (P < 0.01). As expected, B2M and HLA
class I
expression did not significantly affect proliferation of CD4 T cells which are
restricted by HLA
class II molecules. Accordingly, Ii'" NKTs reduced CD4 T cell proliferation
from 68.1% to
31.6% (P <0.01), but did not affect proliferation of CD8 T cells.
[0117] Surprisingly, shRNA-mediated reduction of B2M/HLA-ABC expression in
NKTs
achieved equally effective suppression of allo-reactive CD8 T cell responses
as the one that was
achieved by CRISPR-mediated complete loss of B2M/HLA-ABC expression. These
results
demonstrate for the first time that there is a range of B2M/HLA-ABC expression
in NKTs that
can be tolerated by allogeneic T cells. This knowledge has immediate practical
implications as it
justifies the use of a safer shRNA technology instead of CRISPR or other
genome-editing
methods for a graded downregulation of B2M in NKTs and likely other effector
cells from
unrelated donors for adoptive cell therapy applications.
[01181 Testing susceptibility of B2M null and B21141' to allo-NK cells.
[0119] HLA class I molecules serve as major inhibitory ligands for NK cells
and the loss
of B2M expression is expected to make donor cells susceptible to killing by
host NK cells (24).
It is unknown, however, whether a certain level of B2M/HLA class I can be
achieved in donor
cells, in particular in NKT cells that would be sufficient to prevent
activation of host CD8 T cells
without triggering host NK-cell cytotoxicity. Therefore, we tested
susceptibility of B2M"" and
B2M1' NKTs to killing by allogeneic NK cells, using wildtype (WT) NKT cells as
a negative
28
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
control and NK-sensitive K562 cells that naturally lack inhibitory HLA class I
ligands as a
positive control. NKT or 1(562 cells as target cells were labeled with a
viability dye calcein-AM
followed by 4-hr co-culture with allogeneic NK cells as effector cells that
were obtained by
negative magnetic sorting from unrelated donors. Autologous NK cells were used
as a negative
control. The cytotoxic activity of NK cells was quantified by the loss of
calcein-AM
fluorescence in target cells as measured by flow cytometry. FIG. 5
demonstrates that unlike
K562 cells. NKTs remained largely resistant to NK cell cytotoxicity even after
complete loss of
B2M expression. Indeed, only 21.3% of B2M"ull NKTs were killed by allo-NK
cells at 10:1
effector to target ratio whereas nearly 100% of K562 cells were killed under
the same conditions.
B2M1" NKTs were even more resistant than B2M' ll cells as only 18.8% of the
former were
killed by allo-NK cells at 10:1 effector to target ratio. Therefore, contrary
to expectations, the
results demonstrate for the first time that about 80% of NKTs remain resistant
to allo-NK cell
cytotoxicity even after complete genetic loss of B2M expression. Moreover,
shRNA-mediated
downregulation of B2M expression in NKTs makes them even more resistant to
allo-NK-cell
cytotoxicity compared to CRISPR-mediated B2M knockout.
[0120] Design of retroviral vectors encoding both a CAR construct and B2M
shRNA
and/or Ii shRNA
[0121] To test whether a CAR and a shRNA can be effectively expressed within
the same
retroviral vectors, we have constructed retroviral vectors encoding a GD2-
specific CAR and
B2M shRNA (SEQ ID NO:2) and/or li shRNA (SEQ ID NO:7), as shown in FIG. 6A. hi
order
to clone the shRNA(s) into a retroviral vector, we added one G before the
sense shRNA
sequence to serve as a transcription start site, and five T after the
antisense shRNA sequence to
serve a transcription stop site. The resultant shRNA sequence is the
following:
[0122] CTGGTCTTTCTATCTCTTGTACTCGAGTACAAGAGATAGAAAGACCAG
(SEQ ID NO:12)
[0123] GACCATAGACTGGAAGGTCTTCTCGAGAAGACCTTCCAGTCTATGGTC
(SEQ ID NO:13)
[0124] B2M shRNA was placed under control of U6 promoter and U6-shRNA was
ligated into sphI site in forward or reverse direction while CAR expression
was driven by an
endogenous retroviral LTR or EF1 promoter (FIG. 6A). NKT cell transduction
with
29
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
CAR.GD2/B2M shRNA resulted in effective CAR expression. All 4 constructs
achieved
simultaneous expression of CAR and B2M downregulation in NKTs with construct #
1 being the
most effective (FIG. 6B).
[0125] Significance of Certain Embodiments of the Disclosure
1) [0126] NKT cells can be isolated and ex vivo-expanded from healthy donors
to large
numbers while preserving the phenotype of highly functional cells. These donor-
derived
NKTs can be used as a source of therapeutic products for adoptive cancer
immunotherapy.
2) [0127] NKT cells do not proliferate in response to PBMC from unrelated
donors,
consistent with the inability of NKT TCR to recognize HLA molecules.
3) [0128] B2M-targeting with CRISPR and shRNA are equally effective in
reducing NKT-
cell stimulation of CD8 T cells.
4) [0129] li-targeting with shRNA is effective in reducing NKT-cell
stimulation of CD4 T
cells.
5) [0130] The majority of NKTs remain resistant to allo-NK cell cytotoxicity
after CRISPR-
mediated B2M knockout and even more so after shRNA-mediated B2M knockdown.
6) [0131] Effective expression of CAR and B2M shRNA and/or Ii shRNA in NKTs
has
been achieved within a single retroviral vector, providing a means for
generating CAR-
redirected and universally tolerated allogeneic NKT cell products for cancer
immunotherapy.
EXAMPLE 2
GENERATION OF TUMOR-SPECIFIC AND UNIVERSALLY TOLERATED CELLS
OTHER THAN NKT CELLS FROM HEALTHY DONORS FOR OFF-THE-SHELF CANCER
IMMUNOTHERAPY
[0132] In certain embodiments, cells other than NKT cells are manipulated to
have
reduced expression of endogenous B2M and/or Ii. Such cells may be any immune
cells other
than NKT cells, such as T cells, 1/8 T cells, Mucosal-associated invariant T
(MAIT) cells, NK
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
cells, Innate lymphoid cells (ILCs), or mixtures thereof. In some embodiments,
a mixture of
NKT cells and one or more of immune cells other than NKT cells are utilized in
the
compositions and methods encompassed by the disclosure.
[0133] The non-NKT cells may be manipulated to have reduced expression of
endogenous B2M and/or Li by standard means in the art, such as using one or
more agents to
target expression of the B2M gene, including nucleic acids such as shRNA or
CRISPR guide
RNA. Other means include at least morpholinos, siRNA, S-DNA, TALENs, ZFNs and
so forth.
[0134] In particular embodiments, non-NKT cells used in the compositions and
methods
of the disclosure are expanded prior to and/or after manipulation of the cells
to have reduced
expression of endogenous B2M and/or Ii. Routine methods in the art are known
for expansion
and may include a particular media and one or more particular agents, such as
one or more
cytokines, for example.
[0135] In particular embodiments, one or more types of non-NKT cells for use
in
compositions or methods of the disclosure may need manipulation other than
that needed by a
NKT cell to be able to be used effectively. For example, T cells may be
modified to prevent
damage to a recipient's tissues for rejection. In specific cases, the T cells
are manipulated to
delete a component of a T cell receptor.
EXAMPLE 3
GENERATION OF TUMOR-SPECIFIC AND TOLERANT NKTS AND OTHER CELLS
FROM HEALTHY DONORS FOR OFF-THE-SHELF CANCER IMMUNOTHERAPY BY
TARGETING MHC CLASS II-ASSOCIATED INVARIANT CHAIN (Ii)
[0136] In some embodiments, alternative to (or in addition to) cells and
methods of using
same directed to reduced expression of B2M and/or the cells have reduced
expression of MHC
class II-associated invariant chain (ID. Such cells may be used in place of
cells that have reduced
expression of endogenous B2M. In some cases, the same cell has reduced
expression of both
B2M and Ii, and in some cases a mixture of cells separately having reduced
expression of
endogenous B2M or reduced expression of endogenous Ii are used. In cases
wherein the same
cell has reduced expression of endogenous B2M and endogenous Ii, the same type
of agent may
be used to target their respective reduction in expression. For example, in
some cases both B2M
and Ti are targeted by shRNA to reduce their expression, or in other cases
both B2M and Ii are
31
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
targeted by CRISPR guide RNA to reduce their expression. In some cases,
different agents
target B2M and Ii, such as shRNA for targeting B2M and CRISPR guide RNA for
targeting Ii,
for example.
[0137] In particular embodiments, the cells that comprise reduced expression
of li may
also comprise expression of another entity that is non-natural to the cell,
such as a cytokine or a
CAR, for example. Such additional entities may or may not be expressed from
the same
construct as the agent that targets expression of Ii. In cases wherein in the
same cell both Ii
expression is targeted and another entity is provided for expression in the
cell, they may be
configured in thc same construct in any suitable arrangement, such as one
being 5' or 3' in
relation to the other; they may or may not be regulated by the same regulatory
element(s).
[0138] The cells may be NKT or may not be NKT cells, such as T cells, y8 T
cells,
MAIT cells, NK cells, ILCs, or mixtures thereof, and T cells may be engineered
to lack TCRs.
EXAMPLE 4
GENERATION OF TUMOR-SPECIFIC AND TOLERANT NKTS EXPRESSING CHIMERIC
ANTIGEN RECEPTORS FOR OFF-THE-SHELF CANCER IMMUNOTHERAPY BY
TARGETING WIC CLASS II-ASSOCIATED INVARIANT CHAIN (Ii) OR B2M
[0139] CD19 CAR constructs were generated that expressed either CD28 or 41BB
co-
stimulatory domains with or without 1L15 (FIG. 6). The constructs were
generated based on two
domain architectures: (1) a first group (39 and 84 constructs) that encoded
the IgG4 hinge, IgGi
CH3 spacer, CD28 TM, and either a CD28 or 4-1BB co-stimulatory domain, all
with or without
IL15; and (2) a second group (28 and 41 constructs) that encoded the CD8a
hinge and TM with
either the CD28 or 4-1BB co-stimulatory domains, all with or without IL15
(FIG. 6A).
Alternative or additional co-stimulatory domains may be utilized in such
constructs. Respective
flow cytometry analysis is shown in FIG. 6B. CD19 CAR construct examples are
illustrated in
FIG. 7.
[01401 As shown in FIG. 8, NSG mice were serially imaged that had been
injected
intravenously with 2x105 Ffluc+ Daudi lymphoma cells followed by intravenous
injection of
5x106 NKTs transduced with the noted constructs or no construct (non-
transduced, NT). Just
prior to imaging, the mice received 100 1.t1_, luciferin at 30 mg/mL via
intraperitoneal injection;
32
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
they were imaged under a bioluminescent channel for 5 min. Imaging occurred
over the course
of three to 25 weeks, as an example. FIG. 9 demonstrates survival curves for
those mice.
[0141] FIG. 10 illustrates examples of retroviral vectors that express CD19
CAR with
and without B2M and 1i shRNA. For those constructs comprising shRNA, B2M and
Ii shRNA
sequences were linked to individual U6 promoters and were ligated individually
or together to
28.15 downstream of the CAR in the opposite transcriptional direction.
[0142] FIG. 11 shows shRNA knockdown of B2M and Ii expression with the
respective
constructs. In FIG. 11A, representative flow cytometry analysis of CD19 CAR
expression is
provided following transduction of NKTs and staining with Alexa 647-conjugated
anti-FMC63
mAb. Representative flow cytometry analyses of (11B) B2M, (1 IC) HLA ABC,
(11D) Ii, and
(l 1E) HLA DP-DQ-DR expression in NKT cells transduced with the indicated
constructs are
provided. Cells were stained with anti-FMC63 mAb and 1) PE-conjugated anti-B2M
antibody
with FITC-conjugated anti-HLA ABC antibody or 2) PE-conjugated anti-li
antibody with FITC-
conjugated anti-HLA DP-DQ-DR antibody. FIG. 11F shows quantification of the
indicated gene
knockdown in CAR-shRNA NKTs versus CAR NKTs.
[0143] FIG. 12 indicates that the B2M/Ii shRNAs do not impact CAR-directed in
vitro
cytotoxicity of CAR ulNKT cells. NKTs transduced with the indicated CD19 CAR-
shRNA
constructs or non-transduced (NT) were co-cultured with luciferase-positive
Daudi (CD19-
positive) target cells at the specified effector-to-target ratios. NKT
cytotoxicity was determined
as a function of target cell bioluminescence following co-culture.
[0144] The level of alloreactivity to the CAR uTNKT cells was determined in
FIG. 13, in
which case unmatched CD8+ and CD4+ T cells showed diminished alloreactivity to
CAR uTNKT
cells in an allogeneic mixed lymphocyte reaction (MLR) assay. In FIG. 13A, a
schematic of
expected results for T cell in allogeneic MLR assay is illustrated. In
particular embodiments,
allogeneic CD8+ or CD4+ T cell recognition of MHC class I and MHC class II,
respectively, on
parental NKTs would lead to T cell proliferation. In addition, downregulation
of MHC class 1 via
B2M knockdown or MI-IC class II via Ii knockdown in uTNKTs would lead to a
relative decrease
in allogeneic T cell proliferation. CFSE-labeled CD8+ (FIG. 13B) or CD4+ T
cells (FIG. 13C)
were co-cultured with CAR uTNKT cells expressing the indicated constructs and
T cell
proliferation was assessed five days after stimulation as measured by CFSE
dilution.
33
101451 The uTNKT cells were less susceptible to allogeneic T cell cytotoxicity
than parental
NKTs. FIG. 14A provides a schematic of predicted results for NKT and 'NKT
cells in a T cell
cytotoxicity assay. Allogeneic T cells would recognize MHC molecules on
parental NKTs as
foreign, leading to death of these NKT cells. Downregulation of MHC molecules
on urNKTs would
allow these cells to evade T cell cytotoxicity better than parental NKTs. In
FIG. 14B, NKT cell
counts were determined by flow cytometry upon incubation of allogeneic T cells
with CAR uTNKTs
or non-transduced (NT) NKTs at a 1:1 ratio for four days.
101461 As shown in FIG. 15, uTNKT cells are minimally susceptible to NK cell
cytotoxicity.
FIG. 15A illustrates predicted results for NK cell cytotoxicity assays. As
shown, NK cells do not kill
parental NKTs that express MHC class I, but do usually kill target cells
lacking MHC I. in particular
embodiments, 'NKTs express enough MHC Ito evade killing by NK cells. FIG. 15B
demonstrates
target cell lysis following co-culture of NK cells from healthy donors with
calcein AM-labeled
'NKTs at a 5:1 ratio.
101471 Serial bioluminescence imaging of Ffluc-labeled Daudi lymphoma cells in
mice
injected with CAR.CD19 urNKTs is illustrated in FIG. 16. NSG mice were
injected intravenously
with 2x105 Ffluc+ Daudi lymphoma cells followed by intravenous injection of
5x106 CAR.CD19
'NKTs transduced with indicated constructs or no construct (non-transduced,
NT). Corresponding
survival curves are provided for the mice in FIG. 17.
REFERENCES
101481 All patents and publications mentioned in this specification are
indicative of the level
of those skilled in the art to which the invention pertains.
101491 1. Atkins MB, et al. High-dose recombinant interleukin 2 therapy for
patients with
metastatic melanoma: analysis of 270 patients treated between 1985 and 1993. J
Clin Oncol
1999;17(7):2105-2116.
[0150] 2. Porter DL, Levine BL, Kalos M, Bagg A, June CH. Chimeric antigen
receptor-
modified T cells in chronic lymphoid leukemia. N.Engl.JMed. 2011;365(8):725-
733.
34
Date INR÷../aMe9e.piR922-05-11
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
[0151] 3. Grupp SA, et al. Chimeric antigen receptor-modified T cells
for acute
lymphoid leukemia. N.Engl.J.Med. 2013;368(16):1509-1518.
[0152] 4. Brentjens RJ, et al. CD19-targeted T cells rapidly induce
molecular
remissions in adults with chemotherapy-refractory acute lymphoblastic
leukemia.
Sci.Transl.Med. 2013;5(177):177ra138.
[0153] 5. Kochenderfer JN, et al. B-cell depletion and remissions of
malignancy
along with cytokine-associated toxicity in a clinical trial of anti-CD19
chimeric-antigen-receptor-
transduced T cells. Blood 2012;119(12):2709-2720.
[0154] 6. Ramos CA, Heslop HE, Brenner MK. CAR-T Cell Therapy for
Lymphoma. Annu.Rev.Med. 2015.
[0155] 7. Turtle CJ, Maloney DG. Clinical trials of CD19-targeted CAR-
modified T
cell therapy; a complex and varied landscape. Expert Rev Hetnatol
2016;9(8):719-721.
[0156] 8. Singh N, Perazzelli J, Grupp SA, Barrett DM. Early memory
phenotypes
drive T cell proliferation in patients with pediatric malignancies. Sci Transl
Med
2016;8(320):320ra323.
[0157] 9. Dudley ME, et al. Cancer regression and autoimmunity in
patients after
clonal repopulation with antitumor lymphocytes. Science 2002;298(5594):850-
854.
[0158] 10. Tahir SM, et al. Loss of TN-gamma production by invariant NK T
cells in
advanced cancer. Jimmunol. 2001;167(7):4046-4050.
[0159] 11. Yanagisawa K, Exley MA, Jiang X, Ohkochi N, Taniguchi M, Seino
K.
Hyporesponsiveness to natural killer T-cell ligand alpha-galactosylceramide in
cancer-bearing
state mediated by CD11b+ Gr-1+ cells producing nitric oxide. Cancer Res.
2006;66(23):11441-
11446.
[0160] 12. Dhodapkar MV, et al. A Reversible Defect in Natural Killer T
Cell
Function Characterizes the Progression of Premalignant to Malignant Multiple
Myeloma.
J.Exp.Med. 2003.
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
[0161] 13. Qasim W, et al. Molecular remission of infant B-ALL after
infusion of
universal TALEN gene-edited CAR T cells. Sci Transl Med 2017;9(374).
[0162] 14. Porcelli S, Yockey CE, Brenner MB, Balk SP. Analysis of T cell
antigen
receptor (TCR) expression by human peripheral blood CD4-8- alpha/beta T cells
demonstrates
preferential use of several V beta genes and an invariant TCR alpha chain.
J.Exp.Med.
1993;178(1):1-16.
[0163] 15. Lantz 0, Bendelac A. An invariant T cell receptor alpha chain is
used by a
unique subset of major histocompatibility complex class I-specific CD4+ and
CD4-8- T cells in
mice and humans. J.Exp.Med. 1994;180(3):1097-1106.
[0164] 16. Bendelac A, Lantz 0, Quimby ME, Yewdell JW, Bennink JR,
Brutkiewicz RR. CD1 recognition by mouse NK1+ T lymphocytes. Science
1995;268(5212):863-865.
[0165] 17. Kim EY, Lynch L, Brennan PJ, Cohen NR. Brenner MB. The
transcriptional programs of iNKT cells. Semin.Immunol. 2015;27(1):26-32.
[01661 18. Metelitsa LS. Anti-tumor potential of type-I NKT cells against
CD 1d-
positive and CD id-negative tumors in humans. Clin.Inununol. 2011;140(2):119-
129.
[0167] 19. Heczey A, et al. Invariant NKT cells with chimeric antigen
receptor
provide a novel platform for safe and effective cancer immunotherapy. Blood
2014;124(18):2824-2833.
[0168] 20. Tian G, et al. CD62L+ NKT cells have prolonged persistence and
antitumor activity in vivo. J Clin Invest 2016;126(6):2341-2355.
[0169] 21. Pillai AB, George TI, Dutt S, Teo P. Strober S. Host NKT cells
can
prevent graft-versus-host disease and permit graft antitumor activity after
bone marrow
transplantation. J.Irnmunol. 2007;178(10):6242-6251.
[0170] 22. Morris ES, et al. NKT cell-dependent leukemia eradication
following stem
cell mobilization with potent G-CSF analogs. J.Clininvest 2005;115(11):3093-
3103.
36
CA 03072178 2020-02-05
WO 2019/033023 PCT/US2018/046306
[01711 23. Krangel MS, Orr HT, Strominger JL. Assembly and maturation of
HLA-A
and HLA-B antigens in vivo. Cell 1979;18(4):979-991.
[01721 24. Lanier LL. NK cell recognition. Annu Rev Immunol 2005;23:225-
274.
[01731 25. Gundry MC, et al. Highly Efficient Genome Editing of Murine and
Human Hematopoietic Progenitor Cells by CRISPFUCas9. Cell Rep 2016;17(5):1453-
1461.
Although the present invention and its advantages have been described in
detail, it should
be understood that various changes, substitutions and alterations can be made
herein without
departing from the spirit and scope of the invention as defined by the
appended claims.
Moreover, the scope of the present application is not intended to be limited
to the particular
embodiments of the process, machine, manufacture, composition of matter,
means, methods and
steps described in the specification. As one of ordinary skill in the art will
readily appreciate
from the disclosure of the present invention, processes, machines,
manufacture, compositions of
matter, means, methods, or steps, presently existing or later to be developed
that perform
substantially the same function or achieve substantially the same result as
the corresponding
embodiments described herein may be utilized according to the present
invention. Accordingly,
the appended claims are intended to include within their scope such processes,
machines,
manufacture, compositions of matter, means, methods, or steps.
37
