Note: Descriptions are shown in the official language in which they were submitted.
CA 03087906 2020-07-08
Rape gene resistant to pyrimidinylsalicylate herbicide and use
thereof
Technical Field
The present invention relates to the technical field of plant genetic
engineering, specifically,
relates to a rape gene which resistant to a pyrimidinylsalicylate herbicide
and use thereof. More
specifically, the present invention relates to a rape plant which resistant to
a
pyrimidinylsalicylate herbicide, and a part, resistance gene, mutant protein
and use thereof.
Background Art
Rape (Brassica napus I¨) is the number one oil crop in China, providing a
source of edible
oil for more than half of the country's population. One of the important
biological hazards in rape
production is farmland weeds, which not only competes with rape plants for
water, fertilizer and
light, but also changes the field microclimate of rape crop, and some weeds
even are
intermediate hosts for pests and diseases of rape crop, speeding up the spread
of pests and
diseases, seriously affecting the yield and quality of rape crop. However,
manual weeding is
time-consuming and laborious, increasing production costs. Therefore, the
application of
herbicides to control weeds in the field has become an inevitable choice.
Herbicides mainly inhibit plant growth or kill plants by inhibiting or
interfering with key
metabolic processes of plants. Targeting key enzymes in the process of amino
acid biosynthesis
is an important direction and hotspot in the development of new and highly
effective herbicides.
The herbicides developed with acetolactate synthase (ALS; EC2.2..16) as the
target enzyme have
become the mainstream products of new high performance herbicides. ALS is an
enzyme that
catalyzes the first step of biosynthesis of branched-chain amino acids
(valine, leucine, and
isoleucine). ALS inhibitor herbicides can inhibit ALS enzyme activity in plant
cells, hinder the
biosynthesis of branched-chain amino acids (valine, leucine, and isolencine),
thereby inhibiting
the division and growth of plant cells. In the early 1990s, Kumiai Chemical
Company of Japan
developed a new class of ALS herbicides, i.e., pyrimidinylsalicylate
herbicides, also known as
pyrimidinyl (thio) benzoate herbicides, which use acetolactate synthase as the
target. The first
commercial variety of this class of herbicides is pyrithiobac-sodium.
Subsequently,
pyrirninobac-methyl was developed in 1993, and bispyribac-sodium (Nominee) was
developed
in 1996.
1
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
Since the application of ALS herbicides to agriculture, it has been observed
that sensitive
plant species (including naturally occurring weeds) occasionally show
spontaneous tolerance to
such herbicides. The substitution of a single base at a specific site of the
ALS gene usually
results in more or less resistance. Plants with mutant ALS alleles show
different levels of
tolerance to ALS herbicides, depending on the chemical structure of the ALS
herbicide and the
point mutation site of the ALS gene.
The study found that there were significant differences in the resistance
functionality when
amino acid substitution occurred at different sites on ALS and different amino
acids were used
for substitution at these sites (Yu Q, Han HP, Martin M, Vila-Aiub, Powles SH.
AHAS herbicide
resistance endowing mutations: effect on AHAS functionality and plant growth.
J Exp Botany,
2010, 61: 3925-3934). The resistance effects against ALS inhibitor herbicides
produced by
amino acid substitutions at different sites are significantly different, and
at the same time,
mutations at different sites have a more complex cross-resistance relationship
against other ALS
inhibitor herbicides.
There is also a great need in the art to obtain rape plants that have growth
advantages over
strong vitality weeds, and to obtain non-transgenic rape plants that can
tolerate
pyrimid iny Isalicy late herbicides.
Contents of the present invention
The present invention addresses this need and provides a mutant nucleic acid
of acetolactate
synthase (ALS) and a protein encoded by such mutant nucleic acid. The present
invention also
relates to a rape plant, cell and seed comprising such mutant nucleic acid and
protein, and the
mutation endows the rape plant with tolerance to a pyrimidinylsalicylate
herbicide, wherein an
ALS polypeptide encoded by the ALS gene has an amino acid different from
tryptophan at
position 556 thereof and an amino acid different from serine at position 635
thereof. In a
preferred embodiment, the ALS polypeptide encoded by the ALS gene has a double
mutation
selected from the group consisting of W556L and S635N; W556L and S635T; W556L
and
S635I. In the most preferred embodiment, the ALS polypeptide encoded by the
ALS gene has
the following mutations: W556L and S635N.
In one embodiment, the present invention provides an isolated nucleic acid
encoding a
mutant acetolactate synthase (ALS3), and the mutant acetolactate synthase
(ALS3) protein
comprises the following mutations:
mutation of tryptophan (W) to leucine (L) at a position corresponding to
position 556 of
2
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
SEQ ID NO: 2; and
mutation of serine (S) to asparagine (N), threonine (T) or isoleucine (I) at a
position
corresponding to position 635 of SEQ ID NO: 2;
preferably, the isolated nucleic acid has a nucleotide sequence as shown in
SEQ ID NO: 3;
preferably, the mutant ALS3 protein has an amino acid sequence as shown in SEQ
ID NO:
4.
In one aspect, the present invention provides an expression cassette, vector
or cell, which
comprises the nucleic acid of the present invention. Accordingly, the present
invention provides
a use of the nucleic acid, expression cassette, vector or cell or the mutant
acetolactate synthase
(ALS3) protein of the present invention for producing a plant resistant to a
pyrimidinylsalicylate
herbicide, preferably, the plant is rape.
In another aspect, the present invention provides a method for producing a
plant resistant to
a pyrimidinylsalicylate herbicide, characterized in comprising the following
steps:
introducing the nucleic acid of the present invention into a plant, preferably
introducing the
nucleic acid of the present invention into a plant through a step such as
transgenosis,
hybridization, backcross or vegetative propagation, wherein the plant
expresses the mutant
acetolactate synthase (ALS3) protein of the present invention and has
resistance to a
pyrimidinylsalicylate herbicide.
In yet another aspect, the present invention provides a non-transgenic plant
or a part thereof
resistant to a pyrimidinylsalicylate herbicide, which comprises an isolated
nucleic acid encoding
a mutant acetolactate synthase protein, the mutant acetolactate synthase
protein comprising the
following mutations:
mutation of tryptophan (W) to leucine (L) at a position corresponding to
position 556 of
SEQ ID NO: 2; and
mutation of serine (S) to asparagine (N), threonine (T) or isoleucine (I) at a
position
corresponding to position 635 of SEQ ID NO: 2,
preferably, wherein the plant is rape; wherein the part is an organ, tissue or
cell of the plant,
and preferably a seed;
preferably, wherein the protein comprises a mutation of tryptophan (W) to
leucine (L) at a
position corresponding to position 556 of SEQ ID NO: 2 and a mutation of
serine (S) to
asparagine (N) at a position corresponding to position 635 of SEQ ID NO: 2;
more preferably, wherein the mutant ALS3 protein has an amino acid sequence as
shown in
3
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
SEQ ID NO: 4.
In another aspect, the present invention provides a method of controlling a
weed in a field
containing a rape plant, the method comprising: applying an effective amount
of a
pyrimidinylsalicylate herbicide to the field containing the weed and the rape
plant, the rape plant
comprises an isolated nucleic acid encoding a mutant acetolactate synthase
protein, and the
mutant acetolactate synthase protein comprises the following mutations:
mutation of tryptophan (W) to leucine (L) at a position corresponding to
position 556 of
SEQ ID NO: 2; and
mutation of serine (S) to asparagine (N), threonine (T) or isoleucine (I) at a
position
corresponding to position 635 of SEQ ID NO: 2;
preferably, wherein the protein comprises a mutation of tryptophan (W) to
leucine (L) at a
position corresponding to position 556 of SEQ ID NO: 2 and a mutation of
serine (S) to
asparagine (N) at a position corresponding to position 635 of SEQ ID NO: 2;
more preferably, wherein the mutant ALS3 protein has an amino acid sequence as
shown in
SEQ ID NO: 4.
Brief Description of the Drawings
Figure 1 shows the alignment results of rape ALS3 amino acid partial sequences
from
different sources.
ALS3, a reference sequence of Genbank (accession number: Z11526); ALS3 amino
acid
partial sequence of ALS3 N131 wild type strain N131; ALS3 amino acid partial
sequence of
ALS3 EM28 resistant strain EM28; ALS3 amino acid partial sequence of ALS3 Sh4
resistant
material Sh4; ALS3 amino acid partial sequence of ALS3_Sh5 resistant material
Sh5; ALS3
amino acid partial sequence of ALS3_Sh6 resistant material Sh6; ALS3 amino
acid partial
sequence of ALS3 Sh7 resistant material Sh7. Arrows indicate mutant amino
acids.
Figure 2 shows the in vitro activity inhibition of wild-type and mutant ALS
enzymes by
Tribenuron-methly at different concentrations.
Figure 3 shows the in vitro activity inhibition of wild-type and mutant ALS
enzymes by
Imazethapyr at different concentrations.
Figure 4 shows the in vitro activity inhibition of wild-type and mutant ALS
enzymes by
Bispyribac-sodium at different concentrations.
4
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
Figure 5 shows the resistance performances of Arabidopsis thaliana and tobacco
introduced
with herbicide resistance gene after spraying herbicides (Col, wild-type
Arabidopsis thaliana,
3A-I and 3A-2 Arabidopsis thaliana introduced with herbicide resistance gene;
Tob, wild-type
tobacco, Y3A-1 and Y3A-2 tobacco introduced with herbicide resistance gene). +
Indicates
spraying with 60 g a.i. ha Bispyribac-sodium, and - indicates no herbicide
treatment.
Detailed DescriptionThe embodiments of the present invention and their
different features
and advantageous details will be explained more fully by reference to the non-
limiting
embodiments and examples described and/or illustrated in the drawings and
detailed in the
following description. It should be noted that the features described in the
drawings are not
necessarily drawn to scale, and the features of one embodiment can be used
with other
embodiments when one skilled in the art can recognize it although it is not
clearly described
here.
Definitions
Unless otherwise stated, the terms used in the claims and the description are
defined as
listed below.
The term "non-transgenic" refers to not introducing individual genes via
appropriate
biological carriers or through any other physical means. However, a mutant
gene can be passed
through pollination (naturally or through breeding methods) to produce another
non-transgenic
plant containing that particular gene.
The term "endogenous" gene refers to a gene in a plant that is not introduced
into the plant
by genetic engineering techniques.
The terms "nucleotide sequence", "polynucleotide", "nucleic acid sequence",
"nucleic acid",
and "nucleic acid molecule" are used interchangeably herein and refer to
nucleotides,
ribonucleotides or deoxyribonucleotides or a combination of the both, in form
of unbranched
polymer of any length. Nucleic acid sequences comprise DNA, cDNA, genomic DNA,
RNA,
including synthetic forms and mixed polymers, including sense and antisense
strands, or may
contain unnatural or derived nucleotide bases, as those skilled in the art
will understand this
point.
As used herein, the term "polypeptide" or "protein" (both terms are used
interchangeably
herein) refers to a peptide, protein or polypeptide comprising an amino acid
chain of a given
length, wherein the amino acid residues are linked via covalent peptide bonds.
However, the
present invention also comprises peptide mimics of the protein/polypeptide
(wherein the amino
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
acids and/or peptide bonds have been replaced with functional analogues), as
well as amino acids
such as selenocystine other than the amino acids encoded by the 20 genes.
Peptides,
oligopeptides and proteins can be referred to as polypeptides. The term
polypeptide also refers to
(does not exclude) a modification of polypeptide, such as glycosylation,
acetylation,
phosphorylation and the like. This modification is well documented in the
basic literature and in
more detail in the monographs and research literature.
Amino acid substitution comprises an amino acid change, where an amino acid is
replaced
by a different naturally occurring amino acid residue. Such substitution can
be classified as
"conservative", in which an amino acid residue contained in the wild-type ALS
protein is
replaced by an additional naturally occurring amino acid with similar
characteristics; the
substitution, for example or included in the present invention, may also be
"non-conservative", in
which an amino acid residue present in the wild-type ALS protein is
substituted with an amino
acid having different properties, for example, naturally occurring amino acid
from a different
group (for example, a charged or hydrophobic amino acid is substituted with
alanine). As used
herein, "similar amino acid" refers to an amino acid with a similar amino acid
side chain, i.e., an
amino acid with polar, non-polar, or near-neutral side chain. As used herein,
"dissimilar amino
acid" refers to an amino acid with a different amino acid side chain, for
example, an amino acid
with a polar side chain is not similar to an amino acid with a non-polar side
chain. Polar side
chains generally tend to exist on the surface of protein, where they can
interact with the water
environment present in the cell ("hydrophilic" amino acids). On the other
hand, "non-polar"
amino acids tend to be located in the center of protein, where they can
interact with similar
non-polar neighboring molecules ("hydrophobic" amino acids). Examples of amino
acids having
polar side chains are arginine, asparagine, aspartic acid, cysteine,
glutamine, glutamic acid,
histidine, lysine, serine, and threonine (all are hydrophilic amino acids,
except that eysteine is
hydrophobic). Examples of amino acids with non-polar side chains are alanine,
glycine,
isoleucine, leucine, methionine, phenylalanine, proline and tryptophan (all
hydrophobic, except
that glycine is neutral).
In general, a person skilled in the art will know that the terms ALS, ALSL,
AHAS, or
AHASL refers to the nucleotide sequence or nucleic acid, or the amino acid
sequence or
polypeptide, respectively, according to his(her) common general knowledge and
the context of
using the terms.
As used herein, the term "gene" refers to nucleotides (ribonucleotides or
deoxyribonucleosides) in form of polymer of any length. The term comprises
double-stranded
and single-stranded DNA and RNA, and further comprises known types of
modifications, such
6
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
as methylation, "capping", substitution of one or more naturally occurring
nucleotides with
analogs. Preferably, the gene comprises a coding sequence that encodes a
polypeptide as defined
herein. "Coding sequence" is a nucleotide sequence that can be transcribed
into mRNA and/or
translated into polypeptide when it is subjected to or under the control of an
appropriate
regulatory sequence. The boundaries of the coding sequence are determined by
the translation
initiation codon at the 5' end and the translation stop eodon at the 3' end.
The coding sequence
may include but is not limited to mRNA, cDNA, recombinant nucleic acid
sequence or genomic
DNA, but in some cases an intron may also exist.
When used herein, the term "Brassica napus" may be abbreviated as "B. napus".
In addition,
the term "rape" is used herein. The three terms are used interchangeably and
should be
understood to fully include rape plants in cultivated form. Similarly, for
example, the term
"Arabidopsis thaliana" may be abbreviated as "A. thaliana". These two terms
are used
interchangeably herein.
When used in the present invention, the term "position" refers to a position
of amino acid in
the amino acid sequence described herein or a position of nucleotide in the
nucleotide sequence
described herein, for example, a position in the coding sequence of the wild
type rape ALS3
protein as shown in SEQ ID NO: I or the amino acid sequence of the wild type
rape ALS3
protein as shown in SEQ ID NO: 2, or its corresponding position. The term
"corresponding" as
used herein means that the "position" also includes a position additional to
the position
determined by the aforementioned nucleotide/amino acid numbering. Due to the
deletion or
insertion of nucleotides at other positions in the ALS 5' tmtranslated region
(UTR) (including
promoter and/or any other regulatory sequences) or gene (including eX011 and
intron), the
position of a given nucleotide that can be substituted in the present
invention may be different.
Similarly, due to the deletion or insertion of amino acids at other positions
in the ALS
polypeptide, the position of a given amino acid that can be replaced in the
present invention may
be different. Therefore, the "corresponding position" in the present invention
should be
understood that the nucleotide/amino acid at the indicated number may be
different, but may still
have a similar adjacent nucleotide/amino acid. The nucleotide/amino acid that
can be exchanged,
deleted or inserted are also included in the term "corresponding position". In
order to determine
whether a nucleotide residue or an amino acid residue in a given ALS
nucleotide/amino acid
sequence corresponds to a certain position in the nucleotide sequence SEQ ID
NO: 1 or the
amino acid sequence SEQ ID NO: 2, the skilled person in the art can use tools
and methods
known in the art, such as alignment by human or by using computer programs,
such as BLAST
(Altschul et al. (1990), Journal of Molecular Biology, 215, 403-410) (which
represents Basic
7
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
Local Alignment Search Tool) or ClustalW (Thompson et al. (1994), Nucleic Acid
Res., 22,
4673-4680) or any other suitable programs suitable for generating sequence
alignment.
Specifically, the present invention provides a rape plant, in which a
tryptophan W
leucine L substitution occurs at position 556 of the polypeptide encoded by
the endogenous ALS
gene of the rape plant, which is due to the mutation of "G" nucleotide to "T"
nucleotide at the
position corresponding to the position 1667 of the nucleotide sequence as
shown in SEQ ID
NO:1. Furthermore, a serine S
asparaginc N substitution occurs at position 635 of the
polypeptide encoded by the endogenous ALS gene of the rape plant, which is due
to the mutation
of "G" nucleotide to "A" nucleotide at the position corresponding to the
position 1904 of the
nucleotide sequence as shown in SEQ ID NO: 1. In the most preferred
embodiment, the present
invention provides a rape plant, in which the endogenous ALS3 gene of the rape
plant comprises
(or consists of) the nucleotide sequence as shown in SEQ ID NO: 3, which
encodes a mutant
ALS3 polypeptide as shown in SEQ ID NO: 4.
ALS activity can be measured according to the assay method described in Singh
(1991),
Proc. Natl. Acad. Sci. 88: 4572-4576. The ALS nucleotide sequence encoding the
ALS
polypeptide mentioned herein preferably confer tolerance to one or more
pyrimidinylsalicylate
herbicides described herein (or, lower sensitivity to the
pyrimidinylsalicylate herbicides). This is
due to the point mutations described herein that lead to amino acid
substitutions. Therefore, the
tolerance to pyrimidinylsalicylate herbicides (or lower sensitivity to
pyrimidinylsalicylate
herbicides) can be measured by obtaining ALS samples from cell extracts of a
plant with a
mutant ALS sequence and a plant without a mutant ALS sequence in the presence
of the
pyrimidinylsalicylate herbicides, and comparing their activities, for example,
by the method
described in Singh et al (1988) [J. Chromatogr., 444, 251-2611. When using
plants, preferably in
the presence of pyrimidinylsalicylate herbicides at various concentrations,
more preferably in the
presence of pyrimidinylsalicylate herbicide "Bispyribac-sodium" at various
concentrations, the
assay of ALS activities are carried out in the wild type cell extract or leaf
extract and in the
obtained mutant rape cell extract or leaf extract. When used herein, the lower
the sensitivity, "the
higher the tolerance" or "the higher the resistance", and vice versa.
Similarly, "the higher the
tolerance" or "the higher the resistance", the "lower the sensitivity", and
vice versa.
The term "pyrimidinylsalicylate herbicide" is not intended to be limited to a
single herbicide
that can interfere with ALS enzyme activity. Therefore, unless otherwise
stated or obvious from
the context, the "pyrimidinylsalicylate herbicide" can be one herbicide, or a
mixture of two, three,
four or more herbicides known in the art. The herbicides are preferably those
listed herein, such
as pyrithiobac-sodium, cloransulam-methyl, pyriftalid, bispyribac-sodium,
pyriminobac-methyl,
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
pyribenzoxirn, etc.
The present invention provides a rape plant with an endogenous acetolactate
synthase (ALS)
gene mutation, which is tolerable to a pyrimidinylsalicylate herbicide. As
used herein, unless
expressly stated otherwise, the term "plant" means a plant at any stage of
development. A part of
the plant may be connected to the whole plant or may be separated from the
whole plant. Such
part of the plant includes but is not limited to an organ, tissue and cell of
the plant, preferably a
seed. The rape plant of the present invention is non-transgenic with respect
to the endogenous
ALS gene. Of course, a foreign gene can be transferred into the plant by
genetic engineering or
by conventional methods such as hybridization.
The present invention is described below based on examples, but the present
invention is
not limited to these examples.
Example 1
In the previous patent application (Hu Maolong et al., Chinese patent: CN
107245480 A,
Acetolactate synthase mutant protein with herbicide resistance and use
thereof), the wild type
rape strain N131 (known and publicly used, see Pu Huiming, et al., Jiangsu
Journal of
Agricultural Science, 2010, 26 (6): 1432-1434) was subjected to mutagenesis
treatment with
ethyl methanesulfonate (EMS). In the mutagenized M2 generation, we screened
and identified
mutant EM28 that was resistant to sulfonylurea herbicides. The EM28 plant
seeds were
deposited on June 19, 2017 at the China General Microbiological Culture
Collection Center
(CGMCC) of the China Committee for Culture Collection of Microorganisms,
address: No. 3,
No. 1, West Beichen Road, Chaoyang District, Beijing, 100101, the access
number was CGMCC
No.14299, and the strain was named as Brassica napus. Subsequent genetic and
resistance
identification studies found that the resistance trait of EM28 was an
incomplete dominant trait
controlled by one nuclear gene, which was resistant to irnidazolinone and
sulfonylurea herbicides
but sensitive to pyrimidinylsalicylate herbicides. Therefore, in order to
obtain a germplasm or
resource of rape resistant to pyrimidinylsalicylate herbicides so as to meet
the needs of breeding
of herbicide resistant rape varieties, we performed EMS mutagenesis treatment
on EM28 seeds
again, and the EMS mutagenesis was carried out by the same method. When the M2
generation
seedlings grew to the 3-4 leaf stage, they were sprayed with
pyrimidinylsalicylate herbicide
Bispyribac-sodium [Chemical name: sodium 2,6-bis(4,6-dimethoxypyrimidin-2-
oxyl)benzoate.
Molecular formula: C19H17N4Na0s. CAS number: 125401-92-5 {sodium salt)], the
sprayed
Bispyribac-sodium had a concentration of 60 g a.i. ha--1 as recommended for
weed control,
thereby performing the screening of germplasm resistant to
pyrimidinylsalicylate herbicide.
9
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
After 3 weeks of treatment, almost all rape seedlings were close to death, and
only 10 seedlings
survived and grew normally. These 10 strains were suspected to be individual
rape plants
resistant to pyrimidinylsalicylate herbicide and numbered as Shl to Sh10.
After these seedlings
grew to the 5-6 leaf stage, they were moved to the rape breeding field, and M3
seeds were
harvested by bagging self-cross during flowering phase in that year. In the
light culture room, the
M3 seedlings were sprayed with Bispyribac-sodium herbicide at the recommended
concentration
for weed control to identify resistance effects. From the week 1 after
spraying, the phytotoxicity
reactions were observed every day. The results showed that phytotoxicity
reactions were
observed in the 6 stains numbered Shl, Sh2, Sh3, Sh8, Sh9 and Sh10 and the
control in the week
I after spraying, in which the heart leaves of the seedlings began to turn
yellow, and gradually
rotted, and finally died, and these seedlings were the missed ones of spraying
herbicide under
high-density planting condition; while the 4 strains numbered Sh4, Sh5, Sh6
and Sh7 showed
strong resistance without any symptoms of phytotoxicity and could grow
normally. So far, we
obtained 4 new germplasms of Brassica napus that were resistant to
pyrimidinyisalicylate
herbicide Bispyribac-sodium. Later, through classical genetic studies, it was
found that the
separation ratio of the survival and death strains in the F2 generation
population was 3:1 respect
with the resistance trait, which was consistent with the genetic rule of
single dominant gene. In
other words, the mutant gene was dominant and controlled by a single gene.
Example 2: Molecular cloning of resistance gene in the new Brassica napus
germplasm
resistant to pyrimidinylsalieylate herbicide
Pyrimidinylsalicylate herbicides belong to the general category of ALS
inhibitor herbicides,
and the target of these herbicides is acetolactate synthase. There are 3
functional acetolaetate
synthase genes in the Brassica napus genome, which are located at ALS2 and
ALS3 (Genebank
accession numbers: Z11525 and Z11526) of A genome, as well as ALS1 (Genebank
accession
number: Z11524) of C genome. Based on the three ALS gene sequences, three
pairs of PCR
primers were designed respectively. ALS I Primer 1: GTGGATCTAACTGTTCTTGA and
Primer 2: AGAGATGAAGCTGGTGATC. ALS2 Primer 1: GAGTGTTGCGAGAAATTGCTT
and Primer 2: TTGATTATTCTATGCTCTCTTCTG. ALS3 Primer :
ATGGTTAGATGAGAGAGAGAGAG and Primer 2: GGTCGCACTAAGTACTGAGAG. The
CTAB method was used to extract leaf genomic DNA samples of resistant strains
Sh4, Sh5, Sh6,
Sh7 and non-resistant strains Shl, Sh2, Sh3, Sh8, Sh9, Sh10 as well as N131,
EM28,
respectively, and the wild type and mutant ALS1 ALS2 and ALS3 genes were
subjected to PCR
cloning. 504 PCR reaction system was prepared according to the instructions of
high-fidelity
DNA polymerase KOD-Plus kit of Toyobo (Shanghai) Biotechnology Co., Ltd.
Amplification
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
was performed on a MJ Research PTC-200 PCR instrument, in which the reaction
program was
94 C pre-denaturation for 5 min; 94 C denaturation for 30 s, 55 C annealing
for 30 s, and 72 C
extension for 2.5 min, for a total of 35 cycles. After adding A to the blunt
end, the product was
separated by 1.2% (V/W) agarose gel electrophoresis, purified and recovered by
the agarose gel
DNA recovery kit (catalog number: DP209) of Beijing Tiangen Company, and the
purified PCR
product was sequenced by Nanjing Jinsirui Biological Co., Ltd. As founding in
the sequencing
and comparison, the four resistant strains all showed in the detection the
point mutations at two
sites on the ALS3 gene. That was, in the ALS3 gene, a point mutation occurred
at position
+1667, where the nucleotide changed from G to T, resulting in the mutation of
tryptophan (W) to
leucine (L) at the position 556 of the correspondingly encoded protein; a
point mutation occurred
at position +1904, where the nucleotide changed from G to A, resulting in the
mutation of serine
(S) to asparagine (N) at the position 635 of the correspondingly encoded
protein (Figure 1).
Therefore, compared with the mutant EM28, the ALS3 gene in the resistant
strains had a newly
added mutation site (S635N), the nucleotides of which were shown in SEQ ID NO:
3, and the
amino acid sequence of which was shown in SEQ ID NO: 4. The double-site
mutations (W556L
and S635N) of the ALS3 gene enhanced the resistance of the resistant mutant to
pyrimidinylsalicylate herbicide.
Example 3: Evaluation and identification of herbicide resistance effects of
resistant strains
Sh7 with strong growth potential and good plant type was chosen, tentatively
named as
RP-1, and used as a representative of the resistant strains. N131 and EM28
were used as control
materials, the identification and evaluation of resistance effects of RP-1
were performed by two
methods, i.e., field identification test and greenhouse pot incubation test.
The field identification
test of rape was conducted in the isolated breeding area for rape in Jiangsu
Academy of
Agricultural Sciences, and the greenhouse pot incubation test was conducted in
a light
cultivation room of constant temperature. After all the treatment materials
were sown and grown
to 3-4 leaf seedling age, three kinds of ALS inhibitor herbicides widely used
in China were
sprayed, in which the pyrimidinylsalicylate herbicide was Bispyribac-sodium
[sodium
2,6-bis(4,6-dimethoxypyrimidin-2-oxy)benzoate], the SU herbicide was
Tribenuron-methyl
(methyl 2-
[N -(4-methoxy-6-methy1-1,3,5-triazin-2-y1)-N -methylaminoformamidosulfony1]-
benzoate), and the IMI herbicide was Irnazethapyr RRS)-5-ethy1-2-(4-isopropyl-
4-methyl-5-oxo-
IH-imidazolin-2-yl)nicotinic acid]. Three weeks after spraying herbicides, the
resistance effects
of seedlings at different herbicide concentrations were determined according
to the growth
performance of the seedlings. The results are shown in Table I. It can be seen
from Table I that
the material RP-I with double-site mutations (W556L and S635N) of the ALS3
gene showed
11
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
enhanced resistance to the pyrimidinylsalicylate herbicide.
Table 1: Resistance performances of three rapes after being treated with ALS
inhibitor
herbicides at different concentrations
Bispyribae-sodium Tribenuron-methyl Imazethapyr
Material
(g a.i. ha-1) (g a.i. ha-1) (g a.i. ha-1)
60 120 22.5 45 45 90
RP-1
EM28
N131
Note: R represents that the rape plants grew well after the herbicide
treatment, and there
was no phytotoxicity; S represents that the growth of rape plants after the
herbicide treatment
was severely inhibited, the phytotoxicity performance was obvious, and the
seedlings eventually
died (the same below).
Example 4: Inhibition test of herbicides on ALS enzyme activity
According to the resistance phenotype identification results, in vitro enzyme
activity test
was conducted to compare the inhibition effects of three types of herbicides,
i.e.,
Bispyribac-sodium (PB type), Tribenuron-methyl (SU type) and Imazethapyr (IMI
type), on
ALS enzyme in RP-1, EM28 and the original wild-type N131, and the differences
between the
three materials were compared. For the measurement of ALS enzyme activity,
referred to the
method of Singh et at (Singh BK, et al,, Analytical Biochemistry, 1988, 171:
173-179).
Specifically, 0.2 g of leaf sample was taken, ground and pulverized with
liquid nitrogen in a
mortar, and the ground sample was added into 4.5 ml of initial enzyme extract
solution [100 mM
K2HPO4, 0.5 iriM MgCl2, 0.5 mM thiamine pyrophosphate (TPP), 10 ).tM flavin
adenine
dinucleotide (FAD), 10 mM sodium pyruvate, 10% (v/v) glycerin, 1 mM
dithiothreitol, 1 mM
benzylsulfonyl fluoride (PMSF), 0.5% (w/v) polyvinylpyrrolidone], centrifuged
at 4 C and
12000 rpm for 20 min. The supernatant was taken, added with an equal volume of
saturated
(NH4)2SO4, placed on ice for 30min, centrifuged at 4 C and 12000rpm for 20min,
discarded
supernatant, added with lmL of the initial enzyme extract, and shaken to
dissolve to obtain ALS
enzyme solution for each sample. 2004 of the extracted ALS enzyme solution was
taken, and
separately added with 3604 of 50mM Hepes-NaOH (PH-7.5) enzyme reaction buffer,
801.tL of
20 mM TPP, 804 of 2001iM FAD, 804 of 2M sodium pynivate + 200mM MgCl2 and ALS
herbicide at different concentrations, mixed well, reacted at 37 C for Iii,
then added with 1604
of 3M H2SO4 to stop the reaction, and subjected to decarboxylation at 60 C for
15min; then
12
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
added with 7804. of 5.5% a-naphthol solution and 7804 of 0.55% creatine,
subjected to color
development at 65 C for 15min and color matching at 530nm, the light
absorbance value was
read, and the enzyme activity was calculated according to the standard curve.
The ALS enzyme
activity of the herbicide-free control was recorded as 100%, and the effects
of
Bispyribac-sodium (PB type), Tribenuron-methyl (SU type) and Imazethapyr (1M1
type) on ALS
enzyme activity in RP-1, EM28 and the original wild-type N131 were calculated.
As can be seen from Figures 2 and 3, with the increase of concentrations of SU
herbicide
Tribenuron-methyl and IMI herbicide Imazethapyr, the ALS enzyme activity in
the wild-type
N131, EM28 and RP-1 were all inhibited, while the mutant enzymes in EM28 and
RP-1 all
showed a certain resistance to the herbicides, because compared with the wild
type N131 , with
the increase of concentration of Tribenuron-methyl, the inhibition trend of
ALS enzyme activity
in EM28 and RP-1 decreased slowly, and the both showed the same change trend.
It can be seen from Figure 4 that the mutant enzyme in RP-1 exhibited a strong
resistance to
pyrimidinylsalicylate herbicide Bispyribac-sodium, because compared with the
N131 and EM28,
with the increase of concentration of Bispyribac-sodium, the ALS enzyme
activity in N131 and
EM28 dropped rapidly and showed the same change trend, while the mutant enzyme
activity in
RP-I was less inhibited by the herbicide, that was, even under the condition
of high
concentration (250 mol L-1) of Bispyribac-sodium, the mutant enzyme activity
in RP-1 was
about 51% of the control. However, at this time, the inhibition rates of
enzyme activity in N131
and EM28 were close to 100%, that was, the ALS in N131 and EM28 basically had
no activity,
being only 4% and 10% of the control, respectively. In summary, the
sensitivity of the ALS
enzyme in the mutant RP-1 to the pyrimidinylsalicylate herbicide Bispyribac-
sodium was
significantly lower than those of the ALS enzymes in N131 and EM28. This
further indicates
that the double-site mutations of ALS gene (W556L and S635N) confer RP-1 with
resistance to
pyrimidinylsalicylate herbicides.
Example 5: Functional verification of resistance gene in Arahidopsis thaliana
A plant expression vector was constructed, and the resistance gene was
transferred into an
Arahidopsis thaliana plant by conventional Agrohacterium-mediated
transformation method, and
positive homozygous transgenic lines were screened by PCR in the progeny of
transgenes for
herbicide phenotype identification. In brief, specific primers were designed
according to the
ALS3 gene sequence, ALS3 primer 3: 5'CGCGGTACCCTCTCTCTCTCTCATCTAACCAT3'
and ALS3 primer 4: 5'CGCACTAGTCTCTCTCAGTACTTAGTGCGACC3I, Kpra and SpeI
enzyme modification sites were added at the 5' end, and the underlined
sequences were enzyme
digest sites. Using the genomic DNA of the mutant RP-1 as a template, the
resistance gene was
13
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
obtained by PCR amplification, the nucleotides of which were shown in SEQ ID
NO: 3, and the
amino acid sequence of which was shown in SEQ ID NO: 4. The PCR product was
recovered,
cloned and sequenced according to the method of Example 2 to obtain a
recombinant T vector
carrying the gene encoding the mutant enzyme. The fragments containing the
gene of interest
were recovered by double digestion of the T vector with KpnI and Spel, and
ligated into the
pCAMBIA1390 vector (purchased from CAMBI, Australia), which was also double
digested, to
obtain a recombinant plant expression vector. The constructed recombinant
vector was
transformed into E. colt DH5u, and the plasmid was extracted for enzyme
digestion and
sequencing detection. The recombinant vector which was confirmed by detection
to contain the
target gene correctly was transformed into Agrobacterium EHA105 strain, and
the plasmid was
extracted for PCR and enzyme digestion identification. The obtained
recombinant strain was
cultured, and transformed into Arabidopsis thaliana by Agrobacterium infection
flower dipping
method. After TO generation was screened on medium by antibiotics, the
obtained TI generation
plants were transplanted into pots and placed in an artificial incubator for
growth, and the T3
generation homozygous transgenic lines were obtained by PCR screening and
propagation. At
the 13 generation transgenic seedling stage, 60g a.i. ha Bispyribac-sodium was
sprayed for
resistance identification. After 3 weeks of spraying treatment, all transgenic
Arabidopsis thaliana
seedlings grew well, while non-transgenic Arabidopsis thaliana (Col) seedlings
were all
yellowed and died (Figure 5), indicating that the expression of nucleotides in
RP-1 such as the
mutant acetolactate synthase gene as shown in SEQ ID NO: 3 in Arabidopsis
thaliana had the
function resistant to the pyrimidinylsalicylate herbicide.
Example 6: Functional verification of resistance gene in tobacco
According to the method of Example 5, the nucleotides in RP-1 such as the
mutant
acetolactate synthase gene as shown in SEQ ID NO: 3 were cloned into the plant
expression
vector pCAMBIA1390 plasmid (purchased from CAMBI, Australia). The positive
clones were
selected and transformed into Agrohacteritun EHAl 05, and Nicotiana
benthamiana leaf disc was
transformed by the conventional Agrobacterium-mediated transformation method.
After the
transgenic tobacco plants were harvested, they were identified by PCR and
sprayed with 60 g a.i.
ha-1 Bispyribac-sodium at the T3 transgenic tobacco seedling stage to identify
resistance. After 3
weeks of spraying treatment, all the transgenic tobacco seedlings grew well,
while the
non-transgenic tobacco (Tob) seedlings were all yellowed and died (Figure 5),
indicating that the
expression of nucleotides in RP-1 such as the mutant acetolactate synthase
gene as shown in
SEQ ID NO: 3 in tobacco also had the function resistant to the
pyrimidinylsalicylate herbicide.
Example 7: Functional verification of resistance gene in common rape
14
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
The nucleotides in RP-1 such as the mutant acetolactate synthase gene as shown
in SEQ ID
NO: 3 were introduced into other common rape varieties or strains that were
not resistant to
pyrimidinylsalicylate herbicides using a hybridization method. In brief, RP-1
was used to
prepare hybrid combinations with common rape varieties restoring lines 3075R
(Pu Huiming et
al., 2002, Jiangsu Agricultural Sciences, 4: 33-34) and 3018R (Pu Huiming et
al., 1999, Jiangsu
Agricultural Science, 6: 32-33), two Fl seeds were harvested in the same year
and used for
additional planting in a rape vernalization cultivation room, individual
plants of uniform growth
were subjected to bagging self-pollination at flowering stage, the F2 seeds
were harvested and
sown in Lishui Plant Science Base of the Academy of Agricultural Sciences of
Jiangsu Province
in Nanjing, each F2 population was sown with 20 rows. Individual plant leaves
of the F2
population were taken at the seedling stage, DNA was extracted, the ALS3 gene
was amplified
by PCR, and the product was subjected to purification, recovery and sequencing
according to
steps of Example 2. According to the sequencing results, a homozygous F2
single plant having
the nucleotides in RP-1 such as the mutant acetolactate synthase gene as shown
in SEQ ID NO: 3
was screened. At the flowering stage of rape, each selected F2 single plant
was bagged for
self-cross, and F3 seeds were harvested. At the seedling stage of F3
generation, 60g a.i. ha-1
Bispyribac-sodium was sprayed for resistance identification. After 3 weeks of
spraying treatment,
all selected rape seedlings introduced with resistance gene were in good
growth status, while all
rape seedlings without resistance gene were all yellowed and died, indicating
that the expression
of nucleotides in RP-1 such as the mutant acetolactate synthase gene as shown
in SEQ ID NO: 3
in rape also had the function resistant to the pyrimidinylsalicylate
herbicide.
Example 8: Study on resistance function of substitutions with different amino
acids at
resistance mutation sites
In order to clarify the resistance function produced by ALS3 when two sites
Trp556 and
Ser635 were mutated into other amino acids, we have consulted a large number
of relevant
literatures and designed 5 amino acid mutation combinations (Table 2), which
were introduced
manually into point-mutation sites and used to construct plant expression
vectors thereof, and
their resistance functions were verified by transforming Arabidopsis thaliana.
In brief, the
mutant RP-1 genome was used as a template to perform site-directed mutagenesis
using PCR
technology, which was carried out by commissioning Nanjing Zhongding
Biotechnology Co.,
Ltd. As a result, 5 mutant genes were obtained: LT, in which the nucleotide at
position +1667 of
the ALS3 gene changed from G to T, and the nucleotide at position +1904
changed from G to C,
resulting in the mutation of tryptophan (W) to leucine (L) at position 556 and
the mutation of
serine (S) to threonine (T) at position 635 of the correspondingly encoded
protein; LI, in which
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
the nucleotide at position +1667 of the ALS3 gene changed from G to T and the
nucleotide at
position +1904 changed from G to T, resulting in the mutation of tryptophan
(W) to leueine (L)
at position 556 and the mutation of serine (S) to isoIeueine (1) at position
635 of the
correspondingly encoded protein; GN, in which the nucleotide at position +1666
of the ALS3
gene changed from T to G and the nucleotide at position +1904 changed from G
to A, resulting
in the mutation of tryptophan (W) to glycine (G) at position 556 and the
mutation of serine (S) to
asparagine (N) at position 635 of the correspondingly encoded protein; GT, in
which the
nucleotide at position +1666 of the ALS3 gene changed from T to G and the
nucleotide at
position +1904 changed from G to C, resulting in the mutation of tryptophan
(W) to glycine (G)
at position 556 and the mutation of serine (S) to threonine (T)at position 635
of the
correspondingly encoded protein; GI, in which the nucleotide at position +1666
of the ALS3
gene changed from T to G and the nucleotide at position +1904 changed from G
to T, resulting
in the mutation of tryptophan (W) to glycine (G) at position 556 and the
mutation of serine (S) to
isoleucine (1) at position 635 of the correspondingly encoded protein (Table
2).
According to the method of Example 5, the above five mutant sequences were
constructed
into plant expression vector pCAMBIAI390 plasmid (purchased from CAMBI,
Australia), and
transformed into Arabidopsis thaliana. After obtaining positive transgenic
seedlings, 60 g a.i.
Bispyribac-sodium was sprayed at the seedling stage for resistance
identification. After 3
weeks of spraying treatment, all the transgenic Arcthidopsis thaliana
seedlings of LT and LI grew
well, while the transgenic Arabidopsis thaliana seedlings of GN, UT and Cl and
the
non-transgenic Arabidopsis thaliana seedlings all yellowed and died (Table 2),
indicating that
the expression of sequences of LT and LI amino acid mutation combinations in
Arabiclopsis
thaliana had the function resistant to the pyrimidinylsalicylate herbicide.
Table 2: Resistance performance of different amino acid mutation combination
sequences in
Arabidopsis thaliana
Mutant Corresponding amino acid
Resistance
DNA mutation sites
name site substitutions performance
LT +1667: TGG/TTG; +1904: AGT/ACT W556L; S635T
LI +1667: TGG/TTG; +1904: AGT/ATIF W556L; S6351
GN +1666: TGG/GGG; +1904: AGT/AAT W5566; S635N
CT +1666: TGG/GGG; +1904: AGT/ACT W5566; S635T
GI +1666: TGG/GGG; +1904: AGT/AIT W5566; S6351
Note: Bold letters in italics indicate mutated bases; R represents that the
transgenic plants
grew well after herbicide treatment, and no phytotoxicity occurred; S
represents that the growth
16
Date Recue/Date Received 2020-07-08
CA 03087906 2020-07-08
of rape plants was severely inhibited after herbicide treatment, indicating
obvious phytotoxicity,
and finally the rape seedlings died.
Although the specific embodiments of the present invention have been described
above,
those skilled in the art should understand that these arc merely examples, and
the protection
scope of the present invention is defined by the appended claims. Those
skilled in the art can
make various changes or modifications to these embodiments without departing
from the
principle and essence of the present invention, but these changes and
modifications fall within
the protection scope of the present invention.
17
Date Recue/Date Received 2020-07-08
