Note: Descriptions are shown in the official language in which they were submitted.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 1 -
GAMMA POLYGLUTAMATED ANTIFOLATES AND USES THEREOF
BACKGROUND
[0001] This disclosure generally relates to gamma polyglutamated Antifolate
compositions,
including delivery vehicles such as liposomes containing the gamma
polyglutamated
Antifolate compositions, and methods of making and using the compositions to
treat diseases
including hyperproliferative diseases such as cancer, disorders of the immune
system including
inflammation and autoimmune diseases such as rheumatoid arthritis, and
infectious disease
such as HIV, malaria, and schistomiasis.
[0002] Folate is an essential cofactor that mediates the transfer of one-
carbon units involved
in nucleotide biosynthesis and DNA repair, the remethylation of homocysteine
(Hcy), and the
methylation of DNA, proteins, and lipids. The only circulating forms of
folates in the blood
are monoglutamates and folate monoglutamates are the only form of folate that
is transported
across the cell membrane - likewise, the monoglutamate form of
polyglutamatable antifolates
are transported across the cell membrane. Once taken up into cells,
intracellular folate is
converted to polyglutamates by the enzyme folylpoly-gamma-glutamate synthetase
(FPGS).
[0003] Antifolate is transported into cells by the reduced folate carrier
(RFC) system and
folate receptors (FRs) a and 13 and by Proton Coupled Folate Transporter
(PCFT) that is
generally most active in a lower pH environment. RFC is the main transporter
of antifolates at
physiologic pH and is ubiquitously expressed in both normal and diseased
cells. Consequently,
Antifolate treatment often suffers from the dose-limiting toxicity that is a
major obstacle in
cancer chemotherapy. Once inside the cell, antifolates are polyglutamated by
FPGS, which
may add up to 6 glutamyl groups in an L-gamma carboxyl group linkage to the
antifolate. The
L-gamma polyglutamation of antifolates by FPGS serves at least 2 main
therapeutic purposes:
(1) it greatly enhances Antifolate affinity and inhibitory activity for DHFR;
and (2) it facilitates
the accumulation of polyglutamated antifolate, which unlike antifolate
(monoglutamate), is not
easily transported out of cells by cell efflux pumps.
[0004] While targeting folate metabolism and nucleotide biosynthesis is a
well-established
therapeutic strategy for cancer, for antifolates, clinical efficacy is limited
by a lack of tumor
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 2 -
selectivity and the presence of de novo and acquired drug resistance.
Antifolates often act
during DNA and RNA synthesis, and consequently have a greater toxic effect on
rapidly
dividing cells such as malignant and myeloid cells. Myelosuppression is
typically the dose-
limiting toxicity of antifolate therapy and has limited the clinical
applications of antifolates.
[0005] Resistance to antifolate therapy is typically associated with one or
more of, (a)
increased cell efflux pump activity, (b) decreased transport of antifolates
into cells (c)
increased DHFR activity, (d) decreased folylpoly-gamma-glutamate synthetase
(FPGS)
activity, and (e) increased gamma-glutamyl hydrolase (GGH) activity, which
cleaves gamma
polyglutamate chains attached to folates and antifolates.
[0006] The challenge to the longstanding (>30 years) observation that
higher-level
polyglutamates of various antifolates have much greater potency compared to
lower-level
glutamates, has been that the scientific community has relied on the
intracellular FPGS
mediated mechanisms to convert the lower-level glutamates to their higher-
level forms. The
present inventions provide the means to deliver higher-level polyglutamate
forms of antifolates
directly into the cell, without having to rely on the cells machinery to
achieve this goal.
[0007] The provided gamma polyglutamated Antifolate compositions deliver a
strategy for
overcoming the pharmacological challenges associated with the dose limiting
toxicities and
with treatment resistance associated with antifolate therapy. In some
embodiments, the
provided methods deliver to cancer cells a gamma polyglutamated form of the
antifolate while
(1) minimizing/reducing exposure to normal tissue cells, (2)
optimizing/improving the
cytotoxic effect of antifolate-based agents on cancer cells and (3)
minimizing/reducing the
impact of the efflux pumps, and other resistance mechanisms that limit the
therapeutic efficacy
of antifolates.
BRIEF SUMMARY
[0008] This disclosure generally relates gamma polyglutamated Antifolate
(yPANTIFOL)
compositions and methods of making and using the compositions to treat
diseases including
hyperproliferative diseases such as cancer, disorders of the immune system
such as
inflammation and rheumatoid arthritis, cardiovascular disease such as coronary
artery disease,
and infectious disease such as HIV, malaria, and schistomiasis.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 3 -
[0009] In some embodiments, the disclosure provides:
[1] a composition comprising a gamma polyglutamated Antifolate;
[2] the composition of [1], wherein the Antifolate is selected from:
piritrexim,
pralatrexate, AG2034, GW1843, and LY309887, or a stereoisomer thereof;
[3] the composition of [1], wherein the Antifolate is selected from: PMX,
MTX, RTX,
and LTX, or a stereoisomer thereof;
[4] the composition according to any of [1]-[3], wherein the Antifolate is
selected from:
LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-
methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX,
methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-
MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-
2-methyl-AMT; 10-EdAM, 10-ethyl-10-deazaaminopterin; PT523, N alpha -(4-
amino-4-deoxypteroy1)-N delta-(hemiphthaloyl) -L-omithine; DDATHF
(lometrexol), 5,10-dideaza-5,6,7,8,-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-
deaza-
5,6,7,8-tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methy1-5-deaza-
5,6,7,8-tetrahydroisofolic acid; 5-dPteHCysA, N alpha-(5-deazapteroy1)-L-
homocysteic acid; 5-dPteAPBA, N alpha-(5-deazapteroy1)-DL-2-amino-4-
phosphonobutanoic acid; 5-dPteOrn, N alpha-(5-deazapteroy1)-L-ornithine; 5-
dH4PteHCysA, N alpha -(5-deaza-5,6,7,8-tetrahydropteroy1)-L-homocysteic acid;
5-
dH4PteAPBA, N alpha-(5-deaza-5,6,7,8-tetrahydropteroy1)-DL-2-amino-4-
phosphobutanoic acid; 5-dH4PteOro, N alpha -(5-deaza-5,6,7,8-
tetrahydropteroy1)-
L-ornithine; CB 3717, N10-propargy1-5,8-dideazafolic acid; ICI-198,583, 2-
desamino-2-methyl-N10-propargy1-5,8-dideazafolic acid; 4-H-ICI-198,583, 4-
deoxy-ICI-198,583: 4-0CH3-ICI-198,583, 4-methoxy-ICI-198,583 Glu-to-Val-ICI-
198,583; valine-ICI-198;583; Glu-to-Sub-ICI-198,583, 2-amino-suberate-ICI-
198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-198,583; ZD1694, N45(N-(3,4-dihydro-
2-methy1-4-oxoquinazolin-6-yl-methyl)amino)2-- thieny1)]-L-glutamic acid; 2-
NH2-
ZD1694, 2-amino-ZD1694; BW1843U89, (S)-2[5-(((1,2-dihydro-3-methyl-1-
oxobenzo(f) quinazolin-9-yl)methyl)amino- )-1-oxo-2-isoindolinyll-glutaric
acid;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 4 -
LY231514, N-(4-(2-(2-amino-4,7-dihydro-4-oxo-3H-pyrrolo[2,3-D]pyrimidin-5-
ypethyl)- benzoyll-L-glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-
desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-
deazaaisofolic acid; N9-CH3-5-d(i)PteGlu, N9-methyl-5-deazaisofolic acid; N9-
CH0-5-d(i)PteGlu, N9-formy1-5-deazaisofolic acid; AG337, 3,4-dihydro-2-amino-
6-methly-4-oxo-5-(4-pyridylthio) quanazoline; and 2,4-diamino-6[N-(4-
(phenysulfonyl)benzyl)ethyl)amino] quinazoline; or a stereoisomer thereof;
[5] the composition of [1], wherein the Antifolate is selected from:
methotrexate,
raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,10-
dideazatetrahydrofolic
acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945,
or a
stereoisomer thereof, such as 6-R,S-BGC 945 (ONX-0801), CB300638, and
BW1843U89;
[6] the composition according to any of [1]-[5], wherein the gamma
polyglutamated
Antifolate contains 4, 5 2-10, 4-6, or more than 5, glutamyl groups;
[7] the composition according to any of [1]-[6], wherein the gamma
polyglutamated
Antifolate:
(a) is gamma tetraglutamated Antifolate;
(b) is gamma pentaglutamated Antifolate; or
(c) is gamma hexaglutamated Antifolate;
[8] the composition according to any of [1]-[7], wherein the gamma
polyglutamated
Antifolate comprises 1-10 glutamyl groups having a gamma carboxyl group
linkage;
[9] the composition according to any of [1]-[8], wherein:
(a) at least 2 of the glutamyl groups of the gamma polyglutamated
Antifolate are in
the L-form,
(b) each of the glutamyl groups of the gamma polyglutamated Antifolate is
in the L-
form,
(c) at least 1 of the glutamyl groups of the gamma polyglutamated
Antifolate is in
the D-form,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 5 -
(d) each of the glutamyl groups of the gamma polyglutamated Antifolate
other than
the glutamyl group of the Antifolate is in the D-form, or
(e) at least 2 of the glutamyl groups of the gamma polyglutamated
Antifolate are in
the L-form and at least 1 of the glutamyl groups is in the D-form;
[10] the composition according to any of [1]-[9], wherein the polyglutamate is
linear;
[11] the composition according to any of [I]-[9], wherein the polyglutamate is
branched;
[12] a liposomal composition comprising the gamma polyglutamated Antifolate
according to any of [1]-[11] (Lp-yPANTIFOL);
[13] the Lp-7PANTIFOL composition of [12], wherein the polyglutamated
Antifolate is
selected from:
(a) AG2034, piritrexim, pralatrexate, GW1843, Antifolate, and LY309887; or
(b) PMX, MTX, RTX, and LTX, or a stereoisomer thereof;
[14] the Lp-yPANTIFOL composition of [12] or [13], wherein the polyglutamated
Antifolate is selected from: LV (etoposide), L-leucovorin (L-5-
formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic acid;
PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX;
2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-
desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, 10-ethy1-10-
deazaaminopterin; PT523, N alpha -(4-amino-4-deoxypteroy1)-N delta-
(hemiphthaloy1)-L-ornithine; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8,-
tetrahydrofolic acid; 5-d(i)H4PteG1u, 5-deaza-5,6,7,8-tetrahydroisofolic acid;
N9-
CH3-5-d(i)H4PteGlu, N9-methyl-5-deaza-5,6,7,8-tetrahydroisofolic acid; 5-
dPteHCysA, N alpha -(5-deazapteroy1)-L-homocysteic acid; 5-dPteAPBA, N alpha -
(5-deazapteroy1)-DL-2-amino-4-phosphonobutanoic acid; 5-dPte0m, N alpha -(5-
deazapteroy1)-L-ornithine; 5-dH4PteHCysA, N alpha -(5-deaza-5,6,7,8-
tetrahydropteroy1)-L-homocysteic acid; 5-dH4PteAPBA, N alpha -(5-deaza-5,6,7,8-
tetrahydropteroy1)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N alpha -(5-
deaza-5,6,7,8-tetrahydropteroy1)-L-ornithine; CB 3717, N10-propargy1-5,8-
dideazafolic acid; ICI-198,583, 2-desamino-2-methyl-N10-propargy1-5,8-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 6 -
dideazafolic acid; 4-H40-198,583, 4-deoxy-ICI-198,583: 4-0CH3-ICI-198,583, 4-
methoxy-ICI-198,583 Glu-to-Val-ICI-198,583; valine-ICI-198;583; Glu-to-Sub-ICI-
198,583, 2-amino-suberate-ICI-198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-
198,583; ZD1694, N-[5(N-(3,4-dihydro-2-methy1-4-oxoquinazolin-6-yl-
methyl)amino)2-- thieny1)1-L-glutamic acid; 2-NH2-ZD1694, 2-amino-ZD1694;
BW1843U89, (S)-2[5-(((1,2-dihydro-3-methyl-1-oxobenzo(f)quinazolin-9-
yl)methyl)amino- )-1-oxo-2-isoindoliny11-glutaric acid; LY231514, N-(4-(2-(2-
amino-4,7-dihydro-4-oxo-3H-pyrrolo[2,3-D]pyrimidin-5-yOethyl)- benzoy11-L-
glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-
CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-deazaaisofolic acid; N9-
CH3-5-d(i)PteGlu, N9-methyl-5-deazaisofolic acid; N9-CH0-5-d(i)PteGlu, N9-
formy1-5-deazaisofolic acid; AG337, 3,4-dihydro-2-amino-6-methly-4-oxo-5-(4-
pyridylthio) quanazoline; and AG377, 2,4-diamino-6[N-(4-(phenysulfonyl)
benzyl)ethyl)amino]quinazoline; or a stereoisomer thereof;
[15] the Lp-7PANTIFOL composition according to any of [12]414], wherein the
Antifolate is selected from: methotrexate, raltitrexed, plevitrexed,
pemetrexed,
lometrexol (LMX; 5,10-dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline
with a dipeptide ligand, CB3717, CB300945, or a stereoisomer thereof, such as
6-
R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89;
[16] the Lp-7PANTIFOL composition according to any of [121415], wherein the
liposome comprises a gamma polyglutamated Antifolate containing 4, 5, 2-10, 4-
6,
or more than 5, gamma glutamyl groups;
[17] the Lp-7PANTIFOL composition according to any of [12]-[16], wherein the
liposome comprises a gamma tetraglutamated Antifolate;
[18] the Lp-7PANTIFOL composition according to any of [12]-[16], wherein the
liposome comprises a gamma pentaglutamated Antifolate;
[19] the Lp-7PANTIFOL composition according to any of [121416], wherein the
liposome comprises a gamma hexaglutamated Antifolate;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 7 -
[20] the Lp-yPANTIFOL composition according to any of [12]119], wherein the
gamma
polyglutamated Antifolate comprises 1-10 glutamyl groups having a gamma
carboxyl group linkage;
[21] the Lp-7PANTIFOL composition according to any of [12]-[20], wherein:
(a) at least 2 of the glutamyl groups of the gamma polyglutamated
Antifolate are in
the L-form;
(b) each of the glutamyl groups of the gamma polyglutamated Antifolate is
in the L-
form;
(c) at least 1 of the glutamyl groups of the gamma polyglutamated
Antifolate is in
the D-form;
(d) each of the glutamyl groups of the gamma polyglutamated Antifolate
other than
the glutamyl group of the Antifolate is in the D-form; or
(e) at least 2 of the glutamyl groups of the gamma polyglutamated
Antifolate are in
the L-form and at least 1 of the glutamyl groups is in the D-form;
[22] the Lp-7PANTIFOL composition according to any of [12]-[21], wherein
(a) at least 2 of the glutamyl groups of the gamma polyglutamated
Antifolate are in
the L-form;
(b) each of the glutamyl groups of the gamma polyglutamated Antifolate is
in the L-
form;
(c) at least 1 of the glutamyl groups of the gamma polyglutamated
Antifolate is in
the D-form;
(d) each of the glutamyl groups of the gamma polyglutamated Antifolate
other than
the glutamyl group of the Antifolate is in the D-form; or
(e) at least 2 of the glutamyl groups of the gamma polyglutamated
Antifolate are in
the L-form and at least 1 of the glutamyl groups is in the D-form;
[23] the Lp-7PANTIFOL composition according to any of [121422], wherein the
liposome is pegylated (PLp-7PANTIFOL);
[24] the Lp-7PANTIFOL composition according to any of [121422], wherein the
liposome is not pegylated;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 8 -
[25] the Lp-yPANTIFOL composition according to any of [12]-[24], wherein the
liposome has a diameter in the range of 20 nm to 200 nm;
[26] the Lp-7PANTIFOL composition according to any of [12]-[25], wherein the
liposome has a diameter in the range of 80 nm to 120 nm;
[27] the Lp-7PANTIFOL composition according to any of [121426], wherein the
liposome is formed from liposomal components;
[28] the Lp-7PANTIFOL composition according to [27], wherein the liposomal
components comprise at least one of an anionic lipid and a neutral lipid;
[29] the Lp-7PANTIFOL composition according to [27] or [28], wherein the
liposomal
components comprise at least one selected from: DSPE; DSPE-PEG; DSPE-PEG-
maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol-PEG; and cholesterol-
maleimide;
[30] the Lp-7PANTIFOL composition according to any of [27]-[29], wherein the
liposomal components comprise at least one selected from: DSPE; DSPE-PEG;
DSPE-PEG-FITC; DSPE-PEG-maleimide; cholesterol; and HSPC;
[31] the Lp-7PANTIFOL composition according to any of [27]430], wherein one or
more
liposomal components further comprises a steric stabilizer;
[32] the Lp-7PANTIFOL composition according to [31], wherein the steric
stabilizer is at
least one selected from polyethylene glycol (PEG); poly-L-lysine (PLL);
monosialoganglioside (GM1); poly(vinyl pyrrolidone) (PVP); poly(acrylamide)
(PAA); poly(2-methyl-2-oxazoline); poly(2-ethyl-2-oxazoline); phosphatidyl
polyglycerol; poly[N-(2-hydroxypropyl) methacrylamide]; amphiphilic poly-N-
vinylpyrrolidones; L-amino-acid-based polymer; oligoglycerol, copolymer
containing polyethylene glycol and polypropylene oxide, Poloxamer 188, and
polyvinyl alcohol;
[33] the Lp-7PANTIFOL composition according to [32], wherein the steric
stabilizer is
PEG and the PEG has a number average molecular weight (Mn) of 200 to 5000
daltons;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 9 -
[34] the Lp-yPANTIFOL composition according to any of [121433], wherein the
liposome is anionic or neutral;
[35] the Lp-7PANTIFOL composition according to any of [12]433], wherein the
liposome has a zeta potential that is less than or equal to zero;
[36] the Lp-7PANTIFOL composition according to any of [12]433], wherein the
liposome has a zeta potential that is between 0 to -150 mV;
[37] the Lp-7PANTIFOL composition according to any of [12]433], wherein the
liposome has a zeta potential that is between -30 to -50 mV;
[38] the Lp-7PANTIFOL composition according to any of [12]433], wherein the
liposome is cationic;
[39] the Lp-7PANTIFOL composition according to any of [121438], wherein the
liposome has an interior space comprising the gamma polyglutamated Antifolate
and
an aqueous pharmaceutically acceptable carrier;
[40] the Lp-7PANTIFOL composition of [39], wherein the pharmaceutically
acceptable
carrier comprises a tonicity agent such as dextrose, mannitol, glycerine,
potassium
chloride, sodium chloride, at a concentration of greater than 1%;
[41] the Lp-7PANTIFOL composition of [39], wherein the aqueous
pharmaceutically
acceptable carrier is trehalose;
[42] the Lp-7PANTIFOL composition of [41], wherein the pharmaceutically
acceptable
carrier comprises 1% to 50% trehalose;
[43] the Lp-7PANTIFOL composition according to any of [39] -[42], wherein the
pharmaceutically acceptable carrier comprises 1% to 50% dextrose solution;
[44] the Lp-7PANTIFOL composition according to any of [39] 443], wherein the
interior
space of the liposome comprises 5% dextrose suspended in an HEPES buffered
solution;
[45] the Lp-7PANTIFOL composition according to any of [39]-[44], wherein the
pharmaceutically acceptable carrier comprises a buffer such as HEPES Buffered
Saline (HBS) or similar, at a concentration of between 1 to 200 mM and a pH of
between 2 to 8;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 10 -
[46] the Lp-7PANTIFOL composition according to any of [39]-[45], wherein the
pharmaceutically acceptable carrier comprises a total concentration of sodium
acetate and calcium acetate of between 50 mM to 500 mM;
[47] the Lp-7PANTIFOL composition according to any of [12]-[46], wherein the
interior
space of the liposome has a pH of 5-8 or a pH of 6-7, or any range therein
between;
[48] the Lp-7PANTIFOL composition according to any of [12]-[47], wherein the
liposome comprises less than 500,000 or less than 200,000 molecules of the
gamma
polyglutamated Antifolate;
[49] the Lp-7PANTIFOL composition according to any of [12]-[48], wherein the
liposome comprises between 10 to 100,000 molecules of the gamma polyglutamated
Antifolate, or any range therein between;
[50] the Lp-7PANTIFOL composition according to any of [12]-[49], which further
comprises a targeting moiety and wherein the targeting moiety has a specific
affinity
for a surface antigen on a target cell of interest;
[51] the Lp-7PANTIFOL composition according to [50], wherein the targeting
moiety is
attached to one or both of a PEG and the exterior of the liposome, optionally
wherein
targeting moiety is attached to one or both of the PEG and the exterior of the
liposome by a covalent bond;
[52] the Lp-7PANTIFOL composition of [50] or [51], wherein the targeting
moiety is a
polypeptide;
[53] the Lp-7PANTIFOL composition according to any of [50]-[52], wherein the
targeting moiety is an antibody or an antigen binding fragment of an antibody;
[54] the Lp-7PANTIFOL composition according to any of [50]-[53], wherein the
targeting moiety binds the surface antigen with an equilibrium dissociation
constant
(Kd) in a range of 0;5 x 10-10 to 10 x 10-6 as determined using BIACORE
analysis;
[55] the Lp-7PANTIFOL composition according to any of [50]-[54], wherein the
targeting moiety specifically binds one or more folate receptors selected
from: folate
receptor alpha (FR-a), folate receptor beta (FR-13), and folate receptor delta
(FR-6);
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 11 -
[56] the Lp-7PANTIFOL composition according to any of [50]455], wherein the
targeting moiety comprises one or more selected from: an antibody, a humanized
antibody, an antigen binding fragment of an antibody, a single chain antibody,
a
single-domain antibody, a hi-specific antibody, a synthetic antibody, a
pegylated
antibody, and a multimeric antibody;
[57] the Lp-7PANTIFOL composition according to any of [50]-[56], wherein each
pegylated liposome comprises from 1 to 1000 or 30-200 targeting moieties;
[58] the Lp-7PANTIFOL composition according to any of [391457], further
comprising
one or more of an immunostimulatory agent, a detectable marker and a
maleimide,
wherein the immunostimulatory agent, the detectable marker or the maleimide is
attached to said PEG or the exterior of the liposome;
[59] the Lp-7PANTIFOL composition of [58], wherein the immunostimulating agent
is at
least one selected from:: a protein immunostimulating agent; a nucleic acid
immunostimulating agent; a chemical immunostimulating agent; a hapten; and an
adjuvant;
[60] the Lp-7PANTIFOL composition of [58] or [59], wherein the
immunostimulating
agent is at least one selected from: a fluorescein; a fluorescein
isothiocyanate
(FITC); a DNP; a beta glucan; a beta-1,3-glucan; a beta-1,6-glucan; a resolvin
(e.g.,
a Resolvin D such as Dn-6DPA or Dn-3DPA, a Resolvin E, or a T series
resolvin);
and a Toll-like receptor (TLR) modulating agent such as, an oxidized low-
density
lipoprotein (e.g. OXPAC, PGPC), and an eritoran lipid (e.g., E5564);
[61] the Lp-7PANTIFOL composition according to any of [581460], wherein the
immunostimulatory agent and the detectable marker is the same;
[62] the Lp-7PANTIFOL composition according to any of [58]-[61], further
comprising a
hapten;
[63] the Lp-7PANTIFOL composition of [62], wherein the hapten comprises one or
more
of fluorescein or Beta 1, 6-glucan;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 12 -
[64] the Lp-yPANTIFOL composition according to any of [121463], which further
comprises at least one cryoprotectant selected from mannitol; trehalose;
sorbitol;
and sucrose;
[65] a targeted composition comprising the composition according to any of [1]-
[64];
[66] a non-targeted composition comprising the composition according to any of
[11449];
[67] the Lp-7PANTIFOL composition according to any of [121466], which further
comprises carboplatin and/or pembroluzumab;
[68] a pharmaceutical composition comprising the liposomal gamma
polyglutamated
Antifolate composition according to any of [12]467];
[69] a pharmaceutical composition comprising gamma polyglutamated Antifolate
composition according to any of [1]47];
[70] the composition of any of [1]469], for use in the treatment of disease;
[71] use of the composition of any of [1]-[70], in the manufacture of a
medicament for
the treatment of disease;
[72] a method for treating or preventing disease in a subject needing such
treatment or
prevention, the method comprising administering the composition of any of
[1]470]
to the subject;
[73] a method for treating or preventing disease in a subject needing such
treatment or
prevention, the method comprising administering the liposomal gamma
polyglutamated Antifolate composition of any of [121469] to the subject;
[74] a method of killing a hyperproliferative cell that comprises contacting a
hyperproliferative cell with the composition of any of [1]-[69];
[75] a method of killing a hyperproliferative cell that comprises contacting a
hyperproliferative cell with the liposomal gamma polyglutamated Antifolate
composition of any of [12]-[69];
[76] the method of [74] or [75], wherein the hyperproliferative cell is a
cancer cell, a
mammalian cell, and/or a human cell;
[77] a method for treating cancer that comprises administering an effective
amount of the
composition of any of [1]-[69] to a subject having or at risk of having
cancer;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 13 -
[78] A method for treating cancer that comprises administering an effective
amount of the
liposomal gamma polyglutamated Antifolate composition of any of [121468] to a
subject having or at risk of having cancer;
[79] the method of [77] or [78], wherein the cancer is selected from: a non-
hematologic
malignancy including such as for example, lung cancer, pancreatic cancer,
breast
cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer,
gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical
cancer, liver
cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder
cancer,
sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and
melanoma; and a hematologic malignancy such as for example, a leukemia, a
lymphoma and other B cell malignancies, myeloma and other plasma cell
dyscrasias;
[80] the method of [77] or [78], wherein the cancer is selected from: lung
cancer, breast
cancer, colon cancer, pancreatic cancer, gastric cancer, bladder cancer, head
and
neck cancer, ovarian cancer, and cervical cancer;
[81] the method of [77] or [78], wherein the cancer is selected from:
colorectal cancer,
lung cancer, breast cancer, head and neck cancer, and pancreatic cancer;
[82] the method of [77] or [78], wherein the cancer is selected from:
colorectal cancer,
breast cancer, ovarian cancer, lung cancer, head and neck cancer, pancreatic
cancer,
gastric cancer, and mesothelioma;
[83] a method for treating cancer that comprises administering an effective
amount of the
Lp-yPANTIFOL composition of any of [501466] to a subject having or at risk of
having a cancer cell that expresses on its surface a folate receptor bound by
the
targeting moiety;
[84] a maintenance therapy for subjects that are undergoing or have undergone
cancer
therapy that comprise administering an effective amount of the composition of
any
of [1]-[69] to a subject that is undergoing or has undergone cancer therapy;
[85] a maintenance therapy for subjects that are undergoing or have undergone
cancer
therapy that comprise administering an effective amount of the liposomal gamma
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 14 -
polyglutamated Antifolate composition of any of [12]-[69] to a subject that is
undergoing or has undergone cancer therapy;
[86] a method for treating a disorder of the immune system that comprises
administering
an effective amount of the composition of any of [1]-[69] to a subject having
or at
risk of having a disorder of the immune system, optionally wherein the
disorder of
the immune system is selected from: inflammation (e.g., acute and chronic),
systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD),
Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus,
and
Takayasu, and psoriasis;
[87] a method for treating a disorder of the immune system that comprises
administering
an effective amount of the liposomal gamma polyglutamated Antifolate
composition
of any of [8]-[69] to a subject having or at risk of having a disorder of the
immune
system, optionally wherein the disorder of the immune system is selected from:
inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid
arthritis,
inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/
polymyositis,
systemic lupus erythematosus, and Takayasu, and psoriasis;
[88] a method for treating:
(a) an infectious disease that comprises administering an effective amount
of the
composition according to any of [1]-[69] to a subject having or at risk of
having
an infectious disease;
(b) an infectious disease, cardiovascular disease, metabolic disease, or
another
disease, that comprises administering an effective amount of the composition
according to of any of any of [1]-[69] to a subject having or at risk of
having an
infectious disease, cardiovascular diease, or another disease, wherein the
disease
is a member selected from: atherosclerosis, cardiovascular disease (CVD),
coronary artery disease, myocardial infarction, stroke, metabolic syndrome, a
gestational trophoblastic disease, and ectopic pregnancy;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 15 -
(c) an autoimmune disease, that comprises administering an effective amount
of the
composition according to of any of any of [11469] to a subject having or at
risk
of having an autoimmune disease;
(d) rheumatoid arthritis, that comprises administering an effective amount
of the
composition according to of any of any of [1]469] to a subject having or at
risk
of having rheumatoid arthritis;
(e) an inflammatory condition that comprises administering an effective
amount of
the composition according to of any of any of [11469] to a subject having or
at
risk of having inflammation, optionally wherein the inflammation is acute,
chronic, and/or systemic inflammation; or
(f) a skin condition that comprises administering an effective amount of
the
composition according to of any of claims any of [1]-[69] to a subject having
or
at risk of having a skin condition, optionally wherein the skin condition is
psoriasis;
[89] A method for treating an infectious disease that comprises administering
an effective
amount of the liposomal gamma polyglutamated Antifolate composition of any of
[121469] to a subject having or at risk of having an infectious disease;
[90] A method of delivering gamma polyglutamated Antifolate to a tumor
expressing a
folate receptor on its surface, the method comprising: administering the Lp-
yPANTIFOL composition of any of [11469] to a subject having the tumor in an
amount to deliver a therapeutically effective dose of the gamma polyglutamated
Antifolate to the tumor;
[91] a method of preparing a gamma polyglutamated Antifolate composition
comprising
the liposomal gamma polyglutamated Antifolate composition of any of [121469],
the
method comprising: forming a mixture comprising: liposomal components and
gamma polyglutamated antifolate in solution; homogenizing the mixture to form
liposomes in the solution; and processing the mixture to form liposomes
containing
gamma polyglutamated Antifolate;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 16 -
[92] A method of preparing the composition of any of [12]-[69] comprising the
steps of:
forming a mixture comprising: liposomal components and gamma polyglutamated
Antifolate in a solution; homogenizing the mixture to form liposomes in the
solution;
processing the mixture to form liposomes entrapping and/or encapsulating gamma
polyglutamated Antifolate; and providing a targeting moiety on a surface of
the
liposomes, the targeting moiety having specific affinity for at least one of
folate
receptor alpha (FR-a), folate receptor beta (FR-I3) and folate receptor delta
(FR-6);
[93] the method according to [92], wherein the processing step includes one or
more steps
of: thin film hydration, extrusion, in-line mixing, ethanol injection
technique,
freezing-and-thawing technique, reverse-phase evaporation, dynamic high
pressure
microfluidization, microfluidic mixing, double emulsion, freeze-dried double
emulsion, 3D printing, membrane contactor method, and stirring; and/or
[94] the method according to [92], wherein said processing step includes one
or more
steps of modifying the size of the liposomes by one or more of steps of
extrusion,
high-pressure microfluidization, and/or sonication.
[0010] In some embodiments, the disclosure provides a gamma
polyglutamated Antifolate
(yPANTIFOL) composition wherein at least 2 of the glutamyl residues of the
gamma
polyglutamated Antifolate have a gamma carboxyl group linkage. In some
embodiments, the
yPANTIFOL contains 2-20, 2-15, 2-10, 2-5, or more than 5, glutamyl groups
(including the
glutamyl group of the Antifolate). In some embodiments, the gamma
polyglutamated
Antifolate is selected from: (a) AG2034, piritrexim, pralatrexate, GW1843,
Antifolate, and
LY309887; or (b) PMX, MTX, RTX, and LTX, or a stereoisomer thereof. In some
embodiments, the gamma polyglutamated Antifolate is selected from: LV
(etoposide), L-
leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate;
FA, folic
acid; PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-
MTX; 2-
CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-
CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, 10-ethy1-10-deazaaminopterin;
PT523, N
alpha-(4-amino-4-deoxypteroy1)-N delta-(hemiphthaloy1)-L-ornithine;
DDATHF
(lometrexol), 5,10-dideaza-5,6,7,8,-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-
deaza-5,6,7,8-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 17 -
tetrahydrois ofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-
methy1-5-deaza-5,6,7,8-
tetrahydroisofolic acid; 5-dPteHCysA, N alpha -(5-deazapteroy1)-L-homocysteic
acid; 5-
dPteAPBA, N alpha-(5-deazapteroy1)-DL-2-amino-4-phosphonobutanoic acid; 5-
dPteOrn, N
alpha-(5-deazapteroy1)-L-ornithine; 5-dH4PteHCysA, N alpha -(5-deaza-5,6,7,8-
tetrahydropteroy1)-L-homocysteic acid; 5-dH4PteAPBA, N alpha -(5-deaza-5,6,7,8-
tetrahydropteroy1)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N alpha -(5-
deaza-
5,6,7,8-tetrahydropteroy1)-L-ornithine; CB3717, N10-propargy1-5,8-dideazafolic
acid; ICI-
198,583, 2-desamino-2-methyl-N10-propargy1-5,8-dideazafolic acid; 4-H-ICI-
198,583, 4-
deoxy-ICI-198,583: 4-0CH3-ICI-198,583, 4-methoxy-ICI-198,583 Glu-to-Val-ICI-
198,583;
valine-ICI-198;583; Glu-to-Sub-ICI-198,583, 2-amino-suberate-ICI-198,583; 7-
CH3-ICI-
198,583, 7-methyl-ICI- 198,583; ZD1694, N- [5(N-(3,4-dihydro-2-methy1-4-
oxoquinazolin-6-
yl-methyl)amino)2--thieny1)]-L-glutamic acid; 2-
NH2-ZD1694, 2-amino-ZD1694;
BW1843U89, (S)-2[5-(((1,2-dihydro-3-methyl-1-oxobenzo(f)
quinazolin-9-
yl)methyl)amino)-1-oxo-2-isoindolinyll -glutaric acid; LY231514, N-(4-(2-(2-
amino-4,7-
dihydro-4-oxo-3H-pyrrolo [2,3 -ID] pyrimidin-5-yl)ethyl)-benzoyl] -L-glutamic
acid; IAHQ,
5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-
methyl-IAHQ; 5-d(i)PteGlu, 5-deazaaisofolic acid; N9-CH3-5-d(i)PteGlu, N9-
methy1-5-
deazaisofolic acid; N9-CH0-5-d(i)PteGlu, N9-formy1-5-deazaisofolic acid;
AG337, 3,4-
dihydro-2-amino-6-methly-4-oxo-5-(4-pyridylthio) quanazoline; and AG377, 2,4-
diamino-
6[N-(4-(phenysulfonyl) benzyl)ethyl) amino]quinazoline; or a stereoisomer
thereof. In some
embodiments, the gamma polyglutamated Antifolate is selected from:
methotrexate,
raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,10-dideaza
tetrahydrofolic acid), a
cyclopenta[gMuinazoline with a dipeptide ligand, CB3717, CB300945, or a
stereoisomer
thereof, such as 6-R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89. In some
embodiments, the yPANTIFOL comprises two or more glutamyl groups in the L-
form. In other
embodiments, the yPANTIFOL comprises a glutamyl group in the D-form. In
further
embodiments, the yPANTIFOL comprises a glutamyl group in the D-form and two or
more
glutamyl groups in the L-form.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 18 -
[0011] In one embodiment, the 7PANTIFOL composition contains a chain of 3
glutamyl
groups attached to the glutamyl group in the Antifolate (i.e., a y
tetraglutamated Antifolate). In
some embodiments, the polyglutamated Antifolate is an Antifolate listed in [2]
of the Brief
Summary Section. In some embodiments, the polyglutamated Antifolate is an
Antifolate listed
in [3] of the Brief Summary Section. In some embodiments, the polyglutamated
Antifolate is
an Antifolate listed in [4] of the Brief Summary Section. In some embodiments,
the
polyglutamated Antifolate is an Antifolate listed in [5] of the Brief Summary
Section. In some
embodiments, the yPANTIFOL is a polyglutamated Antifolate descibed in the
Brief Summary
Section. In some embodiments, the tetraglutamated Antifolate comprises two or
more
glutamyl groups in the L-form. In other embodiments, the tetraglutamated
Antifolate
comprises a glutamyl group in the D-form. In some embodiments, the
tetraglutamated
Antifolate comprises two or more glutamyl groups in the D-form. In further
embodiments, the
tetraglutamated Antifolate comprises a glutamyl group in the D-form and two or
more glutamyl
groups in the L-form. In some embodiments, the tetraglutamated Antifolate
comprises one,
two, or three, glutamyl groups in the D-form and three, two, or one, glutamyl
groups in the L-
form, respectively.
[0012] In one embodiment, the 7PANTIFOL composition contains a chain of 4 y-
glutamyl
groups attached to the glutamyl group in the Antifolate (i.e., a 7
pentaglutamated Antifolate).
In some embodiments, the polyglutamated Antifolate is an Antifolate listed in
[2] of the Brief
Summary Section. In some embodiments, the polyglutamated Antifolate is an
Antifolate listed
in [3] of the Brief Summary Section. In some embodiments, the polyglutamated
Antifolate is
an Antifolate listed in [4] of the Brief Summary Section. In some embodiments,
the
polyglutamated Antifolate is an Antifolate listed in [5] of the Brief Summary
Section. In some
embodiments, the 7PANTIFOL is a polyglutamated Antifolate descibed in the
Brief Summary
Section. In some embodiments, the pentaglutamated Antifolate comprises two or
more
glutamyl groups in the L-form. In other embodiments, the pentaaglutamated
Antifolate
comprises a glutamyl group in the D-form. In some embodiments, the
pentaglutamated
Antifolate comprises two or more glutamyl groups in the D-form. In further
embodiments, the
pentaglutamated Antifolate comprises a glutamyl group in the D-form and two or
more
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 19 -
glutamyl groups in the L-form. In some embodiments, the pentaglutamated
Antifolate
comprises one, two, three, or four, glutamyl groups in the D-form and four,
three, two, or one,
glutamyl groups in the L-form, respectively.
[0013] In one embodiment, the yPANTIFOL composition contains a chain of 5 y-
glutamyl
groups attached to the glutamyl group in the Antifolate (i.e., a y
hexaglutamated Antifolate).
In some embodiments, the polyglutamated Antifolate is an Antifolate listed in
[2] of the Brief
Summary Section. In some embodiments, the polyglutamated Antifolate is an
Antifolate listed
in [3] of the Brief Summary Section. In some embodiments, the polyglutamated
Antifolate is
an Antifolate listed in [4] of the Brief Summary Section. In some embodiments,
the
polyglutamated Antifolate is an Antifolate listed in [5] of the Brief Summary
Section. In some
embodiments, the yPANTIFOL is a polyglutamated Antifolate descibed in the
Brief Summary
Section. In some embodiments, the hexaglutamated Antifolate comprises two or
more
glutamyl groups in the L-form. In other embodiments, the hexaglutamated
Antifolate
comprises a glutamyl group in the D-form. In some embodiments, the
hexaglutamated
Antifolate comprises two or more glutamyl groups in the D-form. In further
embodiments, the
hexaglutamated Antifolate comprises a glutamyl group in the D-form and two or
more
glutamyl groups in the L-form. In some embodiments, the pentaglutamated
Antifolate
comprises one, two, three, four, or five glutamyl groups in the D-form and
five, four, three,
two, or one, glutamyl groups in the L-form, respectively.
[0014] In additional embodiments, the disclosure provides compositions
containing delivery
vehicles such as liposomes filled with (i.e., encapsulating) and/or otherwise
associated with
gamma polyglutamated Antifolate, and methods of making and using the yPANTIFOL
filled/associated delivery vehicle compositions (DV-yPANTIFOL) to deliver
gamma
polyglutamated Antifolate to diseased (e.g., cancerous) and/or targeted cells.
These
compositions have uses that include but are not limited to treating diseases
that include for
example, hyperproliferative diseases such as cancer, disorders of the immune
system such as
inflammation and rheumatoid arthritis, and infectious diseases such as HIV,
malaria, and
schistomiasis. The yPANTIFOL filled/associated delivery vehicle compositions
provide
improvements to the efficacy and safety of delivering Antifolate to cancer
cells by providing
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 20 -
the preferential delivery of a more cytotoxic payload (e.g., polyglutamated
Antifolate)
compared to the cytotoxicity the Antifolate administered in its monoglutamate
state
(ANTIFOL). In some embodiments, gamma polyglutamated Antifolate in the DV-
yPANTIFOL contains 2-20, 2-15, 2-10, 2-5, more than 5, or more than 20,
glutamyl groups
(including the glutamyl group of the Antifolate). In some embodiments, the
delivery vehicle
contains a polyglutamated Antifolate according to any of [1]-[11] of the Brief
Summary
Section. In some embodiments, the delivery vehicle contains a polyglutamated
Antifolate
descibed in the Brief Summary Section. In some embodiments, the delivery
vehicle is a
liposome according to any of [121467] of the Brief Summary Section.
[0015] In additional embodiments, the disclosure provides a composition
comprising a
liposome encapsulating (filled with) gamma polyglutamated Antifolate (Lp-
yPANTIFOL). In
some embodiments, the gamma polyglutamated Antifolate in the Lp-yPANTIFOL
contains
2-20, 2-15, 2-10, 2-5, or more than 20, glutamyl groups (including the
glutamyl group in the
Antifolate). In some embodiments, the gamma polyglutamated Antifolate
encapsulated by the
liposome is selected from: (a) AG2034, piritrexim, pralatrexate, GW1843,
Antifolate, and
LY309887; or (b) PMX, MTX, RTX, and LTX, or a stereoisomer thereof. In some
embodiments, the gamma polyglutamated Antifolate encapsulated by the liposome
is selected
from: LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-
methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX,
methotrexate;
2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin;
2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, 10-ethyl-
10-deazaaminopterin; PT523, N alpha -(4-amino-4-deoxypteroy1)-N delta-
(hemiphthaloy1)-L-
ornithine; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8,-tetrahydrofolic acid; 5-
d(i)H4PteGlu,
5-deaza-5,6,7,8-tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methy1-5-
deaza-
5,6,7,8-tetrahydroisofolic acid; 5-dPteHCysA, N alpha -(5 -deazaptero y1)-L-
homoc ysteic acid;
5-dPteAPBA, N alpha -(5-deazapteroy1)-DL-2-amino-4-phosphonobutanoic acid; 5-
dPteOrn,
N alpha -(5-deazapteroy1)-L-ornithine; 5-dH4PteHCysA, N alpha -(5-deaza-
5,6,7,8-
tetrahydropteroy1)-L-homocysteic acid; 5-dH4PteAPBA, N alpha -(5-deaza-5,6,7,8-
tetrahydropteroy1)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N alpha -(5-
deaza-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 21 -
5,6,7,8-tetrahydropteroy1)-L-ornithine; CB3717, N10-propargy1-5,8-dideazafolic
acid; ICI-
198,583, 2-desamino-2-methyl-N10-propargy1-5,8-dideazafolic acid; 4-H-ICI-
198,583, 4-
deoxy-ICI-198,583: 4-0CH3-ICI-198,583, 4-methoxy-ICI-198,583 Glu-to-Val-ICI-
198,583;
valine-ICI-198;583; Gluto-Sub-ICI-198,583, 2-amino-suberate-ICI-198,583;
198,583, 7-methyl-ICI- 198,583; ZD1694, N- [5(N-(3,4-dihydro-2-methy1-4 -
oxoquinazolin-6-
yl-methyl)amino)2--thieny1)] -L-glutamic acid; 2-
NH2-ZD1694, 2-amino-ZD1694;
BW1843U89, (S
)-45-(((1,2-dihydro -3 -methyl-l-oxobenzo(f)quinazolin-9-yl)methyl)
amino)-1-oxo-2-isoindolinyl] -glutaric acid; LY231514, N-(4 -(242- amino-4,7-
dihydro-4-oxo-
3H-pyrrolo[2,3-D]pyrimidin-5-ypethyl)- benzoyli-L-glutamic acid; IAHQ, 5,8-
dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-
methyl-
IAHQ; 5-d(i)PteGlu, 5-deazaaisofolic acid; N9-CH3-5-d(i)PteGlu, N9-methyl-5-
deazaisofolic
acid; N9-CH0-5-d(i)PteGlu, N9-formy1-5-deazaisofolic acid; AG337, 3,4-dihydro-
2-amino-
6-methly-4-oxo-5-(4-pyridylthio) quanazoline; and AG377, 2,4-diamino-6[N-(4-
(phenysulfonyl)benzyl)ethyl)amino]quinazoline; or a stereoisomer thereof. In
some
embodiments, the gamma polyglutamated Antifolate encapsulated by the liposome
is selected
from: methotrexate, raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX;
5,10-
dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline with a dipeptide
ligand, CB3717,
CB300945, or a stereoisomer thereof, such as 6-R,S-BGC 945 (ONX-0801),
CB300638, and
BW1843U89. In some embodiments, the gamma polyglutamated Antifolate in the Lp-
yPANTIFOL comprises two or more glutamyl groups in the L-form. In other
embodiments,
the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises a glutamyl
group in
the D-form. In further embodiments, the gamma polyglutamated Antifolate in the
Lp-
yPANTIFOL comprises a glutamyl group in the D-form and two or more glutamyl
groups in
the L-form.
[0016] In one embodiment, the Lp-yPANTIFOL composition comprises a
gamma
polyglutamated Antifolate that contains a chain of 3 glutamyl groups attached
to the glutamyl
group in the Antifolate (i.e., tetraglutamated Antifolate). In some
embodiments, the
polyglutamated Antifolate is an Antifolate listed in [2] of the Brief Summary
Section. In some
embodiments, the polyglutamated Antifolate is an Antifolate listed in [3] of
the Brief Summary
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 22 -
Section. In some embodiments, the polyglutamated Antifolate is an Antifolate
listed in [4] of
the Brief Summary Section. In some embodiments, the polyglutamated Antifolate
is an
Antifolate listed in [5] of the Brief Summary Section. In some embodiments,
the yPANTIFOL
is a polyglutamated Antifolate descibed in the Brief Summary Section. In some
embodiments,
the tetraglutamated Antifolate comprises two or more glutamyl groups in the L-
form. In other
embodiments, the tetraglutamated Antifolate comprises a glutamyl group in the
D-form. In
further embodiments, the tetraglutamated Antifolate comprises a glutamyl group
in the D-form
and two or more glutamyl groups in the L-form.
[0017] In one embodiment, the Lp-7PANTlFOL composition comprises a gamma
polyglutamated Antifolate that contains a chain of 4 'y-glutamyl groups
attached to the glutamyl
group in the Antifolate (e.g., 'y-pentaglutamated Antifolate). In some
embodiments, the
polyglutamated Antifolate is an Antifolate listed in [2] of the Brief Summary
Section. In some
embodiments, the polyglutamated Antifolate is an Antifolate listed in [3] of
the Brief Summary
Section. In some embodiments, the polyglutamated Antifolate is an Antifolate
listed in [4] of
the Brief Summary Section. In some embodiments, the polyglutamated Antifolate
is an
Antifolate listed in [5] of the Brief Summary Section. In some embodiments,
the yPANTIFOL
is a polyglutamated Antifolate descibed in the Brief Summary Section. In some
embodiments,
the gamma pentaglutamated Antifolate comprises two or more glutamyl groups in
the L-form.
In other embodiments, the pentaglutamated Antifolate comprises a glutamyl
group in the D-
form. In further embodiments, the pentaglutamated Antifolate comprises a
glutamyl group in
the D-form and two or more glutamyl groups in the L-form.
[0018] In one embodiment, the Lp-yPANTlFOL composition comprises a gamma
polyglutamated Antifolate that contains a chain of 5 y-glutamyl groups
attached to the glutamyl
group in the Antifolate (e.g., y-hexaglutamated Antifolate). In some
embodiments, the
polyglutamated Antifolate is an Antifolate listed in [2] of the Brief Summary
Section. In some
embodiments, the polyglutamated Antifolate is an Antifolate listed in [3] of
the Brief Summary
Section. In some embodiments, the polyglutamated Antifolate is an Antifolate
listed in [4] of
the Brief Summary Section. In some embodiments, the polyglutamated Antifolate
is an
Antifolate listed in [5] of the Brief Summary Section. In some embodiments,
the yPANTIFOL
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
-23 -
is a polyglutamated Antifolate descibed in the Brief Summary Section. In some
embodiments,
the gamma hexaglutamated Antifolate comprises two or more glutamyl groups in
the L-form.
In other embodiments, the gamma hexaglutamated Antifolate comprises a glutamyl
group in
the D-form. In further embodiments, the gamma hexaglutamated Antifolate
comprises a
glutamyl group in the D-form and two or more glutamyl groups in the L-form.
[0019] In some embodiments, the Lp-yPANTIFOL composition is cationic. In
some
embodiments, the Lp-yPANTIFOL liposome is cationic and has a diameter in the
range of 20
nm to 200 nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein
between. In further
embodiments, the Lp-yPANTIFOL liposome is cationic and has a diameter in the
range of
30nm to 175 nm or 50 nm to 150 nm, or any range therein between. In further
embodiments,
the Lp-yPANTIFOL liposome is cationic and the composition has a diameter in
the range of
80 nm to 120 nm, or any range therein between. In some embodiments, the
cationic Lp-
yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%,
40%,
45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma tetraglutamated
Antifolate. In some embodiments, the cationic Lp-yPANTIFOL composition
comprises at least
11%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or
75%,
liposome entrapped gamma pentaglutamated Antifolate. In other embodiments, the
Lp-yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%,
35%,
40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma
hexaglutamated
Antifolate. In additional embodiments, the gamma polyglutamated Antifolate
encapsulated by
the liposome is in a HEPES buffered solution within the liposome.
[0020] In other embodiments, Lp-yPANTIFOL composition is anionic or
neutral. In some
embodiments, the Lp-TPANTIFOL composition is cationic. In some embodiments,
the Lp-
yPANTIFOL liposome is anionic or neutral and has a diameter in the range of 20
nm to 200
nm, 30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between. In
further
embodiments, the Lp-yPANTIFOL liposome is anionic or neutral and has a
diameter in the
range of 30nm to 175 nm or 50 nm to 150 nm, or any range therein between. In
further
embodiments, the Lp-yPANTIFOL liposome is anionic or neutral and the
composition has a
diameter in the range of 80 nm to 120 nm, or any range therein between. In
some embodiments,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 24 -
the Lp-yPANTIFOL liposome is anionic and has a diameter in the range of 20 nm
to 200 nm,
30 nm to 175 nm, or 50 nm to 150 nm, or any range therein between. In further
embodiments,
the Lp-yPANTIFOL liposome is anionic and has a diameter in the range of 30nm
to 175 nm
or 50 nm to 150 nm, or any range therein between. In further embodiments, the
Lp-
yPANTIFOL liposome is anionic and the composition has a diameter in the range
of 80 nm to
120 nm, or any range therein between. In some embodiments, the Lp-7PANTIFOL
liposome
is neutral and has a diameter in the range of 20 nm to 200 nm, 30 nm to 175
nm, or 50 nm to
150 nm, or any range therein between. In further embodiments, the Lp-yPANTIFOL
liposome
is neutral and has a diameter in the range of 30nm to 175 nm or 50 nm to 150
nm, or any range
therein between. In further embodiments, the Lp-yPANTIFOL liposome is neutral
and the
composition has a diameter in the range of 80 nm to 120 nm, or any range
therein between. In
some embodiments, the anionic or neutral Lp-yPANTIFOL composition comprises at
least 1%,
5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%,
liposome entrapped gamma tetraglutamated Antifolate. In some embodiments, the
anionic or
neutral Lp-yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%,
25%, 30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma
pentaglutamated Antifolate. In other embodiments, the Lp-yPANTIFOL composition
comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%,
65%, 70%, or 75%, liposome entrapped gamma hexaglutamated Antifolate. In
additional
embodiments, the gamma polyglutamated Antifolate encapsulated by the liposome
is in a
HEPES buffered solution within the liposome.
[0021] In additional embodiments, the liposomal gamma polyglutamated
Antifolate
composition is pegylated (PLp-yPANTIFOL).
[0022] In some embodiments, the liposomal gamma polyglutamated Antifolate
composition
is non-targeted (NTLp-yPANTIFOL). That is, the NTLp-yPANTIFOL composition does
not
have specific affinity towards an epitope (e.g., an epitope on a surface
antigen) expressed on
the surface of a target cell of interest. In some embodiments, the NTLp-
yPANTIFOL
composition does not comprise a targeting moiety. In further embodiments, the
non-targeted
liposomal gamma polyglutamated Antifolate composition is pegylated (NTPLp-
yPANTIFOL).
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
-25 -
[0023] In other embodiments, the liposomal gamma polyglutamated Antifolate
composition
is targeted (TLp-yPANTIFOL). That is, the TLp-yPANTIFOL composition contains a
targeting moiety that has specific affinity for an epitope (surface antigen)
on a target cell of
interest. In some embodiments, the targeting moiety of the TLp-yPANTIFOL or
TPLp-
yPANTIFOL is not attached to the liposome through a covalent bond. In other
embodiments,
the targeting moiety of the TLp-yPANTIFOL or TPLp-yPANTIFOL is attached to one
or both
of a PEG and the exterior of the liposome. In some embodiments, the targeting
moiety of the
TLp-yPANTIFOL or TPLp-yPANTIFOL is attached to the liposome through a covalent
bond.
Functions of the targeting moiety of the TLp-yPANTIFOL and/or TPLp-yPANTIFOL
compositions include but are not limited to, targeting the liposome to the
target cell of interest
in vivo or in vitro; interacting with the surface antigen for which the
targeting moiety has
specific affinity, and delivering the liposome payload (yPANTIFOL) into the
cell. Suitable
targeting moieties are known in the art and include, but are not limited to,
antibodies, antigen-
binding antibody fragments, scaffold proteins, polypeptides, and peptides. In
some
embodiments, the targeting moiety is a polypeptide. In further embodiments,
the targeting
moiety is a polypeptide that comprises at least 3, 5, 10, 15, 20, 30, 40, 50,
or 100, amino acid
residues.
[0024] Targeted liposomal gamma polyglutamated Antifolate compositions (TLp-
yPANTIFOL and TPLp-yPANTIFOL) provide further improvements over the efficacy
and
safety profile of the Antifolate, by specifically delivering gamma
polyglutamated (e.g., y-
pentaglutamated and/or y-hexaglutamated) Antifolate to target cells such as
cancer cells. In
further embodiments, the targeted liposomal gamma polyglutamated Antifolate
composition is
pegylated (TPLp-yPANTIFOL). In some embodiments, the targeting moiety of the
TLp-
yPANTIFOL or TPLp-yPANTIFOL is attached to one or both of a PEG and the
exterior of the
liposome. In some embodiments, the targeting moiety of the TLp-yPANTIFOL or
TPLp-
yPANTIFOL is attached to the liposome through a covalent bond. yPANTIFOL).
Function of
the targeting moiety of the TLp-yPANTIFOL and/or TPLp-yPANTIFOL compositions
include
but are not limited to, targeting the liposome to the target cell of interest
in vivo or in vitro;
interacting with the surface antigen for which the targeting moiety has
specific affinity, and
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 26 -
delivering the liposome payload (yPANTIFOL) into the cell. Suitable targeting
moieties are
known in the art and include, but are not limited to, antibodies, antigen-
binding antibody
fragments, scaffold proteins, polypeptides, and peptides. In some embodiments,
the targeting
moiety is a polypeptide. In further embodiments, the targeting moiety is a
polypeptide that
comprises at least 3, 5, 10, 15, 20, 30, 40, 50, or 100, amino acid residues.
[0025] In some embodiments, the targeting moiety of the TLp-yPANTIFOL or
TPLp-
yPANTIFOL is an antibody or an antigen-binding antibody fragment. In further
embodiments,
the targeting moiety comprises one or more of an antibody, a humanized
antibody, an antigen
binding fragment of an antibody, a single chain antibody, a single-domain
antibody, a hi-
specific antibody, a synthetic antibody, a pegylated antibody, and a
multimeric antibody. In
some embodiments, the targeting moiety of the TLp-yPANTIFOL or TPLp-yPANTIFOL
has
specific affinity for an epitope that is preferentially expressed on a target
cell such as a tumor
cell, compared to normal or non-tumor cells. In some embodiments, the
targeting moiety has
specific affinity for an epitope on a tumor cell surface antigen that is
present on a tumor cell
but absent or inaccessible on a non-tumor cell. In some embodiments, the
targeting moiety
binds an epitope of interest with an equilibrium dissociation constant (Kd) in
a range of 0.5 x
10-10 to 10 x 10-6 as determined using BIACOREO analysis.
[0026] In particular embodiments, the TLp-yPANTIFOL or TPLp-yPANTIFOL
targeting
moiety comprises a polypeptide that specifically binds a folate receptor. In
some embodiments,
the targeting moiety is an antibody or an antigen-binding antibody fragment.
In some
embodiments, the folate receptor bound by the targeting moiety is one or more
folate receptors
selected from: folate receptor alpha (FR-a, FOLR1), folate receptor beta (FR-
f3, FOLR2), and
folate receptor delta (FR-6, FOLR4). In some embodiments, the folate receptor
bound by the
targeting moiety is folate receptor alpha (FR-a). In some embodiments, the
folate receptor
bound by the targeting moiety is folate receptor beta (FR-I3). In some
embodiments, the
targeting moiety specifically binds FR-a and FR-f3.
[0027] In additional embodiments, the Lp-yPANTIFOL composition comprises
one or more
of an immunostimulatory agent, a detectable marker, and a maleimide, disposed
on at least one
of the PEG and the exterior of the lipo some. In some embodiments, the lipo
some yPANTIFOL
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 27 -
composition (e.g., Lp-yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-
yPANTIFOL, TLp-yPANTIFOL, or TPLp-yPANTIFOL) is cationic. In other
embodiments,
the liposome yPANTIFOL composition (e.g., Lp-yPANTIFOL, PLp-yPANTIFOL, NTLp-
yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL or TPLp-yPANTIFOL) is anionic or
neutral. In additional embodiments, the liposome of the liposome yPANTIFOL
composition
(e.g., Lp-yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-
yPANTIFOL or TPLp-yPANTIFOL) has a diameter in the range of 20 nm to 200 nm,
or any
range therein between. In further embodiments, the liposome of the liposome
yPANTIFOL
composition has a diameter in the range of 80 nm to 120 nm, or any range
therein between. In
some embodiments, the liposome yPANTIFOL composition is pegylated (e.g., PLp-
yPANTIFOL, NTPLp-yPANTIFOL, or TPLp-yPANTIFOL). In some embodiments, the
liposome yPANTIFOL composition comprises a targeting moiety (e.g., TLp-
yPANTIFOL or
TPLp-yPANTIFOL). In further embodiments, the liposome yPANTIFOL composition is
pegylated and targeted (e.g., TPLp-yPANTIFOL). In some embodiments, the
liposome
yPANTIFOL composition comprises gamma polyglutamated Antifolate that contains
4, 5, 2-
10, 4-6, or more than 5, glutamyl groups. In some embodiments, the liposome
yPANTIFOL
composition comprises gamma tetraglutamated Antifolate. In some embodiments,
the
liposome yPANTIFOL composition comprises gamma pentaglutamated Antifolate. In
other
embodiments, the liposome yPANTIFOL composition comprises gamma hexaglutamated
Antifolate. In some embodiments, the liposome composition comprises a gamma
polyglutamated Antifolate of any of [11411] of the Brief Summary Section. In
some
embodiments, the liposome comprises a liposome composition according to any of
[11]-[69]
of the Brief Summary Section. In some embodiments, the composition comprises a
gamma
polyglutamated Antifolate descibed in the Brief Summary Section.
[0028] In additional embodiments, the liposome yPANTIFOL composition (i.e.,
Lp-
yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-
yPANTIFOL or TPLp-yPANTIFOL) comprises at least 1%, 5%, 10%, 15%, 20%, 25%,
30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma
polyglutamated Antifolate. In some embodiments, the liposome yPANTIFOL
composition
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 28 -
comprises 1% - 98.5% liposome entrapped gamma polyglutamated Antifolate. In
additional
embodiments, the liposome yPANTIFOL composition comprises at least 1%, 5%,
10%, 15%,
20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome
entrapped
gamma polyglutamated Antifolate that contains 4, 5, 2-10, 4-6, or more than 5,
glutamyl
groups. In some embodiments, the liposome yPANTIFOL composition comprises 1% -
98.5%
liposome entrapped gamma polyglutamated Antifolate that contains 4, 5, 2-10, 4-
6, or more
than 5, glutamyl groups. In some embodiments, the liposome yPANTIFOL
composition
comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%,
65%, 70%, or 75%, liposome entrapped gamma tetraglutamated Antifolate. In some
embodiments, the liposome yPANTIFOL composition comprises 1% - 98.5% liposome
entrapped gamma tetraglutamated Antifolate In some embodiments, the liposome
yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%,
40%,
45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma pentaglutamated
Antifolate. In some embodiments, the liposome yPANTIFOL composition comprises
1% -
98.5% liposome entrapped gamma pentaglutamated Antifolate. In some
embodiments, the
liposome yPANTIFOL composition comprise at least 1%, 5%, 10%, 15%, 20%, 25%,
30%,
35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma
hexaglutamated Antifolate. In some embodiments, the liposome yPANTIFOL
composition
comprises 1%-98.5% liposome entrapped gamma pentaglutamated Antifolate. In
some
embodiments, the liposome composition comprises a gamma polyglutamated
Antifolate of any
of [11411] of the Brief Summary Section. In some embodiments, the liposome
comprises a
liposome composition according to any of [111469] of the Brief Summary
Section. In some
embodiments, the composition comprises a gamma polyglutamated Antifolate
descibed in the
Brief Summary Section or a Figure, herein
[0029] Liposomal compositions comprising liposomes encapsulating yPANTIFOL
are also
provided. In some embodiments, the liposomal composition comprises a pegylated
yPANTIFOL composition. In some embodiments, the liposomal composition
comprises a
yPANTIFOL composition that is linked to or otherwise associated with a
targeting moiety. In
further embodiments, the liposomal composition comprises a yPANTIFOL
composition that
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 29 -
is pegylated and linked to or otherwise associated with a targeting moiety. In
some
embodiments, the liposomal composition comprises yPANTIFOL that contains 4, 5,
2-10, 4-
6, or more than 5, glutamyl groups. In some embodiments, the liposomal
composition
comprises gamma tetraglutamated Antifolate. In some embodiments, the liposomal
composition comprises gamma pentaglutamated Antifolate. In other embodiments,
the
liposomal composition comprises gamma hexaglutamated Antifolate. In some
embodiments,
the polyglutamated Antifolate is an Antifolate listed in [2] of the Brief
Summary Section. In
some embodiments, the polyglutamated Antifolate is an Antifolate listed in [3]
of the Brief
Summary Section. In some embodiments, the polyglutamated Antifolate is an
Antifolate listed
in [4] of the Brief Summary Section. In some embodiments, the polyglutamated
Antifolate is
an Antifolate listed in [5] of the Brief Summary Section. In some embodiments,
the
yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary
Section.
[0030] In some embodiments, the liposomal composition comprises a liposome
yPANTIFOL
(e.g., Lp-TPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-
yPANTIFOL, and TPLp-yPANTIFOL). In some embodiments, the liposome yPANTIFOL is
pegylated (e.g., NTPLp-yPANTIFOL, and TPLp-yPANTIFOL). In some embodiments,
the
pharmaceutical composition comprises yPANTIFOL that contains 4, 5, 2-10, 4-6,
or more than
5, glutamyl groups. In some embodiments, the pharmaceutical composition
comprises gamma
tetraglutamated Antifolate. In some embodiments, the pharmaceutical
composition comprises
gamma pentaglutamated Antifolate. In other embodiments, the pharmaceutical
composition
comprises gamma hexaglutamated Antifolate. In some embodiments, the
polyglutamated
Antifolate is an Antifolate listed in [2] of the Brief Summary Section. In
some embodiments,
the polyglutamated Antifolate is an Antifolate listed in [3] of the Brief
Summary Section. In
some embodiments, the polyglutamated Antifolate is an Antifolate listed in [4]
of the Brief
Summary Section. In some embodiments, the polyglutamated Antifolate is an
Antifolate listed
in [5] of the Brief Summary Section. In some embodiments, the yPANTIFOL is a
polyglutamated Antifolate descibed in the Brief Summary Section. In some
embodiments,
the liposome yPANTIFOL comprises a targeting moiety that has a specific
affinity for an
epitope of antigen on the surface of a target cell of interest such as a
cancer cell (e.g., TLp-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 30 -
yPANTIFOL or TPLp-yPANTIFOL). In further embodiments, the liposomal
composition
comprises a liposome yPANTIFOL that is pegylated and further comprises a
targeting moiety
that has a specific affinity for an epitope of antigen on the surface of a
target cell of interest
such as a cancer cell (e.g., TPLp-yPANTIFOL). In some embodiments, the
liposomal
composition comprises a liposome yPANTIFOL that is cationic. In other
embodiments, the
liposomal composition comprises a liposome yPANTIFOL that is anionic or
neutral. In
additional embodiments, the liposomal composition comprises a liposome
yPANTIFOL that
has a diameter in the range of 20 nm to 200 nm, or any range therein between.
In further
embodiments, the liposome yPANTIFOL has a diameter in the range of 80 nm to
120 nm, or
any range therein between.
[0031] Pharmaceutical compositions comprising gamma polyglutamated
Antifolate
(yPANTIFOL) including delivery vehicles such as liposome yPANTIFOL are also
provided.
In some embodiments, the pharmaceutical composition comprises a pegylated
yPANTIFOL
composition. In some embodiments, the pharmaceutical composition comprise a
yPANTIFOL
composition that is linked to or otherwise associated with a targeting moiety.
In further
embodiments, the pharmaceutical composition comprise a yPANTIFOL composition
that is
pegylated and linked to or otherwise associated with a targeting moiety. In
some embodiments,
the pharmaceutical composition comprises yPANTIFOL that contains 4, 5, 2-10, 4-
6, or more
than 5, glutamyl groups. In some embodiments, the pharmaceutical composition
comprises
gamma tetraglutamated Antifolate. In some embodiments, the pharmaceutical
composition
comprises gamma pentaglutamated Antifolate. In other embodiments, the
pharmaceutical
composition comprises gamma hexaglutamated Antifolate. In some embodiments,
the gamma
polyglutamated Antifolate is a polyglutamated Antifolate according to any of
[1]-Ell] of the
Brief Summary Section. In some embodiments, the gamma polyglutamated
Antifolate is a
polyglutamted Antifolate descibed in the Brief Summary Section.
[0032] In some embodiments, the pharmaceutical compositions comprise a
liposome
yPANTIFOL (e.g., Lp-yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-
yPANTIFOL, TLp-yPANTIFOL, and TPLp-yPANTIFOL). In some embodiments, the
liposome yPANTIFOL composition is pegylated (e.g., NTPLp-yPANTIFOL, and TPLp-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 31 -
yPANTIFOL). In some embodiments, the liposome yPANTIFOL comprises a targeting
moiety
that has a specific affinity for an epitope of antigen on the surface of a
target cell of interest
such as a cancer cell (e.g., TLp-yPANTIFOL or TPLp-yPANTIFOL). In further
embodiments,
the pharmaceutical composition comprises a liposome yPANTIFOL composition that
is
pegylated and further comprises a targeting moiety that has a specific
affinity for an epitope of
antigen on the surface of a target cell of interest such as a cancer cell
(e.g., TPLp-yPANTIFOL).
In some embodiments, the pharmaceutical composition comprises a liposome
yPANTIFOL
that is cationic. In other embodiments, the pharmaceutical composition
comprises a liposome
yPANTIFOL that is anionic or neutral. In additional embodiments, the
pharmaceutical
composition comprises a liposome yPANTIFOL that has a diameter in the range of
20 nm to
200 nm, or any range therein between. In further embodiments, the liposome
yPANTIFOL
composition has a diameter in the range of 80 nm to 120 nm, or any range
therein between. In
some embodiments, the pharmaceutical composition comprises yPANTIFOL that
contains 4,
5, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, the
pharmaceutical
composition comprises gamma tetraglutamated Antifolate. In some embodiments,
the
pharmaceutical composition comprises gamma pentaglutamated Antifolate. In
other
embodiments, the pharmaceutical composition comprises gamma hexaglutamated
Antifolate.
In some embodiments, the composition comprises a gamma polyglutamated
Antifolate
according to any of [11411] of the Brief Summary Section.In some embodiments,
the
pharmaceutical composition comprises a liposome composition according to any
of [111469]
of the Brief Summary Section. In some embodiments, the composition comprises a
gamma
polyglutamated Antifolate descibed in the Brief Summary Section.
[0033] In additional embodiments, the disclosure provides a method of
modulating the
activation, chemokine production, or metabolic activity of a cell that
comprises contacting the
cell with a composition comprising a gamma polyglutamated Antifolate
(yPANTIFOL)
composition. In some embodiments, the contacted cell is a mammalian cell. In
further
embodiments, the contacted cell is a human cell. In some embodiments, the
contacted cell is a
hyperproliferative cell. In further embodiments, the cell is an immune cell.
In some
embodiments, the method is performed in vivo. In other embodiments, the method
is performed
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 32 -
in vitro. In some embodiments, the yPANTIFOL contains 4, 5, 2-10, 4-6, or more
than 5,
glutamyl groups. In some embodiments, the yPANTIFOL composition comprises a
gamma
tetraglutamated Antifolate. In some embodiments, the yPANTIFOL composition
comprises a
gamma pentaglutamated Antifolate. In other embodiments, the yPANTIFOL
composition
comprises a gamma hexaglutamated Antifolate. In some embodiments, the
composition
comprises a gamma polyglutamated Antifolate according to any of [1]- [11] of
the Brief
Summary Section.In some embodiments, the pharmaceutical composition comprises
a
liposome composition according to any of [11]-[69] of the Brief Description
Section. In some
embodiments, the composition comprises a gamma polyglutamated Antifolate
descibed in the
Brief Summary Section or a Figure, herein
[0034] In additional embodiments, the disclosure provides a method of
modulating the
activation, chemokine production, or metabolic activity of a cell that
comprises contacting the
cell with a liposome comprising a gamma polyglutamated Antifolate (yPANTIFOL)
composition. In some embodiments, the contacted cell is a mammalian cell. In
further
embodiments, the contacted cell is a human cell. In some embodiments, the
contacted cell is a
hyperproliferative cell. In further embodiments, the cell is an immune cell.
In some
embodiments, the method is performed in vivo. In other embodiments, the method
is performed
in vitro. In some embodiments, the yPANTIFOL contains 4, 5, 2-10, 4-6, or more
than 5,
glutamyl groups. In some embodiments, the yPANTIFOL composition comprises a
gamma
tetraglutamated Antifolate. In some embodiments, the yPANTIFOL composition
comprises a
gamma pentaglutamated Antifolate. In other embodiments, the yPANTIFOL
composition
comprises a gamma hexaglutamated Antifolate. In some embodiments, the
polyglutamated
Antifolate is an Antifolate listed in [2] of the Brief Summary Section. In
some embodiments,
the polyglutamated Antifolate is an Antifolate listed in [3] of the Brief
Summary Section. In
some embodiments, the polyglutamated Antifolate is an Antifolate listed in [4]
of the Brief
Summary Section. In some embodiments, the polyglutamated Antifolate is an
Antifolate listed
in [5] of the Brief Summary Section. In some embodiments, the yPANTIFOL is a
polyglutamated Antifolate descibed in the Brief Summary Section.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 33 -
[0035] In additional embodiments, the disclosure provides a method of
killing a cell that
comprises contacting the cell with a composition comprising a gamma
polyglutamated
Antifolate (7PANTIFOL) composition. In some embodiments, the contacted cell is
a
mammalian cell. In further embodiments, the contacted cell is a human cell. In
some
embodiments, the contacted cell is a hyperproliferative cell. In further
embodiments, the
hyperproliferative cell is a cancer cell. In further embodiments, the
contacted cancer cell is a
primary cell or a cell from a cell line obtained/derived from a cancer
selected from: a non-
hematologic malignancy including such as for example, lung cancer, pancreatic
cancer, breast
cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer,
gastrointestinal
cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer,
kidney cancer,
biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g.,
osteosarcoma), brain
cancer, central nervous system cancer, and melanoma; and a hematologic
malignancy such as
for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and
other
plasma cell dysplasias or dyscrasias. In some embodiments, the cancer is
selected from: breast
cancer, advanced head and neck cancer, lung cancer, stomach cancer,
osteosarcoma, Non-
Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis
fungoides
(cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic
meningeal
cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder
cancer, and
central nervous system (CNS) cancer. In some embodiments, the contacted cancer
cell is a
primary cell or a cell from a cell line obtained/derived from lung cancer
(e.g., NSCLC or
mesothelioma). In some embodiments, the contacted cancer cell is a primary
cell or a cell from
a cell line obtained/derived from breast cancer (e.g., HER2++ or triple
negative breast cancer).
In some embodiments, the contacted cancer cell is a primary cell or a cell
from a cell line
obtained/derived from colorectal cancer. In some embodiments, the contacted
cancer cell is a
primary cell or a cell from a cell line obtained/derived from ovarian cancer.
In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from endometrial cancer. In some embodiments, the contacted
cancer cell is
a primary cell or a cell from a cell line obtained/derived from pancreatic
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 34 -
obtained/derived from liver cancer. In some embodiments, the contacted cancer
cell is a
primary cell or a cell from a cell line obtained/derived from head and neck
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from osteosarcoma. In some embodiments, the method is
performed in vivo.
In other embodiments, the method is performed in vitro. In some embodiments,
the
yPANTIFOL contains 4, 5, 2-10, 4-6, or more than 5, y-glutamyl groups. In some
embodiments, the yPANTIFOL composition comprises gamma tetraglutamated
Antifolate. In
some embodiments, the yPANTIFOL composition comprises gamma pentaglutamated
Antifolate. In other embodiments, the yPANTIFOL composition comprises gamma
hexaglutamated Antifolate. In some embodiments, the gamma polyglutamated
Antifolate is a
polyglutamated Antifolate according to any of [11411] of the Brief Summary
Section. In some
embodiments, the gamma polyglutamated Antifolate is an polyglutamted
Antifolate descibed
in the Brief Summary Section.
[0036] In additional embodiments, the disclosure provides a method of
killing a cell that
comprises contacting the cell with a liposome containing gamma polyglutamated
Antifolate
(e.g., an Lp-yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-
yPANTIFOL, TLp-yPANTIFOL or TPLp-yPANTIFOL). In some embodiments, the
contacted
cell is a mammalian cell. In further embodiments, the contacted cell is a
human cell. In some
embodiments, the contacted cell is a hyperproliferative cell. In yet further
embodiments, the
contacted hyperproliferative cell is a cancer cell. In further embodiments,
the cancer cell is a
primary cell or a cell from a cell line obtained/derived from a cancer
selected from: a non-
hematologic malignancy including such as for example, lung cancer, pancreatic
cancer, breast
cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer,
gastrointestinal
cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer,
kidney cancer,
biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma (e.g.,
osteosarcoma), brain
cancer, central nervous system cancer, and melanoma; and a hematologic
malignancy such as
for example, a leukemia, a lymphoma and other B cell malignancies, myeloma and
other
plasma cell dysplasias or dyscrasias. In some embodiments, the cell is a
primary cell or a cell
from a cell line obtained/derived from a cancer selected from: breast cancer,
advanced head
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 35 -
and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's
lymphoma
(NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell
lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft
tissue
sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central
nervous
system (CNS) cancer. In some embodiments, the contacted cancer cell is a
primary cell or a
cell from a cell line obtained/derived from lung cancer (e.g., NSCLC or
mesothelioma). In
some embodiments, the contacted cancer cell is a primary cell or a cell from a
cell line
obtained/derived from breast cancer (e.g., HER2++ or triple negative breast
cancer). In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from colorectal cancer. In some embodiments, the contacted
cancer cell is a
primary cell or a cell from a cell line obtained/derived from ovarian cancer.
In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from endometrial cancer. In some embodiments, the contacted
cancer cell is
a primary cell or a cell from a cell line obtained/derived from pancreatic
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from liver cancer. In some embodiments, the contacted cancer
cell is a
primary cell or a cell from a cell line obtained/derived from head and neck
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from osteosarcomaIn some embodiments, the method is performed
in vivo.
In other embodiments, the method is performed in vitro. In some embodiments,
the liposome
contains a yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl
groups. In some
embodiments, the liposome contains gamma tetraglutamated Antifolate. In some
embodiments, the liposome contains gamma pentaglutamated Antifolate. In some
embodiments, the liposome contains gamma hexaglutamated Antifolate. In some
embodiments, the gamma polyglutamated Antifolate is a polyglutamated
Antifolate according
to any of [1]-[11] of the Brief Summary Section. In some embodiments, the
yPANTIFOL is a
polyglutamated Antifolate described in the Brief Summary Section. In some
embodiments,
the liposome is a liposome according to any of [12]-[67] of the Brief Summary
Section.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 36 -
[0037] In additional embodiments, the disclosure provides a method for
treating cancer that
comprises administering an effective amount of a delivery vehicle (e.g., an
antibody
immunoconjugate or liposome) comprising gamma polyglutamated Antifolate to a
subject
having or at risk of having cancer. In some embodiments, the delivery vehicle
is an antibody
containing immunoconjugate (comprising e.g., a full-length IgG antibody, a
bispecific
antibody, or a scFv). In some embodiments, the delivery vehicle is a liposome
(e.g., an Lp-
yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-
yPANTIFOL, or TPLp-yPANTIFOL). In some embodiments, the administered delivery
vehicle is pegylated. In some embodiments, the administered delivery vehicle
is not pegylated.
In additional embodiments, the administered delivery vehicle comprises a
targeting moiety that
has a specific affinity for an epitope of antigen on the surface of a cancer
cell. In additional
embodiments, the delivery vehicle comprises a targeting moiety that
specifically binds a cell
surface antigen selected from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a
folate
receptor (e.g., folate receptor-a, folate receptor-0 or folate receptor-6),
Mucin 1 (MUC-1),
MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4,
NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16,
Tissue
factor, LIV-1 (Z1P6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-
B),
VEGFR2 (CD309), Tenascin, Collagen IV, Periostin, endothelin receptor, HER2,
HER3,
EGFR, IGFR-1, EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD1 1 a, CD15, CD18,
CD19,
CD20, CD22, CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70,
CD74, CD79, CD79b, CD105, CD133, CD138, cripto, CD38, an EphA receptor, an
EphB
receptor, EphA2, an integrin (e.g., integrin av03, av05, or av06), a C242
antigen, Apo2, PSGR,
NGEP, PSCA, TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some
embodiments, the delivery vehicle comprises a targeting moiety that
specifically binds a cell
surface antigen(s) derived from, or determined to be expressed on, a specific
subject's cancer
(tumor) such as a neoantigen. In some embodiments, the targeting moiety
specifically binds a
cell surface antigen(s) derived from or determined to be expressed on a
specific subject's tumor
such as a neoantigen. In some embodiments, the targeting moiety is an antibody
or an antigen
binding antibody fragment. In some embodiments, the administered delivery
vehicle comprises
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 37 -
yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some
embodiments, the administered delivery vehicle comprises gamma tetraglutamated
Antifolate.
In some embodiments, the administered delivery vehicle comprises gamma
pentaglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises L
gamma
polyglutamated Antifolate. In some embodiments, the administered delivery
vehicle comprises
2, 3, 4, 5, or more than 5, L-gamma glutamyl groups. In some embodiments, the
administered
delivery vehicle comprises D gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, D-gamma
glutamyl groups.
In some embodiments, the administered delivery vehicle comprises L and D gamma
polyglutamated Antifolate. In some embodiments, the administered delivery
vehicle
comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups and 2, 3, 4, 5,
or more than 5,
D-gamma glutamyl groups. In some embodiments, the cancer is selected from: a
non-
hematologic malignancy including such as for example, lung cancer, pancreatic
cancer, breast
cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer,
gastrointestinal
cancer, colorectal cancer, esophageal cancer, cervical cancer, liver cancer,
kidney cancer,
biliary duct cancer, gallbladder cancer, bladder cancer, sarcoma, brain
cancer, central nervous
system cancer, and melanoma; and a hematologic malignancy such as for example,
a leukemia,
a lymphoma and other B cell malignancies, myeloma and other plasma cell
dysplasias or
dyscrasias. In some embodiments, the cancer is selected from: breast cancer,
advanced head
and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's
lymphoma
(NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell
lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft
tissue
sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central
nervous
system (CNS) cancer. In some embodiments, the cancer is lung cancer (e.g.,
NSCLC or
mesothelioma). In some embodiments, the cancer is breast cancer (e.g., HER2++
or triple
negative breast cancer). In some embodiments, the cancer is colorectal cancer.
In some
embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is
endometrial
cancer. In some embodiments, the cancer is pancreatic cancer. In some
embodiments, the
cancer is liver cancer. In some embodiments, the cancer is head and neck
cancer. In some
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 38 -
embodiments, the cancer is osteosarcoma. In some embodiments, the administered
delivery
vehicle comprises yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5,
glutamyl groups. In
some embodiments, the administered delivery vehicle comprises a gamma
tetraglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises a
gamma
pentaglutamated Antifolate. In other embodiments, the administered delivery
vehicle
comprises a gamma hexaglutamated Antifolate. In some embodiments, the
administered
delivery vehicle comprises a polyglutamated Antifolate according to any of
[1]111] of the
Brief Summary Section. In some embodiments, the delivery vehicle comprises a
polyglutamated Antifolate described in the Brief Summary Section. In some
embodiments, the
administered delivery vehicle is a liposomal composition comprising a
polyglutamated
Antifolate according to any of [11411] of the Brief Summary Section. In some
embodiments,
the yPANTIFOL is a polyglutamated Antifolate descibed in Brief Summary
Section. In some
embodiments, the liposomal composition comprises a liposome according to any
of [12]167]
of the Brief Summary Section.
[0038] In additional embodiments, the disclosure provides a method for
treating cancer that
comprises administering an effective amount of a liposome comprising gamma
polyglutamated
Antifolate (e.g., an Lp-7PANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL,
NTPLp-
yPANTIFOL, TLp-yPANTIFOL, or TPLp-yPANTIFOL) to a subject having or at risk of
having cancer. In some embodiments, the liposome is pegylated. In some
embodiments, the
liposome is not pegylated. In additional embodiments, the liposome comprises a
targeting
moiety that has a specific affinity for an epitope of antigen on the surface
of a cancer cell. In
additional embodiments, the liposome comprises a targeting moiety that
specifically binds a
cell surface antigen selected from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a
folate receptor (e.g., folate receptor-a, folate receptor-I3 or folate
receptor-6), Mucin 1 (MUC-
1), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC),
SLC44A4,
NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16,
Tissue
factor, LIV-1 (Z1P6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-
B),
VEGFR2 (CD309), Tenascin, Collagen IV, Periostin, endothelin receptor, HER2,
HER3,
EGFR, IGFR-1, EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD1 1 a, CD15, CD18,
CD19,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 39 -
CD20, CD22, CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70,
CD74, CD79, CD79b, CD105, CD133, CD138, cripto, CD38, an EphA receptor, an
EphB
receptor, EphA2, an integrin (e.g., integrin avI33, av135, or avI36), a C242
antigen, Apo2, PSGR,
NGEP, PSCA, TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. This also
includes the use of cancer stem cell targeting moieties such as those
targeting CD 34, CD133
and CD44, CD138, and CD15. In some embodiments, the targeting moiety is an
antibody or
an antigen binding antibody fragment. In some embodiments, the liposome
comprises
yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some
embodiments, the liposome comprises gamma tetraglutamated Antifolate. In some
embodiments, the liposome comprises gamma pentaglutamated Antifolate. In other
embodiments, the liposome comprises gamma hexaglutamated Antifolate. In some
embodiments, the polyglutamated Antifolate is an Antifolate according to any
of [11411] of
the Brief Summary Section. In some embodiments, the yPANTIFOL is a
polyglutamated
Antifolate descibed in the Brief Summary Section. In some embodiments, the
liposomal
composition comprises a liposome according to any of [12]-[67] of the Brief
Summary Section.
In some embodiments, the liposome liposome comprises L gamma polyglutamated
Antifolate.
In some embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, L-
gamma glutamyl
groups. In some embodiments, the liposome comprises D gamma polyglutamated
Antifolate.
In some embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, D-
gamma glutamyl
groups. In some embodiments, the administered liposome comprises 2, 3, 4, 5,
or more than 5,
L-gamma glutamyl groups. In some embodiments, the liposome comprises L and D
gamma
polyglutamated Antifolate. In some embodiments, the liposome n comprises 2, 3,
4, 5, or more
than 5, L-gamma glutamyl groups and 2, 3, 4, 5, or more than 5, D-gamma
glutamyl groups.
In some embodiments, the cancer is selected from: lung (e.g., non-small lung
cancer),
pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and
neck cancer, gastric
cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer,
cervical cancer, liver
cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder
cancer, sarcoma (e.g.,
osteosarcoma), brain cancer, central nervous system cancer, melanoma, and a
hematologic
malignancy (e.g., a leukemia or lymphoma). In some embodiments, the cancer is
selected from:
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 40 -
breast cancer, advanced head and neck cancer, lung cancer, stomach cancer,
osteosarcoma,
Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis
fungoides
(cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic
meningeal
cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder
cancer, and
central nervous system (CNS) cancer. In some embodiments, the cancer is lung
cancer (e.g.,
NSCLC or mesothelioma). In some embodiments, the cancer is breast cancer
(e.g., HER2++
or triple negative breast cancer). In some embodiments, the cancer is
colorectal cancer. In some
embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is
endometrial
cancer. In some embodiments, the cancer is pancreatic cancer. In some
embodiments, the
cancer is liver cancer. In some embodiments, the cancer is head and neck
cancer. In some
embodiments, the cancer is osteosarcoma
[0039] In additional embodiments, the disclosure provides a method for
treating cancer that
comprises administering to a subject having or at risk of having cancer, an
effective amount of
a liposomal composition comprising a liposome that comprises gamma
polyglutamated
Antifolate and a targeting moiety that has a specific affinity for an epitope
of antigen on the
surface of the cancer. In some embodiments, the liposome comprises a targeting
moiety that
specifically binds a cell surface antigen selected from: GONMB, TACSTD2
(TROP2),
CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a, folate receptor-0
or folate
receptor-6), Mucin 1 (MUC-1), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3,
Guanylyl
cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4
(TPBG), SLTRK6, SC-16, Tissue factor, LIV-1 (ZIP6), CGEN-15027, P-Cadherin,
Fibronectin Extra-domain B (ED-B), VEGFR2 (CD309), Tenascin, Collagen IV,
Periostin,
endothelin receptor, HER2, HER3, EGFR, IGFR-1, EGFRvIII, CD2, CD3, CD4, CD5,
CD6,
CD11, CD11a, CD15, CD18, CD19, CD20, CD22, CD26, CD27L, CD30, CD33, CD34,
CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79, CD79b, CD105, CD133, CD138,
cripto, CD38, an EphA receptor, an EphB receptor, EphA2, an integrin (e.g.,
integrin av03,
av05, or av06), a C242 antigen, Apo2, PSGR, NGEP, PSCA, TMEFF2, endoglin,
PSMA,
CD98, CD56, CanAg, and CALLA. In some embodiments, the liposome comprises a
targeting
moiety that specifically binds a cell surface antigen(s) derived from or
determined to be
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 41 -
expressed on a specific subject's tumor such as a neoantigen. In some
embodiments, the
targeting moiety is an antibody or an antigen binding antibody fragment. In
some
embodiments, the liposome comprises yPANTIFOL containing 4, 5, 2-10, 4-6, or
more than
5, y-glutamyl groups. In some embodiments, the liposome comprises a gamma
tetraglutamated
Antifolate. In some embodiments, the liposome comprises a gamma
pentaglutamated
Antifolate. In some embodiments, the liposome comprises a gamma hexaglutamated
Antifolate. In some embodiments, the polyglutamated Antifolate is an
Antifolate according to
any of [1]-[11] of the Brief Summary Section. In some embodiments, the
yPANTIFOL is a
polyglutamated Antifolate descibed in the Brief Summary Section. In some
embodiments, the
liposomal composition comprises a liposome according to any of [14[67] of the
Brief
Summary Section. In some embodiments, the liposome comprises a yPANTIFOL
containing
y-glutamyl groups in the L-form. In some embodiments, the liposome comprises a
yPANTIFOL containing y-glutamyl groups in the D-form. In some embodiments, the
liposome
comprises a yPANTIFOL containing at least one y-glutamyl group in the L-form
and at least
one y-glutamyl group in the D form. In some embodiments, the cancer is
selected from: lung
(e.g., non-small lung cancer), pancreatic cancer, breast cancer, ovarian
cancer, prostate cancer,
head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal
cancer, esophageal
cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer,
gallbladder cancer,
bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous
system cancer,
melanoma, and a hematologic malignancy (e.g., a leukemia or lymphoma). In some
embodiments, the cancer is selected from: breast cancer, advanced head and
neck cancer, lung
cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute
lymphoblastic
leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma,
chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid
tumors,
aggressive fibromatosis), bladder cancer, and central nervous system (CNS)
cancer. In some
embodiments, the cancer is lung cancer (e.g., NSCLC or mesothelioma). In some
embodiments, the cancer is breast cancer (e.g., HER2++ or triple negative
breast cancer). In
some embodiments, the cancer is colorectal cancer. In some embodiments, the
cancer is
ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some
embodiments,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 42 -
the cancer is pancreatic cancer. In some embodiments, the cancer is liver
cancer. In some
embodiments, the cancer is head and neck cancer. In some embodiments, the
cancer is
osteosarcoma.
[0040] In some embodiments, the administered liposomal composition
comprises
pegylated liposomes (e.g., TPLp-yPANTIFOL). In some embodiments, the
administered
liposomal composition comprises liposomes that are not pegylated. In some
embodiments,
liposomes of the administered liposomal composition comprise a yPANTIFOL
containing 4,
5, 2-10, 4-6, or more than 5, glutamyl groups. In some embodiments, liposomes
of the
administered liposomal composition comprise gamma tetraglutamated Antifolate.
In some
embodiments, liposomes of the administered liposomal composition comprise
gamma
pentaglutamated Antifolate. In other embodiments, liposomes of the
administered liposomal
composition comprise gamma hexaglutamated Antifolate. In some embodiments, the
liposome comprises a polyglutamated Antifolate according to any of [1]-[11] of
the Brief
Summary Section. In some embodiments, the yPANTIFOL is a polyglutamated
Antifolate
described in the Brief Summary Section. In some embodiments, the liposome
composition
comprises a liposome according to any of [12[467] of the Brief Summary
Section. In some
embodiments, the liposomal composition is administered to treat a cancer
selected from: lung
cancer (e.g., non-small cell), pancreatic cancer, breast cancer, ovarian
cancer, prostate cancer,
head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal
cancer, esophageal
cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer,
gallbladder cancer,
bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous
system cancer,
melanoma, myeloma and other plasma cell dysplasias or dyscrasias, and leukemia
and a
lymphoma and other B cell malignancies. In some embodiments, the liposomal
composition
is administered to treat a cancer selected from: breast cancer, advanced head
and neck cancer,
lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute
lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma)
choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue
sarcoma
(desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous
system (CNS)
cancer. In some embodiments, the liposomal composition is administered to
treat lung cancer
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
-43 -
(e.g., NSCLC or mesothelioma). In some embodiments, the liposomal composition
is
administered to treat breast cancer (e.g., HER2++ or triple negative breast
cancer). In some
embodiments, the liposomal composition is administered to treat colorectal
cancer. In some
embodiments, the liposomal composition is administered to treat ovarian
cancer. In some
embodiments, the liposomal composition is administered to treat endometrial
cancer. In some
embodiments, the liposomal composition is administered to treat pancreatic
cancer. In some
embodiments, the liposomal composition is administered to treat liver cancer.
In some
embodiments, the liposomal composition is administered to treat head and neck
cancer. In
some embodiments, the liposomal composition is administered to treat
osteosarcoma.
[0041] In additional embodiments, the disclosure provides a method for
treating cancer that
comprises administering an effective amount of a liposomal composition to a
subject having
or at risk of having a cancer that expresses folate receptor on its cell
surface, wherein the
liposomal composition comprises liposomes that comprise (a) gamma
polyglutamated
Antifolate (yPANTIFOL) and (b) a targeting moiety that has specific binding
affinity for a
folate receptor. In some embodiments, the targeting moiety has specific
binding affinity for
folate receptor alpha (FR-a), folate receptor beta (FR-I3), and/or folate
receptor delta (FR-6).
In some embodiments, the targeting moiety has a specific binding affinity for
folate receptor
alpha (FR-a) and folate receptor beta (FR-(3). In some embodiments, the
administered
liposomal composition comprises pegylated liposomes (e.g., TPLp-yPANTIFOL). In
some
embodiments, the administered liposomal composition comprises liposomes that
are not
pegylated. In some embodiments, liposomes of the administered liposomal
composition
comprises a yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, y-glutamyl
groups. In
some embodiments, liposomes of the administered liposomal composition comprise
gamma
tetraglutamated Antifolate. In some embodiments, liposomes of the administered
liposomal
composition comprise gamma pentaglutamated Antifolate. In other embodiments,
liposomes
of the administered liposomal composition comprise gamma hexaglutamated
Antifolate. In
some embodiments, the liposome comprises a polyglutamated Antifolate according
to any of
[1]411] of the Brief Summary Section. In some embodiments, the yPANTIFOL is a
polyglutamated Antifolate described in the Brief Summary Section. In some
embodiments,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 44 -
the liposome composition comprises a liposome according to any of [12]-[67] of
the Brief
Summary Section. In some embodiments, the liposomal composition is
administered to treat
a cancer selected from: a non-hematologic malignancy including such as for
example, lung
cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer,
head and neck
cancer, gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal
cancer, cervical
cancer, liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer,
bladder cancer,
sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and
melanoma;
and a hematologic malignancy such as for example, a leukemia, a lymphoma and
other B cell
malignancies, myeloma and other plasma cell dysplasias or dyscrasias. In some
embodiments,
the liposomal composition is administered to treat a cancer selected from:
breast cancer,
advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-
Hodgkin's
lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides
(cutaneous T-
cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer,
soft tissue
sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central
nervous
system (CNS) cancer. In some embodiments, the liposomal composition is
administered to
treat lung cancer (e.g., NSCLC or mesothelioma). In some embodiments, the
liposomal
composition is administered to treat breast cancer (e.g., HER2++ or triple
negative breast
cancer). In some embodiments, the liposomal composition is administered to
treat colorectal
cancer. In some embodiments, the liposomal composition is administered to
treat ovarian
cancer. In some embodiments, the liposomal composition is administered to
treat endometrial
cancer. In some embodiments, the liposomal composition is administered to
treat pancreatic
cancer. In some embodiments, the liposomal composition is administered to
treat liver cancer.
In some embodiments, the liposomal composition is administered to treat head
and neck
cancer. In some embodiments, the liposomal composition is administered to
treat
osteosarcoma.
[0042] In additional embodiments, the disclosure provides a method for
cancer maintenance
therapy that comprises administering an effective amount of a liposomal
composition
comprising liposomes that contain gamma polyglutamated Antifolate (Lp-
yPANTIFOL) to a
subject that is undergoing or has undergone cancer therapy. In some
embodiments, the
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
-45 -
administered liposomal composition is a PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-
yPANTIFOL, TLp-yPANTIFOL or TPLp-yPANTIFOL. In some embodiments, the
administered liposomal composition comprises pegylated liposomes (e.g., PLp-
yPANTIFOL,
NTPLp-yPANTIFOL, or TPLp-yPANTIFOL). In some embodiments, the administered
liposomal composition comprises targeted liposomes (e.g., TLp-yPANTIFOL or
TPLp-
yPANTIFOL). In some embodiments, the administered liposomal composition
comprises
liposomes that are pegylated and comprise a targeting moiety (e.g., TPLp-
yPANTIFOL). In
some embodiments, liposomes of the administered liposomal composition
comprises gamma
polyglutamated Antifolate that contains 4, 5, 2-10, 4-6, or more than 5, y-
glutamyl groups. In
some embodiments, liposomes of the administered liposomal composition comprise
gamma
tetraglutamated Antifolate. In some embodiments, liposomes of the administered
liposomal
composition comprise gamma pentaglutamated Antifolate. In other embodiments,
liposomes
of the administered liposomal composition comprise gamma hexaglutamated
Antifolate. In
some embodiments, the liposomal composition comprises liposomes that contain a
gamma
polyglutamate according to any of [1]-[11] of the Brief Summary Section. In
some
embodiments, the yPANTIFOL is a polyglutamated Antifolate descibed in the
Brief Summary
Section. In some embodiments, the liposomal composition comprises a liposome
according to
any of [12]467] of the Brief Summary Section.
[0043] In additional embodiments, the disclosure provides a method for
treating a disorder of
the immune system that comprises administering an effective amount of a
liposomal
composition comprising liposomes that contain gamma polyglutamated Antifolate
(e.g., Lp-
yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-
yPANTIFOL or TPLp-yPANTIFOL) to a subject having or at risk of having a
disorder of the
immune system. In some embodiments, the liposomal composition is administered
to treat an
autoimmune disease. In a further embodiment, the liposomal composition is
administered to
treat rheumatoid arthritis. In another embodiment, the liposomal composition
is administered
to treat inflammation. In some embodiments, the disorder of the immune system
is selected
from: inflammation (e.g., acute and chronic), systemic inflammation,
rheumatoid arthritis,
inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/
polymyositis, systemic
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 46 -
lupus erythematosus, Takayasu, and psoriasis. In some embodiments, the
administered
liposomal composition comprises pegylated liposomes (e.g., PLp-yPANTIFOL,
NTPLp-
yPANTIFOL, or TPLp-yPANTIFOL). In some embodiments, the administered liposomal
composition comprises targeted liposomes (e.g., TLp-yPANTIFOL or TPLp-
yPANTIFOL)
that contain a targeting moiety having a specific affinity for a surface
antigen on a target cell
of interest (e.g., an immune cell). In further embodiments, the administered
liposomal
composition comprises liposomes that are pegylated and comprise a targeting
moiety (e.g.,
TPLp-yPANTIFOL). In some embodiments, a liposome of the administered liposomal
composition comprises gamma polyglutamated Antifolate that contains 4, 5, 2-
10, 4-6, or more
than 5, y-glutamyl groups. In some embodiments, liposomes of the administered
liposomal
composition comprise gamma tetraglutamated Antifolate. In some embodiments,
liposomes
of the administered liposomal composition comprise gamma pentaglutamated
Antifolate. In
other embodiments, liposomes of the administered liposomal composition
comprise gamma
hexaglutamated Antifolate. In some embodiments, the liposomal composition
comprises
liposomes that contain a gamma polyglutamate according to any of [1]-[11] of
the Brief
Summary Section. In some embodiments, the yPANTIFOL is a polyglutamated
Antifolate
descibed in the Brief Summary Section. In some embodiments, the liposomal
composition
comprises a liposome according to any of [12]467] of the Brief Summary
Section.
[0044] In additional embodiments, the disclosure provides a method for
treating an
autoimmune disease that comprises administering an effective amount of a
liposomal
composition comprising liposomes that contain gamma polyglutamated Antifolate
(e.g., Lp-
yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-
yPANTIFOL or TPLp-yPANTIFOL) to a subject having or at risk of having an
autoimmune
disease. In some embodiments, the autoimmune disease is rheumatoid arthritis.
In some
embodiments, the autoimmune disease is a disease or disorder selected from:
inflammatory
bowel disease (IBD), Crohn disease, systemic lupus erythematosus, and
psoriasis. In some
embodiments, the autoimmune disease is a disease or disorder selected from:
Addison' s
disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis,
autoimmune parotitis,
diabetes (Type I), dystrophic epidermolysis bullosa, epididymitis,
glomerulonephritis, Graves'
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 47 -
disease, Guillain-Barr syndrome, Hashimoto's disease, hemolytic anemia,
systemic lupus
erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris,
psoriasis, rheumatic
fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome,
spondylo-
arthropathies, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia,
and ulcerative
colitis. In some embodiments, the administered liposomal composition comprises
pegylated
liposomes (e.g., PLp-yPANTIFOL, NTPLp-yPANTIFOL, or TPLp-yPANTIFOL). In some
embodiments, the administered liposomal composition comprises targeted
liposomes (e.g.,
TLp-yPANTIFOL or TPLp-yPANTIFOL) that contain a targeting moiety having a
specific
affinity for a surface antigen on a target cell of interest (e.g., an immune
cell). In further
embodiments, the administered liposomal composition comprises liposomes that
are pegylated
and comprise a targeting moiety (e.g., TPLp-yPANTIFOL). In some embodiments,
liposomes
of the administered liposomal composition comprise gamma polyglutamated
Antifolate that
contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some
embodiments, liposomes of
the administered liposomal composition comprise gamma tetraglutamated
Antifolate. In some
embodiments, liposomes of the administered liposomal composition comprise
gamma
pentaglutamated Antifolate. In other embodiments, liposomes of the
administered liposomal
composition comprise gamma hexaglutamated Antifolate. In some embodiments, the
liposome
comprises a polyglutamated Antifolate according to any of [1]-[11] of the
Brief Summary
Section. In some embodiments, the yPANTIFOL is a polyglutamated Antifolate
described in
Bthe rief Summary Section. In some embodiments, the liposome composition
comprises a
liposome according to any of [12]-[67] of the Brief Summary Section.
[0045] In additional embodiments, the disclosure provides a method for
treating an
inflammatory disorder that comprises administering an effective amount of a
liposomal
composition comprising liposomes that contain gamma polyglutamated Antifolate
(e.g., Lp-
yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-
yPANTIFOL or TPLp-yPANTIFOL) to a subject having or at risk of having an
inflammatory
disorder. In some embodiments, the inflammatory disorder is a disorder
selected from: acute
inflammation, chronic inflammation, systemic inflammation, rheumatoid
arthritis,
inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/
polymyositis, and
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 48 -
systemic lupus erythematosus. In some embodiments, the inflammatory disorder
is a disorder
selected from: a rheumatoid disease or other arthritic disease (e.g., acute
arthritis, acute gouty
arthritis, bacterial arthritis, chronic inflammatory arthritis, degenerative
arthritis
(osteoarthritis), infectious arthritis, juvenile arthritis, mycotic arthritis,
neuropathic arthritis,
polyarthritis, proliferative arthritis, psoriatic arthritis, venereal
arthritis, viral arthritis),
fibrositis, pelvic inflammatory disease, acne, psoriasis, actinomycosis,
dysentery, biliary
cirrhosis, Lyme disease, heat rash, Stevens-Johnson syndrome, mumps, pemphigus
vulgaris,
and blastomycosis. In some embodiments, the inflammatory disorder is an
inflammatory bowel
disease. Inflammatory bowel diseases are chronic inflammatory diseases of
the
gastrointestinal tract which include, without limitation, Crohn's disease,
ulcerative colitis, and
indeterminate colitis. In some embodiments, the administered liposomal
composition
comprises pegylated liposomes (e.g., PLp-yPANTIFOL, NTPLp-yPANTIFOL, or TPLp-
yPANTIFOL). In some embodiments, the administered liposomal composition
comprises
targeted liposomes (e.g., TLp-yPANTIFOL or TPLp-yPANTIFOL) that contain a
targeting
moiety having a specific affinity for a surface antigen on a target cell of
interest (e.g., an
immune cell). In further embodiments, the administered liposomal composition
comprises
liposomes that are pegylated and comprise a targeting moiety (e.g., TPLp-
yPANTIFOL). In
some embodiments, liposomes of the administered liposomal composition comprise
gamma
pentaglutamated Antifolate that contains 4, 5, 2-10, 4-6, or more than 5,
glutamyl groups. In
some embodiments, liposomes of the administered liposomal composition comprise
gamma
tetraglutamated Antifolate. In some embodiments, liposomes of the administered
liposomal
composition comprise gamma pentaglutamated Antifolate. In other embodiments,
liposomes
of the administered liposomal composition comprise gamma hexaglutamated
Antifolate. In
some embodiments, the liposome comprises a polyglutamated Antifolate according
to any of
[1]411] of the Brief Summary Section. In some embodiments, the yPANTIFOL is a
polyglutamated Antifolate described in the Brief Summary Section. In some
embodiments, the
liposome composition comprises a liposome according to any of [12]467] of the
Brief
Summary Section.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 49 -
[0046]
The disclosure also provides a method of delivering gamma polyglutamated
Antifolate to a site of inflammation in a subject that comprises:
administering to the subject
having the inflammation, a composition comprising gamma polyglutamated
Antifolate (L-
yPANTIFOL) and a targeting moiety that has a specific binding affinity for an
epitope on a
surface antigen on a cell that is located at, or otherwise influences the
inflammation (e.g., via
proinflammatory cytokine production). In some embodiments, the administered
targeting
moiety is associated with a delivery vehicle. In some embodiments, the
delivery vehicle is an
antibody or an antigen binding fragment of an antibody. In further
embodiments, the delivery
vehicle is a liposome. In further embodiments, the antibody, antigen-binding
antibody
fragment, or liposome is pegylated liposomes (e.g., TPLp-yPANTIFOL). In some
embodiments, the administered composition comprises a gamma polyglutamated
Antifolate
that contains 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some
embodiments, the
administered composition comprises a gamma tetraglutamated Antifolate. In some
embodiments, the administered composition comprises a gamma pentaglutamated
Antifolate.
In other embodiments, the administered composition comprises a gamma
hexaglutamated
Antifolate. In some embodiments, the yPANTIFOL is a polyglutamated Antifolate
according
to any of 11]-111] of the Brief Summary Section. In some embodiments, the
yPANTIFOL is a
polyglutamated Antifolate described in the Brief Summary Section. In some
embodiments, the
delivery vehicle is a liposome according to any of [121467] of the Brief
Summary Section.
[0047] The disclosure also provides a method of delivering gamma
polyglutamated Antifolate
to a tumor and/or cancer cell that comprises: administering to a subject
having the tumor, a
composition comprising gamma polyglutamated Antifolate (L-yPANTIFOL) and a
targeting
moiety that has a specific binding affinity for an epitope on a surface
antigen on the tumor cell
or cancer cell. In some embodiments, the administered targeting moiety is
associated with a
delivery vehicle. In some embodiments, the delivery vehicle is an antibody or
an antigen
binding fragment of an antibody. In further embodiments, the delivery vehicle
is a liposome.
In further embodiments, the antibody, antigen-binding antibody fragment, or
liposome is
pegylated liposomes (e.g., TPLp-yPANTIFOL). In some embodiments, the
administered
composition comprises gamma polyglutamated Antifolate that contains 4, 5, 2-
10, 4-6, or more
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 50 -
than 5, glutamyl groups. In some embodiments, the administered composition
comprises
gamma tetraglutamated Antifolate. In some embodiments, the administered
composition
comprises gamma pentaglutamated Antifolate. In other embodiments, the
administered
composition comprises gamma hexaglutamated Antifolate. In some embodiments,
the
administered composition comprises an Antifolate according to any of [1]-111]
of the Brief
Summary Section. In some embodiments, the yPANTIFOL is a polyglutamated
Antifolate
descibed in the Brief Summary Section. In some embodiments, the administered
composition
comprises a liposome according to any of [12]-[67] of the Brief Summary
Section.
[0048] In additional embodiments, the disclosure provides a method of
preparing a liposomal
composition that comprises a liposomal gamma polyglutamated Antifolate
(yPANTIFOL)
composition, the method comprising: forming a mixture comprising: liposomal
components
and 7 polyglutamated Antifolate in solution; homogenizing the mixture to form
liposomes in
the solution; and processing the mixture to form liposomes containing
polyglutamated
Antifolate. In some embodiments, the gamma polyglutamated Antifolate contains
4, 5, 2-10,
4-6, or more than 5, y-glutamyl groups. In some embodiments, the yPANTIFOL
comprises
gamma tetraglutamated Antifolate. In some embodiments, the yPANTIFOL comprises
gamma
pentaglutamated Antifolate. In other embodiments, the yPANTIFOL comprises
gamma
hexaglutamated Antifolate. In some embodiments, the yPANTIFOL is a
polyglutamated
Antifolate according to any of [1]411] of the Brief Summary Section. In some
embodiments,
the yPANTIFOL is a polyglutamated Antifolate descibed in the Brief Summary
Section. In
some embodiments, the liposomal composition comprises a liposome according to
any of [12]-
[67] of the Brief Summary Section.
[0049] In one embodiment, the disclosure provides a kit comprising an
Antifolate gamma
poylglutamate composition and/or yPANTIFOL delivery vehicles such as liposomes
containing yPANTIFOL and yPANTIFOL immunoconjugates (e.g., ADCs) described
herein.
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
[0050] FIGS. IA-1N show chemical formulas of the Antifolate pemetrexed
(FIG. IA),
exemplary gamma pemetrexed polyglutamates, gamma pemetrexed diglutamate (FIG.
IB),
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
-51 -
gamma pemetrexed triglutamate (FIGS. 1C and 1D), gamma pemetrexed
tetraglutamate
(FIGS. 1E and 1F), gamma pemetrexed pentaglutamates (FIGS. 1G and 1H), gamma
pemetrexed hexaglutamates (FIGS. 11 and 1J), gamma pemetrexed heptaglutamate
(FIGS.
1K and 1L), and gamma pemetrexed octaglutamates (FIGS. 1M and 1N).
[0051] FIG. 2 presents the relative potency of liposomal pemetrexed gamma-L
hexaglutamate (liposomal aG6) and its mirror image, liposomal gamma-D
hexaglutamate
(liposomal aDG6) relative to pemetrexed following exposure of the cancer cell
lines SW620
(CRC), HT-29 (colon cancer), H1806 (triple negative breast cancer), 0AW28
(ovarian cancer),
H292 (NSCLC, adenocarcinoma subtype), and H2342 (NSCLC, adenocarcinoma
subtype),
over 48 hours.
[0052] FIG. 3 presents an example dose response relationship of free
pemetrexed L-gamma
hexaglutamate (gG6), liposomal pemetrexed L-gamma hexaglutamate (liposomal
gG6),
pemetrexed, and folate receptor alpha targeting antibody (FR1Ab) liposomal
pemetrexed L-
gamma hexaglutamate (liposomal gG6-FR1Ab) in the HT-29 (colon cancer) at 48
hours.
[0053] FIG. 4 shows the effect of free pemetrexed L-gamma hexaglutamate
(hexa gG6) and
liposomal pemetrexed L-gamma hexaglutamate (liposomal hexa gG6), on the growth
of colon
cancer SW260 cells following exposure of 256 nM of the corresponding agent for
48 hours.
The non-targeted and targeted liposomal pemetrexed hexa gG6 are able to enter
cells more
efficiently than free pemetrexed hexa gG6 to inhibit growth of the colon
cancer SW260 cells.
[0054] FIG. 5 presents the relative potency of liposomal pemetrexed L-gamma
hexaglutamate (liposomal gG6) and its mirror image, liposomal pemetrexed gamma-
D
hexaglutamate (liposomal gDG6) relative to pemetrexed following exposure of
the cancer cell
lines SW620 (CRC), HT-29 (colon cancer), H1806 (triple negative breast
cancer), 0AW28
(ovarian cancer), H292 (NSCLC, adenocarcinoma subtype), and H2342 (NSCLC,
adenocarcinoma subtype), over 48 hours.
[0055] FIG. 6 presents the treatment effect on HCC1806 triple negative
breast cancer cells
following exposure of liposomal pemetrexed gamma-L hexaglutamate (Lps Hexa
gG6),
liposomal pemetrexed gamma-D hexaglutamate (Lps Hexa gDG6), and to pemetrexed
over 48
hours.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 52 -
[0056] FIG. 7 presents the treatment effect on 0AW28 ovarian cancer cells
following
exposure of liposomal pemetrexed gamma-L hexaglutamate (Lps Hexa gG6),
liposomal
pemetrexed gamma-D hexaglutamate (Lps Hexa gDG6), as compared to pemetrexed
over 48
hours.
[0057] FIG. 8 presents the treatment effect on H292 non-small cell lung
cancer cells
following exposure of liposomal pemetrexed gamma-L hexaglutamate (Lps Hexa
gG6),
liposomal pemetrexed gamma-D hexaglutamate (Lps Hexa gDG6), and to pemetrexed
over 48
hours.
[0058] FIG. 9 presents the treatment effect on H292 non-small cell lung
cancer cells
following exposure of various dose levels ranging from 16 to 128 nM of
liposomal pemetrexed
gamma-L hexaglutamate (Liposomal gG6), liposomal pemetrexed gamma-D
hexaglutamate
(Liposomal gDG6), and pemetrexed over 48 hours. At each of the tested dose
ranges, the
liposomal pemetrexed gG6 formulation is superior to inhibiting H292 non-small
cell lung
cancer cells compared to pemetrexed.
[0059] FIG. 10 presents the treatment effect on HCC1806 triple negative
breast cancer cells
following exposure of various dose levels ranging from 16 to 128 nM of
liposomal pemetrexed
gamma-L hexaglutamate (Liposomal gG6), liposomal pemetrexed gamma-D
hexaglutamate
(Liposomal gDG6), and pemetrexed over 48 hours. At each of the tested doses,
the liposomal
pemetrexed gG6 formulation is superior to pemetrexed in inhibiting HCC1806
triple negative
breast cancer cells.
[0060] FIG. 11 presents the treatment effect on 0AW28 ovarian cancer cells
of liposomal
pemetrexed gamma-L hexaglutamate (LiposomalgG6), liposomal gamma-D
hexaglutamate
(LiposomalgDG6), and pemetrexed following exposure over 48 hours following
exposure over
a range of concentrations. At the dose of 128 nM, pemetrexed appears to more
effective than
the Liposomal pemetrexed gG6 liposomal formulation, whereas the liposomal
formulation at
the dose of 32 nM and 64 nM has a better treatment effect than pemetrexed; at
16 nM the
Liposomal pemetrexed gG6 treatment effect is similar in to pemetrexed.
[0061] FIG. 12 shows the toxicity of liposomal pemetrexed gamma-L
hexaglutamate
(LiposomalgG6), liposomal pemetrexed gamma-D hexaglutamate (Liposomal gDG6),
and
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 53 -
pemetrexed on differentiating human neutrophils at 64 nM, 128 nM, and 264 nM.
The figure
demonstrates that liposomal pemetrexed gG6 is significantly less toxic to
differentiating
human neutrophils than pemetrexed.
[0062] FIG. 13 shows the effect of liposomal pemetrexed gamma-L
hexaglutamate
(liposomalgG6), liposomal gamma-D hexaglutamate (liposomalgDG6), and
pemetrexed on
neutrophils (differentiated from CD34+ cells) following exposure of various
dose levels
ranging from 16 to 128 nM of the corresponding agent over 48 hours.
[0063] FIG. 14 shows the effect of liposomal pemetrexed gamma-L
hexaglutamate
(liposomalgG6), liposomal pemetrexed gamma-D hexaglutamate (liposomalgDG6),
and
pemetrexed on AML12 liver cells following exposure over 48 hours at 16 nM, 32
nM, and 64
nM, and 128 nM of the corresponding agent. Strikingly, there does not appear
to be any toxicity
to the AML12 liver cells following treatment with a liposomal pemetrexed gG6
at any of the
liposomal agents at the dose levels tested. In contrast, pemetrexed treatment
results in a
reduction in the AML12 liver cell counts of approximately 40% at all doses
studied.
[0064] FIG. 15 shows the effect of liposomal pemetrexed gamma-L
hexaglutamate
(liposomalgG6), liposomal pemetrexed gamma-D hexaglutamate (liposomalgDG6),
and
pemetrexed on CCD841 colon epithelium cells following exposure over 48 hours
at 16 nM, 32
nM, and 64 nM, and 128 nM, of the corresponding agent. At all of the
concentrations tested,
pemetrexed leads to approximately a >50% decrease in the number of CCD841
colon
epithelium cells compared to approximately a 20% or less decrease in cell
number after
treatment with each of the liposome compositions tested.
[0065] FIG. 16 depicts the structure of polyglutamate antifolate, Cisplatin
(CDDP) and two
potential gG6-Cisplatin complexes. The pH dependent formation of the
interstrand and/or
instrastrand coordination between the carboxyl groups of the polyglutamated
antifolate and
cisplatin is likely to disassemble into individual molecules of gG6 and
cisplatin upon
encountering acidic pH of lysosomes (pH 3-5) and presence of chloride ions
inside the cells.
[0066] FIG. 17 presents the effects of liposomal aG6 treatment of mice with
40 mg/kg and
80 mg/kg given once weekly for 4 weeks upon the hematologic parameters: white
blood cell
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 54 -
(WBC) counts, neutrophil counts and as platelet counts. No appreciable
decrease in mean
neutrophil, mean white blood cell or mean platelet counts was observed.
[0067] FIG. 18 presents the effects of liposomal aG6 treatment of mice with
40 mg/kg and
80 mg/kg given once weekly for 4 weeks upon hemoglobin and reticulocyte
indices. There is
a minimal decrease in mean hemoglobin concentrations at the higher dose level.
In parallel
there is a slight increase in mean reticulocytosis indices
[0068] FIG. 19 presents the effects of liposomal aG6 treatment of mice with
40 mg/kg and
80 mg/kg given once weekly for 4 weeks upon hepatic markers including serum
aspartate
transaminase (AST) and serum alanine transaminase (ALT) along with serum
albumin. There
was no appreciable increases in liver transaminases mean AST or mean ALT
levels and there
was no observed change in mean albumin levels.
[0069] FIG. 20 presents the relative tumor volume of immunodeficient female
Nu/J mice (6-
8 weeks old) inoculated with NCI-H292 (Non-Small Cell Lung Cancer) cells and
administered control, pemetrexed, and Liposomal aG6 intravenously at 167 mg/kg
once every
three weeks. As can be seen from these preliminary data, liposomal aG6
provides reduced
tumor control compared to pemetrexed.
[0070] FIGS. 21A-F present the dose response relationship of liposomal
pemetrexed alpha-
L triglutamate (Liposomal aG3), liposomal pemetrexed alpha-L pentaglutamate
(Liposomal
aG5), liposomal pemetrexed alpha-L octaglutamate (Liposomal aG7), and a
combination of
liposomal pemetrexed alpha-L hexaglutamate (aG6) and alpha-L dodecaglutamate
(aG12)
(Liposomal aG6 and aG12), over 48 hours on H2342 (NSCLC, adenocarcinoma
subtype)(FIG. 21A), H292 (NSCLC, adenocarcinoma subtype)(FIG. 21B), HT-29
(colon
cancer)(FIG. 21C), HCC1806 (triple negative breast cancer)(FIG. 21D), MCF7
(ER+ breast
cancer)(FIG. 21E), and 0AW28 (ovarian cancer)(FIG. 21F). Cell viability was
determined
by CellTiter-Glo (CTG) luminescent cell viability assay essentially as
described in Example
1. As shown in all cell lines, the potency of each of the polyglutamated
pemetrexed liposomal
compositions well exceeded that of the liposomal vehicle and empty liposome
controls.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 55 -
DETAILED DESCRIPTION
[0071] The disclosure generally relates to gamma polyglutamated Antifolate
compositions.
The compositions provide advances over prior treatments of hyperproliferative
diseases such
as cancer. Methods of making, delivering and using the gamma polyglutamated
Antifolate
compositions are also provided. The gamma polyglutamated compositions have
uses that
include but are not limited to treating or preventing hyperproliferative
diseases such as cancer,
disorders of the immune system including inflammation and autoimmune disease
such as
rheumatoid arthritis, and infectious diseases such as HIV, malaria, and
schistomiasis.
Definitions
[0072] Unless defined otherwise, all technical and scientific terms used
herein have the same
meaning as commonly understood by one of ordinary skill in the art to which
the disclosure
pertains.
[0073] It is understood that wherever embodiments, are described herein
with the language
"comprising" otherwise analogous embodiments, described in terms of
"containing"
"consisting of' and/or "consisting essentially of' are also provided. However,
when used in
the claims as transitional phrases, each should be interpreted separately and
in the appropriate
legal and factual context (e.g., in claims, the transitional phrase
"comprising" is considered
more of an open-ended phrase while "consisting of' is more exclusive and
"consisting
essentially of' achieves a middle ground).
[0074] As used herein, the singular form "a", "an", and "the", includes
plural references
unless it is expressly stated or is unambiguously clear from the context that
such is not
intended.
[0075] The term "and/or" as used in a phrase such as "A and/or B" herein is
intended to
include both A and B; A or B; A (alone); and B (alone). Likewise, the term
"and/or" as used
in a phrase such as "A, B, and/or C" is intended to encompass each of the
following
embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and
B; B and C; A
(alone); B (alone); and C (alone).
[0076] Headings and subheadings are used for convenience and/or formal
compliance only,
do not limit the subject technology, and are not referred to in connection
with the interpretation
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 56 -
of the description of the subject technology. Features described under one
heading or one
subheading of the subject disclosure may be combined, in various embodiments,
with features
described under other headings or subheadings. Further it is not necessarily
the case that all
features under a single heading or a single subheading are used together in
embodiments.
[0077] Unless indicated otherwise, the terms "Antifolate" and "ANTIFOL" are
used
interchangeably to include a salt, acid and and/or free base form of an
antifolate (e.g.,
Antifolate disodium). Compositions containing a Antifolate salt may further
contain any of a
variety of cations, such as Na+, Mg2+, K+, NH4+, and/or Ca2+. In particular
embodiments,
the salts are pharmaceutically acceptable salts. Antifolate contains one L-
gamma glutamyl
group, and is therefore considered to be monoglutamated for the purpose of
this disclosure.
[0078] Although the compounds of the present invention can exist as a
mixture of
stereoisomers it is preferred that they are resolved into one optically active
isomeric form. Such
a requirement complicates the synthesis of the compounds and it is preferred
therefore that
they contain as few asymmetric carbon atoms as possible consistent with
achieving the desired
activity.
[0079] As indicated previously, however, the cyclopenta[g]quinazolines of
the present
invention contain at least three asymmetric carbon atoms. Of these, that at
the 6 position of the
ring system preferably has the 6S orientation rather than the 6R orientation.
The preferred
compounds (I) described hereinbefore thus preferably have such a configuration
at this
asymmetric carbon atoms or less preferably are a mixture in which one or both
of these
asymmetric carbon atoms is unresolved.
[0080] The Antifolate can be any known or future derived folate or
antifolate that is
polyglutamated. In some embodiments, the Antifolate is selected from LV
(etoposide), L-
leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate;
FA, folic
acid; PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-
MTX; 2-
CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-
CH3 -AMT, 2-de s amino-2-methyl-AMT; 10-EdAM, 10-ethyl- 10-deaz aaminopterin ;
PT523, N
alpha -(4-amino-4-deoxypteroy1)-N delta-(hemiphthaloy1)-L-ornithine; DDATHF
(lometrexol), 5,10-dideaza-5,6,7,8,-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-
deaza-5,6,7,8-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 57 -
tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methy1-5-deaza-5,6,7,8-
tetrahydro-
isofolic acid; 5-dPteHCysA, N alpha -(5-deazapteroy1)-L-homocysteic acid; 5-
dPteAPBA, N
alpha -(5-deazapteroy1)-DL-2-amino-4-phosphonobutanoic acid; 5-dPteOrn, N
alpha -(5-
deazapteroy1)-L-ornithine; 5-dH4PteHCysA, N alpha -(5-deaza-5,6,7,8-
tetrahydropteroy1)-L-
homocysteic acid; 5-dH4PteAPBA, N alpha -(5-deaza-5,6,7,8-tetrahydropteroy1)-
DL-2-
amino-4-phosphobutanoic acid; 5-dH4PteOro, N alpha -(5-deaza-5,6,7,8-
tetrahydropteroy1)-
L-ornithine; CB 3717, N10-propargy1-5,8-dideazafolic acid; ICI-198,583, 2-des
amino-2-
methyl-N10-propargy1-5,8-dideazafolic acid; 4-H-ICI-198,583, 4-deoxy-ICI-
198,583: 4-
OCH3-ICI-198,583, 4-methoxy-ICI-198,583 Glu-to-Val-ICI-198,583; valine-ICI-
198;583;
Glu-to-Sub-ICI-198,583, 2-amino-suberate-ICI-198,583; 7-CH3-ICI-198,583, 7-
methyl-ICI-
198,583; ZD1694, N-[5(N-(3,4-dihydro-2-methy1-4-oxoquinazolin-6-yl-
methyl)amino)2--
thieny1)]-L-glutamic acid; 2-NH2-ZD1694, 2-amino-ZD1694; BW1843U89, (S)-2[5-
(((1,2-
dihydro-3-methyl-1-oxobenzo(f)quinazolin-9-yl)methyl)amino- )-
1-oxo-2-isoindolinyl] -
glutaric acid; LY231514, N-(4-(2-(2-amino-4,7-dihydro-4-oxo-3H-pyrrolo [2,3 -
D] pyrimidin-
5-yl)ethyl)- benzoyll-L-glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-
dIAHQ, 2-
desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-
deazaaiso-
folic acid; N9-CH3-5-d(i)PteGlu, N9-methyl-5-deazaisofolic acid; N9-CH0-5-
d(i)PteGlu,
N9-formy1-5-deazaisofolic acid; AG337, 3,4-dihydro-2-amino-6-methly-4-oxo-5-(4-
pyridylthio) quanazoline; and AG377, 2,4-diamino-6[N-(4-(phenysulfonyl)benzyl)
ethyl)
amino[quinazoline; or a stereoisomer thereof.
[0081] In some embodiments, the Antifolate is a member selected from:
Aminopterin,
methotrexate, raltitrexed (also referred to as TOMUDEXO, ZD1694 (RTX)),
plevitrexed (also
referred to as BGC 9331; ZD9331), pemetrexed (also referred to as ALIMTA,
LY231514),
lometrexol (LMX) (5,10-dideazatetrahydrofolic acid), a
cyclopenta[g]quinazoline with a
dipeptide ligand, CB3717, CB300945 (also referred to as BGC945) or a
stereoisomer thereof
such as, 6-R,S-BGC 945 (ONX-0801), CB300638 (also referred to as BGC638), and
BW1843U89.
[0082] The terms "polyglutamated-Antifolate", "polyglutamated-ANTIFOL",
"ANTIFOL-
PG", "PANTIFOL" and iterations thereof, are used interchangeably herein to
refer to a
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 58 -
Antifolate composition that comprises at least one glutamyl group in addition
to the glutamyl
group in the Antifolate (i.e., ANTIFOL-PGn, wherein n > 1). Reference to the
number of
glutamyl groups in a yPANTIFOL (ANTIFOL-PG) herein takes into account the
glutamyl
group in the Antifolate. For example, a ANTIFOL-PG composition containing 5
glutamyl
residues in addition to the glutamyl group of ANTIFOL is referred to herein as
hexaglutamated
Antifolate or Antifolate hexaglutamate. Polyglutamate chains comprise an N-
terminal
glutamyl group and one or more C-terminal glutamyl groups. The N-terminal
glutamyl group
of a polyglutamate chain is not linked to another glutamyl group via its amine
group, but is
linked to one or more glutamyl group via its carboxylic acid group. In some
embodiments, the
N-terminal glutamyl group of a polyglutamated-Antifolate is the glutamyl group
of Antifolate.
The C-terminal glutamyl group or groups of a polyglutamate chain are linked to
another
glutamyl group via their amine group, but are not linked to another glutamyl
group via their
carboxylic acid group.
[0083] The terms "alpha glutamyl group", "alpha glutamate", "alpha
linkage", and iterations
thereof, as they relate to the linkage of a glutamyl group, refers to a
glutamyl group that
contains an alpha carboxyl group linkage. In some embodiments, none of the
glutamyl groups
of the provided polyglutamated Antifolates contain an alpha linkage.
[0084] The terms "gamma glutamyl group", "gamma glutamate", and "gamma
linkage", as
they relate to the linkage of a glutamyl group, refers to a glutamyl group
that contains a gamma
carboxyl group linkage. In some embodiments, the gamma linkage is an amide
bond between
the gamma carboxyl group of one glutamyl group and a second glutamyl group.
The gamma
linkage can be between a glutamyl group and the glutamyl group in the
Antifolate, or between
the glutamyl group and a second glutamyl group that is not present in
Antifolate, such as a
glutamyl group within a polyglutamate chain attached to Antifolate. In some
embodiments, the
gamma linkage refers to the amide bond of the glutamyl group of the
Antifolate. Reference to
gamma linkages are inclusive of gamma linkage of the glutamyl group of the
Antifolate unless
it is expressly stated or is unambiguously clear from the context that such is
not intended. In
some embodiments, the gamma glutamyl group is in the L-form. In some
embodiments, the
gamma glutamyl group is in the D-form. As discussed herein, during antifolate
therapy,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 59 -
antifolates enter the cell and are polyglutamated by the enzyme folylpoly-
gamma-glutamate
synthetase (FPGS), which adds L glutamyl groups serially to the gamma carboxyl
group of the
glutamate within the L-glutamyl group in the antifolate. Consequently, D-gamma
polyglutamated antifolate compositions are not formed within cells during
antifolate therapy.
[0085] The terms "gamma polyglutamated Antifolate", "y-polyglutamated
Antifolate",
"yPANTIFOL", "gamma polyglutamated-Antifolate", "polyglutamated-ANTIFOL",
"yANTIFOL-PG", and iterations thereof, are used interchangeably herein to
refer to a
Antifolate composition that comprises at least one gamma glutamyl group having
a gamma
carboxyl group linkage in addition to the gamma glutamyl group in the
Antifolate (e.g.,
ANTIFOL-PGn, wherein n > 1 y glutamyl group). Reference to the number of
glutamyl groups
in a yPANTIFOL (yANTIFOL-PG) herein takes into account the y-glutamyl group in
the
Antifolate. For example, a yANTIFOL-PG composition containing 5 y-glutamyl
groups in
addition to the glutamyl group in the Antifolate may be referred to herein as
gamma
hexaglutamated Antifolate or gamma Antifolate hexaglutamate.
[0086] The terms "alpha glutamyl group", "a-glutamyl group", and "alpha
linkage", as they
relate to the linkage of a glutamyl group, refers to a glutamyl group that
contains an alpha
carboxyl group linkage.
[0087] As use herein, the term "isolated" refers to a composition which is
in a form not found
in nature. Isolated gamma polyglutamated compositions include those which have
been
purified to a degree that they are no longer in a form in which they are found
in nature. In some
embodiments, a gamma polyglutamated Antifolate which is isolated is
substantially pure.
Isolated compositions will be free or substantially free of material with
which they are naturally
associated such as other cellular components such as proteins and nucleic
acids with which
they may potentially be found in nature, or the environment in which they are
prepared (e.g.,
cell culture). The gamma polyglutamated compositions may be formulated with
diluents or
adjuvants and still for practical purposes be isolated - for example, the
gamma polyglutamated
compositions will normally be mixed with pharmaceutically acceptable carriers
or diluents
when used in diagnosis or therapy. In some embodiments, the isolated gamma
polyglutamated
compositions (e.g., gamma polyglutamates and delivery vehicles such as
liposomes containing
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 60 -
the gamma polyglutamate contain less than 1% or less than 0.1% undesired DNA
or protein
content. In some embodiments, the gamma polyglutamate compositions (e.g.,
gamma
polyglutamate and delivery vehicles such as liposomes containing the gamma
polyglutamate)
are "isolated."
[0088] The term "targeting moiety" is used herein to refer to a molecule
that provides an
enhanced affinity for a selected target, e.g., a cell, cell type, tissue,
organ, region of the body,
or a compartment, e.g., a cellular, tissue or organ compartment. The targeting
moiety can
comprise a wide variety of entities. Targeting moieties can include naturally
occurring
molecules, or recombinant or synthetic molecules. In some embodiments, the
targeting moiety
is an antibody, antigen-binding antibody fragment, bispecific antibody or
other antibody-based
molecule or compound. In some embodiments, the targeting moiety is an aptamer,
avimer, a
receptor-binding ligand, a nucleic acid, a biotin-avidin binding pair, a
peptide, protein,
carbohydrate, lipid, vitamin, toxin, a component of a microorganism, a
hormone, a receptor
ligand or any derivative thereof. Other targeting moieties are known in the
art and are
encompassed by the disclosure.
[0089] The terms "specific affinity" or "specifically binds" mean that a
targeting moiety such
as an antibody or antigen binding antibody fragment, reacts or associates more
frequently,
more rapidly, with greater duration, with greater affinity, or with some
combination of the
above to the epitope, protein, or target molecule than with alternative
substances, including
proteins unrelated to the target epitope. Because of the sequence identity
between homologous
proteins in different species, specific affinity can, in several embodiments,
include a binding
agent that recognizes a protein or target in more than one species. Likewise,
because of
homology within certain regions of polypeptide sequences of different
proteins, the term
"specific affinity" or "specifically binds" can include a binding agent that
recognizes more
than one protein or target. It is understood that, in certain embodiments, a
targeting moiety that
specifically binds a first target may or may not specifically bind a second
target. As such,
"specific affinity" does not necessarily require (although it can include)
exclusive binding, e.g.,
binding to a single target. Thus, a targeting moiety may, in certain
embodiments, specifically
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 61 -
bind more than one target. In certain embodiments, multiple targets may be
bound by the same
targeting moiety.
[0090] The term "epitope" refers to that portion of an antigen capable of
being recognized
and specifically bound by a targeting moiety (i.e., binding moiety) such as an
antibody. When
the antigen is a polypeptide, epitopes can be formed both from contiguous
amino acids and
noncontiguous amino acids juxtaposed by tertiary folding of a protein.
Epitopes formed from
contiguous amino acids are typically retained upon protein denaturing, whereas
epitopes
formed by tertiary folding are typically lost upon protein denaturing. An
epitope typically
includes at least 3, and more usually, at least 5 or 8-10 amino acids in a
unique spatial
conformation.
[0091] Expressions like "binding affinity for a target", "binding to a
target" and analogous
expressions known in the art refer to a property of a targeting moiety which
may be directly
measured through the determination of the affinity constants, e.g., the amount
of targeting
moiety that associates and dissociates at a given antigen concentration.
Different methods can
be used to characterize the molecular interaction, such as, but not limited
to, competition
analysis, equilibrium analysis and microcalorimetric analysis, and real-time
interaction
analysis based on surface plasmon resonance interaction (for example using a
BIACORE
instrument). These methods are well-known to the skilled person and are
described, for
example, in Neri et al., Tibtech 14:465-470 (1996), and Jansson et al., J.
Biol. Chem. 272:8189-
8197 (1997).
[0092] The term "delivery vehicle" refers generally to any compositions
that acts to assist,
promote or facilitate entry of gamma polyglutamated Antifolate into a cell.
Such delivery
vehicles are known in the art and include, but are not limited to, liposomes,
lipospheres,
polymers (e.g., polymer-conjugates), peptides, proteins such as antibodies
(e.g.,
immunoconjugates, such as Antibody Drug Conjugates (ADCs) and antigen binding
antibody
fragments and derivatives thereof), cellular components, cyclic
oligosaccharides (e.g.,
cyclodextrins), micelles, microparticles (e.g., microspheres), nanoparticles
(e.g., lipid
nanoparticles, biodegradable nanoparticles, and core-shell nanoparticles),
hydrogels,
lipoprotein particles, viral sequences, viral material, or lipid or liposome
formulations, and
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 62 -
combinations thereof. The delivery vehicle can be linked directly or
indirectly to a targeting
moiety. In some examples, the targeting moiety is selected from among a
macromolecule, a
protein, a peptide, a monoclonal antibody or a fatty acid lipid.
[0093] A "subject" refers to a human or vertebrate mammal including but not
limited to a
dog, cat, horse, goat and primate, e.g., monkey. Thus, the invention can also
be used to treat
diseases or conditions in non-human subjects. For instance, cancer is one of
the leading causes
of death in companion animals (e.g., cats and dogs). In some embodiments, of
the invention,
the subject is a human. In this disclosure, the term "subject" and "patient"
is used
interchangeably and has the same meaning. It is preferred generally that a
maximum dose be
used, that is, the highest safe dose according to sound medical judgment.
[0094] As used herein an "effective amount" refers to a dosage of an agent
sufficient to
provide a medically desirable result. The effective amount will vary with the
desired outcome,
the particular condition being treated or prevented, the age and physical
condition of the subject
being treated, the severity of the condition, the duration of the treatment,
the nature of the
concurrent or combination therapy (if any), the specific route of
administration and like factors
within the knowledge and expertise of the health practitioner. An "effective
amount" can be
determined empirically and in a routine manner, in relation to the stated
purpose. In the case
of cancer, the effective amount of an agent may reduce the number of cancer
cells; reduce the
tumor size; inhibit (i.e., slow to some extent and preferably stop) cancer
cell infiltration into
peripheral organs; inhibit (i.e., slow to some extent and preferably stop)
tumor metastasis;
inhibit, to some extent, tumor growth; and/or relieve to some extent one or
more of the
symptoms associated with the disorder. To the extent the drug may prevent
growth and/or kill
existing cancer cells, it may be cytostatic and/or cytotoxic. For cancer
therapy, efficacy in vivo
can, for example, be measured by assessing the duration of survival, duration
of progression
free survival (PFS), the response rates (RR), duration of response, and/or
quality of life.
[0095] The terms "hyperproliferative disorder", "proliferative disease",
and "proliferative
disorder", are used interchangeably herein to pertain to an unwanted or
uncontrolled cellular
proliferation of excessive or abnormal cells which is undesired, such as,
neoplastic or
hyperplastic growth, whether in vitro or in vivo. In some embodiments, the
proliferative disease
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 63 -
is cancer or tumor disease (including benign or cancerous) and/or any
metastases, wherever
the cancer, tumor and/or the metastasis is located. In some embodiments, the
proliferative
disease is a benign or malignant tumor. In some embodiments, the proliferative
disease is a
non-cancerous disease. In some embodiments, the proliferative disease is a
hyperproliferative
condition such as hyperplasias, fibrosis (especially pulmonary, but also other
types of fibrosis,
such as renal fibrosis), angiogenesis, psoriasis, atherosclerosis and smooth
muscle proliferation
in the blood vessels, such as stenosis or restenosis following angioplasty.
[0096] "Cancer," "tumor," or "malignancy" are used as synonymous terms and
refer to any
of a number of diseases that are characterized by uncontrolled, abnormal
proliferation of cells,
the ability of affected cells to spread locally or through the bloodstream and
lymphatic system
to other parts of the body (metastasize) as well as any of a number of
characteristic structural
and/or molecular features. "Tumor," as used herein refers to all neoplastic
cell growth and
proliferation, whether malignant or benign, and all pre-cancerous and
cancerous cells and
tissues. A "cancerous tumor", or "malignant cell" is understood as a cell
having specific
structural properties, lacking differentiation and being capable of invasion
and metastasis. A
cancer that can be treated using a yPANTIFOL composition provided herein
includes without
limitation, a non-hematologic malignancy including such as for example, lung
cancer,
pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head and
neck cancer, gastric
cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer,
cervical cancer, liver
cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder
cancer, sarcoma (e.g.,
osteosarcoma), brain cancer, central nervous system cancer, and melanoma; and
a hematologic
malignancy such as for example, a leukemia, a lymphoma, and other B cell
malignancies,
myeloma and other plasma cell dysplasias or dyscrasias. In some embodiments,
the cancer is
selected from: breast cancer, advanced head and neck cancer, lung cancer,
stomach cancer,
osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia
(ALL),
mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma,
nonleukemic meningeal cancer, soft tissue sarcoma (desmoid tumors, aggressive
fibromatosis), bladder cancer, and central nervous system (CNS) cancer. Other
types of cancer
and tumors that may be treated using a yPANTIFOL composition are described
herein or
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 64 -
otherwise known in the art. The term "metastasis" refers to spread or
dissemination of a tumor,
cancer or neoplasia to other sites, locations, regions or organ or tissue
systems within the
subject, in which the sites, locations regions or organ or tissue systems are
distinct from the
primary tumor, cancer or neoplasia. The terms "cancer," "cancerous," "cell
proliferative
disorder," "proliferative disorder," and "tumor" are not mutually exclusive as
referred to
herein.
[0097] Terms such as "treating," or "treatment," or "to treat" refer to
both (a) therapeutic
measures that cure, slow down, lessen symptoms of, and/or halt progression of
a diagnosed
pathologic condition or disorder and (b) prophylactic or preventative measures
that prevent
and/or slow the development of a targeted disease or condition. Thus, subjects
in need of
treatment include those already with the cancer, disorder or disease; those at
risk of having the
cancer or condition; and those in whom the infection or condition is to be
prevented. Subjects
are identified as "having or at risk of having" cancer, an infectious disease,
a disorder of the
immune system, a hyperproliferative disease, or another disease or disorder
referred to herein
using well-known medical and diagnostic techniques. In certain embodiments, a
subject is
successfully "treated" according to the methods provided herein if the subject
shows, e.g., total,
partial, or transient amelioration or elimination of a symptom associated with
the disease or
condition (e.g., cancer, inflammation, and rheumatoid arthritis). In specific
embodiments, the
terms treating," or "treatment," or "to treat" refer to the amelioration of at
least one measurable
physical parameter of a proliferative disorder, such as growth of a tumor, not
necessarily
discernible by the patient. In other embodiments, the terms treating," or
"treatment," or "to
treat" refer to the inhibition of the progression of a proliferative disorder,
either physically by,
e.g., stabilization of a discernible symptom, physiologically by, e.g.,
stabilization of a physical
parameter, or both. In other embodiments, the terms treating," or "treatment,"
or "to treat" refer
to the reduction or stabilization of tumor size, tumor cell proliferation or
survival, or cancerous
cell count. Treatment can be with a y-PANTIFOL composition, alone or in
combination with
an additional therapeutic agent.
[0098] "Subject" and "patient," and "animal" are used interchangeably and
refer to mammals
such as human patients and non-human primates, as well as experimental animals
such as
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 65 -
rabbits, rats, and mice, and other animals. Animals include all vertebrates,
e.g., mammals and
non-mammals, such as chickens, amphibians, and reptiles. "Mammal" as used
herein refers to
any member of the class Mammalia, including, without limitation, humans and
nonhuman
primates such as chimpanzees and other apes and monkey species; farm animals
such as cattle,
sheep, pigs, goats and horses; domestic mammals such as dogs and cats;
laboratory animals
including rodents such as mice, rats and guinea pigs, and other members of the
class Mammalia
known in the art. In a particular embodiment, the patient is a human.
[0099] "Treatment of a proliferative disorder" is used herein to include
maintaining or
decreasing tumor size, inducing tumor regression (either partial or complete),
inhibiting tumor
growth, and/or increasing the life span of a subject having the proliferative
disorder. In one
embodiment, the proliferative disorder is a solid tumor. Such tumors include,
for example, lung
cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer,
head and neck cancer,
gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer,
cervical cancer,
liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder
cancer, sarcoma
(e.g., osteosarcoma), brain cancer, central nervous system cancer, and
melanoma. In one
embodiment, the proliferative disorder is a hematologic malignancy. Such
hematologic
malignancies include for example, a leukemia, a lymphoma and other B cell
malignancies,
myeloma and other plasma cell dysplasias or dyscrasias.
[00100] The term "autoimmune disease" as used herein is defined as a
disorder that results
from an autoimmune response. An autoimmune disease is the result of an
inappropriate and
excessive response to a self-antigen. Examples of autoimmune diseases include
but are not
limited to, Addison' s disease, alopecia areata, ankylosing spondylitis,
autoimmune hepatitis,
autoimmune parotitis, Crohn's disease, diabetes (Type I), dystrophic
epidermolysis bullosa,
epididymitis, glomerulonephritis, Graves disease, Guillain-Barr syndrome,
Hashimoto's
disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis,
myasthenia
gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis,
sarcoidosis,
scleroderma, Sjogren's syndrome, spondyloarthropathies, thyroiditis,
vasculitis, vitiligo,
myxedema, pernicious anemia, ulcerative colitis, among others.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 66 -
[00101] The terms "inflammation" and "inflammatory disease" are used
interchangeably and
refer to a disease or disorder characterized or caused by inflammation.
"Inflammation" refers
to a local response to cellular injury that is marked by capillary dilatation,
leukocytic
infiltration, redness, heat, and pain that serves as a mechanism initiating
the elimination of
noxious agents and of damaged tissue. The site of inflammation includes the
lungs, the pleura,
a tendon, a lymph node or gland, the uvula, the vagina, the brain, the spinal
cord, nasal and
pharyngeal mucous membranes, a muscle, the skin, bone or bony tissue, a joint,
the urinary
bladder, the retina, the cervix of the uterus, the canthus, the intestinal
tract, the vertebrae, the
rectum, the anus, a bursa, a follicle, and the like. Such inflammatory
diseases include, but are
not limited to, inflammatory bowel disease, rheumatoid diseases (e.g.,
rheumatoid arthritis),
other arthritic diseases (e.g., acute arthritis, acute gouty arthritis,
bacterial arthritis, chronic
inflammatory arthritis, degenerative arthritis (osteoarthritis), infectious
arthritis, juvenile
arthritis, mycotic arthritis, neuropathic arthritis, polyarthritis,
proliferative arthritis, psoriatic
arthritis, venereal arthritis, viral arthritis), fibrositis, pelvic
inflammatory disease, acne,
psoriasis, actinomycosis, dysentery, biliary cirrhosis, Lyme disease, heat
rash, Stevens-
Johnson syndrome, mumps, pemphigus vulgaris, and blastomycosis. Inflammatory
bowel
diseases are chronic inflammatory diseases of the gastrointestinal tract which
include, without
limitation, Crohn's disease, ulcerative colitis, and indeterminate colitis.
Rheumatoid arthritis is
a chronic inflammatory disease primarily of the joints, usually polyarticular,
marked by
inflammatory changes in the synovial membranes and articular structures and by
muscle
atrophy and rarefaction of the bones.
[00102] The term "therapeutic agent" is used herein to refer to an agent or
a derivative or
prodrug thereof, that can interact with a hyperproliferative cell such as a
cancer cell or an
immune cell, thereby reducing the proliferative status of the cell and/or
killing the cell.
Examples of therapeutic agents include, but are not limited to,
chemotherapeutic agents,
cytotoxic agents, platinum-based agents (e.g., cisplatin, carboplatin,
oxaliplatin), taxanes (e.g.,
TAXOLC)), etoposide, alkylating agents (e.g., cyclophosphamide, ifosamide),
metabolic
antagonists (e.g., an Antifolate (ANTIFOL), 5- fluorouracil gemcitabine, or
derivatives
thereof), antitumor antibiotics (e.g., mitomycin, doxorubicin), plant-derived
antitumor agents
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 67 -
(e.g., vincristine, vindesine, Taxol). Such agents may further include, but
are not limited to,
the anticancer agents trimetrexate, temozolomide, raltitrexed, S-(4-
Nitrobenzy1)-6-thioinosine
(NBMPR), 6-benzyguanidine (6-B G), bi s-
chloronitro so urea -- (BCNU) -- and
CAMPTOTHEC1NTm, or a therapeutic derivative of any thereof. Additional
examples of
therapeutic agents that may be suitable for use in accordance with the
disclosed methods
include, without limitation, anti-restenosis, pro- or anti-proliferative, anti-
inflammatory, anti-
neoplastic, antimitotic, anti-platelet, anticoagulant, antifibrin,
antithrombin, cytostatic,
antibiotic and other anti-infective agents , anti-enzymatic, anti-metabolic,
angiogenic,
cytoprotective, angiotensin converting enzyme (ACE) inhibiting, angiotensin II
receptor
antagonizing and/or cardioprotective agents. "Therapeutic agents" also refer
to salts, acids, and
free based forms of the above agents.
[00103] As
used herein, the term "chemotherapeutic agent" when used in relation to cancer
therapy, refers to any agent that results in the death of cancer cells or
inhibits the growth or
spread of cancer cells. Examples of such chemotherapeutic agents include
alkylating agents,
antibiotics, antimetabolitic agents, plant-derived agents, and hormones. In
some embodiments,
the chemotherapeutic agent is cisplatin. In some embodiments, the
chemotherapeutic agent is
carboplatin. In some embodiments, the chemotherapeutic agent is oxaliplatin.
In other
embodiments, the chemotherapeutic agent is gemcitabine. In other embodiments,
the
chemotherapeutic agent is doxorubicin.
[00104]
The term "antimetabolite" is used herein to refer to an antineoplastic drug
that inhibits
the utilization of a metabolite or a prodrug thereof. Examples of
antimetabolites include
Antifolate, pemetrexed, 5-fluorouracil, 5-fluorouracil prodrugs such as
capecitabine, 5-
fluorodeoxyuridine monophosphate, cytarabine, cytarabine prodrugs such as
nelarabine, 5-
azacytidine, gemcitabine, mercaptopurine, thioguanine, azathioprine,
adenosine, pentostatin,
erythrohydroxynonyladenine, and cladribine. Anti-metabolites useful for
practicing the
disclosed methods include nucleoside analogs, including a purine or pyrimidine
analogs. In
some embodiments, the gamma polyglutamated Antifolate compositions are used in
combination with an antimetabolite selection from fluoropyrimidine 5-
fluorouracil, 5-fluoro-
2'-deoxycytidine, cytarabine, gemcitabine, troxacitabine, decitabine,
Azacytidine,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 68 -
pseudoisocytidine, Zebularine, Ancitabine, Fazarabine, 6- azacytidine,
capecitabine, N4-
octadecyl-cytarabine, elaidic acid cytarabine, fludarabine, cladribine,
clofarabine, nelarabine,
forodesine, and pentostatin, or a derivative thereof. In one example, the
nucleoside analog is a
substrate for a nucleoside deaminase that is adenosine deaminase or cytidine
deaminase. In
some examples, the nucleoside analog is selected from among fludarabine,
cytarabine,
gemcitabine, decitabine and azacytidine or derivatives thereof. In certain
embodiments, the
antimetabolite is 5-fluorouracil.
[00105] As used herein, a "taxane" is an anti-cancer agent that interferes
with or disrupts
microtubule stability, formation and/or function. Taxane agents include
paclitaxel and
docetaxel as well as derivatives thereof, wherein the derivatives function
against microtubules
by the same mode of action as the taxane from which they are derived. In
certain embodiments,
the taxane is paclitaxel or docetaxel, or a pharmaceutically acceptable salt,
acid, or derivative
of paclitaxel or docetaxel. In certain embodiments, the taxane is paclitaxel
(TAXOLO),
docetaxel (TAXOTEREC,), albumin-bound paclitaxel (nab-paclitaxel; ABRAXANEO),
DHA-paclitaxel, or PG-paclitaxel.
[00106] The term "pharmaceutically-acceptable carrier" A "pharmaceutically
acceptable
carrier" refers to an ingredient in a pharmaceutical formulation, other than
an active ingredient,
which is nontoxic to a subject., A pharmaceutically acceptable carrier
includes, but is not
limited to, a buffer, excipient, stabilizer, or preservative. Pharmaceutically-
acceptable carriers
can include for example, one or more compatible solid or liquid filler,
diluents or encapsulating
substances which are suitable for administration to a human or other subject.
[00107] This disclosure generally relates gamma polyglutamated Antifolate
(yANTIFOL)
compositions and methods of making and using the compositions to treat
diseases including
hyperproliferative diseases such as cancer, disorders of the immune system
such as rheumatoid
arthritis, and infectious diseases such as HIV, malaria, and schistomiasis.
[00108] In some embodiments, the disclosure provides:
[1] a composition comprising a gamma polyglutamated Antifolate;
[2] the composition of [1], wherein the Antifolate is selected from:
piritrexim,
pralatrexate, AG2034, GW1843, and LY309887, and , or a stereoisomer thereof;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 69 -
[3] the composition of [1], wherein the Antifolate is selected from: PMX,
MTX, RTX,
and LTX, or a stereoisomer thereof;
[4] the composition according to any of [1]-[3], wherein the Antifolate is
selected from:
LV (etoposide), L-leucovorin (L-5-formyltetrahydrofolate); 5-CH3-THF, 5-
methyltetrahydrofolate; FA, folic acid; PteGlu, pteroyl glutamate (FA); MTX,
methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX, 2-desamino-2-methyl-
MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-desamino-
2-methyl-AMT; 10-EdAM, 10-ethyl-10-deazaaminopterin; PT523, N alpha -(4-
amino-4-deoxypteroy1)-N delta-(hemiphthaloyl) -L-ornithine; DDATHF
(lometrexol), 5,10-dideaza-5,6,7,8,-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-
deaza-
5,6,7,8-tetrahydroisofolic acid; N9-CH3-5-d(i)H4PteGlu, N9-methy1-5-deaza-
5,6,7,8-tetrahydroisofolic acid; 5-dPteHCysA, N alpha-(5-deazapteroy1)-L-
homocysteic acid; 5-dPteAPBA, N alpha-(5-deazapteroy1)-DL-2-amino-4-
phosphonobutanoic acid; 5-dPteOrn, N alpha-(5-deazapteroy1)-L-ornithine; 5-
dH4PteHCysA, N alpha -(5-deaza-5,6,7,8-tetrahydropteroy1)-L-homocysteic acid;
5-
dH4PteAPBA, N alpha-(5-deaza-5,6,7,8-tetrahydropteroy1)-DL-2-amino-4-
phosphobutanoic acid; 5-dH4PteOro, N alpha -(5-deaza-5,6,7,8-
tetrahydropteroy1)-
L-ornithine; CB 3717, N10-propargy1-5,8-dideazafolic acid; ICI-198,583, 2-
desamino-2-methyl-N10-propargy1-5,8-dideazafolic acid; 4-H-ICI-198,583, 4-
deoxy-ICI-198,583: 4-0CH3-ICI-198,583, 4-methoxy-ICI-198,583 Glu-to-Val-ICI-
198,583; valine-ICI-198;583; Glu-to-Sub-ICI-198,583, 2-amino-suberate-ICI-
198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-198,583; ZD1694, N45(N-(3,4-dihydro-
2-methy1-4-oxoquinazolin-6-yl-methyDamino)2-- thienylfl-L-glutamic acid; 2-NH2-
ZD1694, 2-amino-ZD1694; BW1843U89, (S)-2[5-(((1,2-dihydro-3-methyl-1-
oxobenzo(f) quinazolin-9-yl)methyl)amino- )-1-oxo-2-isoindoliny1]-glutaric
acid;
LY231514, N-(4-(2-(2-amino-4,7-dihydro-4-oxo-3H-pyrrolo[2,3-D]pyrimidin-5-
ypethyl)- benzoy1]-L-glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-
desamino-IAHQ; 2-CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-
deazaaisofolic acid; N9-CH3-5-d(i)PteGlu, N9-methyl-5-deazaisofolic acid; N9-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 70 -
CH0-5-d(i)PteGlu, N9-formy1-5-deazaisofolic acid; AG337, 3,4-dihydro-2-amino-
6-methly-4-oxo-5-(4-pyridylthio) quanazoline; and 2,4-diamino-6[N-(4-
(phenysulfonyl)benzyl)ethyl)amino] quinazoline; or a stereoisomer thereof;
[5] the composition of [1], wherein the Antifolate is selected from:
methotrexate,
raltitrexed, plevitrexed, pemetrexed, lometrexol (LMX; 5,10-
dideazatetrahydrofolic
acid), a cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945,
or a
stereoisomer thereof, such as 6-R,S-BGC 945 (ONX-0801), CB300638, and
BW1843U89;
[6] the composition according to any of [1]-[5], wherein the gamma
polyglutamated
Antifolate contains 4, 5 2-10, 4-6, or more than 5, glutamyl groups;
[7] the composition according to any of [1]-[6], wherein the gamma
polyglutamated
Antifolate:
(a) is gamma tetraglutamated Antifolate;
(b) is gamma pentaglutamated Antifolate; or
(c) is gamma hexaglutamated Antifolate;
[8] the composition according to any of [1]-[7], wherein the gamma
polyglutamated
Antifolate comprises 1-10 glutamyl groups having a gamma carboxyl group
linkage;
[9] the composition according to any of [1]-[8], wherein:
(a) at least 2 of the glutamyl groups of the gamma polyglutamated Antifolate
are in the
L-form,
(b) each of the glutamyl groups of the gamma polyglutamated Antifolate is in
the L-form,
(c) at least 1 of the glutamyl groups of the gamma polyglutamated Antifolate
is in the D-
form,
(d) each of the glutamyl groups of the gamma polyglutamated Antifolate other
than the
glutamyl group of the Antifolate is in the D-form, or
(e) at least 2 of the glutamyl groups of the gamma polyglutamated Antifolate
are in the
L-form and at least 1 of the glutamyl groups is in the D-form;
[10] the composition according to any of [1]-[9], wherein the polyglutamate is
linear;
[11] the composition according to any of [1]-[9], wherein the polyglutamate is
branched;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
-71 -
[12] a liposomal composition comprising the gamma polyglutamated Antifolate
according to any of [1]-[11] (Lp-yPANTIFOL);
[13] the Lp-7PANTIFOL composition of [12], wherein the polyglutamated
Antifolate is
selected from:
(a) AG2034, piritrexim, pralatrexate, GW1843, Antifolate, and LY309887; or
(b) PMX, MTX, RTX, and LTX, or a stereoisomer thereof;
[14] the Lp-yPANTIFOL composition of [12] or [13], wherein the polyglutamated
Antifolate is selected from: LV (etoposide), L-leucovorin (L-5-
formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic acid;
PteGlu, pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX;
2-CH3-MTX, 2-desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-
desamino-AMT; 2-CH3-AMT, 2-desamino-2-methyl-AMT; 10-EdAM, 10-ethy1-10-
deazaaminopterin; PT523, N alpha -(4-amino-4-deoxypteroy1)-N delta-
(hemiphthaloy1)-L-ornithine; DDATHF (lometrexol), 5,10-dideaza-5,6,7,8,-
tetrahydrofolic acid; 5-d(i)H4PteG1u, 5-deaza-5,6,7,8-tetrahydroisofolic acid;
N9-
CH3-5-d(i)H4PteG1u, N9-methyl-5-deaza-5,6,7,8-tetrahydroisofolic acid; 5-
dPteHCysA, N alpha -(5-deazapteroy1)-L-homocysteic acid; 5-dPteAPBA, N alpha -
(5-deazapteroy1)-DL-2-amino-4-phosphonobutanoic acid; 5-dPteOrn, N alpha -(5-
deazapteroy1)-L-ornithine; 5-dH4PteHCysA, N alpha -(5-deaza-5,6,7,8-
tetrahydropteroy1)-L-homocysteic acid; 5-dH4PteAPBA, N alpha -(5-deaza-5,6,7,8-
tetrahydropteroy1)-DL-2-amino-4-phosphobutanoic acid; 5-dH4PteOro, N alpha -(5-
deaza-5,6,7,8-tetrahydropteroy1)-L-ornithine; CB 3717, N10-propargy1-5,8-
dideazafolic acid; ICI-198,583, 2-desamino-2-methyl-N10-propargy1-5,8-
dideazafolic acid; 4-H-ICI-198,583, 4-deoxy-ICI-198,583: 4-0CH3-ICI-198,583, 4-
methoxy-ICI-198,583 Glu-to-Val-ICI-198,583; valine-ICI-198;583; Glu-to-Sub-ICI-
198,583, 2-amino-suberate-ICI-198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-
198,583; ZD1694, N-[5(N-(3,4-dihydro-2-methy1-4-oxoquinazolin-6-yl-
methyl)amino)2-- thieny1A-L-glutamic acid; 2-NH2-ZD1694, 2-amino-ZD1694;
BW1843U89, (S)-2[5-(41,2-dihydro-3-methyl-1-oxobenzo(f)quinazolin-9-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 72 -
yl)methyl)amino- )-1-oxo-2-isoindoliny11-glutaric acid; LY231514, N-(4-(2-(2-
amino-4,7-dihydro-4-oxo-3H-pyrrolo[2,3-D]pyrimidin-5-yl)ethyl)- benzoy11-L-
glutamic acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-
CH3-dIAHQ, 2-desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-deazaaisofolic acid; N9-
CH3-5-d(i)PteGlu, N9-methyl-5-deazaisofolic acid; N9-CH0-5-d(i)PteGlu, N9-
formy1-5-deazaisofolic acid; AG337, 3,4-dihydro-2-amino-6-methly-4-oxo-5-(4-
pyridylthio) quanazoline; and AG377, 2,4-diamino-6[N-(4-(phenysulfonyl)
benzyl)ethyl)amino]quinazoline; or a stereoisomer thereof;
[15] the Lp-7PANTIFOL composition according to any of [121414], wherein the
Antifolate is selected from: methotrexate, raltitrexed, plevitrexed,
pemetrexed,
lometrexol (LMX; 5,10-dideazatetrahydrofolic acid), a cyclopenta[g]quinazoline
with a dipeptide ligand, CB3717, CB300945, or a stereoisomer thereof, such as
6-
R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89;
[16] the Lp-7PANTIFOL composition according to any of [121415], wherein the
liposome comprises a gamma polyglutamated Antifolate containing 4, 5, 2-10, 4-
6,
or more than 5, gamma glutamyl groups;
[17] the Lp-7PANTIFOL composition according to any of [121416], wherein the
liposome comprises a gamma tetraglutamated Antifolate;
[18] the Lp-7PANTIFOL composition according to any of [12]-[16], wherein the
liposome comprises a gamma pentaglutamated Antifolate;
[19] the Lp-7PANTIFOL composition according to any of [12]-[16], wherein the
liposome comprises a gamma hexaglutamated Antifolate;
[20] the Lp-7PANTIFOL composition according to any of [121419], wherein the
gamma
polyglutamated Antifolate comprises 1-10 glutamyl groups having a gamma
carboxyl group linkage;
[21] the Lp-7PANTIFOL composition according to any of [12]-[20], wherein:
(a) at least 2 of the glutamyl groups of the gamma polyglutamated Antifolate
are in the
L-form;
(b) each of the glutamyl groups of the gamma polyglutamated Antifolate is in
the L-form;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
-73 -
(c) at least 1 of the glutamyl groups of the gamma polyglutamated Antifolate
is in the D-
form;
(d) each of the glutamyl groups of the gamma polyglutamated Antifolate other
than the
glutamyl group of the Antifolate is in the D-form; or
(e) at least 2 of the glutamyl groups of the gamma polyglutamated Antifolate
are in the
L-form and at least 1 of the glutamyl groups is in the D-form;
[22] the Lp-7PANTIFOL composition according to any of [12]-[21], wherein
(a) at least 2 of the glutamyl groups of the gamma polyglutamated Antifolate
are in the
L-form;
(b) each of the glutamyl groups of the gamma polyglutamated Antifolate is in
the L-form;
(c) at least 1 of the glutamyl groups of the gamma polyglutamated Antifolate
is in the D-
form;
(d) each of the glutamyl groups of the gamma polyglutamated Antifolate other
than the
glutamyl group of the Antifolate is in the D-form; or
(e) at least 2 of the glutamyl groups of the gamma polyglutamated Antifolate
are in the
L-form and at least 1 of the glutamyl groups is in the D-form;
[23] the Lp-7PANTIFOL composition according to any of [121422], wherein the
liposome is pegylated (PLp-7PANTIFOL);
[24] the Lp-7PANTIFOL composition according to any of [12]422], wherein the
liposome is not pegylated;
[25] the Lp-7PANTIFOL composition according to any of [121424], wherein the
liposome has a diameter in the range of 20 nm to 200 nm;
[26] the Lp-7PANTIFOL composition according to any of [121425], wherein the
liposome has a diameter in the range of 80 nm to 120 nm;
[27] the Lp-7PANTIFOL composition according to any of [12]426], wherein the
liposome is formed from liposomal components;
[28] the Lp-7PANTIFOL composition according to [27], wherein the liposomal
components comprise at least one of an anionic lipid and a neutral lipid;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 74 -
[29] the Lp-7PANTIFOL composition according to [27] or [28], wherein the
liposomal
components comprise at least one selected from: DSPE; DSPE-PEG; DSPE-PEG-
maleimide; HSPC; HSPC-PEG; cholesterol; cholesterol-PEG; and cholesterol-
maleimide;
[30] the Lp-7PANTIFOL composition according to any of [27]-[29], wherein the
liposomal components comprise at least one selected from: DSPE; DSPE-PEG;
DSPE-PEG-FITC; DSPE-PEG-maleimide; cholesterol; and HSPC;
[31] the Lp-7PANTIFOL composition according to any of [27]-[30], wherein one
or more
liposomal components further comprises a steric stabilizer;
[32] the Lp-7PANTIFOL composition according to [31], wherein the steric
stabilizer is at
least one selected from polyethylene glycol (PEG); poly-L-lysine (PLL);
monosialoganglioside (GM1); poly(vinyl pyrrolidone) (PVP); poly(acrylamide)
(PAA); poly(2-methyl-2-oxazoline); poly(2-ethyl-2-oxazoline); phosphatidyl
polyglycerol; poly[N-(2-hydroxypropyl) methacrylamide]; amphiphilic poly-N-
vinylpyrrolidones; L-amino-acid-based polymer; oligoglycerol, copolymer
containing polyethylene glycol and polypropylene oxide, Poloxamer 188, and
polyvinyl alcohol;
[33] the Lp-7PANTIFOL composition according to [32], wherein the steric
stabilizer is
PEG and the PEG has a number average molecular weight (Mn) of 200 to 5000
daltons;
[34] the Lp-7PANTIFOL composition according to any of [12]-[33], wherein the
liposome is anionic or neutral;
[35] the Lp-7PANTIFOL composition according to any of [12]-[33], wherein the
liposome has a zeta potential that is less than or equal to zero;
[36] the Lp-7PANTIFOL composition according to any of [12]-[33], wherein the
liposome has a zeta potential that is between 0 to -150 mV;
[37] the Lp-7PANTIFOL composition according to any of [12]-[33], wherein the
liposome has a zeta potential that is between -30 to -50 mV;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
-75 -
[38] the Lp-7PANTIFOL composition according to any of [12]-[33], wherein the
liposome is cationic;
[39] the Lp-7PANTIFOL composition according to any of [12]-[38], wherein the
liposome has an interior space comprising the gamma polyglutamated Antifolate
and
an aqueous pharmaceutically acceptable carrier;
[40] the Lp-7PANTIFOL composition of [39], wherein the pharmaceutically
acceptable
carrier comprises a tonicity agent such as dextrose, mannitol, glycerine,
potassium
chloride, sodium chloride, at a concentration of greater than 1%;
[41] the Lp-7PANTIFOL composition of [39], wherein the aqueous
pharmaceutically
acceptable carrier is trehalose;
[42] the Lp-7PANTIFOL composition of [41], wherein the pharmaceutically
acceptable
carrier comprises 1% to 50% trehalose;
[43] the Lp-7PANTIFOL composition according to any of [39] -[42], wherein the
pharmaceutically acceptable carrier comprises 1% to 50% dextrose solution;
[44] the Lp-7PANTIFOL composition according to any of [39] 443], wherein the
interior
space of the liposome comprises 5% dextrose suspended in an HEPES buffered
solution;
[45] the Lp-7PANTIFOL composition according to any of [39]-[44], wherein the
pharmaceutically acceptable carrier comprises a buffer such as HEPES Buffered
Saline (HBS) or similar, at a concentration of between 1 to 200 mM and a pH of
between 2 to 8;
[46] the Lp-7PANTIFOL composition according to any of [39]-[45], wherein the
pharmaceutically acceptable carrier comprises a total concentration of sodium
acetate and calcium acetate of between 50 mM to 500 mM;
[47] the Lp-7PANTIFOL composition according to any of [12]-[46], wherein the
interior
space of the liposome has a pH of 5-8 or a pH of 6-7, or any range therein
between;
[48] the Lp-7PANTIFOL composition according to any of [12]-[47], wherein the
liposome comprises less than 500,000 or less than 200,000 molecules of the
gamma
polyglutamated Antifolate;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 76 -
[49] the Lp-yPANTIFOL composition according to any of [12]-[48], wherein the
liposome comprises between 10 to 100,000 molecules of the gamma polyglutamated
Antifolate, or any range therein between;
[50] the Lp-7PANTIFOL composition according to any of [12]-[49], which further
comprises a targeting moiety and wherein the targeting moiety has a specific
affinity
for a surface antigen on a target cell of interest;
[51] the Lp-7PANTIFOL composition according to [50], wherein the targeting
moiety is
attached to one or both of a PEG and the exterior of the liposome, optionally
wherein
targeting moiety is attached to one or both of the PEG and the exterior of the
liposome by a covalent bond;
[52] the Lp-7PANTIFOL composition of [50] or [51], wherein the targeting
moiety is a
polypeptide;
[53] the Lp-7PANTIFOL composition according to any of [50]-[52], wherein the
targeting moiety is an antibody or an antigen binding fragment of an antibody;
[54] the Lp-7PANTIFOL composition according to any of [50]-[53], wherein the
targeting moiety binds the surface antigen with an equilibrium dissociation
constant
(Kd) in a range of 0.5 x 10-10 to 10 x 10-6 as determined using BIACORE
analysis;
[55] the Lp-7PANTIFOL composition according to any of [50]-[54], wherein the
targeting moiety specifically binds one or more folate receptors selected
from: folate
receptor alpha (FR-a), folate receptor beta (FR-13), and folate receptor delta
(FR-6);
[56] the Lp-7PANTIFOL composition according to any of [50]-[55], wherein the
targeting moiety comprises one or more selected from: an antibody, a humanized
antibody, an antigen binding fragment of an antibody, a single chain antibody,
a
single-domain antibody, a hi-specific antibody, a synthetic antibody, a
pegylated
antibody, and a multimeric antibody;
[57] the Lp-7PANTIFOL composition according to any of [50]-[56], wherein each
pegylated liposome comprises from 1 to 1000 or 30-200 targeting moieties;
[58] the Lp-7PANTIFOL composition according to any of [39]-[57], further
comprising
one or more of an immunostimulatory agent, a detectable marker and a
maleimide,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 77 -
wherein the immunostimulatory agent, the detectable marker or the maleimide is
attached to said PEG or the exterior of the liposome;
[59] the Lp-7PANTIFOL composition of [58], wherein the immunostimulating agent
is at
least one selected from: a protein immunostimulating agent; a nucleic acid
immunostimulating agent; a chemical immunostimulating agent; a hapten; and an
adjuvant;
[60] the Lp-7PANTIFOL composition of [58] or [59], wherein the
immunostimulating
agent is at least one selected from: a fluorescein; a fluorescein
isothiocyanate
(FITC); a DNP; a beta glucan; a beta-1,3-glucan; a beta-1,6-glucan; a resolvin
(e.g.,
a Resolvin D such as Dn-6DPA or Dn-3DPA, a Resolvin E, or a T series
resolvin);
and a Toll-like receptor (TLR) modulating agent such as, an oxidized low-
density
lipoprotein (e.g. OXPAC, PGPC), and an eritoran lipid (e.g., E5564);
[61] the Lp-7PANTIFOL composition according to any of [58]-[60], wherein the
immunostimulatory agent and the detectable marker is the same;
[62] the Lp-7PANTIFOL composition according to any of [58]-[61], further
comprising a
hapten;
[63] the Lp-7PANTIFOL composition of [62], wherein the hapten comprises one or
more
of fluorescein or Beta 1, 6-glucan;
[64] the Lp-7PANTIFOL composition according to any of [12]-[63], which further
comprises at least one cryoprotectant selected from mannitol; trehalose;
sorbitol;
and sucrose;
[65] a targeted composition comprising the composition according to any of [1]-
[64];
[66] a non-targeted composition comprising the composition according to any of
[1]-[49];
[67] the Lp-7PANTIFOL composition according to any of [12]-[66], which further
comprises carboplatin and/or pembroluzumab;
[68] a pharmaceutical composition comprising the liposomal gamma
polyglutamated
Antifolate composition according to any of [12]-[67];
[69] a pharmaceutical composition comprising gamma polyglutamated Antifolate
composition according to any of [1]-[7];
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 78 -
[70] the composition of any of [1]-[69], for use in the treatment of disease;
[71] Use of the composition of any of [1]-[70], in the manufacture of a
medicament for
the treatment of disease;
[72] a method for treating or preventing disease in a subject needing such
treatment or
prevention, the method comprising administering the composition of any of [1]-
[70]
to the subject;
[73] a method for treating or preventing disease in a subject needing such
treatment or
prevention, the method comprising administering the liposomal gamma
polyglutamated Antifolate composition of any of [12]-[69] to the subject;
[74] a method of killing a hyperproliferative cell that comprises contacting a
hyperproliferative cell with the composition of any of [1]-[69];
[75] a method of killing a hyperproliferative cell that comprises contacting a
hyperproliferative cell with the liposomal gamma polyglutamated Antifolate
composition of any of [121469];
[76] the method of [74] or [75], wherein the hyperproliferative cell is a
cancer cell, a
mammalian cell, and/or a human cell;
[77] a method for treating cancer that comprises administering an effective
amount of the
composition of any of [1]-[69] to a subject having or at risk of having
cancer;
[78] a method for treating cancer that comprises administering an effective
amount of the
liposomal gamma polyglutamated Antifolate composition of any of [121468] to a
subject having or at risk of having cancer;
[79] the method of [77] or [78], wherein the cancer is selected from: a non-
hematologic
malignancy including such as for example, lung cancer, pancreatic cancer,
breast
cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric cancer,
gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical
cancer, liver
cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder
cancer,
sarcoma (e.g., osteosarcoma), brain cancer, central nervous system cancer, and
melanoma; and a hematologic malignancy such as for example, a leukemia, a
lymphoma and other B cell malignancies, myeloma and other plasma cell
dyscrasias;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 79 -
[80] the method of [77] or [78], wherein the cancer is selected from: lung
cancer, breast
cancer, colon cancer, pancreatic cancer, gastric cancer, bladder cancer, head
and
neck cancer, ovarian cancer, and cervical cancer;
[81] the method of [77] or [78], wherein the cancer is selected from:
colorectal cancer,
lung cancer, breast cancer, head and neck cancer, and pancreatic cancer;
[82] the method of [77] or [78], wherein the cancer is selected from:
colorectal cancer,
breast cancer, ovarian cancer, lung cancer, head and neck cancer, pancreatic
cancer,
gastric cancer, and mesothelioma;
[83] a method for treating cancer that comprises administering an effective
amount of the
Lp-yPANTIFOL composition of any of [50]-[66] to a subject having or at risk of
having a cancer cell that expresses on its surface a folate receptor bound by
the
targeting moiety;
[84] a maintenance therapy for subjects that are undergoing or have undergone
cancer
therapy that comprise administering an effective amount of the composition of
any
of [1]-[69] to a subject that is undergoing or has undergone cancer therapy;
[85] a maintenance therapy for subjects that are undergoing or have undergone
cancer
therapy that comprise administering an effective amount of the liposomal gamma
polyglutamated Antifolate composition of any of [12]-[69] to a subject that is
undergoing or has undergone cancer therapy;
[86] a method for treating a disorder of the immune system that comprises
administering
an effective amount of the composition of any of [1]-[69] to a subject having
or at
risk of having a disorder of the immune system, optionally wherein the
disorder of
the immune system is selected from: inflammation (e.g., acute and chronic),
systemic inflammation, rheumatoid arthritis, inflammatory bowel disease (IBD),
Crohn disease, dermatomyositis/ polymyositis, systemic lupus erythematosus,
and
Takayasu, and psoriasis;
[87] a method for treating a disorder of the immune system that comprises
administering
an effective amount of the liposomal gamma polyglutamated Antifolate
composition
of any of [8]-[69] to a subject having or at risk of having a disorder of the
immune
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 80 -
system, optionally wherein the disorder of the immune system is selected from:
inflammation (e.g., acute and chronic), systemic inflammation, rheumatoid
arthritis,
inflammatory bowel disease (IBD), Crohn disease, dermatomyositis/
polymyositis,
systemic lupus erythematosus, and Takayasu, and psoriasis;
[88] a method for treating:
(a) an infectious disease that comprises administering an effective amount of
the
composition according to any of [1]-[69] to a subject having or at risk of
having an
infectious disease;
(b) an infectious disease, cardiovascular disease, metabolic disease, or
another disease,
that comprises administering an effective amount of the composition according
to of
any of any of [1]469] to a subject having or at risk of having an infectious
disease,
cardiovascular diease, or another disease, wherein the disease is a member
selected
from: atherosclerosis, cardiovascular disease (CVD), coronary artery disease,
myocardial infarction, stroke, metabolic syndrome, a gestational trophoblastic
disease,
and ectopic pregnancy;
(c) an autoimmune disease, that comprises administering an effective amount of
the
composition according to of any of any of [1]469] to a subject having or at
risk of
having an autoimmune disease;
(d) rheumatoid arthritis, that comprises administering an effective amount of
the
composition according to of any of any of [1]469] to a subject having or at
risk of
having rheumatoid arthritis;
(e) an inflammatory condition that comprises administering an effective amount
of the
composition according to of any of any of [1]469] to a subject having or at
risk of
having inflammation, optionally wherein the inflammation is acute, chronic,
and/or
systemic inflammation; or
(f) a skin condition that comprises administering an effective amount of
the composition
according to of any of claims any of [1]-[69] to a subject having or at risk
of having a
skin condition, optionally wherein the skin condition is psoriasis;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 81 -
[89] a method for treating an infectious disease that comprises administering
an effective
amount of the liposomal gamma polyglutamated Antifolate composition of any of
[12]-[69] to a subject having or at risk of having an infectious disease;
[90] a method of delivering gamma polyglutamated Antifolate to a tumor
expressing a
folate receptor on its surface, the method comprising: administering the Lp-
yPANTIFOL composition of any of [1]-[69] to a subject having the tumor in an
amount to deliver a therapeutically effective dose of the gamma polyglutamated
Antifolate to the tumor;
[91] a method of preparing a gamma polyglutamated Antifolate composition
comprising
the liposomal gamma polyglutamated Antifolate composition of any of [12]-[69],
the
method comprising: forming a mixture comprising: liposomal components and
gamma polyglutamated antifolate in solution; homogenizing the mixture to form
liposomes in the solution; and processing the mixture to form liposomes
containing
gamma polyglutamated Antifolate;
[92] a method of preparing a gamma polyglutamated Antifolate composition
comprising
the liposomal gamma polyglutamated Antifolate composition of any of [12]-[69],
the
method comprising: forming a mixture comprising: liposomal components and
gamma polyglutamated Antifolate in solution; and processing the mixture to
form
liposomes containing gamma polyglutamated Antifolate,
[93] the method of [92], wherein the processing the mixture comprises
homogenizing the
mixture to form liposomes in the solution,
[94] a method of preparing the composition of any of [501469] comprising the
steps of:
forming a mixture comprising: liposomal components and gamma polyglutamated
Antifolate in a solution; homogenizing the mixture to form liposomes in the
solution;
processing the mixture to form liposomes entrapping and/or encapsulating gamma
polyglutamated Antifolate; and providing a targeting moiety on a surface of
the
liposomes, the targeting moiety having specific affinity for at least one of
folate
receptor alpha (FR-a), folate receptor beta (FR-p) and folate receptor delta
(FR-6);
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 82 -
[95] a method of preparing the composition of any of [50]-[69], comprising the
steps of:
forming a mixture comprising: liposomal components and gamma polyglutamated
Antifolate in a solution; processing the mixture to form liposomes entrapping
and/or
encapsulating gamma polyglutamated Antifolate; and providing a targeting
moiety
on a surface of the liposomes, the targeting moiety having specific affinity
for at
least one of folate receptor alpha (FR-a), folate receptor beta (FR-(3) and
folate
receptor delta (FR-6);
[96] the method of [95], wherein the processing step comprises homogenizing
the
mixture to form liposomes in the solution,
[97] the method according to [92], wherein the processing step includes one or
more steps
of: thin film hydration, extrusion, in-line mixing, ethanol injection
technique,
freezing-and-thawing technique, reverse-phase evaporation, dynamic high
pressure
microfluidization, microfluidic mixing, double emulsion, freeze-dried double
emulsion, 3D printing, membrane contactor method, and stirring; and/or
[98] the method according to any of [95] to [97], wherein said processing
step includes
one or more steps of modifying the size of the liposomes by one or more of
steps of
extrusion, high-pressure microfluidization, and/or sonication; and/or
[99] the method of any of [91] to [98], wherein at least 1% of the starting
material of
gamma polyglutamated Antifolate is encapsulated or entrapped in the liposomes.
I. Gamma polyglutamated Antifolate (yPANTIFOL)
[00109] The disclosure generally relates gamma polyglutamated Antifolate
(yPANTIFOL)
compositions. The yPANTIFOL compositions comprise at least one glutamyl group
having a
gamma carboxyl group linkage. These compositions are structurally distinct
from the L-
gamma polyglutamated forms the Antifolate (L11FANTIFOL) that are produced by
the
enzyme folylpoly-gamma-glutamate synthetase (FPGS) in cells during Antifolate
therapy.
[00110] In some embodiments, the yPANTIFOL composition contains 2-20, 2-15,
2-10, 2-5,
or more than 5, glutamyl groups (including the glutamyl group of the
Antifolate). In some
embodiments, each of the glutamyl groups in the yPANTIFOL other than the
glutamyl group
of the Antifolate has a gamma linkage. In some embodiments, 2 or more of the
glutamyl groups
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 83 -
in the yPANTIFOL have a gamma linkage. In some embodiments, each of the
glutamyl groups
in the yPANTIFOL is in the L-form. In some embodiments, each of the glutamyl
groups in the
yPANTIFOL other than the glutamyl group in the Antifolate, is in the D-form.
In some
embodiments, the yPANTIFOL comprises two or more glutamyl groups in the L-form
and one
or more glutamyl groups in the D-form.
[00111] In some embodiments, the Antifolate is selected from: PMX, MTX,
RTX, and LTX,
or a stereoisomer thereof.
[00112] In some embodiments, the Antifolate is selected from: LV
(etoposide), L-leucovorin
(L-5-formyltetrahydrofolate); 5-CH3-THF, 5-methyltetrahydrofolate; FA, folic
acid; PteGlu,
pteroyl glutamate (FA); MTX, methotrexate; 2-dMTX, 2-desamino-MTX; 2-CH3-MTX,
2-
desamino-2-methyl-MTX; AMT, aminopterin; 2-dAMT, 2-desamino-AMT; 2-CH3-AMT, 2-
desamino-2-methyl-AMT; 10-EdAM, 10-ethyl-10-deazaaminopterin; PT523, N alpha -
(4-
amino-4-deoxypteroy1)-N delta-(hemiphthaloy1)-L-ornithine; DDATHF
(lometrexol), 5,10-
dideaza-5,6,7,8,-tetrahydrofolic acid; 5-d(i)H4PteGlu, 5-deaza-5,6,7,8-
tetrahydroisofolic acid;
N9-CH3-5-d(i)H4PteGlu, N9-methyl-5-deaza-5,6,7,8-tetrahydroisofolic acid; 5-
dPteHCysA,
N alpha -(5-deazapteroy1)-L-homocysteic acid; 5-dPteAPBA, N alpha -(5-
deazapteroy1)-DL-
2-amino-4-phosphonobutanoic acid; 5-dPteOrn, N alpha -(5-deazapteroy1)-L-
ornithine; 5-
dH4PteHCysA, N alpha -(5-deaza-5,6,7,8-tetrahydropteroy1)-L-homocysteic acid;
5-
dH4PteAPBA, N alpha -(5-deaza-5,6,7,8-tetrahydropteroy1)-DL-2-amino-4-
phosphobutanoic
acid; 5-dH4PteOro, N alpha -(5-deaza-5,6,7,8-tetrahydropteroy1)-L-ornithine;
CB3717, N10-
propargy1-5,8-dideazafolic acid; ICI-198,583, 2-desamino-2-methyl-N10-
propargy1-5,8-
dideazafolic acid; 4-H-ICI-198,583, 4-deoxy-ICI-198,583: 4-0CH3-ICI-198,583, 4-
methoxy-
ICI-198,583 Glu-to-Val-ICI-198,583; valine-ICI-198;583; Glu-to-Sub-ICI-
198,583, 2-amino-
suberate-ICI-198,583; 7-CH3-ICI-198,583, 7-methyl-ICI-198,583; ZD1694, N-[5(N-
(3,4-
dihydro-2-methy1-4-oxoquinazolin-6-yl-methyl)amino)2-- thieny1)1-L-glutamic
acid; 2-NH2-
ZD1694, 2-amino-ZD1694; BW1843U89, (S)-2[5-(41,2-dihydro-3-methy1-1-oxobenzo
(f)quinazolin-9-yl)methyl)amino- )-1-oxo-2-isoindoliny11-glutaric acid;
LY231514, N-(4-(2-
(2-amino-4,7-dihydro-4-oxo-3H-pyrrolo [2,3 -D] pyrimidin-5-yl)ethyl)- benzoyl]
-L-glutamic
acid; IAHQ, 5,8-dideazaisofolic acid; 2-dIAHQ, 2-desamino-IAHQ; 2-CH3-dIAHQ, 2-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 84 -
desamino-2-methyl-IAHQ; 5-d(i)PteGlu, 5-deazaaisofolic acid; N9-CH3-5-
d(i)PteGlu, N9-
methy1-5-deazaisofolic acid; N9-CH0-5-d(i)PteGlu, N9-formy1-5-deazaisofolic
acid; AG337,
3,4-dihydro-2-amino-6-methly-4-oxo-5-(4-pyridylthio) quanazoline; and AG377,
2,4-
diamino-6[N-(4-(phenysulfonyl) benzyl)ethyl)amino] quinazoline; or a
stereoisomer thereof.
[00113] In
some embodiments, the Antifolate is selected from: methotrexate, raltitrexed,
plevitrexed, pemetrexed, lometrexol (LMX; 5,10-dideazatetrahydrofolic acid), a
cyclopenta[g]quinazoline with a dipeptide ligand, CB3717, CB300945, or a
stereoisomer
thereof, such as 6-R,S-BGC 945 (ONX-0801), CB300638, and BW1843U89.
[00114] In
some embodiments, the Antifolate is a 6-substituted pyrrolo[2,3-d]pyrimidine
benzoyl antifolate. In some embodiments, the Antifolate is a 6-substituted
pyrrolo[2,3-
d]pyrimidine benzoyl antifolate with carbon bridge length from 1- to 6-carbons
(e.g., a
compound having the structure of Formula (I), wherein nl= 1-6). In some
embodiments, the
Antifolate is a 6-substituted thieno[2,3-d]pyrimidine benzoyl antifolates with
bridge with a
bridge length from 2-8 carbons (e.g., a compound having the structure of
Formula (II), wherein
n2=7-13). In some embodiments, the Antifolate is a 6-substituted pyrrolo[2,3-
d]pyrimidine
antifolates with a thienoyl replacement for the benzoyl moiety with a bridge
length from 2-8
carbons (e.g., a compound having the structure of Formula (III), wherein n1=1-
6). In some
embodiments, the Antifolate has a structure according to any of Formula (I)-
(III), wherein x=
4, 5, 2-10, 4-6, or more than 5.
0. 0\\ 0
Formula (I) Mutartni%,
Formuia ()i) iGiutanIA Formula PIO
0 iGkitarnyl)x
,
I
"\. ,/;
' ni ¨ /
Ii-021 ,
'
= if
-N- 142N N". --S 4 n1
H2N
[00115] In
some embodiments, the Antifolate is selected from: an indoline ring and
modified
ornithine-bearing methotrexate derivative, an indoline ring and modified
glutamic acid-
bearing methotrexate derivative, an alkyl-substituted benzene ring C bearing
methotrexate
derivative, a benzoxazine moiety-bearing methotrexate derivative, a
benzothiazine moiety-
bearing methotrexate derivative, a 10-deazaminopterin analog, a 5-
deazaminopterin
methotrexate analog, a 5,10-dideazaminopterin methotrexate analog, a indoline
moiety-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 85 -
bearing methotrexate derivative, a lipophilic amide methotrexate derivative, a
L-threo-
(2S,4S)-4-fluoro-glutamic acid containing methotrexate analog, a DL-3,3-
difluoroglutamic
acid-containing methotrexate analog, a methotrexate tetrahydroquinazoline
analog, a N-(ac-
aminoacyl) methotrexate derivative, a biotin methotrexate derivative, a D-
glutamic acid
methotrexate analog, a D-erythrou, threo-4-fluoroglutamic acid methotrexate
analog, a
methano methotrexate analog, a 10-deazaminopterin (10-EDAM) analog, a y-
tetrazole
methotrexate analog, a N-(L-a-aminoacyl) methotrexate derivative, a meta
isomer of
aminopterin, an ortho isomer of aminopterin, a hydroxymethylmethotrexate, a y-
fluoromethotrexate, a polyglutamyl methotrexate derivative, a gem-
diphosphonate
methotrexate analog (see, e.g., W01988/06158, the contents of which is herein
incorporated
by reference in its entirety), a cc-substituted methotrexate analog, a y-
substituted methotrexate
analog, a 5-methyl-5-deaza methotrexate analog (see. e.g., U.S. Pat. No.
4,725,687, the
contents of each of which is herein incorporated by reference in its
entirety), an N delta-acyl-
N a-(4-amino-4-deoxypteroy1)-L-ornithine derivative, a 8-deaza methotrexate
analogue, an
acivicin methotrexate analog, a polymeric platinol methotrexate derivative, a
methotrexate-y-
dimyristoylphophatidylethanolamine, a methotrexate polyglutamate analog, a
poly-y-
glutamyl methotrexate derivative, a deoxyuridylate methotrexate derivative, a
iodoacetyl
lysine methotrexate analog, a 2,omega.-diaminoalkanoid acid-containing
methotrexate
analog, a polyglutamate methotrexate derivative, a 5-methyl-5-deaza analog, a
quinazoline
methotrexate analog, a pyrazine methotrexate analog, a cysteic or homocysteic
acid
methotrexate analog (see, e.g., U.S. Pat. No. 4,490,529, and EPA 0142220, the
contents of
each of which is herein incorporated by reference in its entirety), a y-tert-
butyl methotrexate
ester, a fluorinated methotrexate analog, a folate methotrexate analog, a
phosphonoglutamic
acid analog, a poly (L-lysine) methotrexate conjugate, a dilysine or trilysine
methotrexate
derivate, a 7-hydroxymethotrexate, a poly-y-glutamyl methotrexate analog, a
3',5'-
dichloromethotrexate, a diazoketone or chloromethylketone methotrexate analog,
a 10-
propargylaminopterin, an alkyl methotrexate homologs, a lectin derivative of
methotrexate, a
polyglutamate methotrexate derivative, a halogentated methotrexate derivative,
a 8-alky1-7,8-
dihydro analog, a 7-methyl methotrexate derivative, a dichloromethotrexate, a
lipophilic
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 86 -
methotrexate derivative, a 3 ',5'-dichloromethotrexate, a deaza amethopterin
analog, and
MX068; or a stereoisomer thereof.
[00116] In some embodiments, the Antifolate has the Formula (IV):
.rµq ,
Ni if.
=
wherein X=CH2, C2H4, or 0(CH2)30; R1= Me or Et; R2=H, Cl, F, OH, or R2=R3; and
R3=
H, Cl, F, OH, Me, or Br.
[00117] In some embodiments, the Antifolate has the Formula (IV) wherein,
X=CH2; R1= Me
or Et; R2=H, Cl, F, OH, or R2=R3; and R3= H, Cl, F, OH, Me, or Br. In some
embodiments,
X=CH2; R1= Me; R2=H, Cl, F, OH; and R3= H, Cl, Me, or Br. In some embodiments,
X=
0(CH2)30; R1= Me; and R2= R3=H.
[00118] In some embodiments, the Antifolate has the Formula (V):
= .. .===,4-,44
'
N
, ...............................
N 3.)(304
wherein X= C2H4, C4H5, C6H12, 0(CH2)20, or 0(CH2)30; RI= H or Cl, or R2=R3;
and R3= H
or Cl.
[00119] In some embodiments, the Antifolate has the Formula (V) wherein, X=
C2H4; and R1=
R2=H or CL. In some embodiments, X= C2H4; R1=C1; and R2=H. In some
embodiments, X=
C4H8; and R1= R2=H. In some embodiments, X= C6H12; and R1= R2=H.
[00120] In some embodiments, the Antifolate has the Formula (VI):
A A
OH
wherein X= CH2 or C2H4; Y=2,5-thiophene; and R= CH2F, Cn, Et, Me, or CH2OH.
[00121] In some embodiments, the Antifolate has the Formula (VI) whererin,
X= CH2; Y=2,5-
thiophene; and R= H2F, Cn, Et, or CH2OH. In some embodiments, X= C2H4; Y=2,5-
thiophene;
and R= Me.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 87 -
[00122] In some embodiments, the Antifolate has the Formula (VII):
0 0
co,H
NI
1
wherein X=N or CH; Y=NH2; CH3, or H; and R=CH3, CHO, or H.
[00123] In some embodiments, the Antifolate has the Formula (VII) wherein,
(a) X = N; Y =
NH2; and R=H; (b) X=N; Y=NH2; and R=CH3; (c) X=N, Y=NH2; and R=CHO; (d) X=CH,
Y=NH2, R = H; (e) X=CH, Y=H, R=H; or (f) X=CH, Y=CH3, and R=H.
[00124] In some embodiments, the Antifolate has the Formula (VIII):
co2H
001
A
HN
wherein A = NH, NCH3, or CH2.
[00125] In some embodiments, the Antifolate has the Formula (IX):
X
1.13C R
wherein, (a) X = OH; R = H; and Y = GIu, (b) X = OCH3; R = H; and Y = GIu, (c)
X =
OH; R = H; and Y = Valine; (d) X = OH; R = H; and Y = Suberate; or (e) X = OH;
R =
CH3; and Y = GIu.
[00126] In additional embodiments, the Antifolate is a
cyclopenta[g]quinazoline derivative.
In some embodiments, the cyclopenta[g]quinazoline derivative is N- N- { 44N-(2-
methy1-4-
oxo-3,4,7,8-tetrahydro-6H-cyclopenta[g] quinazolin-6-y1)-N-(prop-2-ynyl)amino]
benzo yll-L-
y-glutamyl I -D-glutamic acid; or N- N- { 4- [N-(2-hydroxymethy1-4-oxo-3,4,7,8-
tetrahydro-
6H-c yclopenta [g] -quinazolin-6-y1)-N-(prop-2-ynyl)amino]benzoyll-L-y-
glutamyll-D-
glutamic acid; or a pharmaceutically acceptable salt or ester thereof.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 88 -
[00127] In some embodiments, the Antifolate has the Formula (X):
UN
wherein R1 is H, amino, C1-4 alkyl, C1-4 alkoxy, C1-4 hydroxyalkyl or C1-4
fluoroalkyl;
R2 is hydrogen, C1-4 alkyl, C3-4 alkenyl, C3-4 alkynyl, C2-4 hydroxyalkyl C2-4
halogenoalkyl or C1-4 cyanoalkyl;
Ar is phenylene, thiophenediyl, thiazolediyl, pyridinediyl or pyrimidinediyl
which may
optionally bear one or two substituents selected from halogeno, hydroxy,
amino, nitro, cyano,
trifluoromethyl, C1-4 alkyl and C1-4 alkoxy; and
R3 is a group of one of the following formulae: -NHCH(CO2H)-Al-Y1-NH-A3-Y3 or
R3 is
an alpha or gamma carboxyl linked L- or D- glutamyl group.
[00128] In some embodiments, the Antifolate has the Formula (X) wherein, R1
is C1-4 alkyl
or C1-4 hydroxyalkyl (e.g., a methyl or a hydroxymethyl); R2 is (a) methyl,
ethyl, propyl,
prop-2-enyl, prop-2-ynyl, 2-hydroxy-ethyl, 2-fluoroethyl, 2-bromoethyl or 2-
cyanoethyl, (b)
methyl or (c) prop-2-ynyl; and Ar is 1,4-phenylene or a 1,4-phenylene having
one or two
substituents selected from chloro and fluoro (e.g. a 2-fluoro substituent such
as 2-fluoro-1,4-
phenylene or 2,6-difluoro-1,4-phenylene), thiophene-2,5-diyl, thiazole-2,5-
diy1 or pyridine-
2,5-diyl.
[00129] In some embodiments, the Antifolate has the Formula (X) wherein, R1
is methyl or
hydroxymethyl; R2 is methyl or prop-2-ynyl; and Ar is 1,4-phenylene or 1,4-
phenylene having
a 2-fluoro substituent as in 2,6-difluoro-1,4-phenylene or especially 2-fluoro-
1,4-phenylene or
is pyridine 2,5-diyl. In some embodiments, Ar is 1,4-phenylene or 2-fluoro-1,4-
phenylene.
[00130] In other embodiments, the gamma polyglutamated Antifolate is a
cyclopenta[g]quinazoline disclosed in W02009/115776, WO 2003/020300, WO
2003/020706, WO 2003/020748, Gibbs et al., Cancer Research 65 (15):11721-11728
(2005),
and Bavetsias et al., Tetrahedron 63(7):1537-1543 (2007), the contents of each
of which is
herein incorporated by reference in its entirety.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 89 -
[00131] In some embodiments, the gamma polyglutamated Antifolate is
diglutamated. That is,
the gamma polyglutamated Antifolate contains 1 y-glutamyl group in addition to
the glutamyl
group in the Antifolate (yANTIFOL-PG1), and the additional glutamyl group is
linked to the
glutamyl group in the Antifolate through a gamma linkage. In some embodiments,
each of the
glutamyl groups of the gamma diglutamated Antifolate is in the L-form. In
other embodiments,
the gamma diglutamated Antifolate comprises a glutamyl group in the D-form.
[00132] In some embodiments, the gamma polyglutamated Antifolate is
triglutamated. That is,
the gamma polyglutamated Antifolate contains 2 y-glutamyl groups in addition
to the glutamyl
group in the Antifolate (yANTIFOL-PG2). In some embodiments, each of the 2
additional
glutamyl groups have a gamma linkage. In other embodiments, one of the 2
glutamyl groups
have a gamma linkage and the other glutamyl group has a gamma linkage. In some
embodiments, each of the glutamyl groups of the gamma triglutamated Antifolate
is in the L-
form. In other embodiments, the gamma triglutamated Antifolate comprises a
glutamyl group
in the D-form. In further embodiments, each of the glutamyl groups of the y-
triglutamated
Antifolate other than the -y-glutamyl group in the Antifolate, is in the D-
form. In additional
embodiments, the y-triglutamated Antifolate comprises a glutamyl group in the
D-form and
two or more glutamyl groups in the L-form.
[00133] In some embodiments, the gamma polyglutamated Antifolate is
tetraglutamated and
thus contains 3 7-glutamyl groups in addition to the glutamyl group of the
Antifolate
(yANTIFOL-PG3). In some embodiments, the gamma tetraglutamated Antifolate
comprises
two or more y-glutamyl groups in the L-form. In further embodiments, each of
the y-glutamyl
groups of the gamma tetraglutamated Antifolate is in the L-form. In other
embodiments, the
gamma tetraglutamated Antifolate comprises a y-glutamyl group in the D-form.
In some
embodiments, the gamma tetraglutamated Antifolate comprises 2 y-glutamyl
groups in the D-
form. In some embodiments, each of the glutamyl groups of the gamma
tetraglutamated
Antifolate other than the glutamyl group in the Antifolate, is in the D-form.
In additional
embodiments, the tetraglutamated Antifolate comprises a y-glutamyl group in
the D-form and
two or more y-glutamyl groups in the L-form.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 90 -
[00134] In some embodiments, the gamma polyglutamated Antifolate is
pentaglutamated
(yANTIFOL-PG4) and contains a chain of 4 y-glutamyl groups attached to the
glutamyl group
in the Antifolate. In some embodiments, the gamma pentaglutamated Antifolate
comprises two
or more glutamyl groups in the L-form. In further embodiments, each of the
glutamyl groups
of the gamma pentaglutamated Antifolate is in the L-form. In other
embodiments, the gamma
pentaglutamated Antifolate comprises a glutamyl group in the D-form. In some
embodiments,
the gamma tetraglutamated Antifolate comprises 2 or 3, y-glutamyl groups in
the D-form. In
further embodiments, each of the y-glutamyl groups of the gamma
pentaglutamated Antifolate
other than the glutamyl group in the Antifolate, is in the D-form. In
additional embodiments,
the pentaglutamated Antifolate comprises a y-glutamyl group in the D-form and
two or more
y- glutamyl groups in the L-form.
[00135] In some embodiments, the gamma polyglutamated Antifolate is
hexaglutamated
(yANTIFOL-PG5) and contains a chain of 5 y-glutamyl groups attached to the
glutamyl group
in the Antifolate. In some embodiments, the gamma hexaglutamated Antifolate
comprises two
or more y-glutamyl groups in the L-form. In further embodiments, each of the
glutamyl groups
of the gamma hexaglutamated Antifolate is in the L-form. In other embodiments,
the gamma
hexaglutamated Antifolate comprises a y-glutamyl group in the D-form. In some
embodiments,
the gamma tetraglutamated Antifolate comprises 2, 3, 4, or 5, -y-glutamyl
groups in the D-form.
In further embodiments, each of the glutamyl groups of the gamma
hexaglutamated Antifolate
other than the glutamyl group in the Antifolate, is in the D-form. In
additional embodiments,
the hexaglutamated Antifolate comprises a y-glutamyl group in the D-form and
two or more
-y-glutamyl groups in the L-form.
[00136] In some embodiments, the gamma polyglutamated Antifolate is
heptaglutamated
(yANTIFOL-PG6) and thus contains a chain of 6 y-glutamyl groups attached to
the glutamyl
group in the Antifolate. In some embodiments, the gamma heptaglutamated
Antifolate
comprises two or more y-glutamyl groups in the L-form. In further embodiments,
each of the
y-glutamyl groups of the gamma heptaglutamated Antifolate is in the L-form. In
other
embodiments, the gamma heptaglutamated Antifolate comprises a -y-glutamyl
group in the D-
form. In some embodiments, the gamma tetraglutamated Antifolate comprises 2,
3, 4, 5, or 6,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 91 -
y-glutamyl groups in the D-form. In further embodiments, each of the y-
glutamyl groups of
the gamma heptaglutamated Antifolate other than the glutamyl group in the
Antifolate, is in
the D-form. In additional embodiments, the heptaglutamated Antifolate
comprises a y-
glutamyl group in the D-form and two or more y-glutamyl groups in the L-form.
[00137] In some embodiments, the gamma polyglutamated Antifolate is
octaglutamated
(yANTIFOL-PG7) and thus contains a chain of 7 y-glutamyl groups attached to
the glutamyl
group in the Antifolate. In some embodiments, the gamma octaglutamated
Antifolate
comprises two or more glutamyl groups in the L-form. In further embodiments,
each of the
glutamyl groups of the gamma octaglutamated Antifolate is in the L-form. In
other
embodiments, the gamma octaglutamated Antifolate comprises a glutamyl group in
the D-
form. In some embodiments, the gamma octaglutamated Antifolate comprises 2, 3,
4, 5, 6, or
7, y-glutamyl groups in the D-form. In further embodiments, each of the
glutamyl groups of
the gamma octaglutamated Antifolate other than the glutamyl group in the
Antifolate, is in the
D-form. In additional embodiments, the octaglutamated Antifolate comprises a
glutamyl group
in the D-form and two or more glutamyl groups in the L-form.
[00138] In some embodiments, the gamma polyglutamated Antifolate is
nonaglutamated
(yANTIFOL-PG8) and contains a chain of 8 y-glutamyl groups attached to the
glutamyl group
in the Antifolate. In some embodiments, the gamma nonaglutamated Antifolate
comprises two
or more glutamyl groups in the L-form. In further embodiments, each of the
glutamyl groups
of the gamma nonaglutamated Antifolate is in the L-form. In other embodiments,
the gamma
nonaglutamated Antifolate comprises a glutamyl group in the D-form. In further
embodiments,
each of the glutamyl groups of the gamma nonaglutamated Antifolate other than
the glutamyl
group in the Antifolate, is in the D-form. In additional embodiments, the
nonaglutamated
Antifolate comprises a y-glutamyl group in the D-form and two or more y-
glutamyl groups in
the L-form.
[00139] In some embodiments, the gamma polyglutamated Antifolate is
decaglutamated
(yANTIFOL-PG9) (i.e., contains a chain of 9 y-glutamyl groups attached to the
glutamyl group
in the Antifolate). In some embodiments, the gamma decaglutamated Antifolate
comprises two
or more glutamyl groups in the L-form. In further embodiments, each of the
glutamyl groups
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 92 -
of the gamma decaglutamated Antifolate is in the L-form. In other embodiments,
the gamma
decaglutamated Antifolate comprises a glutamyl group in the D-form. In further
embodiments,
each of the glutamyl groups of the gamma decaglutamated Antifolate other than
the glutamyl
group in the Antifolate, is in the D-form. In additional embodiments, the
decaglutamated
Antifolate comprises a glutamyl group in the D-form and two or more glutamyl
groups in the
L-form.
[00140] In some embodiments, the gamma polyglutamated Antifolate is
undecaglutamated
(yANTIFOL-PG10) and contains a chain of 10 y-glutamyl groups attached to the
glutamyl
group in the Antifolate. In some embodiments, the gamma undecaglutamated
Antifolate
comprises two or more glutamyl groups in the L-form. In further embodiments,
each of the
glutamyl groups of the gamma undecaglutamated Antifolate is in the L-form. In
other
embodiments, the gamma undecaglutamated Antifolate comprises a D glutamyl
group. In
further embodiments, each of the glutamyl groups of the gamma undecaglutamated
Antifolate
other than the glutamyl group in the Antifolate, is in the D-form. In
additional embodiments,
the undecaglutamated Antifolate comprises a glutamyl group in the D-form and
two or more
glutamyl groups in the L-form.
[00141] In some embodiments, the gamma polyglutamated Antifolate is
dodecaglutamated
(yANTIFOL-PG11) and contains a chain of 11 y-glutamyl groups attached to the
glutamyl
group in the Antifolate. In some embodiments, the gamma dodecaglutamated
Antifolate
comprises two or more glutamyl groups in the L-form. In further embodiments,
each of the
glutamyl groups of the gamma dodecaglutamated Antifolate is in the L-form. In
other
embodiments, the gamma dodecaglutamated Antifolate comprises a glutamyl group
in the D-
form. In further embodiments, each of the glutamyl groups of the gamma
dodecaglutamated
Antifolate other than the glutamyl group in the Antifolate, is in the D-form.
In additional
embodiments, the dodecaglutamated Antifolate comprises a glutamyl group in the
D-form and
two or more glutamyl groups in the L-form.
[00142] In some embodiments, the gamma polyglutamated Antifolate is
tridecaglutamated
(yANTIFOL-PG12) and contains a chain of 12 y-glutamyl groups attached to the
glutamyl
group in the Antifolate. In some embodiments, the gamma tridecaglutamated
Antifolate
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 93 -
comprises two or more glutamyl groups in the L-form. In further embodiments,
each of the
glutamyl groups of the gamma tridecaglutamated Antifolate is in the L-form. In
other
embodiments, the gamma tridecaglutamated Antifolate comprises a glutamyl group
in the D-
form. In further embodiments, each of the glutamyl groups of the gamma
tridecaglutamated
Antifolate other than the glutamyl group in the Antifolate, is in the D-form.
In additional
embodiments, the tridecaglutamated Antifolate comprises a glutamyl group in
the D-form and
two or more glutamyl groups in the L-form.
[00143] In some embodiments, the gamma polyglutamated Antifolate is
tetradecaglutamated
(yANTIFOL-PG13) and contains a chain of 13 y-glutamyl groups attached to the
glutamyl
group in the Antifolate. In some embodiments, the gamma tetradecaglutamated
Antifolate
comprises two or more glutamyl groups in the L-form. In further embodiments,
each of the
glutamyl groups of the gamma tetradecaglutamated Antifolate is in the L-form.
In other
embodiments, the gamma tetradecaglutamated Antifolate comprises a glutamyl
group in the
D-form. In further embodiments, each of the glutamyl groups of the gamma
tetradecaglutamated Antifolate other than the glutamyl group in the
Antifolate, is in the D-
form. In additional embodiments, the tetradecaglutamated Antifolate comprises
a glutamyl
group in the D-form and two or more glutamyl groups in the L-form.
[00144] In some embodiments, the gamma polyglutamated Antifolate is
pentadecaglutamated
(yANTIFOL-PG14) and contains a chain of 14 y-glutamyl groups attached to the
glutamyl
group in the Antifolate. In some embodiments, the gamma pentadecaglutamated
Antifolate
comprises two or more glutamyl groups in the L-form. In further embodiments,
each of the
glutamyl groups of the gamma pentadecaglutamated Antifolate is in the L-form.
In other
embodiments, the gamma pentadecaglutamated Antifolate comprises a glutamyl
group in the
D-form. In further embodiments, each of the glutamyl groups of the gamma
pentadecaglutamated Antifolate other than the glutamyl group in the
Antifolate, is in the D-
form. In additional embodiments, the pentadecaglutamated Antifolate comprises
a glutamyl
group in the D-form and two or more glutamyl groups in the L-form.
[00145] In some embodiments, the gamma polyglutamated Antifolate is
hexadecaglutamated
(yANTIFOL-PG15) and contains a chain of 15 y-glutamyl groups attached to the
glutamyl
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 94 -
group in the Antifolate. In some embodiments, the gamma hexadecaglutamated
Antifolate
comprises two or more glutamyl groups in the L-form. In further embodiments,
each of the
glutamyl groups of the gamma hexadecaglutamated Antifolate is in the L-form.
In other
embodiments, the gamma hexadecaglutamated Antifolate comprises a glutamyl
group in the
D-form. In further embodiments, each of the glutamyl groups of the gamma
hexadecaglutamated Antifolate other than the glutamyl group in the Antifolate,
is in the D-
form. In additional embodiments, the hexadecaglutamated Antifolate comprises a
glutamyl
group in the D-form and two or more glutamyl groups in the L-form.
[00146] In other embodiments, the gamma polyglutamated Antifolate is
heptadecaglutamated
(yANTIFOL-PG16) and contains a chain of 16 y-glutamyl groups attached to the
glutamyl
group in the Antifolate. In some embodiments, the gamma heptadecaglutamated
Antifolate
comprises two or more glutamyl groups in the L-form. In further embodiments,
each of the
glutamyl groups of the gamma heptadecaglutamated Antifolate is in the L-form.
In other
embodiments, the gamma heptadecaglutamated Antifolate comprises a D glutamyl
group. In
further embodiments, each of the glutamyl groups of the gamma
heptadecaglutamated
Antifolate other than the glutamyl group in the Antifolate, is in the D-form.
In additional
embodiments, the heptadecaglutamated Antifolate comprises a glutamyl group in
the D-form
and two or more glutamyl groups in the L-form.
[00147] In some embodiments, the gamma polyglutamated Antifolate is
octadecaglutamated
(yANTIFOL-PG17) and contains a chain of 17 y-glutamyl groups attached to the
glutamyl
group in the Antifolate. In some embodiments, the gamma octadecaglutamated
Antifolate
comprises two or more glutamyl groups in the L-form. In further embodiments,
each of the
glutamyl groups of the gamma octadecaglutamated Antifolate is in the L-form.
In other
embodiments, the gamma octadecaglutamated Antifolate comprises a D glutamyl
group. In
further embodiments, each of the glutamyl groups of the gamma
octadecaglutamated
Antifolate other than the glutamyl group in the Antifolate, is in the D-form.
In additional
embodiments, the octadecaglutamated Antifolate comprises a glutamyl group in
the D-form
and two or more glutamyl groups in the L-form.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 95 -
[00148] In some embodiments, the gamma polyglutamated Antifolate is
nonadecaglutamated
(yANTIFOL-PG18) and contains a chain of 18 y-glutamyl groups attached to the
glutamyl
group in the Antifolate. In some embodiments, the gamma nonadecaglutamated
Antifolate
comprises two or more glutamyl groups in the L-form. In further embodiments,
each of the
glutamyl groups of the gamma nonadecaglutamated Antifolate is in the L-form.
In other
embodiments, the gamma nonadecaglutamated Antifolate comprises a D glutamyl
group. In
further embodiments, each of the glutamyl groups of the gamma
nonadecaglutamated
Antifolate other than the glutamyl group in the Antifolate, is in the D-form.
In additional
embodiments, the nonadecaglutamated Antifolate comprises a glutamyl group in
the D-form
and two or more glutamyl groups in the L-form.
[00149] In some embodiments, the gamma polyglutamated Antifolate is
icosaglutamated
(yANTIFOL-PG19) and contains a chain of 19 y-glutamyl groups attached to the
glutamyl
group in the Antifolate. In some embodiments, the gamma icosaglutamated
Antifolate
comprises two or more glutamyl groups in the L-form. In further embodiments,
each of the
glutamyl groups of the gamma icosaglutamated Antifolate is in the L-form. In
other
embodiments, the gamma icosaglutamated Antifolate comprises a D glutamyl
group. In further
embodiments, each of the glutamyl groups of the gamma icosaglutamated
Antifolate other than
the glutamyl group in the Antifolate, is in the D-form. In additional
embodiments, the
icosaglutamated Antifolate comprises a glutamyl group in the D-form and two or
more
glutamyl groups in the L-form.
[00150] In some embodiments, the gamma polyglutamated Antifolate is
henicosaglutamated
(yANTIFOL-PG20) and contains a chain of 20 y-glutamyl groups attached to the
glutamyl
group in the Antifolate. In some embodiments, the gamma henicosaglutamated
Antifolate
comprises two or more glutamyl groups in the L-form. In further embodiments,
each of the
glutamyl groups of the gamma henicosaglutamated Antifolate is in the L-form.
In other
embodiments, the gamma henicosaglutamated Antifolate comprises a D glutamyl
group. In
further embodiments, each of the glutamyl groups of the gamma
henicosaglutamated
Antifolate other than the glutamyl group in the Antifolate, is in the D-form.
In additional
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 96 -
embodiments, the henicosaglutamated Antifolate comprises a glutamyl group in
the D-form
and two or more glutamyl groups in the L-form.
[00151] In some embodiments, the gamma polyglutamated Antifolate contains a
chain of 4-7
glutamyl groups attached to Antifolate (i.e., yANTIFOL-PGn, wherein n= 4-7)
and each of the
4-7 attached glutamyl groups have a gamma linkage. In some embodiments, each
of the 4-7
attached glutamyl groups is in the L-form. In other embodiments, each of the 4-
7 attached
glutamyl groups is in the D-form. In other embodiments, the 4-7 attached
glutamyl groups are
in the L-form and the D-form.
[00152] In some embodiments, the gamma polyglutamated Antifolate
(yPANTIFOL) contains
a total of 1-15, 1-10, 2-15, 2-10, 3-15, 3-10, 3-6, 3-5, 4-10, 4-7, or 4-6,
glutamyl groups
including the glutamyl group of the Antifolate, or any range therein between.
In some
embodiments, each of the glutamyl groups in the yPANTIFOL other than the
glutamyl group
in the Antifolate have a gamma linkage. In some embodiments, 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, 11,
12, 13, or 14, of the glutamyl groups in the yPANTIFOL have a gamma linkage.
In some
embodiments, the yPANTIFOL comprises y glutamyl groups in the L-form and the D-
form. In
some embodiments, each of the glutamyl groups in the polyglutamate structure
of the
polyglutamated Antifolate is in the L-form. In some embodiments, each of the
glutamyl groups
in the yPANTIFOL other than the glutamyl group in the Antifolate is in the D-
form. In one
embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, of the
glutamyl groups in the
yPANTIFOL is in the L-form. In another embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13,
or 14, of the glutamyl groups in the yPANTIFOL is in the D-form.
[00153] In some embodiments, the gamma polyglutamated Antifolate
(yPANTIFOL) contains
a total of 2-20, 2-15, 2-10, 2-5, glutamyl groups including the glutamyl group
of the Antifolate,
or any range therein between. In some embodiments, each of the glutamyl groups
in the
yPANTIFOL is in the L-form. In some embodiments, each of the glutamyl groups
in the
yPANTIFOL other than the glutamyl group in the Antifolate is in the D-form. In
one
embodiment, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,
or 20, of the glutamyl
groups in the yPANTIFOL are in the L-form. In another embodiment, 1, 2, 3, 4,
5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, or 19, glutamyl groups in the yPANTIFOL is
in the D-form.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 97 -
[00154] In some embodiments, the gamma polyglutamated Antifolate contains a
total of 1, 2,
3,4, 5, 6,7, 8, 9, 10, 11, 12, 13, 14, or 15, glutamyl groups in addition to
the glutamyl group
of the Antifolate).
[00155] In some embodiments, a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, or 15,
glutamyl groups in the gamma polyglutamated Antifolate are in the L-form, the
D-form, or in
the L-form and the D-form. In some embodiments, each of the glutamyl groups of
the gamma
polyglutamated Antifolate is in the L-form. In other embodiments, each of the
glutamyl groups
of the gamma polyglutamated Antifolate other than the glutamyl group in the
Antifolate is in
the D-form. In alternative embodiments, at least two of the glutamyl groups in
the gamma
polyglutamated Antifolate are in the L-form and at least one of the glutamyl
groups in the
gamma polyglutamated Antifolate is in the D-form. In some embodiments, 1, 2,
3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15 or 16, glutamyl groups in the gamma
polyglutamated Antifolate are
in the L-form. In other embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, or 14, glutamyl
groups in the gamma polyglutamated Antifolate are in the D-form.
[00156] In additional embodiments, the gamma polyglutamated Antifolate
contains 20-100,
20-75, 20-50, 20-40, 20-30, 20-25, or more than 100, gamma glutamyl groups, or
any range
therein between. In some embodiments, each of the glutamyl groups of the gamma
polyglutamated Antifolate is in the L-form. In other embodiments, each of the
glutamyl groups
of the gamma polyglutamated Antifolate other than the glutamyl group in the
Antifolate is in
the D-form. In alternative embodiments, at least two of the glutamyl groups in
the gamma
polyglutamated Antifolate are in the L-form and at least one of the glutamyl
groups in the
gamma polyglutamated Antifolate is in the D-form
[00157] In additional embodiments, the provided compositions comprise a
gamma
polyglutamated Antifolate that contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-
20, glutamyl groups
that have gamma linkages. In some embodiments, the gamma polyglutamated
Antifolate
contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups in the L-
form. In some
embodiments, the gamma polyglutamated Antifolate contains 0, 1, 2, 3, 4, 5, 6,
7, 8, 9, 1-10,
or 1-20, glutamyl groups in the D-form. In some embodiments, the gamma
polyglutamated
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 98 -
Antifolate contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 1-10, or 1-20, glutamyl groups
in the L-form and 0,
1, 2, 3, 4, 5, 6, 7, 8, 9, or 1-10 or 1-20, glutamyl groups in the D- form.
[00158] In some embodiments, the gamma polyglutamated Antifolate
composition provided
herein is capable of adding one or more additional glutamyl groups that, is
the composition is
able to act as a substrate for by FPGS (folylpolyglutamate synthetase).
Reagents and assays
and reagents for determining the ability of a gamma polyglutamated Antifolate
composition to
act as a substrate for FPGS (e.g., human FPGS, or rat liver FPGS) are readily
available and
can routinely be performed.
[00159] In some embodiments, the rate of uptake of naked gamma PANTIFOL
compositions
disclosed herein (e.g., gamma PANTIFOL that is not associated with a delivery
vehicle) by
hepatic cells is significantly reduced compared to the uptake rate of the
Antifolate under
physiologic conditions. In some embodiments, the rate of hepatic cell uptake
of the naked
gamma PANTIFOL composition is less than 30%, 20%, 15%, or 10% compared to the
rate of
the Antifolate. In further embodiments, the rate of the efflux (transport out)
of gamma
PANTIFOL compositions disclosed herein from hepatic-cells occurs at a rate
that is
significantly reduced compared to the Antifolate (e.g., less than 30%, 20%,
15%, or 10%)
compared to the rate of the Antifolate.
[00160] In some embodiments, a gamma polyglutamated Antifolate composition
provided
herein is more cytotoxic to hyperproliferative cells than Antifolate. In some
embodiments the
hyperproliferative cells are cancer cells. In some embodiments, the
hyperproliferative cells a
colorectal carcinoma cells, colon cancer cells, breast cancer cells, or
ovarian cancer cells. In
some embodiments, the cancer cells are mesothelioma cells or non-small cell
lung carcinoma
cells. In some embodiments, cytotoxicity is measured in an in vitro assay. In
some
embodiments, the gamma polyglutamated Antifolate is a hexaglutamated
Antifolate.
[00161] In some embodiments, a gamma polyglutamated Antifolate composition
provided
herein has lower toxic side effects than Antifolate. In some embodiments, the
gamma
polyglutamated Antifolate composition provided herein is less toxic to non-
hyperproliferative
cells than Antifolate. In some embodiments, the gamma polyglutamated
Antifolate
composition provided herein is less toxic to neutrophils, liver cells, or to
colon epithelium cells
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 99 -
than Antifolate. In some embodiments, the neutrophils human neutrophils,
differentiating
human neutrophils, or neutrophils differentiated from CD34+ cells. In some
embodiments, the
liver cells are AML12 liver cells. In some embodiments, the colon epithelium
cells are
CCD841 colon epithelium cells. In some embodiments, the toxicity is measured
in an in vitro
assay. In some embodiments, the gamma polyglutamated Antifolate is a
hexaglutamated
Antifolate.
[00162] In some embodiments, a gamma polyglutamated Antifolate composition
provided
herein has lower toxic side effects than to Antifolate. In some embodiments, a
gamma
polyglutamated Antifolate composition provided herein causes fewer or less
severe toxic side
effects in an vivo assay than Antifolate. In some embodiments, the in vivo
assay is an in vivo
murine model. In some embodiments, a gamma polyglutamated Antifolate
composition
provided herein causes fewer or less severe hematological or hepatic toxic
side effects than
Antifolate. In some embodiments, hematological side effects are assessed by
measuring mean
neutrophil, mean white blood cell or mean platelet counts. In some
embodiments, hepatic toxic
side effects are assessed by measuring serum aspartate transaminase (AST),
serum alanine
transaminase (ALT), and/or serum albumin levels. In some embodiments, the in
vivo assay
comprises administering 40 mg/kg or 80 mg/kg of the gamma polyglutamated
Antifolate
composition once weekly for 4 weeks. In some embodiments, the gamma
polyglutamated
Antifolate is a hexaglutamated Antifolate.
[00163] In some embodiments, treatment with a gamma polyglutamated
Antifolate
composition provided herein does not induce significant hematological or
hepatic toxic side
effects in an in vivo murine model. In some embodiments, hematological side
effects are
assessed by measuring mean neutrophil, mean white blood cell or mean platelet
counts. In
some embodiments, hepatic toxic side effects are assessed by measuring serum
aspartate
transaminase (AST), serum alanine transaminase (ALT), and/or serum albumin
levels. In some
embodiments, a gamma polyglutamated Antifolate composition provided herein
does not
significantly decrease mean neutrophil, mean white blood cell or mean platelet
counts. In some
embodiments, a gamma polyglutamated Antifolate composition provided herein
does not
significantly increase serum aspartate transaminase (AST) and serum alanine
transaminase
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 100 -
(ALT) levels. In some embodiments, a gamma polyglutamated Antifolate
composition
provided herein does not significantly decrease serum albumin levels. In some
embodiments,
the in vivo assay comprises administering 40 mg/kg or 80 mg/kg of the gamma
polyglutamated
Antifolate composition once weekly for 4 weeks. In some embodiments, the gamma
polyglutamated Antifolate is a hexaglutamated Antifolate.
[00164] In some embodiments, the gamma polyglutamated Antifolate
compositions do not
contain a fluorine atom. In some embodiments, the gamma polyglutamated
Antifolate
compositions do not contain a 4-fluoroglutamyl group.
[00165] Gamma polyglutamated Antifolate (y PANTIFOL) compositions and their
uses may
further be described in Intl. Appl. No. PCT/US2017/046667, and U.S. Patent
Appl. Nos.
62/630,824, 62/630,613, 62/630,713, 62/630,620, 62/627,733, 62/630,625,
62/630,652,
62/627,732, 62/636,289, 62/630,751, 62/630,821, 62/627,741, and 62/583,432,
the disclosure
of each of which is herein incorporated by reference in its entirety.
A. Gamma polyglutamated Antifolate analogs and derivatives
[00166] The disclosure also encompasses gamma polyglutamated Antifolate
derivatives and
analogs. The compositions and methods disclosed herein are envisioned to apply
to any and
every known derivative or analog the Antifolate that is polyglutamated. In
some embodiments,
the analog corresponds to a modified form of an Antifolate wherein the
glutamyl group of the
Antifolate is not linked to the remainder of the Antifolate molecule through a
gamma peptide
linkage. In some embodiments, the analog is a variant form of the Antifolate
wherein the
glutamyl group in the Antifolate is in the D-form. In some embodiments, the
polyglutamated
form of the Antifolate, or polyglutamated Antifolate analog or derivative is
not fluorinated.
[00167] In some embodiments, the Antifolate is selected from: an indoline
ring and modified
ornithine-bearing methotrexate derivative, an indoline ring and modified
glutamic acid-bearing
methotrexate derivative, an alkyl-substituted benzene ring C bearing
methotrexate derivative,
a benzoxazine moiety-bearing methotrexate derivative, a benzothiazine moiety-
bearing
methotrexate derivative, a 10-deazaminopterin analog, a 5-deazaminopterin
methotrexate
analog, a 5,10-dideazaminopterin methotrexate analog, a indoline moiety-
bearing
methotrexate derivative, a lipophilic amide methotrexate derivative, a L-threo-
(2S,4S)-4-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 101 -
fluoro-glutamic acid containing methotrexate analog, a DL-3,3-difluoroglutamic
acid-
containing methotrexate analog, a methotrexate tetrahydroquinazoline analog, a
N-(ac-
aminoacyl) methotrexate derivative, a biotin methotrexate derivative, a D-
glutamic acid
methotrexate analog, a D-erythrou, threo-4-fluoroglutamic acid methotrexate
analog, a (3,y-
methano methotrexate analog, a 10-deazaminopterin (10-EDAM) analog, a y-
tetrazole
methotrexate analog, a N-(L-a-aminoacyl) methotrexate derivative, a meta
isomer of
aminopterin, an ortho isomer of aminopterin, a hydroxymethylmethotrexate, a y-
fluoromethotrexate, a polyglutamyl methotrexate derivative, a gem-
diphosphonate
methotrexate analog (see, e.g., W01988/06158, the contents of which is herein
incorporated
by reference in its entirety), a a-substituted methotrexate analog, a y-
substituted methotrexate
analog, a 5-methyl-5-deaza methotrexate analog (see. e.g., U.S. Pat. No.
4,725,687, the
contents of each of which is herein incorporated by reference in its
entirety), an N delta-acyl-
N a-(4-amino-4-deoxypteroy1)-L-ornithine derivative, a 8-deaza methotrexate
analogue, an
acivicin methotrexate analog, a polymeric platinol methotrexate derivative, a
methotrexate-y-
dimyristoylphophatidylethanolamine, a methotrexate polyglutamate analog, a
poly-y-glutamyl
methotrexate derivative, a deoxyuridylate methotrexate derivative, a
iodoacetyl lysine
methotrexate analog, a 2,omega.-diaminoalkanoid acid-containing methotrexate
analog, a
polyglutamate methotrexate derivative, a 5-methyl-5-deaza analog, a
quinazoline methotrexate
analog, a pyrazine methotrexate analog, a cysteic or homocysteic acid
methotrexate analog
(see, e.g., U.S. Pat. No. 4,490,529, and EPA 0142220, the contents of each of
which is herein
incorporated by reference in its entirety), a y-tert-butyl methotrexate ester,
a fluorinated
methotrexate analog, a folate methotrexate analog, a phosphonoglutamic acid
analog, a poly
(L-lysine) methotrexate conjugate, a dilysine or trilysine methotrexate
derivate, a 7-
hydroxymethotrexate, a poly-y-glutamyl methotrexate analog, a 31,5'-
dichloromethotrexate, a
diazoketone or chloromethylketone methotrexate analog, a 10-
propargylaminopterin, an alkyl
methotrexate homologs, a lectin derivative of methotrexate, a polyglutamate
methotrexate
derivative, a halogentated methotrexate derivative, a 8-alkyl-7,8-dihydro
analog, a 7-methyl
methotrexate derivative, a dichloromethotrexate, a lipophilic methotrexate
derivative, a 3',5'-
dichloromethotrexate, a deaza amethopterin analog, and MX068,or a stereoisomer
thereof.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 102 -
[00168] In additional embodiments, the gamma polyglutamated Antifolate
derivative or analog
has a variant polyglutamate chain. In some embodiments, the polyglutamate
chain contains
one or more natural or synthetic residues other than glutamate. In some
embodiments, the
polyglutamate chain contains one or more glutamyl groups that do not contain
an amide
linkage. In other embodiments, one or more of the glutamyl groups of the
polyglutamate chain
is derivatized.
B. 7ANTIFOL-PG synthesis
[00169] The Antifolate polyglutamate compositions provided herein may be
obtained by
following synthetic procedures known in the art. Procedures for synthesizing
Antifolate
(including different pharmaceutically acceptable salts or acids (e.g.,
Antifolate disodium) and
crystalline and amorphous forms) and intermediates for synthesizing Antifolate
include but are
not limited to those described in U.S. Pat. Nos. U.S. Patent Nos. 2,512,572;
3,892,801;
3,989,703; 4,057,548; 4,067,867; 4,079,056; 4,080,325; 4,106,488; 4,136,101;
4,224,446;
4,306,064; 4,374,987; 4,421,913; 4,558,690; 4,662,359; and 4,767,859; and
Calvert, Semin.
Oncol. 26:3-10 (1999)).
[00170] The Antifolate polyglutamate compositions provided herein may be
obtained by
following synthetic procedures using available reagents and synthetic
intermediates. The
addition of glutamyl residues to the glutamyl residues of the Antifolate can
be accomplished
using synthetic procedures known in the art. In some embodiments, glutamyl
residues are
added serially to the glutamyl residue of the Antifolate. In additional
embodiments,
polyglutamates are added to the glutamyl reside of the Antifolate using "click
chemistry"
methods or other bioconjugate chemistries known to those in the art.
Alternatively, a peptide
of glutamyl residues can be generated of the desired length and added to a
precursor of
pemetrexed which does not have a glutamyl residue. The peptide can be produced
using
synthetic procedures known in the art. In some embodiments, an initial
glutamyl residue is
bonded to wang resin and additional glutamyl residues are added serially via
solid phase
peptide synthesis using F-moc chemistry. After the final glutamyl residue is
added the
pemetrexed precursor is coupled to the peptide and the molecule is cleaved
from the resin.
C. Gamma polyglutamated Antifolate complexes
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 103 -
[00171] The inventors have surprisingly found that polyglutamated
antifolates such as
Antifolate (yPANTIFOL) are able to form complexes with other compositions
including
therapeutic agents, including cytotoxic compounds such as platinum-based
compounds.
Accordingly, in some embodiments, the disclosure provides a complex of a
yPANTIFOL (e.g.,
a yPANTIFOL disclosed herein) and a therapeutic agent or a salt or acid
thereof. In some
embodiments, the disclosure provides a complex of a yPANTIFOL according to any
of [1]-
[11] of the Detailed Description Section and a therapeutic agent or a salt or
acid thereof. In
some embodiments, the yPANTIFOL/complex comprise 7PANTIFOL and a therapeutic
agent.
In some embodiments, the therapeutic agent is a cytotoxic compound such as a
chemotherapeutic agent. In further embodiments, the yPANTIFOL/complex contains
a
platinum-based drug such as platinum-based chemotherapeutic agent (e.g.,
carboplatin and
cisplatin). In other embodiments, the yPANTIFOL/complex contains a taxane-
based
chemotherapeutic agent (e.g., carboplatin and cisplatin). In other
embodiments, the
yPANTIFOL/complex contains a cyclodextrin. In further embodiments, the
yPANTIFOL/complex is encapsulated in a liposome. In some embodiments, the
liposome is a
Lp-aPANTIFOL according to any of [12] [67].
[00172] In further embodiments, the 7PANTIFOL/therapeutic agent complex
comprises one
or more yPANTIFOL containing 2-150, 2-100, 2-75, 2-50, 2-24, 2-30, 2-20, 2-19,
2-15, 2-10,
or 2-5, glutamyl groups. In some embodiments, the yPANTIFOL/therapeutic agent
complex
comprises one or more yPANTIFOL containing 3-10, 3-9, 3-8, or 3-7, glutamyl
groups, or any
range therein between. In other embodiments, the yPANTIFOL/therapeutic agent
complex
comprises one or more yPANTIFOL containing 4-10, 4-9, 4-8, 4-7, 4-6, or 4-5,
glutamyl
groups, or any range therein between. In one particular embodiment, the
complex comprises
one or more yPANTIFOL containing 3-10 glutamyl groups. In further embodiments,
the
yPANTIFOL/therapeutic agent complex comprises one or more yPANTIFOL containing
3-7
glutamyl groups. In another embodiment, the yPANTIFOL/therapeutic agent
complex
comprises one or more yPANTIFOL containing 5 glutamyl groups. In another
embodiment,
the yPANTIFOL/therapeutic agent complex comprises one or more yPANTIFOL
containing 6
glutamyl groups. In some embodiments, the therapeutic agent is a cytotoxic
compound or a
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 104 -
salt or acid thereof. In a further embodiment, the therapeutic agent is a
chemotherapeutic agent
or a salt or acid thereof. In another embodiment, the therapeutic agent is a
platinum-based drug.
In another embodiment, the therapeutic agent is a taxane-based drug. In
additional
embodiments, the molar ratio of yPANTIFOL/therapeutic agent in the complex is
in the range
1-10:1. In some embodiments, the molar ratio of yPANTIFOL/therapeutic agent in
the
complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1. In some embodiments,
the
yPANTIFOL/therapeutic agent complex is encapsulated in a liposome (e.g., as
described
herein or otherwise known in the art). In some embodiments, the molar ratio of
yPANTIFOL/therapeutic agent in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6,
1:7, 1:8, 1:9, 1:10,
1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or
1:>50. In some
embodiments, the molar ratio of yPANTIFOL/therapeutic agent in the complex is:
1:1, 2:1,
3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1,
17:1, 18:1, 19:1, 20:1,
(21-50):1, or >50:1. In some embodiments, the yPANTIFOL/therapeutic agent
complex is
encapsulated in a liposome (e.g., as described herein or otherwise known in
the art). In some
embodiments, the liposome is a Lp-aPANTIFOL according to any of [12]467] of
the Detailed
Description Section.
[00173] In an alternative embodiment, the yPANTIFOL complex comprises
yPANTIFOL and
cyclodextrin. In some embodiments, the yPANTIFOL complex comprises a yPANTIFOL
according to any of [1]-[11] of the Detailed Description Section. In some
embodiments, the
yPANTIFOL complex comprises an Antifolate described in Section I. In some
embodiments,
the molar ratio of yPANTIFOL (e.g., yPANTIFOL salt)/cyclodextrin in the
complex is in the
range 1-20:1, or any range therein between. In some embodiments, the molar
ratio of
yPANTIFOL/cyclodextrin in the complex is in the range 1-10:1, or any range
therein between.
In further embodiments, the molar ratio of yPANTIFOL/cyclodextrin in the
complex is in the
range 2-8:1, or any range therein between. In some embodiments, the molar
ratio of
yPANTIFOL/cyclodextrin in the complex is: 1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1,
8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some embodiments,
the molar ratio
of yPANTIFOL/cyclodextrin in the complex is: 1:1, 2:1, 3:1, 4:1, 5:1, 6:1,
7:1, 8:1, 9:1, 10:1,
11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or
>50:1. In other
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 105 -
embodiments, the molar ratio of 7PANTIFOL/cyclodextrin in the complex is in
the range 1:1-
20, 1:1-10, or 1:2-8, or any range therein between. In some embodiments, the
molar ratio of
yPANTIFOL/cyclodextrin in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8,
1:9, 1:10, 1:11,
1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20. In some embodiments,
the molar ratio
of 7PANTIFOL/cyclodextrin in the complex is: 1:1, 1:2, 1:3, 1:4, 1:5, 1:6,
1:7, 1:8, 1:9, 1:10,
1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or
1:>50. In some
embodiments, the yPANTIFOL/ cyclodextrin complex is encapsulated in a liposome
(e.g., as
described herein or otherwise known in the art). In some embodiments, the
liposome is a Lp-
aPANTIFOL according to any of [12[467] of the Detailed Description Section.
[00174] In some embodiments, the disclosure provides a composition
comprising a
yPANTIFOL/platinum-based chemotherapeutic agent complex. In some embodiments,
the
complex comprises a yPANTIFOL according to any of [1]-[11] of the Detailed
Description
Section. In some embodiments, the yPANTIFOL complex comprises a polyglutamated
Antifolate described in Section I. In some embodiments, the platinum-based
chemotherapeutic
agent is selected from: cisplatin, carboplatin, and oxaliplatin, or a salt or
acid thereof. In other
embodiments, the yPANTIFOL/platinum-based chemotherapeutic agent complex
comprises
an analog of a cisplatin, carboplatin, oxaliplatin, or a salt or acid thereof.
In some embodiments,
the molar ratio of yPANTIFOL/platinum-based agent in the complex is in the
range 1-20:1, or
any range therein between. In some embodiments, the molar ratio of
yPANTIFOL/platinum-
based agent in the complex is in the range 1-10:1, or any range therein
between. In further
embodiments, the molar ratio of yPANTIFOL/platinum-based agent in the complex
is in the
range 2-8:1, or any range therein between. In some embodiments, the molar
ratio of
yPANTIFOL/platinum-based agent in the complex is 11:1, 2:1, 3:1, 4:1, 5:1,
6:1, 7:1, 8:1, 9:1,
10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some
embodiments, the
molar ratio of yPANTIFOL/platinum-based agent in the complex is 1:1, 2:1, 3:1,
4:1, 5:1, 6:1,
7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1,
20:1, (21-50):1, or >50:1.
In other embodiments, the molar ratio of yPANTIFOL/ platinum-based
chemotherapeutic
agent in the complex is in the range 1:1-20, 1:1-10, or 1:2-8, or any range
therein between. In
some embodiments, the molar ratio of yPANTIFOL/ platinum-based agent in the
complex is:
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 106 -
1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15,
1:16, 1:17, 1:18, 1:19, or
1:20. In some embodiments, the molar ratio of yPANTIFOL/ platinum-based agent
in the
complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13,
1:14, 1:15, 1:16, 1:17,
1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In additional embodiments, the
yPANTIFOL//platinum-
based agent complex is encapsulated in a liposome. In some embodiments, the
liposome is a
Lp-aPANTIFOL according to any of [121467] of the Detailed Description Section.
[00175] In additional embodiments, the yPANTIFOL/platinum-based
chemotherapeutic agent
complex comprises an analog of a cisplatin, carboplatin, oxaliplatin, or a
salt or acid thereof.
In some embodiments, the complex comprises a yPANTIFOL according to any of [1]-
Ell] of
the Detailed Description Section. In some embodiments, the yPANTIFOL complex
comprises
a polyglutamated Antifolate described in Section I. In some embodiments, the
molar ratio of
-yPANTIFOL/platinum-based analog in the complex is in the range 1-20:1, or any
range therein
between. In some embodiments, the molar ratio of yPANTIFOL/platinum-based
analog in the
complex is in the range 1-10:1, or any range therein between. In further
embodiments, the
molar ratio of yPANTIFOL/platinum-based agent in the complex is in the range 2-
8:1, or any
range therein between. In some embodiments, the molar ratio of
yPANTIFOL/platinum-based
analog in the complex is 11:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1,
11:1, 12:1, 13:1, 14:1,
15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some embodiments, the molar ratio of
yPANTIFOL/platinum-based analog in the complex is 11:1, 2:1, 3:1, 4:1, 5:1,
6:1, 7:1, 8:1,
9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1,18:1, 19:1, 20:1, (21-
50):1, or >50:1. In some
embodiments, the molar ratio of yPANTIFOL/ platinum-based agent in the complex
is: 1:2,
1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16,
1:17, 1:18, 1:19, or
1:20. In some embodiments, the molar ratio of yPANTIFOL/ platinum-based agent
in the
complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13,
1:14, 1:15, 1:16, 1:17,
1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In additional embodiments, the
yPANTIFOL//platinum-
based analog complex is encapsulated in a liposome. In some embodiments, the
liposome is a
Lp-aPANTIFOL according to any of [121467] of the Detailed Description Section.
[00176] In further embodiments, the disclosure provides a complex
containing yPANTIFOL
and cisplatin or a salt or acid thereof. In some embodiments, the complex
comprises a
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 107 -
yPANTIFOL according to any of [1]-[11] of the Detailed Description Section. In
some
embodiments, the yPANTIFOL complex comprises an Antifolate described in
Section I. In
some embodiments, the molar ratio of yPANTIFOL/cisplatin (or cisplatin salt or
acid) in the
complex is in the range 1-20:1, or any range therein between. In some
embodiments, the molar
ratio of yPANTIFOL/cisplatin (or cisplatin salt or acid) in the complex is in
the range 1-10:1,
or any range therein between. In further embodiments, the molar ratio of
yPANTIFOL/cisplatin
(or cisplatin salt or acid) in the complex is in the range 2-8:1, or any range
therein between. In
some embodiments, the molar ratio of yPANTIFOL/ cisplatin (or cisplatin salt
or acid) in the
complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13,
1:14, 1:15, 1:16, 1:17,
1:18, 1:19, or 1:20. In some embodiments, the molar ratio of
yPANTIFOL/cisplatin (or
cisplatin salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1,
8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In
some embodiments,
the molar ratio of yPANTIFOL/cisplatin (or cisplatin salt or acid) in the
complex is: 1:2, 1:3,
1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17,
1:18, 1:19, or 1:20. In
some embodiments, the molar ratio of yPANTIFOL/cisplatin (or cisplatin salt or
acid) in the
complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13,
1:14, 1:15, 1:16, 1:17,
1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In additional embodiments, the
yPANTIFOL//cisplatin
(or cisplatin salt or acid) complex is encapsulated in a liposome. In some
embodiments, the
liposome is a Lp-aPANTIFOL according to any of [12[467] of the Detailed
Description
Section.
[00177] In another embodiment, the disclosure provides a complex containing
yPANTIFOL
and carboplatin or a salt or acid thereof. In some embodiments, the complex
comprises a
yPANTIFOL according to any of [1]-[11] of the Detailed Description Section. In
some
embodiments, the yPANTIFOL complex comprises a polyglutamated Antifolate
described in
Section I, herein. In some embodiments, the molar ratio of
yPANTIFOL/carboplatin (or
carboplatin salt or acid) in the complex is in the range 1-20:1, or any range
therein between. In
further embodiments, the molar ratio of yPANTIFOL/carboplatin (or carboplatin
salt or acid)
in the complex is in the range 1-10:1, or any range therein between. In
further embodiments,
the molar ratio of yPANTIFOL/carboplatin (or carboplatin salt or acid) in the
complex is in
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 108 -
the range 2-8:1, or any range therein between. In some embodiments, the molar
ratio of
yPANTIFOL/ carboplatin (or carboplatin salt or acid) in the complex is 1:1,
2:1, 3:1, 4:1, 5:1,
6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1,
19:1, or 20:1. In some
embodiments, the molar ratio of yPANTIFOL/ carboplatin (or carboplatin salt or
acid) in the
complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1,
13:1, 14:1, 15:1, 16:1,
17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar
ratio of
yPANTIFOL/carboplatin in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8,
1:9, 1:10, 1:11,
1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20. In some embodiments,
the molar ratio
of 7PANTIFOL/carboplatin in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8,
1:9, 1:10, 1:11,
1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In
additional
embodiments, the yPANTIFOL/carboplatin (or carboplatin salt or acid) complex
is
encapsulated in a liposome. In some embodiments, the liposome is a Lp-
aPANTIFOL
according to any of [12[467] of the Detailed Description Section.
[00178] In another embodiment, the disclosure provides a complex containing
yPANTIFOL
and oxaliplatin, or a salt or acid thereof. In some embodiments, the complex
comprises a
yPANTIFOL according to any of [1]-[11] of the Detailed Description Section. In
some
embodiments, the yPANTIFOL complex comprises a polyglutamated Antifolate
described in
Section I. In some embodiments, the molar ratio of yPANTIFOL/oxaliplatin (or
oxaliplatin salt
or acid) in the complex is in the range 1-20:1, or any range therein between.
In further
embodiments, the molar ratio of yPANTIFOL/oxaliplatin (or oxaliplatin salt or
acid) in the
complex is in the range 1-10:1, or any range therein between. In further
embodiments, the
molar ratio of yPANTIFOL/ oxaliplatin (or oxaliplatin salt or acid) in the
complex is in the
range 2-8:1, or any range therein between. In some embodiments, the molar
ratio of
yPANTIFOL/ oxaliplatin (or oxaliplatin salt or acid) in the complex is: 1:2,
1:3, 1:4, 1:5, 1:6,
1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or
1:20. In some
embodiments, the molar ratio of yPANTIFOL/oxaliplatin (or oxaliplatin salt or
acid) in the
complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1,
13:1, 14:1, 15:1, 16:1,
17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar
ratio of
yPANTIFOL/oxaliplatin (or oxaliplatin salt or acid) in the complex is: 1:2,
1:3, 1:4, 1:5, 1:6,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 109 -
1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or
1:20. In some
embodiments, the molar ratio of yPANTIFOL/oxaliplatin (or oxaliplatin salt or
acid) in the
complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13,
1:14, 1:15, 1:16, 1:17,
1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In additional embodiments, the
yPANTIFOL/oxaliplatin
(or oxaliplatin salt or acid) complex is encapsulated in a liposome. In some
embodiments, the
liposome is a Lp-aPANTIFOL according to any of [12[467] of the Detailed
Description
Section.
[00179] In additional embodiments, the disclosure provides a complex
comprising
yPANTIFOL and a platinum-based chemotherapeutic agent (platinum) selected
from:
nedaplatin, heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol,
cycloplatin,
dexormaplatin, spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin,
ormaplatin, zeniplatin,
platinum-triamine, traplatin, enloplatin, JM216, NK121, CI973, DWA 2114R,
NDDP, and
dedaplatin, or a salt or acid thereof. In other embodiments, the
yPANTIFOL/platinum-based
chemotherapeutic agent complex comprises an analog of nedaplatin, heptaplatin,
lobaplatin,
stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin,
picoplatin, triplatin,
tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin,
enloplatin, JM216,
NK121, CI973, DWA 2114R, NDDP, or dedaplatin, or a salt or acid thereof. In
some
embodiments, the molar ratio of yPANTIFOL/platinum-based chemotherapeutic
agent
("platinum")(or platinum-based chemotherapeutic agent salt or acid) in the
complex is in the
range 1-20:1, or any range therein between. In some embodiments, the complex
comprises a
yPANTIFOL according to any of [1]-[11] of the Detailed Description Section. In
some
embodiments, the yPANTIFOL complex comprises a polyglutamated Antifolate
described in
Section I. In further embodiments, the molar ratio of yPANTIFOL/platinum (or
platinum salt
or acid) in the complex is in the range 1-10:1, or any range therein between.
In further
embodiments, the molar ratio of yPANTIFOL/platinum (or platinum salt or acid)
in the
complex is in the range 2-8:1, or any range therein between. In some
embodiments, the molar
ratio of yPANTIFOL/platinum (or platinum salt or acid) in the complex is 1:1,
2:1, 3:1, 4:1,
5:1, 6:1,7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1,
19:1, or 20:1. In some
embodiments, the molar ratio of yPANTIFOL/platinum (or platinum salt or acid)
in the
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 110 -
complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1,
13:1, 14:1, 15:1, 16:1,
17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar
ratio of
yPANTIFOL/platinum (or platinum salt or acid) in the complex is: 1:2, 1:3,
1:4, 1:5, 1:6, 1:7,
1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.
In some
embodiments, the molar ratio of yPANTIFOL/platinum (or platinum salt or acid)
in the
complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13,
1:14, 1:15, 1:16, 1:17,
1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In additional embodiments, the
yPANTIFOL/platinum
(or salt or acid or analog thereof) complex is encapsulated in a liposome. In
some
embodiments, the liposome is a Lp-aPANTIFOL according to any of [12]467] of
the Detailed
Description Section.
[00180] In some embodiments, the disclosure provides a composition
comprising a
yPANTIFOL/taxane-based chemotherapeutic agent (taxane) complex. In some
embodiments,
the complex comprises a yPANTIFOL according to any of [1]-[11] of the Detailed
Description
Section. In some embodiments, the yPANTIFOL complex comprises a polyglutamated
Antifolate described in Section I. In some embodiments, the taxane -based
chemotherapeutic
agent is selected from: paclitaxel (PTX), docetaxel (DTX), larotaxel (LTX),
and cabazitaxel
(CTX), or a salt or acid thereof. In some embodiments, the molar ratio of
yPANTIFOL/taxane
(or taxane salt or acid) in the complex in the complex is in the range 1-20:1,
or any range
therein between. In further embodiments, the molar ratio of yPANTIFOL/taxane
(or taxane
salt or acid) in the complex is in the range 1-10:1, or any range therein
between. In further
embodiments, the molar ratio of yPANTIFOL/taxane (or taxane salt or acid) in
the complex is
in the range 2-8:1, or any range therein between. In some embodiments, the
molar ratio of
yPANTIFOL/taxane (or taxane salt or acid) in the complex is 1:1, 2:1, 3:1,
4:1, 5:1, 6:1, 7:1,
8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1.
In some
embodiments, the molar ratio of yPANTIFOL/taxane (or taxane salt or acid) in
the complex is
1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1,
15:1, 16:1, 17:1, 18:1,
19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar ratio of
yPANTIFOL/taxane
(or taxane salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8,
1:9, 1:10, 1:11, 1:12,
1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20. In some embodiments, the
molar ratio of
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 111 -
yPANTIFOUtaxane (or taxane salt or acid) in the complex is: 1:2, 1:3, 1:4,
1:5, 1:6, 1:7, 1:8,
1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-
50), or 1:>50. In
additional embodiments, the yPANTIFOL/taxane (or taxane salt or acid) complex
is
encapsulated in a liposome. In some embodiments, the liposome is a Lp-
aPANTIFOL
according to any of [12[467] of the Detailed Description Section.
[00181] In additional embodiments, the disclosure provides a complex
comprising
yPANTIFOL and paclitaxel (PTX), or a salt or acid thereof. In other
embodiments, the
yPANTIFOL/paclitaxel (or paclitaxel salt or acid) chemotherapeutic agent
complex comprises
an analog of paclitaxel (PTX), or a salt or acid thereof. In some embodiments,
the complex
comprises a yPANTIFOL according to any of [1]-[11] of the Detailed Description
Section. In
some embodiments, the yPANTIFOL complex comprises a polyglutamated Antifolate
described in Section I. In some embodiments, the molar ratio of
TPANTIFOL/paclitaxel (or
paclitaxel salt or acid) in the complex is in the range 1-20:1, or any range
therein between. In
further embodiments, the molar ratio of yPANTIFOL/paclitaxel (or paclitaxel
salt or acid) in
the complex is in the range 1-10:1, or any range therein between. In further
embodiments, the
molar ratio of yPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the
complex is in the range
2-8:1, or any range therein between. In some embodiments, the molar ratio of
yPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is 1:1,2:1,
3:1, 4:1, 5:1, 6:1,
7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or
20:1. In some
embodiments, the molar ratio of yPANTIFOL/paclitaxel (or paclitaxel salt or
acid) in the
complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1,
13:1, 14:1, 15:1, 16:1,
17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar
ratio of
yPANTIFOL/paclitaxel (or paclitaxel salt or acid) in the complex is: 1:2, 1:3,
1:4, 1:5, 1:6, 1:7,
1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.
In some
embodiments, the molar ratio of yPANTIFOL/paclitaxel (or paclitaxel salt or
acid) in the
complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13,
1:14, 1:15, 1:16, 1:17,
1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In additional embodiments, the
yPANTIFOL/paclitaxel
(or paclitaxel salt or acid) complex is encapsulated in a liposome. In some
embodiments, the
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 112 -
liposome is a Lp-aPANTIFOL according to any of [12[467] of the Detailed
Description
Section.
[00182] In additional embodiments, the disclosure provides a complex
comprising
yPANTIFOL and docetaxel (DTX), or a salt or acid thereof. In other
embodiments, the
yPANTIFOL/docetaxel complex comprises an analog of docetaxel (DTX), or a salt
or acid
thereof. In some embodiments, the complex comprises a yPANTIFOL according to
any of [1]-
[11] of the Detailed Description Section. In some embodiments, the yPANTIFOL
complex
comprises a polyglutamated Antifolate described in Section I. In some
embodiments, the molar
ratio of yPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is in
the range 1-
20:1, or any range therein between. In some embodiments, the molar ratio of
yPANTIFOL/docetaxel (or docetaxel salt or acid) in the complex is in the range
1-10:1, or any
range therein between. In further embodiments, the molar ratio of
yPANTIFOL/docetaxel (or
docetaxel salt or acid) in the complex is in the range 2-8:1, or any range
therein between. In
some embodiments, the molar ratio of 7PANTIFOL/ docetaxel (or docetaxel salt
or acid) in
the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1,
13:1, 14:1, 15:1, 16:1,
17:1, 18:1, 19:1, or 20:1. In some embodiments, the molar ratio of
yPANTIFOL/docetaxel (or
docetaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1,
8:1, 9:1, 10:1, 11:1,
12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In
some embodiments,
the molar ratio of yPANTIFOL/docetaxel (or docetaxel salt or acid) in the
complex is: 1:2, 1:3,
1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17,
1:18, 1:19, or 1:20. In
some embodiments, the molar ratio of yPANTIFOL/docetaxel (or docetaxel salt or
acid) in the
complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13,
1:14, 1:15, 1:16, 1:17,
1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In additional embodiments, the
yPANTIFOL/docetaxel
(or docetaxel salt or acid) complex is encapsulated in a liposome. In some
embodiments, the
liposome is a Lp-aPANTIFOL according to any of [12[467] of the Detailed
Description
Section.
[00183] In additional embodiments, the disclosure provides a complex
comprising
yPANTIFOL and larotaxel (LTX), or a salt or acid thereof. In some embodiments,
the complex
comprises a yPANTIFOL according to any of [1]-[11] of the Detailed Description
Section. In
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 113 -
some embodiments, the yPANTIFOL complex comprises a polyglutamated Antifolate
described in Section I. In some embodiments, the molar ratio of
yPANTIFOL/larotaxel (or
larotaxel salt or acid) in the complex is in the range 1-20:1, or any range
therein between. In
further embodiments, the molar ratio of yPANTIFOL/larotaxel (or larotaxel salt
or acid) in the
complex is in the range 1-10:1, or any range therein between. In further
embodiments, the
molar ratio of yPANTIFOL/ larotaxel (or larotaxel salt or acid) in the complex
is in the range
2-8:1, or any range therein between. In some embodiments, the molar ratio of
yPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is 1:1, 2:1,
3:1, 4:1, 5:1, 6:1,
7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or
20:1. In some
embodiments, the molar ratio of yPANTIFOL/larotaxel (or larotaxel salt or
acid) in the
complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1,
13:1, 14:1, 15:1, 16:1,
17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In some embodiments, the molar
ratio of
yPANTIFOL/larotaxel (or larotaxel salt or acid) in the complex is: 1:2, 1:3,
1:4, 1:5, 1:6, 1:7,
1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20.
In some
embodiments, the molar ratio of yPANTIFOL/larotaxel (or larotaxel salt or
acid) in the
complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13,
1:14, 1:15, 1:16, 1:17,
1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In additional embodiments, the
yPANTIFOL/larotaxel
(or larotaxel salt or acid) complex is encapsulated in a liposome. In some
embodiments, the
liposome is a Lp-aPANTIFOL according to any of [12]-[67] of the Detailed
Description
Section.
[00184] In
additional embodiments, the disclosure provides a complex comprising
yPANTIFOL and cabazitaxel (CTX), or a salt or acid thereof. In some
embodiments, the
complex comprises a yPANTIFOL according to any of [1]-[11] of the Detailed
Description
Section. In some embodiments, the yPANTIFOL complex comprises a polyglutamated
Antifolate described in Section I. In
some embodiments, the molar ratio of
yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the
range 1-20:1, or
any range therein between. In further embodiments, the molar ratio of
yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the
range 1-10:1, or
any range therein between. In
further embodiments, the molar ratio of
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 114 -
-yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is in the
range 2-8:1, or
any range therein between. In some embodiments, the molar ratio of
yPANTIFOL/cabazitaxel
(or cabazitaxel salt or acid) in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1,
7:1, 8:1, 9:1, 10:1,
11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, or 20:1. In some
embodiments, the molar
ratio of yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is
1:1, 2:1, 3:1,
4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1,
18:1, 19:1, 20:1, (21-
50):1, or >50:1. In some embodiments, the molar ratio of yPANTIFOL/cabazitaxel
(or
cabazitaxel salt or acid) in the complex is: 1:2, 1:3, 1:4, 1:5, 1:6, 1:7,
1:8, 1:9, 1:10, 1:11, 1:12,
1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, or 1:20. In some embodiments, the
molar ratio of
yPANTIFOL/cabazitaxel (or cabazitaxel salt or acid) in the complex is: 1:2,
1:3, 1:4, 1:5, 1:6,
1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19,
1:20, 1:(21-50), or 1:>50.
In additional embodiments, the yPANTIFOL/cabazitaxel (or cabazitaxel salt or
acid) complex
is encapsulated in a liposome. In some embodiments, the liposome is a Lp-
aPANTIFOL
according to any of [12]-[67] of the Detailed Description Section.
[00185] In additional embodiments, the disclosure provides a complex
comprising
yPANTIFOL and another anti-metabolite, or a salt or acid thereof. In some
embodiments, the
complex comprises a yPANTIFOL according to any of [1]-[11] of the Detailed
Description
Section. In some embodiments, the yPANTIFOL complex comprises a polyglutamated
Antifolate described in Section I. An anti-metabolite is a chemical with a
structure that is
similar to a metabolite required for normal biochemical reactions, yet
different enough to
interfere with one or more normal functions of cells, such as cell division.
In some
embodiments, the disclosure provides a complex comprising yPANTIFOL and
Antifolate
(ANTIFOL), or a salt or acid thereof. In some embodiments, the disclosure
provides a complex
comprising yPANTIFOL and an anti-metabolite selected from, gemcitabine,
fluorouracil,
capecitabine, an antifolate (e.g., Antifolate, raltitrexed), tegafur, cytosine
arabinoside,
thioguanine, 5-azacytidine, 6-mercaptopurine, azathioprine, 6-thioguanine,
pentostatin,
fludarabine phosphate, and cladribine, as well as pharmaceutically acceptable
salt or acids,
acids, or derivatives of any of these. In some embodiments, the molar ratio of
yPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) in the
complex is in
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 115 -
the range 1-20:1, or any range therein between. In further embodiments, the
molar ratio of
yPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) in the
complex is in
the range 1-10:1, or any range therein between. In further embodiments, the
molar ratio of
yPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) in the
complex is in
the range 2-8:1, or any range therein between. In some embodiments, the molar
ratio of
yPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) in the
complex is 1:1,
2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1,
16:1, 17:1, 18:1, 19:1, or
20:1. In some embodiments, the molar ratio of yPANTIFOL/anti-metabolite (or
anti-
metabolite salt or acid, or prodrug) in the complex is 1:1, 2:1, 3:1, 4:1,
5:1, 6:1, 7:1, 8:1, 9:1,
10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1,
or >50:1. In some
embodiments, the molar ratio of yPANTIFOL/anti-metabolite (or anti-metabolite
salt or acid,
or prodrug) in the complex is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10,
1:11, 1:12, 1:13, 1:14,
1:15, 1:16, 1:17, 1:18, 1:19, or 1:20. In
some embodiments, the molar ratio of
yPANTIFOL/anti-metabolite (or anti-metabolite salt or acid, or prodrug) in the
complex is 1:2,
1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16,
1:17, 1:18, 1:19, 1:20,
1:(21-50), or 1:>50. In additional embodiments, the yPANTIFOL/anti-metabolite
(or anti-
metabolite salt or acid, or prodrug) complex is encapsulated in a liposome. In
some
embodiments, the liposome is a Lp-aPANTIFOL according to any of [12]467] of
the Detailed
Description Section.
[00186] In
additional embodiments, the disclosure provides a complex of yPANTIFOL (e.g.,
a yPANTIFOL disclosed herein) and a cyclodextrin. Cyclodextrins (CDs) are
groups of cyclic
oligosaccharides which have been shown to improve physicochemical properties
of many
drugs through formation of complexes. CDs are cyclic oligosaccharides composed
of several
D-glucose units linked by a-(1,4) bonds. This cyclic configuration provides a
hydrophobic
internal cavity and gives the CDs a truncated cone shape. Many hydroxyl groups
are situated
on the edges of the ring which make the CDs both lipophilic and soluble in
water. As a result,
CDs are able to form complexes with a wide variety of hydrophobic agents, and
thus change
the physical-chemical properties of these complexed agents. In some
embodiments, the
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 116 -
complex comprises a yPANTIFOL according to any of [1]-[11] of the Detailed
Description
Section.
[00187] The terms "cyclodextrin" or "CD" unless otherwise specified herein,
refer generally
to a parent or derivatized cyclic oligosaccharide containing a variable number
of (a-1,4)-linked
D-glucopyranoside units that is able to form a complex with a Antifolate-PG.
Each
cyclodextrin glucopyranoside subunit has secondary hydroxyl groups at the 2
and 3 positions
and a primary hydroxyl group at the 6-position. The terms "parent",
"underivatized", or "inert",
cyclodextrin refer to a cyclodextrin containing D-glucopyranoside units having
the basic
formula C6H1206 and a glucose structure without any additional chemical
substitutions (e.g.,
a-cyclodextrin consisting of 6 D-glucopyranoside units, a f3-cyclodextrin
consisting of 7 D-
glucopyranoside units, and a y-cyclodextrin cyclodextrin consisting of 8 D-
glucopyranoside
units). The physical and chemical properties of a parent cyclodextrin can be
modified by
derivatizing the hydroxyl groups with other functional groups. Any substance
located within
the cyclodextrin internal phase is said to be "complexed" with the
cyclodextrin, or to have
formed a complex (inclusion complex) with the cyclodextrin.
[00188] As used herein, there are no particular limitations on the
cyclodextrin component of
the yPANTIFOL/cyclodextrin complexes so long as the cyclodextrins can form
complexes
with the yPANTIFOL. In particular embodiments, the cyclodextrins have been
derivatized to
bear ionizable (e.g., weakly basic and/or weakly acidic) functional groups to
facilitate complex
formation with yPANTIFOL and/or liposome encapsulation.
[00189] Modifications of the hydroxyl groups of cyclodextrins, such as
those facing away from
the cyclodextrin interior phase, with ionizable chemical groups is known to
facilitate the
loading of cyclodextrins and therapeutic agents complexed with the
cyclodextrins. In some
embodiments, the cyclodextrin of the yPANTIFOL/cyclodextrin complex has at
least 2, 3, 4,
5, 6, 6, 7, 8, 9, or 10, hydroxyl group substituted with an ionizable chemical
group. The term
"charged cyclodextrin" refers to a cyclodextrin having one or more of its
hydroxyl groups
substituted with a charged moiety. Such a moiety can itself be a charged group
or it can
comprise an organic moiety (e.g., a C1-C6 alkyl or C1-C6 alkyl ether moiety)
substituted with
one or more charged moieties.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 117 -
[00190] In some embodiments, the "ionizable" or "charged" moieties of a CD
derivative are
weakly ionizable. Weakly ionizable moieties are those that are either weakly
basic or weakly
acidic. Weakly basic functional groups (W) have a pKa of between about 6.0-
9.0, 6.5-8.5, 7.0-
8.0, 7.5-8.0, and any range in between inclusive according to CH3-W.
Similarly, weakly acidic
functional groups (X) have a log dissociation constant (pKa) of between about
3.0-7.0, 4.0-
6.5, 4.5-6.5, 5.0-6.0, 5.0-5.5, and any range in between inclusive according
to CH3-X.
Representative anionic moieties include, without limitation, carboxylate,
carboxymethyl,
succinyl, sulfonyl, phosphate, sulfoalkyl ether, sulphate carbonate,
thiocarbonate,
dithiocarbonate, phosphate, phosphonate, sulfonate, nitrate, and borate
groups. Representative
cationic moieties include, without limitation, amino, guanidine, and
quarternary ammonium
groups.
[00191] In another embodiment, the derivatized cyclodextrin is a
"polyanion" or "polycation."
A polyanion is a derivatized cyclodextrin having more than one negatively
charged group
resulting in net a negative ionic charge of more than two units. A polycation
is a derivatized
cyclodextrin having more than one positively charged group resulting in net
positive ionic
charger of more than two units.
[00192] In another embodiment, the derivatized cyclodextrin is a
"chargeable amphiphile." By
"chargeable" is meant that the amphiphile has a pK in the range pH 4 to pH 8
or 8.5. A
chargeable amphiphile may therefore be a weak acid or base. By "amphoteric"
herein is meant
a derivatized cyclodextrin having a ionizable groups of both anionic and
cationic character
wherein: (a) at least one, and optionally both, of the cation and anionic
amphiphiles is
chargeable, having at least one charged group with a pK between 4 and 8 to
8.5, (b) the cationic
charge prevails at pH 4, and (c) the anionic charge prevails at pH 8 to 8.5.
[00193] In some embodiments, the "ionizable" or "charged" derivatized
cyclodextrin as a
whole, whether polyionic, amphiphilic, or otherwise, are weakly ionizable
(i.e., have a pKai of
between about 4.0-8.5, 4.5-8.0, 5.0-7.5, 5.5-7.0, 6.0-6.5, and any range in
between inclusive).
[00194] Any one, some, or all hydroxyl groups of any one, some or all a-D-
glucopyranoside
units of a cyclodextrin can be modified to an ionizable chemical group as
described herein.
Since each cyclodextrin hydroxyl group differs in chemical reactivity,
reaction with a
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 118 -
modifying moiety can produce an amorphous mixture of positional and optical
isomers.
Alternatively, certain chemistry can allow for pre-modified a-D-
glucopyranoside units to be
reacted to form uniform products.
[00195] The aggregate substitution that occurs for cyclodextrin derivatives
in a mixture is
described by a term referred to as the degree of substitution. For example, a
6-ethylenediamino-
p-cyclodextrin with a degree of substitution of seven would be composed of a
distribution of
isomers of 6-ethylenediamino-I3-cyclodextrin in which the average number of
ethylenediamino
groups per 6-ethylenediamino-f3-cyclodextrin molecule is seven. The degree of
substitution for
a cyclodextrin derivative mixture can routinely be determined using mass
spectrometry or
nuclear magnetic resonance spectroscopy.
[00196] In one embodiment, at least one hydroxyl moieties facing away from
the cyclodextrin
interior is substituted with an ionizable chemical group. For example, the C2,
C3, C6, C2 and
C3, C2 and C6, C3 and C6, and all three of C2-C3-C6 hydroxyls of at least one
a-D-
glucopyranoside unit are substituted with an ionizable chemical group. Any
such combination
of hydroxyls can similarly be combined with at least two, three, four, five,
six, seven, eight,
nine, ten, eleven, up to all of the alpha-D-glucopyranoside units in the
modified cyclodextrin
as well as in combination with any degree of substitution described herein.
One such derivative
is a sulfoalkyl ether cyclodextrin (SAE-CD). Sulfobutyl ether derivatives of
beta cyclodextrin
(SBE-I3-CD) have been demonstrated to have significantly improved aqueous
solubility
compared to the parent cyclodextrin.
[00197] Additional cyclodextrin derivatives that may be complexed with
therapeutic agents in
the disclosed liposome compositions include sugammadex or Org-25969, in which
the 6-
hydroxy groups on y-CD have been replaced by carboxythio acetate ether
linkages, and
hydroxybuteny1-13-CD. Alternative forms of cyclodextrin include: 2,6-Di-O-
methyl-13-CD
(DIMEB), 2-hydroxylpropy1-3-cyclodextrin (HP-I3-CD), randomly methylated-I3-
cyclodextrin
(RAMEB), sulfobutyl ether 13-cyclodextrin (SBE-13-CD), and sulfobutylether-y-
cyclodextrin
(SBEyCD), sulfobutylated beta-cyclodextrin sodium salt, (2-Hydroxypropy1)-
alpha-
cyclodextrin, (2-Hydroxypropy1)-beta-cyclodextrin, (2-Hydroxy-propy1)-y-
cyclodextrin, 2,6-
di-O-methyl)-beta-cyclodextrin (DIMEB -50 Heptakis), 2,3,6-tri-O-methyl)-beta-
cyclodextrin
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 119 -
(TRIMEB Heptakis), methyl-beta-cyclodextrin, octakis (6-deoxy-6-iodo)-y-
cyclodexrin, and,
octakis (6-deoxy-6-bromo)-gamma-cyclodexrin.
[00198] In some embodiments, the cyclodextrin(s) has a high solubility in
water in order to
facilitate entrapment of a larger amount of the cyclodextrin in the liposome
internal phase. In
some embodiments, the water solubility of the cyclodextrin is at least 10
mg/mL, 20 mg/mL,
30 mg/mL, 40 mg/mL, 50 mg/mL, 60 mg/mL, 70 mg/mL, 80 mg/mL, 90 mg/mL, 100
mg/mL
or higher. In some embodiments, the water solubility of the cyclodextrin(s) is
within a range
of 10-150 mg/mL, 20-100 mg/mL 20-75 mg/mL, and any range in between inclusive.
[00199] In some embodiments, a large association constant between the
cyclodextrin and the
yPANTIFOL and/or other therapeutic agent complexed with cyclodextrin is
preferable and can
be obtained by selecting the number of glucose units in the cyclodextrin based
on the size of
the therapeutic agent (see, for example, Albers et al., Crit. Rev. Therap.
Drug Carrier Syst.
12:311-337 (1995); Stella et al., Toxicol. Pathol. 36:30-42 (2008). When the
association
constant depends on pH, the cyclodextrin can be selected such that the
association constant
becomes large at the pH of the liposome internal phase. As a result, the
solubility (nominal
solubility) of the therapeutic agent in the presence of cyclodextrin can be
further improved. In
some embodiments, the association constant of the cyclodextrin with the
therapeutic agent is
100, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, or higher. In some
embodiments, the
association constant of the cyclodextrin with the therapeutic agent is in the
range 100-1, 200,
200-1,000, 300-750, and any range therein between.
[00200] In some embodiments, the cyclodextrin of the yPANTIFOL/cyclodextrin
complex
and/or cyclodextrin/therapeutic agent complex is underivatized.
[00201] In some embodiments, the cyclodextrin of the yPANTIFOL/cyclodextrin
complex
and/or cyclodextrin/therapeutic agent complex is derivatized. In further
embodiments, the
cyclodextrin derivative of the complex has the structure of Formula I:
11.,0
0 R.20 Rip 0
ii40 II -CI R80 =
wherein: n is 4, 5, or 6;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 120 -
wherein Ri, R2, R3, R4, Rs, R6, R7, R8, and R9 are each, independently, -H, a
straight chain or
branched Ci-Cg- alkylene group, or an optionally substituted straight-chain or
branched Ci-
C6 group, wherein at least one of Ri, R2, R3, R4, Rs, R6, R7, R8 and R9 is a
straight-chain or
branched C i-C8- alkylene (e.g., Ci-C8-(alkylene)-S 03- group);
[00202] In some embodiments, the cyclodextrin derivative of the
yPANTIFOL/cyclodextrin
complex and/or cyclodextrin/therapeutic agent complex has the structure of
Formula II:
0 S3R3
0 ) 0
O-
S tR4 S(R6
S814 S9R 9
- n
wherein: n is 4, 5, or 6;
wherein Ri, R2, R3, R4, Rs, R6, R7, R8, and R9 are each, independently, -0- or
a -0-(C2-C6
alkylene)-S03- group; wherein at least one of Ri and R2 is independently a -0-
(C2-C6
alkylene)-S03- group; and Si, S2, S3, S4, S5, S6, S7, S8, and S9 are each,
independently, a
pharmaceutically acceptable cation. In further embodiments, the
pharmaceutically acceptable
cation is selected from: an alkali metal such as Lit, Nat, or Kt; an alkaline
earth metal such
as Ca+2, or Mg+2 and ammonium ions and amine cations such as the cations of
(C1-C6)-
alkylamines, piperidine, pyrazine, (C1-C6)-alkanolamine and (C4-C8)-
cycloalkanolamine. In
some embodiments, at least one of R1 and R2 is independently a -0-(C2-C6
alkylene)-S03-
group that is a -0-(CH2)mS03- group, wherein m is 2 to 6, preferably 2 to 4,
(e.g., -0-
CH2CH2CH2S03- or -0-CH2CH2CH2CH2S03 -); and Si, S2, S3, S4, S5, S6, Si, S8,
and S9
are each, independently, H or a pharmaceutically cation which includes for
example, alkali
metals (e.g., Lit, Nat, I(+) alkaline earth metals (e.g., Ca+2, Mg 2),
ammonium ions and amine
cations such as the cations of (C1-C6)-alkylamines, piperidine, pyrazine, (C i-
C6)-alkanol-
amine and (C4 -C8)-cycloalkanolamine:
[00203] In some embodiments, a cyclodextrin derivative of the
yPANTIFOL/cyclodextrin
complex and/or cyclodextrin/therapeutic agent complex is a cyclodextrin
disclosed in U.S. Pat.
Nos. 6,133,248, 5,874,418, 6,046,177, 5,376,645, 5,134,127, 7,034,013,
6,869,939; and Intl.
Appl. Publ. No. WO 02005/117911, the contents each of which is herein
incorporated by
reference in its priority.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 121 -
[00204] In some embodiments, the cyclodextrin derivative of the
yPANTIFOL/cyclodextrin
complex and/or cyclodextrin/therapeutic agent complex is a sulfoalkyl ether
cyclodextrin. In
some embodiments, the cyclodextrin derivative of complex is a sulfobutyl ether-
3-cyclodextrin
such as CAPTISOLO (CyDex Pharma. Inc., Lenexa, Kansas). Methods for preparing
sulfobutyl ether-3- cyclodextrin and other sulfoalkyl ether cyclodextrins are
known in the art.
[00205] In some embodiments, the cyclodextrin derivative in of the
yPANTIFOL/cyclodextrin
complex and/or cyclodextrin/therapeutic agent complex is a compound of Formula
III:
RO
i-
n '../ R0
. ,
/ 0R
--- R6 O Ro_ 's,..s..\
RO ,LA\ RO t
00R 0 OR
G,
._ rl ,
, OR
RO- \.>
k
OR 0--
oR 0 OR pR n, i1,,./
c-\-7{=:--c_c_ _0'7-21-..õ.,oR
OR
wherein R equals:
(a) (H)21-x or (-(CH2)4-SO3Na)x, and x=1.0-10.0, 1.0-5.0, 6.0-7.0, or 8.0-
10.0;
(b) (H)21_x or (-(CH2CH(OH)CH3)x, and x=1.0-10.0, 1.0-5.0, 6.0-7.0, or 8.0-
10.0;
(c) (H)21_x or (sulfoalkyl ethers)x, and x=1.0-10.0, 1.0-5.0, 6.0-7.0, or
8.0-10.0; or
(d) (H)21_x or (-(CH2)4-SO3Na)x, and x=1.0-10.0, 1.0-5.0, 6.0-7.0, or 8.0-
10Ø
[00206] In additional embodiments, the yPANTIFOL/cyclodextrin complex
and/or
cyclodextrin/therapeutic agent complex is encapsulated in a liposome (e.g., as
described herein
or otherwise known in the art).
D. yPANTIFOL Delivery Vehicles
[00207] In alternative embodiments, the disclosure provides yPANTIFOL
delivery systems
and their use to deliver a payload of yPANTIFOL to a cell or cells in vitro or
in vivo. In some
embodiments, yPANTIFOL is complexed with or incorporated into a delivery
vehicle. Such
delivery vehicles are known in the art and include, but are not limited to,
liposomes,
lipospheres, polymers, peptides, proteins, antibodies (e.g., ADCs such as
Antibody-
yPANTIFOL conjugates), cellular components, cyclic oligosaccharides (e.g.,
cyclodextrins),
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 122 -
nanoparticles (e.g., lipid nanoparticles, biodegradable nanoparticles, and
core-shell
nanoparticles), lipoprotein particles, and combinations thereof. In particular
embodiments, the
delivery vehicle is a liposome. In other particular embodiments, the delivery
vehicle is an
antibody or an antigen binding antibody fragment. In some embodiments, the
7PANTIFOL
delivery system comprises a 7PANTIFOL according to any of [1]-[11] of the
Detailed
Description Section.
E. Liposomes
[00208] In some embodiments, the disclosure provides liposomal compositions
that comprise
a liposome encapsulating (i.e., filled with) a gamma polyglutamated Antifolate
(e.g., a
yPANTIFOL disclosed herein). In some embodiments, the liposomal composition
comprises
a yPANTIFOL according to any of [1]-[11] of the Detailed Description Section.
In some
embodiments, the liposomal composition comprises a polyglutamated Antifolate
described in
Section I. In some embodiments, the liposome is a liposome according to any of
[12]-[67] of
the Detailed Description Section. In some embodiments, a liposome in the
liposomal
composition comprises a 7PANTIFOL containing 4, 5, 2-10, 4-6, or more than 5,
glutamyl
groups (including the glutamyl group of the Antifolate). In some embodiments,
the gamma
polyglutamated Antifolate in the Lp-yPANTIFOL comprises two or more glutamyl
groups in
the L-form. In other embodiments, the gamma polyglutamated Antifolate in the
Lp-
yPANTIFOL comprises a glutamyl group in the D-form. In further embodiments,
the gamma
polyglutamated Antifolate in the Lp-yPANTIFOL comprises a glutamyl group in
the D-form
and two or more glutamyl groups in the L-form. In additional embodiments, the
gamma
polyglutamated Antifolate in the Lp-yPANTIFOL comprises two or more glutamyl
groups that
have a gamma carboxyl linkage. In some embodiments, the liposomal composition
comprises
a liposome comprising a 7 pentaglutamated Antifolate. In further embodiments,
the liposome
comprises an L-y pentaglutamated Antifolate, a D-y pentaglutamated Antifolate,
or an L- and
D-7 pentaglutamated Antifolate. In some embodiments, the liposomal composition
comprises
a liposome comprising a y hexaglutamated Antifolate (Lp-7PANTIFOL). In further
embodiments, the liposome comprises an L-7 hexaglutamated Antifolate, a D-7
hexaglutamated Antifolate, or an L- and D-y hexaglutamated Antifolate. In some
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 123 -
embodiments, the liposomal composition comprises a liposome that is anionic or
neutral. In
some embodiments, the liposomal composition comprises a liposome that is
cationic. In some
embodiments, the Lp-yPANTIFOL composition is not pegylated. In some
embodiments, the
Lp-yPANTIFOL composition is non-targeted (NTLp-yPANTIFOL). In other
embodiments,
the Lp-yPANTIFOL composition comprises a targeting moiety (TLp-yPANTIFOL). In
some
embodiments, the liposomal composition comprises a liposome having a diameter
in the range
of 20 nm to 500 nm, or any range therein between. In some embodiments, the
liposomal
composition comprises a liposome having a diameter in the range of 20 nm to
400 nm, or any
range therein between. In some embodiments, the liposomal composition
comprises a
liposome having a diameter in the range of 20 nm to 200 nm, or any range
therein between. In
further embodiments, the liposomal composition comprises a liposome having a
diameter in
the range of 20 nm to 150 nm, or any range therein between. In further
embodiments, the
liposomal composition comprises a liposome having a diameter in the range of
80 nm to 120
nm, or any range therein between. In additional embodiments, 30-70%, 30-60%,
or 30-50%
w/w gamma polyglutamated Antifolate, or any range therein between, is
encapsulated
(entrapped) in the Lp-yPANTIFOL during the process of preparing the liposomes.
In some
embodiments, the Lp-yPANTIFOL composition comprises at least 1%, 5%, 10%, 15%,
20%,
25%, 30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of
the
gamma polyglutamated Antifolate. In some embodiments, at least 1%, 5%, 10%,
15%, 20%,
25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or more than 75%, w/w,
gamma
polyglutamated Antifolate, is encapsulated in the Lp-yPANTIFOL during the
process of
preparing the liposomes.
[00209] In some embodiments, the provided liposomes further comprise an
immunostimulatory agent, a detectable marker, or both disposed on its
exterior. The
immunostimulatory agent or detectable marker can be ionically bonded or
covalently bonded
to an exterior of the liposome, including, for example, optionally to a steric
stabilizer
component of the liposome.
[00210] The terms "immunostimulatory agents", also known as
"immunostimulants", and
"immunostimulators", refer to substances that stimulate an immune (including a
preexisting
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 124 -
immune response) by inducing activation or increasing activity of any of the
components of
the immune system. These immunostimulatory agents can include one or more of a
hapten, an
adjuvant, a protein immunostimulating agent, a nucleic acid immunostimulating
agent, and a
chemical immunostimulating agent. Many adjuvants contain a substance designed
to stimulate
immune responses, such as lipid A, Bortadella pertussis or Mycobacterium
tuberculosis
derived proteins. Certain adjuvants are commercially available as, for
example, Freund's
Incomplete Adjuvant and Complete Adjuvant (Difco Laboratories, Detroit,
Mich.); Merck
Adjuvant 65 (Merck and Company, Inc., Rahway, N.J.); AS-2 (SmithKline Beecham,
Philadelphia, Pa.); aluminum salts such as aluminum hydroxide gel (alum) or
aluminum
phosphate; salts of calcium, iron or zinc; an insoluble suspension of acylated
tyrosine; acylated
sugars; cationically or anionically derivatized polysaccharides;
polyphosphazenes;
biodegradable microspheres; monophosphoryl lipid A and quil A; IFN-alpha, IFN-
gamma,
FLT3-ligand; and immunostimulatory antibodies (e.g., anti-CTLA-4, anti-CD28,
anti-CD3).
Cytokines, such as GM-CSF, interleukin-2, -7, -12, and -15, and other like
growth factors, can
also be used as adjuvants. In a preferred embodiment, the immunostimulant can
be at least one
selected from fluorescein, DNP, beta glucan, beta-1,3-glucan, beta-1,6-glucan.
In an
additional preferred embodiment, the immunostimulant is a Toll-like receptor
(TLR)
modulating agent. In further embodiments, the Toll-like receptor (TLR)
modulating agent is
one or more of: OXPAC, PGPC, an eritoran lipid (e.g., E5564), and a resolvin.
[00211] In some embodiments, the provided liposomes further comprise an
agent, that increase
uptake of liposomes into a cellular compartment of interest including the
cytosol. In some
embodiments, the agent provides the liposome contents with the ability to
bypass lysosomes
(e.g., chloroquine). In some embodiments, the agent improves the update of the
liposome
contents by mitochondria (e.g., sphingomyelin and a component of mitoport).
[00212] A detectable marker may, for example, include, at least, a
radioisotope, a fluorescent
compound, a bioluminescent compound, chemiluminescent compound, a metal
chelator, an
enzyme, a dye, an ink, a magnetic compound, a biocatalyst or a pigment that is
detectable by
any suitable means known in the art, e.g., magnetic resonance imaging (MRI),
optical imaging,
fluorescent/luminescent imaging, or nuclear imaging techniques.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 125 -
[00213] In some embodiments, the immunostimulatory agent and/or detectable
marker is
attached to the exterior by co-incubating it with the liposome. For example,
the
immunostimulatory agent and/or detectable marker may be associated with the
liposomal
membrane by hydrophobic interactions or by an ionic bond such as an
avidin/biotin bond or a
metal chelation bond (e.g., Ni-NTA). Alternatively, the immunostimulatory
agent or detectable
marker may be covalently bonded to the exterior of the liposome such as, for
example, by
being covalently bonded to a liposomal component or to the steric stabilizer
which is the PEG.
[00214] One example reagent is fluorescein isothiocyanate (FITC) which,
based on our
experiments, surprisingly serves as both an immunostimulant and a detectable
marker.
[00215] In some embodiments, the liposomes further comprise an agent that
increases the
uptake of liposomes into a cellular compartment of interest including the
cytosol.
[00216] In some embodiments, the liposomes comprise a mitochondrial-
targeting agent. In
some embodiments, the liposomes comprise triphenylphosphonium (TPP). Methods
and
mechanisms for surface functionalizing liposomes with TPP are known in the art
(e.g.,
attaching TPP to the lipid anchor via a peg spacer group and modifying TPP
with a stearyl
group (stearyl triphenylphosphonium (STPP)). In some embodiments, the
liposomes
comprise high-density octa-arginine. In some embodiments, the liposomes
comprise
sphingomyelin and/or a sphingomyelin metabolite. Sphingomyelin metabolite used
to
formulate the liposomes of the present invention can include, for example
ceramide,
sphingosine or sphingosine 1-phosphate. In some embodiments, the liposomes
comprise
Rhodamine 123. In some embodiments, the liposomes comprise, a mitochondria
penetrating
peptide. In some embodiments, the liposomes comprise, a mitochondria
penetrating agent
selected from: a mitofusin peptide, a mitochondrial targeting signal peptide,
and
Antennapedia helix III homeodomain cell-penetrating peptide (ANT) (e.g.,
comprising
RQIKIVVFQNRRMK WKKRKKRRQRRR, RKKRRXRRRGC), or a mitochondrial
penetrating fragment thereof. In some embodiments, the liposomes comprise, a
mitochondria
penetrating polynucleotide sequence selected from: RQIKIVVFQNRRMKWKKRKKRRQR
RR (SEQ ID NO:1), RKKRRXR RRGC where X is any natural or non-natural amino
acid
(SEQ ID NO:2), CCGCCAAGAAGCG (SEQ ID NO:3), GCGTGCACACGCGCGTA
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 126 -
GACTTCCCCCGCAAGTCACTCGTTAGCCCGCCAAGAAGCGACCCCTCCGGGG
CGAGCTGAGCGGCGTGGCGCGGGGGCGTCAT (SEQ ID NO:4), ACGTGCAT
ACGCACGTAGACATTCCCCGCTTCCCACTCCAAAGTCCGCCAAGAAGCGTATC
CCGCTGAG CGGCGTGGCGCGGGGGCGTCATCCGTCAGCTC (SEQ ID NO:5), or
ACTTCCCCCGCAAGTCACTCGTTAGCCCGCCAAGAAGCGACCCCTCCGGGGCG
AGCTG (SEQ ID NO:6)), or a mitochondrial penetrating fragment thereof.
[00217] In some embodiments, liposomes in the provided liposome
compositions comprise a
mitochondria penetrating agent selected from the group: a guanidine-rich
peptoid,
tetraguanidinium, triguanidinium, diguanidinium, monoguanidinium, a guanidine-
rich
polycarbamate, a beta-oligoarginine, a proline-rich dendrimer, and a
phosphonium salt (e.g.,
methyltriphenyl-phosphonium and/or tetraphenylphosphonium).
[00218] In some embodiments, liposomes in the provided liposome
compositions comprise
sphingomyelin and/or stearyl-octa-arginine. In some embodiments, the liposomes
comprise
sphingomyelin and/or stearyl-octa-arginine. In some embodiments, the liposomes
comprise
DOPE, sphingomyelin, stearyl-octa-arginine sphingomyelin and stearyl-octa-
arginine. In
some embodiments, the liposomes comprise DOPE, sphingomyelin, stearyl-octa-
arginine
sphingomyelin and stearyl-octa-arginine at a molar ratio of 9:2:1. In some
embodiments, the
liposomes comprise the MITO-porter system or a variant thereof.
[00219] In some embodiments, liposomes in the provided liposome
compositions comprise an
agent such as a cell penetrating agent that that facilitates delivery of the
liposome across a cell
membrane and provides the liposome with the ability to bypass the endocytic
pathway and the
harsh environment of lysosomes. Cell penetrating agents are known in the art
and can routinely
be used and adapted for manufacture and use of the provided liposome
compositions. In some
embodiments, the cell penetrating/lysosome bypassing agent is chloroquine. In
some
embodiments, the cell penetrating agent is a cell penetrating peptide. In some
embodiments,
liposomes in the provided liposome compositions comprise a cell penetrating
agent selected
from the group: RKKRRQRRR (SEQ ID NO:7), GRKKRRQRRRTPQ (SEQ ID NO:8),
YGRKKRRQRRR (SEQ ID NO:9), AAVAL LPAVLLALLA (SEQ ID NO:10),
MGLGLHLLVLAAALQ (SEQ ID NO:11), GALFL GFLGAAGSTM (SEQ ID NO:12),
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 127 -
AGYLLGKINLKALAALAKKIL (SEQ ID NO:13), RATIRVWFQNKRCKDKK (SEQ ID
NO:14), RQIKIVVFQNRRMKWKK (SEQ ID NO:15), GLFEAIAGFIENGWEGMIDG (SEQ
ID NO:16), GWTLNSAGYLLGKIN (SEQ ID NO:17), RSQSRSRYYRQRQRS (SEQ ID
NO:18), LAIPEQEY (SEQ ID NO:19), LGIAEQEY (SEQ ID NO:20), LGIPAQEY (SEQ ID
NO:21), LGIPEAEY (SEQ ID NO:22), LGIPEQAY (SEQ ID NO:23), LGIAEAEY (SEQ ID
NO:24), LGIPEAAY (SEQ ID NO:25), LGIAEQAY (SEQ ID NO:26), LGIAEAAY (SEQ ID
NO:27), LLIILRRRIRKQAHAHSK (SEQ ID NO:28), LKALAALAKKIL (SEQ ID NO:29),
KLALKLALKALKAALKLA (SEQ ID NO:30), KETWWETWWTEWSQPKKKRKV (SEQ
ID NO:31), DHQLNPAF (SEQ ID NO:32), DPKGDPKG (SEQ ID NO:33),
VTVTVTVTVTGKGDPKPD (SEQ ID NO:34), RQIKIVVFQNRRMKWKK (SEQ ID
NO:35), GRKKRRQRRRPPQ (SEQ ID NO:36), GWTLNSAGYLLGKINLKALAAL
AKKIL (SEQ ID NO:37), GRKKRRQRRR (SEQ ID NO:38), RRRRRRR (SEQ ID NO:39),
RRRRRRRR (SEQ ID NO:40), RRRRRRRRR (SEQ ID NO:41), RRRRRRRR RR (SEQ ID
NO:42), RRRRRRRRRRR (SEQ ID NO:43), and YTIWMPENPRPGT
PCDIFTNSRGKRASNGGG G(R)n wherein n=2-15 R in the L- and/or D- form (SEQ ID
NO:44), or a cell permeating fragment thereof..
[00220] As discussed above, the liposomes may comprise a steric stabilizer
that increase their
longevity in circulation. For those embodiments, which incorporate a steric
stabilizer, the steric
stabilizer may be at least one member selected from polyethylene glycol (PEG),
poly-L-lysine
(PLL), monosialoganglioside (GM1), poly(vinyl pyrrolidone) (PVP),
poly(acrylamide)
(PAA), poly(2-methyl-2-oxazoline), poly(2-ethyl-2-oxazoline), phosphatidyl
polyglycerol,
poly[N-(2-hydroxypropyl) methacrylamide], amphiphilic poly-N-
vinylpyrrolidones, L-amino-
acid-based polymer, oligoglycerol, copolymer containing polyethylene glycol
and
polypropylene oxide, Poloxamer 188, and polyvinyl alcohol. In some
embodiments, the steric
stabilizer or the population of steric stabilizer is PEG. In one embodiment,
the steric stabilizer
is a PEG. In a further embodiment, the PEG has a number average molecular
weight (Mn) of
200 to 5000 daltons. These PEG(s) can be of any structure such as linear,
branched, star or
comb structure and are commercially available.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 128 -
[00221] In some embodiments, the disclosure provides liposomal compositions
that comprise
a pegylated liposome (PLp-yPANTIFOL). In some embodiments, the pegylated
liposome
comprises a 7PANTIFOL according to any of [1]-[11] of the Detailed Description
Section. In
some embodiments, the pegylated liposome comprises a polyglutamated Antifolate
described
in Section I. In some embodiments, a pegylated liposome in the liposomal
composition
comprises a 7PANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl
groups. In some
embodiments, the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises
two or
more glutamyl groups in the L-form. In other embodiments, the gamma
polyglutamated
Antifolate in the Lp--yPANTIFOL comprises a glutamyl group in the D-form. In
further
embodiments, the gamma polyglutamated Antifolate in the Lp-yPANTIFOL comprises
a
glutamyl group in the D-form and two or more glutamyl groups in the L-form. In
some
embodiments, the liposomal composition comprises a pegylated liposome that
comprises a
tetraglutamated Antifolate. In further embodiments, the liposome comprises an
L-7
tetraglutamated Antifolate, a D-y tetraglutamated Antifolate, or an L- and D-7
tetraglutamated
Antifolate. In additional embodiments, the liposomal composition comprises a
pegylated
liposome that comprises a 7 pentaglutamated Antifolate. In further
embodiments, the liposome
comprises an L-7 pentaglutamated Antifolate, a D-y pentaglutamated Antifolate,
or an L- and
D-7 pentaglutamated Antifolate. In some embodiments, the liposomal composition
comprises
a pegylated liposome comprising a y hexaglutamated Antifolate. In further
embodiments, the
liposome comprises an L-7 hexaglutamated Antifolate, a D-y hexaglutamated
Antifolate, or an
L- and D-7 hexaglutamated Antifolate. In some embodiments, the liposomal
composition
comprises a pegylated liposome according any of [23], and [25]-[64] of the
Detailed
Description. In some embodiments, the liposomal composition comprises a
pegylated
liposome that is anionic or neutral. In some embodiments, the liposomal
composition
comprises a pegylated liposome that is cationic. In some embodiments, the PLp-
yPANTIFOL
composition is non-targeted (NTPLp-yPANTIFOL). In other embodiments, the PLp-
yPANTIFOL composition comprises a targeting moiety (TPLp-7PANTIFOL). In
additional
embodiments, the liposomal composition comprises a pegylated liposome that
comprises 30-
70%, 30-60%, or 30-50% liposome entrapped gamma polyglutamated Antifolate, or
any range
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 129 -
therein between. In some embodiments, the liposomal composition comprises a
pegylated
liposome that comprises at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%,
45%, 50%,
55%, 60%, 65%, 70%, or 75%, liposome entrapped gamma polyglutamated
Antifolate. In
some embodiments, the liposomal composition comprises a pegylated liposome
having a
diameter in the range of 20 nm to 200 nm. In further embodiments, the
liposomal composition
comprises a pegylated liposome having a diameter in the range of 80 nm to 120
nm.
[00222] In
some embodiments, greater than 70%, 80% or 90% of the polyglutamated
Antifolate in a provided liposomal composition is pentaglutamated. In some
embodiments,
greater than 70%, 80% or 90% of the polyglutamated Antifolate in a provided
composition is
hexaglutamated. In some embodiments, greater than 70%, 80% or 90% of the
polyglutamated
Antifolate in the composition has 4-10, 4-6, or more than 5, y-glutamyl
groups.
[00223] In
some embodiments, greater than 30%, 40%, 50%, 60%, 70%, 80% or 90%, of the
polyglutamated Antifolate in a provided liposomal composition is
tetraglutamated. In some
embodiments, greater than 30%, 40%, 50%, 60%, 70%, 80% or 90%, of the
polyglutamated
Antifolate in a provided liposomal composition is pentaglutamated. In some
embodiments,
greater than 30%, 40%, 50%, 60%, 70%, 80% or 90%, of the polyglutamated
Antifolate in a
provided liposomal composition is hexaglutamated.
[00224] In
some embodiments, the gamma polyglutamated Antifolate compositions (e.g.,
polyglutamates and delivery vehicles such as liposomes containing the
polyglutamates) are in
an aqueous solution. In some embodiments, the polyglutamated Antifolate
composition is
administered in a liposomal composition at between about 0.005 and about 5000
mg/M2 (meter
of body surface area squared), or between about 0.1 and about 1000 mg/M2, or
any range
therein between. In some embodiments, the yPANTIFOL composition is
administered in a
liposomal composition at about 1 mg/kg to about 500 mg/kg, 1 mg/kg to about
250 mg/kg, 1
mg/kg to about 200 mg/kg, 1 mg/kg to about 150 mg/kg, 1 mg/kg to about 100
mg/kg,1 mg/kg
to about 50 mg/kg, about 1 mg/kg to about 25 mg/kg, about 1 mg/kg to about 20
mg/kg, about
1 mg/kg to about 15 mg/kg, about 1 mg/kg to about 10 mg/kg, or about 1 mg/kg
to about 5
mg/kg, or any range therein between.
(1) Liposome composition
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 130 -
[00225] The lipids and other components of the liposomes contained in the
liposomal
compositions can be any lipid, lipid combination and ratio, or combination of
lipids and other
liposome components and their respective ratios known in the art. However, it
will be
understood by one skilled in the art that liposomal encapsulation of any
particular drug, such
as, and without limitation, the gamma polyglutamated Antifolate discussed
herein, may
involve substantial routine experimentation to achieve a useful and functional
liposomal
formulation. In general, the provided liposomes may have any liposome
structure, e.g.,
structures having an inner space sequestered from the outer medium by one or
more lipid
bilayers, or any microcapsule that has a semi-permeable membrane with a
lipophilic central
part where the membrane sequesters an interior. The lipid bilayer can be any
arrangement of
amphiphilic molecules characterized by a hydrophilic part (hydrophilic moiety)
and a
hydrophobic part (hydrophobic moiety). Usually amphiphilic molecules in a
bilayer are
arranged into two dimensional sheets in which hydrophobic moieties are
oriented inward the
sheet while hydrophilic moieties are oriented outward. Amphiphilic molecules
forming the
provided liposomes can be any known or later discovered amphiphilic molecules,
e.g., lipids
of synthetic or natural origin or biocompatible lipids. The liposomes can also
be formed by
amphiphilic polymers and surfactants, e.g., polymerosomes and niosomes. For
the purpose of
this disclosure, without limitation, these liposome-forming materials also are
referred to as
"lipids".
[00226] The liposome composition formulations provided herein can be in
liquid or dry form
such as a dry powder or dry cake. The dry powder or dry cake may have
undergone primary
drying under, for example, lyophilization conditions or optionally, the dry
cake or dry powder
may have undergone both primary drying only or both primary drying and
secondary drying.
In the dry form, the powder or cake may, for example, have between 1% to 6%
moisture, for
example, such as between 2% to 5% moisture or between 2% to 4% moisture. One
example
method of drying is lyophilization (also called freeze-drying, or
cyrodessication). Any of the
compositions and methods of the disclosure may include liposomes, lyophilized
liposomes or
liposomes reconstituted from lyophilized liposomes. In some embodiments, the
disclosed
compositions and methods include one or more lyoprotectants or
cryoprotectants. These
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 131 -
protectants are typically polyhydroxy compounds such as sugars (mono-, di-,
and
polysaccharides), polyalcohols, and their derivatives, glycerol, or
polyethyleneglycol,
trehalose, maltose, sucrose, glucose, lactose, dextran, glycerol, or
aminoglycosides. In further
embodiments, the lyoprotectants or cryoprotectants comprise up to 10% or up to
20% of a
solution outside the liposome, inside the liposome, or both outside and inside
the liposome.
[00227] In some embodiments, the liposomes include a steric stabilizer that
increases their
longevity in circulation. One or more steric stabilizers such as a hydrophilic
polymer
(Polyethylene glycol (PEG)), a glycolipid (monosialoganglioside (GM1)) or
others occupies
the space immediately adjacent to the liposome surface and excludes other
macromolecules
from this space. Consequently, access and binding of blood plasma opsonins to
the liposome
surface are hindered, and thus interactions of macrophages with such
liposomes, or any other
clearing mechanism, are inhibited and longevity of the liposome in circulation
is enhanced. In
some embodiments, the steric stabilizer or the population of steric
stabilizers is a PEG or a
combination comprising PEG. In further embodiments, the steric stabilizer is a
PEG or a
combination comprising PEG with a number average molecular weight (Mn) of 200
to 5000
daltons. These PEG(s) can be of any structure such as linear, branched, star
or comb structure
and are commercially available.
[00228] In some embodiments, the liposomal composition comprises a liposome
having a
diameter in the range of 20 nm to 150 nm, or any range therein between. In
some embodiments,
the liposomal composition comprises a liposome that contains a 7PANTIFOL
according to any
of [11411] of the Detailed Description Section and has a diameter in the range
of 20 nm to 150
nm. In some embodiments, the liposome is a liposome composition according to
any of [12]-
[67] of the Detailed Description Section and has a diameter in the range of 20
nm to 150 nm.
In further embodiments, the liposomal composition comprises a liposome having
a diameter
in the range of 30 nm to 150 nm, or any range therein between. In some
embodiments, the
liposomal composition comprises a liposome that contains a 7PANTIFOL according
to any of
[11411] of the Detailed Description Section and has a diameter in the range of
30 nm to 150
nm. In some embodiments, the liposome is a liposome composition according to
any of [12]-
[67] of the Detailed Description Section and has a diameter in the range of 30
nm to 150 nm,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 132 -
or any range therein between. In further embodiments, the liposomal
composition comprises a
liposome having a diameter in the range of 80 nm to 120 nm, or any range
therein between. In
some embodiments, the liposomal composition comprises a liposome that contains
a
yPANTIFOL according to any of [1]-[11] of the Detailed Description Section and
has a
diameter in the range of 80 nm to 120 nm. In some embodiments, the liposome is
a liposome
composition according to any of [12]467] of the Detailed Description Section
and has a
diameter in the range of 80 nm to 120 nm. In further embodiments, the
liposomal composition
comprises a liposome having a diameter in the range of 40 nm to 70 nm, or any
range therein
between. In some embodiments, liposomes comprise a yPANTIFOL according to any
of [1]-
[11] of the Detailed Description Section and have a diameter in the range of
40nm-70 nm. In
some embodiments, the liposome is a liposome composition according to any of
[12]467] of
the Detailed Description Section and has a diameter in the range of 40nm-70
nm.
[00229] The properties of liposomes are influenced by the nature of lipids
used to make the
liposomes. A wide variety of lipids have been used to make liposomes. These
include cationic,
anionic and neutral lipids. In some embodiments, the liposomes comprising the
gamma
polyglutamated Antifolate are anionic or neutral. In other embodiments, the
provided
liposomes are cationic. The determination of the charge (e.g., anionic,
neutral or cationic) can
routinely be determined by measuring the zeta potential of the liposome. The
zeta potential of
the liposome can be positive, zero or negative. In some embodiments, the zeta
potential of the
liposome is less than or equal to zero. In some embodiments, the zeta
potential of the liposome
is in a range of 0 to -150 mV. In another embodiment, the zeta potential of
the liposome is in
the range of -30 to -50 mV.
[00230] In some embodiments, cationic lipids are used to make cationic
liposomes which are
commonly used as gene transfection agents. The positive charge on cationic
liposomes enables
interaction with the negative charge on cell surfaces. Following binding of
the cationic
liposomes to the cell, the liposome is transported inside the cell through
endocytosis.
[00231] In some preferred embodiments, a neutral to anionic liposome is
used. In a preferred
embodiment, an anionic liposome is used. Using a mixture of, for example,
neutral lipids such
as HSPC and anionic lipids such as PEG-DSPE results in the formation of
anionic liposomes
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 133 -
which are less likely to non-specifically bind to normal cells. Specific
binding to tumor cells
can be achieved by using a tumor targeting antibody such as, for example, a
folate receptor
antibody, including, for example, folate receptor alpha antibody, folate
receptor beta antibody
and/or folate receptor delta antibody.
[00232] As
an example, at least one (or some) of the lipids is/are amphipathic lipids,
defined
as having a hydrophilic and a hydrophobic portions (typically a hydrophilic
head and a
hydrophobic tail). The hydrophobic portion typically orients into a
hydrophobic phase (e.g.,
within the bilayer), while the hydrophilic portion typically orients toward
the aqueous phase
(e.g., outside the bilayer). The hydrophilic portion can comprise polar or
charged groups such
as carbohydrates, phosphate, carboxylic, sulfato, amino, sulfhydryl, nitro,
hydroxy and other
like groups. The hydrophobic portion can comprise apolar groups that include
without
limitation long chain saturated and unsaturated aliphatic hydrocarbon groups
and groups
substituted by one or more aromatic, cyclo-aliphatic or heterocyclic group(s).
Examples of
amphipathic compounds include, but are not limited to, phospholipids,
aminolipids and
sphingolipids.
[00233]
Typically, for example, the lipids are phospholipids. Phospholipids include
without
limitation phosphatidylcholine, pho sphatidylethanol amine,
pho sphatidylglycerol,
phosphatidylinositol, phosphatidylserine, and the like. It is to be understood
that other lipid
membrane components, such as cholesterol, sphingomyelin, and cardiolipin, can
be used.
[00234]
The lipids comprising the liposomes provided herein can be anionic and neutral
(including zwitterionic and polar) lipids including anionic and neutral
phospholipids. Neutral
lipids exist in an uncharged or neutral zwitterionic form at a selected pH. At
physiological pH,
such lipids include, for example, dioleoylphosphatidylglycerol (DOPG),
diacylpho sphatidylcholine, diacylpho sphatidylethanolamine, ceramide,
sphingomyelin,
cephalin, cholesterol, cerebrosides and diacylglycerols. Examples of
zwitterionic lipids include
without limitation dioleoylphosphatidylcholine (DOPC), dimyristoylphos-
phatidylcholine
(DMPC), and dioleoylphosphatidylserine (DOPS). Anionic lipids are negatively
charged at
physiological pH. These lipids include without limitation
phosphatidylglycerol, cardiolipin,
diacylpho sphatidylserine, diacylpho sphatidic acid, N-dode-
canoyl
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 134 -
pho sphatidylethanolamine s , N-succinyl phosphatidylethanolamines, N-
glutarylphosphatidylethanolamines,
lysylphosphatidylglycerols, palmitoyloleyolphos-
phatidylglycerol (POPG), and other anionic modifying groups joined to neutral
lipids.
[00235]
Collectively, anionic and neutral lipids are referred to herein as non-
cationic lipids.
Such lipids may contain phosphorus but they are not so limited. Examples of
non-cationic
lipids include lecithin, lysolecithin, phosphatidylethanolamine,
lysophosphatidylethan-
olamine, dioleoylphosphati- dylethanolamine (DOPE), dipalmitoyl phosphatidyl
ethanol-
amine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidy 1-
ethan-
olamine (DSPE), palmitoyloleoyl-phosphatidylethanolamine (POPE) palmitoyl-
oleoylphosphatidylcholine (POPC), egg phosphatidylcholine (EPC),
distearoylphosphat-
idylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphospha-
tidylcholine
(DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphospha-tidylglycerol
(DPPG),
palmitoyloleyolphosphatidylglycerol (POPG), 16-0-monomethyl PE, 16-0- dimethyl
PE, 18-
1-trans PE, palmitoyloleoyl-phosphatidylethanolamine
(POPE), 1- stearo y1-2-
oleoylpho sphatidyethano 'amine (S OPE), phosphatidylserine,
phosphatidyl-inositol,
sphingomyelin, cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetyl-
phosphate, and
cholesterol.
[00236]
The liposomes may be assembled using any liposomal assembly method using
liposomal components (also referred to as liposome components) known in the
art. Liposomal
components include, for example, lipids such as DSPE, HSPC, cholesterol and
derivatives of
these components. Other suitable lipids are commercially available for
example, by Avanti
Polar Lipids, Inc. (Alabaster, Alabama, USA). A partial listing of available
negatively or
neutrally charged lipids suitable for making anionic liposomes, can be, for
example, at least
one of the following: DLPC, DMPC, DPPC, DSPC, DOPC, DMPE, DPPE, DOPE, DMPA=Na,
DPPA=Na, DOPA=Na, DMPG=Na, DPPG=Na, DOPG=Na, DMPS=Na, DPPS=Na, DOPS=Na,
DOPE-Glutaryl.(Na)2, Tetramyristoyl Cardiolipin =(Na)2, DSPE-mPEG-2000=Na,
DSPE-
mPEG-5000=Na, and DS PE-Maleimide PEG-2000=Na.
[00237] In
some embodiments, the yPANTIFOL compositions provided herein are formulated
in a liposome comprising a cationic lipid. In one embodiment, the cationic
lipid is selected
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 135 -
from, but not limited to, a cationic lipid described in Intl. Appl. Publ. Nos.
W02012/040184,
W02011/153120, W02011/149733, W02011/090965, W02011/043913, W02011/022460,
W02012/061259, W02012/054365, W02012/044638, W02010/080724, W02010/21865
and W02008/103276, U.S. Pat. Nos. 7,893,302, 7,404,969 and 8,283,333 and US
Appl. Publ.
Nos. US20100036115 and US20120202871; each of which is herein incorporated by
reference
in their entirety. In another embodiment, the cationic lipid may be selected
from, but not limited
to, Formula A described in Intl. Appl. Publ. Nos. W02012/040184,
W02011/153120,
W0201/1149733, W02011/090965, W02011/043913, W02011/022460, W02012/061259,
W02012/054365 and W02012/044638; each of which is herein incorporated by
reference in
their entirety. In yet another embodiment, the cationic lipid may be selected
from, but not
limited to, Formula CLI-CLXXIX of International Publication No. W02008103276,
Formula
CLI-CLXXIX of U.S. Pat. No. 7,893,302, Formula CLI-CLXXXXII of U.S. Pat. No.
7,404,969 and Formula 1-VI of US Patent Publication No. US20100036115; each of
which is
herein incorporated by reference in their entirety. As a non-limiting example,
the cationic lipid
may be selected from (20Z,23Z)-N,N-dimethylnonacosa-20,23-dien-10-amine,
(17Z,20Z)-
N,N-dimemyl-hexaco s a- 17,20-dien-9- amine, (1Z,19Z)-N5N-dimethylpenta co s a-
16, 19-dien-
8- amine, (13Z,16Z)-N,N-dimethyldo co s a- 13,16-dien-5- amine,
(12Z, 15Z)-N,N-
dimethylhenicosa-12,15-dien-4-amine, (14Z,17Z)-N,N-dimethyltrico s a- 14,17-
dien-6-amine,
(15Z,18Z)-N,N- dimethyltetracosa-15,18-dien-7 -amine, (18Z,21Z)-N,N-
dimethylheptaco s a-
18,21-dien- 10-amine, (15Z,18Z)-N,N-dimethyltetraco s a- 15,18-dien-5-amine,
(14Z,17Z)-
N,N-dimethyl-trico s a-14,17-dien-4- amine, (19Z,22Z)-N,N-dimeihyloctaco s a-
19,22-dien-9-
amine, (18Z,21 Z)-N,N-dimethylheptaco s a-18,21-dien- 8-amine,
(17Z,20Z)-N,N-
dimethylhexa-co s a-17,20-dien-7- amine,
(16Z,19Z)-N,N-dimethylpentaco sa-16,19-dien-6-
amine, (22Z,25Z)-N,N-dimethylhentriaconta-22,25-dien-10-amine, (21 Z,24Z)-N,N-
dimethyl- triaconta-21,24-dien-9-amine, (18Z)-N,N-dimetylheptacos-18 -en-10-
amine, (17Z)-
N,N-dimethylhex aco s- 17-en-9-amine, (19Z,22Z)-N,N-dimethyloctaco s a- 19,22-
dien-7-amine,
N,N-dimethylheptacosan-10-amine, (20Z,23Z)-N-ethyl-N-methyl-nonac o s a-20,23 -
dien-10-
amine, 1-
[(11Z,14Z)-1-nonylicosa-11,14-dien-l-yl] pyrrolidine, (20Z)-N,N-dimethyl-
heptacos-20-en-1 0-amine, (15Z)-N,N-dimethyl eptaco s-15-en-1 0-amine, (14Z)-
N,N-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 136 -
dimethylnonacos-14-en-10-amine, (17Z)-N,N-dimethylnonacos-17-en-10-amine,
(24Z)-N,N-
dimethyltritriacont-24-en-10-amine, (20Z)-N,N-dimethyl-nonacos-20-en-10-amine,
(22Z)-
N,N-dimethylhentriacont-22-en-10-amine,
(16Z)-N,N-dimethylpenta-cos-16-en-8-amine,
(12Z,15Z)-N,N-dimethy1-2-nonylhenicosa-12,15-dien-l-amine, (13Z,16Z)-N,N-
dimethy1-3-
nonyldocosa-13,16-dien-l-amine, N,N-dimethy1-1- [(IS ,2R)-2-octylcyclo-propyl]
eptadec an-
8-amine, 1-
[(1S ,2R)-2-hexylcyclo-propy1]-N,N-dimethyl nonadecan-10-amine, N,N-
dimethy1-1- [(IS ,2R)-2-octylcyclo-propyl]nonadecan-10-amine, N,N-dimethy1-21-
[R1S ,2R)-
2-octylcyclopropyl]henico san-10-amine,N,N-dimethy1-1- [(IS ,25)-2- { [(1R,2R)-
2-
pentylcyclopropyl]methyllcyclo-propyl]nonadecan-10-amine,N,N-dimethy1-1-
[(1S,2R)-2-
octylcyclopropyl]hexadecan-8-amine, N,N-
dimethyl-[(1R,2S)-2-undecyl-
cyclopropyl]tetradecan-5-amine, N,N-dimethy1-3-{ 7-[(15, 2R)-2-
octylcyclopropyl]heptyll
dodecan-l-amine, 1- [(1R,2S)-2-heptylcyclopropyl] -N,N-dimethyloctadecan-9-
amine, 1-
[(1S ,2R)-2-decylcyclopropyl] -N,N-dimethyl-penta-decan-6-amine, N,N-
dimethy1-1-
[(15,2R)-2-octylcyclopropyl] pentadecan-8-amine, R--N,N-dimethyl-l-[(9Z,12Z)-
octadeca-
9,12-dien-l-yloxy] -3-(octyloxy)prop a- n-2-amine, S --N,N-dimethy1-1-
[(9Z,12Z)-octadec a-
9,12-dien-l-yloxy] -3-(octyloxy)propan-2-amine, 1-
{ 2- [(9Z,12Z)-octadeca-9,12-dien-1 -
yloxy] -1- [(octyloxy) methyl] ethyllpyrrolidine, (25)--N,N-dimethy1-1-
R9Z,12Z)-octadeca-
9,12-dien-l-yloxy] -3- [(5Z-)-oct-5 -en-l-yloxy] propan-2-amine, 1-1 2-
[(9Z,12Z)-octadec a-
9,12-dien-l-yloxy] -1- [(octyloxy)methyl] ethyl} azetidine, (2S )-1-(hexyloxy)-
N,N-dimethyl-
3- [(9Z,12Z)-octadeca-9,12-dien-l-ylo-
xy]propan-2-amine, (2S )-1-(heptyloxy)-N,N-
dimethy1-3- [(9Z,12Z)-octadeca-9,12-dien-l-yloxy]pr-
opan-2-amine, __ N,N-dimethy1-1-
(nonyloxy)-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-2-amine, N,N-dimethy1-
1-[(9Z)-
octadec-9-en-l-yloxy]-3-(octyloxy) propan-2-amine; (25)-N,N-dimethyl-1-
R6Z,9Z,12Z)-
octadeca-6,9,12-trien-1-yloxy]-3-(octyloxy)propan-2-amine, (2S )-1- [(11Z,14Z)-
ico s a-11 ,14-
dien-1-yloxy] -N,N-dimethy1-3-(pentyloxy)pro- pan-
2-amine, (2S)-1-(hexyloxy)-3-
[(11Z,14Z)-icosa-11,14-dien-1-yloxy]-N,N-dimethylprop- an-2-amine, 1 -
[(11Z,14Z)-icosa-
11,14-dien-l-yloxy]-N,N-dimethyl 1-3-(octyloxy)propan-2-amine, 1- [(13Z,16Z)-
doco s a-
13,16-dien-l-yloxy]-N,N-dimethy1-3-(octyloxy)propan-2--amine, (2S )-1-[(13Z,
16Z)-doco s a-
13,16-dien-l-yloxy]-3-(hexyloxy)-N,N-dime- thyl-propan-2-amine, (2S )-1-
[(13Z)-docos-13-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 137 -
en-l-yloxy] -3 -(hexyloxy)-N,N-dimethyl prop an-2- amine, 1- [(13Z)-docos-13-
en-1- yloxy] -
N,N-dimethy1-3-(octyloxy) prop an-2- amine, 1- R9Z)-hexadec-9-en-1-yloxy1 -N,N-
dimethy1-3-
(octyloxy) prop an-2-amine, (2R)-N,N-dimethyl-H(1-meto yloctyl)oxy] -3-
[(9Z,12Z)-octa-
dec a-9,12-dien- 1- yloxy] prop an-2-amine, (2R)-1-[(3,7-dimethyloctyl)oxy] -
N,N-dimethy1-3-
R9Z,12Z)-octadeca-9,12-die- n-l-yloxylprop an-2-amine, N,N-dimethy1-1 -
(octyloxy)-3 -( { 8-
[(1S ,2S )-2- { [(1R,2R)-2-pentylcyclopropy1]- methyllcyclopropyl] octyll oxy)
prop an-2-
amine, N,N-dimethyl- 1- { [-(2-oclylc ycloprop yeo ctyl] oxy1-3-(octyloxy)
prop an-2- amine and
(11E,20Z,23Z)-N,N-dimethylnonaco s a-11,20,2-trien- 10-amine or a
pharmaceutically
acceptable salt or acid or stereoisomer thereof.
[00238] In
one embodiment, the lipid may be a cleavable lipid such as those described in
in
Intl. Publ. No. W02012/170889, which is herein incorporated by reference in
its entirety
[00239]
The cationic lipid can routinely be synthesized using methods known in the art
and/or
as described in Intl. Publ. Nos. W02012/040184, W02011/153120, W02011/149733,
W02011/090965, W0201/1043913, W02011/022460, W02012/061259, W02012/054365,
W02012/044638, W02010/080724 and W02010/21865; each of which is herein
incorporated
by reference in its entirety.
[00240]
Lipid derivatives can include, for example, at least, the bonding (preferably
covalent
bonding) of one or more steric stabilizers and/or functional groups to the
liposomal component
after which the steric stabilizers and/or functional groups should be
considered part of the
liposomal components. Functional groups comprises groups that can be used to
attach a
liposomal component to another moiety such as a protein. Such functional
groups include, at
least, maleimide. These steric stabilizers include at least one from
polyethylene glycol (PEG);
poly-L-lysine (PLL); mono sialoganglio side (GM1); poly(vinyl pyrrolidone)
(PVP);
poly(acrylamide) (PAA); poly(2-methyl-2-oxazoline);
poly(2-ethyl-2-oxazoline);
phosphatidyl polyglycerol; poly[N-(2-hydroxy-propyl) methacrylamide];
amphiphilic poly-N-
vinylpyrrolidones; L-amino-acid-based polymer; and polyvinyl alcohol.
[00241] In
some embodiments, the 7PANTIFOL compositions are formulated in a lipid-
polycation complex. The formation of the lipid-polycation complex may be
accomplished
using methods known in the art and/or as described in U.S. Pub. No.
20120178702, herein
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 138 -
incorporated by reference in its entirety. As a non-limiting example, the
polycation may
include a cationic peptide or a polypeptide such as, but not limited to,
polylysine, polyornithine
and/or polyarginine and the cationic peptides described in International Pub.
No.
W02012/013326; herein incorporated by reference in its entirety. In another
embodiment, the
yPANTIFOL is formulated in a lipid-polycation complex which further includes a
neutral lipid
such as, but not limited to, cholesterol or dioleoyl phosphatidylethanolamine
(DOPE).
[00242] Since the components of a liposome can include any molecule(s)
(e.g.,
chemical/reagent/protein) that is bound to it, in some embodiments, the
components of the
provided liposomes include, at least, a member selected from the group DSPE,
DSPE-PEG,
DSPE-maleimide, HSPC; HSPC-PEG; HSPC-maleimide; cholesterol; cholesterol-PEG;
and
cholesterol-maleimide. In some embodiments, the components of the provided
liposomes
include DSPE, DSPE-PEG, DSPE-maleimide, HSPC; HSPC-PEG; HSPC-maleimide;
cholesterol; cholesterol-PEG; and cholesterol-maleimide. In a preferred
embodiment, the
liposomal components that make up the liposome comprises DSPE; DSPE-FITC; DSPE-
maleimide; cholesterol; and HSPC.
[00243] In additional embodiments, the liposomes of the liposome
compositions provided
herein comprise oxidized phospholipids. In some embodiments, the liposomes
comprise an
oxidize phospholipid of a member selected from phosphatidylserines,
phosphatidylinositols,
phosphatidylethanolamines, phosphatidyl-cholines and 1 -p almyto y1-2 -
arachidono yl- sn-
glycero-2-phosphate. In some embodiments, the phospholipids have unsaturated
bonds. In
some embodiments, the phospholipids are arachidonic acid containing
phospholipids. In
additional embodiments, the phospholipids are sn-2-oxygenated. In additional
embodiments,
the phospholipids are not fragmented.
[00244] In some embodiments, the liposomes of the disclosed liposome
compositions
comprise oxidized 1-p almitoy1-2 -arachidono yl- sn-glycero-3 -
phosphorylcholine (OxPAPC).
The term "oxPAPC", as used herein, refers to lipids generated by the oxidation
of 1-palmitoy1-
2-arachidonyl-sn-glycero-3-phosphorylcholine (PAPC), which results in a
mixture of oxidized
phospholipids containing either fragmented or full length oxygenated sn-2
residues. Well-
characterized oxidatively fragmented species contain a five- carbon sn-2
residue bearing
CA 03090505 2020-08-05
WO 2019/157148
PCT/US2019/017004
- 139 -
omega-aldehyde or omega-carboxyl groups. Oxidation of arachidonic acid residue
also
produces phospholipids containing esterified isoprostanes. In some
embodiments, the oxPAPC
includes HOdiA-PC, KOdiA-PC, HOOA-PC and KOOA-PC species, among other oxidized
products present in oxPAPC. In further embodiments, the oxPAPCs are
epoxyisoprostane-
containing phospholipids. In further embodiments, the oxPAPC is 1-palmitoy1-2-
(5,6-
epoxyisoprostane E2)- sn-glycero-3 -phosphocholine (5,6-PEIPC), 1-p almitoy1-2-
(epoxy-
cyclo-pentenone)-sn-glycero-3 -pho sphorylcholine (PECPC) and/or 1-palmitoy1-2-
(epoxy-
isoprostane E2)-sn-glycero-4-phosphocholine (PEIPC). In some embodiments, the
phospholipids have unsaturated bonds. In some embodiments, the phospholipids
are
arachidonic acid containing phospholipids. In additional embodiments, the
phospholipids are
sn-2-oxygenated. In additional embodiments, the phospholipids are not
fragmented.
[00245] In
some embodiments, the liposomal gamma polyglutamated Antifolate composition
is pegylated (i.e., a pegylated liposomal gamma polyglutamated (e.g.,
pentaglutamated or
hexaglutamated) antifolate (PLp-yPANTIFOL or TPLp-yPANTIFOL). In some
embodiments,
the PLp-yPANTIFOL or TPLp-yPANTIFOL is water soluble. That is, the PLp-
yPANTIFOL
or TPLp-yPANTIFOL is in the form an aqueous solution.
[00246] In
some embodiments, the liposomes of the disclosed liposome compositions
comprise a lipid selected from: 1-palmitoy1-2-glutaroyl-sn-glycero-3-
phosphocholine (PGPC);
1-p almitoy1-2-(9 'oxo-nonanoy1)-sn-glycero-3-phosphocholine; 1-p almitoy1-2-
arachinodo yl-
sn-glycero-3 -phosphocholine; 1-p
almitoy1-2-myris toyl- sn-glycero-3 -phosphocholine; 1-
palmito y1-2-hexadec yl- sn-glyc ero-3 -phosphocholine; 1-p almitoy1-2-
azelaoyl- sn-glycero-3 -
phosphocholine; and 1-p almito y1-2-aceto yl- sn-glycero-3 -pho spho-choline.
In further
embodiments, the liposome comprises PGPC.
[00247] In
some embodiments, the pH of solutions comprising the liposome composition is
from pH 2 to 8, or any range therein between. In some embodiments, the pH of
solutions
comprising the liposome composition is from pH 5 to 8 or from pH 2 to 6, or
any range therein
between. In some embodiments, the pH of solutions comprising the liposome
composition is
from pH 5 to 8, or any range therein between. In some embodiments, the pH of
solutions
comprising the liposome composition is from pH 6 to 7, or any range therein
between. In some
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 140 -
embodiments, the pH of solutions comprising the liposome composition is from 6
to 7.5, from
6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range therein between.
[00248] In some embodiments, at least one component of the liposome lipid
bilayer is
functionalized (or reactive). As used herein, a functionalized component is a
component that
comprises a reactive group that can be used to crosslink reagents and moieties
to the lipid. If
the lipid is functionalized, any liposome that it forms is also
functionalized. In some
embodiments, the reactive group is one that will react with a crosslinker (or
other moiety) to
form crosslinks. The reactive group in the liposome lipid bilayer is located
anywhere on the
lipid that allows it to contact a crosslinker and be crosslinked to another
moiety (e.g., a steric
stabilizer or targeting moiety). In some embodiments, the reactive group is in
the head group
of the lipid, including for example a phospholipid. In some embodiments, the
reactive group
is a maleimide group. Maleimide groups can be crosslinked to each other in the
presence of
dithiol crosslinkers including but not limited to dithiolthrietol (DTT).
[00249] It is to be understood that the use of other functionalized lipids,
other reactive groups,
and other crosslinkers beyond those described above is further contemplated.
In addition to the
maleimide groups, other examples of contemplated reactive groups include but
are not limited
to other thiol reactive groups, amino groups such as primary and secondary
amines, carboxyl
groups, hydroxyl groups, aldehyde groups, alkyne groups, azide groups,
carbonyls, halo acetyl
(e.g., iodoacetyl) groups, imidoester groups, N-hydroxysuccinimide esters,
sulfhydryl groups,
and pyridyl disulfide groups.
[00250] Functionalized and non-functionalized lipids are available from a
number of
commercial sources including Avanti Polar Lipids (Alabaster, AL) and Lipoid
LLC (Newark,
NJ).
(2) Liposome interior space
[00251] In further non-limiting embodiments, the provided liposomes enclose
an interior
space. In some embodiments, the interior space comprises, but is not limited
to, an aqueous
solution. In some embodiments, the interior space comprises a gamma
polyglutamated
Antifolate as provided herein. In additional embodiments, the interior space
of the liposome
comprises a tonicity agent. In some embodiments. In some embodiments, the
concentration
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 141 -
(weight percent) of the tonicity agent is 0.1-20%, 1-20%, 0.5-15%, 1-15%, or 1-
50%, or any
range therein between. In some embodiments, the interior space of the liposome
includes a
sugar (e.g., trehalose, maltose, sucrose, lactose, mannose, mannitol,
glycerol, dextrose,
fructose, etc.). In further embodiments, the concentration (weight percent) of
the sugar is
0.1-20%, 1-20%, 0.5-15%, 1%-15%, or 1-50%, or any range therein between. In
some
embodiments, the pH of the interior space of the liposome is from pH 2 to 8,
or any range
therein between. In some embodiments, the pH of solutions comprising the
liposome
composition is from pH 5 to 8, or any range therein between. In some
embodiments, the pH of
solutions comprising the liposome composition is from pH 6 to 7, or any range
therein between.
In some embodiments, the pH of solutions comprising the liposome composition
is from 6 to
7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range
therein between. In some
embodiments, the interior space comprises buffer. In further embodiments, the
buffer a buffer
selected from HEPES, citrate, or sodium phosphate (e.g., monobasic and/or
dibasic sodium
phosphate). In some embodiments, the buffer is HEPES. In some embodiments, the
buffer is
citrate. In some embodiments, the buffer is sodium phosphate (e.g., monobasic
and/or dibasic
sodium phosphate). In some embodiments, the buffer is at a concentration of 15
to 200 mM,
or any range therein between. In further embodiments, the buffer is at a
concentration of
between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM,
between 5 to
50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5
to 15
mM, or any range therein between. In some embodiments, the buffer is HEPES at
a
concentration of 15 to 200 mM, or any range therein between. In some
embodiments, the buffer
is citrate at a concentration of 15 to 200 mM, or any range therein between.
In some
embodiments, the buffer is sodium phosphate at a concentration of 15 to 200
mM, or any range
therein between. In some embodiments, the interior space of the liposome
comprises a total
concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM,
or 50 mM
to 500 mM, or any range therein between.
[00252] In some embodiments, the interior space of the liposome includes
glutamine,
glutamate, and/or polyglutamate (e.g., diglutamate, triglutamate,
tetraglutamate, and/or
pentaglutamate, containing one or more gamma glutamyl group linkages, or 1 or
more alpha
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 142 -
glutamyl linkages). In further embodiments, the concentration weight percent
of the
glutamine, glutamate, and/or polyglutamate is 0.1-20%, 1-20%, 0.5-15%, 1%-15%,
5-20%,
or 1-50%, or any range therein between. In some embodiments the interior space
of the
liposome includes glutamine. In some embodiments the interior space of the
liposome
includes glutamate. In some embodiments the interior space of the liposome
includes
polyglutamate. In some embodiments, the concentration (weight percent) of
glutamine,
glutamate, and/or polyglutamate is 1-15%, or any range therein between. In an
additional
embodiment, the glutamine, glutamate, and/or polyglutamate is present at about
5% to 20%
weight percent of the glutamine, glutamate, and/or polyglutamate or any
combination of one
or more lyoprotectants or cryoprotectants at a total concentration of 5% to
20%. In some
embodiments, the interior space comprises buffer. In further embodiments, the
buffer is
HEPES buffer or citrate buffer. In further embodiments, the citrate buffer is
at a concentration
of between 5 to 200 mM. In some embodiments, the interior space has a pH of
between 2.8
to 6. In some embodiments, the pH of solutions comprising the liposome
composition is from
6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any range
therein between. In
some embodiments, the interior space comprises buffer. In some embodiments,
the buffer is
selected from HEPES, citrate, or sodium phosphate (e.g., monobasic and/or
dibasic sodium
phosphate). In some embodiments, the buffer is HEPES. In some embodiments, the
buffer is
citrate. In some embodiments, the buffer is sodium phosphate (e.g., monobasic
and/or dibasic
sodium phosphate). In some embodiments, the buffer is at a concentration of 15
to 200 mM,
or any range therein between. In further embodiments, the buffer is at a
concentration of
between 5 to 200 mM, 15-200, between 5 to 100 mM, between 15 to 100 mM,
between 5 to
50 mM, between 15 to 50 mM, between 5 to 25 mM, between 5 to 20 mM, between 5
to 15
mM, or any range therein between. In some embodiments, the buffer is HEPES at
a
concentration of 15 to 200 mM, or any range therein between. In some
embodiments, the
buffer is citrate at a concentration of 15 to 200 mM, or any range therein
between. In some
embodiments, the buffer is sodium phosphate at a concentration of 15 to 200
mM, or any
range therein between. In additional embodiments, the interior space of the
liposome
comprises sodium acetate and/or calcium acetate. In some embodiments, the
interior space of
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 143 -
the liposome comprises a total concentration of sodium acetate and calcium
acetate of
between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between. In
some
embodiments, the interior space of the liposome comprises a total
concentration of sodium
acetate and calcium acetate of between 50 mM to 500 mM.
[00253] In some embodiments, the interior space of the lipo some includes
glutamine. In further
embodiments, the concentration weight percent of the glutamine is 0.1-20%, 1-
20%, 0.5-15%,
1%-15%, 5-20%, or 1-50%, or any range therein between. In some embodiments,
the
concentration (weight percent) of glutamine is 1-15%, or any range therein
between. In an
additional embodiment, the glutamine is present at about 5% to 20% weight
percent of
glutamine or any combination of one or more lyoprotectants or cryoprotectants
at a total
concentration of 5% to 20%. In some embodiments, the interior space comprises
buffer. In
further embodiments, the buffer is HEPES buffer or citrate buffer. In further
embodiments,
the citrate buffer is at a concentration of between 5 to 200 mM. In some
embodiments, the
interior space has a pH of between 2.8 to 6. In some embodiments, the pH of
solutions
comprising the liposome composition is from 6 to 7.5, from 6.5 to 7.5, from
6.7 to 7.5, or
from 6.3 to 7.0, or any range therein between. In some embodiments, the
interior space
comprises buffer. In some embodiments, the buffer is selected from HEPES,
citrate, or sodium
phosphate (e.g., monobasic and/or dibasic sodium phosphate). In some
embodiments, the
buffer is HEPES. In some embodiments, the buffer is citrate. In some
embodiments, the
buffer is sodium phosphate (e.g., monobasic and/or dibasic sodium phosphate).
In some
embodiments, the buffer is at a concentration of 15 to 200 mM, or any range
therein between.
In further embodiments, the buffer is at a concentration of between 5 to 200
mM, 15-200,
between 5 to 100 mM, between 15 to 100 mM, between 5 to 50 mM, between 15 to
50 mM,
between 5 to 25 mM, between 5 to 20 mM, between 5 to 15 mM, or any range
therein
between. In some embodiments, the buffer is HEPES at a concentration of 15 to
200 mM, or
any range therein between. In some embodiments, the buffer is citrate at a
concentration of
15 to 200 mM, or any range therein between. In some embodiments, the buffer is
sodium
phosphate at a concentration of 15 to 200 mM, or any range therein between. In
additional
embodiments, the interior space of the liposome comprises sodium acetate
and/or calcium
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 144 -
acetate. In some embodiments, the interior space of the liposome comprises a
total
concentration of sodium acetate and calcium acetate of between 5 mM to 500 mM,
or 50 mM
to 500 mM, or any range therein between. In some embodiments, the interior
space of the
liposome comprises a total concentration of sodium acetate and calcium acetate
of between
50 mM to 500 mM.
[00254] In some embodiments, the interior space of the liposome includes
trehalose. In further
embodiments, the concentration weight percent of trehalose is 0.1-20%, 1-20%,
0.5-15%, 1%-
15%, 5-20%, or 1-50%, or any range therein between. In further embodiments,
the
concentration (weight percent) of trehalose is 1-15%, or any range therein
between. In an
additional embodiment, the trehalose is present at about 5% to 20% weight
percent of trehalose
or any combination of one or more lyoprotectants or cryoprotectants at a total
concentration of
5% to 20%. In some embodiments, the interior space comprises buffer. In
further
embodiments, the buffer is HEPES buffer or citrate buffer. In further
embodiments, the citrate
buffer is at a concentration of between 5 to 200 mM. In some embodiments, the
interior space
has a pH of between 2.8 to 6. In some embodiments, the pH of solutions
comprising the
liposome composition is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or
from 6.3 to 7.0, or
any range therein between. In some embodiments, the interior space comprises
buffer. In some
embodiments, the buffer is selected from HEPES, citrate, or sodium phosphate
(e.g.,
monobasic and/or dibasic sodium phosphate). In some embodiments, the buffer is
HEPES. In
some embodiments, the buffer is citrate. In some embodiments, the buffer is
sodium phosphate
(e.g., monobasic and/or dibasic sodium phosphate). In some embodiments, the
buffer is at a
concentration of 15 to 200 mM, or any range therein between. In further
embodiments, the
buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100
mM, between
15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM,
between
to 20 mM, between 5 to 15 mM, or any range therein between. In some
embodiments, the
buffer is HEPES at a concentration of 15 to 200 mM, or any range therein
between. In some
embodiments, the buffer is citrate at a concentration of 15 to 200 mM, or any
range therein
between. In some embodiments, the buffer is sodium phosphate at a
concentration of 15 to 200
mM, or any range therein between. In additional embodiments, the interior
space of the
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 145 -
liposome comprises sodium acetate and/or calcium acetate. In some embodiments,
the interior
space of the liposome comprises a total concentration of sodium acetate and
calcium acetate
of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between.
In some
embodiments, the interior space of the liposome comprises a total
concentration of sodium
acetate and calcium acetate of between 50 mM to 500 mM.
[00255] In some embodiments, the interior space of the liposome includes
dextrose. In further
embodiments, the concentration weight percent of dextrose is 0.1-20%, 1-20%,
0.5-15%, 1-
15%, 5-20%, or 1-50%, or any range therein between. In yet further
embodiments, the
concentration (weight percent) of dextrose is 1-15%, or any range therein
between. In an
additional embodiment, the dextrose is present at about 5% to 20% weight
percent of dextrose
or any combination of one or more lyoprotectants or cryoprotectants at a total
concentration of
5% to 20%. In some embodiments, the pH of solutions comprising the liposome
composition
is from 6 to 7.5, from 6.5 to 7.5, from 6.7 to 7.5, or from 6.3 to 7.0, or any
range therein
between. In some embodiments, the interior space comprises buffer. In some
embodiments,
the buffer is selected from HEPES, citrate, or sodium phosphate (e.g.,
monobasic and/or
dibasic sodium phosphate). In some embodiments, the buffer is HEPES. In some
embodiments, the buffer is citrate. In some embodiments, the buffer is sodium
phosphate (e.g.,
monobasic and/or dibasic sodium phosphate). In some embodiments, the buffer is
at a
concentration of 15 to 200 mM, or any range therein between. In yet further
embodiments, the
buffer is at a concentration of between 5 to 200 mM, 15-200, between 5 to 100
mM, between
15 to 100 mM, between 5 to 50 mM, between 15 to 50 mM, between 5 to 25 mM,
between
to 20 mM, between 5 to 15 mM, or any range therein between. In some
embodiments, the
buffer is HEPES at a concentration of 15 to 200 mM, or any range therein
between. In some
embodiments, the buffer is citrate at a concentration of 15 to 200 mM, or any
range therein
between. In some embodiments, the buffer is sodium phosphate at a
concentration of 15 to 200
mM, or any range therein between. In additional embodiments, the interior
space of the
liposome comprises sodium acetate and/or calcium acetate. In some embodiments,
the interior
space of the liposome comprises a total concentration of sodium acetate and
calcium acetate
of between 5 mM to 500 mM, or 50 mM to 500 mM, or any range therein between.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 146 -
[00256] In additional embodiments, the disclosure provides liposomal
compositions that
comprise a liposome encapsulating (i.e., filled with) a gamma polyglutamated
Antifolate (e.g.,
a 7PANTIFOL disclosed herein). In some embodiments, the liposomal composition
comprises
a yPANTIFOL according to any of [1]411] of the Detailed Description Section.
In some
embodiments, the liposome comprises a polyglutamated Antifolate described in
Section I. In
some embodiments, the liposomal composition comprises a liposome according to
any of [12]-
[67] of the Detailed Description Section. In some embodiments, a liposome in
the liposomal
composition comprises a 7PANTIFOL containing 4, 5, 2-10, 4-6, or more than 5,
y-glutamyl
groups (including the glutamyl group of the Antifolate). In some embodiments,
the gamma
polyglutamated Antifolate in the Lp-yPANTIFOL comprises two or more glutamyl
groups in
the L-form. In other embodiments, the gamma polyglutamated Antifolate in the
Lp-
yPANTIFOL comprises a glutamyl group in the D-form. In further embodiments,
the gamma
polyglutamated Antifolate in the Lp-yPANTIFOL comprises a glutamyl group in
the D-form
and two or more glutamyl groups in the L-form. In additional embodiments, the
gamma
polyglutamated Antifolate in the Lp-yPANTIFOL comprises two or more glutamyl
groups that
have a gamma carboxyl linkage. In some embodiments, the liposomal composition
comprises
a liposome comprising a 7 pentaglutamated Antifolate. In further embodiments,
the liposome
comprises an L-7 pentaglutamated Antifolate, a D-y pentaglutamated Antifolate,
or an L- and
D-7 pentaglutamated Antifolate. In some embodiments, the liposomal composition
comprises
a liposome comprising a 7 hexaglutamated Antifolate (Lp-7PANTIFOL). In further
embodiments, the liposome comprises an L-7 hexaglutamated Antifolate, a D-7
hexaglutamated Antifolate, or an L- and D-7 hexaglutamated Antifolate.
[00257] In some embodiments, the disclosure provides a liposomal
composition comprising a
targeted and pegylated liposome that comprises a gamma polyglutamated
Antifolate (TPLp-
yPANTIFOL). In some embodiments, the liposomal composition comprises a
7PANTIFOL
according to any of [11411] of the Detailed Description Section. In some
embodiments, the
liposomal composition comprises a polyglutamate of an Antifolate disclosed in
Section I,
herein. In some embodiments, the liposomal composition is a targeted pegylated
liposomal
composition according to any of [50]-[69] of the Detailed Decsription. In some
embodiments,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 147 -
the targeted pegylated liposomal gamma polyglutamated (e.g., pentaglutamated
or
hexaglutamated) Antifolate comprises a medium comprising a liposome including
an interior
space; an aqueous gamma polyglutamated Antifolate disposed within the interior
space; and a
targeting moiety comprising a protein with specific affinity for at least one
folate receptor, and
wherein the targeting moiety disposed at the exterior of the liposome. In some
embodiments,
the medium is an aqueous solution. In some embodiments, the interior space,
the exterior space
(e.g., the medium), or both the interior space and the medium contains one or
more
lyoprotectants or cryoprotectants which are listed above. In some embodiments,
the
cryoprotectant is mannitol, trehalose, sorbitol, or sucrose.
[00258] In some embodiments, the liposome encapsulating gamma
polyglutamated Antifolate
(i.e., Lp-yPANTIFOL, including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-yPANTIFOL,
and NTLp-yPANTIFOL) has an interior space that contains less than 500,000 or
less than
200,000 molecules of gamma polyglutamated Antifolate. In some embodiments, the
liposome
interior space contains between 10 to 100,000 molecules of gamma
polyglutamated Antifolate,
or any range therein between. In some embodiments, the liposome interior space
contains
between 10,000 to 100,000 molecules of gamma polyglutamated Antifolate, or any
range
therein between. In some embodiments, the liposome is not pegylated and has an
interior space
that contains less than 500,000 or less than 200,000 molecules of gamma
polyglutamated
Antifolate. In some embodiments, the liposome is not pegylated and the
interior space of the
liposome contains between 10 to 100,000 molecules of gamma polyglutamated
Antifolate, or
any range therein between. In further embodiments, the liposome is not
pegylated and the
interior space of the liposome contains between 10,000 to 100,000 molecules of
gamma
polyglutamated Antifolate, or any range therein between. In some embodiments,
the lipo some
comprises a targeting moiety, is not pegylated (TLp-yPANTIFOL), and has an
interior space
that contains less than 500,000 or less than 200,000 molecules of gamma
polyglutamated
Antifolate. In some embodiments, the liposome comprises a targeting moiety, is
not pegylated,
and the interior space of the liposome contains between 10 to 100,000
molecules of gamma
polyglutamated Antifolate, or any range therein between. In further
embodiments, the
liposome comprises a targeting moiety, is not pegylated, and the interior
space of the liposome
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 148 -
contains between 10,000 to 100,000 molecules of gamma polyglutamated
Antifolate, or any
range therein between. In some embodiments, the liposome does not comprise a
targeting
moiety, is not pegylated, (NTLp-yPANTIFOL) and has an interior space that
contains less than
500,000 or less than 200,000 molecules of gamma polyglutamated Antifolate. In
some
embodiments, the liposome does not comprise a targeting moiety, is not
pegylated, and the
interior space of the liposome contains between 10 to 100,000 molecules of
gamma
polyglutamated Antifolate, or any range therein between. In further
embodiments, the
liposome does not comprise a targeting moiety, is not pegylated, and the
interior space of the
liposome contains between 10,000 to 100,000 molecules of gamma polyglutamated
Antifolate,
or any range therein between.
[00259] In some embodiments, the liposome encapsulates gamma polyglutamated
containing
2-10 glutamyl groups (i.e., Lp-yPANTIFOL, including PLp-yPANTIFOL, TPLp-
yPANTIFOL, TLp-yPANTIFOL, and NTLp-yPANTIFOL) and has an interior space that
contains less than 500,000 or less than 200,000 molecules of gamma
polyglutamated Antifolate
containing 2-10 glutamyl groups. In some embodiments, the liposome interior
space contains
between 10 to 100,000 molecules of gamma polyglutamated Antifolate containing
2-10
glutamyl groups, or any range therein between. In further embodiments, the
liposome interior
space contains between 10,000 to 100,000 molecules of gamma polyglutamated
Antifolate
containing 2-10 glutamyl groups, or any range therein between. In some
embodiments, the
liposome is not pegylated and has an interior space that contains less than
500,000 or less than
200,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl
groups. In
some embodiments, the liposome is not pegylated and the interior space of the
liposome
contains between 10 to 100,000 molecules of gamma polyglutamated Antifolate
containing 2-
glutamyl groups, or any range therein between. In further embodiments, the
liposome is not
pegylated and the interior space of the liposome contains between 10,000 to
100,000 molecules
of gamma polyglutamated Antifolate containing 2-10 glutamyl groups, or any
range therein
between. In some embodiments, the liposome comprises a targeting moiety, is
not pegylated
(TLp-yPANTIFOL) and has an interior space that contains less than 500,000 or
less than
200,000 molecules of gamma polyglutamated Antifolate containing 2-10 glutamyl
groups. In
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 149 -
some embodiments, the liposome comprises a targeting moiety, is not pegylated,
and the
interior space of the liposome contains between 10 to 100,000 molecules of
gamma
polyglutamated Antifolate containing 2-10 glutamyl groups, or any range
therein between. In
further embodiments, the liposome comprises a targeting moiety, is not
pegylated, and the
interior space of the liposome contains between 10,000 to 100,000 molecules of
gamma
polyglutamated Antifolate containing 2-10 glutamyl groups, or any range
therein between. In
some embodiments, the liposome is non-targeted and unpegylated (NTLp-
yPANTIFOL) and
has an interior space that contains less than 500,000 or less than 200,000
molecules of gamma
polyglutamated Antifolate containing 2-10 glutamyl groups. In some
embodiments, the
liposome does not comprise a targeting moiety, is not pegylated, and the
interior space of the
liposome contains between 10 to 100,000 molecules of gamma polyglutamated
Antifolate
containing 2-10 glutamyl groups, or any range therein between. In further
embodiments, the
liposome is non-targeted and unpegylated and the interior space of the
liposome contains
between 10,000 to 100,000 molecules of gamma polyglutamated Antifolate
containing 2-10
glutamyl groups, or any range therein between.
[00260] In some embodiments, the liposome encapsulates gamma
tetraglutamated Antifolate
(i.e., Lp-yPANTIFOL, including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-yPANTIFOL,
and NTLp-yPANTIFOL) and has an interior space that contains less than 500,000
or less than
200,000 molecules of gamma tetraglutamated Antifolate. In some embodiments,
the liposome
interior space contains between 10 to 100,000 molecules of gamma
tetraglutamated Antifolate,
or any range therein between. In some embodiments, the liposome interior space
contains
between 10,000 to 100,000 molecules of gamma tetraglutamated Antifolate, or
any range
therein between. In some embodiments, the liposome is not pegylated and has an
interior space
that contains less than 500,000 or less than 200,000 molecules of gamma
tetraglutamated
Antifolate. In some embodiments, the liposome is not pegylated and the
interior space of the
liposome contains between 10 to 100,000 molecules of gamma tetraglutamated
Antifolate, or
any range therein between. In further embodiments, the liposome is not
pegylated and the
interior space of the liposome contains between 10,000 to 100,000 molecules of
gamma
tetraglutamated Antifolate, or any range therein between. In some embodiments,
the liposome
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 150 -
comprises a targeting moiety, is not pegylated (TLp-yPANTIFOL) and has an
interior space
that contains less than 500,000 or less than 200,000 molecules of gamma
tetraglutamated
Antifolate. In some embodiments, the liposome comprises a targeting moiety, is
not pegylated,
and the interior space of the liposome contains between 10 to 100,000
molecules of gamma
tetraglutamated Antifolate, or any range therein between. In further
embodiments, the
liposome comprises a targeting moiety, is not pegylated, and the interior
space of the liposome
contains between 10,000 to 100,000 molecules of gamma tetraglutamated
Antifolate, or any
range therein between. In some embodiments, the liposome does not comprise a
targeting
moiety, is not pegylated, (NTLp-yPANTIFOL) and has an interior space that
contains less than
500,000 or less than 200,000 molecules of gamma tetraglutamated Antifolate. In
some
embodiments, the liposome does not comprise a targeting moiety, is not
pegylated, and the
interior space of the liposome contains between 10 to 100,000 molecules of
gamma
tetraglutamated Antifolate, or any range therein between. In further
embodiments, the
liposome does not comprise a targeting moiety, is not pegylated, and the
interior space of the
liposome contains between 10,000 to 100,000 molecules of gamma tetraglutamated
Antifolate,
or any range therein between.
[00261] In some embodiments, the liposome encapsulates gamma
pentaglutamated Antifolate
(e.g., Lp-yPANTIFOL, including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-yPANTIFOL,
and NTLp-yPANTIFOL) and has an interior space that contains less than 500,000
or less than
200,000 molecules of gamma pentaglutamated Antifolate. In some embodiments,
the liposome
interior space contains between 10 to 100,000 molecules of gamma
pentaglutamated
Antifolate, or any range therein between. In some embodiments, the liposome
interior space
contains between 10,000 to 100,000 molecules of gamma pentaglutamated
Antifolate, or any
range therein between. In some embodiments, the liposome is not pegylated and
has an interior
space that contains less than 500,000 or less than 200,000 molecules of gamma
pentaglutamated Antifolate. In some embodiments, the liposome is not pegylated
and the
interior space of the liposome contains between 10 to 100,000 molecules of
gamma
pentaglutamated Antifolate, or any range therein between. In further
embodiments, the
liposome is not pegylated and the interior space of the liposome contains
between 10,000 to
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 151 -
100,000 molecules of gamma pentaglutamated Antifolate, or any range therein
between. In
some embodiments, the liposome comprises a targeting moiety, is not pegylated
(TLp-
yPANTIFOL) and has an interior space that contains less than 500,000 or less
than 200,000
molecules of gamma pentaglutamated Antifolate. In some embodiments, the
liposome
comprises a targeting moiety, is not pegylated, and the interior space of the
liposome contains
between 10 to 100,000 molecules of gamma pentaglutamated Antifolate, or any
range therein
between. In further embodiments, the liposome comprises a targeting moiety, is
not pegylated,
and the interior space of the liposome contains between 10,000 to 100,000
molecules of gamma
pentaglutamated Antifolate, or any range therein between. In some embodiments,
the liposome
is non-targeted and unpegylated (NTLp-yPANTIFOL) and has an interior space
that contains
less than 500,000 or less than 200,000 molecules of gamma pentaglutamated
Antifolate. In
some embodiments, the liposome does not contain a targeting moiety and it not
pegylated, and
the interior space of the liposome contains between 10 to 100,000 molecules of
gamma
pentaglutamated Antifolate, or any range therein between. In further
embodiments, the
liposome is non-targeted and unpegylated and the interior space of the
liposome contains
between 10,000 to 100,000 molecules of gamma pentaglutamated Antifolate, or
any range
therein between.
[00262] In some embodiments, the liposome encapsulates gamma hexaglutamated
Antifolate
(i.e., Lp-yPANTIFOL, including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-yPANTIFOL,
and NTLp-yPANTIFOL) and has an interior space that contains less than 500,000
or less than
200,000 molecules of gamma hexaglutamated Antifolate. In some embodiments, the
liposome
interior space contains between 10 to 100,000 molecules of gamma
hexaglutamated Antifolate,
or any range therein between. In further embodiments, the liposome interior
space contains
between 10,000 to 100,000 molecules of gamma hexaglutamated Antifolate, or any
range
therein between. In some embodiments, the liposome is not pegylated and has an
interior space
that contains less than 500,000 or less than 200,000 molecules of gamma
hexaglutamated
Antifolate. In some embodiments, the liposome is not pegylated and the
interior space of the
liposome contains between 10 to 100,000 molecules of gamma hexaglutamated
Antifolate, or
any range therein between. In further embodiments, the liposome is not
pegylated and the
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 152 -
interior space of the liposome contains between 10,000 to 100,000 molecules of
gamma
hexaglutamated Antifolate, or any range therein between. In some embodiments,
the liposome
comprises a targeting moiety, is not pegylated (TLp-7PANTIFOL) and has an
interior space
that contains less than 500,000 or less than 200,000 molecules of gamma
hexaglutamated
Antifolate. In some embodiments, the liposome comprises a targeting moiety, is
not pegylated,
and the interior space of the liposome contains between 10 to 100,000
molecules of gamma
hexaglutamated Antifolate, or any range therein between. In further
embodiments, the
liposome comprises a targeting moiety, is not pegylated, and the interior
space of the liposome
contains between 10,000 to 100,000 molecules of gamma hexaglutamated
Antifolate, or any
range therein between. In some embodiments, the liposome is non-targeted and
unpegylated
(NTLp-yPANTIFOL) and has an interior space that contains less than 500,000 or
less than
200,000 molecules of gamma hexaglutamated Antifolate. In some embodiments, the
liposome
does not comprise a targeting moiety, is not pegylated, and the interior space
of the liposome
contains between 10 to 100,000 molecules of gamma hexaglutamated Antifolate,
or any range
therein between. In further embodiments, the liposome does not comprise a
targeting moiety,
is not pegylated, and the interior space of the liposome contains between
10,000 to 100,000
molecules of gamma hexaglutamated Antifolate, or any range therein between.
[00263] In some embodiments, the disclosure provides a liposomal gamma
polyglutamated
Antifolate composition wherein the liposome encapsulates gamma polyglutamated
Antifolate
or a salt or acid thereof, and one or more aqueous pharmaceutically acceptable
carriers. In
some embodiments, the liposome interior space contains trehalose. In some
embodiments, the
liposome interior space contains 5% to 20% weight of trehalose. In some
embodiments, the
liposome interior space contains HBS at a concentration of between 1 to 200 mM
and a pH of
between 2 to 8. In some embodiments, liposome interior space has a pH 5-8, or
any range
therein between. In some embodiments, liposome interior space has a pH 6-7, or
any range
therein between. In some embodiments, the liposome interior space has a total
concentration
of sodium acetate and calcium acetate of between 50 mM to 500 mM, or any range
therein
between.
A NON-POLYGLUTAMATED POLYGLUTAMATABLE ANTIFOLATES
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 153 -
[00264] In some embodiments, the liposome gamma polyglutamated Antifolate
(e.g., Lp-
yPANTIFOL, including PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-yPANTIFOL, and
NTLp-yPANTIFOL) compositions comprise gamma polyglutamated Antifolate e.g., a
yPANTIFOL disclosed herein) and one or more non-polyglutamated,
polyglutamatable
antifolate compositions.
[00265] In some embodiments, the Lp-yPANTIFOL (e.g., PLp-yPANTIFOL, TPLp-
yPANTIFOL, TLp-yPANTIFOL, and NTLp-yPANTIFOL) comprises gamma
polyglutamated Antifolate (e.g., a yPANTIFOL disclosed herein and the
Antifolate
(ANTIFOL). In some embodiments, the Lp-yPANTIFOL (i.e., liposome gamma
polyglutamated Antifolate) comprises gamma polyglutamated Antifolate and a
polyglutamatable antifolate selected from the group consisting of:
methotrexate (MTX),
pemetrexed (PMX), lometrexol (LMX), raltitrexed (RTX), pralatrexate, AG2034,
GW1843,
aminopterin, and LY309887. In some embodiments, the Lp-yPANTIFOL comprises
gamma
polyglutamated Antifolate and lometrexol. In some embodiments, the Lp-
yPANTIFOL
comprises gamma polyglutamated Antifolate and pemetrexed. In some embodiments,
the Lp-
yPANTIFOL comprises gamma polyglutamated Antifolate and leucovorin. In some
embodiments, the Lp-yPANTIFOL comprises gamma polyglutamated Antifolate and a
triazine antifolate derivative (e.g., a sulphonyl fluoride triazine such as
NSC 127755). In some
embodiments, the Lp-yPANTIFOL comprises gamma polyglutamated Antifolate and a
serine
hydroxymethyltransferase (SHMT2) inhibitor. In some embodiments, the SHMT2
inhibitor
is an antifolate (e.g., a polyglutamatable or nonpolyglutamatable antifolate).
In some
embodiments, the SHMT2 inhibitor is an antifolate.
NON-POLYGLUTAMATABLE ANTIFOLATES
[00266] In some embodiments, the Lp-yPANTIFOL (e.g., PLp-yPANTIFOL, TPLp-
yPANTIFOL, TLp-yPANTIFOL, and NTLp-yPANTIFOL) comprises a gamma
polyglutamated Antifolate (e.g., a yPANTIFOL disclosed herein) and a so-called
"non-
polyglutamatable" antifolate. In some embodiments, the liposome comprises a
yPANTIFOL
according to any of [1]-[11] of the Detailed Description Section. In some
embodiments, the
liposome comprises a polyglutamated Antifolate described in Section I. In some
embodiments,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 154 -
the liposome comprises a gamma polyglutamated Antifolate and a non-
polyglutamatable
antifolate that inhibits one or more enzymes in the folate cycle metabolic
pathway. In further
embodiments, the non-polyglutamatable antifolate inhibits one or more enzymes
selected
from: thymidylate synthase (TS), dihydrofolate reductase (DHFR), glycinamide
ribonucleotide
(GAR) transformylase, and aminoimidazole carboxamide ribonucleotide (AICAR)
transformylase. In some embodiments, the liposome comprises a gamma
polyglutamated
Antifolate and a non-polyglutamatable antifolate that inhibits DHFR. In some
embodiments,
the liposome comprises a gamma polyglutamated Antifolate and a non-
polyglutamatable
antifolate that inhibits TS. In some embodiments, the liposome comprises a
gamma
polyglutamated Antifolate and a non-polyglutamatable antifolate that inhibits
GAR or AICAR
transformylase. In further embodiments, the non-polyglutamatable antifolate is
selected from:
trimetrexate (TMQ), piritrexim (BW301U), and talotrexin (PT523). In further
embodiments,
the non-polyglutamatable antifolate is selected from: nolatrexed (AG337),
plevitrexed
(ZD9331, BGC9331), and BGC 945 (ONX 0801), or a pharmaceutically acceptable
salt
thereof.
PLATINUMS
[00267] In some embodiments, the liposome comprises a gamma polyglutamated
Antifolate
(Lp-yPANTIFOL, such as e.g., PLp-yPANTIFOL, TPLp-yPANTIFOL, TLp-yPANTIFOL,
and NTLp-yPANTIFOL) comprises a gamma polyglutamated Antifolate (e.g., a
yPANTIFOL
disclosed herein) and a platinum-based chemotherapeutic agent or a salt or
acid, thereof. In
some embodiments, the alpha polyglutamated Antifolate/platinum-based agent
complex
comprises a yPANTIFOL according to any of [1[411] of the Detailed Description
Section. In
some embodiments, the complex comprises a polyglutamated Antifolate described
in Section
I.
[00268] In some embodiments, the Lp-yPANTIFOL comprises a platinum-based
chemotherapeutic agent selected from: cisplatin, carboplatin, and oxaliplatin,
or a salt or acid
thereof. In other embodiments, the Lp-yPANTIFOL comprises an analog of a
platinum-based
chemotherapeutic agent selected from: cisplatin, carboplatin, or oxaliplatin,
or a salt or acid
thereof.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 155 -
[00269] In some embodiments, the Lp-yPANTIFOL comprises a gamma
polyglutamated
Antifolate and cisplatin or a salt or acid thereof. In some embodiments, the
Lp-yPANTIFOL
comprises a gamma polyglutamated Antifolate and a cisplatin analog, or a salt
or acid thereof.
[00270] In some embodiments, the Lp-yPANTIFOL comprises a gamma
polyglutamated
Antifolate and carboplatin, or a salt or acid thereof. In some embodiments,
the liposome
comprises a gamma polyglutamated Antifolate and carboplatin analog, or a salt
or acid thereof.
[00271] In some embodiments, the Lp-yPANTIFOL comprises a gamma
polyglutamated
Antifolate and oxaliplatin, or a salt or acid thereof. In some embodiments,
the liposome
comprises a gamma polyglutamated Antifolate and an oxaliplatin analog, or a
salt or acid
thereof.
[00272] In some embodiments, the liposome comprises a gamma polyglutamated
Antifolate
(e.g., a yPANTIFOL disclosed herein) and a platinum-based chemotherapeutic
agent selected
from: nedaplatin, heptaplatin, and lobaplatin, nedaplatin, heptaplatin, and
lobaplatin or a salt
or acid thereof. In some embodiments, the Lp-yPANTIFOL comprises a gamma
polyglutamated Antifolate and an analog of a platinum-based chemotherapeutic
agent selected
from: nedaplatin, heptaplatin, and lobaplatin, or a salt or acid thereof.
[00273] In some embodiments, the Lp-yPANTIFOL comprises a gamma
polyglutamated
Antifolate and a platinum-based chemotherapeutic agent selected from:
stratoplatin,
paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin,
triplatin, tetraplatin,
iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin,
JM-216, 254-S, NK
121, CI-973, DWA 2114R, NDDP, and dedaplatin, or a salt or acid thereof. In
some
embodiments, the Lp-yPANTIFOL comprises a gamma polyglutamated Antifolate and
an
analog of a platinum-based chemotherapeutic agent selected from: stratoplatin,
paraplatin,
platinol, cycloplatin, dexormaplatin, spiroplatin, picoplatin, triplatin,
tetraplatin, iproplatin,
ormaplatin, zeniplatin, platinum-triamine, traplatin, enloplatin, JM-216, 254-
S, NK 121, CI-
973, DWA 2114R, NDDP, and dedaplatin, or a salt or acid thereof.
[00274] In some embodiments, the liposome composition comprises liposomes
that further
contain one or more of an immunostimulatory agent, a detectable marker and a
maleimide
disposed on at least one of the PEG and the exterior of the liposome.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 156 -
D CYCODEXTRINS
[00275] In additional embodiments, the liposome comprise a yPANTIFOL (e.g.,
a
yPANTIFOL disclosed herein) and a cyclodextrin (e.g., a cyclodextrin in
Section TB, herein).
In some embodiments, the liposome comprises a yPANTIFOL according to any of
[1]411] of
the Detailed Description Section. In some embodiments, the liposome comprises
a
polyglutamated Antifolate described in Section I. In some embodiments, the
liposome is a
liposomal composition according to any of [121467] of the Detailed Description
Section. In
some embodiments, the yPANTIFOL liposome is a targeted liposomal composition
according
to any of [121467] of the Detailed Description Section.
[00276] In some embodiments, the yPANTIFOL liposome comprises a complex
formed by a
cyclodextrin and a therapeutic agent. In some embodiments, the therapeutic
agent is a cytotoxic
compound or a salt or acid thereof. In a further embodiment, the therapeutic
agent is a
chemotherapeutic agent or a salt or acid thereof. In another embodiment, the
therapeutic agent
is a platinum-based drug. In another embodiment, the therapeutic agent is a
taxane-based drug.
In further embodiments, the therapeutic agent of the cyclodextrin/therapeutic
agent complex is
selected from: gemcitabine, a gemcitabine-based therapeutic agent,
doxorubicin, an antifolate,
an antifolate-based chemotherapeutic, or a salt or acid, acid or free base
form thereof. In some
embodiments, the 7PANTIFOL liposome comprises a yPANTIFOL according to any of
[1]-
[11] of the Detailed Description Section. In some embodiments, the liposome
comprises a
polyglutamated Antifolate described in Section I. In some embodiments, the
yPANTIFOL
liposome is a liposomal composition according to any of [121467] of the
Detailed Description
Section. In some embodiments, the yPANTIFOL liposome is a targeted liposomal
composition
according to any of [12]467] of the Detailed Description Section. In
additional embodiments,
the molar ratio of cyclodextrin/therapeutic agent in the complex is in the
range 1-10:1. In some
embodiments, the molar ratio of yPANTIFOL/therapeutic agent in the complex is
1:1, 2:1, 3:1,
4:1, 5:1, 6:1, 7:1, or 10:1. In some embodiments, the molar ratio of
yPANTIFOL/therapeutic
agent in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10,
1:11, 1:12, 1:13, 1:14,
1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In some embodiments,
the molar ratio
of cyclodextrin/therapeutic agent in the complex is: 1:1, 2:1, 3:1, 4:1, 5:1,
6:1, 7:1, 8:1, 9:1,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 157 -
10:1,11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or
>50:1. In additional
embodiments, the cyclodextrin//platinum-based agent complex is encapsulated in
a liposome
(e.g., as described herein or otherwise known in the art).
[00277] In some embodiments, the yPANTIFOL liposome comprises yPANTIFOL and
a
cyclodextrin/platinum-based chemotherapeutic agent complex. In some
embodiments, the
platinum-based chemotherapeutic agent is selected from: cisplatin,
carboplatin, and
oxaliplatin, or a salt or acid thereof. In other embodiments, the
cyclodextrin/platinum-based
chemotherapeutic agent complex comprises an analog of a cisplatin,
carboplatin, oxaliplatin,
or a salt or acid thereof. In some embodiments, the liposome comprises a
yPANTIFOL
according to any of [1]-[11] of the Detailed Description Section. In some
embodiments, the
liposome comprises a polyglutamated Antifolate described in Section I. In some
embodiments,
the yPANTIFOL liposome is a liposomal composition according to any of [121467]
of the
Detailed Description Section. In some embodiments, the yPANTIFOL liposome is a
targeted
liposomal composition according to any of [121467] of the Detailed Description
Section. In
some embodiments, the molar ratio of cyclodextrin/platinum-based agent in the
complex is in
the range 1-10:1. In some embodiments, the molar ratio of
cyclodextrin/platinum-based agent
in the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1. In some
embodiments, the molar ratio
of cyclodextrin/platinum-based agent in the complex is 1:1, 1:2, 1:3, 1:4,
1:5, 1:6, 1:7, 1:8, 1:9,
1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50),
or 1:>50. In some
embodiments, the molar ratio of cyclodextrin/platinum-based agent in the
complex is: 1:1, 2:1,
3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1,
17:1, 18:1, 19:1, 20:1,
(21-50):1, or >50:1. In additional embodiments, the cyclodextrin//platinum-
based agent
complex is encapsulated in a liposome.
[00278] In some embodiments, the platinum-based chemotherapeutic agent is
selected from:
cisplatin, carboplatin, and oxaliplatin, or a salt or acid thereof. In other
embodiments, the
cyclodextrin/platinum-based chemotherapeutic agent complex comprises an analog
of a
cisplatin, carboplatin, oxaliplatin, or a salt or acid thereof. In some
embodiments, the molar
ratio of cyclodextrin/platinum-based agent in the complex is in the range 1-
10:1. In some
embodiments, the molar ratio of cyclodextrin/platinum-based agent in the
complex is 1:1, 2:1,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 158 -
3:1, 4:1,5:1, 6:1, 7:1, or 10:1. In some embodiments, the molar ratio of
cyclodextrin/platinum-
based agent in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9,
1:10, 1:11, 1:12, 1:13,
1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In some
embodiments, the molar
ratio of cyclodextrin/platinum-based agent in the complex is: 1:1, 2:1, 3:1,
4:1, 5:1, 6:1, 7:1,
8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1,
(21-50):1, or >50:1.
[00279] In further embodiments, the disclosure provides a complex
containing cyclodextrin
and cisplatin or a salt or acid thereof. In some embodiments, the molar ratio
of
cyclodextrin/cisplatin (or cisplatin salt or acid) in the complex is in the
range 1-10:1. In some
embodiments, the molar ratio of cyclodextrin/cisplatin (or cisplatin salt or
acid) in the complex
is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1. In some embodiments, the molar
ratio of
cyclodextrin/cisplatin (or cisplatin salt or acid) in the complex is 1:1, 1:2,
1:3, 1:4, 1:5, 1:6,
1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19,
1:20, 1:(21-50), or 1:>50.
In some embodiments, the molar ratio of cyclodextrin/cisplatin (or cisplatin
salt or acid) in the
complex is: 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1,
13:1, 14:1, 15:1, 16:1,
17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In additional embodiments, the
cyclodextrin//cisplatin (or cisplatin salt or acid) complex is encapsulated in
a liposome.
[00280] In another embodiment, the disclosure provides a complex containing
cyclodextrin
and carboplatin or a salt or acid thereof. In some embodiments, the molar
ratio of
cyclodextrin/carboplatin (or carboplatin salt or acid) in the complex is in
the range 1-10:1. In
some embodiments, the molar ratio of cyclodextrin/carboplatin (or carboplatin
salt or acid) in
the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1. In some
embodiments, the molar ratio
of cyclodextrin/carboplatin (or carboplatin salt or acid) in the complex is
1:1, 1:2, 1:3, 1:4, 1:5,
1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18,
1:19, 1:20, 1:(21-50), or
1:>50. In some embodiments, the molar ratio of cyclodextrin/carboplatin (or
carboplatin salt
or acid) in the complex is: 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1,
11:1, 12:1, 13:1, 14:1,
15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In additional
embodiments, the
cyclodextrin/carboplatin (or carboplatin salt or acid) complex is encapsulated
in a liposome
(e.g., as described herein or otherwise known in the art).
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 159 -
[00281] In another embodiment, the disclosure provides a complex containing
cyclodextrin
and oxaliplatin, or a salt or acid thereof. In some embodiments, the molar
ratio of
cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) in the complex is in
the range 1-10:1. In
some embodiments, the molar ratio of cyclodextrin/oxaliplatin (or oxaliplatin
salt or acid) in
the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1. In some
embodiments, the molar ratio
of cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) in the complex is
1:1, 1:2, 1:3, 1:4, 1:5,
1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18,
1:19, 1:20, 1:(21-50), or
1:>50. In some embodiments, the molar ratio of cyclodextrin/oxaliplatin (or
oxaliplatin salt or
acid) in the complex is: 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1,
11:1, 12:1, 13:1, 14:1,
15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In additional
embodiments, the
cyclodextrin/oxaliplatin (or oxaliplatin salt or acid) complex is encapsulated
in a liposome
(e.g., as described herein or otherwise known in the art).
[00282] In additional embodiments, the disclosure provides a complex
comprising
cyclodextrin and a platinum-based chemotherapeutic agent selected from:
nedaplatin,
heptaplatin, lobaplatin, stratoplatin, paraplatin, platinol, cycloplatin,
dexormaplatin,
spiroplatin, picoplatin, triplatin, tetraplatin, iproplatin, ormaplatin,
zeniplatin, platinum-
triamine, traplatin, enloplatin, JM216, NK121, CI973, DWA 2114R, NDDP, and
dedaplatin,
or a salt or acid thereof. In other embodiments, the cyclodextrin/platinum-
based
chemotherapeutic agent complex comprises an analog of nedaplatin, heptaplatin,
lobaplatin,
stratoplatin, paraplatin, platinol, cycloplatin, dexormaplatin, spiroplatin,
picoplatin, triplatin,
tetraplatin, iproplatin, ormaplatin, zeniplatin, platinum-triamine, traplatin,
enloplatin, JM216,
NK121, CI973, DWA 2114R, NDDP, or dedaplatin, or a salt or acid thereof. In
some
embodiments, the molar ratio of cyclodextrin/oxaliplatin (or oxaliplatin salt
or acid) in the
complex is in the range 1-10:1. In some embodiments, the molar ratio of
cyclodextrin/platinum-based chemotherapeutic agent (or salt or acid or analog
thereof) in the
complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1. In some embodiments,
the molar ratio of
cyclodextrin/platinum-based chemotherapeutic agent (or salt or acid or analog
thereof) in the
complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12,
1:13, 1:14, 1:15, 1:16,
1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In some embodiments, the molar
ratio of
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 160 -
cyclodextrin/platinum-based chemotherapeutic agent (or salt or acid or analog
thereof) in the
complex is: 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1,
14:1, 15:1, 16:1, 17:1,
18:1, 19:1, 20:1, (21-50):1, or >50:1. In additional embodiments, the
cyclodextrin/platinum-
based chemotherapeutic agent (or salt or acid or analog thereof) complex is
encapsulated in a
liposome (e.g., as described herein or otherwise known in the art).
[00283] In some embodiments, the disclosure provides a composition
comprising a
cyclodextrin/taxane-based chemotherapeutic agent complex. In some embodiments,
the taxane
-based chemotherapeutic agent is selected from: paclitaxel (PTX), docetaxel
(DTX), larotaxel
(LTX), and cabazitaxel (CTX), or a salt or acid thereof. In some embodiments,
the molar ratio
of cyclodextrin/taxane-based agent in the complex is in the range 1-10:1. In
some
embodiments, the molar ratio of cyclodextrin/taxane -based agent in the
complex is 1:1, 2:1,
3:1, 4:1, 5:1, 6:1, 7:1, or 10:1. In some embodiments, the molar ratio of
cyclodextrin/taxane -
based agent in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9,
1:10, 1:11, 1:12, 1:13,
1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In some
embodiments, the molar
ratio of cyclodextrin/taxane-based agent in the complex is: 2:1, 3:1, 4:1,
5:1, 6:1, 7:1, 8:1, 9:1,
10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1,
or >50:1. In additional
embodiments, the cyclodextrin/taxane-based agent complex is encapsulated in a
liposome
(e.g., as described herein or otherwise known in the art).
[00284] In additional embodiments, the disclosure provides a complex
comprising
cyclodextrin and paclitaxel (PTX), or a salt or acid thereof. In other
embodiments, the
cyclodextrin/taxane-based chemotherapeutic agent complex comprises an analog
of paclitaxel
(PTX), or a salt or acid thereof. In some embodiments, the molar ratio of
cyclodextrin/paclitaxel (or paclitaxel salt or acid) in the complex is in the
range 1-10:1. In some
embodiments, the molar ratio of cyclodextrin/paclitaxel (or paclitaxel salt or
acid) in the
complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1. In some embodiments,
the molar ratio of
cyclodextrin/paclitaxel (or paclitaxel salt or acid) in the complex is 1:1,
1:2, 1:3, 1:4, 1:5, 1:6,
1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19,
1:20, 1:(21-50), or 1:>50.
In some embodiments, the molar ratio of cyclodextrin/paclitaxel (or paclitaxel
salt or acid) in
the complex is: 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1,
13:1, 14:1, 15:1, 16:1,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 161 -
17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In additional embodiments, the
cyclodextrin/paclitaxel (or paclitaxel salt or acid) complex is encapsulated
in a liposome (e.g.,
as described herein or otherwise known in the art).
[00285] In additional embodiments, the disclosure provides a complex
comprising
cyclodextrin and docetaxel (DTX), or a salt or acid thereof. In other
embodiments, the
cyclodextrin/taxane-based chemotherapeutic agent complex comprises an analog
of docetaxel
(DTX), or a salt or acid thereof. In some embodiments, the molar ratio of
cyclodextrin/docetaxel (or docetaxel salt or acid) in the complex is in the
range 1-10:1. In some
embodiments, the molar ratio of cyclodextrin/docetaxel (or docetaxel salt or
acid) in the
complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1. In some embodiments,
the molar ratio of
cyclodextrin/docetaxel (or docetaxel salt or acid) in the complex is 1:1, 1:2,
1:3, 1:4, 1:5, 1:6,
1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19,
1:20, 1:(21-50), or 1:>50.
In some embodiments, the molar ratio of cyclodextrin/docetaxel (or docetaxel
salt or acid) in
the complex is: 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1,
13:1, 14:1, 15:1, 16:1,
17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In additional embodiments, the
cyclodextrin/docetaxel (or docetaxel salt or acid) complex is encapsulated in
a liposome (e.g.,
as described herein or otherwise known in the art).
[00286] In additional embodiments, the disclosure provides a complex
comprising
cyclodextrin and larotaxel (LTX), or a salt or acid thereof. In other
embodiments, the
cyclodextrin/taxane-based chemotherapeutic agent complex comprises an analog
of larotaxel
(LTX), or a salt or acid thereof. In some embodiments, the molar ratio of
cyclodextrin/larotaxel
(or larotaxel salt or acid) in the complex is in the range 1-10:1. In some
embodiments, the
molar ratio of cyclodextrin/larotaxel (or larotaxel salt or acid) in the
complex is 1:1, 2:1, 3:1,
4:1, 5:1, 6:1, 7:1, or 10:1. In some embodiments, the molar ratio of
cyclodextrin/larotaxel (or
larotaxel salt or acid) in the complex is 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7,
1:8, 1:9, 1:10, 1:11,
1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:(21-50), or 1:>50. In
some embodiments,
the molar ratio of cyclodextrin/larotaxel (or larotaxel salt or acid) in the
complex is: 2:1, 3:1,
4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1,
18:1, 19:1, 20:1, (21-
50):1, or >50:1. In additional embodiments, the cyclodextrin/larotaxel (or
larotaxel salt or acid)
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 162 -
complex is encapsulated in a liposome (e.g., as described herein or otherwise
known in the
art).
[00287] In additional embodiments, the disclosure provides a complex
comprising
cyclodextrin and cabazitaxel (CTX), or a salt or acid thereof. In other
embodiments, the
cyclodextrin/taxane-based chemotherapeutic agent complex comprises an analog
of
cabazitaxel (CTX), or a salt or acid thereof. In some embodiments, the molar
ratio of
cyclodextrin/cabazitaxel (or cabazitaxel salt or acid) in the complex is in
the range 1-10:1. In
some embodiments, the molar ratio of cyclodextrin/cabazitaxel (or cabazitaxel
salt or acid) in
the complex is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, or 10:1. In some
embodiments, the molar ratio
of cyclodextrin/cabazitaxel (or cabazitaxel salt or acid) in the complex is
1:1, 1:2, 1:3, 1:4, 1:5,
1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18,
1:19, 1:20, 1:(21-50), or
1:>50. In some embodiments, the molar ratio of a cyclodextrin/cabazitaxel (or
cabazitaxel salt
or acid) in the complex is: 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1,
11:1, 12:1, 13:1, 14:1,
15:1, 16:1, 17:1, 18:1, 19:1, 20:1, (21-50):1, or >50:1. In additional
embodiments, the
cyclodextrin/cabazitaxel (or cabazitaxel salt or acid) complex is encapsulated
in a liposome
(e.g., as described herein or otherwise known in the art).
[00288] The cyclodextrin of the cyclodextrin/therapeutic agent complex can
be derivatized or
underivatized. In some embodiments, the cyclodextrin is derivatized. In
further embodiments,
the cyclodextrin is a derivatized beta-cyclodextrin (e.g., a hydroxypropyl
beta-cyclodextrin
(HP-beta-CD), and a sulfobutyl ether beta-CD (SBE)-beta-cyclodextrin)). In
some
embodiments, the cyclodextrin of the cyclodextrin/therapeutic agent complex is
a derivatized
beta-cyclodextrin comprising: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more 2-
hydroxylpropy1-3-group
substitutions of hydroxy groups; or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more
sulfoalkyl ether group
substitutions of hydroxy groups. In further embodiments, the cyclodextrin of
the
cyclodextrin/therapeutic agent complex is a derivatized beta-cyclodextrin
comprising: 1, 2, 3,
4, 5, 6, 7, 8, 9, 10, or more sulfobutyl ether group substitutions of hydroxy
groups.
[00289] In some embodiments, the cyclodextrin of the
cyclodextrin/therapeutic agent complex
contained in the yPANTIFOL liposome composition is a derivatized cyclodextrin
of Formula I:
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 163 -
0 0
0
R40 R. =(' 1140 12., 0
wherein: n is 4, 5, or 6; and wherein R1, R2, R3, R4, R5, R6, R7, R8, and R9
are each,
independently, -H, a straight chain or branched Cl-C8- alkylene group, a 2-
hydroxylpropyl-
3- group; or an optionally substituted straight-chain or branched C1-C6 group,
wherein at
least one of R1, R2, R3, R4, R5, R6, R7, R8 and R9 is a straight-chain or
branched C1-C8-
alkylene group or a 2-hydroxylpropy1-3- group.
[00290] In some embodiments, the cyclodextrin of the
cyclodextrin/therapeutic agent complex
contained in the yPANTIFOL liposome composition is a derivatized cyclodextrin
of Formula
II:
Sd.Z.3
0,
0 0
0 ,
S4R4 S' R' St.Rt, S ,R- S&Rs S Q R9,
t/
wherein: n is 4, 5, or 6; and wherein R1, R2, R3, R4, R5, R6, R7, R8, and R9
are each,
independently, -0- or a -0-(C2-C6 alkylene)-S03- group; wherein at least one
of R1 and R2
is independently a -0-(C2-C6 alkylene)-S03- group; and Si, S2, S3, S4, S5, S6,
S7, S8, and
S9 are each, independently, a -H or a H or a pharmaceutically acceptable
cation. In further
embodiments, the wherein the pharmaceutically acceptable cation is selected
from: an alkali
metal such as Li+, Na+, or K+; an alkaline earth metal such as Ca+2, or Mg+2,
and ammonium
ions and amine cations such as the cations of (C1-C6)-alkylamines, piperidine,
pyrazine, (C1-
C6)-alkanolamine and (C4-C8)-cycloalkanolamine.
[00291] In some embodiments, the yPANTIFOL liposome comprises between 100
to 100,000
of the cyclodextrin/therapeutic agent complexes.
[00292] In some embodiments, a cyclodextrin derivative of the
yPANTIFOL/cyclodextrin
complex and/or cyclodextrin/therapeutic agent complex is a cyclodextrin
disclosed in U.S. Pat.
Nos. 6,133,248, 5,874,418, 6,046,177, 5,376,645, 5,134,127, 7,034,013,
6,869,939; and Intl.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 164 -
Appl. Publ. No. WO 02005/117911, the contents each of which is herein
incorporated by
reference in its priority.
[00293] In some embodiments, the cyclodextrin derivative of the
cyclodextrin/therapeutic
agent complex is a sulfoalkyl ether cyclodextrin. In some embodiments, the
cyclodextrin
derivative of complex is a sulfobutyl ether-3-cyclodextrin such as CAPTISOL
(CyDex
Pharma. Inc., Lenexa, Kansas. Methods for preparing sulfobutyl ether-3-
cyclodextrin and
other sulfoalkyl ether cyclodextrins are known in the art.
[00294] In some embodiments, the cyclodextrin derivative of the
cyclodextrin/therapeutic
agent complex is a compound of Formula III:
RO7, Ro
oRRat ORR
RO RO /
OR
RO, OR,
tOR RO-
'(>\ OR OR o-ji
aiR 0 OR OR 11,01õ.:
OR
wherein R equals:
(a) (H)21_x or (-(CH2)4-SO3Na)x, and x=1.0-10.0, 1.0-5.0, 6.0-7.0, or 8.0-
10.0;
(b) (H)21-x or (-(CH2CH(OH)CH3)x, and x=1.0-10.0, 1.0-5.0, 6.0-7.0, or 8.0-
10.0;
(c) (H)21_x or (sulfoalkyl ethers)x, and x=1.0-10.0, 1.0-5.0, 6.0-7.0, or
8.0-10.0; or
(d) (H)21_x or (-(CH2)4-SO3Na)x, and x=1.0-10.0, 1.0-5.0, 6.0-7.0, or 8.0-
10Ø
[00295] Additional cyclodextrins and cyclodextrin/platinum-based
therapeutic complexes that
can be contained in the yPANTIFOL liposomes and used according to the
disclosed methods
is disclosed in U.S. Appl. No. 62/583,432, the contents of which is herein
incorporated by
reference it its entirety.
[00296] In some embodiments, the yPANTIFOL liposome comprises a complex of
a
cyclodextrin and a platinum-based chemotherapeutic agent, or a salt thereof.
In some
embodiments, the platinum-based chemotherapeutic agent is cisplatin or a
cisplatin analog.
In some embodiments, the platinum-based chemotherapeutic agent is carboplatin.
In
additional embodiments, the liposome composition comprises a platinum-based
chemotherapeutic agent is selected from: carboplatin, cisplatin, oxaliplatin,
satraplatin,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 165 -
picoplatin, nedaplatin, triplatin, tetraplatin, lipoplatin, lobaplatin,
ormaplatin, zeniplatin,
platinum-triamine, traplatin, enloplatin, JM-216, 254-S, NK 121, CI-973, DWA
2114R,
NDDP, and dedaplatin. In some embodiments, the 7PANTIFOL liposome comprises
between
100 to 100,000 platinum-based chemotherapeutic agent/CD complexes. In
additional
embodiments, the liposome composition comprises liposomes that have a diameter
in the
range of 20 nm to 500 nm or 20 nm to 200 nm, or any range therein between. In
some
embodiments, liposomes in the composition comprise between 100 to 100,000
platinum.
(3) Targeted Liposomes
[00297] In some embodiments, the disclosure provides a liposomal gamma
polyglutamated
Antifolate composition wherein the liposome comprises a gamma polyglutamated
Antifolate
and a targeting moiety attached to one or both of a PEG and the exterior of
the liposome, and
wherein the targeting moiety has a specific affinity for a surface antigen on
a target cell of
interest. Such liposomes may generally be referred to herein as "targeted
liposomes", e.g.,
liposomes including one or more targeting moieties or biodistribution
modifiers on the surface
of, or otherwise attached to, the liposomes. The targeting moiety of the
targeted liposomes can
be any moiety or agent that is capable of specifically binding a desired
target (e.g., an antigen
target expressed on the surface of a target cell of interest). In one
embodiment, the targeted
liposome specifically and preferentially binds to a target on the surface of a
target cell of
interest that internalizes the targeted liposome into which the liposome
encapsulated gamma
polyglutamated Antifolate (e.g., gamma pentaglutamated Antifolate or gamma
hexaglutamated Antifolate) exerts its cytotoxic effect. In further
embodiments, the target cell
is a cancer cell, a tumor cell or a metastatic cell. In some embodiments, the
targeted liposome
is pegylated.
[00298] The term "attach" or "attached" refers, for example, to any type of
bonding such as
covalent bonding, ionic bonding (e.g., avidin-biotin) bonding by hydrophobic
interactions, and
bonding via functional groups such as maleimide, or linkers such as PEG. For
example, a
detectable marker, a steric stabilizer, a liposome, a liposomal component, an
immunostimulating agent may be attached to each other directly, by a maleimide
functional
group, or by a PEG-malemide group.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 166 -
[00299] The composition and origination of the targeting moiety is non-
limiting to the scope
of this disclosure. In some embodiments, the targeting moiety attached to the
liposome is a
polypeptide or peptidomimetic ligand. Peptide and peptidomimetic targeting
moieties include
those having naturally occurring or modified peptides, e.g., D or L peptides;
gamma, beta, or
gamma peptides; N-methyl peptides; azapeptides; peptides having one or more
amide, i.e.,
peptide, linkages replaced with one or more urea, thiourea, carbamate, or
sulfonyl urea
linkages; or cyclic peptides. A peptidomimetic is a molecule capable of
folding into a defined
three-dimensional structure similar to a natural peptide. In some embodiments,
the peptide or
peptidomimetic targeting moiety is 2-50 amino acids long, e.g., about 5, 10,
15, 20, 25, 30, 35,
40, 45, or 50 amino acids long
[00300] In some embodiments, the targeting moiety polypeptide is at least
40 amino acid
residues in length. In other embodiments, the targeting moiety polypeptide is
at least 50, 60,
75, 100, 125, 150, 175, 200, 250, or 300 amino acid residues in length.
[00301] In additional embodiments, the targeting moiety polypeptide such as
an antibody or
an antigen-binding antibody fragment that binds a target antigen with an
equilibrium
dissociation constant (Kd) in a range of 0.5 x 10-10 to 10 x 10-6 as
determined using
BIACORE analysis.
[00302] In some embodiments, the targeting moiety is an antibody or an
antibody derivative.
In other embodiments, the binding domain of the targeting moiety polypeptide
is not derived
from the antigen binding domain of an antibody. In some embodiments, the
targeting moiety
is a polypeptide derived from a binding scaffold selected from a DARPin,
affilin, and
armadillo repeat, D domain (see, e.g., WO 2016/164308), Z-domain (Affibody),
adnectin,
lipocalin, affilin, anticalin, knottin, fynomer, atrimer, kunitz domain (see,
e.g., WO
2004/063337), CTLA4, or avimer (see, e.g., U.S. Publ. Nos. 2004/0175756,
2005/0053973,
2005/0048512, and 2006/0008844).
[00303] In additional embodiments, the targeting moiety is an antibody or a
derivative of the
antigen binding domain of an antibody that has specific affinity for an
epitope on a cell surface
antigen of interest expressed on the surface of a target cell. In some
embodiments, the targeting
moiety is a full-length antibody. In some embodiments, the targeting moiety is
an antigen
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 167 -
binding portion of an antibody. In some embodiments, the targeting moiety is
an scFv. In other
embodiments, the targeting moiety is a Fab. In some embodiments, the targeting
moiety
comprises a binding domain derived from the antigen binding domain of an
antibody (e.g., an
scFv, Fab, Fab', F(ab')2, an Fv fragment, a disulfide-linked Fv (sdFv), a Ed
fragment consisting
of VH and CH1 domains, an scFv, a minibody, a BiTE, a Tandab, a diabody ((VL-
VH)2 or
(VH-VL)2), a single domain antibody (e.g., an sdAb such as a nanobody (either
VL or VH)),
and a camelid VHH domain). In some embodiments, the targeting moiety comprises
one or
more complementarity determining regions (CDRs) of antibody origin. Examples
of suitable
antibody-based targeting moieties for the disclosed targeted liposomes include
a full-length
human antibody, a humanized antibody, a chimeric antibody, an antigen binding
fragment of
an antibody, a single chain antibody, a single-domain antibody, a bi-specific
antibody, a
synthetic antibody, a pegylated antibody and a multimeric antibody. The
antibody of the
provided targeted liposomes can have a combination of the above
characteristics. For example,
a humanized antibody can be an antigen binding fragment and can be pegylated
and
multimerized as well.
[00304] The term "humanized antibody" refers to forms of non-human (e.g.,
murine)
antibodies that are specific immunoglobulin chains, chimeric immunoglobulins,
or fragments
thereof that contain minimal non-human (e.g., murine) sequences. Typically,
humanized
antibodies are human immunoglobulins in which residues from the complementary
determining region (CDR) are replaced by residues from the CDR of a non-human
species
(e.g., mouse, rat, rabbit, and hamster) that have the desired specificity,
affinity, and capability
(Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-327
(1988);
Verhoeyen et al., Science 239:1534-1536 (1988)). In some instances, the Fv
framework region
(FR) residues of a human immunoglobulin are replaced with the corresponding
residues in an
antibody from a non-human species that has the desired specificity, affinity,
and capability.
The humanized antibody can be further modified by the substitution of
additional residues
either in the Fv framework region and/or within the replaced non-human
residues to refine and
optimize antibody specificity, affinity, and/or capability. In general, the
humanized antibody
will comprise substantially all of at least one, and typically two or three,
variable domains
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 168 -
containing all or substantially all of the CDR regions that correspond to the
non-human
immunoglobulin whereas all or substantially all of the FR regions are those of
a human
immunoglobulin consensus sequence. The humanized antibody can also comprise at
least a
portion of an immunoglobulin constant region or domain (Fc), typically that of
a human
immunoglobulin. Examples of methods used to generate humanized antibodies are
described
in U.S. Pat. Nos. 5,225,539 and 5,639,641.
[00305] In further embodiments, the targeting moiety has specific affinity
for an epitope on a
surface antigen of a target cell of interest. In some embodiments, the target
cell is a cancer cell.
In some embodiments, the target cell is a tumor cell. In other embodiments,
the target cell is
an immune cell.
[00306] In some embodiments, the targeting moiety has specific affinity for
an epitope
expressed on a tumor cell surface antigen. The term "tumor cell surface
antigen" refers to an
antigen that is common to a specific hyperproliferative disorder such as
cancer. In some
embodiments, the targeting moiety has specific affinity for an epitope of a
tumor cell surface
antigen that is a tumor associated antigen (TAA). A TAA is an antigen that is
found on both
tumor and some normal cells. A TAA may be expressed on normal cells during
fetal
development when the immune system is immature and unable to respond or may be
normally
present at extremely low levels on normal cells but which are expressed at
much higher levels
on tumor cells. Because of the dynamic nature of tumors, in some instances,
tumor cells may
express unique antigens at certain stages, and at others also express antigens
that are also
expressed on non-tumor cells. Thus, inclusion of a certain marker as a TAA
does not preclude
it being considered a tumor specific antigen. In some embodiments, the
targeting moiety has
specific affinity for an epitope of a tumor cell surface antigen that is a
tumor specific antigen
(TSA). A TSA is an antigen that is unique to tumor cells and does not occur on
other cells in
the body. In some embodiments, the targeting moiety has specific affinity for
an epitope of a
tumor cell surface antigen expressed on the surface of a cancer including but
not limited to
primary or metastatic melanoma, thymoma, lymphoma, sarcoma, lung cancer (e.g.,
NSCLC or
SCLC), liver cancer, non-Hodgkin's lymphoma, Hodgkin's lymphoma, leukemias,
multiple
myeloma, glioblastoma, neuroblastoma, uterine cancer, cervical cancer, renal
cancer, thyroid
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 169 -
cancer, bladder cancer, kidney cancer, mesothelioma, and adenocarcinomas such
as breast
cancer, prostate cancer, ovarian cancer, pancreatic cancer, colon cancer and
other cancers
known in the art In some embodiments, the targeting moiety has specific
affinity for an epitope
of a cell surface antigen expressed on the surface of a cell in the tumor
microenvironment (e.g.,
and antigen such as VEGFR and TIE1, or TIE2 expressed on endothelial cells and
macrophage,
respectively, or an antigen expressed on tumor stromal cells such as cancer-
associated
fibroblasts (CAFs) tumor infiltrating T cells and other leukocytes, and
myeloid cells including
mast cells, eosinophils, and tumor-associated macrophages (TAM).
[00307] In some embodiments, the targeted liposome yPANTIFOL composition
(e.g., TLp-
yPANTIFOL or TPLp-yPANTIFOL) comprises a targeting moiety that has specific
affinity for
an epitope of a cancer or tumor cell surface antigen that is
preferentially/differentially
expressed on a target cell such as a cancer cell or tumor cell, compared to
normal or non-tumor
cells, that is present on a tumor cell but absent or inaccessible on a non-
tumor cell. For example,
in some situations, the tumor antigen is on the surface of both normal cells
and malignant
cancer cells but the tumor epitope is only exposed in a cancer cell. As a
further example, a
tumor cell surface antigen may experience a confirmation change in a cancerous
state that
causes a cancer cell specific epitope to be present. A targeting moiety with
specific affinity to
an epitope on a targetable tumor cell surface antigen described herein or
otherwise known in
the art is useful and is encompassed by the disclosed compositions and
methods. In some
embodiments, the tumor cell with the tumor cell surface antigen is a cancer
cell. Examples of
such tumor cell surface antigens include, without limitation folate receptor
alpha, folate
receptor beta and folate receptor delta.
[00308] In further embodiments, the targeting moiety comprises a
polypeptide targeting
moiety such as an antibody or an antigen-binding antibody fragment and the
targeting moiety
has binding specificity for a folate receptor. In some embodiments, the
targeting moiety binds
a folate receptor with an equilibrium dissociation constant (Kd) in a range of
0.5 x 10-10 to 10
x 10-6 as determined using BIACOREO analysis. In some embodiments, the folate
receptor
bound by the targeting moiety is one or more folate receptors selected from:
folate receptor
alpha (FR-a), folate receptor beta (FR-f3), and folate receptor delta (FR-6).
In a further
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 170 -
embodiment, the targeting moiety has specific affinity for at least two
antigens selected from
folate receptor alpha, folate receptor beta, and folate receptor delta. In
another embodiment,
the targeting moiety has specific affinity for folate receptor alpha; folate
receptor beta; and
folate receptor delta.
[00309] In some embodiments, the targeting moiety has a specific affinity
for an epitope of a
cell surface antigen that internalizes the targeting moiety upon binding.
Numerous cell surface
antigens that internalize binding partners such as antibodies upon binding are
known in the art
and are envisioned to be binding targets for the targeting moieties expressed
on the targeted
liposome yPANTIFOL compositions (e.g., TLp-yPANTIFOL or TPLp-yPANTIFOL)
disclosed herein.
[00310] In some embodiments, the targeting moiety has a specific affinity
for an epitope of a
cell surface antigen selected from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a
folate receptor (e.g., folate receptor-a, folate receptor-I3 or folate
receptor-6), Mucin 1 (MUC-
1), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC),
SLC44A4,
NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16,
Tissue
factor, LIV-1 (ZIP6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-
B),
VEGFR2 (CD309), Tenascin, Collagen IV, Periostin, endothelin receptor, HER2,
HER3,
EGFR, IGFR-1, EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD1 1 a, CD15, CD18,
CD19,
CD20, CD22, CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70,
CD74, CD79, CD79b, CD105, CD133, CD138, cripto, CD38, an EphA receptor, an
EphB
receptor, EphA2, an integrin (e.g., integrin avI33, av135, or avI36), a C242
antigen, Apo2, PSGR,
NGEP, PSCA, TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA.
[00311] In some embodiments, the targeting moiety has a specific affinity
for an epitope of a
cell surface antigen selected from mannose-6-phosphate receptor, transferrin
receptor, and a
cell adhesion molecule (CAM). In further embodiments, the targeting moiety has
a specific
affinity for an epitope of a CAM is selected from the group consist of:
intercellular adhesion
molecule (ICAM), platelet-endothelial cell adhesion molecule (PECAM),
activated leukocyte
cell adhesion molecule (ALCAM), B-lymphocyte cell adhesion molecule (BL-CAM),
vascular
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 171 -
cell adhesion molecule (VCAM), mucosal vascular addressin cell adhesion
molecule
(MAdCAM), CD44, LFA-2, LFA-3, and basigin.
[00312] A discussed herein, folate receptors (FRs) are distinct from
reduced folate carriers
(RFCs) and exploit different pathways for bringing folates and antifolates
into cells. In some
embodiments, the targeting moiety specifically binds a folate receptor. In
further embodiments,
the targeting moiety specifically binds a folate receptor selected from folate
receptor alpha,
folate receptor beta and folate receptor delta. Antibodies to folate receptor
alpha can routinely
be generated using techniques known in the art. Moreover, the sequences of
numerous anti-
folate receptor antibodies are in the public domain and/or commercially
available and are
readily obtainable.
[00313] Murine antibodies against folate receptor are examples of
antibodies that can be used
as targeting moieties of the disclosed targeted liposome is a murine antibody
against folate
receptor. The sequence of these antibodies are known and are described, for
example, in U.S.
Pat. Nos. 5,646,253; 8,388,972; 8,871,206; and 9,133,275, and Intl. Appl. Nos.
PCT/US2011/056966, and PCT/US2012/046672. For example, based on the sequences
already
in the public domain, the gene for the antibodies can be synthesized and
placed into a transient
expression vector and the antibody was produced in HEK-293 transient
expression system.
The antibody can be a complete antibody, a Fab, or any of the various antibody
variations
discussed herein or otherwise known in the art.
[00314] In some embodiments, the targeted liposome (e.g., TL- yPANTIFOL or
TPL-
yPANTIFOL) contains from 1 to 1,000, or more than 1,000, targeting moieties on
its surface.
In some embodiments, the targeted liposome contains from 30 to 1,000, 30 to
500, 30 to 250
or 30-200, targeting moieties, or any range therein between. In some
embodiments, the targeted
liposome (e.g., TL- yPANTIFOL or TPL- yPANTIFOL) contains from 30 to 1,000, or
more
than 1,000, targeting moieties on its surface. In some embodiments, the
targeted liposome
contains from 30 to 500, 30 to 250 or 30-200, targeting moieties. In some
embodiments, the
targeted liposome contains less than 220 targeting moieties, less than 200
targeting moieties,
or less than 175 targeting moieties. In some embodiments, the targeting moiety
is non-
covalently bonded to the outside of the liposome (e.g., via ionic interaction
or a GPI anchor).
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 172 -
In some embodiments, the targeted liposome comprises a yPANTIFOL according to
any of
[1]411] of the Detailed Description Section. In some embodiments, the targeted
liposome
comprises a polyglutamate of an Antifolate disclosed in Section I, herein. In
some
embodiments, the targeted liposome is a liposome according to any of [48]467]
of the Detailed
Description Section.
[00315] In some embodiments, the molecules on the outside of the targeted
liposome (e.g., TL-
yPANTIFOL or TPL-yPANTIFOL) include a lipid, a targeting moiety, a steric
stabilizer (e.g.,
a PEG), a maleimide, and a cholesterol. In some embodiments, the targeting
moiety is
covalently bound via a maleimide functional group. In some embodiments, the
targeting
moiety is covalently bound to a liposomal component or a steric stabilizer
such as a PEG
molecule. In some embodiments, all the targeting moieties of the liposome are
bound to one
component of the liposome such as a PEG. In other embodiments, the targeting
moieties of the
targeted liposome are bound to different components of the liposome. For
example, some
targeting moieties may be bound to the lipid components or cholesterol, some
targeting
moieties may be bound to the steric stabilizer (e.g., PEG) and still other
targeting moieties may
be bound to a detectable marker or to another targeting moiety. In some
embodiments, the
outside of the targeted liposome (e.g., TL-yPANTIFOL or TPL-yPANTIFOL) further
comprises one or more of an immunostimulatory agent, a detectable marker and a
maleimide
disposed on at least one of the PEG and the exterior of the liposome. In some
embodiments,
the targeted liposome comprises a yPANTIFOL according to any of [1]411] of the
Detailed
Description Section. In some embodiments, the targeted liposome comprises a
polyglutamate
of an Antifolate disclosed in Section I, herein. In some embodiments, the
targeted liposome is
a liposome according to any of [481467] of the Detailed Description Section.
[00316] In some embodiments, the targeted liposome (e.g., TL-yPANTIFOL or
TPL-
yPANTIFOL) is anionic or neutral. In some embodiments, the targeted anionic or
neutral
liposome has a diameter in the range of 20 nm to 500 nm or 20 nm to 200 nm, or
any range
therein between. In further embodiments, the targeted anionic or neutral
liposome has a
diameter in the range of 80 nm to 120 nm, or any range therein between. In
some embodiments,
the targeted liposome comprises a yPANTIFOL according to any of [11411] of the
Detailed
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 173 -
Description Section. In some embodiments, the targeted liposome comprises a
polyglutamate
of an Antifolate disclosed in Section I, herein. In some embodiments, the
targeted liposome is
a liposome according to any of [48]-[67] of the Detailed Description Section.
[00317] In other embodiments, the targeted liposome (e.g., TL-yPANTIFOL or
TPL-
yPANTIFOL) is cationic. In some embodiments, the targeted anionic or neutral
liposome has
a diameter in the range of 20 nm to 500 nm or 20 nm to 200 nm, or any range
therein between.
In further embodiments, the targeted anionic or neutral liposome has a
diameter in the range
of 80 nm to 120 nm, or any range therein between. In some embodiments, the
targeted
liposome comprises a yPANTIFOL according to any of [1]-[11] of the Detailed
Description
Section. In some embodiments, the targeted liposome comprises a polyglutamate
of an
Antifolate disclosed in Section I, herein. In some embodiments, the targeted
liposome is a
liposome according to any of [48]-[67] of the Detailed Description Section.
[00318] In additional embodiments, the liposomal composition comprising the
targeted
liposome (e.g., TL-yPANTIFOL or TPL-yPANTIFOL) comprises 30-70%, 30-60%, or 30-
50% liposome entrapped gamma polyglutamated Antifolate, or any range therein
between. In
some embodiments, the liposomal composition comprising the targeted liposome
comprises at
least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%,
75%,
or more than 75%, of the starting material of gamma polyglutamated Antifolate
is encapsulated
(entrapped) in the targeted liposomes liposomes.
[00319] In some embodiments, the targeted liposomal compositions comprise
30-70%, 30-
60%, or 30-50%, w/w of the gamma tetraglutamated Antifolate, or any range
therein between
In some embodiments, the targeted liposomes comprise at least 1%, 5%, 10%,
15%, 20%, 25%,
30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the
gamma
tetraglutamated Antifolate. In some embodiments, during the process of
preparing the targeted
liposomes, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%,
65%, 70%, 75%, or more than 75%, of the starting material of gamma
tetraglutamated
Antifolate is encapsulated (entrapped) in the targeted liposomes.
[00320] In some embodiments, the targeted liposomal compositions comprise
30-70%, 30-
60%, or 30-50%, w/w of the gamma pentaglutamated Antifolate, or any range
therein between
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 174 -
In some embodiments, the targeted liposomes comprise at least 1%, 5%, 10%,
15%, 20%, 25%,
30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the
gamma
pentaglutamated Antifolate. In some embodiments, during the process of
preparing the
targeted liposomes, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%,
50%, 55%,
60%, 65%, 70%, 75%, or more than 75%, of the starting material of gamma
pentaglutamated
Antifolate is encapsulated (entrapped) in the targeted liposomes.
[00321] In some embodiments, the targeted liposomal compositions comprise
30-70%, 30-
60%, or 30-50%, w/w of the gamma hexaglutamated Antifolate, or any range
therein between
In some embodiments, the targeted liposomes comprise at least 1%, 5%, 10%,
15%, 20%, 25%,
30%, 35, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, w/w of the
gamma
hexaglutamated Antifolate. In some embodiments, during the process of
preparing the targeted
liposomes, at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%,
60%,
65%, 70%, 75%, or more than 75%, of the starting material of gamma
hexaglutamated
Antifolate is encapsulated (entrapped) in the targeted liposomes.
[00322] Methods and techniques for covalently associating polypeptide
targeting moieties
with a liposome surface molecule are known in the art and can readily be
applied to prepare
the TL-TPANTIFOL or TPL-yPANTIFOL liposome compositions.
[00323] Chemical binding of non-proteinaceous targeting moieties and other
compositions to
the liposomal surface may be employed. Thus, a non-proteinaceous moiety, may
be covalently
or non-covalently linked to, embedded or adsorbed onto the liposome using any
linking or
binding method and/or any suitable chemical linker known in the art. The exact
type and
chemical nature of such cross-linkers and cross linking methods is preferably
adapted to the
type of affinity group used and the nature of the liposome. Methods for
binding or adsorbing
or linking the targeting moiety are also well known in the art. For example,
in some
embodiments, the targeting moiety may be attached to a group at the interface
via, but not
limited to, polar groups such as amino, SH, hydroxyl, aldehyde, formyl,
carboxyl, His-tag or
other polypeptides. In addition, the targeting moiety may be attached via, but
not limited to,
active groups such as succinimidyl succinate, cyanuric chloride, tosyl
activated groups,
imidazole groups, CNBr, NHS, Activated CH, ECH, EAH, Epoxy, Thiopropyl,
Activated
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 175 -
Thiol, etc., Moreover, the targeting moiety may be attached via, but not
limited to, hydrophobic
bonds (Van Der Waals) or electrostatic interactions that may or may not
include cross-linking
agents (e.g., bivalent anions, poly-anions, poly-cations etc.).
Manufacture of liposomes
[00324] In some embodiments, the disclosure provides a method of making a
liposomal
composition disclosed herein. In one embodiment, the method includes forming a
mixture
comprising: (1) a liposomal component; and (2) a gamma polyglutamated (e.g.,
pentaglutamated or hexaglutamated) Antifolate in aqueous solution. In further
embodiments,
the mixture comprises a pegylated liposomal component. The mixture is then
homogenized to
form liposomes in the aqueous solution. Further, the mixture can be extruded
through a
membrane to form liposomes enclosing the gamma polyglutamated Antifolate in an
aqueous
solution. It is understood the liposomal components of this disclosure can
comprise any lipid
(including cholesterol) including functionalized lipids and lipids attached to
targeting moieties,
detectable labels, and steric stabilizers, or any subset of all of these. It
is further noted that the
bioactive gamma polyglutamated Antifolate in aqueous solution can comprise any
reagents
and chemicals discussed herein or otherwise known in the art for the interior
or exterior of the
liposome including, for example, buffers, salts, and cryoprotectants.
[00325] In some embodiments, the disclosure provides a method of making a
targeted
pegylated liposomal gamma polyglutamated Antifolate (targeted-PLp-yPANTIFOL)
or non-
targeted PLp-yPANTIFOL disclosed herein. In one embodiment, the method
includes forming
a mixture comprising: (1) a liposomal component; (2) a gamma polyglutamated
(e.g.,
pentaglutamated or hexaglutamated) Antifolate in aqueous solution; and (3) the
targeting
moiety. The mixture is then homogenized to form liposomes in the aqueous
solution. Further,
the mixture may be extruded through a membrane to form liposomes enclosing the
targeted
gamma polyglutamated Antifolate in an aqueous solution. It is understood that
the targeted
pegylated liposomal components can comprise any lipid (including cholesterol)
including
functionalized lipids and lipids attached to targeting moieties, detectable
labels, and steric
stabilizers, or any subset of all of these. It is further noted that the
targeted pegylated liposome
can comprise any reagents and chemicals discussed herein or otherwise known in
the art for
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 176 -
the interior or exterior of the liposome including, for example, buffers,
salts, and
cryoprotectants.
[00326]
The above methods optionally further comprise the step of lyophilizing the
composition after the removing step to form a lyophilized composition. As
stated above,
targeted- PTPLA or non-targeted-PTPLA in aqueous solution may comprise a
cryoprotectant
described herein or otherwise known in the art. If the composition is to be
lyophilized, a
cryoprotectant may be preferred.
[00327]
Additionally, after the lyophilizing step, the method optionally further
comprises the
step of reconstituting the lyophilized composition by dissolving the
composition in a solvent
after the lyophilizing step. Methods of reconstitution are known in the art.
One preferred
solvent is water. Other preferred solvents include saline solutions and
buffered solutions.
[00328]
While certain exemplary embodiments, are discussed herein, it is understood
that
liposomes can be made by any method that is known in the art. See, for
example, G.
Gregoriadis (editor), Liposome Technology, vol. 1-3, 1st edition, 1983; 2nd
edition, 1993,
CRC Press, 45 Boca Raton, Fla. Examples of methods suitable for making
liposome
compositions include extrusion, reverse phase evaporation, sonication, solvent
(e.g., ethanol)
injection, microfluidization, detergent dialysis, ether injection, and
dehydration/rehydration.
The size of liposomes can routinely be controlled by controlling the pore size
of membranes
used for low pressure extrusions or the pressure and number of passes utilized
in
microfluidization or any other suitable methods known in the art.
[00329] In
general, the gamma polyglutamated Antifolate is contained inside, that is, in
the
inner (interior) space of the liposomes. In one embodiment, substituted
ammonium is partially
or substantially completely removed from the outer medium surrounding the
liposomes. Such
removal can be accomplished by any suitable means known in the art (e.g.,
dilution, ion
exchange chromatography, size exclusion chromatography, dialysis,
ultrafiltration, and
precipitation). Accordingly, the methods of making liposomal compositions set
forth above or
otherwise known in the art can optionally further comprise the step of
removing gamma
polyglutamated Antifolate in aqueous solution outside of the liposomes after
forming the
liposomes, for example, by the homogenization or by the extruding step.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 177 -
[00330] In other embodiments, the disclosure provides a targeted pegylated
liposomal gamma
polyglutamated Antifolate (TPLp-yPANTIFOL) that selectively targets folate
receptors
comprising: a liposome including an interior space, a gamma polyglutamated
Antifolate
disposed within the interior space, a steric stabilizer molecule attached to
an exterior of the
liposome, and a targeting moiety comprising a protein with specific affinity
for at least one
folate receptor, said targeting moiety attached to at least one of the steric
stabilizer and the
exterior of the liposome. The components of this embodiment, may be the same
as described
for other embodiments, of this disclosure. For example, the targeted pegylated
liposomal
gamma polyglutamated Antifolate and the steric stabilizer which may be PEG,
are as described
in other parts of this disclosure.
[00331] In some embodiments, the disclosure provides a method of preparing
a targeted
composition comprising a pegylated liposome including an entrapped and/or
encapsulated
gamma polyglutamated Antifolate; a targeting moiety an amino acid chain, the
amino acid
chain comprising a plurality of amino acids, the targeting moiety having a
specific affinity for
at least one type of folate receptor, the specific affinity being defined to
include an equilibrium
dissociation constant (Kd) in a range of 0.5 x 10-10 to 10 x 10-6 moles [0.05
nM to 10 pM]
for at least one type folate receptor, the targeting moiety attached to one or
both of a PEG and
an exterior of the liposome, the method comprising: forming a mixture
comprising: liposomal
components and a gamma polyglutamated Antifolate in solution; homogenizing the
mixture to
form liposomes in the solution; processing the mixture to form liposomes
entrapping and/or
encapsulating gamma polyglutamated Antifolate; and providing a targeting
moiety on a surface
of the liposomes entrapping and/or encapsulating the gamma polyglutamated
Antifolate, the
targeting moiety having specific affinity for at least one of folate receptor
alpha (FR-a), folate
receptor beta (FR-I3) and folate receptor delta (FR-6). In some embodiments,
the method
comprising: forming a mixture comprising: liposomal components and gamma
polyglutamated
Antifolate in solution; forming liposomes entrapping and/or encapsulating
gamma
polyglutamated Antifolate, for example by homogenizing or otherwise processing
the mixture
to form liposomes; and providing a targeting moiety on a surface of the
liposomes entrapping
and/or encapsulating the gamma polyglutamated Antifolate, the targeting moiety
having
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 178 -
specific affinity for at least one of folate receptor alpha (FR-a), folate
receptor beta (FR-I3) and
folate receptor delta (FR-),In some embodiments, the processing includes one
or more of: thin
film hydration, extrusion, in-line mixing, ethanol injection technique,
freezing-and-thawing
technique, reverse-phase evaporation, dynamic high pressure microfluidization,
microfluidic
mixing, double emulsion, freeze-dried double emulsion, 3D printing, membrane
contactor
method, and stirring, and once the particles have been formed, the particles
can have their sizes
further modified by one or more of extrusion and sonication. In some
embodiments, during the
process of preparing the liposomes at least 1%, 5%, 10%, 15%, 20%, 25%, 30%,
35%, 40%,
45%, 50%, 55%, 60%, 65%, 70%, 75%, or more than 75%, of the starting material
of gamma
polyglutamated Antifolate is encapsulated (entrapped) in the targeted
liposomes. In some
embodiments, the liposomes are anionic or neutral. In some embodiments, the
targeting moiety
has the specific affinity for one or more of: folate receptor alpha (FR-a),
folate receptor beta
(1-R-13) and folate receptor delta (FR-6). In further embodiments, the
targeting moiety has the
specific affinity for folate receptor alpha (FR-a) and folate receptor beta
(FR-13). In additional
embodiments, the targeting moiety has the specific affinity for an epitope on
a tumor cell
surface antigen that is present on a tumor cell but absent or inaccessible on
a non-tumor cell.
[00332] Liposomes can also be prepared to target particular cells, organs,
or cell organelles by
varying phospholipid composition or by inserting receptors or counter-
receptors into the
liposomes. For example, liposomes, prepared with a high content of a nonionic
surfactant, have
been used to target the liver. (See, e.g., Japanese Patent 04-244,018 to
Hayakawa et al.; Kato
et al., Biol. Pharm. Bull. 16:960, 1993.) A liposomal formulation of
dipalmitoylphosphatidylcholine (DPPC) with a soybean-derived sterylgluco side
mixture (SG)
and cholesterol (Ch) has also been shown to target the liver. (See e.g.,
Shimizu et al., Biol.
Pharm. Bull. 20:881 (1997)).
Antibody delivery vehicles
[00333] In additional embodiments, the disclosure provides an antibody
delivery vehicle (e.g.,
ADC). In some embodiments, the disclosure provides an immunoconjugate having
the
Formula (A)-(L)-(yPANTIFOL), wherein: (A) is an antibody or antigen binding
fragment of
an antibody; (L) is a linker; and (yPANTIFOL) is a yPANTIFOL composition
described herein;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 179 -
and wherein said linker (L) links (A) to (yPANTIFOL). In some embodiments, the
yPANTIFOL is a yPANTIFOL according to any of [1]411] of the Detailed
Description
Section. In some embodiments, the polyglutamated Antifolate is an Antifolate
described in
Section I, herein.
[00334] In some embodiments, the antibody or antigen binding antibody
fragment has specific
affinity for an epitope of a cell surface antigen on a cell of interest (e.g.,
an epitope and/or
antigen described herein). In certain embodiments, the antibody binds to an
antigen target that
is expressed in or on the cell membrane (e.g., on the cell surface) of a
cancer/tumor and the
antibody is internalized by the cell after binding to the (antigen) target,
after which the
yPANTIFOL is released intracellularly. In some embodiments, the antibody is a
full length
antibody.
[00335] The antibody or antigen binding antibody fragment of the (A)-(L)-
(yPANTIFOL)
immunoconjugate can be an IgA, IgD, IgE, IgG or IgM antibody. The different
classes of
immunoglobulins have different and well known subunit structures and three-
dimensional
configurations. In certain embodiments, the antibody is an IgG antibody. In
some
embodiments, the antibody is an IgGl, IgG2, IgG3 or IgG4 antibody. In certain
embodiments,
the antibody is an IgG1 antibody.
[00336] In some embodiments, (A) is an antigen binding fragment of an
antibody. In some
embodiments, (A) is an antigen binding fragment of an antibody.
[00337] A "linker" is any chemical moiety that is capable of linking a
compound, usually a
drug, such as a yPANTIFOL, to an antibody or antigen binding fragment of an
antibody in a
stable, covalent manner. The linkers can be susceptible to or be substantially
resistant to acid-
induced cleavage, light-induced cleavage, peptidase-induced cleavage, esterase-
induced
cleavage, and disulfide bond cleavage, at conditions under which the compound
or the antibody
remains active. Suitable linkers are known in the art and include, for
example, disulfide groups,
thioether groups, acid labile groups, photolabile groups, peptidase labile
groups and esterase
labile groups. Linkers also include charged linkers, and hydrophilic forms
thereof.
[00338] In some embodiments, the linker is selected from a cleavable
linker, a non-cleavable
linker, a hydrophilic linker, and a dicarboxylic acid based linker. In another
embodiment, the
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 180 -
linker is a non-cleavable linker. In another embodiment, the linker is
selected from the group
consisting: N-succinimidyl 4-(2-pyridyldithio) pentanoate (SPP); N-
succinimidyl 4-(2-
pyridyldithio)butanoate (SPDB) or N-succinimidyl 4-(2-pyridyldithio) -2-
sulfobutanoate
(sulfo-SPDB); N-succinimidyl 4-(maleimidomethyl) cyclohexane-carboxylate
(SMCC); N-
sulfo s uccinimidyl 4-(maleimidomethyl) cyclohex- anec arboxyl ate ( s ulfo S
MCC ) ; N-
succinimidy1-4-(iodoacety1)-aminobenzoate (S JAB);
and N- succinimidyl- [(N-
maleimidopropionamido)-tetraethyleneglycol]ester (NHS -PEG4-ma-leimide). In a
further
embodiment, the linker is N-succinimidyl-[(N-maleimido-propionamido)-
tetraethyleneglycol]
ester (NHS-PEG4-maleimide).
[00339] In
some embodiments, the y polyglutamated Antifolate is attached (coupled) to the
antibody or antigen binding antibody fragment of the immunoconjugate directly,
or through a
linker using techniques known in the art. Such attachment of one or more
yPANTIFOL can
include many chemical mechanisms, such as covalent binding, affinity binding,
intercalation,
coordinate binding and complexation. Covalent binding of the yPANTIFOL and
antibody or
antigen binding antibody fragment can be achieved by direct condensation of
existing side
chains or by the incorporation of external bridging molecules. Many bivalent
or polyvalent
agents are useful in associating polypeptides to other proteins with coupling
agents such as
carbodiimides, diisocyanates, glutaraldehyde, diazobenzenes, and hexamethylene
diamines.
This list is not intended to be exhaustive of the various coupling agents
known in the art but,
rather, is exemplary of the more common coupling agents. In some embodiments,
the antibody
or antigen binding antibody fragment is derivatized and then attached to the y
polyglutamated
Antifolate. Alternatively, the yPANTIFOL can be derivatized and attached to
the antibody or
antigen binding antibody fragment using techniques known in the art.
[00340] In
some embodiments, the immunoconjugate comprises an antibody or an antigen-
binding fragment of an antibody and yPANTIFOL containing 4, 5, 2-10, 4-6, or
more than 5,
glutamyl groups (including the glutamyl group of the Antifolate). In some
embodiments, the
immunoconjugate comprises a yPANTIFOL according to any of [1]411] of the
Detailed
Description Section. In some embodiments, the immunoconjugate comprises a
polyglutamate
of an Antifolate described in Section I, herein. In some embodiments, the
immunoconjugate
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 181 -
comprises gamma polyglutamated Antifolate that comprises two or more glutamyl
groups in
the L-form. In other embodiments, the immunoconjugate comprises gamma
polyglutamated
Antifolate that comprises a glutamyl group in the D-form. In further
embodiments, the
immunoconjugate comprises gamma polyglutamated Antifolate that comprises a
glutamyl
group in the D-form and two or more glutamyl groups in the L-form. In
additional
embodiments, the immunoconjugate comprises gamma polyglutamated Antifolate
that
comprises two or more glutamyl groups that have a gamma carboxyl linkage. In
some
embodiments, the immunoconjugate comprises y pentaglutamated Antifolate. In
further
embodiments, the immunoconjugate comprises L-7 pentaglutamated Antifolate, a D-
7
pentaglutamated Antifolate, or an L- and D-y pentaglutamated Antifolate. In
some
embodiments, the immunoconjugate comprises a 7 hexaglutamated Antifolate (Lp-
yPANTIFOL). In further embodiments, the immunoconjugate comprises an L-7
hexaglutamated Antifolate, a D-y hexaglutamated Antifolate, or an L- and D-y
hexaglutamated
Antifolate.
[00341] In some embodiments, the antibody delivery vehicle composition
comprises a gamma
polyglutamated Antifolate and an antibody or an antigen binding antibody
fragment that has
specific affinity for an epitope on a cell surface antigen selected from:
GONMB, TACSTD2
(TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a, folate
receptor-0 or
folate receptor-6), Mucin 1 (MUC-1), MUC-6, STEAP1, mesothelin, Nectin 4,
ENPP3,
Guanyly1 cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic
anhydrase),
5T4 (TPBG), SLTRK6, SC-16, Tissue factor, LIV-1 (ZIP6), CGEN-15027, P
Cadherin,
Fibronectin Extra-domain B (ED-B), VEGFR2 (CD309), Tenascin, Collagen IV,
Periostin,
endothelin receptor, HER2, HER3, ErbB4, EGFR, EGFRvIll, FGFR1, FGFR2, FGFR3,
FGFR4, FGFR6, IGFR-1, FZD1, FZD2, FZD3, FZD4, FZD5, FZD6, FZD7, FZD8, FZD9,
FZD10, SMO, CD2, CD3, CD4, CD5, CD6, CD8, CD11, CD1 la, CD15, CD18, CD19,
CD20,
CD22, CD26, CD27L, CD28, CD30, CD33, CD34, CD37, CD38, CD40, CD4OL, CD44,
CD56, CD70, CD74, CD79, CD79b, CD98, CD105, CD133, CD138, cripto, IGF-1R, IGF-
2R,
EphAl an EphA receptor, an EphB receptor, EphA2, EphA3, EphA4, EphA5, EphA6,
EphA7,
EphA8, EphAl, EphB1, EphB2, EphB3, EphB4, EphB6, an integrin (e.g., integrin
av03, av05,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 182 -
or ctv136), a C242 antigen, Apo2, PSGR, NGEP, PSCA, TMEFF2, endoglin, PSMA,
CanAg,
CALLA, c-Met, VEGFR-1, VEGFR-2, DDR1, PDGFR alpha., PDGFR beta, TrkA, TrkB,
TrkC, UFO, LTK, ALK, Tie 1 , Tie2, PTK7, Ryk, TCR, NMDAR, LNGFR, and MuSK. In
some embodiments, the delivery vehicle comprises a targeting moiety that has
specific affinity
for an epitope on a cell surface antigen derived from, or determined to be
expressed on, a
specific subject's cancer (tumor) such as a neoantigen. In some embodiments,
the antibody
delivery vehicle composition comprises a gamma polyglutamated Antifolate
according to any
of [1]411] of the Detailed Description Section.
[00342] In some embodiments, the antibody delivery vehicle composition
comprises a gamma
polyglutamated Antifolate and an antibody or an antigen binding antibody
fragment that has
specific affinity for an epitope on an antigen selected from mannose-6-
phosphate receptor,
transferrin receptor, and a cell adhesion molecule (CAM). In further
embodiments, the
targeting moiety has a specific affinity for an epitope of a CAM is selected
from the group
consist of: intercellular adhesion molecule (ICAM), platelet-endothelial cell
adhesion
molecule (PECAM), activated leukocyte cell adhesion molecule (ALCAM), B-
lymphocyte
cell adhesion molecule (BL-CAM), vascular cell adhesion molecule (VCAM),
mucosal
vascular addres sin cell adhesion molecule (MAdCAM), CD44, LFA-2, LFA-3, and
basigin. In
some embodiments, the antibody delivery vehicle composition comprises a gamma
polyglutamated Antifolate according to any of [11411] of the Detailed
Description Section.
[00343] In some embodiments, the antibody delivery vehicle composition
comprises 1, 2, 3, 4,
5, 5-10, or greater than 10 7 polyglutamated Antifolate. In some embodiments,
the antibody
delivery vehicle composition comprises 1, 2, 3, 4, 5, 5-10, or greater than
10, pentaglutamated
Antifolate. In some embodiments, the antibody delivery vehicle composition
comprises 1, 2,
3, 4, 5, 5-10, or greater than 10, hexaglutamated Antifolate. In some
embodiments, the
antibody delivery vehicle composition comprises a gamma polyglutamated
Antifolate
according to any of [11411] of the Detailed Description Section.
II. Pharmaceutical compositions and administration
[00344] In some embodiments, the liposome composition is provided as a
pharmaceutical
composition containing the liposome and a carrier, e.g., a pharmaceutically
acceptable carrier.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 183 -
In some embodiments, the liposome composition is a liposome according to any
of [12]-[67]
of the Detailed Description Section. Examples of pharmaceutically acceptable
carriers
contained in the provided pharmaceutical compositions include normal saline,
isotonic
dextrose, isotonic sucrose, Ringer's solution, and Hanks' solution. In some
embodiments, a
buffer substance is added to maintain an optimal pH for storage stability of
the pharmaceutical
composition. In some embodiments, the pH of the pharmaceutical composition is
between 6.0
and 7.5. In some embodiments, the pH is between 6.3 and 7Ø In further
embodiments, the pH
is 6.5. Ideally the pH of the pharmaceutical composition allows for both
stability of liposome
membrane lipids and retention of the entrapped entities. Histidine,
hydroxyethylpiperazine-
ethylsulfonate (HEPES), morpholipoethylsulfonate (MES), succinate, tartrate,
and citrate,
typically at 2-20 mM concentration, are exemplary buffer substances. Other
suitable carriers
include, e.g., water, buffered aqueous solution, 0.4% NaCl, and 0.3% glycine.
Protein,
carbohydrate, or polymeric stabilizers and tonicity adjusters can be added,
e.g., gelatin,
albumin, dextran, or polyvinylpyrrolidone. The tonicity of the composition can
be adjusted to
the physiological level of 0.25-0.35 mol/kg with glucose or a more inert
compound such as
lactose, sucrose, mannitol, or dextrin. These compositions can routinely be
sterilized using
conventional, sterilization techniques known in the art (e.g., by filtration).
The resulting
aqueous solutions can be packaged for use or filtered under aseptic conditions
and lyophilized,
the lyophilized preparation being combined with a sterile aqueous medium prior
to
administration.
[00345] The provided pharmaceutical liposome compositions can also contain
other
pharmaceutically acceptable auxiliary substances as required to approximate
physiological
conditions, such as pH adjusting and buffering agents, and tonicity adjusting
agents, for
example, sodium acetate, sodium lactate, sodium chloride, potassium chloride,
and calcium
chloride. Additionally, the liposome suspension may include lipid-protective
agents which
protect lipids against free-radical and lipid-peroxidative damages on storage.
Lipophilic free-
radical quenchers, such as gamma-tocopherol and water-soluble iron-specific
chelators, such
as ferrioxamine, are suitable.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 184 -
[00346] The liposome concentration in the provided fluid pharmaceutical
formulations can
vary widely depending upon need, e.g., from less than about 0.05% usually or
at least about 2-
10% to as much as 30-50% by weight and will be selected primarily by fluid
volumes, and
viscosities, in accordance with the particular mode of administration
selected. For example,
the concentration may be increased to lower the fluid load associated with
treatment. This may
be particularly desirable in patients having atherosclerosis-associated
congestive heart failure
or severe hypertension. Alternatively, liposome pharmaceutical compositions
composed of
irritating lipids may be diluted to low concentrations to lessen inflammation
at the site of
administration.
[00347] Some embodiments, relate to a method of delivering a targeted
pegylated liposomal
formulation of gamma polyglutamated Antifolate, to a tumor expressing folate
receptor on its
surface. An exemplary method comprises the step of administering a liposome
pharmaceutical
composition provided herein in an amount to deliver a therapeutically
effective dose of the
targeted pegylated liposomal gamma polyglutamated Antifolate to the tumor.
[00348] The amount of liposome pharmaceutical composition administered will
depend upon
the particular gamma polyglutamated Antifolate entrapped inside the liposomes,
the disease
state being treated, the type of liposomes being used, and the judgment of the
clinician.
Generally the amount of liposome pharmaceutical composition administered will
be sufficient
to deliver a therapeutically effective dose of the particular therapeutic
entity.
[00349] The quantity of liposome pharmaceutical composition necessary to
deliver a
therapeutically effective dose can be determined by routine in vitro and in
vivo methods,
common in the art of drug testing. See, for example, D. B. Budman, A. H.
Calvert, E. K.
Rowinsky (editors). Handbook of Anticancer Drug Development, LWW, 2003.
Therapeutically effective dosages for various therapeutic compositions are
known to those
skilled in the art. In some embodiments, a therapeutic entity delivered via
the pharmaceutical
liposome composition and provides at least the same or higher activity than
the activity
obtained by administering the same amount of the therapeutic entity in its
routine non-liposome
formulation. Typically the dosages for the liposome pharmaceutical composition
is in a range
for example, between about 0.005 and about 5000 mg of the therapeutic entity
per square meter
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 185 -
of body surface area most often, between about 0.1 and about 1000 mg
therapeutic entity per
square meter of body surface area.
[00350] For example, if the subject has a tumor, an effective amount may be
that amount of
the agent (e.g., gamma polyglutamated Antifolate composition) that reduces the
tumor volume
or load (as for example determined by imaging the tumor). Effective amounts
can also
routinely be assessed by the presence and/or frequency of cancer cells in the
blood or other
body fluid or tissue (e.g., a biopsy). If the tumor is impacting the normal
functioning of a tissue
or organ, then the effective amount can routinely be assessed by measuring the
normal
functioning of the tissue or organ. In some instances the effective amount is
the amount
required to lessen or eliminate one or more, and preferably all, symptoms.
[00351] Pharmaceutical compositions comprising the gamma polyglutamated
Antifolate
compositions (e.g., liposomes containing a pentaglutamated or hexaglutamated
Antifolate) are
also provided. Pharmaceutical compositions are sterile compositions that
comprise a sample
liposome and preferably gamma polyglutamated Antifolate, preferably in a
pharmaceutically-
acceptable carrier.
[00352] Unless otherwise stated herein, a variety of administration routes
are available. The
particular mode selected will depend, upon the particular active agent
selected, the particular
condition being treated and the dosage required for therapeutic efficacy. The
provided methods
can be practiced using any known mode of administration that is medically
acceptable and in
accordance with good medical practice. In some embodiments, the administration
route is an
injection. In further embodiments, the injection is by a parenteral route
elected from an
intramuscular, subcutaneous, intravenous, intraarterial, intraperitoneal,
intraarticular,
intraepidural, intrathecal, intravenous, intramuscular, or intra sternal
injection. In some
embodiments, the administration route is an infusion. In additional
embodiments, the
administration route is oral, nasal, mucosal, sublingual, intratracheal,
ophthalmic, rectal,
vaginal, ocular, topical, transdermal, pulmonary, or inhalation.
[00353] Therapeutic compositions containing yPANTIFOL compositions such as
the
liposomal yPANT1FOL compositions described herein can be conventionally
administered
intravenously, as by injection of a unit dose, for example. The term "unit
dose" when used in
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 186 -
reference to a therapeutic composition provided herein refers to physically
discrete units
suitable as unitary dosage for the subject, each unit containing a
predetermined quantity of
active material calculated to produce the desired therapeutic effect in
association with the
required diluent; e.g., carrier, or vehicle. In a specific embodiment,
therapeutic compositions
containing an Adapter are administered subcutaneously.
[00354] In some embodiments, the y-PANTIFOL composition is administered in
a manner
compatible with the dosage formulation, and in a therapeutically effective
amount. The
quantity to be administered depends on the subject to be treated, capacity of
the subject's
system to utilize the active ingredient, and degree of therapeutic effect
desired. Precise amounts
of active ingredient required to be administered depend on the judgment of the
practitioner and
are peculiar to each individual. However, suitable dosage ranges for systemic
application are
disclosed herein and depend on the route of administration. Suitable regimes
for administration
are also variable, but are typified by an initial administration followed by
repeated doses at one
or more hour intervals by a subsequent injection or other administration.
Alternatively,
continuous intravenous infusion sufficient to maintain concentrations in the
blood in the ranges
specified for in vivo therapies are contemplated.
[00355] The yPANTIFOL composition are formulated, dosed, and administered
in a fashion
consistent with good medical practice. Factors for consideration in this
context include the
particular disorder being treated, the particular patient being treated, the
clinical condition of
the individual patient, the cause of the disorder, the site of delivery of the
agent, the method of
administration, the scheduling of administration, and other factors known to
medical
practitioners. The dosage ranges for the administration of yPANTIFOL
composition are those
large enough to produce the desired effect in which the disease symptoms
mediated by the
target molecule are ameliorated. The dosage should not be so large as to cause
adverse side
effects, such as, hyperviscosity syndromes, pulmonary edema, congestive heart
failure, and
other adverse side effects known in the art. Generally, the dosage will vary
with the age,
weight, height, body surface area, state of health (e.g., renal and liver
function), condition, sex
and extent of the disease in the patient and can routinely be determined by
one of ordinary skill
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 187 -
in the art. The dosage can be adjusted by the individual physician in the
event of any
complication.
[00356] The dosage schedule and amounts effective for therapeutic and
prophylactic uses, i.e.,
the "dosing regimen," will depend upon a variety of factors, including the
cause, stage and
severity of the disease or disorder, the health, physical status, age of the
subject being treated,
and the site and mode of the delivery of the yPANTIFOL composition.
Therapeutic efficacy
and toxicity of the yPANTIFOL composition can be determined by standard
pharmaceutical,
pharmacological, and toxicological procedures in cell cultures or experimental
animals. Data
obtained from these procedures can likewise be used in formulating a range of
dosages for
human use. Moreover, therapeutic index (i.e., the dose therapeutically
effective in 50 percent
of the population divided by the dose lethal to 50 percent of the population
(ED50/LD50)) can
readily be determined using known procedures. The dosage is preferably within
a range of
concentrations that includes the ED50 with little or no toxicity, and may vary
within this range
depending on the dosage form employed, sensitivity of the patient, and the
route of
administration.
[00357] The dosage regimen also takes into consideration pharmacokinetics
parameters known
in the art, such as, drug absorption rate, bioavailability, metabolism and
clearance (see, e.g.,
Hidalgo-Aragones, J. Steroid Biochem. Mol. Biol. 58:611-617 (1996); Groning et
al.,
Pharmazie 51:337-341 (1996); Fotherby, Contraception 54:59-69 (1996); and
Johnson et al.,
J. Pharm. Sci. 84:1144-1146 (1995)). It is well within the state of the art
for the clinician to
determine the dosage regimen for each subject being treated. Moreover, single
or multiple
administrations of the yPANTIFOL composition can be administered depending on
the dosage
and frequency as required and tolerated by the subject. The duration of
prophylactic and
therapeutic treatment will vary depending on the particular disease or
condition being treated.
Some diseases are amenable to acute treatment whereas others require long-
term, chronic
therapy. The yPANTIFOL composition can be administered serially, or
simultaneously with
the additional therapeutic agent.
[00358] In some embodiments, the yPANTIFOL composition is administered in a
liposomal
composition at a dose of between 0.005 and 5000 mg of yPANTIFOL per square
meter of
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 188 -
body surface area, or any range therein between. In further embodiments, the
yPANTIFOL
composition is administered in a liposomal composition at a dose of between
0.1 and 1000 mg
yPANTIFOL/meter squared of body surface area, or any range therein between.
[00359] In some embodiments, the yPANTIFOL composition is administered in
an
immunoconjugate composition at a dose of 1 mg/kg to 500 mg/kg, 1 mg/kg to 250
mg/kg, 1
mg/kg to 200 mg/kg, 1 mg/kg to 150 mg/kg, 1 mg/kg to 100 mg/kg,1 mg/kg to 50
mg/kg, 1
mg/kg to 25 mg/kg, 1 mg/kg to 20 mg/kg, 1 mg/kg to 15 mg/kg, 1 mg/kg to 10
mg/kg, or 1
mg/kg to 5 mg/kg, or any range therein between.
[00360] In another embodiment, the yPANTIFOL composition is administered in
combination
with one or more additional therapeutics.
[00361] In some embodiment, the PLp-yPANTIFOL and/or targeted-PLp-7PANTIFOL
is
prepared as an infusion composition, an injection composition, a parenteral
composition, or a
topical composition. In further embodiments, the injection includes one or
more of:
intraperitoneal injection, direct intratumor injection, intra-arterial
injection, and intravenous
injection, subcutaneous injection, intramuscular injection, delivery via
transcutaneous and
intranasal route. In a further embodiment, the PLp-yPANTIFOL and/or targeted-
PLp-
yPANTIFOL is a liquid solution or a suspension. However, solid forms suitable
for solution
in, or suspension in, liquid vehicles prior to injection are also provided
herein. In some
embodiments, the targeted pegylated liposomal gamma polyglutamated Antifolate
composition is formulated as an enteric-coated tablet or gel capsule according
to methods
known in the art.
[00362] In some embodiments, the targeted pegylated liposomal gamma
polyglutamated
Antifolate formulations are administered to a tumor of the central nervous
system using a slow,
sustained intracranial infusion of the liposomes directly into the tumor
(e.g., a convection-
enhanced delivery (CED)). See, Saito et al., Cancer Research 64:2572-2579
(2004); Mamot et
al., J. Neuro-Oncology 68:1-9 (2004). In other embodiments, the formulations
are directly
applied to tissue surfaces. Sustained release, pH dependent release, and other
specific chemical
or environmental condition-mediated release administration of the pegylated
liposomal gamma
polyglutamated Antifolate formulations (e.g., depot injections and erodible
implants) are also
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 189 -
provided. Examples of such release-mediating compositions are further
described herein or
otherwise known in the art.
[00363] For administration by inhalation, the compositions can be
conveniently delivered in
the form of an aerosol spray presentation from pressurized packs or a
nebulizer, with the use
of a suitable propellant, e.g., dichlorodifluoromethane,
trichlorofluoromethane,
ichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of
a pressurized
aerosol, the dosage unit can be determined by providing a valve to deliver a
metered amount.
[00364] When it is desirable to deliver the compositions systemically, they
can formulated for
parenteral administration by injection, e.g., by bolus injection or continuous
infusion.
Formulations for injection can be presented in unit dosage form, e.g., in
ampoules or in multi-
dose containers. Pharmaceutical parenteral formulations include aqueous
solutions of the
ingredients. Aqueous injection suspensions can contain substances which
increase the
viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol,
or dextran.
Alternatively, suspensions of liposomes can be prepared as oil-based
suspensions. Suitable
lipophilic solvents or vehicles include fatty oils such as sesame oil, or
synthetic fatty acid
esters, such as ethyl oleate or triglycerides.
[00365] Alternatively, the non-targeted or targeted pegylated liposomal
gamma
polyglutamated Antifolate can be in powder form or lyophilized form for
constitution with a
suitable vehicle, e.g., sterile pyrogen-free water, before use.
[00366] The provided compositions (e.g., gamma polyglutamated Antifolate
and liposomes
containing the gamma polyglutamated Antifolate) can also be formulated in
rectal or vaginal
compositions such as suppositories or retention enemas, e.g., containing
conventional
suppository bases such as cocoa butter or other glycerides.
Methods of use and treatment
[00367] In additional embodiments, the disclosure provides methods of using
gamma
polyglutamated Antifolate (yPANTIFOL) compositions. In some embodiments, the
gamma
yPANTIFOL compositions are used to treat a disease or disorder.
[00368] In some embodiments, the disclosure provides a method of killing a
cell that comprises
contacting the cell with a composition comprising a gamma polyglutamated
Antifolate (e.g., a
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 190 -
yPANTIFOL disclosed herein). In some embodiments, the gamma polyglutamated
Antifolate
is a yPANTIFOL according to any of [1]- [11] of the Detailed Description
Section. In some
embodiments, the polyglutamated Antifolate described in Section I. In some
embodiments, the
cell is contacted with a liposomal composition that contains a liposome
according to any of
[12]-[67] of the Detailed Description Section. In some embodiments, the
contacted cell is a
mammalian cell. In further embodiments, the contacted cell is a human cell. In
some
embodiments, the contacted cell is a hyperproliferative cell. In further
embodiments, the
hyperproliferative cell is a cancer cell. In further embodiments, the cancer
cell is a primary cell
or a cell from a cell line obtained/derived from a cancer selected from: a non-
hematologic
malignancy including such as for example, lung cancer, pancreatic cancer,
breast cancer,
ovarian cancer, prostate cancer, head and neck cancer, gastric cancer,
gastrointestinal cancer,
colorectal cancer, esophageal cancer, cervical cancer, liver cancer, kidney
cancer, biliary duct
cancer, gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma),
brain cancer, central
nervous system cancer, and melanoma; and a hematologic malignancy such as for
example, a
leukemia, a lymphoma and other B cell malignancies, myeloma and other plasma
cell
dysplasias or dyscrasias. In some embodiments, the contacted cancer cell is a
primary cell or a
cell from a cell line obtained/derived from lung cancer (e.g., NSCLC or
mesothelioma). In
some embodiments, the contacted cancer cell is a primary cell or a cell from a
cell line
obtained/derived from breast cancer (e.g., HER2++ or triple negative breast
cancer). In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from colorectal cancer. In some embodiments, the contacted
cancer cell is a
primary cell or a cell from a cell line obtained/derived from ovarian cancer.
In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from endometrial cancer. In some embodiments, the contacted
cancer cell is
a primary cell or a cell from a cell line obtained/derived from pancreatic
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from liver cancer. In some embodiments, the contacted cancer
cell is a
primary cell or a cell from a cell line obtained/derived from head and neck
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 191 -
obtained/derived from osteosarcoma. In some embodiments, the method is
performed in vivo.
In other embodiments, the method is performed in vitro. In some embodiments,
the
yPANTIFOL composition contains 4, 5, 2-10, 4-6, or more than 5, y-glutamyl
groups. In some
embodiments, the yPANTIFOL composition comprises gamma pentaglutamated
Antifolate. In
some embodiments, the yPANTIFOL composition comprises gamma hexaglutamated
Antifolate. In some embodiments, the yPANTIFOL composition comprises L gamma
polyglutamated Antifolate. In some embodiments, the yPANTIFOL composition
comprises D
gamma polyglutamated Antifolate. In some embodiments, the yPANTIFOL
composition
comprises L and D gamma polyglutamated Antifolate.
[00369] In additional embodiments, the disclosure provides a method of
killing a cell that
comprises contacting the cell with a liposome containing gamma polyglutamated
Antifolate
(e.g., an Lp-yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-
yPANTIFOL, TLp-yPANTIFOL or TPLp-yPANTIFOL disclosed herein). In some
embodiments, the liposomal composition comprises a yPANTIFOL according to any
of [1]-
[11] of the Detailed Description Section. In some embodiments, the liposomal
composition
comprises a polyglutamated Antifolate described in Section I. In some
embodiments, the
liposomal composition comprises a liposome according to any of [12]467] of the
Detailed
Description Section. In some embodiments, the liposome is pegylated (e.g., PLp-
yPANTIFOL
and NTPLp-yPANTIFOL). In some embodiments, the liposome comprises a targeting
moiety
on its surface that specifically binds an antigen on the surface of the cell
(e.g., TLp-
yPANTIFOL and TPLp-yPANTIFOL). In further embodiments, the liposome is
pegylated and
comprises a targeting moiety on its surface that specifically binds an antigen
on the surface of
the cell (e.g., TPLp-yPANTIFOL). TPLp-yPANTIFOL). In some embodiments, the
contacted
cell is a mammalian cell. In further embodiments, the contacted cell is a
human cell. In
additional embodiments, the contacted cell is a hyperproliferative cell. In
further embodiments,
the hyperproliferative cell is a cancer cell. In further embodiments, the
contacted cancer cell is
a primary cell or a cell from a cell line obtained/derived from a cancer
selected from: lung
cancer (e.g., non-small cell), pancreatic cancer, breast cancer, ovarian
cancer, prostate cancer,
head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal
cancer, esophageal
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 192 -
cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer,
gallbladder cancer,
bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous
system cancer,
melanoma, myeloma, a leukemia and a lymphoma. In some embodiments, the
contacted cancer
cell is a primary cell or a cell from a cell line obtained/derived from lung
cancer (e.g., NSCLC
or mesothelioma). In some embodiments, the contacted cancer cell is a primary
cell or a cell
from a cell line obtained/derived from breast cancer (e.g., HER2++ or triple
negative breast
cancer). In some embodiments, the contacted cancer cell is a primary cell or a
cell from a cell
line obtained/derived from colorectal cancer. In some embodiments, the
contacted cancer cell
is a primary cell or a cell from a cell line obtained/derived from ovarian
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from endometrial cancer. In some embodiments, the contacted
cancer cell is
a primary cell or a cell from a cell line obtained/derived from pancreatic
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from liver cancer. In some embodiments, the contacted cancer
cell is a
primary cell or a cell from a cell line obtained/derived from head and neck
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from osteosarcoma. In some embodiments, the method is
performed in vivo.
In other embodiments, the method is performed in vitro. In some embodiments,
the liposome
contains a 7PANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, 7-glutamyl
groups. In some
embodiments, the liposome comprises L gamma polyglutamated Antifolate. In some
embodiments, the liposome composition comprises 2, 3, 4, 5, or more than 5, L-
gamma
glutamyl groups. In some embodiments, the liposome comprises D gamma
polyglutamated
Antifolate. In some embodiments, the liposome comprises 2, 3, 4, 5, or more
than 5, D-gamma
glutamyl groups. In some embodiments, the administered liposome comprises 2,
3, 4, 5, or
more than 5, L-gamma glutamyl groups. In some embodiments, the liposome
comprises L and
D gamma polyglutamated Antifolate. In some embodiments, the liposome comprises
2, 3, 4,
5, or more than 5, L-gamma glutamyl groups and 2, 3, 4, 5, or more than 5, D-
gamma glutamyl
groups
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 193 -
[00370] In some embodiments, the disclosure provides a method of killing a
hyperproliferative
cell that comprises contacting a hyperproliferative cell with a delivery
vehicle (e.g., a liposome
or antibody) comprising gamma polyglutamated Antifolate (e.g., a yPANTIFOL
disclosed
herein). In some embodiments, the delivery vehicle comprises a yPANTIFOL
according to any
of [1]-[11] of the Detailed Description Section. In some embodiments, the
delivery vehicle
comprises a polyglutamated Antifolate described in Section I. In some
embodiments, the
delivery vehicle is an antibody (e.g., a full-length IgG antibody, a
bispecific antibody, or a
scFv). In some embodiments, the delivery vehicle is a liposome (e.g., an Lp-
TPANTIFOL such
as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL, or
TPLp-yPANTIFOL). In some embodiments, the delivery vehicle is non-targeted. In
other
embodiments, the delivery vehicle is targeted and comprises a targeting moiety
on its surface
that has specific affinity for an epitope on an antigen on the surface of the
hyperproliferative
cell. In further embodiments, the delivery vehicle comprises a targeting
moiety that has specific
affinity for an epitope on an antigen on the surface of the hyperproliferative
cell selected from
GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate
receptor-
cc, folate receptor-I3 or folate receptor-6), Mucin 1 (MUC-1), MUC-6, STEAP1,
mesothelin,
Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9
(Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor, LIV-1 (ZIP6),
CGEN-
15027, P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2 (CD309),
Tenascin,
Collagen IV, Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-1,
EGFRvIII, CD2,
CD3, CD4, CD5, CD6, CD11, CD11a, CD15, CD18, CD19, CD20, CD22, CD26, CD27L,
CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79, CD79b,
CD105, CD133, CD138, cripto, CD38, an EphA receptor, an EphB receptor, EphA2,
an
integrin (e.g., integrin av133, avI35, or av[36), a C242 antigen, Apo2, PSGR,
NGEP, PSCA,
TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some embodiments, the
method is performed in vivo. In some embodiments, the method is performed in
vitro. In some
embodiments, the delivery vehicle comprises a yPANTIFOL consisting of 4, 5, 2-
10, 4-6, or
more than 5, glutamyl groups. In some embodiments, the delivery vehicle
comprises gamma
tetraglutamated Antifolate. In some embodiments, the delivery vehicle
comprises gamma
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 194 -
pentaglutamated Antifolate. In other embodiments, the delivery vehicle
comprises gamma
hexaglutamated Antifolate. In some embodiments, the delivery vehicle comprises
L gamma
polyglutamated Antifolate. In some embodiments, the administered delivery
vehicle comprises
L gamma polyglutamated Antifolate. In some embodiments, the administered
delivery vehicle
comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups. In some
embodiments, the
administered delivery vehicle comprises D gamma polyglutamated Antifolate. In
some
embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or more
than 5, D-gamma
glutamyl groups. In some embodiments, the administered delivery vehicle
comprises L and D
gamma polyglutamated Antifolate. In some embodiments, the administered
delivery vehicle
comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups and 2, 3, 4, 5,
or more than 5,
D-gamma glutamyl groups.
[00371] In particular embodiments, the method of a killing a
hyperproliferative cell is
performed using a liposome delivery vehicle that comprises gamma
polyglutamated Antifolate
(e.g., an Lp-yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-
yPANTIFOL, TLp-yPANTIFOL or TPLp-yPANTIFOL disclosed herein). In some
embodiments, the delivery vehicle comprises a yPANTIFOL according to any of
[1]411] of
the Detailed Description Section. In some embodiments, the delivery vehicle
comprises a
polyglutamated Antifolate described in Section I. In some embodiments, the
delivery vehicle
is a non-targeted liposome. In some embodiments, the delivery vehicle
comprises a targeting
moiety on its surface that has specific affinity for an epitope on an antigen
on the surface of
the hyperproliferative cell (e.g., TLp-yPANTIFOL and TPLp-yPANTIFOL). In some
embodiments, the delivery vehicle is a liposome comprising a targeting moiety
on its surface
that has specific affinity for an epitope on an antigen on the surface of the
hyperproliferative
cell. In further embodiments, the targeting moiety has specific affinity for
an epitope on an
antigen selected from GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate
receptor
(e.g., folate receptor-a, folate receptor-0 or folate receptor-6), Mucin 1
(MUC-1), MUC-6,
STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4,
NaPi2b, CD70
(TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor,
LIV-1
(Z1P6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2
(CD309),
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 195 -
Tenascin, Collagen IV, Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-
1,
EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD11a, CD15, CD18, CD19, CD20, CD22,
CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79,
CD79b, CD105, CD133, CD138, cripto, CD38, an EphA receptor, an EphB receptor,
EphA2,
an integrin (e.g., integrin avf33, avf35, or avf36), a C242 antigen, Apo2,
PSGR, NGEP, PSCA,
TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some embodiments, the
liposome is pegylated (e.g., PLp-yPANTIFOL, and NTPLp-yPANTIFOL). In further
embodiments, the liposome is pegylated and comprises a targeting moiety on its
surface that
has specific affinity for an epitope on an antigen on the surface of the
hyperproliferative cell
(e.g., TPLp-yPANTIFOL). In other embodiments, the embodiments, the liposome is
unpegylated. In some embodiments, the liposome is unpegylated and the liposome
comprises
a targeting moiety on its surface that has specific affinity for an epitope on
an antigen on the
surface of the hyperproliferative cell (e.g., TPLp-yPANTIFOL). In some
embodiments, the
liposome comprises a yPANTIFOL consisting of 4, 5, 2-10, 4-6, or more than 5,
glutamyl
groups. In some embodiments, the liposome comprises gamma tetraglutamated
Antifolate. In
some embodiments, the liposome comprises gamma pentaglutamated Antifolate. In
other
embodiments, the liposome comprises gamma hexaglutamated Antifolate. In some
embodiments, the liposome comprises L gamma polyglutamated Antifolate. In some
embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups.
In some embodiments, the liposome comprises D gamma polyglutamated Antifolate.
In some
embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, D-gamma
glutamyl groups.
In some embodiments, the liposome comprises L and D gamma polyglutamated
Antifolate. In
some embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl
groups and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups.
[00372] In additional embodiments, the disclosure provides a method of
inhibiting the
proliferation of a cancer cell that comprises contacting the cancer cell with
a delivery vehicle
(e.g., a liposome or antibody) comprising gamma polyglutamated Antifolate
(e.g., a
yPANTIFOL disclosed herein). In some embodiments, the delivery vehicle
comprises a
yPANTIFOL according to any of [1]-[11] of the Detailed Description Section. In
some
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 196 -
embodiments, the delivery vehicle comprises a polyglutamated Antifolate
described in Section
I. In some embodiments, the delivery vehicle is a liposome according to any of
[12]467] of
the Detailed Description Section. In some embodiments, the delivery vehicle is
an antibody
(e.g., a full-length IgG antibody, a bispecific antibody, or a scFv). In some
embodiments, the
delivery vehicle is a liposome (e.g., an Lp-yPANTIFOL such as, PLp-yPANTIFOL,
NTLp-
yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL, or TPLp-yPANTIFOL). In some
embodiments, the delivery vehicle is non-targeted. In some embodiments, the
delivery vehicle
is targeted and comprises a targeting moiety on its surface that has specific
affinity for an
epitope on an antigen on the surface of the cancer cell. In further
embodiments, the delivery
vehicle comprises a targeting moiety that has specific affinity for an epitope
on a cell surface
antigen selected from GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate
receptor
(e.g., folate receptor-a, folate receptor-f3 or folate receptor-6), Mucin 1
(MUC-1), MUC-6,
STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4,
NaPi2b, CD70
(TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor,
LIV-1
(Z1P6), CGEN-15027, P Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2
(CD309),
Tenascin, Collagen IV, Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-
1,
EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD1 la, CD15, CD18, CD19, CD20, CD22,
CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79,
CD79b, CD105, CD133, CD138, cripto, CD38, an EphA receptor, an EphB receptor,
EphA2,
an integrin (e.g., integrin avf33, avf35, or avf36), a C242 antigen, Apo2,
PSGR, NGEP, PSCA,
TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some embodiments, the
delivery vehicle is an antibody that has specific affinity for an epitope on
an antigen on the
surface of the cancer cell. In some embodiments, the contacted cancer cell is
a mammalian
cell. In further embodiments, the contacted cancer cell is a human cell. In
additional
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from a cancer selected from: lung cancer (e.g., non-small
cell), pancreatic
cancer, breast cancer, ovarian cancer, prostate cancer, head and neck cancer,
gastric cancer,
gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical
cancer, liver cancer,
kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer,
sarcoma (e.g.,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 197 -
osteosarcoma), brain cancer, central nervous system cancer, melanoma, myeloma,
a leukemia
and a lymphoma. In some embodiments, the contacted cancer cell is a primary
cell or a cell
from a cell line obtained/derived from lung cancer (e.g., NSCLC or
mesothelioma). In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from breast cancer (e.g., HER2++ or triple negative breast
cancer). In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from colorectal cancer. In some embodiments, the contacted
cancer cell is a
primary cell or a cell from a cell line obtained/derived from ovarian cancer.
In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from endometrial cancer. In some embodiments, the contacted
cancer cell is
a primary cell or a cell from a cell line obtained/derived from pancreatic
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from liver cancer. In some embodiments, the contacted cancer
cell is a
primary cell or a cell from a cell line obtained/derived from head and neck
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from osteosarcoma. In some embodiments, the method is
performed in vivo.
In some embodiments, the method is performed in vitro. In some embodiments,
the delivery
vehicle is an antibody that has specific affinity for an epitope on one of the
above-listed cell
surface antigens. In other embodiments, the targeting vehicle is a liposome
that comprises a
targeting moiety that has specific affinity for an epitope on the surface of
the cancer cell. In
other embodiments, the targeting vehicle is a liposome that comprises a
targeting moiety that
has specific affinity for an epitope on one of the above-listed cell surface
antigens. In some
embodiments, the delivery vehicle is a liposome that is pegylated. In other
embodiments, the
delivery vehicle is a liposome that is not pegylated. In some embodiments, the
delivery vehicle
comprises a yPANTIFOL composition containing 4, 5, 2-10, 4-6, or more than 5,
y-glutamyl
groups. In some embodiments, the delivery vehicle comprises gamma
tetraglutamated
Antifolate. In some embodiments, the delivery vehicle comprises gamma
pentaglutamated
Antifolate. In other embodiments, the delivery vehicle comprises gamma
hexaglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises L
gamma
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 198 -
polyglutamated Antifolate. In some embodiments, the administered delivery
vehicle comprises
2, 3, 4, 5, or more than 5, L-gamma glutamyl groups. In some embodiments, the
administered
delivery vehicle comprises D gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, D-gamma
glutamyl groups.
In some embodiments, the administered delivery vehicle comprises L and D gamma
polyglutamated Antifolate. In some embodiments, the administered delivery
vehicle
comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups and 2, 3, 4, 5,
or more than 5,
D-gamma glutamyl groups.
[00373] In
further embodiments, the disclosure provides a method of inhibiting the
proliferation of a cancer cell that comprises contacting the cancer cell with
a liposome
comprising gamma polyglutamated Antifolate (e.g., a yPANTIFOL disclosed
herein). In some
embodiments, the liposome comprises a yPANTIFOL according to any of [1]-[11]
of the
Detailed Description Section. In
some embodiments, the liposome comprises a
polyglutamated Antifolate described in Section I. In some embodiments, the
liposome is a
liposome according to any of [12[467] of the Detailed Description Section. In
some
embodiments, the liposome is non-targeted. In some embodiments, the liposome
is targeted
and comprises a targeting moiety on its surface that has specific affinity for
an epitope on an
antigen on the surface of the cancer cell. In further embodiments, the lipo
some comprises a
targeting moiety that has specific affinity for an epitope on a cell surface
antigen selected from:
GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate
receptor-
a, folate receptor-f3 or folate receptor-6), Mucin 1 (MUC-1), MUC-6, STEAP1,
mesothelin,
Nectin 4, ENPP3, Guanylyl cyclase C (GCC), 5LC44A4, NaPi2b, CD70 (TNFSF7), CA9
(Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor, LIV-1 (ZIP6),
CGEN-
15027, P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2 (CD309),
Tenascin,
Collagen IV, Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-1,
EGFRvIII, CD2,
CD3, CD4, CD5, CD6, CD11, CD11a, CD15, CD18, CD19, CD20, CD22, CD26, CD27L,
CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79, CD79b,
CD105, CD133, CD138, cripto, CD38, an EphA receptor, an EphB receptor, EphA2,
an
integrin (e.g., integrin av133, avf35, or av[36), a C242 antigen, Apo2, PSGR,
NGEP, PSCA,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 199 -
TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some embodiments, the
contacted cancer cell is a mammalian cell. In further embodiments, the
contacted cancer cell
is a human cell. In additional embodiments, the contacted cancer cell is a
primary cell or a cell
from a cell line obtained/derived from a cancer selected from: lung cancer
(e.g., non-small
cell), pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, head
and neck cancer,
gastric cancer, gastrointestinal cancer, colorectal cancer, esophageal cancer,
cervical cancer,
liver cancer, kidney cancer, biliary duct cancer, gallbladder cancer, bladder
cancer, sarcoma
(e.g., osteosarcoma), brain cancer, central nervous system cancer, melanoma,
myeloma, a
leukemia and a lymphoma. In some embodiments, the contacted cancer cell is a
primary cell
or a cell from a cell line obtained/derived from lung cancer (e.g., NSCLC or
mesothelioma).
In some embodiments, the contacted cancer cell is a primary cell or a cell
from a cell line
obtained/derived from breast cancer (e.g., HER2++ or triple negative breast
cancer). In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from colorectal cancer. In some embodiments, the contacted
cancer cell is a
primary cell or a cell from a cell line obtained/derived from ovarian cancer.
In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from endometrial cancer. In some embodiments, the contacted
cancer cell is
a primary cell or a cell from a cell line obtained/derived from pancreatic
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from liver cancer. In some embodiments, the contacted cancer
cell is a
primary cell or a cell from a cell line obtained/derived from head and neck
cancer. In some
embodiments, the contacted cancer cell is a primary cell or a cell from a cell
line
obtained/derived from osteosarcoma. In some embodiments, the method is
performed in vivo.
In some embodiments, the method is performed in vitro. In other embodiments,
the targeting
vehicle is a liposome that comprises a targeting moiety that has specific
affinity for an epitope
on one of the above-listed cell surface antigens. In some embodiments, the
liposome is
pegylated. In other embodiments, the liposome that is not pegylated. In some
embodiments,
the liposome comprises a yPANTIFOL consisting of 4, 5, 2-10, 4-6, or more than
5, glutamyl
groups. In some embodiments, the liposome comprises gamma tetraglutamated
Antifolate. In
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 200 -
some embodiments, the liposome comprises gamma pentaglutamated Antifolate. In
other
embodiments, the liposome comprises gamma hexaglutamated Antifolate. In some
embodiments, t the liposome comprises L gamma polyglutamated Antifolate. In
some
embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups.
In some embodiments, the liposome comprises D gamma polyglutamated Antifolate.
In some
embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, D-gamma
glutamyl groups.
In some embodiments, the liposome comprises L and D gamma polyglutamated
Antifolate. In
some embodiments, t the liposome comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl
groups. In some embodiments, the liposome comprises 2, 3, 4, 5, or more than
5, L-gamma
glutamyl groups and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups.
[00374] In additional embodiments, the disclosure provides a method for
treating a
hyperproliferative disorder that comprises administering an effective amount
of a delivery
vehicle (e.g., antibody or liposome) comprising gamma polyglutamated
Antifolate (e.g., a
yPANTIFOL disclosed herein) to a subject having or at risk of having a
hyperproliferative
disorder. In some embodiments, the delivery vehicle is an antibody (e.g., a
full-length IgG
antibody, a bispecific antibody, or a scFv). In some embodiments, the delivery
vehicle is a
liposome (e.g., an Lp-yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-
yPANTIFOL, TLp-yPANTIFOL, or TPLp-yPANTIFOL). In some embodiments, the
administered delivery vehicle is pegylated. In some embodiments, the
administered delivery
vehicle is not pegylated. In additional embodiments, the administered delivery
vehicle
comprises a targeting moiety that has a specific affinity for an epitope of
antigen on the surface
of the hyperproliferative cell. In additional embodiments, the delivery
vehicle comprises a
targeting moiety that specifically binds a cell surface antigen selected from:
GONMB,
TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a,
folate
receptor-f3 or folate receptor-6), Mucin 1 (MUG-1), MUC-6, STEAP1, mesothelin,
Nectin 4,
ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic
anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor, LIV-1 (ZIP6), CGEN-
15027,
P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2 (CD309), Tenascin,
Collagen IV,
Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-1, EGFRvIII, CD2, CD3,
CD4,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 201 -
CD5, CD6, CD11, CD1 la, CD15, CD18, CD19, CD20, CD22, CD26, CD27L, CD30, CD33,
CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79, CD79b, CD105, CD133,
CD138, cripto, CD38, an EphA receptor, an EphB receptor, EphA2, an integrin
(e.g., integrin
avI33, ctv135, or avI36), a C242 antigen, Apo2, PSGR, NGEP, PSCA, TMEFF2,
endoglin,
PSMA, CD98, CD56, CanAg, and CALLA. In some embodiments, the targeting moiety
is an
antibody or an antigen binding antibody fragment. In some embodiments, the
administered
delivery vehicle does not comprise a targeting moiety that has a specific
affinity for an epitope
on a cell surface antigen of the hyperproliferative cell. In some embodiments,
the delivery
vehicle comprises a yPANTIFOL consisting of 4, 5, 2-10, 4-6, or more than 5,
glutamyl groups.
In some embodiments, the delivery vehicle comprises gamma tetraglutamated
Antifolate. In
some embodiments, the delivery vehicle comprises gamma pentaglutamated
Antifolate. In
other embodiments, the delivery vehicle comprises gamma hexaglutamated
Antifolate. In
some embodiments, the delivery vehicle comprises a yPANTIFOL according to any
of [1]-
[11] of the Detailed Description Section. In some embodiments, the delivery
vehicle comprises
a polyglutamated Antifolate described in Section I. In some embodiments, the
delivery vehicle
is a liposome according to any of [12]467] of the Detailed Description
Section. In some
embodiments, the administered delivery vehicle comprises L gamma
polyglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises
2, 3, 4, 5, or
more than 5, L-gamma glutamyl groups. In some embodiments, the administered
delivery
vehicle comprises D gamma polyglutamated Antifolate. In some embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, D-gamma
glutamyl groups.
In some embodiments, the administered delivery vehicle comprises L and D gamma
polyglutamated Antifolate. In some embodiments, the administered delivery
vehicle
comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups and 2, 3, 4, 5,
or more than 5,
D-gamma glutamyl groups. In some embodiments, the hyperproliferative disorder
is cancer.
In some embodiments, the hyperproliferative disorder is an autoimmune disease
(e.g.,
rheumatoid arthritis). In some embodiments, the hyperproliferative disorder is
a benign or
malignant tumor; leukemia, hematological, or lymphoid malignancy. In other
embodiments,
the hyperproliferative disorder selected from a neuronal, glial, astrocytal,
hypothalamic,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 202 -
glandular, macrophagal, epithelial, stromal, blastocoelic, inflammatory,
angiogenic and
immunologic disorder, including an autoimmune disease.
[00375] In additional embodiments, the disclosure provides a method for
treating a
hyperproliferative disorder that comprises administering an effective amount
of a liposome
comprising gamma polyglutamated Antifolate (e.g., an Lp-yPANTIFOL such as, PLp-
yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL, or TPLp-
yPANTIFOL) to a subject having or at risk of having a hyperproliferative
disorder. In some
embodiments, the liposome is pegylated. In some embodiments, the liposome is
not pegylated.
In additional embodiments, the liposome comprises a targeting moiety that has
a specific
affinity for an epitope of antigen on the surface of the hyperproliferative
cell. In additional
embodiments, the liposome comprises a targeting moiety that specifically binds
a cell surface
antigen selected from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate
receptor
(e.g., folate receptor-a, folate receptor-I3 or folate receptor-6), Mucin 1
(MUC-1), MUC-6,
STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4,
NaPi2b, CD70
(TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor,
LIV-1
(Z1P6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2
(CD309),
Tenascin, Collagen IV, Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-
1,
EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD1 la, CD15, CD18, CD19, CD20, CD22,
CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79,
CD79b, CD105, CD133, CD138, cripto, CD38, an EphA receptor, an EphB receptor,
EphA2,
an integrin (e.g., integrin av(33, avf35, or avf36), a C242 antigen, Apo2,
PSGR, NGEP, PSCA,
TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some embodiments, the
targeting moiety is an antibody or an antigen binding antibody fragment. In
some
embodiments, the liposome does not comprise a targeting moiety that has a
specific affinity
for an epitope on a cell surface antigen of the hyperproliferative cell. In
some embodiments,
the liposome comprises a yPANTIFOL consisting of 4, 5, 2-10, 4-6, or more than
5, glutamyl
groups. In some embodiments, the liposome comprises gamma tetraglutamated
Antifolate. In
some embodiments, the liposome comprises gamma pentaglutamated Antifolate. In
other
embodiments, the liposome comprises gamma hexaglutamated Antifolate. In some
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 203 -
embodiments, the liposome comprises a 7PANTIFOL according to any of [1]-[11]
of the
Detailed Description Section. In some embodiments, the delivery vehicle
liposome a
polyglutamated Antifolate described in Section I. In some embodiments, the
delivery vehicle
is a liposome according to any of [12]-[67] of the Detailed Description
Section. In some
embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups.
In some embodiments, the liposome comprises D gamma polyglutamated Antifolate.
In some
embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, D-gamma
glutamyl groups.
In some embodiments, the liposome comprises L and D gamma polyglutamated
Antifolate. In
some embodiments, t the liposome comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl
groups. In some embodiments, the liposome comprises 2, 3, 4, 5, or more than
5, L-gamma
glutamyl groups and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups. In
some
embodiments, the hyperproliferative disorder is cancer. In some embodiments,
the
hyperproliferative disorder is an autoimmune disease (e.g., rheumatoid
arthritis). In some
embodiments, the hyperproliferative disorder is a benign or malignant tumor;
leukemia,
hematological, or lymphoid malignancy. In other embodiments, the
hyperproliferative disorder
is selected from a neuronal, glial, astrocytal, hypothalamic, glandular,
macrophagal, epithelial,
stromal, blastocoelic, inflammatory, angiogenic and immunologic disorder,
including an
autoimmune disease.
[00376]
Exemplary hyperproliferative disorders that can be treated according to the
disclosed
methods include, but are not limited to, disorders associated with benign, pre-
malignant, and
malignant cellular proliferation, including but not limited to, neoplasms and
tumors (e.g.,
histiocytoma, glioma, astrocytoma, osteoma), cancers (e.g., lung cancer, small
cell lung cancer,
gastrointestinal cancer, bowel cancer, colorectal cancer, breast carcinoma,
ovarian carcinoma,
prostate cancer, testicular cancer, liver cancer, kidney cancer, bladder
cancer, pancreatic
cancer, brain cancer, sarcoma (e.g., osteosarcoma, Kaposi's sarcoma), and
melanoma),
leukemias, psoriasis, bone diseases, fibroproliferative disorders (e.g., of
connective tissues),
and atherosclerosis.
[00377] In
additional embodiments, the disclosure provides a method for treating cancer
that comprises administering an effective amount of a delivery vehicle (e.g.,
antibody or
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 204 -
liposome) comprising gamma polyglutamated Antifolate (e.g., a yPANTIFOL
disclosed
herein) to a subject having or at risk of having cancer. In some embodiments,
the delivery
vehicle is an antibody (e.g., a full-length IgG antibody, a bispecific
antibody, or a scFv). In
some embodiments, the delivery vehicle is a liposome (e.g., an Lp-yPANTIFOL
such as, PLp-
yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL, or TPLp-
yPANTIFOL). In some embodiments, the administered delivery vehicle is
pegylated. In some
embodiments, the administered delivery vehicle is not pegylated. In additional
embodiments,
the administered delivery vehicle comprises a targeting moiety that has a
specific affinity for
an epitope of antigen on the surface of a cancer cell. In some embodiments,
the targeting moiety
is an antibody or an antigen binding antibody fragment. In some embodiments,
the
administered delivery vehicle comprises yPANTIFOL containing 4, 5, 2-10, 4-6,
or more than
5, glutamyl groups. In some embodiments, the administered delivery vehicle
comprises gamma
pentaglutamated Antifolate. In other embodiments, the administered delivery
vehicle
comprises gamma hexaglutamated Antifolate. In some embodiments, the
administered
delivery vehicle comprises L gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups.
In some embodiments, the administered delivery vehicle comprises D gamma
polyglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises
2, 3, 4, 5, or
more than 5, D-gamma glutamyl groups. In some embodiments, the administered
delivery
vehicle comprises L and D gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups
and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups. In some embodiments,
the cancer is
selected from: lung (e.g., non-small lung cancer), pancreatic, breast cancer,
ovarian, lung,
prostate, head and neck, gastric, gastrointestinal, colon, esophageal,
cervical, kidney, biliary
duct, gallbladder, and a hematologic malignancy (e.g., a leukemia or
lymphoma). In some
embodiments, the cancer is lung cancer (e.g., NSCLC or mesothelioma). In some
embodiments, the cancer is breast cancer (e.g., HER2++ or triple negative
breast cancer). In
some embodiments, the cancer is colorectal cancer. In some embodiments, the
cancer is
ovarian cancer. In some embodiments, the cancer is endometrial cancer. hi some
embodiments,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 205 -
the cancer is pancreatic cancer. In some embodiments, the cancer is liver
cancer. In some
embodiments, the cancer is head and neck cancer. In some embodiments, the
cancer is
osteosarcoma.
[00378] In additional embodiments, the disclosure provides a method for
treating, reducing, or
inhibiting metastasis that comprises administering an effective amount of a
delivery vehicle
(e.g., antibody or liposome) comprising gamma polyglutamated Antifolate (e.g.,
a
yPANTIFOL disclosed herein) to a subject having or at risk of having cancer.
In some
embodiments, the disclosed methods provide among other things, (1) reducing or
inhibiting
growth, proliferation, survival, mobility or invasiveness of a primary tumor,
cancer or
neoplasia; (2) reducing or inhibiting growth, proliferation, survival,
mobility or invasiveness
of a primary tumor, cancer or neoplasia that potentially or does develop
metastases; (3)
reducing or inhibiting formation or establishment of metastases arising from a
primary tumor,
cancer or neoplasia to one or more other sites, locations, regions or systems
distinct from the
primary tumor, cancer or neoplasia; (4) reducing or inhibiting growth or
proliferation of a
metastasis at one or more other sites, locations, regions or systems distinct
from the primary
tumor, cancer or neoplasia after a metastasis has formed or has been
established; and/or (5)
reducing or inhibiting formation or establishment of additional metastasis
after the metastasis
has been formed or established. In some embodiments, the delivery vehicle is
an antibody
(e.g., a full-length IgG antibody, a bispecific antibody, or a scFv). In some
embodiments, the
delivery vehicle is a liposome (e.g., an Lp-yPANTIFOL such as, PLp-yPANTIFOL,
NTLp-
yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL, or TPLp-yPANTIFOL). In some
embodiments, the administered delivery vehicle is pegylated. In some
embodiments, the
administered delivery vehicle is not pegylated. In additional embodiments, the
administered
delivery vehicle comprises a targeting moiety that has a specific affinity for
an epitope of
antigen on the surface of a cancer cell. In some embodiments, the targeting
moiety is an
antibody or an antigen binding antibody fragment. In some embodiments, the
administered
delivery vehicle comprises yPANTIFOL containing 4, 5, 2-10, 4-6, or more than
5, glutamyl
groups. In some embodiments, the administered delivery vehicle comprises gamma
pentaglutamated Antifolate. In other embodiments, the administered delivery
vehicle
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 206 -
comprises gamma hexaglutamated Antifolate. In some embodiments, the
administered
delivery vehicle comprises L gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups.
In some embodiments, the administered delivery vehicle comprises D gamma
polyglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises
2, 3, 4, 5, or
more than 5, D-gamma glutamyl groups. In some embodiments, the administered
delivery
vehicle comprises L and D gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups
and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups. In some embodiments,
the cancer is
selected from: lung (e.g., non-small lung cancer), pancreatic, breast cancer,
ovarian, lung,
prostate, head and neck, gastric, gastrointestinal, colon, esophageal,
cervical, kidney, biliary
duct, gallbladder, and a hematologic malignancy (e.g., a leukemia or
lymphoma). In some
embodiments, the cancer is lung cancer (e.g., NSCLC or mesothelioma). In some
embodiments, the cancer is breast cancer (e.g., HER2++ or triple negative
breast cancer). In
some embodiments, the cancer is colorectal cancer. In some embodiments, the
cancer is
ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some
embodiments,
the cancer is pancreatic cancer. In some embodiments, the cancer is liver
cancer. In some
embodiments, the cancer is head and neck cancer. In some embodiments, the
cancer is
osteosarcoma.
[00379] In additional embodiments, the disclosure provides a method for
treating cancer that
comprises administering an effective amount of a delivery vehicle (e.g.,
antibody or liposome)
comprising gamma polyglutamated Antifolate (e.g., a yPANTIFOL disclosed
herein) to a
subject having or at risk of having cancer. In some embodiments, the delivery
vehicle is an
antibody (e.g., a full-length IgG antibody, a bispecific antibody, or a scFv).
In some
embodiments, the delivery vehicle is a liposome (e.g., an Lp-yPANTIFOL such
as, PLp-
yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL, or TPLp-
yPANTIFOL). In some embodiments, the administered delivery vehicle is
pegylated. In some
embodiments, the administered delivery vehicle is not pegylated. In additional
embodiments,
the administered delivery vehicle comprises a targeting moiety that has a
specific affinity for
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 207 -
an epitope of antigen on the surface of a cancer cell. In additional
embodiments, the delivery
vehicle comprises a targeting moiety that specifically binds a cell surface
antigen selected
from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate
receptor-a, folate receptor-f3 or folate receptor-6), Mucin 1 (MUC-1), MUC-6,
STEAP1,
mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70
(TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor,
LIV-1
(Z1P6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2
(CD309),
Tenascin, Collagen IV, Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-
1,
EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD1 la, CD15, CD18, CD19, CD20, CD22,
CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79,
CD79b, CD105, CD133, CD138, cripto, CD38, an EphA receptor, an EphB receptor,
EphA2,
an integrin (e.g., integrin av(33, av(35, or avf36), a C242 antigen, Apo2,
PSGR, NGEP, PSCA,
TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some embodiments, the
targeting moiety is an antibody or an antigen binding antibody fragment. In
some
embodiments, the administered delivery vehicle comprises yPANTIFOL containing
4, 5, 2-10,
4-6, or more than 5, glutamyl groups. In some embodiments, the administered
delivery vehicle
comprises gamma pentaglutamated Antifolate. In other embodiments, the
administered
delivery vehicle comprises gamma hexaglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises L gamma polyglutamated Antifolate. In
some
embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or more
than 5, L-gamma
glutamyl groups. In some embodiments, the administered delivery vehicle
comprises D gamma
polyglutamated Antifolate. In some embodiments, the administered delivery
vehicle comprises
2, 3, 4, 5, or more than 5, D-gamma glutamyl groups. In some embodiments, the
administered
delivery vehicle comprises L and D gamma polyglutamated Antifolate. In some
embodiments,
the administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-
gamma glutamyl
groups and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups. In some
embodiments, the
cancer is selected from: lung (e.g., non-small lung cancer), pancreatic,
breast cancer, ovarian,
lung, prostate, head and neck, gastric, gastrointestinal, colon, esophageal,
cervical, kidney,
biliary duct, gallbladder, and a hematologic malignancy (e.g., a leukemia or
lymphoma). In
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 208 -
some embodiments, the cancer is lung cancer (e.g., NSCLC or mesothelioma). In
some
embodiments, the cancer is breast cancer (e.g., HER2++ or triple negative
breast cancer). In
some embodiments, the cancer is colorectal cancer. In some embodiments, the
cancer is
ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some
embodiments,
the cancer is pancreatic cancer. In some embodiments, the cancer is liver
cancer. In some
embodiments, the cancer is head and neck cancer. In some embodiments, the
cancer is
osteosarcoma.
[00380] In additional embodiments, the disclosure provides a method for
treating cancer that
comprises administering an effective amount of a liposome comprising gamma
polyglutamated
Antifolate (e.g., an Lp-yPANT1FOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL,
NTPLp-
yPANTIFOL, TLp-yPANTIFOL, or TPLp-yPANTIFOL) to a subject having or at risk of
having cancer. In some embodiments, the liposome is pegylated. In some
embodiments, the
liposome is not pegylated. In additional embodiments, the liposome comprises a
targeting
moiety that has a specific affinity for an epitope of antigen on the surface
of a cancer cell. In
additional embodiments, the liposome comprises a targeting moiety that
specifically binds a
cell surface antigen selected from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a
folate receptor (e.g., folate receptor-a, folate receptor-0 or folate receptor-
6), Mucin 1 (MUC-
1), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC),
SLC44A4,
NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16,
Tissue
factor, LIV-1 (ZIP6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-
B),
VEGFR2 (CD309), Tenascin, Collagen IV, Periostin, endothelin receptor, HER2,
HER3,
EGFR, IGFR-1, EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD1 1 a, CD15, CD18,
CD19,
CD20, CD22, CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70,
CD74, CD79, CD79b, CD105, CD133, CD138, cripto, CD38, an EphA receptor, an
EphB
receptor, EphA2, an integrin (e.g., integrin av03, av05, or av06), a C242
antigen, Apo2, PSGR,
NGEP, PSCA, TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some
embodiments, the cancer is selected from: lung (e.g., non-small lung cancer),
pancreatic, breast
cancer, ovarian, lung, prostate, head and neck, gastric, gastrointestinal,
colon, esophageal,
cervical, kidney, biliary duct, gallbladder, and a hematologic malignancy
(e.g., a leukemia or
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 209 -
lymphoma). In some embodiments, the targeting moiety is an antibody or an
antigen binding
antibody fragment. In some embodiments, the liposome comprises yPANTIFOL
containing 4,
5, 2-10, 4-6, or more than 5, y-glutamyl groups. In some embodiments, the
liposome comprises
gamma tetraglutamated Antifolate. In some embodiments, the liposome comprises
gamma
pentaglutamated Antifolate. In other embodiments, the liposome comprises gamma
hexaglutamated Antifolate. In some embodiments, the liposome comprises L gamma
polyglutamated Antifolate. In some embodiments, the liposome comprises a
yPANTIFOL
containing 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, y-glutamyl groups in
the L-form. In some
embodiments, the liposome comprises D gamma polyglutamated Antifolate. In some
embodiments, the liposome comprises a yPANTIFOL containing 1, 2, 3, 4, 5, 6,
7, 8, 9, 10, or
more than 10, y-glutamyl groups in the D-form. In some embodiments, the
liposome comprises
L and D gamma polyglutamated Antifolate. In some embodiments, the liposome
comprises a
yPANTIFOL containing 2, 3, 4, 5, or more than 5, y-glutamyl groups in the L-
form, and 1, 2,
3, 4, 5 or more than 5, y-glutamyl groups in the D-form. In additional
embodiments, the
disclosure provides a method for treating cancer that comprises administering
to a subject
having or at risk of having cancer, an effective amount of a liposomal
composition containing
a liposome that comprises gamma polyglutamated Antifolate and a targeting
moiety that has a
specific affinity for an epitope of antigen on the surface of the cancer. In
some embodiments,
the liposome comprises a targeting moiety that specifically binds a cell
surface antigen selected
from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate
receptor-a, folate receptor-f3 or folate receptor-6), Mucin 1 (MUC-1), MUC-6,
STEAP1,
mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70
(TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor,
LIV-1
(Z1P6), CGEN-15027, P Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2
(CD309),
Tenascin, Collagen IV, Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-
1,
EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD11a, CD15, CD18, CD19, CD20, CD22,
CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79,
CD79b, CD105, CD133, CD138, cripto, CD38, an EphA receptor, an EphB receptor,
EphA2,
an integrin (e.g., integrin avf33, avf35, or ctvf36), a C242 antigen, Apo2,
PSGR, NGEP, PSCA,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 210 -
TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some embodiments, the
liposomal composition is administered to treat a cancer selected from: lung
cancer, pancreatic,
breast cancer, ovarian cancer, lung cancer, prostate cancer, head and neck
cancer, gastric
cancer, gastrointestinal cancer, colon cancer, esophageal cancer, cervical
cancer, kidney
cancer, biliary duct cancer, gallbladder cancer, and a hematologic malignancy.
In some
embodiments, the administered liposomal composition comprises pegylated
liposomes (e.g.,
TPLp-yPANTIFOL). In some embodiments, the administered liposomal composition
comprises liposomes that are not pegylated. In some embodiments, liposomes of
the
administered liposomal composition comprises yPANTIFOL containing 4, 5, 2-10,
4-6, or
more than 5, y-glutamyl groups. In some embodiments, liposomes of the
administered
liposomal composition comprise gamma tetraglutamated Antifolate. In some
embodiments,
liposomes of the administered liposomal composition comprise gamma
pentaglutamated
Antifolate. In other embodiments, liposomes of the administered liposomal
composition
comprises gamma hexaglutamated Antifolate. In some embodiments, a liposome of
the
liposomal composition comprises a yPANTIFOL containing 2, 3, 4, 5, 6, 7, 8, 9,
10, or more
than 10, y-glutamyl groups in the L-form. In some embodiments, a liposome of
the liposomal
composition comprises D gamma polyglutamated Antifolate. In some embodiments,
a
liposome of the liposomal composition comprises a yPANTIFOL containing 1, 2,
3, 4, 5, 6, 7,
8, 9, 10, or more than 10, y-glutamyl groups in the D-form. In some
embodiments, the liposome
comprises L and D gamma polyglutamated Antifolate. In some embodiments, a
liposome of
the liposomal composition comprises yPANTIFOL containing 2, 3, 4, 5, or more
than 5,
y-glutamyl groups in the L-form, and 1, 2, 3, 4, 5 or more than 5, y-glutamyl
groups in the D-
form.
[00381] In some embodiments, the liposome comprises a targeting moiety that
has specific
affinity for an epitope of a tumor specific antigen (TSA) or tumor associated
antigen (TAA).
In some embodiments, the liposome comprises a targeting moiety that has
specific affinity for
an epitope of an antigen selected from: a tumor differentiation antigen (e.g.,
MART1/MelanA,
gp100 (Pmel 17), tyrosinase, TRP1, and TRP2), a tumor-specific multilineage
antigen (e.g.,
MAGE1, MAGE3, BAGE, GAGE1, GAGE2, and p15), an overexpressed embryonic antigen
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 211 -
(e.g., carcinoembryonic antigen (CEA)), an overexpressed oncogene or mutated
tumor-
suppressor gene product (e.g., p53, Ras, and HER2/neu), a unique tumor antigen
resulting
from chromosomal translocations (e.g., BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, and
MYL-
RAR), a viral antigen (e.g., Epstein Barr virus antigen EBVA, human
papillomavirus (HPV)
antigen E6 or E7), GP 100), prostatic acid phosphatase (PAP), prostate-
specific antigen (PSA),
PTGER4, ITGA4, CD37, CD52, CD62L (L-selectin), CXCR4, CD69, EVI2B (CD361),
SLC39A8, MICB, LRRC70, CLELC2B, HMHAl, LST1, and CMTM6 (CKLFSF6). In some
embodiments, the liposome comprises a yPANTTFOL according to any of [1]-[11]
of the
Detailed Description Section. In some embodiments, the liposome is a Lp-
TPANTIFOL
according to any of [48]-[67] of the Detailed Description Section.
[00382] In some embodiments, the liposome comprises a targeting moiety that
has specific
affinity for an epitope of a hematologic tumor antigen. In further
embodiments, the targeting
moiety has specific affinity for an epitope of a hematologic tumor antigen
selected from: CD19,
CD20, CD22, CD30, CD138, CD33, CD34, CD38, CD123, CS1, ROR1, LewisY, Ig kappa
light chain, TCR, BCMA, TACT, BAFFR (CD268), CALLA, and a NKG2DL ligand). In
some
embodiments, the liposome comprises a targeting moiety that has specific
affinity for an
epitope of a B -cell lymphoma-specific idiotype immunoglobulin, or a B-cell
differentiation
antigen (e.g., CD19, CD20, and CD37). In some embodiments, the liposome
comprises a
targeting moiety that has specific affinity for an epitope of an antigen on a
multiple myeloma
cell (e.g., CS-1, CD38, CD138, MUC1, HM1.24, CYP1B1, SP17, PRAME, Wilms' tumor
1
(WT1), and heat shock protein gp96) or an antigen on myeloid cells (e.g.,
TSLPR and IL-7R).
In some embodiments, the liposome comprises a yPANTIFOL according to any of
[1]-[11] of
the Detailed Description Section. In some embodiments, the liposome is a Lp-
TPANTIFOL
according to any of [48]-[67] of the Detailed Description Section.
[00383] In some embodiments, the liposome comprises a targeting moiety that
has specific
affinity for an epitope of a solid tumor antigen. In further embodiments, the
targeting moiety
has specific affinity for an epitope of a hematologic tumor antigen selected
from:
disialoganglioside (GD2), o-acetyl GD2, EGFRvIII, ErbB2, VEGFR2, FAP,
mesothelin,
IL13Ra2 (glioma), cMET, PSMA, L1CAM, CEA, and EGFR. In some embodiments, the
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 212 -
liposome comprises a yPANTIFOL according to any of [1]-[11] of the Detailed
Description
Section. In some embodiments, the liposome is a Lp-yPANTIFOL according to any
of [48]-
[67] of the Detailed Description Section.
[00384] In some embodiments, the liposome comprises a targeting moiety that
has specific
affinity for an epitope of an antigen selected from: GONMB, TACSTD2 (TROP2),
CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-y, folate receptor-0
or folate
receptor-6), Mucin 1 (MUC-1), MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3,
Guanylyl
cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4
(TPBG), SLTRK6, SC-16, Tissue factor, LIV-1 (ZIP6), CGEN-15027, P-Cadherin,
Fibronectin Extra-domain B (ED-B), VEGFR2 (CD309), Tenascin, Collagen IV,
Periostin,
endothelin receptor, HER2, HER3, EGFR, IGFR-1, EGFRvIII, CD2, CD3, CD4, CDS,
CD6,
CD11, CD11a, CD15, CD18, CD19, CD20, CD22, CD26, CD27L, CD30, CD33, CD37,
CD38, CD40, CD44, CD56, CD70, CD74, CD79, CD79b, CD105, CD133, CD138, cripto,
CD38, an EphA receptor, an EphB receptor, EphA2, an integrin (e.g., integrin
yv03, yv05, or
yv06), a C242 antigen, Apo2, PSGR, NGEP, PSCA, TMEFF2, endoglin, PSMA, CD98,
CD56,
CanAg, and CALLA. In some embodiments, the liposome comprises a yPANTIFOL
according
to any of [1]-[11] of the Detailed Description Section. In some embodiments,
the liposome is
a Lp-yPANTIFOL according to any of [48]-[67] of the Detailed Description
Section.
[00385] In some embodiments, the liposome comprises a targeting moiety that
has specific
affinity for an epitope of an antigen selected from : CD137, PDL1, CTLA4,
CD47, KIR,
TNFRSF1OB (DR5), TIM3, PD1, cMet, Glycolipid F77, EGFRvIII, HLAA2 (NY-ESO-1),
LAG3, CD134 (0X40), HVEM, BTLA, TNFRSF25 (DR3), CD133, MAGE A3, PSCA,
MUC1, CD44v6, CD44v6/7, CD44v7/8, IL11Ra, ephA2, CAIX, MNCAIX, CSPG4, MUC16,
EPCAM (EGP2), TAG72, EGP40, ErbB receptor family, ErbB2 (HER2), ErbB3/4,
RAGE1,
GD3, FAR, LewisY, NCAM, HLAA1/MAGE1, MAGEA1, MAGEA3, MAGE-A4, B7H3,
WT1, MelanA (MARTI), HPV E6, HPV E7, thyroglobulin, tyrosinase, PS A, CLL1GD3,
Tn
Ag, FLT3, KIT, PR5521, CD24, PDGFR-beta, SSEA4, prostase, PAP, ELF2M, ephB2,
IGF1,
IGFII, IGFI receptor, LMP2, gp100, bcr-abl, Fucosyl GM1, sLe, GM3, TGS5,
folate receptor
beta, TEM1 (CD248), TEM7R, CLDN6, TSHR, GPRC5D, CXORF61, CD97, CD7a, HLE,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 213 -
CD179a, ALK, Plysialic acid, PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3,
PANX3, GPR20, LY6K, 0R51E2, TARP, LAGEla, legumain, E7, ETV6-AML, sperm
protein 17, XAGE1, Tie 2, MAD-CT1, MAD-CT2, Fos-related antigen 1, p53, p53
mutant,
prostein, survivin, telomerase, PCTA1 (Galectin 8), Ras mutant, hTERT, sarcoma
translocation breakpoints, ML-IAP, ERG (TMPRSS2 ETS fusion gene), NA17, PAX3,
Androgen receptor, Cyclin Bl, MYCN, RhoC, TRP2, CYP1B1, BORIS, SART3, PAX5, OY-
TES 1, LCK, AKAP4, SSX2, reverse transcriptase, RU1, RU2, intestinal carboxyl
esterase,
neutrophil elastase, mut hsp70-2, CD79a, CD79b, CD72, LAIR1, FCAR, LILRA2,
CD300LF,
CLEC12A, BS T2, EMR2, LY75, GPC3, FCRLS, IGLL1, TSP-180, MAGE4, MAGE5,
MAGE6, VEGFR1, IGF1R, hepatocyte growth factor receptor, p185ErbB2, p180ErbB-
3, nm-
23H1, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, beta-Catenin, CDK4, Muml, p15,
p16,
43-9F, 5T4, 791Tgp72, p-human chorionic gonadotropin, BCA225, BTAA, CA125,
CA15-3,
CA 27.29 (BCAA), CA195, CA242, CA-50, CAM43, CD68, CO-029, FGF5, G250, HTgp-
175, M344, MA50, MG7-Ag, MOV18, NB/70K, NY-001, RCAS1, SDCCAG16, M2BP,
TAAL6, TLP, and TPS, glioma-associated antigen, gamma-fetoprotein (AFP), p26
fragment
of AFP, lectin-reactive AFP, and TLR4. In some embodiments, the liposome
comprises a
yPANTIFOL according to any of [1]-[11] of the Detailed Description Section. In
some
embodiments, the liposome is a Lp-yPANTIFOL according to any of [48]-[67] of
the Detailed
Description Section.
[00386] In some embodiments, the liposome comprises a targeting moiety that
has specific
affinity for an epitope of an antigen selected from : PDGFRA, VEGFR1, VEGFR3,
neuropilin
1 (NRP1), neuropilin 2 (NRP2), betacellulin, PLGF, RET (rearranged during
transfection),
TIE1, TIE2 (TEK), CA125, CD3, CD4, CD7, CD10, CD13, CD25 CD32, CD32b, CD44
(e.g.,
CD44v6), CD47, CD49e (integrin gamma 5), CD54 (ICAM), CD55, CD64, CD74, CD80,
CD90, CD200, CD147, CD166, CD200, ESA, SHH, DHH, IHH, patched 1 (PTCH1),
smoothened (SMO), WNT1, WNT2B, WNT3A, WNT4, WNT4A, WNT5A, WNT5B,
WNT7B , WNT8A, WNT10A, WNT1OB , WNT16B , LKP5, LRP5, LRP6, FZD1, FZD2,
FZD4, FZD5, FZD6, FZD7, FZD8, Notch, Notchl, Notch3, Notch4, DLL4, Jagged,
Jaggedl,
Jagged2, Jagged3, TNFRSF1A (TNFR1, p55, p60), TNFRSF1B (TNFR2), TNFRSF6 (Fas,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 214 -
CD95), TNFRSF6B (DcR3), TNFRSF7 (CD27), TNFSF9 (41BB Ligand), TNFRSF8 (CD30),
TNFRSF10A (TRAILR1, DR4), TNFRSF11A (RANK), TNFRSF12 (TWEAKR),
TNFRSF19L (KELT), TNFRSF19 (TROY), TNFRSF21 (DR6), ILIRI, 1L1R2, IL2R, IL5R,
IL6R, 1L8R, ILlOR, IL12R, IL13R, IL15R, IL18R, IL19R, IL21R, IL23R, XAG1,
XAG3,
REGIV, FGFR1, FGFR2, FGFR3, ALK, ALK1, ALK7, ALCAM, Axl, TGFb, TGFb2,
TGFb3, TGFBR1, IGFIIR, BMPRI, N-cadherin, E-cadherin, VE-cadherin, ganglioside
GM2,
ganglioside GD3, PSGR, DCC, CDCP1, CXCR2, CXCR7, CCR3, CCR4, CCR5, CCR7,
CCR10, Claudinl, Claudin2, Claudin3, C1audin4, TMEFF2, neuregulin, MCSF, CSF,
CSFR
(fms), GCSF, GCSFR, BCAM, BRCA1, BRCA2, HLA-DR, ABCC3, ABCB5, HM 1.24,
LFA1, LYNX, S100A8, Si 00A9, SCF, Von Willebrand factor, Lewis Y6 receptor, CA
G250
(CA9), CRYPTO, VLA5, HLADR, MUC18, mucin CanAg, EGFL7, integrin avb3, integrin
y5f3 activin B1 gamma, leukotriene B4 receptor (LTB4R), neurotensin NT
receptor (NTR), 5T4
oncofetal antigen, Tenascin C, MMP, MMP2, MMP7, MMP9, MMP12, MMP14, MMP26,
cathepsin G, SULF1, SULF2, MET, CA9, TM4SF1, syndecan (SDC1), Ephrin B4, TEM1,
TGFbeta 1, and TGFBRII. In some embodiments, the liposome comprises a
yPANTIFOL
according to any of [1]-[11] of the Detailed Description Section. In some
embodiments, the
liposome is a Lp-yPANTIFOL according to any of [48]-[67] of the Detailed
Description
Section.
[00387] In some embodiments, the liposome comprises a targeting moiety that
has specific
affinity for an epitope of an antigen associated with a disorder of the immune
system (e.g., an
autoimmune disorder and an inflammatory disorder), or is associated with
regulating an
immune response. In some embodiments, the targeting moiety has specific
affinity for an
epitope of a cell surface antigen expressed on the surface of a macrophage
(expressing CD44).
[00388] In some embodiments, the liposome comprises a targeting moiety that
has specific
affinity for an epitope of an immunoinhibitory target. In another embodiment,
the AD is an
epitope of an immunoinhibitory target selected from: IL1Ra, IL6R, CD26L, CD28,
CD80,
FcGamma RIIB. In another embodiment, the AD in the Adapter is an epitope of an
immunostimulatory target selected from: CD25, CD28, CTLA4, PD1, B7H1 (PDL1),
B7H4
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 215 -
TGFbeta, TNFRSF4 (0X40), TNFRSF5 (CD40), TNPRSF9 (41BB, CD137), TNFRSF14
(HVEM), TNFRSF25 (DR3), and TNFRSF18 (GITR).
[00389] In some embodiments, the liposome comprises a targeting moiety that
has specific
affinity for an epitope of an antigen selected from: IL1Rb, C3AR, C5AR, CXCR1,
CXCR2,
CCR1, CCR3, CCR7, CCR8, CCR9, CCR10, ChemR23, MPL, GP130, TLR2, TLR3, TLR4,
TLR5, TLR7, TLR8, TLR9, TREM1, TREM2, CD49a (integrin gamma 1), integrin a5b3,
gamma4 integrin subunit, A4B7 integrin, cathepsin G, TNFRSF3 (LTBR), TNFRSF6
(Fas,
CD95), TNFRSF6B (DcR3), TNFRSF8 (CD30), TNFRSF11A (RANK), TNFRSF16 (NGFR),
TNFRSF19L (RELT), TNFRSF19 (TROY), TNFRSF21 (DR6), CD14, CD23, CD36, CD36L,
CD39, CD91, CD153, CD164, CD200, CD200R, B71 (CD80), B72 (CD86), B7h, B7DC
(PDL2), ICOS, ICOSL, MHC, CD, B7H2, B7H3, B7x, SLAM, KIM1, SLAMF2, SLAMF3,
SLAMF4, SLAMF5, SLAMF6, SLAMF7, TNFRSF1A (TNFR1, p55, p60), TNFRSF1B
(TNFR2), TNFRSF7 (CD27), TNFRSF12 (TWEAKR), TNFRSF5 (CD40), IL1R, IL2R,
IL4Ra, IL5R, IL6RIL15R, IL17R, IL17Rb, IL17RC, IL22RA, IL23R, TSLPR, B7RP1,
cKit,
GMCSF, GMCSFR, CD2, CD4, CD11a, CD18, CD30, CD40, CD86, CXCR3, CCR2, CCR4,
CCR5, CCR8, RhD, IgE, and Rh.
[00390] In additional embodiments, the disclosure provides a method for
treating cancer that
comprises administering an effective amount of a liposomal composition to a
subject having
or at risk of having a cancer that expresses folate receptor on its cell
surface, wherein the
liposomal composition comprises liposomes that comprise (a) gamma
polyglutamated
Antifolate (yPANTIFOL) and (b) a targeting moiety that has specific binding
affinity for a
folate receptor. In some embodiments, the targeting moiety has specific
binding affinity for
folate receptor alpha (FR-a), folate receptor beta (FR-13), and/or folate
receptor delta (FR-6).
In some embodiments, the targeting moiety has a specific binding affinity for
folate receptor
alpha (FR-a), folate receptor beta (FR-I3), and/or folate receptor delta (FR-
6). In some
embodiments, the targeting moiety has a specific binding affinity for folate
receptor alpha (FR-
a) and folate receptor beta (FR-I3). In some embodiments, the administered
liposomal
composition comprises pegylated liposomes (e.g., TPLp-7PANTlFOL). In some
embodiments, the administered liposomal composition comprises liposomes that
are not
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 216 -
pegylated. In some embodiments, liposomes of the administered liposomal
composition
comprises yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, y-glutamyl
groups. In some
embodiments, a liposome of the liposomal composition comprises a yPANTIFOL
containing
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, y-glutamyl groups in the D-
form. In some
embodiments, a liposome of the liposomal composition comprises L and D gamma
polyglutamated Antifolate. In some embodiments, a liposome of the liposomal
composition
comprises a yPANTIFOL containing 2, 3, 4, 5, or more than 5, y-glutamyl groups
in the L-
form, and 1, 2, 3, 4, 5 or more than 5, y-glutamyl groups in the D-form. In
some embodiments,
a liposome of the liposomal composition comprises tetraglutamated Antifolate.
In some
embodiments, a liposome of the liposomal composition comprises pentaglutamated
Antifolate.
In some embodiments, a liposome of the liposomal composition comprises
hexaglutamated
Antifolate.
[00391] In
some embodiments, liposomes of the administered liposomal composition comprise
gamma tetraglutamated Antifolate. In some embodiments, liposomes of the
administered
liposomal composition comprise gamma pentaglutamated Antifolate. In some
embodiments,
liposomes of the administered liposomal composition comprises gamma
hexaglutamated
Antifolate. In some embodiments, the liposomal composition is administered to
treat an
epithelial tissue malignancy. In
some embodiments, the liposomal composition is
administered to treat a cancer selected from: lung cancer, pancreatic, breast
cancer, ovarian
cancer, lung cancer, prostate cancer, head and neck cancer, gastric cancer,
gastrointestinal
cancer, colon cancer, esophageal cancer, cervical cancer, kidney cancer,
biliary duct cancer,
gallbladder cancer, and a hematologic malignancy. In some embodiments, the
liposomal
composition is administered to treat a cancer selected from: breast cancer,
advanced head and
neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma
(NHL),
acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell
lymphoma)
choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue
sarcoma
(desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous
system (CNS)
cancer. In some embodiments, the liposomal composition is administered to
treat lung cancer
(e.g., NSCLC or mesothelioma). In some embodiments, the liposomal composition
is
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 217 -
administered to treat breast cancer (e.g., HER2++ or triple negative breast
cancer). In some
embodiments, the liposomal composition is administered to treat colorectal
cancer. In some
embodiments, the liposomal composition is administered to treat ovarian
cancer. In some
embodiments, the liposomal composition is administered to treat endometrial
cancer. In some
embodiments, the liposomal composition is administered to treat pancreatic
cancer. In some
embodiments, the liposomal composition is administered to treat liver cancer.
In some
embodiments, the liposomal composition is administered to treat head and neck
cancer. In
some embodiments, the liposomal composition is administered to treat
osteosarcoma.
[00392] In some embodiments, the disclosure provides a method for treating
lung cancer (e.g.,
non-small lung cancer) that comprises administering an effective amount of a
delivery vehicle
(e.g., an antibody or liposome) comprising gamma polyglutamated Antifolate
(e.g., a
yPANTIFOL disclosed herein) to a subject having or at risk of having lung
cancer. In particular
embodiments, the, the cancer is non-small cell lung cancer. In some
embodiments, the delivery
vehicle is an antibody (e.g., a full-length IgG antibody, a bispecific
antibody, or a scFv). In
some embodiments, the delivery vehicle is a liposome (e.g., an Lp-yPANTIFOL
such as, PLp-
yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL, or TPLp-
yPANTIFOL). In some embodiments, the administered delivery vehicle is
pegylated. In some
embodiments, the administered delivery vehicle is not pegylated. In additional
embodiments,
the delivery vehicle comprises a targeting moiety on its surface that has
specific affinity for an
epitope on an antigen on the surface of a lung cancer (e.g., non-small cell
lung cancer) cell. In
further embodiments, the delivery vehicle comprises a targeting moiety that
has specific
affinity for an epitope on an antigen selected from Mucin 1, Nectin 4, NaPi2b,
CD56, EGFR,
and SC-16. In some embodiments, the targeting moiety is an antibody or a
fragment of an
antibody. In additional embodiments, the delivery vehicle is a liposome, and
the liposome
comprises a targeting moiety that has specific affinity for an epitope on an
antigen selected
from Mucin 1, Nectin 4, NaPi2b, CD56, EGFR, and SC-16. In further embodiments,
the
delivery vehicle is a pegylated liposome that comprises a targeting moiety
that has specific
affinity for an epitope on an antigen selected from: Mucin 1, Nectin 4,
NaPi2b, CD56, EGFR,
and SC-16. In some embodiments, the administered delivery vehicle comprises
yPANTIFOL
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 218 -
containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some
embodiments, the
administered delivery vehicle comprises gamma pentaglutamated Antifolate. In
other
embodiments, the administered delivery vehicle comprises gamma hexaglutamated
Antifolate.
In some embodiments, the administered delivery vehicle comprises L gamma
polyglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises
2, 3, 4, 5, or
more than 5, L-gamma glutamyl groups. In some embodiments, the administered
delivery
vehicle comprises D gamma polyglutamated Antifolate. In some embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, D-gamma
glutamyl groups.
In some embodiments, the administered delivery vehicle comprises L and D gamma
polyglutamated Antifolate. In some embodiments, the administered delivery
vehicle comprises
2, 3, 4, 5, or more than 5, L-gamma glutamyl groups and 2, 3, 4, 5, or more
than 5, D-gamma
glutamyl groups. In some embodiments, the administered delivery vehicle
comprises gamma
tetraglutamated Antifolate. In some embodiments, the administered delivery
vehicle comprises
gamma pentaglutamated Antifolate. In other embodiments, the administered
delivery vehicle
comprises gamma hexaglutamated Antifolate.
[00393] In some embodiments, the disclosure provides a method for treating
pancreatic cancer
that comprises administering an effective amount of a delivery vehicle (e.g.,
an antibody
(ADC) or liposome) comprising gamma polyglutamated Antifolate (e.g., a
yPANTIFOL
disclosed herein) to a subject having or at risk of having pancreatic cancer.
In some
embodiments, the delivery vehicle is an antibody (e.g., a full-length IgG
antibody, a bispecific
antibody, or a scFv). In some embodiments, the delivery vehicle is a liposome
(e.g., an Lp-
yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-
yPANTIFOL, or TPLp-yPANTIFOL). In some embodiments, the administered delivery
vehicle is pegylated. In some embodiments, the administered delivery vehicle
is not pegylated.
In additional embodiments, the delivery vehicle comprises a targeting moiety
on its surface
that has specific affinity for an epitope on an antigen on the surface of a
pancreatic cancer cell.
In further embodiments, the delivery vehicle comprises a targeting moiety that
has specific
affinity for an epitope on an antigen selected from TACSTD2 (TROP2), Mucin 1,
mesothelin,
Guanylyl cyclase C (GCC), SLC44A4, and Nectin 4. In further embodiments, the
delivery
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 219 -
vehicle is a liposome, and the liposome comprises a targeting moiety has
specific affinity for
an epitope on an antigen selected from TACSTD2 (TROP2), Mucin 1, Mesothelin,
Guanylyl
cyclase C (GCC), SLC44A4, and Nectin 4. In some embodiments, the administered
delivery
vehicle comprises yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, y-
glutamyl groups.
In some embodiments, the administered delivery vehicle comprises gamma
tetraglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises
gamma
pentaglutamated Antifolate. In other embodiments, the administered delivery
vehicle
comprises gamma hexaglutamated Antifolate. In some embodiments, the
administered
delivery vehicle comprises L gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups.
In some embodiments, the administered delivery vehicle comprises D gamma
polyglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises
2, 3, 4, 5, or
more than 5, D-gamma glutamyl groups. In some embodiments, the administered
delivery
vehicle comprises L and D gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups
and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups.
[00394] In additional embodiments, the disclosure provides a method for
treating breast cancer
(e.g., triple negative breast cancer (estrogen receptor-, progesterone
receptor-, and HER2)) that
comprises administering an effective amount of a delivery vehicle (e.g., an
antibody or
liposome) comprising gamma polyglutamated Antifolate (e.g., a yPANTIFOL
disclosed
herein) to a subject having or at risk of having breast cancer. In some
embodiments, the
administered delivery vehicle is a liposome that comprises gamma
polyglutamated Antifolate.
In some embodiments, the delivery vehicle is an antibody (e.g., a full-length
IgG antibody, a
bispecific antibody, or a scFv). In some embodiments, the delivery vehicle is
a liposome (e.g.,
an Lp-yPANTIFOL such as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL,
TLp-yPANTIFOL, or TPLp-yPANTIFOL). In some embodiments, the administered
delivery
vehicle is pegylated. In some embodiments, the administered delivery vehicle
is not pegylated.
In additional embodiments, the delivery vehicle comprises a targeting moiety
on its surface
that has specific affinity for an epitope on an antigen on the surface of a
breast cancer cell. In
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 220 -
further embodiments, the delivery vehicle comprises a targeting moiety that
has specific
affinity for an epitope on an antigen selected from: LIV-1 (ZIP6), EGFR, HER2,
HER3, Mucin
1, GONMB, and Nectin 4. In some embodiments, the targeting moiety is an
antibody or a
fragment of an antibody. In additional embodiments, the delivery vehicle is a
liposome, and
the liposome comprises a targeting moiety that has specific affinity for an
epitope on an antigen
selected from: LIV-1 (ZIP6), EGFR, HER2, HER3, Mucin 1, GONMB, and Nectin 4.
In some
embodiments, the administered delivery vehicle comprises yPANTIFOL containing
4, 5, 2-10,
4-6, or more than 5, y-glutamyl groups. In some embodiments, the administered
delivery
vehicle comprises gamma tetraglutamated Antifolate. In some embodiments, the
administered
delivery vehicle comprises gamma pentaglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises gamma hexaglutamated Antifolate. In
some
embodiments, the administered delivery vehicle comprises L gamma
polyglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises
2, 3, 4, 5, or
more than 5, L-gamma glutamyl groups. In some embodiments, the administered
delivery
vehicle comprises D gamma polyglutamated Antifolate. In some embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, D-gamma
glutamyl groups.
In some embodiments, the administered delivery vehicle comprises L and D gamma
polyglutamated Antifolate. In some embodiments, the administered delivery
vehicle comprises
2, 3, 4, 5, or more than 5, L-gamma glutamyl groups and 2, 3, 4, 5, or more
than 5, D-gamma
glutamyl groups.
[00395] In some embodiments, the disclosure provides a method for treating
a hematological
cancer that comprises administering an effective amount of a delivery vehicle
(e.g., an antibody
or liposome) comprising gamma polyglutamated Antifolate (e.g., a yPANTIFOL
disclosed
herein) to a subject having or at risk of having a hematological cancer. In
some embodiments,
the delivery vehicle is an antibody (e.g., a full-length IgG antibody, a
bispecific antibody, or a
scFv). In some embodiments, the delivery vehicle is a liposome (e.g., an Lp-
TPANTIFOL such
as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL, or
TPLp-yPANTIFOL). In some embodiments, the administered delivery vehicle is
pegylated. In
some embodiments, the administered delivery vehicle is not pegylated. In
additional
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 221 -
embodiments, the delivery vehicle comprises a targeting moiety on its surface
that has specific
affinity for an epitope on an antigen on the surface of a hematological cancer
cell. In further
embodiments, the delivery vehicle comprises a targeting moiety that has
specific affinity for
an epitope on an antigen selected from: CD30, CD79b, CD19, CD138, CD74, CD37,
CD19,
CD22, CD33, CD34, and CD98. In further embodiments, the delivery vehicle is a
liposome,
and the liposome comprises a targeting moiety has specific affinity for an
epitope on an antigen
selected from: CD30, CD79b, CD19, CD138, CD74, CD37, CD19, CD22, CD33, CD34,
and
CD98. In some embodiments, the administered delivery vehicle comprises
yPANTIFOL
containing 4, 5, 2-10, 4-6, or more than 5, -y-glutamyl groups. In some
embodiments, the
administered delivery vehicle comprises gamma tetraglutamated Antifolate. In
some
embodiments, the administered delivery vehicle comprises gamma pentaglutamated
Antifolate. In other embodiments, the administered delivery vehicle comprises
gamma
hexaglutamated Antifolate. In some embodiments, the administered delivery
vehicle
comprises L gamma polyglutamated Antifolate. In some embodiments, the
administered
delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl
groups. In some
embodiments, the administered delivery vehicle comprises D gamma
polyglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises
2, 3, 4, 5, or
more than 5, D-gamma glutamyl groups. In some embodiments, the administered
delivery
vehicle comprises L and D gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups
and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups.
[00396] In some embodiments, the disclosure provides a method for treating
a subject having
or at risk of having a cancer that is distinguishable by the expression of an
antigen on its cell
surface. Thus, in some embodiments, the disclosure provides a method for
treating cancer that
comprises administering to a subject having or at risk of having a cancer, an
effective amount
of a delivery vehicle (e.g., an antibody or liposome) comprising a targeting
moiety that has
specific affinity for an epitope on a surface antigen of the cancer and gamma
polyglutamated
Antifolate (e.g., a yPANTIFOL disclosed herein). In some embodiments, the
administered
delivery vehicle comprises a yPANTIFOL according to any of [1]-[11] of the
Detailed
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 222 -
Description Section. In some embodiments, the administered delivery vehicle
comprises a
polyglutamated Antifolate described in Section I. In some embodiments, the
administered
delivery vehicle is a liposome according to any of [12]-[67] of the Detailed
Description
Section. In some embodiments, the administered delivery vehicle is pegylated.
In some
embodiments, the targeting moiety is an antibody or a fragment of an antibody.
In additional
embodiments, the delivery vehicle is a liposome. In some embodiments, the
administered
delivery vehicle comprises yPANTIFOL consisting of 4, 5, 2-10, 4-6, or more
than 5, y-
glutamyl groups. In some embodiments, the administered delivery vehicle
comprises gamma
tetraglutamated Antifolate. In some embodiments, the administered delivery
vehicle comprises
gamma pentaglutamated Antifolate. In other embodiments, the administered
delivery vehicle
comprises gamma hexaglutamated Antifolate. In some embodiments, the
administered
delivery vehicle comprises L gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups.
In some embodiments, the administered delivery vehicle comprises D gamma
polyglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises
2, 3, 4, 5, or
more than 5, D-gamma glutamyl groups. In some embodiments, the administered
delivery
vehicle comprises L and D gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups
and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups.
[00397] In some embodiments, the disclosed compositions (e.g., liposomes
containing gamma
polyglutamated Antifolate) are administered to subjects having or at risk of
having a cancer, a
solid tumor, and/or a metastasis that is distinguishable by the expression of
a tumor specific
antigen or tumor associated antigen on its cell surface. Thus, in some
embodiments, the
disclosure provides a method for treating cancer that comprises administering
an effective
amount of a delivery vehicle (e.g., liposome) comprising a targeting moiety
and gamma
polyglutamated Antifolate (e.g., a yPANTIFOL disclosed herein) to a subject
having or at risk
of having a cancer, solid tumor, and/or metastasis that is distinguishable by
the expression of
a tumor specific antigen or tumor associated antigen on its cell surface
cancer, and wherein the
targeting moiety has specific binding affinity for an epitope on an tumor
specific antigen or
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 223 -
tumor associated antigen. In some embodiments, the administered delivery
vehicle is a
liposome. In further embodiments, the liposome is pegylated. In additional
embodiments, the
delivery vehicle comprises a targeting moiety that has specific affinity for
an epitope on a cell
surface antigen expressed on the surface of a cancer, a solid tumor, and/or a
metastatic cell.
e.g., folate receptor-a, folate receptor-0 or folate receptor-6), Mucin 1 (MUC-
1), MUC-6,
STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4,
NaPi2b, CD70
(TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor,
LIV-1
(Z1P6), CGEN-15027, P Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2
(CD309),
Tenascin, Collagen IV, Periostin, endothelin receptor, HER2, HER3, ErbB4,
EGFR,
EGFRvIII, FGFR1, FGFR2, FGFR3, FGFR4, FGFR6, IGFR-1, FZD1, FZD2, FZD3, FZD4,
FZD5, FZD6, FZD7, FZD8, FZD9, FZD10, SMO, CD2, CD3, CD4, CD5, CD6, CD8, CD11,
CD11a, CD15, CD18, CD19, CD20, CD22, CD26, CD27L, CD28, CD30, CD33, CD34,
CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79, CD79b, CD98, CD105, CD133,
CD138, cripto, IGF-1R, IGF-2R, EphAl an EphA receptor, an EphB receptor,
EphAl, EphA2,
EphA3, EphA4, EphA5, EphA6, EphA7, EphA8, EphB1, EphB2, EphB3, EphB4, EphB6,
an
integrin (e.g., integrin av03, av05, or av06), a C242 antigen, Apo2, PSGR,
NGEP, PSCA,
TMEFF2, endoglin, PSMA, CanAg, CALLA, c-Met, VEGFR-1, VEGFR-2, DDR1, PDGFR
alpha., PDGFR beta, TrkA, TrkB, TrkC, UFO, LTK, ALK, Tiel, Tie2, PTK7, Ryk,
TCR,
NMDAR, LNGFR, and MuSK. In some embodiments, the delivery vehicle comprises a
targeting moiety that has specific affinity for an epitope on a cell surface
antigen(s) derived
from, or determined to be expressed on, a specific subject's cancer (tumor)
such as a
neoantigen. In some embodiments, the administered delivery vehicle comprises
yPANTIFOL
containing 4, 5, 2-10, 4-6, or more than 5, y-glutamyl groups. In some
embodiments, the
delivery vehicle comprises a yPANTIFOL containing 2, 3, 4, 5, 6, 7, 8, 9, 10,
or more than 10,
y-glutamyl groups in the L-form. In some embodiments, the delivery vehicle
comprises a
yPANTIFOL containing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, y-
glutamyl groups in the
L-form. In some embodiments, the delivery vehicle comprises D gamma
polyglutamated
Antifolate. In some embodiments, the delivery vehicle comprises a yPANTIFOL
containing 1,
2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10, y-glutamyl groups in the D-form.
In some
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 224 -
embodiments, the delivery vehicle comprises L and D gamma polyglutamated
Antifolate. In
some embodiments, the delivery vehicle comprises a yPANTIFOL containing 2, 3,
4, 5, or
more than 5, y-glutamyl groups in the L-form, and 1, 2, 3, 4, 5 or more than
5, y-glutamyl
groups in the D-form. In some embodiments, the administered delivery vehicle
comprises
gamma tetraglutamated Antifolate. In some embodiments, the administered
delivery vehicle
comprises gamma pentaglutamated Antifolate. In other embodiments, the
administered
delivery vehicle comprises gamma hexaglutamated Antifolate.
[00398] In additional embodiments, the targeting moiety has specific
affinity for an epitope on
an antigen selected from: GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate
receptor (e.g., folate receptor-a, folate receptor-I3 or folate receptor-6),
Mucin 1 (MUC-1),
MUC-6, STEAP1, mesothelin, Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4,
NaPi2b, CD70 (TNFSF7), CA9 (Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16,
Tissue
factor, LIV-1 (ZIP6), CGEN-15027, P-Cadherin, Fibronectin Extra-domain B (ED-
B),
VEGFR2 (CD309), Tenascin, Collagen IV, Periostin, endothelin receptor, HER2,
HER3,
EGFR, IGFR-1, EGFRvIII, CD2, CD3, CD4, CD5, CD6, CD11, CD1 1 a, CD15, CD18,
CD19,
CD20, CD22, CD26, CD27L, CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70,
CD74, CD79, CD79b, CD105, CD133, CD138, cripto, CD38, an EphA receptor, an
EphB
receptor, EphA2, an integrin (e.g., integrin avI33, av135, or avI36), a C242
antigen, Apo2, PSGR,
NGEP, PSCA, TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA.
[00399] In further embodiments, the delivery vehicle is a liposome, and the
liposome
comprises a targeting moiety that specifically binds a cell surface antigen
selected from:
GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate
receptor-
a, folate receptor-f3 or folate receptor-6), Mucin 1 (MUC-1), MUC-6, STEAP1,
mesothelin,
Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9
(Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor, LIV-1 (ZIP6),
CGEN-
15027, P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2 (CD309),
Tenascin,
Collagen IV, Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-1,
EGFRvIII, CD2,
CD3, CD4, CD5, CD6, CD11, CD11a, CD15, CD18, CD19, CD20, CD22, CD26, CD27L,
CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79, CD79b,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 225 -
CD105, CD133, CD138, cripto, CD38, an EphA receptor, an EphB receptor, EphA2,
an
integrin (e.g., integrin av133, avf35, or av[36), a C242 antigen, Apo2, PSGR,
NGEP, PSCA,
TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some embodiments, the
administered delivery vehicle comprises yPANTIFOL containing 4, 5, 2-10, 4-6,
or more than
5, glutamyl groups. In some embodiments, the liposome comprises gamma
pentaglutamated
Antifolate. In other embodiments, the liposome comprises gamma hexaglutamated
Antifolate.
In some embodiments, the liposome comprises a yPANTIFOL according to any of
[1]-[11] of
the Detailed Description Section. In some embodiments, the liposome is a Lp-
TPANTIFOL
according to any of [48]-[67] of the Detailed Description Section.In some
embodiments, the a
liposome comprises L gamma polyglutamated Antifolate. In some embodiments, the
liposome
comprises L gamma polyglutamated Antifolate. In some embodiments, the
administered
delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl
groups. In some
embodiments, the liposome comprises D gamma polyglutamated Antifolate. In some
embodiments, the liposome comprises 2, 3, 4, 5, or more than 5, D-gamma
glutamyl groups.
In some embodiments, the liposome comprises L and D gamma polyglutamated
Antifolate. In
some embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or
more than 5, L-
gamma glutamyl groups and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups.
[00400] In further embodiments, the disclosure provides a method for
treating cancer that
comprises administering an effective amount of a delivery vehicle (e.g., an
antibody or
liposome) comprising a targeting moiety on its surface that specifically binds
a folate receptor,
and a gamma polyglutamated Antifolate (e.g., a yPANTIFOL disclosed herein) to
a subject
having or at risk of having a cancer that contains cells expressing the folate
receptor on their
cell surface. In some embodiments, the targeting moiety is an antibody, or an
antigen binding
fragment of an antibody. In further embodiments, the targeting moiety has
specific affinity for
folate receptor alpha, folate receptor beta or folate receptor delta. As
disclosed herein, the folate
receptor targeted pegylated liposomes containing gamma polyglutamated
Antifolate are able
to deliver high quantities of gamma polyglutamated Antifolate to cancer cells
and particularly
cancer cells that express folate receptors, compared to normal cells (i.e.,
cells that unlike cancer
cells do not actively take up liposomes, and/or do not express folate
receptors). Any cancers
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 226 -
that express folate receptors may be treated according to the disclosed
methods. It should be
noted that some cancers may express folate receptors in an early stage while
the majority of
cancers may express folate receptors at late stages. In some embodiments, the
administered
delivery vehicle is a lipo some. In further embodiments, the liposome is
pegylated. In some
embodiments, the administered delivery vehicle comprises yPANTIFOL containing
4, 5, 2-10,
4-6, or more than 5, glutamyl groups. In some embodiments, the administered
delivery vehicle
comprises gamma pentaglutamated Antifolate. In other embodiments, the
administered
delivery vehicle comprises gamma hexaglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises L gamma polyglutamated Antifolate. In
some
embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or more
than 5, L-gamma
glutamyl groups. In some embodiments, the administered delivery vehicle
comprises D gamma
polyglutamated Antifolate. In some embodiments, the administered delivery
vehicle comprises
2, 3, 4, 5, or more than 5, D-gamma glutamyl groups. In some embodiments, the
administered
delivery vehicle comprises L and D gamma polyglutamated Antifolate. In some
embodiments,
the administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-
gamma glutamyl
groups and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups.
[00401] In additional embodiments, the disclosure provides a method for
cancer maintenance
therapy that comprises administering an effective amount of a liposomal
composition
comprising liposomes that contain gamma polyglutamated Antifolate (e.g., a
yPANTIFOL
disclosed herein) to a subject that is undergoing or has undergone cancer
therapy. In some
embodiments, the administered liposomal composition is a PLp-yPANTIFOL, NTLp-
yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL or TPLp-yPANTIFOL. In some
embodiments, the administered liposomal composition comprises pegylated
liposomes (e.g.,
PLp-yPANTIFOL, NTPLp-yPANTIFOL, or TPLp-yPANTIFOL). In some embodiments, the
administered liposomal composition comprises a targeting moiety that has
specific affinity for
an epitope on a surface antigen of a cancer cell (e.g., TLp-yPANTIFOL or TPLp-
yPANTIFOL). In some embodiments, the administered liposomal composition
comprises
liposomes that are pegylated and comprise a targeting moiety (e.g., TPLp-
yPANTIFOL). In
some embodiments, the administered liposomal composition comprises liposomes
that are
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 227 -
targeted and liposomes that do not comprise a targeting moiety (e.g., are not
targeted). In some
embodiments, the administered liposomal composition comprises liposomes that
are pegylated
and liposomes that are not pegylated. In some embodiments, liposomes of the
administered
liposomal composition comprise gamma polyglutamated Antifolate that contains
4, 5, 2-10,
4-6, or more than 5, y-glutamyl groups. In some embodiments, the administered
liposomal
composition comprises gamma tetraglutamated Antifolate. In some embodiments,
the
administered liposomal composition comprises gamma pentaglutamated Antifolate.
In other
embodiments, the administered liposomal composition comprises gamma
hexaglutamated
Antifolate. In some embodiments, the administered liposomal composition
comprises L
gamma polyglutamated Antifolate. In some embodiments, the administered
liposomal
composition comprises L gamma polyglutamated Antifolate. In some embodiments,
the
administered liposomal composition comprises 2, 3, 4, 5, or more than 5, L-
gamma glutamyl
groups. In some embodiments, the administered liposomal composition comprises
D gamma
polyglutamated Antifolate. In some embodiments, the administered liposomal
composition
comprises 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups. In some
embodiments, the
administered liposomal composition comprises L and D gamma polyglutamated
Antifolate. In
some embodiments, the administered liposomal composition comprises 2, 3, 4, 5,
or more than
5, L-gamma glutamyl groups. In some embodiments, the administered liposomal
composition
comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups and 2, 3, 4, 5,
or more than 5,
D-gamma glutamyl groups.
[00402] In some embodiments, the cancer treated by one or more of the
methods disclosed
herein is a solid tumor lymphoma. Examples of solid tumor lymphoma include
Hodgkin's
lymphoma, Non-Hodgkin's lymphoma, and B cell lymphoma.
[00403] In some embodiments, the cancer treated by one or more of the
methods disclosed
herein is bone cancer, brain cancer, breast cancer, colorectal cancer,
connective tissue cancer,
cancer of the digestive system, endometrial cancer, esophageal cancer, eye
cancer, cancer of
the head and neck, gastric cancer, intra-epithelial neoplasm, melanoma
neuroblastoma,
Non-Hodgkin's lymphoma, non-small cell lung cancer, prostate cancer,
retinoblastoma, or
rhabdomyosarcoma.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 228 -
[00404] In
some embodiments, the disclosure provides a method for treating cancer that
comprises administering an effective amount of a composition comprising a
delivery vehicle
and a gamma polyglutamated Antifolate to a subject having or at risk of having
cancer. In some
embodiments, the administered composition comprises a pegylated delivery
vehicle. In some
embodiments, the administered composition comprises a targeting moiety that
has a specific
affinity for an epitope of antigen on the surface of a target cell of interest
such as a cancer cell.
In some embodiments, the delivery vehicle comprises an antibody or an antigen
binding
antibody fragment. In some embodiments, the composition is administered to
treat a cancer
selected from: lung cancer, pancreatic cancer, breast cancer, ovarian cancer,
prostate cancer,
head and neck cancer, gastric cancer, gastrointestinal cancer, colorectal
cancer, esophageal
cancer, cervical cancer, liver cancer, kidney cancer, biliary duct cancer,
gallbladder cancer,
bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central nervous
system cancer,
melanoma, myeloma, a leukemia and a lymphoma. In some embodiments, the
composition is
administered to treat a cancer selected from: breast cancer, advanced head and
neck cancer,
lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute
lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma)
choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft tissue
sarcoma
(desmoid tumors, aggressive fibromatosis), bladder cancer, and central nervous
system (CNS)
cancer. In some embodiments, the cancer is lung cancer (e.g., NSCLC or
mesothelioma). In
some embodiments, the cancer is breast cancer (e.g., HER2++ or triple negative
breast cancer).
In some embodiments, the cancer is colorectal cancer. In some embodiments, the
cancer is
ovarian cancer. In some embodiments, the cancer is endometrial cancer. In some
embodiments,
the cancer is pancreatic cancer. In some embodiments, the cancer is liver
cancer. In some
embodiments, the cancer is head and neck cancer. In some embodiments, the
cancer is
osteosarcoma.
[00405] In
some embodiments, the administered composition contains 4, 5, 2-10, 4-6, or
more
than 5, glutamyl groups. In some embodiments, the administered delivery
vehicle comprises
yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some
embodiments, the administered delivery vehicle comprises gamma tetraglutamated
Antifolate.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 229 -
In some embodiments, the administered delivery vehicle comprises gamma
pentaglutamated
Antifolate. In other embodiments, the administered delivery vehicle comprises
gamma
hexaglutamated Antifolate. In some embodiments, the administered delivery
vehicle
comprises L gamma polyglutamated Antifolate. In some embodiments, the
administered
delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl
groups. In some
embodiments, the administered delivery vehicle comprises D gamma
polyglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises
2, 3, 4, 5, or
more than 5, D-gamma glutamyl groups. In some embodiments, the administered
delivery
vehicle comprises L and D gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups
and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups. In some embodiments,
the
administered delivery vehicle is an immunoconjugate. In some embodiments, the
administered
delivery vehicle comprises a gamma polyglutamated Antifolate according to any
of [1]-[ l I] of
the Detailed Description Section. In some embodiments, the administered
delivery vehicle
comprises a polyglutamate of an Antifolate disclosed in Section I, herein. In
some
embodiments, the administered delivery vehicle is a liposome. In some
embodiments, the
administered delivery vehicle is a liposome according to any of [12]-[67] of
the Detailed
Description Section.
[00406] In additional embodiments, the disclosure provides a method for
treating cancer
that comprises administering an effective amount of a liposomal composition
comprising
liposomes that contain gamma polyglutamated Antifolate (e.g., Lp-yPANTIFOL,
PLp-
yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL or TPLp-
yPANTIFOL) to a subject having or at risk of having cancer. In some
embodiments, the
liposomal composition comprises a gamma polyglutamated Antifolate according to
any of
[l]411] of the Detailed Description Section. In some embodiments, the
liposomal
composition comprises a polyglutamate of an Antifolate disclosed in Section I,
herein. In
some embodiments, the liposomal composition comprises a liposome according to
any of
[12]-[67] of the Detailed Description Section. In some embodiments, the
liposomal
composition is administered to treat a cancer selected from: lung cancer,
pancreatic cancer,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 230 -
breast cancer, ovarian cancer, prostate cancer, head and neck cancer, gastric
cancer,
gastrointestinal cancer, colorectal cancer, esophageal cancer, cervical
cancer, liver cancer,
kidney cancer, biliary duct cancer, gallbladder cancer, bladder cancer,
sarcoma (e.g.,
osteosarcoma), brain cancer, central nervous system cancer, melanoma, myeloma,
a leukemia
and a lymphoma. In some embodiments, the liposomal composition is administered
to treat
lung cancer (e.g., NSCLC or mesothelioma). In some embodiments, the liposomal
composition is administered to treat breast cancer (e.g., HER2++ or triple
negative breast
cancer). In some embodiments, the liposomal composition is administered to
treat colorectal
cancer. In some embodiments, the liposomal composition is administered to
treat ovarian
cancer. In some embodiments, the liposomal composition is administered to
treat endometrial
cancer. In some embodiments, the liposomal composition is administered to
treat pancreatic
cancer. In some embodiments, the liposomal composition is administered to
treat liver cancer.
In some embodiments, the liposomal composition is administered to treat head
and neck
cancer. In some embodiments, the liposomal composition is administered to
treat
osteosarcoma. In some embodiments, the administered liposomal composition
comprises
pegylated liposomes (e.g., PLp-yPANTIFOL, NTPLp-yPANTIFOL, or TPLp-yPANTIFOL).
In some embodiments, liposomes of the administered liposomal composition
comprise a
yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some
embodiments, liposomes of the administered liposomal composition comprise a
gamma
tetraglutamated Antifolate. In some embodiments, liposomes of the administered
liposomal
composition comprise a gamma pentaglutamated Antifolate. In other embodiments,
liposomes of the administered liposomal composition comprises a gamma
hexaglutamated
Antifolate.
[00407] In additional embodiments, the disclosure provides a method for
treating cancer
that comprises administering an effective amount of a liposomal composition
that comprises
targeted liposomes (e.g., TLp-yPANTIFOL or TPLp-yPANTIFOL) to a subject having
or at
risk of having cancer, wherein the liposomal composition comprises liposomes
that comprise
a gamma polyglutamated Antifolate (Lp-yPANTIFOL) and further comprise a
targeting
moiety having a specific affinity for a surface antigen (epitope) on the
cancer. In some
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 231 -
embodiments, the liposomal composition comprises a gamma polyglutamated
Antifolate
according to any of [1]-[11] of the Detailed Description Section. In some
embodiments, the
liposomal composition comprises a polyglutamate of an Antifolate disclosed in
Section I,
herein. In some embodiments, the liposomal composition comprises a liposome
according to
any of [12]-[67] of the Detailed Description Section. In additional
embodiments, the
disclosure provides a method for treating cancer that comprises administering
an effective
amount of a liposomal composition comprising liposomes that contain gamma
polyglutamated Antifolate (e.g., Lp-yPANTIFOL, PLp-yPANTIFOL, NTLp-yPANTIFOL,
NTPLp-yPANTIFOL, TLp-7PANTIFOL or TPLp-yPANTIFOL) to a subject having or at
risk
of having cancer. In some embodiments, the liposomal composition is
administered to treat a
cancer selected from: lung cancer, pancreatic cancer, breast cancer, ovarian
cancer, prostate
cancer, head and neck cancer, gastric cancer, gastrointestinal cancer,
colorectal cancer,
esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct
cancer,
gallbladder cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain
cancer, central
nervous system cancer, melanoma, myeloma, a leukemia and a lymphoma. In some
embodiments, the liposomal composition is administered to treat a cancer
selected from:
breast cancer, advanced head and neck cancer, lung cancer, stomach cancer,
osteosarcoma,
Non-Hodgkin's lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis
fungoides
(cutaneous T-cell lymphoma) choriocarcinoma, chorioadenoma, nonleukemic
meningeal
cancer, soft tissue sarcoma (desmoid tumors, aggressive fibromatosis), bladder
cancer, and
central nervous system (CNS) cancer. In some embodiments, the liposomal
composition is
administered to treat lung cancer (e.g., NSCLC or mesothelioma). In some
embodiments, the
liposomal composition is administered to treat breast cancer (e.g., HER2++ or
triple negative
breast cancer). In some embodiments, the liposomal composition is administered
to treat
colorectal cancer. In some embodiments, the liposomal composition is
administered to treat
ovarian cancer. In some embodiments, the liposomal composition is administered
to treat
endometrial cancer. In some embodiments, the liposomal composition is
administered to treat
pancreatic cancer. In some embodiments, the liposomal composition is
administered to treat
liver cancer. In some embodiments, the liposomal composition is administered
to treat head
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 232 -
and neck cancer. In some embodiments, the liposomal composition is
administered to treat
osteosarcoma.
[00408] In some embodiments, the administered liposomal composition
comprises pegylated
liposomes (e.g., PLp-yPANTIFOL, NTPLp-yPANTIFOL, or TPLp-yPANTIFOL). In some
embodiments, liposomes of the administered liposomal composition comprise a
yPANTIFOL
containing 4, 5, 2-10, 4-6, or more than 5, glutamyl groups. In some
embodiments, the
administered liposomal composition comprises gamma tetraglutamated Antifolate.
In some
embodiments, liposomes of the administered liposomal composition comprises
gamma
pentaglutamated Antifolate. In other embodiments, liposomes of the
administered liposomal
composition comprises gamma hexaglutamated Antifolate. In some embodiments,
the
administered liposomal composition comprises L gamma polyglutamated
Antifolate. In some
embodiments, the administered liposomal composition comprises 2, 3, 4, 5, or
more than 5, L-
gamma glutamyl groups. In some embodiments, the administered liposomal
composition
comprises D gamma polyglutamated Antifolate. In some embodiments, the
administered
liposomal composition comprises 2, 3, 4, 5, or more than 5, D-gamma glutamyl
groups. In
some embodiments, the administered liposomal composition comprises L and D
gamma
polyglutamated Antifolate. In some embodiments, the administered liposomal
composition
comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups and 2, 3, 4, 5,
or more than 5,
D-gamma glutamyl groups.
[00409] In additional embodiments, the disclosure provides a method for
treating cancer that
comprises administering an effective amount of a liposomal composition that
comprises
targeted liposomes (e.g., TLp-yPANTIFOL or TPLp-yPANTIFOL) to a subject having
or at
risk of having cancer, wherein the liposomal composition comprises liposomes
that comprise
gamma polyglutamated Antifolate (Lp-yPANTIFOL) and further comprise a
targeting moiety
having a specific affinity for a surface antigen (epitope) on the cancer. In
some embodiments,
the liposomal composition comprises a gamma polyglutamated Antifolate
according to any of
[11411] of the Detailed Description Section. In some embodiments, the
yPANTIFOL is a
polyglutamate of an Antifolate disclosed in Section I, herein. In some
embodiments, the
liposomal composition comprises a liposome according to any of [481467] of the
Detailed
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 233 -
Description Section. In some embodiments, the liposomal composition is
administered to treat
a cancer selected from: lung cancer, pancreatic cancer, breast cancer, ovarian
cancer, prostate
cancer, head and neck cancer, gastric cancer, gastrointestinal cancer,
colorectal cancer,
esophageal cancer, cervical cancer, liver cancer, kidney cancer, biliary duct
cancer, gallbladder
cancer, bladder cancer, sarcoma (e.g., osteosarcoma), brain cancer, central
nervous system
cancer, melanoma, myeloma, a leukemia and a lymphoma. In some embodiments, the
liposomal composition is administered to treat a cancer selected from: breast
cancer, advanced
head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-Hodgkin's
lymphoma
(NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides (cutaneous T-cell
lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft
tissue
sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central
nervous
system (CNS) cancer. In some embodiments, the liposomal composition is
administered to
treat lung cancer (e.g., NSCLC or mesothelioma). In some embodiments, the
liposomal
composition is administered to treat breast cancer (e.g., HER2++ or triple
negative breast
cancer). In some embodiments, the liposomal composition is administered to
treat colorectal
cancer. In some embodiments, the liposomal composition is administered to
treat ovarian
cancer. In some embodiments, the liposomal composition is administered to
treat endometrial
cancer. In some embodiments, the liposomal composition is administered to
treat pancreatic
cancer. In some embodiments, the liposomal composition is administered to
treat liver cancer.
In some embodiments, the liposomal composition is administered to treat head
and neck
cancer. In some embodiments, the liposomal composition is administered to
treat
osteosarcoma. In some embodiments, the administered liposomal composition
comprises
pegylated liposomes (e.g., PLp-yPANTIFOL, NTPLp-yPANTIFOL, or TPLp-yPANTIFOL).
In some embodiments, liposomes of the administered liposomal composition
comprise a
yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, y-glutamyl groups. In
some
embodiments, liposomes of the administered liposomal composition comprise
gamma
tetraglutamated Antifolate. In some embodiments, liposomes of the administered
liposomal
composition comprise gamma pentaglutamated Antifolate. In other embodiments,
the
liposomes of the administered liposomal composition comprise gamma
hexaglutamated
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 234 -
Antifolate. In some embodiments, the administered liposomal composition
comprises L
gamma polyglutamated Antifolate. In some embodiments, the administered
liposomal
composition comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups. In
some
embodiments, the administered liposomal composition comprises D gamma
polyglutamated
Antifolate. In some embodiments, the administered liposomal composition
comprises 2, 3, 4,
5, or more than 5, D-gamma glutamyl groups. In some embodiments, the
administered
liposomal composition comprises L and D gamma polyglutamated Antifolate. In
some
embodiments, the administered liposomal composition comprises 2, 3, 4, 5, or
more than 5, L-
gamma glutamyl groups and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups.
[00410] In further embodiments, the disclosure provides a method for
treating cancer that
comprises administering an effective amount of a liposomal composition that
contains targeted
liposomes (e.g., TLp-yPANTIFOL or TPLp-yPANTIFOL) to a subject having or at
risk of
having a cancer that expresses folate receptor on its cell surface, wherein
the liposomal
composition comprises liposomes that comprise (a) gamma polyglutamated
Antifolate
(yPANTIFOL) and (b) a targeting moiety that has specific binding affinity for
the folate
receptor. In some embodiments, the administered liposomal composition
comprises pegylated
liposomes (e.g., TPLp-yPANTIFOL). In some embodiments, the liposomal
composition
comprises a gamma polyglutamated Antifolate according to any of [1]-[11] of
the Detailed
Description Section. In some embodiments, the polyglutamated Antifolate is a
polyglutamate
of an Antifolate disclosed in Section I, herein. In some embodiments, the
liposomal
composition comprises a liposome according to any of [48]-[67] of the Detailed
Description
Section. In some embodiments, the targeting moiety has a specific binding
affinity for folate
receptor alpha (FR-a), folate receptor beta (FR-0), and/or folate receptor
delta (FR-6). In some
embodiments, the targeting moiety has a specific binding affinity for folate
receptor alpha (FR-
a), folate receptor beta (FR-I3), and/or folate receptor delta (FR-6). In some
embodiments, the
targeting moiety has a specific binding affinity for folate receptor alpha (FR-
a) and folate
receptor beta (FR-I3). In some embodiments, the liposomal composition is
administered to treat
a cancer selected from: lung cancer, pancreatic, breast cancer, ovarian
cancer, lung cancer,
prostate cancer, head and neck cancer, gastric cancer, gastrointestinal
cancer, colon cancer,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 235 -
esophageal cancer, cervical cancer, kidney cancer, biliary duct cancer,
gallbladder cancer, and
a hematologic malignancy. In some embodiments, the liposomal composition is
administered
to treat a cancer selected from: breast cancer, advanced head and neck cancer,
lung cancer,
stomach cancer, osteosarcoma, Non-Hodgkin's lymphoma (NHL), acute
lymphoblastic
leukemia (ALL), mycosis fungoides (cutaneous T-cell lymphoma) choriocarcinoma,
chorioadenoma, nonleukemic meningeal cancer, soft tissue sarcoma (desmoid
tumors,
aggressive fibromatosis), bladder cancer, and central nervous system (CNS)
cancer. In some
embodiments, the liposomal composition is administered to treat lung cancer
(e.g., NSCLC or
mesothelioma). In some embodiments, the liposomal composition is administered
to treat
breast cancer (e.g., HER2++ or triple negative breast cancer),In some
embodiments, the
composition is administered to treat colorectal cancer. In some embodiments,
the composition
is administered to treat ovarian cancer. In some embodiments, the composition
is administered
to treat endometrial cancer. In some embodiments, the composition is
administered to treat
pancreatic cancer. In some embodiments, the composition is administered to
treat liver cancer.
In some embodiments, the composition is administered to treat head and neck
cancer. In some
embodiments, the composition is administered to treat osteosarcoma.In some
embodiments,
liposomes of the administered liposomal composition comprise a 7PANTIFOL
containing 4,
5, 2-10, 4-6, or more than 5, 7-g1utamyl groups. In some embodiments,
liposomes of the
administered liposomal composition comprise gamma tetraglutamated Antifolate.
In some
embodiments, liposomes of the administered liposomal composition comprise
gamma
pentaglutamated Antifolate. In other embodiments, liposomes of the
administered liposomal
composition comprise gamma hexaglutamated Antifolate. In some embodiments, the
administered liposomal composition comprises L gamma polyglutamated
Antifolate. In some
embodiments, the administered liposomal composition comprises 2, 3, 4, 5, or
more than 5, L-
gamma glutamyl groups. In some embodiments, the administered liposomal
composition
comprises D gamma polyglutamated Antifolate. In some embodiments, the
administered
liposomal composition comprises 2, 3, 4, 5, or more than 5, D-gamma glutamyl
groups. In
some embodiments, the administered liposomal composition comprises L and D
gamma
polyglutamated Antifolate. In some embodiments, the administered liposomal
composition
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 236 -
comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups and 2, 3, 4, 5,
or more than 5,
D-gamma glutamyl groups.
[00411] In some embodiments, the disclosure provides a method for treating
a disorder of the
immune system (e.g., an autoimmune disease such as inflammation and rheumatoid
arthritis)
that comprises administering an effective amount of a delivery vehicle (e.g.,
antibody or
liposome) comprising gamma polyglutamated Antifolate (e.g., a yPANTIFOL
disclosed
herein) to a subject having or at risk of having a disorder of the immune
system. In some
embodiments, the autoimmune disease is rheumatoid arthritis. In some
embodiments, the
delivery vehicle comprises a gamma polyglutamated Antifolate according to any
of [1]-[11] of
the Detailed Description Section. In some embodiments, the polyglutamated
Antifolate is a
polyglutamate of an Antifolate disclosed in Section I, herein. In some
embodiments, the
delivery vehicle is an antibody (e.g., a full-length IgG antibody, a
bispecific antibody, or a
scFv). In some embodiments, the delivery vehicle is a liposome (e.g., an Lp-
yPANTIFOL such
as, PLp-yPANTIFOL, NTLp-yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL, or
TPLp-yPANTIFOL). In some embodiments, the delivery vehicle is a liposome
according to
any of [12]-[67] of the Detailed Description Section. In some embodiments, the
administered
delivery vehicle is pegylated. In some embodiments, the administered delivery
vehicle is not
pegylated. In additional embodiments, the administered delivery vehicle
comprises a targeting
moiety that has a specific affinity for an epitope of antigen on the surface
of an immune cell
associated with a disorder of the immune system. In some embodiments, the
targeting moiety
is an antibody or an antigen binding antibody fragment. In some embodiments,
the
administered delivery vehicle comprises a yPANTIFOL containing 4, 5, 2-10, 4-
6, or more
than 5, y-glutamyl groups. In some embodiments, the administered delivery
vehicle comprises
gamma tetraglutamated Antifolate. In some embodiments, the administered
delivery vehicle
comprises gamma pentaglutamated Antifolate. In other embodiments, the
administered
delivery vehicle comprises gamma hexaglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises L gamma polyglutamated Antifolate. In
some
embodiments, the administered delivery vehicle comprises 2, 3, 4, 5, or more
than 5, L-gamma
glutamyl groups. In some embodiments, the administered delivery vehicle
comprises D gamma
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 237 -
polyglutamated Antifolate. In some embodiments, the administered delivery
vehicle comprises
2, 3, 4, 5, or more than 5, D-gamma glutamyl groups. In some embodiments, the
administered
delivery vehicle comprises L and D gamma polyglutamated Antifolate. In some
embodiments,
the administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-
gamma glutamyl
groups and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups.
[00412] In some embodiments, the disclosure provides a method for treating
an infectious
disease (e.g., HIV malaria, and schistomiasis) that comprises administering an
effective
amount of a delivery vehicle (e.g., antibody or liposome) comprising gamma
polyglutamated
Antifolate (e.g., a 7PANTIFOL disclosed herein) to a subject having or at risk
of having an
infectious disease. In some embodiments, the delivery vehicle comprises a
gamma
polyglutamated Antifolate according to any of [1]- [11] of the Detailed
Description Section. In
some embodiments, the polyglutamated Antifolate is a polyglutamate of an
Antifolate
disclosed in Section I, herein. In some embodiments, the delivery vehicle is
an antibody (e.g.,
a full-length IgG antibody, a bispecific antibody, or a scFv). In some
embodiments, the
delivery vehicle is a liposome (e.g., an Lp-yPANTIFOL such as, PLp-yPANTIFOL,
NTLp-
yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL, or TPLp-yPANTIFOL). In some
embodiments, the delivery vehicle is a liposome according to any of [12]467]
of the Detailed
Description Section. In some embodiments, the administered delivery vehicle is
pegylated. In
some embodiments, the administered delivery vehicle is not pegylated. In
additional
embodiments, the administered delivery vehicle comprises a targeting moiety
that has a
specific affinity for an epitope of antigen on the surface of a pathogen
associated with an
infectious disease. In some embodiments, the targeting moiety is an antibody
or an antigen
binding antibody fragment. In some embodiments, the administered delivery
vehicle comprises
yPANTIFOL containing 4, 5, 2-10, 4-6, or more than 5, y-glutamyl groups. In
some
embodiments, the administered delivery vehicle comprises gamma tetraglutamated
Antifolate.
In some embodiments, the administered delivery vehicle comprises gamma
pentaglutamated
Antifolate. In other embodiments, the administered delivery vehicle comprises
gamma
hexaglutamated Antifolate. In some embodiments, the administered delivery
vehicle
comprises L gamma polyglutamated Antifolate. In some embodiments, the
administered
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 238 -
delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl
groups. In some
embodiments, the administered delivery vehicle comprises D gamma
polyglutamated
Antifolate. In some embodiments, the administered delivery vehicle comprises
2, 3, 4, 5, or
more than 5, D-gamma glutamyl groups. In some embodiments, the administered
delivery
vehicle comprises L and D gamma polyglutamated Antifolate. In some
embodiments, the
administered delivery vehicle comprises 2, 3, 4, 5, or more than 5, L-gamma
glutamyl groups
and 2, 3, 4, 5, or more than 5, D-gamma glutamyl groups.
[00413] In some embodiments, the administered delivery vehicle is a
liposome or an antibody.
In some embodiments, the delivery vehicle comprises a gamma polyglutamated
Antifolate
according to any of [1]-[11] of the Detailed Description Section. In some
embodiments, the
delivery vehicle comprises a polyglutamate of an Antifolate disclosed in
Section I, herein. In
some embodiments, the delivery vehicle is a liposome according to any of
[12[467] of the
Detailed Description Section. In some embodiments, the delivery vehicle is an
antibody (e.g.,
a full-length IgG antibody, a bispecific antibody, or a scFv). In some
embodiments, the
delivery vehicle is a liposome (e.g., an Lp-yPANTIFOL such as, PLp-yPANTIFOL,
NTLp-
yPANTIFOL, NTPLp-yPANTIFOL, TLp-yPANTIFOL, or TPLp-yPANTIFOL). In further
embodiments, the liposome is pegylated. In additional embodiments, the
delivery vehicle
comprises a targeting moiety on its surface that specifically binds an antigen
on the surface of
a target cell of interest. In further embodiments, the delivery vehicle
comprises a targeting
moiety that specifically binds a cell surface antigen selected from: GONMB,
TACSTD2
(TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate receptor-a, folate
receptor-0 or
folate receptor-6), Mucin 1 (MUC-1), MUC-6, STEAP1, mesothelin, Nectin 4,
ENPP3,
Guanyly1 cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9 (Carbonic
anhydrase),
5T4 (TPBG), SLTRK6, SC-16, Tissue factor, LIV-1 (ZIP6), CGEN-15027, P-
Cadherin,
Fibronectin Extra-domain B (ED-B), VEGFR2 (CD309), Tenascin, Collagen IV,
Periostin,
endothelin receptor, HER2, HER3, EGFR, IGFR-1, EGFRvIII, CD2, CD3, CD4, CD5,
CD6,
CD11, CD11a, CD15, CD18, CD19, CD20, CD22, CD26, CD27L, CD30, CD33, CD34,
CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79, CD79b, CD105, CD133, CD138,
cripto, CD38, an EphA receptor, an EphB receptor, EphA2, an integrin (e.g.,
integrin av03,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 239 -
av135, or avI36), a C242 antigen, Apo2, PSGR, NGEP, PSCA, TMEFF2, endoglin,
PSMA,
CD98, CD56, CanAg, and CALLA.
[00414] In further embodiments, the delivery vehicle is a liposome, and the
liposome
comprises a targeting moiety that specifically binds a cell surface antigen
selected from:
GONMB, TACSTD2 (TROP2), CEACAM5, EPCAM, a folate receptor (e.g., folate
receptor-
a, folate receptor-f3 or folate receptor-6), Mucin 1 (MUC-1), MUC-6, STEAP1,
mesothelin,
Nectin 4, ENPP3, Guanylyl cyclase C (GCC), SLC44A4, NaPi2b, CD70 (TNFSF7), CA9
(Carbonic anhydrase), 5T4 (TPBG), SLTRK6, SC-16, Tissue factor, LIV-1 (ZIP6),
CGEN-
15027, P-Cadherin, Fibronectin Extra-domain B (ED-B), VEGFR2 (CD309),
Tenascin,
Collagen IV, Periostin, endothelin receptor, HER2, HER3, EGFR, IGFR-1,
EGFRvIII, CD2,
CD3, CD4, CD5, CD6, CD11, CD11a, CD15, CD18, CD19, CD20, CD22, CD26, CD27L,
CD30, CD33, CD34, CD37, CD38, CD40, CD44, CD56, CD70, CD74, CD79, CD79b,
CD105, CD133, CD138, cripto, CD38, an EphA receptor, an EphB receptor, EphA2,
an
integrin (e.g., integrin av133, avf35, or av[36), a C242 antigen, Apo2, PSGR,
NGEP, PSCA,
TMEFF2, endoglin, PSMA, CD98, CD56, CanAg, and CALLA. In some embodiments, the
liposome comprises a gamma polyglutamated Antifolate according to any of [1]-
[11] of the
Detailed Description Section. In some embodiments, the liposome comprises a
polyglutamate
of an Antifolate disclosed in Section I, herein. In some embodiments, the
delivery vehicle is a
liposome according to any of [481467] of the Detailed Description Section.
[00415] In some embodiments, the disclosure provides for the use of a
composition comprising
a gamma polyglutamated Antifolate for manufacture of a medicament for
treatment of a
hyperproliferative disease. In some embodiments, the composition comprises a
gamma
polyglutamated Antifolate according to any of [1]411] of the Detailed
Description Section. In
some embodiments, the composition comprises a polyglutamate of an Antifolate
disclosed in
Section I, herein. In some embodiments, the composition comprises a liposome
according to
any of [12]467] of the Detailed Description Section. In some embodiments, the
composition
comprises a liposome according to any of [48]-[67] of the Detailed Description
Section that
comprises a targeting moiety. In some embodiments, the gamma polyglutamated
Antifolate
comprise 5 or more glutamyl groups. In some embodiments, the gamma
polyglutamated
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 240 -
Antifolate is pentaglutamated or hexaglutamated. In some embodiments, the
gamma
polyglutamated Antifolate is in a liposome. In some embodiments, the
hyperproliferative
disease is cancer. In some embodiments, the cancer is selected from: lung
(e.g., non-small lung
cancer), pancreatic, breast cancer, ovarian, lung, prostate, head and neck,
gastric,
gastrointestinal, colon, esophageal, cervical, kidney, biliary duct,
gallbladder, and a
hematologic malignancy. In some embodiments, the cancer is selected from:
breast cancer,
advanced head and neck cancer, lung cancer, stomach cancer, osteosarcoma, Non-
Hodgkin's
lymphoma (NHL), acute lymphoblastic leukemia (ALL), mycosis fungoides
(cutaneous T-cell
lymphoma) choriocarcinoma, chorioadenoma, nonleukemic meningeal cancer, soft
tissue
sarcoma (desmoid tumors, aggressive fibromatosis), bladder cancer, and central
nervous
system (CNS) lymphoma. In some embodiments, the liposomal composition is
administered
to treat lung cancer (e.g., NSCLC or mesothelioma). In some embodiments, the
liposomal
composition is administered to treat breast cancer (e.g., HER2++ or triple
negative breast
cancer). In some embodiments, the composition is administered to treat
colorectal cancer. In
some embodiments, the composition is administered to treat ovarian cancer. In
some
embodiments, the composition is administered to treat endometrial cancer. In
some
embodiments, the composition is administered to treat pancreatic cancer. In
some
embodiments, the composition is administered to treat liver cancer. In some
embodiments, the
composition is administered to treat head and neck cancer. In some
embodiments, the
composition is administered to treat osteosarcoma. In some embodiments, the
cancer is
leukemia or lymphoma. In some embodiments, the hyperproliferative disease is
an
autoimmune disease. In some embodiments, the hyperproliferative disease is
inflammation and
rheumatoid arthritis.
[00416] The disclosed methods can be practiced in any subject that is
likely to benefit from
delivery of compositions contemplated herein (e.g., gamma polyglutamated
Antifolate
compositions such as liposome containing a gamma pentaglutamated or gamma
hexaglutamated Antifolate). Mammalian subjects, and in particular, human
subjects are
preferred. In some embodiments, the subjects also include animals such as
household pets (e.g.,
dogs, cats, rabbits, and ferrets), livestock or farm animals (e.g., cows,
pigs, sheep, chickens
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 241 -
and other poultry), horses such as thoroughbred horses, laboratory animals
(e.g., mice, rats,
and rabbits), and other mammals. In other embodiments, the subjects include
fish and other
aquatic species.
[00417] The subjects to whom the agents are delivered may be normal
subjects. Alternatively,
the subject may have or be at risk of developing a condition that can be
diagnosed or that can
benefit from delivery of one or more of the provided compositions. In some
embodiments,
such conditions include cancer (e.g., solid tumor cancers or non-solid cancer
such as
leukemias). In some embodiments, these conditions (e.g., cancers) involve
cells that express
an antigen that can be specifically bound by a targeted pegylated liposomal
gamma
polyglutamated Antifolate disclosed herein. In further embodiments, these
antigens
specifically bind and internalize the targeted pegylated liposomal gamma
polyglutamated
Antifolate into the cell. In some embodiments, the targeted pegylated
liposomal gamma
polyglutamated Antifolate specifically binds a folate receptor (e.g., folate
receptor alpha (FR-
O, folate receptor beta (FR-I3) and folate receptor delta (FR-6)) expressed on
the surface of the
cancer cell.
[00418] Tests for diagnosing the conditions that can be treated with the
provided compositions
are known in the art and will be familiar to the medical practitioner. The
determination of
whether a cell type expresses folate receptors can be made using commercially
available
antibodies. These laboratory tests include without limitation microscopic
analyses, cultivation
dependent tests (such as cultures), and nucleic acid detection tests. These
include wet mounts,
stain-enhanced microscopy, immune microscopy (e.g., FISH), hybridization
microscopy,
particle agglutination, enzyme-linked immunosorbent assays, urine screening
tests, DNA
probe hybridization, and serologic tests. The medical practitioner will
generally also take a full
history and conduct a complete physical examination in addition to running the
laboratory tests
listed above.
[00419] A subject having a cancer can, for example, be a subject that has
detectable cancer
cells. A subject at risk of developing a cancer can, for example, be a subject
that has a higher
than normal probability of developing cancer. These subjects include, for
instance, subjects
having a genetic abnormality that has been demonstrated to be associated with
a higher
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 242 -
likelihood of developing a cancer, subjects having a familial disposition to
cancer, subjects
exposed to cancer causing agents (.e.g., carcinogens) such as tobacco,
asbestos, or other
chemical toxins, and subjects previously treated for cancer and in apparent
remission.
[00420] In some embodiments, the disclosure provides methods for
selectively deliver a folate
receptor targeted pegylated liposomal gamma polyglutamated Antifolate to a
tumor cell
expressing a folate receptor on its surface at a rate that is higher (e.g., at
least two-fold greater,
at least three-fold greater, at least four-fold greater, or at least five-fold
greater, than a cell not
expressing folate receptor on its cell surface). In some embodiments, the
pegylated liposome
comprises L gamma polyglutamated Antifolate. In some embodiments, the
pegylated liposome
comprises an alpha polyglutamated Antifolate according to any of [1]-[11] of
the Detailed
Description Section. In some embodiments, the pegylated liposome comprises a
polyglutamate
of an Antifolate disclosed in Section I, herein. In some embodiments, the
liposome is a
liposome according to any of [48]-[67] of the Detailed Description Section. In
some
embodiments, the pegylated liposome comprises 2, 3, 4, 5, or more than 5, L-
gamma glutamyl
groups. In some embodiments, the pegylated liposome comprises D gamma
polyglutamated
Antifolate. In some embodiments, the pegylated liposome comprises 2, 3, 4, 5,
or more than 5,
D-gamma glutamyl groups. In some embodiments, the pegylated liposome comprises
L and D
gamma polyglutamated Antifolate. In some embodiments, the pegylated liposome
comprises
2, 3, 4, 5, or more than 5, L-gamma glutamyl groups. In some embodiments, the
pegylated
liposome comprises 2, 3, 4, 5, or more than 5, L-gamma glutamyl groups and 2,
3, 4, 5, or
more than 5, D-gamma glutamyl groups.
III. Combination therapy
[00421] In certain embodiments, in addition to administering gamma
polyglutamated
Antifolate composition described herein, the method or treatment further
comprises
administering at least one additional therapeutic agent. An additional
therapeutic agent can be
administered prior to, concurrently with, and/or subsequently to,
administration of the gamma
polyglutamated Antifolate composition. The additional therapeutic agent can be
associated
with a gamma polyglutamated Antifolate delivery vehicle (e.g., coencapsulated
with gamma
polyglutamated Antifolate in a liposome), present in a solution containing a
gamma
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 243 -
polyglutamated Antifolate delivery vehicle, or in a separate formulation from
the composition
containing the gamma polyglutamated Antifolate composition. Pharmaceutical
compositions
comprising a polypeptide or agent and the additional therapeutic agent(s) are
also provided. In
some embodiments, the at least one additional therapeutic agent comprises 1,
2, 3, or more
additional therapeutic agents.
[00422] Combination therapy with two or more therapeutic agents often uses
agents that work
by different mechanisms of action, although this is not required. Combination
therapy using
agents with different mechanisms of action may result in additive or
synergetic effects.
Combination therapy may allow for a lower dose of each agent than is used in
monotherapy,
thereby reducing toxic side effects and/or increasing the therapeutic index of
the polypeptide
or agent(s). Combination therapy may decrease the likelihood that resistant
cancer cells will
develop. In some embodiments, combination therapy comprises a therapeutic
agent that affects
the immune response (e.g., enhances or activates the response) and a
therapeutic agent that
affects (e.g., inhibits or kills) the tumor/cancer cells.
[00423] In some embodiments, the disclosure provides a method for treating
cancer that
comprises administering an effective amount of a gamma polyglutamated
Antifolate
composition disclosed herein and a biologic. In some embodiments, the
administered gamma
polyglutamated Antifolate is a yPANTIFOL according to any of [1]411] of the
Detailed
Description Section. In some embodiments, the administered gamma
polyglutamated
Antifolate is a polyglutamate of an Antifolate disclosed in Section I, herein.
In some
embodiments, the administered gamma polyglutamated Antifolate is in a liposome
according
to any of [12]467] of the Detailed Description Section. In some embodiments,
the gamma
polyglutamated Antifolate is administered in combination with a therapeutic
antibody. In
further embodiments, the gamma polyglutamated Antifolate is administered in
combination
with an anti-CD antibody (e.g., rituximab) or an antibody that binds an immune
checkpoint
protein (e.g., CTLA4, PD1, PDL1, and TIM3). In further embodiments, the gamma
polyglutamated Antifolate is administered in combination with an fc-fusion
protein (e.g.,
entanercept).
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 244 -
[00424] In some embodiments, the disclosure provides a method for treating
disorder of the
immune system that comprises administering an effective amount of a gamma
polyglutamated
Antifolate composition disclosed herein and a biologic. In some embodiments,
the
administered gamma polyglutamated Antifolate is a yPANTIFOL according to any
of [1]- [11]
of the Detailed Description Section. In some embodiments, the administered
gamma
polyglutamated Antifolate is a polyglutamate of an Antifolate disclosed in
Section I, herein. In
some embodiments, the administered gamma polyglutamated Antifolate is in a
liposome
according to any of [12]467] of the Detailed Description Section. In some
embodiments, the
gamma polyglutamated Antifolate is administered in combination with a
therapeutic antibody.
In further embodiments, the gamma polyglutamated Antifolate is administered in
combination
with an anti-TNF antibody (e.g., adalimumab). In some embodiments, the gamma
polyglutamated Antifolate is administered in combination with an fc-fusion
protein (e.g.,
entanercept).
[00425] In some embodiments of the methods described herein, the
combination of a
yPANTIFOL compositions described herein and at least one additional
therapeutic agent
results in additive or synergistic results. In some embodiments, the
combination therapy results
in an increase in the therapeutic index of the yPANTIFOL or agent. In some
embodiments, the
combination therapy results in an increase in the therapeutic index of the
additional therapeutic
agent(s). In some embodiments, the combination therapy results in a decrease
in the toxicity
and/or side effects of the yPANTIFOL or agent. In some embodiments, the
combination
therapy results in a decrease in the toxicity and/or side effects of the
additional therapeutic
agent(s).
[00426] In some embodiments, in addition to administering gamma
polyglutamated Antifolate
compositions described herein, the methods or treatments described herein
further comprise
administering at least one additional therapeutic agent selected from: an anti-
tubulin agent, an
auristatin, a DNA minor groove binder, a DNA replication inhibitor, an
alkylating agent (e.g.,
platinum complexes such as cisplatin, mono(platinum), bis(platinum) and tri-
nuclear platinum
complexes and carboplatin), an anthracycline, an antibiotic, an anti-folate
(e.g., a
polyglutamatable antifolate or a non polyglutamatable anti-folate), an
antimitotic (e.g., a vinca
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 245 -
alkaloid, such as vincristine, vinblastine, vinorelbine, or vindesine),
radiation sensitizer, a
steroid, a taxane, a topoisomerase inhibitor (e.g., doxorubicin HC1,
daunorubicin citrate,
mitoxantrone HC1, actinomycin D, etoposide, topotecan HC1, teniposide (VM-26),
and
irinotecan), an anti-metabolite, a chemotherapy sensitizer, a duocarmycin, an
etoposide, a
fluorinated pyrimidine, an ionophore, a lexitropsin, a nitrosourea, a
platinol, a purine
antimetabolite, a PARP inhibitor, and a puromycin. In certain embodiments, the
second
therapeutic agent is an alkylating agent, an antimetabolite, an antimitotic, a
topoisomerase
inhibitor, or an angiogenesis inhibitor. In some embodiments, the administered
gamma
polyglutamated Antifolate is a yPANTIFOL according to any of [1]- [11] of the
Detailed
Description Section. In some embodiments, the administered gamma
polyglutamated
Antifolate is a polyglutamate of an Antifolate disclosed in Section I, herein.
In some
embodiments, the administered gamma polyglutamated Antifolate is in a liposome
according
to any of [121467] of the Detailed Description Section.
[00427] Therapeutic agents that may be administered in combination with the
yPANTIFOL
compositions described herein include chemotherapeutic agents. Thus, in some
embodiments,
the methods or treatments described herein further comprise administering at
least one involves
the administration of a yPANTIFOL composition described herein in combination
with a
chemotherapeutic agent or in combination with a cocktail of chemotherapeutic
agents. In some
embodiments, the administered gamma polyglutamated Antifolate is a yPANTIFOL
according
to any of [1]-[11] of the Detailed Description Section. In some embodiments,
the administered
gamma polyglutamated Antifolate is a polyglutamate of an Antifolate disclosed
in Section I,
herein. In some embodiments, the administered gamma polyglutamated Antifolate
is in a
liposome according to any of [12[467] of the Detailed Description Section.
Treatment with a
yPANTIFOL composition can occur prior to, concurrently with, or subsequent to
administration of chemotherapies. Combined administration can include co-
administration,
either in a single pharmaceutical formulation or using separate formulations,
or consecutive
administration in either order but generally within a time period such that
all active agents can
exert their biological activities simultaneously. Preparation and dosing
schedules for such
chemotherapeutic agents can be used according to manufacturers' instructions
or as determined
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 246 -
empirically by the skilled practitioner. Preparation and dosing schedules for
such
chemotherapy are also described in The Chemotherapy Source Book, 4th
Edition, 2008,
M. C. Perry, Editor, Lippincott, Williams & Wilkins, Philadelphia, PA.
[00428] Chemotherapeutic agents useful in the present invention include,
but are not limited
to, alkylating agents such as thiotepa and cyclosphosphamide (CYTOXANC); alkyl
sulfonates
such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa,
carboquone,
meturedopa, and uredopa; ethylenimines and methylamelamines including
altretamine,
triethylenemelamine, trietylenephosphoramide, triethylenethiophosphaoramide
and
trimethylolomelamime; nitrogen mustards such as chlorambucil, chlornaphazine,
cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine
oxide
hydrochloride, melphalan, novembichin, phenesterine, prednimustine,
trofosfamide, uracil
mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine,
lomustine, nimustine,
ranimustine; antibiotics such as aclacinomysins, actinomycin, authramycin,
azaserine,
bleomycins, cactinomyc in, calicheamicin, carabicin, c aminomycin,
carzinophilin,
chromomycins, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-
norleucine,
doxorubicin, epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins,
mycophenolic
acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin,
quelamycin,
rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin,
zorubicin; anti-
metabolites such as Antifolate and 5-fluorouracil (5-FU); folic acid analogs
such as denopterin,
Antifolate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-
mercaptopurine,
thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine,
6-azauridine,
carmofur, cytosine arabinoside, dideoxyuridine, doxifluridine, enocitabine,
floxuridine, 5-FU;
androgens such as calusterone, dromostanolone propionate, epitiostanol,
mepitiostane,
testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane;
folic acid
replenishers such as folinic acid; aceglatone; aldophosphamide glycoside;
aminolevulinic acid;
amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine;
diaziquone;
elformithine; elliptinium acetate; etoglucid; gallium nitrate; hydroxyurea;
lentinan;
lonidamine; mitoguazone; mitoxantrone; mopidamol; nitracrine; pentostatin;
phenamet;
pirarubicin; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSK;
razoxane; sizofuran;
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 247 -
spirogermanium; tenuazonic acid; triaziquone; 2,2',2"-trichlorotriethylamine;
urethan;
vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman;
gacytosine;
arabinoside (Ara-C); taxoids, such as paclitaxel (TAXOLIO) and docetaxel
(TAXOTERE0);
chlorambucil; gemcitabine; 6-thioguanine; mercaptopurine; platinum analogs
such as cisplatin
and
carboplatin; vinblastine; platinum; etopo side (VP-16); ifosfamide; mitomycin
C;
mitoxantrone; vincristine; vinorelbine; navelbine; novantrone; teniposide;
daunomycin;
aminopterin; ibandronate; CPT11; topoisomerase inhibitor RFS 2000;
difluoromethylornithine
(DMF0); retinoic acid; esperamicins; capecitabine (XELODA0); anti-hormonal
agents such
as, tamoxifen, raloxifene, aromatase inhibiting 4(5)-imidazoles, 4-
hydroxytamoxifen,
trioxifene, keoxifene, LY117018, onapristone, and toremifene (FARES TONG);
anti-
androgens such as flutamide, nilutamide, bicalutamide, leuprolide, and
goserelin; and
pharmaceutically acceptable salts, acids or derivatives according to any of
the above. In certain
embodiments, the additional therapeutic agent is cisplatin. In certain
embodiments, the
additional therapeutic agent is carboplatin. In other embodiments, the
additional therapeutic
agent is oxaloplatin.
[00429]
Additional therapeutic agents that may be administered in combination with the
yPANTIFOL compositions described herein include one or more immunotherapeutic
agents.
[00430] In
some embodiments yPANTIFOL is administered in combination with an
immunotherapeutic agent that inhibits one or more T cell-associated inhibitory
molecules
(e.g., CTLA4, PD1, Lymphocyte activation gene-3 (LAG-3, CD223), T cell
immunoglobulin-
3 (TIM-3), T cell immunoglobulin and ITIM domain (TIGIT), V-domain Ig
suppressor of T
cell activation (VISTA), B7 homolog 3 (B7-H3, CD276), B and T cell lymphocyte
attenuator
(BTLA, CD272), or Adenosine A2a receptor (A2aR) or CD73). In some embodiments,
the
yPANTIFOL composition is administered separately from the immunotherapeutic
agent. In
some embodiments, the yPANTIFOL composition is administered at the same time
(e.g.,
concurrently or serially) as the immunotherapeutic agent. In some embodiments,
the
yPANTIFOL and the immunotherapeutic agent are encapsulated in or otherwise
associated
with the same liposome.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 248 -
[00431] In some embodiments, treatment methods provided herein comprise
administering a
yPANTIFOL composition described herein in combination with a PD1 inhibitor. In
some
embodiments, the yPANTIFOL composition is administered in combination with
pembroluzumab. In some embodiments, the yPANTIFOL composition is administered
in
combination with nivolumab. In some embodiments, the 7PANTIFOL composition is
administered separately from the PD1 inhibitor. In some embodiments, the
yPANTIFOL
composition is administered at the same time (e.g., concurrently or serially)
as the PD1
inhibitor. In some embodiments, the yPANTIFOL and the PD1 inhibitor are
encapsulated in
or otherwise associated with the same liposome.
[00432] In other embodiments, the yPANTIFOL composition is administered in
combination
with a PDL1 inhibitor. In some embodiments, the yPANTIFOL composition is
administered
in combination with atezolizumab. In some embodiments, the yPANTIFOL
composition is
administered in combination with avelumab. In some embodiments, the yPANTIFOL
composition is administered in combination with durvalumab. In some
embodiments, the
yPANTIFOL composition is administered in combination with PDR001. In some
embodiments, the yPANTIFOL composition is administered separately from the PDL-
1
inhibitor. In some embodiments, the yPANTIFOL composition is administered at
the same
time (e.g., concurrently or serially) as the PDL-1 inhibitor. In some
embodiments, the
yPANTIFOL and the PDL-1 inhibitor are encapsulated in or otherwise associated
with the
same liposome.
[00433] In some embodiments, treatment methods provided herein comprise
administering an
yPANTIFOL composition in combination with a therapeutic agent that inhibits
activity of
CTLA4 LAG3, TIM-3, TIGIT, VISTA, B7-H3, BTLA, A2aR or CD73. In some
embodiments, treatment methods provided herein comprise administering a
yPANTIFOL
composition described herein in combination with a CTLA4 inhibitor. In further
embodiments, the yPANTIFOL composition is administered in combination with
ipilimumab.
In some embodiments, treatment methods provided herein comprise administering
a
yPANTIFOL composition in combination with a LAG3 inhibitor. In further
embodiments, the
yPANTIFOL composition is administered in combination with TSR-033, MK-4280,
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 249 -
LAG525, BMS-986106, or MGD013. In some embodiments, treatment methods provided
herein comprise administering a yPANTIFOL composition in combination with a
TIM-3
inhibitor. In further embodiments, the yPANTIFOL composition is administered
in
combination with MBG453 or MEDI9447. In some embodiments, treatment methods
provided herein comprise administering a yPANTIFOL composition in combination
with a
TIGIT inhibitor. In further embodiments, the yPANTIFOL composition is
administered in
combination with BMS-986207 or OMP-31M32. In some embodiments, treatment
methods
provided herein comprise administering a yPANTIFOL composition in combination
with a
VISTA inhibitor. In further embodiments, the yPANTIFOL composition is
administered in
combination with JNJ-61610588 or CA-170. In some embodiments, treatment
methods
provided herein comprise administering a yPANTIFOL composition in combination
with a
B7-H3 inhibitor. In further embodiments, the yPANTIFOL composition is
administered in
combination with neoblituzumab, enoblituzumab, MGD009, or 8H9. In some
embodiments,
treatment methods provided herein comprise administering a yPANTIFOL
composition in
combination with a BTLA inhibitor. In some embodiments, treatment methods
provided
herein comprise administering a yPANTIFOL composition in combination with an
A2aR or
CD73 inhibitor. In further embodiments, the yPANTIFOL composition is
administered in
combination with CPI444. In some embodiments, the yPANTIFOL composition is
administered separately from the immunotherapeutic agent. In some embodiments,
the
yPANTIFOL composition is administered at the same time (e.g., concurrently or
serially) as
the immunotherapeutic agent. In some embodiments, the yPANTIFOL and the
immunotherapeutic agent are encapsulated in or otherwise associated with the
same liposome.
[00434] In some embodiments, treatment methods provided herein comprise
administering an
yPANTIFOL composition in combination with a therapeutic agent that inhibits
activity of
transforming growth factor (TGF)-[3, phosphoinositide 3-kinase gamma (PI3Ky),
Killer
immunoglobulin-like receptors (KIR, CD158), CD47, or Indoleamine 2,3-
dioxygenase
(IDO). In some embodiments, treatment methods provided herein comprise
administering a
yPANTIFOL composition described herein in combination with a TGFI3 antagonist.
In further
embodiments, the yPANTIFOL composition is administered in combination with
M7824 or
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 250 -
Galusertinib (LY2157299). In some embodiments, treatment methods provided
herein
comprise administering a yPANTIFOL composition described herein in combination
with a
PI3Ky antagonist. In further embodiments, the 7PANTTFOL composition is
administered in
combination with IPI-549. In some embodiments, treatment methods provided
herein
comprise administering a yPANTIFOL composition described herein in combination
with a
KIR antagonist. In further embodiments, the yPANTIFOL composition is
administered in
combination with IPH4102 or lirilumab. In some embodiments, treatment methods
provided
herein comprise administering a yPANTIFOL composition described herein in
combination
with a CD47 antagonist. In further embodiments, the yPANTlFOL composition is
administered in combination with Hu5F9-G4 or TTI-621. In some embodiments,
treatment
methods provided herein comprise administering a yPANTIFOL composition
described
herein in combination with an IDO antagonist. In further embodiments, the
yPANTIFOL
composition is administered in combination with BMS-986205, indoximod, or
epacadostat.
In some embodiments, the yPANTIFOL composition is administered separately from
the
therapeutic agent. In some embodiments, the yPANTIFOL composition is
administered at the
same time (e.g., concurrently or serially) as the therapeutic agent. In some
embodiments, the
yPANTIFOL and the therapeutic agent are encapsulated in or otherwise
associated with the
same liposome.
[00435] In some embodiments, treatment methods provided herein comprise
administering an
yPANTIFOL composition in combination with a therapeutic agent that is an
agonist of 0X40
(CD134), inducible co-stimulator (ICOS), Glucocorticoid-induced TNF receptor
family-
related protein (GITR), 4-1BB (CD137), CD40, CD27-CD70, or a Toll-like
receptor (TLR).
In some embodiments, treatment methods provided herein comprise administering
a
yPANTIFOL composition described herein in combination with an 0X40 agonist. In
further
embodiments, the yPANTIFOL composition is administered in combination with
GSK3174998, MOXR0916, 9B12, PF-04518600 (PF-8600), MEDI6383, MEDI0562,
INCAGN01949, or GSK3174998. In some embodiments, treatment methods provided
herein
comprise administering a yPANTIFOL composition described herein in combination
with an
ICOS agonist. In further embodiments, the yPANTIFOL composition is
administered in
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 251 -
combination with JTX-2011, GSK3359609, or MEDI-570. In some embodiments,
treatment
methods provided herein comprise administering a yPANTIFOL composition
described
herein in combination with a GITR agonist. In further embodiments, the
yPANTIFOL
composition is administered in combination with TRX-518, AMG 228, BMS-986156,
MEDI1873, MK-4166, INCAGN01876, or GWN32. In some embodiments, treatment
methods provided herein comprise administering a yPANTIFOL composition
described
herein in combination with a 4-1BB agonist. In further embodiments, the
yPANTIFOL
composition is administered in combination with utomilumab or urelumab (PF-
05082566). In
some embodiments, treatment methods provided herein comprise administering a
yPANTIFOL composition described herein in combination with a CD40 agonist. In
further
embodiments, the yPANTIFOL composition is administered in combination with CP-
870893,
APX005M, ADC-1013, lucatumumab, Chi Lob 7/4, dacetuzumab, SEA-CD40, or
R07009789. In some embodiments, treatment methods provided herein comprise
administering a 7PANTIFOL composition described herein in combination with a
CD27-
CD70 agonist. In further embodiments, the yPANTIFOL composition is
administered in
combination with ARGX-110, or BMS-936561 (MDX-1203). In some embodiments,
treatment methods provided herein comprise administering a yPANTIFOL
composition
described herein in combination with a TLR agonist. In further embodiments,
the
yPANTIFOL composition is administered in combination with MEDI9197, PG545
(pixatimod, plNN), or poly-ICLC. In some embodiments, the yPANTIFOL
composition is
administered separately from the therapeutic agent. In some embodiments, the
yPANTIFOL
composition is administered at the same time (e.g., concurrently or serially)
as the therapeutic
agent. In some embodiments, the yPANTIFOL and the therapeutic agent are
encapsulated in
or otherwise associated with the same liposome.
[00436] In some embodiments, the disclosure provides a combination therapy
wherein a
gamma polyglutamated Antifolate composition described herein is administered
in
combination with another DMARD. In some embodiments, the administered gamma
polyglutamated Antifolate is a yPANTIFOL according to any of [1]-[11] of the
Detailed
Description Section. In some embodiments, the administered gamma
polyglutamated
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 252 -
Antifolate is a polyglutamate of an Antifolate disclosed in Section I, herein.
In some
embodiments, the administered gamma polyglutamated Antifolate is in a liposome
according
to any of [12]467] of the Detailed Description Section. In further
embodiments, the gamma
polyglutamated Antifolate composition is administered in combination
sulfasalazine or
hydroxychloroquine. In some embodiments, the disclosure provides a combination
therapy
wherein a gamma polyglutamated Antifolate composition described herein is
administered in
combination with chloroquine.
[00437] In some embodiments, the disclosure provides a combination therapy
wherein a
gamma polyglutamated Antifolate composition described herein is administered
in
combination with a steroid. In some embodiments, the administered gamma
polyglutamated
Antifolate is a yPANTIFOL according to any of [1]-[11] of the Detailed
Description Section.
In some embodiments, the administered gamma polyglutamated Antifolate is a
polyglutamate
of an Antifolate disclosed in Section I, herein. In some embodiments, the
administered gamma
polyglutamated Antifolate is in a liposome according to any of [12]467] of the
Detailed
Description Section.In further embodiments, the gamma polyglutamated
Antifolate
composition is administered in combination with prednisolone.
[00438] In some embodiments, the disclosure provides a combination therapy
wherein a
gamma polyglutamated Antifolate composition described herein is administered
in
combination a biologic agent. In some embodiments, the administered gamma
polyglutamated
Antifolate is a yPANTIFOL according to any of [1]-[11] of the Detailed
Description Section.
In some embodiments, the administered gamma polyglutamated Antifolate is a
polyglutamate
of an Antifolate disclosed in Section I, herein. In some embodiments, the
administered gamma
polyglutamated Antifolate is in a liposome according to any of [12]467] of the
Detailed
Description Section. In some embodiments, the biologic agent is a therapeutic
antibody. In
further embodiments, the therapeutic binds TNF-alpha or CD-20.
IV. Kits Comprising yPANTIFOL Compositions
[00439] The disclosure also provides kits that comprise the yPANTIFOL
compositions
described herein and that can be used to perform the methods described herein.
In certain
embodiments, a kit comprises at least one purified yPANTIFOL composition in
one or more
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 253 -
containers. In some embodiments, the kit comprises a gamma polyglutamated
Antifolate
according to any of 1111-till] of the Detailed Description Section. In some
embodiments, the kit
comprises a gamma polyglutamated Antifolate wherein the Antifolate is a
polyglutamate of an
Antifolate disclosed in Section I, herein. In some embodiments, the kit
comprises a gamma
polyglutamated Antifolate according to any of [12]-[67] of the Detailed
Description Section.
[00440] In some embodiments, the kits contain all of the components
necessary and/or
sufficient to perform a detection assay, including all controls, directions
for performing assays,
and any necessary software for analysis and presentation of results. One
skilled in the art will
readily recognize that the disclosed agents can be readily incorporated into
one of the
established kit formats which are well known in the art.
[00441] In some embodiments, the kits include a dosage amount (e.g., as
used for therapy or
diagnosis) of at least one yPANTIFOL compositions (e.g., a yPANTIFOL
liposome), or
pharmaceutical formulation thereof, as disclosed herein. Kits may further
comprise suitable
packaging and/or instructions for use of the composition. Kits may also
comprise a means for
the delivery for the composition, or pharmaceutical formulation thereof, such
as a syringe for
injection or other device as described herein and known to those of skill in
the art. One of skill
in the art will readily recognize that the disclosed yPANTIFOL compositions
can be readily
incorporated into one of the established kit formats which are well known in
the art.
[00442] Further provided are kits that comprise a -yPANTIFOL compositions
as well as at least
one additional therapeutic agent. In certain embodiments, the second (or more)
therapeutic
agent is an anti-metabolite. In certain embodiments, the second (or more)
therapeutic agent is
a chemotherapeutic agent.
[00443] The following examples are intended to illustrate but not to limit
the disclosure in any
manner, shape, or form, either explicitly or implicitly. While they are
typical of those that
might be used, other procedures, methodologies, or techniques known to those
skilled in the
art may, be used without departing from the scope of the present disclosure.
[00444] FIGS. 1B-1N show chemical formulas of exemplary gamma
polyglutamates
encompassed by the disclosure.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 254 -
Examples
Example 1: Liposomal gamma polyglutamated Antifolate compositions
Methods
Production of gamma Hexaglutamated Pemetrexed (yFIgPMX) Liposomes
[00445] Briefly Gamma Hexaglutamated Pemetrexed (gGR6) and D gamma
hexaglutamated
Pemetrexed (gDGR6) was encapsulated in liposomes by the following procedure.
First, the
lipid components of the lipo some membrane were weighed out and combined as a
concentrated
solution in ethanol at a temperature of around 65 C. In this example, the
lipids used were
hydrogenated soy phosphatidylcholine, cholesterol, and DSPE-PEG-2000 (1,2-
distearoyl-sn-
glycero-3-phosphoethanolamine-N4methoxy (poly-ethylene glycol)-2000]). The
molar ratio
of HSPC: Cholesterol: PEG-DSPE was approximately 3:2:0.15. Next, the gGR6 or
gDGR6
was dissolved in an aqueous buffer at a concentration of 150 mg/ml with a pH
of 6.5-6.9. The
drug solution was heated up to 65 C. The ethanolic lipid solution was injected
into the gGR6
or gDGR6 solution using a small-bore needle. During this step the drug
solution was well
stirred using a magnetic stirrer. The mixing was performed at an elevated
temperature (63 C -
72 C) to ensure that the lipids were in the liquid crystalline state (as
opposed to the gel state
that they attain at temperatures below the lipid transition temperature Tm =
51 C -54 C). As a
result, the lipids were hydrated and form multiple bilayer (multilamellar)
vesicles (MLV)
containing gGR6 or gDGR6 in the aqueous core.
Downsizing of MLV' s Using Filter Extrusion
[00446] The MLVs were fragmented into unilamellar (single bilayer) vesicles
of the desired
size by high-pressure extrusion using three passes through stacked (track-
etched
polycarbonate) membranes. The first pass was performed through stacked
membranes
consisting of two layers with a pore size of 200nm. The remaining two passes
were through
the stacked membranes consisting of three layers with a pore size of 100nm.
During extrusion,
the temperature was maintained above the Tm to ensure plasticity of the lipid
membranes. As
a result of the extrusion, large and heterogeneous in size and lamellarity
MLVs turned into
small, homogenous (90-125 nm) unilamellar vesicles (ULV) that sequestered the
drug in their
interior. A Malvern Zetasizer Nano ZS instrument (Southborough, MA) with back
scattering
CA 03090505 2020-08-05
WO 2019/157148
PCT/US2019/017004
- 255 -
detector (900) was used for measuring the hydrodynamic size (diameter) at 25 C
in a quartz
micro cuvette. The samples were diluted 50-fold in formulation matrix before
analysis.
Purification of liposomes
[00447] After the ULV's containing gGR6 or gDGR6 pemetrexed had been
produced, the
extra-liposomal free drug was removed using columns for small volume or
tangential flow
diafiltration against a suitable buffer for large volume. Although any buffer
solution can be
used, in this example the buffer used was 5 mM HEPES, 145 mM Sodium Chloride,
pH 6.7.
Upon completion of purification, filter sterilization was performed using a
0.22 micron filter.
The typical characteristics of liposomal derivatives are shown in the table
below.
Starting Encapsulation Final Drug/ Lipid Diameter PDI Zeta
con. efficiency con. Ratio potential
Lps 1 5.71% 0.038 25-30 103.8 nm
0.017 -1.77
gDG6 mg/m1 mg/ml g/mol mV
Lps 20 10.60% 1.39 35-50 114.9 nm
0.035 -1.76
gG6 mg/m1 mg/ml g/mol mV
Lps 100 34% 7.5 225 ¨265
116.3 nm 0.045 -2.32
gG6 inghlil mg/ml g/mol mV
Dose response study of gamma HGP (hexaglutamated pemetrexed) and liposomes
[00448] Cell viability was determined by CellTiter-Glo (CTG) luminescent
cell viability
assay on Day 3 (48 hour) and Day 4 (72 hour). This assay determines the number
of viable
cells in culture based on quantifying ATP that is present within, which in
turn signals the
presence of metabolically active cells. The CTG assay uses luciferase as a
readout. To assess
cell viability Dose response inhibition of pemetrexed, HGP and liposomes on
different cancer
cell growth were investigated using CellTiter-Glo0 luminescent cell viability
assay. Human
cancer cells were harvested, counted and plated at a same cell density on Day
0. A series of 8
dilutions of each test article were added to the cells on Day 1. Dose response
curve were
generated and fit using GraphPad Prism and IC50 of each test article were
calculated. A lower
the IC50 is, the more potent the test article is in term of cancer cell growth
inhibition.
[00449] Cells were seeded into 96-well plate at a cell density of 5 x 104
cells per well in 100iitl
of fresh media on Day 0. Eight serial 2-fold dilutions of each test article in
culture medium
were generated and added to cells in triplicate on Day 1. In addition, three
wells of cells were
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 256 -
treated with vehicle (HBS for free drug or empty liposome for liposomal HGP)
alone as a
control.
[00450] On Days 3 and 4, 100 1 of CellTiterGlo Reagent were added to each
well and
incubated at room temperature for 15 minutes. Luciferase luminescence were
recorded for each
well. In addition, 8 serial 2-fold dilutions of the vehicle (HBS or empty
liposome) in culture
medium were added into empty wells and included in the assay to generate the
background
luminescence signals. Luciferase signals were normalized by subtracting the
background
luminescence signal out of the read-outs respectively.
[00451] Human Normal Primary Bone Marrow CD34+ Cells were obtained from
ATCC.
(ATCC Catalog Number PCS-800-012). Cells were thawed at 37 C for 1 minute and
then
placed on ice. The cells were then resuspended in StemSpan SFEM (Stem Cell
Tech Catalog
Number 9650) plus 10% heat inactivated fetal bovine serum (Corning 35-015-CV).
The cells
were plated into 96 well culture plates at a density of 2.5 x 104 cells/well.
The following day,
live cells were collected via centrifugation and resuspended in neutrophil
growth media
(StemSpan SFEM plus 10% Heat Inactivated fetal bovine serum plus 100 ng/ml
human stem
cell factor (Sigma Catalog Number H8416), 20ng/m1 human granulocyte colony-
stimulation
factor (Sigma Catalog Number H5541), and lOng/m1 human recombinant IL3 (Sigma
SRP3090) at a density of 2.5x104ce11s/well. Cells were incubated at 37 C for
10 days. Fresh
media was added every two days. Mature neutrophils were then collected and
plated in 96 well
plates at a density of 1x104 cells/well and incubated at 37 C overnight. The
next day, test
article or vehicle was resuspended in neutrophil growth media and added to the
plates. The
cells were then incubated for either 48 hours or 72 hours at 37 C and then
assayed at each time
point using the Cell Titer Glo Assay (Promega Catalog #G7572).
[00452] Methodologies used for cell line AML12 (non-cancerous liver cells)
and CCD841
(non-cancerous colon epithelial cells) are similar to the methods used for
cancer cells.
Results
[00453] In a set of dose response experiments, 6 cell lines representing
different types of
cancers, namely HT-29 (colon cancer), H2342 (NSCLC, adenocarcinoma subtype),
H292
(NSCLC, adenocarcinoma subtype), 5W620 (CRC), H1806 (triple negative breast
cancer) and
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 257 -
0AW28 (ovarian cancer), were studied (FIG. 5). Treatment consisted of exposure
for 48 hours
using 2 different encapsulated derivatives of liposomal gamma pemetrexed
hexaglutamate,
namely liposomal gamma L hexaglutamate (liposomal gG6) and its mirror image,
liposomal
gamma D hexaglutamate (liposomal gDG6) also referred to as its corresponding
enantiomer.
[00454] The relative potency of the above mentioned derivatives as compared
to pemetrexed,
following exposure over 48 hours, is represented in FIG. 5. The relative
potency of treatment
using the various derivatives, as shown in this figure was calculated by
dividing the IC50 of
pemetrexed by the IC50 of the liposomal gamma pemetrexed hexaglutamate for
each cell line.
As shown in this figure, in all cell lines, the potency of liposomal gamma
pemetrexed
hexaglutamate well exceeded that of pemetrexed. By way of example, consider
the NSCLC
cell line H292. As shown in the figure, the potency of liposomal gamma
pemetrexed
hexaglutamate was? 50-fold that of pemetrexed. This suggests that a 2% or
lower dose of the
liposomal gamma pemetrexed hexaglutamate could have the same treatment effect
as a 100%
dose of pemetrexed.
[00455] Cancer cell viability studies comparing the liposomal gamma
pemetrexed
hexaglutamate derivatives (liposomal L gammaG6/Lps Hexa gG6 and liposomal D
gammaG6/Lps Hexa gDG6) and pemetrexed for cytotoxic activity on representative
cell lines
in breast, colon, lung and ovarian cancer are shown in FIGS. 2, 3, 4, 6, 7 and
8. These data
show that both liposomal gamma L pemetrexed hexaglutamate and liposomal gamma
D
pemetrexed hexaglutamate are more potent than pemetrexed. Further, as an
indicator of
efficacy, the results of the experiments on the same cell lines depicted at
various dose levels
ranging from 16 to 128 nM in FIGS. 9-11. As shown in these figures, at each of
these dose
ranges, liposomal gamma L pemetrexed hexaglutamate and liposomal gamma D
pemetrexed
hexaglutamate are superior to pemetrexed in terms of inhibiting cancer cells
for the lung and
breast cancer cell lines. In the ovarian cancer cell line, pemetrexed at the
dose of 128 nM,
appears to be equally effective as liposomal gamma pemetrexed hexaglutamate,
whereas the
liposomal gamma pemetrexed hexaglutamate at the dose of 32 nM and 64 nM has a
better
treatment effect than pemetrexed; at 16 nM the treatment effect is lower and
similar in
magnitude for liposomal gamma pemetrexed hexaglutamate and pemetrexed.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 258 -
[00456] The major toxicities seen in patients treated with pemetrexed is
bone marrow
suppression which manifests as a decrease in blood counts including neutrophil
counts (a type
of white blood cells). There is also some adverse effect on the lining of the
mouth and gut that
manifests as diarrhea and mucositis, as well as an adverse effect on the liver
in some instances.
To assess the above-mentioned toxicities, treatment of the liposomal gamma
pemetrexed
hexaglutamate derivatives (L and D) and pemetrexed was measured at 48 hours on
CD34+
cells that were differentiated into neutrophils, CCD841 colon epithelium cells
and AML12
liver cells. As shown in FIG. 12, liposomal gamma pemetrexed hexaglutamate is
significantly
less toxic to differentiating human neutrophils in contrast to pemetrexed.
This is also supported
by neutrophil counts that are better preserved following treatment with the
liposomal gamma
L pemetrexed hexaglutamate or liposomal gamma D pemetrexed hexaglutamate
compared to
pemetrexed, at dose ranges from 16 nM to 128 nM (FIG. 13). Strikingly, there
does not appear
to be any toxicity to the liver cells following treatment with liposomal L
gamma pemetrexed
hexaglutamate or liposomal gamma D pemetrexed hexaglutamate at the dose levels
studied
(FIG. 14). In contrast, pemetrexed at all doses studied is leading to a
reduction in the liver cell
counts of approximately 40%. And finally, the same trend is seen following
treatment of
epithelial colon cells (FIG. 15). As shown in this figure, pemetrexed at all
doses studied is
leading to approximately a >50% decrease in the number of cells compared to
approximately
a 20% or less decrease after treatment with liposomal gamma L pemetrexed
hexaglutamate
and liposomal gamma D pemetrexed hexaglutamate.
Example 2: Targeted liposome polyglutamated antifolate cell delivery
Methods:
Production of targeted gamma hexaglutamated pemetrexed (HGP) liposomes
[00457] Gamma HGP (gG6) was encapsulated in liposomes and the liposomes
were downsized
and purified according to procedures essentially as set forth above in Example
1.
Antibody conjugation
[00458] Activated liposomes were prepared by adding DSPE-PEG-maleimide to
the lipid
composition. The liposomes contain four different lipids: hydrogenated soy
phosphatidylcholine (HS PC), cholesterol, 1,2-di stearo yl- s n-glyc ero-3-pho
sphoethanolamine-
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 259 -
N-[methoxy(polyethylene glycol)-2000] (DSPE-PEG-2000), and 1,2-distearoyl-sn-
glycero-3-
phosphoethanolamine-N-[maleimide (polyethylene glycol)-2000] (DSPE-PEG-
maleimide), in
ratios of 3:2:0.1125:0.0375.
[00459] Antibody thiolation was accomplished through use of Traut' s
reagent (2-
iminothiolane) to attach a sulfhydryl group onto primary amines. Antibody was
suspended in
PBS at a concentration of 0.9-1.6 mg/ml. Traue s reagent (14 mM) was added to
antibody
solution at a final concentration of 1-5 mM and then removed through dialysis
after one-hour
incubation at room temperature. Thiolated antibody was added to activated
liposome at a ratio
of 60 g/mol phosphate lipids, and the reaction mixture was incubated for one
hour at room
temperature and overnight at 4uL-cysteine was used to terminate the reaction
and unconjugated
antibody was removed through dialysis.
Exemplary direct and post insertion antibody-liposome conjuation methods are
provided
below.
Exemplary Antibody Conjugation Method 1: Direct Conjugation
[00460] Antibody or its fragments, such as Fab or scFv, can be conjugated
directly onto thiol-
reactive liposome. Thiol-reactive liposomes are prepared by adding DSPE-PEG-
maleimide to
the lipid composition. The liposomes contain four different lipids:
hydrogenated soy
phosphatidylcholine (HS PC), cholesterol, 1,2-di stearo yl- sn-glycero-3-
phosphoethanolamine-
N-[methoxy(polyethylene glycol)-2000] (DSPE-PEG-2000), and 1,2-distearoyl-sn-
glycero-3-
phosphoethanolamine-N-[maleimide (polyethylene glycol)-2000] (DSPE-PEG-
maleimide), in
ratios of 3:2:0.1125:0.0375.
[00461] Antibody (or its fragments, such as Fab or scFv) thiolation is
accomplished through
use of Traut's reagent (2-iminothiolane) to attach a sulfhydryl group onto
primary amines.
Antibody (or its fragment) is suspended in PBS at a concentration of 0.9-1.6
mg/ml. Traut' s
reagent (14 mM) is added to antibody (or its fragment) solution at a final
concentration of 1-5
mM and then removed through dialysis after one-hour incubation at room
temperature.
Thiolated antibody (or its fragment) is added to thiol-reacitve liposome at a
ratio of 60 g/mol
phosphate lipids, and the reaction mixture is incubated for one hour at room
temperature and
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 260 -
over-night at 4 C. L-cysteine is used to terminate the reaction and
unconjugated antibody (or
its fragment) is removed through dialysis.
[00462] Antibody or its fragments, such as Fab or scFv, which contains a
cysteine residue at
the C-terminal can be conjugated directly onto the liposome by incubating a
reduced antibody
(or its fragment) with thiol-reactive liposome. Antibody (or its fragment)
with a cysteine tail
is dissolved and reduced by a 10-20 mM reducing reagent (such as 2-
mercaptoethylamine,
cysteine, or dithioerythritol) at pH < 7. The excess reducing reagent is
removed thoroughly by
size exclusion chromatography or dialysis. The purified and reduced antibody
(or its fragment)
can be directly conjugated to the thiol-reactive liposome.
Exemplary Antibody Conjugation Method 2: Post Insertion
[00463] Antibody or its fragments, such as Fab or scFv, which contains a
cysteine residue at
the C-terminal can be conjugated and incorporated into the liposome through a
"post insertion"
method. Micelles of thiol-reactive lipopolymer (such as DSPE-PEG-maleimide) is
prepared
by dissolving in an aqueous solution at 10 mg/ml. Antibody (or its fragment)
with a cysteine
tail is dissolved and reduced by a 10-20 mM reducing reagent (such as 2-
mercaptoethylamine,
cysteine, or dithioerythritol) at pH < 7. The excess reducing reagent is
removed thoroughly by
size exclusion chromatography or dialysis. The purified and reduced antibody
(or its fragment)
is then incubated with the micelles of thiol-reactive lipopolymers at a molar
ratio of 1:4. At the
end of the reaction, the excess maleimide groups are quenched by a small
amount of cysteine
(1 mM) or mercaptoethanol. Unconjugated antibody (or its fragment) is removed
by size
exclusion chromatography. Purified conjugated micelles is then incubated with
liposome at 37
C or elevated temperature.
Physical Characteristics of the Nanoparticles
Dose response study of HGP (pentaglutamated pemetrexed) and liposomes.
[00464] Cell viability was determined by CellTiter-GloO(CTG) luminescent
cell viability
assay on Day 3 (48 hour) and Day 4 (72 hour). This assay determines the number
of viable
cells in culture based on quantifying ATP that was present within, which in
turn signals the
presence of metabolically active cells. The CTG assay uses luciferase as a
readout. To assess
cell viability Dose response inhibition of pemetrexed, HGP and liposomes on
different cancer
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 261 -
cell growth were investigated using CellTiter-Glo0 luminescent cell viability
assay. Human
cancer cells were harvested, counted and plated at a same cell density on Day
0. A series of 8
dilutions of each test article were added to the cells on Day 1. Dose response
curve were
generated and fit using GraphPad Prism and IC50 of each test article were
calculated. A lower
the IC50 is, the more potent the test article was in term of cancer cell
growth inhibition.
[00465] Cells were seeded into 96-well plate at a cell density of 5 x 104
cells per well in 100 .1
of fresh media on Day 0. Eight serial 2-fold dilutions of each test article in
culture medium
were generated and added to cells in triplicate on Day 1. In addition, three
wells of cells were
treated with vehicle (HBS for free drug or empty liposome for liposomal HGP)
alone as a
control.
[00466] On Days 3 and 4, 1000 of CellTiterGlo Reagent were added to each
well and
incubated at room temperature for 15 minutes. Luciferase luminescence were
recorded for each
well. In addition, 8 serial 2-fold dilutions of the vehicle (HBS or empty
liposome) in culture
medium were added into empty wells and included in the assay to generate the
background
luminescence signals. Luciferase signals were normalized by subtracting the
background
luminescence signal out of the read-outs respectively.
[00467] Human Normal Primary Bone Marrow CD34+ Cells were obtained from
ATCC.
(ATCC Catalog Number PCS-800-012). Cells were thawed at 37 C for 1 minute and
then
placed on ice. The cells were then resuspended in StemSpan SFEM (Stem Cell
Tech Catalog
Number 9650) plus 10% heat inactivated fetal bovine serum (Corning 35-015-CV).
The cells
were plated into 96 well culture plates at a density of 2.5x104 cells/well.
The following day,
live cells were collected via centrifugation and resuspended in neutrophil
growth media
(StemSpan SFEM plus 10% Heat Inactivated fetal bovine serum plus 100 ng/ml
human stem
cell factor (Sigma Catalog Number H8416), 20ng/m1 human granulocyte colony-
stimulation
factor (Sigma Catalog Number H5541), and lOng/m1 human recombinant IL3 (Sigma
SRP3090) at a density of 2.5x104 cells/well. Cells were incubated at 37 C for
10 days. Fresh
media was added every two days. Mature neutrophils were then collected and
plated in 96
well plates at a density of lx104 cells/well and incubated at 37 C overnight.
The next day,
test article or vehicle was resuspended in neutrophil growth media and added
to the plates. The
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 262 -
cells were then incubated for either 48 hours or 72 hours at 37 C and then
assayed at each time
point using the Cell Titer Glo Assay (Promega Catalog #G7572).
[00468] Methodologies used for cell line AML12 (non-cancerous liver cells)
and CCD841
(non-cancerous colon epithelial cells) are similar to the methods used for
cancer cells.
Results
[00469] The dose response relationship of free pemetrexed gamma
hexaglutamate (gG6), (non-
targeted) liposomal gamma hexaglutamate (liposomal gG6), pemetrexed and folate
receptor
alpha targeting antibody (FR1Ab) liposomal pemetrexed gamma hexaglutamate
(liposomal
gG6-FR1Ab), in the NCI H2342 non-small cell lung cancer (NSCLC),
adenocarcinoma
subtype is shown in FIG 2. The output is percentage of viable cells after 48
hours of treatment
as measured by luciferase luminescence. As shown in FIG. 2, the free
pemetrexed gG6
appears to be the least potent as measured by IC50. Both the liposomal
pemetrexed gG6 and
the liposomal pemetrexed gG6-FR1Ab are 7-fold and 40-fold more potent,
respectively, than
free pemetrexed.
[00470] Similar data is shown for the HT-29 colon cancer cell line in FIG.
3 that depict cell
viability expressed as a percentage. As shown in this figure, free pemetrexed
gG6 appears to
be the least potent. In this instance, the liposomal pemetrexed gG6 is twice
as potent as
pemetrexed and the liposomal pemetrexed gG6-FR1Ab is 5-fold more potent than
free
pemetrexed.
Example 3: Polyglutamated Antifolate ¨Cisplatin Complexes (PGPD)
Methods
[00471] Folate Analogs also known as antifolates have been an important
anticancer treatment
for the last 70 years. Used in this setting this class of anti-cancer drugs
interferes with various
enzymes in the important folate metabolic pathway. This can result in impaired
pyrimidine
and purine (DNA and RNA) synthesis, impaired amino acid glycine and serine
metabolism,
impaired redox response and impaired methylation processes within the cell.
[00472] In clinical practice, antifolates such as pemetrexed is often used
in combination with
platinum agents such as cisplatin and carboplatin. The combinations result in
enhanced
efficacy. In this context, we set out to coencapsulated the polyglutamates
with platinum agents
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 263 -
in a specific ratio to facilitate controlled delivery of a predetermined ratio
of the two anticancer
drugs namely a polyglutamated pemetrexed and a platinum analog. We
surprisingly discovered
that long forms of polyglutamate pemetrexed (e.g., pentaglutamated pemetrexed)
forms a
complex with cisplatin that is stable at high pH, and that this complex
disassociates into
polyglutamate and cisplatin at low pH. Low pH is believed to be occur in many
tumor cells
and the tumor cell environment, particularly in hypoxic settings. Application
of this discovery
provides the ability to facilitate the delivery of combinations of yPPMX and
therapeutic agents
such as cisplatin to target cells such as tumor cells and to release the drugs
from the complex
in physiologically relevant low pH conditions.
Production of Polyglutamated pemetrexed ¨ DDAP (Cisplatin) Complexes (PGPD):
[00473] To
produce a polyglutamated pemetrexed complex (Polyglutamated pemetrexed ¨
DDAP Complex), gamma pemetrexed hexaglutamate (aG6) and Diammine dicarboxylic
acid platinum (DDAP) was used. The process of complexation was dependent on
the
presence of chlorinated platinum compound and pH conditions. The complexation
was
achieved by a nucleophilic attack on one or two carboxyl groups of glutamate
by the
platinate derivative. Briefly the complex was formed by the following
procedure. First,
the active compound DDAP was weighed and dissolved in in 5% dextrose. After
the DDAP
dissolution step, aG6 was weighed out and added to the DDAP-Captisol solution
and
allowed to stir for 1 hour at 45 - 550C. The pH of the solution was adjusted
to 6.5 ¨ 7.0
using 1N NaOH and the solution was stirred for 1-2 hour. The formation of
complex was
confirmed visually. However, when the pH is adjusted to acidic pH 3 to 5, the
color
reverted back to its original, indicating the decomplexation of the
polyglutmated
pemetrexed and cisplatin.
[00474]
Complex formation was confirmed using HPLC which showed two distinct peaks
that
merge into 1 large peak at high pH of 6.5 to 7.5 and then reappear at low pH
of 3 to 5.
Repeating the experiment without Captisol showed that complex formation was
independent
of Captisol . FIG. 16 depicts structure of polyglutamate pemetrexed, cisplatin
(CDDP) and
two potential gG6-Cisplatin complexes. The pH dependent formation of the
interstrand and/or
instrastrand coordination between the carboxyl groups of the polyglutamated
pemetrexed and
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 264 -
cisplatin is likely to disassemble into individual molecules of gG6 and
cisplatin upon
encountering acidic pH of lysosomes (pH 3-5) and presence of chloride ions
inside the cells.
Production of Pentaglutamated Pemetrexed-DDAP/CDDP complex (PGPD) Liposomes:
[00475] Briefly PGPD was encapsulated in liposomes by the following
procedure. First, the
lipid components of the liposome membrane was weighed out and combined as a
concentrated
solution in ethanol at a temperature of around 65 C. In this example, the
lipids used were
hydrogenated soy phosphatidylcholine, cholesterol, and DSPE-PEG-2000 (1,2-
distearoyl-sn-
glycero-3-phosphoethanolamine-N4methoxy(polyethylene glycol)-2000]). The molar
ratio of
HSPC: Cholesterol: PEG-DSPE was approximately 3:2:0.15. Next, PGPD was
prepared as
described above. The PGPD drug solution was heated up to 65 C. The ethanolic
lipid solution
was injected into the PGPD solution using a small-bore needle. During this
step the drug
solution was well stirred using a magnetic stirrer. The mixing was performed
at an elevated
temperature (63 C -72 C) to ensure that the lipids were in the liquid
crystalline state (as
opposed to the gel state that they attain at temperatures below the lipid
transition temperature
Tm = 51 C -54 C). As a result, the lipids were hydrated and formed multiple
bilayer
(multilamellar) vesicles (MLV) containing PGPD in the aqueous core.
Downsizing of MLV' s Using Filter Extrusion:
[00476] The MLVs were fragmented into unilamellar (single bilayer) vesicles
of the desired
size by high-pressure extrusion using two passes through stacked (track-etched
polycarbonate)
membranes. The stacked membranes have two layers with a pore size of 200 nm
and six layers
with a pore size of 100 nm. During extrusion, the temperature was maintained
above the Tm
to ensure plasticity of the lipid membranes. Because of the extrusion, large
and heterogeneous
in size and lamellarity MLVs turn into small, homogenous (90 -120 nm)
unilamellar vesicles
(ULV) that sequester the drug in their interior. A Malvern Zetasizer Nano ZS
instrument
(Southborough, MA) with back scattering detector (90 ) was used for measuring
the
hydrodynamic size (diameter) at 25 C in a polystyrene micro cuvette. The
samples were
diluted 50-fold in formulation matrix before analysis.
Purification of liposomes:
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 265 -
[00477] After the ULV's containing PGPD had been produced, the extra-
liposomal PGPD was
removed using columns for small volume or tangential flow diafiltration
against a suitable
buffer for large volume. Although many different buffers known in the art
could have been
used, in this example the buffer used was 5 mM HEPES, 145 mM Sodium Chloride,
pH 6.7.
Upon completion of purification, filter sterilization was performed using a
0.22-micron filter.
Example 4: In vivo studies
[00478] The following example describes in vivo efficacy and toxicity data
obtained upon
administering alpha G6 (Lp- aG6) (alpha polyglutamated pemetrexed) in an in-
vivo (murine)
model. Those skilled in the art will appreciate that the efficacy and reduced
toxicity observed
for liposomal alpha polyglutamated pemetrexed compositions is expected to also
be observed
upon administration of the counterpart liposomal gamma polyglutamated
pemetrexed (gamma
G6 (Lp- gG6) under the same conditions, albeit at possibly different levels.
Methods:
Safety Studies in Mice
[00479] Because some of the major toxicities associated with a pemetrexed
based treatment
are hematologic and hepatic, it is important to evaluate the effect of
Liposomal alpha G6 (Lp-
aG6) in an in-vivo (murine) model and compare the changes in hematologic and
the liver
serum chemistry panel following treatment. To obtain this data an initial dose
ranging study
was conducted using healthy female BALB/c mice (6-8 weeks old) which were
purchased
from The Jackson Laboratory (Bar Harbor, ME). Prior to the study, animals were
weighed,
randomized by weight, observed for clinical abnormalities, and distributed
into groups (5
mice per group). Doses from 10 mg/kg up to 200 mg/kg were investigated to
identify a
tolerable dose in mice. Treatments were administrated intravenously once a
week for four
weeks. Body weight and detailed clinical observation were recorded daily. At
the end of study,
Day 28, mice were euthanized, and blood and tissue were harvested from
untreated Control
mice and for the mice treated with Liposomal aG6 (Lp-aG6) 40 mg/kg and
Liposomal aG6
80 (Lp-aG6) mg/kg. Whole blood was collected into K2-EDTA anticoagulant tubes
for
comprehensive complete blood count (CBC) and serum was isolated for
comprehensive
chemistry and was sent to 1DEXX (Westbrook, ME) on the day of collection.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 266 -
Results:
[00480] In general, treatment with once weekly liposomal aG6 at two dose
levels of 40 mg/kg
and 80 mg/kg for 4 weeks was well tolerated and there were no major
differences in weight
compared to untreated controls. To assess some of the effects on hematologic
parameters,
white blood cell (WBC) counts, neutrophil counts as well as platelet counts
were measured
after treatment with liposomal aG6 at two dose levels of 40 mg/kg and 80 mg/kg
both given
once weekly for 4 weeks. As can be seen in FIG. 17, there were no appreciable
decreases in
mean neutrophil, mean white blood cell and mean platelet counts, after four
weeks of
treatment with Liposomal aG6 in treated animals compared to untreated control
animals.
Hemoglobin and reticulocyte indices were measured to assess the impact on red
blood cell.
As shown in FIG. 18, there was a minimal decrease in mean hemoglobin
concentrations at
the higher dose level. In parallel there is a slight increase in mean
reticulocytosis indices
which suggests a bone marrow's response to treatment by increasing red blood
cell
production. Altogether this effect seems minor as the mice hemoglobin levels
are maintained
after 4 weeks of treatment. Taken together these data suggest that at these
dose levels, 40
mg/kg and 80 mg/kg once-weekly, there is little impact on the bone marrow and
related
hematologic indices.
[00481] Another concern with pemetrexed is hepatic toxicity that has been
observed in some
patients treated with pemetrexed based therapy. To assess hepatic well being
in mice serum
chemistries including serum aspartate transaminase (AST) and serum alanine
transaminase
(ALT) along with serum albumin were measured. As shown in FIG. 19, there were
no
appreciable increases in liver transaminases mean AST and mean ALT levels at 4
weeks
following treatment with Liposomal aG6 at the two dose levels of 40 mg/kg and
80 mg/kg
both given once weekly for 4 weeks when compared to untreated controls. There
was no
change in mean albumin levels either. Taken together these data suggest a
favorable safety
profile for Liposomal aG6.
Preliminary Pilot Efficacy Study in Mice Xenografts
[00482] To assess whether there was any tumor control following treatment
with Liposomal
alpha G6 (Lp-aG6) the pilot study was conducted. In this study immunodeficient
female Nude
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 267 -
mice (Nun; 6-8 weeks old) were purchased from The Jackson Laboratory (Bar
Harbor, ME).
NCI-H292 (Non-Small Cell Lung Cancer) cells were cultured in RPMI media
supplemented
with 10% Fetal Bovine Serum in a 37 C, 5% CO2 incubator. 1 X 106 cells were
inoculated
subcutaneously into the dorsal hind flank of each mouse. Tumor volume and body
weight
were monitored twice every week. Tumor-bearing mice were randomized by tumor
volume
on Day 0 and distributed into groups (5 mice per group): Control, pemetrexed,
and Liposomal
aG6. Pemetrexed was given intravenously at 167 mg/kg once every three weeks.
This murine
dose of 167 mg/kg every three weeks is equivalent to the FDA/EMA approved
human dose
and schedule of 500 mg/m2 every three weeks. Liposomal aG6 was dosed
intravenously at
80 mg/kg once a week for four weeks. Tumor size was measured with a caliper
and tumor
burden is calculated using the following equations: tumor volume=0.5x (tumor
length) x
(tumor width)2; Relative tumor volume=(tumor volume/tumor volume on Day 0)
x100%. This
study is still ongoing but preliminary data are shown in FIG. 20. In this
figure, relative tumor
volume is displayed following treatment with Liposomal aG6 and pemetrexed. As
can be seen
from these preliminary data, liposomal aG6 provides better tumor control when
compared to
pemetrexed.
Further embodiments:
[00483] In a non-limiting embodiment, of this disclosure, there is provided
a composition
comprising gamma polyglutamated Antifolate.
[00484] In the composition of the immediately preceding paragraph, the
composition may
comprise pentaglutamated or hexaglutamated Antifolate.
[00485] In the composition according to any of the preceding two
paragraphs, the composition
may comprise gamma polyglutamated Antifolate which may include pentaglutamated
or
hexaglutamated Antifolate.
[00486] A non-limiting example liposomal gamma polyglutamated Antifolate (L-
yPANTIFOL) composition may comprise a composition according to any of the
preceding
three paragraphs and the lipo some may be optionally pegylated (PL-yPANTIFOL).
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 268 -
[00487] In the L-yPANTIFOL or PL-1/PANTIFOL composition of the immediately
preceding
paragraph, the gamma polyglutamated Antifolate may include pentaglutamated or
hexaglutamated Antifolate.
[00488] In the Ll/PANTIFOL or PL-yPANTIFOL composition according to any of
the
preceding two paragraphs, the liposome may be anionic or neutral.
[00489] In the Li/PANTIFOL or PL-yPANTIFOL composition according to any of
the
preceding three paragraphs, a targeting moiety may be attached to one or both
of a PEG and
the exterior of the liposome, and the targeting moiety may have a specific
affinity for a surface
antigen on a target cell of interest (TL-yPANTIFOL or TPL-yPANTIFOL).
[00490] In the Ll/PANTIFOL or PL-yPANTIFOL composition according to any of
the
preceding four paragraphs, a targeting moiety may be attached to one or both
of a PEG and the
exterior of the liposome and may be a polypeptide.
[00491] In the Ll/PANTIFOL or PL-yPANTIFOL composition according to any of
the
preceding five paragraphs, a targeting moiety may be attached to one or both a
PEG and the
exterior of the lipo some and may be an antibody or a fragment of an antibody.
[00492] In the Li/PANTIFOL or PL-yPANTIFOL composition according to any of
the
preceding six paragraphs, one or more of an immunostimulatory agent, a
detectable marker
and a maleimide may be disposed on at least one of a PEG and the exterior of
the liposome.
[00493] In the Li/PANTIFOL or PL-yPANTIFOL composition according to any of
the
preceding seven paragraphs, a polypeptide may bind an antigen with an
equilibrium
dissociation constant (Kd) in a range of 0.5 x 10-10 to 10 x 10-6 as
determined using
BIACORE analysis.
[00494] In the L-7PANTIFOL or PL-yPANTIFOL composition according to any of
the
preceding eight paragraphs, a polypeptide may specifically bind one or more
folate receptors
selected from: folate receptor alpha (FR-a), folate receptor beta (FR-(3), and
folate receptor
delta (FR-6).
[00495] A non-limiting exemplary method of killing a hyperproliferative
cell that includes
contacting a hyperproliferative cell with a liposomal gamma polyglutamated
Antifolate
composition according to any of the preceding nine paragraphs.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 269 -
[00496] In
the method of the immediately preceding paragraph, the hyperproliferative cell
is a
cancer cell.
[00497] A
non-limiting example method for treating cancer comprises administering an
effective amount of the gamma polyglutamated Antifolate composition according
to any of
preceding paragraphs from preceding paragraph eleven to preceding paragraph
three, to a
subject having or at risk of having cancer.
[00498] In
the method of the immediately preceding paragraph, the cancer may be one or
more selected from: lung cancer, pancreatic, breast cancer, ovarian cancer,
lung cancer,
prostate cancer, head and neck cancer, gastric cancer, gastrointestinal
cancer, colon cancer,
esophageal cancer, cervical cancer, kidney cancer, biliary duct cancer,
gallbladder cancer, and
a hematologic malignancy. In some embodiments, the cancer is lung cancer
(e.g., NSCLC or
mesothelioma). In some embodiments, the cancer is breast cancer (e.g., HER2++
or triple
negative breast cancer). In some embodiments, the cancer is colorectal cancer.
In some
embodiments, the cancer is ovarian cancer. In some embodiments, the cancer is
endometrial
cancer. In some embodiments, the cancer is pancreatic cancer. In some
embodiments, the
cancer is liver cancer. In some embodiments, the cancer is head and neck
cancer. In some
embodiments, the cancer is osteosarcoma.
[00499] A
non-limiting example maintenance therapy for subjects that are undergoing or
have
undergone cancer therapy includes administering an effective amount of the
gamma
polyglutamated Antifolate composition according to any of preceding paragraphs
from
preceding paragraph thirteen to preceding paragraph five, to a subject that is
undergoing or has
undergone cancer therapy.
[00500] A
non-limiting example pharmaceutical composition may include any gamma
polyglutamated Antifolate composition according to Section II.
[00501] A
non-limiting example method for treating a disorder of the immune system may
include administering an effective amount of the of the gamma polyglutamated
Antifolate
composition according to any of preceding paragraphs from preceding paragraph
fourteen to
preceding paragraph six, to a subject having or at risk of having a disorder
of the immune
system.
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
- 270 -
[00502] A non-limiting example method for treating an infectious may
include comprises
administering an effective amount of the of the gamma polyglutamated
Antifolate composition
according to any of preceding paragraphs from preceding paragraph fifteen to
preceding
paragraph seven, to a subject having or at risk of having an infectious
disease.
[00503] A non-limiting example method of delivering gamma polyglutamated
Antifolate to a
tumor expressing a folate receptor on its surface may include administering a
polyglutamated
Antifolate composition according to any of preceding paragraphs from preceding
paragraph
sixteen to preceding paragraph eight, to a subject having the tumor in an
amount to deliver a
therapeutically effective dose of the gamma polyglutamated Antifolate to the
tumor.
[00504] A non-limiting example method of preparing a liposomal gamma
polyglutamated
Antifolate composition which includes gamma polyglutamated Antifolate
composition
according to any of preceding paragraphs from preceding paragraph seventeen to
preceding
paragraph nine includes forming a mixture comprising: liposomal components;
gamma
polyglutamated Antifolate in solution; homogenizing the mixture to form
liposomes in the
solution; and processing the mixture to form liposomes containing the
polyglutamated
Antifolate.
[00505] A non-limiting example pharmaceutical composition includes a gamma
polyglutamated Antifolate composition according to any of preceding paragraphs
from
preceding paragraph eighteen to preceding paragraph ten.
[00506] Although the disclosure has been described with reference to
various some
embodiments, it should be understood that various modifications can be made
without
departing from the spirit of the disclosure. Accordingly, the scope of the
disclosure should be
determined with reference to the appended claims, along with the full scope of
equivalents to
which such claims are entitled. Throughout this application, various
publications are
referenced by author name and date, or by Patent No. or Patent Publication No.
The disclosure
of these publications are hereby incorporated in their entireties by reference
into this
application in order to more fully describe the state of the art as known to
those skilled therein
as of the date of the invention described and claimed herein. However, the
citation of a
CA 03090505 2020-08-05
WO 2019/157148 PCT/US2019/017004
-271 -
reference herein should not be construed as an acknowledgement that such
reference is prior
art to the present invention.
[00507]
Various new chemical entities, methods and equipment for making these chemical
entities are set forth below in the appended claims. It is to be appreciated
that the Detailed
Description section, and not the Summary and Abstract sections, is intended to
be used to
interpret the claims. The Summary and Abstract sections may set forth one or
more but not all
exemplary embodiments, of the present invention as contemplated by the
inventor(s), and thus,
are not intended to limit the present invention and the appended claims in any
way.
[00508]
The disclosure of each of U.S. Appl. No. 62/627,732, filed 2/7/2018; U.S.
Appl.
No. 62/627,733, filed 2/7/2018; U.S. Appl. No. 62/630,613, filed 2/14/2018;
U.S. Appl. No.
62/630,620, filed 2/14/2018; U.S. Appl. No. 62/630,625, filed 2/14/2018; U.S.
Appl. No.
62/630,652, filed 2/14/2018; U.S. Appl. No. 62/630,751, filed 2/14/2018; U.S.
Appl. No.
62/630,824, filed 2/14/2018; U.S. Appl. No. 62/636,289, filed 2/28/2018; U.S.
Appl. No.
62/662,372, filed 4/25/2018; U.S. Appl. No. 62/702,774, filed 7/24/2018; U.S.
Appl. No.
62/702,779, filed 7/24/2018; U.S. Appl. No. 62/764,945, filed 8/17/2018; and
U.S. Appl. No.
62/764,951, filed 8/17/2018; is herein incorporated by reference in its
entirety.
