CA 03091136 2020-08-11
1
DESCRIPTION
TITLE OF INVENTION
METHOD FOR PRODUCING LOW-ANTIGENIC CELL
Technical Field
.. [0001]
The present invention relates to a method for producing a low-antigenic cell.
More specifically, the present invention relates to a method for producing a
low-antigenic
cell, a kit for detecting a low-antigenic cell, a cell, a gRNA, and a method
for specifying
a target base sequence. Priority is claimed on Japanese Patent Application No.
2018-
026421, filed February 16, 2018, the content of which is incorporated herein
by
reference.
Background Art
[0002]
In a case of allogeneic transplantation in which donor cells are transplanted
into
a recipient (patient) who is the other person, transplanted cells are rejected
due to an
immune reaction.
[0003]
A protein that plays the most important role in distinguishing between self
cells
and non-self cells is a cell surface protein called a human leukocyte antigen
(HLA) or a
major histocompatibility complex (MHC).
[0004]
HLA is classified into class I and class II. Class I HLA proteins are
expressed
in most cell types in a body. The class I HLA protein has a function of
forming a
.. heterodimer with132-Microglobulin (B2M) to be expressed on a cell surface,
and
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
2
presenting a peptide with respect to CD8-positive cytotoxic T cells to induce
activation.
The antigenic peptides presented are endogenous and have a length of 8 to 10
amino
acids in many cases.
[0005]
Genes classified into class I HLA are mainly six genes of an HLA-A gene, an
HLA-B gene, an HLA-C gene, an HLA-E gene, an HLA-F gene, and an HLA-G gene.
In addition, many pseudogenes (HLA-H, HLA-J, HLA-K, HLA-L, HLA-P, HLA-T,
HLA-U, HLA-V, HLA-W, HLA-X, HLA -Y, and the like) are also known. Among the
genes, three genes of the HLA-A gene, HLA-B gene, and HLA-C gene have
particularly
great sequence diversity among individuals and play a major role in
identifying self cells
and non-self cells in transplantation immunity.
[0006]
Class II HLA proteins are mainly expressed in immune cells such as
macrophages, dendritic cells, activated T cells and B cells, and the like. The
class II
HLA protein has a function of forming a heterodimer with an a chain and a 13
chain and
presenting a peptide with respect to CD4 helper T cells to induce activation.
The
antigenic peptides presented are exogenous and have a length of 15 to 24 amino
acids in
many cases.
[0007]
Genes classified into class II HLA are HLA-DR (a chain: HLA-DRA, 13 chain:
HLA-DRB), HLA-DQ (a chain: HLA-DQA1, f3 chain: HLA-DQB1), HLA-DP (a chain:
HLA-DPA1 or HLA-DPA2, 13 chain: HLA-DPB1 or HLA-DPB2). In addition, many
pseudogenes (HLA-DMA, HLA-DMB, HLA-DOA, HLA-DOB) are also known to exist.
[0008]
HLA genes have sequence diversity and thus are involved in recognition of self
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
3
and non-self cells at the cellular level. HLA matching is also particularly
important for
reducing immune rejection during allogeneic transplantation. For example, in
transplantation of hematopoietic stem cells, it is recommended to find and
transplant
donors in which antigenicities in both alleles of HLA-A, HLA-B, HLA-C, and HLA-
DR,
that is, alleles at a total of 8 loci, are as consistent as possible.
[0009]
In addition, in consideration of results of engraftment rates of kidney
transplantation and the like, it has been reported that, as the degree of
consistency of
HLA antigenicity becomes high, engraftment efficiency becomes significantly
high.
[0010]
There is also an immune system induced by the absence of HLA antigens on a
cell surface. NK cells express multiple inhibitory receptors. For example, it
is known
that a complex receptor of CD94 and NKG2A, which recognizes HLA-E and inhibits
the
action of NK cells, induces activation of NK cells when a cell without HLA-E
is found,
and attacks the cells. In addition, there is also a receptor family called
Killer cell
lmmunoglobulin-like Receptor (KIR), which is classified into 2D and 3D
according to
the number of extracellular domains, and is also divided into L (long) and S
(short)
depending on lengths of intracellular domain. It is known that a 2DL1 receptor
recognizes HLA-C2, 2DL2 and 2DL3 receptors recognize HLA-C1, a 2DL4 receptor
recognizes HLA-G, a 3DL1 recognizes HLA-Bw4, and a 3DL2 recognizes HLA-A3 or
HLA-All to inhibit activity of NK cells. There are polymorphisms in KIR, and
for
example, almost all Japanese (98% or more) have 2DL1, 2DL3, or 3DL4, but it
has been
reported that a proportion of persons having 2DL2 is about 15%, which is rare.
[0011]
In addition, because pluripotent stem cells such as iPS cells and ES cells
have
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
4
pluripotency capable of differentiating into various cell types, cell therapy
and
regenerative medicine in which pluripotent stem cells are differentiated into
various cells
and then transplanted to patients are attracting attention.
[0012]
There have been reported cases in which ES cells are differentiated into nerve
cells and transplanted into a bone marrow injury patient, and cases in which
iPS cells are
differentiated into retinal pigment epithelial cells and transplanted into an
age-related
macular degeneration patient. It has been reported that, in a case of
transplanting such
pluripotent stem cell-derived cells, it is important to match transplanted
cells with an
HLA type of a patient.
[0013]
However, pluripotent stem cells require a great deal of costs and time for
establishment, and thus there is a problem in that it is difficult to prepare
cells with
matching HLA types for each patient. As one means for solving this problem,
for
example, Patent Literature 1 discloses cells deficient in a B2M gene required
for
displaying class 1 HLA proteins on a cell surface.
[0014]
In recent years, by genome editing technology that uses CRISPR-Cas9 and
guide RNA (gRNA), it became possible to insert an arbitrary DNA fragment by
inducing
.. double-stranded DNA breaks (Double strand break, DSB) in genomic DNA
depending on
target base sequences of gRNA to delete part of genomic DNA, and by co-
introducing
Cas9 and gRNA with a template DNA having a partially homologous sequence near
the
double-stranded DNA cleavage induction site.
[0015]
However, DSB induction in the genome editing technique is determined by a
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
spacer base sequence of about 20 bases of gRNA that recognizes and binds to a
target
sequence and by a base sequence called a PAM sequence of about 3 to 5 bases.
Accordingly, unless a base sequence of gRNA matches a base sequence of a
target site,
efficient DSB induction is difficult.
5 [0016]
In addition, a risk is known, in which, in a case where a base sequence that
is
very similar to a base sequence of a target site, for example, a base sequence
that differs
by only one base, is present outside the target site, it will induce a DSB to
sites other than
the target site due to errors, resulting in induction of undesired genomic
sequence
mutations.
Citation List
Patent Literature
[0017]
[Patent Literature 1]
PCT International Publication No. W02012/145384
Summary of Invention
Technical Problem
[0018]
Because the cells disclosed in Patent Literature 1 are deficient in a B2M
gene,
class 1 HLA proteins are not displayed on the cell surface. Accordingly, it is
considered
that an immune reaction in the case where the cells are allogeneically
transplanted is
inhibited. However, in a case where an HLA protein is not displayed on the
cell
surface, an antigen-presenting ability of the cell is lost. In a case where
the cell loses its
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
6
antigen-presenting ability, a B2M-deficient cell cannot present virus- or
tumor-derived
antigens when they are infected with viruses or the like or when they become
tumors, and
as a result, there is a risk in which it may help growth of viruses and
tumors. In
addition, a cell in which an HLA protein is not presented on the cell surface
is attacked
by NK cells that recognize "missing self."
[0019]
Accordingly, it is possible to selectively disrupt only an arbitrary HLA gene
by
using the genome editing technique. However, there are multiple HLA genes, and
there
is a high degree of sequence homology between HLA genes, including many
pseudogenes. In addition, because sequence diversity among individuals is
large even
with the same HLA genes, even when a target base sequence that matches a
certain HLA
gene sequence is identified, it cannot always be used in cells derived from
other donors.
For this reason, it is not easy to determine an appropriate target sequence
for genome
editing. Furthermore, in the genome editing technique of the related art, it
takes a great
deal of time to search for a cell in which a desired genome has been edited.
[0020]
An object of the present invention is to provide a technique for producing a
low-
antigenic cell in which a rejection reaction is reduced in a case where the
cell is
allogeneically transplanted into a recipient.
Solution to Problem
[0021]
The present invention includes the following aspects.
[1] A method for producing, from a donor cell, a low-antigenic cell in which a
rejection reaction is reduced in a case where the cell is allogeneically
transplanted into a
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
7
recipient, the method including: determining human leukocyte antigen (HLA)
alleles for
the donor cell and the recipient, respectively; specifying an HLA allele that
is present in
the donor cell but is not present in the recipient; and disrupting or
modifying the
specified HLA allele to obtain a cell population including a cell not
expressing an HLA
protein specific to the donor cell, in which the cell not expressing the HLA
protein
specific to the donor cell is the low-antigenic cell.
[2] The production method according to [1], in which the HLA allele determined
in the determining the HLA alleles for the donor cell and the recipient,
respectively,
includes an HLA-A allele, an HLA-B allele, and an HLA-C allele.
[3] The production method according to [1] or [2], further including:
recovering
the cell not expressing the HLA protein specific to the donor cell from the
cell population
after the obtaining of the cell population including the cell not expressing
the HLA
protein specific to the donor cell, in which the recovering includes bringing
the cell
population into contact with an HLA protein expression-inducing agent, and
recovering
the cell not expressing the HLA protein specific to the donor cell from the
cell population
using, as an index, expression of the HLA protein specific to the donor cell
in the cell
population brought into contact with the HLA protein expression-inducing
agent.
[4] The production method according to [3], in which the HLA protein
expression-inducing agent is interferon (IFN)-y, IFN-a, IFN-f3, interleukin
(IL)-4,
.. granulocyte macrophage colony-stimulating factor (GM-CSF), transforming
growth
factor (TGF)-a, or TGF-f3.
[5] The production method according to any one of [1] to [4], in which the low-
antigenic cell is a pluripotent stem cell.
[6] A kit for detecting a low-antigenic cell in which a rejection reaction is
reduced in a case where the cell is allogeneically transplanted into a
recipient, the kit
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
8
comprising an HLA protein expression-inducing agent.
[7] The kit according to [6], in which the HLA protein expression-inducing
agent is IFN-y, IFN-a, IFN-(3, IL-4, GM-CSF, TGF-a, or TGF-13.
[8] The kit according to [6] or [7], in which the low-antigenic cell is a
pluripotent stem cell.
[9] An HLA protein expression-inducing agent consisting of IFN-y, IFN-a, IFN-
I3, IL-4, GM-CSF, TGF-a, or TGF-I3.
[10] A cell in which at least one HLA allele is disrupted or modified and at
least
one kind of HLA protein can be expressed.
[11] The cell according to [10], in which the HLA allele includes an HLA-A
allele, an HLA-B allele, or an HLA-C allele.
[12] The cell according to [10] or [11], which is a low-antigenic cell in
which a
rejection reaction is reduced in a case where the cell is allogeneically
transplanted into a
recipient, and in which the disrupted or modified HLA allele is an HLA allele
that is not
.. present in the recipient.
[13] The cell according to any one of [10] to [12], which is a pluripotent
stem
cell.
[14] The cell according to any one of [10] to [13], in which at least one
allele of
a class II major histocompatibility complex transactivator (CIITA) allele, a
regulatory
factor X5 (RFX5) allele, a regulatory factor X associated protein (RFXAP)
allele, or a
regulatory factor X associated ankyrin containing protein (RFXANK) allele is
further
disrupted or modified.
[15] The cell according to any one of [10] to [14], in which the HLA-A allele
and the HLA-B allele are disrupted and at least one kind of HLA-C protein can
be
expressed.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
9
[16] The cell according to [15], in which the HLA-C protein is a protein
encoded
by one kind of allele selected from the group consisting of an HLA-C*01:02
allele, an
HLA-C*02:02 allele, an HLA-C*03:03 allele, an HLA-C*03:04 allele, an HLA-
C*04:01
allele, an HLA-C*05:01 allele, an HLA-C*06:02 allele, an HLA-C*07:01 allele,
an
HLA-C*07:02 allele, an HLA-C*08:01 allele, an HLA-C*12:02 allele, and an HLA-
C*16:01 allele.
[17] A method for producing, from a donor cell, a low-antigenic cell in which
a
rejection reaction is reduced in a case where the cell is allogeneically
transplanted into a
recipient, the method including: disrupting or modifying an allele including
at least one
of a OITA allele, an RFX5 allele, an RFXAP allele, and an RFXANK allele of the
donor
cell, in which a cell in which the CIITA allele, the RFX5 allele, the RFXAP
allele, or the
RFXANK allele is disrupted or modified is the low-antigenic cell.
[18] A cell according to [17], in which the low-antigenic cell is a
pluripotent
stem cell.
[19] A cell in which an allele including at least one of a CIITA allele, an
RFX5
allele, an RFXAP allele, and an RFXANK allele is disrupted or modified.
[20] The cell according to [19], which is a pluripotent stem cell.
[21] A gRNA targeting, as a target base sequence, a base sequence that is
mapped to only one target HLA haplotype in a case where the base sequence is
mapped
to base sequence data of genomic DNA of all HLA haplotypes, but that is not
mapped in
a case where the base sequence is mapped to base sequence data of all genomic
DNA
except for HLA alleles.
[22] The gRNA according to [21], in which the target base sequence consists of
a base sequence set forth in any of SEQ ID NOs: 3, 4, 7, 45 to 52, and 72 to
2459, or a
base sequence in which one or several bases are deleted, substituted, or added
at a 5' end
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
of a base sequence set forth in any of SEQ ID NOs: 3, 4, 7, 45 to 52, and 72
to 2459.
[23] The gRNA according to [21] or [22], in which the target base sequence
consists of a base sequence set forth in any of SEQ ID NOs: 3, 4, 7, and 45 to
52, or a
base sequence in which one or several bases are deleted, substituted, or added
at a 5' end
5 of a base sequence set forth in any of SEQ ID NOs: 3, 4, 7, and 45 to 52.
[24] The gRNA according to any one of [21] to [23], in which the target base
sequence is mapped to an exon 2 or 3 of an HLA gene.
[25] A gRNA targeting, as a target base sequence, a base sequence that is
mapped to two or more target HLA haplotypes in a case where the base sequence
is
10 mapped to base sequence data of genomic DNA of all HLA haplotypes, but
that is not
mapped in a case where the base sequence is mapped to base sequence data of
all
genomic DNA except for HLA alleles.
[26] The gRNA according to [25], in which the target base sequence consists of
a base sequence set forth in any of SEQ ID NOs: 53 to 55 and 2460 to 8013, or
a base
sequence in which one or several bases are deleted, substituted, or added at a
5' end of a
base sequence set forth in any of SEQ ID NOs: 53 to 55 and 2460 to 8013.
[27] The gRNA according to [25] or [26], in which the target base sequence
consists of a base sequence set forth in any of SEQ ID NOs: 53 to 55, or a
base sequence
in which one or several bases are deleted, substituted, or added at a 5' end
of a base
.. sequence set forth in any of SEQ ID NOs: 53 to 55.
[28] The gRNA according to any one of [25] to [27], in which the target base
sequence is mapped to an exon 2 or 3 of an HLA gene.
[29] A method for specifying a target base sequence for producing, by genome
editing, a low-antigenic cell in which a rejection reaction is reduced in a
case where the
cell is allogeneically transplanted into a recipient, the method including:
mapping a
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
11
candidate base sequence to base sequence data of genomic DNA of all HLA
haplotypes;
mapping the candidate base sequence to base sequence data of all genomic DNA
except
for HLA alleles; and specifying, as a target base sequence, the candidate base
sequence
that is mapped to only one target HLA haplotype in a case where the base
sequence is
.. mapped to base sequence data of genomic DNA of all HLA haplotypes, but that
is not
mapped in a case where the base sequence is mapped to base sequence data of
all
genomic DNA except for the HLA alleles.
[30] A method for specifying a target base sequence for producing, by genome
editing, a low-antigenic cell in which a rejection reaction is reduced in a
case where the
cell is allogeneically transplanted into a recipient, the method including:
mapping a
candidate base sequence to base sequence data of genomic DNA of all HLA
haplotypes;
mapping the candidate base sequence to base sequence data of all genomic DNA
except
for HLA alleles; and specifying, as a target base sequence, the candidate base
sequence
that is mapped to two or more target HLA haplotypes in a case where the base
sequence
is mapped to base sequence data of genomic DNA of all HLA haplotypes, but that
is not
mapped in a case where the base sequence is mapped to base sequence data of
all
genomic DNA except for the HLA alleles.
Advantageous Effects of Invention
[0022]
According to the present invention, it is possible to provide a technique for
producing a low-antigenic cell in which a rejection reaction is reduced in a
case where
the cell is allogeneically transplanted into a recipient.
Brief Description of Drawings
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
12
[0023]
Fig. 1(a) is a Venn diagram showing HLA alleles targeted by sgRNAs extracted
in Experimental Example 1. Fig. 1(b) is a diagram showing which sites of an
HLA-A
allele, an HLA-B allele, and an HLA-C allele sgRNAs identified in Experimental
Example 1 target.
Fig. 2 is a graph showing results of flow cytometry in Experimental Example 2.
Fig. 3 is a graph showing results of flow cytometry in Experimental Example 3.
Fig. 4(a) is a graph showing results of flow cytometry in Experimental Example
4. Fig. 4(b) is a diagram showing a schedule for an IFN-y treatment of iPS
cells and
analysis of an expression level of an FILA-A protein in Experimental Example
4.
Fig. 5(a) is a diagram showing target bases and target sites of sgRNAs in
Experimental Example 6. Fig. 5(b) is a photograph showing results of a T7
endonuclease I assay in Experimental Example 6.
Fig. 6(a) and Fig. 6(b) are graphs showing results of flow cytometry in
Experimental Example 7.
Fig. 7 is a graph showing a proportion of base sequence mutation of each clone
in Experimental Example 7.
Fig. 8(a) and Fig. 8(b) are graphs showing results of flow cytometry in
Experimental Example 8.
Fig. 9(a) and Fig. 9(b) are graphs showing results of flow cytometry in
Experimental Example 8.
Fig. 10(a) is a table showing a base mutation pattern of each clone recovered
in
Experimental Example 8. Fig. 10(b) shows a base sequence of a representative
clone
recovered in Experimental Example 8.
Fig. 11 is a graph showing results of flow cytometry in Experimental Example
9.
Date Regue/Date Received 2020-08-11
CA 03091136 2020-08-11
13
Fig. 12(a) is a table showing a base mutation pattern of each clone recovered
in
Experimental Example 9. Fig. 12(b) shows a base sequence of a representative
clone
recovered in Experimental Example 9.
Fig. 13(a) and Fig. 13(b) are tables showing a base mutation pattern of each
clone recovered in Experimental Example 10. Fig. 13(c) shows a base sequence
of a
representative clone recovered in Experimental Example 10.
Fig. 14(a) is a table showing a base mutation pattern of each clone recovered
in
Experimental Example 11. Fig. 14(b) shows a base sequence of a representative
clone
recovered in Experimental Example 11.
Fig. 15(a) is a graph showing results of flow cytometry in Experimental
Example 11. Fig. 15(b) is a table showing a base mutation pattern of each
clone
recovered in Experimental Example 11. Fig. 15(c) shows a base sequence of a
representative clone recovered in Experimental Example 11.
Fig. 16(a) is a diagram showing target sites of sgRNAs in Experimental
Example 12. Fig. 16(b) and Fig. 16(c) are graphs showing results of flow
cytometry in
Experimental Example 12.
Fig. 17(a) is a table showing a base mutation pattern of a clone recovered in
Experimental Example 12. Fig. 17(b) shows a base sequence of a clone recovered
in
Experimental Example 12.
Fig. 18(a) is a graph showing results of flow cytometry in Experimental
Example 13. Fig. 18(b) and Fig. 18(d) are tables showing a base mutation
pattern of
each clone recovered in Experimental Example 13. Fig. 18(c) and Fig. 18(e)
show a
base sequence of a representative clone recovered in Experimental Example 13.
Fig. 19(a) and Fig. 19(b) are graphs showing results of flow cytometry in
Experimental Example 14. Fig. 19(c) is a table showing a base mutation pattern
of each
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
14
clone recovered in Experimental Example 14. Fig. 19(d) shows a base sequence
of a
representative clone recovered in Experimental Example 14.
Fig. 20(a) is a diagram showing target sites of sgRNAs in Experimental
Example 15. Fig. 20(b) and Fig. 20(c) are graphs showing results of flow
cytometry in
Experimental Example 15.
Fig. 21(a) and Fig. 21(b) are schematic diagrams illustrating homologous
recombination in Experimental Example 16. Fig. 21(c) is a graph showing
results of
flow cytometry in Experimental Example 15.
Fig. 22(a) and Fig. 22(b) are diagrams showing results of analysis of a base
sequence in Experimental Example 16.
Fig. 23(a) and Fig. 23(b) are graphs showing results of flow cytometry in
Experimental Example 17. Fig. 23(c) is a diagram showing results of analysis
of a base
sequence in Experimental example 17.
Fig. 24(a) is a graph showing results of flow cytometry in Experimental
Example 18. Fig. 24(b) is a diagram showing results of analysis of a base
sequence in
Experimental example 18.
Fig. 25(a) to Fig. 25(e) are graphs showing results of flow cytometry in
Experimental Example 19.
Fig. 26(a) to Fig. 26(f) are graphs showing results of flow cytometry in
Experimental Example 20.
Fig. 27(a) to Fig. 27(e) are graphs showing results of flow cytometry in
Experimental Example 21.
Fig. 28 is a schematic diagram showing a procedure of Experimental Example
22.
Fig. 29(a) to Fig. 29(e) are graphs showing results of flow cytometry in
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
Experimental Example 22.
Fig. 30 is a schematic diagram showing a procedure of Experimental Example
23.
Fig. 31 is a graph showing results of Experimental Example 23.
5 Fig. 32 is a graph showing results of Experimental Example 24.
Fig. 33 is a graph showing results of Experimental Example 25.
Fig. 34(a) and Fig. 34(b) are graphs showing results of flow cytometry in
Experimental Example 26. Fig. 34(c) is a graph showing results of Experimental
Example 26.
10 Fig. 35(a) to Fig. 35(g) are graphs showing results of flow cytometry in
Experimental Example 27.
Fig. 36 is a graph showing results of Experimental Example 28.
Fig. 37(a) to Fig. 37(f) are phase-contrast micrographs showing results of
Experimental Example 29.
15 Fig. 38(a) to Fig. 38(f) are phase-contrast micrographs showing results
of
Experimental Example 30.
Fig. 39(a) and Fig. 39(b) are graphs showing results of flow cytometry in
Experimental Example 31. Fig. 39(c) is a graph showing results of Experimental
Example 31.
Fig. 40(a) and Fig. 40(b) are graphs showing results of flow cytometry in
Experimental Example 32. Fig. 40(c) is a graph showing results of Experimental
Example 32.
Fig. 41(a) is a diagram illustrating an experimental schedule in Experimental
Example 33. Fig. 41(b) shows a photograph showing results of capturing
fluorescence
of ER-derived blood-cell-like cells in Experimental Example 33. Fig. 41(c) is
a graph
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
16
showing a survival rate of the EB-derived blood-cell-like cells in
Experimental Example
33.
Fig. 42(a) is a graph showing results of flow cytometric analysis in
Experimental Example 34. Fig. 42(b) is a graph showing results of Experimental
.. Example 34.
Fig. 43(a) is a graph showing results of flow cytometric analysis in
Experimental Example 35. Fig. 43(b) is a graph showing results of Experimental
Example 35.
Fig. 44(a) and Fig. 44(b) are graphs showing results of flow cytometric
analysis
in Experimental Example 36.
Fig. 45(a) is a diagram illustrating an experimental schedule in Experimental
Example 37. Fig. 45(b) shows a photograph showing results of capturing
fluorescence
of EB-derived blood-cell-like cells in Experimental Example 37. Fig. 45(c) is
a graph
showing a relative survival rate of the EB-derived blood-cell-like cells in
Experimental
Example 37.
Fig. 46 is a graph showing results of Experimental Example 38.
Fig. 47(a) is a table showing an HLA haplotype of 585A1-C7 residual cells used
in Experimental Example 39, and an HLA haplotype of 585A1-C7 residual cells in
which
a CIITA gene was knocked out and which were produced in Experimental Example
39.
Fig. 47(b) is a table showing a base mutation pattern of each clone obtained
in
Experimental Example 39. Fig. 47(c) shows a base sequence of a representative
clone
obtained in Experimental Example 39.
Fig. 48(a) to Fig. 48(d) are graphs showing results of flow cytometry in
Experimental Example 40.
Fig. 49(a) to Fig. 49(c) are graphs showing results of flow cytometry in
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
17
Experimental Example 41.
Fig. 50(a) to Fig. 50(c) are diagrams illustrating a procedure of Experimental
Example 42.
Fig. 51(a) is a graph showing results of flow cytometry in Experimental
Example 42. Fig. 51(b) is a table showing a base mutation pattern of each
subclone
obtained in Experimental Example 42.
Fig. 52(a) and Fig. 52(b) are tables showing a base mutation pattern of each
subclone obtained in Experimental Example 42.
Fig. 53 is a table showing allele frequency of an HLC-C allele in various
races.
Fig. 54 is a table showing a base mutation pattern of each subclone obtained
in
Experimental Example 43.
Fig. 55 is a table showing a base mutation pattern of each subclone obtained
in
Experimental Example 44. Fig. 56(a) and Fig. 56(b) are graphs showing results
of flow
cytometry in Experimental Example 45.
Fig. 57 is a graph showing results of flow cytometry in Experimental Example
46.
Fig. 58 is a table showing a base mutation pattern of each subclone obtained
in
Experimental Example 47.
Fig. 59 is a table showing a base mutation pattern of each subclone obtained
in
Experimental Example 48.
Fig. 60 is a table showing a base mutation pattern of each subclone obtained
in
Experimental Example 49.
Description of Embodiments
[0024]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
18
[Method for producing a low-antigenic cell with reduced rejection reaction]
(First embodiment)
A production method of the first embodiment is a method for producing, from a
donor cell, a low-antigenic cell in which a rejection reaction is reduced in a
case where
.. the cell is allogeneically transplanted into a recipient, the method
including: (a)
detelmining HLA alleles for the donor cell and the recipient, respectively;
(b) specifying
an HLA allele that is present in the donor cell but is not present in the
recipient; and (c)
disrupting or modifying the specified HLA allele to obtain a cell population
including a
cell not expressing an 1-ILA protein specific to the donor cell, in which the
cell not
expressing the HLA protein specific to the donor cell is the low-antigenic
cell.
[0025]
As described below in Examples, according to the production method of the
first
embodiment, it is possible to produce low-antigenic cells with reduced
rejection reaction
(graft-versus-host disease) when the cells are allogeneically transplanted
into a recipient.
Furthermore, as will be described later in Examples, low-antigenic cells
produced by the
production method of the first embodiment are less likely to be attacked by NK
cells of a
recipient even in a case where the cells are allogeneically transplanted into
the recipient.
[0026]
In the present specification, an HLA genetic locus may be referred to as an
"HLA allele", and antigenic diversity of HLA proteins displayed on a cell
surface may be
referred to as an "HLA type." Hereinafter, each of the steps will be
described.
[0027]
(Step (a))
In the present step, HLA alleles of a donor cell and a recipient are
respectively
determined. The donor cell may be a human cell or a non-human animal cell.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
19
Furthermore, the donor cell may be a pluripotent stern cell or a
differentiated cell. In
the present specification, pluripotent stem cells mean embryonic stem cells
(ES cells),
induced pluripotent stem cells (iPS cells), and the like.
[0028]
Furthermore, low-antigenic cells produced by the production method of the
first
embodiment are cells in which an HLA allele of donor cells has been disrupted
or
modified. Accordingly, the low-antigenic cell may be a pluripotent stern cell
similar to
the donor cell, or may be a differentiated cell.
[0029]
Furthermore, a recipient is preferably an animal of the same species as the
low-
antigenic cells. The recipient may be a patient who is actually scheduled for
transplantation, or may be a recipient having a hypothetical HLA allele that
can be a
recipient in the future.
[0030]
HLA alleles can be determined by methods of the related art such as a PCR-
rSSO method (PCR-reverse Sequence Specific Oligonucleotide), a PCR-SSP
(Sequence
specific primer) method, a PCR-SBT (Sequence based typing) method, and a next-
generation sequencing method, and the determination can be carried out using a
commercially available HLA typing kit or the like. In addition, HLA reporter,
HLA-
PRG, hla-genotyper, PHLAT, Optitype, neXtype, Athlates, HLAforest, SOAP-HLA,
HLAminer, seq2HLA, GATK HLA Caller, and the like are known as software for
performing HLA typing from sequence data of next-generation sequencers such as
whole
genome sequence (WGS), exome sequence (WES), and RNA-seq.
[0031]
The HLA allele determined in the present step is preferably an HLA allele
highly
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
relevant to a rejection reaction upon cell transplantation, and preferably
includes an
HLA-A allele, an HLA-B allele, and an HLA-C allele.
[0032]
The HLA allele determined in the present step may further include an HLA-DR
5 allele, an HLA-DQ allele, and an HLA-DP allele, and may further include
other HLA
alleles.
[0033]
(Step (b))
In the present step, an HLA allele not present in a recipient but present in
donor
10 cells (hereinafter, may be referred to as "donor-specific HLA allele")
is specified.
Donor-specific HLA alleles can be specified by comparing an HLA allele of
donor cells
and an HLA allele of a recipient.
[0034]
The HLA allele is a base sequence encoded on genomic DNA and encodes the
15 HLA protein. Serological classification of HLA proteins is called HLA
serotype.
Examples of methods for identifying an HLA serotype include a method of
analyzing
reactivity with a serum or an antibody that recognizes a specific HLA
serotype; a method
of collating a base sequence of DNA of an HLA allele or an RNA transcribed
from the
HLA allele with existing correspondence tables, IPD-IMGT database
20 (https://www.ebi.ac.uldipd/imgt/h1a/), and the like; and the like.
[0035]
The HLA serotype generally refers to a difference in a first section (two-
digit
notation) of the HLA allele notation
(http://hla.alleles.org/nomenclatureinaming.html),
but in the present specification, even in a case where an HLA serotype is the
same
serologically, in a case where amino acid sequences are different (non-
synonymous
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
21
substitution), it is determined that HLA alleles are different HLA alleles.
[0036]
Specifically, it is determined whether alleles are the same HLA alleles or
different HLA alleles from a difference between the first section and the
second section
(four-digit notation) in the HLA allele notation. Then, it is determined that
whether
HLA alleles in which the first section and the second section indicated by the
HLA allele
notation are the same HLA alleles. Furthermore, in a case where it is
necessary to
distinguish base sequences of genome such as in a case of determining a target
sequence
for genome editing, differences in the third section (a base substitution in a
translation
region not associated with an amino acid mutation) and the fourth section (a
base
substitution outside the translation region) may also be considered.
[0037]
(Step (c))
In a case where cells having an HLA protein of an HLA serotype that are not
present in a recipient are allogeneically transplanted into the recipient, a
rejection
reaction occurs, and thereby the transplanted cells are rejected. Accordingly,
in the
present step, a cell population is obtained, which contains cells that disrupt
or modify the
donor-specific HLA allele and do not express the donor cell-specific HLA
protein
(hereinafter, also referred to as "donor-specific HLA protein").
[0038]
A cell that does not express a donor-specific HLA protein refers to a cell in
which the expression of a specific HLA protein is negative due to the
disruption of an
HLA allele of donor cells, or a cell changed front a specific HLA type to
another HLA
type by modifying the VILA allele of the donor cells.
[0039]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
22
A cell that does not express the donor-specific HLA protein obtained in the
present step is a low-antigenic cell. In a case where the donor-specific 1-ILA
protein is
not present, the present step is unnecessary.
[0040]
It is preferable that a B2M gene be not disrupted in low-antigenic cells
produced
by the production method of the first embodiment. As a result, a class 1 HLA
protein is
present on a cell surface, and even in a case where low-antigenic cells are
allogeneically
transplanted into a recipient, the cells are less likely to be attacked by NK
cells of the
recipient. In addition, because only part of HLA is disrupted and the
remaining HLA
retains an antigen-presenting ability, the antigen-presenting ability can be
maintained
even in a case where the cell is infected with a virus or becomes a tumor.
[0041]
<Genome editing>
As will be described later in Examples, disruption or modification of HLA
.. alleles of donor cells can be performed by, for example, genome editing.
Disruption of
HLA alleles can be performed by specifically cleaving the HLA alleles and
inducing
double-stranded DNA break (DSB). In a case where a base is deleted or added to
cause
a frameshift mutation in a DSB repairing process. HLA alleles are disrupted,
and thereby
an HLA protein is not expressed. In the present specification, disruption of
the HLA
alleles may be referred to as knockout of the HLA alleles.
[0042]
Furthermore, by specifically cleaving the HLA alleles in the presence of donor
DNA and inducing DSB, it is possible to induce homologous recombination in the
DSB
repairing process and modify the HLA alleles. Specifically, for example, an
HLA-
.. A*02:07 allele can be modified to an HLA-A*01:01 allele, as will be
described later in
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
23
Examples.
[0043]
As the donor DNA, donor DNA having a sequence identity with a region
including before and after a position of double-stranded DNA cleavage of
genomic DNA
and encoding a desired HLA allele may be used. The donor DNA may be single-
stranded DNA or double-stranded DNA. The donor DNA may be a DNA having a
single base sequence or a mixture of DNAs having a plurality of base
sequences.
[0044]
The phrase "having a sequence identity" means that 90% or more of base
sequences match a region including double-strand break positions of donor DNA
and
target genomic DNA. In the donor DNA, 95% or more of base sequences preferably
match and 99% or more of base sequences more preferably match the region
including
the double-strand break positions in the genomic DNA.
[0045]
The donor DNA may be single-stranded DNA of about 50 to 5,000 bases or
double-stranded DNA of about 50 to 5,000 base pairs. In a case where the donor
DNA
is single-stranded DNA, the donor DNA may have sequence identity with any of
the
double strands of genomic DNA.
[0046]
<Sequence-specific DNA-cleaving enzyme>
In general, sequence-specific DNA-cleaving enzymes used for inducing DSB to
perform genome editing are roughly classified into RNA-induced nucleases and
artificial
nucleases. The sequence-specific DNA-cleaving enzyme may be an RNA-induced
nuclease or an artificial nuclease.
[0047]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
24
The sequence-specific DNA-cleaving enzyme is not particularly limited as long
as it cleaves genomic DNA in a target sequence-specific manner to form a
double-strand
break. A length of a target sequence recognized by the sequence-specific DNA-
cleaving enzyme may be, for example, about 10 to 60 bases.
[0048]
Furthermore, the sequence-specific DNA-cleaving enzyme may be, for example,
in a form in which a plurality of nickases are combined to cleave DNA. The
nickase
means an enzyme that forms a nick in a single strand of double-stranded DNA.
For
example, a double-strand break can be formed by forming nickases at both
strands of
double-stranded DNA at close locations on genomic DNA.
[0049]
The RNA-induced nuclease is an enzyme that guides a short-chain RNA that
binds to a target sequence and recruits a nuclease having two DNA cleavage
domains
(nuclease domains) to induce sequence-specific cleavage. Examples of RNA-
induced
nucleases include CRISPR-Cas family proteins. The CRISPR-Cas family proteins
are
roughly classified into class 1 and class 2. Class 1 includes type I, type
111, and type IV,
and class 2 includes type Il, type V, and type VI.
[0050]
Examples of CRISPR-Cas family protein include Cas9, Cpfl, CasX, CasY,
Cas12, Cas13, C2C2, and the like. The RNA-derived nuclease may be a homologue
of
a CRISPR-Cas family protein or a modified CRISPR-Cas family protein. For
example,
it may be a nickase-modified nuclease in which one of two existing wild-type
nuclease
domains is modified to be inactive. Alternatively, it may be Cas9-HF, HiFi-
Cas9,
eCas9, or the like having improved target specificity.
[0051]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
Examples of Cas9 include those derived from Pseudomonas aeruginosa,
Staphylococcus aureus, Streptococcus thermophilus, Geobacillus
stearothermophilus, and
the like. Examples of Cpfl include those derived from Acidaminococcus,
Lachnospira,
Chlamydomonas, Francicella-Novicida, and the like.
5 [0052]
The artificial nuclease is an artificial restriction enzyme having a DNA
binding
domain designed/produced to specifically bind to a target sequence and a
nuclease
domain (such as a DNA cleavage domain of Fold which is a restriction enzyme).
Examples of artificial nucleases include Zinc finger nuclease (ZFN),
Transcription
10 activator-like effector nuclease (TALEN), meganucleases, and the like,
but examples are
not limited thereto.
[0053]
Introduction of sequence-specific DNA-cleaving enzyme
For example, in a case where CRISPR-Cas is used as the sequence-specific
15 DNA-cleaving enzyme introduced into donor cells, a target base sequence
is determined
by gRNA. Details of gRNA will be described later. A gRNA may be introduced
into
donor cells in the form of RNA, or may be introduced into the donor cells in
the form of
an expression vector and expressed intracellularly.
[0054]
20 Examples of methods of preparing a gRNA in the form of RNA include a
method of producing a construct in which a promoter such as T7 is added
upstream of a
nucleic acid fragment encoding gRNA, and synthesizing by an in vitro
transcription
reaction; a method of chemical synthesis; and the like. In the case of
chemically
synthesizing gRNA, chemically modified RNA may be used.
25 [0055]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
26
Examples of expression vectors include a plasmid vector or a viral vector
which
transcribes gRNA from Pol III promoter such as H1 promoter or U6 promoter. In
a case
where gRNA is expressed using an expression vector, gRNA may be expressed
constitutively or may be expressed under the control of an expression-
inducible
promoter.
[0056]
Subsequently, Cas9 is prepared. Cas9 may be introduced into donor cells in the
form of an expression vector that is expressed from a Pol II promoter, or may
be
introduced into the donor cells in the form of a purified protein. Examples of
expression vectors include transposon vectors, virus vectors, episomal
vectors, plasmid
vectors, and the like.
[0057]
In introduction of gRNA and Cas9 into donor cells, in a case where the gRNA
and Cas9 are in the form of a viral vector, it is sufficient for the gRNA and
Cas9 be added
to a medium of the donor cells. Examples of viral vectors include adeno-
associated
virus vectors, adenovirus vectors, retrovirus vectors, lentivirus vectors,
Sendai virus
vectors, baculovirus vectors, and the like.
[0058]
In a case where gRNA and Cas9 are transposon vectors, episomal vectors,
plasmid vectors, or the like, or in a case where the gRNA is RNA and the Cas9
is a
purified protein, they may be introduced into donor cells by a transfection
reagent or an
electroporation method.
[0059]
As the transfection reagent, for example, it is possible to use Lipofectamine
2000, Lipofectamine 3000, CRISPRMAX, and RNAMAX (all of which are from
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
27
Thermo Fisher Scientific); FuGENE 6 and FuGENE HD (both are from Promega); and
the like.
[0060]
In addition, the electroporation method can be performed using a device such
as
NEPA21 (Neppagene Co., Ltd.), Neon (Thermo Fisher Scientific), and 4D-
Nucleofector
(Lonza Co., Ltd.).
[0061]
(Step (d))
In the step (c), it is possible to obtain the cell population which includes
low-
antigenic cells and which does not express a donor-specific HLA protein.
However, the
cell population obtained in step (c) may include, in addition to cells (low-
antigenic cells)
in which desired HLA alleles are disrupted or modified, cells in which HLA
alleles are
not disrupted or modified, cells in which HLA alleles are not completely
disrupted or
modified, and the like. Accordingly, after the step (c), a step (d) of
recovering cells
(low-antigenic cells) that do not express the donor-specific HLA protein may
be further
performed.
[0062]
The step (d) includes step of bringing the cell population including low-
antigenic cells into contact with an agent for inducing HLA protein expression
(HLA
protein expression-inducing agent), and recovering the cell not expressing the
HLA
protein specific to the donor cell from the cell population using, as an
index, expression
of the HLA protein specific to the donor cell in the cell population brought
into contact
with the HLA protein expression-inducing agent. The step of bringing the HLA
protein
expression-inducing agent into contact with the cell population can be
performed, for
example, by adding the HLA protein expression-inducing agent to a medium of
the cell
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
28
population.
[0063]
In the present step, to recover cells that do not express the donor-specific
HLA
protein from the cell population using the expression of the donor-specific
HLA protein
as an index means to detect the presence of the expressed HLA protein, to
detect the
presence or absence of the expressed HLA protein, and to recover cells that do
not
express the donor-specific HLA protein.
[0064]
Examples of 1-ILA protein expression-inducing agents include cytokines such as
IFN-y, IFN-a, IFN-13, IL-4, GM-CSF, TGF-n, and TGF-I3. These expression-
inducing
agents may be used alone or in combination of two or more kinds thereof.
[0065]
In a case where the above-mentioned cytokines are used in human cells, the
cytokines are preferably human-derived cytokines. The NCBI accession numbers
of
human IFN-y protein are NP_000610.2 and the like. The NCBI accession numbers
of
human 1FN-a protein are NP_076918.1, NP_000596.2, NP_066546.1, and the like.
The
NCBI accession numbers of human IFN-I3 protein are NP_002167.1 and the like.
The
NCBI accession numbers of human IL-4 protein are NP_000580.1, NP_758858.1,
NP_001341919.1, and the like. The NCBI accession numbers of human GM-CSF
protein are NP 000749.2, and the like. The NCBI accession numbers of human TGF-
a
protein are NP 001093161.1, NP_003227.1, NP_001295088.1, NP_001295087.1, and
the like. The NCBI accession numbers of human TGF-f3 protein are NP 000651.3,
XP_011525544.1, and the like.
[0066]
The above-mentioned cytokine may have a mutation in an amino acid sequence
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
29
described in each of the above-mentioned accession numbers as long as it has
an activity
of inducing the expression of HLA protein. More specifically, it may have an
amino
acid sequence in which one or several amino acids are deleted, substituted, or
added in an
amino acid sequence described in each of the above accession numbers. One or
several
.. amino acids may be, for example, 1 to 10 amino acids, for example, 1 to 5
amino acids,
and for example, 1 to 3 amino acids. The above-mentioned cytokine may further
have
an amino acid sequence from which a signal peptide has been removed.
[0067]
It is known that pluripotent stem cells generally do not express the 1-ILA
protein
on the cell surface in an undifferentiated state, and therefore it is
difficult to detect the
HLA protein. In order to display the HLA protein, it is necessary to induce
differentiation. However, a differentiation induction process is generally
complicated
and time consuming. In addition, because cells that have once been
differentiation-
induced do not spontaneously return to an undifferentiated state, even in a
case where an
HLA protein-negative differentiated cell population is recovered, it is no
longer a
pluripotent stem cell.
[0068]
The inventors of the present invention have revealed that it is possible
induce the
expression of HLA protein while maintaining pluripotency of pluripotent stem
cells by
causing the above-mentioned HLA protein expression-inducing agent to act on
pluripotent stem cells.
[0069]
Accordingly, the expression of the HLA protein in the cell population obtained
in the step (d) is induced, and thereby pluripotent stem cells (low-antigenic
cells) in
which desired HLA alleles are disrupted or modified can be efficiently
detected and
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
recovered.
[0070]
For example, after inducing the expression of HLA protein in cells, by
staining
the cells with an anti-HLA protein antibody, it is possible to distinguish HLA-
expressing
5 cells or HLA-non-expressing cells with a flow cytorneter and recover them
by sorting.
[0071]
Alternatively, an anti-HLA protein antibody may be adsorbed on magnetic beads
and brought into contact with HLA protein-expressing cells. Then, the cells to
which
the magnetic beads are bonded can be recovered using magnetic force.
10 [0072]
Alternatively, cells expressing a specific HLA protein on a culture dish are
labeled with an anti-HLA protein antibody or the like, unnecessary undesired
cells are
removed by suction or laser irradiation, and thereby only target low-antigenic
cells may
be recovered.
15 [0073]
Alternatively, HLA protein-expressing cells on a culture dish are mixed with T
cells that recognize an undesired HLA protein, only cells expressing the
undesired HLA
protein are attacked and removed, and thereby only target low-antigenic cells
may be
recovered.
20 [0074]
The production method of the first embodiment may further include a step of
disrupting or modifying an allele including at least one allele of a CIITA
allele, an RFX5
allele, an RFXAP allele, and an RFXANK allele of the donor cell. A CIITA gene
is a
gene encoding a Class 11 Major Histocompatibility Complex Transactivator
protein.
25 Furthermore, an RFX5 gene is a gene encoding a Regulatory Factor X5
protein.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
31
Furthermore, an RFXAP gene is a gene encoding a Regulatory Factor X Associated
Protein. Furthermore, an RFXANK gene is a gene encoding a Regulatory Factor X
Associated Ankyrin Containing Protein.
[0075]
The CIITA gene, together with the RFX5 gene, the RFXAP gene, and the
RFXANK gene, encodes a transcription factor that controls transcriptional
activation of
HLA class 11. Accordingly, for cells in which at least one of the ClITA
allele, the RFX5
allele, the RFXAP allele, and the RFXANK allele is disrupted do not express
the HLA
class II protein, a rejection reaction in a case where the cells are
allogeneically
transplanted into a recipient is further reduced.
[0076]
The NCBI accession numbers of the human CII'l __ A gene are NM_000246.3.,
NM_001286402.1, NM_001286403.1, and the like. The NCBI accession numbers of
human RFX5 gene are NM_000449.3, NM_001025603.1, and the like. The NCBI
accession numbers of the human RFXAP gene is NM_000538.3, and the like. The
NCBI accession numbers of the human RFXANK gene are NM_001278727.1,
NM_001278728.1, NM_003721.3, NM_134440.2, and the like.
[0077]
(Second embodiment)
A production method according to a second embodiment is a method for
producing, from a donor cell, a low-antigenic cell in which a rejection
reaction is reduced
in a case where the cell is allogeneically transplanted into a recipient, the
method
including: disrupting or modifying an allele including at least one of a Cl1TA
allele, an
RFX5 allele, an RFXAP allele, and an RFXANK allele of the donor cell, in which
a cell
in which an allele including at least one of the CIITA allele, the RFX5
allele, the RFXAP
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
32
allele, or the RFXANK allele is disrupted or modified is the low-antigenic
cell. The
production method of the present embodiment mainly differs from the production
method
of the first embodiment described above in that HLA alleles are not disrupted.
[0078]
As described above, expression of the CIITA gene, the RFX5 gene, the RFXAP
gene, and the RFXANK gene is known to be essential for expression of class II
HLA
protein. Accordingly, for cells in which at least one of the CIITA allele, the
RFX5
allele, the RFXAP allele, and the RFXANK allele is disrupted do not express
the HLA
class II protein, a rejection reaction in a case where the cells are
allogeneically
transplanted into a recipient is reduced.
[0079]
In the production method of the second embodiment, donor cells may be
pluripotent stem cells similar to those described above, or may be
differentiated cells.
[0080]
Furthermore, a recipient is preferably an animal of the same species as the
low-
antigenic cells. The recipient may be a patient who is actually scheduled for
transplantation, or may be a recipient having a hypothetical HLA allele that
can be a
recipient in the future.
[0081]
Furthermore, as described above, cells in which a B2M allele is disrupted do
not
express an HLA class I protein even in a case where an HLA allele is wild
type. The
production method of the second embodiment may further include a step of
disrupting a
B2M allele of a donor cell.
[0082]
Disruption of the CIITA allele or the B2M allele of the donor cell can be
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
33
performed by, for example, genome editing. The genome editing is the same as
described above.
[0083]
[Kit for detecting low-antigenic cell]
In one embodiment, the present invention provides a kit for detecting a low-
antigenic cell in which a rejection reaction is reduced in a case where the
cell is
allogeneically transplanted into a recipient, the kit including an HLA protein
expression-
inducing agent. Low-antigenic cells can be detected and recovered by the kit
of the
present embodiment. Accordingly, it can be said that the kit of the present
embodiment
is a kit for recovering low-antigenic cells.
[0084]
In the kit of the present embodiment, an HLA protein expression-inducing agent
is the same as described above, and examples thereof include cytokines such as
IFN-y,
IFN-a, IFN-13, IL-4, GM-CSF, TGF-a, and TGF-13. The kit of the present
embodiment
may include one of these expression-inducing agent alone or may include two or
more
kinds thereof.
[0085]
In the kit of this embodiment, low-antigenic cells may be pluripotent stem
cells.
As will be described later in Examples, according to the kit of the present
embodiment,
.. even in a case where low-antigenic cells are pluripotent stem cells,
expression of the
HLA protein is induced while still maintaining pluripotency of the low-
antigenic cells.
[0086]
[Cell]
(First embodiment)
A cell according to the first embodiment is a cell in which at least one HLA
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
34
allele is disrupted or modified and at least one kind of HLA protein can be
expressed.
The cell of the first embodiment may be a pluripotent stem cell or a
differentiated cell.
In the cell of the first embodiment, at least one HLA allele that has been
disrupted or
modified is preferably a class I HLA allele.
[0087]
Pluripotent stem cells generally have weak expression of HLA protein. The
term "weak expression" means that, for example, expression of the HLA protein
cannot
be clearly detected even though cells are stained with an anti-HLA protein
antibody and
subjected to flow cytometric analysis.
[0088]
However, as will be described later in Examples, in a case where the HLA
protein expression-inducing agent is brought into contact with pluripotent
stem cells,
expression of an HLA protein is enhanced. In the cell of the first embodiment,
the
phrase "capable of expressing at least one HLA protein" means that the cell is
a cell in
which expression of the HLA protein is enhanced by bringing the HLA protein
expression-inducing agent into contact with the cells even in a case where the
cell is a
cell in which expression of the HLA protein generally usually weak, such as
pluripotent
stem cells. Furthermore, the cell of the first embodiment may be a
differentiated cell in
which the HLA protein is expressed.
[0089]
As will be described later in Examples, for example, cells in which a B2M
allele
is disrupted do not express an HLA classl protein even in a case where an HLA
allele is
wild type. The cell of the first embodiment do not include such cells.
[0090]
In the cell of the first embodiment, a disrupted or modified HLA allele
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
preferably includes a class I HLA allele, and preferably includes an HLA-A
allele, an
HLA-B allele, or an HLA-C allele.
[0091]
Since the cell of the first embodiment expresses the at least one class I HLA
5 protein, the cell is less likely to be attacked by NK cells of a
recipient even in a case
where the cell is allogeneically transplanted into the recipient. The at least
one class I
HLA protein includes an HLA-C protein, an HLA-E protein, an HLA-G protein, and
the
like. In the cell of the first embodiment, because only part of HLA is
disrupted and the
remaining HLA retains an antigen-presenting ability, the antigen-presenting
ability can be
10 maintained even in a case where the cell is infected with a virus or
becomes a tumor.
[0092]
The cell of the first embodiment may be a low-antigenic cell in which a
rejection
reaction is reduced in a case where the cell is allogeneically transplanted
into a recipient,
in which the disrupted or modified HLA allele is an HLA allele that is not
present in the
15 recipient. In the above-mentioned low-antigenic cell, a rejection
reaction is reduced in a
case where the cells is allogeneically transplanted to a recipient.
[0093]
The low-antigenic cell of the first embodiment is preferably a cell of the
same
species as a recipient, and may be a human cell or a non-human animal cell.
The
20 recipient may be a patient who is actually scheduled for
transplantation, or may be a
recipient having a hypothetical HLA allele that can be a recipient in the
future.
[0094]
In the cell of the first embodiment, an allele including at least one of a
CIITA
allele, an RFX5 allele, an RFXAP allele, and an RFXANK allele may be further
25 disrupted or modified. As described above, expression of the CIITA gene,
the RFX5
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
36
gene, the RFXAP gene, and the RFXANK gene is known to be essential for
expression
of class II HLA protein. Accordingly, for cells in which at least one of the
CIITA allele,
the RFX5 allele, the RFXAP allele, and the RFXANK allele is disrupted do not
express
the HLA class ii protein, a rejection reaction in a case where the cells are
allogeneically
transplanted into a recipient is further reduced.
[0095]
(Second embodiment)
A cell according to the second embodiment is a cell in which an allele
including
at least one of a OITA allele, an RFX5 allele, an RFXAP allele, and an RFXANK
allele
is disrupted or modified. As described above, a cell, in which an allele
including at
least one of the CHTA allele, the RFX5 allele, the RFXAP allele, and the
RFXANK allele
is disrupted or modified do not express the HLA class II protein, is a low-
antigenic cell in
which a rejection reaction in a case where the cell is allogeneically
transplanted into a
recipient is reduced.
[0096]
The cell according to the second embodiment may express an HLA class 1
protein. The cell of the second embodiment may be useful for allogeneic
transplantation into a recipient.
[0097]
The cell of the second embodiment may be a pluripotent stem cell or a
differentiated cell. Furthermore, as described above, cells in which a B2M
allele is
disrupted do not express an HLA class 1 protein even in a case where an HLA
allele is
wild type. In the cell of the second embodiment, a B2M allele may be further
disrupted
in addition to the at least one of the CIITA allele, the RFX5 allele, the
RFXAP allele, and
the RFXANK allele.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
37
[0098]
A low-antigenic cell of the second embodiment is preferably a cell of the same
species as a recipient, and may be a human cell or a non-human animal cell.
The
recipient may be a patient who is actually scheduled for transplantation, or
may be a
recipient having a hypothetical HLA allele that can be a recipient in the
future.
[0099]
(Usage applications of low-antigenic cells)
The cells of the first embodiment and the second embodiment described above
are low-antigenic cells in which a rejection reaction in a case where the
cells are
allogeneically transplanted into a recipient is reduced. Accordingly, the
cells can be
used for cell therapy and regenerative medicine.
[0100]
In a case where low-antigenic cells are pluripotent stem cells, for example,
the
cells may be differentiated into nerve cells, hepatocytes, pancreatic islet
cells,
cardiomyocytes, kidney cells, hematopoietic stem cells, cytotoxic T cells, and
the like,
and then the cells may be transplanted into a patient.
[0101]
Alternatively, the low-antigenic cells may be introduced into a patient after
gene
transfection. For example, after differentiation of pluripotent stem cells
into T cells,
gene transfection of a chimeric antigen receptor (CAR) is performed, and
transplantation
into cancer patients as CAR-T cells is performed.
[0102]
[Method of specifying target base sequence]
(First embodiment)
In one embodiment, the present invention provides a method for specifying a
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
38
target base sequence for producing, by genome editing, a low-antigenic cell in
which a
rejection reaction is reduced in a case where the cell is allogeneically
transplanted into a
recipient, the method including: mapping a candidate base sequence to base
sequence
data of genomic DNA of all HLA haplotypes; mapping the candidate base sequence
to
base sequence data of all genomic DNA except for HLA alleles; and specifying,
as a
target base sequence, the candidate base sequence that is mapped to only one
target HLA
haplotype in a case where the base sequence is mapped to base sequence data of
genomic
DNA of all HLA haplotypes, but that is not mapped in a case where the base
sequence is
mapped to base sequence data of all genomic DNA except for the HLA alleles.
[0103]
By the method of the first embodiment, a target base sequence of the gRNA of
the first embodiment to be described later can be specified. As described
below, the
gRNA of the first embodiment can specifically induce DSB in an HLA haplotype-
specific manner, which makes the risk of off-target mutation introduction low.
[0104]
As described above, an HLA gene has many pseudogenes, HLA gene sequences
are highly homologous to each other, and sequence diversity among individuals
is large.
Accordingly, it is not easy to determine an appropriate target base sequence
for genome
editing using a sequence-specific DNA-cleaving enzyme.
[0105]
A target base sequence of a sequence-specific DNA-cleaving enzyme specific to
an HLA gene can be specified, for example, as follows. First, base sequence
data of
genomic DNA of all HLA haplotypes (base sequence data of all known HLA genes)
is
obtained. The base sequence data of all HLA genes can be obtained from, for
example,
1PD-IIVIGT/HLA database (https://www.ebi.ac.uk/ipd/imgt/h1a/). As of July
2017,
Date Regue/Date Received 2020-08-11
CA 03091136 2020-08-11
39
12,544 base sequences of HLA class I genes and 4,622 base sequences of HLA
class 11
genes have been registered in the present database.
[0106]
Subsequently, a base sequence which is a target of a sequence-specific DNA-
cleaving enzyme to be used is extracted from a base sequence of each HLA
allele. For
example, in a case where CRISPR-Cas is used as a sequence-specific DNA-
cleaving
enzyme, a base sequence, which includes a PAM sequence of about 3 to 5 bases
(for
example, "NGG" for Cas9 derived from Streptococcus pyogenes, "TTTN" for Cpfl
derived from Acidaminococcus) and which is usable as a target base sequence of
gRNA,
is extracted as a candidate base sequence.
[0107]
In the method of the present embodiment, a target base sequence is assumed to
include the PAM sequence. A length of the target base sequence including the
PAM
sequence varies depending on sequence-specific DNA-cleaving enzymes. For
example,
in a case where a sequence-specific DNA-cleaving enzyme is Cas 9 derived from
Pseudomonas aeruginosa, a length of the target base sequence including the PAM
sequence is preferably 19 to 33 bases, and is more preferably 20 to 24 bases.
Furthermore, in a case where a sequence-specific DNA-cleaving enzyme is Cpfl
derived
from Acidaminococcus, a length of the target base sequence including the PAM
sequence
is preferably 20 to 34 bases, and more preferably about 24 bases.
[0108]
Subsequently, a candidate base sequence including the PAM sequence is mapped
to the base sequence data of the genomic DNA of all HLA haplotypes.
[0109]
Mapping refers to an operation of specifying a position having high sequence
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
identity in a query base sequence (meaning a candidate base sequence herein)
on a
reference base sequence (meaning base sequence data of genomic DNA of all HLA
haplotypes herein). A sequence identity between the query base sequence and
the
reference base sequence is preferably 90% or more, more preferably 95% or
more, even
5 more preferably 99% or more, and particularly preferably 100%.
[0110]
The sequence identity of the query base sequence with respect to the reference
base sequence can be determined as follows, for example. First, the reference
base
sequence and the query base sequence are aligned. Subsequently, the number of
bases
10 of matched bases in the reference base sequence and the query base
sequence can be
calculated, and a sequence identity can be determined according to Formula
(1).
Sequence identity (%) = number of matched bases/total number of bases in
query base sequence x 100(1)
[0111]
15 As will be described later in Examples, mapping can be performed using,
for
example, a Bowtie program (http://bowtie-bio.sourceforge.net/index.shtml). In
addition, mapping may be performed using a sequence homology (sequence
identity)
search program other than the Bowtie program, such as BWA, BLAST, BLAT, SOAP,
Novoalign, and TopHat.
20 [0112]
Subsequently, the candidate base sequence is mapped to base sequence data of
all genomic DNA except for HLA alleles. A reference human genome sequence
(Hg19)
or the like can be used as base sequence data of total genomic DNA. in
addition, for
mapping, the Bowtie program or a sequence homology search program other than
the
25 Bowtie program can be used.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
41
[0113]
Subsequently, a candidate base sequence, that is mapped to only one target HLA
haplotype in a case where the base sequence is mapped to base sequence data of
genomic
DNA of all HLA haplotypes, but that is not mapped in a case where the base
sequence is
mapped to base sequence data of all genomic DNA except for HLA alleles, is
specified as
a target base sequence. The target HLA haplotype means a target HLA haplotype
to be
disrupted or niodified.
[0114]
As will be described later in Examples, a gRNA targeting the target base
.. sequence specified by the method of the first embodiment as a target base
sequence (the
gRNA of the first embodiment to be described later) can induce a DSB specific
to a
target specific HLA haplotype, which makes the risk of off-target mutagenesis
low.
[0115]
Even though an HLA gene is composed of eight exons in many cases, the target
base sequence preferably targets a protein coding region of the HLA gene. The
target
base sequence preferably targets an exon 1, 2, 3, or 4 encoding an
extracellular domain of
the HLA protein, and particularly preferably targets the exon 2 or 3.
[0116]
Alternatively, in a case where the target base sequence is set at two
positions, a
base sequence between therebetween can be largely deleted. In order to utilize
this
deletion, two or more target base sequences may be designed to include a gene
region
encoding a protein of HLA gene.
[0117]
Furthermore, the target base sequence preferably does not target other genomic
.. regions other than the HLA gene or mitochondrial DNA. Furthermore, even in
a case
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
42
where a mismatch of several bases is allowed, it is preferable to select a
target base
sequence that has few sites targeting regions other than the HLA gene.
[0118]
(Second embodiment)
In one embodiment, the present invention provides a method for specifying a
target base sequence for producing, by genome editing, a low-antigenic cell in
which a
rejection reaction is reduced in a case where the cell is allogeneically
transplanted into a
recipient, the method including: mapping a candidate base sequence to base
sequence
data of genomic DNA of all H LA haplotypes; mapping the candidate base
sequence to
base sequence data of all genomic DNA except for HLA alleles; and specifying,
as a
target base sequence, the candidate base sequence that is mapped to two or
more target
HLA haplotypes in a case where the base sequence is mapped to base sequence
data of
genomic DNA of all HLA haplotypes, but that is not mapped in a case where the
base
sequence is mapped to base sequence data of all genomic DNA except for the HLA
alleles.
[0119]
The method of the second embodiment mainly differs from the above-described
first embodiment in that, in the method of the second embodiment, the
candidate base
sequence that is mapped to two or more target HLA haplotypes is specified as a
target
base sequence when the candidate base sequence is mapped to base sequence data
of
genomic DNA of all HLA haplotypes.
[0120]
In the method of the second embodiment, the candidate base sequence, the base
sequence data of all genomic DNA of HLA haplotypes, the base sequence data of
all
genomic DNA, and mapping are the same as those of the above-described first
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
43
embodiment.
[0121]
By the method of the present embodiment, a target base sequence of the gRNA
of the second embodiment to be described later can be specified. As will be
described
later, the gRNA of the second embodiment can cleave multiple target HLA genes
(or
alleles). Accordingly, it is possible to reduce the types of gRNA required in
a case of
disrupting or modifying multiple HLA genes. Thereby, costs of producing gRNAs
can
be reduced. In addition, the risk of off-target mutagenesis can be reduced by
reducing
the types of gRNA used.
.. [0122]
[GRNA]
(First embodiment)
In one embodiment, the present invention provides a gRNA targeting, as a
target
base sequence, a base sequence that is mapped to only one target HLA haplotype
in a
case where the base sequence is mapped to base sequence data of genomic DNA of
all
HLA haplotypes, but that is not mapped in a case where the base sequence is
mapped to
base sequence data of all genomic DNA except for HLA alleles.
[0123]
The gRNA of the first embodiment can specifically induce DSB in an HLA
haplotype-specific manner, which makes the risk of off-target mutation
introduction low.
[0124]
In the present embodiment, the gRNA may be a complex of CRISPR RNA
(crRNA) and trans-activated CR1SPR RNA (tracrRNA), or a single synthetic gRNA
(sgRNA) obtained by combining tracrRNA and crRNA. With any structure of gRNA,
DSB can be induced in a target base sequence-specific manner.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
44
[0125]
A target base sequence is preferably specified by the method described above.
As described above, in the present specification, the target base sequence is
a base
sequence including a PAM sequence. Accordingly, a base sequence obtained by
removing the PAM sequence from the target base sequence is used as a spacer
base
sequence of crRNA or sgRNA.
[0126]
In a case where the gRNA of the present embodiment is sgRNA, a base
sequence of sgRNA can be the following base sequence.
[0127]
First, a base sequence in which the PAM sequence has been removed from the
target base sequence is used as a spacer base sequence. Then, a base sequence
in which
a scaffold sequence is linked to a 3' end of the spacer base sequence is
designed. As the
scaffold sequence, for example, a base sequence set forth in SEQ ID NO:39 can
be used,
.. but it is not limited thereto.
[0128]
The base sequence set forth in SEQ ID NO: 39 may be a base sequence in which
one or several bases have been deleted, substituted, or added in the base
sequence set
forth in SEQ ID NO: 39, as long as the base sequence set forth in SEQ ID NO:
39
functions as a scaffold sequence. One or several bases may be, for example, 1
to 10
bases, for example, 1 to 5 bases, and for example, 1 to 3 bases.
[0129]
The designed sgRNA can be prepared by chemical synthesis or the like. The
sgRNA may be prepared as RNA and directly introduced into a donor cell, or may
be
prepared as DNA and incorporated into an expression vector, introduced into a
donor cell
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
in the form of the expression vector, and expressed intracellularly.
[0130]
In a case where the sgRNA is expressed in cells, a polymerase III promoter
such
as U6 promoter or H1 promoter can be used. In this case, a base sequence at a
5' end of
5 the sgRNA may be changed to G or GG in order to improve transcription
efficiency.
Even in a case where the base sequence at the 5' end of the sgRNA is changed
to G or
GG, a cleavage activity of Cas9 is hardly affected.
[0131]
For example, in a case where a base sequence from which the PAM sequence is
10 removed from the target base sequence is "5'-NNNNNNNNNNNNNNNNNNNN-3'
(SEQ ID NO: 62), a base sequence of the sgRNA that specifically cleaves the
target base
sequence is "5'-
NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAAAA
UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU
15 UUUU-3" (SEQ ID NO: 63).
[0132]
The gRNA of the present embodiment may be a complex of crRNA and
tracrRNA. In addition, the crRNA and tracrRNA may be directly introduced into
a
donor cell, or may be introduced into a donor cell in the form of an
expression vector and
20 expressed in the cell. In a case where the crRNA and tracrRNA are
expressed in cells, a
polymerase III promoter such as U6 promoter or H1 promoter can be used. In
this case,
a base sequence at a 5' end of the crRNA or tracrRNA may be changed to G or GG
in
order to improve transcription efficiency. Even in a case where the base
sequence at the
5' end of the crRNA or tracrRNA is changed to G or GG, a cleavage activity of
Cas9 is
25 hardly affected.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
46
[0133]
In a case where the gRNA of the present embodiment is a complex of crRNA
and tracrRNA, base sequences of crRNA and tracrRNA can be the following base
sequences.
[0134]
First, a base sequence in which the PAM sequence has been removed from the
target base sequence is used as a spacer base sequence. Then, a base sequence
in which
a scaffold sequence is linked to a 3' end of the spacer base sequence is
designed to be a
base sequence of the crRNA. For example, in a case where a base sequence from
which
the PAM sequence is removed from the target base sequence is "5%
NNNNNNNNNNNNNNNNNNNN-3" (SEQ ID NO: 62), a base sequence of the
crRNA is "5'-
NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAUGCUGUUUUG-3" (SEQ ID
NO: 64). In addition, a base sequence of the tracrRNA can be, for example, "5'-
CAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAA
AAGUGGCACCGAGUCGGUGC-3" (SEQ ID NO: 65).
[0135]
The base sequence of the crRNA may have a mutation with respect to the base
sequence set forth in SEQ ID NO:64 as long as it functions as crRNA. More
specifically, it may be a base sequence in which one or several bases are
deleted,
substituted, or added in the base sequence of SEQ ID NO: 64. One or several
bases
may be, for example, 1 to 10 bases, for example, 1 to 5 bases, and for
example, 1 to 3
bases.
[0136]
In addition, the base sequence of the tracrRNA may be a base sequence in which
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
47
one or several bases are deleted, substituted, or added in the base sequence
of SEQ ID
NO: 65, as long as it functions as tracrRNA. One or several bases may be, for
example,
1 to 10 bases, for example, I to 5 bases, and for example, 1 to 3 bases.
[0137]
The designed crRNA and tracrRNA can be prepared by chemical synthesis or
the like. The crRNA and tracrRNA may be prepared as RNA and directly
introduced
into a donor cell, or may be prepared as DNA and incorporated into an
expression vector,
introduced into a donor cell in the form of the expression vector, and
expressed
intracellularly.
[0138]
Specific examples of gRNAs of the first embodiment include a gRNA targeting
a base sequence set forth in any of SEQ ID NOs: 3, 4, 7, 45 to 52, and 72 to
2459 as a
target base sequence; or a gRNA targeting, as a target base sequence, a base
sequence in
which one or several bases are deleted, substituted, or added at a 5' end of a
base
sequence set forth in any of SEQ ID NOs: 3, 4, 7, 45 to 52, and 72 to 2459.
One or
several bases may be, for example, 1 to 10 bases, for example, 1 to 5 bases,
and for
example, 1 to 3 bases. For example, by shortening a 5' end of a spacer
sequence by 2 to
3 bases, a binding ability to DNA can be reduced, and thereby sequence
recognition
specificity of CRISPR-Cas9 can be increased.
[0139]
Among the examples, a gRNA is preferably a gRNA targeting a base sequence
set forth in any of SEQ ID NOs: 3, 4, 7, and 45 to 52 as a target base
sequence; or a
gRNA targeting, as a target base sequence, a base sequence in which one or
several bases
are deleted, substituted, or added at a 5' end of a base sequence set forth in
any of SEQ
ID NOs: 3, 4, 7, and 45 to 52. As will be described later in Examples, gRNAs
having
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
48
these base sequences as a target base sequence disrupts or modifies HLA
alleles in an
HLA haplotype-specific manner, and thereby it is possible to produce low-
antigenic cells
in which a rejection reaction in a case where the cells are allogeneically
transplanted into
a recipient is reduced.
[0140]
(Second embodiment)
In one embodiment, the present invention provides a gRNA targeting, as a
target
base sequence, a base sequence that is mapped to two or more target HLA
haplotypes in a
case where the base sequence is mapped to base sequence data of genomic DNA of
all
HLA haplotypes, but that is not mapped in a case where the base sequence is
mapped to
base sequence data of all genomic DNA except for HLA alleles.
[0141]
Specific examples of gRNAs of the second embodiment include a gRNA
targeting a base sequence set forth in any of SEQ ID NOs: 53 to 55 and 2460 to
8013 as a
target base sequence; or a gRNA targeting, as a target base sequence, a base
sequence in
which one or several bases are deleted, substituted, or added at a 5' end of a
base
sequence set forth in any of SEQ ID NOs: 53 to 55 and 2460 to 8013. One or
several
bases may be, for example, 1 to 10 bases, for example, 1 to 5 bases, and for
example, 1 to
3 bases. For example, by shortening a 5' end of a spacer sequence by 2 to 3
bases, a
binding ability to DNA can be reduced, and thereby sequence recognition
specificity of
CRISPR-Cas9 can be increased.
[0142]
Among the examples, a gRNA is preferably a gRNA targeting a base sequence
set forth in any of SEQ ID NOs: 53 to 55 as a target base sequence; or a gRNA
targeting,
as a target base sequence, a base sequence in which one or several bases are
deleted,
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
49
substituted, or added at a 5' end of a base sequence set forth in any of SEQ
ID NOs: 53 to
55.
[0143]
Furthermore, as described above, a base sequence at a 5' end of the sgRNA may
be changed to G or GG in order to improve transcription efficiency from a
polymerase III
promoter.
[0144]
For example, in a case of focusing on the HLA-A allele, the HLA-A allele has
two genes, which are an HLA-A gene derived from a father and an HLA-A gene
derived
from a mother, and the FILA-A genes may be the same as or different from each
other in
depending on cases. In order to retain an antigen-presenting ability of HLA-A,
it is
necessary to cleave only one HLA-A gene and induce knockout, and leave the
opposite
FILA-A gene. Alternatively, in a case where it is desired to induce complete
knockout,
it is necessary to cleave both HLA-A genes.
[0145]
In general, in a case of targeting two genes to CRISPR-gRNA, it is general to
design two gRNAs and induce DNA cleavage separately. Accordingly, in a case of
knockout of multiple HLA genes, it is possible to use a gRNA specific to each
HLA gene.
[0146]
As will be described later in Examples, when the inventors of the present
invention utilized a feature, in which HLA genes have high DNA sequence
homology
with each other, to search for a gRNA capable of inducing cleavage of multiple
HLA
genes with one gRNA (for example, both the father-derived sequence and the
mother-
derived sequence of the HLA-A gene, or the HLA-A gene and the HLA-B gene),
such
gRNA sequences could be identified.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
[0147]
As will be described later in Examples, by using the gRNA of the second
embodiment, it is possible to reduce the types of gRNA required in a case of
cleaving
multiple HLA genes (or alleles). Thereby, costs of producing gRNAs can be
reduced.
5 In addition, the risk of off-target mutagenesis can be reduced by
reducing the types of
gRNA used.
[0148]
[Other Embodiments]
In one embodiment, the present invention provides an HLA protein expression-
10 inducing agent which includes IFNI', IFN-a, IFN-f3, IL-4, GM-CSF, TGF-a,
or TGF-13 as
an active ingredient, and which induces HLA protein expression while still
maintaining
pluripotency of pluripotent stem cells.
[0149]
In one embodiment, the present invention provides a method for inducing
15 expression of an HLA protein while still maintaining pluripotency of
pluripotent stem
cells, the method including a step of adding 1FN-7, IFN-a, IFN-13, IL-4, GM-
CSF, TGF-a,
or TGF-13 in a medium of pluripotent stem cells.
Examples
20 [0150]
Next, the present invention will be described in more detail with reference to
examples, but the present invention is not limited to the following examples.
[0151]
[Experimental Example 1]
25 (Design of gRNA)
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
51
It is difficult to design a base sequence of gRNA that cleaves only a specific
HLA haplotype because an HLA gene has a large individual difference in
sequence and
homology between HLA genes is high. Specifically, for example, it was
difficult to
design a gRNA sequence that recognizes only an HLA-A*01:01 allele and does not
recognize other HLA-A alleles, HLA genes other than HLA-A, and other genomic
regions.
[0152]
Accordingly, a target base sequence of gRNA that recognizes the HLA-A allele,
the HLA-B allele, and the HLA-C allele was determined by the following method.
First, from the IPD-IMGT/HLA database (https://www.ebi.ac.uk/ipd/imgt/h1a/),
an
"hla_gen.fasta" file including base sequences of genomic DNA of all HLA
haplotypes
was downloaded.
[0153]
Then, from the base sequences of genomic DNA of all HLA haplotypes, a base
sequence corresponding to "NNNNNNNNNNNNNNNNNNNNNGG" (SEQ ID NO:40)
was extracted as a candidate of a target base sequence of a gRNA of SpCas9
(sgRNA).
[0154]
Then, base sequences of each candidate were mapped to the base sequences of
all HLA haplotypes using a Bowtie program (http://bowtie-
bio.sourceforge.net/index.shtml), and it was analyzed how many sites and to
which HLA
gene the base sequences of each candidate were mapped. The same operation can
be
performed using a sequence homology search program other than the Bowtie
program.
[0155]
Then, based on results of the Bowtie program, the results were classified into
a
case in which each sgRNA was bonded to only one of the HLA-A allele, the HLA-B
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
52
allele or the HLA-C allele, and a case in which each sgRNA was bonded to two
or more
HLA alleles such as the HLA-A allele and the HLA-B allele, the HLA-A allele
and the
HLA-C allele, the HLA-B allele and the HLA-C allele, and the HLA-A allele, the
HLA-
B allele, and the HLA-C allele.
[0156]
Then, all candidate base sequences were mapped to a reference human genome
sequence (Hg19) using Bowtie, and it was checked whether or not the candidate
base
sequences were mapped to a genomic region other than the HLA allele. As a
result, a
candidate base sequence mapped only to the HLA allele was extracted as an
intended
.. target base sequence.
[0157]
Fig. 1(a) is a Venn diagram showing which of the HLA-A allele, the HLA-B
allele, and the HLA-C allele is targeted by a target base sequence extracted
in the present
experimental example. The numbers in the figure indicate the number of target
base
.. sequences of sgRNA. As a result, it was possible to determine a large
number of target
base sequences of sgRNA targeting only one of the HLA-A allele, the HLA-B
allele, or
the HLA-C allele, and target base sequences of sgRNA targeting two or more HLA
alleles such as the HLA-A allele and the HLA-B allele, the HLA-A allele and
the HLA-C
allele, the HLA-B allele and the HLA-C allele, the HLA-A allele, the HLA-B
allele, and
the HLA-C allele.
[0158]
Fig. 1(b) is a diagram showing which sites of an HLA-A allele, an HLA-B
allele,
and an HLA-C allele a target base sequence of an sgRNA identified in the
present
experimental example targets. In Fig. 1(b), boxes connected by lines indicate
exons of
.. each HLA gene, and the HLA-A allele has an exon 1 on the left side, and the
HLA-B
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
53
allele and the HLA-C allele have an exon 1 on the right side. In addition, the
term "[+]
strand sgRNAs" indicates target base sequences targeting plus-strand DNA, the
term "[-]
strand sgRNAs" indicates target base sequences targeting minus-strand DNA, and
the
term "Unique k-mers" indicates a set of 10 to 16 mer base sequences (also
referred to as
"k-mer sequences") that is present only at one site on the human genome.
[0159]
As a result, it was revealed that a large number of sgRNA target sequences
could
be found at a site at which a peak of unique k-mers was high. A considerable
number of
target base sequences could be found in both the plus-strand DNA and the minus-
strand
DNA.
[0160]
On SEQ ID NOs: 3, 4, 7, 45 to 52, and 72 to 2459, a base sequence is shown,
which is extracted as a base sequence that is mapped to only one target HLA
haplotype in
a case where the base sequence is mapped to base sequence data of genomic DNA
of all
HLA haplotypes, but that is not mapped in a case where the base sequence is
mapped to
base sequence data of all genomic DNA except for HLA alleles. In addition,
Table 1
shows, as an example, the number of target HLA alleles and target HLA alleles
for some
base sequences.
[0161]
[Table 1]
SEQ ID NO. Number of target HLA alleles Target HLA alleles
72 1 A*11:01:01:02
73 1 A*11:05
74 1 A*11:01:01:02
75 1 A*02:43N
76 1 B*73:01
[0162]
In addition, on SEQ ID NOs: 53 to 55 and 2460 to 8013, a base sequence is
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
54
shown, which is extracted as a base sequence that is mapped to two or more
target HLA
haplotypes in a case where the base sequence is mapped to base sequence data
of
genomic DNA of all HLA haplotypes, but that is not mapped in a case where the
base
sequence is mapped to base sequence data of all genomic DNA except for HLA
alleles.
In addition, Table 2 shows, as an example, the number of target HLA alleles
and target
HLA alleles for some base sequences.
[0163]
[Table 2]
Number of target
SEQ ID NO. Target HLA alleles
HLA alleles
A*02:01:01:01, A*02:01:01:02L, A*02:01:01:03, A*02:01:01:04, A
*02:01:01:05, A*02:01:01:06, A*02:01:120, A*02:01:121, A*02:02:
01:01, A*02:02:01:02, A*02:03:01, A*02:03:03, A*02:05:01, A*02
:06:01:01, A*02:06:01:02, A*02:06:01:03, A*02:06:22, A*02:07:01,
2460 44 A*02:10, A*02:193, A*02:251, A*02:259, A*02:264,
A*02:265,
A*02:266, A*02:269, A*02:279, A*02:32N, A*02:376, A*02:43N,
A*02:455, A*02:48, A*02:51, A*02:533, A*02:53N, A*02:602, A
*02:603, A*02:60:01, A*02:68, A*02:77, A*02:81, A*02:89, A*02
:95, A*69:01
2461 2 A*80:01:01:01, A*80:01:01:02
-A*01:01:01:01, A*01:01:01:02N, A*01:01:38L, A*01:01:71, A*01:
01:73, A*01:02, A*01:03, A*01:04N, A*01:09, A*01:11N, A*01:1
4, A*01:16N, A*01:194, A*01:20, A*02:57, A*02:65, A*03:01:01:
01, A*03:01:01:02N, A*03:01:01:03, A*03:01:01:04, A*03:01:01:0
5, A*03:01:01:06, A*03:02:01, A*03:11N, A*03:213, A*03:218, A
*03:21N, A*03:224, A*03:231, A*03:234Q, A*03:36N, A*03:89:0
2, A*11:01:01:01, A*11:01:18, A*11:02:01, A*11:05, A*11:110,
A*11:183, A*11:190, A*11:210N, A*11:25:01, A*11:50Q, A*11:6
0, A*11:69N, A*11:74, A*11:75, A*11:77, A*23:01:01, A*23:09,
A*23:17, A*23:19N, A*23:38N, A*24:02:01:01, A*24:02:01:02L,
A*24:02:01:03, A*24:02:01:04, A*24:02:01:05, A*24:02:03Q, A*2
4:02:10, A*24:03:01, A*24:07:01, A*24:08, A*24:09N, A*24:10:0
1, A*24:11N, A*24:152, A*24:20, A*24:215, A*24:252N, A*24:2
2462 138 93, A*24:56, A*24:61, A*24:86N, A*25:01:01,
A*26:01:01:01, A*
26:01:01:02, A*26:01:39, A*26:04, A*26:07:02, A*26:107N, A*26
:115, A*26:11N, A*26:15, A*26:50, A*29:01:01:01, A*29:01:01:0
2N. A*29:02:01:01, A*29:02:01:02, A*29:02:01:03, A*29:02:17, A
*29:03, A*29:46, A*31:01:02:01, A*31:01:02:02, A*31:01:02:03N,
A*31:01:04, A*31:01:23, A*31:01:24, A*31:04, A*31:14N, A*31:
36, A*31:46, A*32:01:01, A*32:06, A*32:69, A*33:01:01, A*33:0
3:01, A*33:07, A*34:01:01, A*34:02:01, A*34:14, A*36:01, A*43
:01, A*66:01:01, A*66:17, A*68:01:01:01, A*68:01:01:02, A*68:0
1:02:01, A*68:01:02:02, A*68:01:02:03, A*68:02:01:01, A*68:02:0
1:02, A*68:02:01:03, A*68:02:02, A*68:03:01, A*68:07, A*68:08:
01, A*68:139, A*68:140, A*68:17, A*68:18N, A*68:22, A*68:71,
A*74:01:01, A*74:01:02, A*74:01:03, A*74:02:01:01, A*74:02:01:
02
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
2463 2 A*80:01:01:01, A*80:01:01:02
A*30:01:01, A*30:01:1 , A*30:02:01:01, A*30:02:0 I :02, A*30:02:
2464 7
01:03, A*30:04:01, A*30:89
[0164]
Furthermore, Table 3 shows the number of target HLA alleles and the number of
extracted target base sequences, regarding a base sequence extracted as a base
sequence
that is mapped to two or more target HLA haplotypes in a case where the base
sequence
5 is mapped to base sequence data of genomic DNA of all HLA haplotypes, but
that is not
mapped in a case where the base sequence is mapped to base sequence data of
all
genomic DNA except for HLA alleles.
[0165]
[Table 3]
Number of target HLA alleles Number of target base sequences
2 378
3 115
4 88
5-10 537
11-100 2604
101-200 926
20]-300 547
301-400 173
40]-500 65
501 or more 121
10 [0166]
[Experimental Example 2]
(Induction 1 of HLA protein expression by stimulation of iPS cells)
An attempt was made to stimulate undifferentiated iPS cells to induce HLA
protein expression. Specifically, 100 ng/mL of lipopolysaccharide (LPS), 100
ng/mL of
15 .. TNF-a, or 50 ng/mL of IFN-y was added to a medium of iPS cells and
treated for 48
hours. Thereafter, flow cytometric analysis was performed using an anti-HLA-
ABC
antibody (product number: 311418, BIOLEGEND) to examine expression of HLA
protein.
[0167]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
56
Fig. 2 is a graph showing results of flow cytometry. As a result, it was
revealed
that the addition of IFN-y increased the expression of HLA protein.
[0168]
[Experimental Example 3]
(Induction 2 of HLA protein expression by stimulation of iPS cells)
ng/mL, 50 ng/mL, or 100 ng/mL of 1FN-y was added to a medium of iPS
cells and treated for 48 hours. Thereafter, flow cytometric analysis was
performed
using an anti-HLA-ABC antibody (product number: 311418, B1OLEGEND) to examine
expression of HLA protein.
10 [0169]
Fig. 3 is a graph showing results of flow cytometry. As a result, it was
revealed
that the addition of IFN-y increased the expression of HLA protein. As a
result, it was
revealed that the addition of any concentration of IFN-y increased the
expression of HLA
protein.
[0170]
[Experimental Example 4]
(Induction 3 of HLA protein expression by stimulation of iPS cells)
50 ng/mL of 1FN-y was added to a medium of iPS cells and treated for 4 hours,
8
hours, 16 hours, 24 hours, and 48 hours. Thereafter, flow cytometric analysis
was
performed using anti-HLA-A2 antibody (product number:740082, BD) to examine
expression of HLA-A2 protein.
[0171]
Fig. 4(a) is a graph showing results of flow cytometry. In addition, Fig. 4(b)
is
a diagram showing a schedule for an IFN-y treatment of iPS cells and analysis
of an
expression level of an HLA-A protein. As a result, it was revealed that the
longer the
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
57
IFN-y treatment time, the higher the expression of HLA protein. Furthermore,
as a
result of further examination, it was revealed that after the iPS cells were
treated with
IFN-y for 48 hours, the expression of HLA protein was maintained even 7 days
after
removal of IFN-y from the medium.
[0172]
[Experimental Example 5]
(Determination of HLA haplotype of cells)
An HLA haplotype of each cell (a pair of each HLA allele inherited from
parents) was determined by the following method.
[0173]
First, a FASTQ sequence file was created for each of 604B1 iPS cells and
1383D2 iPS cells based on Whole Exome Sequencing (WES) analysis results of the
604B1 iPS cells and Whole Genome Sequencing (WGS) analysis results of the
1383D2
iPS cells.
[0174]
Subsequently, each FASTQ sequence file was mapped to a reference human
genome sequence (Hg19) to create a BAM file. Subsequently, each of the above-
described BAM files was analyzed using software (name "HLA-genotyper,"
https://pypi.python.org/pypi/hla-genotyper/0.4.2b1) to determine an HLA
haplotype of
each cell.
[0175]
In addition, for 585A1 iPS cells, extracted genomic DNA was sent to HLA
Research Institute (http://hla.or.jp/), and an HLA haplotype was determined by
a
fluorescent bead method (PCR-rSSO/Luminex method). Furthermore, for 604B1 iPS
.. cells, an HLA haplotype was determined in the same manner as for 585A1 iPS
cells.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
58
[0176]
Furthermore, regarding peripheral blood mononuclear cells (PBMC), cells for
which HLA haplotype information was provided by the vendors (CTL, Wako) were
used.
[0177]
[Experimental Example 6]
(Examination on genomic cleavage activity of sgRNA)
Among the sgRNAs targeting the target base sequence specified in Experimental
Example 1, A0207-ex3-gl (where a target base sequence is shown in SEQ ID NO:
3),
A0207-ex3-g2 (where a target base sequence is shown in SEQ ID NO: 4), and
A0207-
ex3-g4 (where a target base sequence is shown in SEQ ID NO: 7), which were
sgRNAs
which cleaved only an A*02:07 allele and of which base sequences did not match
an
A*32:01 allele, were selected.
[0178]
A base sequence of each sgRNA used in each of the following experimental
examples was a base sequence in which a scaffold sequence set forth in SEQ ID
NO:39
was linked to a 3' side of a base sequence from which a PAM sequence was
removed
from a target base sequence of each sgRNA. For example, in a case where a base
sequence from which a PAM sequence was removed from a target base sequence was
"5'-NNNNNNNNNNNNNNNNNNNN-3¨ (SEQ ID NO:62), a base sequence of an
sgRNA used was "5'-
NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAAAA
UAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU
UUUU-3" (SEQ ID NO:63). Furthermore, in each of the following experimental
examples, each sgRNA was introduced into a cell in the form of an expression
vector and
expressed in the cell to be used.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
59
[0179]
Fig. 5(a) is a diagram showing target bases and target sites of sgRNAs found
in
an exon 3 region of HLA-A. In Fig. 5 (a), a box indicates an exon of an HLA-
A*02:07
gene, and an arrow indicates a position of a target base sequence of each
sgRNA.
Furthermore, Fig. 5(a) also shows a base sequence of a wild type A*02:07
allele and a
base sequence of a wild type A*32:01 allele. Portions of both alleles at which
sequences differ are shown with capital letters, and a PAM sequence of sgRNA
is shown
with an underline.
[0180]
Subsequently, A0207-ex3-gl, A0207-ex3-g2, and A0207-ex3-g4 were each
transfected together with purified Cas9 protein into 1383D2 iPS cells having
an HLA
haplotype of Table 4. The transfection was carried out using a commercially
available
kit (model "CRISPR-MAX," product number: CMAX00003, Thermo Fisher Scientific).
[0181]
[Table 4]
1-ILA haplotype of 1383D2 iPS cell
HLA-A HLA-B HLA-C
HLA allele A*02:07 A*32:01 B*15:02 B*51:01 C*08:01 C*14:02
[0182]
Then, after extracting genomic DNA, gene mutation introduction efficiency in
each cell was examined by T7 endonuclease I (T7EI) assay. The T7EI assay was
performed as follows.
[0183]
First, Nested PCR was performed using a primer that specifically amplifies the
A*02:07 allele of the HLA-A2 region. Primers shown in Table 5 were used for
Nested
PCR.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
[0184]
[Table 5]
Primers for 1st PCR
Primer name Base sequence SEQ ID NO.
1383D2-HLA-A-be-ex1-fwd TTGGGGATTCCCCAACTCC 41
HLA-A-in7-rev GTCCACTGTTCCGCCCAA 42
Primers for 2nd PCR
Primer name Base sequence SEQ ID NO.
HLA-A0207-ex2-fwd GGTCCGGAGTATTGGGACGG 43
HLA-A0207-ex3-rev TCTCAACTGCTCCGCCACAT 44
5 [0185]
Then, a PCR product was purified, and 1/10 volume of 10 x NEBuffer2 (NEB)
buffer was added to the purified PCR product (400 ng) and heated at 95 C for 5
minutes
to heat-modify double-stranded DNA. Thereafter, re-annealing was performed by
gradually lowering the temperature. More specifically, cooling was performed
from
10 95 C to 85 C at -2 C/sec, and from 85 C to 25 C at -0.1 C/sec.
[0186]
Then, 10 units of T7 endonuclease I (T7EI, Cat. No. M0302S, NEB) was added
to the PCR product after reannealing and treated at 37 C for 15 minutes.
Subsequently,
activity of T7EI was stopped by adding a 0.25 M EDTA solution at 1/10 volume
of the
15 reaction solution, and then a sample was maintained at a low temperature
(on ice).
[0187]
Subsequently, the T7EI-treated PCR product was subjected to 2% agarose gel
electrophoresis, and DNA signal intensities of a cleaved band and an uncut
band were
quantified with ImageJ software.
20 [0188]
Fig. 5(b) shows the results of analysis of the genomic DNA mutation
introduction efficiency in a case where each sgRNA was used by the T7EI assay.
In
Date Regue/Date Received 2020-08-11
CA 03091136 2020-08-11
61
Fig. 5(b), "T7E1" indicates T7 endonuclease I, "-" indicates that no addition
was
performed, and "+" indicates that addition was performed. Furthermore, "ex3-
gl"
indicates a result of introducing A0207-ex3-gl , "ex3-g2" indicates a result
of introducing
A0207-ex3-g2, and "ex3-g4" indicates a result of introducing A0207-ex3-g4, and
"DMD#1" indicates a result of introducing an sgRNA specific to a dystrophin
gene,
which was used as a positive control. Furthermore, an arrowhead indicates a
band
cleaved by T7EI.
[0189]
As a result, it was revealed that A0207-ex3-g4 sgRNA has the highest genome
cleavage activity.
[0190]
[Experimental Example 7]
(HLA-allele-specific knockout 1)
<<Confirmation of HLA protein expression
In order to confirm the expression of HLA on a cell surface, two iPS cell
strains
having HLA serotype A2 (1383D2 strain and 404C2 strain) were selected.
Furthermore,
a 604B1 strain was selected as an iPS cell strain not having the HLA serotype
A2.
Regarding undifferentiated iPS cells of a total of three strains, for in a
case where the
cells were treated with cytokine and a case where the cells were treated with
50 ng/mL of
IFN-y for 48 hours, the cells were stained using an anti-HLA-A2 antibody
(product
number: 740082, BD), and flow cytometric analysis was performed thereon.
[0191]
Fig. 6(a) is a graph showing results of flow cytometric analysis. As a result,
by
1FN-7 treatment, specific expression of HLA-A2 was confirmed in the 1383D2
cells and
the 404C2 cells.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
62
[0192]
<<HLA-allele-specific knockout
Subsequently, A0207-ex3-gl (where a target base sequence is shown in SEQ ID
NO: 3), A0207-ex3-g2 (where a target base sequence is shown in SEQ ID NO: 4),
and
A0207-ex3-g4 (where a target base sequence is shown in SEQ ID NO: 7), which
were
the above-described sgRNAs, were respectively transfected into 1383D2 iPS
cells
together with a purified Cas9 protein. The transfection was carried out using
a
commercially available kit (model "CRISPR-MAX," product number: CMAX00003,
Thermo Fisher Scientific).
[0193]
In addition, as a control sgRNA that does not disrupt an HLA gene, sgRNA-
DMD#1 (where a target base sequence is shown in SEQ ID NO: 61) targeting a
dystrophin (DMD) gene on the X chromosome was used.
[0194]
Subsequently, each transfected iPS cell was passaged in 2 wells, one well kept
untreated with cytolcines and the other well was treated with 50 ng/mL of 1FN-
y added to
a medium for 48 hours. Thereafter, flow cytometric analysis was performed on
the cells
using an anti-HLA-A2 antibody (product number: 740082, BD).
[0195]
Fig. 6(b) is a graph showing results of flow cytometric analysis. As a result,
it
was revealed that, in a case where A0207-ex3-g4 sgRNA targeting the highest
genome
cleaving activity was used, the cells in which the largest number of an HLA-A2
antigen
was disrupted appeared.
[0196]
.. <<Analysis of base sequence of target site of sgRNA
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
63
Then, genomic DNA was extracted from 1383D2 iPS cells into which sgRNA
(A0207-ex3-g4) had been introduced, and using a primer specifically amplifying
the
A*02:07 allele and not amplifying the A*32:01 allele, Nested PCR was performed
to
amplify a target site of sgRNA. Primers shown in Table 6 were used for Nested
PCR.
[0197]
[Table 6]
Primers for 1st PCR
Primer name Base sequence SEQ ID NO.
1383D2-HLA-A-be-ex1-fwd TTGGGGATTCCCCAACTCC 41
HLA-A-in7-rev GTCCACTGTTCCGCCCAA 42
Primers for 2nd PCR
Primer name Base sequence SEQ ID NO.
HLA-A0207-ex2-fwd GGTCCGGAGTATTGGGACGG 43
HLA-A0207-ex3-rev TCTCAACTGCTCCGCCACAT 44
[0198]
Then, a PCR product was cloned by TA cloning into a pGEM-T-Easy vector
(Promega). Subsequently, 21 strains of Escherichia coli colonies were
recovered, and a
base sequence was determined by Sanger sequence. As a result, it was revealed
that 11
strains had a wild-type base sequence, but 10 strains (4 strains of deletion
and 6 strains of
insertion) had some insertion deletion mutation (Indel mutation).
[0199]
In addition, 1383D2 iPS cells to which sgRNA (A0207-ex3-g4) was introduced
were stained with an anti-HLA-A2 antibody (product number:740082, BD), and
cells in
which an HLA-A2 antigen became negative were sorted by a flow cytometer.
Genomic
DNA was extracted from the sorted iPS cells, and Nested PCR was performed
using each
of the primers (described above) that specifically amplify the A*02:07 allele
which was
the target allele. In addition, Nested PCR was performed using each of primers
that
specifically amplify the A*32:01 allele which was not the target. Primers
shown in
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
64
Table 7 were used for Nested PCR of the A*32:01 allele.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
[0200]
[Table 7]
Primers for 1st PCR
Primer name Base sequence SEQ ID NO.
1383D2-HLA-A-be-ex1-fwd TTGGGGATTCCCCAACTCC 41
HLA-A-in7-rev GTCCACTGTTCCGCCCAA 42
Primers for 2nd PCR
Primer name Base sequence SEQ ID NO.
HLA-A3201-ex2-fwd GGGCCGGAGTATTGGGACCA 70
HLA-A3201-ex3-rev CTCAACTGCTCCGCCACAT 71
5 [0201]
Then, a PCR product was cloned by TA cloning into a pGEM-T-Easy vector
(Promega). Escherichia coli colonies were recovered from 16 strains (A*02:07
allele)
and 19 strains (A*32:01 allele), and base sequences were determined by Sanger
sequence. Then, based on the determined base sequence, the number of clones
with a
10 deletion in the sequence, the number of clones with insertion, and the
number of clones
without sequence change were counted.
[0202]
As a result, the A*02:07 allele had some insertion deletion mutation (Indel
mutation) in all subclones of the 16 strains. On the other hand, the A*32:01
allele was
15 confirmed to be a wild-type base sequence in all subclones of the 19
strains.
[0203]
Fig. 7 shows a graph showing genomic DNA mutation introduction efficiency in
a case where sorting by HLA-A2 antigen expression was not performed and in a
case
where sorting a cell group in which HLA-A2 antigen expression was negative was
20 performed, after introducing sgRNA into the iPS cell 1383D2 strain to
induce genome
editing.
[0204]
Date Regue/Date Received 2020-08-11
CA 03091136 2020-08-11
66
As a result, it was revealed that proportion of cells in which the A*02:07
target
allele was genome-edited was increased by sorting HLA antigen-negative cells.
In
addition, it was also confirmed that no mutation was introduced into the HLA-
A*32:01
allele, which is a non-target allele.
[0205]
[Experimental Example 8]
(HLA-allele-specific knockout 2)
By disrupting the HLA allele of 604B1 iPS cells having the 1-ILA haplotype
shown in Table 8, low-antigenic cells were produced in which a rejection
reaction was
.. reduced in a case where the cells were allogeneically transplanted into a
recipient A
having a hypothetical HLA haplotype shown in Table 9. HLA haplotypes shown in
Table 9 are HLA haplotypes of peripheral blood mononuclear cells (PBMC, type
"LP_194," CTL).
[0206]
As shown in Table 8 and Table 9, 604B1 iPS cells have A*01:01 and B*07:02
alleles. In addition, these HLA alleles are not present in the recipient A.
Accordingly,
in a case where the 604B1 iPS cells or cells differentiation-induced from the
604B1 iPS
cells are transplanted into a recipient, T cells of the recipient A attack the
cells and
immune rejection occurs.
[0207]
For this reason, in order to reduce a rejection reaction, the HLA alleles that
are
present in the donor cells but not present in the recipient A, that is, the
A*01:01 allele and
the B*07:02 allele, are disrupted such that cells do not express an HLA
protein specific to
donor cells.
[0208]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
67
[Table 8]
HLA haplotype of 604131 iPS cell
HLA-A HLA-B HLA-C
A*01:01 A*24:02 B*07:02 B*37:01 C*06:02 C*07:02
[0209]
[Table 9]
HLA haplotype of virtual recipient A (PBMC "LP_194," CTL)
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*37:01 B*39:06 C*06:02 C*07:02
[0210]
From among the sgRNAs identified in Experimental Example 1, two sgRNAs
(A0101-ex3-gl (where a target base sequence is set forth in SEQ ID NO: 45) and
A0101-
ex3-g2 (where a target base sequence is set forth in SEQ ID NO: 46)) which
cleave only
the A*01:01 allele and of which base sequences do not match the A*24:02
allele; two
sgRNAs (B0702-ex2-gl (where a target base sequence is set forth in SEQ ID NO:
47)
and B0702-ex2-g2 (where a target base sequence is set forth in SEQ ID NO: 48))
which
cleave only the B*07:02 allele and of which sequences do not match the B*37:01
allele
were selected.
[0211]
Then, each of the above sgRNAs was synthesized by an in vitro transcription
reaction, and each was transfected into 604131 iPS cells together with a
purified Cas9
protein. The transfection was carried out using a commercially available kit
(model
"CRISPR-MAX," product number: CMAX00003, Thermo Fisher Scientific).
[0212]
When the A*01:01 allele or the B*07:02 allele was cleaved by the introduction
of sgRNA and a gene mutation occurred in the process of repairing it, the
A*01:01 allele
or the B*07:02 allele was knocked out, and thereby cells in which an HLA -Al
protein or
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
68
an HLA-B7 protein was deficient were obtained.
[0213]
Subsequently, each iPS cell was stimulated with 50 ng/naL of IFN-y for 48
hours
to induce the expression of HLA protein. Subsequently, each iPS cell was
stained with
an anti-HLA-Al antibody (type "ab33883," abeam) or an anti-HLA-B7 antibody
(type
"MCA986," Bio-Rad), and a percentage of HLA protein-negative cells was
analyzed by
flow cytometry.
[0214]
Fig. 8(a) and Fig. 8(b) are graphs showing results of flow cytometric
analysis.
Fig. 8(a) shows the results of measuring an expression level of the HLA-Al
protein in
the iPS cells in which the A*01:01 allele was disrupted, and Fig. 8(b) shows
the results of
measuring an expression level of the HLA-B7 protein in the iPS cells in which
the
B*07:02 allele was disrupted. In Figs. 8(a) and 8(b), "No transfection"
indicates the
results of the iPS cells into which an sgRNA was not introduced.
[0215]
As a result, it was revealed that 11.2% of cells were deficient in the HLA-Al
protein in a case where A0101-ex3-gl (where a target base sequence is set
forth in SEQ
ID NO: 45) was used as sgRNA. In addition, it was revealed that 18.9% of the
cells
were deficient in the HLA-Al protein in a case where A0101-ex3-g2 (where a
target base
sequence is set forth in SEQ ID NO: 46) was used as an sgRNA. Based on these
results, it was revealed that A0101-ex3-g2 was an sgRNA targeting a higher
knockout
efficiency.
[0216]
Furthermore, it was revealed that 11.6% of cells were deficient in the HLA-B7
protein in a case where B0702-ex2-gl (where a target base sequence is set
forth in SEQ
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
69
ID NO: 47) was used as sgRNA. Furthermore, it was revealed that 0.7% of cells
were
deficient in the HLA-B7 protein in a case where B0702-ex2-g2 (where a target
base
sequence is set forth in SEQ ID NO: 48) was used as sgRNA. Based on these
results, it
was revealed that B0702-ex2-gl was an sgRNA targeting a higher knockout
efficiency.
[0217]
Based on these results, A0101-ex3-g2 and B0702-ex2-gl which had high
knockout efficiency were selected, and both A*01:01 allele and B*07:02 allele
were
knocked out. Specifically, 604B1 iPS cells were transfected with the selected
two kinds
of sgRNA together with a purified Cas9 protein. The transfection was carried
out using
a commercially available kit (model "CRISPR-MAX," product number: CMAX00003,
Thermo Fisher Scientific).
[0218]
Subsequently, iPS cells were stimulated with 50 ng/mL of IFN-y for 48 hours to
induce the expression of HLA protein. Subsequently, iPS cells were stained
with an
anti-HLA-Al antibody (type "ab33883," abeam) and an anti-HLA-B7 antibody (type
"MCA986," Bio-Rad), and analysis was performed by flow cytometry.
[0219]
Fig. 9(a) and Fig. 9(b) are graphs showing results of flow cytometric
analysis.
In Fig. 9(a), "No transfection" indicates the analysis results of the iPS
cells into which an
sgRNA was not introduced. In addition, in Fig. 9(b), "A0101-ex3-g2" and "B0702-
ex2-
gl" indicate the analysis results of iPS cells into which these two sgRNAs
were co-
introduced and both the A*01:01 allele and the B*07:02 allele were knocked
out.
[0220]
In addition, single cell sorting was performed from a cell population in which
both HLA-Al protein and HLA-I37 protein were negative, and subclones of 15
strains
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
were recovered. Subsequently, genomic DNA was extracted from each subclone.
Then, a PCR reaction for amplifying a region containing a target site (exon 3)
of A0101-
ex3-g2, which is the sgRNA used and a region containing a target site (exon 2)
of B0702-
ex2-gl was performed. Thereafter, a base sequence was analyzed by Sanger
sequence.
5 [0221]
Fig. 10(a) is a table showing a base mutation pattern of each clone recovered.
In Fig. 10(a), "WT" indicates that it was a wild-type base sequence, "-"
indicates that it
had a deletion mutation, and "+" indicates that it had an insertion mutation.
For
example, "-5 bp" indicates that it has a deletion of 5 bases, and "+18 bp"
indicates that it
10 has an insertion of 18 bases. In Fig. 10(b), base sequences of two
strains (#8 and #10)
are shown as a representative example.
(0222]
As a result, it was revealed that some insertion deletion mutation (hidel
mutation) occurred in both A*01:01 allele and B*07:02 allele in clones of 11
strains out
15 of 15 strains. From the clones of 11 strains in which Indel mutation
occurred, two
strains in which frameshift mutation occurred (#8 and #10) were selected and
used in the
following experiments.
[0223]
[Experimental Example 9]
20 (HLA-allele-specific knockout 3)
By disrupting the HLA allele of 585A1 iPS cells having the HLA haplotype
shown in Table 10, low-antigenic cells were produced in which a rejection
reaction was
reduced in a case where the cells were allogeneically transplanted into a
recipient B
having a hypothetical HLA haplotype shown in Table 11. HLA haplotypes shown in
25 Table 11 are HLA haplotypes of peripheral blood mononuclear cells (PBMC,
type
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
71
"2010113203," Wako).
[0224]
As shown in Table 10 and Table 11, the 585A1 iPS cells had the B*07:02 allele
and the C*07:02 allele. In addition, these HLA alleles are not present in the
recipient B.
Accordingly, in a case where the 585A1 iPS cells or cells differentiation-
induced from
the 585A1 iPS cells are transplanted into a recipient, T cells of the
recipient B attack the
cells and immune rejection occurs.
[0225]
For this reason, in order to reduce a rejection reaction, the HLA alleles that
are
present in the donor cells but not present in the recipient B, that is, the
B*07:02 allele and
the C*07:02 allele, are disrupted such that cells do not express an HLA
protein specific to
donor cells.
[0226]
[Table 10]
HLA haplotype of 585A1 iPS cell
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*07:02 B*52:01 C*07:02 C*12:02
[0227]
[Table 11]
HLA haplotype of virtual recipient B (PBMC "2010113203," Wako)
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*40:06 B*52:01 C*08:01 C*12:02
[0228]
As sgRNA, B0702-ex2-gl (where a target base sequence is set forth in SEQ ID
NO: 47) specific to the B*07:02 allele, and C0702-ex3-g3 (where a target base
sequence
is set forth in SEQ ID NO: 49) specific to the C*07:02 allele were used. In
addition,
both the B*07:02 allele and C*07:02 allele of the 585A1 iPS cells were knocked
out in
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
72
the same manner as in Experimental Example 7 except that a commercially
available kit
(trade name "4D-Nucleofector," model "V4XP-4032," Lonza) was used for
transfection.
[0229]
Subsequently, iPS cells were stimulated with 50 ng/mL of IFN-y for 48 hours to
induce the expression of HLA protein. Subsequently, iPS cells were stained
with an
anti-HLA-B7 antibody (type "MCA986," Bio-Rad), and analysis was performed by
flow
cytometry.
[0230]
Fig. Ills a graph showing results of flow cytometric analysis. In Fig. 11, "No
stain" indicates the analysis results of iPS cells that were not stained with
an antibody,
"No transfection" indicates the analysis results of iPS cells into which sgRNA
was not
introduced, and "B0702-ex2-gl" and "C0702-ex3-g3" indicate the analysis
results of iPS
cells in which both B*07:02 allele and C*07:02 allele were knocked out by
introducing
these sgRNAs into the cells.
[0231]
In addition, single cell sorting was performed from a cell population in which
an
HLA-B7 protein was negative, and subclones of 28 strains were recovered.
Subsequently, genomic DNA was extracted from each subclone. Then, a PCR
reaction
for amplifying a region containing a target site (exon 2) of B0702-ex2-gl ,
which is the
sgRNA used and a region containing a target site (exon 3) of C0702-ex3-g3 was
performed. Thereafter, a base sequence was analyzed by Sanger sequence.
[0232]
Fig. 12 is a table showing a base mutation pattern of each clone recovered. In
Fig. 12(a), "WT" indicates that it was a wild-type base sequence, "-"
indicates that it had
a deletion mutation, and "+" indicates that it had an insertion mutation. In
Fig. 12(b),
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
73
base sequences of three strains (#2, #11, and #26) are shown as a
representative example.
[0233]
As a result, it was revealed that some insertion deletion mutation (Indel
mutation) occurred in both B*07:02 allele and C*07:02 allele in multiple
clones. Three
strains (#2, #11, and #26) were selected from the clones in which the Indel
mutation had
occurred and used in the following experiment.
[0234]
[Experimental Example 10]
(HLA-allele-specific knockout 4)
By disrupting the HLA allele of 585A1 iPS cells having the HLA haplotype
shown in Table 12, low-antigenic cells were produced in which a rejection
reaction was
reduced in a case where the cells were allogeneically transplanted into a
recipient C
having a hypothetical HLA haplotype shown in Table 13. HLA haplotypes shown in
Table 13 are HLA haplotypes of peripheral blood mononuclear cells (PBMC, type
"LP_266," CTL).
[0235]
As shown in Tables 12 and 13, the 585A1 iPS cells had the B*52:01 allele and
the C*12:02 allele. In addition, these HLA alleles are not present in the
recipient C.
Accordingly, in a case where the 585A1 iPS cells or cells differentiation-
induced from
the 585A1 iPS cells are transplanted into the recipient C, T cells of the
recipient C attack
the cells and immune rejection occurs.
[0236]
For this reason, in order to reduce a rejection reaction, the HLA alleles that
are
present in the donor cells but not present in the recipient C, that is, the
B*52:01 allele and
the C*12:02 allele, are disrupted such that cells do not express an HLA
protein specific to
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
74
donor cells.
[0237]
[Table 12]
HLA haplotype of 585A1 iPS cell
HLA-A HLA-B 1-1LA-C
A*24:02 A*24:02 B*07:02 B*52:01 C*07:02 C*12:02
[0238]
[Table 13]
HLA haplotype of virtual recipient C (PBMC "LP_266," CTL)
HLA-A HLA-B HLA-C
A*03:01 A*24:02 B*07:02 B*40:02 C*03:05 C*07:02
[0239]
The C*12:02 allele in the 585A1 iPS cells was knocked out in the same manner
as in Experimental Example 9 except that C1202-ex3-gl (where a target base
sequence is
set forth in SEQ ID NO: 50), which was specific to the C*12:02 allele, was
used as
sgRNA, and that cell sorting was not performed. Thereby, subclones of 17
strains were
obtained. The cells were not sorted because the anti-HLA-C12 allele-specific
antibody
was not available.
[0240]
Subsequently, genomic DNA was extracted from each subclone. Then, a PCR
reaction for amplifying a region containing a target site (exon 3) of C1202-
ex3-gl, which
was sgRNA used, was performed. Thereafter, a base sequence was analyzed by
Sanger
sequence.
[0241]
Fig. 13(a) is a table showing a base mutation pattern of each clone recovered.
In Fig. 13(a), "-" indicates that it had a deletion mutation, and "+"
indicates that it had an
insertion mutation. As a result, it was revealed that some insertion deletion
mutation
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
(lndel mutation) occurred near the target site of sgRNA. From among the clones
in
which the Indel mutation had occurred, #1 cells having frameshift mutation
were
selected.
[0242]
5 Then, B5201-ex3-g2 (where a target base sequence is set forth in SEQ ID
NO:
51) specific to the B*52:01 allele was introduced, as sgRNA, into the #1 cells
in which
the C*12:02 allele was knocked out so that the B*52:01 allele was knocked out.
Thereby, subclones of 12 strains (clones #1-1 to #1-12) were obtained. The
cells were
not sorted because the anti-HLA-B52 allele-specific antibody was not
available.
10 [0243]
Subsequently, genomic DNA was extracted from each subclone. Then, a PCR
reaction for amplifying a region containing a target site (exon 3) of B5201-
ex3-g2, which
was sgRNA used, was performed. Thereafter, a base sequence was analyzed by
Sanger
sequence.
15 [0244]
Fig. 13(b) is a table showing a base mutation pattern of each clone recovered.
In Fig. 13(b), "Mut" indicates that it had a substitution mutation, "WT"
indicates that it
was a wild-type base sequence, and "-" had a deletion mutation. As a result,
it was
revealed that some mutation occurred near the target site of sgRNA. Fig. 13(c)
shows a
20 base sequence of a strain #1-1 as a representative example.
[0245]
[Experimental Example 11]
(HLA-allele-specific knockout 5)
By disrupting the HLA allele of 604B1 iPS cells having the HLA haplotype
25 shown in Table 14, low-antigenic cells were produced in which a
rejection reaction was
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
76
reduced in a case where the cells were allogeneically transplanted into a
recipient C
having a hypothetical HLA haplotype shown in Table 15. HLA haplotypes shown in
Table 15 are HLA haplotypes of peripheral blood mononuclear cells (PBMC, type
"LP_266," CTL).
.. [0246]
As shown in Tables 14 and 15, 604B1 iPS cells had A*01:01 allele, B*37:01
allele, and C*06:02 allele. In addition, these HLA alleles are not present in
the recipient
C. Accordingly, in a case where the 604B1 iPS cells or cells
differentiation-induced
from the 604B1 iPS cells are transplanted into the recipient, T cells of the
recipient attack
the cells and immune rejection occurs.
[0247]
For this reason, in order to reduce a rejection reaction, the HLA alleles that
are
present in the donor cells but not present in the recipient C, that is, the
A*01:01 allele, the
B*37:01 allele, and the C*06:02 allele, are disrupted such that cells do not
express an
.. HLA protein specific to donor cells.
[0248]
[Table 14]
HLA haplotype of 604B1 iPS cell
HLA-A HLA-B HLA-C
A*01:01 A*24:02 B*07:02 B*37:01 C*06:02 C*07:02
[0249]
.. [Table 15]
HLA haplotype of virtual recipient C (PBMC "LP_266," CTL)
HLA-A HLA-B HLA-C
A*03:01 A*24:02 B*07:02 B*40:02 C*03:05 C*07:02
[0250]
A0101-ex3-g2 (where a target base sequence is set forth in SEQ ID NO: 46)
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
77
which was specific to the *01:01 allele was used as sgRNA, and the A*01:01
allele of
604B1 iPS cells was knocked out in the same manner as in Experimental Example
9.
Subsequently, C0602-ex3-gl (where a target base sequence is set forth in SEQ
ID NO:
52), which was an sgRNA and was specific to the C*06:02 allele, was introduced
into the
cells to knock out the C*06:02 allele, and subclones of nine strains were
obtained.
[0251]
Subsequently, genomic DNA was extracted from each subclone. Then, a PCR
reaction for amplifying a region containing a target site (exon 3) of A0101-
ex3-g2, which
is the sgRNA used and a region containing a target site (exon 3) of C0602-ex3-
gl was
performed. Thereafter, a base sequence was analyzed by Sanger sequence.
[0252]
Fig. 14(a) is a table showing a base mutation pattern of each clone recovered.
In Fig. 14(a), "WT" indicates that it was a wild-type base sequence, "-"
indicates that it
had a deletion mutation, and "+" indicates that it had an insertion mutation.
As a result,
a clone having some insertion deletion mutation (Indel mutation) near the
target site of
sgRNA was obtained. In Fig. 14(b), the base sequence is shown as a
representative
example of a clone #3 in which frameshift mutation had occurred among clones
in which
Indel mutation had occurred.
[02531
Subsequently, B-ex2-gl (where a target base sequence is set forth in SEQ ID
NO: 53) specific to the HLA-B allele was introduced, as sgRNA, into the clone
#3 in
which the A*01:01 allele and the C*06:02 allele were knocked out to test
whether or not
a clone in which only the B*37:01 allele was knocked out could be obtained. B-
ex2-gl
is an sgRNA targeting both B*37:01 allele and B*07:02 allele.
[0254]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
78
Subsequently, iPS cells were stimulated with 50 ng/mL of IFN-y for 48 hours to
induce the expression of 1-ILA protein. Subsequently, iPS cells were stained
with an
anti-HLA-B7 antibody (type "MCA986," Bio-Rad), and analysis was performed by
flow
cytometry.
[0255]
Fig. 15(a) is a graph showing results of flow cytometric analysis. In Fig.
15(a),
"No stain" indicates the analysis results of iPS cells that were not stained
with an
antibody, "No transfection" indicates the analysis results of iPS cells into
which sgRNA
was not introduced, and "B-ex2-gl" indicates the analysis results of iPS cells
into which
the sgRNA was introduced and in which the HLA-B allele was knocked out.
[0256]
In addition, single cell sorting was performed from a cell population in which
an
HLA-B7 protein was positive, and subclones of 12 strains (clones #3-1 to #3-
12) were
recovered. Subsequently, genomic DNA was extracted from each subclone. Next, a
PCR reaction was performed for respectively amplifying a target B*37:01 allele
and a
non-target B*07:02 allele of a region containing a target site (exon 2) of B-
ex2-gl, which
is the sgRNA used. Thereafter, a base sequence was analyzed by Sanger
sequence.
[0257]
Fig. 15(b) is a table showing a base mutation pattern of each clone recovered.
In Fig. 13(b), "Mut" indicates that it had a substitution mutation, "WT"
indicates that it
was a wild-type base sequence, "-" had a deletion mutation, and "+" indicates
that it had
an insertion mutation. As a result, a clone having some insertion deletion
mutation
(lndel mutation) near the target site of sgRNA was obtained. In Fig. 15(c),
base
sequences of two strains (clones #3-11 and #3-12) are shown as representative
examples
among the clones in which the Indel mutation occurs only in the B*37:01
allele.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
79
[0258]
[Experimental Example 12]
(HLA-allele-specific knockout 6)
By disrupting an HLA allele of 604B1 iPS cells having an HLA haplotype
shown in Table 16, cells in which all three genetic loci of an HLA-A allele,
an HLA-B
allele, and an HLA-C allele were knocked out were produced. Fig. 16(a) is a
diagram
showing a target site of an sgRNA used in the present experimental example.
[0259]
[Table 16]
HLA haplotype of 604131 iPS cell
HLA-A HLA-B HLA-C
A*01:01 A*24:02 B*07:02 B*37:01 C*06:02 C*07:02
[0260]
The B*07:02 allele, B*37:01 allele, C*06:02 allele, and C*07:02 allele of
604B1 iPS cells were knocked out in the same manner as in Experimental Example
9
using, as sgRNA, BC-ex2-gl (where a target base sequence is set forth in SEQ
1D NO:
54) capable of targeting both HLA-B allele and HLA-C allele.
[0261]
Then, iPS cells were stimulated with 50 ng/mL 1FN-y for 48 hours and subjected
to flow cytometric analysis to examine the expression of HLA-B protein and HLA-
C
protein. Fig. 16(b) is a graph showing the results of flow cytometry. In Fig.
16(b),
"No stain" indicates the analysis results of iPS cells that were not stained
with an
antibody, "No transfection" indicates the analysis results of iPS cells into
which sgRNA
was not introduced, and "BC-ex2-gl" indicates the analysis results of iPS
cells into
which the sgRNA was introduced and in which both the HLA-B allele and the HLA-
C
allele were knocked out.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
[0262]
Subsequently, a cell population in which both the HLA-B protein and the HLA-
C protein was negative was sorted and recovered. Subsequently, A-ex3-gl (where
a
target base sequence is set forth in SEQ ID NO: 55) capable of targeting both
alleles of
5 an HLA-A gene was introduced into the recovered cell population, and the
A*01:01
allele and the A*24:02 allele were knocked out.
[0263]
Then, iPS cells were stimulated with 50 ng/mL IFN-y for 48 hours and subjected
to flow cytometric analysis to examine the expression of HLA-A protein, HLA-B
protein,
10 and HLA-C protein. Fig. 16(c) is a graph showing the results of flow
cytometry. In
Fig. 16(c), "No stain" indicates the analysis results of iPS cells that were
not stained with
an antibody, "No transfection" indicates the analysis results of iPS cells
into which
sgRNA was not introduced, and "A-ex3-gl" indicates the analysis results of iPS
cells
into which the sgRNA was introduced and in which the HLA-A allele was knocked
out.
15 [0264]
Subsequently, single cell sorting of a cell population in which HLA-A protein,
HLA-B protein, and HLA-C protein were all negative was performed to recover
subclones of 8 strains. Subsequently, genomic DNA was extracted from each
subelone.
Then, a PCR reaction for respectively amplifying a region containing a target
site which
20 was sgRNA used, was performed. Thereafter, a base sequence was analyzed
by Sanger
sequence.
[0265]
Fig. 17(a) is a table showing a base mutation pattern of one of the recovered
clones (clone #1). In Fig. 17(a), "-" indicates that it had a deletion
mutation, and "+"
25 indicates that it had an insertion mutation. As a result, it was
confirmed that a clone
Date Regue/Date Received 2020-08-11
CA 03091136 2020-08-11
81
could be obtained, in which an insertion deletion mutation (mndel mutation)
had occurred
in all of the A*01:01 allele, A*24:02 allele, B*07:02 allele, B*37:01 allele,
C*06:02
allele, and C*07:02 allele. Fig. 17(b) shows a base sequence of each HLA
allele of the
clone #1. In Fig. 17(b), "WT" indicates a wild-type base sequence.
[0266]
[Experimental Example 13]
(HLA-allele-specific knockout 7)
By disrupting an HLA allele of 585A1 iPS cells having an 1-ILA haplotype
shown in Table 17, cells in which the HLA-A allele and the HLA-B allele were
knocked
out and only one of the HLA-C allele was knocked out were produced.
[0267]
[Table 17]
HLA haplotype of 585A1 iPS cell
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*07:02 B*52:01 C*07:02 C*12:02
[0268]
The A*24:02 allele, B*07:02 allele, and B*52:01 allele of 585A1 iPS cells were
knocked out in the same manner as in Experimental Example 9 using, as sgRNA, A-
ex3-
gl capable of targeting the HLA-A allele (where a target base sequence is set
forth in
SEQ ID NO: 55) and B-ex2-gl capable of targeting the HLA-B allele (where a
target
base sequence is set forth in SEQ ID NO: 53).
.. [0269]
Then, iPS cells were stimulated with 50 ng/mL IFNI, for 48 hours and subjected
to flow cytometric analysis to examine the expression of HLA-A24 antigen and
HLA-B7
antigen. Fig. 18(a) is a graph showing results of flow cytometry.
[0270]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
82
Subsequently, single cell sorting was performed on a cell population in which
both HLA-A24 antigen and HLA-B7 antigen were negative, and subclones of 10
strains
were recovered. Subsequently, genomic DNA was extracted from each subclone.
Then, a PCR reaction for respectively amplifying a region containing a target
site which
was sgRNA used, was performed. Thereafter, a base sequence was analyzed by
Sanger
sequence.
[0271]
Fig. 18(b) is a table showing a base mutation pattern of each clone recovered.
In Fig. 18(b), "WT" indicates that it was a wild-type base sequence, "-" had a
deletion
mutation, "+" indicates that it had an insertion mutation, and "?" indicates
that it could
not be determined. As a result, a clone #3 was selected in which it was
revealed that
insertion deletion mutation (Indel mutations) had occurred in all of the
A*24:02 allele,
B*07:02 allele, and B*52:0I allele. Fig. 18(c) shows a base sequence of the
clone #3.
[0272]
Subsequently, C1202-ex3-gl (where a target base sequence is set forth in SEQ
ID NO: 50) specific to the C*12:02 allele was introduced into the clone #3,
and the
C*12:02 allele was knocked out. Subsequently, subclones of four strains
(clones #3-1
to #3-4) were recovered. Subsequently, genomic DNA was extracted from each
subclone. Subsequently, a PCR reaction for respectively amplifying the C*07:02
allele
and the C*12:02 allele was performed. Thereafter, the base sequence was
analyzed by
Sanger sequence.
[0273]
Fig. 18(d) is a table showing a base mutation pattern of each clone recovered.
In Fig. 18(d), "WT" indicates that it was a wild-type base sequence, and "-"
indicates that
it had a deletion mutation. As a result, it was confirmed that the C*07:02
allele
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
83
remained and clones of three strains (clones #3-1, #3-2, and #3-3) in which an
insertion
deletion mutation (Indel mutation) had occurred in the C*12:02 allele were
obtained.
Fig. 18(e) shows a base sequence of a clone #3-1 as a representative example.
[0274]
[Experimental Example 14]
(HLA-allele-specific knockout 8)
By disrupting an HLA allele of 604B1 iPS cells having an HLA haplotype
shown in Table 18, cells in which the HLA-A allele and HLA-B allele were
knocked out
were produced.
[0275]
[Table 18]
HLA haplotype of 604B1 iPS cell
HLA-A HLA-B HLA-C
A*01:01 A*24:02 B*07:02 B*37:01 C*06:02 C*07:02
[0276]
The A*01:01 allele, A*24:02 allele, B*07:02 allele, and B*37:01 allele of
.. 604B1 iPS cells were knocked out in the same manner as in Experimental
Example 9
using, as sgRNA, A-ex3-gl capable of targeting the HLA-A allele (where a
target base
sequence is set forth in SEQ ID NO: 55) and B-ex2-gl capable of targeting the
HLA-B
allele (where a target base sequence is set forth in SEQ ID NO: 53).
[0277]
Then, iPS cells were stimulated with 50 ng/mL IFN-y for 48 hours and subjected
to flow cytometric analysis to examine the expression of HLA-A24 antigen and
HLA-B7
antigen. Fig. 19(a) is a graph showing results of flow cytometry. In Fig.
19(a), "No
stain" indicates the analysis results of iPS cells that were not stained with
an antibody,
"No transfection" indicates the analysis results of iPS cells into which sgRNA
was not
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
84
introduced, and "A-ex2-gl" and "B-ex2-gl" indicate the analysis results of iPS
cells into
which these sgRNAs were introduced and in which both the HLA-A allele and the
HLA-
B allele were knocked out.
[0278]
Subsequently, a cell population in which both HLA-A24 antigen and HLA-B7
antigen were negative was sorted and recovered, and furthermore, the
expression of
HLA-Al antigen was examined. Fig. 19(b) is a graph showing the results of flow
cytometry. In Fig. 19(b), "No stain" indicates the analysis results of the iPS
cells not
stained with an antibody, and "HLA-A24, B7 (-) sorted" indicates the analysis
results of
a cell population in which both HLA-A24 antigen and HLA-B7 antigen were
negative.
[0279]
Subsequently, a cell population in which HLA-Al antigen was negative was
sorted and recovered, and subclones of 23 strains were recovered.
Subsequently,
genomic DNA was extracted from each subclone. Then, a PCR reaction for
respectively amplifying a region containing a target site which was sgRNA
used, was
performed. Thereafter, a base sequence of seven strains was analyzed by Sanger
sequence.
[0280]
Fig. 19(c) is a table showing a base mutation pattern of each clone recovered.
In Fig. 19(c), "WT" indicates that it was a wild-type base sequence, "-"
indicates that it
had a deletion mutation, and "+" indicates that it had an insertion mutation.
As a result,
it became clear that clones of six strains could be obtained in which all of
the A*01:01
allele, A*24:02 allele, B*07:02 allele, and B*37:01 allele had an insertion
deletion
mutation (lndel mutation). A base sequence of a clone #4 is shown in Fig.
19(d) as a
representative example.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
[0281]
[Experimental Example 15]
(HLA-allele-specific knockout 9)
By disrupting an HLA allele of 1383D2 iPS cells having an HLA haplotype
5 shown in Table 19, cells in which all three genetic loci of an HLA-A
allele, an HLA-B
allele, and an HLA-C allele were knocked out were produced. Fig. 20(a) is a
diagram
showing a target site of an sgRNA used in the present experimental example.
[02821
[Table 19]
10 HLA haplotype of 1383D2 iPS cell
HLA-A HLA-B HLA-C
A*02:07 A*32:01 B*15:02 B*51:01 C*08:01 C*14:02
[0283]
The B*15:02 allele, B*51:01 allele, C*08:01 allele, and C*14:02 allele of
1383D2 iPS cells were knocked out in the same manner as in Experimental
Example 9
using, as sgRNA, BC-ex2-gl (where a target base sequence is set forth in SEQ
1D NO:
15 54) capable of targeting both HLA-B allele and HLA-C allele.
[0284]
Then, iPS cells were stimulated with 50 ng/mL IFN-y for 48 hours and subjected
to flow cytometric analysis to examine the expression of HLA-B protein and HLA-
C
protein. Fig. 20(b) is a graph showing the results of flow cytometry. In Fig.
20(b),
20 "No stain" indicates the analysis results of iPS cells that were not
stained with an
antibody, "No transfection" indicates the analysis results of iPS cells into
which sgRNA
was not introduced, and "BC-ex2-gl" indicates the analysis results of iPS
cells into
which the sgRNA was introduced and in which both the HLA-B allele and the HLA-
C
allele were knocked out.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
86
[0285]
Subsequently, a cell population in which both the HLA-B protein and the HLA-
C protein was negative was sorted and recovered. Subsequently, A-ex3-gl (where
a
target base sequence is set forth in SEQ ID NO: 55) capable of targeting both
alleles of
.. an HLA-A gene was introduced into the recovered cell population, and the
A*02:07
allele and the A*32:01 allele were knocked out.
[0286]
Then, iPS cells were stimulated with 50 ng/mL IFN-y for 48 hours and subjected
to flow cytometric analysis to examine the expression of HLA-A protein, HLA-B
protein,
and HLA-C protein.
[0287]
Fig. 20(c) is a graph showing the results of flow cytometry. In Fig. 20(c),
"No
stain" indicates the analysis results of iPS cells that were not stained with
an antibody,
"No transfection" indicates the analysis results of iPS cells into which sgRNA
was not
introduced, and "A-ex3-gl" indicates the analysis results of iPS cells into
which the
sgRNA was introduced and in which the HLA-A allele was knocked out. As a
result,
the presence of a cell population in which all of HLA-A protein, HLA-B
protein, and
HLA-C protein were negative was confirmed.
[0288]
[Experimental Example 16]
(Modification of HLA allele)
An examination was conducted to modify the A*02:07 allele of 1383D2 iPS
cells having an HLA haplotype shown in Table 20 into the A*01:01 allele by
genome
editing.
[0289]
Date Regue/Date Received 2020-08-11
CA 03091136 2020-08-11
87
[Table 20]
HLA haplotype of 1383D2 iPS cell
HLA-A HLA-B HLA-C
A*02:07 A*32:01 B*15:02 B*51:01 C*08:01 C*14:02
[0290]
First, a double-regulated Cas9 expression vector and an sgRNA expression
vector, both of which are piggyBac transposon vectors, were introduced into
1383D2 iPS
cells. Drug selection was performed for 5 days using Puromycin (Cat. No. 29455-
54,
NACALAI TESQUE, INC.) at a final concentration of 1 to 15 kg/mL or hygromycin
B
(Cat. No. 10687-010, Thermo Fisher Scientific) at a final concentration of 100
to 200
ug/mL. Thereby, a cell population into which the chromosome was stably
introduced
was obtained.
[0291]
The double-regulated Cas9 expression vector is a Cas9 expression vector
capable of controlling both expression induction and intracellular
localization (Ishida et
al., Site-specific randomization of the endogenous genome by a regulatable
CR1SPR-
Cas9 piggyBac system in human cells, Sci. Rep., 8: 310, 2018). In the present
experimental example, a double-regulated Cas9 expression vector capable of
inducing
expression of a fusion protein of Cas9 protein and glucocorticoid receptor
(GR)
(hereinafter referred to as a "Cas9-GR protein") by adding doxycycline (Dox)
to a
medium of cells, and capable of translocating Cas9-GR into the nucleus by
adding
dexamethasone (Dex) to the medium of cells, was used. In addition, as the
sgRNA,
A0207-ex3-gl (where a target base sequence is set forth in SEQ ID NO: 3) was
used.
[0292]
Fig. 21(a) and Fig. 21(b) are schematic diagrams illustrating homologous
recombination in the present experimental example. Then, in order to induce
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
88
homologous recombination, single-stranded DNA (where a target base sequence is
set
forth in SEQ ID NO: 56) encoding a region containing exons 1 to 3 of the
A*01:01 allele
was produced.
[0293]
Specifically, first, using genomic DNA of 604B1 iPS cells as a template, a
portion from 67 bases upstream of exon 1 to 1247 bases downstream of exon 3 of
the
A*01:01 allele was amplified by PCR using a primer shown in Table 21, and
integrated
into a pENTR plasmid to produce a pENTR vector.
[0294]
[Table 21]
Primer name Base sequence SEQ ID
NO.
604B1-HLA-A-be-ex1+15bp-fwd ccaattcagtcgacgGTCGCGGTCGCTGTTCTAA 57
604B1-HLA-A-in3+15bp-rev gtetagatatctcgaTCATCAGTATTCGAGGGATCGTCT .. 58
[0295]
Subsequently, this plasmid DNA was treated with nicking endonuclease Nb.
BsrDI enzyme (Model number "R0648S," New England Biolabs), agarose
electrophoresis was performed under formamide denaturing conditions, the
corresponding DNA band was cut out and purified, and thereby a desired single-
stranded
DNA donor (IssDNA donor, SEQ ID NO: 56) was prepared.
[0296]
Subsequently, a PENTR vector (dsDNA donor) in a double-stranded DNA state
and prepared single-stranded DNA (lssDNA donor, SEQ ID NO: 56) were
respectively
introduced into 1383D2 iPS cells, Dox and Dex were added at final
concentrations of 2
uM and 1 uM, respectively, and homologous recombination was induced by genuine
editing.
[0297]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
89
Then, respective iPS cells were stimulated with 50 ng/mL IFN-y for 48 hours
and subjected to flow cytometric analysis to examine the expression of HLA-A2
antigen
and HLA-Al antigen.
[0298]
Fig. 21(c) is a graph showing the results of flow cytometry. In Fig. 20(c),
"No
stain" indicates the analysis results of iPS cells that were not stained with
an antibody,
"No Dox/Dex" indicates the analysis results of iPS cells that did not induce
Cas9
expression, "dsDNA donor" indicates the analysis results of iPS cells in which
a double-
stranded DNA donor was introduced to induce homologous recombination, and
"lssDNA
donor" indicates the analysis results of iPS cells in which a single-stranded
DNA donor
was introduced to induce homologous recombination.
[0299]
As a result, a ratio of negative A2 antigen and positive Al antigen was 0.2%
in a
case where double-stranded DNA was used as a donor, and was 1.6% in a case
where
single-stranded DNA was used as a donor.
[0300]
Subsequently, a cell population in which the A2 antigen became negative and
the
Al antigen became positive by homologous recombination using a single-stranded
DNA
donor was sorted by flow cytometry, and a base sequence of the HLA-A genetic
locus
was analyzed for the cell population and subclones after single cell sorting.
[0301]
Fig. 22(a) is a diagram showing the results of analyzing a base sequence of
the
cell population as it is. In Fig. 22(a), "Bulk" indicates the results obtained
by analyzing
the cell population as it is. As a result, it was revealed that cells in which
part of the
A*02:07 genetic locus (particularly a 5' side of exon 2 and exon 3) was
modified to an
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
A*01:01 gene were present in combination.
[0302]
In addition, Fig. 22(b) is a diagram showing the results of analyzing a base
sequence of a typical single cell-sorted subclone (clone #2). As a result, it
was revealed
5 that part of the A*02:07 genetic locus was modified to the A*01:01 gene.
[0303]
[Experimental Example 17]
(Production 1 of B2M knockout iPS cell)
1383D2 iPS cells were transfected with a plasmid vector expressing Cas9 and
10 B2M-specific sgRNA. As sgRNA, B2M-gl (where a target base sequence is
set forth
in SEQ ID NO: 59) and B2M-g2 (where a target base sequence is set forth in SEQ
ID
NO: 60) were used.
[0304]
Subsequently, cells stimulated with 50 ng/mL IFN-y for 48 hours were stained
15 with an anti-HLA-ABC antibody, and flow cytometric analysis was
performed.
[0305]
Fig. 23(a) is a graph showing results of flow cytometry. In Fig. 23(a), "No
stain" indicates the analysis results of iPS cells that were not stained with
an antibody,
"No transfection" indicates the analysis results of iPS cells into which sgRNA
was not
20 introduced, and "B2M-gl" and "B2M-g2" indicate the analysis results of
iPS cells into
which the sgRNA was introduced and in which the B2M allele was knocked out.
[0306]
As a result, a proportion of the cell population in which all of HLA-A
protein,
HLA-B protein, and HLA-C protein were negative was 2.8% in a case where B2M-gl
25 (where a target base sequence is set forth in SEQ ID NO: 59) was used as
sgRNA.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
91
Furthermore, a proportion thereof was 6.9% in a case where B2M-g2 (where a
target
base sequence is set forth in SEQ ID NO: 60) was used as sgRNA.
[0307]
Subsequently, single cell sorting was performed from a cell population in
which
HLA-A, HLA-B, and HLA-C were all negative, which were obtained by the
introduction
of B2M-g2 sgRNA. Thereby, subclones of two strains of clones #1 and #2 were
obtained.
[0308]
The obtained subclones of two strains were stimulated again with IFN-y for 48
hours, and flow cytometric analysis was performed. Fig. 23(b) is a graph
showing the
results of flow cytometry. In Fig. 23(b), "B2M-K0 #1" indicates the results of
the
clone #1, and "B2M-K0 #2" indicates the results of the clone #2. As a result,
it was
confirmed that HLA-A, HLA-B, and HLA-C were all negative in all the clones.
[0309]
Subsequently, the B2M gene of the clone #1 was amplified by PCR to check a
base sequence, and it was confirmed that an insertion deletion mutation (lndel
mutation)
had been introduced. Fig. 23(c) shows a base sequence of the B2M allele of the
clone
#1. In Fig. 23(c), "WT" indicates a wild-type base sequence.
[0310]
[Experimental Example 18]
(Production 2 of B2M knockout iPS cell)
604B1 iPS cells were subjected to the same operation as in Experimental
Example 17 to knock out the B2M allele. B2M-g2 (where a target base sequence
is set
forth in SEQ ID NO: 60) was used as sgRNA.
[0311]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
92
Subsequently, cells stimulated with 50 ng/mL 1FN-y for 48 hours were stained
with an anti-HLA-ABC antibody, and flow cytometric analysis was performed.
[0312]
Fig. 24(a) is a graph showing results of flow cytometry. In Fig. 24(a), "No
stain" indicates the analysis results of iPS cells that were not stained with
an antibody,
"No transfection" indicates the analysis results of iPS cells into which sgRNA
was not
introduced, and "B2M-g2" indicates that these sgRNAs were introduced to knock
out the
B2M allele. As a result, it became clear that a cell population in which all
of HLA-A
protein, HLA-I3 protein, and HLA-C protein were negative could be obtained.
[0313]
Subsequently, single cell sorting was performed from a cell population in
which
HLA-A, HLA-B, and HLA-C were all negative. Thereby, subclones of four strains
of
clones #1, #2, #3, and #4 were obtained.
[0314]
Then, the B2M gene of these subclones was amplified by PCR to check a base
sequence. Fig. 24(b) is a diagram showing results of analysis of a base
sequence. As a
result, it was confirmed that an insertion deletion mutation (Indel mutation)
was
introduced into all the subclones.
[0315]
[Experimental Example 19]
(Test 1 of T cell activation)
(1) 604B1 iPS cells having an HLA haplotype shown in Table 22, (2) a clone #8
which was produced in Experimental Example 8 and in which the A*01:01 and
B*07:02
alleles of the 604B1 iPS cells had been knocked out, (3) same clone #10, (4)
1383D2 iPS
cells having an HLA haplotype in Table 23, and (5) 604B1 iPS cells (clone #1)
which
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
93
were produced in Experimental Example 18 and in which the B2M allele had been
knocked out were respectively differentiation-induced into blood-cell-like
cells derived
from embryoid body (EB).
[0316]
[Table 22]
HLA haplotype of 604B1 iPS cell
HLA-A HLA-B HLA-C
A*01:01 A*24:02 B*07:02 B*37:01 C*06:02 C*07:02
[0317]
[Table 23]
HLA haplotype of 1383D2 iPS cell
HLA-A HLA-B HLA-C
A*02:07 A*32:01 B*15:02 B*51:01 C*08:01 C*14:02 -
[0318]
Subsequently, CD8-positive T cells recovered by sorting from peripheral blood
mononuclear cells having an HLA haplotype shown in Table 24 (PBMC, type
"LP_194,"
CTL, corresponding to the above-mentioned recipient A) were stained with CFSE
(Cayman Chemical Co., Ltd.). The cells were co-cultured with EB-derived blood-
cell-
like cells differentiated from the respective cells of (1) to (5) in the
presence of IL-2 and
IFN-y for 8 days.
[0319]
[Table 24]
HLA haplotype of PBMC (LP_194, CTL)
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*37:01 B*39:06 C*06:02 C*07:02-
[0320]
After co-culture, flow cytometric analysis was performed to examine
fluorescence of CFSE. Figs. 25(a) to 25(e) are graphs showing results of flow
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
94
cytometry. Figs. 25(a) to 25(e) show the results of CD8-positive T cells co-
cultured
with EB-derived blood-cell-like cells differentiated from the respective cells
of (1) to (5).
As a result, it was confirmed that only a T cell population that specifically
recognized an
HLA antigen of each of the iPS cells proliferated, and CFSE became negative.
[0321]
[Experimental Example 20]
(Test 2 of T cell activation)
(1) 585A1 iPS cells having an HLA haplotype shown in Table 25, (2) a clone #2
which was produced in Experimental Example 9 and in which the B*07:02 and
C*07:02
alleles of the 585A1 iPS cells had been knocked out, (3) same clone #11, (4)
same clone
#26, (5) 1383D2 iPS cells having an HLA haplotype in Table 26, and (6) 604B1
iPS cells
(clone # 1) which were produced in Experimental Example 18 and in which the
B2M had
been knocked out were respectively differentiation-induced into ES-derived
blood-cell-
like cells.
[0322]
[Table 25]
HLA haplotype of 585A1 iPS cell
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*07:02 B*52:01 C*07:02 C*12:02
[0323]
[Table 26]
HLA haplotype of 1383D2 iPS cell
HLA-A HLA-B HLA-C
A*02:07 A*32:01 B*15:02 B*51:01 C*08:01 C*14:02
[0324]
Subsequently, CDS-positive T cells recovered by sorting from peripheral blood
mononuclear cells having an HLA haplotype shown in Table 27 (PBMC, type
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
"2010113203," Wako, corresponding to the above-mentioned recipient B) were
stained
with CFSE (Cayman Chemical Co., Ltd.). The cells were co-cultured with EB-
derived
blood-cell-like cells differentiated from the respective cells of (1) to (6)
in the presence
of IL-2 and IFN-y for 8 days.
5 [0325]
[Table 27]
HLA haplotype of PBMC ("2010113203," Walco)
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*40:06 B*52:01 C*08:01 C*12:02
[0326]
After co-culture, flow cytometric analysis was performed to examine
10 fluorescence of CFSE. Figs. 26(a) to 26(f) are graphs showing results of
flow
cytometry. Figs. 26(a) to 26(f) show the results of CD8-positive T cells co-
cultured
with EB-derived blood-cell-like cells differentiated from the respective cells
of (1) to (6).
As a result, it was confirmed that a T cell population that specifically
recognized an HLA
antigen of each of the iPS cells proliferated, and CFSE became negative.
15 [0327]
[Experimental Example 21]
(Test 3 of T cell activation)
(1) 604B1 iPS cells having an HLA haplotype shown in Table 28, (2) a clone #3-
11 which was produced in Experimental Example 11 and in which the A*01:01,
B*37:01,
20 and C*06:02 alleles of the 604B1 iPS cells had been knocked out, (3)
same clone #3-12,
(4) 1383D2 iPS cells having an HLA haplotype in Table 29, and (5) 604B1 iPS
cells
(clone # 1) which were produced in Experimental Example 18 and in which the
B2M had
been knocked out were respectively differentiation-induced into ER-derived
blood-cell-
like cells.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
96
[0328]
[Table 28]
HLA haplotype of 604B1 iPS cell
HLA-A HLA-B HLA-C
A*01:01 A*24:02 B*07:02 B*37:01 C*06:02 C*07:02
[0329]
[Table 29]
HLA haplotype of 1383D2 iPS cell
HLA-A HLA-B HLA-C
A*02:07 A*32:01 B*15:02 B*51:01 C*08:01 C*14:02
[0330]
Subsequently, CD8-positive T cells recovered by sorting from peripheral blood
mononuclear cells having an HLA haplotype shown in Table 30 (PBMC, type
"LP_266,"
CTL, corresponding to the above-mentioned recipient C) were stained with CFSE
(Cayman Chemical Co., Ltd.). The cells were co-cultured with EB-derived blood-
cell-
like cells differentiated from the respective cells of (1) to (5) in the
presence of IL-2 and
IFN-y for 8 days.
[0331]
[Table 30]
HLA haplotype of PBMC (LP_266, CTL)
HLA-A EILA-B HLA-C
A*03:01 A*24:02 B*07:02 B*40:02 C*03:05 C*07:02
[0332]
After co-culture, flow cytometric analysis was performed to examine
fluorescence of CFSE. Figs. 27(a) to 27(e) are graphs showing results of flow
cytometry. Figs. 27(a) to 27(e) show the results of CD8-positive T cells co-
cultured
with EB-derived blood-cell-like cells differentiated from the respective cells
of (1) to (5).
As a result, it was confirmed that a T cell population that specifically
recognized an HLA
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
97
antigen of each of the iPS cells proliferated, and CFSE became negative.
[0333]
[Experimental Example 22]
(Preparation of HLA-antigen-reactive CD8-positive T cells)
CD8-positive T cells reactive with an HLA antigen of 604B1 iPS cells were
prepared. Peripheral blood mononuclear cell (PBMC)-derived T cells were
present in
combination with T cells that recognized various antigens. Among these T
cells, CD8-
positive T cells reactive with the HLA antigen of 604B1 iPS cells were
stimulated to
proliferate and were recovered.
[0334]
Fig. 28 is a schematic diagram showing a procedure of the present experimental
example. As shown in Fig. 28, first, 604B1 iPS cells were differentiated into
EB-
derived blood-cell-like cells. The EB-derived blood-cell-like cells include
CD45-
positive leukocytes. Subsequently, CD8-positive T cells contained in PBMC were
stained with CFSE (Cayman Chemical Co.) and co-cultured with EB-derived blood-
cell-
like cells differentiated from 604B1 iPS cells in the presence of IL-2 and IFN-
y for 8
days.
[0335]
Subsequently, after co-culture, flow cytometric analysis was performed to
examine fluorescence of CFSE. Figs. 29(a) to 29(e) are graphs showing results
of flow
cytometry.
[0336]
Fig. 29(a) shows the results of co-culturing a PBMC cell population with a
PBMC cell population of allogeneic cells (allo), Fig. 29(b) shows the results
of co-
.. culturing the PBMC cell population with EB-derived blood-cell-like cells
differentiated
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
98
from 604B1 iPS cells, Fig. 29(c) shows the results of culturing only the PBMC
cell
population, Fig. 29(d) shows the results of co-culturing CD8-positive T cells
recovered
from the PBMC cell population by sorting with EB-derived blood-cell-like cells
differentiated from 604B1 iPS cells, and Fig. 29(e) shows the results of
culturing only
CD8-positive T cells recovered from the PBMC cell population by sorting. As a
result,
it was confirmed that a T cell population that specifically recognized an
incompatible
HLA antigen proliferated, and CFSE became negative.
[0337]
Subsequently, CD8-positive T cells that became CFSE-negative as shown in Fig.
29(d) were sorted and recovered. Thereby, T cells reactive with the HLA
antigen of
604B1 iPS cells were obtained.
[0338]
[Experimental Example 23]
(Test 1 of T cell cytotoxicity)
Fig. 30 is a schematic diagram showing a procedure of the present experimental
example. First, (1) 604B1 iPS cells having an HLA haplotype shown in Table 31,
(2) a
clone #8 which was produced in Experimental Example 8 and in which the A*01:01
and
B*07:02 alleles of the 604B1 iPS cells had been knocked out, (3) same clone
#10, and
(4) 1383D2 iPS cells (clone #1) which were produced in Experimental Example 17
and
in which the B2M had been knocked out, were respectively differentiation-
induced into
cardiomyocytes.
[0339]
[Table 31]
HLA haplotype of 604B1 iPS cell
HLA-A HLA-B HLA-C
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
99
A*01:01 A*24:02 B*07:02 B*37:01 C*06:02 C*07:02
[0340]
Subsequently, each cardiomyocyte was stimulated with IFNI, to induce the
expression of HLA protein. Subsequently, in order to perform a 51Cr release
assay to be
described later, 51Cr (chromium) was added to a medium and incorporated into
each
cardiomyocyte.
[0341]
Subsequently, CD8-positive T cells reactive with the HLA antigen of 604B1 iPS
cells prepared in Experimental Example 22 were added to the medium of each
cardiomyocyte at various ratios to examine whether each cardiomyocyte was
attacked.
That is, the CD8 T cells reactive with the HLA antigen prepared in
Experimental
Example 22 were used as effector cells, and the above-described cardiomyocytes
derived
from iPS cells were used as target cells. A ratio of the number of CD8-
positive T cells
to be added was 0.625, 1.25, 2.5, 5, and 10 with respect to cardiomyocytes 1.
[0342]
When cardiomyocytes are attacked by CD8-positive cells, the cells are damaged
and 51Cr is released from the inside of the cells. Accordingly, by measuring
51Cr
released into the medium, it is possible to determine whether or not each
cardiomyocyte
is attacked. This is called 51Cr release assay. An amount of 51Cr contained in
the
supernatant of the cardiomyocytes that had not been treated after labeling
with 51Cr was
defined as 0% Specific Lysis. A value obtained by subtracting an amount of
51Cr
released in the supernatant when 51Cr-labeled cardiomyocytes were cultured in
a normal
medium from an amount of 51Cr released in the supernatant when 51Cr-labeled
cardiomyocytes were treated by a surfactant (Triton-X) and killed was defined
as 100%
Specific Lysis.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
100
[0343]
Fig. 31 is a graph showing a ratio of each cardiomyocyte damaged and lysed.
In Fig. 31, the symbol "*" indicates that there is a significant difference at
P < 0.05,
"Non-edited" indicates the results of cardiomyocytes differentiation-induced
the 604B1
iPS cells of (1), "A1-137-#8" indicates the results of the cardiomyocytes
differentiation-
induced the clone #8 of (2), "A1-137-#10" indicates the results of the
cardiomyocytes
differentiation-induced the clone #10 of (3), and "1383D2-B2M-#1" indicates
the results
of cardiomyocytes differentiation-induced the 1383D2 iPS cells (clone #1) of
(4) in
which B2M had been knocked out.
[0344]
As a result, it was revealed that the cardiomyocytes differentiation-induced
from
the 604B1 iPS cells had a higher degree of injury when a proportion of CD8-
positive T
cells as effectors was increased.
[0345]
In contrast, it was clarified that the cardiomyocytes differentiation-induced
from
the 1383D2 iPS cells in which B2M had been knocked out were not damaged even
when
a proportion of CD8-positive T cells as effectors was increased. Similarly, it
was
clarified that the cardiomyocytes differentiation-induced from the clones #8
and #10 in
which the A*01:01 and B*07:02 alleles of 604B1 iPS cells were knocked out we-
re not
damaged even when a proportion of CD8-positive T cells as effectors was
increased.
[0346]
These results show that it is possible to reduce a rejection reaction in a
case
where cells were differentiation-induced and allogeneically transplanted by
disrupting the
HLA allele of iPS cells.
[0347]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
101
In addition, the fact that the respective iPS cells of (2) to (4) were able to
be
differentiation-induced into cardiomyocytes indicates that expression of HLA
protein
could be maintained by the IFN-y treatment while maintaining pluripotency of
pluripotent stem cells.
[0348]
[Experimental Example 24]
(Test 2 of T cell cytotoxicity)
The iPS cells of (1) to (4) similar to those of Experimental Example 23 were
differentiation-induced into EB-derived blood-cell-like cells, and 51Cr
release assay was
performed.
[0349]
First, (1) 604B1 iPS cells, (2) a clone #8 which was produced in Experimental
Example 7 and in which the A*01:01 and B*07:02 alleles of the 604B1 iPS cells
had
been knocked out, (3) same clone #10, and (4) 604B1 iPS cells (clone #1) which
were
produced in Experimental Example 18 and in which the B2M had been knocked out
were
respectively differentiation-induced into EB-derived blood-cell-like cells.
The EB-
derived blood-cell-like cells include blood cells.
[0350]
Subsequently, CD8-positive T cells reactive with the HLA antigen of 604B1 iPS
cells prepared in Experimental Example 22 were added to the medium of each EB-
derived blood-cell-like cell at various ratios to examine whether each EB-
derived blood-
cell-like cell was attacked. That is, the CD8 T cells reactive with the HLA
antigen
prepared in Experimental Example 21 were used as effector cells, and the above-
described EB-derived blood-cell-like cells were used as target cells. A ratio
of the
number of CD8-positive T cells to be added was 0.625, 1.25, 2.5, 5, 10, and 20
with
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
102
respect to EB-derived blood-cell-like cells 1.
[0351]
Fig. 32 is a graph showing a ratio of each EB-derived blood-cell-like cell
damaged and lysed. In Fig. 32, the symbol "*" indicates that there is a
significant
difference at P < 0.05, "Non-edited" indicates the results of EB-derived blood-
cell-like
cells differentiation-induced from the 604B1 iPS cells of (1), "A1-137-#8"
indicates the
results of the EB-derived blood-cell-like cells differentiation-induced from
the clone #8
of (2), "Al -B7-#10" indicates the results of the EB-derived blood-cell-like
cells
differentiation-induced from the clone #10 of (3), and "604B1-B2M-#1"
indicates the
results of EB-derived blood-cell-like cells differentiation-induced from the
604B1 iPS
cells (clone #1) of (4) in which B2M had been knocked out.
(0352]
As a result, it was revealed that the EB-derived blood-cell-like cells
differentiation-induced from the 604B1 iPS cells had a higher degree of injury
when a
proportion of CD8-positive T cells as effectors was increased.
[0353]
In contrast, it was clarified that the EB-derived blood-cell-like cells
differentiation-induced from the 604B1 iPS cells in which B2M had been knocked
out
were not damaged even when a proportion of CD8-positive T cells as effectors
was
increased. Similarly, it was clarified that the EB-derived blood-cell-like
cells
differentiation-induced from the clones #8 and #10 in which the A*01:01 and
B*07:02
alleles of 604B1 iPS cells were knocked out were not damaged even when a
proportion
of CD8-positive T cells as effectors was increased.
[0354]
These results show that it is possible to reduce a rejection reaction in a
case
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
103
where cells were differentiation-induced and allogeneically transplanted by
disrupting the
HLA allele of iPS
[0355]
In addition, the fact that the respective iPS cells of (2) to (4) were able to
be
differentiation-induced into EB-derived blood-cell-like cells indicates that
expression of
HLA protein could be maintained by the IFN-7 treatment while maintaining
pluripotency
of pluripotent stem cells.
[0356]
[Experimental Example 25]
(Test 3 of T cell cytotoxicity)
The same examination as in Experimental Example 24 was performed except
that iPS cells different from those in Experimental Example 24 were used.
First, (1)
585AI iPS cells having an HLA haplotype shown in Table 32, (2) a clone #2
which was
produced in Experimental Example 9 and in which the B*07:02 and C*07:02
alleles of
the 585A1 iPS cells had been knocked out, (3) same clone #11, (4) same clone
#26, and
(5) 604B1 iPS cells (clone # 1) which were produced in Experimental Example 18
and in
which the B2M had been knocked out were respectively differentiation-induced
into EB-
derived blood-cell-like cells. The EB-derived blood-cell-like cells include
blood cells.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
104
[0357]
[Table 32]
HLA haplotype of 585A I iPS cell
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*07:02 B*52:01 C*07:02 C*12:02
[0358]
Subsequently, CD8-positive T cells as effectors derived from peripheral blood
mononuclear cells having HLA haplotypes shown in Table 33 (corresponding to
PBMC,
type "2010113203," Wako, the above-mentioned recipient B) were added to a
medium of
each EB-derived blood-cell-like cell at various ratios to examine whether or
not each EB-
derived blood-cell-like cell was attacked. As the effector cells, the CD8-
positive T cells
.. in CFB-negative PBMC shown in Fig. 26(a) of Experimental Example 20 were
sorted
and used. In addition, target cells were the above-mentioned EB-derived blood-
cell-like
cells. A ratio of the number of CD8-positive T cells to be added as effectors
was 0.625,
1.25, 2.5, 5, 10, and 20 with respect to EB-derived blood-cell-like cells 1.
[0359]
[Table 33]
HLA haplotype of PBMC ("2010113203," Wako)
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*40:06 B*52:01 C*08:01 C*12:02
[0360]
Fig. 33 is a graph showing a ratio of each EB-derived blood-cell-like cell
damaged and lysed. In Fig. 33, the symbol "*" indicates that there is a
significant
difference at P < 0.05, "Non-edited" indicates the results of EB-derived blood-
cell-like
cells differentiation-induced from the 585A1 iPS cells of (1), "B7-C7-#2"
indicates the
results of the EB-derived blood-cell-like cells differentiation-induced from
the clone #2
of (2), "B7-C7-#11" indicates the results of the EB-derived blood-cell-like
cells
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
105
differentiation-induced from the clone #11 of (3), "B7-C7-#26" indicates the
results of the
EB-derived blood-cell-like cells differentiation-induced from the clone #26 of
(4), and
"604B1-B2M-#1" indicates the results of EB-derived blood-cell-like cells
differentiation-
induced from the 604B1 iPS cells (clone #1) of (5) in which B2M had been
knocked out.
[0361]
As a result, it was revealed that the EB-derived blood-cell-like cells
differentiation-induced from the 585A1 iPS cells had a higher degree of injury
when a
proportion of CD8-positive T cells as effectors was increased.
[0362]
In contrast, it was clarified that the EB-derived blood-cell-like cells
differentiation-induced from the 604B1 iPS cells in which B2M had been knocked
out
were not damaged even when a proportion of CD8-positive T cells as effectors
was
increased. Similarly, it was clarified that the EB-derived blood-cell-like
cells
differentiation-induced from the clones #2, #11, and #26 in which the B*07:02
and
C*07:02 alleles of 585A1 iPS cells were knocked out were not damaged even when
a
proportion of CD8-positive T cells as effectors was increased.
[0363]
These results show that it is possible to reduce a rejection reaction in a
case
where cells were differentiation-induced and allogeneically transplanted by
disrupting the
.. HLA allele of iPS cells.
[0364]
In addition, the fact that the respective iPS cells of (2) to (5) were able to
be
differentiation-induced into EB-derived blood-cell-like cells indicates that
expression of
HLA protein could be maintained by the IFN-7 treatment while maintaining
pluripotency
of pluripotent stem cells.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
106
[0365]
[Experimental Example 26]
(Test 4 of T cell cytotoxicity)
The 604B1 iPS cells having HLA haplotypes shown in Table 34 and the 604B1
iPS cells (clone #1) which were produced in Experimental Example 18 and in
which
B2M had been knocked out were mixed with cells obtained by labeling, with
CFSE,
peripheral blood mononuclear cells having an HLA haplotype shown in Table 35
(PBMC, type "LP_266," CTL, corresponding to the above-mentioned recipient C).
These cells were co-cultured for 7 days.
[0366]
[Table 34]
HLA haplotype of 604B1 iPS cell
HLA-A HLA-B HLA-C
A*01:01 A*24:02 B*07:02 B*37:01 C*06:02 C*07:02
[0367]
[Table 35]
HLA haplotype of PBMC (LP 266, CTL)
HLA-A HLA-B HLA-C
A*03:01 A*24:02 B*07:02 B*40:02 C*03:05 C*07:02
[0368]
After co-culture, flow cytometric analysis was performed to examine
fluorescence of CFSE. Fig. 34(a) and 34(b) are graphs showing results of flow
cytometry. In Figs. 34(a) and 34(b), "604B1-B2M-#1" indicates the results of
PBMC
co-cultured with the 604B1 iPS cells (clone # 1) in which B2M had been knocked
out,
and "604B1" indicates the results of PBMC co-cultured with the 604B1 iPS
cells.
[0369]
As a result, as shown in Fig. 34(a), 11.3% of CD8-positive and CSFE-negative T
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
107
cells were contained in the PBMC co-cultured with the 604B1 iPS cells (clone
#1) in
which B2M had been knocked out. Furthermore, as shown in Fig. 34(b), 21.3% of
CD8-positive and CSFE-negative T cells were contained in the PBMC co-cultured
with
the 604B1 iPS cells. Subsequently, from the PBMC co-cultured with the 604B1
iPS
cells shown in Fig. 34(b), CD8-positive and CSFE-negative cells were sorted
and
recovered as effector CD8-positive T cells.
[0370]
Subsequently, (1) 604B1 iPS cells; (2) clone #3-11 which was produced in
Experimental Example 11 and in which A*01:01 allele, B*37:01 allele, and
C*06:02
allele of the 604131 iPS cells had been knocked out; and (3) the same clone #3-
12 were
respectively differentiation-induced into EB-derived blood-cell-like cells.
The EB-
derived blood-cell-like cells include blood cells.
[0371]
Subsequently, the recovered effector CD8-positive T cells were added to the
.. medium of each EB-derived blood-cell-like cell at various ratios to examine
whether
each EB-derived blood-cell-like cell was attacked. That is, target cells were
EB-derived
blood-cell-like cells that had been differentiation-induced from the cells of
(1) to (3). A
ratio of the number of CD8-positive T cells to be added as effectors was
0.625, 1.25, 2.5,
5, 10, and 20 with respect to EB-derived blood-cell-like cells 1.
[0372]
Fig. 34(c) is a graph showing a ratio of each EB-derived blood-cell-like cell
damaged and lysed. in Fig. 34(c), the symbol "*" indicates that there is a
significant
difference at P < 0.05, "Non-edited" indicates the results of EB-derived blood-
cell-like
cells differentiation-induced from the 604B1 iPS cells of (1), "A1-1337-C6-#3-
11"
indicates the results of the EB-derived blood-cell-like cells differentiation-
induced from
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
108
the clone #3-11 of (2), and "A1-B37-C6-#3-12" indicates the results of the EB-
derived
blood-cell-like cells differentiation-induced from the clone #3-12 of (3).
[0373]
As a result, it was revealed that the EB-derived blood-cell-like cells
differentiation-induced from the 604B1 iPS cells had a higher degree of injury
when a
proportion of CD8-positive T cells as effectors was increased.
[0374]
In contrast, it was clarified that the EB-derived blood-cell-like cells
differentiation-induced from the clones #3-11 and #3-12 in which the A*01:01
allele,
B*37:01 allele, and C*06:02 allele of 604B1 iPS cells were knocked out were
not
damaged even when a proportion of CD8-positive T cells as effectors was
increased.
[0375]
These results show that it is possible to reduce a rejection reaction in a
case
where cells were differentiation-induced and allogeneically transplanted by
disrupting the
HLA allele of iPS cells.
[0376]
In addition, the fact that the respective iPS cells of (2) and (3) were able
to be
differentiation-induced into EB-derived blood-cell-like cells indicates that
expression of
HLA protein could be maintained by the IFN-y treatment while maintaining
pluripotency
of pluripotent stem cells.
[0377]
[Experimental Example 27]
(Reactivity test 1 of NK cells)
(1) 604B1 iPS cells having an HLA haplotype shown in Table 36, (2) a clone #8
which was produced in Experimental Example 8 and in which the A*01:01 and
B*07:02
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
109
alleles of the 604B1 iPS cells had been knocked out, (3) same clone #10, (4)
1383D2 iPS
cells having an HLA haplotype in Table 37, and (5) 604B1 iPS cells (clone # 1)
which
were produced in Experimental Example 18 and in which the B2M had been knocked
out
were respectively differentiated into EB-derived blood-cell-like cells. The EB-
derived
blood-cell-like cells include CD45-positive leukocytes.
[0378]
[Table 36]
HLA haplotype of 604E31 iPS cell
HLA-A HLA-B HLA-C
A*01:01 A*24:02 B*07:02 B*37:01 C*06:02 C*07:02
[0379]
[Table 371
HLA haplotype of 1383D2 iPS cell
HLA-A HLA-B HLA-C
A*02:07 A*32:01 B*15:02 B*51:01 C*08:01 C*14:02
[0380]
In addition, CD56-positive cells (NK cells) were recovered from PBMC having
an HLA haplotype shown in Table 38 (type "LP 194," CTL, corresponding to the
above-
mentioned recipient A) by sorting. Subsequently, the recovered NK cells were
co-
cultured with each of differentiated CD45-positive leukocytes in the presence
of the anti-
CD107a antibody. As a result, when the NK cells were activated, they became
CD107a-positive. After co-culture, flow cytometric analysis was performed to
measure
a percentage of activated NK cells.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
110
[0381]
[Table 38]
HLA haplotype of PBMC (LP_194, CTL)
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*37:01 B*39:06 C*06:02 C*07:02
[0382]
Figs. 35(a) to 35(g) are graphs showing results of flow cytometric analysis.
Fig. 35 (a) shows the results of culturing only NK cells and analyzing them.
Fig. 35(b)
shows the results of analysis of NK cells co-cultured with EB-derived blood-
cell-like
cells differentiation-induced from 604B1 iPS cells. Fig. 35(c) shows the
results of
analysis of NK cells co-cultured with EB-derived blood-cell-like cells
differentiation-
induced from the clone #8 in which the A*01:01 and B*07:02 alleles of 604B1
iPS cells
were knocked out. Fig. 35(d) shows the results of analysis of NK cells co-
cultured with
EB-derived blood-cell-like cells differentiation-induced from the clone #10.
Fig. 35(e)
shows the results of analysis of NK cells co-cultured with EB-derived blood-
cell-like
cells differentiation-induced from 1383D2 iPS cells. Fig. 35(f) shows the
results of
analysis of NK cells co-cultured with EB-derived blood-cell-like cells
differentiation-
induced from 604B1 iPS cells in which B2M had been knocked out. Fig. 35(g)
shows
the results of analysis of NK cells co-cultured with K562 cells known not to
express
HLA antigen, as a positive control.
[0383]
As a result, it was revealed that 5.9% of NK cells co-cultured with K562 cells
were activated. In addition, it was revealed that 3.2% of NK cells co-cultured
with EB-
derived blood-cell-like cells differentiation-induced from 604B1 iPS cells in
which B2M
had been knocked out and which did not express 1-ILA antigen were activated.
[0384]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
111
In contrast, in the clones #8 and #10 in which the A*01:01 and B*07:02 alleles
of 604B1 iPS cells had been knocked out, expression of the other A*24:02 and
B*37:01
alleles remained. Based on this result, it was revealed that activation of NK
cells co-
cultured with EB-derived blood-cell-like cells differentiation-induced
therefrom was
inhibited.
[0385]
That is, it was revealed that cells in which B2M had been knocked out were
significantly attacked by NK cells, whereas cells in which some HLA alleles
remained
were able to avoid attack by NK cells.
[0386]
[Experimental Example 28]
(Confirmation test 1 of pluripotency)
For 1383D2 iPS cells and 604B1 iPS cells, (1) cells in an untreated state, (2)
cells immediately after being treated with 50 ng/mL IFN-y for 48 hours, and
(3) cells 5
days after being treated with 50 ng/mL IFN-y for 48 hours were respectively
prepared,
and mRNA was extracted. Then, after synthesizing cDNA using Reverse Tra Ase
qPCR
RT Master Mix (Toyobo), quantitative PCR was performed using a primer for
amplifying
human NANOG cDNA specifically expressed in pluripotent stem cells, and as a
control
of a total amount of mRNA, a primer for amplifying human ACTB cDNA.
[0387]
The primer used for amplifying human NANOG cDNA and the primer used for
amplifying human ACTB cDNA are shown in Table 39.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
112
[0388]
[Table 39]
Primer name Base sequence SEQ ID NO.
INANOG(+4835)-fwd CTTCACTTCCCAGGTGCAA 66
hNANOG(+4835)-rev ,AGGCTAGCCAACATGAGGAA 67
hACTB-Fwd CCAACCGCGAGAAGATGA 68
hACTB-Rev CCAGAGGCGTACAGGGATAG 69
[0389]
Fig. 36 is a graph showing the results of quantitative PCR in which an
expression level of the NANOG gene was measured. The expression level of the
NANOG gene was shown as a relative value with an expression level of the NANOG
gene relative to the ACTB gene in "untreated" 1383D2 cells being 1.
[0390]
In Fig. 36, the term "untreated" indicates the results of iPS cells that were
not
treated with IFN-y and cultured under normal undifferentiated condition, the
term
"immediately after IFN" indicates immediately after being treated with IFN-y
for 48
hours, and the term "5 days after" indicates the results of cells 5 days after
being treated
with IFN-y for 48 hours.
[0391]
As a result, it was revealed that an expression level of NANOG, which has been
widely used as a pluripotency marker, did not decrease even when iPS cells
were treated
with IFN-y for 48 hours. This result indicates that pluripotency is maintained
even
when iPS cells are treated with IFN-y.
[0392]
[Experimental Example 29]
(Confirmation test 2 of pluripotency)
(1) 604B1 iPS cells, (2) a clone #3-11 which was produced in Experimental
Example 11 and in which the A*01:01, B*37:01, and C*06:02 alleles of the 604B1
iPS
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
113
cells had been disrupted, (3) same clone #3-12, (4) clone #1 in which a B2M
gene of
604B1 iPS cells produced in Experimental Example 18 was had been disrupted,
(5)
1383D2 iPS cells, (6) clone # 1 in which a B2M gene of 1383D2 iPS cells
produced in
Experimental Example 17 had been disrupted were respectively cultured under
undifferentiated conditions, and morphology of the respective cells was
observed with a
phase contrast microscope.
[0393]
The culture under undifferentiated conditions was carried out using an AKO3N
medium (StemFit, Ajinomo) as a medium and using a type "iMatrix-511" (Nippi)
as a
cell matrix.
[0394]
Figs. 37(a) to 37(f) are photographs of the cells of (1) to (5) respectively
captured with a phase contrast microscope. A scale bar is 1 mm.
[0395]
As a result, it was revealed that the HLA allele and the B2M allele were
disrupted, and the IFN-y-treated iPS cells also formed flat colonies as
characteristics of
undifferentiated pluripotent stem cells and proliferated. This result
indicates that
pluripotency is maintained even when iPS cells are treated with 1FN-y. This
result also
indicates that pluripotency is maintained even when the HLA allele or B2M
allele of iPS
cells has been disrupted.
[0396]
[Experimental Example 30]
(Confirmation test 3 of pluripotency)
(1) 604B1 iPS cells, (2) a clone #3-11 which was produced in Experimental
.. Example 11 and in which the A*01:01. B*37:01, and C*06:02 alleles of the
604B1 iPS
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
114
cells had been disrupted, (3) same clone #3-12, (4) clone #1 in which a B2M
gene of
604B1 iPS cells produced in Experimental Example 18 was had been disrupted,
(5)
1383D2 iPS cells, (6) clone # 1 in which a B2M gene of 1383D2 iPS cells
produced in
Experimental Example 17 had been disrupted were respectively cultured under
conditions for inducing blood cell differentiation, and morphology of EB-
derived blood-
cell-like cells was observed with a phase contrast microscope.
[0397]
Differentiation-induction of blood cell of iPS cells was performed as follows.
First, undifferentiated iPS cells were seeded on an ultra-low adhesion culture
plate
(Corning), and EB (embryoid body) was formed for 2 days in an AKO3N medium
containing Y-27633. Subsequently, the cells were cultured for 3 days in a
StemPro-34
SFM medium (Thermo Fisher Scientific) containing human bFGF (Oriental Yeast
Co.,
Ltd.), human VEGF (R & D Systems), Insulin-Transferrin-Selenium (ITS) (Thermo
Fisher Scientific Co.), GlutaMax-I (Thermo Fisher Scientific), L-ascorbic acid
2-
phosphate sesquimagnesium salt hydrate (Sigma), 1-Thioglycerol (MTG, NACALAI
TESQUE, INC.), and human BMP4 (R & D Systems). Thereafter, human BMP4 was
removed, human SCF was added, and the cells were cultured for 2 days.
Subsequently,
human F113-Ligand (Peprotech) and human TPO (Peprotech) were added and
cultured.
As a result, EB-derived blood-cell-like cells were generated.
[0398]
Figs. 38(a) to 38(f) are photographs of EB-derived blood-cell-like cells of
(1) to
(5) on the 22nd day of induction of differentiation, which were captured with
a phase
contrast microscope. A scale bar is 1 mm.
[0399]
As a result, it was revealed that the HLA allele and the B2M allele were
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
115
disrupted, and the iPS cells treated with 1FN--y could also be able to be
differentiation-
induced into blood cells. This result indicates that pluripotency is
maintained even
when iPS cells are treated with IFN-y. This result also indicates that
pluripotency is
maintained even when the HLA allele or B2M allele of iPS cells has been
disrupted.
[0400]
[Experimental Example 31]
(Test 5 of T cell cytotoxicity)
(1) Cells (clone # 1) which were produced in Experimental Example 17 and in
which the B2M allele of the 1383D2 iPS cells having HLA haplotypes shown in
Table 40
had been knocked out, and (2) 585A1 iPS cells having HLA haplotypes shown in
Table
41, were stained with CFSE (Cayman Chemical Company), and were co-cultured for
7
days with peripheral blood mononuclear cells having HLA haplotypes shown in
Table 42
(PBMC, type "LP_275," CTL).
[0401]
[Table 40]
HLA haplotype of 1383D2 iPS cell
HLA-A HLA-B HLA-C
A*02:07 A*32:01 B*15:02 B*51:01 C*08:01 C*14:02
[0402]
[Table 41]
HLA haplotype of 585A1 iPS cell
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*07:02 B*52:01 C*07:02 C*I2:02
[0403]
[Table 42]
HLA haplotype of PBMC (LP_275, CTL)
HLA-A HLA-B HLA-C
Date Regue/Date Received 2020-08-11
CA 03091136 2020-08-11
116
A*02:06 A*33:03 B*40:01 B*58:01 C*03:02 C*07:02
[0404]
After co-culture, flow cytometric analysis was performed to examine
fluorescence of CFSE. Fig. 39(a) and 39(b) are graphs showing results of flow
cytometry. In Figs. 39(a) and 39(b), "1383D2 B2M-K0 #1" indicates the results
of
PBMC co-cultured with the 1383D2 iPS cells (clone # 1) in which B2M had been
knocked out, and "585A1-WT" indicates the results of PBMC co-cultured with the
585A1 iPS cells.
[0405]
As a result, as shown in Fig. 39(a), no CD-positive and CSFE-negative T cells
were present in the PBMC co-cultured with the 1383D2 iPS cells (clone #1) in
which
B2M had been knocked out. In addition, as shown in Fig. 39(b), the PBMC co-
cultured
with the 585A1 iPS cells contained 24.4% of CD8-positive T cells that had been
activated and became CSFE-negative. Subsequently, from the PBMC co-cultured
with
the 585A1 iPS cells shown in Fig. 39(b), CD8-positive and CSFE-negative cells
were
sorted and recovered as effector CD8-positive T cells.
[0406]
Subsequently, (1) 585A1 iPS cells, (2) clone #3-1 which was produced in
Experimental Example 13 and in which A*24:02 allele, B*07:02 allele, B*52:01
allele,
and C*12:02 allele of 585A1 iPS cells had been knocked out, (3) the same clone
# 3-3,
and (4) cells (not subcloned bulk cells) produced in Experimental Example 46
to be
described later and in which the B2M allele of 585A1 iPS cells had been
knocked out,
were respectively differentiation-induced into EB-derived blood-cell-like
cells. The
EB-derived blood-cell-like cells include blood cells.
[0407]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
117
Subsequently, the recovered effector CD8-positive T cells were added to the
medium of each EB-derived blood-cell-like cell at various ratios to examine
whether
each EB-derived blood-cell-like cell was attacked. That is, target cells were
EB-derived
blood-cell-like cells that had been differentiation-induced from the cells of
(1) to (4). A
ratio of the number of CD8-positive T cells to be added as effectors was
0.625, 1.25, 2.5,
5, 10, and 20 with respect to EB-derived blood-cell-like cells 1.
[0408]
Fig. 39(c) is a graph showing a ratio of each EB-derived blood-cell-like cell
damaged and lysed. In Fig. 39(c), the symbol "*" indicates that there is a
significant
difference at P < 0.01, "WT" indicates the results of EB-derived blood-cell-
like cells
differentiation-induced from the 585A1 iPS cells of (1), "C7#3-1" indicates
the results of
the EB-derived blood-cell-like cells differentiation-induced from the clone #3-
1 of (2),
"C7#3-3" indicates the results of the EB-derived blood-cell-like cells
differentiation-
induced from the clone #3-3 of (3), and "B2M-" indicates the results of the EB-
derived
blood-cell-like cells differentiation-induced from cells in which the B2M
allele of the
585A1 iPS cells of (4) had been knocked out.
[0409]
As a result, it was revealed that the EB-derived blood-cell-like cells
differentiation-induced from the 585A1 iPS cells had a higher degree of injury
when a
proportion of CD8-positive T cells as effectors was increased.
[0410]
In contrast, it was clarified that EB-derived blood-cell-like cells
differentiation-
induced from the clones #3-1 and #3-3 in which the A*24:02 allele, B*07:02
allele,
B*52:01 allele, and C*12:02 allele of the 585A1 iPS cells were knocked out;
and the EB-
derived blood-cell-like cells differentiation-induced from cells in which the
B2M allele
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
118
of the 585A1 iPS cells were knocked out, were not damaged even when a
proportion of
CD8-positive T cells as effectors was increased.
[0411]
These results further support that it is possible to reduce a rejection
reaction in a
case where cells were differentiation-induced and allogeneically transplanted
by
disrupting the HLA allele of iPS cells.
[0412]
[Experimental Example 32]
(Test 6 of T cell cytotoxicity)
(1) Cells (clone # 1) which were produced in Experimental Example 17 and in
which the B2M allele of the 1383D2 iPS cells having HLA haplotypes shown in
Table 43
had been knocked out, and (2) 585A1 iPS cells having HLA haplotypes shown in
Table
44, were co-cultured for 7 days with cells obtained by staining, with CFSE
(Cayman
Chemical Company), peripheral blood mononuclear cells having HLA haplotypes
shown
in Table 45 (PBMC, type "LP_329," CTL).
[0413]
[Table 43]
HLA haplotype of 1383D2 iPS cell
HLA-A HLA-B HLA-C
A*02:07 A*32:01 B*15:02 B*51:01 C*08:01 C*14:02
[0414]
[Table 44]
HLA haplotype of 585A1 iPS cell
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*07:02 B*52:01 C*07:02 C*12:02
[0415]
[Table 45]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
119
HLA haplotype of PBMC (LP_329, CTL)
HLA-A HLA-B HLA-C
A*29:02 A*68:01 B*39:06 B*40:02 C*03:05 C*07:02
[0416]
After co-culture, flow cytometric analysis was performed to examine
fluorescence of CFSE. Fig. 40(a) and 40(b) are graphs showing results of flow
cytometry. In Figs. 40(a) and 40(b), "1383D2 B2M-K0 #1" indicates the results
of
PBMC co-cultured with the 1383D2 iPS cells (clone # 1) in which B2M had been
knocked out, and "585A1-WT" indicates the results of PBMC co-cultured with the
585A1 iPS cells.
[0417]
As a result, as shown in Fig. 40(a), no CD8-positive and CSFE-negative T cells
were present in the PBMC co-cultured with the 1383D2 iPS cells (clone #1) in
which
B2M had been knocked out. In addition, as shown in Fig. 40(b), the PBMC co-
cultured
with the 585A1 iPS cells contained 11.7% of CD8-positive T cells that had been
activated and became CSFE-negative. Subsequently, from the PBMC co-cultured
with
the 585A1 iPS cells shown in Fig. 40(b), CD8-positive and CSFE-negative cells
were
sorted and recovered as effector CD8-positive T cells.
[0418]
Subsequently, (1) 585A1 iPS cells, (2) clone #3-1 which was produced in
Experimental Example 13 and in which A*24:02 allele, B*07:02 allele, B*52:01
allele,
and C*12:02 allele of 585A1 iPS cells had been knocked out, (3) the same clone
# 3-3,
and (4) cells (not subcloned bulk cells) produced in Experimental Example 46
to be
described later and in which the B2M allele of 585A1 iPS cells had been
knocked out,
were respectively differentiation-induced into EB-derived blood-cell-like
cells. The
EB-derived blood-cell-like cells include blood cells.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
120
[0419]
Subsequently, the recovered effector CD8-positive T cells were added to the
medium of each EB-derived blood-cell-like cell at various ratios to examine
whether
each EB-derived blood-cell-like cell was attacked. That is, target cells were
EB-derived
blood-cell-like cells that had been differentiation-induced from_ the cells of
(1) to (4). A
ratio of the number of CD8-positive T cells to be added as effectors was
0.625, 1.25, 2.5,
5, 10, and 20 with respect to EB-derived blood-cell-like cells 1.
[0420]
Fig. 40(c) is a graph showing a ratio of each EB-derived blood-cell-like cell
damaged and lysed. In Fig. 40(c), the symbol "*" indicates that there is a
significant
difference at P < 0.01, "WT" indicates the results of EB-derived blood-cell-
like cells
differentiation-induced from the 585A1 iPS cells of (1), "C7#3-1" indicates
the results of
the EB-derived blood-cell-like cells differentiation-induced from the clone #3-
1 of (2),
"C7#3-3" indicates the results of the EB-derived blood-cell-like cells
differentiation-
induced from the clone #3-3 of (3), and "B2M-" indicates the results of the EB-
derived
blood-cell-like cells differentiation-induced from cells in which the B2M
allele of the
585A1 iPS cells of (4) had been knocked out.
[0421]
As a result, it was revealed that the EB-derived blood-cell-like cells
differentiation-induced from the 585A1 iPS cells had a higher degree of injury
when a
proportion of CD8-positive T cells as effectors was increased.
[0422]
In contrast, it was clarified that EB-derived blood-cell-like cells
differentiation-
induced from the clones #3-1 and #3-3 in which the A*24:02 allele, B*07:02
allele,
B*52:01 allele, and C*12:02 allele of the 585A1 iPS cells were knocked out;
and the EB-
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
121
derived blood-cell-like cells differentiation-induced from cells in which the
B2M allele
of the 1383D2 iPS cells were knocked out, were not damaged even when a
proportion of
CD8-positive T cells as effectors was increased.
[0423]
These results further support that it is possible to reduce a rejection
reaction in a
case where cells were differentiation-induced and allogeneically transplanted
by
disrupting the HLA allele of iPS cells.
[0424]
[Experimental Example 33]
(Cell transplantation experiment 1)
(1) 585A1 iPS cells, and (2) the clone #3-1 which was produced in Experimental
Example 13 and in which the A*24:02 allele, B*07:02 allele, B*52:01 allele,
and
C*12:02 allele of the 585A1 iPS cells were knocked out, were respectively
differentiation-induced into EB-derived blood-cell-like cells. Subsequently,
the
respective EB-derived blood-cell-like cells were labeled with luciferase.
[0425]
Subsequently, one hour before the start of the experiment, each of the cell
was
transplanted into immunodeficient mice (NOD.Cg-Ragiunimomilaguntwilr z.
J (NRG), The
Jackson Laboratory) by intraperitoneal administration. Subsequently, at the
start of the
experiment, effector CD8-positive T cells which were prepared in the same
manner as in
Experimental Example 32 and were derived from peripheral blood mononuclear
cells
(PBMC, type "LP 329," CTL) or a medium (control) were further
intraperitoneally
administered.
[0426]
Then, at the time of cell transplantation (before T cell injection), 5 hours,
I day,
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
122
3 days, and 7 days after the start of the experiment, luciferin, which is a
substrate of
luciferase, was administered to each mouse. Using an IVIS imaging system
(trade name
"IVIS Spectrum," SPI), fluorescence of the EB-derived blood-cell-like cells
labeled with
luciferase was captured, and a survival rate of the transplanted cells was
measured.
[0427]
Fig. 41(a) is a diagram illustrating an experimental schedule. Furthermore,
Fig.
41(b) shows a photograph showing results of capturing fluorescence of EB-
derived
blood-cell-like cells in each mouse. Furthermore, Fig. 41(c) is graph of a
relative
survival curve showing the results of calculating a survival rate of each ER-
derived
blood-cell-like cell in a case where the effector CD8-positive T cells were
administered
to the mouse, with a fluorescence intensity before T cell injection being
100%.
[0428]
In Figs. 41(b) and 41(c), "WT" indicates the results of EB-derived blood-cell-
like cells differentiation-induced from the 585A1 iPS cells of (1), "C7 #3-1"
indicates the
results of EB-derived blood-cell-like cells differentiation-induced from the
clone #3-1 of
(2), "Mock" indicates the results of administration of the medium as a
control, and "T
cell" indicates the results of administration of the effector CD8-positive T
cells derived
from peripheral blood mononuclear cells (PBMC, type "LP_329," CTL).
[0429]
As a result, as shown in Fig. 41(c), it was confirmed that the EB-derived
blood-
cell-like cells differentiation-induced from 585A1 iPS cells had a reduced
survival rate
after administration of the effector CD8-positive T cells. On the other hand,
it became
clear that the EB-derived blood-cell-like cells differentiation-induced from
the clone #3-1
in which the A*24:02 allele, B*07:02 allele, B*52:01 allele, and C*12:02
allele of 585A1
iPS cells were knocked out maintained a high survival rate even after the
administration
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
123
of the effector CD8-positive T cells.
[0430]
These results further support that it is possible to reduce a rejection
reaction in a
case where cells were differentiation-induced and allogeneically transplanted
by
disrupting the HLA allele of iPS cells.
[0431]
[Experimental Example 34]
(Reactivity test 2 of NK cells)
(1) 585A1 iPS cells, (2) clone #3-1 which was produced in Experimental
Example 13 and in which A*24:02 allele, B*07:02 allele, B*52:01 allele, and
C*12:02
allele of 585A1 iPS cells had been knocked out, and (3) cells (not subcloned
bulk cells)
produced in Experimental Example 46 to be described later and in which the B2M
allele
of 585A 1 iPS cells had been knocked out, were prepared. Table 46 shows HLA
haplotypes of 585A1 iPS cells, and Table 47 shows HLA haplotypes of 1383D2 iPS
cells.
.. [Table 46]
HLA haplotype of 585A1 iPS cell
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*07:02 B*52:01 C*07:02 C*12:02
[0432]
[Table 47]
HLA haplotype of 1383D2 iPS cell
HLA-A HLA-B HLA-C
A*02:07 A*32:01 B*15:02 B*51:01 C*08:01 C*14:02
[0433]
In addition, CD56-positive cells (NK cells) were recovered from PBMC having
an HLA haplotype shown in Table 48 (type "LP_275," CTL) by sorting.
Subsequently,
the recovered NK cells were co-cultured with each of cells of (1) to (3) in
the presence of
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
124
the anti-CD107a antibody. As a result, when the NK cells were activated, they
became
CD107a-positive. After co-culture, flow cytometric analysis was performed to
measure
a percentage of activated NK cells.
[0434]
[Table 48]
HLA haplotype of PBMC (LP_275, CTL)
HL A-A HLA-B HLA-C
A*02:06 A*33:03 B*40:01 B*58:01 C*03:02 C*07:02
[0435]
Fig. 42(a) is a graph showing results of flow cytometric analysis. In Fig.
42(a),
the symbol """ indicates that there is a significant difference at P < 0.01,
"WT"
indicates the results of the 585A1 iPS cells of (1), "C7#3-1" indicates the
results of the
clone #3-1 of (2), and "B2M-" indicates the results of the cells in which the
B2M allele of
the 585A1 iPS cells of (3) had been knocked out.
[0436]
As a result, it was revealed that the 585A1 iPS cells and the clone #3-1 were
able to significantly inhibit activation of NK cells, as compared to cells in
which the
B2M allele was knocked out. Then, NK cells activated with cells in which the
B2M
allele was knocked out were sorted and recovered.
[0437]
Subsequently, for (4) K562 cells known not to express HLA antigen; (5) cells
which were produced in Experimental Example 46 to be described later and in
which
B2M allele of 585A1 iPS cells was knocked out (not subcloned bulk cells); (6)
cells
which were produced in Experimental Example 47 to be described later and in
which the
HLA-A allele, HLA-B allele, and HLA-C allele of 585A1 iPS cells were knocked
out
(where clones #3-5, HLA-F, and HLA-G alleles remained); (7) the clone #
3-1
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
125
which was produced in Experimental Example 13 and in which the A*24:02 allele,
B*07:02 allele, B*52:01 allele, and C*12:02 allele of 585A1 i PS cells were
knocked out;
(8) the same clone #3-3; (9) cells which were produced in Experimental Example
13 and
in which the FILA-A and HLA-B alleles of the 585A1 iPS cells were knocked out
(where
clone #3, HLA-C, HLA-E, HLA-F, and HLA-G alleles remained); and (10) 585A1 iPS
cells, activated NK cells were added to each of cells at various ratios, and a
51Cr release
assay was performed.
[0438]
That is, the above-mentioned activated NK cells were used as effector cells,
and
the above-mentioned cells of (4) to (10) were used as target cells. A
percentage of the
number of NK cells to be added was 0.33, 1, and 3 with respect to the target
cells 1.
[0439]
Fig. 42(b) is a graph showing a ratio of the cells of (4) to (10) described
above
that were damaged and lysed. In Fig. 42(b), the symbol "*" indicates that
there is a
significant difference at P < 0.05, the symbol "**" indicates that there is a
significant
difference at P < 0.01, "K562" indicates the results of the K562 cells of (4),
"B2M¨
indicates the results of cells in which the B2M allele of the 585A1 iPS cell
of (5) was
knocked out, "A-13-C-#5" indicates the results of the cells (clone #3-5) in
which the HLA-
A allele, HLA-B allele, and HLA-C allele of (6) were knocked out, "C7#3-1"
indicates
the results of the clone #3-1 of (7), "C7#3-3" indicates the results of the
clone #3-3 of
(8), "A-13-#3" indicates the results of the cells (clone #3) in which the HLA-
A allele and
the HLA-B allele of (9) were knocked out, and "585A1-WT" indicates the results
of the
585A1 iPS cells of (10).
[0440]
As a result, it was revealed that the cells in which the HLA-C allele remained
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
126
could significantly avoided attack by NK cells, as compared to cells in which
B2M was
knocked out, and cells in which the HLA-A allele, HLA-B allele, and HLA-C
alleles
were knocked out.
[0441]
.. [Experimental Example 35]
(Reactivity test 3 of NK cells)
(1) 585A1 iPS cells, (2) clone #3-1 which was produced in Experimental
Example 13 and in which A*24:02 allele, 13*07:02 allele, B*52:01 allele, and
C*12:02
allele of 585A1 iPS cells had been knocked out, and (3) cells (not subcloned
bulk cells)
produced in Experimental Example 46 to be described later and in which the B2M
allele
of 585A1 iPS cells had been knocked out, were prepared. Table 49 shows HLA
haplotypes of 585A1 iPS cells, and Table 50 shows HLA haplotypes of 1383D2 iPS
cells.
[Table 49]
HLA haplotype of 585A1 iPS cell
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*07:02 B*52:01 C*07:02 C*12:02
[0442]
[Table 50]
HLA haplotype of 1383D2 iPS cell
HLA-A HLA-B HLA-C
A*01:07 A*32:01 B*15:02 B*51:01 C*08:01 C*14:02
[0443]
In addition, CD3-negative and CD56-positive cells (NK cells) were recovered
from PBMC having an HLA haplotype shown in Table 51 (type "LP_329," CTL) by
sorting. Subsequently, the recovered NK cells were co-cultured with each of
cells of (1)
to (3) in the presence of the anti-CD107a antibody. As a result, when the NK
cells were
activated, they became CD107a-positive. After co-culture, flow cytometric
analysis
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
127
was performed to measure a percentage of activated NK cells.
[0444]
[Table 51]
HLA haplotype of PBMC (LP_329, CTL)
HLA- A HLA-B HLA-C
A*29:02 A*68:01 B*39:06 B*40:02 C*03:05 C*07:02
[0445]
Fig. 43(a) is a graph showing results of flow cytometric analysis. In Fig.
43(a),
the symbol "**" indicates that there is a significant difference at P < 0.01,
"WT"
indicates the results of the 585A1 iPS cells of (1), "C7#3-1" indicates the
results of the
clone #3-1 of (2), and "B2M-" indicates the results of the cells in which the
B2M allele of
the 585A1 iPS cells of (3) had been knocked out.
[0446]
As a result, it was revealed that the 585A1 iPS cells and the clone #3-1 were
able to significantly inhibit activation of NK cells, as compared to cells in
which the
B2M allele was knocked out. Then, NK cells activated with cells in which the
B2M
allele was knocked out were sorted and recovered.
[0447]
Subsequently, for (4) K562 cells known not to express HLA antigen; (5) cells
which were produced in Experimental Example 46 to be described later and in
which
B2M allele of 585A1 iPS cells was knocked out (not subcloned bulk cells); (6)
cells
.. which were produced in Experimental Example 47 to be described later and in
which the
HLA-A allele, HLA-B allele, and HLA-C allele of 585A1 iPS cells were knocked
out
(where clones #3-5, HLA-E, HLA-F, and HLA-G alleles remained); (7) the clone #
3-1
which was produced in Experimental Example 13 and in which the A*24:02 allele,
B*07:02 allele, 13*52:01 allele, and C*12:02 allele of 585A1 iPS cells were
knocked out;
Date Regue/Date Received 2020-08-11
CA 03091136 2020-08-11
128
(8) the same clone #3-3; (9) cells which were produced in Experimental Example
13 and
in which the HLA-A and HLA-B alleles of the 585A1 iPS cells were knocked out
(where
clone #3, HLA-C, HLA-E, HLA-F, and HLA-G alleles remained); and (10) 585A1 iPS
cells, activated NK cells were added to each of cells at various ratios, and a
51Cr release
assay was performed.
[0448]
That is, the above-mentioned activated NK cells were used as effector cells,
and
the above-mentioned cells of (4) to (10) were used as target cells. A
percentage of the
number of NK cells to be added was 0.33, 1, and 3 with respect to the target
cells 1.
[0449]
Fig. 43(b) is a graph showing a ratio of the cells of (4) to (10) described
above
that were damaged and lysed. In Fig. 43(b), the symbol """ indicates that
there is a
significant difference at P < 0.01, "K562" indicates the results of the K562
cells of (4),
"B2M-" indicates the results of cells in which the B2M allele of the 585A1 iPS
cell of (5)
was knocked out, "ABC-#5" indicates the results of the cells (clone #5) in
which the
HLA-A allele, HLA-B allele, and HLA-C allele of (6) were knocked out, "C7#3-1"
indicates the results of the clone #3-1 of (7), "C7#3-3" indicates the results
of the clone
#3-3 of (8), "A-B-#3" indicates the results of the cells (clone #3) in which
the HLA-A
allele and the HLA-B allele of (9) were knocked out, and "585A1-WT" indicates
the
results of the 585A1 iPS cells of (10).
[0450]
As a result, it was revealed that the cells in which the HLA-C allele remained
could significantly avoided attack by NK cells, as compared to cells in which
B2M was
knocked out, and cells in which the HLA-A allele, HLA-B allele, and HLA-C
alleles
were knocked out.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
129
[0451]
[Experimental Example 36]
(Reactivity test 4 of NK cells)
(1) 585A1 iPS cells, (2) clone #3-1 which was produced in Experimental
Example 13 and in which A*24:02 allele, B*07:02 allele, B*52:01 allele, and
C*12:02
allele of 585A1 iPS cells had been knocked out, (3) cells (not subcloned bulk
cells)
produced in Experimental Example 46 to be described later and in which the B2M
allele
of 585A1 iPS cells had been knocked out, and (4) K562 cells known not to
express HLA
antigen, were prepared. Table 52 shows HLA haplotypes of 585A1 iPS cells, and
Table
53 shows HLA haplotypes of 1383D2 iPS cells.
[Table 52]
HLA haplotype of 585A1 iPS cell
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*07:02 B*52:01 C*07:02 C*12:02
[0452]
[Table 53]
HLA haplotype of 1383D2 iPS cell
HLA-A HLA-B HLA-C
A*02:07 A*32:01 B*15:02 B*51:01 C*08:01 C*14:02
[0453]
In addition, CD3-negative and CD56-positive cells (NK cells) were respectively
recovered from PBMC having HLA haplotypes shown in Table 54 (type "LP_118,"
CTL)
and PBMC having HLA haplotypes shown in Table 55 (type "LP_266," CTL) by
sorting.
Subsequently, the recovered NK cells were co-cultured with each of cells of
(1) to (4) in
the presence of the anti-CD107a antibody. As a result, when the NK cells were
activated, they became CD107a-positive. After co-culture, flow cytometric
analysis
was performed to measure a percentage of activated NK cells.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
130
[0454]
[Table 54]
HLA haplotype of PBMC (LP_118, CTL)
HLA-A HLA-B HLA-C
A*03:01 A*24:02 B*07:02 B*35:01 C*07:02 C*07:02
[0455]
[Table 55]
HLA haplotype of PBMC (LP_266, CTL)
HLA-A HLA-B HLA-C
A*03:01 A*24:02 B*07:02 B*40:02 C*03:05 C*07:02
[0456]
Fig. 44(a) and Fig. 44(b) are graphs showing results of flow cytometric
analysis.
Fig. 44(a) shows the results of NK cells derived from PBMC having HLA
haplotypes
shown in Table 54 (type "LP_118," CTL), and Fig. 44(b) shows the results of NK
cells
derived from PBMC having HLA haplotypes shown in Table 55 (type "LP_266,"
CTL).
In Figs. 44(a) and 44(b), the symbol """ indicates that there is a significant
difference at
P < 0.01, "WT" indicates the results of the 585A1 iPS cells of (1), "C7#3-1"
indicates the
results of the clone #3-1 of (2), "B2M-" indicates the results of the cells in
which the
B2M allele of the 585A1 iPS cells of (3) had been knocked out, and "K562"
indicates the
results of the K562 cells of (4).
[0457]
As a result, it was revealed that the 585A1 iPS cells and the clone #3-1 were
able to significantly inhibit activation of NK cells, as compared to cells in
which the
B2M allele was knocked out.
[0458]
[Experimental Example 37]
(Cell transplantation experiment 2)
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
131
(1) Cells in which a B2M gene of 585A1 iPS cell was knocked out, and (2) the
clone #3-1 which was produced in Experimental Example 13 and in which the
A*24:02
allele, B*07:02 allele, B*52:01 allele, and C*12:02 allele of the 585A1 iPS
cells were
knocked out, were respectively differentiation-induced into EB-derived blood-
cell-like
cells. Subsequently, the respective EB-derived blood-cell-like cells were
labeled with
luciferase.
[0459]
Subsequently, one hour before the start of the experiment, each of the cell
was
transplanted into immunodeficient mice (NOD.Cg-Rag1tnam0mil2retwil¨z.
(NRG), The
Jackson Laboratory) by intraperitoneal administration. Subsequently, at the
start of the
experiment, activated NK cells which were prepared in the same manner as in
Experimental Examples 34 and 35 and were derived from peripheral blood
mononuclear
cells (PBMC, type "LP_329," CTL) or a medium (control) were further
intraperitoneally
administered. Table 56 shows HLA haplotypes of PBMC (type "LP_329," CTL).
[0460]
[Table 56]
HLA haplotype of PBMC (LP_329, CTL)
HLA-A HLA-B HLA-C
A*29:02 A*68:01 B*39:06 B*40:02 C*03:05 C*07:02
[0461]
Then, at the time of cell transplantation (before NK cells injection), 5
hours, 1
day, 3 days, 5 days, and 7 days after the start of the experiment, luciferin,
which is a
substrate of luciferase, was administered to each mouse. Using an IVIS imaging
system
(trade name "IVIS Spectrum," SPI), fluorescence of the EB-derived blood-cell-
like cells
labeled with luciferase was captured, and a survival rate of the transplanted
cells was
measured.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
132
[0462]
Fig. 45(a) is a diagram illustrating an experimental schedule. Furthermore,
Fig.
45(b) shows a photograph showing results of capturing fluorescence of EB-
derived
blood-cell-like cells in each mouse. Furthermore. Fig. 45(c) is graph showing
the
.. results of calculating a survival rate of each EB-derived blood-cell-like
cell in a case
where the NK cells were administered to the mouse, with a fluorescence
intensity before
NK cell injection being 100%, and furthermore, calculating a relative survival
rate at
each measurement time by Formula (F1). In Fig. 45(c), a unit of a vertical
axis is (%).
Relative survival rate (%) = survival rate (%) of NK cell administration
group/survival rate (%) of control group x 100(F1)
[0463]
In Figs. 45(b) and 45(c), "B2M-" indicates the results of EB-derived blood-
cell-
like cells differentiation-induced from cells in which a B2M gene of the 585A1
iPS cells
of (1) was knocked out, "C7 #3-1" indicates the results of EB-derived blood-
cell-like
cells differentiation-induced from the clone #3-1 of (2), "Mock" indicates the
results of
administration of the medium as a control, and "NK cell" indicates the results
of
administration of the activated NK cells derived from peripheral blood
mononuclear cells
(PBMC, type "LP_329," CTL).
[0464]
As a result, as shown in Fig. 45(c), it was confirmed that the EB-derived
blood-
cell-like cells differentiation-induced from the cells in which a B2M gene was
knocked
out had a reduced survival rate after administration of the NK cells. On the
other hand,
it was recognized that the EB-derived blood-cell-like cells differentiation-
induced from
the clone #3-1 tended to maintain a higher survival rate even after
administration of
activated NK cells.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
133
[0465]
These results further support that by partially leaving the HLA allele, it is
possible to reduce the attack by NK cells in the case of allogeneic
transplantation.
[0466]
[Experimental Example 38]
(Cytotoxicity test using T cells and NK cells)
(1) 585A1 iPS cells, (2) clone #3-1 which was produced in Experimental
Example 13 and in which A*24:02 allele, 13*07:02 allele, B*52:01 allele, and
C*12:02
allele of 585A1 iPS cells had been knocked out, and (3) cells (not subcloned
bulk cells)
produced in Experimental Example 46 to be described later and in which the B2M
allele
of 585A1 iPS cells had been knocked out, were respectively differentiation-
induced into
EB-derived blood-cell-like cells.
[0467]
Subsequently, in a medium for each of the EB-derived blood-cell-like cells and
at various proportions, effector CD8-positive T cells recovered by sorting
from peripheral
blood mononuclear cells (PBMC, type "LP 275," CTL) were added in the same
manner
as in Experimental Example 31, and activated NK cells recovered by sorting
from PBMC
(type "LP_275," CTL) were added in the same manner as in Experimental Example
34,
and a 51Cr release assay was performed.
[0468]
That is, target cells were EB-derived blood-cell-like cells that had been
differentiation-induced from the cells of (1) to (3), and the effector cells
were the above-
mentioned CD8-positive T cells and activated NK cells. A ratio of the number
of CD8-
positive T cells to be added as effectors was 1, 3, and 9 with respect to EB-
derived blood-
cell-like cells 1. In addition, a ratio of the number of activated NK cells to
be added
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
134
was 0.33, 1, and 3 with respect to EB-derived blood-cell-like cells 1.
[0469]
Fig. 46 is a graph showing a ratio of each EB-derived blood-cell-like cell
damaged and lysed. In Fig. 46, the symbol "*" indicates that there is a
significant
.. difference at P < 0.05, the symbol "*" indicates that there is a
significant difference at P
<0.01, "WT" indicates the results of EB-derived blood-cell-like cells
differentiation-
induced from the 585A1 iPS cells of (1), "C7#3-1" indicates the results of the
EB-
derived blood-cell-like cells differentiation-induced from the clone #3-1 of
(2), and
"B2M-" indicates the results of the EB-derived blood-cell-like cells
differentiation-
induced from cells in which the B2M allele of the 585A1 iPS cells of (3) had
been
knocked out.
[0470]
As a result, it was confirmed that when EB-derived blood-cell-like cells were
mixed alone with the effector CD8-positive T cells, only EB-derived blood-cell-
like cells
that were differentiation-induced from 585A1 iPS cells were damaged.
[0471]
In addition, it was confirmed that when each of the EB-derived blood-cell-like
cells was mixed with the activated NK cell alone, only the EB-derived blood-
cell-like
cell differentiation-induced from the cells in which the B2M allele was
knocked out, was
damaged.
[0472]
In addition, it was revealed that when each of the effector CD8-positive T
cells
and the activated NK cells are mixed with each of the EB-derived blood-cell-
like cells,
both EB-derived blood-cell-like cells differentiation-induced from 585A1 iPS
cells and
EB-derived blood-cell-like cells differentiation-induced from cells in which
the B2M
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
135
allele was knocked out were damaged, but a degree of damage was significantly
suppressed in the EB-derived blood-cell-like cells that were differentiation-
induced from
C7#3-1 cells.
[0473]
These results indicate that damage caused by both the effector CD8-positive T
cells and the activated NK cells can be reduced by disrupting an HLA allele
present in
donor cells but not present in recipient cells and by leaving HLA alleles
matching in the
donor cells and the recipient cells.
.. [0474]
[Experimental Example 39]
(Production of CIITA gene knockout iPS cell)
A CIITA gene is a gene encoding a Class II Major Histocompatibility Complex
Transactivator protein. As described above, expression of the CIITA gene is
known to
be essential for expression of class TI HLA protein.
[0475]
A CBTA gene of the clone #3-1 (hereinafter, may be referred to as "585A1-C7
residual cells"), which was produced in Experimental Example 13 and in which
the
A*24:02 allele, B*07:02 allele, B*52:01 allele, and C*12:02 allele of 585A1
iPS cells
were knocked out, was knocked out.
[0476]
Fig. 47(a) is a table showing 585A1-C7 residual cells and an HLA haplotype of
the 585A1-C7 residual cells in which a CIITA gene was knocked out. By knocking
out
the ClITA gene, class II HLA proteins such as HLA-DP, HLA-DQ, and HLA-DR can
be
deleted.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
136
[0477]
Specifically, the 585A1-C7 residual cells were transfected with a purified
Cas9
protein together with CIITA-ex3g5 that is an sgRNA that cleaves a CITTA allele
(where a
target base sequence is set forth in SEQ ID NO: 8017), and subclones of 28
strains were
obtained. A commercially available kit (trade name "4D-Nucleofector," model
"V4XP-
4032," Lonza) was used for transfection.
[0478]
Then, a base sequence of the CIITA allele of the genome of each subclone was
analyzed. Fig. 47(b) is a table showing a base mutation pattern of each
subclone. In
.. Fig. 47(b), "Clone ID" indicates the subclone name, "WT" indicates that it
was a wild-
type base sequence, "-" had a deletion mutation, and "+" indicates that it had
an insertion
mutation.
[0479]
As a result, as shown in Fig. 47(b), it was confirmed that a deletion mutation
or
an insertion mutation was introduced into at least one of CIITA alleles in 15
strains
among subclones of 28 strains. In Fig. 47(c), a base sequence of clone #3-1-3
is shown
as a representative example.
[0480]
[Experimental Example 40]
(Test of CD4-positive T cell activation)
CD4-positive T cells were recovered from peripheral blood mononuclear cells
(PBMC) derived from healthy volunteer #21 by sorting, and were stained with
CFSE
(Cayman Chemical Co.).
[0481]
Subsequently, the above CD4-positive T cells were mixed and co-cultured for 1
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
137
week with (1) 585A1 iPS cells, (2) clone #3-1 which was produced in
Experimental
Example 13 and in which A*24:02 allele, B*07:02 allele, B*52:01 allele, and
C*12:02
allele of 585A1 iPS cells had been knocked out (hereinafter, also referred to
as "585A1-
C7 residual cells"), and (3) the cells which were produced in Experimental
Example 39
and in which a CIITA gene of 585A1-C7 residual cells was knocked out (clone #3-
1-3).
In addition, for comparison, a group in which the above-mentioned CD4-positive
T cells
of (4) were cultured alone for 1 week was prepared.
[0482]
After co-culture, flow cytometric analysis was performed to examine
fluorescence of CFSE. Figs. 48(a) to 48(d) are graphs showing results of flow
cytometry. In Figs. 48(a) to 48(d), "Mock" indicates the results of culturing
only the
CD4-positive T cells of (4), "585A1-WT" indicates the results of 585A1 iPS
cells of (1),
"585A 1 -C7 #3-1" indicates the results of the 585A 1 -C7 residual cells of
(2), and
"585A1-C7 + CIITA-#3-1-3" indicates the results of the cells (clone #3-1-3) in
which the
CIITA gene of the 585A1-C7 residual cells of (3) was knocked out.
[0483]
As a result, as shown in Fig. 48(a), it was revealed that the CD4-positive T
cells
were not activated even when only the CD4-positive T cells were cultured
alone.
[0484]
Furthermore, as shown in Fig. 48(b), it became clear that when the CD4-
positive
T cells derived from healthy volunteer #21 and the 585A1 iPS cells were co-
cultured,
45.6% of the CD4-positive T cells were activated and became CFSE-negative.
[0485]
Furthermore, as shown in Fig. 48(c), it became clear that when the CD4-
positive
T cells derived from healthy volunteer #21 and the 585A1-C7 residual cells
were co-
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
138
cultured, 49.2% of the CD4-positive T cells were activated and became CFSE-
negative.
[0486]
Furthermore, as shown in Fig. 48(d), it became clear that even when the CD4-
positive T cells derived from healthy volunteer #21 and the cells (clone #3-1-
3) in which
the CIITA gene of 585A1-C7 residual cells was knocked out were co-cultured,
the CD4-
positive T cells were not activated.
[0487]
[Experimental Example 41]
(Test of activation of CD4-positive T cells, CD8-positive T cells, and NK
cells)
Peripheral blood mononuclear cells (PBMC, type "LP_329," CTL) were stained
with CFSE (Cayman Chemical). Table 57 shows HLA haplotypes of PBMC (type
"LP_329," CTL).
[0488]
[Table 57]
HLA haplotype of PBMC (LP_329, CTL)
HLA-A HLA-B HLA-C
A*29:02 A*68:01 B*39:06 B*40:02 C*03:05 C*07:02
[04891
Subsequently, the above PBMC was mixed and co-cultured for 1 week with (1)
585A1 iPS cells, (2) clone #3-1 which was produced in Experimental Example 13
and in
which A*24:02 allele, B*07:02 allele, B*52:01 allele, and C*12:02 allele of
585A1 iPS
cells had been knocked out (hereinafter, also referred to as "585A1-C7
residual cells"),
(3) the cells which were produced in Experimental Example 39 and in which a
ClITA
gene of 585A1-C7 residual cells was knocked out (clone #3-1-3), (4) EB-derived
blood-
cell-like cells differentiated from each cell of the clone #3-1-6, and (5)
K562 cells known
not to express HLA antigen. In addition, for comparison, a group in which the
above-
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
139
mentioned PBMC of (6) were cultured alone for 1 week was prepared.
[0490]
After co-culture, flow cytometric analysis was performed to examine
fluorescence of CFSE. Figs. 49(a) to 49(c) are graphs showing results of flow
cytometry. In Figs. 49(a) to 49(c), "Mock" indicates the results of culturing
only PBMC
of (6) alone; "585A1-WT" indicates the results of EB-derived blood-cell-like
cells
differentiation-induced from the 585A1 iPS cells of (1); "585A1-C7 #3-1"
indicates the
results of EB-derived blood-cell-like cells differentiation-induced from the
585A1-C7
residual cells of (2); "585A1-C7 + CITTA-# 3-1-3" indicates the results of EB-
derived
blood-cell-like cells differentiation-induced from the cells (clone #3-1-3) in
which the
CIITA gene of the 585A1-C7 residual cells of (3) was knocked out; "585A1-C7 +
CIITA"
#3-1-6" indicates the results of EB-derived blood-cell-like cells
differentiation-induced
from the cells (clone #3-1-6) in which the CIITA gene of the 585A1-C7 residual
cells of
(4) was knocked out; and "K562" indicates the results of the K562 cells of
(5).
[0491]
As a result, as shown in Fig. 49(a), it became clear that the CD8-positive T
cells
reacted with the EB-derived blood-cell-like cells differentiation-induced from
the 585A1
iPS cells, and 51.0% of the CD8-positive T cells were activated and became
CFSE-
negative. On the other hand, it was revealed that even when the CD8-positive T
cells
were co-cultured with cells other than the EB-derived blood-cell-like cells
differentiation-induced from 585A1 iPS cells, only 2% or less of the CD8-
positive T cells
were activated.
[0492]
Furthermore, as shown in Fig. 49(b), it became clear that the CD4-positive T
cells reacted with the ER-derived blood-cell-like cells differentiation-
induced from
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
140
585A1 iPS cells and the EB-derived blood-cell-like cells differentiation-
induced from
585A1-C7 residual cells, and for each of the cases, 49.2% and 26.7% of the CD4-
positive
T cells were activated and became CFSE-negative. On the other hand, it was
revealed
that even when the CD4-positive T cells were co-cultured with other cells,
only 2% or
.. less of the CD4-positive T cells were activated.
[0493]
Furthermore, as shown in Fig. 49(c), it was revealed that the NK cells reacted
with the K562 cells, and 79.2% of the NK cells were activated and became CFSE-
negative. On the other hand, it was revealed that even when the NK cells were
co-
cultured with other cells, only 7% or less of the NK cells were activated.
[0494]
[Experimental Example 42]
(Production of iPS cells with residual HLA-C7 and deficient CIITA)
An HLA-A allele, an HLA-B allele, and a CIITA allele were knocked out from
iPS stock cells (Ff-Xt-28s05 iPS cells) which has the third most frequent HLA
allele
among Japanese homozygously. Knockout was performed by one-stage genome
editing
and two-stage genome editing. Table 58 shows HLA haplotypes of Ff-Xt-28s05 iPS
cells.
[0495]
[Table 58]
HLA haplotype of Ff-Xt-28s05 iPS cells
HLA-A HLA-B HLA-C
A*24:02 A*24:02 B*07:02 B*07:02 C*07:02 C*07:02
[0496]
Figs. 50(a) to 50(c) are diagrams illustrating a procedure of the present
experimental example. Fig. 50(a) is a diagram illustrating a procedure in
which the
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
141
HLA-A allele, the HLA-B allele, and the CIITA allele were knocked out in one
stage.
Furthermore, Figs. 50(b) and 50(c) are diagrams illustrating a procedure in
which the
HLA-A allele, the HLA-B allele, and the CIITA allele were knocked out in two
stages.
[0497]
In the one-stage knockout, as shown in Fig. 50(a), first, Ff-Xt-28s05 iPS
cells
were transfected with A-ex3-gl which is an sgRNA capable of targeting the HLA-
A
allele (where a target base sequence is set forth in SEQ ID NO: 55), B-ex2-gl
which is
an sgRNA capable of targeting the HLA-B allele (where a target base sequence
is set
forth in SEQ ID NO: 53), and CIITA-ex3g5 which is an sgRNA capable of
targeting the
CIITA allele (where a target base sequence is set forth in SEQ ID NO: 8017),
and a
purified Cas9 protein. A commercially available kit (trade name "4D-
Nucleofector,"
model "V4XP-4032," Lonza) was used for transfection.
[0498]
Then, iPS cells were stimulated with 50 ng/mL IFN-y for 48 hours and subjected
to flow cytometric analysis to examine the expression of HLA-A24 antigen and
HLA-B7
antigen. Fig. 51(a) is a graph showing results of flow cytometry. In Fig.
51(a), "No
stain" indicates the analysis result of iPS cells that were not stained with
an antibody,
"No TF" indicates the analysis results of iPS cells into which sgRNA was not
introduced,
"HLA-A-ex3g1" indicates the results of introduction of A-ex3-gl (where a
target base
sequence is set forth in SEQ ID NO: 55), "HLA-B-ex2g1" indicates the results
of
introducing B-ex2-gl (where a target base sequence is set forth in SEQ ID NO:
53), and
CIITA-ex3g5 indicates the results of introducing CIITA-ex3g5 (where a target
base
sequence is set forth in SEQ ID NO: 8017).
[0499]
Subsequently, cell populations in which both HLA-A24 antigen and HLA-B7
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
142
antigen were negative were sorted and recovered, and subclones of 15 strains
were
obtained. Then, a base sequence of the HLA-A24 allele, HLA-B7 allele, and
CIITA
allele of the genome of each subclone was analyzed. Fig. 51(b) is a table
showing a
base mutation pattern of each subclone. In Fig. 51(b), "Clone ID" indicates
the
subclone name, "WT" indicates that it was a wild-type base sequence, "-" had a
deletion
mutation, "+" indicates that it had an insertion mutation, and "N.D."
indicates that a base
sequence was not determined. Furthermore, "ABTo" in the subclone name means
that
the HLA-A allele, HLA-B allele, and CIITA allele were knocked out.
[0500]
As a result, as shown in Fig. 51(b), clones #1, #2, #3, #6, #13, and #15 were
obtained in which insertion deletion mutations (Indel mutations) were detected
in all of
the HLA-A allele, HLA-B allele, and CIITA allele.
[0501]
In the two-stage knockout, as shown in Fig. 50(b), first, Ff-Xt-28s05 iPS
cells
were transfected with A-ex3-gl which is an sgRNA capable of targeting the HLA-
A
allele (where a target base sequence is set forth in SEQ ID NO: 55), B-ex2-gl
which is
an sgRNA capable of targeting the HLA-B allele (where a target base sequence
is set
forth in SEQ ID NO: 53), and a purified Cas9 protein. Thereby, subclones of 17
strains
were obtained. A commercially available kit (trade name "4D-Nucleofector,"
model
"V4XP-4032," Lonza) was used for transfection.
[0502]
Then, a base sequence of the HLA-A24 allele and HLA-B7 allele of the genome
of each subclone was analyzed. Fig. 52(a) is a table showing a base mutation
pattern of
each subclone. In Fig. 52(a), "Clone ID" indicates the subclone name, "WT"
indicates
that it was a wild-type base sequence, "-" had a deletion mutation, "+"
indicates that it
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
143
had an insertion mutation, and "Mut." indicates that it had a substitution
mutation.
Furthermore, "ABo" in the subclone name means that the HLA-A allele and HLA-B
allele were knocked out.
[0503]
As a result, as shown in Fig. 52(a), clone #14 was obtained in which insertion
deletion mutations (lndel mutations) were detected in both of the HLA-A allele
and the
HLA-B allele.
[0504]
Subsequently, as shown in Fig. 50(c), the obtained clone #14 was transfected
with CIITA-ex3g5 (where a target base sequence is set forth in SEQ ID NO:
8017),
which is an sgRNA capable of targeting the CIITA allele, and a purified Cas9
protein.
Thereby, subclones of 12 strains were obtained. A commercially available kit
(trade
name "4D-Nucleofector," model "V4XP-4032," Lonza) was used for transfection.
[0505]
Then, a base sequence of the OITA allele of the genome of each subclone was
analyzed. Fig. 52(b) is a table showing a base mutation pattern of each
subclone. In
Fig. 52(b), "Clone ID" indicates the subclone name, "WT" indicates that it was
a wild-
type base sequence, "-" had a deletion mutation, "+" indicates that it had an
insertion
mutation, and "N.D." indicates that a base sequence was not determined.
Furthermore,
"ABo_To" in the subclone name means that the HLA-A and HLA-B alleles were
knocked out, subcloned once, and then the CIITA allele was knocked out.
[0506]
As a result, as shown in Fig. 52(b), clones #14-3, #14-4, #14-6, and #14-12
were
obtained in which insertion deletion mutations (Indel mutations) that were
frameshift
mutations were detected in both alleles of QUA.
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
144
[0507]
Fig. 53 is a table showing allele frequency of an HLC-C allele in various
races.
In Fig. 53, "JPN" indicates Japanese, "EUR" indicates European American, "AFA"
indicates African American, "API" indicates Asian, and "HIS" indicates
Hispanic. In
addition, "allele frequency" indicates frequency (%) of an allele in each
race, and "rank"
indicates the order of frequency from the highest frequency.
[0508]
As shown in Fig. 53, it is possible to cover 93% or more of the population in
any
of the above races by producing 12 kinds of cells, which are HLA-C*01:02, 1-
ILA-
.. C*02:02, HLA-C*03:03, HLA-C*03:04, HLA-C*04:01, HLA-C*05:01, HLA-C*06:02,
HLA-C*07:01, HLA-C*07:02, HLA-C*08:01, HLA-C*12:02, and HLA-C*16:01.
[0509]
That is, cells deficient in the HLA-A and HLA-B alleles and having any of the
above 12 kinds of the HLA-C alleles, or cells deficient in the HLA-A allele,
HLA-B
allele, and CIITA allele and having any of the above 12 kinds of the HLA-C
alleles are
very useful as cells for cell therapy and regenerative medicine. The cells are
not
particularly limited as long as they are cells used for cell therapy, and they
may be
pluripotent stem cells or differentiated cells. Specifically, for example, iPS
cells. T
cells, hematopoietic stern cells, mesenchymal stem cells, and the like may be
used.
[0510]
[Experimental Example 43]
(Production 3 of B2M knockout iPS cell)
A B2M allele was knocked out from the iPS stock cells (Ff-Xt-28s05 iPS cells)
also used in Experimental Example 41.
[0511]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
145
Ff-Xt-28s05 iPS cells were transfected with B2M-g2, which is an sgRNA
capable of targeting the B2M allele (where a target base sequence is set forth
in SEQ ID
NO: 60) and a purified Cas9 protein. Thereby, subclones of 5 strains were
obtained. A
commercially available kit (trade name "4D-Nucleofector," model "V4XP-4032,"
Lonza)
was used for transfection.
[0512]
Then, a base sequence of the B2M allele of the genome of each subclone was
analyzed. Fig. 54 is a table showing a base mutation pattern of each subclone.
In Fig.
54, "Clone ID" indicates the subclone name, "WT" indicates that it was a wild-
type base
sequence, "-" had a deletion mutation, and "+" indicates that it had an
insertion mutation.
Furthermore, "Mo" in the subclone name means that the B2M allele was knocked
out.
[0513]
As a result, as shown in Fig. 54, clones #1 and #3 having frameshift mutations
in
the B2M allele were obtained.
[0514]
[Experimental Example 44]
(Preparation of B2M and CI1TA knockout iPS cells)
A B2M allele and a CIITA allele were knocked out at the same time from the iPS
stock cells (Ff-Xt-28s05 iPS cells) also used in Experimental Example 41.
[0515]
Ff-Xt-28s05 iPS cells were transfected with B2M-g2 which is an sgRNA
capable of targeting the B2M allele (where a target base sequence is set forth
in SEQ ID
NO: 60), CIITA-ex3g5 which is an sgRNA capable of targeting the ClITA allele
(where a
target base sequence is set forth in SEQ ID NO: 8017), and a purified Cas9
protein.
Thereby, subclones of 19 strains were obtained. A commercially available kit
(trade
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
146
name "4D-Nucleofector," model "V4XP-4032," Lonza) was used for transfection.
[0516]
Then, a base sequence of the B2M and CIITA alleles of the genome of each
subclone was analyzed. Fig. 55 is a table showing a base mutation pattern of
each
subclone. In Fig. 55, "Clone ID" indicates the subclone name, "WY' indicates
that it
was a wild-type base sequence, "-" had a deletion mutation, and "+" indicates
that it had
an insertion mutation. Furthermore, "MTo" in the subclone name means that the
B2M
allele and the CIITA allele were knocked out in one stage.
[0517]
As a result, as shown in Fig. 55, clone #8 having a frameshift mutation in
both
the B2M allele and the CIITA allele was obtained.
[0518]
Furthermore, it was revealed that in clone #2, only one of the B2M alleles was
knocked out, and both of the CIITA alleles were knocked out. Accordingly, the
clone
_______________________________________________________________ #2 was
obtained as a cell strain in which substantially only the CIF! A allele was
knocked
out.
[0519]
[Experimental Example 45]
(Examination of HLA protein expression in B2M and CIITA knockout iPS cells)
Expression of HLA-ABC protein in Ff-Xt-28s05-MTo #2 iPS cells produced in
Experimental Example 44 was examined.
[0520]
First, Ff-Xt-28s05-MTo #2 iPS cells were stimulated with 50 ng/mLIFN-y for
48 hours. Thereafter, the cells were stained with an anti-HLA-ABC antibody
(product
number:311418, BIOLEGEND) to be subjected to flow cytometric analysis, and
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
147
expression of HLA-A protein, HLA-B protein, and HLA-C protein was examined.
[0521]
Fig. 56(a) and 56(b) are graphs showing results of flow cytometry. In Fig.
56(a), "No stain" indicates the analysis results of iPS cells not stained with
the antibody.
Furthermore, in Fig. 16(b), "Ff-Xt-28s05-MTo #2" indicates the analysis
results of Ff-Xt-
28s05-MTo #2 iPS cells.
[0522]
As a result, it was revealed that the Ff-Xt-28s05-MTo #2 iPS cells maintained
an
expression ability of HLA-A protein, HLA-B protein, and HLA-C protein.
[0523]
[Experimental Example 46]
(Production 4 of B2M knockout iPS cell)
585A1 iPS cells were transfected with a plasmid vector expressing Cas9 and
B2M-specific sgRNA. B2M-g2 (where a target base sequence is set forth in SEQ
ID
NO: 60) was used as sgRNA.
[0524]
Subsequently, cells stimulated with 50 ng/mL 1FN-y for 48 hours were stained
with an anti-HLA-ABC antibody, and flow cytometric analysis was performed.
[0525]
Fig. 57 is a graph showing results of flow cytometry. In Fig. 57, "No stain"
indicates the analysis results of iPS cells that were not stained with an
antibody, "No TF"
indicates the analysis results of iPS cells into which sgRNA was not
introduced, and
"B2M-g2" indicates the analysis results of iPS cells into which this sgRNA was
introduced and in which the B2M allele was knocked out.
[0526]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
148
As a result, a proportion of the cell population in which all of HLA-A
protein,
HLA-B protein, and HLA-C protein were negative was 27.0%. Subsequently, a cell
population which was obtained by the introduction of B2M-g2 sgRNA and in which
all
of HLA-A, HLA-B, and HLA-C were negative was recovered by sorting. No
subcloning was performed herein.
[0527]
[Experimental Example 47]
(HLA-allele-specific knockout 10)
HLA-A, HLA-B, and HLA-C alleles of 585A1 iPS cells were knocked out to
produce cells. Specifically, a purified Cas9 protein, an sgRNA specific to
C*07:02
allele, and an sgRNA specific to C*12:02 allele were transfected to the cells
(clone # 3)
which were produced in Experimental Example 13 and in which the A*24:02
allele,
B*07:02 allele, and B*52:01 allele of the 585A1 iPS cells were knocked out.
[0528]
C0702-ex3-g3 (where a target base sequence is set forth in SEQ ID NO: 49) was
used as the sgRNA specific to the C*07:02 allele. In addition, C1202-ex3-gl
(where a
target base sequence is set forth in SEQ ID NO: 50) was used as the sgRNA
specific to
the C*12:02 allele. A commercially available kit (trade name "4D-
Nucleofector,"
model "V4XP-4032," Lonza) was used for transfection.
[0529]
Thereafter, subcloning was performed to obtain subclones of six strains.
Subsequently, genomic DNA was extracted from each subclone. Subsequently, base
sequences of the HLA-C*07:02 allele and the HLA-C*12:02 allele were analyzed
by
Sanger sequence.
[0530]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
149
Fig. 58 is a table showing a base mutation pattern of each clone recovered. In
Fig. 58, "Clone ID" indicates the subclone name, "HLA-007" indicates the HLA-
C*07:02 allele, "HLA-C12" indicates the HLA-C*12:02 allele, "WT" indicates
that it
was a wild-type base sequence, "-" had a deletion mutation, and "+" indicates
that it had
an insertion mutation. As a result, it was confirmed that both HLA-C alleles
were
knocked out in clones #3-4, #3-5, #3-6, and #3-7.
[0531]
[Experimental Example 48]
(HLA-allele-specific knockout 11)
A purified Cas9 protein and an sgRNA specific to C*07:02 allele were
transfected to the cells (clone # 3) which were produced in Experimental
Example 13 and
in which the A*24:02 allele, B*07:02 allele, and B*52:01 allele of the 585A1
iPS cells
were knocked out.
[0532]
C0702-ex3-g3 (where a target base sequence is set forth in SEQ ID NO: 49) was
used as the sgRNA specific to the C*07:02 allele. A commercially available kit
(trade
name "4D-Nucleofector," model "V4XP-4032," Lonza) was used for transfection.
[0533]
Thereafter, subcloning was performed to obtain subclones of six strains.
Subsequently, genomic DNA was extracted from each subclone. Subsequently, base
sequences of the HLA-C*07:02 allele and the HLA-C*12:02 allele were analyzed
by
Sanger sequence.
[0534]
Fig. 59 is a table showing a base mutation pattern of each clone recovered. In
Fig. 59, "Clone ID" indicates the subclone name, "HLA-007" indicates the HLA-
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
150
C*07:02 allele, "HLA-C12" indicates the HLA-C*12:02 allele, "WT" indicates
that it
was a wild-type base sequence, and "+" indicates that it had an insertion
mutation. As a
result, it was confirmed that the HLA-C*07:02 allele was knocked out and only
the
HLA-C*12:02 allele was left in the clones #3-1, #3-2, #3-3, #3-5, and #3-6.
[0535]
As described above with reference to Fig. 53, by preparing 12 kinds of cells,
which are HLA-C*01:02, HLA-C*02:02, HLA-C*03:03, HLA-C*03:04, 1ILA-C*04:01,
HLA-C*05:01, HLA-C*06:02, HLA-C*07:01, HLA-C*07:02, HLA-C*08:01, HLA-
C*12:02, and HLA-C*16:01, it is possible to cover a population of 93% or more
in any
race of Japanese, European American, African American, Asian, and Hispanic.
[0536]
The cells produced in the present experimental example can be used as one of
these 12 kinds of cells.
[0537]
[Experimental Example 49]
(HLA-allele-specific knockout 12)
A purified Cas9 protein and an sgRNA specific to C*07:02 allele were
transfected to the cells (clone # 4) which were produced in Experimental
Example 14 and
in which the A*01:01 allele, A*24:02 allele, B*07:02 allele, and B*37:01
allele of the
604B1 iPS cells were knocked out.
[0538]
C0702-ex3-g3 (where a target base sequence is set forth in SEQ ID NO: 49) was
used as the sgRNA specific to the C*07:02 allele. A conunercially available
kit (trade
name "4D-Nucleofector," model "V4XP-4032," Lonza) was used for transfection.
[0539]
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
151
Thereafter, subcloning was performed to obtain subclones of 11 strains.
Subsequently, genomic DNA was extracted from each subclone. Subsequently, base
sequences of the HLA-C*06:02 allele and the HLA-C*12:02 allele were analyzed
by
Sanger sequence.
[0540]
Fig. 60 is a table showing a base mutation pattern of each clone recovered. In
Fig. 60, "Clone ID" indicates the subclone name, "HLA-006" indicates the HLA-
C*06:02 allele, "HLA-007" indicates the HI-A-C*07:02 allele, "WT" indicates
that it
was a wild-type base sequence, "-" had an insertion mutation, and "+"
indicates that it
had an insertion mutation. As a result, it was confirmed that the HLA-C*07:02
allele
was knocked out and only the HLA-C*06:02 allele was left in the clones #4-2,
#4-6, #4-
10, and #4-11.
[0541]
As described above with reference to Fig. 53, by preparing 12 kinds of cells,
which are HLA-C*01:02, HLA-C*02:02, HLA-C*03:03, HLA-C*03:04, HLA-C*04:01,
HLA-C*05:01, HLA-C*06:02, HLA-C*07:01, HLA-C*07:02, HLA-C*08:01, HLA-
C*12:02, and HLA-C*16:01, it is possible to cover a population of 93% or more
in any
race of Japanese, European American, African American, Asian, and Hispanic.
[0542]
The cells produced in the present experimental example can be used as one of
these 12 kinds of cells.
Industrial Applicability
[0543]
According to the present invention, it is possible to provide a technique for
Date Recue/Date Received 2020-08-11
CA 03091136 2020-08-11
152
producing a low-antigenic cell in which a rejection reaction is reduced in a
case where
the cell is allogeneically transplanted into a recipient.
Date Recue/Date Received 2020-08-11
