Note: Descriptions are shown in the official language in which they were submitted.
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
DESCRIPTION
USE OF EXOSOMES FOR TARGETED DELIVERY OF THERAPEUTIC AGENTS
REFERENCE TO RELATED APPLICATIONS
100011 The present application claims the priority benefit of United States
provisional
application number 62/649,057, filed March 28, 2018, the entire contents of
which is
incorporated herein by reference.
REFERENCE TO A SEQUENCE LISTING
100021 The instant application contains a Sequence Listing, which has been
submitted
in ASCII format via EFS-Web and is hereby incorporated by reference in its
entirety. Said
ASCII copy, created on March 21, 2019, is named UTFC.P1363W0_5T25.txt and is 3
kilobytes in size.
BACKGROUND
1. Field
100031 The present invention relates generally to the fields of biology,
medicine, and
oncology. More particularly, it concerns the use of exosomes to target
delivery of therapeutic
agents to diseased or disordered cells.
2. Description of Related Art
100041 Exosomes are small extracellular vesicles (EVs) with a lipid bilayer
that
contain proteins and polynucleotides, including messenger RNAs (mRNAs), non-
coding
RNAs and double-stranded genomic DNA (Kalluri, 2016; Raposo and Stoorvogel,
2013).
After their initial discovery as byproducts of reticulocyte differentiation
(Harding et al., 1984;
Raposo and Stoorvogel, 2013), it is now generally accepted that exosomes are
secreted by
virtually all mammalian cells and found in all body fluids (El-Andaloussi et
al., 2013;
Kalluri, 2016).
100051 Exosomes are part of a larger group of extracellular vesicles, which
also
include microvesicles and apoptotic bodies (Colombo et al., 2014). Amongst
extracellular
vesicles, exosomes are typically distinguished through their unique biogenesis
via the
endocytic pathway. Endocytic vesicles mature into late endosomes, also known
as
1
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
multivesicular bodies, which contain a number of intracellular vesicles (ILVs)
generated
through invagination of the endosomal membrane. Through a likely fusion of
these
multivesicular bodies with the plasma membrane, exosomes are released into the
extracellular
space and enter circulation (Bastos et al., 2017; Colombo et al., 2014). As a
result of their
endocytic origin, exosomes membranes have a similar polarity to cellular
membranes,
containing membrane proteins anchored with their intracellular domains facing
the lumen and
the extracellular domains facing the extracellular space. While the protein
content of
exosomes varies depending on their cellular origin, several proteins seem to
be generally
enriched. These include members of the tetraspanin family and components of
the endocytic
and ELV maturation pathways, such as Rab proteins and members of the ESCRT
complex.
Interestingly, different proteomics studies performed with exosomes derived
from many
different cell types have identified many constituents associated with the
protein translation
machinery, such as eukaryotic initiation factors, ADP ribosylation factors,
ribosomal proteins
(Pisitkun et al., 2004; Valadi et al., 2007). Additionally, a subset of
transcriptional and
translation regulators identified in exosomes by proteomic analysis has been
suggested to be
delivered to recipient cells, altering their pattern of gene and protein
expression (Ung et al.,
2014).
100061 Amongst the proteins commonly identified in exosomes are growth factor
receptors, such as the epithelial growth factor receptor (EGFR). EGFR is a
member of the
ErbB family of growth factor receptors, which also includes HER2, HER3 and
HER4
(Seshacharyulu et al., 2012). Upon binding one of its ligands, such as the
epitheial growth
factor (EGF), the receptor dimerizes, forming either homodimers or
heterodimers with other
members of the ErbB family (Seshacharyulu et al., 2012). This dimerization
activates the
receptor's intrinsic kinase activity, leading to the autophosphorylation of
different key
tyrosine residues on its cytoplasmic domain. This authophosphorylation
reaction recruits
different adaptor proteins containing SH2 and PTB (phosphotyrosine binding)
domains, such
as Shc and GRB2, which mediate different downstream signaling activities,
including the
synthesis of relevant proteins (Normanno et al., 2006; Tomas et al., 2014).
Phosphorylated
EGFR is ultimately ubiquitinated and transported to the endosomal pathway,
from which it
will either recycle back to the membrane or remain in the late endosomal
pathway leading to
integration into multivesicular bodies or lysosomal degradation (Tomas et al.,
2014). Since
multivesicular bodies originate exosomes, it is likely that the post-
phosphorylation recycling
2
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
of EGFR (and other growth factors) contribute to their membrane localization
in these
extracellular vesicles.
100071 EGFR signaling has been shown to be important for the progression of
different malignancies, such as glioblastoma, lung cancer, and breast cancer
(Lim et al., 2016;
Liu et al., 2012; Masuda et al., 2012; Morgillo et al., 2016; Westphal et al.,
2017; Zhang et
al., 2013). Perhaps for this reason, most studies of EGFR in exosomes have
been performed
in the context of cancer development. EGFR signaling has particularly been
implicated in the
patterns of cellular uptake and secretion of exosomes from different origins.
In mantle cell
carcinoma cells, incubation with gefitinib (an EGFR inhibitor) has been shown
to
dramatically decrease the rate of exosomes uptake (Hazan-Halevy et al., 2015).
Treatment of
lung cancer cells with gefitinib leads to an increased secretion of exosomes,
which mediate
horizontal transfer of cisplatin resistance (Li et al., 2016). The transfer of
EGFR via cancer
cell-derived exosomes has also been known to cause alterations in components
of the
microenvironment, such as endothelial cells and T cells (Al-Nedawi et al.,
2009; Huang et al.,
2013). More recently, exosomes derived from gastric cancer cells containing
EGFR were
shown to be delivered to stromal cells in the liver, mediating metastasis
(Zhang et al., 2017).
Finally, exosomes derived from breast cancer cells were shown to contain
functional
phosphorylated forms of EGFR, which can be transferred to monocytes mediating
their
survival through activation of the ERK pathway (Song et al., 2016).
100081 While the delivery of EGFR and members of the protein translation
machinery
by exosomes seems to have clear biological importance in the context of cell-
cell
communications, these properties may be harnessed to target the delivery of
therapeutic
agents to certain tissues and to induce therapeutic protein production at the
desired delivery
site.
SUMMARY
100091 Here, protein synthesis was induced in exosomes through growth factor
stimulation. Exosomes that contain DNA, RNA, and proteins, can respond to
biological
stimuli, and initiate properties such as migration, multiplication, initiation
of signaling
network/cascade, transcription, and protein translation. Thus, in one
embodiment, provided
herein are exosomes with the ability to function like minicells. As discussed
further below,
3
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
these minicell-like exosomes can be employed in numerous therapeutic means to
treat various
disease and/or disorders.
100101 In one embodiment, provided herein are methods of treating a disease or
disorder in a patient in need thereof, the method comprising (a) obtaining
exosomes having a
growth factor receptor on their surface; (b) transfecting the exosomes with a
nucleic acid
encoding a therapeutic protein; (c) administering the transfected exosomes to
a patient; (d)
providing a growth factor gradient at a site of the disease or disorder to
attract the exosomes
to the site and stimulate production of the therapeutic protein at the site,
thereby treating the
disease in the patient.
100111 In some aspects, the method is further defined as a method of
administering a
therapeutic protein to a diseased cell in a patient. In some aspects, the
exosomes obtained in
step (a) are obtained from a body fluid sample obtained from the patient. In
some aspects,
the body fluid sample is blood, lymph, saliva, urine, cerebrospinal fluid,
bone marrow
aspirates, eye exudate/tears, or serum. In some aspects, the nucleic acid is
an mRNA, a
plasmid, or a cDNA.
100121 In some aspects, the disease or disorder is cancer, an injury, an
autoimmune
disorder, a neurological disorder, a gastrointestinal disorder, an infectious
disease, a kidney
disease, a cardiovascular disorder, an ophthalmic disorder, a skin disease or
disorder, a
urogenita1 disorder, or a bone disease or disorder. In certain aspects, the
cancer is a breast
cancer, lung cancer, head & neck cancer, prostate cancer, esophageal cancer,
tracheal cancer,
brain cancer, liver cancer, bladder cancer, stomach cancer, pancreatic cancer,
ovarian cancer,
uterine cancer, cervical cancer, testicular cancer, colon cancer, rectal
cancer or skin cancer.
In some aspects, the site of the disease or disorder is a tumor. In some
aspects, the cancer is
metastatic. In certain aspects, the site of the disease or disorder is a
metastatic node.
100131 In some aspects, the therapeutic protein is a kinase, a phosphatase, or
a
transcription factor. In certain aspects, the therapeutic protein corresponds
to a wildtype
version of a protein that is mutated or inactivated in a cell at the site of
the disease or
disorder. In certain aspects, the therapeutic protein corresponds to a
dominant negative
version of a protein that is hyperactive in a cell at the site of the disease
or disorder. In
certain aspects, the disease or disorder is cancer, wherein the therapeutic
protein is a tumor
4
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
suppressor. In some aspects, the exosomes comprise CD47 on their surface. In
some
aspects, transfection comprises electroporation.
100141 In some aspects, the method further comprises administering at least a
second
therapy to the patient. In some aspects, the second therapy comprises a
surgical therapy,
chemotherapy, radiation therapy, cryotherapy, hormonal therapy, or
immunotherapy.
100151 In one embodiment, methods are provided of treating a disease or
disorder in a
patient in need thereof, the method comprising (a) obtaining exosomes having a
growth factor
receptor on their surface; (b) transfecting the exosomes with therapeutic
agent; (c)
administering the transfected exosomes to a patient; (d) providing a growth
factor gradient at
a site of the disease or disorder to attract the exosomes to the site and
deliver the therapeutic
agent to the site, thereby treating the disease in the patient.
100161 In some aspects, the method is further defined as a method of
administering a
therapeutic agent to a diseased cell in a patient. In some aspects, the
exosomes obtained in
step (a) are obtained from a body fluid sample obtained from the patient. In
certain aspects,
the body fluid sample is blood, lymph, saliva, urine, cerebrospinal fluid,
bone marrow
aspirates, eye exudate/tears, or serum.
100171 In some aspects, the therapeutic agent is a therapeutic protein, an
antibody, an
inhibitory RNA, a gene editing system, or a small molecule drug. In certain
aspects, the
antibody binds an intracellular antigen. In certain aspects, the antibody is a
full-length
antibody, an scFv, a Fab fragment, a (Fab)2, a diabody, a triabody, or a
minibody. In certain
aspects, the inhibitory RNA is a siRNA, shRNA, miRNA, or pre-miRNA. In certain
aspects,
the gene editing system is a CRISPR/Cas system. In certain aspects, the
therapeutic protein
is a kinase, a phosphatase, or a transcription factor. In certain aspects, the
therapeutic protein
corresponds to a wildtype version of a protein that is mutated or inactivated
in a cell at the
site of the disease or disorder. In certain aspects, the therapeutic protein
corresponds to a
dominant negative version of a protein that is hyperactive in a cell at the
site of the disease or
disorder. In some aspects, the small molecule drug is an imaging agent.
100181 In some aspects, the disease or disorder is cancer, an injury, an
autoimmune
disorder, a neurological disorder, a gastrointestinal disorder, an infectious
disease, a kidney
disease, a cardiovascular disorder, an ophthalmic disorder, a skin disease or
disorder, a
urogenital disorder, or a bone disease or disorder. In certain aspects, the
cancer is a breast
5
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
cancer, lung cancer, head & neck cancer, prostate cancer, esophageal cancer,
tracheal cancer,
brain cancer, liver cancer, bladder cancer, stomach cancer, pancreatic cancer,
ovarian cancer,
uterine cancer, cervical cancer, testicular cancer, colon cancer, rectal
cancer or skin cancer.
In some aspects, the site of the disease or disorder is a tumor. In some
aspects, the cancer is
metastatic. In some aspects, the site of the disease or disorder is a
metastatic node. In some
aspects, the disease or disorder is cancer, wherein the therapeutic protein is
a tumor
suppressor. In some aspects, the disease or disorder is cancer, wherein the
therapeutic agent
is an inhibitory RNA targeting an oncogene.
100191 In some aspects, the exosomes comprise CD47 on their surface In some
aspects, transfection comprises electroporation. In some aspects, the method
further
comprises administering at least a second therapy to the patient. In some
aspects, the second
therapy comprises a surgical therapy, chemotherapy, radiation therapy,
cryotherapy,
hormonal therapy, or immunotherapy.
100201 In further aspects, exosomes for use according to the embodiments are
comprised in a tissue scaffold matrix. For example, such a matrix may be a
synthetic matrix,
such a matrix that degradable or can be absorbed in tissues. In further
aspects, the matrix
may be a living tissue matrix. In some aspects, a exosomes of the embodiments
are cultured
in a matrix.
100211 As used herein, "essentially free," in terms of a specified component,
is used
herein to mean that none of the specified component has been purposefully
formulated into a
composition and/or is present only as a contaminant or in trace amounts. The
total amount of
the specified component resulting from any unintended contamination of a
composition is
therefore well below 0.01%. Most preferred is a composition in which no amount
of the
specified component can be detected with standard analytical methods.
100221 As used herein the specification, "a" or "an" may mean one or more. As
used
herein in the claim(s), when used in conjunction with the word "comprising,"
the words "a"
or "an" may mean one or more than one.
100231 The use of the term "or" in the claims is used to mean "and/or" unless
explicitly indicated to refer to alternatives only or the alternatives are
mutually exclusive,
although the disclosure supports a definition that refers to only alternatives
and "and/or." As
used herein "another" may mean at least a second or more.
6
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
100241 Throughout this application, the term "about" is used to indicate that
a value
includes the inherent variation of error for the device, the method being
employed to
determine the value, or the variation that exists among the study subjects.
100251 Other objects, features and advantages of the present invention will
become
apparent from the following detailed description. It should be understood,
however, that the
detailed description and the specific examples, while indicating preferred
embodiments of the
invention, are given by way of illustration only, since various changes and
modifications
within the spirit and scope of the invention will become apparent to those
skilled in the art
from this detailed description.
BRIEF DESCRIPTION OF THE DRAWINGS
100261 The following drawings form part of the present specification and are
included
to further demonstrate certain aspects of the present invention. The invention
may be better
understood by reference to one or more of these drawings in combination with
the detailed
description of specific embodiments presented herein.
100271 FIGS. IA-E. EGFR phosphoiylation in exosomes. FIG. 1A ¨ Immunoblot of
EGFR expression on exosomes obtained from different human and murine cell
lines. The
exosomes marker CD81 is used as a loading control, and to confirm the exosomal
origin of
protein extracts. FIG. 1B ¨ Immunoblot showing phosphorylation of EGFR on
exosomes
derived from MDA-MB-231 cells, but not MCF10A cells, after incubation with 500
ng/ml
rhEGF for 15 minutes at 37 C. Phosphorylation levels are detected using an
antibody specific
for the Tyr] 068 residue of EGFR. EGFR levels are shown as a loading control,
to confirm
differences in phosphorylation. Band densitometry quantification was performed
using
ImageJ software. FIG. IC ¨ Immunoblot showing the presence of EGFR adaptor
proteins Shc
and GRB2, as well increased levels of phosphorylated-ERK protein, in exosomes
derived
from MDA-MB-231 cells, with and without rhEGF stimulation for 15 minutes at 37
C. The
exosomes marker CD81 is used as a loading control, and to confirm the exosomal
origin of
protein extracts. FIG. 1D ¨ GRB immunecomplexes were obtained from protein
extracts of
/VIDA-MB-23 1 exosomes, with and without incubation with 500 ng/ml rhEGF for
15 minutes
at 37 C, using a GRB2 specific antibody. Immunoblot analysis of the
immunocomplexes
shows association of GRB2 with EGFR only upon rhEGF stimulation. Non-specific
isotype
control IgG was used as a negative control for the GRB2 pulldown. Equal
volumes of the
7
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
stimulated and unstimulated extracts were probed for f3-actin as input
control. FIG. 1E -
Similar experiment using an Shc antibody for the pull down experiment in
duplicates, also
showing association with EGFR only after stimulation with 500 ng/ml rhEGF for
15 minutes
at 37 C. Non-specific isotype control IgG was used as a negative control for
the Shc
pulldown. Equal volumes of the stimulated and unstimulated extracts were
probed for bactin
as an input control.
100281 FIGS. 2A-G. EGFR phosphorylation alters the content of exosomes. FIG
.2A
- Luciferase-based ATP determination assay ran on protein extracts obtained
from exosomes
either unstimulated or after rhEGF stimulation for 15 minutes at 37 C.
Luciferin-derived
.. luminescence was measured in a plate reader and is presented as arbitrary
units. Significance
was determined with a Mann-Whitney test (n = 4). FIG. 2B - Immunoblot analysis
of
exosomes from MDA-MB-231 cells incubated with 500 ng/ml rhEGF at 37 C for 48
h,
showing an increase in both pEGFR and GRB2 levels when compared to
unstimulated
exosomes. FIG. 2C - Cellular component association analysis of mass
spectrometry data
obtained for MDA-MB-231 exosomes unstimulated or after incubation with 500
ng/ml EGF
at 37 C for 48 h. A list of significant proteins identified for stimulated and
unstimulated
exosomes was obtained and used as input for the open access FunRich functional
enrichment
analysis tool in order to identify the subcellular origin of the identified
proteins. FIG. 2D -
Venn diagram depicting the overlap in proteins identified in control IvIDA-MB-
231 exosomes
and exosomes incubated with 500 ng/ml rhEGF at 37 C for 48 h. FIG. 2E -
Individual EGFR
and GRB2 protein scores obtained from mass spectrometry analysis of MDA-MB-231
exosomes with or without incubation with 500 ng/ml rhEGF for 48 h. FIG. 2F -
BCA
analysis of protein extracts obtained from control MDA-MB-231 exosomes and
exosomes
incubated with 500 ng/ml rhEGF at 37 C for 48 h. Significance was determined
with a
Mann-Whitney test (n = 3). FIG. 2G - Immunoblot analysis of 0-actin expression
on protein
extracts obtained from control MDA-MB-231 exosomes and exosomes incubated with
500
ng/ml and 1000 ng/ml rhEGF at 37 C for 48 h. (*p < 0.05, **p < 0.01, ***p <
0.005, ****p
<0.0001).
100291 FIGS. 3A-F. Exosomes contain functional components for transcription
and
translation. FIG. 3A - Ultra-performance liquid chromatography-mass
spectrometry
(UPLCMS) was used to detect free amino acids in MCF10A-, MDA-MB-231-, HDF, E
10-,
and NIH-3T3-derived exosomes. Data are represented as a HeatMap using
normalized signal
8
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
intensities (log10), with hotter colors corresponding to higher intensity
levels, as represented
in the color legend. FIG. 3B ¨ Immunoblot of elF4A1, elF3A, and elF1A in
protein extracts
of exosomes obtained from El 0-, NIH-3T3-, MCF10A-, HDF-, and MDA-MB-231-
derived
exosomes. CD9 was used as a loading control. FIG. 3C ¨ In vitro translation
assay using
protein lysates from MCF10A- and MDA-MB-231-derived exosomes incubated with
the
pEMT7-GFP cDNA expression plasmid. Protein lysates obtained from cells were
used as
controls. FIG. 3D ¨ Immunoblot analysis of RNA Polymerase II in exosomes
protein
extracts, with CD9 shown as a loading control. FIG. 3E ¨ Autoradiography of
exosomes
derived from MDA-MB-231 and E10 cells cultured in the presence of 35S-
methionine.
Exosomes only, as well as exosomes cultured in the presence of 35S-methionine
and
cycloheximide, were used as controls. FIG. 3F ¨ BCA quantification of protein
extracts
obtained from exosomes immediately after isolation, or after incubation in
cell-free
conditions for 24 h and 48 h. Significance was determined with a one-way ANOVA
followed
by Tukey's multiple comparisons test (*p <0.05, **p <0.01, ***p < 0.005, ****p
< 0.0001,
n = 3).
100301 FIGS. 4A-J. Exosomes synthesize new proteins through DNA transcription
and cap-dependent mRNA translation. FIG. 4A ¨ qPCR analysis of GFP mRNA levels
in
exosomes isolated from /vIDA-MB-231 cells and either non-electroporated, mock
electroporated, or electroporated with a pCMV-GFP plasmid with or without the
presence of
a-amanitin. Expression levels were normalized to GAPDH. FIG. 4B Transmission
electron
microscopy images of immunogold labeling, using anti-GFP antibody, of exosomes
electroporated with GFP plasmid and incubated in cell-free conditions for 48 h
(bottom row).
Secondary antibody only was used as a negative control (top row). Gold
particles are
depicted as black dots. Scale bar, 100 nm. FIG. 4C ¨ Immunoblot of GFP protein
expression
in exosomes electroporated with a pCMV-GFP plasmid and incubated for 12 hours,
2 days,
or 1 week at 37 C. Exosomes only and mock-electroporated exosomes were used as
negative
controls. The exosomes marker TSG101 was used as a loading control for the
presence of
exosomes. FIG. 4D ¨ Immunoblot of GFP protein expression in exosomes
electroporated
with GFP plasmid and incubated for several periods of time up to one month.
Non-
electroporated exosomes were used as negative controls. The exosomes marker
CD63 was
used as a loading control for the presence of exosomes. FIG. 4E ¨ Immunoblot
of GFP
protein expression in exosomes electroporated with a GFP plasmid immediately
after
isolation (0 h) or after incubation in cell-free conditions (24 h) and
cultured as previously
9
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
described. Mock electroporated exosomes were used as negative controls. The
exosomes
marker TSG101 was used as a loading control for the presence of exosomes. FIG.
4F -
Immunoblot of GFP protein expression in exosomes electroporated with a pCMV-
GFP
plasmid and cultured with the translation inhibitor cycloheximide. Exosomes
only and
exosomes mock electroporated were used as negative controls. TSG101 was used
as a
loading control for the presence of exosomes. Band densitometry was performed
using
ImageJ software. FIG. 4G - Immunoblot of GFP protein expression in exosomes
electroporated with a GFP plasmid and cultured with the transcription
inhibitor a-amanitin.
Exosomes only and exosomes mock electroporated were used as negative controls.
TSG101
was used as a loading control for the presence of exosomes. Band densitometry
was
performed using ImageJ software. FIG. 4H - Schematic representation of the
bicistronic
plasmid used as a reporter for cap-dependent or cap-independent translation
(pCDNA3-rLuc-
polIRESfLuc). FIG. 41 - Activities of renilla (r-Luc) and firefly luciferase
(f-Luc) measured
by bioluminescence after 48 h incubation of exosomes electroporated with the
bicistronic
plasmid. Non-electroporated exosomes were used as negative controls. FIG. 4J -
Luminescence counts measured from exosomes incubated for 48 h after
electroporation with
or without a plasmid with firefly luciferase expressed under a CMV promoter.
100311 FIGS. 5A-E. Protein translation in exosomes generates functional
proteins
and can be increased by growth factor stimulation. FIG. 5A - Confocal
microscopy showing
the presence of GFP in MCF10A electroporated cells as well as in MCF10A cells,
previously
treated with cycloheximide, incubated with MDA-MB-231-derived exosomes
electroporated
with a pCMV-GFP plasmid and pre-incubated for 48 h. MCF10A cells treated with
non-
electroporated MDA-MB-231-derived exosomes were used as a negative control.
FIG. 5B -
Immunoblot analysis of GFP expression on protein lysates from MDA-MB-231-
derived
exosomes electroporated with a p53-GFP expression plasmid. Non-electroporated
exosomes
were used as negative controls. TSG101 was used as a loading control for the
presence of
exosomes. FIG.5C - p21 mRNA expression in MDA-MB-231 cells treated with mock
electroporated MDA-MB-231-derived exosomes or exosomes electroporated with the
p53-
GFP plasmid with and without the presence of cycloheximide. Expression levels
were
normalized to the housekeeping gene GAPDH. FIG. 5D - Immunoblot of exosomes
isolated
from MDA-MB-231 cells, incubated with 100 [tg/m1 of the translation inhibitor
cycloheximide. Exosomes lysates were probed for I3-actin and GAPDH. Band
densitometry
quantification was performed using ImageJ software. FIG. 5E - Immunoblot of
GFP protein
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
expression in exosomes electroporated with a pCMV-GFP plasmid, and then
incubated in the
presence of different concentrations of rhEGF at 37 C for 48 h. Exosomes mock
electroporated and exosomes without rhEGF incubation are shown as negative
controls. The
exosomes marker CD81 is used as a loading control. Band densitometry
quantification was
performed using ImageJ software.
100321 FIG. 6A-C. Exosomes derived from MDA-MB-231 cells demonstrate
chemotaxis towards a gradient of growth factors. FIG. 6A - Schematic
demonstrating the set
up for exosomes retrograde migration assay. In short, 10 x 109 exosomes
isolated from
MDA-MB-231 cells were placed in the bottom well of a Corning Transwell
system. An
HIS Transwelle insert with 400 nm pores was placed on top of the exosomes
suspension
containing either PBS, 20% FBS, or 10,000 ng/ml rhEGF and incubated at 37 C.
The number
of exosomes on the top insert was measured by Nanosight NTA after different
time points to
assess exosomes motility. FIGS. 6B&6C - Quantification of MDA-MB-231 exosomes
on the
top insert of the retrograde migration assay, after 4 h (FIG. 6B) and 24 h
(FIG. 6C) incubation
at 37 C, by Nanosight NTA. Significance was determined with a one-way ANOVA
followed
by Newman-Keuls multiple comparison test. (*p <0.05, **p <0.01, ***p <0.005,
****p <
0.0001, n = 3).
100331 FIGS. 7A-D. Tumor-bearing mice show increased protein synthesis in
delivered exosomes. FIG. 7A - Schematic depicting the experimental plan for
the in vivo
translation experiment. In short, female Balb/C mice were injected with 411
tumor
orthotopically and the tumor was allowed to grow to 500 mm3, after which mice
were
injected with 30 billion MDA-MB-231 exosomes electroporated with a pCMV-
mCherry
plasmid. The mice were euthanized 12 h after exosomes injection and serum was
collected
for exosomes extraction. FIG. 7B - Graphic showing the tumor growth of mice
injected with
411 tumors and electroporated exosomes, or 411 tumors alone, showing
comparable growth
kinetics. FIG. 7C - Nanosight NTA analysis of exosomes extracted from the
serum of healthy
mice injected with electroporated exosomes, as well as 411 tumor-bearing mice
injected with
electroporated exosomes and 411 tumor bearing mice with no exosomes injection.
All
exosomes show similar size peaks, around 100 nm. FIG. 7D - Nanosight NTA
quantification
of serum exosomes shown in FIG. 7C, showing no significant differences in the
exosomes
amount obtained from the serum of different animals, but a trend towards more
exosomes in
411 tumor-bearing mice injected with MDA-MB-231 electroporated exosomes.
11
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
100341 FIGS. 8A-G. Exosomes characterization. FIG. 8A ¨ Nanoparticle tracking
analysis of exosomes collected from MDA-MB-231 cells, obtained using the
Nanosight NTA
2.1 Analytical Software. Left graph represents the size distribution of
particles in solution
showing a mean size of 104 nm and also showing no peaks at larger sizes. Right
graph
represents the distribution by size and concentration of particles in
solution. FIG. 8B ¨
Atomic Force Microscopy image of exosomes (left image). Right graph represents
the
distribution of particles in the area analyzed. FIG. 8C ¨ Transmission
electron micrograph of
MDA-MB-231 exosomes. Scale bar ¨ 100 nm. FIG. 8D ¨ Transmission electron
micrograph
of immunogold labeled MDA-MB-231 exosomes using anti-CD9 antibody. Gold
particles are
depicted as black dots. Scale bar ¨ 100 nm. FIG. 8E ¨ Immunoblot analysis of
exosomes
markers CD9, CD63, and TSG101 in protein extracts of exosomes obtained from
different
cell lines. FIG. 8F ¨ Imaging Flow Cytometry analysis of exosomes from MDA-MB-
231
cells coupled to 0.4 gm beads, using antibodies for markers CD9, CD81, CD82,
and CD63.
FIG. 8G ¨ Representative images of LB culture plates incubated with E. coli
and either
MDA-MB-231 (top) or MCF10A (bottom) exosomes, showing colony formation on the
E.
coli inoculated sides (left) and not on the exosomes inoculated sides (right).
100351 FIGS. 9A-B. EGFR phosphorylation and downstream biological activity in
exosomes from MDA-MB-231 cells. FIG. 9A ¨ Immunoblot of protein extracts
obtained
from MDA-MB-231 cells and probed for p-EGFR and GRB2. 13-actin is used as a
loading
control. FIG. 9B ¨ Immunoblot of immunocomplexes obtained with an anti-EGFR
antibody
pull down of protein lysates from MDA-MB-231 exosomes with or without
incubation with
500 ng/ml at 37 C for 15 minutes. Immuncomplexes were probed for GRB2. Non-
specific
isotype control IgG was used as a negative control for the GRB2 pulldown.
Equal volumes of
the stimulated and unstimulated extracts were probed for -actin as input
control.
100361 FIG. 10. Proteomics analysis of exosomes derived from various cells.
Heatmap representing the binary identification of all individual proteins
included in the
Protein Translation pathway in the Reactome (Croft et al., 2014) database, in
mass
spectrometry data obtained from mouse liver cells (Valadi et al., 2007), mouse
fibroblasts
(Luga et al., 2012), human colorectal cancer cells (Choi et al., 2012), human
plasma (Kalra et
al., 2013), human thymic tissue (Skogberg et al., 2013), and human urine
(Gonzales et al.,
2009). Black represents the presence and white represents the absence of each
protein in each
dataset. The summary column represents how ubiquitous each protein is in all
analyzed
12
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
datasets, with warmer colors representing a more widespread distribution among
different
types of exosomes.
100371 FIGS. 11A-B. Proteomics analysis of exosomes from various origins. FIG.
11A ¨ Heatmap representing the number of proteins identified in mass
spectrometry data
obtained from mouse liver cells (Valadi et al., 2007), mouse fibroblasts (Luga
et al., 2012),
human colorectal cancer cells (Choi et al., 2012), human plasma (Kalra et al.,
2013), human
thymic tissue (Skogberg et al., 2013), and human urine (Gonzales et al., 2009)
that associate
with different pathways related to protein translation in the Reactome (Croft
et al., 2014)
database. Warmer colors represent higher numbers of proteins identified per
pathway. FIG.
11B ¨ Heatmap representing the protein score of proteins associated with
protein translation
identified in mass spectrometry obtained from exosomes isolated from HDF, NIH
3T3,
MDA-MB231, MCF10A, and E10 cells. Warmer colors represent a higher protein
score.
100381 FIGS. 12A-C. Exosomes contain nucleic acids and proteins associated
with
the protein translation machinery. FIG. 12A ¨ RNA extracted from exosomes of
NTH-3T3,
E10, 67NR, 4T1, HDF, MCF10A, MCF7, and MDA-MB-231 cell lines were used to
quantify
18S and 28S rRNAs by qPCR. Expression levels of the rRNAs were normalized to
U6
snRNA expression. The bars in each group represent, from left to right, N1H
313, E10,
67NR, 4T1, HDF, MCF10A, MCF7, and IvIDA-MB-231. FIG. 12B ¨ RNA extracted from
4T1 exosomes and cells were used to identify the presence of tRNAMet, tRNAGly,
tRNALeu, tRNASer, and tRNAVal by digital qPCR. The bars in each group
represent, from
left to right, Leu, Met, Val, Ser, and Gly. FIG. 12C ¨ Immunoprecipitation of
eIF4A1
showing presence of elF3A MCF10A and MDA-MB-231-derived exosomes. MB231 and
MCF10A cell lysates were used as positive controls. The exosomes marker CD82
was used
as a loading control.
100391 FIGS. 13A-E. DNA transcription and mRNA translation in exosomes derived
from MCF10A and MDA-MB-231 cells. FIG. 13A ¨ Immunoblot of GFP protein
expression
in exosomes isolated from MCF10A cells, electroporated with a pCMV-GFP plasmid
and
incubated at 37 C for different periods of time. Exosomes only and mock
electroporated
exosomes were used as negative controls. CD63 was used as a loading control
and to confirm
the presence of exosomes. FIG. 13B ¨ Plot depicting the amount of green
exosomes detected
by NanoSight in MCF10A-derived exosomes electroporated with a GFP plasmid.
MCFIOA-
derived exosomes, MCF 10A-derived mock electroporated exosomes as well as
exosomes
13
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
electroporated with a-amanitin and cycloheximide were used as negative
controls. FIG. 13C
¨ Flow cytometry analysis of beads attached to exosomes after electroporation
with a GFP
plasmid using increasing voltages, showing the percentages of beads with green
fluorescent
signal. FIG. 13D ¨ Immunoblot of ovalbumin protein levels in MDA-MB-231
exosomes
electroporated with a pCMV-Ova plasmid and incubated at 37 C for 48 h. 0-actin
was used
as a loading control. FIG. 13E ¨ p21 mRNA expression in MDA-MB-231 cells
treated with
mock electroporated MDA-MB-231-derived exosomes or exosomes electroporated
with the
p53-GFP plasmid and either added to the cells immediately (0 h) or allowed to
incubate in
cell conditions at 37 C for 48 h before treatment (48 h). Exosomes were added
to the cells for
either 30 minutes or 48 hours before RNA extraction. Expression levels were
normalized to
the housekeeping gene GAPDH.
DETAILED DESCRIPTION
[0040] Extracellular vesicles (EVs), including exosomes, are nano-sized
intercellular
communication vehicles having a lipid bilayer that encloses cytosol-like
material. Exosomes
participate in several physiological processes and contain DNA, RNA, and
proteins. It is
generally assumed that all contents in exosomes are derived from cells and
they remain as
such in the exosomes until they enter other cells and deposit their contents.
Exosomes are
released by all cells in large numbers and are considered as garbage bags that
carry cellular
constituents into the extracellular space as a payload without any biological
significance for
exosomes themselves per se.
[0041] Provided here are exosomes that behave like minicells and exhibit the
ability
to biologically respond to stimuli and multiply and migrate just as cells do
but without a
defined nucleus. These exosomes exhibit chemotaxis towards serum factors and
upon
stimulation with growth factors such as EGF, will phosphorylate the EGFR
receptor on their
surface and initiate a signaling cascade that leads to transcription and
translation of new
proteins. When these exosomes are injected into tumor bearing mice, they
preferentially
accumulate in the tumors. Collectively, the capacity for protein translation
and growth factor
response by these exosomes provides them a functional role in tissue
homeostasis and
modulation of disease.
14
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
I. Aspects of the Present invention
100421 Extracellular vesicles, and in particular exosomes, have gained much
attention
over the last few years with identification of several constituents such as
DNA, RNA, and
proteins. Moreover, exosomes have been implicated in influencing many diverse
biological
processes via transfer of its content into recipient cells in different
tissues, and facilitating a
unique form of cell-cell communication (Bastos et al., 2017). Alternatively,
the potential of
exosomes as delivery vehicles for therapeutics, particularly in the context of
cancer or
neurological pathologies was also reported (El-Andaloussi et al., 2012;
Kamerkar et al.,
2017). However, the exact patterns of systemic distribution and organ tropism
of exosomes
are still not fully understood.
100431 However, the nuclear and cytoplasmic components of the exosomes are not
just used for passive transfer to recipient cells but can respond to external
stimuli to
phosphorylate growth factor receptors, such as EGFR, and generate new proteins
via active
transcription and translation. External stimulation of exosomes can initiate
de novo biological
activities such as retrograde migration. It is conceivable that exosomes may
function like
mini cells, albeit primitive with respect to their fine-tuned operations in
response to external
stimuli. In fact, recently it has been suggested that exosomes could
potentially constitute
extant representations of protocellular ribosomes, for which they would need
to contain
rRNAs, which is confirm in this study (Sinkovics, 2015). Exosomes are
biologically
responsive and migrate towards growth factor gradients in an active manner.
Actin
remodeling might be involved. The patterns of actin polymerization could
therefore constitute
an interesting target in the modulation of exosomes biodistribution.
100441 Vesicles such as prostasomes obtained from different species have been
shown
to contain different components of the glycolytic pathway, which allow them to
produce ATP
in cell-free conditions (Ronquist et al., 2013a; Ronquist et al., 2013b).
While direct
transcription in exosomes has not been previously reported, a study showed
that exosomes
from bovine milk infected with bovine leukemia virus have been shown to
exhibit reverse
transaiptase activity (Yamada et al., 2013). It was also recently demonstrated
that
independent production of mature miRNAs in exosomes isolated from cancer cells
is possible
(Melo et al., 2014). Here, exosomes were demonstrated to possess an intrinsic
capacity for de
novo synthesis of functional proteins via DNA transcription coupled with mRNA
translation.
Platelets can translate proteins from mRNA molecules remaining within them
after
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
megakaryocyte differentiation (Weyrich et al., 2004). Nevertheless, DNA
transcription
resulting in new mRNA molecules is not reported in platelets. Additionally,
foci of mRNA
translation activity, associated with polyribosomes and mRNA binding proteins,
is observed
in dendritic spines even when severed from the major body of the cell (Aakalu
et al., 2001;
Smith et al., 2001; Steward and Levy, 1982). It is therefore clear that some
cellular structures
have preserved the capacity for protein biosynthesis in the absence of a
nucleus, perhaps in
order to support their specific biological functions in a rapid manner. Apart
from protein
translation, exosomes are capable of DNA transcription via RNA polymerase II.
It is well
established that basic transcription of naked DNA in nucleosome-free regions
is possible with
minimal components of transcriptional machinery, namely only RNA Pol II and a
cocktail of
six general transcription factors (GTFs) (Lorch et al., 2014; Nagai et al.,
2017). It has also
been shown that exosomes contain a plethora of transcription factors that can
be delivered to
cells in order to alter their patterns of protein expression (Ung et al.,
2014). It is therefore
conceivable that exosomes contain naked DNA residues unbound by chromatin,
which could
undergo transcription in the presence of these minimal transcriptional
components.
100451 This study also suggests that the required components for
transcription/translation are likely exhausted within 24 h, resulting in a
limited rate of
transcription and translation. Since it has been suggested that different
subpopulations of
exosomes may possess distinct molecular characteristics (Willms et al., 2016),
it is possible
that only a small subset of exosomes possess the capacity for de novo protein
synthesis. The
newly synthetized proteins in exosomes are functionally active, suggestive of
an appropriate
protein conformation. It has been shown that exosomes contain not only the
components of
ribosomes, but also several molecular chaperones, such as Hsp60 and Hsp70. The
ribosome
itself has an important role in co-translational protein folding, for
instance, it can promote the
formation of secondary structures in newly formed proteins. The ribosome also
acts as a
platform for the association of chaperones that can assist with the
appropriate folding of
nascent proteins (Kramer et al., 2009). It is conceivable that these exosomes
components
could contribute to the stabilization of newly formed proteins. Physical
confinement, as
would be the case in the lumen of exosomes, can also have a stabilizing effect
on the folding
of proteins (Rao and Cruz, 2013). The possibility, however, cannot be ruled
out that many
proteins might exhibit inappropriate conformation or mis-folding. These could
still have
important biological implications, as demonstrated with the recent unraveling
of unexpected
features of the "dark proteome" (Perdigao et al., 2015), which suggested that
proteins with
16
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
unknown structure or intrinsically disordered regions may have important
physiological
functions.
100461 A meticulous and quantitative identification of the proteins naturally
synthetized in exosomes is necessary to fully appreciate the biological
significance of this
process. It is clear, however, that this could have significant impact in re-
evaluating the
understanding of eukaryotic biology. Recent studies suggest that cells can
selectively
incorporate mRNAs into exosomes (Raposo and Stoorvogel, 2013). This raises the
possibility
that mRNAs selectively packaged into exosomes could be translated into
proteins whose
expression is repressed in their cell of origin, as shown in this study as a
proof of concept.
The identification of newly synthetized proteins in exosomes up to one month
after
translation, suggests that exosomes-mediated production of proteins could lead
to a
significantly increased protein half-life, possibly due to lower levels of
protein degradation
enzymes.
100471 Taken together, these results collectively demonstrate exosomes possess
previously unappreciated biological activity with a potentially profound
impact on body
homeostasis and tissue pathogenesis. One could speculate that growth factor
gradients could
play a role on the systemic tropism of exosomes in the body. A disruption of
the naturally
occurring pattern of growth factor production could have immediate
consequences on both
the redistribution and delivery patterns of exosomes. These patterns of
response could have
potential implications in determining cell-cell communication, particularly
between distant
body sites. The fact that they can change their patterns of protein expression
in response to
these extracellular cues would suggest that exosomes could act as the primary
responders in
tissue injury. In conclusion, these findings provide a novel insight into the
basic biology of
exosomes and inform on their biological functions in organism homeostasis and
their
potential impact in disease states.
I. Lipid-based Nanoparticles
100481 In some embodiments, a lipid-based nanoparticle is a liposomes, an
exosomes,
lipid preparations, or another lipid-based nanoparticle, such as a lipid-based
vesicle (e.g., a
DOTAP:cholesterol vesicle). Lipid-based nanoparticles may be positively
charged,
negatively charged or neutral. Lipid-based nanoparticles may comprise the
necessary
17
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
components to allow for transcription and translation, signal transduction,
chemotaxis, or
other cellular functions.
A. Liposomes
100491 A "liposome" is a generic term encompassing a variety of single and
multilamellar lipid vehicles formed by the generation of enclosed lipid
bilayers or aggregates.
Liposomes may be characterized as having vesicular structures with a bilayer
membrane,
generally comprising a phospholipid, and an inner medium that generally
comprises an
aqueous composition. Liposomes provided herein include unilamellar
liposomes,
multilamellar liposomes, and multivesicular liposomes. Liposomes provided
herein may be
positively charged, negatively charged, or neutrally charged. In certain
embodiments, the
liposomes are neutral in charge.
100501 A multilamellar liposome has multiple lipid layers separated by aqueous
medium. Such liposomes form spontaneously when lipids comprising phospholipids
are
suspended in an excess of aqueous solution. The lipid components undergo self-
rearrangement before the formation of closed structures and entrap water and
dissolved
solutes between the lipid bilayers. Lipophilic molecules or molecules with
lipophilic regions
may also dissolve in or associate with the lipid bilayer.
100511 In specific aspects, a polypeptide, a nucleic acid, or a small molecule
drug
may be, for example, encapsulated in the aqueous interior of a liposome,
interspersed within
the lipid bilayer of a liposome, attached to a liposome via a linking molecule
that is
associated with both the liposome and the polypeptide/nucleic acid, entrapped
in a liposome,
complexed with a liposome, or the like.
100521 A liposome used according to the present embodiments can be made by
different methods, as would be known to one of ordinary skill in the art. For
example, a
phospholipid, such as for example the neutral phospholipid
dioleoylphosphatidylcholine
(DOPC), is dissolved in tert-butanol. The lipid(s) is then mixed with a
polypeptide, nucleic
acid, and/or other component(s). Tween 20 is added to the lipid mixture such
that Tween 20
is about 5% of the composition's weight. Excess tert-butanol is added to this
mixture such
that the volume of tert-butanol is at least 95%. The mixture is vortexed,
frozen in a dry
ice/acetone bath and lyophilized overnight. The lyophilized preparation is
stored at -20 C
18
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
and can be used up to three months. When required the lyophilized liposomes
are
reconstituted in 0.9% saline.
100531 Alternatively, a liposome can be prepared by mixing lipids in a solvent
in a
container, e.g., a glass, pear-shaped flask. The container should have a
volume ten-times
greater than the volume of the expected suspension of liposomes. Using a
rotary evaporator,
the solvent is removed at approximately 40 C under negative pressure. The
solvent normally
is removed within about 5 min to 2 h, depending on the desired volume of the
liposomes.
The composition can be dried further in a desiccator under vacuum. The dried
lipids
generally are discarded after about 1 week because of a tendency to
deteriorate with time.
100541 Dried lipids can be hydrated at approximately 25-50 niM phospholipid in
sterile, pyrogen-free water by shaking until all the lipid film is
resuspended. The aqueous
liposomes can be then separated into aliquots, each placed in a vial,
lyophilized and sealed
under vacuum.
100551 The dried lipids or lyophilized liposomes prepared as described above
may be
dehydrated and reconstituted in a solution of a protein or peptide and diluted
to an
appropriate concentration with a suitable solvent, e.g., DPBS. The mixture is
then vigorously
shaken in a vortex mixer. Unencapsulated additional materials, such as agents
including but
not limited to hormones, drugs, nucleic acid constructs and the like, are
removed by
centrifugation at 29,000 x g and the liposomal pellets washed. The washed
liposomes are
resuspended at an appropriate total phospholipid concentration, e.g., about 50-
200 tnM. The
amount of additional material or active agent encapsulated can be determined
in accordance
with standard methods. After determination of the amount of additional
material or active
agent encapsulated in the liposome preparation, the liposomes may be diluted
to appropriate
concentrations and stored at 4 C until use. A pharmaceutical composition
comprising the
liposomes will usually include a sterile, pharmaceutically acceptable carrier
or diluent, such
as water or saline solution.
100561 Additional liposomes which may be useful with the present embodiments
include cationic liposomes, for example, as described in W002/100435A1, U.S
Patent
5,962,016, U.S. Application 2004/0208921, W003/015757A1, W004029213A2, U.S.
Patent
5,030,453, and U.S. Patent 6,680,068, all of which are hereby incorporated by
reference in
their entirety without disclaimer.
19
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
100571 In preparing such liposomes, any protocol described herein, or as would
be
known to one of ordinary skill in the art may be used. Additional non-limiting
examples of
preparing liposomes are described in U.S. Patents 4,728,578, 4,728,575,
4,737,323,
4,533,254, 4,162,282, 4,310,505, and 4,921,706; International Applications
PCT/US85/01161 and PCT/U589/05040, each incorporated herein by reference.
100581 In certain embodiments, the lipid based nanoparticle is a neutral
liposorne
(e.g., a DOPC liposome). "Neutral liposomes" or "non-charged liposomes", as
used herein,
are defined as liposomes having one or more lipid components that yield an
essentially-
neutral, net charge (substantially non-charged). By "essentially neutral" or
"essentially non-
charged", it is meant that few, if any, lipid components within a given
population (e.g., a
population of liposomes) include a charge that is not canceled by an opposite
charge of
another component (i.e., fewer than 10% of components include a non-canceled
charge, more
preferably fewer than 5%, and most preferably fewer than 1%). In certain
embodiments,
neutral liposomes may include mostly lipids and/or phospholipids that are
themselves neutral
under physiological conditions (i.e., at about pH 7).
100591 Liposomes and/or lipid-based nanoparticles of the present embodiments
may
comprise a phospholipid. In certain embodiments, a single kind of phospholipid
may be used
in the creation of liposomes (e.g., a neutral phospholipid, such as DOPC, may
be used to
generate neutral liposomes). In other embodiments, more than one kind of
phospholipid may
be used to create liposomes. Phospholipids may be from natural or synthetic
sources.
Phospholipids include, for example, phosphatidylcholines,
phosphatidylglycerols, and
phosphatidylethanolamines; because phosphatidylethanolamines and phosphatidyl
cholines
are non-charged under physiological conditions (i.e., at about pH 7), these
compounds may
be particularly useful for generating neutral liposomes. In certain
embodiments, the
phospholipid DOPC is used to produce non-charged liposomes. In certain
embodiments, a
lipid that is not a phospholipid (e.g., a cholesterol) may be used
100601 Phospholipids include glycerophospholipids and certain sphingolipids.
Phospholipids include, but are not limited to, dioleoylphosphatidylycholine
("DOPC"), egg
phosphatidylcholine ("EPC"), di lauryloylphosphati dyl choline
("DLPC"),
dimyristoylphosphatidylcholine ("DMPC"), dipalmitoylphosphafidylcholine
("DPPC"),
di stearoylphosphatidylcholi ne (" DSPC"), 1-my ri stoy1-2-palmitoyl
phosphatidyl choline
("MPPC"), 1-palmitoy1-2-myristoyl phosphatidylcholine ("PMPC"), 1-palmitoy1-2-
stearoyl
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
ph osphati dylch ol i ne ("PSPC"), 1-stearoy1-2-pal mitoyl phosphatidylcholine
("SPPC"),
dilauryloylphosphatidylglycerol ("DLPG"), dimyristoylphosphatidylglycerol
("DMPG"),
di pal mi toylphosph atidylgl ycerol ("DPPG"), di stearoylphosphati dyl gl y
cerol ("DSPG"),
di stearoyl sphingomyelin ("DSSP"), di stearoyl phophati dylethanol ami ne
("DSPE"),
dioleoylphosphatidylglycerol ("DOPG"), dimyristoyl phosphatidic acid ("DMPA"),
dipalmitoyl phosphatidic acid ("DPPA"), dimyristoyl phosphatidylethanolamine
("DMPE"),
dipalmitoyl phosphatidylethanolamine ("DPPE"), dimyristoyl phosphatidylserine
("DMPS"),
dipalmitoyl phosphatidylserine ("DPPS"), brain phosphatidylserine ("BPS"),
brain
sphingomyelin ("BSP"), dipalmitoyl sphingomyelin ("DPSP"), dimyristyl
ph osphati dylch ol i ne (" DMPC"), 1,2-di stearoyl-sn-glycero-3-phosphocholi
ne ("DAPC"), 1,2-
diarachidoyl-sn-glycero-3-phosphocholine ("DBPC"),
1,2-dieicosenoyl-sn-glycero-3-
phosphochol me ("DEPC"), di ol eoyl ph osphati dylethanol am i ne ("DOPE"),
pal mitoyloeoyl
phosphatidylcholine ("POPC"), palmitoyloeoyl phosphatidylethanolamine
("POPE"),
lysophosphatidylcholine, lysophosphatidylethanolamine, and
dilinoleoylphosphatidylcholine.
B. Exosomes
100611 The terms "microvesicle" and "exosomes," as used herein, refer to a
membranous particle having a diameter (or largest dimension where the
particles is not
spheroid) of between about 10 nm to about 5000 nm, more typically between 30
nm and 1000
nm, and most typically between about 50 nm and 750 nm, wherein at least part
of the
membrane of the exosomes is directly obtained from a cell. Most commonly,
exosomes will
have a size (average diameter) that is up to 5% of the size of the donor cell.
Therefore,
especially contemplated exosomes include those that are shed from a cell.
100621 Exosomes may be detected in or isolated from any suitable sample type,
such
as, for example, body fluids. As used herein, the term "isolated" refers to
separation out of its
natural environment and is meant to include at least partial purification and
may include
substantial purification. As used herein, the term "sample" refers to any
sample suitable for
the methods provided by the present invention. The sample may be any sample
that includes
exosomes suitable for detection or isolation. Sources of samples include
blood, bone marrow,
pleural fluid, peritoneal fluid, cerebrospinal fluid, urine, saliva, amniotic
fluid, malignant
ascites, broncho-alveolar lavage fluid, synovial fluid, breast milk, sweat,
tears, joint fluid, and
bronchial washes. In one aspect, the sample is a blood sample, including, for
example, whole
blood or any fraction or component thereof. A blood sample suitable for use
with the present
21
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
invention may be extracted from any source known that includes blood cells or
components
thereof, such as venous, arterial, peripheral, tissue, cord, and the like. For
example, a sample
may be obtained and processed using well-known and routine clinical methods
(e.g.,
procedures for drawing and processing whole blood). In one aspect, an
exemplary sample
may be peripheral blood drawn from a subject with cancer.
100631 Exosomes may also be isolated from tissue samples, such as surgical
samples,
biopsy samples, tissues, feces, and cultured cells. When isolating exosomes
from tissue
sources it may be necessary to homogenize the tissue in order to obtain a
single cell
suspension followed by lysis of the cells to release the exosomes. When
isolating exosomes
from tissue samples it is important to select homogenization and lysis
procedures that do not
result in disruption of the exosomes. Exosomes contemplated herein are
preferably isolated
from body fluid in a physiologically acceptable solution, for example,
buffered saline, growth
medium, various aqueous medium, etc
100641 Exosomes may be isolated from freshly collected samples or from samples
that have been stored frozen or refrigerated. In some embodiments, exosomes
may be
isolated from cell culture medium. Although not necessary, higher purity
exosomes may be
obtained if fluid samples are clarified before precipitation with a volume-
excluding polymer,
to remove any debris from the sample. Methods of clarification include
centrifugation,
ultracentrifugation, filtration, or ultrafiltration. Most typically, exosomes
can be isolated by
numerous methods well-known in the art. One preferred method is differential
centrifugation
from body fluids or cell culture supernatants. Exemplary methods for isolation
of exosomes
are described in (Losche et al., 2004; Mesri and Alfieri, 1998; Morel et al.,
2004).
Alternatively, exosomes may also be isolated via flow cytometry as described
in (Combes et
al., 1997).
100651 One accepted protocol for isolation of exosomes includes
ultracentrifugation,
often in combination with sucrose density gradients or sucrose cushions to
float the relatively
low-density exosomes. Isolation of exosomes by sequential differential
centrifugations is
complicated by the possibility of overlapping size distributions with other
microvesicles or
macromolecular complexes. Furthermore, centrifugation may provide insufficient
means to
separate vesicles based on their sizes. However, sequential centrifugations,
when combined
with sucrose gradient ultracentrifugation, can provide high enrichment of
exosomes.
22
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
100661 Isolation of exosomes based on size, using alternatives to the
ultracentrifugation routes, is another option. Successful purification of
exosomes using
ultrafiltration procedures that are less time consuming than
ultracentrifugation, and do not
require use of special equipment have been reported. Similarly, a commercial
kit is available
(EXOMIRTm, Bioo Scientific) which allows removal of cells, platelets, and
cellular debris on
one microfilter and capturing of vesicles bigger than 30 nm on a second
microfilter using
positive pressure to drive the fluid. However, for this process, the exosomes
are not
recovered, their RNA content is directly extracted from the material caught on
the second
microfilter, which can then be used for PCR analysis. HPLC-based protocols
could
potentially allow one to obtain highly pure exosomes, though these processes
require
dedicated equipment and are difficult to scale up. A significant problem is
that both blood
and cell culture media contain large numbers of nanoparticles (some non-
vesicular) in the
same size range as exosomes. For example, some miRNAs may be contained within
extracellular protein complexes rather than exosomes; however, treatment with
protease (e.g.,
proteinase K) can be performed to eliminate any possible contamination with
"extraexosomal" protein.
100671 In another embodiment, cancer cell-derived exosomes may be captured by
techniques commonly used to enrich a sample for exosomes, such as those
involving
immunospecific interactions (e.g., immunomagnetic capture). Immunomagnetic
capture, also
known as immunomagnetic cell separation, typically involves attaching
antibodies directed to
proteins found on a particular cell type to small paramagnetic beads. When the
antibody-
coated beads are mixed with a sample, such as blood, they attach to and
surround the
particular cell. The sample is then placed in a strong magnetic field, causing
the beads to
pellet to one side. After removing the blood, captured cells are retained with
the beads. Many
variations of this general method are well-known in the art and suitable for
use to isolate
exosomes. In one example, the exosomes may be attached to magnetic beads
(e.g.,
aldehyde/sulphate beads) and then an antibody is added to the mixture to
recognize an
epitope on the surface of the exosomes that are attached to the beads.
Exemplary proteins
that are known to be found on cancer cell-derived exosomes include ATP-binding
cassette
sub-family A member 6 (ABCA6), tetraspanin-4 (TSPAN4), SLIT and NTRK-like
protein 4
(SLITRK4), putative protocadherin beta-18 (PCDHB18), myeloid cell surface
antigen CD33
(CD33), and glypican-1 (GPC1). Cancer cell-derived exosomes may be isolated
using, for
example, antibodies or aptamers to one or more of these proteins.
23
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
100681 As used herein, analysis includes any method that allows direct or
indirect
visualization of exosomes and may be in vivo or ex vivo. For example, analysis
may include,
but not limited to, ex vivo microscopic or cytometric detection and
visualization of exosomes
bound to a solid substrate, flow cytometry, fluorescent imaging, and the like.
In an exemplary
aspect, cancer cell-derived exosomes are detected using antibodies directed to
one or more of
ATP-binding cassette sub-family A member 6 (ABCA6), tetraspanin-4 (TSPAN4),
SLIT and
NTRK-like protein 4 (SLITRK4), putative protocadherin beta-18 (PCDHB18),
myeloid cell
surface antigen CD33 (CD33), glypican-1 (GPC1), Histone H2A type 2-A
(HIST1H2AA),
Histone H2A type 1-A (HI ST1H1AA), Histone H3.3 (H3F3A), Histone H3.1
(HI5T1H3A),
Zinc finger protein 37 homolog (ZFP37), Laminin subunit beta-1 (LAMB1),
Tubulointerstitial nephritis antigen-like (TINAGL1), Peroxiredeoxin-4 (PRDX4),
Collagen
alpha-2(IV) chain (COL4A2), Putative protein C3P1 (C3P1), Hemicentin-1
(HMCN1),
Putative rhophilin-2-like protein (RHPN2P1), Ankyrin repeat domain-containing
protein 62
(ANKRD62), Tripartite motif-containing protein 42 (TRIM42), Junction
plakoglobin (JUP),
Tubulin beta-2B chain (TUBB2B), Endoribonuclease Dicer (DICER1), E3 ubiquitin-
protein
ligase TRIM71 (TRI1v171), Katanin p60 ATPase-containing subunit A-like 2
(KATNAL2),
Protein S100-A6 (S100A6), 5'-nucleotidase domain-containing protein 3
(NT5DC3), Valine-
tRNA ligase (VARS), Kazrin (KAZN), ELAV-like protein 4 (ELAVL4), RING finger
protein 166 (RNF166), FERM and PDZ domain-containing protein 1 (FRMPD1), 78
kDa
glucose-regulated protein (HSPA5), Trafficking protein particle complex
subunit 6A
(TRAPPC6A), Squalene monooxygenase (SQLE), Tumor susceptibility gene 101
protein
(TSG101), Vacuolar protein sorting 28 homolog (VPS28), Prostaglandin F2
receptor negative
regulator (PTGFRN), Isobutyryl-CoA dehydrogenase, mitochondrial (ACAD8), 26S
protease
regulatory subunit 6B (PS/vIC4), Elongation factor 1-gamma (EEF1G), Titin
(TTN),
Tyrosine-protein phosphatase type 13 (PTPN13), Triosephosphate isomerase
(TPI1), or
Carboxypeptidase E (CPE) and subsequently bound to a solid substrate and/or
visualized
using microscopic or cytometric detection.
100691 It should be noted that not all proteins expressing in a cell are found
in
exosomes secreted by that cell (see FIG. 11). For example, calnexin, GM130,
and LAMP-2
are all proteins expressed in MCF-7 cells but not found in exosomes secreted
by MCF-7 cells
(Baietti et al., 2012). As another example, one study found that 190/190
pancreatic ductal
adenocarcinoma patients had higher levels of GPC1+ exosomes than healthy
controls (Melo
24
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
et al., 2015, which is incorporated herein by reference in its entirety).
Notably, only 2.3% of
healthy controls, on average, had GPC1+ exosomes.
1. Exemplary Protocol for Collecting Exosomes from Cell Culture
100701 On Day 1, seed enough cells (e.g., about five million cells) in T225
flasks in
media containing 10% FBS so that the next day the cells will be about 70%
confluent. On
Day 2, aspirate the media on the cells, wash the cells twice with PBS, and
then add 25-30 mL
base media (i.e., no PenStrep or FBS) to the cells. Incubate the cells for 24-
48 hours. A 48
hour incubation is preferred, but some cells lines are more sensitive to serum-
free media and
so the incubation time should be reduced to 24 hours. Note that FBS contains
exosomes that
will heavily skew NanoSight results.
100711 On Day 3/4, collect the media and centrifuge at room temperature for
five
minutes at 800 x g to pellet dead cells and large debris. Transfer the
supernatant to new
conical tubes and centrifuge the media again for 10 minutes at 2000 x g to
remove other large
debris and large vesicles. Pass the media through a 0.2 gm filter and then
aliquot into
ultracentrifuge tubes (e.g., 25 x 89 mm Beckman Ultra-Clear) using 35 mL per
tube. If the
volume of media per tube is less than 35 mL, fill the remainder of the tube
with PBS to reach
35 mL. Ultracentrifuge the media for 2-4 hours at 28,000 rpm at 4 C using a SW
32 Ti rotor
(k-factor 266.7, RCF max 133,907). Carefully aspirate the supernatant until
there is roughly
1-inch of liquid remaining. Tilt the tube and allow remaining media to slowly
enter aspirator
pipette. If desired, the exosomes pellet can be resuspended in PBS and the
ultracentrifugation
at 28,000 rpm repeated for 1-2 hours to further purify the population of
exosomes.
100721 Finally, resuspend the exosomes pellet in 210 ML PBS. If there are
multiple
ultracentrifuge tubes for each sample, use the same 210 ML PBS to serially
resuspend each
exosomes pellet. For each sample, take 10 pi and add to 990 pi, H20 to use for
nanoparticle
tracking analysis. Use the remaining 200 gL exosomes-containing suspension for
downstream processes or immediately store at -80 C.
2. Exemplary Protocol for Extracting Exosomes from Serum
Samples
100731 First, allow serum samples to thaw on ice. Then, dilute 250 ML of cell-
free
serum samples in 11 mL PBS; filter through a 0.2 gm pore filter.
Ultracentrifuge the diluted
sample at 150,000 x g overnight at 4 C. The following day, carefully discard
the supernatant
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
and wash the exosomes pellet in 11 mL PBS. Perform a second round of
ultracentrifugation
at 150,000 x g at 4 C for 2 hours. Finally, carefully discard the supernatant
and resuspend the
exosomes pellet in 100 !IL PBS for analysis
C. Exemplary Protocol for Electroporation of Exosomes and
Liposomes
100741 Mix 1 x 108 exosomes (measured by NanoSight analysis) or 100 nm
liposomes (e.g., purchased from Encapsula Nano Sciences) and 1 1.1g of siRNA
(Qiagen) or
shRNA in 400 jiL of electroporation buffer (1.15 mM potassium phosphate, pH
7.2, 25 mM
potassium chloride, 21% Optiprep). Electroporate the exosomes or liposomes
using a 4 mm
cuvette (see, e.g., Alvarez-Erviti et a, 2011; El-Andaloussi et al., 2012).
After
electroporation, treat the exosomes or liposomes with protease-free RNAse
followed by
addition of 10x concentrated RNase inhibitor. Finally, wash the exosomes or
liposomes with
PBS under ultracentrifugation methods, as described above.
H. Diagnosis, Prognosis, and Treatment of Diseases
190751 Certain aspects of the present invention provide for treating a patient
with
exosomes that express or comprise a therapeutic agent or a diagnostic agent. A
"therapeutic
agent" as used herein is an atom, molecule, or compound that is useful in the
treatment of
cancer or other conditions. Examples of therapeutic agents include, but are
not limited to,
drugs, chemotherapeutic agents, therapeutic antibodies and antibody fragments,
toxins,
radioisotopes, enzymes, nucleases, hormones,
immunomodulators, anti sense
oligonucleotides, chelators, boron compounds, photoactive agents, and dyes. A
"diagnostic
agent" as used herein is an atom, molecule, or compound that is useful in
diagnosing,
detecting or visualizing a disease. According to the embodiments described
herein, diagnostic
agents may include, but are not limited to, radioactive substances (e.g.,
radioisotopes,
radionuclides, radiolabels or radiotracers), dyes, contrast agents,
fluorescent compounds or
molecules, bioluminescent compounds or molecules, enzymes and enhancing agents
(e.g.,
paramagnetic ions).
100761 In some aspects, a therapeutic recombinant protein may be a protein
having an
activity that has been lost in a cell of the patient, a protein having a
desired enzymatic
activity, a protein having a desired inhibitory activity, etc. For example,
the protein may be a
transcription factor, an enzyme, a proteinaceous toxin, an antibody, a
monoclonal antibody,
etc. The monoclonal antibody may specifically or selectively bind to an
intracellular antigen.
26
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
The monoclonal antibody may inhibit the function of the intracellular antigen
and/or disrupt a
protein-protein interaction. Other aspects of the present invention provide
for diagnosing a
disease based on the presence of cancer cell-derived exosomes in a patient
sample.
100771 As exosomes are known to comprise the machinery necessary to complete
mRNA transcription and protein translation (see PCT/US2014/068630, which is
incorporated
herein by reference in its entirety), mRNA or DNA nucleic acids encoding a
therapeutic
protein may be transfected into exosomes. Alternatively, the therapeutic
protein itself may be
electroporated into the exosomes or incorporated directly into a liposome.
Exemplary
therapeutic proteins include, but are not limited to, a tumor suppressor
protein, peptides, a
wild type protein counterparts of a mutant protein, a DNA repair protein, a
proteolytic
enzyme, proteinaceous toxin, a protein that can inhibit the activity of an
intracellular protein,
a protein that can activate the activity of an intracellular protein, or any
protein whose loss of
function needs to be reconstituted. Specific examples of exemplary therapeutic
proteins
include 123F2, Abcb4, Abccl, Abcg2, Actb, Ada, Ahr, Akt, Aktl, Akt2, Akt3,
Amhr2,
Anxa7, Apc, Ar, Atm, Axin2, B2m, Bardl, Bc1211, Becnl, Bhlhal5, Binl, Blm,
Braf, Brcal,
Brca2, Brca3, Brat Brcata, Brinp3, Bripi, Bublb, Bwscrla, Cadm3, Cascl, Casp3,
Casp7,
Casp8, Cavl, Ccam, Ccndl, Ccr4, Ccsl, Cd28, Cdc25a, Cd95, Cdhl, Cdknla,
Cdknlb,
Cdkn2a, Cdkn2b, CdIcn2c, Cftr, Chekl, Chek2, Crcsl, Crcs10, Crcsl 1, Crcs2,
Crcs3, Crcs4,
Crcs5, Crcs6, Crcs7, Crcs8, Crcs9, Ctnnbl, Ctsl, Cyplal, Cyp2a6, Cyp2b2, Cyld,
Dcc,
Dkcl, Dicerl, Dmtfl, Dnmtl, Dpc4, E2f1, Eaf2, Eefl al, Egfr, Egfr4, Erbb2,
Erbb4, Ercc2,
Ercc6, Ercc8, Errfil, Esrl, Etv4, Faslg, Fbxol 0, Fcc, Fgfr3, Fntb, Foxml,
Foxnl, Fus1, Fzd6,
Fzd7, Fzrl, Gadd45a, Gast, Gnai2, Gpcl, Gpr124, Gpr87, Gprc5a, Gprc5d, Grb2,
Gstml,
Gstm5, Gstpl, Gstt1, H19, H2afx, Hck, Lims1, Hdac, Hexa, Hid, Hini, Hmmr,
Hnpcc8,
Hprt, Hras, Htatip2, 111b, 1110, 112, 116, 118rb Inha, Itgav, Jun, Jak3, Kit,
Klf4, Kras, Kras2,
Kras2b, Ligl, Lig4, Lkbl, Lmo7, Lncrl, Lncr2, Lncr3, Lncr4, Ltbp4, Lucal,
Luca2, Lyz2,
Lztsl, Madill, Mad211, Madr2/Jv18, Mapk14, Mcc, Mcm4, Menl, Men2, Met, Mgat5,
Mif,
Mlhl, Mlh3, Mmacl, Mmp8, Mnt, Mpo, Msh2, Msh3, Msh6, Msmb, Mthfr, Mtsl, Mutyh,
Myhll, Nat2, Nbn, Ncoa3, Neill, Nfl, Nf2, Nfe211, Nhej 1, Nkx2-1, Nkx2-9, Nkx3-
1, Npr12,
Nqol, Nras, Nudtl, Oggl, Oxgrl, p16, p19, p21, p27, p27mt, p57, p 1 4ARF,
Pa1b2, Park2,
Pggtlb, Pgr, Pi3k, Pik3ca, Piwil2, P16, Pla2g2a, Plg, Plk3, Pmsl, Pms2, Poldl,
Pole, Ppard,
Pparg, Ppfia2, Ppmld, Prdm2, Prdxl, Prkarl a, Ptch, Pten, Prom 1, Psca, Ptchl,
Ptfl a, Ptger2,
Ptpn13, Ptprj, Rara, Rad51, Rassfl, Rb, Rbl, Rblccl, Rb12, Recg14, Ret, Rgs5,
Rhoc, Rintl,
Robol, Rp138, Si 00a4, SCGB 1 Al, Skp2, Smad2, Smad3, Smad4, Smarcbl, Smo,
Snx25,
27
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
Spata13, Srpx, Ssic I, Sstr2, Sstr5, Stat3, St5, St7, St14, Stkl 1, Suds3,
Tapl, Tbx21, Terc,
Tnf, Tp53, Tp73, Trpm5, Tsc2, Tscl, Vhl, Wrn, Wtl, Wt2, Xrccl, Xrcc5, Xrcc6,
and Zacl.
100781 One specific type of protein that it may be desirable to introduce into
the
intracellular space of a diseased cell is an antibody (e.g., a monoclonal
antibody). Such an
antibody may disrupt the function of an intracellular protein and/or disrupt
an intracellular
protein-protein interaction. Exemplary targets of such monoclonal antibodies
include, but are
not limited to, proteins involved in the RNAi pathway, telomerase,
transcription factors that
control disease processes, kinases, phosphatases, proteins required for DNA
synthesis,
protein required for protein translation. Specific examples of exemplary
therapeutic antibody
targets include proteins encoded by the following genes: Dicer, Ago!, Ago2,
Trbp, Ras, raf,
wnt, btk, BcI-2, Akt, Sis, src, Notch, Stathmin, mdm2, abl, hTERT, c-fos, c-
jun, c-myc, erbB,
HER2/Neu, HER3,VEGFR, PDGFR, c-kit, c-met, c-ret, flt3, API, AML1, axl, alk,
fins, fps,
gip, lck, Stat, Hox, MLM, PRAD-I, and trk. In addition to monoclonal
antibodies, any
antigen binding fragment there of, such as a scFv, a Fab fragment, a Fab', a
F(ab')2, a Fv, a
peptibody, a diabody, a triabody, or a minibody, is also contemplated. Any
such antibodies or
antibody fragment may be either glycosylated or aglycosylated.
100791 As exosomes are known to comprise DICER and active RNA processing
RISC complex (see PCT PubIn. WO 2014/152622, which is incorporated herein by
reference
in its entirety), shRNA transfected into exosomes can mature into RISC-complex
bound
siRNA with the exosomes themselves. Alternatively, mature siRNA can itself be
transfected
into exosomes or liposomes. Thus, by way of example, the following are classes
of possible
target genes that may be used in the methods of the present invention to
modulate or attenuate
target gene expression: wild-type or mutant versions of developmental genes
(e.g., adhesion
molecules, cyclin kinase inhibitors, Wnt family members, Pax family members,
Winged helix
family members, Hox family members, cytokines/lymphokines and their receptors,
growth or
differentiation factors and their receptors, neurotransmitters and their
receptors), tumor
suppressor genes (e.g., APC, CYLD, HIN-1, KRAS2b, p16, p19, p21, p27, p27mt,
p53, p57,
p73, PTEN, Rb, Uteroglobin, Skp2, BRCA-1, BRCA-2, CHK2, CDKN2A, DCC, DPC4,
MADR2/JV18, MEN1, MEN2, MTS1, NF1, NF2, VHL, WRN, WTI, CFTR, C-CAM, CTS-
1, zacl, ras, MMAC1, FCC, MCC, FUS1, Gene 26 (CACNA2D2), PL6, Beta* (BLU),
Luca-
1 (HYAL1), Luca-2 (HYAL2), 123F2 (RASSF1), 101F6, Gene 21 (NPRL2), or a gene
encoding a SEM A3 polypeptide), pro-apoptotic genes (e.g.. CD95, caspase-3,
Bax, Bag-1,
28
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
CRADD, TSSC3, bax, hid, Bak, MKP-7, PARP, bad, bc1-2, MST1, bbc3, Sax, BIK,
and
BID), cytokines (e.g., GM-CSF, G-CSF, IL-la, IL-113, IL-2, IL-3, IL-4, IL-5,
IL-6, IL-7, IL-
8, EL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19,
IL-20, IL-21,
IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32
IFN-a,
IFNI, MIP-1 a, MIP-113, TGF-13, TNF-a, TNF-13, PDGF, and mda7), oncogenes
(e.g., ABLI,
BLC1, BCL6, CBFA1, CBL, CSFIR, ERBA, ERBB, EBRB2, ETS1, ETS1, ETV6, FGR,
FOX, FYN, HCR, HRAS, JUN, KRAS, LCK, LYN, MDM2, MLL, IvIYB, MYC, MYCL1,
MYCN, NRAS, PIM1, PML, RET, SRC, TAL1, TCL3 and YES), and enzymes (e.g., ACP
desaturases and hycroxylases, ADP-glucose pyrophorylases, ATPases, alcohol
dehycrogenases, amylases, amyloglucosidases, catalases, cellulases,
cyclooxygenases,
decarboxylases, dextrinases, esterases, DNA and RNA polymerases,
galactosidases,
glucanases, glucose oxidases, GTPases, helicases, hemicellulases, integrases,
invertases,
isomersases, kinases, lactases, lipases, lipoxygenases, lysozymes, nucleases,
pectinesterases,
peroxidases, phosphatases, phospholipases, phosphorylases, polygalacturonases,
proteinases
and peptideases, pullanases, recombinases, reverse transcriptases,
topoisomerases,
xylanases). In some cases, sh/siRNA may be designed to specifically target a
mutant version
of a gene expressed in a cancer cell while not affecting the expression of the
corresponding
wild-type version. In fact, any inhibitory nucleic acid that can be applied in
the compositions
and methods of the present invention if such inhibitory nucleic acid has been
found by any
source to be a validated downregulator of a protein of interest.
100801 In designing RNAi there are several factors that need to be considered,
such as
the nature of the siRNA, the durability of the silencing effect, and the
choice of delivery
system. To produce an RNAi effect, the siRNA that is introduced into the
organism will
typically contain exonic sequences. Furthermore, the RNAi process is homology
dependent,
so the sequences must be carefully selected so as to maximize gene
specificity, while
minimizing the possibility of cross-interference between homologous, but not
gene-specific
sequences. Preferably the siRNA exhibits greater than 80%, 85%, 90%, 95%, 98%,
or even
100% identity between the sequence of the siRNA and the gene to be inhibited.
Sequences
less than about 80% identical to the target gene are substantially less
effective. Thus, the
greater homology between the siRNA and the gene to be inhibited, the less
likely expression
of unrelated genes will be affected.
29
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
100811 Exosomes may also be engineered to comprise a gene editing system, such
as
a CRISPR/Cas system. In general, "CRISPR system" refers collectively to
transcripts and
other elements involved in the expression of or directing the activity of
CRISPR-associated
("Cas") genes, including sequences encoding a Cas gene, a tracr (trans-
activating CRISPR)
sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence
(encompassing
a "direct repeat" and a tracrRNA-processed partial direct repeat in the
context of an
endogenous CRISPR system), a guide sequence (also referred to as a "spacer" in
the context
of an endogenous CRISPR system), and/or other sequences and transcripts from a
CRISPR
locus. In some aspects, a Cas nuclease and gRNA (including a fusion of crRNA
specific for
the target sequence and fixed tracrRNA) are introduced into the cell. In
general, target sites at
the 5' end of the gRNA target the Cas nuclease to the target site, e.g., the
gene, using
complementary base pairing. The target site may be selected based on its
location
immediately 5' of a protospacer adjacent motif (PAM) sequence, such as
typically NGG, or
NAG. In this respect, the gRNA is targeted to the desired sequence by
modifying the first 20,
19, 18, 17, 16, 15, 14, 14, 12, 11, or 10 nucleotides of the guide RNA to
correspond to the
target DNA sequence. In general, a CRISPR system is characterized by elements
that
promote the formation of a CRISPR complex at the site of a target sequence.
Typically,
"target sequence" generally refers to a sequence to which a guide sequence is
designed to
have complementarity, where hybridization between the target sequence and a
guide
sequence promotes the formation of a CRISPR complex. Full complementarity is
not
necessarily required, provided there is sufficient complementarity to cause
hybridization and
promote formation of a CRISPR complex. The CRISPR system in exosomes
engineered to
comprise such a system may function to edit the genomic DNA inside a target
cell, or the
system may edit the DNA inside the exosomes itself.
100821 In addition to protein- and nucleic acid-based therapeutics, exosomes
may be
used to deliver small molecule drugs, either alone or in combination with any
protein- or
nucleic acid-based therapeutic. Exemplary small molecule drugs that are
contemplated for
use in the present embodiments include, but are not limited to, toxins,
chemotherapeutic
agents, agents that inhibit the activity of an intracellular protein, agents
that activate the
activity of intracellular proteins, agents for the prevention of restenosis,
agents for treating
renal disease, agents used for intermittent claudication, agents used in the
treatment of
hypotension and shock, angiotensin converting enzyme inhibitors, antianginal
agents, anti-
arrhythmics, anti-hypertensive agents, antiotensin ii receptor antagonists,
antiplatelet drugs,
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
b-blockers b I selective, beta blocking agents, botanical product for
cardiovascular indication,
calcium channel blockers, cardiovascular/diagnostics, central alpha-2
agonists, coronary
vasodilators, diuretics and renal tubule inhibitors, neutral
endopeptidase/angiotensin
converting enzyme inhibitors, peripheral vasodilators, potassium channel
openers, potassium
.. salts, anticonvulsants, antiemetics, antinauseants, anti-parkinson agents,
antispasticity agents,
cerebral stimulants, agents that can be applied in the treatment of trauma,
agents that can be
applied in the treatment of Alzheimer disease or dementia, agents that can be
applied in the
treatment of migraine, agents that can be applied in the treatment of
neurodegenerative
diseases, agents that can be applied in the treatment of kaposi's sarcoma,
agents that can be
applied in the treatment of AIDS, cancer chemotherapeutic agents, agents that
can be applied
in the treatment of immune disorders, agents that can be applied in the
treatment of
psychiatric disorders, analgesics, epidural and intrathecal anesthetic agents,
general, local,
regional neuromuscular blocking agents sedatives, preanesthetic adrenal/acth,
anabolic
steroids, agents that can be applied in the treatment of diabetes, dopamine
agonists, growth
hormone and analogs, hyperglycemic agents, hypoglycemic agents, oral insulins,
large
volume parenterals (lvps), lipid-altering agents, metabolic studies and inborn
errors of
metabolism, nutrients/amino acids, nutritional lvps, obesity drugs
(anorectics), somatostatin,
thyroid agents, vasopressin, vitamins, corticosteroids, mucolytic agents,
pulmonary anti-
inflammatory agents, pulmonary surfactants, antacids, anticholinergics,
antidiarrheals,
antiemetics, cholelitholytic agents, inflammatory bowel disease agents,
irritable bowel
syndrome agents, liver agents, metal chelators, miscellaneous gastric
secretory agents,
pancreatitis agents, pancreatic enzymes, prostaglandins, prostaglandins,
proton pump
inhibitors, sclerosing agents, sucralfate, anti-progestins, contraceptives,
oral contraceptives,
not oral dopamine agonists, estrogens, gonadotropins, GNRH agonists, GHRH
antagonists,
oxytocics, progestins, uterine-acting agents, anti-anemia drugs,
anticoagulants,
antifibrinolytics, antiplatelet agents, antithrombin drugs, coagulants,
fibrinolytics,
hematology, heparin inhibitors, metal chelators, prostaglandins, vitamin K,
anti-androgens,
aminoglycosides, antibacterial agents, sulfonamides, cephalosporins,
clindamycins,
dermatologics, detergents, erythromycins, anthelmintic agents, antifungal
agents,
antimalarial s, anti mycobacteri al agents, anti parasitic agents, an ti
protozoal agents,
antitrichomonads, antituberculosis agents, immunomodulators, immunostimulatory
agents,
macrolides, antiparasitic agents, corticosteroids, cyclooxygenase inhibitors,
enzyme blockers,
immunomodulators for rheumatic diseases, metalloproteinase inhibitors,
nonsteroidal anti-
inflammatory agents, analgesics, antipyretics, alpha adrenergic
agonists/blockers, antibiotics,
31
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
antivirals, beta adrenergic blockers, carbonic anhydrase inhibitors,
corticosteroids, immune
system regulators, mast cell inhibitors, nonsteroidal anti-inflammatory
agents, and
prostaglandi ns.
100831 Exosomes may also be used to deliver diagnostic agents. Exemplary
diagnostic agents include, but are not limited to, magnetic resonance image
enhancement
agents, positron emission tomography products, radioactive diagnostic agents,
radioactive
therapeutic agents, radio-opaque contrast agents, radiopharmaceuticals,
ultrasound imaging
agents, and angiographic diagnostic agents.
100841 The term "subject" as used herein refers to any individual or patient
to which
the subject methods are performed. Generally the subject is human, although as
will be
appreciated by those in the art, the subject may be an animal. Thus other
animals, including
mammals, such as rodents (including mice, rats, hamsters, and guinea pigs),
cats, dogs,
rabbits, farm animals (including cows, horses, goats, sheep, pigs, etc.), and
primates
(including monkeys, chimpanzees, orangutans, and gorillas) are included within
the
definition of subject.
100851 "Treatment" and "treating" refer to administration or application of a
therapeutic agent to a subject or performance of a procedure or modality on a
subject for the
purpose of obtaining a therapeutic benefit of a disease or health-related
condition. For
example, a treatment may include administration of chemotherapy,
immunotherapy, or
radiotherapy, performance of surgery, or any combination thereof.
100861 The term "therapeutic benefit" or "therapeutically effective" as used
throughout this application refers to anything that promotes or enhances the
well-being of the
subject with respect to the medical treatment of this condition. This
includes, but is not
limited to, a reduction in the frequency or severity of the signs or symptoms
of a disease. For
example, treatment of cancer may involve, for example, a reduction in the
invasiveness of a
tumor, reduction in the growth rate of the cancer, or prevention of
metastasis. Treatment of
cancer may also refer to prolonging survival of a subject with cancer.
100871 The term "cancer," as used herein, may be used to describe a solid
tumor,
metastatic cancer, or non-metastatic cancer. In certain embodiments, the
cancer may
originate in the bladder, blood, bone, bone marrow, brain, breast, colon,
esophagus,
32
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
duodenum, small intestine, large intestine, colon, rectum, anus, gum, head,
kidney, liver,
lung, nasopharynx, neck, ovary, pancreas, prostate, skin, stomach, testis,
tongue, or uterus.
100881 The cancer may specifically be of the following histological type,
though it is
not limited to these: neoplasm, malignant; carcinoma; carcinoma,
undifferentiated; giant and
spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous
cell carcinoma;
lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma;
transitional cell
carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma,
malignant;
cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular
carcinoma and
cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma;
adenocarcinoma
in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid
carcinoma; carcinoid
tumor, malignant; branchiolo-alveol ar adenocarci noma; papillary adenocarci
noma;
chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil
carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular
adenocarcinoma;
papillary and follicular adenocarcinoma; nonencapsulating sclerosing
carcinoma; adrenal
cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine
adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma;
mucoepidermoid
carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous
cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma;
signet ring
cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular
carcinoma;
inflammatory carcinoma; paget's disease, mammary; acinar cell carcinoma;
adenosquamous
carcinoma; adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian
stromal
tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant;
androblastoma,
malignant; sertoli cell carcinoma; leydig cell tumor, malignant; lipid cell
tumor, malignant;
paraganglioma, malignant; extra-mammary paraganglioma, malignant;
pheochromocytoma;
glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial
spreading
melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell
melanoma; blue
nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant;
myxosarcoma;
liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma;
alveolar
rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed
tumor;
nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant;
brenner
tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma,
malignant;
dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii,
malignant;
choriocarcinoma; mesonephroma, malignant; hemangiosarcoma;
hemangioendothelioma,
33
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
malignant; kaposi's sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma;
osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma,
malignant;
mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma;
odontogenic
tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant;
ameloblastic
fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma;
astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma;
glioblastoma;
oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar
sarcoma;
ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic
tumor;
meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular
cell tumor,
malignant; malignant lymphoma; hodgkin's disease; hodgkin's; paragranuloma;
malignant
lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse;
malignant
lymphoma, follicular; mycosis fungoides; other specified non-hodgkin's
lymphomas,
malignant histiocytosis; multiple myeloma; mast cell sarcoma;
immunoproliferative small
intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia;
erythroleukemia;
lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia;
eosinophilic
leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia;
myeloid
sarcoma; and hairy cell leukemia.
100891 The terms "contacted" and "exposed," when applied to a cell, are used
herein
to describe the process by which a therapeutic agent are delivered to a target
cell or are
placed in direct juxtaposition with the target cell. To achieve cell killing,
for example, one or
more agents are delivered to a cell in an amount effective to kill the cell or
prevent it from
dividing.
100901
An effective response of a patient or a patient's "responsiveness" to
treatment refers to the clinical or therapeutic benefit imparted to a patient
at risk for, or
suffering from, a disease or disorder. Such benefit may include cellular or
biological
responses, a complete response, a partial response, a stable disease (without
progression or
relapse), or a response with a later relapse. For example, an effective
response can be reduced
tumor size or progression-free survival in a patient diagnosed with cancer.
100911
Treatment outcomes can be predicted and monitored and/or patients
benefiting from such treatments can be identified or selected via the methods
described
herein.
34
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
100921
Regarding neoplastic condition treatment, depending on the stage of
the neoplastic condition, neoplastic condition treatment involves one or a
combination of the
following therapies: surgery to remove the neoplastic tissue, radiation
therapy, and
chemotherapy. Other therapeutic regimens may be combined with the
administration of the
anticancer agents, e.g., therapeutic compositions and chemotherapeutic agents.
For example,
the patient to be treated with such anti-cancer agents may also receive
radiation therapy
and/or may undergo surgery.
100931
For the treatment of disease, the appropriate dosage of a therapeutic
composition will depend on the type of disease to be treated, as defined
above, the severity
and course of the disease, the patient's clinical history and response to the
agent, and the
discretion of the attending physician. The agent is suitably administered to
the patient at one
time or over a series of treatments.
100941 Therapeutic and prophylactic methods and compositions can be provided
in a
combined amount effective to achieve the desired effect. A tissue, tumor, or
cell can be
contacted with one or more compositions or pharmacological formulation(s)
comprising one
or more of the agents, or by contacting the tissue, tumor, and/or cell with
two or more distinct
compositions or formulations. Also, it is contemplated that such a combination
therapy can
be used in conjunction with chemotherapy, radiotherapy, surgical therapy, or
immunotherapy.
100951
Administration in combination can include simultaneous
administration of two or more agents in the same dosage form, simultaneous
administration
in separate dosage forms, and separate administration. That is, the subject
therapeutic
composition and another therapeutic agent can be formulated together in the
same dosage
form and administered simultaneously. Alternatively, subject therapeutic
composition and
another therapeutic agent can be simultaneously administered, wherein both the
agents are
present in separate formulations. In another alternative, the therapeutic
agent can be
administered just followed by the other therapeutic agent or vice versa. In
the separate
administration protocol, the subject therapeutic composition and another
therapeutic agent
may be administered a few minutes apart, or a few hours apart, or a few days
apart.
100961 A first anti-cancer treatment (e.g., exosomes that express a
recombinant
protein or with a recombinant protein isolated from exosomes) may be
administered before,
during, after, or in various combinations relative to a second anti-cancer
treatment. The
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
administrations may be in intervals ranging from concurrently to minutes to
days to weeks.
In embodiments where the first treatment is provided to a patient separately
from the second
treatment, one would generally ensure that a significant period of time did
not expire between
the time of each delivery, such that the two compounds would still be able to
exert an
advantageously combined effect on the patient. In such instances, it is
contemplated that one
may provide a patient with the first therapy and the second therapy within
about 12 to 24 or
72 h of each other and, more particularly, within about 6-12 h of each other.
In some
situations it may be desirable to extend the time period for treatment
significantly where
several days (2, 3, 4, 5, 6, or 7) to several weeks (1, 2, 3, 4, 5, 6, 7, or
8) lapse between
respective administrations.
100971 In certain embodiments, a course of treatment will last 1-90 days or
more (this
such range includes intervening days). It is contemplated that one agent may
be given on any
day of day 1 to day 90 (this such range includes intervening days) or any
combination
thereof, and another agent is given on any day of day 1 to day 90 (this such
range includes
intervening days) or any combination thereof. Within a single day (24-hour
period), the
patient may be given one or multiple administrations of the agent(s).
Moreover, after a
course of treatment, it is contemplated that there is a period of time at
which no anti-cancer
treatment is administered. This time period may last 1-7 days, and/or 1-5
weeks, and/or 1-12
months or more (this such range includes intervening days), depending on the
condition of
the patient, such as their prognosis, strength, health, etc. It is expected
that the treatment
cycles would be repeated as necessary.
[0098] Various combinations may be employed. For the example below a first
anti-
cancer therapy is "A" and a second anti-cancer therapy is "B":
A/B/A B/A/B B/B/A A/A/B AJB/B B/A/A A/B/B/B B/A/B/B
B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A
B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A
[0099] Administration of any compound or therapy of the present invention to a
patient will follow general protocols for the administration of such
compounds, taking into
account the toxicity, if any, of the agents. Therefore, in some embodiments
there is a step of
.. monitoring toxicity that is attributable to combination therapy.
36
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
1. Chemotherapy
[00100]
A wide variety of chemotherapeutic agents may be used in accordance
with the present invention. The term "chemotherapy" refers to the use of drugs
to treat
cancer. A "chemotherapeutic agent" is used to connote a compound or
composition that is
administered in the treatment of cancer. These agents or drugs are categorized
by their mode
of activity within a cell, for example, whether and at what stage they affect
the cell cycle.
Alternatively, an agent may be characterized based on its ability to directly
cross-link DNA,
to intercalate into DNA, or to induce chromosomal and mitotic aberrations by
affecting
nucleic acid synthesis.
[00101] Examples
of chemotherapeutic agents include alkylating agents, such
as thiotepa and cyclosphosphamide; alkyl sulfonates, such as busulfan,
improsulfan, and
piposulfan; aziridines, such as benzodopa, carboquone, meturedopa, and
uredopa;
ethylenimines and methylamelamines, including altretamine,
triethylenemelamine,
tri etyl enephosphorami de, tri ethi y I en ethi ophosphorami de, and
trimethylol om el ami ne;
acetogenins (especially bullatacin and bullatacinone); a camptothecin
(including the synthetic
analogue topotecan); bryostatin; callystatin; CC-1065 (including its
adozelesin, carzelesin
and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1
and
cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues,
KW-2189 and
CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen
mustards, such
as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide,
mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin,
phenesterine, prednimustine, trofosfamide, and uracil mustard; nitrosureas,
such as
carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and
ranimnustine; antibiotics,
such as the enediyne antibiotics (e.g., calicheamicin, especially
calicheamicin gammall and
calicheamicin omegall ); dynemicin, including dynemicin A; bisphosphonates,
such as
clodronate; an esperamicin; as well as neocarzinostatin chromophore and
related
chromoprotein enediyne anti obi oti c chromophores, acl aci n om y sins, acti
nomycin,
authrarnycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin,
carzinophilin,
chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-
norleucine,
doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-
pyrrolino-
doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin,
marcellomycin,
mitomycins, such as mitomycin C, mycophenolic acid, nogalarnycin, olivomycins,
peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin,
streptozocin,
37
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
tubercidin, ubenimex, zinostatin, and zorubicin; anti-metabolites, such as
methotrexate and 5-
fluorouracil (5-FU); folic acid analogues, such as denopterin, pteropterin,
and trimetrexate;
purine analogs, such as fludarabine, 6-mercaptopurine, thiamiprine, and
thioguanine;
pyrimidine analogs, such as ancitabine, azacitidine, 6-azauridine, carmofur,
cytarabine,
dideoxyuridine, doxifluridine, enocitabine, and floxuridine; androgens, such
as calusterone,
dromostanolone propionate, epitiostanol, mepitiostane, and testolactone; anti-
adrenals, such
as mitotane and trilostane; folic acid replenisher, such as frolinic acid;
aceglatone;
aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine;
bestrabucil;
bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine;
elliptinium
acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan;
lonidainine;
maytansinoids, such as maytansine and ansamitocins; mitoguazone; mitoxantrone;
mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone;
podophyllinic
acid; 2-ethylhydrazide; procarbazine; PSKpolysaccharide complex; razoxane;
rhizoxin;
sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2',2"-
trichlorotriethylamine,
trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine);
urethan;
vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman;
gacytosine;
arabinoside ("Ara-C"); cyclophosphamide; taxoids, e.g., paclitaxel and
docetaxel
gemcitabine; 6-thioguanine; mercaptopurine; platinum coordination complexes,
such as
cisplatin, oxaliplatin, and carboplatin; vinblastine; platinum; etoposide (VP-
16); ifosfamide;
mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate;
daunomycin;
aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase
inhibitor RFS
2000; difluorometlhylornithine (DNIF0); retinoids, such as retinoic acid;
capecitabine;
carboplatin, procarbazine,plicomycin, gemcitabi en, navelbine, farnesyl -
protein tansferase
inhibitors, transplatinum, and pharmaceutically acceptable salts, acids, or
derivatives of any
of the above.
2. Radiotherapy
1001021 Other factors that cause DNA damage and have been used
extensively
include what are commonly known as y-rays, X-rays, and/or the directed
delivery of
radioisotopes to tumor cells. Other forms of DNA damaging factors are also
contemplated,
such as microwaves, proton beam irradiation (U.S. Patents 5,760,395 and
4,870,287), and
UV-irradiation. It is most likely that all of these factors affect a broad
range of damage on
DNA, on the precursors of DNA, on the replication and repair of DNA, and on
the assembly
and maintenance of chromosomes. Dosage ranges for X-rays range from daily
doses of 50 to
38
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of
2000 to 6000
roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-
life of the
isotope, the strength and type of radiation emitted, and the uptake by the
neoplastic cells.
3. Immunotherapy
1001031 The
skilled artisan will understand that additional immunotherapies
may be used in combination or in conjunction with methods of the invention. In
the context
of cancer treatment, immunotherapeutics, generally, rely on the use of immune
effector cells
and molecules to target and destroy cancer cells. Rituximab (Rituxane) is such
an example.
The immune effector may be, for example, an antibody specific for some marker
on the
surface of a tumor cell. The antibody alone may serve as an effector of
therapy or it may
recruit other cells to actually affect cell killing. The antibody also may be
conjugated to a
drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin,
pertussis toxin,
etc.) and serve merely as a targeting agent. Alternatively, the effector may
be a lymphocyte
carrying a surface molecule that interacts, either directly or indirectly,
with a tumor cell
target. Various effector cells include cytotoxic T cells and NK cells.
1001041
In one aspect of immunotherapy, the tumor cell must bear some marker
that is amenable to targeting, i.e., is not present on the majority of other
cells. Many tumor
markers exist and any of these may be suitable for targeting in the context of
the present
invention. Common tumor markers include CD20, carcinoembryonic antigen,
tyrosinase
(p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, laminin
receptor,
erb B, and p155. An alternative aspect of immunotherapy is to combine
anticancer effects
with immune stimulatory effects. Immune stimulating molecules also exist
including:
cytokines, such as IL-2, IL-4, 1L-12, GM-CSF, gamma-IFN, chemokines, such as
M1P-1,
MCP-1, IL-8, and growth factors, such as FLT3 ligand.
1001051 Examples
of immunotherapies currently under investigation or in use
are immune adjuvants, e.g., Mycobacterium bovis, Plasmodium .fakiparum,
dinitrochlorobenzene, and aromatic compounds (U.S. Patents 5,801,005 and
5,739,169; Hui
and Hashimoto, 1998; Christodoulides et al., 1998); cytokine therapy, e.g.,
interferons a, 13,
and 7, IL-1, GM-CSF, and TNF (Bukowski et al., 1998; Davidson et al., 1998;
Hellstrand et
al., 1998); gene therapy, e.g., TNF, IL-1, IL-2, and p53 (Qin et al., 1998;
Austin-Ward and
Villaseca, 1998; U.S. Patents 5,830,880 and 5,846,945); and monoclonal
antibodies, e.g.,
39
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
anti-CD20, anti-ganglioside GM2, and anti-p185 (Hollander, 2012; Hanibuchi et
al., 1998;
U.S. Patent 5,824,311). It is contemplated that one or more anti-cancer
therapies may be
employed with the antibody therapies described herein.
1001061
In some embodiments, the immunotherapy may be an immune
checkpoint inhibitor. Immune checkpoints either turn up a signal (e.g., co-
stimulatory
molecules) or turn down a signal. Inhibitory immune checkpoints that may be
targeted by
immune checkpoint blockade include adenosine A2A receptor (AZAR), B7-H3 (also
known
as CD276), B and T lymphocyte attenuator (BTLA), cytotoxic T-lymphocyte-
associated
protein 4 (CTLA-4, also known as CD152), indoleamine 2,3-dioxygenase (ID0),
killer-cell
immunoglobulin (KIR), lymphocyte activation gene-3 (LAG3), programmed death 1
(PD-1),
T-cell immunoglobulin domain and mucin domain 3 (TIM-3) and V-domain 1g
suppressor of
T cell activation (VISTA). In particular, the immune checkpoint inhibitors
target the PD-1
axis and/or CTLA-4.
1001071
The immune checkpoint inhibitors may be drugs such as small
molecules, recombinant forms of ligand or receptors, or, in particular, are
antibodies, such as
human antibodies (e.g., International Patent Publication W02015016718;
Pardo11, Nat Rev
Cancer, 12(4): 252-64, 2012; both incorporated herein by reference). Known
inhibitors of the
immune checkpoint proteins or analogs thereof may be used, in particular
chimerized,
humanized or human forms of antibodies may be used. As the skilled person will
know,
alternative and/or equivalent names may be in use for certain antibodies
mentioned in the
present disclosure. Such alternative and/or equivalent names are
interchangeable in the
context of the present disclosure. For example, it is known that lambrolizumab
is also known
under the alternative and equivalent names MK-3475 and pembrolizumab.
1001081
In some embodiments, the PD-1 binding antagonist is a molecule that
inhibits the binding of PD-1 to its ligand binding partners. In a specific
aspect, the PD-1
ligand binding partners are PDL1 and/or PDL2. In another embodiment, a PDL1
binding
antagonist is a molecule that inhibits the binding of PDL1 to its binding
partners. In a specific
aspect, PDL1 binding partners are PD-1 and/or B7-1. In another embodiment, the
PDL2
binding antagonist is a molecule that inhibits the binding of PDL2 to its
binding partners. In a
specific aspect, a PDL2 binding partner is PD-1. The antagonist may be an
antibody, an
antigen binding fragment thereof, an immunoadhesin, a fusion protein, or
oligopeptide.
Exemplary antibodies are described in U.S. Patent Nos. 8,735,553, 8,354,509,
and 8,008,449,
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
all incorporated herein by reference. Other PD-1 axis antagonists for use in
the methods
provided herein are known in the art such as described in U.S. Patent
Publication Nos.
20140294898, 2014022021, and 20110008369, all incorporated herein by
reference.
[00109]
In some embodiments, the PD-1 binding antagonist is an anti-PD-1
antibody (e.g., a human antibody, a humanized antibody, or a chimeric
antibody). In some
embodiments, the anti-PD-1 antibody is selected from the group consisting of
nivolumab,
pembrolizumab, and CT-011. In some embodiments, the PD-1 binding antagonist is
an
immunoadhesin (e.g., an immunoadhesin comprising an extracellular or PD-1
binding portion
of PDL1 or PDL2 fused to a constant region (e.g., an Fc region of an
immunoglobulin
sequence). In some embodiments, the PD-1 binding antagonist is AMP- 224.
Nivolumab, also
known as MDX-1106-04, MDX-1106, ONO-4538, BMS-936558, and OPDIVO , is an anti-
PD-1 antibody described in W02006/121168. Pembrolizumab, also known as MK-
3475,
Merck 3475, lambrolizumab, KEYTRUDA , and SCH-900475, is an anti-PD-1 antibody
described in W02009/114335. CT-011, also known as hBAT or hBAT-1, is an anti-
PD-1
antibody described in W02009/101611. AMP-224, also known as B7-DCIg, is a PDL2-
Fc
fusion soluble receptor described in W02010/027827 and W02011/066342.
[00110]
Another immune checkpoint that can be targeted in the methods
provided herein is the cytotoxic T-lymphocyte-associated protein 4 (CTLA-4),
also known as
CD152. The complete cDNA sequence of human CTLA-4 has the Genbank accession
number L15006. CTLA-4 is found on the surface of T cells and acts as an "off'
switch when
bound to CD80 or CD86 on the surface of antigen-presenting cells. CTLA4 is a
member of
the immunoglobulin superfamily that is expressed on the surface of Helper T
cells and
transmits an inhibitory signal to T cells. CTLA4 is similar to the T-cell co-
stimulatory
protein, CD28, and both molecules bind to CD80 and CD86, also called B7-1 and
B7-2
respectively, on antigen-presenting cells. CTLA4 transmits an inhibitory
signal to T cells,
whereas CD28 transmits a stimulatory signal. Intracellular CTLA4 is also found
in regulatory
T cells and may be important to their function. T cell activation through the
T cell receptor
and CD28 leads to increased expression of CTLA-4, an inhibitory receptor for
B7 molecules.
[00111]
In some embodiments, the immune checkpoint inhibitor is an anti-
CTLA-4 antibody (e.g., a human antibody, a humanized antibody, or a chimeric
antibody), an
antigen binding fragment thereof, an immunoadhesin, a fusion protein, or
oligopeptide.
41
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
1001121
Anti-human-CTLA-4 antibodies (or VI-1 and/or VL domains derived
therefrom) suitable for use in the present methods can be generated using
methods well
known in the art. Alternatively, art recognized anti-CTLA-4 antibodies can be
used. For
example, the anti-CTLA-4 antibodies disclosed in: US Patent No. 8,119,129, WO
01/14424,
WO 98/42752; WO 00/37504 (CP675,206, also known as tremelimumab; formerly
ticilimumab), U.S. Patent No. 6,207,156; Hurwitz et al. (1998) Proc Nat! Acad
Sci USA
95(17): 10067-10071; Camacho et al. (2004) J Clin Oncology 22(145): Abstract
No. 2505
(antibody CP-675206); and Mokyr etal. (1998) Cancer Res 58:5301-5304 can be
used in the
methods disclosed herein. The teachings of each of the aforementioned
publications are
hereby incorporated by reference. Antibodies that compete with any of these
art-recognized
antibodies for binding to CTLA-4 also can be used. For example, a humanized
CTLA-4
antibody is described in International Patent Application No. W02001014424,
W02000037504, and U.S. Patent No. 8,017,114; all incorporated herein by
reference.
1001131
An exemplary anti-CTLA-4 antibody is ipilimumab (also known as
10D1, MDX- 010, MDX- 101, and Yervoye) or antigen binding fragments and
variants
thereof (see, e.g., WO 01/14424). In other embodiments, the antibody comprises
the heavy
and light chain CDRs or VRs of ipilimumab. Accordingly, in one embodiment, the
antibody
comprises the CDR1, CDR2, and CDR3 domains of the VH region of ipilimumab, and
the
CDR1, CDR2 and CDR3 domains of the VL region of ipilimumab. In another
embodiment,
the antibody competes for binding with and/or binds to the same epitope on
CTLA-4 as the
above- mentioned antibodies. In another embodiment, the antibody has at least
about 90%
variable region amino acid sequence identity with the above-mentioned
antibodies (e.g., at
least about 90%, 95%, or 99% variable region identity with ipilimumab).
1001141
Other molecules for modulating CTLA-4 include CTLA-4 ligands and
receptors such as described in U.S. Patent Nos. 5844905, 5885796 and
International Patent
Application Nos. W01995001994 and W01998042752; all incorporated herein by
reference,
and immunoadhesins such as described in U.S. Patent No. 8329867, incorporated
herein by
reference.
1001151
In some embodiment, the immune therapy could be adoptive
immunotherapy, which involves the transfer of autologous antigen-specific T
cells generated
ex vivo. The T cells used for adoptive immunotherapy can be generated either
by expansion
of antigen-specific T cells or redirection of T cells through genetic
engineering (Park,
42
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
Rosenberg et al. 2011). Isolation and transfer of tumor specific T cells has
been shown to be
successful in treating melanoma. Novel specificities in T cells have been
successfully
generated through the genetic transfer of transgenic T cell receptors or
chimeric antigen
receptors (CARs) (Jena, Dofti et al. 2010). CARs are synthetic receptors
consisting of a
targeting moiety that is associated with one or more signaling domains in a
single fusion
molecule. In general, the binding moiety of a CAR consists of an antigen-
binding domain of
a single-chain antibody (scFv), comprising the light and variable fragments of
a monoclonal
antibody joined by a flexible linker. Binding moieties based on receptor or
ligand domains
have also been used successfully. The signaling domains for first generation
CARs are
derived from the cytoplasmic region of the CD3zeta or the Fc receptor gamma
chains. CARs
have successfully allowed T cells to be redirected against antigens expressed
at the surface of
tumor cells from various malignancies including lymphomas and solid tumors
(Jena, Dotti et
al. 2010).
[00116]
In one embodiment, the present application provides for a combination
therapy for the treatment of cancer wherein the combination therapy comprises
adoptive 1-
cell therapy and a checkpoint inhibitor. In one aspect, the adoptive 1-cell
therapy comprises
autologous and/or allogenic T cells. In another aspect, the autologous and/or
allogenic T cells
are targeted against tumor antigens.
4. Surgery
[00117]
Approximately 60% of persons with cancer will undergo surgery of
some type, which includes preventative, diagnostic or staging, curative, and
palliative
surgery. Curative surgery includes resection in which all or part of cancerous
tissue is
physically removed, excised, and/or destroyed and may be used in conjunction
with other
therapies, such as the treatment of the present invention, chemotherapy,
radiotherapy,
hormonal therapy, gene therapy, immunotherapy, and/or alternative
therapies.Tumor
resection refers to physical removal of at least part of a tumor. In addition
to tumor resection,
treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and
microscopically-controlled surgery (Mohs' surgery).
[00118]
Upon excision of part or all of cancerous cells, tissue, or tumor, a
cavity may be formed in the body. Treatment may be accomplished by perfiision,
direct
injection, or local application of the area with an additional anti-cancer
therapy. Such
treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or
every 1, 2, 3, 4,
43
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These
treatments may be
of varying dosages as well.
5. Other Agents
1001191
It is contemplated that other agents may be used in combination with
certain aspects of the present invention to improve the therapeutic efficacy
of treatment.
These additional agents include agents that affect the upregulation of cell
surface receptors
and GAP junctions, cytostatic and differentiation agents, inhibitors of cell
adhesion, agents
that increase the sensitivity of the hyperproliferative cells to apoptotic
inducers, or other
biological agents. Increases in intercellular signaling by elevating the
number of GAP
junctions would increase the anti-hyperproliferative effects on the
neighboring
hyperproliferative cell population. In other embodiments, cytostatic or
differentiation agents
can be used in combination with certain aspects of the present invention to
improve the anti-
hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are
contemplated to
improve the efficacy of the present invention. Examples of cell adhesion
inhibitors are focal
adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated
that other
agents that increase the sensitivity of a hyperproliferative cell to
apoptosis, such as the
antibody c225, could be used in combination with certain aspects of the
present invention to
improve the treatment efficacy.
III. Pharmaceutical Compositions
1001201 It is
contemplated that exosomes that express or comprise a therapeutic
protein, inhibitory RNA, and/or small molecule drug can be administered
systemically or
locally to inhibit tumor cell growth and, most preferably, to kill cancer
cells in cancer patients
with locally advanced or metastatic cancers. They can be administered
intravenously,
intrathecally, and/or intraperitoneally. They can be administered alone or in
combination
with anti-proliferative drugs. In one embodiment, they are administered to
reduce the cancer
load in the patient prior to surgery or other procedures. Alternatively, they
can be
administered after surgery to ensure that any remaining cancer (e.g., cancer
that the surgery
failed to eliminate) does not survive.
1001211
It is not intended that the present invention be limited by the particular
nature of the therapeutic preparation. For example, such compositions can be
provided in
formulations together with physiologically tolerable liquid, gel, solid
carriers, diluents, or
44
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
excipients. These therapeutic preparations can be administered to mammals for
veterinary
use, such as with domestic animals, and clinical use in humans in a manner
similar to other
therapeutic agents. In general, the dosage required for therapeutic efficacy
will vary
according to the type of use and mode of administration, as well as the
particular
requirements of individual subjects.
1001221
Where clinical applications are contemplated, it may be necessary to
prepare pharmaceutical compositions comprising recombinant proteins and/or
exosomes in a
form appropriate for the intended application. Generally, pharmaceutical
compositions may
comprise an effective amount of one or more recombinant proteins and/or
exosomes or
additional agents dissolved or dispersed in a pharmaceutically acceptable
carrier. The
phrases "pharmaceutical or pharmacologically acceptable" refers to molecular
entities and
compositions that do not produce an adverse, allergic, or other untoward
reaction when
administered to an animal, such as, for example, a human, as appropriate. The
preparation of
a pharmaceutical composition comprising a recombinant protein and/or exosomes
as
disclosed herein, or additional active ingredient will be known to those of
skill in the art in
light of the present disclosure, as exemplified by Remington's Pharmaceutical
Sciences, 18th
Ed., 1990, incorporated herein by reference. Moreover, for animal (e.g.,
human)
administration, it will be understood that preparations should meet sterility,
pyrogenicity,
general safety, and purity standards as required by the FDA Office of
Biological Standards.
1001231 Further
in accordance with certain aspects of the present invention, the
composition suitable for administration may be provided in a pharmaceutically
acceptable
carrier with or without an inert diluent. As used herein, "pharmaceutically
acceptable
carrier" includes any and all aqueous solvents (e.g., water, alcoholic/aqueous
solutions,
ethanol, saline solutions, parenteral vehicles, such as sodium chloride,
Ringer's dextrose,
eic.), non-aqueous solvents (e.g., fats, oils, polyol (for example, glycerol,
propylene glycol,
and liquid polyethylene glycol, and the like), vegetable oil, and injectable
organic esters, such
as ethyloleate), lipids, liposomes, dispersion media, coatings (e.g.,
lecithin), surfactants,
antioxidants, preservatives (e.g., antibacterial or antifungal agents, anti-
oxidants, chelating
agents, inert gases, parabens (e.g., methylparabens, propylparabens),
chlorobutanol, phenol,
sorbic acid, thimerosal or combinations thereof), isotonic agents (e.g.,
sugars and sodium
chloride), absorption delaying agents (e.g., aluminum monostearate and
gelatin), salts, drugs,
drug stabilizers, gels, resins, fillers, binders, excipients, disintegration
agents, lubricants,
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
sweetening agents, flavoring agents, dyes, fluid and nutrient replenishers,
such like materials
and combinations thereof, as would be known to one of ordinary skill in the
art. The carrier
should be assimilable and includes liquid, semi-solid, i.e., pastes, or solid
carriers. In
addition, if desired, the compositions may contain minor amounts of auxiliary
substances,
such as wetting or emulsifying agents, stabilizing agents, or pH buffering
agents. The pH and
exact concentration of the various components in a pharmaceutical composition
are adjusted
according to well-known parameters. The proper fluidity can be maintained, for
example, by
the use of a coating, such as lecithin, by the maintenance of the required
particle size in the
case of dispersion, and by the use of surfactants.
1001241 A
pharmaceutically acceptable carrier is particularly formulated for
administration to a human, although in certain embodiments it may be desirable
to use a
pharmaceutically acceptable carrier that is formulated for administration to a
non-human
animal but that would not be acceptable (e.g., due to governmental
regulations) for
administration to a human. Except insofar as any conventional carrier is
incompatible with
the active ingredient (e.g., detrimental to the recipient or to the
therapeutic effectiveness of a
composition contained therein), its use in the therapeutic or pharmaceutical
compositions is
contemplated. In accordance with certain aspects of the present invention, the
composition is
combined with the carrier in any convenient and practical manner, i.e., by
solution,
suspension, emulsification, admixture, encapsulation, absorption, and the
like. Such
procedures are routine for those skilled in the art.
1001251
Certain embodiments of the present invention may comprise different
types of carriers depending on whether it is to be administered in solid,
liquid, or aerosol
form, and whether it needs to be sterile for the route of administration, such
as injection. The
compositions can be administered intravenously, intradermally, transdermally,
intrathecally,
intraarterially, intraperitoneally, intranasally, intravaginally,
intrarectally, intramuscularly,
subcutaneously, mucosally, orally, topically, locally, by inhalation (e.g.,
aerosol inhalation),
by injection, by infusion, by continuous infusion, by localized perfusion
bathing target cells
directly, via a catheter, via a lavage, in lipid compositions (e.g.,
liposomes), or by other
methods or any combination of the forgoing as would be known to one of
ordinary skill in the
art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed., 1990,
incorporated
herein by reference).
46
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
[00126]
The active compounds can be formulated for parenteral administration,
e.g., formulated for injection via the intravenous, intramuscular, sub-
cutaneous, or even
intraperitoneal routes. Typically, such compositions can be prepared as either
liquid
solutions or suspensions; solid forms suitable for use to prepare solutions or
suspensions
upon the addition of a liquid prior to injection can also be prepared; and the
preparations can
also be emulsified.
1001271
The pharmaceutical forms suitable for injectable use include sterile
aqueous solutions or dispersions; formulations including sesame oil, peanut
oil, or aqueous
propylene glycol; and sterile powders for the extemporaneous preparation of
sterile injectable
solutions or dispersions. In all cases the form must be sterile and must be
fluid to the extent
that it may be easily injected. It also should be stable under the conditions
of manufacture
and storage and must be preserved against the contaminating action of
microorganisms, such
as bacteria and fungi.
1001281
The therapeutics may be formulated into a composition in a free base,
neutral, or salt form. Pharmaceutically acceptable salts include the acid
addition salts, e.g.,
those formed with the free amino groups of a proteinaceous composition, or
which are
formed with inorganic acids, such as, for example, hydrochloric or phosphoric
acids, or such
organic acids as acetic, oxalic, tartaric, or mandelic acid and the like.
Salts formed with the
free carboxyl groups can also be derived from inorganic bases, such as, for
example, sodium,
potassium, ammonium, calcium, or ferric hydroxides; or such organic bases as
isopropylamine, trimethylamine, histidine, or procaine and the like. Upon
formulation,
solutions will be administered in a manner compatible with the dosage
formulation and in
such amount as is therapeutically effective. The formulations are easily
administered in a
variety of dosage forms, such as formulated for parenteral administrations,
such as injectable
solutions, or aerosols for delivery to the lungs, or formulated for alimentary
administrations,
such as drug release capsules and the like.
[00129]
In a specific embodiment of the present invention, the composition is
combined or mixed thoroughly with a semi-solid or solid carrier. The mixing
can be carried
out in any convenient manner, such as grinding. Stabilizing agents can be also
added in the
mixing process in order to protect the composition from loss of therapeutic
activity, i.e.,
denaturation in the stomach. Examples of stabilizers for use in a composition
include buffers,
47
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
amino acids, such as glycine and lysine, carbohydrates, such as dextrose,
mannose, galactose,
fructose, lactose, sucrose, maltose, sorbitol, mannitol, etc.
[00130]
In further embodiments, the present invention may concern the use of a
pharmaceutical lipid vehicle composition comprising one or more lipids and an
aqueous
solvent. As used herein, the term "lipid" will be defined to include any of a
broad range of
substances that is characteristically insoluble in water and extractable with
an organic
solvent. This broad class of compounds is well known to those of skill in the
art, and as the
term "lipid" is used herein, it is not limited to any particular structure.
Examples include
compounds that contain long-chain aliphatic hydrocarbons and their
derivatives. A lipid may
be naturally occurring or synthetic (i.e., designed or produced by man).
However, a lipid is
usually a biological substance. Biological lipids are well known in the art,
and include for
example, neutral fats, phospholipids, phosphoglycerides, steroids, terpenes,
lysolipids,
glycosphingolipids, glycolipids, sulphatides, lipids with ether- and ester-
linked fatty acids,
polymerizable lipids, and combinations thereof. Of course, compounds other
than those
specifically described herein that are understood by one of skill in the art
as lipids are also
encompassed by the compositions and methods.
[00131]
One of ordinary skill in the art would be familiar with the range of
techniques that can be employed for dispersing a composition in a lipid
vehicle. For
example, the therapeutic agent may be dispersed in a solution containing a
lipid, dissolved
with a lipid, emulsified with a lipid, mixed with a lipid, combined with a
lipid, covalently
bonded to a lipid, contained as a suspension in a lipid, contained or
complexed with a micelle
or liposome, or otherwise associated with a lipid or lipid structure by any
means known to
those of ordinary skill in the art. The dispersion may or may not result in
the formation of
liposomes.
[00132] The term
"unit dose" or "dosage" refers to physically discrete units
suitable for use in a subject, each unit containing a predetermined quantity
of the therapeutic
composition calculated to produce the desired responses discussed above in
association with
its administration, i.e., the appropriate route and treatment regimen. The
quantity to be
administered, both according to number of treatments and unit dose, depends on
the effect
desired. The actual dosage amount of a composition of the present invention
administered to
a patient or subject can be determined by physical and physiological factors,
such as body
weight, the age, health, and sex of the subject, the type of disease being
treated, the extent of
48
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
disease penetration, previous or concurrent therapeutic interventions,
idiopathy of the patient,
the route of administration, and the potency, stability, and toxicity of the
particular
therapeutic substance. For example, a dose may also comprise from about 1
jig/kg/body
weight to about 1.000 mg/kg/body weight (this such range includes intervening
doses) or
more per administration, and any range derivable therein. In non-limiting
examples of a
derivable range from the numbers listed herein, a range of about 5 jig/kg/body
weight to
about 100 mg/kg/body weight, about 5 jig/kg/body weight to about 500
mg/kg/body weight,
etc., can be administered. The practitioner responsible for administration
will, in any event,
determine the concentration of active ingredient(s) in a composition and
appropriate dose(s)
for the individual subject.
1001331
The actual dosage amount of a composition administered to an animal
patient can be determined by physical and physiological factors, such as body
weight,
severity of condition, the type of disease being treated, previous or
concurrent therapeutic
interventions, idiopathy of the patient, and on the route of administration.
Depending upon
the dosage and the route of administration, the number of administrations of a
preferred
dosage and/or an effective amount may vary according to the response of the
subject. The
practitioner responsible for administration will, in any event, determine the
concentration of
active ingredient(s) in a composition and appropriate dose(s) for the
individual subject.
1001341
In certain embodiments, pharmaceutical compositions may comprise,
for example, at least about 0.1% of an active compound. In other embodiments,
an active
compound may comprise between about 2% to about 75% of the weight of the unit,
or
between about 25% to about 60%, for example, and any range derivable therein.
Naturally,
the amount of active compound(s) in each therapeutically useful composition
may be
prepared in such a way that a suitable dosage will be obtained in any given
unit dose of the
compound. Factors, such as solubility, bioavailability, biological half-life,
route of
administration, product shelf life, as well as other pharmacological
considerations, will be
contemplated by one skilled in the art of preparing such pharmaceutical
formulations, and as
such, a variety of dosages and treatment regimens may be desirable.
1001351
In other non-limiting examples, a dose may also comprise from about 1
microgram/kg/body weight, about 5 microgram/kg/body weight, about 10
microgram/kg/body weight, about 50 microgram/kg/body weight, about 100
microgram/kg/body weight, about 200 microgram/kg/body weight, about 350
49
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
microgram/kg/body weight, about 500 microgram/kg/body weight, about 1
milligram/kg/body weight, about 5 milligram/kg/body weight, about 10
milligram/kg/body
weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight,
about 200
milligram/kg/body weight, about 350 milligram/kg/body weight, about 500
milligram/kg/body weight, to about 1000 milligram/kg/body weight or more per
administration, and any range derivable therein. In non-limiting examples of a
derivable
range from the numbers listed herein, a range of about 5 milligram/kg/body
weight to about
100 milligram/kg/body weight, about 5 microgram/kg/body weight to about 500
milligram/kg/body weight, etc., can be administered, based on the numbers
described above.
IV. Nucleic Acids and Vectors
1001361 In certain aspects of the invention, nucleic acid
sequences encoding a
therapeutic protein or a fusion protein containing a therapeutic protein may
be disclosed.
Depending on which expression system is used, nucleic acid sequences can be
selected based
on conventional methods. For example, the respective genes or variants thereof
may be
codon optimized for expression in a certain system. Various vectors may be
also used to
express the protein of interest. Exemplary vectors include, but are not
limited, plasmid
vectors, viral vectors, transposon, or liposome-based vectors.
V. Recombinant Proteins, Inhibitory RNAs, and Gene Editing Systems
A. Recombinant Proteins
1001371 Some embodiments concern recombinant proteins and polypeptides.
Particular embodiments concern a recombinant protein or polypeptide that
exhibits at least
one therapeutic activity. In some embodiments, a recombinant protein or
polypeptide may be
a therapeutic antibody. In some aspects, a therapeutic antibody may be an
antibody that
specifically or selectively binds to an intracellular protein. In further
aspects, the protein or
polypeptide may be modified to increase serum stability. Thus, when the
present application
refers to the function or activity of "modified protein" or a "modified
polypeptide," one of
ordinary skill in the art would understand that this includes, for example, a
protein or
polypeptide that possesses an additional advantage over the unmodified protein
or
polypeptide. It is specifically contemplated that embodiments concerning a
"modified
protein" may be implemented with respect to a "modified polypeptide," and vice
versa.
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
[00138]
Recombinant proteins may possess deletions and/or substitutions of
amino acids; thus, a protein with a deletion, a protein with a substitution,
and a protein with a
deletion and a substitution are modified proteins. In some embodiments, these
proteins may
further include insertions or added amino acids, such as with fusion proteins
or proteins with
linkers, for example. A "modified deleted protein" lacks one or more residues
of the native
protein, but may possess the specificity and/or activity of the native
protein. A "modified
deleted protein" may also have reduced immunogenicity or antigenicity. An
example of a
modified deleted protein is one that has an amino acid residue deleted from at
least one
antigenic region that is, a region of the protein determined to be antigenic
in a particular
organism, such as the type of organism that may be administered the modified
protein.
[00139]
Substitution or replacement variants typically contain the exchange of
one amino acid for another at one or more sites within the protein and may be
designed to
modulate one or more properties of the polypeptide, particularly its effector
functions and/or
bioavailability. Substitutions may or may not be conservative, that is, one
amino acid is
replaced with one of similar shape and charge. Conservative substitutions are
well known in
the art and include, for example, the changes of: alanine to serine; arginine
to lysine;
asparagine to glutamine or histidine; aspartate to glutamate; cysteine to
serine; glutamine to
asparagine; glutamate to aspartate; glycine to proline; histidine to
asparagine or glutamine;
isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to
arginine; methionine
to leucine or isoleucine; phenylalanine to tyrosine, leucine, or methionine;
serine to
threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan
or
phenylalanine; and valine to isoleucine or leucine.
1001401
In addition to a deletion or substitution, a modified protein may
possess an insertion of residues, which typically involves the addition of at
least one residue
in the polypeptide. This may include the insertion of a targeting peptide or
polypeptide or
simply a single residue. Terminal additions, called fusion proteins, are
discussed below.
[00141]
The term "biologically functional equivalent" is well understood in the
art and is further defined in detail herein. Accordingly, sequences that have
between about
70% and about 80%, or between about 81% and about 90%, or even between about
91% and
about 99% of amino acids that are identical or functionally equivalent to the
amino acids of a
control polypeptide are included, provided the biological activity of the
protein is maintained.
51
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
A recombinant protein may be biologically functionally equivalent to its
native counterpart in
certain aspects.
1001421
It also will be understood that amino acid and nucleic acid sequences
may include additional residues, such as additional N- or C-terminal amino
acids or 5' or 3'
sequences, and yet still be essentially as set forth in one of the sequences
disclosed herein, so
long as the sequence meets the criteria set forth above, including the
maintenance of
biological protein activity where protein expression is concerned. The
addition of terminal
sequences particularly applies to nucleic acid sequences that may, for
example, include
various non-coding sequences flanking either of the 5' or 3' portions of the
coding region or
may include various internal sequences, i.e., introns, which are known to
occur within genes.
1001431
As used herein, a protein or peptide generally refers, but is not limited
to, a protein of greater than about 200 amino acids, up to a full length
sequence translated
from a gene; a polypeptide of greater than about 100 amino acids; and/or a
peptide of from
about 3 to about 100 amino acids. For convenience, the terms "protein,"
"polypeptide," and
"peptide are used interchangeably herein.
1001441
As used herein, an "amino acid residue" refers to any naturally
occurring amino acid, any amino acid derivative, or any amino acid mimic known
in the art.
In certain embodiments, the residues of the protein or peptide are sequential,
without any
non-amino acids interrupting the sequence of amino acid residues. In other
embodiments, the
sequence may comprise one or more non-amino acid moieties. In particular
embodiments,
the sequence of residues of the protein or peptide may be interrupted by one
or more non-
amino acid moieties.
1001451
Accordingly, the term "protein or peptide" encompasses amino acid
sequences comprising at least one of the 20 common amino acids found in
naturally
occurring proteins, or at least one modified or unusual amino acid.
1001461
Certain embodiments of the present invention concern fusion proteins.
These molecules may have a therapeutic protein linked at the N- or C-terminus
to a
heterologous domain. For example, fusions may also employ leader sequences
from other
species to permit the recombinant expression of a protein in a heterologous
host. Another
useful fusion includes the addition of a protein affinity tag, such as a serum
albumin affinity
tag or six histidine residues, or an immunologically active domain, such as an
antibody
52
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
epitope, preferably cleavable, to facilitate purification of the fusion
protein. Non-limiting
affinity tags include polyhistidine, chitin binding protein (CBP), maltose
binding protein
(MBP), and glutathione-S-transferase (GST).
1001471
In a particular embodiment, the therapeutic protein may be linked to a
peptide that increases the in vivo half-life, such as an XTEN polypeptide
(Schellenberger et
al., 2009), IgG Fc domain, albumin, or albumin binding peptide.
1001481
Methods of generating fusion proteins are well known to those of skill
in the art. Such proteins can be produced, for example, by de novo synthesis
of the complete
fusion protein, or by attachment of the DNA sequence encoding the heterologous
domain,
followed by expression of the intact fusion protein.
1001491
Production of fusion proteins that recover the functional activities of
the parent proteins may be facilitated by connecting genes with a bridging DNA
segment
encoding a peptide linker that is spliced between the polypeptides connected
in tandem. The
linker would be of sufficient length to allow proper folding of the resulting
fusion protein.
B. Inhibitory RNAs
1001501
siNA (e.g., siRNA) are well known in the art. For example, siRNA and
double-stranded RNA have been described in U.S. Pat. Nos. 6,506,559 and
6,573,099, as well
as in U.S. Patent Applications 2003/0051263, 2003/0055020, 2004/0265839,
2002/0168707,
2003/0159161, and 2004/0064842, all of which are herein incorporated by
reference in their
entirety.
1001511
Within a siNA, the components of a nucleic acid need not be of the
same type or homogenous throughout (e.g., a siNA may comprise a nucleotide and
a nucleic
acid or nucleotide analog). Typically, siNA form a double-stranded structure;
the double-
stranded structure may result from two separate nucleic acids that are
partially or completely
complementary. In certain embodiments of the present invention, the siNA may
comprise
only a single nucleic acid (polynucleotide) or nucleic acid analog and form a
double-stranded
structure by complementing with itself (e.g., forming a hairpin loop). The
double-stranded
structure of the siNA may comprise 16, 20, 25, 30, 35, 40, 45, 50, 60, 65, 70,
75, 80, 85, 90,
100, 150, 200, 250, 300, 350, 400, 450, 500 or more contiguous nucleobases,
including all
ranges therein. The siNA may comprise 17 to 35 contiguous nucleobases, more
preferably 18
53
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
to 30 contiguous nucleobases, more preferably 19 to 25 nucleobases, more
preferably 20 to
23 contiguous nucleobases, or 20 to 22 contiguous nucleobases, or 21
contiguous nucleobases
that hybridize with a complementary nucleic acid (which may be another part of
the same
nucleic acid or a separate complementary nucleic acid) to form a double-
stranded structure.
[00152] Agents
of the present invention useful for practicing the methods of the
present invention include, but are not limited to siRNAs. Typically,
introduction of double-
stranded RNA (dsRNA), which may alternatively be referred to herein as small
interfering
RNA (siRNA), induces potent and specific gene silencing, a phenomena called
RNA
interference or RNAi. RNA interference has been referred to as
"cosuppression," "post-
transcriptional gene silencing," "sense suppression," and "quelling." RNAi is
an attractive
biotechnological tool because it provides a means for knocking out the
activity of specific
genes.
1001531
In designing RNAi there are several factors that need to be considered,
such as the nature of the siRNA, the durability of the silencing effect, and
the choice of
delivery system. To produce an RNAi effect, the siRNA that is introduced into
the organism
will typically contain exonic sequences. Furthermore, the RNAi process is
homology
dependent, so the sequences must be carefully selected so as to maximize gene
specificity,
while minimizing the possibility of cross-interference between homologous, but
not gene-
specific sequences. Preferably the siRNA exhibits greater than 80%, 85 A, 90
A, 95%, 98%,
or even 100% identity between the sequence of the siRNA and the gene to be
inhibited.
Sequences less than about 80% identical to the target gene are substantially
less effective.
Thus, the greater homology between the siRNA and the gene to be inhibited, the
less likely
expression of unrelated genes will be affected.
[00154]
In addition, the size of the siRNA is an important consideration. In
some embodiments, the present invention relates to siRNA molecules that
include at least
about 19-25 nucleotides and are able to modulate gene expression. In the
context of the
present invention, the siRNA is preferably less than 500, 200, 100, 50, or 25
nucleotides in
length. More preferably, the siRNA is from about 19 nucleotides to about 25
nucleotides in
length.
[00155] A target
gene generally means a polynucleotide comprising a region
that encodes a polypeptide, or a polynucleotide region that regulates
replication, transcription,
54
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
or translation or other processes important to expression of the polypeptide,
or a
polynucleotide comprising both a region that encodes a polypeptide and a
region operably
linked thereto that regulates expression. Any gene being expressed in a cell
can be targeted.
Preferably, a target gene is one involved in or associated with the
progression of cellular
activities important to disease or of particular interest as a research
object.
1001561
siRNA can be obtained from commercial sources, natural sources, or
can be synthesized using any of a number of techniques well-known to those of
ordinary skill
in the art. For example, one commercial source of predesigned siRNA is Ambion
, Austin,
Tex. Another is Qiagene (Valencia, Calif.). An inhibitory nucleic acid that
can be applied in
the compositions and methods of the present invention may be any nucleic acid
sequence that
has been found by any source to be a validated downregulator of a protein of
interest.
Without undue experimentation and using the disclosure of this invention, it
is understood
that additional siRNAs can be designed and used to practice the methods of the
invention.
1001571
The siRNA may also comprise an alteration of one or more
nucleotides. Such alterations can include the addition of non-nucleotide
material, such as to
the end(s) of the 19 to 25 nucleotide RNA or internally (at one or more
nucleotides of the
RNA). In certain aspects, the RNA molecule contains a 3'-hydroxyl group.
Nucleotides in the
RNA molecules of the present invention can also comprise non-standard
nucleotides,
including non-naturally occurring nucleotides or deoxyribonucleotides. The
double-stranded
oligonucleotide may contain a modified backbone, for example,
phosphorothioate,
phosphorodithioate, or other modified backbones known in the art, or may
contain non-
natural internucleoside linkages. Additional modifications of siRNAs (e.g., 2'-
0-methyl
ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, "universal base"
nucleotides, 5-C-methyl
nucleotides, one or more phosphorothioate internucleotide linkages, and
inverted deoxyabasic
residue incorporation) can be found in U.S. Application Publication
2004/0019001 and U.S.
Pat. No. 6,673,611 (each of which is incorporated by reference in its
entirety). Collectively,
all such altered nucleic acids or RNAs described above are referred to as
modified siRNAs.
C. Gene Editing Systems
1001581
In general, "CRISPR system" refers collectively to transcripts and
other elements involved in the expression of or directing the activity of
CRISPR-associated
("Cas") genes, including sequences encoding a Cas gene, a tracr (trans-
activating CRISPR)
sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence
(encompassing
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
a "direct repeat" and a tracrRNA-processed partial direct repeat in the
context of an
endogenous CRISPR system), a guide sequence (also referred to as a "spacer" in
the context
of an endogenous CRISPR system), and/or other sequences and transcripts from a
CRISPR
locus.
1001591 The
CRISPR/Cas nuclease or CRISPR/Cas nuclease system can
include a non-coding RNA molecule (guide) RNA, which sequence-specifically
binds to
DNA, and a Cas protein (e.g., Cas9), with nuclease functionality (e.g., two
nuclease
domains). One or more elements of a CRISPR system can derive from a type I,
type II, or
type HI CRISPR system, e.g., derived from a particular organism comprising an
endogenous
CRISPR system, such as Streptococcus pyogenes.
1001601
In some aspects, a Cas nuclease and gRNA (including a fusion of
crRNA specific for the target sequence and fixed tracrRNA) are introduced into
the cell. In
general, target sites at the 5' end of the gRNA target the Cas nuclease to the
target site, e.g.,
the gene, using complementary base pairing. The target site may be selected
based on its
location immediately 5' of a protospacer adjacent motif (PAM) sequence, such
as typically
NGG, or NAG. In this respect, the gRNA is targeted to the desired sequence by
modifying
the first 20, 19, 18, 17, 16, 15, 14, 14, 12, 11, or 10 nucleotides of the
guide RNA to
correspond to the target DNA sequence. In general, a CRISPR system is
characterized by
elements that promote the formation of a CRISPR complex at the site of a
target sequence.
Typically, "target sequence" generally refers to a sequence to which a guide
sequence is
designed to have complementarity, where hybridization between the target
sequence and a
guide sequence promotes the formation of a CRISPR complex. Full
complementarity is not
necessarily required, provided there is sufficient complementarity to cause
hybridization and
promote formation of a CRISPR complex.
1001611 The
CRISPR system can induce double stranded breaks (DSBs) at the
target site, followed by disruptions as discussed herein. In other
embodiments, Cas9 variants,
deemed "nickases," are used to nick a single strand at the target site. Paired
nickases can be
used, e.g., to improve specificity, each directed by a pair of different gRNAs
targeting
sequences such that upon introduction of the nicks simultaneously, a 5'
overhang is
introduced. In other embodiments, catalytically inactive Cas9 is fused to a
heterologous
effector domain such as a transcriptional repressor or activator, to affect
gene expression.
56
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
1001621
The target sequence may comprise any polynucleotide, such as DNA
or RNA polynucleotides. The target sequence may be located in the nucleus or
cytoplasm of
the cell, such as within an organelle of the cell. Generally, a sequence or
template that may be
used for recombination into the targeted locus comprising the target sequences
is referred to
as an "editing template" or "editing polynucleotide" or "editing sequence". In
some aspects,
an exogenous template polynucleotide may be referred to as an editing
template. In some
aspects, the recombination is homologous recombination.
1001631
Typically, in the context of an endogenous CRISPR system, formation
of the CRISPR complex (comprising the guide sequence hybridized to the target
sequence
and complexed with one or more Cas proteins) results in cleavage of one or
both strands in or
near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs
from) the target
sequence. The tracr sequence, which may comprise or consist of all or a
portion of a wild-
type tracr sequence (e.g. about or more than about 20, 26, 32, 45, 48, 54, 63,
67, 85, or more
nucleotides of a wild-type tracr sequence), may also form part of the CRISPR
complex, such
as by hybridization along at least a portion of the tracr sequence to all or a
portion of a tracr
mate sequence that is operably linked to the guide sequence. The tracr
sequence has sufficient
complementarity to a tracr mate sequence to hybridize and participate in
formation of the
CRISPR complex, such as at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of
sequence
complementarity along the length of the tracr mate sequence when optimally
aligned.
1001641 One or
more vectors driving expression of one or more elements of the
CRISPR system can be introduced into the cell such that expression of the
elements of the
CRISPR system direct formation of the CRISPR complex at one or more target
sites.
Components can also be delivered to cells as proteins and/or RNA. For example,
a Cas
enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence
could each be
operably linked to separate regulatory elements on separate vectors.
Alternatively, two or
more of the elements expressed from the same or different regulatory elements,
may be
combined in a single vector, with one or more additional vectors providing any
components
of the CRISPR system not included in the first vector. The vector may comprise
one or more
insertion sites, such as a restriction endonuclease recognition sequence (also
referred to as a
"cloning site"). In some embodiments, one or more insertion sites are located
upstream
and/or downstream of one or more sequence elements of one or more vectors.
When multiple
57
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
different guide sequences are used, a single expression construct may be used
to target
CRISPR activity to multiple different, corresponding target sequences within a
cell.
1001651
A vector may comprise a regulatory element operably linked to an
enzyme-coding sequence encoding the CRISPR enzyme, such as a Cas protein. Non-
limiting
examples of Cas proteins include Casl, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6,
Cas7, Cas8,
Cas9 (also known as Csnl and Csx12), Cas10, Csy 1, Csy2, Csy3, Csel, Cse2,
Cscl, Csc2,
Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl,
Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csxl, Csx15, Csfl, Cst'2,
Csf3, Csf4,
homologs thereof, or modified versions thereof These enzymes are known; for
example, the
amino acid sequence of S. pyogenes Cas9 protein may be found in the SwissProt
database
under accession number Q99ZW2.
[00166]
The CRISPR enzyme can be Cas9 (e.g., from S. pyogenes or S.
pneumonia). The CRISPR enzyme can direct cleavage of one or both strands at
the location
of a target sequence, such as within the target sequence and/or within the
complement of the
target sequence. The vector can encode a CRISPR enzyme that is mutated with
respect to a
corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the
ability to
cleave one or both strands of a target polynucleotide containing a target
sequence. For
example, an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic
domain of Cas9
from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a
nickase
(cleaves a single strand). In some embodiments, a Cas9 nickase may be used in
combination
with guide sequence(s), e.g., two guide sequences, which target respectively
sense and
antisense strands of the DNA target. This combination allows both strands to
be nicked and
used to induce 1=THEI or IlDR.
1001671
In some embodiments, an enzyme coding sequence encoding the
CRISPR enzyme is codon optimized for expression in particular cells, such as
eukaryotic
cells. The eukaryotic cells may be those of or derived from a particular
organism, such as a
mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-
human primate.
In general, codon optimization refers to a process of modifying a nucleic acid
sequence for
enhanced expression in the host cells of interest by replacing at least one
codon of the native
sequence with codons that are more frequently or most frequently used in the
genes of that
host cell while maintaining the native amino acid sequence. Various species
exhibit particular
bias for certain codons of a particular amino acid. Codon bias (differences in
codon usage
58
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
between organisms) often correlates with the efficiency of translation of
messenger RNA
(mRNA), which is in turn believed to be dependent on, among other things, the
properties of
the codons being translated and the availability of particular transfer RNA
(tRNA) molecules.
The predominance of selected tRNAs in a cell is generally a reflection of the
codons used
most frequently in peptide synthesis. Accordingly, genes can be tailored for
optimal gene
expression in a given organism based on codon optimization.
1001681
In general, a guide sequence is any polynucleotide sequence having
sufficient complementarity with a target polynucleotide sequence to hybridize
with the target
sequence and direct sequence-specific binding of the CRISPR complex to the
target
sequence. In some embodiments, the degree of complementarity between a guide
sequence
and its corresponding target sequence, when optimally aligned using a suitable
alignment
algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%,
97.5%, 99%,
or more.
1001691
Optimal alignment may be determined with the use of any suitable
algorithm for aligning sequences, non-limiting example of which include the
Smith-
Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the
Burrows-
Wheeler Transform (e.g. the Burrows Wheeler Aligner), Clustal W, Clustal X,
BLAT,
Novoalign (Novocraft Technologies, ELAND (IIlumina, San Diego, Calif.), SOAP
(available
at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).
1001701 The
CRISPR enzyme may be part of a fusion protein comprising one
or more heterologous protein domains. A CRISPR enzyme fusion protein may
comprise any
additional protein sequence, and optionally a linker sequence between any two
domains.
Examples of protein domains that may be fused to a CRISPR enzyme include,
without
limitation, epitope tags, reporter gene sequences, and protein domains having
one or more of
the following activities: methylase activity, demethylase activity,
transcription activation
activity, transcription repression activity, transcription release factor
activity, histone
modification activity, RNA cleavage activity and nucleic acid binding
activity. Non-limiting
examples of epitope tags include histidine (His) tags, V5 tags, FLAG tags,
influenza
hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags.
Examples of
reporter genes include, but are not limited to, glutathione-5- transferase
(GST), horseradish
peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta galactosidase,
beta-
glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan
fluorescent
59
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins
including blue
fluorescent protein (BFP). A CRISPR enzyme may be fused to a gene sequence
encoding a
protein or a fragment of a protein that bind DNA molecules or bind other
cellular molecules,
including but not limited to maltose binding protein (MBP), S-tag, Lex A DNA
binding
domain (DBD) fusions, GAL4A DNA binding domain fusions, and herpes simplex
virus
(HSV) BP16 protein fusions. Additional domains that may form part of a fusion
protein
comprising a CRISPR enzyme are described in US 20110059502, incorporated
herein by
reference.
VI. Kits and Diagnostics
1901711 In various aspects of the invention, a kit is envisioned
containing the
necessary components to purify exosomes from a body fluid or tissue culture
medium. In
other aspects, a kit is envisioned containing the necessary components to
isolate exosomes
and transfect them with a therapeutic nucleic acid, therapeutic protein, or a
nucleic acid
encoding a therapeutic protein therein. The kit may comprise one or more
sealed vials
containing any of such components. In some embodiments, the kit may also
comprise a
suitable container means, which is a container that will not react with
components of the kit,
such as an eppendorf tube, an assay plate, a syringe, a bottle, or a tube. The
container may be
made from sterilizable materials such as plastic or glass. The kit may further
include an
instruction sheet that outlines the procedural steps of the methods set forth
herein, and will
follow substantially the same procedures as described herein or are known to
those of
ordinary skill. The instruction information may be in a computer readable
media containing
machine-readable instructions that, when executed using a computer, cause the
display of a
real or virtual procedure of purifying exosomes from a sample and transfecting
a therapeutic
nucleic acid therein, expressing a recombinant protein therein, or
electroporating a
recombinant protein therein.
VII. Examples
1001721 The following examples are included to demonstrate preferred
embodiments of the invention. It should be appreciated by those of skill in
the art that the
techniques disclosed in the examples which follow represent techniques
discovered by the
inventor to function well in the practice of the invention, and thus can be
considered to
constitute preferred modes for its practice. However, those of skill in the
art should, in light
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
of the present disclosure, appreciate that many changes can be made in the
specific
embodiments which are disclosed and still obtain a like or similar result
without departing
from the spirit and scope of the invention.
Materials and Methods
1001731 Cell
Culture. MCF7, MDA-MB231, E10, HDF, and BJ human cell
lines, as well as the Nil-1 3T3 murine cell line were cultured in DME/VI with
100/o FBS. The
4T1 and 67NR murine cell lines were cultured in RPMI with 100/o FBS. MCF10A
human
mammary epithelial cell line was cultured in DMEM/F12 media with 5% Horse
Serum, 20
ng/ml EGF, 0.5 mg/ml Hydrocortisone, 100 ng/ml Cholera Toxin, and 10 gg/ml
Insulin. All
cells originated from the American Type Culture Collection ¨ ATCC.
1901741
Isolation and purification of exosomes. Exosomes were purified by
differential centrifugation as described previously (Luga et al., 2012; Thery
et al., 2006).
Supernatant from cells cultured for 48 h were subjected to sequential
centrifugation steps of
800g and 2000g. The resulting supernatant was filtered using a 0.2 gm filter.
A pellet was
recovered after ultracentrifugation in an SW40Ti swinging bucket rotor at
100,000g for 3 h
(Beckman-Coulter). Supernatant was removed and the pellet was re-suspended in
PBS,
followed by a second ultracentrifugation at 100,000g for 3 h. The resulting
pellet was
analyzed for exosomes content. Exosomes used for RNA extraction were
resuspended in 500
gL of Trizol; exosomes used for protein extraction were resuspended in
Urea/SDS lysis
buffer (8M Urea, 2.5% SDS, 5 gg/mL leupeptin, 1 gg/mL pepstatin, and 1 mM
phenylmethylsulphonyl fluoride); and exosomes used for delivery to cells were
re-suspended
in serum-free DMEM culture medium. For other applications, isolated exosomes
were
processed as described in the remaining experimental procedures.
1001751
Imaging Flow cytometry analysis (ImageStream). Exosomes were
attached to 4 gm aldehyde/sulfate latex beads (Invitrogen, Carlsbad, CA, USA)
in NaC1 0.9%
saline solution (B. Braun Medical Inc, Bethlehem, PA, USA). The reaction was
stopped with
100 mM glycine and 2% BSA in saline and blocked with 10% BSA with rotation at
room
temperature for 30 min. After washing in saline/2% BSA, bead-bound exosomes
were
centrifuged for 2 min at 10,000 rpm and incubated with 1:200 anti-CD63 (Santa
Cruz), anti-
CD9 (Abcam), anti-CD81 (Abcam), anti-CD82 (Abcam), and anti-FLOT1 (Santa Cruz)
for
30 min rotating at 4 C. Beads were centrifuged for 2 min at 10,000 rpm, washed
in saline/2%
61
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
BSA and incubated with 1:400 Alexa-488 secondary antibodies (Life
Technologies, NY
14072) for 30 min rotating at 4 C. After three washes the beads were
resuspended in saline
solution and analyzed on the ImageStream (Merck Millipore). The image
acquisition gain
(%) was set using a positive sample, in order to avoid pixel saturation. Image
processing was
done using the IDEAS (Merck Millipore) software. Gates were defined to
exclude out-of-
focus beads and select single beads. Alexa-488 positive bead gates were
defined on the
negative control sample. Percentage of positive beads is relative to the
number of events
analyzed per sample.
1001761
immunogold Labeling and Electron Microscopy. Pelleted exosomes
were fixed by re-suspending in 2.5% Glutaraldehyde in 0.1 M Phosphate buffer.
Fixed
specimens at an optimal concentration were placed onto a 300 mesh
carbon/formvar coated
grids and allowed to absorb to the formvar for a minimum of 1 minute. For
immunogold
staining the grids were placed into a blocking buffer for a
block/permeabilization step for 1 h.
Without rinsing, the grids were immediately placed into the primary antibody
at the
appropriate dilution overnight at 4 C (polyclonal anti-GFP 1:10, Abcam). As
controls, some
grids were not exposed to the primary antibody. The next day all grids were
rinsed with PBS
and floated on drops of the appropriate secondary antibody attached with 10 nm
gold
particles (AURION, Hatfield, PA) for 2 h at room temperature. Grids were
rinsed with PBS
and placed in 2.5% Glutaraldehyde in 0.1 M Phosphate buffer for 15 minutes.
After rinsing in
PBS and distilled water, the grids were allowed to dry and stained for
contrast using uranyl
acetate. The samples were viewed with a Tecnai Bio Twin transmission electron
microscope
(FEI, Hillsboro, OR) and images were taken with an AMT CCD Camera (Advanced
Microscopy Techniques, Danvers, MA).
1001771
EGF stimulation of exosomes. Exosomes were collected from MBA-
MB-23I cells as described above. 1-3 x 109 exosomes were resuspended in 1 mL
PBS and
different concentrations of rEGF were added. Exosomes suspensions, with or
without EGF,
were incubated at 37 C with 5% CO2 for 15 minutes and then placed on ice.
Three replicates
were pooled and PBS was added to a total volume of 11 mL and stimulated
exosomes were
collected through ultracentrifugation in an SW40Ti swinging bucket rotor at
100,000g for 3
h, as before. Protein extracts were collected from the pelleted stimulated
exosomes in
Urea/SDS lysis buffer (with 100 mM NaF and 1 mM Na0V4) for immunoblot analysis
or a
Triton X-100 buffer (150 mM NaCl, 1% (v/v) Triton X-100, 10 mM Na2HPO4, 2 mM
62
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
KH2PO4, pH 7.4, 50 mM 6-aminohexanoic acid, 10 mM EDTA, 5 mM N-ethylmaleimide,
5
mM benzamidine, 5 1.1g/mL leupeptin, 1 lig/mL pepstatin, 1 mM
phenylmethylsulphonyl
fluoride, 100 mM NaF, and 1 mM Na0V4) for immunoprecipitation assays.
1001781
Protein Western Blot and Antibodies. Exosomes protein extracts were
loaded according to a Bicinchoninic Acid (BCA) protein assay kit (Pierce,
Thermo Fisher
Scientific) onto acrylamide gels and transferred onto PVDF membranes
(ImmobilonP) by wet
electrophoretic transfer. Blots were blocked for 1 h at RT with 5% non-fat dry
milk in
TBS/0.05% Tween20 and incubated overnight at 4 C with the following primary
antibodies:
1:300 anti-CD9 ab92726 (Abeam); 1:300 anti-TSG101 ab83 (Abeam); 1:1000 anti-
EGFR
4267S (CST); 1:300 anti-CD63 sc-365604, (Santa Cruz); 1:200 anti-CD81 cs-
166029 (Santa
Cruz); 1:1000 anti-pEGFR Tyr1068 3777S (CST); 1:2000 anti-GRB2 610111 (BD
Biosciences); 1:1000 anti-Shc 06-203 (Millipore); 1:5000 anti-GFP ab13970
(Abeam);
1:1000 GAPDH ab9483 (Abcam); 1:10,000 HRPconjugated I3-actin a3854 (Sigma);
1:400
anti-RNA Pol II cat#39097 (Active Motif); 1:500 anti-Hsp90 ab1429 (Abcam);
1:500 anti-
elF3A ab86146 (Abeam); 1:500 anti-elF4A1 ab31217 (Abeam). HRP-conjugated
secondary
antibodies (Sigma, 1:2000) were incubated for 1 h at room temperature. Washes
after
antibody incubations were done on an orbital shaker, four times at 10 min
intervals, with 1 x
TBS 0.05% Tween20. Blots were developed with chemiluminescent reagents from
Pierce.
1001791
Immunoprecipitation. Exosomes and cell protein extracts gently rocked
at 4 C for 2 h. The lysates were centrifuged at 14,000g in a pre-cooled
centrifuge for 15
minutes and the pellet was discarded. Protein A or G agarose/sepharose beads
were washed
twice with PBS and restored to a 50% slurry with PBS. A bead/slurry mix (100
ill) was added
to 100 lig of exosomes protein extracts or 20 lig of cells protein extracts
and incubated at 4 C
for 10 min. Beads were removed by centrifugation at 14,000g at 4 C for 10
minutes and
pellets discarded. 10 tig of anti-elF4A1 antibody was added to 100 AL of
exosomal lysate and
incubated overnight at 4 C on an orbital shaker. 100 pL of Protein A or G
agarose/sepharose
bead slurry were added and left at 4 C overnight. After centrifugation the
supernatant was
discarded and beads washed 3 times with ice-cold Urea/SDS buffer. The
agarose/sepharose
beads were boiled for 5 minutes to dissociate the immunocomplexes from the
beads. The
beads were collected by centrifugation and immunoblot was performed on the
supernatant.
1001801
Identification of amino acids using UPW-MS. Exosomes were mixed
with 200 p1. of methanol spiked with the Internal Standard tryptophan-d5 and
incubated for
63
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
an hour at -20 C. After centrifugation at 16,000g for 15 min at 4 C, 190 RL
of the
supernatants was collected and the solvent removed. Dried extracts were
reconstituted in 15
RL of methanol, of which 10 IlL were transferred to microtubes and
derivatized.
Chromatographic separation and mass spectrometric detection conditions
employed are
summarized in Table 1. The mass range, 50 - 1000 m/z, was calibrated with
cluster ions of
sodium formate. An appropriate test mixture of standard compounds was analyzed
before and
after the entire set of randomized duplicated sample injections, in order to
examine the
retention time stability and sensitivity of the LC/MS system throughout the
course of the run.
Table 1. Chromatographic conditions for the amino acids platform.
System SQL)
Column type UPLC BEH C18, 1.0 x 100 mm, 1.7 um
Flow rate 0.14 ml/min
Solvent A H20 + 10mM Ammonium Bicarbonate
(+N1140H until pH: 8.8)
Solvent B CAN
(%B), time 2%, 0 min
(%B), time 8%, 6.5 min
(%B), time 20%, 10 min
(%B), time 30%, 11 min
(%B), time 99.9%, 12 min
(%B), time 2%, 14 min
Column temperature 40 C
Injection volume 1 I
Ionisation ES+
Source temperature 120 C
Nebulisation N2 flow 600 1/ hour
Nebulisation N2 temperature 350 C
Cone N2 flow 10 1/ hour
Capillary voltage 3.2 kV
Cone voltage 30 V
1001811 Data were processed using the TargetLynx application
manager for
MassLynx 4.1 software (Waters Corp., Milford, USA). A set of predefined
retention time,
mass-to-charge ratio pairs, Rt-m/z, corresponding to metabolites included in
the analysis are
fed into the program. Associated extracted ion chromatograms (mass tolerance
window =
0.05 Da) are then peak-detected and noise-reduced in both the LC and MS
domains such that
only true metabolite related features are processed by the software. A list of
chromatographic
peak areas is then generated for each sample injection, using the Rt-m/z data
pairs (retention
time tolerance = 6 s) as identifiers. Normalization factors were calculated
for each metabolite
64
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
by dividing their intensities in each sample by the recorded intensity of the
internal standard
in that same sample.
1001821
Digital ql)CR. Digital RNA reaction was performed using 3 ng of
cDNA, TaqMan Universal Master mix and QuantStudioTm 3D Digital PCR Master Mix
vi
(Applied Biosystems) according to manufacture recommendations. Using
QuantStudioTm 3D
Digital PCR Chip Loader (Applied Biosystems) a total of 14.5
of the mix were loaded to
a QuantStudioTm 3D Digital PCR 20K Chip Kit vi (Applied Biosystems). PCR
reaction was
performed on GeneAmp 9700 (Applied Biosystems) following manufacture
protocol. The
chips were imaged using QuantStudion4 3D Digital PCR Instrument (Applied
Biosystems).
Table 2. Digital PCR Primers.
Name Sequence
SEQ ID
NO
Met AGTAGGTAGCGCGTCAGTCTCATAATCTGAAGGTCGTGAGT 1
TCGATCCTCACACGGGGCA
Leu AGGCGCTGGATTAAGGCTCCAGTCTCTTCGGAGGCGTGGGT 2
TCGAATCCCACCGCTGCCA
Val AGTGGTTATCACGTTCGCCTAACACGCGAAAGGTCCCCGGT 3
TCGAAACCGGGCGGAAACA
Ser GGC G ATGGACTAGA A ATC C ATMGGGITTCC CCG CGCAGGT 4
TCGA ATCCTGCCGACTACG
1001831
[355:Imethionine labeling of exosomes. Exosomes were isolated as
previously described and resuspended in methionine-free culture medium without
FBS with
0.1 ¨ 1.0 mCi/m1 trans label [355]-L-methionine (Amersham Biosciences) and
incubated
overnight. Alternatively exosomes were incubated in the presence of
cycloheximide (Sigma,
100 1.tg/mL). Exosomes were pelleted, washed in ice-cold PBS and resuspended
in Urea/SDS
lysis buffer as previously described. Protein extracts were quantified using a
BCA protein
assay kit, run on acrylamide gels and transferred onto PVDF membranes
(ImmobilonP) by
wet electrophoretic transfer, after which the membranes were analyzed by
autoradiography
using the EN3HANCE autoradiography enhancer according to the manufacturer's
instructions (Perkin-Elmer).
1001841
Real-time PSI? Analysis. DNase treated RNA was retro-transcribed
with MultiScribe Reverse Transcriptase (Applied Biosystems) and oligo-d(T)
primers
following total exosomes RNA purification with Trizol (Invitrogen). Real-time
PCR was
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
performed on an ABI PRISM 7300HT Sequence Detection System Instrument using
SYBR
Green Master Mix (Applied Biosystems) and 13-actin as the control. 28S rRNA
primer pairs
(QF00318857) and 18S rRNA primer pairs (QF00530467) were purchased as ready
specific
primer pairs from Qiagen. Other primers are listed below. Each measurement was
performed
in triplicate. Threshold cycle (Rothstein et al.), the fractional cycle number
at which the
amount of amplified target reached a fixed threshold, was determined and
expression was
measured using the 2-ACt formula, as previously reported (Livak and
Schmittgen, 2001).
Table 3. qPCR Probes.
Name Sequence SEQ ID NO
p21 F 5' TACCCTTGTGCCTCGCTC AG3' 5
p21 R 5' GAGAA GATC AGCC GGCGTTT3 ' 6
lisa-Actin F 5'CATGTACGTICiCIATCCAGGC3 7
hsa-Actin R 5'CICCITAATGICACGCACGAT3' 8
mmu-Actin F 5' GGCIGTATTCCCCICCATCG3 ' 9
mmu-Actin R 5'CCAGITGGTAACAATGCCAIGT3' 10
[00185] Lysate
preparation for in vitro transcription and translation.
Exosomes and cell pellets were washed once in ice-cold PBS and resuspended in
an equal
volume of ice-cold 20 mM HEPES (pH 7.5), 100 mM potassium acetate, 1 mM
magnesium
acetate, 2 mM dithiothreitol, and 100 g/mL lysolecithin. After 1 min on ice,
they were again
pelleted and resuspended in an equal volume of ice-cold hypotonic extraction
buffer. After 5
min on ice, the lysates were disrupted by passing 10 times through a 26-gauge
needle
attached to a 1-mL syringe. The resulting homogenates were centrifuged at
1000g for 5 min
at 4 C. The supernatant was collected, and aliquots were frozen in liquid
nitrogen and stored
at ¨80 C for use in the in vitro translation assay.
[00186]
In vitro coupled transcription and translation. Lysates obtained from
cells and exosomes as previously described were used for in vitro translation
in reaction
volumes of 12 AL. Standard reaction conditions were as follows: cell lysate
(final protein
concentration 10 pg) or exosomes lysate (final concentration 100 ig), 1
pEMT7-GFP
cDNA expression plasmid, 20 mM HEPES-KOH (pH 7.6), 80 mM potassium acetate, 1
mM
magnesium acetate, 1 mM ATP, 0.12 m/VI GTP, 17 mM creatine phosphate, 0.1 mWmL
creatine phosphokinase, 2 mM dithiothreitol, 40 pM of each of the 20 amino
acids, 0.15 mM
spermidine, and 400 U/mL RNAsin (Promega). Incubations were carried out for 3
h at 37 C.
66
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
1001871
Electroporation and culture of exosomes. Exosomes were pelleted and
resuspended in 400 pi, of electroporation buffer (1.15 mM potassium phosphate
pH 7.2, 25
mM potassium chloride, 21% Optiprep), with 20 g of plasmid (pCMV-GFP, pEGFP-
p53
Addgene plasmid 12091, pcDNA3-RLUC-POLIRES-FLUC and pcDNA-FLUC). Exosomes
were electroporated using a 4 mm cuvette using a Gene Pulser Xcell
Electroporation System
(BioRad), as previously described (Alvarez-Erviti et al., 2011). When
appropriate, exosomes
were electroporated in the presence of cycloheximide (Sigma, 100 mg/mL) or a-
amanitin
(Sigma, 30 g/mL), for inhibition of translation and transcription,
respectively.
Electroporated exosomes were cultured in serum-free DMEM at 37 C for the time
points
indicated.
1001881
Flow cytometry analysis of electroporated exosomes. Exosomes
preparations (5 ¨10 g) were incubated with 5 pi, of 4 JIM diameter
aldehyde/sulfate latex
beads (Interfacial Dynamics, Portland, OR) and resuspended into 600 tiL.
Exosomes-coated
beads were analyzed on a FACS Calibur flow cytometer (BD Biosciences) and
analyzed for
green fluorescence.
1001891
Exosomes delivery and cortfocal microscopy. MCF10A cells were
plated at an appropriate confluency in 12-well plates on inserted coverslips
and cultured
overnight. The following day cells were incubated with MDA-MB-231 exosomes
resuspended in serum-free culture DMEM for 2 h, washed with cold PBS lx and
fixed for 20
min at room temperature with 4 /o PFA/PBS. Slides were permeabilized for 10
min at RT
with PBS 0.5% Triton X-100 and counterstained with DAPI. Images were obtained
using a
Zeiss LSM510 Upright Confocal System using the recycle tool to maintain
identical settings.
For data analysis, images were selected from a pool drawn from at least two
independent
experiments. Figures show representative fields.
1001901 Reverse
transwell assay. Exosomes were isolated from MDA-MB-231
cells as previously described, and resuspended in PBS and quantified using
Nanosight NTA.
10 x 109 exosomes in 150 I, PBS were added to each bottom well of a 96-well
Corningrm
HTSTranswell system. PBS alone was added to bottom wells as a negative
control. An
insert containing a polycarbonate membrane with 40 nm pores was added to each
well, and
100 L of PBS alone, PBS with 20% FBS, or PBS with 10,000 ng/ml of EGF were
added to
the insert. Trasnswell plates were incubated at 37 C with 5% CO2, and at
samples were
67
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
collected from the upper inserts after 4 h and 24 h incubation for exosomes
quantification
using Nanosight NTA.
[00191]
Statistics. Error bars indicate s.d. between biological replicates.
Technical as well as biological triplicates of each experiment were performed.
Statistical
significance was calculated by Student's t-test, ANOVA or Mann-Whitney test,
as
appropriate and specified in the description of the figures.
Example 1 ¨ EGFR phosphorylation is detected in exosomes derived from MDA-MB-
231, triple negative human breast cancer cells
[00192]
Exosomes were isolated from different murine and human cell lines
using established ultracentrifugation techniques (Melo et al., 2015; Melo et
al., 2014). The
isolated exosomes represent a heterogeneous mix, with the same size
distribution being
consistently observed between preparations. NanoSight nanoparticle tracking
analysis (NTA)
as well as atomic force microscopy (AFM) revealed particles with a size
distribution
averaging 104 1.5 nm in diameter, and ranging roughly between 30 and 200 nm.
This was
confirmed by transmission electron microscopy (TEM) showing extracellular
vesicles
surrounded by a lipid bilayer (FIGS. 8A-C). The isolated exosomes were further
shown by
immunogold/TEM imaging, immunoblot analysis and imaging flow cytometry to
possess
known markers of exosomes (Raposo and Stoorvogel, 2013) (FIGS. 8D-F). To
further
confirm their purity, exosomes samples were inoculated onto solidified LB
plates, showing
no colony formation when compared to bacterial controls obtained from mouth
swabs. This
demonstrates the absence of bacterial contamination in the isolated exosomes
(FIG. 8G).
[00193]
Exosomes obtained from different cell lines were probed by
immunoblotting for their EGFR content. While exosomes from all cell lines show
low levels
of EGFR expression, exosomes derived from the BJ fibroblast cell line and MDA-
MB-231
triple negative breast cancer cell line showed strong expression of the
receptor. The known
exosomes marker CD81 is shown as a loading control (FIG. 1A). Given the
importance of
EGFR for the progression of triple negative breast cancer (Lim et al., 2016;
Liu et al., 2012;
Nakai et al., 2016), its functional role in MDA-MB-231 derived exosomes was
further
explored. Exosomes were derived from MDA-MB-231 and MCF10A cells, and 1
billion
exosomes were incubated with 500 ng/ml of recombinant human EGF (rhEGF) for 15
minutes at 37 C in serum-free culture media. Immunoblotting of protein
extracts obtained
68
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
from these exosomes with an antibody specific for the Tyr1068 residue of EGFR
revealed an
increase in the phosphorylation levels of this receptor in exosomes derived
from MDA-MB-
231, but not non-tumorigenic MCF10A breast epithelial cells (FIG. 1B).
Baseline levels of
EGFR did not change in any of the samples, confirming the specificity of the
observed
increase in phosphorylation. Recombinant human EGF (rhEGF) stimulation also
lead to an
increase in the levels of phosphorylated ERIC, suggesting that the observed
EGFR
phosphorylation triggers downstream signaling events within the exosomes (FIG.
1C).
Further probing of the protein content of MDA-MB-231 exosomes showed that they
also
contained downstream effectors of EGFR, namely GRB2 and Shc (FIG. 1C).
1001941 It was
then investigated whether upon rhEGF stimulation, exosomal
EGFR could engage its downstream adaptors. Exosomes were stimulated with rhEGF
for 15
minutes at 37 C. The exosomal protein extracts were subjected to pull down
assays using
specific antibodies for GRB2 and Shc, and it was detected that upon EGF
stimulation they
showed increased co-immunoprecipitation with EGFR (FIGS. 1D,E). Isotype IgGs
were used
as a negative control for the pull down, and did not reveal EGFR co-
immunoprecipitation.
Additionally, by reversing the assay and pulling down EGFR, it was also
possible to detect
coimmunoprecipitated GRB2 only in EGF stimulated exosomes (FIG. 8B). Taken
together
these results demonstrate that exosomes from MDA-MB-231 cells contain EGFR
that can be
phosphorylated by incubation with its ligand in cell-free conditions, leading
to putative
downstream signaling events within the exosomes.
Example 2 ¨ EGF stimulation of exosoines alters their protein content
1001951
Receptor tyrosine kinases require ATP as a substrate for their kinase
activity, and prostate-derived exosomes have been shown to have the capacity
to generate
ATP (Ronquist et al., 2013a). To further confirm the existence of
phosphorylation activity in
the absence of cells, an ATP quantification assay was performed on exosomes
with or
without rhEGF stimulation. Using a luminescence based kit, ATP was detected in
exosomes
from both MDA-MB-231 cells and MCF10A cells, albeit in smaller quantities in
the latter.
Exosomes from MDA-103-231 cells, but not MCF10A cells, demonstrated a slight
decrease
in their ATP quantity upon stimulation with EGF (FIG. 2A). To further
investigate the impact
of EGF stimulation on exosomes, they were incubated them in cell-free
conditions for a
period of 48 h. The levels of GRB2 protein levels were consistently higher in
exosomes
stimulated with EGF for 48 h, compared to their unstimulated counterparts
(FIG. 2B). This
69
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
raised the intriguing possibility that the protein content of exosomes might
have changed
upon growth factor stimulation. To further investigate this possibility, mass
spectrometry
analysis was performed on protein extracts obtained from rhEGF unstimulated or
stimulated
exosomes. Protein extracts were subjected to bypsin digestion and evaluated
using an ESI-
TRAP mass spectrometer to obtain an MS/MS peptide spectrum for each sample.
The
obtained spectra were then evaluated against a SwissProt database for peptide
identification
to obtain a list of proteins for each exosomes sample. Using the open access
FunRich
functional enrichment analysis tool (Pathan et al., 2015) it was observed that
the majority of
identified hits in both the unstimulated and stimulated exosomes matched
proteins previously
identified in exosomes (Vesiclepedia database) (FIG. 2C). A higher number of
proteins were
identified in exosomes stimulated with rhEGF when compared to the unstimulated
ones (491
vs. 371, FIG. 2D). While the majority of these proteins were common to both
stimulated and
unstimulated exosomes, 224 out of 491 proteins were detected only upon rhEGF
stimulation.
While EGFR was identified on both samples, GRB2 was only identified in rhEGF
stimulated
exosomes (FIG. 2E). It should be stressed however that this does not mean that
GRB2 is not
present in unstimulated exosomes, but it might be present at a level under the
detectable
threshold for this type of analysis. The Exponentially Modified Protein
Abundance Index
(emPAI), which allows for label-free quantification of relative changes in
protein content
based on the observable peptide matches, was employed (Ishihama et al., 2005).
The top 15
proteins that revealed a stronger increase in rhEGF stimulated exosomes when
compared to
their unstimulated counterparts included several participants of actin
remodeling and
membrane dynamics, such as a-actinin, MARCKS, ezrin, moesin, and integrin
alpha-2
(Tables 4&5). A gene ontology (GO) analysis was then performed using the
PANTHER
overrepresentation test. Interestingly, among the top GO biological processes
enriched in the
rhEGF stimulated exosomes, several were related to actin remodeling and
migration (5 out of
the 20 top pathways, Table 6).
Table 4. Top 15 proteins identified as upregulated in exosomes from MDA-MB-231
cells
incubated with 500 ng/ml of EGF at 37 C for 48 h compared to control exosomes,
based on
the protein scores using the emPAI method (Ishihama et al., 2005).
Protein Name Description Control EGF- Fold
Treatment Change
CHMP2A Charged multivesicular body 0.4 2.25 5.625
protein 2a OS=Homo spapiens
GN=CHMP2A PE::::1 S V :::1
C'HM1)2B Charged multivesicular body 0.19 1.03
5.421052632
CA 03095136 2020-09-24
WO 2019/191444 PCT/US2019/024603
Protein Name Description Control EGF- Fold
Treatment Change
protein 2b OS=Homo sapiens
GN:=CHMP2B PE=1 SV=1
ACSL4 Long-chain-fatty-acid--CoAligase 0.06 0.31 5.166666667
4 OS=Homo sapiens GN=ACSL4
PE=1 SV=2
LDHB L-lactate dehydrogenase B chain 0.12 0.59
4.916666667
OS=Homo sapiens GN=LDHB
PE=1 SV=2
ACTN1 Alpha-actinin-1 OS=Homo 0.04 0.18 4.5
sapiens GN=ACTN1 PE=1 SV=2
ITGA2 Integrin alpha-2 OS=Homo 0.07 0.26 3.714285714
sapiens GN=ITGA2 PE=1 SV-1
HIST2H2AA3 Histone H2A type 2-A OS=Homo 6.9 24.85 3.601449275
sapiens GN-HIST2H2AA3 PE:::1
SV=3
MARCKS Myristoylated alanine-rich C- 0.14 0.5 3.571428571
kinase substrate OS=Homo
sapiens GN=MARCKS PE=1
SV=4
VPS37B Vacuolar protein sorting- 0.14 0.5 3.571428571
associated protein 37B OS=Homo
sapiens GN:::VPS37B PE=1 SV:=1
RPL5 60S ribosomal protein L5 0.13 0.45 3.461538462
OS=Homo sapiens GN=RPL5
PE=1 SV=3
EHD2 EH domain-containing protein 2 0.07 0.23 3.285714286
OS=Homo sapiens GN=EHD2
PE=1 SV=2
DNAJA1 DnaJ homolog subfamily A 0.61 1.84 3.016393443
member 1 OS=Homo sapiens
GN-1)NAJA1 PE-1 SV=2
EZR Ezrin OS:-.Homo sapiens 1.23 3.39 2.756097561
GN:=EZR PE:::1 SV=4
MSN .Moesin OS=Homo sapiens 1.74 4.48 2.574712644
GN=MSN PE=1 SV=3
ARF I ADP-ribosylation factor 1 0.5 1.26 2.52
OS=Homo sapiens GN=ARF1
PE=1 SV=2
Table 5. Top 15 proteins identified as downregulated in exosomes from MDA-MB-
231 cells
incubated with 500 ng/ml of EGF at 37 C for 48 h compared to control exosomes,
based on
the protein scores using the emPAI method (Ishihama et al., 2005).
Protein Name Description Control EGF- Fold
Treatment Change
KRT9 "Keratin, type 1 cytoskeletal 9 6.86 1.28
0.186588921
OS=Homo sapiens GN=KRT9
71
CA 03095136 2020-09-24
WO 2019/191444 PCT/US2019/024603
Protein Name Description Control EGF- Fold
Treatment Change
PE=1 SV=3"
KRT2 "Keratin, type II cytoskeletal 2 2.46 0.92
0.37398374
epidermal OS=Homo sapiens
GN=KRT2 PE=1 SV=2"
GOLGA7 Golgin subfamily A member 7 0.7 0.3 0.428571429
OS=Homo sapiens GN=GOLGA7
PE-1 SV=2
CALMI Calmodulin OS=Homo sapiens 0.64 0.28 0.4375
GN=CALM1 PE=1 SV=2
HRAS GTPase HRas OS=Homo sapiens 0.48 0.22 0.458333333
GN=HRAS PE=1 SV=1
SCAMP2 Secretory carrier-associated 0.26 0.12 0.461538462
membrane protein 2 OS=Homo
sapiens GN=SCAMP2 PE=1
SV=2
RGSI9 Regulator of G-protein signaling 0.41 0.19
0.463414634
19 OS=Homo sapiens GN=RGS19
PE:::1 SV=1
RAB5B Ras-related protein Rab-5B 0.43 0.2 0.465116279
OS=Homo sapiens GN=RAB5B
PE=1 SV=1
CORO 1 C Coronin-1C OS=Homo sapiens 0.17 0.08 0.470588235
GN=COROIC PE=1 SV=1
SLC7A1l Cystine/glutamate transporter 0.17 0.08 0.470588235
OS=Homo sapiens GN=SLC7A1 I
PE=1 SV=1
PACSIN3 Protein kinase C and casein kinase 0.19 0.09
0.473684211
substrate in neurons protein 3
OS=Homo sapiens GN=PACSIN3
PE=1 SV=2
VPS4B Vacuolar protein sorting- 0.19 0.09 0.473684211
associated protein 4B OS=Homo
sapiens GN=VPS4B PE=1 SV=2
OR51E1 Olfactory receptor 51E1 0.27 0.13 0.481481481
OS=Homo sapiens GN=OR51E1
PE=2 SV=1
Table 6. Top 20 gene ontology (GO) pathways identified based on the
differential protein
scores between control exosomes and exosomes incubated with 500 ng/ml EGF at
37 C for
48 h. A list of differentially expressed proteins was obtained using the emPAI
method and
used as input for GO analysis using the PANTHER overrepresentation test.
GO Homo upload _l upload 1 upload_l upload_l
upload_l
biological sapiens - (113) (expected) (over/under) (fold
(P-value)
process REFLIST Enrichment)
complete (21002)
actomyosin 3 3 0.02 > 100
5.77E-03
72
CA 03095136 2020-09-24
WO 2019/191444 PCT/US2019/024603
GO Homo upload_l upload _l upload _1 upload ...1
upload _l
biological sapiens ¨ (113) (expected) (over/under) (fold (P-
value)
process REFLIST Enrichment)
complete (21002)
contractile
ring
organization
(GO:0044837)
actomyosin 3 3 0.02 > 100
5.77E-03
contractile
ring assembly
(GO:0000915)
assembly of 3 3 0.02 > 100
5.77E-03
actomyosin
apparatus
involved in
cytokinesis
(GO:0000912)
positive 4 3 0.02 >1.00
1.36E-03
regulation of
extracellular
exosome
assembly
(GO:1903553)
regulation of 6 4 0.03 > 100
3.58E-04
extracellular
exosome
assembly
(GO:1903551)
viral release 6 3 0.03 92.93
4.56E-02
from host cell
(GO:0019076)
movement in 6 3 0.03 92.93
4.56E-02
environment
of other
organism
involved in
symbiotic
interaction
(GO:0052192)
movement in 6 3 0.03 92.93
4.56E-02
host
environment
(GO:0052126)
exit from host 6 3 0.03 92.93
4.56E-02
cell
(GO:0035891)
exit from host 6 3 0.03 92.93
4.56E-02
(GO:0035890)
cell separation 17 7 0.09 76.53
6.98E-08
73
CA 03095136 2020-09-24
WO 2019/191444 PCT/US2019/024603
GO Homo upload_l upload _l upload _1 upload _1
upload 1
biological sapiens ¨ (113) (expected) (over/under) (fold
(P-value)
process REFLIST Enrichment)
complete (21002)
after
cytokinesis
(GO:0000920)
ESCRT Ill 10 4 0.05 74.34
2.72E-03
complex
disassembly
(GO:1904903)
ESCRT 10 4 0.05 74.34
2.72E-03
complex
disassembly
(GO:1904896)
positive 15 6 0.08 74.34
2.69E-06
regulation of
exosomal
secretion
(GO:1903543)
regulation of 16 6 0.09 69.7
3.94E-06
exosomal
secretion
(GO:1903541)
regulation of 15 5 0.08 61.95
2.09E-04
mitotic
spindle
assembly
(GO:1901673)
positive 16 5 0.09 58.08
2.88E-04
regulation of
viral release
from host cell
(GO:1902188)
viral budding 23 7 0.12 56.57
5.64E-07
(GO:0046755)
viral budding 20 6 0.11 55.76
1.48E-05
via host
ESCRT
complex
(GO:0039702)
[00196] Taken together, these mass spectrometry data suggest that
MDA-MB-
231 exosomes can alter their protein content upon rhEGF stimulation. These
data also suggest
that the same exosomes stimulated with rhEGF could undergo actomyosin
remodeling and
migration, indicative of a motility phenotype in response to rhEGF
stimulation. A
bicinchoninic acid (BCA) assay for protein quantification confirmed the
increase in protein
74
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
content in exosomes stimulated with rhEGF, when compared with unstimulated
controls
(FIG. 2F). Immunoblotting for 13-actin also shows an increase in the levels of
polymerized
actin in exosomes stimulated with different amounts of rhEGF when compared
with control
unstimulated exosomes (FIG. 2G). Collectively, these observations indicate an
unexpected
degree of biological activity in exosomes. Therefore, the possibility that
exosomes are
capable of synthesizing proteins de novo under permissive conditions was
further
investigated and the potential induction of exosomes motility upon growth
factor stimulation
was explored.
Example 3 ¨ Exosomes derived from different cell types contain the functional
constituents required for transcription and translation
[00197]
Analysis of proteomics data from exosomes of different cellular
origins revealed the presence of several constituents of the protein synthesis
machinery, such
as eukaryotic initiation factors, ADP ribosylation factors, and ribosomal
proteins (Choi et al.,
2012; Melo et al., 2015; Pisitkun et al., 2004; Valadi et al., 2007) (FIGS.
10, 11A,B). This
information, taken together with the knowledge that mRNAs and their
corresponding proteins
are found in exosomes, further suggested that isolated exosomes could possess
the capacity to
translate InRNA into proteins.
[00198]
Using quantitative PCR (qPCR) analysis, the presence of both 18S and
28S rRNAs was confirmed, as well as tRNAs for methionine, glycine, leucine,
serine, and
valine in all analyzed exosomes (FIGS. 12A,B). Additionally, Ultra Performance
Liquid
Chromatography-Mass Spectrometry (UPLC-MS) analysis of exosomes revealed the
existence of all free amino acids (FIG. 3A). Immunoblotting analysis
identified the presence
of different members of the translation initiation complex in exosomes,
including elF4A,
elF3A, and elF1A (FIG. 3B), confirming the observations made through mass
spectrometry
analysis. In addition, initiation factors elF4A and elF3A co-immunoprecipitate
in protein
extracts obtained from exosomes (Morino et al., 2000) (FIG. 12C).
[00199]
To functionally address the relevance of constituents for protein
production present in exosomes, total protein extracts of exosomes isolated
from MCF10A
and MDA-MB-231 cells were incubated with a cDNA expression plasmid for green
fluorescent protein (GFP plasmid) and a coupled in vitro transcription and
translation assay
was performed. Western Blot analysis of the extracts after incubation with the
GFP encoding
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
plasmid revealed production of GFP protein (FIG. 3C). The fact that exosomes
lysates from
both MDA-MB-231 and MCF10A cells allowed for the synthesis of protein from the
GFP
expression plasmid confirmed that exosomes derived from different cells likely
contain all
the necessary functional components for both DNA transcription and mRNA
translation.
Consistent with the potential for DNA transcription, additional immunoblot
analysis of
protein extracts from exosomes isolated from different cell sources identified
the presence of
RNA polymerase II subunits, both in its phosphorylated and non-phosphorylated
forms (FIG.
3D).
Example 4 Exosomes are capable of cell-independent protein synthesis
1002001 To
further validate the finding that exosomes have the autonomous
capability for de novo mRNA translation, isolated exosomes obtained from MDAMB-
231
cells as well as the murine lung cancer El 0 cell line were incubated with 35S-
methionine to
enable labeling of newly synthesized proteins by the exosomes. The assay was
performed at
37 C in order to activate the putative biosynthetic processes and potential
autoctine
stimulation. Autoradiography of protein extracts from exosomes incubated for
72 h in the
presence of 35S-methionine exhibited the incorporation of the radioactive
amino acid into
several proteins in the range of 40 to 300 kDa. This was largely inhibited
when exosomes
were incubated with the protein translation inhibitor cycloheximide along with
35S-
methionine (FIG. 3E). A distinct pattern of labeled proteins was observed when
exosomes
derived from different cancer cells were incubated with 35S-methionine.
Additionally, total
protein content was quantified from freshly isolated exosomes incubated in
cell-free culture
media. After 48 h of incubation, the total exosomal protein content was
significantly
increased (FIG. 3F).
1002011
Next, whether transcription and translation can take place in intact
exosomes, rather than just their lysates, was confirmed by setting up a
protocol of exosomes
in vitro translation. A pCMV-GFP expression plasmid was electroporated
directly into
exosomes derived from MDA-MB-231 cells (Borges et al., 2013; El-Andaloussi et
al., 2012;
Kamerkar et al., 2017) and the electroporated exosomes were incubated at 37 C
in serum-free
culture media, for 48 h. qPCR analysis of isolated exosomal RNA after
digestion with
DNAse revealed the presence of GFP mRNA in exosomes electroporated with the
pCMV-
GFP expression plasmid (FIG. 4A). Transmission electron microscopy showed that
the
structure of the exosomes electroporated with the pCMV-GFP plasmid was intact,
and
76
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
immunogold labeling using an anti-GFP antibody showed that the protein could
only be
detected in the GFP plasmid-containing exosomes (FIG. 4B). Immunoblot analysis
of
exosomes protein extracts using a GFP antibody further confirmed the presence
of GFP in
pCMV-GFP plasmid electroporated exosomes, observed as early as 12 h after
electroporation
(FIG. 4C). GFP could be observed in exosomes electroporated with the
expression plasmid
after 1 week and up to 1 month (FIGS. 4C,D), albeit without any increase over
the levels
observed at 24 h. The same pattern was also observed in exosomes derived from
MCF10A
cells, confirming that exosomes derived from different cells, not just
tumorigenic, contain all
the required constituents and have the capacity for de novo protein synthesis
(FIG. 13A).
1002021
Immunoblot analysis of exosomes electroporated with a GFP plasmid
showed a reduction of about 80% in GFP levels when incubated in the presence
of the protein
translation inhibitor cycloheximide (FIG. 4E). GFP production was also
decreased in the
presence of a-amanitin, a transcription inhibitor of RNA polymerase II (FIGS.
4E,F).
NanoSight NTA of electroporated exosomes using a 488 nm laser also detected
green
fluorescence in exosomes electroporated with the pCMV-GFP plasmid but not in
mock-
electroporated exosomes or exosomes electroporated with the plasmid and
cycloheximide or
a-amanitin (FIG. 13B). Additionally, beads based flow cytometry analysis of
plasmid-
containing exosomes using different electroporation conditions detected the
presence of GFP
(FIG. 13C). Next, exosomes were incubated for 24 h at 37 C to initiate
biological processes,
before electroporation with pCMV-GFP plasmid. The GFP production, as detected
by
immunoblotting, was impaired, suggesting an exhaustion of the required
components for
transcription and translation in the exosomes that are pre-incubated at 37 C.
(FIG. 4G).
1002031
To confirm that these results were not specific to just GFP, an
ovalbumin expression plasmid (pCMV-Ova), a protein that is also not expressed
in
mammalian cells, was used. As with GFP, immunoblotting analysis of exosomes
after
electroporation and incubation at 37 C for 48 h showed production of ovalbumin
only in
exosomes electroporated with the pCMV-Ova plasmid (FIG. 13D).
1002041
Initiation of protein translation of most mRNAs in eukaryotes involves
recognition of the 5' cap structure by the elF4F complex (Merrick, 2004). To
determine
whether protein translation in exosomes is cap-dependent, a cDNA bicistronic
construct was
employed consisting of two different luciferase cistrons separated by an
internal ribosome
entry site (FIG. 4H) (Poulin et al., 1998). In this system, translation of
Renilla luciferase is
77
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
cap-dependent, whereas translation of firefly luciferase is directed by the
poliovirus IRES,
and is therefore cap-independent (FIG. 4H). Electroporation of the plasmid
directly into
exosomes led to an increase in Renilla Luciferase activity with no apparent
change in Firefly
Luciferase activity (FIG. 41) (Poulin et al., 1998), suggesting that protein
translation in
exosomes occurs in a cap-dependent manner. Since Firefly and Renilla
Luciferase enzymes
have different activity requirements, this assay was repeated using a plasmid
where Firefly
luciferase is expressed under the control of a CMV promoter. The luciferase
activity was also
observed in the pCMV-Fluc electroporated exosomes (FIG. 4.1).
Example 5¨ mRNA translation in exosomes generates functional proteins and can
be
stimulated by growth factors
1002051
MCF10A cells pretreated with cycloheximide were incubated with
MDA-MB-231 exosomes that were directly electroporated with the pCMV-GFP
plasmid.
Imaging by confocal microscopy detected green fluorescence in the MCF10A
cells, likely
contributed by the GFP protein (after transcription and translation) delivered
by MDAMB-
231 exosomes (FIG. 5A, top and bottom panels). Interestingly, cells directly
electroporated
with the pCMV-GFP plasmid show a GFP fluorescence pattern distinct from
fluorescence
pattern observed in cells incubated with pCMV-GFP plasmid containing exosomes
(FIG. 5A,
middle and bottom panels).
1002061
MDA-MB-231 cells overexpress an inactive mutant form of the tumor
suppressor protein p53, which is therefore unable to activate the p21 promoter
(Gartel et al.,
2003). Wild-type (wt) p53 typically responds to DNA damage by direct induction
of p21,
facilitating cell cycle arrest (Zilfou and Lowe, 2009). Exosomes isolated from
MDA-MB-231
cells were electroporated with a plasmid encoding for wt p53 fused to GFP. The
electroporated exosomes were incubated in culture media for 48 h to allow
transcription and
translation to generate wt p53 protein (FIG. 5B). Subsequently, exosomes
containing the
newly formed wt p53 were incubated with recipient MDA-103-231 cells under the
influence
of cycloheximide. The recipient MDA-MB-231 cells revealed a substantial
increase in
expression of p21 (FIG. 5C), confirming the functionality of wt p53 protein
that was
exclusively synthetized by the exosomes (FIG. 5B). To additionally confirm
that this increase
in p21 expression was indeed due to wt p53 protein newly translated by
exosomes rather than
due to delivery of the plasmid, MDA-MB-231 derived exosomes were
electroporated with
the p53-GFP plasmid and either allowed to incubate for 48 h to synthesize the
wt p53 protein
78
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
prior to incubation with the recipient MDA-MB-231 cells (48 h), or delivered
immediately to
the recipient MDA-MB-231 cells without allowing them to produce the wt p53
protein (0 h,
FIG. 13E). Exosomes that were allowed to actively synthesize wt p53 protein 48
h prior to
delivery induced p21 expression in the recipient MDA-MB-231 cells as early as
30 minutes
post exosomes incubation, higher than when compared to exosomes with just the
plasmid,
which show the same baseline p21 expression observed in control MDA-MB-231
cells (FIG.
13E).
1002071
In order to further demonstrate that exosomes from MDA-MB-231
cells exhibit a baseline capacity for intrinsic protein synthesis, exosomes
were incubated at
37 C, with and without the presence of cycloheximide. Immunoblotting of
protein extracts
from these exosomes showed a consistent reduction in the expression levels of
small
cytoplasmic proteins, 13-actin and GAPDH, upon incubation with cycloheximide,
again
demonstrating the existence of a baseline level of protein synthesis in these
exosomes (FIG.
5D).
1002081 In order
to determine which proteins are produced by the /VIDA-MB-
231 exosomes in the absence of external stimuli, an adapted version of stable
isotope labeling
with amino acids in culture (SILAC) was performed. Exosomes derived from /VIDA-
MB-231
cells were incubated in SILAC medium supplemented with heavy labeled '3C-
Lysine and
15N-Arginine. IVIDA-MB-231 exosomes were incubated in heavy labeled SILAC
medium for
5 days and protein extracts were obtained, trypsin digested, and subjected to
mass
spectrometry analysis. While only a small number of heavy-labeled peptides
matched the
obtained MS/MS spectra, 11 proteins were able to be identified each matching 1
or 2 peptides
containing the heavy-labeled amino acids (Table 7). This confirms that, albeit
at low levels,
baseline mRNA translation occurs in exosomes leading to the formation of very
small
amounts of newly synthesized proteins.
79
Table 7. List of proteins containing peptides matching spectra with heavy
isotopes, obtained from mass spectrometry analysis of protein
extracts of MDA-MB-231 exosomes incubated with 13C-Lysine and 15N-Arginine
SILAC medium for 5 days. Each protein listed contains at g
least 1 peptide matching a 13C-Lysine or 15N-Arginine heavy-labeled spectra.
N
Acession Description Score Coverage # # Unique #
# PSMs # AAs MW calc. PE 1 -
,..T..
-
Proteins peptides Peptides
IkDal
Q7Z4S6 Kinesin-like protein 51.34 1.31% 1 1
3 4 1674 187.1 6.42 4.=
KIF21A OS=Homo
sapiens GN=KIF21A
PE=1 SV=2 -
[KI21A HUMAN)
076038 Secretagogin 32.14 5.80% 1 1 1
2 276 32 5.41
OS=Homo sapiens
GN=SCGN PE=1
Q
SV=2 -
.
w
co
[SEGN HUMAN]
.
'=. Q9NQYO Bridging integrator 3 26.41 4.35% 1 1
1 4 253 29.6 7.47
OS=Homo sapiens
.
,
GN=BIN3 PE=1
' ,
S V=1 -
A
[BIN3 HUMAN]
P05305 Endothelin-1. 57.22 8.96% 1 -, 3
3 212 24.4 9.41
OS=Homo sapiens
GN=EDN1 PE=1
SV=1 -
[EDN1 HUMAN]
9:1
en
P07476 Involucrin OS=Homo 40.81 1.71% 1 1 1
..? 585 68.4 4.61 - 3
sapiens GN=IVL
cil
b.)
PE=1 SV=2 -
0
[INVO HUMAN]
-.
0
b.)
015014 Zinc finger protein 40.51 1.49% 1 1 2
1 1411 151.1 8.03 4.
o
o
609 OS=Human
w
Acession Description Score Coverage # # Unique #
# PSMs # AAs MW calc. PI
Proteins peptides Peptides
IkDal
0
sapiens GN=ZNF609
,..)
PE=1 SV=2 -
¨
`&:=
[ZN609 HUMAN]
,..T..
Q9H013 Coiled-coil domain- 40.91 4.51% 1 1 7
2 377 44.2 8.73
4,
4.
containing protein
113 OS= Homo
sapiens
GN=CCDC113 PE=2
SV=1 -
[CC113 HUMAN]
Q8IYE0 Coiled-coil domain 57.08 3.87% 1 1 3
5 955 112.7 8.48
containing protein
Q
146 OS=Homo
w
ce sapiens
,
w
. 0
GN=CCDC146 PE=2
SV=2 -
,s9
0
,
[CC146 HUMAN]
,
Q96KM6 Zinc finger protein 23.93 1.23% 1 1 1
1 892 97.2 9.83 A
512B OS=Homo
sapiens
GN=1NF512B PE=1
S V=1 -
[Z512B HUMAN] .
015018 PDZ domain- 81.48 1.62% 1 1 4
5 2839 301.5 7.43 9:1
n
containing protein 2
- 3
OS=Homo sapiens
cil
b.)
GN=PDZD2 PE=1
o
SV=1 -
,
o
b.)
[PDZD2 HUMAN]
4,
o
o
P43308 Translocon- 24.02 3.83% 1 1 1
1 183 20.1 8.35 (..e
_
Acession Description Score Coverage # # Unique #
# PSMs # AAs MW calc. PI
Proteins peptides Peptides
IkDal
0
associated protein
subunit beta
OS=Homo sapiens
GN=SSR2 PE=1
SV= 1 -
4.=
[SSRB HUMAN]
La
0
0
9:1
1-3
=
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
1002091
Next, the protein translation assay was repeated using exosomes
derived from MDA-MB-231 cells with electroporated pCMV-GFP plasmid. The
exosomes
were incubated in serum-free culture media at 37 C for 48 h with or without
stimulation with
rhEGF. While the unstimulated exosomes presented with a baseline level of GFP
production,
the GFP levels increased upon incubation with different concentrations of
rhEGF (FIG. 5E).
This again confirmed that, while all exosomes can synthetize proteins, growth
factor
stimulation can alter their rate of production by leading to increased levels
of protein
synthesis.
Example 6 ¨ Exosomes actively migrate in response to stimulation by rhEGF and
serum
factors
1002101
In order to determine whether growth factors can induce a motility
phonotype in exosomes, a reverse migration assay based on the Boyden chamber
system was
designed including rhEGF and serum factors. Ten billion exosomes isolated from
MDA-MB-
231 cells were placed in the culture wells of a 96-well plate, covered by a
polycarbonate
surface insert containing 400 nm pores. The insert contained either PBS, PBS
with 10 0/1
rhEGF, or PBS with 20% exosomes-depleted FBS (FIG. 6A). Because exosomes-
depleted
FBS could still contain trace amounts of exosomes (data not shown), 20% FBS
was placed on
the top insert with no exosomes in the bottom well, as a control. After
incubation at 37 C,
samples were obtained from the top insert at different time points and
exosomes quantified
using Nanosight NTA.
1002111
After a 4 h incubation, the levels of exosomes on the top insert were
comparable across all experimental groups (FIG. 6B). After a 24 h incubation,
20% FBS
significantly increased migration of the exosomes from the bottom to the top,
suggesting a
sustained chemotactic influence on MDA-MB-231 exosomes towards the higher
serum
growth factor gradient (FIG. 6C). The inserts with 20% FBS over wells with no
exosomes
had significantly fewer exosomes after 24 h, confirming the identity of the
migrating
exosomes as being from MDA-MB-231 cells (FIG. 6C). PBS resulted in negligible
amounts
of exosomes migration but rhEGF alone also induced motility of exosomes,
albeit at a lower
level when compared to complete serum associated growth factors (FIG. 6C).
Taken together,
these results suggest that exosomes exhibit functional chemotactic capacity
that can be
induced by growth factors.
83
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
Example 7 ¨ Exosornes specifically exhibit enhanced protein production in
tumor
bearing mice
1002121
To address whether the capacity of exosomes to respond to the growth
factor gradient induced by tumors involves intrinsic production of new
proteins with
functional consequences, a reference mouse model was generated. Mice with
established 4T1
mammary tumors were injected with 5 billion MDA-MD 231/CD63-mCherry exosomes
electroporated with either GFP or ovalbumin expression plasmids. Control
experimental arms
of this study included CD63-mCherry exosomes without the plasmids and CD63-
mCherry
exosomes electroporated with plasmid and cyclohexamide. Twenty-four hours
after the I.P.
injection of exosomes in tumor-bearing mice or non-tumor-bearing mice, the
tumor, serum,
and several other organs were collected. Exosomes were FACS isolated using the
CD63
mCherry tag and evaluated for GFP or ovalbumin protein. GFP and ovalbumin were
predominantly detected in the tumor, lung, bone, brain, and serum of mice with
tumors, but
were found only at very low levels in the tissues of non-tumor bearing mice
and in tumor
bearing mice that were injected with cyclohexamide-containing exosomes. These
results
demonstrate that while exosomes might be detected in the liver, lung, and
brain of the non-
tumor bearing mice, the exosomes enter these organs and more robustly
(presumably via
enhanced motility) including the tumor tissue, and biologically respond by
generating de
novo proteins. Additionally, the serum-derived exosomes from tumor bearing
mice exhibit
protein production, suggesting that tumors biologically influence exosomes at
a systemic
level.
* * *
1002131
All of the methods disclosed and claimed herein can be made and executed
without undue experimentation in light of the present disclosure. While the
compositions and
methods of this invention have been described in terms of preferred
embodiments, it will be
apparent to those of skill in the art that variations may be applied to the
methods and in the
steps or in the sequence of steps of the method described herein without
departing from the
concept, spirit and scope of the invention. More specifically, it will be
apparent that certain
agents which are both chemically and physiologically related may be
substituted for the
agents described herein while the same or similar results would be achieved.
All such similar
substitutes and modifications apparent to those skilled in the art are deemed
to be within the
spirit, scope and concept of the invention as defined by the appended claims.
84
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
RE R1ENCES
The following references, to the extent that they provide exemplary procedural
or
other details supplementary to those set forth herein, are specifically
incorporated herein by
reference.
U.S. Patent 4,870,287
U.S. Patent 5,739,169
U.S. Patent 5,760,395
U.S. Patent 5,801,005
U.S. Patent 5,824,311
U.S. Patent 5,830,880
U.S. Patent 5,846,945
Aakalu et al., Dynamic visualization of local protein synthesis in hippocampal
neurons.
Neuron, 30:489-502, 2001.
Almoguera et al., Most human carcinomas of the exocrine pancreas contain
mutant c-K-ras
genes. Cell, 53:549-554, 1988.
Al-Nedawi et al., Endothelial expression of autocrine VEGF upon the uptake of
tumor-
derived microvesicles containing oncogenic EGFR. Proc. Natl. Acad. Sci.
U.S.A.,
106:3794-3799, 2009.
Alvarez-Erviti et al., Delivery of siRNA to the mouse brain by systemic
injection of targeted
exosomes. Nature Biotechnology, 29:341-345, 2011.
Austin-Ward & Villaseca, Gene therapy and its applications. Rev. Med ChiL,
126:838-845,
1998.
Baietti et al., Syndecan-syntenin-ALIX regulated the biogenesis of exosomes.
Nat. Cell Biol.,
14:677-685, 2012.
Bastos et al., Exosomes in cancer: Use them or target them? Semin. Cell Dev.
BioL, 78:13-21,
2018.
Biankin et al., Pancreatic cancer genomes reveal aberrations in axon guidance
pathway genes.
Nature, 491:399-405, 2012.
Borges et al., TGF-betal-containing exosomes from injured epithelial cells
activate
fibroblasts to initiate tissue regenerative responses and fibrosis. J. Amer.
Soc.
Nephrology, 24:385-392, 2013.
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
Bukowski et al., Signal transduction abnormalities in T lymphocytes from
patients with
advanced renal carcinoma: clinical relevance and effects of cytokine therapy.
Clin.
Cancer Res., 4:2337-2347, 1998.
Chang et al., Pancreatic cancer genomics. Current Opinion in Genetics &
Development,
24:74-81, 2014.
Choi et al., The protein interaction network of extracellular vesicles derived
from human
colorectal cancer cells. J Proteome Res., 11:1144-1151, 2012.
Christodoulides et al., Immunization with recombinant class 1 outer-membrane
protein from
Neisseria meningitidis: influence of liposomes and adjuvants on antibody
avidity,
recognition of native protein and the induction of a bactericidal immune
response
against meningococci. Microbiology, 144:3027-3037, 1998.
Clayton et al., Antigen-presenting cell exosomes are protected from complement-
mediated
lysis by expression of CD55 and CD59. Eur. J. Immunology, 33:522-531, 2003.
Collins et al., Oncogenic Kras is required for both the initiation and
maintenance of
pancreatic cancer in mice. J. Clinical Investigation, 122:639-653, 2012a.
Collins et al., Metastatic pancreatic cancer is dependent on oncogenic Kras in
mice. PLoS
One, 7:e49707, 2012b.
Colombo et al., Biogenesis, secretion, and intercellular interactions of
exosomes and other
extracellular vesicles. Annu. Rev. Cell. Dev. Biol., 30:255-289, 2014.
Combes et al., A new flow cytometry method of platelet-derived microvesicle
quantitation in
plasma, Thromb. Haemost., 77:220, 1997.
Cooper et al., Systemic exosomal siRNA delivery reduced alpha-synuclein
aggregates in
brains of transgenic mice. Movement Disorders, 29:1476-1485, 2014.
Croft et al., The Reactome pathway knowledgebase. Nuc. Acids Res., 42:D472-
477, 2014.
Davidson et al., Intralesional cytokine therapy in cancer: a pilot study of GM-
CSF infusion in
mesothelioma../. Immunother., 21:389-398, 1998.
Du et al., A systematic analysis of the silencing effects of an active siRNA
at all single-
nucleotide mismatched target sites. Nuc. Acids Res., 33:1671-1677, 2005.
El-Andaloussi et al., Extracellular vesicles: biology and emerging therapeutic
opportunities.
Nature Reviews Drug Discovery, 12:347-357, 2013.
El-Andaloussi et al., Exosome-mediated delivery of siRNA in vitro and in vivo.
Nature
Protocols, 7:2112-2126, 2012.
Eser et al., Oncogenic KRAS signalling in pancreatic cancer. British Journal
of Cancer,
111:817-822,2014.
86
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
Gartel et al., A new method for determining the status of p53 in tumor cell
lines of different
origin. Oncology Research, 13:405-408, 2003.
Gomes-da-Silva et al., Lipid-based nanoparticles for siRNA delivery in cancer
therapy:
paradigms and challenges. Accounts of Chemical Research, 45:1163-1171, 2012.
Gonzales et al., Large-scale proteomics and phosphoproteomics of urinary
exosomes. J.
Amer. Soc. Nephrology, 20:363-379, 2009.
Gysin et al., Therapeutic strategies for targeting ras proteins. Genes &
Cancer, 2:359-372,
2011.
Hanibuchi et al., Therapeutic efficacy of mouse-human chimeric anti-
ganglioside GM2
monoclonal antibody against multiple organ micrometastases of human lung
cancer in
NK cell-depleted SC1D mice. Mt. J. Cancer, 78:480-485, 1998.
Harding et al., Endocytosis and intracellular processing of transferrin and
colloidal gold-
transferrin in rat reticulocytes: demonstration of a pathway for receptor
shedding.
European J. Cell Biol., 35:256-263, 1984.
Hazan-Halevy et al., Cell-specific uptake of mantle cell lymphoma-derived
exosomes by
malignant and non-malignant B-lymphocytes. Cancer Lett., 364:59-69, 2015.
Hellstrand et at., Histamine and cytokine therapy. Acta Oncol., 37:347-353,
1998.
Hingorani et al., Trp53R172H and KrasG12D cooperate to promote chromosomal
instability
and widely metastatic pancreatic ductal adenocarcinoma in mice. Cancer Cell,
7:469-
483, 2005.
Hollander, Immunotherapy for B-cell lymphoma: current status and prospective
advances.
Front M1117111tol., 3:3, 2013.
Howlader et at., SEER Cancer Statistics Review, 1975-2011, National Cancer
Institute.
Bethesda, MD. On the World Wide Web at seercancergov/csr/1975_2011/, 2013.
Hruban et at., K-ras oncogene activation in adenocarcinoma of the human
pancreas. A study
of 82 carcinomas using a combination of mutant-enriched polymerase chain
reaction
analysis and allele-specific oligonucleotide hybridization. American J.
Pathology,
143:545-554, 1993.
Huang et at., Epidermal growth factor receptor-containing exosomes induce
tumor-specific
regulatory T cells. Cancer Invest., 31:330-335, 2013.
Hui & Hashimoto, Pathways for Potentiation of Immunogenicity during Adjuvant-
Assisted
Immunizations with Plasmodium falciparum Major Merozoite Surface Protein 1.
Mfec. 'MUM , 66:5329-5336, 1998.
87
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
Ishihama et al., Exponentially modified protein abundance index (emPAI) for
estimation of
absolute protein amount in proteomics by the number of sequenced peptides per
protein. MoL Cell. Proteomics, 4:1265-1272, 2005.
Ji et al., Ras activity levels control the development of pancreatic diseases.
Gastroenterology,
137:1072-1082, 82 el-6, 2009.
Johnsen et al., A comprehensive overview of exosomes as drug delivery vehicles
-
endogenous nanocarriers for targeted cancer therapy. Biochimica et Biophy.sica
Ada,
1846:75-87, 2014.
Kahlert et al., Identification of Double Stranded Genomic DNA Spanning all
Chromosomes
with Mutated KRAS and p53 DNA in the Serum Exosomes of Patients with
Pancreatic Cancer. J. Biol. Chem., 289:3869-3875, 2014.
Kalra et al., Comparative proteomics evaluation of plasma exosome isolation
techniques and
assessment of the stability of exosomes in normal human blood plasma.
Proteomics,
13:3354-3364, 2013.
Kalluri, The biology and function of exosomes in cancer. J. Clin. Invest.,
126:1208-1215,
2016.
Kamerkar et al., Exosomes facilitate therapeutic targeting of oncogenic KRAS
in pancreatic
cancer. Nature, 546:498-503, 2017.
Kowal et al., Biogenesis and secretion of exosomes. Current Opinion in Cell
Biology,
29:116-125, 2014.
Kramer et al., The ribosome as a platform for co-translational processing,
folding and
targeting of newly synthesized proteins. Nat. Struct. MoL Biol., 16:589-597,
2009.
Li et al., Exosomes derived from gefitinib-treated EGFR-mutant lung cancer
cells alter
cisplatin sensitivity via up-regulating autophagy. Oncotarget, 7:24585-24595,
2016.
Lim et al., EGFR Signaling Enhances Aerobic Glycolysis in Triple-Negative
Breast Cancer
Cells to Promote Tumor Growth and Immune Escape. Cancer Research, 76:1284-
1296, 2016.
Liu et al.,. EGFR expression correlates with decreased disease-free survival
in triple-negative
breast cancer: a retrospective analysis based on a tissue microarray. Med
Oncol,
29:401-405, 2012.
Livak & Schmittgen, Analysis of relative gene expression data using real-time
quantitative
PCR and the 2(-Delta Delta C(T)) Method. Methods, 25:402-408, 2001.
Lorch et al., Role of DNA sequence in chromatin remodeling and the formation
of
nucleosome-free regions. Genes Dev., 28:2492-2497, 2014.
88
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
Luga et al., Exosomes mediate stromal mobilization of autocrine Wnt-PCP
signaling in breast
cancer cell migration. Cell, 151:1542-1556, 2012.
Ma et al., Structural basis for overhang-specific small interfering RNA
recognition by the
PAZ domain. Nature, 429:318-322, 2004.
Marcus & Leonard, FedExosomes: Engineering Therapeutic Biological
Nanoparticles that
Truly Deliver. Pharmaceuticals (Basel), 6:659-680, 2013.
Masuda et al., Role of epidermal growth factor receptor in breast cancer.
Breast Cancer Res.
Treat., 136:331-345, 2012.
Melo et al., Cancer exosomes perform cell-independent microRNA biogenesis and
promote
tumorigenesi s. Cancer ('dl, 26:707-721, 2014.
Melo et al., Glypican-1 identifies cancer exosomes and detects early
pancreatic cancer.
Nature, 523:177-182, 2015.
Merrick, Cap-dependent and cap-independent translation in eukaryotic systems.
Gene, 332:1-
11,2004.
Morgillo et at., Mechanisms of resistance to EGFR-targeted drugs: lung cancer.
ESMO Open,
1:e000060, 2016.
Morino et al., Eukaryotic translation initiation factor 4E (eIF4E) binding
site and the middle
one-third of elF4GI constitute the core domain for cap-dependent translation,
and the
C-terminal one-third functions as a modulatory region. Mol. Cell Biol., 20:468-
477,
2000.
=Nagai et at., Chromatin potentiates transcription. Proc. Natl. Acad. Sci.
U.S.A., 114:1536-
1541, 2017.
Nakai et al., A perspective on anti-EGFR therapies targeting triple-negative
breast cancer.
Am. J. Cancer Res., 6:1609-1623, 2016.
Normanno et al., Epidermal growth factor receptor (EGFR) signaling in cancer.
Gene, 366:2-
16, 2006.
Ozdemir et al., Depletion of carcinoma-associated fibroblasts and fibrosis
induces
immunosuppression and accelerates pancreas cancer with reduced survival.
Cancer
Cell, 25:719-734, 2014.
Pardoll, Cancer immunotherapy through checkpoint blockade: the future of
cancer treatment.
Medicographia, 36:274-284, 2014.
Pathan et al., FunRich: An open access standalone functional enrichment and
interaction
network analysis tool. Proteomics, 15:2597-2601, 2015.
89
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
Pecot et al., Therapeutic Silencing of KRAS using Systemically Delivered
siRNAs.
Molecular Cancer Ihercpeutics, 13:2876-2885, 2014.
Peinado et al., Melanoma exosomes educate bone marrow progenitor cells toward
a pro-
metastatic phenotype through MET. Nature Medicine, 18:883-891, 2012.
Perdigao et al., Unexpected features of the dark proteome. Proc. Natl. Acad.
S'ci. U.S.A.,
112:15898-5903, 2015.
Pico de Coana et al., Checkpoint blockade for cancer therapy: revitalizing a
suppressed
immune system. Trends in Molecular Medicine, 21:482-492, 2015.
Pisitkun et al., Identification and proteomic profiling of exosomes in human
urine. Proc. Natl.
Acad. ScL U.S.A., 101:13368-13373, 2004.
Poliseno et al., A coding-independent function of gene and pseudogene mRNAs
regulates
tumour biology. Nature, 465:1033-1038, 2010.
Poulin et al., 4E-BP3, a new member of the eukaryotic initiation factor 4E-
binding protein
family. J. Biol. Chem., 273:14002-14007, 1998.
Qin et al., Interferon-beta gene therapy inhibits tumor formation and causes
regression of
established tumors in immune-deficient mice. Proc. Nall. Acad. Sci. U.S.A.,
95:14411-14416, 1998.
Rachagani et al., Activated KrasG12D is associated with invasion and
metastasis of
pancreatic cancer cells through inhibition of E-cadherin. Br. J. Cancer,
104:1038-
1048, 2011.
Rao & Cruz, Effects of confinement on the structure and dynamics of an
intrinsically
disordered peptide: a molecular-dynamics study. J. Phys. Chem. B., 117:3707-
3719,
2013.
Raposo & Stoorvogel, Extracellular vesicles: exosomes, microvesicles, and
friends. J. Cell
Biol., 200:373-383, 2013.
Rejiba et al., K-ras oncogene silencing strategy reduces tumor growth and
enhances
gemcitabine chemotherapy efficacy for pancreatic cancer treatment. Cancer
Science,
98:1128-1136, 2007.
Ronquist et al., Prostasomes from four different species are able to produce
extracellular
adenosine triphosphate (ATP). Biochim Biophys. Ada, 1830:4604-4610, 2013a.
Ronquist et al., Human prostasomes express glycolytic enzymes with capacity
for ATP
production. Am. J. PhysioL Endocrinol. Metah., 304:E576-582, 2013b.
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
Rothstein et at, Targeting signal 1 through CD45RB synergizes with CD40 ligand
blockade
and promotes long term engraftment and tolerance in stringent transplant
models. J.
Immunol., 166:322-329, 2001.
Seshachaiyulu et al., Targeting the EGFR signaling pathway in cancer therapy.
Expert Op/n.
flier. Targets, 16:15-31, 2012.
Siegel et at, Cancer statistics, 2014. CA: A cancer journal for clinicians,
64:9-29, 2014.
Simoes et al., Cationic liposomes for gene delivery. Expert Opinion on Drug
Delivery, 2:237-
254, 2005.
Sinkovics, The cell survival pathways of the primordial RNA-DNA complex remain
conserved in the extant genomes and may function as proto-oncogenes. Eur. J.
Microbiol. Immunot (Bp), 5:25-43, 2015.
Skogberg et al., Characterization of human thymic exosomes. PLoS ONE,
8:e67554, 2013.
Smakman et al., Dual effect of Kras(D12) knockdown on tumorigenesis: increased
immune-
mediated tumor clearance and abrogation of tumor malignancy. Oncogene, 24:8338-
8342, 2005.
Smith et al., Local protein synthesis in neurons. Curr. Biol., 11:R901-903,
2001.
Song et al., Cancer Cell-derived Exosomes Induce Mitogen-activated Protein
Kinase-
dependent Monocyte Survival by Transport of Functional Receptor Tyrosine
Kinases.
J. Biol. Chem., 291:8453-8464, 2016.
Steward & Levy, Preferential localization of polyribosomes under the base of
dendritic spines
in granule cells of the dentate gyrus. J. Neurosci., 2:284-291, 1982.
Sun et al., Characterization of the mutations of the K-ras, p53, p16, and
SMAD4 genes in 15
human pancreatic cancer cell lines. Oncology Reports, 8:89-92, 2001.
Thery et al., Exosomes: composition, biogenesis and function. Nature Reviews
Immunology,
2:569-579, 2002.
Thery et al., Isolation and characterization of exosomes from cell culture
supernatants and
biological fluids. Current Protocols in Cell Biology, Chapter 3, Unit 3 22,
2006.
Tomas et al., EGF receptor trafficking: consequences for signaling and cancer.
Trends Cell
Biol., 24:26-34, 2014.
Ung et al., Exosome proteomics reveals transcriptional regulator proteins with
potential to
mediate downstream pathways. Cancer Sci., 105:1384-1392, 2014.
Valadi et al., Exosome-mediated transfer of mRNAs and microRNAs is a novel
mechanism
of genetic exchange between cells. Nature Cell Biology, 9:654-659, 2007.
91
CA 03095136 2020-09-24
WO 2019/191444
PCT/US2019/024603
van den Boom et al., Exosomes as nucleic acid nanocarriers. Advanced Drug
Delivery
Reviews, 65:331-335, 2013.
van der Meel et al., Extracellular vesicles as drug delivery systems: Lessons
from the
liposome field-1. Controlled Release, 195:72-85, 2014.
Wahlgren et al., Plasma exosomes can deliver exogenous short interfering RNA
to monocytes
and lymphocytes. Nucleic Acids Research, 40:e130, 2012.
Westphal et al., EGFR as a Target for Glioblastoma Treatment: An Unfulfilled
Promise. CNS
Drugs, 31:723-735, 2017.
Weyrich et al., Change in protein phenotype without a nucleus: translational
control in
platelets. Semin. Thromb. Hemost., 30:491-498, 2004.
Willms et al., Cells release subpopulations of exosomes with distinct
molecular and
biological properties. Sc!. Rep., 6:22519, 2016.
Wykes & Lewin, Immune checkpoint blockade in infectious diseases. Nat. Rev.
Immunology,
18:91-104, 2018.
.. Xue et al., Small RNA combination therapy for lung cancer. Proc. Natl. Acad
Sci. U.S.A.,
111:E3553-3561, 2014.
Yamada et al., Cell Infectivity in Relation to Bovine Leukemia Virus gp51 and
p24 in Bovine
Milk Exosomes. PLoS ONE, 8:e77359, 2013.
Ying et al., Oncogenic Kras maintains pancreatic tumors through regulation of
anabolic
glucose metabolism. Cell, 149:656-670, 2012.
Yuan et al., Development of siRNA payloads to target KRAS-mutant cancer.
Cancer
Discovery, 4:1182-1197, 2014.
Zhang et al., Exosome-delivered EGFR regulates liver microenvironment to
promote gastric
cancer liver metastasis. Nat. Commun., 8:15016, 2017.
Zhang et al., A mechanism for the upregulation of EGF receptor levels in
glioblastomas. Cell.
Rep., 3:2008-2020, 2013.
Zilfou & Lowe, (2009). Tumor suppressive functions of p53. Cold Spring Harb.
Perspect.
Biol.,1:a001883, 2009.
Zorde Khvalevsky et al., Mutant KRAS is a druggable target for pancreatic
cancer. Proc.
Natl. Acad. Sci. U.S.A., 110:20723-20728, 2013.
92
