Note: Descriptions are shown in the official language in which they were submitted.
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
1
LACTOCOCCUS LACTIS STRAINS FOR THE PREVENTION AND/OR THE
TREATMENT OF VISCERAL PAIN
The present invention relates to Lactococcus lactis strains which have the
ability to
reduce pain, in particular visceral pain; these strains are useful for the
prevention and/or the
.. treatment of visceral pain in an individual. The present invention also
relates to new strains
among these Lactococcus lactis strains and compositions containing them.
Visceral pain is pain associated with the viscera, which encompass the
internal
organs of the body. Here the term of viscera includes all the gastro-
intestinal tract from the
oral cavity to the anus. These organs also include, for example, the heart,
lungs, reproductive
organs, bladder, ureters, the organs of the digestive tract, preferably
tongue, abdominal gut,
liver, pancreas, spleen, and kidneys. Visceral pain is characterized by a
vague, diffuse, dull,
aching pain, which is localized but can have a tendency to radiate abdomen
and/or back. It
can be accompanied by a feeling of malaise, and, when severe, it induces
strong autonomic
phenomena such as sweating, vasomotor responses, bradycardia, nausea and
vomiting. It is
usually felt in the midline and deep in the body.
There are a variety of conditions in which abdominal or visceral pain may
exist. For
example, pancreatitis pain, labor pain, pain from abdominal surgery associated
with ileus,
pain in irritable bowel syndrome, abdominal pain in non-ulcer dyspepsia, or in
dysmenorrhea. Likewise, liver pain, kidney pain, epigastric pain, pleural
pain, and painful
biliary colic, appendicitis pain may all be considered to be visceral pain.
Substernal pain or
pressure from early myocardial infarction is also visceral. Further, burning
mouth syndrome
(BMS) is a chronic idiopathic disorder characterized by burning sensation or
dysesthesia in
the tongue and other oral sites without clear etiology even if gastric origins
are suspected.
This BMS is accompanied by dry mouth, tingling, or dysgeusia. Considering the
peripheral
nervous alterations identified in BMS patients, some clinical trials have
demonstrated the
efficacy of topical GABA-A binding receptor ligands on BMS symptoms (de Castro
et al.,
2014). Diseases of the stomach, duodenum or colon can cause visceral pain.
Commonly
encountered gastrointestinal (GI) disorders that cause visceral pain include
functional bowel
disorder (FBD) and inflammatory bowel disease (IBD). These GI disorders
include a wide
range of disease states that are currently only moderately controlled,
including, with respect
to FBD, gastro-esophageal reflux, dyspepsia, irritable bowel syndrome (IBS)
and functional
abdominal pain syndrome (FAPS), and, with respect to 1BD, Crohn's disease,
ileitis and
ulcerative colitis, all of which regularly produce visceral pain.
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
2
According to Rome IV criteria, irritable bowel syndrome (IBS) is a functional
gastrointestinal disorder with unknown etiology, affecting 10-20% of adults in
most
countries. IBS results in various symptoms that strongly affect the patient's
quality of life
(Dean et al., 2005). It has been shown that stress is an important factor in
the onset,
maintenance and deterioration of IBS (Chang et al., 2011), which results in
significant
morbidity and health care costs. IBS is a disorder of the brain-gut axis and
clinical symptoms
include abdominal pain and changes in bowel habits (i.e., constipation,
diarrhea) without
structural abnormalities (Camilleri et al., 2012). A subset of IBS patients,
varying from 30%
to 40%, were reported to exhibit enhanced sensitivity to colonic distension,
which is
noticeable through their reduced threshold for pain, increased intensity of
sensations and/or
exaggerated viscerosomatic referral in response to colonic distension (Mayer
et al., 1994,
Mayer et al., 2008, Bouin et al., 2001, Zhou et al., 2010). Thus, visceral
hypersensitivity has
been proposed as a key clinical marker accounting for the severity of bowel
movements,
bloating and abdominal pain symptoms experienced by IBS patients (Kuiken et
al., 2005,
Posserud et al., 2007, Camilleri et al., 2008). For a better understanding of
the IBS
pathophysiology, acute and chronic stress animal models were developed
mimicking IBS
features, such as changes in visceral sensitivity and gut transit time (Gue et
al., 1997). In rat,
acute restraint stress associated with visceral hypersensitivity to rectal
distension is linked
to central release of corticotrophin releasing factor (CRF) (Gue et al.,
1997). Current
.. pharmacological treatments for these disorders (IBS and BMS) are to date
mainly symptom-
driven and their efficacy is generally low (Craig et al., 2018).
It appears from the foregoing that there is a need for alternatives to
pharmacological
agents for the prevention and/or the treatment of visceral pain.
Some experimental evidence suggests that probiotics would be an effective
treatment option to modulate abdominal pain in particular in IBS patients
(Moayyedi et al.,
2010, Hungin et al., 2013, Ford et al., 2014, Didari et al. 2015); however,
clinical results
differ considerably among studies due to the strains of probiotics used,
mixtures and dosages
of these strains, as well as treatment duration and subtypes of IBS patients
(Mazurak et al.,
2015).
Recently, the human gut commensal Bifidobacteriurn dentiurn, producing y-
aminobutyric acid (GABA), was shown to modulate sensory neuron activity in a
rat fecal
retention model of visceral hypersensitivity (Pokusaeva et al., 2017).
Moreover, the
Escherichia coli strain Nissle 1917 was demonstrated to produce the
C12AsnGABAOH
lipopeptide, able to inhibit visceral sensitivity in mice (Perez-Berezo et
al., 2017). However,
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
3
no proof of the efficacy of the probiotic itself was given, only the analgesic
properties of the
C12AsnGABAOH lipopeptide was shown.
Thus, it remains useful to identify new therapeutic approaches to reduce
visceral
pain and that are easy to produce with a low production cost.
In this context, the Inventors focused on the study of the lactic acid
bacteria,
Lactococcus lactis. While the Lactococcus lactis subsp. lactis strains are
known to produce
GABA in vitro (Nomura et al., 1999) and are theoretically, genetically able to
express the
pyridocal-5' -phosphate (PLP)-dependent enzyme glutamate decarboxylase (GAD),
the
enzyme which converts the glutamate in GABA, their effective capacity to
express GAD
and produce GABA is very aleatory for reasons that are not known. Indeed, the
Inventors
showed that despite the strong similarity of the gad operon involved in GABA
biosynthesis
between L. lactis NCD02727 and NCD02118 strains, GABA production under similar
culture conditions was very different with a very weak amount of GABA produced
by the
NCD02727 strain (GABA concentration always below 0.2 mM in Figure 2A). In a
same
way, a high GAD activity was obtained in the NCD02118 strain, while in the
NCD02727
strain, the amount was extremely low (Table 3).
Frequently encountered in dairy products, L. lactis is one of the most
ingested
bacteria (Mills et al., 2010, Laroute et al., 2017). This bacterium is
commonly found in dairy
products such as cheese or dairy fermented products, including fermented milk.
Although not considered as a commensal bacterium, L. lactis was found to
persist
transiently in the gut, depending on the strain under study (Wang et al.,
2011, Radziwill-
Bienkowska et al., 2016, Zhang et al., 2016).
The Inventors identified new L. lactis strains able to produce high amounts of
GABA, i.e., at least 10 mM of y-aminobutyric acid (GABA) in a time of culture
lower or
equal of 24 hours, and they have shown that these strains possess the
surprising and
unexpected ability to reduce visceral pain. Thus, these L. lactis strains
represent new agents
for preventing and/or treating visceral pain.
Moreover, the Inventors have demonstrated that a L. lactis stain, NCD02727,
which produces low amount of GABA, do not possess such advantageous
properties.
Accordingly, an object of the present invention is a Lactococcus lactis strain
able
to produce at least 10 mM of y-aminobutyric acid (GABA) in a time of culture
lower or
equal to 24 hours, for use in the prevention and/or the treatment of visceral
pain, in an
individual.
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
4
Preferably, the Lactococcus lactis strain of the present invention is able to
produce
at least 10 mM of GABA, more preferably 20 mM of GABA, still more preferably
40 mM
of GABA and most preferably at least 60 mM of GABA in a time of culture lower
or equal
to 24 hours (Figure 2A).
The ability to produce GABA may be assessed by culturing a Lactococcus lactis
strain in a medium M17 supplemented with glutamate, arginine, glucose and NaCl
in a
fermenter. In the first hours of culture, the pH is maintained at 6.6, GAD is
induced and
accumulated. At 7-8 hours of culture, the strains are collected for individual
treatment then
pH is decreased at 4.6 to quantify GABA production rate. The concentration of
GABA is
measured over time until 24 hours.
The preparation of culture media and the definition of the culture conditions
allowing the growth and the induction of GAD expression in the strains of
Lactococcus lactis
of the present invention are well known by the person skilled in the art; such
culture medium
may be adapted to each specific L. lactis strain; for example, for the strain
CNCM 1-5388,
the addition of arginine and NaCl to a basic M17 culture medium has been
proven to induce
the expression of GAD; other strains such as CNCM 1-5386 are able to enhance
the GAD
expression at a level similar to NCD02118 when cultured on this M17 culture
medium
without addition of any specific compound.
An individual according to the invention is a mammal or a bird; for example,
the
individual may be an animal from a livestock breeding, such as poultry, or a
pet; according
to a specific embodiment, the individual is a human.
Preferably, the strain L. lactis of the present invention is characterized in
that the
activity of the pyridocal-5'-phosphate (PLP)-dependent enzyme glutamate
decarboxylase
(GAD) produced by said strain is at least 20 iimole/min.mg of protein in a
time of culture
comprised between 7 hours and 8 hours.
Preferably, the activity of the GAD produced by Lactococcus lactis strain in
the
present invention is at least 20 iimole/min.mg of protein, more preferably 40
iimole/min.mg,
still more preferably 60 iimole/min.mg and in an increasing order at least
100, at least 200,
at least 300, at least 400, at least 500, at least 600, at least 700
iimole/min.mg and most
preferably at least 820 iimole/min.mg in a time of culture comprised between 7
hours and 8
hours.
Preferably, the strain L. lactis of the present invention is characterized in
that the
GABA production rate at pH 4.6 by said strain is at least of 1 mmole/h/g of
cell dry weight
in a time of culture comprised between 8.5 hours and 11.5 hours.
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
Preferably, the specific production rate of GABA in the present invention is
at least
1 mmole/h/g of cell dry weight, more preferably 3 mmole/h/g of cell dry weight
and most
preferably at least 7 mmole/h/g of cell dry weight in a time of culture
comprised between
8.5 hours and 11.5 hours.
5
Methods for assessing the GAD activity are known in the art as shown in
Example
1. The GABA production rate is a specific rate calculated between 8.5 hours
and 11.5 hours
(mean value).
The strain L. lactis in the present invention can be selected in the group
consisting
of: CNCM 1-5388, CNCM 1-5386 and NCD02118, preferably between CNCM 1-5388 and
.. CNCM 1-5386, and more preferably said L. lactis strain is the strain CNCM 1-
5388.
The strains CNCM 1-5388 and CNCM 1-5386 were deposited according to the
Budapest Treaty, at CNCM (Collection Nationale de Cultures de Microorganismes,
25 rue
du Docteur Roux, Paris) on November 29, 2018 for CNCM 1-5386 and on
December 13, 2018 for CNCM 1-5388.
The L. lactis strains of the present invention are of a particular interest in
preventing
or treating visceral pain.
The prophylactic and therapeutic effect of the L. lactis strains of the
invention is
obtained in presence of free glutamate; for example, the amount of free
glutamate is about 4
mg per 109 cfu of L lactis and per day or is about 17 mg/kg bw/day.
As demonstrated in Example 2, free glutamate per se does not produce any
beneficial or unwanted effect on basal and stress-induced colorectal activity.
Depending of the continent and diet culture, classic diet provides different
levels of
free glutamate (average population intakes of free glutamate range from 5.5
mg/kg bw/day
(elderly Austrians) to 37 mg/kg bw/day (toddlers in Belgium); high-level
intakes range up
to 82 mg/kg bw/day for other children in Belgium, 77 mg/kg bw/day for Danish
infants, and
56 mg/kg bw/day for other children in Bulgaria; moreover, from natural free
glutamate and
dietary protein, a range of 81 to 155 mg/kg bw/day can be ingested in adults.
David R.
Tennant, Ann. Nutr. Metab. 2018;73:21-28). Therefore, according to these data,
the
Inventors considered that L. lactis strains of the invention can be
administered alone, i.e.
without the addition of free glutamate to exert an efficient prevention or a
reduction of
abdominal or visceral pain.
Alternatively, in case of free glutamate-free diet or diet especially poor in
free
glutamate, the L. lactis strains of the invention may be administered together
with free
glutamate. Accordingly, in a specific embodiment, another object of the
present invention is
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
6
the combination of strain L. lactis of the present invention and of between 10
and
20 mg/kg bw/day, in particular 17 mg/kg bw/day of free glutamate for use in
the prevention
and/or the treatment of visceral pain, in an individual.
For the different aspects of present invention, visceral pain may be caused by
an
.. injury, an infection, an inflammation, a disease or by a thermal stimulus,
a mechanical
stimulus, an electric stimulus a chemical stimulus or a radioactive stimulus.
Visceral pain in the invention is in particular those observed in chronic
abdominal
and pelvic pain disorders, including irritable bowel syndrome (IBS) but also
burning mouth
syndrome (BMS). IBS patients exhibit significantly lower response thresholds
to
provocative stimuli (i.e., rectal distension), complain of increased
sensitivity during normal
organ function, and present increased tenderness in expanded areas of somatic
(abdominal)
referral (i.e., both visceral and somatic hypersensitivity). Functional
visceral (gastro-
intestinal) disorders resulted from altered central nervous system processing
and/or
dysregulated central modulation. In this cascade of events, visceral inputs of
primary afferent
nociceptors located in the Dorsal Root Ganglia (DRG) are responsible for
changes in the
perception of pain. However, all chronic diseases such as hepatitis, peptic
ulcer, IBD
(Crohn's disease and ulcerative colitis), IBS in which abdominal and/or back
pain is a
principal complaint and all the perceived sensations are initiated by activity
in peripheral
sensory (afferent) neurons (Keszthelyi D. et al., 2012). Regarding Burning
mouth syndrome
(BMS) that is an important chronic pain disorder that affects more than 1
million people in
the United States (Miziara et al., 2009). BMS is characterized by both
positive (burning pain,
dysgeusia and dysesthesia) and negative (loss of taste and paraesthesia)
sensory symptoms
involving the lips and tongue, mainly the tip and anterior two-thirds. BMS may
be classified
into three types (Sun et al., 2013). In Type 1, patients are free of pain on
waking but
experience increasing symptoms as the day goes on. In Type 2, patients have
continuous
pain throughout the day; this type accounts for 55% of patients and has the
strongest
association with psychological disorders (Coculescu et al., 2014). In Type 3,
patients have
intermittent symptoms with pain-free periods during the day. Moreover, these
BMS patients
frequently have depression, anxiety, sometimes diabetes, and even
nutritional/mineral
deficiencies.
According to an embodiment of the invention, visceral pain is caused by a
gastrointestinal disorder, such as an Irritable Bowel Syndrome or Burning
Mouth Syndrome
characterized by burning of the oral mucosa in the absence of underlying
dental or medical
causes. This is also the case with a functional and organic dyspepsia,
narcotic bowel
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
7
syndrome, IBD, colonic cancer, chronic pancreatitis, diverticulitis,
appendicitis, ovarian
cyst.
It is known that visceral pain is increased in various psychological stress
conditions
(acute and chronic).
An acute partial restraint stress increases visceral sensitivity
(hypersensitivity) and
also reduces the threshold of the sensitivity (allodynia).
According to an embodiment of the invention, the L. lactis strains in the
present
invention are useful when visceral pain is linked to psychological stress
events and/or
anxiety. The model of the psychological stress events and/or anxiety is an
acute partial
restraint stress (PRS).
PRS is considered as a mild non-ulcerogenic model (Williams et al., 1987) and
consists of under light anesthesia with ethyl ether, constraining animal body
movements. For
this, the upper forelimbs of the animal are taped up to the thoracic trunk in
order to constrain
animal body movements during 2 hours. Rats are then replaced in their home
cages. In rats
PRS is reflected by both an increase of adrenocorticotropic hormone (ACTH) and
corticosterone plasmatic concentrations (Sun et al., 2006), associated with
visceral
hypersensitivity to rectal distension linked to central release of
corticotrophin releasing
factor (CRF), (Gue et al., 1997), as well as increase in gut permeability (Ait-
Belgnaoui et
al., 2005).
Indeed, the Inventors showed that L. lactis NCD02118, producing high level of
GABA, prevents visceral hypersensitivity in an acute-stress rat model, whereas
L. lactis
NCD02727, producing low level of GABA, is not able to induce such an effect.
Further, the NCD02118 AgadB mutant strain, unable to produce GABA, failed to
prevent visceral hypersensitivity in the same model.
In one aspect of the invention, the L. lactis strains of the present invention
are
characterized in that the effect produced by these strains is obtained from 10
days, more
preferably from 7 days, still more preferably from 5 days and most preferably
from 4 days
of the treatment of visceral pain linked to psychological stress events and/or
anxiety.
Indeed, the Inventors showed that the beneficial effect produced by CNCM 1-
5388
is obtained from 5 days of the treatment of visceral pain linked to an acute
stress, and the
effect produced by NCD02118 is obtained from 10 days of such treatment.
Another aspect of the invention is the Lactococcus lactis strain as defined
above,
for use in the prevention and/or the treatment of visceral pain due to burning
mouth
syndrome (BMS).
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
8
An object of the present invention is also a cell fraction obtained from the
Lactococcus lactis strain as defined above, for use in the prevention and/or
the treatment of
visceral pain and in particular for use in the prevention and/or the treatment
of visceral pain
linked to psychological stress events and/or anxiety.
Said cell fraction is in particular preparations containing bacterial enzymes,
especially GAD, obtained from cultures of L. lactis of the invention. It may
also be culture
supernatants or fractions of these strains. The cell fractions can be prepared
according to the
methods known for the person skilled in the art. In a non-limited way, these
methods
generally include a step of lysis of the bacteria obtained after culture and a
step of separation
of the fractions containing the membranes of the said bacteria from the total
lysate obtained
after the lysis step, in particular by centrifugation or filtration.
Another aspect of the invention is the cell fraction obtained from Lactococcus
lactis
strain as defined above, for use in the prevention and/or the treatment of
visceral pain due to
burning mouth syndrome (B MS ).
An object of the present invention is also a composition comprising the
Lactococcus
lactis strain according to the present invention or the cell fraction
according to the present
invention and optionally free glutamate preferably in an amount of between 10
and
mg/kg bw/day, in particular of 17 mg/kg bw/day, for use in the prevention
and/or the
treatment of visceral pain.
20 In
the composition of the invention, said strain can be used in the form of whole
bacteria which may be living or dead. Alternatively, said strain can be used
in the form of a
bacterial lysate. Preferably the bacterial cells are present as living, viable
cells.
The composition of the invention can be in any form suitable for
administration, in
particular oral administration. This includes for instance solids, semi-
solids, liquids, and
powders.
When the bacteria are in the form of living bacteria, the composition given
per day
may comprise a content of the L. lactis strain according to the present
invention allowing the
administration of at least 106 colony forming units (cfu) of said L. lactis
strain, preferably at
least 107 cfu, still more preferably at least 108 cfu, and most preferably at
least 109 cfu.
Another aspect of the invention is the composition comprising the Lactococcus
lactis strain according to the present invention or the cell fraction
according to the present
invention, for use in the prevention and/or the treatment of visceral pain due
to burning
mouth syndrome (B MS ).
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
9
An object of the present invention is also a method for preventing and/or
treating
visceral pain, comprising administering to a mammal in need thereof, a
therapeutic amount
of the Lactococcus lactis strain of the invention or the cell fraction of the
invention, as
defined above. Determination of a therapeutic amount is well known from the
person skilled
in the art, especially in view of the detailed disclosure provided herein.
An object of the present invention is also the use of the Lactococcus lactis
strain of
the invention or the cell fraction of the invention, as defined above for the
manufacture of a
medicament for preventing and/or treating visceral pain.
As used herein, the treatment or prevention encompasses inter alia: preventing
and/or decreasing visceral pain.
The composition of the present invention can be a pharmaceutical composition
or
a nutritional composition, including food products such as food supplements
and functional
food. The food products comprise dairy products and dairy fermented products.
A pharmaceutical composition can be in an oral form such as tablets, capsules,
powders, syrups effervescent compositions and sprays. Said pharmaceutical
composition
can also be in sublingual and buccal forms such as sublingual tablets and
solution
compositions that are administered under the tongue and buccal tablets that
are placed
between the cheek and gum.
A food supplement designates a product made from compounds usually used in
foodstuffs, but which is in the form of tablets, powder, capsules, potion or
any other form
usually not associated with aliments, and which has beneficial effects for
one's health.
A functional food is an aliment which also has beneficial effects for one's
health. In
particular, food supplements and functional food can have a physiological
effect, protective
or curative, against a disease or a pain.
The composition can be in the form of a liquid or present in the form of a dry
powder
obtained by drying the liquid.
In a preferred embodiment, the product is a fresh product. A fresh product,
which
has not undergone severe heat treatment steps, has the advantage that the
bacterial strains
present are in the living form.
The Inventors have also identified two new Lactococcus lactis strains having
the
specific abilities discussed previously.
Thus, the present invention also provides a Lactococcus lactis strain,
characterized
in that said strain is selected in the group consisting of: CNCM 1-5388, CNCM
1-5386.
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
The present invention also encompasses a cell fraction obtained from the
Lactococcus lactis strain selected in the group consisting of: CNCM 1-5388,
CNCM 1-5386.
The present invention also provides a composition comprising said Lactococcus
lactis strain as defined above or said cell fraction as defined above.
5 Said composition can comprise at least 106 colony forming units (cfu),
preferably
at least 107 cfu, more preferably at least 108 cfu, and most preferably at
least i09 cfu per gram
dry weight of the composition.
The composition as defined above can be a pharmaceutical composition or a
nutritional composition, including food products as defined above.
10 Said composition can be in the form of a liquid or present in the form
of a dry
powder obtained by drying the liquid.
In a preferred embodiment, the product is a fresh product.
An object of this invention is related to a pharmaceutical composition
comprising
the Lactococcus lactis strain or the cell fraction as defined above and a
pharmaceutically
acceptable vehicle; optionally said composition also comprises free glutamate.
In an embodiment of the invention, the composition as defined above is for use
as
a medicament. The formulation of said medicament is adapted allowing local
treatment in
the form of a spray or tablets to melt under the tongue.
Said composition is particularly useful for preventing and/or treating
visceral pain.
The present invention further relates to a method of treatment for preventing
and/or
treating visceral pain as defined above, comprising the administration of the
Lactococcus
lactis strain or the cell fraction or the composition as defined above to an
individual.
The present invention also relates to the Lactococcus lactis strain or the
cell fraction
of the invention, optionally in association with free glutamate, for the
preparation of a
medicine for the prevention and/or the treatment of visceral pain as defined
above.
The present invention will be understood more clearly from the further
description
which follows, which refers to examples illustrating the capacity of the L.
lactis strains in
the present invention for reducing visceral pain, as well as to the appended
figures.
Figure 1 shows the organization of the gad cluster in the different strains.
Figure 2 shows the GABA production (mM) (A) and evolution of biomass (g/L)
(B) during growth of L. lactis NCD02118 (square), CNCM 1-5388 (diamond), CNCM
I-
5386 (triangle) or NCD02727 (circle) in M17 supplemented with free glutamate
(8 g/L),
arginine (5 g/L), glucose (45 g/L) and NaCl (300 mM). Independent duplicates
(filled
symbols: first experiment and open symbols: second experiment).
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
11
Figure 3 shows the effect of 10-day oral administration of free glutamate (2
mg in
the diet and 2 mg co-administrated with L lactis) on and PRS-induced
colorectal sensitivity
of vehicle-treated rats at all the distension pressures of CRD (from 15 to 60
mmHg). Data
are expressed as means SEM (n=10 for the "vehicle" group (open square,
dashed line);
n=10 for the "PRS+vehicle" group (black square, solid line); n=11 for the
"vehicle+free
glutamate" group (black circle, dashed line); n=11 for the "PRS+vehicle+free
glutamate"
group (black circle, solid line)). *P<005; **P<001; ***P<0.001 vs. basal
values for animals
treated with vehicle.
Figure 4 shows the effect of 10-day oral administration of L. lactis NCD02118
and
L. lactis NCD02727 on PRS -induced visceral hypersensitivity at all the
distension pressures
of CRD (from 15 to 60 mmHg). Data are expressed as means SEM (n=9 for the
"vehicle"
group (white square, dashed line) and "PRS+vehicle" group (black square, solid
line); n=12
for the "PRS+NCD02118+free glutamate" group (black triangle, solid line); n=8
for the
"PRS+NCD02727+free glutamate" group (black star, solid line)). P<0.001 vs.
basal
values for animals treated with vehicle. P<0.05; P <0.01 vs. values for
stressed animals
treated with vehicle.
Figure 5 shows the effect of 5-day or 10-day-oral administration of L. lactis
NCD02118 and L. lactis CNCM 1-5388 on PRS-induced visceral hypersensitivity at
all the
distension pressures of CRD (from 15 to 60 mmHg). A. Results obtained with L.
lactis
NCD02118 at 5 days. Data are expressed as means SEM (n=11 for the "vehicle"
group
(white square, dashed line), n=11 for the "PRS+vehicle" group (black square,
solid line) and
n=11 for the "PRS+NCD02118+free glutamate" group (black triangle, solid
line)).
"P<0.01 significantly different vs. basal values for animals treated with
vehicle. B. Results
obtained with L. lactis CNCM 1-5388 at 5 days. Data are expressed as means
SEM (n=7
for the "vehicle" group (white square, dashed line); n=7 for the "PRS+vehicle"
group (black
square, solid line); n=7 for the "PRS+CNCM 1-5388" group (black/white diamond,
dash-
dotted line) and "PRS+CNCM I-5388+free glutamate" (black diamond, solid
line)).
*P<005; **P <0.01 vs. basal values for animals treated with vehicle, C.
Results obtained
with L. lactis NCD02118 at 10 days. Data are expressed as means SEM (n=9 for
the
.. "vehicle" group (white square, solid line); n=9 for the "PRS+vehicle" group
(black square,
solid line); n=12 for the "PRS+NCD02118+free glutamate" group (black triangle,
solid
line); n=8 for the "PRS+NCD02118" group (black/white triangle, dash-dotted
line))***P<0.001 vs. basal values for animals treated with vehicle. P<0.05;
P <0.01 vs.
values for stressed animals treated with vehicle. D. Results obtained with L.
lactis CNCM I-
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
12
5388 at 10 days. Data are expressed as means SEM (n=7 for the "vehicle"
group (white
square, dashed line); n=7 for the "PRS+vehicle" group (black square, solid
line); n=8 for the
"PRS+CNCM 1-5388" group (black/white diamond, dash-dotted line) and n=7 for
the
"PRS+CNCM I-5388+free glutamate" (black diamond, solid line).**P <0.01 vs.
basal values
for animals treated with vehicle. P <0.05 vs. values for stressed animals
treated with vehicle.
Figure 6 shows the effect of GABA-producing L. lactis NCD02118 and the non-
GABA producing NCD02118 AgadB mutant (109 cfu per day) on PRS-induced visceral
hypersensitivity at all the distension pressures of CRD (from 15 to 60 mmHg).
Data are
expressed as means SEM (n=13 for the "vehicle" group (white square, dashed
line) and
"PRS+vehicle" group (black square, solid line); n=14 for the
"PRS+NCD02118+free
glutamate" group (black triangle, solid line); n=13 for the "PRS+ NCD02118
AgadB+free
glutamate" group (inverted triangle, dash-dotted line)). **P<001; ****P
<0.0001 vs. basal
values for animals treated with vehicle. P <0.01; P <0.001 vs. values for
stressed animals
treated with vehicle SP <0.05 vs. values for stressed animals treated with
NCD02118.
Figure 7 shows the effect of 5-day or 10-day-oral administration of L. lactis
CNCM
1-5388 on PRS-induced visceral hypersensitivity at all the distension
pressures of CRD (from
15 to 60 mmHg). A. Results obtained with L. lactis CNCM 1-5388 at 5 days. Data
are
expressed as means SEM (n=10 for the "vehicle" group (white square, dashed
line), n=10
for the "PRS+vehicle" group (black square, solid line), n=10 for the "PRS+CNCM
1-5388"
group (white ring, solid line), n=9 for the "PRS+CNCM I-5388+free glutamate"
group
(black ring, solid line), n=9 for the "PRS+CNCM I-5388+free
glutamate+inhibitor" group
(white rhombus, solid line), n=9 for the "PRS+CNCM I-5388Agad mutant+free
glutamate"
group (black rhombus, solid line). *P<0.05; **P <0.01;
P<0.0001 vs. basal values for
animals treated with vehicle. P <0.001 vs. values for stressed animals
treated with vehicle.
B. Results obtained with L. lactis CNCM 1-5388 at 10 days. Data are expressed
as means
SEM (n=10 for the "vehicle" group ((white square, dashed line), n=10 for the
"PRS+vehicle"
group (black square, solid line), n=9 for the "PRS+CNCM 1-5388" group (white
ring, solid
line), n=9 for the "PRS+CNCM I-5388+free glutamate" group (black ring, solid
line), n=9
for the "PRS+CNCM I-5388+free glutamate+inhibitor" group (white rhombus, solid
line),
n=9 for the "PRS+CNCM I-538 8 Agad mutant+free glutamate" group (black
rhombus, solid
line)). *P<0.05; **P <0.01; ****P <0.0001 vs. basal values for animals treated
with vehicle.
P<0.05; P <0.01 vs. values for stressed animals treated with vehicle.
EXAMPLE 1: Physiological characterization of bacterial suspensions of interest
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
13
1. Materials and Methods:
1.1.B acterial strains, medium and culture conditions:
The data set is composed of four strains belonging to the Lactococcus lactis
subsp.
lactis. The two strains, NCD02118 and NCD02727 were isolated from vegetables
while
CNCM 1-5388 and CNCM 1-5386 have a dairy origin (raw milk and whey
respectively).
In these strains, the gad cluster involved in GABA biosynthesis is located on
the
chromosome between kefA and mhB genes (Figure 1). The gad cluster is composed
of gadR,
gadC and gadB encoding respectively the operon regulator, glutamate/GABA
antiporter and
glutamate decarboxylase. The same cluster organization is retained in these
strains except
for CNCM 1-5386. Indeed, a copy of the insertion sequence IS981 has been found
in the
promoter of the gadCB operon. This insertion sequence contains outward -35
promoter
component and its insertion at the correct distance from the native -10 box
can modify the
strength of the promoter and its regulation. The nucleotide sequences of gadR,
gadC and
gadB genes are highly similar in the 4 strains with more than 98% identity
(Figure 1).
Bacterial cultures were performed in duplicate in 2-L Biostat B -plus
bioreactor
(Sartorius, Melsungen, Germany) in medium M17 (Table 1) supplemented with 55
mM
(8 g/L) free glutamate, 29 mM (5 g/L) arginine, 250 mM (45 g/L) glucose and
300 mM
NaCl. Cultures were incubated at 30 C.
Ingredients g/L
Tryptone 2.5
Peptic digest of animal tissue 2.5
Papaic digest of soybean meal 5
Meat extract 5
Yeast extract 2.5
Ascorbic acid 0.5
Magnesium sulphate 0.5
Sodium glycerophosphate 19
Table 1: Composition of medium M17.
Fermentations were carried out under oxygen-limiting conditions, with air in
the
gaseous phase but without air bubbling. pH was maintained at 6.6 by KOH
addition for 8 h,
then pH was modified and regulated at 4.6.
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
14
Culture was inoculated with cells from pre-cultures grown in Erlenmeyer flask
on
similar medium, harvested during the exponential phase and concentrated in
order to obtain
an initial optical density (OD) at 580 nm of 0.25 in the fermenter.
Bacterial growth was estimated by spectrophotometric measurements at 580 nm
(Libra S11, Biochom, 1 Unity of absorbance is equivalent to 0.3 g/L).
Samples were collected every 30 min for HPLC measurement of GABA
concentration in the growth medium.
Cellular samples for oral administration were prepared as follows. Cells were
harvested before the pH modification (i.e. at 7 h for NCD02118 and NCD02727).
The culture volume required for approximately 3x1011 cells was centrifuged at
5000 g and 4 C for 10 min to pellet the bacterial cells.
Cells were washed twice with 0.9% NaCl and suspended in 0.9% NaCl containing
15% glycerol to a final concentration of 10x109 cfu/mL and stored at -20 C
until use.
1.2.GABA extraction and quantification:
GABA concentration in culture supernatant or reaction mixture of enzyme assay
was measured by HPLC (Agilent Technologies 1200 Series, Waldbronn, Germany).
Prior to HPLC, proteins were precipitated by adding four volumes of methanol
to
one volume of sample. The mixture was centrifuged and the supernatant kept for
HPLC
analysis. Amino acids were automatically derived with OrthoPhtalic Aldehyde
(OPA) and
9-fluorenylmethyl-chloroformiate (FM0C-C1). The derivatives were separated on
Hypersil
AA-ODS column (Agilent Technologies) at 40 C by a linear gradient of acetate
buffer (pH
7.2) with triethylamin (0.018%), tetrahydrofuran (0.3%) and acetonitrile. A
diode array
detector, at 338 nm for OPA derivatives and 262 nm for FMOC derivatives, was
used.
1.3. Glutamate decarboxylase (GAD) activity:
50 mg of bacterial cells were harvested at 7 h of culture. Cells were washed
twice
with 0.2% KC1 and suspended in sodium acetate buffer (100 mM, pH 4.6)
containing
4.5 mM MgCl2, 22% glycerol and 1.5 mM DTT. Cells were disrupted by sonication
(four
cycles of 30s and 60s spaced out, 6.5m/s) and kept on ice during the
treatment. Cell debris
were removed by centrifugation for 15 min at 10,000 g and 4 C.
The supernatant was used for enzyme assays, and the protein concentration of
the
extract was determined by the Bradford method with bovine serum albumin as the
standard.
Enzyme assay was realized with 0.5 mL of substrate solution, consisting of 20
mM
sodium glutamate, 2 mM pyridoxal phosphate (PLP) incubated at 30 C then mixed
with 0.5
mL supernatant. Every 30 min until 4 h, 100 i.iL were sampled and inactivated
by boiling for
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
5 min to stop the decarboxylation reaction. Reaction mixtures were
subsequently analyzed
for the presence of GABA using HPLC.
The GAD activity was measured at 7 h and neutral pH condition.
One unit of enzyme activity was defined here as the amount of enzyme which
5 converted 1 mole of glutamate per min and per mg of protein.
2. Results:
2.1./n vitro GABA production:
The biomass and GABA concentrations were measured all along the culture for
NCD02118, CNCM 1-5388, CNCM 1-5386 and NCD02727 strains (Figure 2).
10 In the first 8 hours, the bacterium NCD02118 as well as CNCM 1-5388,
CNCM I-
5386 grew fast (growth rate around 0.7-0.8h-1) at pH 6.6 compared to NCD02727.
GABA
was accumulated at low levels for all strains. Then at 8 hours, the pH was
lowered and
controlled to 4.6, growth stopped thereafter and biomass decreased. This loss
in cell viability
was confirmed by plating.
15 Despite the growth arrest, the production of GABA by NCD02118 strain or
CNCM
1-5388 and CNCM 1-5386 continued with increased GABA production rate (Table
2). The
maximal GABA concentration reached 60 mM at 24 hours for CNCM 1-5388. Similar
results
were obtained with a second culture in bioreactor (independent duplicate).
GABA
production of 40-60 mM corresponds to the complete bioconversion of initial
concentration
of free glutamate into the bioreactor.
Despite the strong similarity of the gad operon sequence and organization in
all the
four strains, GABA production pattern of the NCD02727 strain characterized
under similar
culture conditions was very different with a very weak amount of GABA produced
since
GABA concentration is always below 0.2 mM (Figure 2A) and GABA production rate
is
low (Table 2).
NCD02118 NCD02727 CNCM 1-5388 CNCM 1-5386
max (h-1) 0.71 0.05 0.21 0.04 0.81
0.08 0.71 0.05
V mean GABA 2.86 0.39 0.02 0.04 6.70 2.67 1.09
0.27
(mmole/g/h)
Table 2: Specific rates of GABA production calculated between 7 and 11.5 hours
(mmole/g
cell dry weight/h) during growth of L. lactis NCD02118, CNCM 1-5388, CNCM 1-
5386 and
NCD02727 in bioreactor (in duplicates).
2.2./n vitro GAD activity:
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
16
High GAD activity was obtained in the NCD02118 strain consistently with its
high
GABA production ability, while in the NCD02727 strain, the amount was
extremely low
(Table 3). Intermediary level of GAD activity was obtained for CNCM 1-5386
strain while
a very high activity was measured for the CNCM 1-5388 strain. One can notice
however that,
under neutral pH condition at 7 hours, the GAD activity in the NCD02118
strain, CNCM I-
5388 or CNCM 1-5386 was high despite the low GABA production accumulated in
the
bioreactor, suggesting that the enzymatic equipment for GABA production was
already
expressed in cells but not yet active.
NCD02118 NCD02727 CNCM 1-5388 CNCM 1-5386
GAD 7 hours 42.7 5.9 0.6 0.4 826.2 93.0 20.7 4.3
Table 3: Specific GAD activity (i.tmole/min.mg of protein) of the L. lactis
strains after 7
hours of growth in M17 supplemented with free glutamate (8 g/L), arginine (5
g/L), and
NaCl (300 mM) (n=3 for each of the two cultures replicates in bioreactor).
EXAMPLE 2: Effect of L. lactis strains of interest in a stress model in rat
(model IBS)
1. Materials and Methods:
1.1. Animals and surgical procedure:
Adult female Wistar rats (200-225 g) were purchased from Janvier Labs (Le
Genest
St Isle, France) and individually housed in polypropylene cages under standard
conditions
(temperature 22 2 C and a 12-h light/dark cycle). Animals were allowed free
access to
water and food (standard pellets 2016, Envigo RMS SARL, Gannat, France). All
experiments were approved by the Local Animal Care and Use Committee, in
compliance
with European directive 2010/63/UE.
Under general anesthesia by intraperitoneal administration of 0.6 mg/kg
acepromazine (calmivet, Vetoquinol, Lure, France) and 120 mg/kg ketamine
(Imalgene
1000, Merial, Lyon, France), animals were prepared for abdominal striated
muscle
electromyography (EMG) according to a previously described technique (Morteau
et al.,
1994).
Three pairs of NiCr wire electrodes (60 cm length and 80 iim diameter) were
implanted bilaterally in the striated muscles at 2 cm laterally from the
midline. The free ends
of electrodes were exteriorised on the back of the neck and protected by a
glass tube attached
to the skin.
1.2. Colorectal distension procedure and EMG recordings:
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
17
Female rats were accustomed to being in polypropylene tunnels (20 cm length
and
7 cm diameter), where they could not move, escape or turn around, for several
days before
colorectal distension (CRD) in order to achieve familiarization with that
environment.
A 4-cm long latex balloon, fixed on rigid catheter taken from an embolectomy
probe
(Fogarty), was used.
CRD which is a mechanical stimulus was performed after insertion of the
balloon
in the rectum at 1 cm from the anus. The tube was fixed at the basis of the
tail. Isobaric
distensions of the colon were performed from 0 to 60 mmHg by connecting the
balloon to
Distender Series IIR Barostat (G&J Electronics Inc, Toronto, Canada).
The first distension was performed at a pressure of 15 mmHg and an increment
of
mmHg was added at each following step, until a maximal pressure of 60 mmHg was
reached, each distension step lasting 5 min.
The striated muscle spike bursts, related to abdominal cramps, were recorded
on an
electroencephalograph machine (Mini VIII, Alvar, Paris, France) from implanted
electrodes,
15 using a short time constant (0.03 s) to remove low-frequency signals (<3
Hz). EMG
recordings started 7 days after surgery.
The number of contractions for a period of 5 minutes represents the intensity
of
visceral pain.
1.3. Stress procedure:
All stress sessions were performed at the same time of day (between 10 am and
12
noon) to minimise any influence of circadian rhythm.
Partial restraint stress (PRS), a relatively mild non-ulcerogenic model of
acute
stress, was performed as previously described (Williams et al., 1988).
Female rats were sedated with diethyl-ether and their fore shoulders, upper
forelimbs and thoracic trunk were wrapped in a confining harness of paper tape
to restrict,
but not prevent, body movements.
Animals were then placed in their home cage for 2 h.
1.4. Experimental protocol:
Four series of experiments, based on a 10-day treatment by oral gavage, were
conducted using, for each series, three groups of 7 to 12 female rats equipped
for EMG.
Rats were given L. lactis NCD02118 or NCD02727 by gavage once daily for 10
days. Washed bacterial cells (109 cfu per day) were used in order to minimize
the amount of
GABA initially administered to rats. Unless otherwise stated, free glutamate
(0.2% (w/v))
was added to the gavage mixture to favor in vivo GABA production.
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
18
For all conditions, basal abdominal response to CRD was recorded on Day 9 of
the
treatment and PRS-induced visceral hypersensitivity to CRD recorded on Day 10
of the
treatment.
CRD measurements were performed 20 minutes after the 2 h PRS session.
On vehicle-treated animals, free glutamate (0.2% (m/v)) is verified as having
no
effect per se on basal and stress-induced colorectal sensitivity.
1.5.Statistical methods:
For animal experiments, data are reported as the means standard errors of
the
means (SEM). The software GraphPad Prism 6.0 (GraphPad, San Diego, CA) was
used for
statistical analysis. One-way ANOVA, followed by Tukey' s Multiple Comparison
test, was
performed to compare data between the different groups of animals. Statistical
significance
was accepted at P < 0.05.
2. Results:
2.1. Effect of free glutamate on basal and stress-induced colorectal
sensitivity
In rats treated with the vehicle under basal conditions (i.e. before PRS),
gradual
colorectal distension (CRD) increased the frequency of abdominal contractions
in a pressure-
dependent manner (Figure 3).
Compared with vehicle, administration of free glutamate did not affect the
abdominal response to CRD (Figure 3).
In vehicle-treated rats, a 2-h PRS significantly increased the number of
abdominal
contractions in comparison with basal conditions; administration of free
glutamate did not
modify the visceral hypersensitivity response to CRD measured after the PRS
session
(Figure 3).
Thus, free glutamate had no effect per se on basal and stress-induced
colorectal
sensitivity.
2.2. Effect of the L. lactis NCD02118 on visceral hypersensitivity
The influence of L. lactis NCD02118 and NCD02727 on stress-induced visceral
hypersensitivity to CRD is shown in Figure 4.
In vehicle-treated rats, a 2-h PRS significantly increased the number of
abdominal
contractions compared to basal conditions for all the pressures of distention
applied from 30
mmHg (P<0.001, Figure 4).
Importantly, a 10-day oral administration of the L. lactis NCD02118 suppressed
the PRS-induced enhancement of abdominal contractions (P<0.01 for a distension
pressure
of 60 mmHg, Figure 4), restoring a quasi-basal sensitivity to CRD.
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
19
In contrast, oral administration of the L. lactis NCD02727 had no effect on
stress-
induced visceral hypersensitivity (Figure 4).
In conclusion, acute restraint stress induced colonic hypersensitivity to
distension
in rats and this hypersensitivity phenotype was reversed by L. lactis NCD02118
but not by
L. lactis NCD02727 after a 10-day daily oral administration (109 cfu per day).
EXAMPLE 3: The prevention of the stress-induced visceral hypersensitivity by
L. lactis
NCD02118 is due to its ability to deliver GABA in vivo
1. Materials and Methods:
1.1. Bacterial strains
The strains NCD02118 and NCD02727 were used.
L. lactis NCD02118 AgadB was constructed by double crossing over in the
chromosome.
The GAD encoding gene gadB was deleted in order to interrupt the GABA
pathway.
Two fragments of 829 and 981 bp were PCR amplified just upstream and
downstream of the gadB coding sequence, respectively, with NCD02118 chromosome
as a
matrix. Primers are listed in Table 4. The two fragments were fused by
overlapping PCR.
The pGhost9 vector was PCR amplified and linked to the fused fragments using
Gibson
assembly method (New Englang Biolabs). Resulting plasmid was verified by
sequencing
and introduced in L. lactis NCD02118. Chromosomal deletion of gadB was then
obtained
by double crossing over as previously described (Maguin et al., 1996).
Deletion of gadB
sequence into the chromosome was verified by PCR.
The culture conditions of the strains are the same as the one described in
Example
1.
SEQ ID Use for:
Primer name 5 '-3' sequence NO:
GGAATTCGATTTAGATGC 1
821-GB gadCR CATAGGAGGATTTTC Amplification
of
gabB upstream
GATGAATATCGTACATCC 2 sequence
894-GB gadC2F
TCCAATTTTTTAATG
AAGCTTGATAAAACAAGA 3 Amplification
of
892-GBkefA2F AAATATTCATGAAATTCA gabB downstream
G sequence
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
GGAGGATGTACGATATTC 4
893-GBkefA2R ATCTTAAGAAAAATCAAA
AGC
CATCTAAATCGAATTCCT 5
822-GBpGhost9EVF GCAGCCCG Amplification
of
TCTTGTTTTATCAAGCTTA 6 pGhost9
backbone
891-GBpGh9EV2R
TCGATACCGTC
898-amt TTGGATTAGCTGCGGCAT 7
GadB(DCO) ATTTTATCG Verification of
gabB deletion onto
899-a CCTTGTTGACCATAATGC 8 the chromosome
vl GadB(DCO)
AAAGCAGGT
Table 4: Primers used for the inactivation of gadB in L. lactis NCD02118.
1.2. Sequence analysis of gad operon:
In the NCD02118 strain, the gad operon sequence was extracted from the
chromosome sequence deposited in NCBI-GenBank database under the accession
number
5 CP009054.
To amplify the gad operon in NCD02727 strain, two primers were used, GadSeq_F
(5'¨TCCAGAAATAACAGCTACATTGACATAATG-3') and GadSeq_R (5'¨
TAACAGCCCCATTATCTAAGATTACTCC-3'). The amplification was carried out with
20 ng of genomic DNA in 25-i.iL reaction mixture using the Q5 High-Fidelity
DNA
10 polymerase (NEB) and according to the manufacturer's recommendation. PCR
conditions
consisted of an initial denaturation step of 3 min at 98 C, followed by 30
cycles of 98 C for
10 sec, 64 C for 30 sec, and 72 C for 3 min and a final elongation step of 2
min at 72 C.
Then, the amplicon was purified using the QIAquick gel extraction kit
(QIAgen).
The sequence was performed by Eurofins Genomics with a set of primers listed
in
15 Table 5. The sequence of the operon has been deposited in NCBI-GenBank
database under
the accession number MK225577.
Sequences of gad operon were compared by Blast alignment algorithm.
Primer name 5'-3' sequence SEQ ID NO:
AAAATATAGAAGGAGACTATTGCAAATA 9
GabSeq_2_F
GC
AAAAATTAATGGCCATCGTTGGTAGTTCT 10
GabSeq_2_R C
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
21
TCTGTGCAGCAGAAATGGCGACGGTTGA 11
GabSeq_3_F
A
GabSeq_3_R TCCCCATAAATTTTTCTTTTTCACTCGCAT 12
CGGTTATTCCTCAAAAAGACTTATCATTA 13
GabSeq_4_F
A
Table 5: Primers used for the sequencing of gad operon in L. lactis NCD02727.
2. Results:
With this deletion, and under the same culture conditions, the mutant could
grow
similarly to the wild type (growth rate of 0.65 h-1). Under these conditions
however, no
GABA was produced (<0.29 mM at 24 h) and no GAD activity detected at 7 h.
The beneficial effect of L. lactis NCD02118 treatment on stress-induced
visceral
hypersensitivity (P<0.001) was reversed when animals received the NCD02118
AgadB
isogenic strain (Figure 6, P<0.05 NCD02118 AgadB- vs. NCD02118-treated
animals).
EXAMPLE 4: Comparison of the effects obtained on visceral hypersensitivity
with L.
lactis strains of interest in a stress model in rat (model IBS)
1. Materials and Methods:
The preparation of the animals is the same as the one described in Example 2.
Rats were given L. lactis NCD02118 or CNCM 1-5388 by gavage once daily for 4
or 9 days. Washed bacterial cells (109 cfu per day) were used in order to
minimize the amount
of GABA initially administered to rats. Unless otherwise stated, free
glutamate (0.2% (w/v))
was added to the gavage mixture to favor in vivo GABA production.
2. Results:
The influence over time of L. lactis NCD02118, CNCM 1-5388 and CNCM 1-5388
Agad on stress-induced visceral hypersensitivity to CRD is shown in Figures 5
and 7.
CNCM 1-5388 and NCD02118 in the presence of glutamate reduce the visceral
hypersensitivity to the stress.
REFERENCES
- Ait-Belgnaoui A. et al., Pain. 2005;113:141-7.
- Bouin M. et al., Dig. Dis. Sci. 2001; 46:2542-2548.
- Camilleri M. et al., Clin. Gastroenterol. Hepatol. 2008; 6:772-781.
- Camilleri M et al., Am J Physiol Gastrointest Liver Physiol.
2012;303:G775-85.
- Chang L. et al., Gastroenterology. 2011; 140:761-765.
CA 03127726 2021-07-23
WO 2020/157297
PCT/EP2020/052466
22
- Coculescu E. et al., J. Med. Life. 2014; 7:512-515.
- Craig 0. et al., Curr Opin Gastroenterol. 2018; 34:50-56.
- Dean B.B. et al., Am J Manag Care. 2005; 11:S17-26.
- de Castro LA. et a/.,Pain Med. 2014; 15: 2164-5.
- Didari T. et al., World. J. Gastroenterol. 2015; 21:3072-3084.
- Ford A.C. et al., Am. J. Gastroenterol. 2014; 109:1547-1561.
- Gue M. et al., Neurogastroenterol Motil. 1997;9(4):271-9.
- Hungin A.P. et al., Aliment. Pharmacol. Ther. 2013; 38:864-886.
- Keszthelyi D. et al., EJP. 2012; 16: 1444-1454.
- Kuiken S.D. et al., Aliment. Pharmacol. Ther. 2005; 22:157-164.
- Laroute V. et al., Microorganisms. 2017; 5.
- Maguin E. et al., J. Bacteriol. 1996; 178:931-935.
- Mayer E.A. et al., Gastroenterology. 1994; 107:271-293.
- Mayer E.A. et al., Gut. 2008; 57:384-404.
- Mazurak N. et al., J. Neurogastroenterol. Motil. 2015; 21:471-485.
- Mills S. et al., Int. J. Dairy Technol. 2010; 63:149-170.
- Miziara ID. et al., J. Psychosom. Res., 2009; 62:443-448.
- Moayyedi P. et al., Gut. 2010; 59:325-332.
- Morteau 0. et al., Dig. Dis. Sci. 1994; 39:1239-1248.
- Nomura M. et al., Int. J. Syst. Bacteriol. 1999; 49:163-166.
- Perez-Berezo T. et al., Nat. Commun. 2017; 8, 1314.
- Pokusaeva K. et al., Neurogastroenterol. Motil. 2017; 29, e12904.
- Posserud I. et al., Gastroenterology. 2007; 133:1113-1123.
- Radziwill-Bienkowska et al., Appl. Microbiol. Biotechnol. 2016;
100:9605-9617.
- Sun Y. et al., Chin J Dig Dis. 2006;7:149-55.
- Sun A. et al., J. Oral Pathol. Med., 2013; 42:649-655.
- Wang Y. et al., J. Microbiol. Methods. 2011; 86:390-392.
- Williams C.L. et al., Am J Physiol. 1987; 253:G582-6.
- Williams C.L. et al., Gastroenterology. 1988; 94:611-621.
- Zhang C. et al., ISME J. 2016; 10:2235-2245.
- Zhou Q. et al., Pain. 2010; 148:454-461.
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
23
INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule 13bis)
A. The indications made below relate to the deposited microorganism or other
biological material referred to in the description
on page 4 ,line 16
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an
additional sheet ri
Name of depositary institution
CNCM Collection nationale de cultures de micro-organismes (CNCM)
Address of depositary institution (including postal code and country)
Institut Pasteur
25-28, rue du Dr. Roux
75724 Paris Cedex 15, France
Date of deposit Accession Number
November 29, 2018 CNCM 1-5386
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information
is continued on an additional sheet El
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are
not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank linos applicable)
The indications listed below will be submitted to the International Bureau
later (spect& the general nature ofthe inelications e.g, "Accession
Number of Deposit")
For receiving Office use only For International Bureau use only
This sheet was received with the international application El This sheet
was received by the International Bureau on:
Authorized officer Authorized officer
Benzler, Annemarie
Form PCT/RO/134 (JulyI998; reprint January 2004)
SUBSTITUTE SHEET (RULE 26)
CA 03127726 2021-07-23
WO 2020/157297 PCT/EP2020/052466
24
INDICATIONS RELATING TO DEPOSITED MICROORGANISM
OR OTHER BIOLOGICAL MATERIAL
(PCT Rule 13bis)
A. The indications made below relate to the deposited microorganism or other
biological material referred to in the description
on page 4 ,line 14
B. IDENTIFICATION OF DEPOSIT Further deposits are identified on an
additional sheet 1::
Name of depositary institution
CNCM Collection nationale de cultures de micro-organismes (CNCM)
Address of depositary institution (including postal code and country)
Institut Pasteur
25-28, rue du Dr. Roux
75724 Paris Cedex 15, France
Date of deposit Accession Number
December 13, 2018 CNCM 1-5388
C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information
is continued on an additional sheet 0
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE ('((the indications are
not for all designated States)
E. SEPARATE FURNISHING OF INDICATIONS (leave blank ((not applicable)
The indications listed below will be submitted to the International Bureau
later (spec(/5' the general nature ofthe indications e.g, "Accession
Number of Deposit")
______________________________________________ For receiving Office use only
For International Bureau use only
IZIThis sheet was received with the international application p This sheet
was received by the International Bureau on:
Authorized officer Authorized officer
Benzler, Annemarie
Form PCT/RO/134 (July1998; reprint January 2004)
SUBSTITUTE SHEET (RULE 26)
