Note: Descriptions are shown in the official language in which they were submitted.
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
COMPOSITIONS AND METHODS FOR TREATING HUNTINGTON'S
DISEASE
This application claims priority under 35 U.S.C. 119(e) to U.S. Provisional
Patent Application No. 62/815,647, filed March 8, 2019. The foregoing
application is
incorporated by reference herein.
FIELD OF THE INVENTION
This invention relates generally to the field of gene silencing. Specifically,
the
invention provides compositions and methods for regulating the expression of
the
huntingtin gene.
BACKGROUND OF THE INVENTION
Huntington's disease (HD) is an autosomal dominant neurodegenerative
disease. HD is part of the family of polyglutamine (polyQ) disorders
comprising at
least nine different neurodegenerative diseases that result from the variably
expanded
trinucleotide CAG repeat in specific genes (e.g., huntingtin) (Walker, F.O.
(2007)
Lancet, 369:218-228; Walker, F.O. (2007) Semin. Neurol., 27:143-150). The size
of
2 0 the expansion is partially negatively correlated with age of onset
(e.g., adult-onset vs.
juvenile). HD is caused by CAG repeat expansion (¨>36 repeats) within the
first
exon of the huntingtin gene.
The huntingtin gene (htt) and protein (HTT) are widely and ubiquitously
expressed, but the disease has a pattern of selective neuronal vulnerability
(e.g.,
within the brain) (Ambrose, et al. (1994) Somat. Cell Mol. Genet., 20:27-38;
Landles,
et al. (2004) EMBO Rep., 5:958-963). Neither the normal function for htt nor
the
pathological mechanism for mutant htt is completely understood. Multiple
mechanisms including a toxic gain of function and loss of wild type function
may
exist. Notably, aggregates of the HTT protein can be found in different
locations and
different types of neurons.
There is no cure for HD and treatments are focused on managing its symptoms
(Johnson, et al. (2010) Hum. Mol. Genet., 19:R98-R102). Recent data indicate
that
full length and truncated mRNA transcripts and their associated protein
products exist
in HD patients and contribute to the mechanism of neuron dysfunction and death
1
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
(Sathasivam, et al. (2013) Proc. Natl. Acad. Sci., 110:2366-2370). Notably,
the use
of genetically modified mouse models showed that HD-like disease phenotypes
can
be resolved if mutant huntingtin expression is eliminated, even at advanced
disease
stages (Yamamoto, etal. (2000) Cell, 101:57-66; Diaz-Hernandez, etal. (2005)
J.
Neurosci., 25:9773-9781). Thus, reducing mutant htt mRNA (full-length and/or
terminated) can lead to therapeutic intervention (Sah, et al. (2011) J. Clin.
Invest.,
121:500-507). However, improved methods of regulating htt gene expression are
required.
SUMMARY OF THE INVENTION
In accordance with the instant invention, nucleic acid molecules for
inhibiting
the expression of the huntingtin gene (htt) are provided. In a particular
embodiment,
the nucleic acid molecules comprise an annealing domain operably linked to at
least
one effector domain, wherein the annealing domain hybridizes to the pre-mRNA
of
htt and wherein the effector domain hybridizes to the Ul snRNA of Ul snRNP. In
a
particular embodiment, the U1 AO may be directed to full-length and/or
truncated htt.
In accordance with another aspect of the instant invention, the nucleic acid
molecules may be conjugated to (e.g., directly or via a linker) a targeting
moiety. The
targeting moiety may be conjugated to the 5' end and/or the 3' end (e.g., the
nucleic
2 0 acid may comprise two targeting moieties, either the same or
different). In a
particular embodiment, the nucleic acid molecules are conjugated to an
aptamer.
In accordance with another aspect of the invention, methods are provided for
inhibiting the expression of htt comprising delivering to a cell at least one
of the
nucleic acid molecules of the instant invention.
In accordance with another aspect of the invention, compositions are provided
which comprise at least one of the nucleic acid molecules of the invention and
at least
one pharmaceutically acceptable carrier.
In still another aspect, vectors encoding the nucleic acid molecules of the
instant invention are also provided.
In accordance with another aspect of the instant invention, methods of
treating, inhibiting, and/or preventing Huntington's disease in a subject are
provided.
The methods comprise administering a therapeutically effective amount of at
least one
nucleic acid molecule of the instant invention (e.g., U1A0 or vector encoding
the
U1 AO) to a subject in need thereof. In a particular embodiment, the method
2
CA 03132388 2021-09-01
WO 2020/185651
PCT/US2020/021652
comprises administering more than one U1 AO. In a particular embodiment, the
method comprises administering a U1 AO directed to full-length htt, truncated
htt, or
both full-length and truncated htt (e.g., with separate U1A0).
BRIEF DESCRIPTIONS OF THE DRAWING
Figure 1A is a schematic of a Ul adaptor oligonucleotide depicting its 2
domains: an annealing domain to base pair to the target gene's pre-mRNA in the
3'
terminal exon and an effector domain that inhibits maturation of the pre-mRNA
via
binding of endogenous Ul snRNP. The provided sequence of the effector domain
is
SEQ ID NO: 1. Figure 1B is a schematic of the Ul adaptor annealing to target
pre-
mRNA. The provided sequence of the effector domain is SEQ ID NO: 1. Figure 1C
is a schematic of the Ul adaptor binding Ul snRNP, which leads to poly(A) site
inhibition. 1P = pseudouridines of the Ul snRNA in the Ul snRNP. The provided
sequence of the Ul snRNA in the Ul snRNP is SEQ ID NO: 2. The provided
sequence of the effector domain is SEQ ID NO: 1.
Figure 2 provides a graph showing the percent change of human huntingtin
(HTT) mRNA normalized to hypoxanthine phosphoribosyltransferase 1 (HPRT1) in
HD9197 cells transfected for 44 hours with a panel of 20 nM Ul adaptor
oligonucleotides (U1A0s) and 20 nM siRNAs directed against full length human
HTT.
Figure 3 provides a Western blot of DU145 cells transfected 48 hours with 20
nM various hHTT-FL U1A0s and siRNAs, with the exception of 7 nM in lane 9 and
nM in lane 7. GAPDH is provided as a loading control. Ul A (U1 snRNP subunit)
is provided as a second loading control. 1,500,00 cell equivalents were loaded
per
25 lane. Lanes 4 and 6 are independent replicates. MW: molecular weight
markers.
Figure 4A provides a graph of the percent change of hHTT-FL mRNA in
YAC128 forebrain after intracerebroventricular (ICV) injection into the left
ventricle
of saline or hHTT-FL-2 U1A0. YAC128 are a well established mouse model of
Huntington's diseases containing the ¨300,000 basepair human huntingtin gene
with
30 128 CAG repeats. Average of control mice was set to 100%. N = 7 are from
two
different experiments (n = 3 and n = 4). Figure 4B provides a graph of the
percent
change of hHTT-TR mRNA in YAC128 forebrain after ICV injection of saline or
hHTT-FL-2 U1 AO. Average of control mice was set to 100%.
3
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
Figure 5 provides an image of an 8% denaturing polyacrylamide gel
electrophoresis (PAGE) Northern blot of total RNA from YAC128 forebrain after
injection of saline or hHTT-FL-2 U1 AO. The probe was a 33 nucleotide 32P-anti-
hHTT-FL-2 oligonucleotide. Standards are uninjected U1A0.
Figure 6 provides images of RNAScopeg detection of hHTT-FL in the
striatum of saline ICV-treated mice (left) or hTT-FL-2 U1A0 ICV-treated mice
(right). Mice were analyzed after a 4 day duration. 4' ,6-diamidino-2-
phenylindole
(DAPI) was used to stain the nuclei.
Figure 7A provides a graph of the percent change of hHTT-FL mRNA in
YAC128 forebrain after ICV-injection of saline or hHTT-FL-2 U1 AO over the
indicated times. Average of control mice was set to 100%. Figure 7B provides
an
image of a Northern blot of total RNA from YAC128 forebrain at the indicated
times
after injection of saline or hHTT-FL-2 U1A0. The probe was a 33 nucleotide 32P-
anti-hHTT-FL-2 oligonucleotide. Standards are uninjected U1A0. Control saline
mice 1-7 and mice 11-12 and 16-17 are the same mice as shown in Figures 4 and
5.
Figure 8A provides a graph of the percent change of hHTT-TR mRNA in
YAC128 forebrain after ICV-injection of saline, hHTT-TR-1 U1A0, or hHTT-TR-2
U1 AO. Mice tissues were analyzed after a 5 day duration. Average of control
mice
was set to 100%. N = 7 are from two different experiments (n = 3 and n = 4).
Figure
8B provides a graph of the percent change of hHTT-FL mRNA in YAC128 forebrain
after injection of saline, hHTT-TR-1 U1A0, or hHTT-TR-2 U1A0. Average of
control mice was set to 100%. N = 7 are from two different experiments (n = 3
and n
= 4).
Figure 9A provides a graph of the percent change of mHTT-TR mRNA in 8-9
month old Q175 forebrain after injection of saline, mHTT-TR-A U1A0, or NC-A
control U1A0. Q175 are a well-established knock-in mouse with ¨175 CAG repeats
in the mouse htt gene. Average of control mice was set to 100%. N = 7 are from
two
different experiments (n = 3 and n = 4). Figure 9B provides a graph of the
percent
change of mHTT-FL mRNA using the same samples as in Fig. 9A. Average of
control mice was set to 100%. N = 7 are from two different experiments (n = 3
and n
= 4).
4
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
Figure 10 provides images of RNAScopeg detection of mHTT-TR in the
striatum of saline treated mice (left) or mHTT-TR-A U1 AO treated mice (right)
with
a 4 day duration.
Figure 11A provides a graph of the percent change of mHTT-TR mRNA in 8-
9 month old Q175 mice forebrain twenty-one days after ICV-injection of saline
or
mHTT-TR-A U1A0. Average of control mice was set to 100%. Figure 11B provides
a graph of the percent change of mHTT-FL mRNA in 8-9 month old Q175 mice
forebrain twenty-one days after injection of saline or mHTT-TR-A U1 AO.
Average
of control mice was set to 100%.
Figure 12A provides a graph of the percent change of mHTT-FL mRNA in 8-
9 month old Q175 forebrain after injection of saline, mHTT-FL-A U1A0, or NC-A
control U1A0. Average of control mice was set to 100%. N = 7 are from two
different experiments (n = 3 and n = 4). Figure 12B provides a graph of the
percent
change of mHTT-TR mRNA in Q175 forebrain after injection of saline, mHTT-FL-A
U1 AO, or NC-A control U1 AO. Average of control mice was set to 100%. N = 7
are
from two different experiments (n = 3 and n = 4).
Figure 13 provides images of RNAScopeg detection of mHTT-FL in the
striatum of saline treated mice (left) or mHTT-FL-A U1 AO treated mice
(right).
Figures 14A-14L provides target sites in human htt for U1A0 and examples of
U1A0 sequences in DNA format. The target sequences in rows 50, 272, 151, 3,
187,
4, 5, 10, and 2 are SEQ ID NOs: 26-34, respectively. The target sequences in
rows 1,
6-9, 11-49, 51-150, 152-186, 188-271, and 273-325 are SEQ ID NOs: 40-355,
respectively. The U1 AO sequences provided in DNA format are SEQ ID Nos: 356-
680, from top to bottom.
Figures 15A-15C provide graphs of the level of silencing of mHTT-F1 and
mHTT-Tr at 1 month (Fig. 15A), 2 months (Fig. 15B), and 4 months (Fig. 15C)
after
ICV injection of mHTT-FL-a U1A0 at four different concentration into Q175
mice.
Figure 15D provides graphs of the level of silencing of mHTT-F1 and mHTT-Tr at
1
month, 2 months, and 4 months after ICV injection of control NC-a U1 AO at 80
tg
into Q175 mice.
Figures 16A-16C provide graphs of the level of silencing of mHTT-F1 and
mHTT-Tr at 1 month (Fig. 16A), 2 months (Fig. 16B), and 4 months (Fig. 16C)
after
ICV injection of mHTT-Tr-a U1 AO at four different concentration into Q175
mice.
5
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
Figure 17 provide graphs of the pharmacokinetics of mHTT-FL-a U1A0
(top), mHTT-Tr-a U1A0 (middle), and NC-a U1A0 (bottom). The amount of RNA
is shown at 1 month, 2 months, and 4 months. Each of the four different
concentration of mHTT-FL-a U1 AO and mHTT-Tr-a U1 AO are shown while only
the 80 i.tg concentration for NC-a U1A0 is shown.
DETAILED DESCRIPTION OF THE INVENTION
Ul Adaptors (or Ul adaptor oligonucleotides (U1A0)) are an oligonucleotide-
mediated gene silencing technology which are mechanistically distinct from
antisense
or siRNA. Ul Adaptors act by selectively interfering with a key step in mRNA
maturation: the addition of a 3' polyadenosine (polyA) tail. Nearly all
protein-coding
mRNAs require a polyA tail and the failure to add one results in rapid
degradation of
the nascent mRNA inside the nucleus, thereby preventing expression of a
protein
product. Ul Adaptors have been described in U.S. Patent No. 9,441,221; U.S.
Patent
No. 9,078,823; U.S. Patent No. 8,907,075; and U.S. Patent No. 8,343,941 (each
of
which is incorporated by reference herein).
Ul Adaptor oligonucleotides are well suited to in vivo applications because
they can accept extensive chemical modifications to improve nuclease
resistance and
the attachment of bulky groups, such as tags for imaging or ligands for
receptor-
2 0 mediated uptake by target cells, without loss of silencing activity.
Huntington's
disease has several characteristics that make it a particularly well suited
for treatment
using U1 AO. First, reducing expression of the mutant htt gene will be
beneficial in
slowing and/or halting neurodegeneration. Second, the disease can be diagnosed
with
certainty via genetic testing. Third, the disease usually has an adult onset.
Fourth, the
disease is slowly progressive and well documented, with a predictable course.
Fifth,
both the clinical exam and non-invasive methods are available to follow the
progression of disease and determine if interventions are beneficial. Sixth,
the
caudate nucleus is a region prominently affected, can be monitored with
imaging, and
lies close to the cerebral ventricle for diffusion from interventions
administered in the
ventricular system. Lastly, the highly vulnerable medium spiny neurons in the
caudate nucleus have been well studied and express markers that can be useful
for cell
directed targeting by modified carriers.
Provided herein are methods and compositions for the modulation of the
expression of htt, particularly mutant htt (htt comprising expanded
trinucleotide CAG
6
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
repeats, including full-length and/or truncated). The methods comprise the use
of a
Ul adaptor oligonucleotide/ molecule (see, generally, Figure 1). In its
simplest form,
the U1A0 is an oligonucleotide with two domains: (1) an annealing domain
designed
to base pair to the htt gene's pre-mRNA (e.g., in the terminal exon) and (2)
an effector
domain (also referred to as the Ul domain) that inhibits 3'-end formation of
the target
pre-mRNA via binding endogenous Ul snRNP. Without being bound by theory, the
Ul adaptor tethers endogenous Ul snRNP to a gene-specific pre-mRNA and the
resulting complex blocks proper 3' end formation. Notably, Ul snRNP is highly
abundant (-1 million/mammalian cell nucleus) and in stoichiometric excess
compared
to other spliceosome components. Therefore, there are no deleterious effects
of
titrating out endogenous Ul snRNP.
The U1A0 is able to enter cells either alone or in complex with delivery
reagents (e.g., lipid-based transfection reagents). The U1A0 should also be
capable
of entering the nucleus to bind to pre-mRNA. Indeed, this property has already
been
established for small nucleic acid molecules such as in those antisense
approaches that
utilize the RNase H pathway where the oligo enters the nucleus and binds to
pre-
mRNA. Additionally, it has been showed that antisense oligos can bind to
nuclear
pre-mRNA and sterically block access of splicing factors leading to altered
splicing
patterns (Ittig et al. (2004) Nuc. Acids Res., 32:346-53).
In a particular embodiment, the annealing domain of the Ul adaptor molecule
is designed to have high affinity and specificity to the target site on the
target pre-
mRNA (e.g., to the exclusion of other pre-mRNAs). In a particular embodiment,
a
balance should be achieved between having the annealing domain too short, as
this
will jeopardize affinity, or too long, as this will promote "off-target"
effects or alter
other cellular pathways. Furthermore, the annealing domain should not
interfere with
the function of the effector domain (for example, by base pairing and hairpin
formation). The U1 AO annealing domain does not have an absolute requirement
on
length. However, the annealing domain will typically be from about 10 to about
50
nucleotides in length, more typically from about 10 to about 30 nucleotides or
about
10 to about 20 nucleotides. In a particular embodiment, the annealing domain
is at
least about 13 or 15 nucleotides in length. The annealing domain may be at
least
75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or,
more
particularly, 100% complementary to the gene of interest (htt). In one
embodiment,
the annealing domain hybridizes with a target site within the 3' terminal
exon, which
7
CA 03132388 2021-09-01
WO 2020/185651
PCT/US2020/021652
includes the terminal coding region and the 3'UTR and polyadenylation signal
sequences (e.g., through the polyadenylation site). In another embodiment, the
target
sequence is within about 500 basepair, about 250 basepair, about 100 basepair,
or
about 50 bp of the poly(A) signal sequence.
The CAG (encoding glutamine) disease expansion (typically greater than 36
repeats) in HTT is located within the 1st exon of the HTT gene (The
Huntington's
Disease Collaborative Research Group (1993) Cell 72:971-983). A short exon 1
HTT
polyadenylated mRNA resulting from aberrant splicing of the mutant allele is
translated into a pathogenic exon 1 HTT protein that contributes to disease
progression (Sathasivam et al. (2013) Proc. Natl. Acad. Sci., 110:2366-2370;
Gipson
et al. (2013) RNA Biol., 10:1647-1652). Exemplary amino acid and nucleotide
sequences of human HTT and htt can be found, for example, in Gene ID: 3064 and
GenBank Accession Nos. NM 002111.8 and NP 002102.4.
Target sites within htt for the U1 AO have been identified herein using
selection criteria for gene silencing. Figures 14A-14L list target sites
within htt for
the U1 AO with the best scoring target sites listed first. In a particular
embodiment,
the annealing domain hybridizes with a target site provided in Figures 14A-
14L. In a
particular embodiment, the annealing domain hybridizes with a target site
provided in
rows 1-278 of Figures 14A-14L. In a particular embodiment, the annealing
domain
hybridizes with a target site provided in rows 1-192 of Figures 14A-14L. In a
particular embodiment, the annealing domain hybridizes with a target site
provided in
rows 1-58 of Figures 14A-14L. In a particular embodiment, the annealing domain
hybridizes with a target site provided in rows 1-26 of Figures 14A-14L. In a
particular embodiment, the annealing domain hybridizes with a target site
provided in
rows 1-10 of Figures 14A-14L. In a particular embodiment, the annealing domain
hybridizes with a target site selected from:
CCCACATGTCATCAGCAGGA (SEQ ID NO: 26);
CAGCAGGATGGGCAAGCTGG (SEQ ID NO: 27);
GAGCAGGTGGACGTGAACCT (SEQ ID NO: 28);
GTGGACGTGAACCTTTTCTG (SEQ ID NO: 29);
TCTGCCTGGTCGCCACAGAC (SEQ ID NO: 30);
GTCTGTGCTTGAGGTGGTTG (SEQ ID NO: 31):
GCTGCTGACTTGTTTACGAA (SEQ ID NO: 32);
GGTGGGAGAGACTGTGAGGC (SEQ ID NO: 33);
8
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
TCCTTTCTCCTGATAGTCAC (SEQ ID NO: 34);
GCGGGGATGGCGGTAACCCT (SEQ ID NO: 35); or
GTCTTCCCTTGTCCTCTCGC (SEQ ID NO: 36).
In a particular embodiment, the annealing domain hybridizes with
GTGGACGTGAACCTTTTCTG (SEQ ID NO: 29). The annealing domain may be at
least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least
97%, or,
more particularly, 100% complementary to any target sequence within Figures
14A-
14L or any one of SEQ ID NO: 26-36. The annealing domain may comprise
additional or fewer nucleotides at the 5' and/or 3' end of any target sequence
within
Figures 14A-14L or any one of SEQ ID NO: 26-36. For example, the annealing
domain may comprise at least 1, 2, 3, 4, 5, or up to 10 or 20 nucleotides
added to the
5' and/or 3' end of any target sequence within Figures 14A-14L or any one of
SEQ ID
NO: 26-36 (e.g., from the sequence of the htt gene) or may have a deletion of
at least
1, 2, 3, 4, or 5 nucleotides from the 5' and/or 3' end of any target sequence
within
Figures 14A-14L or any one of SEQ ID NO: 26-36.
In a particular embodiment, the Ul domain of the U1A0 binds with high
affinity to Ul snRNP. In a particular embodiment, the Ul domain is
complementary
to nucleotides 2-11 of endogenous Ul snRNA. In a particular embodiment, the Ul
domain comprises 5'-CAGGUAAGUA-3' (SEQ ID NO: 1); 5'-CAGGUAAGUAU-
2 0 3' (SEQ ID NO: 4); 5'-GCCAGGUAAGUAU-3' (SEQ ID NO: 5). In a particular
embodiment, the Ul domain comprises the sequence 5'-CAGGUAAGUA-3' (SEQ
ID NO: 1). In a particular embodiment, the Ul domain comprises the sequence 5'-
GCCAGGUAAGUAU-3' (SEQ ID NO: 5). In another embodiment, the Ul domain
has at least 70%, at least 75%, at least 80%, at least 85%, and more
particularly at
least 90%, at least 95%, or at least 97% identity to SEQ ID NO: 1, SEQ ID NO:
4, or
SEQ ID NO: 5. The Ul domain may comprise additional nucleotides 5' or 3' to
SEQ
ID NO: 1, SEQ ID NO: 4, or SEQ ID NO: 5. For example, the Ul domain may
comprise at least 1, 2, 3, 4, 5, or up to 10 or 20 nucleotides 5' or 3' to SEQ
ID NO: 1,
SEQ ID NO: 4, or SEQ ID NO: 5. Indeed, increasing the length of the Ul domain
to
include basepairing into stem 1 and/or basepairing to position 1 of Ul snRNA
improves the Ul adaptor's affinity to Ul snRNP. The effector domain may be
from
about 8 nucleotides to about 30 nucleotides, from about 10 nucleotides to
about 20
nucleotides, or from about 10 to about 15 nucleotides in length. For example,
the
9
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
effector domain may be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
nucleotides
in length.
The insertion of point mutations into the Ul domain, i.e., diverging from the
consensus sequence SEQ ID NO: 1, SEQ ID NO: 4, or SEQ ID NO: 5, can moderate
silencing. Indeed, altering the consensus sequence will produce Ul domains of
different strength and affinity for the Ul snRNA, thereby leading to different
levels of
silencing. Therefore, once an annealing domain has been determined for a gene
of
interest, different Ul domains of different strength can be attached to the
annealing
domain to effect different levels of silencing of the gene of interest. For
example,
gAGGUAAGUA (SEQ ID NO: 3) would bind more weakly to Ul snRNP than SEQ
ID NO: 1 and, therefore, would produce a lower level of silencing. As
discussed
above, nucleotide analogues can be included in the Ul domain to increase the
affinity
to endogenous Ul snRNP. The addition of nucleotide analogs may not be
considered
a point mutation if the nucleotide analog binds the same nucleotide as the
replaced
nucleotide.
The U1 AO may be modified to be resistant to nucleases. In a particular
embodiment, the U1 AO may comprise at least one non-natural nucleotide and/or
nucleotide analog. The nucleotide analogs may be used to increase annealing
affinity,
specificity, bioavailability in the cell and organism, cellular and/or nuclear
transport,
2 0 stability, and/or resistance to degradation. For example, it has been
well-established
that inclusion of Locked Nucleic Acid (LNA) bases within an oligonucleotide
increases the affinity and specificity of annealing of the oligonucleotide to
its target
site (Kauppinen et al. (2005) Drug Discov. Today Tech., 2:287-290; Orum et al.
(2004) Letters Peptide Sci., 10:325-334). Unlike RNAi and RNase H-based
silencing
technologies, U1A0 inhibition does not involve enzymatic activity. As such,
there is
significantly greater flexibility in the permissible nucleotide analogs that
can be
employed in the U1A0 when compared with oligos for RNAi and RNase H-based
silencing technologies.
Nucleotide analogs include, without limitation, nucleotides with phosphate
modifications comprising one or more phosphorothioate, phosphorodithioate,
phosphodiester, methyl phosphonate, phosphoramidate, methylphosphonate,
phosphotriester, phosphoroaridate, morpholino, amidate carbamate,
carboxymethyl,
acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal,
thioformacetal, and/or alkylsilyl substitutions (see, e.g., Hunziker and
Leumann
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
(1995) Nucleic Acid Analogues: Synthesis and Properties, in Modern Synthetic
Methods, VCH, 331-417; Mesmaeker et al. (1994) Novel Backbone Replacements for
Oligonucleotides, in Carbohydrate Modifications in Antisense Research, ACS, 24-
39); nucleotides with modified sugars (see, e.g., U.S. Patent Application
Publication
No. 2005/0118605) and sugar modifications such as 2'-0-methyl (2'-0-
methylnucleotides), 2'-0-methyloxyethoxy, and 2'-halo (e.g., 2'-fluoro); and
nucleotide mimetics such as, without limitation, peptide nucleic acids (PNA),
morpholino nucleic acids, cyclohexenyl nucleic acids, anhydrohexitol nucleic
acids,
glycol nucleic acid, threose nucleic acid, and locked nucleic acids (LNA)
(see, e.g.,
U.S. Patent Application Publication No. 2005/0118605). Other nucleotide
modifications are also provided in U.S. Patent Nos. 5,886,165; 6,140,482;
5,693,773;
5,856,462; 5,973,136; 5,929,226; 6,194,598; 6,172,209; 6,175,004; 6,166,197;
6,166,188; 6,160,152; 6,160,109; 6,153,737; 6,147,200; 6,146,829; 6,127,533;
and
6,124,445. In a particular embodiment, the U1 AO comprises at least one locked
nucleic acid. In a particular embodiment, the annealing domain comprises at
least one
locked nucleic acid (optionally where the effector domain does not contain a
locked
nucleic acid). In a particular embodiment, the U1 AO, particularly the
annealing
domain, has locked nucleic acids spaced apart by 2-4 nucleotides, particularly
three
nucleotides.
2 0 Notably, care should be taken so as to not design a Ul adaptor
wherein the
effector domain has significant affinity for the target site of the mRNA or
the sites
immediately flanking the target site. In other words, the target site should
be selected
so as to minimize the base pairing potential of the effector domain with the
target pre-
mRNA, especially the portion flanking upstream of the annealing site.
To increase the silencing ability of the U1A0, the U1A0 should also be
designed to have low self annealing so as to prevent the formation of hairpins
within a
single Ul adaptor and/or the formation of homodimers or homopolymers between
two
or more Ul adaptors.
The annealing and effector domains of the U1A0 may be linked such that the
effector domain is at the 5' end and/or 3' end of the annealing domain.
Further, the
annealing and effector domains may be operably linked via a linker domain. The
linker domain may comprise, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, up to
15, up to
20, or up to 25 nucleotides.
11
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
The U1A0 may comprise ribonucleotides and/or deoxynucleotides. With
regard to the sequences provided herein, uracil bases and thymidine bases may
be
exchanged. In a particular embodiment, the U1A0 comprises 2'-0-methyl
nucleotides, 2'-0-methyloxyethoxy nucleotides, 2'-halo (e.g., 2'-fluoro),
and/or
locked nucleic acids. In a particular embodiment, the U1A0 comprises
phosphorothioates.
In a particular embodiment, the U1A0 comprises a U1A0 provided in Figures
14A-14L (particularly in RNA). In a particular embodiment, the U1A0 comprises
a
U1A0 sequence provided in rows 1-278 of Figures 14A-14L. In a particular
embodiment, the U1A0 comprises a U1A0 sequence provided in rows 1-192 of
Figures 14A-14L. In a particular embodiment, the U1A0 comprises a U1 AO
sequence provided in rows 1-58 of Figures 14A-14L. In a particular embodiment,
the
U1A0 comprises a U1A0 sequence provided in rows 1-26 of Figures 14A-14L. In a
particular embodiment, the U1A0 comprises a U1A0 sequence provided in rows 1-
10 of Figures 14A-14L. In a particular embodiment, the U1A0 comprises:
UCCUGCUGAUGACAUGUGGGGCCAGGUAAGUAU (SEQ ID NO: 8);
CCAGCUUGCCCAUCCUGCUGGCCAGGUAAGUAU (SEQ ID NO: 37);
AGGUUCACGUCCACCUGCUCGCCAGGUAAGUAU (SEQ ID NO: 38);
CAGAAAAGGUUCACGUCCACGCCAGGUAAGUAU (SEQ ID NO: 9);
GUCUGUGGCGACCAGGCAGAGCCAGGUAAGUAU (SEQ ID NO: 39);
CAACCACCUCAAGCACAGACGCCAGGUAAGUAU (SEQ ID NO: 10):
UUCGUAAACAAGUCAGCAGCGCCAGGUAAGUAU (SEQ ID NO: 11);
GCCUCACAGUCUCUCCCACCGCCAGGUAAGUAU (SEQ ID NO: 12);
GUGACUAUCAGGAGAAAGGAGCCAGGUAAGUAU (SEQ ID NO: 13);
CAGAAAAGGTUCACGUCCACGCCAGGUAAGUAU (SEQ ID NO: 14);
AGGGUTACCGCCATCCCCGCGCCAGGUAAGUAU (SEQ ID NO: 15);
or
GCGAGAGGACAAGGGAAGACGCCAGGUAAGUAU (SEQ ID NO: 16).
In a particular embodiment, the U1A0 comprises
CAGAAAAGGUUCACGUCCACGCCAGGUAAGUAU (SEQ ID NO: 9). In
another embodiment, the U1A0 has at least 70%, at least 75%, at least 80%, at
least
85%, and more particularly at least 90%, at least 95%, at least 97% or more
identity
with one of the above sequences or in Figures 14A-14L. With regard to the
sequences
provided herein, uracil bases and thymidine bases may be exchanged. In a
particular
12
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
embodiment, the U1A0 comprises at least one or all nucleotide analogs. In a
particular embodiment, the U1A0 comprises 2'-0-methyl nucleotides, 2'-0-
methyloxyethoxy nucleotides, 2'-halo (e.g., 2'-fluoro), and/or locked nucleic
acids.
In a particular embodiment, the U1A0 comprises phosphorothioates. In a
particular
embodiment, the U1A0 are modified as set forth in the Example.
In another embodiment of the instant invention, more than one U1A0 directed
to a gene of interest (htt) may be used to modulate expression. Multiple U1A0
targeting (annealing) to different sequences in the same pre-mRNA can provide
enhanced inhibition. Compositions of the instant invention may comprise more
than
one U1A0 directed to the htt gene (e.g., different targets within the htt
gene).
In still another embodiment, the U1A0 can be combined with other methods
of modulating the expression of a gene of interest. For example, a U1A0 can be
used
in coordination with other inhibitory nucleic acid molecules such as antisense
oligonucleotides or RNase H-based methods, RNAi, miRNA, and morpholino-based
methods to give enhanced inhibition. Inasmuch as U1A0 utilize a different
mechanism than these other approaches, the combined use will result in an
increased
inhibition of gene expression compared to the use of a single inhibitory agent
alone.
Indeed, U1A0 may target the biosynthetic step in the nucleus whereas RNAi and
certain antisense approaches generally target cytoplasmic stability or
translatability of
a pre-existing pool of mRNA.
In another aspect of the instant invention, the effector domain of the Ul
adaptor can be replaced with the binding site for any one of a number of
nuclear
factors that regulate gene expression. For example, the binding site for
polypyrimidine tract binding protein (PTB) is short and PTB is known to
inhibit
poly(A) sites. Thus, replacing the effector domain with a high affinity PTB
binding
site would also silence expression of the target gene.
There are Ul snRNA genes that vary in sequence from the canonical Ul
snRNA described hereinabove. Collectively, these Ul snRNA genes can be called
the
Ul variant genes. Some Ul variant genes are described in GenBank Accession
Nos.
L78810, ACO25268, ACO25264 and AL592207 and in Kyriakopoulou et al. (RNA
(2006) 12:1603-11), which identified close to 200 potential Ul snRNA-like
genes in
the human genome. Since some of these Ul variants have a 5' end sequence
different
than canonical Ul snRNA, one plausible function is to recognize alternative
splice
signals during pre-mRNA splicing. Accordingly, the Ul domain of the U1A0 of
the
13
CA 03132388 2021-09-01
WO 2020/185651
PCT/US2020/021652
instant invention may be designed to hybridize with the 5' end of the Ul
variant
snRNA in the same way as the Ul domain was designed to hybridize with the
canonical Ul snRNA as described herein. The U1A0 which hybridize to the Ul
variants may then be used to modulate the expression of a gene of interest.
There are many advantages of the Ul adaptor technology to other existing
silencing technologies. Certain of these advantages are as follows. First, the
U1A0
separates into two independent domains: (1) the annealing (i.e., targeting)
activity and
(2) the inhibitory activity, thereby allowing one to optimize annealing
without
affecting the inhibitory activity or vice versa. Second, as compared to other
technologies, usage of two U1A0 to target the same gene gives additive even
synergistic inhibition. Third, the U1A0 has a novel inhibitory mechanism.
Therefore, it will be compatible when used in combination with other methods.
Fourth, the U1 AO inhibits the biosynthesis of mRNA by inhibiting the
critical,
nearly-universal, pre-mRNA maturation step of poly(A) tail addition (also
called 3'
end processing).
Compositions of the instant invention comprise at least one U1 AO of the
instant invention and at least one pharmaceutically acceptable carrier. The
compositions may further comprise at least one other agent which inhibits the
expression of the gene of interest (htt). For example, the composition may
further
2 0 comprise at least one siRNA or antisense oligonucleotide directed
against the gene of
interest (htt).
The U1A0 of the present invention may be administered alone, as naked
polynucleotides, to cells or an organism, including animals and humans. The
U1A0
may be administered with an agent which enhances its uptake by cells. In a
particular
embodiment, the U1A0 may be contained within a liposome, nanoparticle, or
polymeric composition.
In another embodiment, the U1A0 may be delivered to a cell or animal,
including humans, in an expression vector such as a plasmid or viral vector.
For
example, a U1A0 can be expressed from a vector such as a plasmid or a virus.
Expression of such short RNAs from a plasmid or virus has become routine and
can
be easily adapted to express a U1A0. Expression vectors for the expression of
RNA
molecules may employ a strong promoter which may be constitutive or regulated.
Such promoters are well known in the art and include, but are not limited to,
RNA
polymerase II promoters, the T7 RNA polymerase promoter, and the RNA
14
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
polymerase III promoters U6 and Hl. Viral-mediated delivery includes the use
of
vectors based on, without limitation, retroviruses, adenoviruses, adeno-
associated
viruses, vaccinia virus, lentiviruses, polioviruses, and herpesviruses.
The pharmaceutical compositions of the present invention can be administered
by any suitable route, for example, by injection (e.g., intravenously,
intracerebroventricularly, and intramuscularly), by oral, pulmonary, nasal,
rectal, or
other modes of administration. The compositions can be administered for the
treatment of Huntington's disease which can be treated through the
downregulation of
htt. The compositions may be used in vitro, in vivo, and/or ex vivo. With
regard to ex
vivo use, the U1A0 of the instant invention (or compositions comprising the
same)
may be delivered to autologous cells (optionally comprising the step of
obtaining the
cells from the subject) and then re-introduced into the subject. The
compositions,
U1 AO, and/or vectors of the instant invention may also be comprised in a kit.
The instant invention also encompasses methods of treating, inhibiting
(slowing or reducing), and/or preventing Huntington's disease in a subject. In
a
particular embodiment, the methods comprise the administration of a
therapeutically
effective amount of at least one composition of the instant invention to a
subject (e.g.,
an animal or human) in need thereof In a particular embodiment, the
composition
comprises at least one U1 AO of the instant invention and at least one
2 0 pharmaceutically acceptable carrier. In a particular embodiment, the U1
AO is
directed to htt, particularly htt (e.g., mutant htt) that is full-length
and/or truncated.
The instant methods may further comprise the administration of at least one
other agent which inhibits the expression of the target htt gene. For example,
the
method may further comprise the administration of at least one siRNA or anti
sense
oligonucleotide directed against the htt gene. The methods may also comprise
the
administration at least one other therapeutic agent (e.g., a symptom-
alleviating
therapeutic agent for Huntington's disease (e.g., tetrabenazine (Xenazineg) or
deutetrabenazine (Austedog)). In a particular embodiment, the therapeutic
agent is
conjugated to the U1A0 (e.g., directly or via a linker; e.g., at the 3' end
and/or 5'end).
The therapeutic agent may be administered in separate compositions (e.g., with
at
least one pharmaceutically acceptable carrier) or in the same composition. The
therapeutic agent may be administered simultaneously and/or consecutively with
the
U1A0.
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
As stated hereinabove, the U1 AO of the present invention may be
administered alone (as naked polynucleotides) or may be administered with an
agent
which enhances its uptake by cells. In a particular embodiment, the U1 AO may
be
contained within a delivery vehicle such as a micelle, liposome, nanoparticle,
or
polymeric composition. In a particular embodiment, the U1A0 is complexed with
(e.g., contained within or encapsulated by) a dendrimer, particularly cationic
dendrimers such as poly(amido amine) (PAMAM) dendrimers and
polypropyleneimine (PPI) dendrimers (e.g., generation 2, 3, 4, or 5). In a
particular
embodiment, the U1A0 is complexed with PPI-G2.
1 0 In a particular embodiment, the U1 AO are targeted to a particular
cell type
(e.g., neurons). In a particular embodiment, the U1A0 is covalently linked
(e.g.,
directly or via a linker) to at least one targeting moiety. The targeting
moiety may be
operably linked to the 5' end, the 3' end, or both ends or to internal
nucleotides. In a
particular embodiment, one or more targeting moieties are conjugated to one
end of
the U1 AO (e.g., through a single linker). In a particular embodiment, a
complex
comprising the U1A0 (e.g., a dendrimer, micelle, liposome, nanoparticle, or
polymeric composition) is covalently linked (e.g., directly or via a linker)
to at least
one targeting moiety.
Generally, the linker is a chemical moiety comprising a covalent bond or a
2 0 chain of atoms that covalently attaches two compounds such as a
targeting moiety to
the U1A0 or complex. The linker can be linked to any synthetically feasible
position
of the targeting moiety and the U1 AO or complex (vehicle). In a particular
embodiment, the linker connects the targeting moiety and the U1 AO or complex
via
an amine group and/or sulfhydryl/thiol group, particularly a sulfhydryl/thiol
group.
For example, the U1A0 may be derivatized (e.g., at the 5' end) with one or
more
amino or thio groups. In a particular embodiment, the linker is attached at a
position
which avoids blocking the targeting moiety or the activity of the U1 AO.
Exemplary
linkers may comprise at least one optionally substituted; saturated or
unsaturated;
linear, branched or cyclic alkyl group or an optionally substituted aryl
group. The
linker may also be a polypeptide (e.g., from about 1 to about 20 amino acids
or more,
or 1 to about 5). The linker may be biodegradable (cleavable (e.g., comprises
a
disulfide bond)) under physiological environments or conditions. In a
particular
embodiment, the linker comprises polyethylene glycol (PEG) (alone or in
combination with another linker). In a particular embodiment, the linker is a
SPDP
16
CA 03132388 2021-09-01
WO 2020/185651
PCT/US2020/021652
(N-Succinimidyl 3-(2-pyridyldithio)-propionate) linker such as LC- SPDP
(succinimidyl 6-(3-[2-pyridyldithio]-propionamido)hexanoate) or a SMCC
(succinimidy1-4-(N-maleimidomethyl) cyclohexane-l-carboxylate) linker such as
LC-
SMCC(succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-
amidocaproate)). The linker may also be non-degradable (non-cleavable) and may
be
a covalent bond or any other chemical structure which cannot be substantially
cleaved
or cleaved at all under physiological environments or conditions.
Targeting moieties of the instant invention preferentially bind to the
relevant
tissue (e.g., nerves) or organ (e.g., brain). In a particular embodiment, the
targeting
1 0 moiety specifically binds to a marker specifically (e.g., only)
expressed on the target
cells or a marker up-regulated on the target cells compared to other cells. In
a
particular embodiment, the targeting moiety is an antibody or antibody
fragment
immunologically specific for a surface protein on the target cells or a
surface protein
expressed at higher levels (or greater density) on the target cells than other
cells,
tissues, or organs. The antibody or antibody fragment may be a therapeutic
antibody
(e.g., possessing a therapeutic effect itself). In a particular embodiment,
the targeting
moiety is a ligand or binding fragment thereof for a cell surface receptor on
the target
cells. In a particular embodiment, the targeting moiety is an aptamer.
The U1 AO of the instant invention may further be conjugated to other
desirable compounds. For example, the U1A0 may be further conjugated (directly
or
via a linker as described above) to detectable agents, therapeutics (e.g.,
monoclonal
antibodies, peptides, proteins, inhibitory nucleic acid molecules, small
molecules,
chemotherapeutic agents, etc.), carrier protein, and agents which improve
bioavailability, stability, and/or absorption (e.g., PEG). The additional
compounds
may be attached to any synthetically feasible position of the U1A0 (or
conjugate
(e.g., to the Ul Adaptor (e.g., either end) or the targeting moiety).
Alternatively, the
targeting moiety and the U1 AO are each individually attached to additional
compound (e.g., carrier protein) (as such the additional compound can be
considered
to serve as the linker between the U1 AO and the targeting moiety). In a
particular
embodiment, the U1A0 is conjugated to a targeting moiety (e.g., neuron
targeting
moiety) at one end and, optionally, a therapeutic agent on the other.
Preferentially,
the attachment of the additional compounds does not significantly affect the
activity
of the U1 AO or the targeting moiety. Detectable agents may be any compound or
protein which may be assayed for directly or indirectly, particularly
directly.
17
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
Detectable agents include, for example, chemiluminescent, bioluminescent,
and/or
fluorescent compounds or proteins, imaging agent, contrast agent,
radionuclides,
paramagnetic or superparamagnetic ions, isotopes (e.g., radioisotopes (e.g.,
3H
(tritium) and "C) or stable isotopes (e.g., 2H (deuterium), nc, 13C, 170 and
180),
optical agents, and fluorescence agents.
Carrier proteins include, without limitation, serum albumin (e.g., bovine,
human), ovalbumin, and keyhole limpet hemocyanin (KLH). In a particular
embodiment, the carrier protein is human serum albumin. Carrier proteins (as
well as
other proteins or peptides) may be conjugated to the U1A0 (or conjugate) at
any
synthetically feasible position. For example, linkers (e.g., LC-SPDP) may be
attached
to free amino groups found on lysines of the carrier protein and then the U1A0
and
targeting moieties may be conjugated to the linkers. Any unreacted linkers may
be
inactivated by blocking with cysteine.
The U1A0 of the instant invention may be conjugated (e.g., directly or via a
linker) to a compound (e.g., antibodies, peptides, proteins, nucleic acid
molecules,
small molecules, etc.) which targets the U1A0 to a desired cell type and/or
promotes
cellular uptake of the U1A0 (e.g., a cell penetrating moiety). The targeting
moiety
may be operably linked to the 5' end, the 3' end, or both ends or to internal
nucleotides. In a particular embodiment, the targeting moiety and/or cell
penetrating
moiety are conjugated to the 5' end and/or 3' end. In a particular embodiment,
the
targeting moiety and/or cell penetrating moiety is conjugated to the 5' end.
In a
particular embodiment, the U1A0 is conjugated to both a targeting moiety and a
cell
penetrating moiety. As used herein, the term "cell penetrating agent" or "cell
penetrating moiety" refers to compounds or functional groups which mediate
transfer
of a compound from an extracellular space to within a cell. In a particular
embodiment, the U1A0 is conjugated to an aptamer. The aptamer may be targeted
to
a surface compound or protein (e.g., receptor) of a desired cell type (e.g.,
the surface
compound or protein may be preferentially or exclusively expressed on the
surface of
the cell type to be targeted). In a particular embodiment, the aptamer is a
cell
penetrating aptamer (e.g., Cl or Otter (see, e.g., Burke, D.H. (2012) Mol.
Ther., 20:
251-253)). In a particular embodiment, the U1 AO is conjugated to a cell
penetrating
peptide (e.g., Tat peptides (e.g., YGRKKKRRQRRRPPQ; SEQ ID NO: 6 (optionally
acetylated on N-terminus)), Penetratin (e.g., RQIKIWFQNRRMKWKKGG; SEQ ID
NO: 7), short amphipathic peptides (e.g., from the Pep- and MPG-families),
18
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
oligoarginine (e.g., 4-12 consecutive arginine), oligolysine (e.g., 4-12
consecutive
lysine)). In a particular embodiment, the U1A0 is conjugated to a small
molecule
such as biotin (as part of targeting antibodies) or a non-polar fluorescent
group (e.g., a
cyanine such as Cy3 or Cy5) or to other cell penetrating agents.
In a particular embodiment, at least one of the 3' end and 5' end of the U1A0
comprises a free-SH group.
The U1A0 (including the vehicles comprising the same) described herein will
generally be administered to a patient as a pharmaceutical preparation. The
terms
"patient" and "subject", as used herein, include humans and animals. These Ul
adaptors may be employed therapeutically, under the guidance of a physician.
The compositions comprising the U1A0 of the instant invention may be
conveniently formulated for administration with any pharmaceutically
acceptable
carrier(s). For example, the U1 AO may be formulated with an acceptable medium
such as water, buffered saline, ethanol, polyol (for example, glycerol,
propylene
glycol, liquid polyethylene glycol and the like), dimethyl sulfoxide (DMSO),
oils,
detergents, suspending agents or suitable mixtures thereof The concentration
of the
U1A0 in the chosen medium may be varied and the medium may be chosen based on
the desired route of administration of the pharmaceutical preparation. Except
insofar
as any conventional media or agent is incompatible with the U1 AO to be
2 0 administered, its use in the pharmaceutical preparation is
contemplated.
The dose and dosage regimen of U1 AO according to the invention that are
suitable for administration to a particular patient may be determined by a
physician
considering the patient's age, sex, weight, general medical condition, and the
specific
condition for which the U1 AO is being administered and the severity thereof
The
physician may also take into account the route of administration, the
pharmaceutical
carrier, and the UlAO's biological activity.
Selection of a suitable pharmaceutical preparation will also depend upon the
mode of administration chosen. For example, the U1A0 of the invention may be
administered by direct injection to a desired site (e.g., brain). In this
instance, a
pharmaceutical preparation comprises the U1A0 dispersed in a medium that is
compatible with the site of injection. U1 AO of the instant invention may be
administered by any method. For example, the U1A0 of the instant invention can
be
administered, without limitation parenterally, subcutaneously, orally,
topically,
pulmonarily, rectally, vaginally, intravenously, intracerebroventricularly,
19
CA 03132388 2021-09-01
WO 2020/185651
PCT/US2020/021652
intracrani ally, intraperitoneally, intrathecally, intracerebrally,
epidurally,
intramuscularly, intradermally, or intracarotidly. In a particular embodiment,
the
method of administration is by direct injection (e.g., into the brain) or
intracerebroventricularly. Pharmaceutical preparations for injection are known
in the
art. If injection is selected as a method for administering the U1 AO, steps
should be
taken to ensure that sufficient amounts of the molecules or cells reach their
target cells
to exert a biological effect.
Pharmaceutical compositions containing a U1 AO of the present invention as
the active ingredient in intimate admixture with a pharmaceutically acceptable
carrier
can be prepared according to conventional pharmaceutical compounding
techniques.
The carrier may take a wide variety of forms depending on the form of
preparation
desired for administration, e.g., intravenous, oral, direct injection,
intracranial,
intracerebroventricular, and intravitreal.
A pharmaceutical preparation of the invention may be formulated in dosage
unit form for ease of administration and uniformity of dosage. Dosage unit
form, as
used herein, refers to a physically discrete unit of the pharmaceutical
preparation
appropriate for the patient undergoing treatment. Each dosage should contain a
quantity of active ingredient calculated to produce the desired effect in
association
with the selected pharmaceutical carrier. Procedures for determining the
appropriate
2 0 dosage unit are well known to those skilled in the art.
Dosage units may be proportionately increased or decreased based on the
weight of the patient. Appropriate concentrations for alleviation of a
particular
pathological condition may be determined by dosage concentration curve
calculations,
as known in the art.
In accordance with the present invention, the appropriate dosage unit for the
administration of U1 AO may be determined by evaluating the toxicity of the
molecules or cells in animal models. Various concentrations of U1 AO in
pharmaceutical preparations may be administered to mice, and the minimal and
maximal dosages may be determined based on the beneficial results and side
effects
observed as a result of the treatment. Appropriate dosage unit may also be
determined by assessing the efficacy of the U1 AO treatment in combination
with
other standard drugs. The dosage units of U1A0 may be determined individually
or
in combination with each treatment according to the effect detected.
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
The pharmaceutical preparation comprising the U1A0 may be administered at
appropriate intervals, for example, at least twice a day or more until the
pathological
symptoms are reduced or alleviated, after which the dosage may be reduced to a
maintenance level. The appropriate interval in a particular case would
normally
depend on the condition of the patient.
Definitions
The singular forms "a," "an," and "the" include plural referents unless the
context clearly dictates otherwise.
1 0 "Nucleic acid" or a "nucleic acid molecule" as used herein refers to
any DNA
or RNA molecule, either single or double stranded and, if single stranded, the
molecule of its complementary sequence in either linear or circular form. In
discussing nucleic acid molecules, a sequence or structure of a particular
nucleic acid
molecule may be described herein according to the normal convention of
providing
the sequence in the 5' to 3' direction. With reference to nucleic acids of the
invention,
the term "isolated nucleic acid" is sometimes used. This term, when applied to
DNA,
refers to a DNA molecule that is separated from sequences with which it is
immediately contiguous in the naturally occurring genome of the organism in
which it
originated. For example, an "isolated nucleic acid" may comprise a DNA
molecule
2 0 inserted into a vector, such as a plasmid or virus vector, or
integrated into the genomic
DNA of a prokaryotic or eukaryotic cell or host organism.
When applied to RNA, the term "isolated nucleic acid" may refer to an RNA
molecule encoded by an isolated DNA molecule as defined above. Alternatively,
the
term may refer to an RNA molecule that has been sufficiently separated from
other
nucleic acids with which it would be associated in its natural state (i.e., in
cells or
tissues). An isolated nucleic acid (either DNA or RNA) may further represent a
molecule produced directly by biological or synthetic means and separated from
other
components present during its production.
A "vector" is a genetic element, such as a plasmid, cosmid, bacmid, phage or
virus, to which another genetic sequence or element (either DNA or RNA) may be
attached. The vector may be a replicon so as to bring about the replication of
the
attached sequence or element.
An "expression operon" refers to a nucleic acid segment that may possess
transcriptional and translational control sequences, such as promoters,
enhancers,
21
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
translational start signals (e.g., ATG or AUG codons), polyadenylation
signals,
terminators, and the like, and which facilitate the expression of a nucleic
acid or a
polypeptide coding sequence in a host cell or organism. An "expression vector"
is a
vector which facilitates the expression of a nucleic acid or a polypeptide
coding
sequence in a host cell or organism.
The term "oligonucleotide," as used herein, refers to nucleic acid sequences,
primers, and probes of the present invention, and is defined as a nucleic acid
molecule
comprised of two or more ribo or deoxyribonucleotides, preferably more than
three.
The exact size of the oligonucleotide will depend on various factors and on
the
particular application and use of the oligonucleotide.
The phrase "small, interfering RNA (siRNA)" refers to a short (typically less
than 30 nucleotides long, more typically between about 21 to about 25
nucleotides in
length) double stranded RNA molecule. Typically, the siRNA modulates the
expression of a gene to which the siRNA is targeted. The term "short hairpin
RNA"
or "shRNA" refers to an siRNA precursor that is a single RNA molecule folded
into a
hairpin structure comprising an siRNA and a single stranded loop portion of at
least
one, typically 1-10, nucleotide.
The term "RNA interference" or "RNAi" refers generally to a sequence-
specific or selective process by which a target molecule (e.g., a target gene,
protein or
RNA) is downregulated via a double-stranded RNA. The double-stranded RNA
structures that typically drive RNAi activity are siRNAs, shRNAs, microRNAs,
and
other double-stranded structures that can be processed to yield a small RNA
species
that inhibits expression of a target transcript by RNA interference.
The term "antisense" refers to an oligonucleotide having a sequence that
hybridizes to a target sequence in an RNA by Watson-Crick base pairing, to
form an
RNA:oligonucleotide heteroduplex with the target sequence, typically with an
mRNA. The antisense oligonucleotide may have exact sequence complementarity to
the target sequence or near complementarity. These antisense oligonucleotides
may
block or inhibit translation of the mRNA, and/or modify the processing of an
mRNA
to produce a splice variant of the mRNA. Antisense oligonucleotides are
typically
between about 5 to about 100 nucleotides in length, more typically, between
about 7
and about 50 nucleotides in length, and even more typically between about 10
nucleotides and about 30 nucleotides in length.
22
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
The term "substantially pure" refers to a preparation comprising at least 50-
60% by weight of a given material (e.g., nucleic acid, oligonucleotide,
protein, etc.).
More preferably, the preparation comprises at least 75% by weight, and most
preferably 90- 95% by weight of the given compound. Purity is measured by
methods
appropriate for the given compound (e.g. chromatographic methods, agarose or
polyacrylamide gel electrophoresis, HPLC analysis, and the like).
The term "isolated" may refer to a compound or complex that has been
sufficiently separated from other compounds with which it would naturally be
associated. "Isolated" is not meant to exclude artificial or synthetic
mixtures with
other compounds or materials, or the presence of impurities that do not
interfere with
fundamental activity or ensuing assays, and that may be present, for example,
due to
incomplete purification, or the addition of stabilizers.
The term "gene" refers to a nucleic acid comprising an open reading frame
encoding a polypeptide, including both exon and (optionally) intron sequences.
The
nucleic acid may also optionally include non coding sequences such as promoter
or
enhancer sequences. The term "intron" refers to a DNA sequence present in a
given
gene that is not translated into protein and is generally found between exons.
As used herein, the term "aptamer" refers to a nucleic acid that specifically
binds to a target, such as a protein, through interactions other than Watson-
Crick base
2 0 pairing. In a particular embodiment, the aptamer specifically binds to
one or more
targets (e.g., a protein or protein complex) to the general exclusion of other
molecules
in a sample. The aptamer may be a nucleic acid such as an RNA, a DNA, a
modified
nucleic acid, or a mixture thereof The aptamer may also be a nucleic acid in a
linear
or circular form and may be single stranded or double stranded. The aptamer
may
comprise oligonucleotides that are at least 5, at least 10, at least 15, at
least 20, at least
25, at least 30, at least 35, at least 40 or more nucleotides in length.
Aptamers may
comprise sequences that are up to 40, up to 60, up to 80, up to 100, up to
150, up to
200 or more nucleotides in length. Aptamers may be from about 5 to about 150
nucleotides, from about 10 to about 100 nucleotides, or from about 20 to about
75
nucleotides in length. While aptamers are discussed herein as nucleic acid
molecules
(e.g., oligonucleotides) aptamers, aptamer equivalents may also be used in
place of
the nucleic acid aptamers, such as peptide aptamers.
The phrase "operably linked", as used herein, may refer to a nucleic acid
sequence placed into a functional relationship with another nucleic acid
sequence.
23
CA 03132388 2021-09-01
WO 2020/185651
PCT/US2020/021652
Examples of nucleic acid sequences that may be operably linked include,
without
limitation, promoters, transcription terminators, enhancers or activators and
heterologous genes which when transcribed and, if appropriate to, translated
will
produce a functional product such as a protein, ribozyme or RNA molecule.
"Pharmaceutically acceptable" indicates approval by a regulatory agency of
the Federal government or a state government. "Pharmaceutically acceptable"
agents
may be listed in the U.S. Pharmacopeia or other generally recognized
pharmacopeia
for use in animals, and more particularly in humans.
A "carrier" refers to, for example, a diluent, preservative, solubilizer,
1 0 emulsifier, adjuvant, excipient, auxilliary agent or vehicle with which
an active agent
of the present invention is administered. Such pharmaceutical carriers can be
sterile
liquids, such as water and oils, including those of petroleum, animal,
vegetable or
synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and
the like.
Water or aqueous saline solutions and aqueous dextrose and glycerol solutions
may be
employed as carriers. Suitable pharmaceutical carriers are described, for
example, in
"Remington's Pharmaceutical Sciences" by E.W. Martin.
An "antibody" or "antibody molecule" is any immunoglobulin, including
antibodies and fragments thereof (e.g., immunologically specific fragments),
that
binds to a specific antigen. As used herein, antibody or antibody molecule
contemplates intact immunoglobulin molecules, immunologically active portions
of
an immunoglobulin molecule, and fusions of immunologically active portions of
an
immunoglobulin molecule. The term includes polyclonal, monoclonal, chimeric,
single domain (Dab) and bispecific antibodies. As used herein, antibody or
antibody
molecule contemplates recombinantly generated intact immunoglobulin molecules
and immunologically active portions of an immunoglobulin molecule such as,
without
limitation: Fab, Fab', F(al302, F(v), scFv, scFv2, and scFv-Fc.
With respect to antibodies, the term "immunologically specific" refers to
antibodies that bind to one or more epitopes of a protein or compound of
interest, but
which do not substantially recognize and bind other molecules in a sample
containing
a mixed population of antigenic biological molecules.
The term "treat" refers to the ability of the compound to relieve, alleviate,
and/or slow the progression of the patient's disease. In other words, the term
"treat"
refers to inhibiting and/or reversing the progression of a disease.
24
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
The following example describes illustrative methods of practicing the instant
invention and is not intended to limit the scope of the invention in any way.
EXAMPLE
HD9197 cells (Coriel Institute GM09197; 21/181 CAG repeats, fibroblast 6
year old male) were transfected with a panel of Ul adaptor oligonucleotides
(U1A0s)
and siRNAs (see below) directed against full length human huntingtin (HTT)
using
LipofectamineTM RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA). The
percent change of human HTT mRNA normalized to hypoxanthine
phosphoribosyltransferase 1 (HPRT1) was determined. As seen in Figure 2, human
HTT-full length mRNA-2 (hHTT-FL-2) U1A0 had the highest silencing activity
which was significantly greater than the silencing observed with any siRNA.
Notably, further experiments also showed that hHTT-FL-1 U1A0 can silence to <
30%. Similar results were obtained with DU145 (human prostate cancer cell
line) and
Mia PaCa2 cells (human pancreatic cancer cell line). With regard to the
truncated
version of HTT (also referred to as the alternatively spliced or intron 1
truncated
form), hHTT-TR-1 U1A0 was determined to have the greatest silencing activity.
The U1A0s and siRNA used for the experiments described herein are:
U1A0s:
hHTT-fl-li: UCCUGCUGAUGACAUGUGGGGCCAGGUAAGUAU (SEQ ID NO:
8), wherein each nucleotide is 2'-0-methyl;
hHTT-fl-21: CAGAAAAGGUUCACGUCCACGCCAGGUAAGUAU (SEQ ID NO:
9), wherein each nucleotide is 2'-0-methyl;
hHTT-fl-31: CAACCACCUCAAGCACAGACGCCAGGUAAGUAU (SEQ IDNO:
10), wherein each nucleotide is 2'-0-methyl;
hHTT-fl-41: UUCGUAAACAAGUCAGCAGCGCCAGGUAAGUAU (SEQ ID NO:
11), wherein each nucleotide is 2'-0-methyl;
hHTT-fl-51: GCCUCACAGUCUCUCCCACCGCCAGGUAAGUAU (SEQ ID NO:
12), wherein each nucleotide is 2'-0-methyl;
hHTT-fl-61: GUGACUAUCAGGAGAAAGGAGCCAGGUAAGUAU (SEQ ID NO:
13), wherein each nucleotide is 2'-0-methyl;
hHTT-FL-2: mC+AmGmAmA+AmAmGmG+TmUmCmA+CmGmUmC+CmAmC
mGmCmCmAmGmGmUmAmAmGmUmAmU (SEQ ID NO: 14), wherein m
= 2'-0-methyl and + = Locked Nucleic Acid;
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
hHTT-TR-1: mA+GmGmGmU+TmAmCmC+GmCmCmA+TmCmCmC+CmGmC
mGmCmCmAmGmGmUmAmAmGmUmAmU (SEQ ID NO: 15), wherein m
= 2'-0-methyl and + = Locked Nucleic Acid;
hHTT-TR-2: mGmC+GmAmGmA+GmGmAmC+AmAmGmG+GmAmAmG+AmC
mGmCmCmAmGmGmUmAmAmGmUmAmU (SEQ ID NO: 16), wherein m
= 2'-0-methyl and + = Locked Nucleic Acid;
NC-a (ctrl): mAAmCmGmGmUmUmAmGmGmCmAmCmCmTmCmUmUmGmA
mGmCmCmAmGmGmUmAmAmGmUmAmU (SEQ ID NO: 17), wherein m
= 2'-0-methyl;
mHTT-FL-A: mUmGmC+AmGmCmC+AmCmCmA+CmCmUmC+AmAmAmC+A
mGmCmC+AmGmG+TmA+AmGmU+AmU (SEQ ID NO: 18), wherein m
= 2'-0-methyl and + = Locked Nucleic Acid; and
mHTT-TR-A: mA+GmUmUmC+TmCmUmU+CmAmCmA+AmCmAmG+TmCmA
mGmCmC+AmGmG+TmA+AmGmU+AmU (SEQ ID NO: 19), wherein m
= 2'-0-methyl and + = Locked Nucleic Acid;
siRNA:
hHTT-siRNA-1 (both strands presented; r = RNA):
5'-rGrGrA rUrArG rUrArG rArCrA rGrCrA rArUrA rArCrU rCrGG T-3'
(SEQ ID NO: 20)
5'-rArCrC rGrArG rUrUrA rUrUrG rCrUrG rUrCrU rArCrU rArUrC rCrGrU-
3' (SEQ ID NO: 21);
hHTT-siRNA-2 (both strands presented; r = RNA):
5'-rArGrA rArCrU rUrUrC rArGrC rUrArC rCrArA rGrArA rArGA C-3'
(SEQ ID NO: 22)
5'-rGrUrC rUrUrU rCrUrU rGrGrU rArGrC rUrGrA rArArG rUrUrC rUrUrU-
3' (SEQ ID NO: 23); and
hHTT-siRNA-3 (both strands presented; r = RNA):
5'-rArCrA rGrCrU rCrCrA rGrCrC rArGrG rUrCrA rGrCrG rCrCG T-3'
(SEQ ID NO: 24)
5'-rArCrGr GrCrG rCrTrG rArCrC rTrGrG rCrTrG rGrArG rCrTrG rTrTrG-
3' (SEQ ID NO: 25).
26
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
Figure 3 provides a Western blot of Human DU145 cells transfected 48 hours
(LipofectamineTM 2000) with various anti-hHTT-FL Ul AOs and siRNAs (see
below).
Cells were lysed directly into laemmli buffer and then analyzed by Western
blot after
electrophoresis on a 6-20% gradient gel. The best anti-hHTT-FL Ul AOs (hHTT-FL-
1 and hHTT-FL-2) were used here and show silencing activity at the protein
level.
The anti-HTT-FL siRNA also showed silencing activity. Notably, using less U1A0
gave less silencing (compare lane 9 with lane 7).
YAC128 are mice containing the entire human HTT gene (300,000 bp) having
128 CAG repeats. To determine the effectiveness of the U1A0, either 1 or 20
of hHTT-FL-2 U1 AO or saline was unilaterally intracerebroventricular (ICV)
injected
into YAC128 mice. After 48 hours, mice were sacrificed with perfusion. Total
RNA
from left forebrains was extracted by a Trizol-based method and was analyzed
by RT-
qPCR and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3).
As
seen in Figure 4A, a 20 tg unilaterally-ICV-injected dose of the hHTT-FL-2
U1A0
silences with a 62% reduction of the hHTT-F1 mRNA in YAC128 brain as compared
to saline treated mice. The specificity of silencing is confirmed by the fact
that
neither the hHTT-Tr mRNA isoform (Fig. 4B) nor the Eif4a3 housekeeping gene
underwent an observable change in expression.
Total RNA (4 tg /lane) from forebrains of YAC128 mice were analyzed by
32P Northern blot (8% PAGE) (Figure 5). Specifically, the blot was probed with
a
33nt 32P-anti-hHTT-FL-2 oligonucleotide complementary to hHTT-FL-2 U1A0 in
order to measure U1 AO levels. The lanes marked "Standards" are the uninjected
U1A0 and their inclusion allows for a rigorous quantitation. As seen in Figure
5, the
U1A0 in the brain tissue is neither degraded nor shortened. Shortening of the
injected U1 AO, even by just a few nucleotides, would result in a noticeable
change in
migration relative to the standards.
An RNAScopeg analysis, a type of in situ hybridization (ISH) technology,
was used to detect hHTT-FL transcripts at single cell resolution. Briefly, the
RNAScopeg method involves fixing the hemibrain in 4% paraformaldehyde for 48
hours, transferring to PBS, and processing through tissue processor for
paraffin
embedding. The formalin-fixed paraffin-embedded (FFPE) brains were cut at 5
microns thick through the sagittal plane and striatal sections followed by in
situ
hybridization using an RNAScopeg probe specific to hHTT-FL mRNA. As seen in
Figure 6, the hHTT-FL-2 U1 AO-treated mice (right) have fewer dots and a
reduced
27
CA 03132388 2021-09-01
WO 2020/185651
PCT/US2020/021652
intensity as compared to saline treated mice (left), thereby demonstrating
silencing of
hHTT-FL.
To further demonstrate the stability of hHTT-FL-2 U1 AO, 20 tg of hHTT-
FL-2 U1 AO or saline was unilaterally intracerebroventricular (ICV) injected
into
YAC128 mice. After 2, 4, or 7 days, mice were sacrificed with perfusion. Total
RNA from left forebrains was extracted by a Trizol-based method and was
analyzed
by RT-qPCR and normalized to eukaryotic translation initiation factor 4A3
(Eif4a3).
As seen in Figure 7A, a 2011g unilaterally-ICV-injected dose of the hHTT-FL-2
U1 AO reduces hHTT-F1 mRNA in YAC128 brain constantly over time. Figure 7B
provides a Northern blot analysis probed with a 33nt32P-anti-hHTT-FL-2
oligonucleotide complementary to hHTT-FL-2 U1 AO in order to measure U1 AO
levels. As seen in Figure 7B, the U1 AO in the brain tissue is neither
degraded nor
shortened over time.
The ability to silence hHTT-Tr has also been demonstrated. 20 tg of hHTT-
1 5 TR-1 U1A0, hHTT-TR-2 U1A0, or saline was unilaterally ICV injected into
YAC128 mice. After 48 hours, mice were sacrificed with perfusion. Total RNA
from forebrains was extracted by a Trizol-based method and was analyzed by RT-
qPCR and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3).
As
seen in Figure 8A, hHTT-TR-1 U1A0 did not effectively silence hHTT-TR whereas
the hHTT-TR-2 U1A0 significantly silences hHTT-TR by about 79%. The effect
was specific as no silencing was observed for the hHTT-FL mRNA in either the
saline-treated or hHTT-TR-treated mice (Fig. 8B).
Anti-mouse HTT Ul AOs were also synthesized and shown to silence mHTT
in cultured cells. The best anti-mouse HTT Ul AOs were mHTT-TR-a (targeting
mHTT-TR mRNA transcript) and mHTT-FL-a (targeting mHTT-FL mRNA
transcript). These Ul AOs were then tested in the Q175 mouse model. Q175 mice
are
a knock-in mice where, for heterozygotes, one of the HTT alleles has 175 CAG
repeat. To determine the effectiveness of the U1A0, saline, 20 of
mHTT-TR-A
U1 AO, or 40 tg of non-specific control adaptor (NC-A) U1 AO was unilaterally
ICV
injected into Q175 mice. The NC-A U1A0 is a non-specific control U1A0 designed
to not silence any mouse gene. After 48 hours, mice were sacrificed with
perfusion.
Total RNA from left forebrains was extracted by a Trizol-based method and was
analyzed by RT-qPCR and normalized to eukaryotic translation initiation factor
4A3
(Eif4a3). As seen in Figure 9A, a 20 tg unilaterally-ICV-injected dose of the
mHTT-
28
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
TR-A U1A0 silences with a 75% reduction of the mHTT-TR mRNA in Q175 brain
as compared to control treated mice. The specificity of silencing is confirmed
by the
fact that neither the mHTT-FL mRNA isoform (Fig. 9B) nor the Eif4a3
housekeeping
gene underwent a significant change in expression.
An RNAScopeg analysis was also performed to detect mHTT-TR transcripts
at single cell resolution. Briefly, the RNAScopeg method involves fixing the
hemibrain in 4% paraformaldehyde for 48 hours, transferring to PBS, and
processing
through tissue processor for paraffin embedding. The formalin-fixed paraffin-
embedded (FFPE) brains were cut at 5 microns thick through the sagittal plane
and
striatal sections followed by in situ hybridization using an RNAScopeg probe
specific
to mHTT-TR mRNA. As seen in Figure 10, the mHTT-TR-A U1 AO-treated mice
(right) have fewer dots and a reduced intensity as compared to saline treated
mice
(left), thereby demonstrating silencing of mHTT-TR.
To further demonstrate the stability of mHTT-TR-A U1 AO, 20 tg of mHTT-
1 5 TR-A U1 AO or saline was unilaterally intracerebroventricular (ICV)
injected into
Q175 mice. After 21 days, mice were sacrificed with perfusion. Total RNA from
left
forebrains was extracted by a Trizol-based method and was analyzed by RT-qPCR
and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3). As
seen in
Figure 11A, a 20 tg unilaterally-ICV-injected dose of the mHTT-TR-A U1 AO
reduces mHTT-TR mRNA in Q175 mouse brain even after 21 days. The specificity
of silencing is confirmed by the fact that neither the mHTT-FL mRNA isoform
(Fig.
11B) nor the Eif4a3 housekeeping gene underwent a significant change in
expression.
To determine the effectiveness of the mHTT-FL U1A0, saline, 40 tg of
mHTT-FL-A U1 AO, or 40 tg of non-specific control adaptor (NC-A) U1 AO was
unilaterally ICV injected into Q175 mice. The NC-A U1A0 is a non-specific
control
U1A0 designed to not silence any mouse gene. After 48 hours, mice were
sacrificed
with perfusion. Total RNA from left forebrains was extracted by a Trizol-based
method and was analyzed by RT-qPCR and normalized to eukaryotic translation
initiation factor 4A3 (Eif4a3). As seen in Figure 12A, a 40 unilaterally-
ICV-
injected dose of the mHTT-FL-A U1A0 silences with a 69% reduction of the mHTT-
FL mRNA in Q175 brain as compared to control treated mice. The specificity of
silencing is confirmed by the fact that neither the mHTT-TR mRNA isoform (Fig.
12B) nor the Eif4a3 housekeeping gene underwent a significant change in
expression.
29
CA 03132388 2021-09-01
WO 2020/185651
PCT/US2020/021652
An RNAScopeg analysis was also performed to detect mHTT-FL transcripts
at single cell resolution. Briefly, the RNAScopeg method involves fixing the
hemibrain in 4% paraformaldehyde for 48 hours, transferring to PBS, and
processing
through tissue processor for paraffin embedding. The formalin-fixed paraffin-
embedded (FFPE) brains were cut at 5 microns thick through the sagittal plane
and
striatal sections followed by in situ hybridization using an RNAScopeg probe
specific
to mHTT-FL mRNA. As seen in Figure 13, the mHTT-FL-A U1A0-treated mice
(right) have fewer dots and a reduced intensity as compared to saline treated
mice
(left), thereby demonstrating silencing of mHTT-FL.
Biodistribution studies for hHTT-FL-2 U1A0 were also performed. Briefly,
to assess biodistribution in brain regions at the single cell level, a series
of
experiments was performed with a Cy3-fluorescently labelled hHTT-FL-2 U1A0
(Cy3-hHTT-FL-2 U1A0). 5 ig of Cy3-hHTT-FL-2 U1A0 was unilaterally ICV-
inj ected into 6-8 month old YAC128 mice. At 1, 7, and 28 days post-injection,
mice
were sacrificed with perfusion (with saline) to remove blood and extracellular
U1A0.
Brain samples were subsequently studied by confocal microscopy. Notably,
higher
doses of Cy3-hHTT-FL-2 U1 AO were not used because the Cy3 fluorescent group
itself proved toxic. Indeed, the injection of 1.5
and 4 of free Cy3, which is the
stoichiometric equivalent of 30 tg and 80 tg Cy3-hHTT-FL-2 U1A0, respectively,
was determined to be highly toxic to YAC128 mice. The use of 5 tg of Cy3-hHTT-
FL-2 U1A0 resulted in no overt toxic effects in YAC128 mice.
The biodistribution assays showed that after Cy3-hHTT-FL-2 U1 AO was
ICV-injected into the left ventricle, Cy3-hHTT-FL-2 U1A0 rapidly (within 1
day)
and significantly distributed across both left and right hemibrains, resulting
in
symmetric distribution of Cy3-hHTT-FL-2 U1 AO in both the left and right side
of the
brain by days 7 and 28. These results show that Cy3-hHTT-FL-2 U1A0 quickly
migrates from the left-ventricle injection site into other brain regions
(e.g., striatum,
cortex, hippocampus, cerebellum), including right hemibrain regions that are
farthest
from the injection site. Cy3-hHTT-FL-2 U1 AO also had widespread uptake by
most
neurons (e.g., cortical neurons) and cell types. Additionally, Cy3-hHTT-FL-2
U1A0
was clearly visible in the nucleus and perinucleus. Lastly, fluorescent
intensity was
only slightly diminished at the 28 day time point as compared to the 1 and 7
day time
points, thereby demonstrating the stability of Cy3-hHTT-FL-2 U1 AO over time.
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
Further experiments were performed to demonstrate 50% to 80% sustained
reduction of the mHTT-F1 transcript from one to four months. In parallel
experiments, conditions were identified that achieved 50% to 80% sustained
reduction
of the mHTT-Tr transcript from one to four months.
First, Q175 mice underwent a single unilateral ICV dose with the mHTT-FL-a
U1A0 at four different concentrations - 10, 20, 40, and 80 i.tg (mice n = 9
per dose) -
giving 36 mice in total. A cohort of three mice from each concentration was
euthanized after 1, 2, and 4 months where mice underwent perfusion with lx PBS
and
then sacrificed. Hemibrains were collected and processed for analysis by RT-
qPCR
and Northern blot. All Ul Adaptor treated mice were compared to untreated Q175
mice. Silencing of the mHTT-F1 transcript was assessed by RT-qPCR which were
then compared to untreated mice set to 100%. RT-qPCR to detect mHTT-Tr
transcript included Dnase treatment necessary to remove intron #1 DNA that
would
have interfered with mHTT-Tr transcript Ct values.
As seen in Figures 15A, 15B, and 15C, the mHTT-F1 transcript was
specifically reduced at 1, 2, and 4 months, respectively, after treatment.
Figure 15D
shows that control-treated Q175 mice treated with a single unilateral ICV dose
of
control NC-a U1 AO at the highest concentration of 80 i.tg had no reduction in
the
mHTT-F1 transcript or the mHTT-Tr transcript.
Second, Q175 mice underwent a single unilateral ICV dose with the mHTT-
Tr-a U1 AO at four different concentrations - 10, 20, 40, and 80 i.tg (mice n
= 9 per
dose) - giving 36 mice in total. A cohort of three mice from each
concentration was
euthanized after 1, 2, and 4 months where mice underwent perfusion with lx PBS
and
then sacrificed. Hemibrains were collected and processed for analysis by RT-
qPCR
and Northern blot. All Ul Adaptor treated mice were compared to untreated Q175
mice. Silencing of the mHTT-Tr transcript was assessed by RT-qPCR which were
then compared to untreated mice set to 100%. RT-qPCR to detect mHTT-Tr
transcript included Dnase treatment necessary to remove intron #1 DNA that
would
have interfered with mHTT-Tr transcript Ct values.
As seen in Figures 16A, 16B, and 16C, the mHTT-Tr transcript was
specifically reduced at 1, 2, and 4 months, respectively, after treatment.
Silencing of the mHTT-Tr transcript by mHTT-Tr-a U1 AO was deemed
specific because: 1) no significant changes in the mHTT-F1 transcript were
observed
and 2) the NC-a non-specific control U1A0 showed no silencing at the highest
dose
31
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
(80 g) at the 1, 2 and 4 month durations. Likewise, silencing of the mHTT-F1
transcript by mHTT-Fl-a U1A0 was deemed specific because: 1) no significant
changes in the mHTT-Tr transcript were observed and 2) the NC-a non-specific
control U1A0 showed no silencing at the highest dose (80 g) at the 1, 2 and 4
month
durations.
Pharmacokinetics (PK) studies were also performed. A PK profile was
achieved by 32P-Northern blot analysis over a four point dose response
combined with
a 3-point time-course duration of the same mice listed above. An aliquot of
the same
RNA used to perform RT-qPCR was used for Northern blotting. In brief, RNA
1 0 samples from Ul Adaptor-treated mice along with standards and a 32P
tracer were
separated on an 8% denaturing urea-PAGE gel followed by transfer to a Northern
blot
membrane. The membrane was then probed with the cognate 32P-probe, washed and
exposed to X-ray film. The cognate probes were a 32P-labelled oligonucleotide
called
32P-anti-mHTT-FL-a that is antisense to the mHTT-Fl-a U1 AO or a 32P-labelled
oligonucleotide called 32P-anti-mHTT-Tr-a that is antisense to the mHTT-Tr-a
U1 AO
or a 32P-labelled oligonucleotide called 32P-anti-NC-a that is antisense to
the NC-a
U1 AO. After several exposures to X-ray film, the Northern blots were
quantified by
phosphoimager analysis on a TyphoonTm system. Results are provided in Figure
17.
The histopathology of the U1A0 was also studied. Briefly, YAC128 mice
were ICV injected with saline (n = 3) or 50 [tg of hHTI-FL-2 Ul Adaptor Oligo
in
saline (n = 5). Two mice were used as untreated controls. The mice were all
males
and ranged in age from 3-5 months. Mice were treated for 7 days. Two
hematoxylin
and eosin (H&E) stained slides from brain, kidney and liver tissue from each
mouse
was examined for histopathology analysis. Microscopic examination of the above
slides does not reveal specific histopathologic changes of toxicity related to
ICV-50 g
Ul Adaptor Oligo. Microscopic examination of the H&E slides did not reveal
specific histopathologic changes of toxicity related to IC V-50 [tg Ul Adaptor
Oligo.
While certain of the preferred embodiments of the present invention have been
described and specifically exemplified above, it is not intended that the
invention be
limited to such embodiments. Various modifications may be made thereto without
departing from the scope and spirit of the present invention, as set forth in
the
following claims.
32
CA 03132388 2021-09-01
WO 2020/185651 PCT/US2020/021652
Several publications and patent documents are cited in the foregoing
specification in order to more fully describe the state of the art to which
this invention
pertains. The disclosure of each of these citations is incorporated by
reference herein.
33
