Note: Descriptions are shown in the official language in which they were submitted.
WO 2021/007365
PCT/US2020/041272
METHODS OF MAKING AND USING LIPOOLIGOSACCHARIDE
COMPOSITIONS AND VACCINES
CROSS REFERNCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No.
62/871,472,
filed 8 July 2019 and U.S. Provisional Application No. 62/872,973, filed 11
July 2019 each of
which is incorporated by reference herein in its entirety.
FIELD OF THE INVENTION
The present invention relates generally to compositions and methods for
treating
and/or preventing gonococcal infection and/or gonorrhea disease in a subject
The invention
further relates to providing transformed microbial host cells (e.g., bacterial
cells) that have
been engineered to produce modified and/or non-naturally occurring Neisseria
lipooligosaccharides through stable integration of genetic sequences. The
invention still
further relates to immunogenic compositions and vaccines that comprise, in
pertinent part,
Neisseria gonorrhoeae derived lipooligosaccharide(s).
BACKGROUND OF THE INVENTION
Neisseria gonorrhoeae ("N. gonorrhoeae") is a Gram-negative bacterial pathogen
that is the causative agent of the sexually transmitted disease known as
gonorrhea.
Gonorrhea is a common infection especially among sexually active 15-24 year-
old
individuals. In fact, gonococcal infection and gonorrhea disease are major
public health
concerns in the U.S. and globally that are exacerbated by growing multiple
drug-resistance
in the causative organism.
In 2017 more than 550,000 new cases of gonorrhea were reported to the U.S.
Centers for Disease Control 'CDC"), representing a 67% percent increase from
2013, while
the World Health Organization ("WHO") estimates the global yearly incidence of
gonorrhea
at approximately 106.1 million cases and some experts think the number is even
higher at
around 176 million cases.
N. gonorrhoeae typically infects the mucosal surfaces of the genitals, rectum,
throat,
and in rare circumstances, the infection can spread through the bloodstream
resulting in a
disseminated gonococcal infection ("DGr). Men infected with gonorrhea
typically experience
painful and/or frequent urination, off colored and purulent discharge, and
inflammation of the
genitals. Women typically also suffer discomfort during urination as well as
inter menses
bleeding, abnormal vaginal discharge, and abdominal or pelvic pain. Similar
symptoms effect
both sexes when the infection is localized in the eyes (conjunctivitis),
throat, (painful and
swollen lymph nodes), and rectum (discharge and itching). A percentage of men
infected
1
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
with the disease are asymptomatic. And some infected women fail to experience
or
outwardly present with any symptoms of infection. Often the symptoms
experienced by
women are only mild and can be mistaken for more common bladder or vaginal
infections.
Serious long-term complications in women suffering with N. gonorrhoea&
infection include
pelvic inflammatory disease, ectopic pregnancy, and infertility.
While the prevalence of the disease in pregnant women in the U.S. is generally
low
(less than 1%), its prevalence in certain subsets of the population remains a
matter of great
concern. Indeed, rates of nearly 10% have been observed in some central city
adolescent
prenatal clinics. Outside of the U.S., especially in developing countries, the
incidence of
pregnant women infected with gonorrhea can be even greater. Pregnant women
infected
with gonorrhea can pass the disease to their babies during labor and delivery.
The risk of
transmitting the disease to a newborn is well studied in the case of
ophthalmia neonatorum
and runs about 30%-40%. The risk of disseminated gonococcal infection (e.g.,
sepsis or
arthritis) in newborns has not been widely studied, and while probably
relatively rare, it is not
negligible. (See, Alexander ER, "Gonorrhea in the newborn," Ann. N.Y. Acad.
Sci., 549:180-
186 (1988)).
Antibiotic treatment of gonorrhea has been complicated by the ability of the
causative
organism to develop resistance to antibiotics used for treatment. Resistance
in N.
gonorrhoea& to fluoroquinolones began to emerge in the U.S. in the 1990s and
2000s, and
by 2007 the CDC stopped recommending fluoroquinolones for treatment. This move
left the
cephalosporin antibiotics as the only remaining class of antimicrobials
recommended for
treating the disease. Further, in 2010 the CDC's gonorrhea treatment
guidelines were again
amended to reflect the concern about the growing antibiotic resistance in
frequently co-
occurring pathogens (e.g., Chlamydia trachomatis) to thusly include oral
administration of
azithromycin or doxycycline in addition to third generation cephalosporins
(e.g., ceftriaxone
250 mg or cefixime 400 mg).
Antimicrobial resistance in N. gonoffhoeae is not a new phenomena, it has been
growing steadily since the 1940s and there have been frequent emergence of
multidrug-
resistant strains. (See, Lewis DA, "Global resistance of Neisseria
gonorrhoeae: when theory
becomes reality," Curr. Opin. Infect. Dis., 27(1):62-67 (2014); and Bolan GA,
et aL, "The
Emerging Threat of Untreatable Gonococcal Infection," N. Engl. J. Med.,
366:485-487
(2012)). As N. gonorrhoeae resistance to ceftriaxone increases and high-level
macrolide
resistance spreads, the state of treatment is precariously disposed to return
to the pre-
antibiotics era where this common infection could not be treated and there was
considerable
morbidity (pelvic inflammatory disease) and infertility in women and urethral
strictures and
renal insufficiency in men.
2
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
Several challenges to developing a successful gonorrhea vaccine exist in the
laboratory and in the characteristics of causative organism itself. These
challenges include
the lack of strong correlates of protection, the lack of suitable animal
models, the organism's
high antigenic variability, and the typical confinement of the gonococcal
infection to mucosa!
surfaces. Additionally, N. gonorrhoeae interacts with innate immune cells such
as
macrophage and dendritic cells to elicit inflammatory responses while
suppressing Th1iTh2
mediated specific immune responses, although localized non-specific and non-
memory
inducing antibody responses do occur. (See, Jerse AE, et at, "Vaccines against
gonorrhea:
current status and future challenges," Vaccine, 32(14):1579-1587 (2014)).
Gonococcal
infection does not induce protective immunity and repeated infections are
common.
(Plummer FA, et at, "Epidenniologic evidence for the development of serovar-
specific
immunity after gonococcal infection," J. Clin. Invest., 83:1472-1476(1989)).
Thus far, the administration of meningococcal vaccines has not provided
protection
against gonococcal infection or gonorrhea and the innmunogens in meningococcal
vaccines
have, again thus far, generally been considered unsuitable for protection
against N.
gonorrhoeae. (Jerse, et at, supra).
The increase of antibiotic resistance and emergence of untreatable gonococcal
strains emphasizes the need for the development of new and efficacious
vaccines against N.
gonorrhoeae. Accordingly, there is a need for compositions (e.g., immunogenic
compositions
and vaccines) and therapeutic methods that protect against N. gonorrhoeae
infection and
gonorrhea. Preferred compositions and methods in this regard would be
administered in one
or more doses as vaccines (e.g., to prevent and/or attenuate infection) or as
therapeutic
compositions (e.g., to treat and/or cure disease).
BRIEF DESCRIPTION OF TFIE DRAWINGS
Figure 1 shows an exemplary LOS molecule with a Lacto-N-neotetraose (nLc4) a
chain and no 13 chain extension. The nLc4 a chain consists of lactose (Lc2)
and N-acetyl
lactosamine (LacNAc) and extends from Hep1. The p chain would extend from C3
of Hep2,
which is substituted by the Ra phosphoethanolamine (PEA) in the Figure. The N-
acetyl
glucosamine (GIcNAc) is the y chain, which is not extended_
Figure 2 shows the GaINAc-nLc4 a chain and the addition of the non-reducing
terminal GaINAc. Each sugar conforms a separate antigen: the nLc4 a chain
presents four
separate antigens, in order from the non-reducing terminus, nLc4, nLc3, Lc2
and 6-Glc.
(Plummer FA, et al., "Epidemiologic evidence for the development of serovar-
specific
immunity after gonococcal infection," J. Clin. Invest., 83:1472-1476(1989);
and Schmidt KA,
et at, "Experimental gonococcal urethritis and reinfection with homologous
gonococci in
male volunteers," Sex Transm. Dis., 28(10):555-564 (2001)). The GaINAc-nLc4 a
chain has
3
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
a fifth antigen, the terminal GaINAc, and the I and y chains present
additional antigens.
(Schneider H, et at, "Expression of paragloboside-like lipooligosaccharides
may be a
necessary component of gonococcal pathogenesis in men," J. Exp. Med., 174:1601-
1605
(1991)). This Figure further shows Lc2 conforms the antigen recognized by mAb
2C7
wherein binding of this mAb to Lc2 is enhanced by the presence of a parallel a-
lactose 13
chain. N. gonorrhoeae strains isolated from blood cultures (DGI strains)
frequently make
LOS with a-lactose 13. chains (Gibson BW, et al., "Structure and heterogeneity
of the
oligosaccharides from the lipooligosaccharides of a pyocin-resistant Neisseria
gonorrhoeae,"
Proc. Natl. Acad. Sci. USA, 86:17-21 (1989); Yamasaki R, etal., "The structure
of
lipooligosaccharide produced by Neisseria gonorrhoeae, strain 15253 isolated
from a patient
with disseminated infection: Evidence for a new glycosylation pathway of the
gonococcal
lipooligosaccharide" J. Biol. Chem., 269(48):30345-30351 (1994); and Yamasaki
R, at at,
"Structural and immunochemical characterization of a Neisseria gonorrhoeae
epitope
defined by a monoclonal antibody 2C7; the antibody recognizes a conserved
epitope on
specific lipooligosaccharides in spite of the presence of human carbohydrate
epitopes," J.
Biol. Chem., 274(51):36550-36558 (1999)).
Figure 3 shows the high-level organization of the Neisseria Igt operon.
Figure 4 shows an exemplary organization of the Neisseria lgt operon as
described in
Braun DC and Stein DC. (See, Braun DC and Stein DC, "The IgtABCDE gene
cluster,
involved in lipooligosaccharide biosynthesis in Neisseria gonorrhoeae,
contains multiple
promoter sequences," J. Bacteriol., 186(4):1038-1049 (2004)).
Figure 5 shows silver-stained F62 LOS separated through SDS-PAGE.
Figure 6 shows an assay using LOS from pyocin-selected mutants of gonococcal
strain 1291, denominated 1291a-e to charge immunofluorescent microspheres that
bind
antibodies specific for four of the five LOS a chain antigens, nLc4, nLc3, Lc2
and 13-G1c.
SUMMARY OF THE INVENTION
The present invention relates generally to compositions and methods for
treating
and/or preventing gonococcal infection and/or gonorrhea disease in a subject.
The invention
further relates to providing transformed microbial host cells (e.g., bacterial
cells) that have
been engineered to produce modified and/or non-naturally occurring Neisseria
lipooligosaccharides through stable integration of genetic sequences. The
invention still
further relates to immunogenic compositions and vaccines that comprise, in
pertinent part,
Neissetia gonoffhoeae derived lipooligosaccharide(s).
The present invention further relates to methods of producing and
administering
immunogenic compositions and/or vaccines to prevent infection by N.
gonorrhoeae in a
subject. More particularly, the present invention provides methods of and
compositions
4
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
wherein said immunogenic compositions and/or vaccines are produced in a
commensal
species of Neisseria bacteria.
Compositions and methods are still further provided for preventing gonorrhea
and/or
associated pathological conditions caused by N. gonorrhoeae in a human subject
The present invention further provides a number of embodiments of compositions
(e.g.,
vaccines, immunogenic compositions, pharmaceutical compositions comprising
fusions or
conjugates of LOS molecules with one or more carrier proteins).
Compositions and methods are provided for treating (e.g., lessening the
severity,
duration, or (re)occurrence of complications or sequelae related to a disease)
caused in a
subject (e.g., a human) by infection by N. gonorrhoeae.
The present invention provides immunogenic compositions (and N. gonorrhoeae
vaccines) comprising a GaINAc-nLc4 a chain and an nLc4 a chain from a strain
of N.
gonorrhoeae. The invention still further provides immunogenic composition (and
N.
gonorrhoeae vaccines) further comprising a lipid A moiety from a strain of N.
gonorrhoeae.
Additionally, the immunogenic compositions (and N. gonorrhoeae vaccines)
optionally
comprise an adjuvant. Preferred embodiments, in this regard, comprise
adjuvants
comprising metallic salt(s) (e.g., an aluminum salt selected from the group
comprising
aluminum hydroxide, aluminum oxy hydroxide, aluminum hydroxyphosphate,
aluminum
hydroxyphosphate sulfate, aluminum phosphate, and/or potassium aluminum
phosphate).
Additionally provided are methods of making immunogenic compositions (and N.
gonorrhoeae vaccines) in commensal N. gonorrhoeae species (e.g., a commensal
selected
from the group comprising/consisting of: N. cinerea, N. elongata, N.
flavescens, N.
lactamica, N. mucosa, N. polysaccharea, N. sicca, N. subtlava, N. perflava,
and/or N. !lava).
In a preferred embodiment, the commensal species is N. Iactamica. In a
particularly
preferred embodiment, the commensal species of N. tactamica is transformed
(i.e.,
genetically engineered to express) one or more genes from pathogenic N.
gonorrhoeae
strain F62.
Further additional methods provide medical uses of the immunogenic
compositions
(and N. gonorrhoeae vaccines) in subjects in one or more doses or over one or
more dosing
or administration schedules. Schemes for providing booster doses or
administrations of the
instant compositions are contemplated as well.
It is desirable to identify antigens and immunogenic components for
incorporation
into the compositions of the present invention (e.g., vaccines) that elicit
protective immunity,
immunological responses, and/or immunological modulation upon infection, or
prior to
infection, of a host with a pathogenic bacteria, especially infection of said
host with a
pathogenic bacteria selected from the Neisseriaceae family of Gram negative
bacteria, for
example, N. gonorrhoeae. It is also desirable to provide a vaccine that
confers protective
5
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
immunity to infants as well as adults and whose protection is long-term. It
may also be of
advantage to provide a vaccine that protects against sub-clinical infection,
i.e., where
symptoms of ineningococcal or gonococcal infection are not immediately
apparent and the
infected individual may act as a carrier of the pathogen. It would further be
of advantage to
protect against all or a wide range of strains Neisseria, notably N_
gonorrhoeae.
DEFINITIONS
The terminology used herein is for the purpose of describing particular
embodiments
only and is not intended to be generally limiting of the invention.
As used herein, the singular forms "a", "an" and "the" are intended to include
the
plural forms as well, unless the context dearly indicates otherwise.
Furthermore, to the
extent that the terms "induding," "includes," "having," "has," and "with," or
variants thereof,
are used in either the detailed description and/or the claims, such terms are
intended to be
inclusive in a manner similar to the term "comprising" unless otherwise noted.
In this application, the use of "or" means "and/or' unless stated otherwise.
Also,
terms such as "element," "component," "moiety" encompass both elements and
components
comprising one unit and elements and components that comprise more than one
subunit
unless specifically stated otherwise.
The term "about" or "approximately' means within an acceptable error range for
the
particular value as determined by one of ordinary skill in the art, which will
depend in part on
how the value is measured or determined, La, the limitations of the
measurement system.
For example, "about" can mean within 1 or more than 1 standard deviation, per
the practice
in the art Alternatively, "about" can mean a range of up to 20%, up to 10%, up
to 5%, or up
to 1% of a given value. Alternatively, particularly with respect to biological
systems or
processes, the term can mean within an order of magnitude, preferably within 5-
fold, and
more preferably within 2-fold, of a value. Where particular values are
described in the
application and claims, unless otherwise stated the term "about meaning within
an
acceptable error range for the particular value should be assumed.
The term "infection," as used herein, is intended to include the proliferation
of a
pathogenic organism within and/or on the tissues of a host organism and
especially the
proliferation of N. gonorrhoeae in a host. Pathogenic organisms typically
include bacteria,
viruses, fungi and protozoans, although growth of any microbe within and/or on
the tissues
of an organism are considered to fall within the term "infection."
As used herein the term "gonorrhea" refers to a sexually transmitted disease
("STD")
caused by infection with the N. gonorrhoeae. N. gonorrhoeae infects the
mucosal epithelium
membranes of the reproductive tract, including the cervix (i.e., gonococcal
cervicitis), uterus,
and fallopian tubes in women, and the urethra in women and men (La, gonococcal
6
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
urethritis). N. gonorrhoeae can also infect the mucous membranes of the mouth,
throat,
eyes, and rectum and in a small subset of cases lead to disseminated
gonococcal infection.
As used herein, a "connnnensal(s)" or a "commensal micro-organism(s)" are
those
that microorganisms (e.g., bacteria) can colonize a host organism without
causing disease.
A number of different commensal bacteria exist. Commensal Neisseria are
suitable for use
in the invention, and these commensal Neisseria are typically selected from
the group
consisting of N. lactemica, N. cinema, N. elongate, N. flavescens, N. mucosa,
N.
polysaccharea, IQ sicca, N. perflava and N. sub flava. Different species of
these commensal
organisms are known to colonize the buccal or nasal areas or other mucosal. In
preferred
embodiments the "commensal" species (e.g., N. lactamica) does not possess a
capsule.
As used herein, the term "antigen" or "immunogenic polypeptide/peptide" is a
molecule capable of being bound by an antibody or T-cell receptor. An antigen
is additionally
capable of inducing a humoral immune response and/or cellular immune response
leading to
the production of B- and/or T-lymphocytes in a subject (e.g., a human).
Similarly, the term
"immunogen" refers to an antigen that is recognized as unwanted, undesired,
and/or foreign
in a subject (e.g., a human). A "vaccine antigen" is an antigen that when
included in a
vaccine composition elicits protective immunity to bacterial infection. The
vaccine
compositions of the present invention are particularly suited to vaccination
against infection
of an animal (e.g., a mammal, and more particularly, a human).
As used herein, the term "adjuvant" refers to an agent (e.g., metals, metal
salts,
mineral salt amino acid, saccharides, oligosaccharides, polysaccharides,
lipids, oils, oil in
water emulsions, polynucleotides, peptides, polypeptides, proteins, and the
like) that
stimulates and/or enhances an immune response in a subject (e.g., a human). An
adjuvant
can stimulate and/or enhance an immune response in the absence of an immunogen
(i.e.,
antigen) and/or can stimulate and/or enhance an immune response in the
presence of an
immunogen. In the present invention, a preferred adjuvant is aluminum
hydroxyphosphate.
A used herein, the term "immune response" includes a response by a subject's
immune system to an immunogenic composition or vaccine of the present
invention. Immune
responses include both cell-mediated immune responses (responses mediated by
antigen-
specific T cells and non-specific cells of the immune system) and hunnoral
immune
responses (responses mediated by antibodies present in the plasma lymph, and
tissue
fluids). The term "immune response" further encompasses both the initial
responses to an
immunogen as well as potential memory responses that are a result of "acquired
immunity."
As used herein, the phrase "stimulating an immune response" refers to an
increase
in an immune response in the subject following administration of an
immunogenic
composition or vaccine composition of the present invention relative to the
level of immune
7
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
response in the subject when a composition of the present invention has not
been
administered.
As used herein, the term "immunogenic composition" refers to a composition
that
elicits an endogenous immune response in a subject (e.g., a human). The
endogenous
immune response may result in, for example, the switching of a Th1 biased
immune
response to a Th2 biased immune response, the activation or enhancement of T
effector cell
responses and/or the reduction of T regulatory cell response, the activation
of antigen-
specific naive lymphocytes that may then give rise to antibody-secreting B
cells or antigen-
specific effector and memory T cells or both, and/or the direct activation of
antibody-
secreting B cells. Similarly, as used herein the term "vaccine" or "vaccine
composition" refer
to an immunogenic composition as above that elicits an immune response in a
subject
sufficient to protect the subject from acquiring a disease for a period of
time (e.g.,
gonorrhea).
As used herein, "prophylactic" and "preventive" immunogenic compositions,
vaccines, or compositions are compositions designed and administered to
prevent infection,
disease, and/or any related sequelae caused by or associated with a pathogenic
organism
(e.g., N. gonorrhoeae) in a subject (e.g., a human).
The term "administering" includes any method of delivery of a pharmaceutical
composition or agent (i.e., an immunogenic composition or vaccine) into a
subject's system
or to a particular region in or on a subject In certain embodiments of the
invention,
immunogenic compositions and vaccines are administered intramuscularly,
subcutaneously,
intradermally, intranasally, orally, subcutaneously, transcutaneously, or
transmucosally to a
subject. As used herein, and as based on context, the terms "administration"
or
"administrations" encompass a singular and multiple instances of delivery of
an agent to a
subject over time such that an immunogenically effective singular delivery as
well as a
priming delivery (first dose or administration) and a subsequent (second,
third, etc., doses or
administrations) boosting delivery of an agent are encompassed.
As used herein, the following terms, "treatment," "treating," "palliating" and
"ameliorating," are used interchangeably as context indicates. These terms
refer to an
approach for obtaining beneficial or desired results induding, but not limited
to, a therapeutic
benefit. "Therapeutic benefit" is meant to encompass the eradication or
amelioration of the
underlying disease or disorder being treated. Also, a therapeutic benefit is
achieved with the
eradication or amelioration of one or more of the physiological symptoms
associated with the
underlying disease or disorder such that an improvement is observed in the
subject,
notwithstanding that the subject may still be afflicted with the underlying
disease or disorder
For prophylactic benefit, the compositions may be administered to a subject at
risk of
8
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
developing a particular disease, or to a subject reporting one or more of the
physiological
symptoms of a disease, even though a diagnosis of this disease may not have
been made.
As used herein, the term "synergism" refers to at least two substances working
together to increase the total effect, the combination is more effective than
either substance
alone. A "synergistically effective" therapeutic amount or "synergistically
effective" amount of
an agent or therapy is an amount which, when combined with an effective or sub-
therapeutic
amount of another agent or therapy, produces a greater effect than when either
of the two
agents are used alone. In some embodiments, a synergistically effective
therapeutic amount
of an agent or therapy produces a greater effect when used in combination than
the additive
effects of each of the two agents or therapies when used alone. The term
"greater effect"
encompasses not only a reduction in symptoms of the disorder to be treated,
but also an
improved side effect profile, improved tolerability, improved patient
compliance, improved
efficacy, or any other improved clinical outcome.
The terms "co-administration," "administered in combination with," and their
grammatical equivalents, encompass administration of two or more agents to a
subject so
that both agents and/or their metabolites are present in the subject at the
same time. Co-
administration includes simultaneous administration in separate compositions,
administration
at different times in separate compositions, or administration in a
composition in which both
agents are present. Co-administered agents may be in the same formulation. Co-
administered agents may also be in different formulations.
A "therapeutic amount," as used herein, encompasses the amount of a substance
(e.g., the compositions of the present invention) that is sufficient to elicit
or promote the
desired therapeutic benefit and/or prophylactic benefit. A prophylactic effect
includes
delaying or eliminating the appearance of a disease or condition, delaying or
eliminating the
onset of symptoms of a disease or condition, slowing, halting, or reversing
the progression of
a disease or condition, or any combination thereof. Specifically, as used
herein, a
"therapeutic amount" of the present compositions is sufficient to successfully
prevent
infection in a subject (e.g., human) with N. gonorrhoeae.
As used herein, the term "immunologically effective amount" is that amount
sufficient
to treat or prevent a disease and/or affect an endogenous immune response in a
subject but
not causing side effects or severe or excessive immune responses. The accurate
dosage
may vary depending on the antigen(s) to be administered and the desired effect
to be
obtained, and may be readily determined by those skilled in the art according
to factors
known in medicine and vaccinology, including the patients age, weight, health
state, gender
and sensitivity to any components of the intended administration(s),
administration routes,
and various administration methods. Thus, as used herein, an "immunologically
effective
amount" is the amount of composition sufficient to produce the desired
"immunological
9
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
efficacy" desired as a clinical result (e.g., disease/infection treatment
and/or prevention) in a
subject. An "immunologically effective amount" can be administered in one or
more
administrations over a set period of time, including, seconds, minutes, days,
or years.
A "sub-therapeutic amount of a substance (e.g., the compositions of the
present
invention) or therapy using the substance is an amount or application less
than the effective
amount for that substance or therapy, but when combined with an effective or
sub-
therapeutic amount of another substance or therapy can produce a result
desired by the
physician, due to, for example, synergy in the resulting efficacious effects,
or reduced side
effects.
As used herein, the phrase "pharmacologically effective carrier refers to any
carrier
approved for use in humans which facilitates delivery of the compositions of
the instant
invention without interfering with their therapeutic effect. The carrier
preferably is an inert
vehicle that exhibits no pharmacologic or therapeutic action.
The term "pharmaceutically acceptable salt' refers to salts derived from a
variety of
organic and inorganic counter ions well known in the art. Pharmaceutically
acceptable acid
addition salts can be formed with inorganic adds and organic acids. Inorganic
adds from
which salts can be derived include, for example, hydrochloric acid,
hydrobromic acid, sulfuric
add, nitric add, phosphoric add, and the like. Organic adds from which salts
can be derived
include, for example, acetic acid, propionic acid, glycolic acid, pyruvic add,
oxalic add,
maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric
acid, benzoic acid,
cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-
toluenesulfonic
acid, salicylic acid, and the like. Pharmaceutically acceptable base addition
salts can be
formed with inorganic and organic bases. Inorganic bases from which salts can
be derived
include, for example, sodium, potassium, lithium, ammonium, calcium,
magnesium, iron,
zinc, copper, manganese, aluminum, and the like. Organic bases from which
salts can be
derived include, for example, primary, secondary, and tertiary amines,
substituted amines
including naturally occurring substituted amines, cyclic amines, basic ion
exchange resins,
and the like, specifically such as isopropylamine, trimethylamine,
diethylamine, triethylamine,
tripropylamine, and ethanolamine. In some embodiments, the pharmaceutically
acceptable
base addition salt is chosen from ammonium, potassium, sodium, calcium, and
magnesium
salts. "Pharmaceutically acceptable carrier" or "pharmaceutically acceptable
excipient"
includes, but is not limited to, polysorbates, as well as polymers, more
generally, thickening
agents, solvents, dispersion media, coatings, antibacterial and antifungal
agents, isotonic
and absorption delaying agents and the like. Exemplary pharmaceutical
formulation methods
and methods of producing pharmaceuticals useful in certain embodiments are
described in
U.S. 20030211046A1; U.S. 20030004182A1; U.S. 2002060356384; U.S.
20020015728A1;
U.S. 6,511,660; U.S. 6,406,745; U.S. 6,346,269; U.S. 6,039,977; U.S.
5,858,408; U.S.
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
5,631,023; U.S. 5,476,667; 5,044,091; U.S. 4,867,970; and WO 0028969A2 (each
of which
is incorporated herein by reference in its entirety). The use of such media
and agents for
pharmaceutically active substances is well known in the art. Except insofar as
any
conventional media or agent is incompatible with the active ingredient, its
use in the
therapeutic compositions of the invention is contemplated. Supplementary
active ingredients
can also be incorporated into the compositions. The phrase "pharmaceutically
acceptable"
further denotes those substances, compounds, materials, compositions, and/or
dosage
forms which are, within the scope of sound medical judgment, suitable for use
in the
administration of the immunogenic compositions and vaccines of the present
invention in
subjects (e.g., humans) without excessive toxicity, irritation, allergic
response,
reactogenicity, or other problems or complications commensurate with a
reasonable
benefit/risk ratio.
As used herein, the term "subject" refers to an animal, such as a mammal, for
example, a human. In preferred embodiments, the subject is a mammal, and in
particularly
preferred embodiments, the subject is human.
The term "in vitro" refers to an event that takes places outside of a subjects
body.
For example, an in vitro assay encompasses any assay run outside of a subject.
In vitro
assays encompass cell-based assays in which cells alive or dead are employed.
In vitro
assays also encompass cell-free assays in which no intact cells are employed.
The term "in vivo" refers to an event that takes place in a subject's body. In
the
limited sense of the term "in vivo," a subject is understood to include both
laboratory animals
(e.g., mice, rats, monkeys, dogs, and the like) as well humans as in
conducting human clinic
trials or approved experimental uses.
The term "sample," as used herein, refers to any sample suitable for testing
or
assaying according to the methods of the present invention or to routine
analytic and/or
diagnostic techniques for determining disease and/or the identity of cultured
microorganisms. The term "sample" is not limited to bacterial cultures, but
can also be used
to describe collected fluids, exudates, tissues, cell, and/or collected
microorganisms, viruses,
prions, or any portion or subunit thereof of the aforementioned, that are
suitably obtained,
processed, transported and stored using various standard procedures. For
examples, the
samples can be stored in suitable storage or transportation devices,
refrigerated, frozen,
desiccated, diluted, cultured, divided, passaged, separated, mixed with
various additives,
mounted on slides, subjected to common molecular or immunological techniques
(e.g.,
amplification, sequencing, immunoprecipitation, and the like) or
physicochemical techniques
(e.g., spectroscopy, electrophoresis, chromatography, microscopy, nuclear
magnetic
resonance, and the like).
11
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
Recitation of ranges of values herein are merely intended to serve as a
shorthand
method of referring individually to each separate value falling within the
range, unless
otherwise indicated herein, and each separate value is incorporated into the
specification as
if it were individually recited herein.
All methods described herein can be performed in any suitable order unless
otherwise indicated herein or otherwise clearly contradicted by context. The
use of any and
all examples, or exemplary language (e.g., "such as") provided herein, is
intended merely to
better illuminate the invention and does not pose a limitation on the scope of
the invention
unless otherwise claimed. No language in the specification should be construed
as indicating
any non-claimed element as essential to the practice of the invention.
Unless otherwise defined herein, scientific and technical terms used in
connection
with the present invention shall have the meanings that are commonly
understood by those
of ordinary skill in the art. The meaning and scope of the terms should be
clear, however, in
the event of any latent ambiguity, definitions provided herein take precedent
over any
dictionary or extrinsic definition.
That the present invention may be more readily understood, additional select
terms
may be defined functional as mentioned below.
DESCRIPTION OF THE INVENTION
The present invention relates generally to compositions and methods for
treating
ancVor preventing gonococcal infection and/or gonorrhea disease in a subject.
The invention
further relates to providing transformed microbial host cells (e.g., bacterial
cells) that have
been engineered to produce modified and/or non-naturally occurring Neisseria
lipooligosaccharides through stable integration of genetic sequences. The
invention still
further relates to immunogenic compositions and vaccines that comprise, in
pertinent part,
N. gonorrhoeae derived lipooligosaccharide(s). In preferred embodiments, these
transformed microbial host cells are alternatively described as being LOS
production
systems and/or the component cells and cell cultures thereof.
1. LOS ANTIGENIC STRUCTURES
N. gonorrhoeae lipooligosaccharide is an antigenically complex triantennary
glycolipid molecule comprising three glycose antennae designated as a, 13, and
y chains.
While the present invention is not limited to any particular mechanisms,
sequences, or
structures whether antigenic or not, a general structure for N. gonorrhoeae
lipooligosaccharide is discussed, for example, by Schneider H., etal., and
thusly
incorporated herein. (See, Schneider H, "Expression of paragloboside-like
lipooligosaccharides may be a necessary component of gonococcal pathogenesis
in men,"
12
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
J. Exp. Med., 174(6):1601-1605 (1991)). Fig.1 and Fig 2. show potential
antigenic
compositions and lipooligosaccharide structures contemplated by the present
invention and
are discussed more fully herein.
The compositions of the present invention comprise immunogenic, and more
preferably vaccinal (Le., as a prophylactic or therapeutic vaccine), LOS
molecules
comprising one or more a,13, or y chains, and a Lipid A moiety and optionally
one or more
additional constituents such, but not limited to, adjuvants, enteric coatings,
and/or antigens.
In certain embodiments, the compositions of the present invention comprise LOS
molecules
further comprising an a chain and a Lipid A moiety. In certain other
embodiments, the
compositions of the present invention comprise LOS molecules further
comprising a 13 chain.
In still further embodiments, the compositions of the present invention
comprise LOS
molecules further comprising a y chain. More typical embodiments, the
compositions
comprise one each of a, 13, and y chains, and a Lipid A moiety.
While the present invention is not limited to any particular mechanism(s) or
mode(s)
of action, it is contemplated that although the mAb 2C7 a chain epitope is
most strongly
conformed in the presence of the 13 chain extensions that are frequently made
by gonococcal
isolates from blood, that the a chain is found on virtually all first pass
gonococcal cultures,
even if it is rapidly lost on subculture. (See, Gibson BW, et al., "Structure
and heterogeneity
of the oligosaccharides from the lipooligosaccharides of a pyocin-resistant
Neisseria
gonorrhoeae," Proc. Natl. Acad. Sci. USA, 86(1):17-21 (1989); Yamasaki R,
etal., "The
structure of lipooligosaccharide produced by Neisseria gonorrhoeae, strain
15253 isolated
from a patient with disseminated infection: Evidence for a new glycosylation
pathway of the
gonococcal lipooligosaccharide" J. Biol. Chem., 269(48):30345-30351 (1994);
Yamasaki R,
et at, "Structural and immunochemical characterization of a Neisseria
gonorrhoeae epitope
defined by a monoclonal antibody 2C7; the antibody recognizes a conserved
epitope on
specific lipooligosaccharides in spite of the presence of human carbohydrate
epitopes," J.
Biol. Chem., 274(51):36550-36558 (1999); and Chakraborti 5, et al., "Phase-
variable
heptose I glycan extensions modulate efficacy of 2C7 vaccine antibody directed
against
Neisseria gonorrhoeae lipooligosaccharide" J. Immunol., 196:4576-4586 (2016)).
Additionally, those skilled in the art will understand there are a variety of
methods,
protocols, and techniques (e.g., chemical, enzymatic, NMR, and the like) used
separately or
in combination to characterize the LOS molecules and thus determine a,13, and
y chain
structure. (See e.g., Yamasaki R, et at, "Structural determination of
oligosaccharides
derived from lipooligosaccharide of Neisseria gonorrhoeae F62 by chemical,
enzymatic, and
two-dimensional NMR methods," Biochemistry, 30(43)10566-10575 (1991)).
In preferred embodiments, the immunogenic, and more preferably vaccinal LOS
compositions of the present invention comprise GaINAc-nLc4 and nLc4 a chains.
13
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
Accordingly, some embodiments provide LOS molecules having GaINAc-nLc4 a
chains as
well as molecules having nLc4 a chains. Thus, the final compositions of the
invention, i.e.,
those formulated and intended for administration, are preferably formulated to
encompass
LOS molecules having: 1) GaINAc-nLc4 a chain(s); or 2) nLc4 a chain(s); or 3)
combination
products having a ratio of both GaINAc-nLc4 a chain(s) and nLc4 a chain(s).
Suitable ratios,
when a combined product is desired, comprise both GaINAc-nLc4 a chains and
nLc4 a
chains formulated, respectively, in ratios from: 0.0001:99.9999, 0.001:99.999,
0.01:99.99,
0.1:99.9,... 0.5:99.50,... 1:99,... 5:95,... 10:90,... 25:75,... 50:50, and
likewise from,
50:50,... 25:75,... 10:90,... 5:95,... 1:99,... 0.5:99.50,... 0.1:99.9,...
0.01:99.99,...
0.001:99.999,... 0.0001:99.9999, and any ratio(s) there between.
2. N. gonorrhoeae STRAIN F62
N. gonorrhoeae strain F62 uniquely makes LOS with both nLc4 and GaINAc-nLc4 a
chains. (Fig. 5). (See, Schneider H, et at, "Stability of expression of
Neisseria gonorrhoeae
lipooligosaccharides. Infect Immun., 54(3):924-927 (1986)). In further regard
to Fig. 5, silver
stained LOS from strain F62 is shown in an SDS-PAGE gel. F62 IgtC is 00F, but
its polyG
tract optimally splits the promoter, so that the downstream IgtD, which is IF,
is re-promoted
and strongly expressed. F62 makes two LOS molecules, one with nLc4 a chains
(faster
migrating) and one with GaINAc-nLc4 a chains (slower migrating). In preferred
embodiments, engineered LOS production systems (e.g., engineered bacteria) are
thus
modified to make the F62 LOS molecules with nLc4 and GaINAc-nLc4 a chains.
In preferred embodiments, the LOS production systems of the present invention
are
selected from harmless commensal Neisseria species (e.g., N. lactamica). In
some of these
embodiments, a suitable strain N. lactamica is engineered to stably express
immunogenic
(Le., vaccine!) LOS nLc4 and GaINAc-nLc4 a chain glycoforms as contemplated by
the
present invention; wherein the particular glycoforms are the same as, or
substantially similar
to, those in strain F62.
3. LOS PRODUCTION SYSTEMS
In certain preferred embodiments, the compositions of the present invention
are
produced in prokaryotic host cells, and more particularly, in bacterial host
cells. However,
certain compositions of the present invention may be produced in eukaryotic
cells (e.g.,
fungi, yeast etc.) instead of, or in addition to, being produced in
prokaryotic cells. In some
embodiments, a bacteria host is selected from one or more bacterial species of
known
commensal species of Neisseria. There are 10 identified species of Neisseria,
wherein eight
of these are classified as human commensal organisms that are generally
nonpathogenic in
healthy non-immunocompromised individuals.
14
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
While production of the compositions of the present invention is possible
directly in N.
gonorrhoeae, in preferred embodiments, other cells are utilized as LOS
production systems
mainly because N. gonorrhoeae is a BSL2 bacterium and it grows poorly in
liquid media.
Accordingly, in certain embodiments, the bacterial LOS production system is
selected
from a species of commensal Neisseria, including, but not limited to: N.
cinema, N. elongata,
N. flavescens, N. lactamica, N. mucosa, N. polysaccharea, N. sicca, and N.
sub/lava, with N.
perflava and N. f/ava considered biovars of N. sub/lava. In still further
embodiments, the
bacterial host of choice (S., the LOS production system) is selected from
Neisseria
commensals consisting of: N. lactamica, N. cinema, N. flavescens, N. sub/lava,
or N.
perflava. In particularly preferred embodiments, the bacterial host comprises
N. lactamica. N.
lactamica, like N. gonorrhoeae, is a Gram-negative diplococcic bacteria. N.
lactamica
however is a strictly commensal species that colonizes the human nasopharynx.
It is
especially common in young children and forms part of normal healthy placental
microbiome.
Colonization with N. lactamica very rarely leads to invasive disease, and then
only in
severely immunocompromised individuals. Genetically engineering a strain of
Neisseria
commensal to express the relevant LOS antigens of the present invention (e.g.,
N.
gonorrhoeae F62 LOS) provides a solution to the difficulty of growing large
volumes of
gonococci necessary for commercial scale vaccine production.
Production in N. lactamica is contemplated to have several additional
advantages
over other potential LOS production systems. In addition to be being a
harmless commensal,
the endotoxin moiety of N. lactamica can be further attenuated by deleting the
tptA gene.
N. Iactamica can also be grown in liquid culture for large scale production
and most
strains of the bacteria make LOS with nLc4 a chains while lacking igtD. (See,
Kim JJ, et at,
"Neisseria lactamica and Neisseria meningitidis share lipooligosaccharide
epitopes but lack
common capsular and class 1, 2 and 3 protein epitopes," Infect. Immun.,
57(2):602-608
(1989); and Stein DC, et at, "Sequence-based predictions of
lipooligosaccharide diversity in
the Neisseriaceae and their implication in pathogenicity," PLoS One
6(4):e18923
(https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3078933/pdf/pone.0018923.pdf)).
Nevertheless, the regions flanking the genes needed for GaINAc-nLc4 a chain
synthesis in
N. lactamica are typically highly conserved.
Furthermore, N. lactamica is colistin-resistant, grows well on gonococcal
selective
medium, and is characterized by its ability to produce acid from glucose,
maltose, and
lactose as well as for its ability to produce beta-galactosidase. N. lactamica
is the only
species of Neisseria that produces beta-galactosidase and acid from lactose;
however, one
lactose-negative strain of N. lactamica is known to exist. While growth media
requirements
are generally similar for the various species of Neisseria (e.g., Mueller
Hinton medium,
Thayer-Marlin medium, American Type Culture Collection ("ATCC") Medium 814:GC
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
Agar/Broth Medium, or Columbia Blood Media 693), the respective species have
slightly
different nutritional profiles that can be used for differentiation and
identification. The
nutritional requirements for many of the Neisseria species, including, N.
gonorrhoeae, N.
meningitidis, and N. lactamica, have been previously described. (See, Thayer
JD and Martin
JE, "A selective medium for the cultivation of N. gonorrhoeae and N_
meningitidis," Public
Health Rep., 79(1):49-57 (1964); Thayer and Martin, "Improved medium selective
for
cultivation of N. gonorrhoeae and N. meningitidis," Public Health Rep.,
81(6):559-562
(1966); and B.W. Catlin, "Nutritional Profiles of Neisseria gonorrhoeae,
Neisseria
meningitidis, and Neisseria lactamica in Chemically Defined Media and the Use
of Growth
Requirements for Gonococcal Typing, J. Infect. Dis., 128(2):178-194 (1973)).
In certain preferred embodiments, a growth media is preferentially supplied as
a
liquid broth that is supplemented (e.g., with minerals, amino acids, peptones,
hemoglobin,
sugars, salts, and/or antibiotics, and the like) that is held under a CO2
enriched atmosphere
(e.g., 3-7% CO2) at or near 37 C to preferentially sustain the particular
species of bacteria
(e.g., N. lactamica).
A number of strains of N. lactamica have been, at least partially, sequenced
and/or
are available as live cultures, including, but not limited to: N. lactamica
ST640 (Wellcome
Trust Sanger Institute, Hinxton, UK,
ftp://ftp.sanger. ac_ukipub/pathogens/Neisseria/lactamical); N. lactamica Y92-
1009 (K. Anish,
et al., "Neisseria lactamica Y92-1009 complete genome sequence," Standards in
Genomic
Sci., 12(41):1-9 (2017)); and N. lactamica Hollis et al., Strains ATCC 23970,
23971, 23972 /
NCTC 10617, 10618, 10616 (American Type Culture Collection ("ATCC"), Manassas,
VA
and National Collection of Type Cultures ("NCTC"), Public Health England,
Salisbury, UK).
When commensal bacterial species are used for producing the modified LOS
compositions of the present invention, preferably, the cells are from a
suitable strain of the
species N. (actamica, and more preferably, the strain has been engineered
and/or selected
to exhibit: 1) low lipid phosphate substitutions; 2)10w inflammatory profile;
3) good growth in
liquid media; and 4) sufficient genetic mutability to be engineered to express
high levels of
immunogenic gonococcal lipooligosaccharides (e.g., N. gonorrhoeae strain F62
GaINAc-
nLc4 and nLc4 a chains).
In preferred methods when a species of commensal Neisseria (e.g., N.
lactamica, N.
cinerea, or N. flavescens) is selected for production of the LOS compositions
of the present
invention, the strain has been engineered to contain a deletion of a portion,
or substantially a
deletion of all, of IptA gene and/or corresponding operon. In these
embodiments, the LOS
production system cells comprise AlptA strains of a Neisseria commensal, and
more
preferably, comprise a AlptA strain of N. lactamica, N. cinerea, or N.
flavescens. In general,
factors that contribute to the cells of LOS production systems being deemed to
have suitably
16
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
low lipid phosphate substitutions and/or low inflammatory profiles include,
but are not limited
to, a lack of (or intended reduction therein) of pyrophosphorylation and/or
phosphoethanolanninylation of the lipid A moiety of LOS, in pertinent part,
leading to
observation of a functional change(s) in signal transduction through TLR4
and/or the
expression of inflammatory cytokines, and/or induction of TN F-a in human THP-
1 cells. (See
e.g., John CM, et at, "Lack of Lipid A Pyrophosphorylation and Functional LOA
Reduces
Inflammation by Neisseria Commensals," Infect. Innmun., 80(11):4014-4026
(2012)). In
certain embodiments, lipid phosphates preferably are from 1-3 phosphates, and
more
preferably two phosphates.
Methods for selecting and/or quantifying the inflammatory profile of
expression
products from Neisseria species (e.g., N. lactamica) are known in the art For
example, 400-
1000 pg/mL of TNF-a released from 104 of the human monocytic leukemia cell
line, THP-1,
after incubation for 18 h with 100 ng/mL of LOS. (See e.g., Fowler MI, et at,
"Comparison of
the Inflammatory Responses of Human Meningeal Cells following Challenge with
Neisseria
lactamica and with Neisseria meningitidis," Infect. Immun., 74(11):6467-6478
(2006); John
CM, et al., "Lack of Lipid A Pyrophosphorylation and Functional LptA Reduces
Inflammation
by Neisseria Commensals," Infect. lmmun., 80(11):4014-4026 (2012); and John
CM, et at,
"Natural phosphoryl and acyl variants of lipid A from Neisseria nneningitidis
strain 891
differentially induce tumor necrosis factor-a in human monocytes", J. Biol.
Chem.,
280:21515-21525 (2009)).
The present invention further contemplates that LOS productions systems (e.g.,
bacterial host cells) are selected, or subsequently modified, to exhibit good
growth
characteristics in liquid growth media, for example, from 30-60 min.
generation times, and
preferably about a 45 min. generation time.
4. ENGINEERED NEISSERIA COMMENSALS AND TRANSFORMATION OF
PRODUCTION STRAINS
The present invention provides one or more stably transformed commensal
Neisseria
species. In preferred embodiments, the commensal strain comprises N.
lactamica, and
further comprise a functional igtA-E operon integrated into the strain for the
reliable, safe,
and efficient production of LOS antigens of interest. More particularly, the
invention provides
stably transformed Neisseria commensal species used to make LOS molecules
comprising
F62 nLc4 and GaINAC-nLc4 a chains.
Transforming (i.e., genetically engineering) a commensal Neisseria species is
preferentially done using one or more of the various primers and methods
described in: 1)
Cheng H, et at, 1-luman lipooligosaccharide IgG that prevents endemic
meningococcal
disease recognizes and internal lacto-N-neotetraose structure," J. Biol.
Chem., 286:43622-
17
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
43633 (2011); 2) Braun and Stein DC "The IgtABCDE gene cluster, involved in
lipooligosaccharide biosynthesis in Neisseria gonorrhoeae, contains multiple
promoter
sequences," J. Bacteriol., 186:1038-1049 (2004); 3) Song W, et al., "Role of
lipooligosaccharide in opa-independent invasion of Neisseria gonorrhoeae into
human
epithelial cells," J. Exp. Med., 191(6):949-59 (2000); 4) Burch CL, et at,
"Antigenic variation
in Neisseria gonorrhoeae: production of multiple lipooligosaccharides," J.
Bacteriol.,
179(3):982-986 (1997); 5) Danaher RJ, et at, "Genetic basis of Neisseria
gonorrhoeae
lipooligosaccharide antigenic variation," J. Bacteriol., 177(24):7275-7279
(1995); 6)
Gotschlich EC, "Genetic locus for the biosynthesis of the variable portion of
Neisseria
gonorrhoeae lipooligosaccharide." J. Exp. Med., 180(6):2181-2190 (1994);
and/or 7)
Schneider HA, et at, Heterogeneity of molecular size and antigenic expression
within
lipooligosaccharides of individual strains of Neisseria gonorrhoeae and
Neisseria
meningitidis," Infect. Immun., 45(3):544549 (1984), and the sequences
described therein,
and more particularly, the exemplary sequences provided in Table 1.
Table
Exemplary Primer Sequences
PRIMER SEQUENCE
SEQ ID SOURCE
NOs.
CB-5 GCCGGCATCGAGGACGTGGAACCTGA SEQ ID
Gotschlich EC, et
NO.1
at, 1994, supra
JL-12 AGCGGCCCATCCCGATACGGA
SEQ ID NO. Schneider HA, et
2
at,
1984, supra
J1-50 GGCCGACATCGCGCTTTTGGGCG
SEQ ID NO. Danaher RJ, etal.,
3
1995, supra
JL-51 GGGGCGATTTTACCTAGCAGATGAA
SEQ ID NO. Danaher RJ, et at,
4
1995, supra
One contemplated aspect of these engineering methods involves the
amplification of the Igt
gene cluster from a N. gonorrhoeae strain (e.g., F62) and modification of the
lgtA, IgtC and
IgtD coding sequences. A further contemplated aspect of these engineering
methods
involves providing fixed polyguanine tracts that resist slip, produced by
replacing every third
guanine nucleotide with an alternative nucleotide thus preferentially,
avoiding, or minimizing,
subsequent changes to the translated protein products so that IgtA, IgtC and
lgtD are phase
invariant (e.g., GGGGGGGGG becomes GGCGGAGGT). A still further aspect of these
18
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
engineering methods, is the internal promoter found in IgtC is modified to
promote (e.g.,
strongly promote) IgtD expression.
In preferred embodiments, the final annplicon is introduced into the commensal
Neisseria specie(s) (e.g., N. lactamica) using the spot transformation method
described by
JS Gun and DC Stein. (Gunn JS and Stein DC, "Use of a non-selectable
transformation
technique to construct a multiple restriction modification deficient mutant of
Neisseria
gonorrhoeae," Mol. Gen. Genet., 251(5):509-517 (1996)). The Gunn and Stein
method
permits introduction of DNA sequence alterations into the neisserial
chromosome without
having to use antibiotic selection. Using this method, LOS production strains
with defined
chromosomal changes can be constructed without regard to potential polarity
effects caused
by the insertion of antibiotic resistance cassettes, the availability of
antibiotic resistance
cassettes, and/or the common problems associated with using antibiotic
resistant organisms
for production.
DNA sequencing methods are used to validate intended modifications to the
production strains. Likewise, SDS-PAGE/Western blot analysis with mAb 1-1M is
used to
validate the stable expression of GaINAc-nLc4 a chains as per the methods
described in
Song et at (Song W, et at, supra).
The reactogenicity of neisserial LOS is mediated in part by the addition of
PEA to the
lipoidal moiety and is catalyzed by LptA. (Zariri A, et at, "Modulating
endotoxin activity by
combinatorial bioengineering of meningococcal lipopolysaccharide," Sci. Rep.,
6:36575
(2016)). Alone among commensal Neisseria species, strains of N. lactamica have
a
functional IptA and their Lipid A is phosphoethanolaminylatecl. (John CM, et
aL, "Lack of lipid
A pyrophosphorylation and of a functional IptA reduce inflammation by
Neisseria
commensals," Infect. lmmun., 80(11):4014-4026 (2012)). In preferred
embodiments, the
LOS lipid A of pathogenic Neisseria is substituted with 2-3 P and 1-2 PEA;
where
phosphorylation correlates with the inflammatory potential of both LOS and
bacteria. Lipid A
of some N. lactamica strains is highly phosphorylatecl and moderately
inflammatory.
Accordingly, the present invention contemplates using high mass resolution
mass
spectrometry to discriminate phosphoforms of lipid A from the spectra of
various N.
lactamica strains as part of LOS production system selection. (See, John CM.,
et at, "Lack
of Lipid A Pyrophosphorylation and Functional LptA Reduces Inflammation by
Neisseria
Commensals," Infect. Immun., 80(11):40144026 (2012)).
It is further contemplated that known DNA sequencing methods (e.g., PCR) be
used
to determine the IptA status of the candidate Neisseria commensal (e.g., N.
lactamica) as
part of the LOS production system strain selection. (See e.g., Zarin A, et at,
supra and John
CM, et at, supra). Should a candidate LOS production strain contain IptA, the
spot
transformation method mentioned above is used to delete the gene.
19
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
5. LOS BIOSYNTHESIS
While the present invention is not limited to any particular mechanism(s) or
mode(s)
of action, it is contemplated that LOS biosynthesis is regulated primarily by
the IgtA-E operon
that consists of five genes promoted by upstream and internal promoters. (See,
Fig. 3). The
size of the operon depicted in Fig. 3 is about 5.8 kb. IgtE and IgtB encode
galactosyl
transferases that complete the nLc4 basal lactose and terminal LacNAc,
respectively, they
are invariant. The other three genes, IgtA, IgtC and IgtD, each have a
homopolymeric
guanine (polyG) tract that causes slip-strand mispairing during DNA
replication. As a result,
these genes slip in and out of frame and the enzymes they encode (glycosyl
transferases)
may or may not be functional. These slip-strand nnispairings result in the
production of a
different LOS chemotypes. The positioning of the polyG tract between two
halves of a
Pribnow box of an internal promoter found in IgtC can also effect LOS
biosynthesis. (See,
Braun DC and Stein DC, "The IgtABCDE gene duster, involved in
lipooligosaccharide
biosynthesis in Neisseria gonorrhoeae, contains multiple promoter sequences,"
J. Bacteriol.,
186(4):1038-1049 (2004)). This results in an increase in downstream promotion
when the
number of guanines is optimal for a strong promoter. This provides the
bacteria with
considerable biosynthetic flexibility and the ability to make multiple LOS
structures with use
of only five genes_ And it enables the gonococcus to undergo microevolution in
a particular
biological niche, such as the female genitourinary tract and the male urethra.
The skilled
artisan will consider these features, and others, to beneficially engineer an
optimal LOS
production system.
Fig. 4, as compared to Fig. 3, provides a more detailed representation of an
exemplary organization of the Neisseria Igt operon described in Braun DC and
Stein DC.
More particularly, the diagram in Fig. 4 was derived from the DNA sequence of
the Igt gene
duster originally published by Gotschlich under NCB! accession number U14554.
The
sequence numbers given in Fig. 4 correspond to those described in that
accession. The
features identified in Fig. 4 are indicated as follows: al, glyS stop codon;
a2, IgtC stop
codon; b, BsrGI restriction site; c, potential stem-loop structure than could
function as a
transcriptional terminator d, putative ribosome-binding site; el, putative
IgtA start codon;
and e2, putative Igtel start codon. (See, Gotschlich EC, "Genetic locus for
the biosynthesis of
the variable portion of Neisseria gonorrhoeae lipooligosaccharide." J. Exp.
Med.,
180(6):2181-2190 (1994)).
6. LOS PURIFICATION
In one embodiment, the immunogenic compositions (i.e., F62 LOS comprising
GaINAc-nLc4 and nLc4 a chains) are extracted and purified from the production
system
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
using a modification (See, Apicella MA, Griffiss JMcL and Schneider H,
"Isolation and
characterization of Iipopolysaccharides, lipooligosaccharides, and lipid A,"
Methods
Enzyrnol. 235:242-252 (1994)) of the hot aqueous phenol method described by
Westphal
and Jann. (Bacterial lipopolysaccharides. Extraction with phenol-water and
further
application of the procedure. p. 83-91. In R. L Whistler (ed.), Methods in
carbohydrate
chemistry, Vol. 5, Academic Press Inc., New York, NY (1965)). Purified LOS is
characterized
by gel-electrophoresis, Western blot with monoclonal antibodies and mass
spectroscopy.
(Schneider, et al 1991, supra, Apicella, et at , supra, and John CM, et at,
supra).
7. GENDER-SPECIFIC LOS IgG INDUCTION DURING N. GONORRHOEAE
INFECTION
While the present invention is not limited to any particular mechanism(s) or
mode(s)
of action, it is contemplated that protective LOS immune responses vary
between males and
females (i.e., gender-specific protective LOS IgG induction during gonococcal
infection). In
preferred embodiments, the present invention provides vaccine compositions
that are
substantially as effective for preventing (or treating) gonococcal infections
and/or gonorrhea
in both men and women. In other embodiments, a vaccine product is provided
that is tailored
to the immunological responses and gonorrhea disease pathogenesis in either a
male or a
female.
In an unpublished study, Schneider found that 10/12 (83%) of primary
gonococcal
isolates from women made LOS with GaINAc-nLc4 a chains as compared with 19/37
(51%)
isolates from men seen at the same clinic, but who were not known consorts.
Expression of
LOS with GaINAc-nLc4 a chains by isolates from these women were lost on sub-
culture.
(See, Schmidt KA, et at, "Experimental gonococcal urethritis and reinfection
with
homologous gonococci in male volunteers," Sex Transm. Dis., 28(10):555-564
(2001); and
Schneider H, et at, "Expression of paragloboside-like lipooligosaccharides may
be a
necessary component of gonococcal pathogenesis in men," J. Exp. Med., 174:1601-
1605
(1991)). In contrast, it has been further determined that GaINAc-nLc4 a chains
are seldom
made by gonococci within polynuclear white cells in the discharge of men with
gonorrhea.
(See, McLaughlin SE, et aL, "Urethral exudates of men with Neissetia
gonorrhoeae
infections select a restricted lipooligosaccharide phenotype during
transmission," J. Infect.
Dis., 206(8):1227-32 (2012)). IgtA, IgtC and IgtD were amplified from
gonococci scraped
from diagnostic slides of urethral exudates and their polyguanine tracts
sequenced. LgtA,
which encodes the glucosaminyl transferase that initiates the nLc4 LacNAc is
in-frame (IF) in
bacteria from the male urethra while IgtC is out of frame (00F). The frame of
IgtD, the
galactosaminyl transferase that adds GaINAc to nLc4, varied widely: it was OOF
in most, but
not all cases. This genotype would result in the predominant synthesis of nLc4
a chains;
21
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
however, an active 100 in a few bacteria would enable replication within
female cervical
epithelial cells of bacteria with GaINAc-nLc4 a chains.
The present invention thus contemplates providing effective gonococcal LOS
vaccines that induce IgG that binds the nLc4 a chains made by gonococci in the
male
urethra (La, urethral discharge) to protect women, and also binds the GaINAc-
nLc4 a chains
made by gonococci shed from the female cervix to protect men. In preferred
embodiments,
the immunogenic, and more preferably vaccinal, compositions of the present
invention
comprise both GaINAc-nLc4 and nLc4 a chains. Accordingly, certain embodiments
provide
LOS molecules comprising GaINAc-nLc4 a chains as well as nLc4 a chains.
In one preferred embodiment, the present invention provides methods that use
multiplexed indirect innnnunofluorescent assays based on the LUMINEX
(ThernnoFisher
Scientific, Waltham, MA) platform for LOS IgG profiling. (See, Pickering JW,
et at, "A
multiplexed fluorescent microsphere immunoassay for antibodies to pneumococcal
capsular
polysaccharides," Am. J. Clin. Pathol., 117:589-596 (2002)). This particular
assay uses LOS
from pyocin-selected mutants of gonococcal strain 1291, denominated 1291a-e
(Fig. 6), to
charge immunofluorescent microspheres that bind antibodies specific for four
of the five LOS
a chain antigens, nLc4, nLc3, Lc2 and 13-G1c. (Cheng H, etal., 2011, supra).
See also,
Braun DC and Stein DC, 2004, supra; and McLaughlin SE, 2012, supra). Anti-
human IgG is
used as the detection antibody, in preferred embodiments. Figure 6 shows a SDS-
PAGE of
LOS made by the 1291 mutants, wherein the columns read left to right represent
mutants:
1291, 1291a, 1291b, 1291c, 1291d, and 1291e, respectively.
The 1291 mutants make LOS with a single glycose deletion in the a chain. (See,
Fig.
6). In contrast, 1291wt makes nLc4 a chains, but not GaINAc-nLc4 a chains;
1291a makes
nLc3 a chains (nLc3 is lacto-N-neotriaose, without the nLc4 terminal Gal);
1291b makes Gb3
a chains (not made by gonococci within urethral discharge PMNs) (McLaughlin
SE, 2012,
supra); 1291c makes Lc2 a chains (lactose, Fig. 2); and, 1291e makes13-Glc a
chains and
LOS without an a chain (Cheng H, et at, 2011, supra). Cheng H, et aL, provide
a detailed
discussion of the 1291 mutants. The assay was further validated by quantifying
LOS IgG
specific for nLc4, nLc3 and Lc2 a chains in the sera of Baltimore City Health
Department
clients who reported as contacts of persons with gonococcal infections. (See,
McLaughlin
SE, et at, "Risk of gonococcal infection during vaginal exposure is associated
with high
vaginal pH and active menstruation," Sex. Transm. Dis., 46:86-90 (2019)).
In preferred embodiments, the invention contemplates IgG that binds 291wt LOS
represents the total IgG that binds any of the 1291wt antigens. In order to
quantify IgG
specific for the nLc4 terminal Gal residue, IgG binding to 1291a (nLc3) LOS
was subtracted
from 1291wt LOS IgG. And to quantify IgG specific for the nLc3 internal GIcNAc
residue, IgG
binding to 1291c (Lc2) LOS was subtracted from 1291a LOS IgG. The results are
shown in
22
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
Table 2 and are presented in pg/mL. Table 2 shows the accuracy of the assays
used in this
aspect of the invention.
Table 2
Comparison of LOS IgG in sera of infected contacts seen >7 days
after exposure with those in sera of contacts seen within 7 days
Infected Contacts
Infected Contacts
IgG LOS
seen >7 days after seen within 7 days p
exposure (N=8)
of exposure (N=16)
nLc4 1291wt 28.62
21.37 0.07
nLc4-nLc3 1291wt- 8.13 6.15 0.04
1291a
nLc3-Lc2 1291a- 5.48 3.92 0.10
1291c
Lc2 1291c 14.93
11.30 0.09
Concentrations of IgG, in pg/mL, specific for the nLc4 terminal Gal (nLc4-
nLc3), the internal
GIcNAc of the nLc4 LacNAc (nLc3-Lc2) and the antigens of the lactose a chain
and basal
PEA-diheptoside glycolipid and y chain GIcNAc (Braun DC and Stein DC, 2004,
supra; and
Schneider H, 1991, supra) sum to the concentrations bound by the native 1291wt
LOS
(nLc4) - .28.54 v. 28.62 and 21.37 v. 21.37.
Table 2 also shows the induction of LOS IgG antibodies during acute gonococcal
infection. Concentrations of the four specificities in the sera of infected
contacts who were
seen within seven days of exposure, before an immune response would have
produced new
antibodies, were less than those in the sera of infected contacts seen after
seven days.
While the present invention is not limited to any particular theories related
to infection or
epidemiology, it is contemplated that these data support to the hypothesis
that early
treatment contributes to recidivism by preventing induction of protective
antibodies.
Still further embodiments of the present invention include IgG specific for
the
GaINAc-nLc4 and mAb 2C7 antigens by conjugating 1291e, F62 and 15253 LOS to
the
microspheres, and incorporating them in the assay. (See, Yamasaki R, et at,
1991, supra,
and Yamasaki R, et at, 1994, supra). N. gonorrhoeae strain F62 makes LOS
molecules with
nLc4 and GaINAc-nLc4 a chains in nearly equal abundance; 15253 makes LOS with
truncated and parallel 13-lactose a chains and a-lactosel3 chains; it strongly
binds mAb 2C7.
In order to quantify GaINAc-nLc4 a chain Ige, the concentrations of IgG bound
by 1291wt
LOS (nLc4) are subtracted from those bound to F62 LOS, as described above.
In still other embodiments of the methods of the present invention, mAb 2C7-
like IgG
are quantified in two ways: 1) by subtracting concentrations that bind 1291e
LOS (13-Gic a
23
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
chain and basal antigens) from those that bind 1291c LOS (Lc2); and 2) by
subtracting
concentrations that bind 1291e LOS from those that bind 15253 LOS. Since the a
and 13
chains of 15253 LOS are truncated at lactose (Fig. 2), they will not bind the
distal nLc3, nLc4
and GaINAc-nLc4 a chains.
8. ADJUVANTA11ON
In preferred embodiments, the immunogenic and/or vaccinal compositions of the
present invention optionally further comprise one or more adjuvants or
adjuvant systems as
a means of enhancing the immune response or immunomodulatory effects of the
administered compositions in the intended subject. The compositions of the
present
invention can be associated (e.g., chemically linked) to the adjuvant(s) by a
coordinate,
covalent, hydrophilic, or hydrophobic bonds. The association can optionally
proceed through
an activated moiety or chemical group on the adjuvant or the immunogenic
composition and,
at least in part, through a fluoride, phosphate, sulfate, carbonate group, or
like chemically
reactive group or moiety, or through one or more linker molecules. In some of
these
embodiments, the compositions of the present invention are absorbed to the
chosen
adjuvant(s); while in other embodiments, the compositions are adsorbed to the
adjuvant(s).
The present invention is not intended to be limited however by the method of
association
between the compositions and the chosen adjuvant(s) and/or adjuvant system(s).
Examples of suitable adjuvants include, but are not limited to, aluminum
salts, 3D-
MPL, oil in water emulsions including, but not limited, to AS03, AF03, AF04,
MF-59, and
0S21. Suitable oil in water emulsions can be comprised a-tocopherol, squalene,
and
polysorbates, TVVEEN (ag., 20, 80, etc., Sigma Aldrich, St. Louis, MO), SPAN
(e.g., 20,
601 80, 85, etc., Sigma-Aldrich), and the like.
In particularly preferred embodiments, the adjuvant comprises one or more
metallic
adjuvants such as an aluminum adjuvant comprising aluminum hydroxide, aluminum
oxy
hydroxide, aluminum hydroxyphosphate, aluminum hydroxyphosphate sulfate,
aluminum
phosphate, or alum (potassium aluminum phosphate) or combinations thereof. In
addition to
aluminum, other metallic salts have been used to adsorb antigens, including
salts of zinc,
calcium, cerium, chromium, iron, and beryllium. And these metal salts find use
in some
embodiments. The hydroxide and phosphate salts of aluminum are the most common
adjuvants and as such have been widely studied and generally approved for use
by
regulatory agencies worldwide.
The use of aluminum oxyhydroxide adjuvant is especially preferred in the
compositions of the present invention, but it is not required. The skilled
artisan will select a
suitable adjuvant/adjuvant system based on consideration of various factors
including, but
not limited to, the desired immune response in the recipient, potential
antigen/adjuvant
24
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
interactions, and potential issues related to immunogenicity (e.g., potency,
Th1/2 bias), ease
of formulation (e.g., adsorption state, charge), purification, final product
distribution and
storage, regulatory acceptability, and the like.
In some embodiments comprising oil in water emulsions (e.g., squalene), the
final
product might lack the desired stability due to the emulsion's hydrophobic
nature.
Accordingly, in certain of these embodiments, one or more nonionic surfactant
emulsifiers,
such as TWEENO 80 and/or SPAN 85, are used to prepare stable emulsions;
wherein, the
two phases are prepared separately then mixed to make the emulsion. Desired
homogeneity
in these products (e.g., sub-micron particle sizes) for example, <0.2 microns,
preferably, 40-
80 nm (0.04-0.08 microns, is obtained by using standard methods, including,
rnicrofluidization, sheer force, and/or temperature induced phase
inversion(s). These
methods yield products that can be sterilized by terminal filtration and
stored ready for
administration with, or without refrigeration. In certain embodiments,
products comprising
squalene adjuvants are stored cold (or refrigerated) to retard oxidation of
the squalene. The
stability of products comprising emulsions can be monitored by standard
methods, such as,
Light Scatter (DLS), gel-electrophoresis, and/or ELISA.
9. POTENCY AND IMMUNOGENICITY
In some embodiments, the potency of adsorbed and non-adsorbed LOS can be
compared by producing a series of charged aluminum surfaces ranging from
positively
charged aluminum hydroxide adjuvant to negatively charged aluminum phosphate.
Aluminum hydroxide adjuvant can be treated with increasing amounts of
phosphate ion to
decrease the surface charge of the adjuvant Phosphate in solution can exchange
with
surface hydroxyls of aluminum hydroxide adjuvant due to higher affinity for
aluminum
causing the change in surface charge. (See e.g., lyer S. at at, "Effect of the
degree of
phosphate substitution in aluminum hydroxide adjuvant on the adsorption of
phosphorylated
proteins," Pharm. Dev. Technol., 8(1):81-86 (2003); and Hansen B,
"Relationship between
the strength of antigen adsorption to an aluminum-containing adjuvant and the
immune
response," Vaccine, 25(36):6618-6624 (2007)). In a preferred embodiment,
various
formulations are prepared with each of these adjuvant surfaces and the
adsorption stability
is monitored over time under accelerated conditions (e.g., elevated
temperature) using
standard methods, including, but not limited to, DLS, gel-electrophoresis,
and/or ELISA.
10. PRODUCT FILTRATION
Product formulations (e.g., immunogenic compositions and vaccines) comprising
aluminum containing adjuvants typically cannot be sterilized using standard
methods due to
the particle size of the adjuvant being greater than 0.2 pm. Materials used to
prepare
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
vaccines with aluminum containing adjuvants are thus preferentially sterilized
prior to
adjuvantation and subsequently handled aseptically during final formulation
and filling
processes.
Because components of product formulations can interact with the filter
membrane
materials during processing, it should be determined if any of these
interactions will
detrimentally effect to the final product (e.g., vaccine). Thus, preferred
methods used during
production consider and monitor a number of product parameters including, but
not limited
to, quantifying the amount of antigen (e.g., GaINAc-nLc4 and nLc4 a chains)
lost during
filtration, determining the amount of product effectively filtered before
changing filters, and
the ability of filters to retain biological contaminants (e.g., microbial
organisms) and other
undesirable compounds during filtration. Similarly, ideal formulations are
optimized for their
stability and efficacy based upon consideration of pH and any buffers or
excipients used
therein. In one preferred embodiment LOS antigens are dissolved in 20 mM
succinate, 130
mM NaCI, and adjusted to a of about pH 6.5 and further prepared according to
the methods
described herein and known in the art.
In certain formulations, isolated gonococcal LOS is provided in an aggregated
state
when reconstituted (e.g., as micelles). Micelle formations can be reduced by
adding about
0.02% of a polysorbate-type nonionic surfactant (e.g., polysorbate 20).
MiceIlar formulated
LOS molecules are then formulated (e.g., conjugated, aggregated, and the like)
with one or
more suitable protein carriers to achieve the desired level of immunogenicity.
11. pH STABILIZATION
In preferred embodiments, the bulk product is purified in buffered saline at
from about
pH 5 to about pH 9. The pH stability of the bulk product is determined using
common
methods such as DLS, gel-electrophoresis, ELISA, and endotoxin activity
assays.
Preferably, the final product (e.g., immunogenic composition and/or vaccine)
is isotonic with
body fluid. Accordingly, the pH of the bulk/final product is adjusted with one
or more agents
generally regarded as safe (Le., GRAS) such as salts and sugars or sugar
alcohols (e.g.,
sodium chloride, sucrose, sorbitol, mannitol, and the like) or surfactants
(e.g., polysorbate
80, TRITON IN x-100 (Sigma-Aldrich), or deoxycholic add ("DOC") and the like)
and amino
acids. In preferred embodiments, the potential impact of buffering
agents/osmolytes on the
physical stability and/or immunogenicity of the bulk product is determined
experimentally
before filling.
DOC can be included in the bulk/final product formulation to beneficially
reduce the
reactogenicity of the endotoxin portion of the LOS molecule. Consequently, in
certain
embodiments, the buffing agent comprises DOC.
26
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
Amino acids are also suitable for use as stabilizers in certain formulations.
In
particular, lysine, histidine, glycine, arginine, praline, aspartic acid as
well as poly-lysine, and
combinations thereof, are further contemplated for use in certain embodiments.
Poly-lysine
can also bind the endotoxin portion of the LOS molecule and can reduce or
minimize
potential reactogenicity.
During production, the final/bulk product formulations are stored under
various
temperature conditions (e.g., 25 , 37 , to 45 C) and subsequently monitored
over time using
common methods such as DLS, gel-electrophoresis, ELISA, and endotoxin
activity. It is
contemplated that high temperature storage accelerates antigen degradation
thus aiding
proper stabilizer selection. Similarly, DLS analysis is used to detect antigen
aggregation,
while gel electrophoresis and ELISA are used to monitor antigen stability.
12. IMMUNOGENICITY ASSAYS
In preferred embodiments, the potency of final or candidate products is
generally
determined using one or more in vivo and/or in vitro methods. In one of these
embodiments,
the present invention contemplates in vivo testing in mice wherein test
animals are
administered either an adsorbed or non-adsorbed formulation at one or more
relevant times
(e.g., days 0 and 14). Sera is collected from the animals (e.g., day 28) and
the resulting
immune responses evaluated using standard ELISA techniques.
In a more particular aspect of the invention, mice receive high, medium, or
low doses
of final products or candidate formulations comprising either an aluminum or
oil in water
emulsion adjuvant, wherein a prime dose of the composition is delivered on day
0, and a
booster dose on day 14. Sera is collected on day 28 and analyzed for antibody
response
and any Th1/Th2 bias according to standard protocols. It is contemplated that
aluminum
adjuvanted product will produce a Th2 biased response while emulsion
adjuvanted systems
will produce a more Th1 biased response.
In yet other aspects of the invention, the immune response to final products
or
candidate formulations produced in N. lactamica is compared to LOS antigens
produced in
N. gonorrhoeae strain F62. For example, in one embodiments C57BU6 mice are
administered a vaccine formulated with LOS produced from either N. lactamica
or N.
gonorrhoeae on days 0 and 14. Sera is collected on day 28 and the resulting
immune
responses are evaluated by ELISA and confirmed by multiplex assays.
13. EXEMPLARY PHARMACEUTICAL FORMULATIONS, ADDMONAL
CONSTITUENTS, and ADMINISTRATION AND DOSING CONSIDERATIONS
The practice of the present invention will employ, unless otherwise indicated,
conventional techniques of preparing pharmaceutical and/or vaccinal
formulations as well as
27
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
drug delivery and dosing techniques which are well known in the art. Generally
speaking, the
compositions of the present invention may be prepared by means standard in the
art. A
number of standard text are known in the art regarding preparation and
formulation
considerations. (See e.g., Remington's Pharmaceutical Sciences).
In preferred embodiments, the compositions (e.g., immunogenic compositions and
vaccines) of the present disclosure are sterile and, optionally, preservative-
free (e.g.,
mercurial and/or organornercurial compounds such as thimerosal). In other
embodiments the
compositions are sterile, optionally preservative-free, and formulated in a
single-use or unit-
dose formats. In still further embodiments the sterile formulations contain
one or more
preservatives, stabilizers, sugars, or sugar alcohols.
The methods and compositions of the present invention provide immunogenic
compositions and vaccines for use in a subject (e.g., a human) in order to
confer a medicinal
or therapeutic benefit (e.g., treating or preventing infection with N.
gonorrhoeee and/or
gonorrhea disease) in the subject upon administration of an effective dose of
the one or
more of compositions described herein. Methods of administering the compounds
of the
invention may be by metered dose by one or more injection devices. The
compositions may
be filled in unit dosage forms suitable for single administration of a precise
dosage.
In some embodiments, the concentration of one or more of the component
antigens,
or other constituents, provided in the pharmaceutical compositions of the
present invention is
less than 100%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 19%, 18%, 17%, 16%,
15%,
14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.4%, 0.3%,
0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%,
0.009%,
0.008%, 0.007%, 0.006%, 0.005%, 0.004%, 0.003%, 0.002%, 0.001%, 0.0009%,
0.0008%,
0.0007%, 0.0006%, 0.0005%, 0.0004%, 0.0003%, 0.0002%, or 0.0001% w/w, w/v or
v/v.
In yet some other embodiments, the concentration of one or more of the
component
antigens, or other constituents, of the present invention is greater than 90%,
80%, 70%,
60%, 50%, 40%, 30%, 20%, 19.75%, 19.50%, 19.25% 19%, 18.75%, 18.50%, 18.25%
18%,
17.75%, 17.50%, 17.25% 17%, 16.75%, 16.50%, 16.25% 16%, 15.75%, 15.50%, 15.25%
15%, 14.75%, 14.50%, 14.25% 14%, 1a75%, 13.50%, 13.25% 13%, 12.75%, 12.50%,
12.25% 12%, 11.75%, 11.50%, 11.25% 11%, 10_75%, 10.50%, 10.25% 10%, 9.75%,
9.50%,
9.25% 9%, 8.75%, 8.50%, 8.25% 8%, 7.75%, 7.50%, 7.25% 7%, 6.75%, 6.50%, 6.25%
6%,
5.75%, 5.50%, 5.25% 5%, 4.75%, 4.50%, 4.25%, 4%, 3.75%, 3.50%, 3.25%, 3%,
2.75%,
2.50%, 2.25%, 2%, 1.75%, 1.50%, 125%, 1%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%,
0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.009%, 0.008%,
0.007%,
0.006%, 0.005%, 0.004%, 0.003%, 0.002%, 0.001%, 0.0009%, 0.0008%, 0.0007%,
0.0006%, 0.0005%, 0.0004%, 0.0003%, 0.0002%, or 0.0001% w/w, w/v, or v/v.
28
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
In still some other embodiments, the concentration of one or more of the
component
antigens, or other constituents, of the present invention is in the range from
approximately
0.0001% to approximately 50%, approximately 0_001% to approximately 40%,
approximately
0.01% to approximately 30%, approximately 0.02% to approximately 29%,
approximately
0.03% to approximately 28%, approximately 0.04% to approximately 27%,
approximately
0.05% to approximately 26%, approximately 0.06% to approximately 25%,
approximately
0.07% to approximately 24%, approximately 0.08% to approximately 23%,
approximately
0.09% to approximately 22%, approximately 0.1% to approximately 21%,
approximately
0.2% to approximately 20%, approximately 0.3% to approximately 19%,
approximately 0.4%
to approximately 18%, approximately 0.5% to approximately 17%, approximately
0.6% to
approximately 16%, approximately 0.7% to approximately 15%, approximately 0.8%
to
approximately 14%, approximately 0.9% to approximately 12%, approximately 1%
to
approximately 10% w/w, w/v or v/v.
In some embodiments, the concentration of one or more of the component
antigens,
or other constituents, of the present invention is in the range from
approximately 0.001% to
approximately 10%, approximately 0.01% to approximately 5%, approximately
0.02% to
approximately 4.5%, approximately 0.03% to approximately 4%, approximately
0.04% to
approximately 3.5%, approximately 0.05% to approximately 3%, approximately
0.06% to
approximately 2.5%, approximately 0.07% to approximately 2%, approximately
0.08% to
approximately 1.5%, approximately 0.09% to approximately 1%, approximately
0.1cY0 to
approximately 0.9% w/w, w/v or v/v.
In some other embodiments, the amount of one or more of the component
antigens,
or other constituents, of the present invention is equal to or less than 10 g,
9.5 g, 9.0 g, 8.5
g, 8.0 g, 7.5 g, 7.09, 6.5 g, 6.0 g, 5.5 g, 5.0 g, 4.5 g, 4.0g, 3.5 g, 3.0 g,
2.5 g, 2.0 g, 1.5 g,
1.0 9, 0.95 9, 0.9 9, 0.85 g, 0.8 g, 0.75 g, 0.79, 0.65 9, 0.69, 0.559, 0.5g,
0.45 9, 0.49,
0.35 g, 0.3 g, 0259, 0_2 g, 0.159, 0.1 g, 0.09 g, 0_08 g, 0.079, 0.06 g, 0.05
g, 0.04 g, 0.03
g, 0.02 91 0.01 g, 0.0099, 0.008 g, 0.00791 0.00691 0.005 g, 0.004 g, 0.0039,
0.002 g,
0.001 g, 0.0009 g, 0.0008 g, 0.00079, 0.0006 g, 0.0005 g, 0.0004 g, 0.00039,
0.0002 g, or
0.0001 g.
In some embodiments, the amount of one or more of the component antigens, or
other constituents, of the present invention is more than 0.0001 g, 0.0002g,
0.00039,
0.000491 0.0005 g, 0.0006 g, 0.0007 g, 0.000891 0.0009 g, 0.001 g, 0.0015 g,
0.002 g,
0.0025 g, 0.003 g, 0_0035 g, 0.004 g, 0.0045 g, 0.005 g, 0_0055 g, 0.0069,
0.0065 g, 0.007
g, 0.007591 0.008 g, 0.0085 g, 0.009 g, 0.009591 0.01 g, 0.015 g, 0.02 g,
0.025 g, 0.039,
0.035 g, 0.04 g, 0.0459, 0.059, 0.055 g, 0.06 g, 0.065 g, 0.07 g, 0.075 g,
0.08 g, 0.085 g,
0.09 g, 0.095 g, 0.1 g, 0.15g, 0.2 g, 0.259, 0.3 g, 0.35 g, 0.4 g, 0.45g,
0.59, 0.55 g, 0.69,
29
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
0.65 g, 0.7 g, 0.759, 0.8 g, 0.85 g, 0.9 g, 0.95 g, 1 g, 1.59, 2 g, 2.5, 3 g,
3.5, 4 g, 4.5 g, 5 g,
5.5 g, 6 g, 6.5 g, 7 g, 7.5 g, 8 g, 8.5 g, 9 g, 9.5 g, or 10 g.
Other embodiments provide, amounts of one or more of the component antigens,
or
other constituents, of the present invention in the range of 0.0001-10 g,
0.0005-9 g, 0.001-8
g, 0.005-7 g, 0.01-6 g, 1105-59, 0.1-4g. 0.5-4 g, 1-39, or 1-10 g.
The target dose may be administered in a single dose. Alternatively, the
target dose
may be administered in about or more than about 1, 2, or 3, or more, doses.
The administration schedule may be repeated according to any prescribed
regimen,
including any administration schedule described herein. The composifions of
the present
invention may be administered in one dose or multiple dosages. Methods of
determining the
most effective means and dosage of administration are well known to those of
skill in the art
and will vary with the particular compositions used, the purpose of the use,
the target cells or
tissues infected, and the subject being treated. Single or multiple
administrations (e.g., about
or more than about 1, 2, 3, or more doses) over the course of from 1, 2, 3, 4,
5, 6, 7, 8, 9, or
10, or 50, or more, minutes, hours, days, weeks, or months.
In some particularly preferred embodiments, one or more doses of the
composition
is/are administered (e.g., intramuscularly, subcutaneously, and the like) as
prescribed by a
physician or as otherwise deemed necessary for maintaining health.
Administration can be
carried out with the dose level and pattern being selected by the treating
physician. It is
known in the art that due to intersubject variability in compound
pharmacokinetics,
individualization of dosing regimens is often necessary. Dosing for
compositions of the
present invention may be found by routine experimentation considering the
instant
disclosure and one's skill in the art.
Additionally, it is to be noted that, similar to the approaches described in
the fields of
medicinal and pharmaceutical chemistry, a suitable pharmaceutical preparation
may also
indude, optionally, in addition to one or more compounds of the present
invention, other
agents, including, but not limited to, excipients, diluents, stabilizers,
formulating agents (e.g.,
gels and thickeners), antioxidants, chelating agents, preservatives, sterile
aqueous solutions,
buffers, sugars, and the like, as are generally known and accepted.
Exemplary diluents include, but are not limited to, calcium carbonate, sodium
carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium
hydrogen
phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline
cellulose, kaolin,
mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch,
powdered sugar, and
combinations thereof.
Exemplary preservatives include, but are not limited to, antioxidants,
chelating
agents, antimicrobial preservatives, antifungal preservatives, alcohol
preservatives, acidic
preservatives, and other preservatives. Exemplary antioxidants include, but
are not limited
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
to, alpha tocopherol, ascorbic acid, acorbyl palmitate, butylated
hydroxyanisole, butylated
hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid,
propyl gallate,
sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite.
Exemplary
chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid
monohydrate,
disodium edetate, dipotassium edetate, edetic acid, fumaric acid, malic acid,
phosphoric
acid, sodium edetate, tartaric acid, and trisodium edetate. Exemplary
antimicrobial
preservatives include, but are not limited to, benzalkonium chloride,
benzethonium chloride,
benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine,
chlorobutanol,
chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine,
imidurea, phenol,
phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol,
and
thinnerosal. Exemplary antifungal preservatives include, but are not limited
to, butyl paraben,
methyl paraben, ethyl paraben, propyl paraben, benzoic acid, hydroxybenzoic
add,
potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and
sorbic
acid. Exemplary alcohol preservatives include, but are not limited to,
ethanol, polyethylene
glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate,
and
phenylethyl alcohol. Exemplary acidic preservatives include, but are not
limited to, vitamin A,
vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroacetic
acid, ascorbic
add, sorbic acid, and phytic acid. Other preservatives include, but are not
limited to,
t000pherol, t000pherol acetate, deteroxime mesylate, cetrimide, butylated
hydroxyanisol
(BHA), butylated hydroxytoluened (BHT), ethylenediamine, sodium lauryl sulfate
(SLS),
sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite,
potassium sulfite,
and potassium metabisulfite. In certain embodiments, the preservative is an
antioxidant. In
certain other embodiments, the preservative is a chelating agent.
Exemplary buffering agents include, but are not limited to, citrate buffer
solutions,
acetate buffer solutions, phosphate buffer solutions, ammonium chloride,
calcium carbonate,
calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate,
calcium gluconate,
D-gluconic acid, calcium glycerophosphate, calcium lactate, propanoic acid,
calcium
levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid,
tribasic calcium
phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride,
potassium
gluconate, potassium mixtures, dibasic potassium phosphate, monobasic
potassium
phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate,
sodium
chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic
sodium
phosphate, sodium phosphate mixtures, trimethamine, magnesium hydroxide,
aluminum
hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringers
solution, and ethyl
alcohol, and combinations thereof.
In other embodiments, one or more additional small molecule drug and/or
biological
agents may be preferentially combined with the one or more compounds of the
present
31
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
invention to achieve a beneficial, or even synergistic, outcome in the
subject. Certain
compounds of the present invention are also useful as co-therapeutic compounds
for use in
combination with other one or more additional agents/drug substances,
immunogenic
compositions, and/or vaccines against other STDs available now or as they
become
available (e.g., T pailidum, C. tachomatis, HPV- 6, 11, 16, 18, 31, 33,45, 52,
and 58, HSV-
2, AIDS, and the like).
It will be readily apparent to those skilled in the art that other suitable
modifications
and adaptations of the compositions and methods of the invention described
herein are
obvious and may be made using suitable equivalents without departing from the
scope of the
invention or the embodiments disclosed herein.
Typically, compositions of present invention are administered in a manner
consistent
with vaccine formulations, and in such amounts as will be therapeutically
effective and/or
immunogenic. The quantity to be administered depends on the subject to be
treated,
including the capacity of the individual's immune system to synthesize
antibodies and the
degree of protection desired. Precise amounts of active ingredient required to
be
administered depend on the judgment of the practitioner. Typically, from about
0.1, to 1, to 5,
to 10, to 20, to 30, to 40, to 50, to 60, to 70, to 80, to 90, to 100 ng, rig,
or mg may be
administered per vaccination or administration.
Suitable regimes for initial administration and booster shots are also
variable, but are
typified by an initial administration followed by subsequent inoculations or
other
administrations. In some embodiments, from 1, 2, 3, 4, 5, . . 10, . . 20,. . .
35, . . . 55, . .
100, . . 1,000, . . 10,000, or more, units of time (e.g., minutes, hours,
days, weeks, etc.)
pass between the first administration of a composition and subsequent
administration(s) to a
subject. In some of these embodiments, the interval(s) between any two or more
administrations are constant (e.g., of equal duration). In still other
embodiments, the
interval(s) between any two or more administrations are varied (e.g., not of
equal duration).
Varied intervals can be either random or repeating and formulaic.
More particularly, the compositions and methods of the present invention are
immunogenic and/or prophylactic and are administered to a subject to treat and
more
preferably prevent infection with and/or disease caused AL gonorrhoeae.
Accordingly, the
present invention specifically contemplates providing a first administration
of the
immunogenic con-positions/vaccines at a time zero, and a subsequent second,
third, fourth,
etc., administration from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
... 30, ... 60, ... 90, or
more months subsequent, respectively, between subsequent administration(s).
Thusly, an
administration schedule can proceed with administrations occurring every 1, 2,
3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, ... 30, ... 60, ... 90, or more, days or months
apart. In preferred
32
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
embodiments, a first administration of the present immunogenic
compositions/vaccines is
followed by a subsequent booster administration.
A single dose of the present compositions will normally be in the range of
from about
.001 mL to about 5.0 mL of the composition; preferably the single dose is
about 0.03 mL to
about 0.05 mL. (See, e.g., Griffiss JMcL, et al., "Relationship of dose to the
reactogenicity
and immunogenicity of meningococcal polysaccharide vaccines in adults."
Military Med. 150
(10): 529-533(1985)).
Of course, doses higher or lower than these amounts can be used if desired and
the
skilled administering physician or healthcare consultant (e.g., nurse, nurse
practitioner,
pharmacist, and the like) will be able to readily adjust dosing amounts and
frequencies to
obtain the desired results. Indeed, those skilled in the art will appreciate
the steps necessary
for designing and adjusting the dosing schedules and/or the dosing order of
compositions or
therapies as mentioned herein. Physicians can use standard tests to determine
the efficacy
of the various embodiments of the inventive compositions and methods. However,
in
addition to these standard tests, the physician may also consider quality of
life, comfort,
hygiene related issues, and prevention of disease transmission in evaluating
efficacy of a
particular treatment regime and adjust specific administration schedules.
Methods and schemes for administering and sufficiently dosing the
immunological
compositions and vaccines of the present invention are known within the art
and are
described herein. Other therapeutic regimens or agents can be used in
conjunction with the
methods and compositions, proteins or polypeptides of the present invention.
Exemplary routes of administration to the subject can be through the eyes
(ophthalmic), mouth (oral), skin (transdermal), nose (nasal), lungs
(inhalant), oral mucosa
(buccal), ear, etc., by injection (e.g., intravenously, subcutaneously,
inlratumorally,
intraperitoneally, etc.) and the like. In specific embodiments, suitable
routes of administration
indude, for example, oral or transmucosal administration as well as parenteral
delivery (e.g.,
intramuscular, subcutaneous, intramedullary, intrathecal, intraventricular,
intravenous,
intraperitoneal, or intranasal administration). A brief review of methods for
drug delivery is
provided by Langer, Science, 249:1527-1533 (1990).
The present invention further provides embodiments comprising injectable
preparations for example, sterile injectable aqueous or oleaginous
suspensions. A sterile
injectable preparation may be a sterile injectable solution, suspension or
emulsion in a
nontoxic parenterally acceptable diluent or solvent, for example, as a
solution in 1,3-
butanediol, using physiological saline, aqueous solutions such as Ringers
solution, U.S.P.,
isotonic sodium chloride solution, and non-aqueous solutions, such as
vegetable oils, high
fatty acid esters (e.g., ethyl oleic acid, etc.), alcohols (e.g., ethanol,
benzyl alcohol,
propylene glycol and glycerin, etc.). The injectable preparation(s) may be
supplemented with
33
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
pharmaceutical carriers, which are exemplified by a stabilizer for preventing
degeneration
(e.g., ascorbic acid, sodium hydrogen sulfite, sodium pyrosulfite, BHA,
tocopherol, EDTA,
eta), or reagents, and techniques, for facilitating solidification/semi-
solidification of the
preparation(s) (e.g., foam drying, freeze-foam drying, spray drying
(atomization), spray-
freeze-drying, evaporative drying, percolative drying, vacuum drying,
lyophilization,
micropelleting, pilling, and variations thereof, eta), an emulsifier(s), an
excipient(s), a
buffering agent for pH adjustment, and a preservative for inhibiting
contamination, including
but not limited to, microbial growth (e.g., phenylmercury nitrate, thimerosal,
benzalkonium
chloride, phenol, cresol, benzyl alcohol, eta), and other appropriate GRAS
reagents.
Injectable formulations can be sterilized, for example, by filtration through
a bacterial-
retaining filter, or by incorporating sterilizing agents in the form of
sterile solid compositions
which can be dissolved or dispersed in sterile water or other sterile
injectable medium prior
to use.
In addition to standard needle delivered formulations and methods of
administration
(e.g., intramuscular and transcutaneous and the like), certain formulations
and embodiments
of the compositions and methods of the present invention are suitable for
delivery using
intradermal delivery devices (Le., short singular or plural needle arrays)
such as those
described in U.S. 4,886,499; U.S.5,190,521; U.S. 5,328,483; U.S. 5,527,288;
U.S.
4,270,537; U.S. 5,015,235; U.S. 5,141,496; and U.S. 5,417,662 (each of which
is specifically
incorporated by reference in its entirety). Accordingly, compositions
formulated for
intradermal delivery may be administered by devices that limit the effective
penetration of a
needle into the skin, such as those described in PCT publication W099/34850
and functional
equivalents thereof. In still further embodiments, jet injection devices which
deliver liquid
vaccines to the dermis via a liquid jet injector and/or via a needle which
pierces the stratum
coraeum and produces a jet which reaches the dermis are suitable. Jet
injection devices are
described, for example, in U.S. 5,480,381; U.S. 5,599,302; U.S. 5,334,144;
U.S. 5,993,412;
U.S. 5,649,912; U.S. 5,569,189; U.S. 5,704,911; U.S. 5,383,851; U.S.
5,893,397; U.S.
5,466,220; U.S. 5,339,163; U.S. 5,312,335; U.S. 5,503,627; U.S. 5,064,413;
U.S. 5,520,639;
U.S. 4,596,556; U.S. 4,790,824; U.S. 4,941,880; and U.S. 4,940,460; and PCT
publications
WO 97/37705 and WO 97/13537 (each of which is incorporated by reference in its
entirety).
In yet other embodiments, ballistic powder/particle delivery devices that use
compressed gas
to accelerate a vaccine in powder form through the outer layers of the skin to
the dermis are
suitable. Alternatively, or additionally, conventional syringes may be used in
the classical
Mantoux method of intradermal administration.
Compositions for oral administration are typically liquid or in solid dosage
forms.
Compositions for oral administration may include protease inhibitors,
including organic acids
such as citric acid, in order to inhibit pancreatic and brush border
proteases. Compositions
34
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
for oral administration may additionally include absorption enhancers, such as
acylcarnitine
and lauroylcarnitine, to facilitate the uptake of the peptide through the
lumen of the intestine
into the systemic circulation by a paracellular transport mechanism.
Compositions for oral
administration may additionally include detergents to improve the solubility
of the peptides
and excipients and to decrease interactions with intestinal mucus. Solid form
compositions
for oral administration, such as tablets or capsules, may typically comprise
an enteric coating
which further protects the peptides from stomach proteases and permits passage
of the
tablet or capsule into the small intestine. The solid form composition may
additionally
comprise a subcoat such as a non-ionic polymer. Examples of preparation of
such orally
available formulations are disclosed in U.S. 5,912,014; U.S. 6,086,918; and
U.S. 6,673,574.
The disclosure of each of these documents is hereby incorporated herein by
reference in its
entirety.
In particular solid formulation embodiments intended for oral administration,
the
compositions are presented as capsules, tablets, pills, powders, or granules.
In certain of
these solid dosage forms, the active ingredients (e.g., LOS antigens and/or
adjuvant(s)) are
mixed with at least one inert, pharmaceutically acceptable excipient or
carrier such as
sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as
starches,
lactose, sucrose, glucose, rnannitol, and silicic acid, b) binders such as,
for example,
carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose,
and acacia, c)
humectants such as glycerol, d) disintegrating agents such as agar, calcium
carbonate,
potato or tapioca starch, alginic acid, certain silicates, and sodium
carbonate, e) solution
retarding agents such as paraffin, f) absorption accelerators such as
quaternary ammonium
compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol
monostearate, h) absorbents such as kaolin and bentonite clay, and i)
lubricants such as
talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium
lauryl sulfate,
and mixtures thereof. In the case of capsules, tablets and pills, the dosage
form may
comprise buffering agents.
Solid compositions of a similar type may be employed as fillers in soft- and
hard-filled
gelatin capsules using such excipients as lactose or milk sugar as well as
high molecular
weight polyethylene glycols and the like. The solid dosage forms of tablets,
dragees,
capsules, pills, and granules can be prepared with coatings and shells such as
enteric
coatings and other coatings well known in the pharmaceutical formulating art.
They may
optionally comprise pacifying agents and can be of a composition that they
release the
active ingredient(s) only, or preferentially, in a certain part of the
intestinal tract, optionally, in
a delayed manner. Examples of embedding compositions which can be used include
polymeric substances and waxes. Solid compositions of a similar type may be
employed as
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
fillers in soft- and hard-filled gelatin capsules using such excipients as
lactose or milk sugar
as well as high molecular weight polyethylene glycols and the like.
The solid dosage forms of tablets, dragees, capsules, pills, and granules can
be
prepared with coatings and shells such as enteric coatings, release
controlling coatings and
other coatings well known in the pharmaceutical formulating art. In such solid
dosage forms
the active ingredient may be admixed with at least one inert diluent such as
sucrose, lactose
or starch. Such dosage forms may comprise, as is normal practice, additional
substances
other than inert diluents, e.g., tableting lubricants and other tableting aids
such a magnesium
stearate and microcrystalline cellulose. In the case of capsules, tablets and
pills, the dosage
forms may comprise buffering agents. They may optionally comprise opacifying
agents and
can be of a composition that they release the active ingredient(s) only, or
preferentially, in a
certain part of the intestinal tract, optionally, in a delayed manner.
Examples of embedding
compositions which can be used include polymeric substances and waxes.
In certain embodiments, exemplary techniques and reagents for
solidification/semi-
solidification of the compositions in particular embodiments may be found in,
for example,
U.S. 5,307,640; U.S. 5,897,852; U.S. 6,106,836; U.S. 6,458,363; U.S.
7,836,606; U.S.
20080060213; U.S. 12/397,140; U.S. 12/500,156; and EP 0 689 867B1; EP 0 799
61361;
EP 1 140 152B1; EP 1 794 524B1; WO 2003/072016; WO 2004/073652; WO
2006/008006;
FR 1054443; and FR 1056961, each of which is incorporated herein by reference
in its
entirety.
In still other embodiments, for aerosol administration, the compositions and
vaccines
of the present invention are preferably supplied in finely divided form along
with a surfactant
and propellant. The surfactant must, of course, be nontoxic, and preferably
soluble in the
propellant. Representatives of such agents are the esters or partial esters of
fatty acids
containing from 6 to 22 carbon atoms, such as caproic, octanoic, lauric,
palmitic, stearic,
linoleic, linolenic, olesteric and oleic acids with an aliphatic polyhydric
alcohol or its cyclic
anhydride. Mixed esters, such as mixed or natural glycerides may be employed.
A carrier
can also be included, as desired, such as the inclusion of lecithin for
intranasal delivery.
Formulations suitable for nasal administration may, for example, comprise from
about
as little as 0.1% (w/w) and as much as 100% (w/w) of the active ingredient,
and may
comprise one or more of the additional ingredients described herein. A vaccine
of the
invention may be prepared, packaged, and/or sold in a formulation suitable for
buccal
administration. Such formulations may, for example, be in the form of tablets
and/or
lozenges made using conventional methods, and may, for example, comprise about
0.1% to
20% (w/w) active ingredient, the balance comprising an orally dissolvable
and/or degradable
composition and, optionally, one or more of the additional ingredients.
Alternately,
formulations suitable for administration to buccal mucosa may comprise a
powder and/or an
36
CA 03147314 2022-2-8
WO 2021/007365
PCT/US2020/041272
aerosolized and/or atomized solution and/or suspension comprising the active
ingredient.
Such powdered, aerosolized, and/or aerosolized formulations, when dispersed,
may have an
average particle and/or droplet size in the range from about 0.1 pm to about
200 pm, and
may further comprise one or more of the additional ingredients (constituents).
All constituents of the compositions whether biologically, or more
particularly
immunologically active (i.e., immunogens, antigens, adjuvants, and the like)
or conversely
inert (e.g., excipients, diluents, buffers, and the like) are selected such
that they do not
deleteriously react (e.g., acutely diminish stability or immunological
efficacy and the like) with
other constituents of the composition or produce untoward or adverse reactions
in a subject.
Depending on the condition being treated, preferred embodiments of the present
invention
are formulated and administered systemically or locally.
INCORPORATION BY REFERENCE
The contents of all cited references including literature references as well
as all
foreign patents and foreign patent applications that are cited throughout this
application are
hereby expressly and specifically incorporated by reference in their
entireties. Additionally,
all U.S. Patent Publications, U.S. Patent Applications, and U.S. Patents and
any
international patent documents mentioned are hereby expressly and specifically
incorporated by reference in their entireties.
37
CA 03147314 2022-2-8
