Note: Descriptions are shown in the official language in which they were submitted.
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION
OF TRANSTHYRETIN (TTR)
Related Applications
The present application claims the benefit of priority to U.S. Provisional
Application No.
62/985,950, filed on March 6, 2020, the entire contents of which are
incorporated herein by reference.
Sequence Listing
The instant application contains a Sequence Listing which has been submitted
electronically in
ASCII format and is hereby incorporated by reference in its entirety. Said
ASCII copy, created on
February 26, 2021, is named 121301_12320_SL.txt and is 44,455 bytes in size.
Background
Transthyretin (TTR) (also known as prealbumin) is found in serum and
cerebrospinal fluid
(CSF). TTR transports retinol-binding protein (RBP) and thyroxine (T4) and
also acts as a carrier of
retinol (vitamin A) through its association with RBP in the blood and the CSF.
Transthyretin is named
for its transport of thyroxine and retinol. TTR also functions as a protease
and can cleave proteins
including apoA-I (the major HDL apolipoprotein), amyloid I3-peptide, and
neuropeptide Y. See Liz,
M.A. et al. (2010) IUBMB Life, 62(6):429-435.
TTR is a tetramer of four identical 127-amino acid subunits (monomers) that
are rich in beta
sheet structure. Each monomer has two 4-stranded beta sheets and the shape of
a prolate ellipsoid.
Antiparallel beta-sheet interactions link monomers into dimers. A short loop
from each monomer forms
the main dimer-dimer interaction. These two pairs of loops separate the
opposed, convex beta-sheets of
the dimers to form an internal channel.
The liver is the major site of TTR expression. Other significant sites of
expression include the
choroid plexus, retina (particularly the retinal pigment epithelium) and
pancreas.
Transthyretin is one of at least 27 distinct types of proteins that is a
precursor protein in the
formation of amyloid fibrils. See Guan, J. et al. (Nov. 4, 2011) Current
perspectives on cardiac
amyloidosis, Am J Physiol Heart Circ Physiol, doi:10.1152/ajpheart.00815.2011.
Extracellular
deposition of amyloid fibrils in organs and tissues is the hallmark of
amyloidosis. Amyloid fibrils are
composed of misfolded protein aggregates, which may result from either excess
production of or
specific mutations in precursor proteins. The amyloidogenic potential of TTR
may be related to its
extensive beta sheet structure; X-ray crystallographic studies indicate that
certain amyloidogenic
mutations destabilize the tetrameric structure of the protein. See, e.g.,
Saraiva M.J.M. (2002) Expert
Reviews in Molecular Medicine, 4(12):1-11.
Amyloidosis is a general term for the group of amyloid diseases that are
characterized by
amyloid deposits. Amyloid diseases are classified based on their precursor
protein; for example, the
name starts with "A" for amyloid and is followed by an abbreviation of the
precursor protein, e.g.,
ATTR for amloidogenic transthyretin. Ibid.
1
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
There are numerous TTR-associated diseases, most of which are amyloid
diseases. Normal-
sequence TTR is associated with cardiac amyloidosis in people who are elderly
and is termed senile
systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or
cardiac amyloidosis).
SSA often is accompanied by microscopic deposits in many other organs. TTR
amyloidosis manifests
in various forms. When the peripheral nervous system is affected more
prominently, the disease is
termed familial amyloidotic polyneuropathy (FAP). When the heart is primarily
involved but the
nervous system is not, the disease is called familial amyloidotic
cardiomyopathy (FAC). A third major
type of TTR amyloidosis is leptomeningeal amyloidosis, also known as
leptomeningeal or
meningocerebrovascular amyloidosis, central nervous system (CNS) amyloidosis,
or amyloidosis VII
form. Mutations in TTR may also cause amyloidotic vitreous opacities, carpal
tunnel syndrome, and
euthyroid hyperthyroxinemia, which is a non-amyloidotic disease thought to be
secondary to an
increased association of thyroxine with TTR due to a mutant TTR molecule with
increased affinity for
thyroxine. See, e.g., Moses et al. (1982) J. Clin. Invest., 86, 2025-2033.
Abnormal TTR alleles may be either inherited or acquired through somatic
mutations. Guan, J.
et al. (Nov. 4, 2011) Current perspectives on cardiac amyloidosis, Am J
Physiol Heart Circ Physiol,
doi:10.1152/ajpheart.00815.2011. Transthyretin associated ATTR is the most
frequent form of
hereditary systemic amyloidosis. Lobato, L. (2003) J. Nephrol., 16:438-442.
TTR mutations accelerate
the process of TTR amyloid formation and are the most important risk factor
for the development of
ATTR. More than 85 amyloidogenic TTR variants are known to cause systemic
familial amyloidosis.
TTR mutations usually give rise to systemic amyloid deposition, with
particular involvement of the
peripheral nervous system, although some mutations are associated with
cardiomyopathy or vitreous
opacities. Ibid.
The V3OM mutation is the most prevalent TTR mutation. See, e.g., Lobato, L.
(2003) J
Nephrol, 16:438-442. The V1221 mutation is carried by 3.9% of the African
American population and
is the most common cause of FAC. Jacobson, D.R. et al. (1997) N. Engl. J. Med.
336 (7): 466-73. It is
estimated that SSA affects more than 25% of the population over age 80.
Westermark, P. et al. (1990)
Proc. Natl. Acad. Sci. U.S.A. 87 (7): 2843-5.
Accordingly, there is a need in the art for effective treatments for TTR-
associated diseases.
Summary of the Invention
The present invention provides compositions and methods for inhibiting
expression of TTR and
methods of treating or preventing a transthyretin- (TTR-) associated disease
in a human subject using
double stranded RNAi agents, targeting the TTR gene.
The invention provides a double stranded RNAi agent comprising a sense strand
and an
antisense strand, wherein:
each the sense strand and the antisense strand are independently up to 30
nucleotides in length;
the sense strand comprises the modified nucleotide sequence 5'-
usgsggauUfuCfAfUfguaaccaaga-3' (SEQ ID NO: 6); and
2
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
the antisense strand comprises the modified nucleotide sequence 5'-
usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3' (SEQ ID NO: 7),
wherein a, c, g, and u are 2'-0-methyladenosine-3'-phosphate, 2'-0-
methylcytidine-3'-
phosphate, 2'-0-methylguanosine-3' -phosphate, and 2'-0-methyluridine-3'-
phosphate, respectively;
Af, Cf, Gf, and Uf are 2' -fluoroadenosine-3'-phosphate, 2' -fluorocytidine-3'
-phosphate, 2'-
fluoroguanosine-3'-phosphate, and 2'-fluorouridine-3'-phosphate, respectively;
(Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer; and
s is a phosphorothioate linker.
In certain embodiments, the sense strand of the double stranded RNAi agent is
conjugated to at
least one ligand. In certain embodiments, the ligand is one or more GalNAc
derivatives attached through
a bivalent or trivalent branched linker. In certain embodiments, the ligand is
HO OH
0
HO0N0
AcHN 0
HO
OH
0
HO Or.N
AcHN
HO
0 0 0
OH
0
HOON N0
AcHN
o
In certain embodiments, the ligand is attached to the 3' end of the sense
strand.
In certain embodiments, the double stranded RNAi agent is conjugated to the
ligand as shown in the
following schematic:
3'
0
e
0=P¨X
OH
0HO <OH
\
0H H L(31
HO
AcHN 0
f
HO 1 1-1
0HO õ H
AcHN 0 0 o
_OH
HO 0
AcHN
0H
wherein X is 0 or S.
In certain embodiments, the sense strand is 21 nucleotides in length and the
antisense strand is
23 nucleotides in length.
The invention provides a use of a double stranded RNAi agent in a method of
treating a human
subject suffering from a TTR-associated disease, comprising administration of
a fixed dose of about 25
mg to about 1000 mg of a double stranded RNAi agent, wherein:
each the sense strand and the antisense strand are independently up to 30
nucleotides in length;
3
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
the sense strand comprises the modified nucleotide sequence 5'-
usgsggauUfuCfAfUfguaaccaaga-3' (SEQ ID NO: 6); and
the antisense strand comprises the modified nucleotide sequence 5'-
usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3' (SEQ ID NO: 7),
wherein a, c, g, and u are 2'-0-methyladenosine-3'-phosphate, 2'-0-
methylcytidine-3'-
phosphate, 2'-0-methylguanosine-3' -phosphate, and 2'-0-methyluridine-3'-
phosphate, respectively;
Af, Cf, Gf, and Uf are 2' -fluoroadenosine-3'-phosphate, 2' -fluorocytidine-3'
-phosphate, 2'-
fluoroguanosine-3'-phosphate, and 2'-fluorouridine-3'-phosphate, respectively;
(Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer; and
s is a phosphorothioate linker.
The invention also provides a use of a double stranded RNAi agent in a method
of inhibiting
expression of TTR in a human subject who does not meet diagnostic criteria of
a TTR-associated
disease, comprising administration of a fixed dose of about 25 mg to about
1000 mg of a double
stranded RNAi agent, wherein:
each the sense strand and the antisense strand are independently up to 30
nucleotides in length;
the sense strand comprises the modified nucleotide sequence 5'-
usgsggauUfuCfAfUfguaaccaaga-3' (SEQ ID NO: 6); and
the antisense strand comprises the modified nucleotide sequence 5'-
usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3' (SEQ ID NO: 7),
wherein a, c, g, and u are 2'-0-methyladenosine-3'-phosphate, 2'-0-
methylcytidine-3'-
phosphate, 2'-0-methylguanosine-3' -phosphate, and 2'-0-methyluridine-3'-
phosphate, respectively;
Af, Cf, Gf, and Uf are 2' -fluoroadenosine-3'-phosphate, 2' -fluorocytidine-3'
-phosphate, 2'-
fluoroguanosine-3'-phosphate, and 2'-fluorouridine-3'-phosphate, respectively;
(Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer; and
s is a phosphorothioate linker.
In certain embodiments, the sense strand of the double stranded RNAi agent is
conjugated to at
least one ligand. In certain embodiments, the ligand is one or more GalNAc
derivatives attached through
a bivalent or trivalent branched linker. In certain embodiments, the ligand is
HO OH
0
HO
HO 0
AcHN 0
OH
0
HO Or.N
AcHN
HO
0 0 0
OH
0
HOON N0
AcHN o H
4
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
In certain embodiments, the ligand is attached to the 3' end of the sense
strand. In certain
embodiments, the double stranded RNAi agent is conjugated to the ligand as
shown in the following
schematic
3'
0
= N 011
0
0=P¨X
OH
0\
HO\
Ho
AcHN 0
f
HO 1 F1
0, H
AcHN 0 F1 0 0' 0
_
HO
0
AcHN 0H H
wherein X is 0 or S.
In certain embodiments, the sense strand is 21 nucleotides in length and the
antisense strand is
23 nucleotides in length.
In certain embodiments, the uses of the invention comprise improving at least
one indicia of
neurological impairement, quality of life, nerve damage, cardiovascular
health. In certain embodiments,
the indicia assessed is a neurological impairment, for example, using a
Neuropathy Impairment (NIS)
score or a modified NIS (mNIS+7) score. In certain embodiments, the indicia is
a quality of life indicia
assessed, for example, using a SF-36 health survey score, a Norfolk Quality
of Life-Diabetic
Neuropathy (Norfolk QOL-DN) score, a NIS-W score, a Rasch-built Overall
Disability Scale (R-ODS)
score, a composite autonomic symptom score (COMPASS-31), a median body mass
index (mBMI)
.. score, a 6-minute walk test (6MWT) score, and a 10-meter walk test score.
In certain embodiments, the
indicia is nerve damage assessed, for example, a change in the level of one or
more proteins selected
from the group neurofilament light chain (NfL), RSP03, CCDC80, EDA2R, NT-
proBNP, and N-
CDase, such as a human blood sample, or serum or plasma derived therefrom. In
certain embodiments,
the indicia of nerve damage is a change from baseline in the level of
neurofilament light chain (NfL)
protein level. In certain embodiments, the indicia of cardiovascular
impairment is cardiovascular
hospitalization, using Kansas City Cardiomyopathy Questionnaire Overall
Summary (KCCQ-OS) with
an increased score indicative of better health status, change from baseline in
mean left lventricular (LV)
wall thickness by echocardiographic assessment, change from baseline in global
longitudinal strain by
echocardiographic assessment, and change from baseline in N-terminal
prohormone B-type Natriuretic
Peptide (NTproBNP).
In certain embodiments, the human subject carries a TTR gene mutation that is
associated with
the development of a TTR-associated disease, e.g., senile systemic amyloidosis
(SSA), systemic familial
amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic
cardiomyopathy (FAC),
leptomeningeal/Central Nervous System (CNS) amyloidosis, and
hyperthyroxinemia.
In certain embodiments, the human subject has a transthyretin-mediated
amyloidosis (ATTR
amyloidosis) and the use of the double stranded RNAi agent reduces an amyloid
TTR deposit in the
5
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
human subject. In certain embodiments, the ATTR amyloidosis is hereditary ATTR
(h-ATTR)
amyloidosis. In certain embodiments, the ATTR amyloidosis is non-heriditary
ATTR (wt ATTR)
amyloidosis.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
by subcutaneously or intravenously. In certain embodiments, the subcutaneous
administration is self
administration. In certain embodiments, the self-administration is via a pre-
filled syringe or auto-
injector device.
In certain embodiments, the use further comprises assessing the level of TTR
mRNA expression
or TTR protein expression in a sample derived from the human subject, such as
a human blood sample,
or serum or plasma derived therefrom.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
once every month, once every other month, once every three months, once every
four months, once
every five months, or once every six months. In certain embodiments, the fixed
dose of the double
stranded RNAi agent is administered to the human subject once about every
three months. In certain
embodiments, the fixed dose of the double stranded RNAi agent is administered
to the human subject
once about every six months.
In certain embodiments, the double stranded RNAi agent is chronically
administered to the
human subject.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
about once per quarter to about once per year. In certain embodiments, the
double stranded RNAi agent
is administered to the human subject about once per quarter, about once every
six months, or about once
per year.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
at a fixed dose of about 25 mg to about 300 mg. In certain embodiments, the
double stranded RNAi
agent is administered to the human subject at a fixed dose of about 25 mg to
about 200 mg. In certain
embodiments, the double stranded RNAi agent is administered to the human
subject at a fixed dose of
about 75 mg to about 200 mg. In certain embodiments, the double stranded RNAi
agent is administered
to the human subject at a fixed dose of about 25 mg. In certain embodiments,
the double stranded RNAi
agent is administered to the human subject at a fixed dose of about 50 mg. In
certain embodiments, the
double stranded RNAi agent is administered to the human subject at a fixed
dose of about 75 mg. In
certain embodiments, the double stranded RNAi agent is administered to the
human subject at a fixed
dose of about 100 mg. In certain embodiments, the double stranded RNAi agent
is administered to the
human subject at a fixed dose of about 200 mg. In certain embodiments, the
double stranded RNAi
agent is administered to the human subject at a fixed dose of about 25 mg to
about 300 mg; about 25 mg
to about 200 mg; about 75 mg to about 200 mg; about 25 mg; about 50 mg; about
75 mg; about 100 mg;
about 200mg; or about 300 mg once per quarter, i.e., about once every three
months.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
at a fixed dose of about 400 mg to about 600 mg. In certain embodiments, the
double stranded RNAi
agent is administered to the human subject at a fixed dose of about 400 mg or
about 600 mg about once
6
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
every six months to about once per year. In certain embodiments, the double
stranded RNAi agent is
administered to the human subject at a fixed dose of about 400 mg or about 600
mg about once every
six months or about once per year.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
at a fixed dose of about 700 mg to about 1000 mg or about 700 mg to about 900
mg. In certain
embodiments, the double stranded RNAi agent is administered to the human
subject at a fixed dose of
about 700 mg, about 800 mg, about 900mg, or about 1000 mg about once per year.
In certain embodiments, the use further comprises administering to the human
subject an
additional therapeutic agent, e.g., a TTR tetramer stabilizer or a non-
steroidal anti-inflammatory agent.
The present invention also provides kits for performing any of the methods of
the invention.
The kits may include the double stranded RNAi agent; and a label comprising
instructions for use.
The present invention is further illustrated by the following detailed
description and drawings.
Brief Description of the Drawings
Figure 1 is a graph depicting relative serum TTR protein levels in V3OM
transgenic mice (n=3
per group) after administration of a single 1 mg/kg dose of the indicated
double stranded RNAi agents
on Day 0.
Figure 2 is a graph depicting relative serum TTR protein levels in cynomolgus
monkeys (n=3
per group) after administration of a single 1 mg/kg dose or 3 mg/kg dose of
the indicated double
stranded RNAi agents on Day 0. Results shown are from three independent
studies.
Detailed Description of the Invention
The present invention provides methods of inhibiting expression of TTR,
including inhibiting
TTR expression in a human subject who does not meet diagnostic criteria of a
TTR-associated disease
and methods of treating a human subject with a Transthyretin- (TTR-)
associated disease using double
stranded RNAi agents, targeting the TTR gene wherein the sense strand
comprises the modified
nucleotide sequence 5'-usgsggauUfuCfAfUfguaaccaaga-3' (SEQ ID NO: 6); and the
antisense strand
comprises the modified nucleotide sequence 5'-
usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3' (SEQ ID
NO: 7.
The following detailed description discloses how to make and use compositions
containing
iRNA agents to selectively inhibit the expression of a TTR gene, as well as
compositions, uses, and
methods for treating subjects having diseases and disorders that would benefit
from inhibition or
reduction of the expression of a TTR gene.
I. Definitions
In order that the present invention may be more readily understood, certain
terms are first
defined. In addition, it should be noted that whenever a value or range of
values of a parameter are
7
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
recited, it is intended that values and ranges intermediate to the recited
values are also intended to be
part of this invention.
The articles "a" and "an" are used herein to refer to one or to more than one
(i.e., to at least one)
of the grammatical object of the article. By way of example, "an element"
means one element or more
than one element, e.g., a plurality of elements.
The term "including" is used herein to mean, and is used interchangeably with,
the phrase
"including, but not limited to".
The term "or" is used herein to mean, and is used interchangeably with, the
term "and/or,"
unless context clearly indicates otherwise.
The term "about" is used herein to mean within the typical ranges of
tolerances in the art, e.g.,
acceptable variation in time between doses, acceptable variation in dosage
unit amount. For example,
"about" can be understood as within about 2 standard deviations from the mean.
In certain
embodiments, about means +10%. In certain embodiments, about means +5%. When
about is present
before a series of numbers or a range, it is understood that "about" can
modify each of the numbers in
the series or range.
The term "at least" , "no less than", or "or more" prior to a number or series
of numbers is
understood to include the number adjacent to the term "at least", and all
subsequent numbers or integers
that could logically be included, as clear from context. For example, the
number of nucleotides in a
nucleic acid molecule must be an integer. For example, "at least 18
nucleotides of a 21 nucleotide
nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the
indicated property. When at
least is present before a series of numbers or a range, it is understood that
"at least" can modify each of
the numbers in the series or range.
As used herein, "no more than" or "less than" is understood as the value
adjacent to the phrase
and logical lower values or integers, as logical from context, to zero. For
example, a duplex with an
overhang of "no more than 2 nucleotides" has a 2, 1, or 0 nucleotide overhang.
When "no more than" is
present before a series of numbers or a range, it is understood that "no more
than" can modify each of
the numbers in the series or range.
As used herein, methods of detection can include determination that the amount
of analyte
present is below the level of detection of the method.
As used herein, a "transthyretin" ("TTR") refers to the well-known gene and
protein. TTR is
also known as prealbumin, HsT2651, PALB, and TBPA. TTR functions as a
transporter of retinol-
binding protein (RBP), thyroxine (T4) and retinol, and it also acts as a
protease. The liver secretes TTR
into the blood, and the choroid plexus secretes TTR into the cerebrospinal
fluid. TTR is also expressed
in the pancreas and the retinal pigment epithelium. The greatest clinical
relevance of TTR is that both
normal (wild type) and mutant TTR protein can form amyloid fibrils that
aggregate into extracellular
deposits, causing amyloidosis. See, e.g., Saraiva M.J.M. (2002) Expert Reviews
in Molecular Medicine,
4(12):1-11 for a review. The molecular cloning and nucleotide sequence of rat
transthyretin, as well as
the distribution of mRNA expression, was described by Dickson, P.W. et al.
(1985) J. Biol. Chem.
260(13)8214-8219. The X-ray crystal structure of human TTR was described in
Blake, C.C. et al.
8
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
(1974) J Mol Biol 88, 1-12. The sequence of a human TTR mRNA transcript can be
found at National
Center for Biotechnology Information (NCBI) RefSeq accession number NM_000371
(e.g., SEQ ID
NOs:1 and 5). The sequence of mouse TTR mRNA can be found at RefSeq accession
number
NM_013697.2, and the sequence of rat TTR mRNA can be found at RefSeq accession
number
NM_012681.1. Additional examples of TTR mRNA sequences are readily available
using publicly
available databases, e.g., GenBank, UniProt, and OMIM.
A "TTR-associated disease," as used herein, is intended to include any disease
associated with
the TTR gene or protein. Such a disease may be caused, for example, by excess
production of the TTR
protein, by TTR gene mutations, by abnormal cleavage of the TTR protein,
instability of TTR tetramers,
by abnormal interactions between TTR and other proteins or other endogenous or
exogenous
substances. A "TTR-associated disease" includes any type of transthyretin-
mediated amyloidosis
(ATTR amyloidosis) wherein TTR plays a role in the formation of abnormal
extracellular aggregates or
amyloid deposits, e.g., either herititary ATTR (h-ATTR) amyloidosis or non-
heriditary ATTR (ATTR)
amyloidosis. TTR-associated diseases include senile systemic amyloidosis
(SSA), systemic familial
amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic
cardiomyopathy (FAC),
leptomeningeal/Central Nervous System (CNS) amyloidosis, amyloidotic vitreous
opacities, carpal
tunnel syndrome, and hyperthyroxinemia. Symptoms of TTR amyloidosis include
sensory neuropathy
(e.g., paresthesia, hypesthesia in distal limbs), autonomic neuropathy (e.g.,
gastrointestinal dysfunction,
such as gastric ulcer, or orthostatic hypotension), motor neuropathy,
seizures, dementia, myelopathy,
polyneuropathy, carpal tunnel syndrome, autonomic insufficiency,
cardiomyopathy, vitreous opacities,
renal insufficiency, nephropathy, substantially reduced mBMI (modified Body
Mass Index), cranial
nerve dysfunction, and corneal lattice dystrophy.
As used herein, the term "strand comprising a sequence" refers to an
oligonucleotide
comprising a chain of nucleotides that is described by the sequence referred
to using the standard
nucleotide nomenclature.
The terms "iRNA," "RNAi agent," "iRNA agent,", "RNA interference agent" as
used
interchangeably herein, refer to an agent that contains RNA as that term is
defined herein, and which
mediates the targeted cleavage of an RNA transcript via an RNA-induced
silencing complex (RISC)
pathway. iRNA directs the sequence-specific degradation of mRNA through a
process known as RNA
interference (RNAi). The iRNA modulates, e.g., inhibits, the expression of a
TTR gene in a cell, e.g., a
cell within a subject, such as a mammalian subject.
As used herein, an "iRNA" for use in the compositions, uses, and methods of
the invention is a
double stranded RNA and is referred to herein as a "double stranded RNAi
agent," "double stranded
RNA (dsRNA) molecule," "dsRNA agent," or "dsRNA". The term "dsRNA" refers to a
complex of
ribonucleic acid molecules, having a duplex structure comprising two anti-
parallel and substantially
complementary nucleic acid strands, referred to as having "sense" and
"antisense" orientations with
respect to a target RNA, i.e., a TTR gene. A double stranded RNAi agent
triggers the degradation of a
target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing
mechanism referred to herein
as RNA interference or RNAi.
9
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
As used herein, the term "modified nucleotide" refers to a nucleotide having,
independently, a
modified sugar moiety, a modified internucleotide linkage, or a modified
nucleobase. Thus, the term
modified nucleotide encompasses substitutions, additions or removal of, e.g.,
a functional group or
atom, to internucleoside linkages, sugar moieties, or nucleobases. The
modifications suitable for use in
the agents of the invention include all types of modifications disclosed
herein or known in the art. Any
such modifications, as used in a siRNA type molecule, are encompassed by "RNAi
agent" for the
purposes of this specification and claims.
The duplex region may be of any length that permits specific degradation of a
desired target
RNA through a RISC pathway, and may range from about 21 to 36 base pairs in
length, e.g., about 21-
30 base pairs in length, for example, about 21-30, 21-29, 21-28, 21-27, 21-26,
21-25, 21-24, 21-23, or
21-22 base pairs in length. In one embodiment, an RNAi agent of the invention
is a dsRNA agent, each
strand of which comprises 21-23 nucleotides that interacts with a TTR mRNA
sequence to direct the
cleavage of the target mRNA. Without wishing to be bound by theory, long
double stranded RNA
introduced into cells is broken down into siRNA by a Type III endonuclease
known as Dicer (Sharp et
al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme,
processes the dsRNA into 19-23
base pair short interfering RNAs with characteristic two base 3' overhangs
(Bernstein, et al., (2001)
Nature 409:363). The siRNAs are then incorporated into an RNA-induced
silencing complex (RISC)
where one or more helicases unwind the siRNA duplex, enabling the
complementary antisense strand to
guide target recognition (Nykanen, et al., (2001) Cell 107:309). Upon binding
to the appropriate target
mRNA, one or more endonucleases within the RISC cleave the target to induce
silencing (Elbashir, et
al., (2001) Genes Dev. 15:188). In one embodiment, an RNAi agent of the
invention is a dsRNA of 24-
nucleotides that interacts with a TTR mRNA sequence to direct the cleavage of
the target RNA.
As used herein, the term "nucleotide overhang" refers to at least one unpaired
nucleotide that
protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example,
when a 3'-end of one
25 strand of a dsRNA extends beyond the 5'-end of the other strand, or vice
versa, there is a nucleotide
overhang. A dsRNA can comprise an overhang of at least one nucleotide;
alternatively, the overhang
can comprise at least two nucleotides, at least three nucleotides, at least
four nucleotides, at least five
nucleotides or more. A nucleotide overhang can comprise or consist of a
nucleotide/nucleoside analog,
including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense
strand, the antisense
30 strand or any combination thereof. Furthermore, the nucleotide(s) of an
overhang can be present on the
5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA.
In one embodiment of the
dsRNA, at least one strand comprises a 3' overhang of at least 1 nucleotide.
In another embodiment, at
least one strand comprises a 3' overhang of at least 2 nucleotides, e.g., 2,
3, 4, 5, 6, 7, 8, or 9
nucleotides. In other embodiments, at least one strand of the RNAi agent
comprises a 5' overhang of at
least 1 nucleotide. In certain embodiments, at least one strand comprises a 5'
overhang of at least 2
nucleotides, e.g., 2, 3, 4, 5, 6, 7, 8, or 9 nucleotides. In still other
embodiments, both the 3' and the 5'
end of one strand of the RNAi agent comprise an overhang of at least 1
nucleotide.
In one embodiment, the antisense strand of a dsRNA has a 1-9 nucleotide, e.g.,
0-3, 1-3, 2-4, 2-
5, 4-9, 5-9, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, or 9 nucleotide, overhang at the
3'-end or the 5'-end. In one
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
embodiment, the sense strand of a dsRNA has a 1-9 nucleotide, e.g., a 1, 2, 3,
4, 5, 6, 7, 8, or 9
nucleotide, overhang at the 3'-end or the 5'-end. In another embodiment, one
or more of the nucleotides
in the overhang is replaced with a nucleoside thiophosphate.
"Blunt" or "blunt end" means that there are no unpaired nucleotides at that
end of the double
stranded RNAi agent, i.e., no nucleotide overhang. A "blunt ended" RNAi agent
is a dsRNA that is
double stranded over its entire length, i.e., no nucleotide overhang at either
end of the molecule. The
RNAi agents of the invention include RNAi agents with nucleotide overhangs at
one end (i.e., agents
with one overhang and one blunt end) or with nucleotide overhangs at both
ends.
The term "antisense strand" or "guide strand" refers to the strand of an iRNA,
e.g., a dsRNA,
which includes a region that is substantially complementary to a target
sequence, e.g., a TTR mRNA.
As used herein, the term "region of complementarity" refers to the region on
the antisense strand that is
substantially complementary to a sequence, for example a target sequence,
e.g., a TTR nucleotide
sequence, as defined herein. Where the region of complementarity is not fully
complementary to the
target sequence, the mismatches can be in the internal or terminal regions of
the molecule. Generally,
the most tolerated mismatches are in the terminal regions, e.g., within 5, 4,
3, 2, or 1 nucleotides of the
5'- or 3'-terminus of the iRNA. In one embodiment, a double stranded RNAi
agent of the invention
includea a nucleotide mismatch in the antisense strand. In another embodiment,
a double stranded
RNAi agent of the invention includes a nucleotide mismatch in the sense
strand. In one embodiment,
the nucleotide mismatch is, for example, within 5, 4, 3, 2, or 1 nucleotides
from the 3'-terminus of the
iRNA. In another embodiment, the nucleotide mismatch is, for example, in the
3'-terminal nucleotide
of the iRNA.
The term "sense strand," or "passenger strand" as used herein, refers to the
strand of an iRNA
that includes a region that is substantially complementary to a region of the
antisense strand as that term
is defined herein.
As used herein, the term "cleavage region" refers to a region that is located
immediately
adjacent to the cleavage site. The cleavage site is the site on the target at
which cleavage occurs. In
some embodiments, the cleavage region comprises three bases on either end of,
and immediately
adjacent to, the cleavage site. In some embodiments, the cleavage region
comprises two bases on either
end of, and immediately adjacent to, the cleavage site. In some embodiments,
the cleavage site
specifically occurs at the site bound by nucleotides 10 and 11 of the
antisense strand, and the cleavage
region comprises nucleotides 11, 12 and 13.
As used herein, and unless otherwise indicated, the term "complementary," when
used to describe
a first nucleotide sequence in relation to a second nucleotide sequence,
refers to the ability of an
oligonucleotide or polynucleotide comprising the first nucleotide sequence to
hybridize and form a
duplex structure under certain conditions with an oligonucleotide or
polynucleotide comprising the
second nucleotide sequence, as will be understood by the skilled person. Such
conditions can be, for
example, "stringent conditions", where stringent conditions can include: 400
mM NaCl, 40 mM PIPES
pH 6.4, 1 mM EDTA, 50 oC or 70 oC for 12-16 hours followed by washing (see,
e.g., "Molecular
Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor
Laboratory Press). Other
11
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
conditions, such as physiologically relevant conditions as can be encountered
inside an organism, can
apply. The skilled person will be able to determine the set of conditions most
appropriate for a test of
complementarity of two sequences in accordance with the ultimate application
of the hybridized
nucleotides.
Complementary sequences within an iRNA, e.g., within a dsRNA as described
herein, include
base-pairing of the oligonucleotide or polynucleotide comprising a first
nucleotide sequence to an
oligonucleotide or polynucleotide comprising a second nucleotide sequence over
the entire length of one
or both nucleotide sequences. Such sequences can be referred to as "fully
complementary" with respect
to each other herein. However, where a first sequence is referred to as
"substantially complementary"
with respect to a second sequence herein, the two sequences can be fully
complementary, or they can
form one or more, but generally not more than 5, 4, 3 or 2 mismatched base
pairs upon hybridization for
a duplex up to 30 base pairs, while retaining the ability to hybridize under
the conditions most relevant
to their ultimate application, e.g., inhibition of gene expression, in vitro
or in vivo.. However, where
two oligonucleotides are designed to form, upon hybridization, one or more
single stranded overhangs,
such overhangs shall not be regarded as mismatches with regard to the
determination of
complementarity. For example, a dsRNA comprising one oligonucleotide 21
nucleotides in length and
another oligonucleotide 23 nucleotides in length, wherein the longer
oligonucleotide comprises a
sequence of 21 nucleotides that is fully complementary to the shorter
oligonucleotide, can yet be
referred to as "fully complementary" for the purposes described herein.
"Complementary" sequences, as used herein, can also include, or be formed
entirely from, non-
Watson-Crick base pairs or base pairs formed from non-natural and modified
nucleotides, in so far as
the above requirements with respect to their ability to hybridize are
fulfilled. Such non-Watson-Crick
base pairs include, but are not limited to, G:U Wobble or Hoogstein base
pairing.
The terms "complementary," "fully complementary" and "substantially
complementary" herein
can be used with respect to the base matching between the sense strand and the
antisense strand of a
dsRNA, or between two oligonucleotides or polynucleotides, such as the
antisense strand of an iRNA
agent and a target sequence, as will be understood from the context of their
use.
As used herein, a polynucleotide that is "substantially complementary to at
least part of' a
messenger RNA (mRNA) refers to a polynucleotide that is substantially
complementary to a contiguous
portion of the mRNA of interest (e.g., an mRNA encoding a TTR gene). For
example, a polynucleotide
is complementary to at least a part of a TTR mRNA if the sequence is
substantially complementary to a
non-interrupted portion of an mRNA encoding a TTR gene.
Accordingly, in some embodiments, the antisense polynucleotides disclosed
herein are fully
complementary to the target TTR sequence. In other embodiments, the antisense
polynucleotides
disclosed herein are fully complementary to SEQ ID NO:8 (5'-
UGGGAUUUCAUGUAACCAAGA -
3'). In one embodiment, the antisense polynucleotide sequence is 5'-
UCUUGGUUACAUGAAAUCCCAUC -3' (SEQ ID NO:9), wherein the U at position 7 of the
antisense strand can be a T.
12
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
As used herein, a "reference level" is understood as a predetermined level to
which a level
obtained from an assay, e.g., a biomarker level, e.g., a protein biomarker
level, is compared. In certain
embodiments, a reference level can be a control level determined for a healthy
population, e.g., a
population that does not have a disease or condition associated with a changed
level of the biomarker
and does not have a predisposition, e.g., genetic predisposition, to a disease
or condition associated with
a changed level of the biomarker. In certain embodiments, the population
should be matched for certain
criteria, e.g., age, sex. In certain embodiments, the reference level of the
biomarker is a level from the
same subject at an earlier time, e.g., before the development of symptomatic
disease or before the start
of treatment. Typically, samples are obtained from the subject at clinically
relevant intervals, e.g., at
intervals sufficiently separated in time that a change in the biomarker could
be observed, e.g., at least a
three month interval, at least a six month interval, or at least a nine month
interval. When more than two
samples are obtained from a subject over time, it is understood that any of
the prior samples can act as a
reference level.
As used herein, a "change as compared to a reference level" and the like is
understood as a
statistically or clinically significant change in the biomarker level, e.g.,
the change in the protein
biomarker level, as compared to the reference level, is greater than the
typical standard deviation of the
assay method. Moreover, the change should be clinically relevant. The change
as compared to a
reference level can be determined as a percent change. For example, if a
reference level is 100 pg/ml
for biomarker X, and the level of biomarker X in the subject is 150 pg/ml, the
level is increased by 50%
calculated by ((150 pg/ml -100 pg/m1)/100 pg/ml) X 100% = 50%. If the level of
biomarker X in the
subject is 300 pg/ml, the level is increased by 300%. If the level of
biomarker X in the subject is 50
pg/ml, the level is decreased by 50%. In certain embodiments, the change as
compared to a reference
level is increased by at least 50%. In certain embodiments, the change as
compared to a reference level
is increased by at least 100%, at least 200%, or at least 300%. In certain
embodiments, the change as
.. compared to a reference sample is decreased by at least 25%. In certain
embodiments, the change as
compared to a reference sample is decreased by at least 50%.
A "biological sample from a subject" or a "sample from a subject" as used
herein, includes one
or more fluids, cells, or tissues isolated from a subject. Examples of
biological fluids include blood,
serum, serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph,
urine, saliva, and the like.
Tissue samples may include samples from tissues, organs, or localized regions.
For example, samples
may be derived from particular organs, parts of organs, or fluids or cells
within those organs. In certain
embodiments, samples may be liver tissue or be derived from the liver. In some
embodiments, a
"biological sample from a subject" can refer to blood or blood derived serum
or plasma from the
subject. In some embodiments, the fluid is substantially free of cells, e.g.,
is free of cells.
As used herein, a "clinically relevant difference" is understood as at least
greater difference than
typical interobserver variation for the assessment, wherein the observer may
be a trained health care
professional, a caregiver, or the patient, performing the same assessment on
the same individual at
around the same time, e.g., within a week, such as within consecutive days. It
is understood that certain
patient observations are subjective and should be nearly identical when
performed by different
13
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
observers within a short time frame, e.g., body weight, heart rate. Other
qualitative measures, such as
some aspects of mNIS+7 (e.g., response to touch-pressure, vibration, joint
position and motion) and
Norfolk-Quality of Life (e.g., pain level, hot or cold hands and feet,
steadiness while standing) may vary
more from day to day, and from one observer to another. Therefore, composite
scores are used to
aggregate observations and larger variations between observers are expected
without any indication of
clinically relevant change. Assays for biomarker levels have known levels of
variations within and
between samples. Determination of a clinically relevant difference is within
the ability of one of skill in
the art, e.g., a health care professional experienced in treating patients
with TTR associated diseases,
clinical laboratory professional.
As used herein, "chronically administered" is understood as administration for
an indefinite
interval, e.g., for the remainder of the life of the subject, until liver
transplant.
As used herein, a "therapeutic agent that stabilizes TTR" or "that stabilizes
a TTR tetramer" is
an agent that reduces or prevents the dissociation of the subunits of a TTR
tetramer, e.g., into
monomers. In some embodiments, the agent reduces the formation of TTR amyloid
plaques, e.g., by
reducing the level of TTR monomers or proteolytic fragments of TTR monomers
that form TTR
amyloid plaques. Such agents include, but are not limited to, tafamidis,
diflunisal, and AG10.
As used herein, the term "administering a therapeutic agent" is understood as
providing a
therapeutic agent to a subject. In embodiments, the therapeutic agent is
provided at an appropriate
dosage and by a route of administration for the agent as provided, for
example, by the label of the
therapeutic agent.
II. Methods for Treating a TTR-Associated Disease
The present invention provides double stranded RNAi agents and their use in
methods for
treating a TTR-associated disease in a human subject, such as a transthyretin-
mediated amyloidosis
(ATTR amyloidosis), e.g., hereditary ATTR (h-ATTR) amyloidosis or non-
heriditary ATTR (wt ATTR)
amyloidosis; or for inhibiting expression of TTR in a subject that does not
yet meet the diagnostic
criteria of a TTR-associated disease, but who is at risk for developing a TTR-
associated disease, e.g., a
subject with a TTR mutation associated with TTR amyloidosis, a subject with
some indicia of TTR
amyloidosis who does not yet meet the diagnostic criteria of TTR amyloidosis,
a subject with altered
biomarker levels associated with TTR amyloidosis. The methods include
administering to the subject a
therapeutically effective amount of an RNAi agent of the invention.
In one aspect, the present invention provides methods of treating a human
subject suffering
from a TTR-associated disease or at risk for developing a TTR-associated
disease. The methods include
administering to the human subject a fixed dose of about 25 mg to about 1000
mg of a double stranded
RNAi agent
wherein the sense strand comprises the modified nucleotide sequence 5'-
usgsggauUfuCfAfUfguaaccaaga-3' (SEQ ID NO: 6); and the antisense strand
comprises the modified
nucleotide sequence 5'-usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3' (SEQ ID NO: 7),
14
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
wherein a, c, g, and u are 2'-0-methyladenosine-3'-phosphate, 2'-0-
methylcytidine-3'-
phosphate, 2'-0-methylguanosine-3' -phosphate, and 2'-0-methyluridine-3'-
phosphate, respectively;
Af, Cf, Gf, and Uf are 2' -fluoroadenosine-3'-phosphate, 2' -fluorocytidine-3'
-phosphate, 2'-
fluoroguanosine-3'-phosphate, and 2'-fluorouridine-3'-phosphate, respectively;
(Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer; and
s is a phosphorothioate linker.
In another aspect, the present invention provides methods of improving at
least one indicia of
neurological impairement or quality of life in a human subject suffering from
a TTR-associated disease
or at risk for developing a TTR-associated disease. The methods include
administering to the human
subject a fixed dose of about 25 mg to about 1000 mg of a double stranded RNAi
agent wherein the
sense strand comprises the modified nucleotide sequence 5'-
usgsggauUfuCfAfUfguaaccaaga-3' (SEQ
ID NO: 6); and the antisense strand comprises the modified nucleotide sequence
5'-
usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3' (SEQ ID NO: 7).
In another aspect, the present invention provides methods of reducing,
slowing, or arresting a
.. Neuropathy Impairment Score (NIS) or a modified NIS (mNIS+7) in a human
subject suffering from a
TTR-associated disease or at risk for developing a TTR-associated disease. The
methods include
administering to the human subject a fixed dose of about 25 mg to about 1000
mg of a double stranded
RNAi agent wherein the sense strand comprises the modified nucleotide sequence
5'-
usgsggauUfuCfAfUfguaaccaaga-3' (SEQ ID NO: 6); and the antisense strand
comprises the modified
nucleotide sequence 5'-usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3' (SEQ ID NO: 7).
In another aspect, the present invention provides methods of increasing a 6-
minute walk test
(6MWT) in a human subject suffering from a TTR-associated disease or at risk
for developing a TTR-
associated disease. The methods include administering to the human subject a
fixed dose of about 25
mg to about 1000 mg of a double stranded RNAi agent wherein the sense strand
comprises the modified
nucleotide sequence 5'-usgsggauUfuCfAfUfguaaccaaga-3' (SEQ ID NO: 6); and the
antisense strand
comprises the modified nucleotide sequence 5'-
usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3' (SEQ ID
NO: 7).
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
about once per quarter to about once per year. In certain embodiments, the
double stranded RNAi agent
is administered to the human subject about once per quarter, about once every
six months, or about once
per year.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
at a fixed dose of about 25 mg to about 300 mg. In certain embodiments, the
double stranded RNAi
agent is administered to the human subject at a fixed dose of about 25 mg to
about 200 mg. In certain
embodiments, the double stranded RNAi agent is administered to the human
subject at a fixed dose of
about 75 mg to about 200 mg. In certain embodiments, the double stranded RNAi
agent is administered
to the human subject at a fixed dose of about 25 mg. In certain embodiments,
the double stranded RNAi
agent is administered to the human subject at a fixed dose of about 50 mg. In
certain embodiments, the
double stranded RNAi agent is administered to the human subject at a fixed
dose of about 75 mg. In
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
certain embodiments, the double stranded RNAi agent is administered to the
human subject at a fixed
dose of about 100 mg. In certain embodiments, the double stranded RNAi agent
is administered to the
human subject at a fixed dose of about 200 mg. In certain embodiments, the
double stranded RNAi
agent is administered to the human subject at a fixed dose of about 25 mg to
about 300 mg; about 25 mg
to about 200 mg; about 50 mg to about 300 mg; about 25 mg; about 50 mg; about
100 mg; about
200mg; or about 300 mg once per quarter, i.e., about once every three months.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
at a fixed dose of about 400 mg to about 600 mg. In certain embodiments, the
double stranded RNAi
agent is administered to the human subject at a fixed dose of about 400 mg or
about 600 mg about once
every six months to about once per year. In certain embodiments, the double
stranded RNAi agent is
administered to the human subject at a fixed dose of about 400 mg or about 600
mg about once every
six months or about once per year.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
at a fixed dose of about 700 mg to about 1000 mg or about 700 mg to about 900
mg. In certain
.. embodiments, the double stranded RNAi agent is administered to the human
subject at a fixed dose of
about 700 mg, about 800 mg, about 900mg, or about 1000 mg about once per year.
In an embodiment, the subject is a human being treated or assessed for a
disease, disorder or
condition that would benefit from reduction in TTR gene expression; a human at
risk for a disease,
disorder or condition that would benefit from reduction in TTR gene
expression, e.g., a human who does
not meet the diagnostic criteria of a TTR-associated disease, but who
demonstrates at least one sign or
symptom of a TTR-associated disease or has at least one risk factor of
developing a TTR associated
disease; a human having a disease, disorder or condition that would benefit
from reduction in TTR gene
expression; or human being treated for a disease, disorder or condition that
would benefit from
reduction in TTR gene expression, as described herein.
In some embodiments, the human subject is suffering from a TTR-associated
disease. In other
embodiments, the subject is a subject at risk for developing a TTR-associated
disease, e.g., a subject
with a TTR gene mutation that is associated with the development of a TTR
associated disease, a
subject with a family history of TTR-associated disease, or a subject who has
signs or symptoms
suggesting the development of TTR associated disease without meeting the
diagnostic criteria for a
TTR-associated disease.
A "TTR-associated disease," as used herein, includes any disease caused by or
associated with
the formation of amyloid deposits in which the fibril precurosors consist of
variant or wild-type TTR
protein. Mutant and wild-type TTR give rise to various forms of amyloid
deposition (amyloidosis).
Amyloidosis involves the formation and aggregation of misfolded proteins,
resulting in extracellular
.. deposits that impair organ function. Climical syndromes associated with TTR
aggregation include, for
example, senile systemic amyloidosis (SSA); systemic familial amyloidosis;
familial amyloidotic
polyneuropathy (FAP); familial amyloidotic cardiomyopathy (FAC); and
leptomeningeal amyloidosis,
also known as leptomeningeal or meningocerebrovascular amyloidosis, central
nervous system (CNS)
amyloidosis, or amyloidosis VII form.
16
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
In one embodiment, the RNAi agents of the invention are administered to
subjects suffering
from familial amyloidotic cardiomyopathy (FAC). In another embodiment, the
RNAi agents of the
invention are administered to subjects suffering from FAC with a mixed
phenotype, i.e., a subject
having both cardiac and neurological impairements. In yet another embodiment,
the RNAi agents of the
invention are administered to subjects suffering from FAP with a mixed
phenotype, i.e., a subject
having both neurological and cardiac impairements. In one embodiment, the RNAi
agents of the
invention are administered to subjects suffering from FAP that has been
treated with an orthotopic liver
transplantation (OLT).
In another embodiment, the RNAi agents of the invention are administered to
subjects suffering
from senile systemic amyloidosis (SSA). In other embodiments of the methods of
the invention, RNAi
agents of the invention are administered to subjects suffering from familial
amyloidotic cardiomyopathy
(FAC) and senile systemic amyloidosis (SSA). Normal-sequence TTR causes
cardiac amyloidosis in
people who are elderly and is termed senile systemic amyloidosis (SSA) (also
called senile cardiac
amyloidosis (SCA) or cardiac amyloidosis). SSA often is accompanied by
microscopic deposits in
many other organs. TTR mutations accelerate the process of TTR amyloid
formation and are the most
important risk factor for the development of clinically significant TTR
amyloidosis (also called ATTR
(amyloidosis-transthyretin type)). More than 85 amyloidogenic TTR variants are
known to cause
systemic familial amyloidosis.
In some embodiments of the methods of the invention, RNAi agents of the
invention are
administered to subjects suffering from transthyretin (TTR)-related familial
amyloidotic polyneuropathy
(FAP). Such subjects may suffer from ocular manifestations, such as vitreous
opacity and glaucoma. It
is known to one of skill in the art that amyloidogenic transthyretin (ATTR)
synthesized by retinal
pigment epithelium (RPE) plays important roles in the progression of ocular
amyloidosis. Previous
studies have shown that panretinal laser photocoagulation, which reduced the
RPE cells, prevented the
progression of amyloid deposition in the vitreous, indicating that the
effective suppression of ATTR
expression in RPE may become a novel therapy for ocular amyloidosis (see,
e.g., Kawaji, T., et al.,
Ophthalmology. (2010) 117: 552-555). Another TTR-associated disease is
hyperthyroxinemia, also
known as "dystransthyretinemic hyperthyroxinemia" or "dysprealbuminemic
hyperthyroxinemia". This
type of hyperthyroxinemia may be secondary to an increased association of
thyroxine with TTR due to a
mutant TTR molecule with increased affinity for thyroxine. See, e.g., Moses et
al. (1982) J. Clin.
Invest., 86, 2025-2033.
The RNAi agents of the invention may be administered to a subject using any
mode of
administration known in the art, including, but not limited to subcutaneous,
intravenous, and
intramuscular injection, and any combinations thereof.
In some embodiments, the agents are administered to the subject
subcutaneously.
In some embodiments, a subject is administered a single dose of an RNAi agent
via
subcutaneous injection, e.g., abdominal, thigh, or upper arm injection. In
other embodiments, a subject
is administered a split dose of an RNAi agent via subcutaneous injection. In
one embodiment, the split
dose of the RNAi agent is administered to the subject via subcutaneous
injection at two different
17
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
anatomical locations on the subject. For example, the subject may be
subcutaneously injected
subcutaneously at a dose of 25 mg to 1000 mg. In some embodiments of the
invention, the
subcutaneous administration is self-administration via, e.g., a pre-filled
syringe or auto-injector syringe.
In some embodiments, a dose of the RNAi agent for subcutaneous administration
is contained in a
volume of less than or equal to one ml of, e.g., a pharmaceutically acceptable
carrier. In some
embodiments, the RNAi agent is in a non-pyrogenic formulation.
In some embodiments, the RNAi agent is administered to a subject in an amount
effective to
inhibit TTR expression in a cell within the subject. The amount effective to
inhibit TTR expression in a
cell within a subject may be assessed using methods discussed below, including
methods that involve
assessment of the inhibition of TTR mRNA, TTR protein, or related variables,
such as amyloid deposits.
In some embodiments, the RNAi agent is administered to a subject in a
therapeutically effective
amount.
"Therapeutically effective amount," as used herein, is intended to include the
amount of an
RNAi agent that, when administered to a patient for treating a TTR associated
disease, is sufficient to
effect treatment of the disease (e.g., by diminishing, maintaining, or slowing
the progression of the
existing disease as compared to an appropriate control; or diminishing,
maintaining, or slowing one or
more symptoms of disease as compared to an appropriate control). The
"therapeutically effective
amount" may vary depending on the RNAi agent, how the agent is administered,
the disease and its
severity and the history, age, weight, family history, genetic makeup, stage
of pathological processes
mediated by TTR expression, the types of preceding or concomitant treatments,
if any, and other
individual characteristics of the patient to be treated. Diagnostic criteria
for TTR amyloidosis,
polyneuropathies, and cardiomyopathies are discussed further below.
"Therapeutically effective amount," as used herein, is intended to include the
amount of an
RNAi agent that, when administered to a subject who does not yet meet the
diagnositic criteria of a
TTR-associated disease, e.g., a subject who has not been diagnosed with hTTR
amyloidosis
polyneuropathy; a subject who does not meet the diagnostic criteria of Stage 1
FAP, but who may be
predisposed to the disease, e.g., a subject with a TTR mutation associated
with TTR amyloidosis, a
subject suffering from one or more of orthostatic hypotension, heart failure,
cardiac arrhythmia, left
ventricular wall thickness, interventricular septal wall thickness, cardiac
posterior wall thickness
diarrhea, constipation, erectile dysfunction, glaucoma, intravitreal
deposition, scalloped pupils; carpal
tunnel syndrome, lumbar spinal stenosis, and bicep tendon rupture; a subject
with an elevated
neurofilament light chain (NfL) level as compared to a reference sample, e.g.,
a Nfl level of at least 37
pg/ml in serum, is sufficient to prevent or ameliorate the disease or one or
more symptoms of the
disease. Symptoms that may be ameliorated include sensory neuropathy (e.g.,
paresthesia, hypesthesia
in distal limbs), autonomic neuropathy (e.g., gastrointestinal dysfunction,
such as gastric ulcer, or
orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy,
polyneuropathy, carpal
tunnel syndrome, autonomic insufficiency, cardiomyopathy, vitreous opacities,
renal insufficiency,
nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial
nerve dysfunction,
corneal lattice dystrophy, left lventricular (LV) wall thickening by
echocardiographic assessment,
18
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
increased global longitudinal strain by echocardiographic assessment,
increased N-terminal prohormone
B-type Natriuretic Peptide (NTproBNP), and hospitalization due to cardiac
event. Diminishing the
disease includes slowing the course of the disease or reducing the severity of
later-developing disease.
The dose may vary depending on the RNAi agent, how the agent is administered,
the degree of risk of
disease, and the history, age, weight, family history, genetic makeup, the
types of preceding or
concomitant treatments, if any, and other individual characteristics of the
patient to be treated.
A "therapeutically-effective amount" also includes an amount of an RNAi agent
that produces
some desired local or systemic effect at a reasonable benefit/risk ratio
applicable to any treatment. RNAi
agents employed in the methods of the present invention may be administered in
a sufficient amount to
produce a reasonable benefit/risk ratio applicable to such treatment.
As used herein, the phrase "therapeutically effective amount" also includes an
amount that
provides a benefit in the treatment, prevention, or management of pathological
processes or symptom(s)
of pathological processes mediated by TTR expression. Symptoms of TTR
amyloidosis include sensory
neuropathy (e.g. paresthesia, hypesthesia in distal limbs), autonomic
neuropathy (e.g., gastrointestinal
dysfunction, such as gastric ulcer, or orthostatic hypotension), motor
neuropathy, seizures, dementia,
myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic insufficiency,
cardiomyopathy,
vitreous opacities, renal insufficiency, nephropathy, substantially reduced
mBMI (modified Body Mass
Index), cranial nerve dysfunction, corneal lattice dystrophy, left
lventricular (LV) wall thickening by
echocardiographic assessment, increased global longitudinal strain by
echocardiographic assessment,
increased N-terminal prohormone B-type Natriuretic Peptide (NTproBNP), and
hospitalization due to
cardiac event.
In one embodiment, for example, when the subject has FAP, FAP with mixed
phenotype, FAC
with mixed phenotype, or FAP and has had an OLT, treatment of the subject with
a dsRNA agent of the
invention slows the progression of neuropathy. In another embodiment, for
example, when the subject
has FAP, FAP with mixed phenotype, FAC with mixed phenotype, SSA, or FAP and
has had an OLT,
treatment of the subject with a dsRNA agent of the invention slows the
progression of neuropathy and
cardiomyopathy. In another embodiment, for example, when the subject has
cardiac involvement, the
method of the invention improve cardiac structure and function, including, for
example, the methods
reduce the mean left ventricular wall thickness and longitudinal strain, and
reduce the expression level
of the cardiac stress biomarker, N-terminal pro b-type natriuretic peptide (NT-
proBNP).
Adminsitration of a therapeutically or prophylactically effective amount of
the RNAi agent of
the invention is also useful in methodsfor improving at least one indicia of
neurological impairment or
quality of life in a subject suffering from or at risk of developing a TTR-
associated disease.
For example, in one embodiment, the methods of the invention improve at least
indicia of
neurological impairment in the subject. "Improving at least one indicia of
neurological impairment" in
the subject refers to the ability of the methods of the invention to slow,
reduce, or arrest neurological
impairment, or improve any symptom associated with neurological impairment.
Any suitable measure
of neurological impairment can be used to determine whether a subject has
reduced, slowed, or arrested,
neurological impairment, or an improvement of a symptom associated with
neurological impairment.
19
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
One suitable measure is a Neuropathy Impairment Score (NIS). NIS refers to a
scoring system
that measures weakness, sensation, and reflexes, especially with respect to
peripheral neuropathy. The
NIS score evaluates a standard group of muscles for weakness (1 is 25% weak, 2
is 50% weak, 3 is 75%
weak, 3.25 is movement against gravity, 3.5 is movement with gravity
eliminated, 3.75 is muscle flicker
without movement, and 4 is paralyzed), a standard group of muscle stretch
reflexes (0 is normal, 1 is
decreased, 2 is absent) , and touch-pressure, vibration, joint position and
motion, and pinprick (all
graded on index finger and big toe: 0 is normal, 1 is decreased, 2 is absent).
Evaluations are corrected
for age, gender, and physical fitness.
In one embodiment, the methods of the invention reduce a NIS by at least 5
points at 18 months
from the start of dosing. In other embodiments, the methods of the invention
result in a stabilization of
NIS at 18 months from the start of treatment with an RNAi agent provided
herein. In other
embodiments, the methods slow an increasing NIS score as compared to an
appropriate control group
showing the natural history of the disease, e.g., a placebo control group as
provided, for example in
Adams et al., N Engl J Med 2018;379:11-21. It is understood that the rate of
disease progression is
dependent upon a number of factors including, but not limited to, the severity
of disease in the subject at
the initiation of treatment, the duration of treatment, prior treatments, and
the specific TTR mutation
present, if any.
Methods for determining a NIS in a human subject are well known to one of
skill in the art and
can be found in, for example, Dyck, PJ et al., (1997) Neurology 1997. 49(1):
pgs. 229-239); Dyck PJ.
(1988) Muscle Nerve. Jan; 11(1):21-32.
Another suitable measurement of neurological impairment is a Modified
Neuropathy
Impairment Score (mNIS+7). As known to one of ordinary skill in the art,
mNIS+7 refers to a clinical
exam-based assessment of neurologic impairment (NIS) combined with
electrophysiologic measures of
small and large nerve fiber function (NCS and QST), and measurement of
autonomic function (postural
blood pressure). The mNIS+7 score is a modification of the NIS+7 score (which
represents NIS plus
seven tests). NIS+7 analyzes weakness and muscle stretch reflexes. Five of the
seven tests include
attributes of nerve conduction. These attributes are the peroneal nerve
compound muscle action
potential amplitude, motor nerve conduction velocity and motor nerve distal
latency (MNDL), tibial
MNDL, and sural sensory nerve action potential amplitudes. These values are
corrected for variables of
age, gender, height, and weight. The remaining two of the seven tests include
vibratory detection
threshold and heart rate decrease with deep breathing.
The mNIS+7 score modifies NIS+7 to take into account the use of Smart
Somatotopic
Quantitative Sensation Testing, new autonomic assessments, and the use of
compound muscle action
potential of amplitudes of the ulnar, peroneal, and tibial nerves, and sensory
nerve action potentials of
the ulnar and sural nerves (Suanprasert, N. et al., (2014) J. Neurol. Sci.,
344(1-2): pgs. 121-128).
In one embodiment, the methods of the invention reduce a mNIS+7 by at least 5
points at 18
months from the start of dosing. In other embodiments, the methods of the
invention result in a
stabilization of mNIS+7 at 18 months from the start of treatment with an RNAi
agent provided herein.
In other embodiments, the methods slow an increasing mNIS+7 score as compared
to an appropriate
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
control group showing the natural history of the disease, e.g., a placebo
control group as provided, for
example in Adams et al., N Engl J Med 2018;379:11-21. It is understood that
the rate of disease
progression is dependent upon a number of factors including, but not limited
to, the severity of disease
in the subject at the initiation of treatment, the duration of treatment,
prior treatments, and the specific
.. TTR mutation present, if any.
In another embodiment, the methods of the invention improve at least one
indicia of quality of
life in the subject. "Improving at least one indicia of quality of life" in
the subject refers to the ability of
the methods of the invention to slow or arrest quality of life worsening or
improve quality of life. Any
suitable measure of quality of life can be used to determine whether a subject
has slowed or arrested
.. quality of life worsening, or improved quality of life.
For example, the SF-36@ health survey provides a self-reporting, multi-item
scale measuring
eight health parameters: physical functioning, role limitations due to
physical health problems, bodily
pain, general health, vitality (energy and fatigue), social functioning, role
limitations due to emotional
problems, and mental health (psychological distress and psychological well-
being). Each scale is
.. directly transformed into a 0-100 scale on the assumption that each
question carries equal weight. The
lower the score the more disability. The higher the score the less disability
i.e., a score of zero is
equivalent to maximum disability and a score of 100 is equivalent to no
disability. The survey also
provides a physical component summary and a mental component summary.
In one embodiment, the methods of the invention provide to the subject an
improvement versus
baseline in at least one of the SF- 36 physical health related parameters
(physical health, role-physical,
bodily pain or general health) or in at least one of the SF-36 mental health
related parameters (vitality,
social functioning, role-emotional or mental health). Such an improvement can
take the form of an
increase of, for example at least 2 or at least 3 points, on the scale for any
one or more parameters at 9
months from the start of the dosing.
In other embodiments, the methods of the invention arrest a decreasing SF-36
parameter score
at 9 months from the start of dosing for any one or more parameters, e.g., the
methods result in no
clinically significant change of the SF-36 e.g., within the variation observed
for individuals performing
an SF-36 assessment. In yet other embodiments, the methods of the invention
slow the rate at which a
SF-36 score decreases at 9 months from the start of dosing, e.g., the rate of
decrease of an SF-36 score
in a subject treated with an RNAi agent of the invention as compared to the
rate of decrease of an SF-36
score as compared to an appropriate control group showing the natural history
of the disease, e.g., a
placebo control group as provided, for example in Adams et al., N Engl J Med
2018;379:11-21. It is
understood that the rate of disease progression is dependent upon a number of
factors including, but not
limited to, the severity of disease in the subject at the initiation of
treatment, the duration of treatment,
.. prior treatments, and the specific TTR mutation present, if any.
Another suitable measurement of quality of life is the Norfolk Quality of Life-
Diabetic
Neuropathy (Norfolk QOL-DN) questionnaire. The Norfolk QOL-DN is a validated
comprehensive
questionnaire designed to capture the entire spectrum of DN related to large
fiber, small fiber, and
autonomic neuropathy not captured in existing instruments.
21
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
In one embodiment, the methods of the invention improve a subject's Norfolk
QOL-DN score
from baseline, e.g., a change of about -2.5, -3.0, -3.5, -4.0, -4.5, or -5.0
at 9 months from the start of
treatment with an RNAi agent provided herein. In other embodiments, the
methods arrest an increasing
Norfolk QOL-DN score, e.g., the methods result in no clinically significant
change of theNorfolk QOL-
DN score, e.g., within the variation observed between individuals performing a
QOL-DN assessment.
In yet other embodiments, the methods of the invention slow the rate at which
an QOL-DN score
increases, e.g., the rate of increase of a QOL-DN score in a subject treated
with an RNAi agent of the
invention as compared to the rate of increase of a QOL-DN score as compared to
an appropriate control
group showing the natural history of the disease, e.g., a placebo control
group as provided, for example
in Adams et al., N Engl J Med 2018;379:11-21. It is understood that the rate
of disease progression is
dependent upon a number of factors including, but not limited to, the severity
of disease in the subject at
the initiation of treatment, the duration of treatment, prior treatments, and
the specific TTR mutation
present, if any.
Another suitable measurement of quality of life is motor strength as assessed
by, for example, a
NIS-W score. A NIS-W score is a composite score that summates the weakness of
head, trunk, and
limb muscles. Using the NIS (W) (referring to the portion of the scale
measuring weakness), muscle
power is assessed as normal (0) or complete paralysis (4) with intermediate
grades; 1 representing a
muscle that is deemed 25% weak by clinical strength testing, 2 as 50% weak, 3
as 75% weak, 3.25 as
movement against gravity, 3.50 as movement with gravity eliminated, and 3.75
as muscle flicker.
In one embodiment, the methods of the invention provide to the subject an
improvement versus
baseline in an NIS-W score Such an improvement can take the form of a decrease
of at least 5, 6, 7, 8,
9, or 10 points of the subject's NIS-W score at 18 months from the start of
treatment with an RNAi
agent provided herein. In other embodiments, the methods arrest a decrease NIS-
W score, e.g., the
methods result in no clinically significant increase of the NIS-W score, or a
slowing in the rate of
increase of NIS-W score as compared to an appropriate control group showing
the natural history of the
disease, e.g., a placebo control group as provided, for example in Adams et
al., N Engl J Med
2018;379:11-21. It is understood that the rate of disease progression is
dependent upon a number of
factors including, but not limited to, the severity of disease in the subject
at the initiation of treatment,
the duration of treatment, prior treatments, and the specific TTR mutation
present, if any.
Yet another suitable indicia of quality of life is the Rasch-built Overall
Disability Scale (R-
ODS), which is a a patient questionnaire designed to capture activity and
social participation limitations
in patients. In one embodiment, the methods of the invention provide to the
subject an improvement
versus baseline in an R-ODS score. Such an improvement can take the form of an
increase of at least 2,
for example at least 2, 3, 4, or 5 points of the subject's R-ODS score at 18
months from the start of
treatment with an RNAi agent provided herein. In other embodiments, the
methods arrest a decreasing
R-ODS score, e.g., the methods result in no clinically significant decrease of
the R-ODS score at 18
months from the start of treatment with an RNAi agent provided herein. In yet
other embodiments, the
methods of the invention slow the rate at which a R-ODS score decreases at 18
months from the start of
treatment with an RNAi agent provided herein, e.g., the rate of decrease of a
R-ODS score in a subject
22
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
treated with an RNAi agent of the invention as compared to the rate of
decrease of a R-ODS score as
compared to an appropriate control group showing the natural history of the
disease, e.g., a placebo
control group as provided, for example in Adams et al., N Engl J Med
2018;379:11-21. It is understood
that the rate of disease progression is dependent upon a number of factors
including, but not limited to,
the severity of disease in the subject at the initiation of treatment, the
duration of treatment, prior
treatments, and the specific TTR mutation present, if any.
The composite autonomic symptom score (COMPASS-31), a patient questionnaire
that assesses
symptoms of dysautonomia autonomic which provides a symptom score from 0 to
100, is another
suitable indicia of quality of life. In one embodiment, the methods of the
invention provide to the
subject an improvement versus baseline in a COMPASS-31 score. Such an
improvement can take the
form of an increase of at least 5, for example at least 5, 6, 7, 8, 9, or 10,
points of the subject's
COMPASS-31 score at 18 months from the start of treatment with an RNAi agent
provided herein. In
other embodiments, the methods arrest a decreasing COMPASS-31 score, e.g., the
methods result in no
clinically relevant change of the COMPASS-31 score at 18 months from the start
of treatment with an
RNAi agent provided herein. In yet other embodiments, the methods of the
invention slow the rate at
which a COMPASS-31 score decreases, e.g., the rate of decrease of a COMPASS-31
score at 18 months
from the start of treatment with an RNAi agent provided herein in a subject
treated with an RNAi agent
of the invention as compared to the rate of decrease of a COMPASS-31 score as
compared to an
appropriate control group showing the natural history of the disease, e.g., a
placebo control group as
provided, for example in Adams et al., N Engl J Med 2018;379:11-21. It is
understood that the rate of
disease progression is dependent upon a number of factors including, but not
limited to, the severity of
disease in the subject at the initiation of treatment, the duration of
treatment, prior treatments, and the
specific TTR mutation present, if any.
Other quality of life indicia may include nutritional status (e.g., as
assessed by change in median
body mass index (mBMI). In one embodiment, the methods of the invention
provide to the subject an
improvement versus baseline in mBMI. Such an improvement can take the form of
a mBMI score
increase of at least 2, 3, 4, 5, or more at 18 months from the start of
treatment with an RNAi agent
provided herein. In other embodiments, the methods arrest a decreasing mBMI
index score, e.g., the
methods result in no clinically significant change of the mBMI score at 18
months from the start of
treatment with an RNAi agent provided herein. In yet other embodiments, the
methods of the invention
slow the rate at which mBMI score decreases, e.g., the rate of decrease of a
mBMI score at 18 months
from the start of treatment with an RNAi agent provided herein in a subject
treated with an RNAi agent
of the invention as compared to the rate of decrease of a mBMI score in a
subject as compared to an
appropriate control group showing the natural history of the disease, e.g., a
placebo control group as
provided, for example in Adams et al., N Engl J Med 2018;379:11-21. It is
understood that the rate of
disease progression is dependent upon a number of factors including, but not
limited to, the severity of
disease in the subject at the initiation of treatment, the duration of
treatment, prior treatments, and the
specific TTR mutation present, if any.
23
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
Another quality of life indicia includes assessment of exercise capacity. One
suitable measure
of exercise capacity is a 6-minute walk test (6MWT), which measures how far
the subject can walk in 6
minutes, i.e., the 6-minute walk distance (6MWD). In one embodiment, the
methods of the invention
provide to the subject an increase from baseline in the 6MWD by at least 10
meters, e.g., at least 10, 15,
20, or about 30 meters at 18 months from the start of treatment with an RNAi
agent provided herein.
Another suitable measure is the 10-meter walk test which measures gait speed.
In one
embodiment, the methods of the invention provide to the subject an increase
from baseline in the 10-
meter walk test by at least 0.025 meters/second, e.g., at least 0.025, 0.03,
0.04, 0.05, 0.06, 0.07, 0.08,
0.09, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4Ø 4.5, or about 5.0 meters/second at 18
months from the start of
treatment with an RNAi agent provided herein.
In some embodiments, a change in a plasma biomarker level is an indicia of a
decrease in
ongoing nerve damage or progression of polyneuropathy in ATTR amyloidosis. For
example, a
decrease in the level of neurofilament light chain (NfL) at 9 months as
compared to an NfL level at the
start of treatment can be an indicia of a decrease in ongoing nerve damage or
progression of
polyneuropathy in ATTR amyloidosis. In certain embodiments, a decrease in the
level of other proteins,
especially RSP03, CCDC80, EDA2R, and NT-proBNP, either alone or in combination
with a decrease
in NfL level at 9 months from the start of treatment as compared to its
corresponding level at the start of
treatment can be an indicia of a decrease in ongoing nerve damage or
progression of polyneuropathy in
ATTR amyloidosis. In certain embodiments, an increase in the level of N-CDase,
either alone or in
combination with the other markers listed above, at 9 months from the start of
treatment as compared to
an its corresponding level at the start of treatment can be an indicia of a
decrease in ongoing nerve
damage or progression of polyneuropathy in ATTR amyloidosis. Further
biomarkers that can act as
indicia of a decrease in nerve damage or polyneuropathy in ATTR amyloidosis,
such as at 9 months
from the initiation of treatment with an RNAi agent provided herein, are
provided in Table 1. A
decrease in ongoing nerve damage or progression of polyneuropathy in ATTR
amyloidosis is correlated
with a decrease in the proteins having a positive beta coefficient. A decrease
in ongoing nerve damage
or progression of polyneuropathy in ATTR amyloidosis is correlated with an
increase in proteins having
a negative beta coefficient. It is understood that the change in the biomarker
level is a statistically
significant change, i.e., a change larger than the inherent variability of the
assay.
In certain embodiments, the methods of the invention provide an improvement in
cardiovascular
indicia, e.g., increase in Kansas City Cardiomyopathy Questionnaire Overall
Summary (KCCQ-OS),
decreased left lventricular (LV) wall thickening by echocardiographic
assessment as compared to
baseline, decreased global longitudinal strain by echocardiographic assessment
as compared to baseline,
decreased N-terminal prohormone B-type Natriuretic Peptide (NTproBNP) as
compared to baseline, and
decrease in hospitalization due to cardiac event.
The methods of the present invention may also improve the prognosis of the
subject being
treated. For example, the methods of the invention may provide to the subject
a reduction in probability
of a clinical worsening event during the treatment period, or an increased
longevity, or decreased
hospitalization as compared to an appropriate control group showing the
natural history of the disease,
24
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
e.g., a placebo control group as provided, for example in Adams et al., N Engl
J Med 2018;379:11-21.
In certain embodiments, a reduction in the probability of a clinical worsening
event during the treatment
can include a decrease in all-cause mortality or rates of cardiovascular-
related hospitalization as
assessed, e.g., according to the Finkelstein¨Schoenfeld method, as compared to
an appropriate control
group, as provided, for example, in Maurer et al., N Engl J Med 2018:379:11-
21. It is understood that
the rate of disease progression is dependent upon a number of factors
including, but not limited to, the
severity of disease in the subject at the initiation of treatment, the
duration of treatment, prior
treatments, and the specific TTR mutation present, if any.
The dose of an RNAi agent that is administered to a subject may be tailored to
balance the risks
and benefits of a particular dose, for example, to achieve a desired level of
inhibition of TTR gene
expression (as assessed, e.g., based on TTR mRNA expression, TTR protein
expression, or a reduction
in an amyloid deposit, as defined above) or a desired therapeutic effect,
while at the same time avoiding
undesirable side effects.
In one embodiment, an iRNA agent of the invention is administered to a subject
as a "fixed
dose" (e.g., a dose in mg) means that one dose of an iRNA agent is used for
all subjects regardless of
any specific subject-related factors, such as weight.
In some embodiments, the RNAi agent is administered as a fixed dose of about
25 mg to about
1000 mg, e.g., about 25 mg, about 50 mg, about 100 mg, about 200 mg, about 300
mg, about 400 mg,
about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, or about
1000 mg.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
about once per quarter to about once per year. In certain embodiments, the
double stranded RNAi agent
is administered to the human subject about once per quarter, about once every
six months, or about once
per year.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
at a fixed dose of about 25 mg to about 300 mg. In certain embodiments, the
double stranded RNAi
agent is administered to the human subject at a fixed dose of about 25 mg to
about 200 mg. In certain
embodiments, the double stranded RNAi agent is administered to the human
subject at a fixed dose of
about 75 mg to about 200 mg. In certain embodiments, the double stranded RNAi
agent is administered
to the human subject at a fixed dose of about 25 mg. In certain embodiments,
the double stranded RNAi
agent is administered to the human subject at a fixed dose of about 50 mg. In
certain embodiments, the
double stranded RNAi agent is administered to the human subject at a fixed
dose of about 75 mg. In
certain embodiments, the double stranded RNAi agent is administered to the
human subject at a fixed
dose of about 100 mg. In certain embodiments, the double stranded RNAi agent
is administered to the
human subject at a fixed dose of about 200 mg. In certain embodiments, the
double stranded RNAi
agent is administered to the human subject at a fixed dose of about 25 mg to
about 300 mg; about 25 mg
to about 200 mg; about 75 mg to about 200 mg; about 25 mg; about 50 mg; about
100 mg; about
200mg; or about 300 mg once per quarter, i.e., about once every three months.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
at a fixed dose of about 400 mg to about 600 mg. In certain embodiments, the
double stranded RNAi
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
agent is administered to the human subject at a fixed dose of about 400 mg or
about 600 mg about once
every six months to about once per year. In certain embodiments, the double
stranded RNAi agent is
administered to the human subject at a fixed dose of about 400 mg or about 600
mg about once every
six months or about once per year.
In certain embodiments, the double stranded RNAi agent is administered to the
human subject
at a fixed dose of about 700 mg to about 1000 mg or about 700 mg to about 900
mg. In certain
embodiments, the double stranded RNAi agent is administered to the human
subject at a fixed dose of
about 700 mg, about 800 mg, about 900mg, or about 1000 mg about once per year.
In certain embodiments, the administration is subcutaneous administration,
e.g., self-
administration via, e.g., a pre-filled syringe or auto-injector syringe. In
some embodiments, a dose of
the RNAi agent for subcutaneous administration is contained in a volume of
less than or equal to one ml
of, e.g., a pharmaceutically acceptable carrier.
Any of these schedules may optionally be repeated for one or more iterations.
The number of
iterations may depend on the achievement of a desired effect, e.g., the
suppression of a TTR gene,
retinol binding protein level, vitamin A level, or the achievement of a
therapeutic effect, e.g., reducing
an amyloid deposit or reducing a symptom of a TTR-associated disease. In
certain embodiments, the
iRNA agent is administered chronically, for an indefinite period of time,
e.g., throughout the life of the
patient.
In some embodiments, the RNAi agent is administered with other therapeutic
agents or other
therapeutic regimens. For example, other agents or other therapeutic regimens
suitable for treating a
TTR-associated disease may include a liver transplant, a heart transplant,
implantation of a pacemaker,
an agent which can reduce monomer TTR levels in the body; Tafamidis (Vyndaqel
or Vyndamax@) or
AG10, which kinetically stabilizes the TTR tetramer preventing tetramer
dissociation required for TTR
amyloidogenesis; nonsteroidal anti-inflammatory drugs (NSAIDS), e.g.,
diflunisal, and diuretics, which
may be employed, for example, to reduce edema in TTR amyloidosis with cardiac
involvement.
In one embodiment, a subject is administered an initial dose and one or more
maintenance doses
of an RNAi agent. The maintenance dose or doses can be the same or lower than
the initial dose, e.g.,
one-half of the initial dose. Following treatment, the patient can be
monitored for changes in his/her
condition.
In some embodiments of the methods of the invention, expression of a TTR gene
as assessed by
serum or plasma TTR levels is inhibited by at least 85%, in some embodiments
at least 90%. It is
understood that inhibition of TTR expression using the iRNA agents provided
herein would inhibit
expression of TTR in the liver and not substantially in other tissues, e.g.,
TTR expression in the eye.
The term "inhibiting," as used herein, is used interchangeably with
"reducing," "silencing,"
"downregulating", "suppressing", and other similar terms, and includes any
level of inhibition. In some
embodiments, inhibiting includes a statistically significant or clinically
significant inhibition.
The phrase "inhibiting expression of a TTR" is intended to refer to inhibition
of expression of
any TTR gene including variants or mutants of a TTR gene. Thus, the TTR gene
may be a wild-type
TTR gene, a mutant TTR gene (such as a mutant TTR gene giving rise to amyloid
deposition).
26
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
Inhibition may be assessed by a decrease in an absolute or relative level of
one or more
variables that are associated with TTR expression compared with a control
level. The control level may
be any type of control level that is utilized in the art, e.g., a pre-dose
baseline level, or a level
determined from a similar subject, cell, or sample that is untreated or
treated with a control (such as,
e.g., buffer only control or inactive agent control). As used herein,
inhibition of TTR expression is
typically assessed by determining a TTR level in an appropriate sample (e.g.,
historical control sample,
level determined in a normal sample or clinical trial) or before treatment of
the subject with an iRNA
agent, such as those provided herein or in PCT publications W02010048228,
W02013075035, and
W02017023660, or other agent, e.g., antisense oligonucleotide agent, dicer
substrate agent, that inhibits
the expression of TTR, see, e.g., W02011139917 and W02015085158; and after
treatment with an
iRNA agent provided herein. It is understood that the iRNA agents provided
herein are durable but slow
acting. Therefore, the level of knockdown is determined after sufficient time
to reach nadir, e.g., at least
3 weeks after first dose of the iRNA agent in a human subject, or when steady
state of TTR knockdown
has been achieved, e.g., after multiple doses with an iRNA agent provided
herein.
Inhibition of the expression of a TTR gene may be manifested by a reduction of
the amount of
mRNA expressed by a first cell or group of cells (such cells may be present,
for example, in a sample
derived from a subject) in which a TTR gene is transcribed and which has or
have been treated (e.g., by
contacting the cell or cells with an RNAi agent of the invention, or by
administering an RNAi agent of
the invention to a subject in which the cells are or were present) such that
the expression of a TTR gene
is inhibited, as compared to a second cell or group of cells substantially
identical to the first cell or
group of cells but which has not or have not been so treated (control
cell(s)). In some embodiments, the
percent inhibition is assessed by expressing the level of mRNA in treated
cells as a percentage of the
level of mRNA in control cells, using the following formula:
(mRNA in control cells) - (mRNA in treated cells)
____________________________________________ 100%
(mRNA in control cells)
A similar calculation may be performed on serum TTR protein concentrations,
e.g., in a blood
sample obtained froma subject, to determine percent inhibition of expression.
If no TTR is detected in
the serum or plasma sample after treatment, the amount of TTR present is
considered to be the at the
lower limit of detection of the assay used.
In some embodiments, the percent inhibition is determined using a validated
and clinically
acceptable method.
Alternatively, inhibition of the expression of a TTR gene may be assessed in
terms of a
reduction of a parameter that is functionally linked to TTR gene expression,
e.g., TTR protein
expression, retinol binding protein level, vitamin A level, or presence of
amyloid deposits comprising
TTR. TTR gene silencing may be determined in any cell expressing TTR, either
constitutively or by
genomic engineering, and by any assay known in the art. The liver is the major
site of TTR gene
expression. Other significant sites of expression include the retina and
choroid plexus.
27
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
III. iRNAs of the Invention
Suitable iRNAs for use in the methods of the present invention include double
stranded
ribonucleic acid (dsRNA) molecules for inhibiting the expression of a TTR gene
in a cell, such as a cell
within a subject, e.g., a mammal, such as a human having a TTR-associated
disease. The dsRNA
includes an antisense strand having a region of complementarity which is
complementary to at least a
part of an mRNA formed in the expression of a TTR gene. The region of
complementarity is about 21-
30 nucleotides or less in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23,
22, or 21 nucleotides in
length). Upon contact with a cell expressing the TTR gene, the iRNA
selectively inhibits the expression
of the TTR gene (e.g., a human, a non-human primate, or a non-primate mammal
TTR gene) by at least
about 70% as assayed by, for example, real time PCR using the method provided
in Example 4 of
W02013075035 when Hep3B cells are transfected with 10 nM of the iRNA agent
using the method
provided therein.
A dsRNA includes two RNA strands that are complementary and hybridize to form
a duplex
structure under conditions in which the dsRNA will be used. One strand of a
dsRNA (the antisense
strand) includes a region of complementarity that is substantially
complementary, and generally fully
complementary, to a target sequence. The target sequence can be derived from
the sequence of an
mRNA formed during the expression of a TTR gene. The other strand (the sense
strand) includes a
region that is complementary to the antisense strand, such that the two
strands hybridize and form a
duplex structure when combined under suitable conditions. As described
elsewhere herein and as
known in the art, the complementary sequences of a dsRNA can also be contained
as self-
complementary regions of a single nucleic acid molecule, as opposed to being
on separate
oligonucleotides.
Generally, the duplex structure is 21 to 30 base pairs in length. Similarly,
the region of
complementarity to the target sequence is 22 and 30 nucleotides in length.
A dsRNA can be synthesized by standard methods known in the art as further
discussed below.
iRNA compounds of the invention may be prepared using a two-step procedure.
First, the
individual strands of the double stranded RNA molecule are prepared
separately. Then, the component
strands are annealed. The individual strands of the siRNA compound can be
prepared using solution-
phase or solid-phase organic synthesis or both. Organic synthesis offers the
advantage that the
oligonucleotide strands comprising unnatural or modified nucleotides can be
easily prepared. Single-
stranded oligonucleotides of the invention can be prepared using solution-
phase or solid-phase organic
synthesis or both.
IV. Modified iRNAs of the Invention
The iRNA agents for use in the methods of the invention include defined
chemical
modifications in the sense and antisense strand. When the length of either
strand is extended to provide
an antisense strand longer than 23 nucleotides and a sense strand longer than
21 nucleotides, the
nucleotides can include modifications including, but not limited to, sugar
modifications, backbone
modifications, and base modifications.Modifications include, for example, end
modifications, e.g., 5'-
28
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
end modifications (phosphorylation, conjugation, inverted linkages) or 3'-end
modifications
(conjugation, DNA nucleotides, inverted linkages, etc.); base modifications,
e.g., replacement with
stabilizing bases, destabilizing bases, or bases that base pair with an
expanded repertoire of partners,
removal of bases (abasic nucleotides), or conjugated bases; sugar
modifications (e.g., at the 2' -position
or 4'-position) or replacement of the sugar; or backbone modifications,
including modification or
replacement of the phosphodiester linkages. Specific examples of iRNA
compounds useful in the
embodiments described herein include, but are not limited to, RNAs containing
modified backbones or
no natural internucleoside linkages. RNAs having modified backbones include,
among others, those that
do not have a phosphorus atom in the backbone. For the purposes of this
specification, and as
sometimes referenced in the art, modified RNAs that do not have a phosphorus
atom in their
internucleoside backbone can also be considered to be oligonucleosides. In
some embodiments, a
modified iRNA has a phosphorus atom in its internucleoside backbone.
Modified RNA backbones include, for example, phosphorothioates, chiral
phosphorothioates,
phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and
other alkyl
phosphonates including 3'-alkylene phosphonates and chiral phosphonates,
phosphinates,
phosphoramidates including 3'-amino phosphoramidate and
aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters,
and boranophosphates
having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having
inverted polarity wherein
the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to
5'-2'. Various salts, mixed salts
and free acid forms are also included.
Modified RNA backbones that do not include a phosphorus atom therein have
backbones that
are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed
heteroatoms and alkyl or
cycloalkyl internucleoside linkages, or one or more short chain heteroatomic
or heterocyclic
internucleoside linkages. These include those having morpholino linkages
(formed in part from the
.. sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and
sulfone backbones;
formacetyl and thioformacetyl backbones; methylene formacetyl and
thioformacetyl backbones; alkene
containing backbones; sulfamate backbones; methyleneimino and
methylenehydrazino backbones;
sulfonate and sulfonamide backbones; amide backbones; and others having mixed
N, 0, S and CH2
component parts.
In other embodiments, suitable RNA mimetics are contemplated for use in iRNAs,
in which
both the sugar and the internucleoside linkage, i.e., the backbone, of the
nucleotide units are replaced
with novel groups. The base units are maintained for hybridization with an
appropriate nucleic acid
target compound. One such oligomeric compound, an RNA mimetic that has been
shown to have
excellent hybridization properties, is referred to as a peptide nucleic acid
(PNA). In PNA compounds,
the sugar backbone of an RNA is replaced with an amide containing backbone, in
particular an
aminoethylglycine backbone. The nucleobases are retained and are bound
directly or indirectly to aza
nitrogen atoms of the amide portion of the backbone.
Some embodiments featured in the disclosure include RNAs with phosphorothioate
backbones
and oligonucleosides with heteroatom backbones, and in particular --CH2--NH--
CH2-, --CH2--N(CH3)--
29
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
0--CH2-4known as a methylene (methylimino) or MMI backbone], --CH2-0--N(CH3)--
CH2--, --CH2--
N(CH3)--N(CH3)--CH2-- and --N(CH3)--CH2--CH2-- of the above-referenced U.S.
Patent No.
5,489,677, and the amide backbones of the above-referenced U.S. Patent No.
5,602,240. In some
embodiments, the RNAs featured herein have morpholino backbone structures of
the above-referenced
U.S. Patent No. 5,034,506. The native phosphodiester backbone can be
represented as 0-P(0)(OH)-
OCH2-.
Modified RNAs can also contain one or more substituted sugar moieties. The
iRNAs, e.g.,
dsRNAs, featured herein can include one of the following at the 2'-position:
OH; F; 0-, S-, or N-alkyl;
0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or 0-alkyl-0-alkyl, wherein the
alkyl, alkenyl and alkynyl
can be substituted or unsubstituted C1 to C10 alkyl or C2 to Cif) alkenyl and
alkynyl. Exemplary suitable
modifications include ORCH2)110] ll,CH3, 0(CH2).110CH3, 0(CH2)11NE2, 0(CH2)
11CH3, 0(CH2)110NH2,
and 0(CH2)110N(CH2)11CH3)]2, where n and m are from 1 to about 10. In other
embodiments, dsRNAs
include one of the following at the 2' position: C1 to C10 lower alkyl,
substituted lower alkyl, alkaryl,
aralkyl, 0-alkaryl or 0-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3,
502CH3, 0NO2, NO2,
N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino,
polyalkylamino, substituted silyl, an
RNA cleaving group, a reporter group, an intercalator, a group for improving
the pharmacokinetic
properties of an iRNA, or a group for improving the pharmacodynamic properties
of an iRNA, and other
substituents having similar properties. In some embodiments, the modification
includes a
2'-methoxyethoxy (2'-0--CH2CH2OCH3, also known as 2'-0-(2-methoxyethyl) or 2'-
M0E) (Martin et
al., Hely. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another
exemplary modification
is 2'-dimethylaminooxyethoxy, i.e., a 0(CH2)20N(CH3)2 group, also known as 2'-
DMA0E, as described
in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the
art as 2'-0-
dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-0--CH2--0--CH2--N(CH3)2.
Further exemplary
modifications include: 5'-Me-2'-F nucleotides, 5' -Me-2' -0Me nucleotides, 5'-
Me-2'-deoxynucleotides,
(both R and S isomers in these three families); 2'-alkoxyalkyl; and 2'-NMA (N-
methylacetamide).
Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-
OCH2CH2CH2NH2)
and 2'-fluoro (2'-F). Similar modifications can also be made at other
positions on the RNA of an iRNA,
particularly the 3' position of the sugar on the 3' terminal nucleotide or in
2'-5' linked dsRNAs and the 5'
position of 5' terminal nucleotide. iRNAs can also have sugar mimetics such as
cyclobutyl moieties in
place of the pentofuranosyl sugar.
The RNA of an iRNA of the invention can also include nucleobase (often
referred to in the art
simply as "base") modifications or substitutions. As used herein, "unmodified"
or "natural" nucleobases
include the purine bases adenine (A) and guanine (G), and the pyrimidine bases
thymine (T), cytosine
(C) and uracil (U). Modified nucleobases include other synthetic and natural
nucleobases such as
deoxythymidine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine,
xanthine, hypoxanthine,
2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-
propyl and other alkyl
derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-
thiocytosine, 5-halouracil and
cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine,
5-uracil (pseudouracil), 4-
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-
substituted adenines and
guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-
substituted uracils and cytosines,
7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-
deazaguanine and 7-
daazaadenine and 3-deazaguanine and 3-deazaadenine. Certain of these
nucleobases are particularly
.. useful for increasing the binding affinity of the oligomeric compounds
featured in the invention. These
include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6
substituted purines, including
2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-
methylcytosine substitutions have
been shown to increase nucleic acid duplex stability by 0.6-1.2 C (Sanghvi, Y.
S., Crooke, S. T. and
Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton,
1993, pp. 276-278) and
are exemplary base substitutions, even more particularly when combined with 2'-
0-methoxyethyl sugar
modifications.
An RNAi agent of the disclosure can also be modified to include one or more
bicyclic sugar
moities. A "bicyclic sugar" is a furanosyl ring modified by a ring formed by
the bridging of two
carbons, whether adjacent or non-adjacent atoms. A "bicyclic nucleoside"
("BNA") is a nucleoside
having a sugar moiety comprising a ring formed by bridging comprising a bridge
connecting two
carbons, whether adjacent or non-adjacent, two carbon atoms of the sugar ring,
thereby forming a
bicyclic ring system. In certain embodiments, the bridge connects the 4'-
carbon and the 2'-carbon of the
sugar ring, optionally, via the 2'-acyclic oxygen atom. Thus, in some
embodiments an agent of the
disclosure may include one or more locked nucleic acids (LNA). A locked
nucleic acid is a nucleotide
having a modified ribose moiety in which the ribose moiety comprises an extra
bridge connecting the 2'
and 4' carbons. In other words, an LNA is a nucleotide comprising a bicyclic
sugar moiety comprising a
4'-CH2-0-2' bridge. This structure effectively "locks" the ribose in the 3'-
endo structural conformation.
The addition of locked nucleic acids to siRNAs has been shown to increase
siRNA stability in serum,
and to reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids
Research 33(1):439-447; Mook,
OR. et al., (2007) Mol Cane Ther 6(3):833-843; Grunweller, A. et al., (2003)
Nucleic Acids Research
31(12):3185-3193). Examples of bicyclic nucleosides for use in the
polynucleotides of the disclosure
include without limitation nucleosides comprising a bridge between the 4' and
the 2' ribosyl ring atoms.
In certain embodiments, the antisense polynucleotide agents of the disclosure
include one or more
bicyclic nucleosides comprising a 4' to 2' bridge.
A locked nucleoside can be represented by the structure (omitting
stereochemistry),
OH
0
4'
2'
OH
wherein B is a nucleobase or modified nucleobase and L is the linking group
that joins the 2'-
carbon to the 4'-carbon of the ribose ring.
31
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not
limited to 4'-
(CH2)-0-2' (LNA); 4'-(CH2)¨S-2'; 4'-(CH2)2-0-2' (ENA); 4'-CH(CH3)-0-2' (also
referred to as
"constrained ethyl" or "cEt") and 4'-CH(CH2OCH3)-0-2' (and analogs thereof;
see, e.g., U.S. Pat.
No. 7,399,845); 4'-C(CH3)(CH3)-0-2' (and analogs thereof; see e.g., US Patent
No. 8,278,283); 4'-
CH2¨N(OCH3)-2' (and analogs thereof; see e.g., US Patent No. 8,278,425); 4'-
CH2-0¨N(CH3)-2'
(see, e.g.,U.S. Patent Publication No. 2004/0171570); 4'-CH2¨N(R)-0-2',
wherein R is H, C1-C12
alkyl, or a nitrogen protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4'-
CH2¨C(H)(CH3)-2' (see,
e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-
CH2¨C(=CH2)-2' (and analogs
thereof; see, e.g., US Patent No. 8,278,426). The entire contents of each of
the foregoing are hereby
incorporated herein by reference.
Additional representative US Patents and US Patent Publications that teach the
preparation of
locked nucleic acid nucleotides include, but are not limited to, the
following: US Patent Nos. 6,268,490;
6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207;
7,034,133;7,084,125; 7,399,845;
7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426;
8,278,283; US
2008/0039618; and US 2009/0012281, the entire contents of each of which are
hereby incorporated
herein by reference.
Any of the foregoing bicyclic nucleosides can be prepared having one or more
stereochemical
sugar configurations including for example a-L-ribofuranose and I3-D-
ribofuranose (see WO 99/14226).
An RNAi agent of the disclosure can also be modified to include one or more
constrained ethyl
nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a
locked nucleic acid
comprising a bicyclic sugar moiety comprising a 4'-CH(CH3)-0-2' bridge (i.e.,
L in the preceding
structure). In one embodiment, a constrained ethyl nucleotide is in the S
conformation referred to herein
as "S-cEt."
An iRNA of the invention may also include one or more "conformationally
restricted
nucleotides" ("CRN"). CRN are nucleotide analogs with a linker connecting the
C2'and C4' carbons of
ribose or the C3 and -05' carbons of ribose. CRN lock the ribose ring into a
stable conformation and
increase the hybridization affinity to mRNA. The linker is of sufficient
length to place the oxygen in an
optimal position for stability and affinity resulting in less ribose ring
puckering.
One or more of the nucleotides of an iRNA of the invention may also include a
hydroxymethyl
substituted nucleotide. A "hydroxymethyl substituted nucleotide" is an acyclic
2'-3'-seco-nucleotide,
also referred to as an "unlocked nucleic acid" ("UNA") modification.
Potentially stabilizing modifications to the ends of RNA molecules can include
N-
(acetylaminocaproy1)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproy1-4-
hydroxyprolinol (Hyp-C6), N-
(acety1-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-0-deoxythymidine (ether), N-
(aminocaproy1)-4-
hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3'- phosphate, inverted
base dT(idT) and
others. Disclosure of this modification can be found in WO 2011/005861.
Other modifications of the nucleotides of an iRNA of the invention include a
5' phosphate or 5'
phosphate mimic, e.g., a 5'-terminal phosphate or phosphate mimic on the
antisense strand of an RNAi
32
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
agent. Suitable phosphate mimics are disclosed in, for example US Patent
Publication No.
2012/0157511, the entire contents of which are incorporated herein by
reference.
V. iRNAs Conjugated to Ligands
Another modification of the RNA of an iRNA of the invention involves
chemically linking to
the RNA one or more ligands, moieties or conjugates that enhance the activity,
cellular distribution or
cellular uptake of the iRNA. Such moieties include but are not limited to
lipid moieties such as a
cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86:
6553-6556), cholic acid
(Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether,
e.g., beryl-S-tritylthiol
(Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al.,
Biorg. Med. Chem. Let.,
1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res.,
1992, 20:533-538), an
aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et
al., EMBO J, 1991,
10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et
al., Biochimie, 1993,
75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-
ammonium 1,2-di-O-hexadecyl-
rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-
3654; Shea et al., Nucl.
Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol chain
(Manoharan et al.,
Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid
(Manoharan et al.,
Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al.,
Biochim. Biophys. Acta, 1995,
1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol
moiety (Crooke et al., J.
Pharmacol. Exp. Ther., 1996, 277:923-937).
In one embodiment, a ligand alters the distribution, targeting or lifetime of
an iRNA agent into
which it is incorporated. In some embodiments, a ligand provides an enhanced
affinity for a selected
target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or
organ compartment, tissue, organ
or region of the body, as, e.g., compared to a species absent such a ligand.
Exemplary ligands will not
take part in duplex pairing in a duplexed nucleic acid.
Ligands can also include targeting groups, e.g., a cell or tissue targeting
agent, e.g., a lectin,
glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified
cell type such as a kidney cell.
A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein,
surfactant protein A, Mucin
carbohydrate, multivalent lactose, monovalent galactose, N-acetyl-
galactosamine, N-acetyl-
gulucoseamine multivalent mannose, multivalent fucose, glycosylated
polyaminoacids, multivalent
galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid,
cholesterol, a steroid, bile
acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide
mimetic. In certain
embodiments, ligands include monovalent or multivalent galactose. In certain
embodiments, ligands
include cholesterol.
Ligand-conjugated oligonucleotides of the invention may be synthesized by the
use of an
oligonucleotide that bears a pendant reactive functionality, such as that
derived from the attachment of a
linking molecule onto the oligonucleotide (described below). This reactive
oligonucleotide may be
reacted directly with commercially available ligands, ligands that are
synthesized bearing any of a
variety of protecting groups, or ligands that have a linking moiety attached
thereto.
33
CA 03174473 2022-09-01
WO 2021/178778 PCT/US2021/021049
The oligonucleotides used in the conjugates of the present invention may be
conveniently and
routinely made through the well-known technique of solid-phase synthesis. Any
other means for such
synthesis known in the art may additionally or alternatively be employed. It
is also known to use similar
techniques to prepare other oligonucleotides, such as the phosphorothioates
and alkylated derivatives.
A. Carbohydrate Conjugates
In some embodiments of the compositions and methods of the invention, an iRNA
oligonucleotide further comprises a carbohydrate. The carbohydrate conjugated
iRNA are advantageous
for the in vivo delivery of nucleic acids, as well as compositions suitable
for in vivo therapeutic use, as
described herein. As used herein, "carbohydrate" refers to a compound which is
either a carbohydrate
per se made up of one or more monosaccharide units having at least 6 carbon
atoms (which can be
linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to
each carbon atom; or a
compound having as a part thereof a carbohydrate moiety made up of one or more
monosaccharide units
each having at least six carbon atoms (which can be linear, branched or
cyclic), with an oxygen,
nitrogen or sulfur atom bonded to each carbon atom. Representative
carbohydrates include the sugars
(mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or
9 monosaccharide units),
and polysaccharides such as starches, glycogen, cellulose and polysaccharide
gums. Specific
monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and
trisaccharides include
sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).
In one embodiment, a carbohydrate conjugate for use in the compositions and
methods of the
invention is a monosaccharide. In another embodiment, a carbohydrate conjugate
for use in the
compositions and methods of the invention is selected from the group
consisting of:
HO OH
0
HO N- NO
AcHN
0
HO OH 0,
0
HO
AcHN
0 0 0
HO OH
0
HO 0 NN,c3,
AcHN
0 Formula II,
HOHH
0
HO HO
HO 0 H(73
0,
HOOOO
C31
HOHH -0
Formula III,
34
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
OH
HO &...\.......
0
HO 0 0
0
NHAc \Th
OH
HO,...\......\. r N¨
O --I
HO 0 0
0
NHAc Formula IV,
OH
H0.1,....\
0
HO 0,0
NHAc
0
O
HO H
HO 00,r
NHAc Formula V,
HO OH
HO..\.2..\ H
Or N\
NHAc 0
HO OH
HO01,NH/
NHAc 0 Formula VI,
HO OH
HO0_0
HO OH NHAc
HO....,\.,C2.0_0 ___________ fl'
NHAc Ho OH 0
HO0.)
NHAc Formula VII,
Bz0 0-130z
Bz0
Bz0
Bz0 0_130z 0 OAc
Bz0 AGO 1-C'
Bz0
0 1-6Formula VIII,
CA 03174473 2022-09-01
WO 2021/178778 PCT/US2021/021049
O
HO H
0
H
N.Ny0
HO
AcHN H 0
O
HO H
0
0 (:) H
HO NNy0
AcHN H 0
OH
HO
0 0
HO-
N0
HO
AcHN H Formula IX,
OH
HO
0
HO Oe\ON __ .(:)
AcHN H
OH
HC__T_______\/ (31
0
0c)ON
HO
AcHN H
0 0
O )
HO H
0
HO 0.-----...õØ.õ,---...N0
AcHN H Formula X,
po3
6 OH
HOHT) _____ I )
0
H
H0 ,
6:-_-%
HO I 0
-63p
6-\ OH H 0 0
HO _________ ----\ \- "C) )
HO )
H Formula XI,
PO3
OH
!:_l_._____
HO
HO
H H
Or N N
po3
0 OH 0
HO -0
HO 1Z)
H H
I0_ 0.i N N .=0.=,,,,.
3
(.2......0_. 0 8 0
HO )
HO
0.........,,.....,.r_N
HN
H
0 Formula XII,
36
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
HO OH 0 H
HO 0.,,,,
N.,,,...õ--,,,õ..õN liO\
AcHN H 0
HO OH
0
0,)c H
HO
AcHN
H 0 /
HO OH HO n 0 H 0
--,,----.,)1--NmNA0.--
AcHN H Formula XIII,
HO OH
_ __;_z\ 0 0
HO OH HO _ AcHN
0 0 NH
HO
AcHN /\).LNrs'rs
H
0 Formula XIV,
HO _ H
0
HOZH HO ------r-- -------0 0
AcHN
0 NH
HO------r-P---\/oLNi,,
AcHN
H
0 Formula XV,
HO _ H
0
HO H HO ------r-- -------0 0
HOµ__7_2%.0 AcHN 0
NH
AcHN \)-LN\/\/Hipps
H
0 Formula XVI,
_ ()H
OH H H¨C-r(--)--C) 0
HO II
HOH() 0 NH
HO /\ANrrPi
H
0 Formula XVII,
_ ()H
OH H H¨C-3T-(-2--,\ 0
HO _ it
HOHO \ 0 0 N H
HO
H
0 Formula XVIII,
_ ()H
OH H H¨C-3T-9-\ 0
HO _ it
HOHO _r____\ 0 0 N H
HO
H
0 Formula XIX,
37
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
HO OH
HOH-0
OH 0 0
H'-8 -
HO 0 .LNH
0
0 Formula XX,
HO OH
HOH-0
OH 0 0
H'-8 -
HO O .LNH
0 Formula XXI,
HO OH
HOTEP
HO
OHHO ___
0 0
HOH--0 0 .-)LI\IH
)LNrijj
0
0 Formula XXII.
In one embodiment, the monosaccharide is an N-acetylgalactosamine, such as
HO (:)E1
HO I.--1111
AcHN
0
HO (:)E1
O
HO OrNNy=O"^"`
AcHN
0 0
HO OH
0
HOON NO
AcHN
0 H Formula II.
Another representative carbohydrate conjugate for use in the embodiments
described herein
includes, but is not limited to,
38
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
HO OH
HO
AcHN
0 o
0
HO
AcHN H 0 0 H
X0õ.
OH
HO
C;)
0
L
HO N
AcHN
cisfiro 0
0
(Formula XXIII), when one of X or Y is an oligonucleotide, the other is a
hydrogen.
In certain embodiments of the invention, the GalNAc or GalNAc derivative is
attached to an
iRNA agent of the invention via a monovalent linker. In some embodiments, the
GalNAc or GalNAc
derivative is attached to an iRNA agent of the invention via a bivalent
linker. In yet other embodiments
of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent
of the invention via a
trivalent linker.
In one embodiment, the double stranded RNAi agents of the invention comprise
one GalNAc or
GalNAc derivative attached to the iRNA agent. In another embodiment, the
double stranded RNAi
agents of the invention comprise a plurality (e.g., 2, 3, 4, 5, or 6) GalNAc
or GalNAc derivatives, each
independently attached to a plurality of nucleotides of the double stranded
RNAi agent through a
plurality of monovalent linkers.
In some embodiments, for example, when the two strands of an iRNA agent of the
invention
are part of one larger molecule connected by an uninterrupted chain of
nucleotides between the 3'-end
of one strand and the 5'-end of the respective other strand forming a hairpin
loop comprising, a plurality
of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may
independently comprise a
GalNAc or GalNAc derivative attached via a monovalent linker. The hairpin loop
may also be formed
by an extended overhang in one strand of the duplex.
In some embodiments, the carbohydrate conjugate further comprises one or more
additional
ligands as described above, such as, but not limited to, a PK modulator or a
cell permeation peptide.
Additional carbohydrate conjugates suitable for use in the present invention
include those
described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the
entire contents of each
of which are incorporated herein by reference.
B. Linkers
In some embodiments, the conjugate or ligand described herein can be attached
to an iRNA
oligonucleotide with various linkers that can be cleavable or non-cleavable.
The term "linker" or "linking group" means an organic moiety that connects two
parts of a
compound, e.g., covalently attaches two parts of a compound. Linkers typically
comprise a direct bond
or an atom such as oxygen or sulfur, a unit such as NR8, C(0), C(0)NH, SO,
SO2, SO2NH or a chain of
39
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
atoms, such as, but not limited to, substituted or unsubstituted alkyl,
substituted or unsubstituted
alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl,
arylalkynyl, heteroarylalkyl,
heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl,
heterocyclylalkynyl, aryl,
heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl,
alkylarylalkenyl, alkylarylalkynyl,
alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl,
alkynylarylalkenyl,
alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl,
alkylheteroarylalkynyl,
alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl,
alkynylheteroarylalkyl,
alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl,
alkylheterocyclylalkenyl,
alkylhererocyclylalkynyl, alkenylheterocyclylalkyl,
alkenylheterocyclylalkenyl,
alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl,
alkynylheterocyclylalkenyl,
alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl,
alkylheteroaryl, alkenylheteroaryl,
alkynylhereroaryl, which one or more methylenes can be interrupted or
terminated by 0, S, S(0), SO2,
N(R8), C(0), substituted or unsubstituted aryl, substituted or unsubstituted
heteroaryl, substituted or
unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or
substituted aliphatic. In one
embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-
24, 6-18, 7-18, 8-18
atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.
A cleavable linking group is one which is sufficiently stable outside the
cell, but which upon
entry into a target cell is cleaved to release the two parts the linker is
holding together. In one
embodiment, the cleavable linking group is cleaved at least about 10 times,
20, times, 30 times, 40
times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least
about 100 times faster in a
target cell or under a first reference condition (which can, e.g., be selected
to mimic or represent
intracellular conditions) than in the blood of a subject, or under a second
reference condition (which
can, e.g., be selected to mimic or represent conditions found in the blood or
serum).
Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox
potential or the
presence of degradative molecules. Generally, cleavage agents are more
prevalent or found at higher
levels or activities inside cells than in serum or blood. Examples of such
degradative agents include:
redox agents which are selected for particular substrates or which have no
substrate specificity,
including, e.g., oxidative or reductive enzymes or reductive agents such as
mercaptans, present in cells,
that can degrade a redox cleavable linking group by reduction; esterases;
endosomes or agents that can
create an acidic environment, e.g., those that result in a pH of five or
lower; enzymes that can hydrolyze
or degrade an acid cleavable linking group by acting as a general acid,
peptidases (which can be
substrate specific), and phosphatases.
A cleavable linkage group, such as a disulfide bond can be susceptible to pH.
The pH of human
serum is 7.4, while the average intracellular pH is slightly lower, ranging
from about 7.1-7.3.
Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have
an even more acidic pH
at around 5Ø Some linkers will have a cleavable linking group that is
cleaved at a selected pH, thereby
releasing a cationic lipid from the ligand inside the cell, or into the
desired compartment of the cell.
A linker can include a cleavable linking group that is cleavable by a
particular enzyme. The
type of cleavable linking group incorporated into a linker can depend on the
cell to be targeted. For
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
example, a liver-targeting ligand can be linked to a cationic lipid through a
linker that includes an ester
group. Liver cells are rich in esterases, and therefore the linker will be
cleaved more efficiently in liver
cells than in cell types that are not esterase-rich. Other cell-types rich in
esterases include cells of the
lung, renal cortex, and testis.
Linkers that contain peptide bonds can be used when targeting cell types rich
in peptidases, such
as liver cells and synoviocytes.
In general, the suitability of a candidate cleavable linking group can be
evaluated by testing the
ability of a degradative agent (or condition) to cleave the candidate linking
group. It will also be
desirable to also test the candidate cleavable linking group for the ability
to resist cleavage in the blood
or when in contact with other non-target tissue. Thus, one can determine the
relative susceptibility to
cleavage between a first and a second condition, where the first is selected
to be indicative of cleavage
in a target cell and the second is selected to be indicative of cleavage in
other tissues or biological fluids,
e.g., blood or serum. The evaluations can be carried out in cell free systems,
in cells, in cell culture, in
organ or tissue culture, or in whole animals. It can be useful to make initial
evaluations in cell-free or
culture conditions and to confirm by further evaluations in whole animals. In
some embodiments,
useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40,
50, 60, 70, 80, 90, or about
100 times faster in the cell (or under in vitro conditions selected to mimic
intracellular conditions) as
compared to blood or serum (or under in vitro conditions selected to mimic
extracellular conditions).
i. Redox cleavable linking groups
In one embodiment, a cleavable linking group is a redox cleavable linking
group that is cleaved
upon reduction or oxidation. An example of reductively cleavable linking group
is a disulphide linking
group (-S-S-). To determine if a candidate cleavable linking group is a
suitable "reductively cleavable
linking group," or for example is suitable for use with a particular iRNA
moiety and particular targeting
agent one can look to methods described herein. For example, a candidate can
be evaluated by
incubation with dithiothreitol (DTT), or other reducing agent using reagents
know in the art, which
mimic the rate of cleavage which would be observed in a cell, e.g., a target
cell. The candidates can
also be evaluated under conditions which are selected to mimic blood or serum
conditions. In one,
candidate compounds are cleaved by at most about 10% in the blood. In other
embodiments, useful
candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60,
70, 80, 90, or about 100
times faster in the cell (or under in vitro conditions selected to mimic
intracellular conditions) as
compared to blood (or under in vitro conditions selected to mimic
extracellular conditions). The rate of
cleavage of candidate compounds can be determined using standard enzyme
kinetics assays under
conditions chosen to mimic intracellular media and compared to conditions
chosen to mimic
extracellular media.
ii. Phosphate-based cleavable linking groups
In certain embodiments, a cleavable linker comprises a phosphate-based
cleavable
linking group. A phosphate-based cleavable linking group is cleaved by agents
that degrade or
hydrolyze the phosphate group. An example of an agent that cleaves phosphate
groups in cells are
enzymes such as phosphatases in cells. Examples of phosphate-based linking
groups are -0-
41
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
P(0)(ORk)-0-, -0-P(S)(ORk)-0-, -0-P(S)(SRk)-0-, -S-P(0)(ORk)-0-, -0-P(0)(ORk)-
S-, -S-
P(0)(ORk)-S-, -0-P(S)(ORk)-S-, -S-P(S)(ORk)-0-, -0-P(0)(Rk)-0-, -0-P(S)(Rk)-0-
, -S-P(0)(Rk)-0-,
-S-P(S)(Rk)-0-, -S-P(0)(Rk)-S-, -0-P(S)( Rk)-S, wherein Rk at each occurrence
can be, independently,
C1-C20 alkyl, C1-C20 haloalkyl, C6-C10 aryl, or C7-C12 aralkyl. Exemplary
embodiments include -
0-P(0)(OH)-0-, -0-P(S)(OH)-0-, -0-P(S)(SH)-0-, -S-P(0)(OH)-0-, -0-P(0)(OH)-S-,
-S-P(0)(OH)-
S-, -0-P(S)(OH)-S-, -S-P(S)(OH)-0-, -0-P(0)(H)-0-, -0-P(S)(H)-0-, -S-P(0)(H)-
0, -S-P(S)(H)-0-, -
S-P(0)(H)-S-, and -0-P(S)(H)-S-. In one embodiment, a phosphate-based linking
group is -0-
P(0)(OH)-0-. These candidates can be evaluated using methods analogous to
those described above.
Acid cleavable linking groups
In certain embodiments, a cleavable linker comprises an acid cleavable linking
group. An acid
cleavable linking group is a linking group that is cleaved under acidic
conditions. In some embodiments
acid cleavable linking groups are cleaved in an acidic environment with a pH
of about 6.5 or lower (e.g.,
about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that
can act as a general acid. In
a cell, specific low pH organelles, such as endosomes and lysosomes can
provide a cleaving
environment for acid cleavable linking groups. Examples of acid cleavable
linking groups include but
are not limited to hydrazones, esters, and esters of amino acids. Acid
cleavable groups can have the
general formula -C=NN-, C(0)0, or -0C(0). An exemplary embodiment is when the
carbon attached
to the oxygen of the ester (the alkoxy group) is an aryl group, substituted
alkyl group, or tertiary alkyl
group such as dimethyl pentyl or t-butyl. These candidates can be evaluated
using methods analogous
to those described above.
iv. Ester-based linking groups
In another embodiment, a cleavable linker comprises an ester-based cleavable
linking group.
An ester-based cleavable linking group is cleaved by enzymes such as esterases
and amidases in cells.
Examples of ester-based cleavable linking groups include but are not limited
to esters of alkylene,
alkenylene and alkynylene groups. Ester cleavable linking groups have the
general formula -C(0)0-, or
-0C(0)-. These candidates can be evaluated using methods analogous to those
described above.
v. Peptide-based cleaving groups
In yet another embodiment, a cleavable linker comprises a peptide-based
cleavable linking
group. A peptide-based cleavable linking group is cleaved by enzymes such as
peptidases and proteases
in cells. Peptide-based cleavable linking groups are peptide bonds formed
between amino acids to yield
oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide-
based cleavable groups do
not include the amide group (-C(0)NH-). The amide group can be formed between
any alkylene,
alkenylene or alkynelene. A peptide bond is a special type of amide bond
formed between amino acids
to yield peptides and proteins. The peptide based cleavage group is generally
limited to the peptide
bond (i.e., the amide bond) formed between amino acids yielding peptides and
proteins and does not
include the entire amide functional group. Peptide-based cleavable linking
groups have the general
formula ¨ NHCHRAC(0)NHCHRBC(0)-, where RA and RB are the R groups of the two
adjacent
amino acids. These candidates can be evaluated using methods analogous to
those described above.
42
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
In one embodiment, an iRNA of the invention is conjugated to a carbohydrate
through a linker.
Non-limiting examples of iRNA carbohydrate conjugates with linkers of the
compositions and methods
of the invention include, but are not limited to,
OH (OH
H H
HO
AcHN HO
0
OH (OH
0,
H H
)(\ 0
AcHN
0 0 e ) 0
Cr rOH
H H
HO---r- ----\, N 7-.,N---0
AcHN
o (Formula XXIV),
HO OH
0 H H
HO 0NN.r0 I
Ha,
AcHN 0
O
HO\ OH N
H H H
AcHN 0 8 0- 0
HO OH
0
HO (:)NN 0
AcHN H
0 H (Formula XXV),
HO OH
0 H
HO 0 "}t-''' N N isc) x-ol___
AcHN H 0
HO OH
0 0 H
HO $0 N
, H N.--...õ----,....-",õ N yO.,,,-
--..õ---Nr N 0
AcHN
H 0 H x 0 Y
r,
HOIr........\,
x = 1 -30
HO Li...,....--,}1--Nm Nyll.c y = 1 -1 5e
AcHN H (Formula XXVI),
HO OH
0 N w,N 0
HO y \
AcHN H 0 X-Ot
HO OH
0 H H 0 H N
HO N..)N Nii0¨Nõ,ir>1.N
AcHN
H 0 ./ 0 H x 0 Y
HO OH
-t--7-!IV¨ = 0 H 0 x 1-30
HO u..,...,,¨NmNA0.-- y = 1-15
AcHN H
(Formula XXVII),
HO OH 0 H
..r.!..:)...\,,11-,
HO 0 N --,........ 0
N y N X-Ot_
AcHN H 0
HO OH
ON H H S¨Sr NN'h'VL
0
HO N..¨..._...-..,N,ir,0,---,õ--N-..rrt..) 0 y
AcHN
H 0 õ--- 0 x
9211 x=0-30
y=1-15
HO--- --\-- fa-------5¨klm 51-
N 0--
AcHN H
43
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
(Formula XXVIII),
HO OH 0 H
0, ..w......N 0
HO N y \ X-01_
AcHN
H 0
0. ,,0--Y
HO OH
H
0 N '
NH ,c)
HON..--.........-õ,õ.."...õ.õ,N yo..õ---..õ---N-v-1....1S¨S
AcHN H 0 õ,--- 0 x z 0 Y
HO OH x = 0-30
_..,r.!.:)...\,,, 0 H 0 y = 1-15
HO.J..........--¨N,..õ-----,_.õ---..õ---.N.-11.0,-- z = 1-20
AcHN H
(Formula XXIX),
HO OH 0 H
(.,r...E....c0,......--....A, N 0
HO N y \ X-Ot
AcHN H 0
HO OH
0 H H N,, '
ro) H
HO N.-...õ.....,,,,,,¨õN 0..õ---..õ,..--N--r----...1 0
0,4 N
AcHN If Y
H 0 ,,- 0 x z 0
HO OH x = 1-30
9 y = 1-15
HOONmNI'`O z =1-20
AcHN H
(Formula XXX), and
HO OH 0 H
HO ) N N 1O\ X-
01_
AcHN H 0
HO H
H H
N ,,(=.),Ao
AcHN
z 0 Y
H 0 ,,- 0 x
HO OH x = 1-30
9 y = 1-15
HO 0 NMN'`O' z = 1-20
AcHN H
(Formula XXXI),
when one of X or Y is an oligonucleotide, the other is a hydrogen.
In certain embodiments of the compositions and methods of the invention, a
ligand is one or
more "GalNAc" (N-acetylgalactosamine) derivatives attached through a bivalent
or trivalent branched
linker.
In one embodiment, a dsRNA of the invention is conjugated to a bivalent or
trivalent branched
linker selected from the group of structures shown in any of formula (XXXII) ¨
(XXXV):
44
CA 03174473 2022-09-01
WO 2021/178778 PCT/US2021/021049
Formula XXXII Form a XXXIII
pz4.4.4.41,,õwi=A ______ T2A.L2A P3A-(ek.R.I'\ rkliiµk
'A
q--
JAN:NI
p21.4_02kR2I3 , _________ 1-70...08 \fõ. 1 ' ' 1............. = ,
Pll'Q3:13..R 38 i4ki 4
-
__________________________ 4LA 4A . P5A-Q5A:iefk c--7---T5k0A
q
- T -
4.A ..",
''= 1.,,S.
Nt\ _____________________ T 44: 1
B. iB
-
4b \ I Psr-05c -0:7 I-Tx-0c
,
Formula *XXIV Formula VCXV
wherein:
q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for
each occurrence q2A,
q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each
occurrence 0-20 and
wherein the repeating unit can be the same or different;
p2A, p2B, p3A, p3B, p4A, p4B, p5A, p5B, p5C, T2A, T2B, T3A, T3B, T4A, T4B,
T4A, TSB, T5C are each
independently for each occurrence absent, CO, NH, 0, S, OC(0), NHC(0), CM,
CH2NH or CH20;
Q2A, Q2B, Q3A, Q3B, Q4A, Q4B, QsA, Q5B, y ,--s5C
are independently for each occurrence absent, alkylene,
substituted alkylene wherin one or more methylenes can be interrupted or
terminated by one or more of
0, S, S(0), SO2, N(RN), C(R')=C(R"), CEC or C(0);
R2A, R2B, R3A, R3B, R4A, R4B, RSA, RsB, Rs' are each independently for each
occurrence absent, NH, 0, S,
0
HO-
HI
CH2, C(0)0, C(0)NH, NHCH(Ra)C(0), -C(0)-CH(Ra)-NH-, CO, CH=N-0, s=ri\j'i=-,
0 S-S
S-S
1,,, sP:X\ \pc' JJ"11S-S,,...,
H , , N
=-$4.-/ S') or heterocyclyl;
L2A, L2B, L3A, L3B, L4A, L4B, LsA, LsB and Ls' represent the ligand; i.e. each
independently for
each occurrence a monosaccharide (such as GalNAc), disaccharide,
trisaccharide, tetrasaccharide,
oligosaccharide, or polysaccharide; andRa is H or amino acid side
chain.Trivalent conjugating GalNAc
derivatives are particularly useful for use with RNAi agents for inhibiting
the expression of a target
gene, such as those of formula (XXXVI):
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
Formula XXXVI
p5A_Q5A_R5A1_1-5A_L5A
q5A
I p5B_Q5B_R5B 1_1-5B_L5B
q5B
I p5C_Q5C_R5C ic7i-
jvvvE¨ 5c-L5c
,
wherein L', L' and L' represent a monosaccharide, such as GalNAc derivative.
Examples of suitable bivalent and trivalent branched linker groups conjugating
GalNAc
derivatives include, but are not limited to, the structures recited above as
formulas II, VII, XI, X, and
XIII.
Representative U.S. patents that teach the preparation of RNA conjugates
include, but are not
limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465;
5,541,313; 5,545,730; 5,552,538;
5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077;
5,486,603; 5,512,439;
5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737;
4,824,941; 4,835,263;
4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830;
5,112,963; 5,214,136;
5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098;
5,371,241, 5,391,723;
5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810;
5,574,142; 5,585,481;
5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941;
6,294,664; 6,320,017;
6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of
each of which are hereby
incorporated herein by reference.
It is not necessary for all positions in a given compound to be uniformly
modified, and in fact
more than one of the aforementioned modifications can be incorporated in a
single compound or even at
a single nucleoside within an iRNA. The present invention also includes iRNA
compounds that are
chimeric compounds.
VI. Delivery of an iRNA of the Invention
The delivery of an iRNA of the invention to a cell e.g., a cell within a human
subject (e.g., a
subject in need thereof, such as a subject having a disease, disorder or
condition associated with contact
activation pathway gene expression) can be achieved in a number of different
ways. For example,
delivery may be performed by contacting a cell with an iRNA of the invention
either in vitro or in vivo.
In vivo delivery may also be performed directly by administering a composition
comprising an iRNA,
e.g., a dsRNA, to a subject. Delivery may be performed, for example, by
intravenous administration or
subcutaneous administration. In certain embodiments, the iRNA agent is
delivered by subcutaneous
.. administration. In certain embodiments, the iRNA agent is administered by
self-administration using a
pre-filled syringe or auto-injector device.
In general, any method of delivering a nucleic acid molecule (in vitro or in
vivo) can be adapted
for use with an iRNA of the invention (see e.g., Akhtar S. and Julian RL.
(1992) Trends Cell. Biol.
46
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
2(5):139-144 and W09402595, which are incorporated herein by reference in
their entireties). For in
vivo delivery, factors to consider in order to deliver an iRNA molecule
include, for example, biological
stability of the delivered molecule, prevention of non-specific effects, and
accumulation of the delivered
molecule in the target tissue.
VII. Pharmaceutical Compositions of the Invention
The present invention also includes pharmaceutical compositions and
formulations which
include the iRNAs described herein for use in the methods of the invention. In
one embodiment,
provided herein are pharmaceutical compositions containing an iRNA, as
described herein, and a
pharmaceutically acceptable carrier. The pharmaceutical compositions
containing the iRNA are useful
for treating a disease or disorder associated with the expression or activity
of a TTR gene. Such
pharmaceutical compositions are formulated based on the mode of delivery. One
example is
compositions that are formulated for systemic administration via parenteral
delivery, e.g., by
subcutaneous (SC) or intravenous (IV) delivery. The pharmaceutical
compositions of the invention may
be administered in dosages sufficient to inhibit expression of a TTR gene. In
one embodiment, the
iRNA agents of the invention, e.g., a dsRNA agent, is formualted for
subcutaneous administration in a
pharmaceutically acceptable carrier
In other embodiments, a single dose of the pharmaceutical compositions can be
long lasting,
such that subsequent doses are administered at 1 month intervals, at not more
than 1, 2, 3, or 4 month
intervals, or at quarterly (about every three months) intervals. In some
embodiments of the invention, a
single dose of the pharmaceutical compositions of the invention is
administered once per month. In
other embodiments of the invention, a single dose of the pharmaceutical
compositions of the invention
is administered once every other month. In other embodiments, a single dose of
the pharmaceutical
compositions of the invention is administered quarterly, i.e., about once
every three months. In other
embodiments, a single dose of the pharmaceutical compositions of the invention
is administered once
every four months. In another embodiment, a single dose of the pharmaceutical
compositions of the
invention is administered once every five months. In other embodiments, a
single dose of the
pharmaceutical compositions of the invention is administered once every six
months. In other
embodiments, a single dose of the pharmaceutical compositions of the invention
is administered once
every twelve months.
VIII. Kits
The present invention also provides kits for performing any of the methods of
the invention.
Such kits include one or more double stranded RNAi agent(s) and a label
providing instructions for use
of the double-stranded agent(s) for use in any of the methods if the
invention. The kits may optionally
further comprise means for contacting the cell with the RNAi agent (e.g., an
injection device or an
infusion pump), or means for measuring the inhibition of TTR (e.g., means for
measuring the inhibition
of TTR mRNA or TTR protein). Such means for measuring the inhibition of TTR
may comprise a
47
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
means for obtaining a sample from a subject, such as, e.g., a plasma sample.
The kits of the invention
may optionally further comprise means for administering the RNAi agent(s) to a
subject or means for
determining the therapeutically effective or prophylactically effective
amount.
The RNAi agent may be provided in any convenient form, such as a solution in
sterile water or
other appropriate solution, e.g., PBS, normal saline, 5 mM phosphate buffer,
for resuspension and
injection. For example, the RNAi agent may be provided as a 300 mg, 200 mg,
100 mg, or 50 mg vial
with water or other appropriate solution in sterile water for injection. In
certain embodiments, the RNAi
agent is provided in a kit for self administration comprising a pre-filled
syringe or autoinjector
containing 300mg, 200 mg, 100 mg, or 50 mg of the RNAi agent in an appropriate
volume of excipient
for administration, optionally further including instructions for use. In
certain embodiments, the RNAi
agent may be provided in multiple vials or devices for administration of the
dose by multiple injections
to be given at about the same time, e.g, within one week, within one day,
within one hour.
IX. Diagnosis of TTR amyloidosis polyneuropathy and assessment of
disease burden
TTR amyloidosis is a complex, multifactorial disease. An expanding list of
criteria have been
used to monitor the progression of TTR-FAP: neuropathy impairment score (NIS),
NIS + 7, and
modified NIS (mNIS) + 7 and mNIS + 7 Icnils. These diagnostic criteria are
well known in the art and
highlights of the criteria are provided below. As used herein, meeting the
diagnostic criteria of TTR-
FAP is understood as meeting FAP stage 1 criteria, with or without the
presence of a mutation
associated with hereditary TTR-FAP. Progression of indicators of neuropathy is
considered an increase
of at least two points in modified neuropathy impairment score (mNIS) + 7.
Familial Amyloid Polyneuropathy (FAP) Stage
Coutinho et al. developed a clinical staging system for the neuropathy
symptoms of hATTR
(formerly termed familial amyloid neuropathy). The scale ranges from 1 to 3,
as follows (Ando et al.
Orphanet J Rare Dis. 2013;8:31):
FAP Stage 1: Walking without assistance, mild neuropathy (sensory, autonomic,
and motor) in
lower limbs.
FAP Stage 2: Walking with assistance, moderate impairment in lower limbs,
trunk, and upper
limbs.
FAP Stage 3: wheelchair or bed-ridden, severe neuropathy.
A subject with no neuropathy is considered to be FAP Stage 0.
Neuropathy Impairment Scoring Methods
Methods to assess neuropathies are known in the art. For example, in the Mayo
Clinic
Neurologic Examination Sheet and also in the weakness subscores of Neuropathy
Impairment Score
(NIS), weakness (NIS-W) are scored in 25% decrements from 1 to 4 points and
separately for major
muscle groups of each side of the body (Dyck et al., Quantitating overall
neuropathic symptoms,
impairments, and outcomes. In: Dyck PJ, Thomas PK, editors. Peripheral
neuropathy. 4th ed.
Philadelphia: Elsevier; 2005. p. 1031-52). A broad group, especially of
cranial, proximal, and distal
limb muscles, is evaluated in NIS-W with a maximum score of 192 points. A
decrease of the major 5
48
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
muscle stretch reflexes is usually assessed by neurologists and touch
pressure, vibration, joint motion,
and pin-prick sensations of feet and hands are scored in 25% decrements and
from 1 to 4 in the Mayo
Clinic Neurology Examination Sheet. To complete NIS of reflexes (NIS-R) and of
sensation (NIS-S)
Mayo Clinic record scores are transformed to NIS point scores (i.e., Mayo
Clinic scores of 1 or 2 are
given an NIS point score of 1 and Mayo Clinic scores of 3 or 4 are given an
NIS score of 2). Therefore,
the maximal NIS scores of the usual reflexes evaluated by neurologists (NIS-R)
are 5 x 2 x 2 = 20
points and of the 4 modalities of sensation often evaluated by neurologists
(NIS-S) are 8 x 2 x 2 = 32
points. Therefore, the maximum NIS score is: 192 + 20 + 32 =244 points. The
NIS has been described
in previous publications (Dyck et al. 2005 and Dyck et al., Neurol.
1997;49:229-39).
NIS + 7 has been used as the primary or co-primary outcome measure in the
trials of diabetic
sensorimotor polyneuropathy, TTR FAP, and other generalized sensorimotor
polyneuropathies (N.
Suanprasert et al. J Neurol Sci 344 (2014) 121-128). NIS + 7 adequately
assesses graded severities of
muscle weakness and muscle stretch reflex abnormality with only minimal
ceiling effects for reflexes.
In NIS + 7,5 of the 7 tests are attributes of nerve conduction ¨ expressed
either as normal deviates (Z
scores) or points. The attributes included in NIS + 7 were chosen because
their abnormality sensitively
detects diabetic sensorimotor polyneuropathy (Dyck et al. Muscle Nerve
2003;27(2):202-10). The
attributes included are the peroneal nerve compound muscle action potential
(CMAP) amplitude, motor
nerve conduction velocity (MNCV), and motor nerve distal latency (MNDL),
tibial MNDL and sural
sensory nerve action potential (SNAP) amplitudes. Their measured values can be
transformed to normal
deviates from percentile values correcting for applicable variables of age,
gender, height, or weight as
based on earlier studies of a large healthy subject reference cohort.
Additionally, these percentile values
can be expressed as NIS points from obtained percentile values (i.e., N5th = 0
points; <5th¨ N 1st = 1
point and <1st = 2 points (and similarly when abnormality is in the upper tail
of the normal distribution).
Assessment of weakness and reflex abnormality, assessment of sensation loss,
autonomic
dysfunction, and neurophysiologic test abnormalities are not adequately
assessed by NIS + 7 for use in
trials of TTR FAP. In NIS + 7 sensation loss is not optimally assessed: 1)
body distribution of sensation
loss is not adequately taken into account, 2) large as compared to small fiber
sensory loss is over
emphasized and 3) improved methods of testing and comparison to reference
values are preferred over
clinical assessments. Also, autonomic dysfunction is not adequately assessed
by the use of only heart
rate deep breathing (HRdb). The attributes of nerve conduction used to assess
NIS + 7 are not ideal for
the study of TTR FAP.
Modified neuropathy impairment score +7 (mNIS+7), and updated version of NIS +
7, is a
composite score measuring motor strength, reflexes, sensation, nerve
conduction, and autonomic
function. Two versions of this composite measure were adapted from the NIS+7
to better reflect hATTR
amyloidosis with polyneuropathy and have been used as primary outcomes in
inotersen and patisiran
clinical trials. Key differences between these two versions, and the other
neuropathy scoring systems,
are summarized in the table below (from Adams et al., BMC Neurology, volume
17, Article number:
181 (2017)). In both scales, a lower score represents better neurologic
function (e.g. an increase in score
reflects worsening of neurologic impairment).
49
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
Neuropathy Impairment Score Criteria
ms-LL :N[s NIS+7 mNIS+7 mNIS+7j011i9
Total score 88 .244 279 304 3.443
A,s osment (wort)
N.2urologic
e \ am Neurologic
Neurologic exam Neurologic exam
Motor Ittn% et- exam Neurologic exam 092)
strengthlWealthess (192) (192)
limbs (192)
only] (64).
Neurologic
exam
eur;µlogie Neurologic exam NeurolVP earn
Refle)tos [lower Neurologic Oath -(20)
exam (21:1) (20) (201
limbs
onl I(8):
()ST ¨ heat pain QST ¨ heai pain
and touch (ind touch pressure
pressure at (4 multiple sitos:
multiple sites (80) MO
Neurologic
SOns.ation QN:1111
t)10c urologic Mt
32) n
- Neurologic exam (32)
Mull ( limbs (32)
only] (16)
Vibration detection threshold
E.5 ¨ sum' SNAP fibular nerve ¨ Attar
CMAP 5 ¨ ulnar 1AP
C MAP. tibial motor Ilene diAal and sNAP. and SNAP.
Composik nenie _
latency . motor nerve conduction peroneal CNIAP, peron,2alc p,
conduction se(tp
eloc11- 1110[('T11,'n diAal tibial CM AR tibizil
CM.1P.ural
latenc:, (1 8,6t1 sum! SNAP (10) b SNAP (18.6).3
Dean rale
Autonomic heart rate iespPnio:b;$.dekp Postural blood
, response to deep
function breathing (3.7)a pressure (2) "
breathing (3.3r
C.A.L.i= compound muscle action potential; aialn examination; niNTS+11nOdified
NIS 7;A:1$ Neuropak
Impairment Score; A7S-I L NIS based on :examination of lo \\ er litribs:only;
2,31 iltiantitatiNe s.,:nsor]k testing;::
SV. ; P sensor 11 rve ic!ion potential
2. 'Score expressed :I, normal deviates (t) 372) btised on health:k -subject
parameters
:3, hSeore graded aecoi ding to de lii led categ:Iries: ; ;mina! (95th
percentile) points; mildly reduLvel 01501 to
99th percentile) = 1 point; and 1 cry t educed >99th percentile) = 2 points
4. Nay also be referred to as fibular
Diagnosis of TTR amyloidosis cardiomyopathy (ATTR-CM) and assessment of
disease burden
Patients with hATTR amyloidosis and cardiomyopathy typically experience
progressive
symptoms of heart failure (HF) and cardiac arrhythmias, with death typically
occurring 2.5 to 5 years
after diagnosis. Cardiac infiltration of the extracellular matrix by TTR
amyloid fibrils leads to a
progressive increase of ventricular wall thickness and a marked increase in
chamber stiffness, resulting
in impaired diastolic function. Systolic function is also impaired, typically
reflected by abnormal
longitudinal strain despite a normal ejection fraction, which is preserved
until late stages of the disease.
In patients with ATTR amyloidosis and light-chain (AL) cardiac amyloidosis,
both longitudinal strain
and N-terminal prohormone of brain natriuretic peptide (NT-proBNP) have been
shown to be
independent predictors of survival.
Echocardiography is routinely used to assess cardiac structure and function;
parameters pre-
specified in the statistical analysis plan include mean left ventricular (LV)
wall thickness, LV mass,
longitudinal strain, and ejection fraction. Cardiac output, left atrial size,
LV end-diastolic volume
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
(LVEDV), and LV end-systolic volume (LVESV). Echocardiograms are routinely
used for cardiac
imaging. Myocardial strain can be assessed with speckle tracking using vendor-
independent software
(TOMTEC, Munich, Germany). Analysis of NT-proBNP and troponin I levels is
routinely performed in
clinical laboratories using commercially available diagnostic tests, e.g.,
using chemiluminescence assays
(Roche Diagnostic Cobas, Indianapolis, IN, USA for NT-proBNP; Siemens Centaur
XP, Camberley,
Surrey, UK for troponin I). Similarly, clinical practice routinely includes
measurement of creatinine
levels and estimated glomerular filtration rate (eGFR) based on creatinine
levels, e.g., using the
Modification of Diet in Renal Disease study formula.
A review providing screening and diagnostic methods for ATTR-CM was recently
published by
Witteles et al., 2019 (JACC: Heart Failure, 2019. 7:709-716) which provides
information on methods of
diagnosis including a list of "red flags" suggesting the presence of ATTR-CM
and screening methods
including echocardiography, electrocardiography, cardiac magnetic resonance,
the presence of systemic
symptoms involving the peripheral or autonomic nervous system along with
cardiac dysfunction
including bilateral sensory motor polyneuropathy that begins in the lower
limbs and follows an
ascending pattern, dysautonomia in the form of orthostatic hypotension,
diarrhea/ constipation, and
erectile dysfunction, and eye involvement such as glaucoma, intravitreal
deposition, and scalloped
pupils; carpal tunnel syndrome, especially bilateral carpal tunnel syndrome,
lumbar spinal stenosis, and
bicep tendon rupture. Other diagnostic methods include bone scintography with
technetium (Tc)-
labelled bisphosphonates localizes to TTR cardiac amyloid deposits for reasons
that are not known.
Biopsy is also used to confirm the presence of TTR amyloidosis in heart.
Methods for assessment and classification of cardiac function of the
parameters provided above
are known in the art. As used herein, the specific method of assessment or
classification of cardiac
function may be any clinically acceptable standard to demonstrate sufficiently
decreased cardiac
function such that the standard of care includes a medical intervention, e.g.,
administration of a
pharmacological agent, surgery.
Serum Biomarkers as an Indicia of Nerve Damage and TTR Amyloidosis Progression
The diagnostic and monitoring methods set forth above are complex and often
subjective.
Moreover, as TTR amyloidosis is rare, and the signs and symptoms above can be
present in a number of
other diseases, clinically validated, non-invasive plasma biomarkers may
facilitate earlier diagnosis and
aid monitoring of disease progression. In a study by Ticau et al., 2019 (see
www.medrxiv.org/content/10.1101/19011155v2.full.pdf) plasma levels of >1000
proteins were
measured in patients with hATTR amyloidosis with polyneuropathy who received
either placebo or
patisiran in the phase 3 APOLLO study (NCT01960348) and in a cohort of healthy
individuals. The
impact of treatment with patisiran, a lipid formulated RNAi agent that
inhibits the hepatic expression of
TTR, on the time profile of each protein was determined by a linear mixed
model at 0, 9, and 18
months. Neurofilament light chain (NfL) protein was further assessed using an
orthogonal quantitative
approach. A significant change in the levels of 66 proteins was observed with
patisiran vs placebo, with
change in NfL, a marker of neuronal damage, most significant. Analysis of the
changes in protein levels
51
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
demonstrated that the proteome of patients treated with patisiran trended
towards healthy individuals at
18 months. Plasma NfL levels in healthy controls were four-fold lower than in
patients with TTR
amyloidosis with polyneuropathy (16.3 [SD 12.0] pg/mL vs 69.4 [SD 42.1] pg/mL,
p<1016). Levels of
NfL at 18 months increased with placebo (99.5 [SD 60.1] pg/mL) and decreased
with patisiran
treatment (48.8 [SD 29.9] pg/mL). At 18 months, improvement in modified
Neuropathy Impairment
Score+7 (mNIS+7) in patisiran-treated patients significantly correlated with a
reduction in NfL levels
(R=0.43, p<10 7). NfL reduction with patisiran treatment correlated with
improvement in mNIS+7
suggests it may serve as a biomarker of nerve damage and polyneuropathy in TTR
amyloidosis. This
biomarker may enable earlier diagnosis of polyneuropathy in patients with
hATTR amyloidosis and
facilitate monitoring of disease progression.
A decrease in the level of other proteins, especially RSP03, CCDC80, EDA2R,
and NT-
proBNP, were found to correlate with an improvement in mNIS+7, suggesting
that, either alone or in
combination with each other or Nfl, they may serve as a biomarker of nerve
damage and
polyneuropathy in ATTR amyloidosis. An increase in the level of N-CDase was
found to correlate with
an improvement in mNIS+7, suggesting that, either alone or in combination with
the other markers
listed above, it may serve as a biomarker of nerve damage and polyneuropathy
in ATTR amyloidosis.
Further potential biomarkers are listed in the table below which were observed
to change in
response to treatment with patisiran. When a subject has an increase in the
level of a protein having a
positive beta coefficient relative to a reference level indicative of
progression of ATTR amyloidosis,
and when a subject has a decrease in the level of a protein having a negative
beta coefficient relative to a
reference level indicative of progression of ATTR amyloidosis. Changes in the
level of one or more of
these markers can be indicia of improvement, stabilization, or decrease in
ongoing nerve damage and
progression of polyneuropathy in ATTR amyloidosis.
52
CA 03174473 2022-09-01
WO 2021/178778 PCT/US2021/021049
Table 1. Biomarkers with changed levels in response to patisiran treatment
Protein beta coefficient og10 (p-value) Protein beta
coefficient -log10 (p-value)
T.1/4.4.1, 0.55 2040 LDLR -0.20 5,85
RSPO3 0.53 18A3 NOV 0.19 5.83
CCDC80 0.40 17.28 CD160 0.16 5,69
EDA2R 0.25 17.10 P13 0.19 5.61
N-cP.Pn -0.25 15.17 SMOC1 0.12 5.61
NT-prONP 0.62 13.15 TFP1-2 0.22 5.54
0.46 11,43 LEP -0.38 5.49
VVNT9A 0.20 10.78 INFR5F19 0.16 5.47
SMOC2 0.14 10.33 ERBB3 -0.07 5.44
PIN 039 9.20 DUA -0.14 5.43
1-1GF 0,17 9.02 ft-4RA 0.1.3 5.33
0.14 6.13 REN -0.24 5.31
NELL1 -0,16 8.98 CES2 -0.15 5.23
DCN 0.10 8.90 CR2 0.15 5.23
ARSA -0.23 8.86 PSG1 0,21 510
KLK4 0.27 8.66 FGF-BP1 0.11 5.19
GPC1 0.18 8.57 OPN 0.18 5.18
SFRP 0.21 841 If F3 0.17 5.08
DRAX1N 0.20 8.11 ANGPT2 0.15 5.05
1L48R1 -0.15 7.82 CCL24 -0.17 5.05
BNP 0.48 7.81 lAYN 0.13 5.02
GFR-alphal 0.17 7.69 FUCA1 -0.11 4,97
CXCL9 0,31 742 AXL 0.11 4.95
T1MD4 -0.21 7.02 TLR3 -0.10 4.94
RSPO1 0.16 6.94 SCARB2 0.12 4.90
MY0C 0.21 6.94 B4GAT1 -0.09 4.83
WFDC2 0.11 6.76 SORCS2 0.15 4.65
GUSB -0.27 6.71 CD300E 0.18 4.63
HSPB6 0.19 6.70 CD27 0.10 4.62
MFGE8 -0.21 6.68 SPON1 0.10 4,58
SMPD1 -0.15 6.59 1GFBP-2 0.15 4.58
FLT1 0.09 6.29 DNER -0.07 4.57
CTSD -0,13 6.06 RARRES1 0.09 4.57
CD209 -0,11 5.85 Dkk-4 0.15 4.49
Sequences for these biomarkers are provided herein as SEQ ID NOs:17-34.
This invention is further illustrated by the following examples which should
not be construed as
limiting. The contents of all references and published patents and patent
applications cited throughout
the application, as well the Sequence Listing are hereby incorporated herein
by reference.
53
CA 03174473 2022-09-01
WO 2021/178778 PCT/US2021/021049
EXAMPLES
Exemplary double straded RNAi agents for use in the methods of the invention
are provided in
Table 3 below. Table 2, below, provides the abbreviations of the nucleotide
monomers and ligands used
in nucleic acid sequence representation. It will be understood that these
monomers, when present in an
oligonucleotide, are mutually linked by 5'-3'-phosphodiester bonds unless
otherwise indicated.
Table 2. Abbreviations of nucleotide monomers and ligands
Abbreviation Nucleotide(s) and ligands
A Adenosine-3'-phosphate
Af 2' -fluoroadenosine-3' -phosphate
Afs 2'-fluoroadenosine-3'-phosphorothioate
As adenosine-3' -phosphorothioate
cytidine-3' -phosphate
Cf 2' -fluorocytidine-3' -phosphate
Cfs 2'-fluorocytidine-3'-phosphorothioate
Cs cytidine-3'-phosphorothioate
guanosine-3'-phosphate
Gf 2' -fluoroguanosine-3' -phosphate
Gfs 2'-fluoroguanosine-3'-phosphorothioate
Gs guanosine-3'-phosphorothioate
5' -methyluridine-3' -phosphate
Tf 2' -fluoro-5-methyluridine-3' -phosphate
Tfs 2' -fluoro-5-methyluridine-3' -phosphorothioate
Ts 5-methyluridine-3'-phosphorothioate
Uridine-3'-phosphate
Uf 2' -fluorouridine-3' -phosphate
Ufs 2'-fluorouridine -3'-phosphorothioate
Us uridine -3' -phosphorothioate
any nucleotide (G, A, C, T or U)
a 2'-0-methyladenosine-3' -phosphate
as 2'-0-methyladenosine-3'- phosphorothioate
2'-0-methylcytidine-3'-phosphate
cs 2'-0-methylcytidine-3'- phosphorothioate
2'-0-methylguanosine-3'-phosphate
gs 2'-0-methylguanosine-3'- phosphorothioate
2' -0-methyl-5-methylthymine-3'-phosphate
ts 2' -0-methyl-5-methylthymine-3'-phosphorothioate
2'-0-methyluridine-3'-phosphate
54
CA 03174473 2022-09-01
WO 2021/178778 PCT/US2021/021049
Abbreviation Nucleotide(s) and ligands
us 2'-0-methyluridine-3'-phosphorothioate
phosphorothioate linkage
L96 N-Itris(GalNAc-alkyl)-amidodecanoy1)1-4-hydroxyprolinol
Hyp-(GalNAc-alky1)3
OH
HO
0
HO
AcHN
0
HO OH 0
0,
0
HO
N 0
AcHN 0 0 0-- 0
OH
HO
C-j
0
HO 0
AcHN
0
(Agn) Adenosine-glycol nucleic acid (GNA)
(Cgn) Cytidine-glycol nucleic acid (GNA)
(Ggn) Guanosine-glycol nucleic acid (GNA)
(Tgn) thymidine-glycol nucleic acid (GNA) S-Isomer
Table 3. Modified nucleotide sequences of sense and antisense strands of RNAi
agents targeted to
TTR
SEQ ID
Duplex ID Strand Modified Oligonucleotide Sequence (5'-3') NO:
AD-65492 sense usgsggauUfuCfAfUfguaaccaagaL96 10
antisense usCfsuugGfuuAfcaugAfaAfucccasusc 11
AD-87400 sense usgsggauUfuCfAfUfguaaccaagaL96 10
antisense usCfs(Tgn)ugGfuuAfcaugAfaAfucccasusc 12
AD-87401 sense usgsggauUfuCfAfUfguaaccaagaL96 10
antisense usCfsu(Tgn)gGfuuAfcaugAfaAfucccasusc 13
AD-87402 sense usgsggauUfuCfAfUfguaaccaagaL96 10
antisense usCfsuu(Ggn)GfuuAfcaugAfaAfucccasusc 14
AD-87403 sense usgsggauUfuCfAfUfguaaccaagaL96 10
antisense usCfsuug(Ggn)uuAfcaugAfaAfucccasusc 15
AD-87404 sense usgsggauUfuCfAfUfguaaccaagaL96 10
antisense usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc 7
AD-87405 sense usgsggauUfuCfAfUfguaaccaagaL96 10
antisense usCfsuugGfu(Tgn)AfcaugAfaAfucccasusc 16
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
Example 1: TTR Protein Knockdown by RNAi agents in the V3OM Transgenic Mouse
The V3OM mutation is a common amyloidogenic mutation in human TTR. Transgenic
mice
lacking mouse TTR and expressing human TTR with a V3OM mutation were used in
the study. Mice (n
= 3 per group) were administered a single subcutaneous 1 mg/kg dose of RNAi
agent AD-65492,
previously disclosed in W02018112320, or other RNAi agents based on the
sequence and chemistry of
AD-65492 in which a chemical modification at a single position of the
antisense strand was changed to
a GNA modification as shown in Table 2 above. Blood samples were obtained on
days 0 (pre-dose), 3,
7, 10, 14, 21, 35, and 49. Serum was prepared and human TTR levels were
determined using ELISA
assay (see, e.g., Coelho, et al. (2013) N Engl J Med 369:819). Relative TTR
levels as compared to Day
0 are shown in Figure 1.
Incorporation of a GNA at position 7 or 8 in the antisense strand was well
tolerated (AD-87404
and AD-87405). Similar kinetics and maximum protein knockdown were similar to
the parent RNAi
agent AD-65492. Durability of knockdown by AD-87404 was similar to AD-65492.
Incorporation of a
GNA at positions 3-6 in the antisense strand was less well tolerated.
Example 2: TTR Protein Knockdown by RNAi agents in Non-Human Primate
The sequence of the iRNA agents in Table 2 is fully cross-reactive with
cynomolgus monkey
TTR. A single subcutaneous dose of AD-65492 (1 mg/kg) or AD-87404 (1 mg/kg or
3 mg/k) was
administered to cynomolgus monkey (n = 3 per group) on day 0 in three separate
studies. Blood samples
were collected variously on Days -7 (7 days predose) through Day 119 as shown
in Figure 2. Serum was
prepared and cynomolgus monkey TTR levels were determined using ELISA assay
(see, e.g., Coelho, et
al. (2013)N Engl J Med 369:819). Relative TTR levels as compared to Day 0 are
shown in Figure 2.
TTR knockdown was similar in in monkeys administered 1 mg/kg of AD-65492 and 3
mg/kg of AD-
87404.
Example 3: Administration of a Single Dose of AD-87404 to Healthy Human
Subjects
In a Phase I, randomized, single-blind, placebo-controlled study, AD-87404
(Sense: 5'-
usgsggauUfuCfAfUfguaaccaaga ¨ 3' (SEQ ID NO: 6), wherein an L96 ligand is
conjugated to the 3'
end of the sense strand); Antisense: 5'- usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc
¨ 3' (SEQ ID NO:
7)) are administered to healthy human volunteers as a single dose of 25mg, 75
mg, 100 mg, 200 mg, or
400 mg, with possible dose groups of 600 mg, 700 mg, 900 mg, and 1000 mg.
Groups are balanced for
relevant demographic characteristics, e.g., age, sex, body weight.
Demographically matched control subjects are also administered a single dose
of a placebo.
Plasma samples are collected and the level of TTR protein in the samples from
the subjects in
the placebo group and the subjects in all of the treatment groups is
determined using an ELISA assay
(see, e.g., Coelho, et al. (2013) N Engl J Med 369:819) at pre-determined
intervals, e.g., days 1, 2, 3, 8,
15, 22, 29, 43, 57, 90, and then, for active treatment group subjects, every
twenty-eighth day until the
level of TTR recovers to 80% of the pre-treatment level (up through,
approximately one year post-dose).
Level and duration of knockdown are determined.
56
CA 03174473 2022-09-01
WO 2021/178778
PCT/US2021/021049
Subjects in both AD-87404 groups and the control group are also monitored for
adverse events.
Exemplary adverse events monitored in the study include, but are not limited
to, injection site erythema,
injection site pain, pruritus, cough, nausea, fatigue, and abdominal painand
clinically significant
changes in physical exams, ECG, vital signs, or clinical laboratory
parameters, e.g., renal function,
-- hematologic parameters, and liver function (e.g., alanine aminotransferase
(ALT), aspartate
aminotransferase (AST)).
The results of this study demonstrate that a single subcutaneous dose of AD-
87404 potently and
durably knocks down TTR protein levels in a dose dependent manner.
Multiple dose studies and multiple ascending dose studies are also
contemplated with
-- monitoring of TTR protein knockdown in serum and adverse events.
Equivalents:
Those skilled in the art will recognize, or be able to ascertain using no more
than routine
experimentation, many equivalents to the specific embodiments and methods
described herein. Such
-- equivalents are intended to be encompassed by the scope of the following
claims.
57
