CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
LIPID NANOPARTICLE COMPOSITION
[0001] This application claims priority to Chinese Patent Application No.
202010275664.4,
filed on April 9, 2020, U.S. Provisional Application No. 63/011,140, filed on
April 16, 2020, and
Chinese Patent Application No. 202110299761.1, filed on March 19, 2021, the
entireties of
which are incorporated herein by reference.
1. FIELD
100021 The present disclosure generally relates to lipids that can be used
in combination with
other lipid components, such as neutral lipids, cholesterol and polymer
conjugated lipids, to form
lipid nanoparticles for delivery of therapeutic agents (e.g., nucleic acid
molecules, including
nucleic acid mimics such as locked nucleic acids (LNAs), peptide nucleic acids
(PNAs), and
morpholinos), both in vitro and in vivo, for therapeutic or prophylactic
purposes, including
vaccination.
2. BACKGROUND
[00031 Therapeutic nucleic acids have the potential to revolutionize
vaccination, gene
therapies, protein replacement therapies, and other treatments of genetic
diseases. Since the
commencement of the first clinical studies on therapeutic nucleic acids in the
2000s, significant
progresses have been made through the design of nucleic acid molecules and
delivery methods
thereof. However, nucleic acid therapeutics still face several challenges,
including low cell
permeability and high susceptibility to degradation of certain nucleic acids
molecules, including
RNAs. Thus, there exists a need to develop new nucleic acid molecules, as well
as related
methods and compositions that facilitate their delivery in vitro or in vivo
for therapeutic and/or
prophylactic purposes.
3. SUMMARY
[0004] In one embodiment, provided herein are lipid compounds, including
pharmaceutically
acceptable salts, prodrugs or stereoisomers thereof, which can be used alone
or in combination
with other lipid components such as neutral lipids, charged lipids, steroids
(including for
example, all sterols) and/or their analogs, and/or polymer conjugated lipids
and/or polymers to
form lipid nanoparticles for the delivery of therapeutic agents (e.g., nucleic
acid molecules,
including nucleic acid mimics such as locked nucleic acids (LNAs), peptide
nucleic acids
- 1 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
(PNAs), and morpholinos). In some instances, the lipid nanoparticles are used
to deliver nucleic
acids such as antisense and/or messenger RNA. Methods for use of such lipid
nanoparticles for
treatment of various diseases or conditions, such as those caused by
infectious entities and/or
insufficiency of a protein, are also provided.
[0005] In one embodiment, provided herein is a compound of Formula (1).
R3
G3
L1
N
G1 G2
(I),
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof,
wherein GI, G2, G3, LI,
L2, and R3 are as defined herein or elsewhere.
[0006] In one embodiment, provided herein is a compound of Formula (II):
G4
Ll
G G2
OD,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof,
wherein GI, G2, G4, Li,
L2, and R3 are as defined herein or elsewhere.
[0007] In one embodiment, provided herein is a nanoparticle composition
comprising a
compound provided herein, and a therapeutic or prophylactic agent. In one
embodiment, the
therapeutic or prophylactic agent comprises at least one mRNA encoding an
antigen or a
fragment or epitope thereof.
[0008] Additional features of the present disclosure will become apparent
to those skilled in
the art upon consideration of the following detailed description of particular
embodiments.
4. BRIEF DESCRIPTION OF THE FIGURES
[0009] FIG. 1 illustrates an example of forming a lipid nanoparticle
involving the use of
cationic lipids.
CA 03178455 2022-09-29
WO 2021/204175
PCT/CN2021/085879
182110784FF
[0010] FIG. 2 shows the effects of different lipid compounds on the hEPO
expression levels
in an animal study.
5. DETAILED DESCRIPTION
5.1 General Techniques
[0011] Techniques and procedures described or referenced herein include
those that are
generally well understood and/or commonly employed using conventional
methodology by those
skilled in the art, such as, for example, the widely utilized methodologies
described in Sambrook
et al., Molecular Cloning: A Laboratory Manual (3d ed. 2001); Current
Protocols in Molecular
Biology (Ausubel et al. eds., 2003).
5.2 Terminology
[0012] Unless described otherwise, all technical and scientific terms used
herein have the
same meaning as is commonly understood by one of ordinary skill in the art.
For purposes of
interpreting this specification, the following description of terms will apply
and whenever
appropriate, terms used in the singular will also include the plural and vice
versa. All patents,
applications, published applications, and other publications are incorporated
by reference in their
entirety. In the event that any description of terms set forth conflicts with
any document
incorporated herein by reference, the description of term set forth below
shall control.
100131 As used herein and unless otherwise specified, the term "lipid"
refers to a group of
organic compounds that include, but are not limited to, esters of fatty acids
and are generally
characterized by being poorly soluble in water, but soluble in many nonpolar
organic solvents.
While lipids generally have poor solubility in water, there are certain
categories of lipids (e.g.,
lipids modified by polar groups, e.g., DMG-PEG2000) that have limited aqueous
solubility and
can dissolve in water under certain conditions. Known types of lipids include
biological
molecules such as fatty acids, waxes, sterols, fat-soluble vitamins,
monoglycerides, diglycerides,
triglycerides, and phospholipids. Lipids can be divided into at least three
classes: (1) "simple
lipids," which include fats and oils as well as waxes; (2) "compound lipids,"
which include
phospholipids and glycolipids (e.g., DMPE-PEG2000); and (3) "derived lipids"
such as steroids.
Further, as used herein, lipids also encompass lipidoid compounds. The term
"lipidoid
- 3 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
compound," also simply "lipidoid", refers to a lipid-like compound (e.g. an
amphiphilic
compound with lipid-like physical properties).
[0014] The term "lipid nanoparticle" or "LNP" refers to a particle having
at least one
dimension on the order of nanometers (nm) (e.g., 1 to 1,000 nm), which
contains one or more
types of lipid molecules. The LNP provided herein can further contain at least
one non-lipid
payload molecule (e.g., one or more nucleic acid molecules). In some
embodiments, the LNP
comprises a non-lipid payload molecule either partially or completely
encapsulated inside a lipid
shell. Particularly, in some embodiments, wherein the payload is a negatively
charged molecule
(e.g., mRNA encoding a viral protein), and the lipid components of the LNP
comprise at least
one cationic lipid. Without being bound by the theory, it is contemplated that
the cationic lipids
can interact with the negatively charged payload molecules and facilitates
incorporation and/or
encapsulation of the payload into the LNP during LNP formation. Other lipids
that can form part
of a LNP as provided herein include but are not limited to neutral lipids and
charged lipids, such
as steroids, polymer conjugated lipids, and various zwitterionic lipids. In
certain embodiments, a
LNP according to the present disclosure comprises one or more lipids of
Formula (I) to (IV) (and
sub-formulas thereof) as described herein.
[0015] The term "cationic lipid" refers to a lipid that is either
positively charged at any pH
value or hydrogen ion activity of its environment, or capable of being
positively charged in
response to the pH value or hydrogen ion activity of its environment (e.g.,
the environment of its
intended use). Thus, the term "cationic" encompasses both "permanently
cationic" and
"cationisable." In certain embodiments, the positive charge in a cationic
lipid results from the
presence of a quaternary nitrogen atom. In certain embodiments, the cationic
lipid comprises a
zwitterionic lipid that assumes a positive charge in the environment of its
intended use (e.g., at
physiological pH). In certain embodiments, the cationic lipid is one or more
lipids of Formula
(I) to (IV) (and sub-formulas thereof) as described herein.
[0016] The term "polymer conjugated lipid" refers to a molecule comprising
both a lipid
portion and a polymer portion. An example of a polymer conjugated lipid is a
pegylated lipid
(PEG-lipid), in which the polymer portion comprises a polyethylene glycol.
[0017] The term "neutral lipid" encompasses any lipid molecules existing in
uncharged
forms or neutral zwitterionic forms at a selected pH value or within a
selected pH range. In
- 4 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
some embodiments, the selected useful pH value or range corresponds to the pH
condition in an
environment of the intended uses of the lipids, such as the physiological pH.
As non-limiting
examples, neutral lipids that can be used in connection with the present
disclosure include, but
are not limited to, phosphotidylcholines such as 1,2-distearoyl-sn-glycero-3-
phosphocholine
(DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-
glycero-3-
phosphocholine (DMPC), 1-palmitoy1-2-oleoyl-sn-glycero-3-phosphocholine
(POPC), 1,2-
dioleoyl-sn-glycero-3-phosphocholine (DOPC), phophatidylethanolamines such as
1,2-dioleoyl-
sn-glycero-3-phosphoethanolamine (DOPE), 2-((2,3-
bis(oleoyloxy)propyl)dimethylammonio)ethyl hydrogen phosphate (DOCP),
sphingomyelins
(SM), ceramides, steroids such as sterols and their derivatives. Neutral
lipids as provided herein
may be synthetic or derived (isolated or modified) from a natural source or
compound.
100181 The term "charged lipid" encompasses any lipid molecules that exist
in either
positively charged or negatively charged forms at a selected pH or within a
selected pH range.
In some embodiments, the selected pH value or range corresponds to the pH
condition in an
environment of the intended uses of the lipids, such as the physiological pH.
As non-limiting
examples, neutral lipids that can be used in connection with the present
disclosure include, but
are not limited to, phosphatidylserines, phosphatidic acids,
phosphatidylglycerols,
phosphatidylinositols, sterol hemisuccinates, dialkyl trimethylarnmonium-
propanes, (e.g.,
DOTAP, DOTMA), dialkyl dimethylaminopropanes, ethyl phosphocholines,
dimethylaminoethane carbamoyl sterols (e.g., DC-Chol), 1,2-dioleoyl-sn-glycero-
3-phospho-L-
serine sodium salt (DOPS-Na), 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-
glycerol) sodium salt
(DOPG-Na), and 1,2-dioleoyl-sn-glycero-3-phosphate sodium salt (DOPA-Na).
Charged lipids
as provided herein may be synthetic or derived (isolated or modified) from a
natural source or
compound.
[0019] As used herein, and unless otherwise specified, the term "alkyl"
refers to a straight or
branched hydrocarbon chain radical consisting solely of carbon and hydrogen
atoms, which is
saturated. In one embodiment, the alkyl group has, for example, from one to
twenty-four carbon
atoms (C1-C24 alkyl), four to twenty carbon atoms (C4-C2o alkyl), six to
sixteen carbon atoms
(C6-C16 alkyl), six to nine carbon atoms (C6-C9 alkyl), one to fifteen carbon
atoms (C1-C15 alkyl),
one to twelve carbon atoms (C1-C12 alkyl), one to eight carbon atoms (Ci-Cs
alkyl) or one to six
carbon atoms (CI-C6 alkyl) and which is attached to the rest of the molecule
by a single bond.
- 5 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1821 1 0784FF
Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-
propyl, 1-methylethyl
(isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl), 3-methylhexyl, 2-
methylhexyl, and the
like. Unless otherwise specified, an alkyl group is optionally substituted.
[0020] As used herein, and unless otherwise specified, the term "alkenyl"
refers to a straight
or branched hydrocarbon chain radical consisting solely of carbon and hydrogen
atoms, which
contains one or more carbon-carbon double bonds. The term "alkenyl" also
embraces radicals
having "cis" and "trans" configurations, or alternatively, "E" and "Z"
configurations, as
appreciated by those of ordinary skill in the art. In one embodiment, the
alkenyl group has,, for
example, from two to twenty-four carbon atoms (C2-C24 alkenyl), four to twenty
carbon atoms
(C4-C2o alkenyl), six to sixteen carbon atoms (C6-C16 alkenyl), six to nine
carbon atoms (C6-
C9 alkenyl), two to fifteen carbon atoms (C2-C15 alkenyl), two to twelve
carbon atoms (C2-
C12 alkenyl), two to eight carbon atoms (C2-Cs alkenyl) or two to six carbon
atoms (C2-
C6 alkenyl) and which is attached to the rest of the molecule by a single
bond. Examples of
alkenyl groups include, but are not limited to, ethenyl, prop-l-enyl, but-1-
enyl, pent-1-enyl,
penta-1,4-dienyl, and the like. Unless otherwise specified, an alkenyl group
is optionally
substituted.
[0021] As used herein, and unless otherwise specified, the term "alkynyl"
refers to a straight
or branched hydrocarbon chain radical consisting solely of carbon and hydrogen
atoms, which
contains one or more carbon-carbon triple bonds. In one embodiment, the
alkynyl group has, for
example, from two to twenty-four carbon atoms (C2-C24 alkynyl), four to twenty
carbon atoms
(C4-C2o alkynyl), six to sixteen carbon atoms (C6-C16 alkynyl), six to nine
carbon atoms (C6-
C9 alkynyl), two to fifteen carbon atoms (C2-C15 alkynyl), two to twelve
carbon atoms (C2-
C12 alkynyl), two to eight carbon atoms (C2-C8 alkynyl) or two to six carbon
atoms (C2-
C6 alkynyl) and which is attached to the rest of the molecule by a single
bond. Examples of
alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl,
pentynyl, and the like.
Unless otherwise specified, an alkynyl group is optionally substituted.
[0022] As used herein, and unless otherwise specified, the term "alkylene"
or "alkylene
chain" refers to a straight or branched divalent hydrocarbon chain linking the
rest of the
molecule to a radical group, consisting solely of carbon and hydrogen, which
is saturated. In one
embodiment, the alkylene has, for example, from one to twenty-four carbon
atoms (CI-
- 6 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
1821 1 0784FF
C24 alkylene), one to fifteen carbon atoms (C1-C15 alkylene), one to twelve
carbon atoms (Ci-
C12 alkylene), one to eight carbon atoms (C1-C8 alkylene), one to six carbon
atoms (CI-
C6 alkylene), two to four carbon atoms (C2-C4 alkylene), one to two carbon
atoms (Ci-
C2 alkylene). Examples of alkylene groups include, but are not limited to,
methylene, ethylene,
propylene, n-butylene, and the like. The alkylene chain is attached to the
rest of the molecule
through a single bond and to the radical group through a single bond. The
points of attachment
of the alkylene chain to the rest of the molecule and to the radical group can
be through one
carbon or any two carbons within the chain. Unless otherwise specified, an
alkylene chain is
optionally substituted.
100231 As used herein, and unless otherwise specified, the term
"alkenylene" refers to a
straight or branched divalent hydrocarbon chain linking the rest of the
molecule to a radical
group, consisting solely of carbon and hydrogen, which contains one or more
carbon-carbon
double bonds. In one embodiment, the alkenylene has, for example, from two to
twenty-four
carbon atoms (C2-C24 alkenylene), two to fifteen carbon atoms (C2-C15
alkenylene), two to
twelve carbon atoms (C2-C12 alkenylene), two to eight carbon atoms (C2-C8
alkenylene), two to
six carbon atoms (C2-C6 alkenylene) or two to four carbon atoms (C2-C4
alkenylene). Examples
of alkenylene include, but are not limited to, ethenylene, propenylene, n-
butenylene, and the like.
The alkenylene is attached to the rest of the molecule through a single or
double bond and to the
radical group through a single or double bond. The points of attachment of the
alkenylene to the
rest of the molecule and to the radical group can be through one carbon or any
two carbons
within the chain. Unless otherwise specified, an alkenylene is optionally
substituted.
[0024] As used herein, and unless otherwise specified, the term
"cycloalkyl" refers to a non-
aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of
carbon and hydrogen
atoms, and which is saturated. Cycloalkyl group may include fused or bridged
ring systems. In
one embodiment, the cycloalkyl has, for example, from 3 to 15 ring carbon
atoms (C3-
C15 cycloalkyl), from 3 to 10 ring carbon atoms (C3-C10 cycloalkyl), or from 3
to 8 ring carbon
atoms (C3-Cs cycloalkyl). The cycloalkyl is attached to the rest of the
molecule by a single
bond. Examples of monocyclic cycloalkyl radicals include, but are not limited
to, cyclopropyl,
cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of
polycyclic
cycloalkyl radicals include, but are not limited to, adamantyl, norbomyl,
decalinyl, 7,7-dimethyl-
- 7 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
bicyclo[2.2.1]heptanyl, and the like. Unless otherwise specified, a cycloalkyl
group is optionally
substituted.
100251 As used herein, and unless otherwise specified, the term
"cycloalkylene" is a divalent
cycloalkyl group. Unless otherwise specified, a cycloalkylene group is
optionally substituted.
100261 As used herein, and unless otherwise specified, the term
"cycloalkenyl" refers to a
non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of
carbon and
hydrogen atoms, and which includes one or more carbon-carbon double bonds.
Cycloalkenyl
may include fused or bridged ring systems. In one embodiment, the cycloalkenyl
has, for
example, from 3 to 15 ring carbon atoms (C3-C15 cycloalkenyl), from 3 to 10
ring carbon atoms
(C3-C10 cycloalkenyl), or from 3 to 8 ring carbon atoms (C3-C8 cycloalkenyl).
The cycloalkenyl
is attached to the rest of the molecule by a single bond. Examples of
monocyclic cycloalkenyl
radicals include, but are not limited to, cyclopropenyl, cyclobutenyl,
cyclopentenyl,
cyclohexenyl, cycloheptenyl, cyclooctenyl, and the like. Unless otherwise
specified, a
cycloalkenyl group is optionally substituted.
100271 As used herein, and unless otherwise specified, the term
"cycloalkenylene" is a
divalent cycloalkenyl group. Unless otherwise specified, a cycloalkenylene
group is optionally
substituted.
100281 As used herein, and unless otherwise specified, the term
"heterocyclyl" refers to a
non-aromatic radical monocyclic or polycyclic moiety that contains one or more
(e.g., one, one
or two, one to three, or one to four) heteroatoms independently selected from
nitrogen, oxygen,
phosphorous, and sulfur. The heterocyclyl may be attached to the main
structure at any
heteroatom or carbon atom. A heterocyclyl group can be a monocyclic, bicyclic,
tricyclic,
tetracyclic, or other polycyclic ring system, wherein the polycyclic ring
systems can be a fused,
bridged or spiro ring system. Heterocyclyl polycyclic ring systems can include
one or more
heteroatoms in one or more rings. A heterocyclyl group can be saturated or
partially unsaturated.
Saturated heterocycloalkyl groups can be termed "heterocycloalkyl". Partially
unsaturated
heterocycloalkyl groups can be termed "heterocycloalkenyl" if the heterocyclyl
contains at least
one double bond, or "heterocycloalkynyl" if the heterocyclyl contains at least
one triple bond. In
one embodiment, the heterocyclyl has, for example, 3 to 18 ring atoms (3- to
18-membered
heterocyclyl), 4 to 18 ring atoms (4- to 18-membered heterocyclyl), 5 to 18
ring atoms (3- to 18-
- 8 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
membered heterocyclyl), 4 to 8 ring atoms (4- to 8-membered heterocyclyl), or
5 to 8 ring atoms
(5- to 8-membered heterocyclyl). Whenever it appears herein, a numerical range
such as "3 to
18" refers to each integer in the given range; e.g., "3 to 18 ring atoms"
means that the
heterocyclyl group can consist of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6
ring atoms, 7 ring
atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, etc., up to and including 18
ring atoms.
Examples of heterocyclyl groups include, but are not limited to, imidazolyl,
imidazolidinyl,
oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl,
isoxazolidinyl,
isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl,
pyrrolidinyl, fury!,
tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and
isoquinolyl. Unless otherwise
specified, a heterocyclyl group is optionally substituted.
[0029] As used herein, and unless otherwise specified, the term
"heterocyclylene" is a
divalent heterocyclyl group. Unless otherwise specified, a heterocyclylene
group is optionally
substituted.
100301 As used herein, and unless otherwise specified, the term "aryl"
refers to a monocyclic
aromatic group and/or multicyclic monovalent aromatic group that contain at
least one aromatic
hydrocarbon ring. In certain embodiments, the aryl has from 6 to 18 ring
carbon atoms (C6-
C18 aryl), from 6 to 14 ring carbon atoms (C6-C14 aryl), or from 6 to 10 ring
carbon atoms (C6-
Cio aryl). Examples of aryl groups include, but are not limited to, phenyl,
naphthyl, fluorenyl,
azulenyl, anthryl, phenanthryl, pyrenyl, biphenyl, and terphenyl. The term
"aryl" also refers to
bicyclic, tricyclic, or other multicyclic hydrocarbon rings, where at least
one of the rings is
aromatic and the others of which may be saturated, partially unsaturated, or
aromatic, for
example, dihydronaphthyl, indenyl, indanyl, or tetrahydronaphthyl
(tetralinyl). Unless otherwise
specified, an aryl group is optionally substituted.
[0031] As used herein, and unless otherwise specified, the term "arylene"
is a divalent aryl
group. Unless otherwise specified, an arylene group is optionally substituted.
[0032] As used herein, and unless otherwise specified, the term
"heteroaryl" refers to a
monocyclic aromatic group and/or multicyclic aromatic group that contains at
least one aromatic
ring, wherein at least one aromatic ring contains one or more (e.g., one, one
or two, one to three,
or one to four) heteroatoms independently selected from 0, S. and N. The
heteroaryl may be
attached to the main structure at any heteroatom or carbon atom. In certain
embodiments, the
- 9 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
heteroaryl has from 5 to 20, from 5 to 15, or from 5 to 10 ring atoms. The
term "heteroaryl" also
refers to bicyclic, tricyclic, or other multicyclic rings, where at least one
of the rings is aromatic
and the others of which may be saturated, partially unsaturated, or aromatic,
wherein at least one
aromatic ring contains one or more heteroatoms independently selected from 0,
S. and N.
Examples of monocyclic heteroaryl groups include, but are not limited to,
pyrrolyl, pyrazolyl,
pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl,
isothiazolyl, furanyl,
thienyl, oxadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, and
triazinyl. Examples of
bicyclic heteroaryl groups include, but are not limited to, indolyl,
benzothiazolyl, benzoxazolyl,
benzothienyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl,
benzimidazolyl, benzopyranyl,
indolizinyl, benzofuranyl, isobenzofuranyl, chromonyl, coumarinyl, cinnolinyl,
quinoxalinyl,
indazolyl, purinyl, pyrrolopyridinyl, furopyridinyl, thienopyridinyl,
dihydroisoindolyl, and
tetrahydroquinolinyl. Examples of tricyclic heteroaryl groups include, but are
not limited to,
carbazolyl, benzindolyl, phenanthrollinyl, acridinyl, phenanthridinyl, and
xanthenyl. Unless
otherwise specified, a heteroaryl group is optionally substituted.
[0033] As used herein, and unless otherwise specified, the term
"heteroarylene" is a divalent
heteroaryl group. Unless otherwise specified, a heteroarylene group is
optionally substituted.
[0034] When the groups described herein are said to be "substituted," they
may be
substituted with any appropriate substituent or substituents. Illustrative
examples of substituents
include, but are not limited to, those found in the exemplary compounds and
embodiments
provided herein, as well as: a halogen atom such as F, CI, Br, or I; cyano;
oxo (0); hydroxyl (-
OH); alkyl; alkenyl; alkynyl; cycloalkyl; aryl; -(C=0)OR'; -0(C=0)R'; -C(D)R';
-OR'; -
S(0)mR'; -S-SR'; -C(3)SR'; -SC(0)R'; -NR'R'; -NR'C(=0)R'; -
NR'C(0)NR'R'; -0C(=0)NR'R'; -NR'C(0)OR'; -NR'S(0)mNR'R'; -NR'S(0)mR'; and -
S(0) ,NR'R', wherein: R' is, at each occurrence, independently H, CI-CB alkyl
or cycloalkyl,
and x is 0, 1 or 2. In some embodiments the substituent is a C1-C12 alkyl
group. In other
embodiments, the substituent is a cycloalkyl group. In other embodiments, the
substituent is a
halo group, such as fluor . In other embodiments, the substituent is an oxo
group. In other
embodiments, the substituent is a hydroxyl group. In other embodiments, the
substituent is an
alkoxy group (-OR'). In other embodiments, the substituent is a carboxyl
group. In other
embodiments, the substituent is an amino group (-NR'R').
-10-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[0035] As used herein, and unless otherwise specified, the term "optional"
or "optionally"
(e.g., optionally substituted) means that the subsequently described event of
circumstances may
or may not occur, and that the description includes instances where said event
or circumstance
occurs and instances in which it does not. For example, "optionally
substituted alkyl" means that
the alkyl radical may or may not be substituted and that the description
includes both substituted
alkyl radicals and alkyl radicals having no substitution.
[0036] As used herein, and unless otherwise specified, the term "prodrug"
of a biologically
active compound refers to a compound that may be converted under physiological
conditions or
by solvolysis to the biologically active compound. In one embodiment, the term
"prodrug"
refers to a metabolic precursor of the biologically active compound that is
pharmaceutically
acceptable. A prodrug may be inactive when administered to a subject in need
thereof, but is
converted in vivo to the biologically active compound. Prodrugs are typically
rapidly
transformed in vivo to yield the parent biologically active compound, for
example, by hydrolysis
in blood. The prodrug compound often offers advantages of solubility, tissue
compatibility or
delayed release in a mammalian organism (see, Bundgard, H., Design of Prodrugs
(1985), pp. 7-
9, 21-24 (Elsevier, Amsterdam)). A discussion of prodrugs is provided in
Higuchi, T., et al.,
A.C.S. Symposium Series, Vol. 14, and in Bioreversible Carriers in Drug
Design, Ed. Edward B.
Roche, American Pharmaceutical Association and Pergamon Press, 1987.
[00371 In one embodiment, the term "prodrug" is also meant to include any
covalently
bonded carriers, which release the active compound in vivo when such prodrug
is administered to
a mammalian subject. Prodrugs of a compound may be prepared by modifying
functional groups
present in the compound in such a way that the modifications are cleaved,
either in routine
manipulation or in vivo, to the parent compound. Prodrugs include compounds
wherein a
hydroxyl, amino or mercapto group is bonded to any group that, when the
prodrug of the
compound is administered to a mammalian subject, cleaves to form a free
hydroxyl, free amino
or free mercapto group, respectively.
[0038] Examples of prodrugs include, but are not limited to, acetate,
formate and benzoate
derivatives of alcohol or amide derivatives of amine functional groups in the
compounds
provided herein.
- 11 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[0039] As used herein, and unless otherwise specified, the term
"pharmaceutically acceptable
salt" includes both acid and base addition salts.
[0040] Examples of pharmaceutically acceptable acid addition salts include,
but are not
limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid,
phosphoric acid and the
like, and organic acids such as, but not limited to, acetic acid, 2,2-
dichloroacetic acid, adipic
acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid,
benzoic acid, 4-
acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid,
caproic acid,
caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid,
dodecylsulfuric acid,
ethane-1,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid,
formic acid,
fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic
acid, glucuronic acid,
glutamic acid, glutaric acid, 2-oxo-glutaric acid, glycerophosphoric acid,
glycolic acid, hippuric
acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic
acid, malic acid, malonic
acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1,5-
disulfonic acid,
naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic
acid, orotic acid,
oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid,
pyruvic acid, salicylic
acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid,
tartaric acid, thiocyanic acid,
p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid, and the like.
[0041] Examples of pharmaceutically acceptable base addition salt include,
but are not
limited to, salts prepared from addition of an inorganic base or an organic
base to a free acid
compound. Salts derived from inorganic bases include, but are not limited to,
the sodium,
potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper,
manganese, aluminum
salts and the like. In one embodiment, the inorganic salts are the ammonium,
sodium, potassium,
calcium, and magnesium salts. Salts derived from organic bases include, but
are not limited to,
salts of primary, secondary, and tertiary amines, substituted amines including
naturally occurring
substituted amines, cyclic amines and basic ion exchange resins, such as
ammonia,
isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine,
diethanolamine,
ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol,
dicyclohexylamine,
lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline,
betaine, benethamine,
benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine,
triethanolamine,
tromethamine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine
resins and the like.
-12-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
In one embodiment, the organic bases are isopropylamine, diethylamine,
ethanolamine,
trimethylamine, dicyclohexylamine, choline and caffeine.
[0042] A compound provided herein may contain one or more asymmetric
centers and may
thus give rise to enantiomers, diastereomers, and other stereoisomeric forms
that may be defined,
in terms of absolute stereochemistry, as (R)- or (S)- or, as (D)- or (L)- for
amino acids. Unless
otherwise specified, a compound provided herein is meant to include all such
possible isomers,
as well as their racemic and optically pure forms. Optically active (+) and (-
), (R)- and (S)-, or
(D)- and (L)- isomers may be prepared using chiral synthons or chiral
reagents, or resolved using
conventional techniques, for example, chromatography and fractional
crystallization.
Conventional techniques for the preparation/isolation of individual
enantiomers include chiral
synthesis from a suitable optically pure precursor or resolution of the
racemate (or the racemate
of a salt or derivative) using, for example, chiral high pressure liquid
chromatography (HPLC).
When the compounds described herein contain olefinic double bonds or other
centers of
geometric asymmetry, and unless specified otherwise, it is intended that the
compounds include
both E and Z geometric isomers. Likewise, all tautomeric forms are also
intended to be
included.
[0043] As used herein, and unless otherwise specified, the term "isomer"
refers to different
compounds that have the same molecular formula. "Stereoisomers" are isomers
that differ only
in the way the atoms are arranged in space. "Atropisomers" are stereoisomers
from hindered
rotation about single bonds. "Enantiomers" are a pair of stereoisomers that
are
non-superimposable mirror images of each other. A mixture of a pair of
enantiomers in any
proportion can be known as a "racemic" mixture. "Diastereoisomers" are
stereoisomers that
have at least two asymmetric atoms, but which are not mirror-images of each
other.
[0044] "Stereoisomers" can also include E and Z isomers, or a mixture
thereof, and cis and
trans isomers or a mixture thereof. In certain embodiments, a compound
described herein is
isolated as either the E or Z isomer. In other embodiments, a compound
described herein is a
mixture of the E and Z isomers.
[0045] "Tautomers" refers to isomeric forms of a compound that are in
equilibrium with
each other. The concentrations of the isomeric forms will depend on the
environment the
- 13-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
compound is found in and may be different depending upon, for example, whether
the compound
is a solid or is in an organic or aqueous solution.
[0046] It should also be noted a compound described herein can contain
unnatural
proportions of atomic isotopes at one or more of the atoms. For example, the
compounds may be
radiolabeled with radioactive isotopes, such as for example tritium (3H),
iodine-125 (1251),
sulfur-35 (35S), or carbon-14 (14C), or may be isotopically enriched, such as
with deuterium (2H),
carbon-13 (13C), or nitrogen-15 (15N). As used herein, an "isotopolog" is an
isotopically
enriched compound. The term "isotopically enriched" refers to an atom having
an isotopic
composition other than the natural isotopic composition of that atom.
"Isotopically enriched"
may also refer to a compound containing at least one atom having an isotopic
composition other
than the natural isotopic composition of that atom. The term "isotopic
composition" refers to the
amount of each isotope present for a given atom. Radiolabeled and isotopically
enriched
compounds are useful as therapeutic agents, e.g., cancer therapeutic agents,
research reagents,
e.g., binding assay reagents, and diagnostic agents, e.g., in vivo imaging
agents. All isotopic
variations of a compound described herein, whether radioactive or not, are
intended to be
encompassed within the scope of the embodiments provided herein. In some
embodiments, there
are provided isotopologs of a compound described herein, for example, the
isotopologs are
deuterium, carbon-13, and/or nitrogen-15 enriched. As used herein,
"deuterated", means a
compound wherein at least one hydrogen (II) has been replaced by deuterium
(indicated by D or
2H), that is, the compound is enriched in deuterium in at least one position.
[0047] It should be noted that if there is a discrepancy between a depicted
structure and a
name for that structure, the depicted structure is to be accorded more weight.
[0048] As used herein, and unless otherwise specified, the term
"pharmaceutically acceptable
carrier, diluent or excipient" includes without limitation any adjuvant,
carrier, excipient, glidant,
sweetening agent, diluent, preservative, dye/colorant, flavor enhancer,
surfactant, wetting agent,
dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, or
emulsifier which has
been approved by the United States Food and Drug Administration as being
acceptable for use in
humans or domestic animals.
[0049] The term "composition" is intended to encompass a product containing
the specified
ingredients (e.g., a mRNA molecule provided herein) in, optionally, the
specified amounts.
-14-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[0050] The term "polynucleotide" or "nucleic acid," as used interchangeably
herein, refers to
polymers of nucleotides of any length and includes, e.g., DNA and RNA. The
nucleotides can
be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases,
and/or their analogs, or
any substrate that can be incorporated into a polymer by DNA or RNA polymerase
or by a
synthetic reaction. A polynucleotide may comprise modified nucleotides, such
as methylated
nucleotides and their analogs. Nucleic acid can be in either single- or double-
stranded forms. As
used herein and unless otherwise specified, "nucleic acid" also includes
nucleic acid mimics such
as locked nucleic acids (LNAs), peptide nucleic acids (PNAs), and morpholinos.
"Oligonucleotide," as used herein, refers to short synthetic polynucleotides
that are generally, but
not necessarily, fewer than about 200 nucleotides in length. The terms
"oligonucleotide" and
"polynucleotide" are not mutually exclusive. The description above for
polynucleotides is
equally and fully applicable to oligonucleotides. Unless specified otherwise,
the left-hand end of
any single-stranded polynucleotide sequence disclosed herein is the 5' end;
the left-hand
direction of double-stranded polynucleotide sequences is referred to as the 5'
direction. The
direction of 5' to 3' addition of nascent RNA transcripts is referred to as
the transcription
direction; sequence regions on the DNA strand having the same sequence as the
RNA transcript
that are 5' to the 5' end of the RNA transcript are referred to as "upstream
sequences"; sequence
regions on the DNA strand having the same sequence as the RNA transcript that
are 3' to the 3'
end of the RNA transcript are referred to as "downstream sequences."
[0051] An "isolated nucleic acid" is a nucleic acid, for example, an RNA,
DNA, or a mixed
nucleic acids, which is substantially separated from other genome DNA
sequences as well as
proteins or complexes such as ribosomes and polymerases, which naturally
accompany a native
sequence. An "isolated" nucleic acid molecule is one which is separated from
other nucleic acid
molecules which are present in the natural source of the nucleic acid
molecule. Moreover, an
"isolated" nucleic acid molecule, such as an mRNA molecule, can be
substantially free of other
cellular material, or culture medium when produced by recombinant techniques,
or substantially
free of chemical precursors or other chemicals when chemically synthesized. In
a specific
embodiment, one or more nucleic acid molecules encoding an antigen as
described herein are
isolated or purified. The term embraces nucleic acid sequences that have been
removed from
their naturally occurring environment, and includes recombinant or cloned DNA
or RNA isolates
-15-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
and chemically synthesized analogues or analogues biologically synthesized by
heterologous
systems. A substantially pure molecule may include isolated forms of the
molecule.
[0052] The term "encoding nucleic acid" or grammatical equivalents thereof
as it is used in
reference to nucleic acid molecule encompasses (a) a nucleic acid molecule in
its native state or
when manipulated by methods well known to those skilled in the art that can be
transcribed to
produce mRNA which is then translated into a peptide and/or polypeptide, and
(b) the mRNA
molecule itself. The antisense strand is the complement of such a nucleic acid
molecule, and the
encoding sequence can be deduced therefrom. The term "coding region" refers to
a portion in an
encoding nucleic acid sequence that is translated into a peptide or
polypeptide. The term
"untranslated region" or "UTR" refers to the portion of an encoding nucleic
acid that is not
translated into a peptide or polypeptide. Depending on the orientation of a
UTR with respect to
the coding region of a nucleic acid molecule, a UTR is referred to as the 5'-
UTR if located to the
5'-end of a coding region, and a UTR is referred to as the 3'-UTR if located
to the 3'-end of a
coding region.
[0053] The term "mRNA" as used herein refers to a message RNA molecule
comprising one
or more open reading frame (ORF) that can be translated by a cell or an
organism provided with
the mRNA to produce one or more peptide or protein product. The region
containing the one or
more ORFs is referred to as the coding region of the mRNA molecule. In certain
embodiments,
the mRNA molecule further comprises one or more untranslated regions (UTRs).
[0054] In certain embodiments, the mRNA is a monocistronic mRNA that
comprises only
one ORF. In certain embodiments, the monocistronic mRNA encodes a peptide or
protein
comprising at least one epitope of a selected antigen (e.g., a pathogenic
antigen or a tumor
associated antigen). In other embodiments, the mRNA is a multicistronic mRNA
that comprises
two or more ORFs. In certain embodiments, the multiecistronic mRNA encodes two
or more
peptides or proteins that can be the same or different from each other. In
certain embodiments,
each peptide or protein encoded by a multicistronic mRNA comprises at least
one epitope of a
selected antigen. In certain embodiments, different peptide or protein encoded
by a
multicistronic mRNA each comprises at least one epitope of different antigens.
In any of the
embodiments described herein, the at least one epitope can be at least 2, at
least 3, at least 4, at
least 5, at least 6, at least 7, at least 8, at least 9, or at least 10
epitopes of an antigen.
-16-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[0055] The term "nucleobases" encompasses purines and pyrimidines,
including natural
compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural or
synthetic analogs
or derivatives thereof.
[0056] The term "functional nucleotide analog" as used herein refers to a
modified version of
a canonical nucleotide A, G, C, U or T that (a) retains the base-pairing
properties of the
corresponding canonical nucleotide, and (b) contains at least one chemical
modification to (i) the
nucleobase, (ii) the sugar group, (iii) the phosphate group, or (iv) any
combinations of (i) to (iii),
of the corresponding natural nucleotide. As used herein, base pairing
encompasses not only the
canonical Watson-Crick adenine-thymine, adenine-uracil, or guanine-cytosine
base pairs, but
also base pairs formed between canonical nucleotides and functional nucleotide
analogs or
between a pair of functional nucleotide analogs, wherein the arrangement of
hydrogen bond
donors and hydrogen bond acceptors permits hydrogen bonding between a modified
nucleobase
and a canonical nucleobase or between two complementary modified nucleobase
structures. For
example, a functional analog of guanosine (G) retains the ability to base-pair
with cytosine (C) or
a functional analog of cytosine. One example of such non-canonical base
pairing is the base
pairing between the modified nucleotide inosine and adenine, cytosine, or
uracil. As described
herein, a functional nucleotide analog can be either naturally occurring or
non-naturally
occurring. Accordingly, a nucleic acid molecule containing a functional
nucleotide analog can
have at least one modified nucleobase, sugar group and/or internucleoside
linkage. Exemplary
chemical modifications to the nucleobases, sugar groups, or internucleoside
linkages of a nucleic
acid molecule are provided herein.
[0057] The terms "translational enhancer element," "TEE" and "translational
enhancers" as
used herein refers to an region in a nucleic acid molecule that functions to
promotes translation
of a coding sequence of the nucleic acid into a protein or peptide product,
such as via cap-
dependent or cap-independent translation. A TEE typically locates in the UTR
region of a
nucleic acid molecule (e.g., mRNA) and enhance the translational level of a
coding sequence
located either upstream or downstream. For example, a TEE in a 5'-UTR of a
nucleic acid
molecule can locate between the promoter and the starting codon of the nucleic
acid molecule.
Various TEE sequences are known in the art (Wellensiek et al. Genome-wide
profiling of human
cap-independent translation-enhancing elements, Nature Methods, 2013 Aug;
10(8): 747-750;
Chappell et al. PNAS June 29, 2004 101(26) 9590-9594). Some TEEs are known to
be
-17-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
conserved across multiple species (Panek et al. Nucleic Acids Research, Volume
41, Issue 16, 1
September 2013, Pages 7625-7634).
[0058] As used herein, the term "stem-loop sequence" refers to a single-
stranded
polynucleotide sequence having at least two regions that are complementary or
substantially
complementary to each other when read in opposite directions, and thus capable
of base-pairing
with each other to form at least one double helix and an unpaired loop. The
resulting structure is
known as a stem-loop structure, a hairpin, or a hairpin loop, which is a
secondary structure found
in many RNA molecules.
[0059] The term "peptide" as used herein refers to a polymer containing
between two and
fifty (2-50) amino acid residues linked by one or more covalent peptide
bond(s). The terms
apply to naturally occurring amino acid polymers as well as amino acid
polymers in which one
or more amino acid residues is a non-naturally occurring amino acid (e.g., an
amino acid analog
or non-natural amino acid).
100601 The terms "polypeptide" and "protein" are used interchangeably
herein to refer to a
polymer of greater than fifty (50) amino acid residues linked by covalent
peptide bonds. That is,
a description directed to a polypeptide applies equally to a description of a
protein, and vice
versa. The terms apply to naturally occurring amino acid polymers as well as
amino acid
polymers in which one or more amino acid residues is a non-naturally occurring
amino acid (e.g.,
an amino acid analog). As used herein, the terms encompass amino acid chains
of any length,
including full length proteins (e.g., antigens).
[0061] The term "antigen" refers to a substance that can be recognized by
the immune
system of a subject (including by the adaptive immune system), and is capable
of triggering an
immune response after the subject is contacted with the antigen (including an
antigen-specific
immune response). In certain embodiments, the antigen is a protein associated
with a diseased
cell, such as a cell infected by a pathogen or a neoplastic cell (e.g., tumor
associated antigen
(TAA)).
[0062] In the context of a peptide or polypeptide, the term "fragment" as
used herein refers
to a peptide or polypeptide that comprises less than the full length amino
acid sequence. Such a
fragment may arise, for example, from a truncation at the amino terminus, a
truncation at the
carboxy terminus, and/or an internal deletion of a residue(s) from the amino
acid sequence.
- I 8 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
Fragments may, for example, result from alternative RNA splicing or from in
vivo protease
activity. In certain embodiments, fragments refers to polypeptides comprising
an amino acid
sequence of at least 5 contiguous amino acid residues, at least 10 contiguous
amino acid
residues, at least 15 contiguous amino acid residues, at least 20 contiguous
amino acid residues,
at least 25 contiguous amino acid residues, at least 30 contiguous amino acid
residues, at least 40
contiguous amino acid residues, at least 50 contiguous amino acid residues, at
least 60
contiguous amino residues, at least 70 contiguous amino acid residues, at
least 80 contiguous
amino acid residues, at least 90 contiguous amino acid residues, at least
contiguous 100 amino
acid residues, at least 125 contiguous amino acid residues, at least 150
contiguous amino acid
residues, at least 175 contiguous amino acid residues, at least 200 contiguous
amino acid
residues, at least 250, at least 300, at least 350, at least 400, at least
450, at least 500, at least 550,
at least 600, at least 650, at least 700, at least 750, at least 800, at least
850, at least 900, or at
least 950 contiguous amino acid residues of the amino acid sequence of a
polypeptide. In a
specific embodiment, a fragment of a polypeptide retains at least 1, at least
2, at least 3, or more
functions of the polypeptide.
[0063] An "epitope" is the site on the surface of an antigen molecule to
which a single
antibody molecule binds, such as a localized region on the surface of an
antigen that is capable of
being bound to one or more antigen binding regions of an antibody, and that
has antigenic or
immunogenic activity in an animal, such as a mammal (e.g., a human), that is
capable of eliciting
an immune response. An epitope having immunogenic activity is a portion of a
polypeptide that
elicits an antibody response in an animal. An epitope having antigenic
activity is a portion of a
polypeptide to which an antibody binds as determined by any method well known
in the art,
including, for example, by an immunoassay. Antigenic epitopes need not
necessarily be
immunogenic. Epitopes often consist of chemically active surface groupings of
molecules such
as amino acids or sugar side chains and have specific three dimensional
structural characteristics
as well as specific charge characteristics. Antibody epitopes may be linear
epitopes or
conformational epitopes. Linear epitopes are formed by a continuous sequence
of amino acids in
a protein. Conformational epitopes are formed of amino acids that are
discontinuous in the
protein sequence, but which are brought together upon folding of the protein
into its three-
dimensional structure. Induced epitopes are formed when the three dimensional
structure of the
protein is in an altered conformation, such as following activation or binding
of another protein
-19-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
or ligand. In certain embodiments, an epitope is a three-dimensional surface
feature of a
polypeptide. In other embodiments, an epitope is linear feature of a
polypeptide. Generally an
antigen has several or many different epitopes and may react with many
different antibodies.
[0064] The term "genetic vaccine" as used herein refers to a therapeutic or
prophylactic
composition comprising at least one nucleic acid molecule encoding an antigen
associated with a
target disease (e.g., an infectious disease or a neoplastic disease).
Administration of the vaccine
to a subject ("vaccination") allows for the production of the encoded peptide
or protein, thereby
eliciting an immune response against the target disease in the subject. In
certain embodiments,
the immune response comprises adaptive immune response, such as the production
of antibodies
against the encoded antigen, and/or activation and proliferations of immune
cells capable of
specifically eliminating diseased cells expressing the antigen. In certain
embodiments, the
immune response further comprises innate immune response. According to the
present
disclosure, a vaccine can be administered to a subject either before or after
the onset of clinical
symptoms of the target disease. In some embodiments, vaccination of a healthy
or asymptomatic
subject renders the vaccinated subject immune or less susceptible to the
development of the
target disease. In some embodiments, vaccination of a subject showing symptoms
of the disease
improves the condition of, or treats, the disease in the vaccinated subject.
[0065] The terms "innate immune response" and "innate immunity" are
recognized in the art,
and refer to non-specific defense mechanism a body's immune system initiates
upon recognition
of pathogen-associated molecular patterns, which involves different forms of
cellular activities,
including cytokine production and cell death through various pathways. As used
herein, innate
immune responses include, without limitation, increased production of
inflammation cytokines
(e.g., type I interferon or TL-10 production), activation of the NFKI3
pathway, increased
proliferation, maturation, differentiation and/or survival of immune cells,
and in some cases,
induction of cell apoptosis. Activation of the innate immunity can be detected
using methods
known in the art, such as measuring the (NF)-KB activation.
[0066] The terms "adaptive immune response" and "adaptive immunity" are
recognized in
the art, and refer to antigen-specific defense mechanism a body's immune
system initiates upon
recognition of a specific antigen, which include both humoral response and
cell-mediated
responses. As used herein, adaptive immune responses include cellular
responses that is
-20-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
triggered and/or augmented by a vaccine composition, such as a genetic
composition described
herein. In some embodiments, the vaccine composition comprises an antigen that
is the target of
the antigen-specific adaptive immune response. In other embodiments, the
vaccine composition,
upon administration, allows the production in an immunized subject of an
antigen that is the
target of the antigen-specific adaptive immune response. Activation of an
adaptive immune
response can be detected using methods known in the art, such as measuring the
antigen-specific
antibody production, or the level of antigen-specific cell-mediated
cytotoxicity.
10067.1 The term "antibody" is intended to include a polypeptide product of
B cells within the
immunoglobulin class of polypeptides that is able to bind to a specific
molecular antigen and is
composed of two identical pairs of polypeptide chains, wherein each pair has
one heavy chain
(about 50-70 kDa) and one light chain (about 25 kDa), each amino-terminal
portion of each
chain includes a variable region of about 100 to about 130 or more amino
acids, and each
carboxy-terminal portion of each chain includes a constant region. See, e.g.,
Antibody
Engineering (Borrebaeck ed., 2d ed. 1995), and Kuby, Immunology (3d ed. 1997).
In specific
embodiments, the specific molecular antigen can be bound by an antibody
provided herein,
including a polypeptide, a fragment or an epitope thereof. Antibodies also
include, but are not
limited to, synthetic antibodies, recombinantly produced antibodies, camelized
antibodies,
intrabodies, anti-idiotypic (anti-Id) antibodies, and functional fragments of
any of the above,
which refers to a portion of an antibody heavy or light chain polypeptide that
retains some or all
of the binding activity of the antibody from which the fragment was derived.
Non-limiting
examples of functional fragments include single-chain Fvs (scFv) (e.g.,
including monospecific,
bispecific, etc.), Fab fragments, F(ab') fragments, F(ab)2 fragments, F(ab)2
fragments, disulfide-
linked Fvs (dsFv), Fd fragments, Fv fragments, diabody, triabody, tetrabody,
and minibody. In
particular, antibodies provided herein include immunoglobulin molecules and
immunologically
active portions of immunoglobulin molecules, for example, antigen-binding
domains or
molecules that contain an antigen-binding site (e.g., one or more CDRs of an
antibody). Such
antibody fragments can be found in, for example, Harlow and Lane, Antibodies:
A Laboratory
Manual (1989); Mol. Biology and Biotechnology: A Comprehensive Desk Reference
(Myers ed.,
1995); Huston et al., 1993, Cell Biophysics 22:189-224; Pluck-thun and Skerra,
1989, Meth.
Enzymol. 178:497-515; and Day, Advanced Immunochemistry (2d ed. 1990). The
antibodies
- 21 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
provided herein can be of any class (e.g., IgG, IgE, IgM, IgD, and IgA) or any
subclass (e.g.,
IgG1, IgG2, IgG3, IgG4, IgA 1, and IgA2) of immunoglobulin molecule.
100681 The term "administer" or "administration" refers to the act of
injecting or otherwise
physically delivering a substance as it exists outside the body (e.g., a lipid
nanoparticle
composition as described herein) into a patient, such as by mucosal,
intradermal, intravenous,
intramuscular delivery, and/or any other method of physical delivery described
herein or known
in the art. When a disease, disorder, condition, or a symptom thereof, is
being treated,
administration of the substance typically occurs after the onset of the
disease, disorder, condition,
or symptoms thereof. When a disease, disorder, condition, or symptoms thereof,
are being
prevented, administration of the substance typically occurs before the onset
of the disease,
disorder, condition, or symptoms thereof.
100691 "Chronic" administration refers to administration of the agent(s) in
a continuous
mode (e.g., for a period of time such as days, weeks, months, or years) as
opposed to an acute
mode, so as to maintain the initial therapeutic effect (activity) for an
extended period of time.
"Intermittent" administration is treatment that is not consecutively done
without interruption, but
rather is cyclic in nature.
100701 The term "targeted delivery" or the verb form "target" as used
herein refers to the
process that promotes the arrival of a delivered agent (such as a therapeutic
payload molecule in
a lipid nanoparticle composition as described herein) at a specific organ,
tissue, cell and/or
intracellular compartment (referred to as the targeted location) more than any
other organ, tissue,
cell or intracellular compartment (referred to as the non-target location).
Targeted delivery can
be detected using methods known in the art, for example, by comparing the
concentration of the
delivered agent in a targeted cell population with the concentration of the
delivered agent at a
non-target cell population after systemic administration. In certain
embodiments, targeted
delivery results in at least 2 fold higher concentration at a targeted
location as compared to a
non-target location.
100711 An "effective amount" is generally an amount sufficient to reduce
the severity and/or
frequency of symptoms, eliminate the symptoms and/or underlying cause, prevent
the occurrence
of symptoms and/or their underlying cause, and/or improve or remediate the
damage that results
from or is associated with a disease, disorder, or condition, including, for
example, infection and
-22-
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
neoplasia. In some embodiments, the effective amount is a therapeutically
effective amount or a
prophylactically effective amount.
[0072] The term "therapeutically effective amount" as used herein refers to
the amount of an
agent (e.g., a vaccine composition) that is sufficient to reduce and/or
ameliorate the severity
and/or duration of a given disease, disorder, or condition, and/or a symptom
related thereto (e.g.,
an infectious disease such as caused by viral infection, or a neoplastic
disease such as cancer). A
"therapeutically effective amount" of a substance/molecule/agent of the
present disclosure (e.g.,
the lipid nanoparticle composition as described herein) may vary according to
factors such as the
disease state, age, sex, and weight of the individual, and the ability of the
substance/molecule/agent to elicit a desired response in the individual. A
therapeutically
effective amount encompasses an amount in which any toxic or detrimental
effects of the
substance/molecule/agent are outweighed by the therapeutically beneficial
effects. In certain
embodiments, the term "therapeutically effective amount" refers to an amount
of a lipid
nanoparticle composition as described herein or a therapeutic or prophylactic
agent contained
therein (e.g., a therapeutic mRNA) effective to "treat" a disease, disorder,
or condition, in a
subject or mammal.
[0073] A "prophylactically effective amount" is an amount of a
pharmaceutical composition
that, when administered to a subject, will have the intended prophylactic
effect, e.g., preventing,
delaying, or reducing the likelihood of the onset (or reoccurrence) of a
disease, disorder,
condition, or associated symptom(s) (e.g., an infectious disease such as
caused by viral infection,
or a neoplastic disease such as cancer). Typically, but not necessarily, since
a prophylactic dose
is used in subjects prior to or at an earlier stage of a disease, disorder, or
condition, a
prophylactically effective amount may be less than a therapeutically effective
amount The full
therapeutic or prophylactic effect does not necessarily occur by
administration of one dose, and
may occur only after administration of a series of doses. Thus, a
therapeutically or
prophylactically effective amount may be administered in one or more
administrations.
[0074] The terms "prevent," "preventing," and "prevention" refer to
reducing the likelihood
of the onset (or recurrence) of a disease, disorder, condition, or associated
symptom(s) (e.g., an
infectious disease such as caused by viral infection, or a neoplastic disease
such as cancer).
-23 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1821 1 0784FF
[0075] The terms "manage," "managing," and "management" refer to the
beneficial effects
that a subject derives from a therapy (e.g., a prophylactic or therapeutic
agent), which does not
result in a cure of the disease. In certain embodiments, a subject is
administered one or more
therapies (e.g., prophylactic or therapeutic agents, such as a lipid
nanoparticle composition as
described herein) to "manage" an infectious or neoplastic disease, one or more
symptoms
thereof, so as to prevent the progression or worsening of the disease.
[0076] The term "prophylactic agent" refers to any agent that can totally
or partially inhibit
the development, recurrence, onset, or spread of disease and/or symptom
related thereto in a
subject.
100771 The term "therapeutic agent" refers to any agent that can be used in
treating,
preventing, or alleviating a disease, disorder, or condition, including in the
treatment, prevention,
or alleviation of one or more symptoms of a disease, disorder, or condition
and/or a symptom
related thereto.
100781 The term "therapy" refers to any protocol, method, and/or agent that
can be used in
the prevention, management, treatment, and/or amelioration of a disease,
disorder, or condition.
In certain embodiments, the terms "therapies" and "therapy" refer to a
biological therapy,
supportive therapy, and/or other therapies useful in the prevention,
management, treatment,
and/or amelioration of a disease, disorder, or condition, known to one of
skill in the art such as
medical personnel.
[0079] As used herein, a "prophylactically effective serum titer" is the
serum titer of an
antibody in a subject (e.g., a human), that totally or partially inhibits the
development,
recurrence, onset, or spread of a disease, disorder, or condition, and/or
symptom related thereto
in the subject.
[0080] In certain embodiments, a "therapeutically effective serum titer" is
the serum titer of
an antibody in a subject (e.g., a human), that reduces the severity, the
duration, and/or the
symptoms associated with a disease, disorder, or condition, in the subject.
[0081] The term "serum titer" refers to an average serum titer in a subject
from multiple
samples (e.g., at multiple time points) or in a population of at least 10, at
least 20, at least 40
subjects, up to about 100, 1000, or more.
-24-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[0082] The term "side effects" encompasses unwanted and/or adverse effects
of a therapy
(e.g., a prophylactic or therapeutic agent). Unwanted effects are not
necessarily adverse. An
adverse effect from a therapy (e.g., a prophylactic or therapeutic agent)
might be harmful,
uncomfortable, or risky. Examples of side effects include, diarrhea, cough,
gastroenteritis,
wheezing, nausea, vomiting, anorexia, abdominal cramping, fever, pain, loss of
body weight,
dehydration, alopecia, dyspenea, insomnia, dizziness, mucositis, nerve and
muscle effects,
fatigue, dry mouth, loss of appetite, rashes or swellings at the site of
administration, flu-like
symptoms such as fever, chills, and fatigue, digestive tract problems, and
allergic reactions.
Additional undesired effects experienced by patients are numerous and known in
the art. Many
are described in Physician's Desk Reference (68th ed. 2014).
[0083] The terms "subject" and "patient" may be used interchangeably. As
used herein, in
certain embodiments, a subject is a mammal, such as a non-primate (e.g., cow,
pig, horse, cat,
dog, rat, etc.) or a primate (e.g., monkey and human). In specific
embodiments, the subject is a
human. In one embodiment, the subject is a mammal (e.g., a human) having an
infectious
disease or neoplastic disease. In another embodiment, the subject is a mammal
(e.g., a human) at
risk of developing an infectious disease or neoplastic disease
[0084] The term "detectable probe" refers to a composition that provides a
detectable signal.
The term includes, without limitation, any fluorophore, chromophore,
radiolabel, enzyme,
antibody or antibody fragment, and the like, that provide a detectable signal
via its activity.
[0085] The term "detectable agent" refers to a substance that can be used
to ascertain the
existence or presence of a desired molecule, such as an antigen encoded by an
mRNA molecule
as described herein, in a sample or subject A detectable agent can be a
substance that is capable
of being visualized or a substance that is otherwise able to be determined
and/or measured (e.g.,
by quantitation).
[0086] "Substantially all" refers to at least about 60%, at least about
65%, at least about 70%,
at least about 75%, at least about 80%, at least about 85%, at least about
90%, at least about
95%, at least about 98%, at least about 99%, or about 100%.
[0087] As used herein, and unless otherwise indicated, the term "about" or
"approximately"
means an acceptable error for a particular value as determined by one of
ordinary skill in the art,
which depends in part on how the value is measured or determined. In certain
embodiments, the
-25 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
term "about" or "approximately" means within 1, 2, 3, or 4 standard
deviations. In certain
embodiments, the term "about" or "approximately" means within 20%, 15%, 10%,
9%, 8%, 7%,
6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.05%, or less of a given value or range.
10088.1 The singular terms "a," "an," and "the" as used herein include the
plural reference
unless the context clearly indicates otherwise.
10089.1 All publications, patent applications, accession numbers, and other
references cited in
this specification are herein incorporated by reference in their entirety as
if each individual
publication or patent application were specifically and individually indicated
to be incorporated
by reference. The publications discussed herein are provided solely for their
disclosure prior to
the filing date of the present application. Nothing herein is to be construed
as an admission that
the present invention is not entitled to antedate such publication by virtue
of prior invention.
Further, the dates of publication provided can be different from the actual
publication dates
which can need to be independently confirmed.
100901 A number of embodiments of the invention have been described.
Nevertheless, it will
be understood that various modifications may be made without departing from
the spirit and
scope of the invention. Accordingly, the descriptions in the Experimental
section and examples
are intended to illustrate but not limit the scope of invention described in
the claims.
5.3 Lipid Compounds
10091j In one embodiment, provided herein is a compound of Formula (I):
R3
\G3
L =V.L2
G-
(I),
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof,
wherein:
G' and G2 are each independently a bond, C2-C12 alkylene, or C2-C12
alkenylene, wherein
one or more -CH2- in the alkylene or alkenylene is optionally replaced by -0-;
LI is ¨OC(=0)R1, -C(=D)ORI, -0C(=0)0R1, -C(0)R1, -OR', -8(0)x1R.1, -
C(=0)SIZI, -SC(D)R', _NRac(=0)NRbRe, _
-26-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1821 1 0784FF
NRaC(0)0R1, -SC(=S)R1, -C(=S)SR1, -C(=S)R', -CH(OH)R1, -P(0)(0Rb)(01tc), -(C6-
Cm arylene)-R1, -(6- to 10-membered heteroarylene)-R1, or IV;
L2 is -0C(=0)R2, -C(=0)0R2, -0C(=0)0R2, -C(0)R2, -0R2, -S(0)R2, -S-SR2, -
C(=0)SR2, -SC(=0)R2, -NIVC(0)R2, -C(=0)NReltf, -NRdC(D)NReltf, -0C(=0)NReltf, -
NRdC(=0)0R2, -SC(=S)R2, -C(=S)SR2, -C(=S)R2, -CH(OH)R2, -P(=0)(0Re)(01e.), -
(C6-
Cm arylene)-R2, -(6- to 10-membered heteroarylene)-R2, or R2;
R' and R2 are each independently C6-C32 alkyl or C6-C32 alkenyl;
Ra, Rb, Rd, and Re are each independently H, C1-C24 alkyl, or C2-C24 alkenyl;
Re and le are each independently C1-C32 alkyl or C2-C32 alkenyl;
G3 is C2-C24 alkylene, C2-C24 alkenylene, C3-Cs cycloalkylene, or C3-Cs
cycloalkenylene;
R3 is -N(R4)R5;
R4 is C3-C8 cycloalkyl, C3-C8 cycloalkenyl, 4- to 8-membered heterocyclyl, or
C6-
C10 aryl; or R4, G3 or part of G3, together with the nitrogen to which they
are attached form a
cyclic moiety;
R5 is CI-C12 alkyl or C3-Cs cycloalkyl; or R4, R5, together with the nitrogen
to which they
are attached form a cyclic moiety;
x is 0, 1 or 2; and
wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl,
alkylene,
alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic
moiety is
independently optionally substituted.
[0092] In one embodiment, provided herein is a compound of Formula (I):
R3
G-
L /L2
G I
(I),
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof,
wherein:
G1 and G2 are each independently a bond, C2-C12 alkylene, or C2-C12
alkenylene;
L1 is -0C(=0)R1, -C(=0)0R1, -0C(=0)0R1, -C(0)R1, -0R1, -S(0)R', -S-SR1, -
C(=0)SIV, -SC(1)11.1, -C(=0)NRbRc, -NRaC(=0)NRbRc, -0C(0)NRb115, -
-27-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
NRaC(0)0R1, -SC(=S)R1, -C(=S)SR1, -C(=S)R', -CH(OH)R', -P(0)(0Rb)(01tc), -(C6-
Cm -(6- to 10-membered heteroarylene)-IV, or IV;
L2 is -0C(=0)R2, -C(=0)0R2, -0C(=0)0R2, -C(A))R2, -0R2, -S(0)R2, -S-SR2, -
C(=0)SR2, -SC(=0)R2, -NIVC(A))R2, -C(=0)NReltf, -NRdC(D)NReltf, -0C(=0)NReltf,
-
NRdC(=0)0R2, -SC(=S)R2, -C(=S)SR2, -C(=S)R2, -CH(OH)R2, -P(=0)(0Re)(01e.), -
(C6-
Cm -(6- to 10-membered heteroarylene)-R2, or R2;
R' and R2 are each independently C6-C24 alkyl or C6-C24 alkenyl;
Ra, Rb, Rd, and Re are each independently H, CI-Cu alkyl, or C2-C12 alkenyl;
Re and le are each independently CI-C12 alkyl or C2-C12 alkenyl;
G3 is C2-C24 alkylene, C2-C24 alkenylene, C3-Cs cycloalkylene, or C3-Cs
cycloalkenylene;
R3 is -N(R4)R5;
R4 is C3-C8 cycloalkyl, C3-03 cycloalkenyl, or C6-C10 aryl;
R5 is CI-C12 alkyl;
x is 0, 1 or 2; and
wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, aryl, alkylene,
alkenylene,
cycloalkylene, cycloalkenylene, arylene, and heteroarylene is independently
optionally
substituted.
[0093] In one embodiment, provided herein is a compound of Formula 01):
73
G4
Gi G2
(II),
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof,
wherein:
- is a single bond or a double bond;
GI and G2 are each independently a bond, C2-C12 alkylene, or C2-C12
alkenylene, wherein
one or more -C1-12- in the alkylene or alkenylene is optionally replaced by -0-
;
LI is -0C(AO)R1, -C(A0)0RI, -0C(=0)0RI, -01e, -S(0)xR1, -S-SR1, -
C(=0)SRI, -SC(A))Ri, -NRaC(A))R1, -C(=0)NRbRc, -NRaC(=0)NRbRc, -0C(=0)NRbRe, -
-28-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1821 1 0784FF
NRaC(0)0R1, -SC(=S)R1, -C(=S)SR1, -C(=S)R', -CH(OH)R', -P(0)(0R1')(ORc), -(C6-
Cm arylene)-R1, -(6- to 10-membered heteroarylene)-IV, or IV;
L2 is ¨0C(=0)R2, -C(=0)0R2, -0C(=0)0R2, -C(0)R2, -0R2, -S(0)R2, -S-SR2, -
C(=0)SR2, -SC(=0)R2, -NIVC(0)R2, -C(=0)NReltf, -NRdC(D)NReltf, -0C(=0)NReltf, -
NRdC(=0)0R2, -SC(=S)R2, -C(=S)SR2, -C(=S)R2, -CH(OH)R2, -P(=0)(0Re)(01e.), -
(C6-
Cm arylene)-R2, -(6- to 10-membered heteroarylene)-R2, or R2;
R' and R2 are each independently C6-C32 alkyl or C6-C32 alkenyl;
Ra, Rb, Rd, and Re are each independently H, C1-C24 alkyl, or C2-C24 alkenyl;
Re and le are each independently C1-C32 alkyl or C2-C32 alkenyl;
G4 is a bond, CI-C23 alkylene, C2-C23 alkenylene, C3-Cs cycloalkylene, or C3-
C8 cycloalkenylene;
R3 is -N(R4)R5;
R4 is CI-C12 alkyl, C3-Cs cycloalkyl, C3-Cs cycloalkenyl, 4- to 8-membered
heterocyclyl,
or C6-Cio aryl; or R4, G3 or part of G3, together with the nitrogen to which
they are attached
form a cyclic moiety;
R5 is CI-C12 alkyl or C3-Cs cycloalkyl; or R4, R5, together with the nitrogen
to which they
are attached form a cyclic moiety;
x is 0, 1 or 2; and
wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl,
alkylene,
alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic
moiety is
independently optionally substituted.
[0094] In one embodiment, provided herein is a compound of Formula (11):
Gç
L2
Gi G2
(II),
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof,
wherein:
¨ is a single bond or a double bond;
G' and G2 are each independently a bond, C2-C12 alkylene, or C2-C12
alkenylene;
-29-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
1,1 is -0C(=0)RI, -C(=0)0R1, -0C(=0)0R1, -C(0)R1, -0R1, -S(0)R', -S-SR', -
C(=0)SR1, -SC(=0)R1, -NR8C(=0)R1, -C(=0)NRbRc, -NR8C(=0)NRbRc, -0C(3)NRbitc, -
NR8C(=D)OR1, -SC(=S)R1, -C(=S)SR1, -C(=S)R', -CH(OH)R1, -P(=D)(0Rb)(ORc), -(C6-
Cm -(6- to 10-membered heteroarylene)-IV, or IV;
L2 is -0C(=0)R2, -C(=0)0R2, -0C(=0)0R2, -C(0)R2, -0R2, -S(0)R2, -S-SR2, -
C(=0)SR2, -SC(=0)R2, -NRdC(0)R2, -C(=0)NReRf, -NRdC(D)NIteRf, -0C(=0)NReRf, -
NRIC(=0)0R2, -SC(=S)R2, -C(=S)SR2, -C(=S)R2, -CH(OH)R2, -P(=0)(0Re)(0Rf), -(C;-
Cm -(6- to 10-membered heteroarylene)-R2, or R2;
R' and R2 are each independently C6-C24 alkyl or C6-C24 alkenyl;
Ra, Rb, Rd, and Re are each independently H, C1-C12 alkyl, or C2-C12 alkenyl;
RC and Rf are each independently CI-C12 alkyl or C2-C12 alkenyl;
G4 is a bond, C,-C23 alkylene, C2-C23 alkenylene, C3-C8 cycloalkylene, or C3-
C8 cycloalkenylene;
R3 is -N(R4)R5;
R4 is CI-C12 alkyl, C3-Cs cycloalkyl, C3-Cs cycloalkenyl, or C6-C10 aryl;
R5 is CI-C12 alkyl;
x is 0, 1 or 2; and
wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, aryl, alkylene,
alkenylene,
cycloalkylene, cycloalkenylene, arylene, and heteroarylene is independently
optionally
substituted.
[0095] In one embodiment, - is a single bond. In one embodiment, - is a double
bond. In one embodiment, - is a double bond, and the compound has a (Z)-
configuration.
In one embodiment, - is a double bond, and the compound has a (E)-
configuration.
[0096] In one embodiment, provided herein is a compound of Formula 014
73
G4
õ,.L2
G1 G2
(111),
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
-30-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1821 10784FF
[0097] In one embodiment, provided herein is a compound of Formula (IV):
R3
G4
Ll L2
G2
(IV),
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
100981 In one embodiment, GI is a bond. In one embodiment, G2 is a bond. In
one
embodiment, G' and 62 are both a bond.
[0099] In one embodiment, GI and 62 are each independently C2-C12 alkylene
or C2-
C12 alkenylene. In one embodiment, GI and G2 are each independently C2-C12
alkylene. In one
embodiment, GI and 62 are each independently C2-C12 alkenylene. In one
embodiment, G' and
62 are each independently C3-C7 alkylene. In one embodiment, G' and 62 are
each
independently C5 alkylene.
[00100] In one embodiment, G' is unsubstituted. In one embodiment, GI is
substituted. In
one embodiment, GI is substituted with -OH. In one embodiment, G' is
substituted with (a
second) LI (i.e., GI is connected to two LI). In one embodiment, GI is
substituted with -0-(C6-
C24 alkyl). In one embodiment, GI is substituted with -0-(C6-C24 alkenyl). In
one embodiment,
GI is substituted with --C(D)-(C6-C24 alkyl). In one embodiment, GI is
substituted with -
C(=0)-(C6-C24 alkenyl).
[00101] In one embodiment, G2 is unsubstituted. In one embodiment, 62 is
substituted. In
one embodiment, 62 is substituted with -OH. In one embodiment, 62 is
substituted with (a
second) L2 (i.e., 62 is connected to two L2). In one embodiment, 62 is
substituted with -0-(C6-
C24 alkyl). In one embodiment, 62 is substituted with -0-(C6-C24 alkenyl). In
one embodiment,
62 is substituted with -C(0)-(C6-C24 alkyl). In one embodiment, 62 is
substituted with -
C(:=0)-(C6-C24 alkenyl).
[00102] In one embodiment, one or more -CH2- in the alkylene or alkenylene in
GI and/or 62
is optionally replaced by -0-. In one embodiment, GI and 62 are each
independently C5-
C9 alkylene, wherein one or more -CH2- in the alkylene is optionally replaced
by -0-. In one
- 3 1 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
embodiment, G' and G2 are each independently C5-C7 alkylene, wherein one or
more -C112- in
the alkylene is optionally replaced by -0-. In one embodiment, GI and G2 are
both -CH2-CH2-0-
CH2-CH2-. In one embodiment, GI and G2 are both -C112-CH2-0-CH2-CH2-0-CH2-.
[00103] In one embodiment, the compound is a compound of Formula (I-A):
R3
G-
Ll L2
(I-A),
wherein y and z are each independently an integer from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[00104] In one embodiment, the compound is a compound of Formula (11-A):
R3
I
G'
L L2
wherein y and z are each independently an integer from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[00105] In one embodiment, the compound is a compound of Formula (III-A):
R3
G4
L2
wherein y and z are each independently an integer from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[00106] In one embodiment, the compound is a compound of Formula (IV-A):
-32-
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
G4
Li L2
(TV-A),
wherein y and z are each independently an integer from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[001071 In one embodiment, y and z are each independently an integer from 2 to
10. In one
embodiment, y and z are each independently an integer from 2 to 6. In one
embodiment, y and z
are each independently an integer from 4 to 10.
[001081 In one embodiment, y and z are different. In one embodiment, y and z
are the same.
In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8,
and 9. In one
embodiment, y is 5 and z is 5.
[00109] In one embodiment, L' is -0C(3)R1, -C(=0)0R1, -0C( :::0)0R1, -C(=0)R1,
-
S(0)xR1, -S-SR', -C(=0)SR1, -SC(=D)R1, -NRaC(=0)R1, -C(=0)NRbRe, -
NRaC(=0)NRIIRc, -
0C(=0)NRbitc, -NRaC(=0)0R1, -SC(=S)R1, -C(=S)SR1, -CH(OH)R1, or -
P(:=0)(0Rb)(ORc). In one embodiment, L1 is -(C6-Cio arylene)-R'. In one
embodiment, 1,1 is -
(6- to 10-membered heteroarylene)-R1. In one embodiment, L1 is R1.
1001101 In one embodiment, L1 is -0C(=0)1V, -C(=0)01V, -C(0)SR', -SC(0)R', -
NIVC(Co)R1, or -C(3)NRbItc. In one embodiment, L1 is -0C(=0)R1, -C(0)0R1, -
NRaC(0)R1, or -C(1)NRbRc. In one embodiment, L1 is -0C(=0)R1. In one
embodiment,
L1 is -C(30)01t1. In one embodiment, L1 is -NRaC(=0)1V. In one embodiment, Li
is -
C(=0)NRbRe. In one embodiment, L' is -NR8C(=0)NRbRc. In one embodiment, L' is -
0C(=0)NRbItc. In one embodiment, L1 is -NR8C(=0)01e,
[00111] In one embodiment, L2 is -0C(0)R2, -C(=0)0R2, -0C(0)0R2, -C(=0)R2, -
0R2, -
S(0),,R2, -S-SR2, -C(=0)SR2, -SC(co)R2, _NRdc()R2, _c(o)NReRf, _NRcic()NReRr,
_
OC(=0)NReRf, -NRdC(=0)0R2, -SC(=S)R2, -C(=S)SR2, -C(=S)R2, -CH(OH)R2, or -
P(D)(0Re)(0Rf). In one embodiment, L2 is -(C6-Cio arylene)-R2. In one
embodiment, L2 is -
(6- to 10-membered heteroarylene)-R2. in one embodiment, L2 is R2.
- 33 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00112] In one embodiment, L2 is -0C(0)R2, -C(=0)0R2, -C(=0)SR2, -SC(=0)R2, -
NRdC(D)R2, or -C(=0)NReRf. In one embodiment, L2 is -0C(0)R2, -C(0)0R2, -
NRdC(=0)R2, or -C(=0)NReRf. In one embodiment, L2 is -0C(0)R2. In one
embodiment,
L2 is -C(=0)0R2. In one embodiment, L2 is -NRdC(=0)R2. In one embodiment, L2
is -
C(=0)NReRf. In one embodiment, L2 is -NRdC(0)NReRf. In one embodiment, L2 is -
OC(=0)NReRf. In one embodiment, L2 is -NRdC(=0)0R2.
[00113] In one embodiment, Li is -0C(3)R1, -NIVC(-0)R1, -C(=0)0R1, or -
C(=0)NRIac
and L2 is -0C(=0)R2, -NRdC(=0)R2, -C(=0)0R2, or -C(=0)NReRf. In one
embodiment, Li is -
0C(=0)R1, -C(=0)0RI, or -C(=0)NRI}R` and L2 is -0C(D)R2, -C(0)0R2, or -
C(0)NReRf.
In one embodiment, Li is -0C(=0)R1 and L2 is -0C(=0)R2. In one embodiment, Li
is -
0C(=0)R1 and L2 is -NRdC(=0)R2. In one embodiment, L' is -NRaC(=0)Ri and L2 is
-
NRdC(:))R2. In one embodiment, Li is -C(3)0R1 and L2 is -C(=0)0R2. In one
embodiment,
Li is -C(3)0R1 and L2 is -C(=0)NReRf. In one embodiment, LI is -C(=0)NRbRe and
L2 is -
C(=0)NReRf.
[00114] In one embodiment, Li is -NRaC(0)NRbRc and L2 is -NRdC(=0)NReRf. In
one
embodiment, Li is -0C(=0)NRbRe and L2 is -0C(=0)NReRf. In one embodiment, Li
is -
NR3C(0)0R1 and L2 is -NRdC())OR2.
[00115] In one embodiment, the compound is a compound of Formula (I-B), (I-
B'), (I-B"), (I-
C), (I-D), or (I-E):
R3 R3
G- 'Rd
R1 0 2 R1 0N G2 N R2
GN'NG2AyR
0 0 0 0
(I-B), (I-B').
Ra y Rd
I R3
R1 N N R2 µG3
y G2.
R R2
0 0 0 G1 G 0
(I-C),
- 34 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
R3 R3
s's'a3" N's.G3
0 9 o 0
N .....jNZ Re Rb A N
,INNZ Re
= G1 G2 Gi ''NG2
1 1
Rf Rc Rt
(I-D,), or (I-F),
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[001161 In one embodiment, the compound is a compound of Formula (11-B), (11-
B'), (11-B"),
(11-C), (H-D), or (H-E):
R3 R3
I
G4 G`i
),,,,, ),,,,,.
1 1
I
t 1
R1 0 ' 0 R2 Ri 0 1 N
y N--Gi G2--- y y -,,,...
G1 G2-- yR2
O 0 0 0
(11-4), (II-B'),
R3
R3
G4
R3 ),,,, Rd
1 G4
R1 N ' N R2 0 1 0
--- y
y G2 RI 711,,,, ,it, R2
N.
0 0 0 G1 G2 OZ
(11-B"), (TLC),
R3 R3
1 i
G4 G4
-...õ
0 0 0 i 0
O G1 G2 N N G1 G2 N
i 1
Rf RC Rf
(H-D), or (H-E),
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof
-35 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1821 10784FF
[001171 In one embodiment, the compound is a compound of Formula (III-B), (111-
B'), (111-
B"), (III-C), (111-D), or (111-E):
R3 R3
I
G4 G4
Rd
R2
0 0 0 0
(11I-B), (III-B'),
R3
R3
G4
Ra Rd G4
R ' )1 N N R2 N (1)
y Gi G2,,, y
Ri 1
0 0 0 G.1
(III-B"), (III-C),
R3
R3
G4 G4
`,..õ..,
0 Q 0 0
1
R0
NO G ' G2 N
I I
Rf Rc Rf
(III-D), or (HI-E),
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof
[ON 181 In one embodiment, the compound is a compound of Formula (IV-B), (IV-
B'), (IV-
B"), IV-C), IV-D), or (IV-E):
R3 R3
I
G4 G4
Rd
R2 Y y Ri 0 y
ti R2
0 0 0 0
(IV-B), (IV-B'),
- 36 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
R3
R3
G4
Ra 1, Rd G4
ri\IR1 NI y 0 I, 0 Gi G2...-' R2 y II
R2
0 0 0 G1 G2 0
(IV-B"), (IV-C),
,
R
R3
G4 G4
1
Ri\ .2,NVRe
i 1
Rf Rc Rf
(IV-D), or (IV-E),
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof
[00119] In one embodiment, the compound is a compound of Formula (1-F), (1-F),
(1-F"), (1-
G), (1-H), or (I-I):
R3 R3.N.3
G- Rd
1
Rly0,wN 0 R2 R1 0 µ N Ny
z R2
0 0 0 0
(I-F), (I-F ' ),
R"
:1
Ra G- Rd R3
y 1
0
R ' N.1.., 1,..,,, N R2 s-1---)--zNy R2
0 0
0 0 Y z
(1-F"), (I-G),
- 37 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
R3 R3
\ 1
0 0 0 0
R1 7J-Npr rt,/,)/ )NN e Rb 1
Z
N R NZRe
0 ...,....N7.-..14.,.N,...4. A
Y z 1 I Y V...-= z 1
Rf Rc Ri
(T-T-I), or (14),
wherein y and z are each independently an integer from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[001201 In one embodiment, the compound is a compound of Formula (TT-F), (II-
F'), (TI-F"),
(II-G), (11-H), or (114):
R3 R13
I
G4 G4
Rd
i 1
1 1
I
1
1
y
Rii0WONzR2 R1 014,-I N R2
Y z Y z
0 0 0 0
(II-F), (11-F),
R3
1 4 R3
G 1
Ra ..'-`,' Rd G4
I ,
' , 0
RlN7NIN4õ).\N R2 =
Y z y w
.o a
,R2
0
(II-F"), (11-G),
R
73 3
I
G4 G4
t t
t t
W t
Rb 1
NvRe
N ,
NZR6
\ N 0
Rf Rc Rt
(TT-H), or (114),
wherein y and z are each independently an integer from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
-38-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1 821 1 0784FF
1001211 In one embodiment, the compound is a compound of Formula (III-F), (111-
F), (III-
F"), (III-G), (Ill-H), or (111-1):
73 T3
G4 G4
Rd
1
R2
C)ZR
0 0 0 0
(111-F), (III-F'),
R3
R3
Ra ' Rd G4
0
R4N7' N z NN,R2
I Y W
N
0 ,
0 R2
(III-F"), (III-G),
R3 R.5
I I
G4 G4
0 0 0 0
Ri'No Nz Re Rb vi-NV Re
N N
Y *z 1 I Y z 1
W Rc 1,2f
(111-1-1), or (111-0,
wherein y and z are each independently an integer from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
1001221 In one embodiment, the compound is a compound of Formula (IV-F), (IV-
F'), (IV-
F"), (IV-G), (IV-1-1), or (IV-!):
73 T3
G4 G4
..õ_ ....,.
Rd
1 1
1:24
CINZR
0 0 0 0
(IV-F), (IV-F'),
-39-
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
R3
R3
G4
Ra Rd G4
0
0
R
R2
0 0
(1V-F"), (1V-G),
R3 R3
G4 G4
0 0 0 0
W
NV Re Rb I Re
N/
0
z z
Rf IR Rf
(IV-H), or
wherein y and z are each independently an integer from 2 to 12,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[00123] In one embodiment, y and z are each independently an integer from 2 to
10. In one
embodiment, y and z are each independently an integer from 2 to 6. In one
embodiment, y and z
are each independently an integer from 4 to 10.
[00124] In one embodiment, y and z are different. In one embodiment, y and z
are the same.
In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8,
and 9. In one
embodiment, y is 5 and z is 5.
[00125] In one embodiment, G3 is C2-C24 alkylene. In one embodiment, G3 is C2-
C12 alkylene. In one embodiment, G3 is C2-C8 alkylene. In one embodiment, G3
is C2-
C6 alkylene. In one embodiment, G3 is C2-C4 alkylene. In one embodiment, G3 is
C2 alkylene.
In one embodiment, G3 is C4 alkylene.
[00126] In one embodiment, G3 is substituted with one or more oxo. In one
embodiment, G3
is -(CI-C23 alkylene)-C(=0)-. In one embodiment, G3 is -(CI-Cii alkylene)-
C(=0)-. In one
embodiment, G3 is -(Ci-C7 alkylene)-C(=0)-. In one embodiment, G3 is -(CI-
05alky1ene)-
C(=0)-. In one embodiment, G3 is -(CI-C3 alkylene)-C(=0)-. In one embodiment,
G3 is ¨CH2-
- 40 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
C(=0)-. In one embodiment, G3 is ¨C112-CH2-C112-C(0)-. In one embodiment, the
¨C(=0)- is
connected to the nitrogen atom, and the alkylene is connected to R3.
[00127] In one embodiment, the compound is a compound of Formula (I-I), (1-.1r
), (I-J"), (I-
K), (1-L), or (I-M:
R1
R) R2 R3
N) Rd
r N N'N 0 R1 0
Y z y Z
0 0
(I-J), (I-J').
R3,/,
R. rs) R. R3
0 )s 0
R''NVNN N
Y " z yR.2
R2
RINO/VW N
0 0
(1-1(),
R3 R3
0 1%1 s 0 0 )1 s 0
N.õ
R N
b õRe
Z z
Rf Rc Rt
(I-L), or (I-M),
wherein y and z are each independently an integer from 2 to 12, and
s is an integer from 2 to 24,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
100128.1 In one embodiment, y and z are each independently an integer from 2
to 10. In one
embodiment, y and z are each independently an integer from 2 to 6. In one
embodiment, y and z
are each independently an integer from 4 to 10.
1001291 In one embodiment, y and z are different. In one embodiment, y and z
are the same.
In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8,
and 9. In one
embodiment, y is 5 and z is 5.
- 41 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00130] In one embodiment, s is an integer from 2 to 12. In one embodiment, s
is an integer
from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one
embodiment, s is an integer
from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 4.
100131] ln one embodiment, y is 5, z is 5, and s is 2.
1001321 In one embodiment, y is 5, z is 5, and s is 4.
[00133] ln one embodiment, G3 is C2-C24 alkenylene. In one embodiment, G3 is
C2-
C12 alkenylene. In one embodiment, G3 is C2-C8 alkenylene. ln one embodiment,
G3 is C2-
C6 alkenylene. In one embodiment, G3 is C2-C4 alkenylene.
[00134] In one embodiment, G3 is C3-C8 cycloalkylene. In one embodiment, G3 is
C5-
C6 cycloalkylene.
[00135] In one embodiment, G3 is C3-C8 cycloalkenylene. In one embodiment, G3
is C5-
C6 cycloalkenylene.
1001361 In one embodiment, G4 is a bond.
[00137] ln one embodiment, G4 is CI-C23 alkylene. In one embodiment, G4 is CI-
Cii alkylene. ln one embodiment, G4 is Ci-C7 alkylene. In one embodiment, G4
is CI-
05 alkylene. In one embodiment, G4 is Ci-C3 alkylene. In one embodiment, G4 is
CI alkylene.
In one embodiment, G4 is C2 alkylene. In one embodiment, G4 is C3 alkylene. In
one
embodiment, G4 is C4 alkylene.
[00138] In one embodiment, the compound is a compound of Formula (II-A (Thr),
(II-K), (II-L), or (II-M):
R3 R3
Rd
U U
R1 yR2 R1 0 NNN7 R2
z
0 0 0 0
(11-F),
- 42 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
R3
R3
Rd ( .3.,.
I g
i
RINI,,N--N(N/r,N R2
Y z y w
0 ,
,
0,R2
0 0 Y z
(II-J"), (11-K),
R3 R3
(
0 u 1 0 0 u i 0
,
,
I
W Rh Re
N.
N,/Re
0 .
Y z 1 1 Y z 1
Rf R Rf
(II-1,), or (II-M),
wherein y and z are each independently an integer from 2 to 12, and
u is an integer from 0 to 23,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
1001391 In one embodiment, the compound is a compound of Formula (III-J), (111-
r), (III-1"),
(Ill-K), (11I-L), or (III-M'):
R3 R3
u u Td
Rly0,0,Nsz R2 WO.I.,,,K.,mr,N
Y z Y z yR2
0 0 0 0
(1114), (111-3),
R3
R3
( ')Nõ
Ra u Rd (
I 1 0 U 0
W
Y z \ ,R2
0 0
0 0 Y z
(III-J"), (Ill-K),
-43 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
R3 R3
t \
k (
0 Q 0 Lj 0
R1 u 1
VRe 1
Rb :
ZRe
NC) N i N
Y z 1 Y z 1
Rf Rc Ri
(III-L), or (III-NI),
wherein y and z are each independently an integer from 2 to 12, and
u is an integer from 0 to 23,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
1001401 In one embodiment, the compound is a compound of Formula (IV-J), (IV-
J'), (IV-J"),
(IV-K), (IV-L), or (IV-M):
R3 R3
( (
u u Rd
R0 , 0 R2 Ri 0 N R2
11 Y z y yky kzy
(1V-J), (IV-J'),
R3
R3
i
\ R Rd a u / N
I k
0 u I 0
N y
11 R2 1 i 1 Y z
R`,.:
0 OZR2
0 0 Y z
(IV-T'), (IV-K),
R3 R3
( \ (
0 u Q 0 u 0
1
R1
õRe 1
NZ Re
N /
Y z 1 Y z 1
Rf ic
Rf
(IV-I), or (IV-M),
- 44 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
wherein y and z are each independently an integer from 2 to 12, and
u is an integer from 0 to 23,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
100141.1 In one embodiment, y and z are each independently an integer from 2
to 10. In one
embodiment, y and z are each independently an integer from 2 to 6. In one
embodiment, y and z
are each independently an integer from 4 to 10.
1001421 In one embodiment, y and z are different. In one embodiment, y and z
are the same.
In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8,
and 9. In one
embodiment, y is 5 and z is 5.
100143.1 In one embodiment, u is an integer from 0 to 12. In one embodiment, u
is an integer
from 0 to 8. In one embodiment, u is an integer from 0 to 6. In one
embodiment, u is an integer
from 0 to 4. In one embodiment, u is 0. In one embodiment, u is 1. In one
embodiment, u is 2.
In one embodiment, u is 3. In one embodiment, u is 4.
1001441 In one embodiment, y is 5, z is 5, and u is 0.
1001451 In one embodiment, y is 5, z is 5, and 1.1 is 2.
100146.1 In one embodiment, G4 is C2-C23 alkenylene. In one embodiment, G4 is
C2-
C 1 2 alkenylene. In one embodiment, G4 is C2-Cs alkenylene. In one
embodiment, G4 is C2-
C6 alkenylene. In one embodiment, G4 is C2-C4 alkenylene.
1001471 In one embodiment, G4 is C3-Cs cycloalkylene. In one embodiment, G4 is
C5-
C6 cycloalkylene.
1001481 In one embodiment, G4 is C3-Cs cycloalkenylene. In one embodiment, G4
is C5-
C6 cycloalkenylene.
1001491 In one embodiment, R5 is CI-C1? alkyl. In one embodiment, R5 is CI-Cm
alkyl. In
one embodiment, R5 is C1-C8 alkyl. In one embodiment, R5 is Ci-C6 alkyl. In
one embodiment,
R5 is CI-C4 alkyl. In one embodiment, R5 is CI-C2 alkyl. In one embodiment, R5
is methyl. In
one embodiment, R5 is ethyl. In one embodiment, R5 is propyl. In one
embodiment, R5 is n-
butyl. In one embodiment, R5 is n-hexyl. In one embodiment, R5 is n-octyl. In
one
embodiment, R5 is n-nonyl.
-45-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00150] In one embodiment, R5 is C3-C8 cycloalkyl. In one embodiment, R5 is
cyclopropyl.
In one embodiment, R5 is cyclobutyl. In one embodiment, R5 is cyclopentyl. In
one
embodiment, R5 is cyclohexyl. In one embodiment, R5 is cycloheptyl. In one
embodiment, R5 is
cyclooctyl.
[00151] In one embodiment, R4, R5, together with the nitrogen to which they
are attached
form a cyclic moiety.
[00152] In one embodiment, the cyclic moiety (formed by R4 and R5 together
with the
nitrogen to which they are attached) is heterocyclyl. In one embodiment, the
cyclic moiety is
heterocycloalkyl. In one embodiment, the cyclic moiety is 4- to 8-membered
heterocycloalkyl.
In one embodiment, the cyclic moiety is 4-membered heterocycloalkyl. In one
embodiment, the
cyclic moiety is 5-membered heterocycloalkyl. In one embodiment, the cyclic
moiety is 6-
membered heterocycloalkyl. In one embodiment, the cyclic moiety is 7-membered
heterocycloalkyl. In one embodiment, the cyclic moiety is 8-membered
heterocycloalkyl.
[00153] In one embodiment, the cyclic moiety (formed by R4 and R5 together
with the
nitrogen to which they are attached) is azetidin-1-yl. In one embodiment, the
cyclic moiety is
pyrrolidin-1-yl. In one embodiment, the cyclic moiety is piperidin-l-yl. In
one embodiment, the
cyclic moiety is azepan-l-yl. In one embodiment, the cyclic moiety is azocan-l-
yl. In one
embodiment, the cyclic moiety is morpholinyl. In one embodiment, the cyclic
moiety is
piperazin-l-yl. The point of attachment in these groups is to G3.
[00154] As described herein and unless otherwise specified, the substitution
patterns for R5
also applies to the cyclic moiety formed by R4 and R5 together with the
nitrogen to which they
are attached.
[00155] In one embodiment, R5 is unsubstituted.
[00156] In one embodiment, R5 is substituted with one or more substituents
selected from the
group consisting of oxo, -NRgC(=0)Rh, -C(=0)NRgRh, -C(0)Rh, - OC(=0)Rh, -
C(=0)0Rh and ¨O-R'-OH, wherein:
Rg is at each occurrence independently H or C1-C6 alkyl;
Rh is at each occurrence independently C1-C6 alkyl; and
Ri is at each occurrence independently C i-C6 alkylene.
-46-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1821 1 0784FF
11001571 In one embodiment, R5 is substituted with one or more hydroxyl. In
one
embodiment, R5 is substituted with one hydroxyl.
[00158] In one embodiment, R5 is substituted with one or more hydroxyl and one
or more
oxo. In one embodiment, R5 is substituted with one hydroxyl and one oxo. In
one embodiment,
R5 is -CH2CH2OH.
100159] In one embodiment, R5 is -(CH2)pQ, -(CH2)pCHQR, -CHQR, or -CQ(R)2,
wherein Q
is C3-Cs cycloalkyl, C3-Cs cycloalkenyl, C3-C8 cycloalkynyl, 4- to 8-membered
heterocyclyl, C6-
Cm aryl, 5- to 10-membered heteroaryl, -OR, -0(CH2)pN(R)2, -C(0)0R, -0C(0)R, -
CX3, -
CX2H, -CXH2, -CN, -N(R)2, -C(0)N(R)2, -N(R)C(0)R, -N(R)S(0)2R, -N(R)C(0)N(R)2,
-
N(R)C(S)N(R)2, -N(R)R22, -0(0-12)pOR, -N(R)C(=NR23)N(R)2, -N(R)C(HR23)N(R)2, -
OC(0)N(R)2, -N(R)C(0)0R, -N(OR)C(0)R, -N(OR)S(0)2R, -N(OR)C(0)0R, -
N(OR)C(0)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR23)N(R)2, -N(OR)C(=CHR23)N(R)2, -
C(=NR23)N(R)2, -C(=NR23)R, -C(0)N(R)OR, or -C(R)N(R)2C(0)0R, and each p is
independently 1, 2, 3, 4, or 5;
R22 is C3-Cs cycloalkyl, C3-Cs cycloalkenyl, C3-C8 cycloalkynyl, 4- to 8-
membered heterocyclyl,
C6-Cio aryl, or 5- to 10-membered heteroaryl;
R23 is H, -CN, -NO2, C1-C6 alkyl, -OR, -S(0)2R, -S(0)2N(R)2, C2-C6 alkenyl, C3-
Cs cycloalkyl,
C3-C8 cycloalkenyl, C3-Cs cycloalkynyl, 4- to 8-membered heterocyclyl, C6-C10
aryl, or 5- to
10-membered heteroaryl;
each R is independently H, C1-C3 alkyl, or C2-C3 alkenyl; or two R in a N(R)2
moiety together
with the nitrogen to which they are attached form a cyclic moiety; and
each X is independently F, CI, Br, or I.
[00160] In one embodiment, the compound is a compound of Formula (I-N), (I-
N'), (I-N"), (I-
0), (I-P), or (I-Q):
-47-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
R6 r. if11 06
.<1) t
t
i
R4 s'IC1 ) s R4 'IC) ) Rd
1 s 1
I
R1 0 N.
y 0 R2 R1 0 N R2 l-----)-
-;--N1---').--; y y 1----).--y--N y
0 0 0 0
(I-N), (I-N'),
R6 \
.(11t R6
N 11 ) t
R\
a 4R -/ "h)s 70
R
i 1 0 This 0
. y 1 N NN,L N R2
1.-----)--;-: k----iz y ..
0 0/
0 0 Y z
(I-N"), (1-0),
R6.õ./ \ R6
\-" i
R4¨N
)
0 siN1 s Q 0 'N ) s 0
i
i
:
R1
NZ Re Rb N
Nz Re
i Y z 1
Rf IR' Rf
(I-P), or (I-Q),
wherein y and z are each independently an integer from 2 to 12,
s is an integer from 2 to 24,
t is an integer from 1 to 12, and
R6 is hydrogen or hydroxyl,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
1001611 In one embodiment, the compound is a compound of Formula (IT-N), (II-
N), (II-N"),
(II-0), (II-P), or (II-Q):
- 48 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
R6 R6
Rt, k ) Rt,
N t N t
u , Rd
, u :
, I
1 2 1 - 1
RI,N.7,01.,,,yR0 R kNNõ R2
0 0 0 0
(11-N), (11-N'),
R6
R6
N t
Ra U1 Rd ( 'k,
I ,
,
VR2 .
I Y z NNN
R1
N.o ,
,
zR2
0
0 0 Y z
(11-N"), (11-0),
R6 R6
R4 k ) Ra...,_
N t N t
( `k, (
0 u ,
, 0
R1Nso ,
Y z 1 I Y z 1
Rf Rc Rf
(11-P), or (ii-Q),
wherein y and z are each independently an integer from 2 to 12,
u is an integer from 0 to 23,
t is an integer from 1 to 12, and
R6 is hydrogen or hydroxyl,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
(001621 In one embodiment, the compound is a compound of Formula (111-N), (111-
N'), (111-
N"), (111-0), (111-P), or (III-Q):
-49-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1 821 1 0784FF
R6 R6
R4.,, k ) R4,..
N t N t
u u Rd
I
Rly00 R2
Y z y Y z
0 0 0 0
(Ill-N), (Ill-N'),
Re
R6
( -k,
Ra u Rd
RlyNIIN.4,õ.-N,r, NI 0 u 0
Y z y R2
\o
R1 R2
OV
0 0 Y z
(111-N"), (111-0),
R6 R6
R4 ,( ) Rt,_
N t N t
( '4%., (
0 u 0 0 u 0
R1
\
R==IN v Re
0 N
Y z 1 1 Y z 1
Rf Rc Rf
(111-P), or (111-Q),
wherein y and z are each independently an integer from 2 to 12,
u is an integer from 0 to 23,
t is an integer from 1 to 12, and
R6 is hydrogen or hydroxyl,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[001631 In one embodiment, the compound is a compound of Formula (IV-N), (IV-
N'), (IV-
N"), (IV-0), (IV-]), or (IV-Q):
- 50 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
R6 R6
R4 ) Ri..,, )
't N t
u Rd
I i
1
iy k z yR2
0 0 0 0
(J\T-N), (IV-N'),
R6
R6
R4,, j) )
N t R4 j.I )
Ra ( u Rd
I (
R.N.,..õ7.! 0
N N R2 1 0 1
-s-,
0 i
0
0 N1 i
0 Y z
(IV-N"), (IV-0),
R6 R6
R4,, ) R4 j) )
N t N t
/ r N
I
o u o o LI 0
1
Ri 1
õRe
NO N Rf Rc RI
(IV-P), or (IV-Q),
wherein y and z are each independently an integer from 2 to 12,
u is an integer from 0 to 23,
t is an integer from 1 to 12, and
R6 is hydrogen or hydroxyl,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof
-51 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
1001641 In one embodiment, the compound is a compound of Formula (1-R), (1-
R'), (1-R"), (1-
S), (I-T), or (I-U):
R6 R6
( 0 ( 0
t t
R1 R2 1 õN
R4 Rd ) s 1
0 R 0 R2
N,7- 'No
0 0 0 0
(1-R),
R6
R6
( 4
tf ( Lµ,.,,, 0
t
Ra R4 N Rd
R1 \N s 1 R4N
¨.f,, )
0 µ i s 0
N y y
N R2 1--.4-N(----.)--; 1
RNO
, NNP)LNo R2
0 0 Y = z
(1-R"), (1-S),
R6 R6
( 0 ( 0
t t
R4¨N
R1 Rb
Y z 1 i Y z 1
RI Rb Rf
(1-T), or (I-U),
wherein y and z are each independently an integer from 2 to 12,
s is an integer from 2 to 24,
t is an integer from 1 to 12, and
R6 is hydrogen or hydroxyl,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
- 52 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[001.651 In one embodiment, the compound is a compound of Formula (II-R), (II-
R'), (H-R"),
(II-S), (.11-T), or (II-U):
X
R R6 6
R4 R4
--., ---.
N 0 N0
u ,
r
, .
R2 R10 N
I I Y z y
y R2
0 0 0 0
(II-R), (11-10,
, R6
R6
t
R4 ( it
"---s'N'i4O
R4,_
`N 0
(
R3 1-4>1 Rcl
, .
RiNr7N N R2 0 Li ,
, 0
I I Y z y R.,'
, . R2
OZ
0 0 Y z
(II-R"), (II-S),
x R6 ( R6
\ it
t
R4 R`1,..,
-"N 0 N 0
1 1
( L) i : \
k s'ilLT-1,
0 LI : . 0 0 , 0
:..
R1
NZ Re Rt's :
NZ Re
1
Rf Rc Rf
(II-T), or (H-U),
wherein y and z are each independently an integer from 2 to 12,
u is an integer from 0 to 23,
t is an integer from 1 to 12, and
- 53 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
I82110784FF
R6 is hydrogen or hydroxyl,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[001661 In one embodiment, the compound is a compound of Formula (III-R),
(III-R'), (ill-
R"), (III-S), (III-T), or (III-U):
R6 (R6
i
\ )t
R4 R-
----.N ----N
0 0
u R`l
1
R2 R1,,N.Ne70 N
11 Y z y
11 y \ lz yR2
0 0 0 0
(III-R), (111-R),
R6
! , R6
t
R4 ( it
N 0 R4
N 0
(
Ra Rd (
1 0 ti
R1, 0
N N R2
1
R,'
\
0 .
Z R2
0
0 0 Y z
(III-R"), (III-S),
R6 R6
:1/4....õZ ( it
R4 R4
---.N 0 N 0
1 ( L) i : 1 \
k isj-Tn
0
R1 '1
z Re 1
i
Rb ' z Re
\ \ N 0 N N
1
Rf RC Rf
(III-T), or (III-U),
- 54 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
wherein y and z are each independently an integer from 2 to 12,
u is an integer from 0 to 23,
t is an integer from 1 to 12, and
R6 is hydrogen or hydroxyl,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
100167] In one embodiment, the compound is a compound of Formula (IV-R), (IV-
R'), (IV-
R"), (IV-S), (IV-T), or (IV-U):
6 Re
R4õ,
0
Rd
R1 0 1
N-N,7 aNy R2 R 0
N-N.Z R2
0 0 0 0
(IV-R), (IV-R'),
Re
R4õ,
0
Ra LI Rd
0 U 0
R N N Nz R2
R z R2
1N-T
0 0
(IV-R"),
- 55 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
(
/--t 1:R6
N0
0 u
0 0 0
R1
N"Re RbN.
NZ Re
N 0
z
Rf Rf
(IV-T), or (IV-U),
wherein y and z are each independently an integer from 2 to 12,
u is an integer from 0 to 23,
t is an integer from 1 to 12, and
R6 is hydrogen or hydroxyl,
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
[00168] In one embodiment, y and z are each independently an integer from 2 to
10. In one
embodiment, y and z are each independently an integer from 2 to 6. In one
embodiment, y and z
are each independently an integer from 4 to 10.
[00169] In one embodiment, y and z are different. In one embodiment, y and z
are the same.
In one embodiment, y and z are the same and are selected from 4, 5, 6, 7, 8,
and 9. In one
embodiment, y is 5 and z is 5.
[00170] In one embodiment, s is an integer from 2 to 12. In one embodiment, s
is an integer
from 2 to 8. In one embodiment, s is an integer from 2 to 6. In one
embodiment, s is an integer
from 2 to 4. In one embodiment, s is 2. In one embodiment, s is 4.
1001711 In one embodiment, y is 5, z is 5, and s is 2.
1001721 In one embodiment, y is 5, z is 5, and s is 4.
[00173] In one embodiment, u is an integer from 0 to 12. In one embodiment, u
is an integer
from 0 to 8. In one embodiment, u is an integer from 0 to 6. In one
embodiment, u is an integer
from 0 to 4. In one embodiment, u is 0. In one embodiment, u is 1. In one
embodiment, u is 2.
In one embodiment, u is 3. In one embodiment, u is 4.
-56-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
100174j In one embodiment, y is 5, z is 5, and u is 0.
1001751 In one embodiment, y is 5, z is 5, and u is 2.
1001761 In one embodiment, t is an integer from 1 to 10. In one embodiment, t
is an integer
from 1 to 8. In one embodiment, t is an integer from 1 to 6. In one
embodiment, t is an integer
from 1 to 4. In one embodiment, t is an integer from 1 to 3. In one
embodiment, t is an integer
from 1 to 2. In one embodiment, t is 1. In one embodiment, t is 2. In one
embodiment, t is 3. In
one embodiment, t is 4. In one embodiment, t is 5. In one embodiment, t is 6.
In one
embodiment, t is 7.
1001771 In one embodiment, R4 is CI-C12 alkyl. In one embodiment, R4 is Ci-Cs
alkyl. In one
embodiment, R4 is CI-C6 alkyl. In one embodiment, R4 is CI-Ca alkyl. In one
embodiment, R4 is
methyl. In one embodiment, R4 is ethyl. In one embodiment, R4 is n-propyl. In
one
embodiment, R4 is n-butyl. In one embodiment, R4 is n-pentyl. In one
embodiment, R4 is n-
hexyl. In one embodiment, R4 is n-octyl. In one embodiment, R4 is n-nonyl.
1001781 In one embodiment, R4 is C3-Cs cycloalkyl. In one embodiment, R4 is
cyclopropyl.
In one embodiment, R4 is cyclobutyl. In one embodiment, R4 is cyclopentyl. In
one
embodiment, R4 is cyclohexyl. In one embodiment, R4 is cycloheptyl. In one
embodiment, R4 is
cyclooctyl.
1001791 In one embodiment, R4 is C3-Cs cycloalkenyl. In one embodiment, R4 is
cyclopropenyl. In one embodiment, R4 is cyclobutenyl. In one embodiment, R4 is
cyclopentenyl. In one embodiment, R4 is cyclohexenyl. In one embodiment, R4 is
cycloheptenyl. In one embodiment, R4 is cyclooctenyl.
1001801 In one embodiment, R4 is C6-CIO aryl. In one embodiment, R4 is phenyl.
[001811 In one embodiment, R4 is 4- to 8-membered heterocyclyl. In one
embodiment, R4 is
4- to 8-membered heterocycloalkyl. In one embodiment, R4 is oxetanyl. In one
embodiment, R4
is tetrahydrofuranyl. In one embodiment, R4 is tetrahydropyranyl. In one
embodiment, R4 is
tetrahydrothiopyranyl. In one embodiment, R4 is N-methylpiperidinyl.
[00182] In one embodiment, R4, G3 or part of G3, together with the nitrogen to
which they are
attached form a cyclic moiety.
- 57 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00183] In one embodiment, the cyclic moiety (formed by R4, G3 or part of G3,
together with
the nitrogen to which they are attached) is heterocyclyl. In one embodiment,
the cyclic moiety is
heterocycloalkyl. In one embodiment, the cyclic moiety is 4- to 8-membered
heterocycloalkyl.
In one embodiment, the cyclic moiety is 4-membered heterocycloalkyl. In one
embodiment, the
cyclic moiety is 5-membered heterocycloalkyl. In one embodiment, the cyclic
moiety is 6-
membered heterocycloalkyl. In one embodiment, the cyclic moiety is 7-membered
heterocycloalkyl. In one embodiment, the cyclic moiety is 8-membered
heterocycloalkyl.
[00184] In one embodiment, the cyclic moiety (formed by R4, G3 or part of (i3,
together with
the nitrogen to which they are attached) is azetidin-3-yl. In one embodiment,
the cyclic moiety is
pyrrolidin-3-yl. In one embodiment, the cyclic moiety is piperidin-4-yl. In
one embodiment, the
cyclic moiety is azepan-4-yl. In one embodiment, the cyclic moiety is azocan-5-
yl. The point of
attachment for these groups is to the direction of the nitrogen that is
connected to G' and G2.
[00185] As described herein and unless otherwise specified, the substitution
patterns for R4
also applies to the cyclic moiety formed by R4, G3 or part of G3, together
with the nitrogen to
which they are attached.
[00186] In one embodiment, R4 is unsubstituted.
[00187] In one embodiment, R4 is substituted with one or more substituents
selected from the
group consisting of oxo, -NRgC(=0)Rh, -C(=0)NRgRh, -C(0)Rh, - OC(=0)Rh, -
C(=0)0Rh and ¨O-R'-OH, wherein:
Rg is at each occurrence independently H or C1-C6 alkyl;
Rh is at each occurrence independently C1-C6 alkyl; and
Ri is at each occurrence independently CI-C6 alkylene.
[00188] In one embodiment, R4 is substituted with one or more hydroxyl. In one
embodiment, R4 is substituted with one hydroxyl.
[00189] In one embodiment, R4 is substituted with one or more hydroxyl and one
or more
oxo. In one embodiment, R4 is substituted with one hydroxyl and one oxo.
[00190] In one embodiment, R3 has one of the following structures:
- 58 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
HO
N=
"5,f..s.õ---s.,NX
0
0 0
0 HO"."-sNX
HON HON HON HON
<I>or
HON
a.
[00191] In one embodiment, R3 has the structure of
[00192] In one embodiment, R3 has the structure of .
[00193] In one embodiment, R.' and R2 are each independently branched C6-C32
alkyl or
branched C6-C32 alkenyl. In one embodiment, 11' and R2 are each independently
branched C6-
C24 alkyl or branched C6-C24 alkenyl.
[00194] In one embodiment, R and R2 are each independently -R7-CH(R8)(R9),
wherein R7 is
C1-05 alkylene, and R8 and R9 are independently C2-C10 alkyl or C2-C10
alkenyl.
[00195] In one embodiment, R is straight C6-C32 alkyl. In one embodiment, RI
is straight C6-
C24 alkyl. In one embodiment, R.' is straight C7-C15 alkyl. In one embodiment,
IV is straight
C7 alkyl. In one embodiment, RI is straight Cs alkyl. In one embodiment, R' is
straight C9 alkyl.
In one embodiment, IV is straight Cm alkyl. In one embodiment, R' is straight
Cii alkyl. In one
embodiment, is straight C12 alkyl. In one embodiment, RI is straight C13
alkyl. In one
embodiment, RI is straight C14 alkyl. In one embodiment, R' is straight C15
alkyl.
-59-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00196] In one embodiment, IV is straight C6-C32 alkenyl. In one embodiment,
RI is straight
C6-C24 alkenyl. In one embodiment, RI is straight C7-Ci7 alkenyl. In one
embodiment, R' is
straight C7 alkenyl. In one embodiment, IV is straight C8 alkenyl. In one
embodiment, R' is
straight C9 alkenyl. In one embodiment, IV is straight Cm alkenyl. In one
embodiment, IV is
straight Cii alkenyl. In one embodiment, IV is straight C12 alkenyl. In one
embodiment, R' is
straight C13 alkenyl. In one embodiment, IV is straight C14 alkenyl. In one
embodiment, IV is
straight C15 alkenyl. In one embodiment, IV is straight C16 alkenyl. In one
embodiment, R' is
straight C17 alkenyl.
[00197] In one embodiment, IV is branched C6-C32 alkyl. In one embodiment, R'
is branched
C6-C24 alkyl. In one embodiment, R' is -R7-CH(R8)(R9), wherein R7 is Co-05
alkylene, and R8
and R9 are independently C2-C10 alkyl. In one embodiment, IV is -R7-
CH(128)(R9), wherein R7 is
Co-Ci alkylene, and R8 and R9 are independently C4-Cs alkyl.
[00198] In one embodiment, IV is branched C6-C32 alkenyl. In one embodiment,
IV is
branched C6-C24 alkenyl. In one embodiment, IV is -R7-CH(R8)(R9), wherein R7
is Co-
05 alkylene, and R8 and R9 are independently C2-C10 alkenyl. In one
embodiment, RI is -R7-
CH(R8)(R9), wherein R7 is Co-C1 alkylene, and R8 and R9 are independently C6-
C10 alkenyl.
[00199] In one embodiment, R2 is straight C6-C32 alkyl. In one embodiment, R2
is straight C6-
C24 alkyl. In one embodiment, R2 is straight C7-C15 alkyl. In one embodiment,
R2 is straight
C7 alkyl. In one embodiment, R2 is straight Cs alkyl. In one embodiment, R2 is
straight C9 alkyl.
In one embodiment, R2 is straight Cm alkyl. In one embodiment, R2 is straight
Cii alkyl. In one
embodiment, R2 is straight C12 alkyl. In one embodiment, R2 is straight C13
alkyl. In one
embodiment, R2 is straight Cia alkyl. In one embodiment, R2 is straight C15
alkyl.
[00200] In one embodiment, R2 is straight C6-C32 alkenyl. In one embodiment,
R2 is straight
C6-C24 alkenyl. In one embodiment, R2 is straight C7-C17 alkenyl. In one
embodiment, R2 is
straight C7 alkenyl. In one embodiment, R2 is straight Cs alkenyl. In one
embodiment, R2 is
straight C9 alkenyl. In one embodiment, R2 is straight Cio alkenyl. In one
embodiment, R2 is
straight Cii alkenyl. In one embodiment, R2 is straight C12 alkenyl. In one
embodiment, R2 is
straight C13 alkenyl. In one embodiment, R2 is straight C14 alkenyl. In one
embodiment, R2 is
straight C15 alkenyl. In one embodiment, R2 is straight C16 alkenyl. In one
embodiment, R2 is
straight C17 alkenyl.
-60-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00201] In one embodiment, R2 is branched C6-C32 alkyl. In one embodiment, R2
is branched
C6-C24 alkyl. In one embodiment, R2 is -1e-CH(R8)(R9), wherein R7 is Co-Cs
alkylene, and le
and R9 are independently C2-Cio alkyl. In one embodiment, R2 is -R7-
CH(R8)(R9), wherein R7 is
Co-CI alkylene, and R8 and R9 are independently C4-C8 alkyl.
[00202] In one embodiment, R2 is branched C6-C32 alkenyl. In one embodiment,
R2 is
branched C6-C24 alkenyl. In one embodiment, R2 is -R7-CH(R8)(R9), wherein R7
is CO-
05 alkylene, and R8 and R9 are independently C2-Cio alkenyl. In one
embodiment, R2 is -R7-
CH(R8)(R9), wherein R7 is Co-C1 alkylene, and R8 and R9 are independently C6-
Cto alkenyl.
[00203] In one embodiment, RC is straight C6-C32 alkyl. In one embodiment, RC
is straight C6-
C24 alkyl. In one embodiment, RC is straight C7-C15 alkyl. In one embodiment,
RC is straight
C7 alkyl. In one embodiment, RC is straight Cs alkyl. In one embodiment, Itc
is straight C9 alkyl.
In one embodiment, Itc is straight Cu) alkyl. In one embodiment, RC is
straight Cii alkyl. In one
embodiment, RC is straight C12 alkyl. In one embodiment, Itc is straight CI?
alkyl. In one
embodiment, RC is straight C14 alkyl. In one embodiment, Itc is straight C15
alkyl.
[00204] In one embodiment, RC is straight C6-02 alkenyl. In one embodiment, R`
is straight
C6-C24 alkenyl. In one embodiment, R` is straight C7-C17 alkenyl. In one
embodiment, RC is
straight C7 alkenyl. In one embodiment, RC is straight Cs alkenyl. In one
embodiment, RC is
straight C9 alkenyl. In one embodiment, RC is straight CI alkenyl. In one
embodiment, RC is
straight Cli alkenyl. In one embodiment, RC is straight C12 alkenyl. In one
embodiment, RC is
straight C13 alkenyl. In one embodiment, RC is straight C14 alkenyl. In one
embodiment, RC is
straight C15 alkenyl. In one embodiment, RC is straight C16 alkenyl. In one
embodiment, RC is
straight C17 alkenyl.
[00205] In one embodiment, RC is branched C6-C32 alkyl. In one embodiment, RC
is branched
C6-C24 alkyl. In one embodiment, RC is -R7-CH(R8)(R9), wherein R7 is Co-Cs
alkylene, and R8
and R9 are independently C2-Cio alkyl. In one embodiment, RC is -RI-
CH(R8)(R9), wherein le is
Co-Ci alkylene, and R8 and R9 are independently C4-03 alkyl.
[00206] In one embodiment, RC is branched C6-C32 alkenyl. In one embodiment,
Re is
branched C6-C24 alkenyl. In one embodiment, RC is -R7-CH(11.8)(R9), wherein R7
is Co-
Cs alkylene, and R8 and R9 are independently C2-Cio alkenyl. In one
embodiment, RC is -R7-
CH(R8)(R9), wherein R7 is Co-C1 alkylene, and R8 and R9 are independently C6-
Cio alkenyl.
- 61 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00207] In one embodiment, Rf is straight C6-C32 alkyl. In one embodiment, Rf
is straight C6-
C24 alkyl. In one embodiment, Rf is straight C7-C15 alkyl. In one embodiment,
Rf is straight
C7 alkyl. In one embodiment, Rf is straight Cs alkyl. In one embodiment, Rf is
straight C9 alkyl.
In one embodiment, Rf is straight Cio alkyl. In one embodiment, Rf is straight
Cii alkyl. In one
embodiment, Rf is straight C12 alkyl. In one embodiment, Rf is straight C13
alkyl. In one
embodiment, Rf is straight C14 alkyl. In one embodiment, Rf is straight C15
alkyl.
[00208] In one embodiment, Rf is straight C6-C32 alkenyl. In one embodiment,
Rf is straight
C6-C24 alkenyl. In one embodiment, Rf is straight C7-C17 alkenyl. In one
embodiment, Rf is
straight C7 alkenyl. In one embodiment, Rf is straight Cs alkenyl. In one
embodiment, Rf is
straight C9 alkenyl. In one embodiment, Rf is straight Cm alkenyl. In one
embodiment, Rf is
straight Cii alkenyl. In one embodiment, Rf is straight C12 alkenyl. In one
embodiment, Rf is
straight C13 alkenyl. In one embodiment, Rf is straight C14 alkenyl. In one
embodiment, Rf is
straight C15 alkenyl. In one embodiment, Rf is straight C16 alkenyl. In one
embodiment, Rf is
straight C17 alkenyl.
[00209] In one embodiment, Rf is branched C6-C32 alkyl. In one embodiment, Rf
is branched
C6-C24 alkyl. In one embodiment, Rf is -R7-CH(R8)(R9), wherein R7 is Co-05
alkylene, and R8
and R9 are independently C2-Cio alkyl. In one embodiment, Rf is -R7-
CH(R8)(R9), wherein R7 is
Co-CI alkylene, and R8 and R9 are independently C4-C8 alkyl.
[00210] In one embodiment, Rf is branched C6-C32 alkenyl. In one embodiment,
Rf is
branched C6-C24 alkenyl. In one embodiment, Rf is -R7-CH(R8)(R9), wherein R7
is Co-
05 alkylene, and R8 and R9 are independently C2-Cio alkenyl. In one
embodiment, Rf is -R7-
CH(R8)(R9), wherein R7 is Co-C1 alkylene, and R8 and R9 are independently C6-
C10 alkenyl.
[00211] In one embodiment, R', R2, Re, and Rare each independently straight C6-
Cis alkyl,
straight C6-Cis alkenyl, or -R7-CH(R8)(R9), wherein RI is Co-05 alkylene, and
R8 and R9 are
independently C2-C10 alkyl or C2-C10 alkenyl.
[00212] In one embodiment, R', R2, Re, and Rf are each independently straight
C7-C15 alkyl,
straight C7-C15 alkenyl, or -R7-CH(R8)(R9), wherein R7 is Co-Ci alkylene, and
R8 and R9 are
independently C4-C8 alkyl or C6-C10 alkenyl.
-62-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00213] In one embodiment, IV, R2, Re, and R1 are each independently one of
the following
structures:
=
,
[00214] In one embodiment, IV, R2, Re, and Rf are each independently
optionally substituted.
In one embodiment, the optional substituent is -0-(C6-C24 alkyl). In one
embodiment, the
optional substituent is -0-(C6-C24 alkenyl). In one embodiment, the optional
substituent is ¨
C(=0)-(C6-C24 alkyl). In one embodiment, the optional substituent is ¨C(=0)-
(C6-C24 alkenyl).
1002151 In one embodiment, Ra and Rd are each independently H. In one
embodiment, Ra, Rb,
Rd, and Re are each independently H. In one embodiment, Ra and Rd are each
independently CI-
C24 alkyl. In one embodiment, Ra and Rd are each independently C1-C18 alkyl.
In one
embodiment, Ra and Rd are each independently CI-C12 alkyl. In one embodiment,
Ra and Rd are
each independently CI-C6 alkyl.
1002161 In one embodiment, Rb, Re, Re, and Rf are each independently n-hexyl
or n-octyl.
1002171 In one embodiment, Re and Rf are each independently branched C6-C24
alkyl or
branched C6-C24 alkenyl. In one embodiment, Re and Rf are each independently -
R7-CH(R8)(R9),
wherein R7 is CI-Cs alkylene, and R8 and R9 are independently C2-C10 alkyl or
C2-C10 alkenyl.
-63 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
1002181 In one embodiment, the compound is a compound in Table 1, or a
pharmaceutically
acceptable salt, prodrug or stereoisomer thereof
Table 1.
O o
("`-iLo r"-"==-)Lo
HON. N
0 0
a 0 0
Compound 1 Compound 2
o o
HO.,,,,.=.,N,",,,N 110........õ."-,N...--,,,, N
6 0 0 A 0 0
Compound 3 Compound 4
o
o
o
HON,,,,-,
,,,, N
0 0
a 0 0
Compound 5 Compound 6
0
(---..-----..)--0 o
HO.,..,...--..N.,....õ-N
HO"=,,KN-".."-..N
I* 0 0
6 0 0
Compound 7 Compound 8
o o
? r--..--,--Ko o r"---'--)Lo
HO'',.../N-'-\7-`vN
a HO,'\=N
. 0
a 0 0
Compound 9 Compound 10
o o
F10........N....TN
N
,o, 0 0
o o o o
Compound 11 Compound 12
-64-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
0
o
----,------11,0 I 0
HON
o. 0
0 0 0 0
Compound 13 Compound 14(
0
9' 0
C6H 13
N 110-...---N,
HO
0 0
C61-113
Compound 15 Compound 16
Q 0
0
...--,,T.C8/117
Fl
I 0
e.---(
C81117
c6Fii,
e.õ,,N C6F113 HO'''N
0 0
C61113 C61-113
Compound 17 Compound 18
o
6 0
0 OH
Compound 20 Compound 21
0 0
i---------A0 ,----õ,...-11,0
HO...,_,..-s.N..--,.....N
0 0 :
CI ,.
0 0
OH F F
Compound 22 Compound 23
A .0 HOõ,õ..,-..tr.--
.,,,N.,,,,,,õer..) 0
6 0.
6
Compound 24 Compound 25
-65 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
r....õ,,,,......o
Ho.,..-.N....õN,,,,,"=..f)
a r o o
6
Compound 26 Compound 27
o 9
is
(-----A=o rwo
140,.......N.^.,,,N
o
Compound 28 Compound 29
9 c)
'''-'-'-i`o r''.-^-3Co--"=-'''',
6 `-'-"--0),-0--,7,--,.--,----
o
c.,......... t......õ.
Compound 30 Compound 31
.
o
o
NO
NO ,r,==,N ..,,,,.,õ.N
, 6
0 0 .<;. 0 o
Compound 32 Compound 33
9
0
r-Lo
Compound 34 Compound 35
(--"Ir
r.".õ......õ......y.0
0
0
6 Li0
6 6
0
Compound 36 Compound 37
.
o
o :
H0.õ..,==,N.-..,,N
0 0o 6 0 o
Compound 38 Compound 39
-66-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
0
o' 0 0
Compound 40 Compound 41
0
/----,-,---ko 0
Ho.,-.N...*õ..,
0 0).'0
Compound 42 Compound 43
9
9 rwo 0.
zr,----.....---.....-------,0
,..,.N 0 Ft0.,,,,N.,..õ,NN,wo
o 0
Ø
Compound 44 Compound 45
0
9
HONN
o. 0
0 cl`.0
Compound 46 Compound 47 .
0
0
r",-,-,..-1=0
(0
HO.,,,N,,,N
00 0 0 0
Compound 48 Compound 49
o o
r----,-)Lo
HON.,,, N
Compound 50 Compound 51
-67-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
0
0
r'j(0'/`yClOH21
C101121
46 0 eNyCio1121 0 0
Ci0H21 OH
Compound 52 Compound 54
0
0 0
CLd
OH OH
Compound 55 Compound 56
0
r---..---,A0
0 0
Compound 57 Compound 58
0
Ho.. rK0----,y,",..-^,-,"..."..:
OH Compound 59 Compound 60
9
C5H :114,.. N .. 0
t:Ir) 0 0
0 ---"...-"--..-"--
---------
OH o'
Compound 61 Compound 62
o
ro
0 -------,-...
("`-^--A0 --- Ac0,..õ----.N.--..,,N
0
Compound 63 Compound 64
-68-
CA 03178455 2022-09-29
WO 2021/204175
PCT/CN2021/085879
182110784FF
0
r-')(0
,-....y 8C Hi7
N CA7 0
---...--....---,
0 0----s'r-C8H1 7 HO.
<a> t'=='...,'"y ,..-..'''
0 C81117
Compound 65 Compound 66
o
0 0
6,0H
0 0
OH
Compound 67 Compound 68
0
qr...--.....)-0.
ar,OH
OH
Compound 69 Compound 70
0
9
''-'1.'-''`'l C.,-'V'N.," .,-,',N====,..N C...
L---/-,,
= OH OH
Compound 71 Compound 72
0 9
r=---)Lo (--...------ko
.-N-N
lj 0 0
(*1
00
OH OH
Compound 73 Compound 74
0
eNyC81-117
HO.,,,,/^=,N,,--,,õ.. N C8I-117
o
f-'--'-`=-=-11-o 0 0
---...y. 8C H 17
rJ
081117
o0
OH
Compound 75 Compound 76
-69-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
0
(----)(008F117
0
,----..------)(0----yw.
1:21 1)) 0
( C8H"
,Th
C8H 17
:
o
Compound 77 Compound 78
0
A0-'-''=(C8H 17
N C8F17 9
1
,----------it-o
17
0017
A
F r
Compound 79 Compound 80
0 0 _
0 0===,0-.1r,"-
f.,,,=',.../".....
Compound 81 Compound 82
0
1,,,,,.....õ.,..),0,c 1,1123
0
r.,..,-,-...,...ko-C ii H23 HO,,,,....N,,...,.N
Ho....,....,N,--,õ.N
,...y.C8H17
0 0
0 0"-µNr
C81117
a a c8H17
c8H17
Compound 83 Compound 84
r..õõ........õ,,or=
nco.-----,,=0
0 0
0
0 0
Compound 85 Compound 86
0
(008F1 17 0
rs`=....*'"--)
N..,,===,õ----. C81117
on
ti/NyC8H17
c8H17 6
0 . 0
Compound 87 Compound 88
- 70-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
o
a 0 0
0 0
c-'0.7
0
Compound 89 Compound 90
0
1.0,--,..,-.. õ...õ.1
110,,en r 0
-_,A (...--,-----.
\--,,N,,,,,, ,
0 0.--y--õ........^.----...
a 1...----,_,-----, 13 0,,,c-,...-õ-.,
Compound 91 Compound 92
0
o
HON___,. N,-,=-,õ,,, N
aN.............N L.......-====õ,
OH i
Compound 93 Compound 94
0
HO
,...."-./1 W.
0 0 0 0
Compound 95 Compound 96
o
9
Ho-N-\..).
o o Ho^,--13- 0 o
Compound 97 Compound 98
o
-
r"-,.../`-...K0 ...-.
0 0 HO
OH 0
Compound 99 Compound 101
0
r---0---,A0 0
"o. 00
Compound 102 Compound 103
- 71 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
H
0
HO.,..,,..N.,-=,,,,,N..,..,,N,õ,-,) 0
0
C.."..,"-. .6 HN
0
Compound 104 Compound 105
o 0
".õ.N HO,-^=,N
o
0 N
H 6 0 N
H
Compound 106 Compound 107
o
-..,...,,N .,..,."...õ,--.1 0
HO
6 HN N'''''N''''-"' H
A0 0
0
Compound 108 Compound 109
0
o r-NV`N.,"..
HO N H t..,..,,-
...,_,---=,,,i
Compound 110 Compound 111
0
H
H
...õõN 110.,..,.",,N,,,=,,.N
,,,,=,.,,,,====,1 0
a 0 N
H A HN
o
Compound 112 Compound 113
H H
r.õ,-===,,,.N r..f.,...N
..õ_,.N ,õ,...--=,,,..,1 0 110N,,,, N 0
o HN
0 a HN
0
Compound 114 Compound 115
.
H
r.,====.,,,,õ N
r.".õ.,..".,..,. 0
HO N ,..,.. N ,..,..õ.,...õ.."-1 0
HO,,.--.N..,..., 0
a HN
0 A HN
o
Compound 116 Compound 117
- 72 -
CA 03178455 2022-09-29
WO 2021/204175
PCT/CN2021/085879
182110784FF
0 0
N..--...y.C8H17
H 17
H H
C61-113col 3
6 0 HNC8111 7 C8 A
0 NyH C8-17
H
C6H13
C61113
Compound 118 Compound 119
0
N
A
H
110..õ..--.N C6H13 figi #11
NH
a O _C H 8 17
tNrY
H
C6H13
0 N
H
Compound 120 Compound 121
0 0
AVI i
.......,,,,,,õ......,,,. ...,"\.-AK"...W
H
HO,....,N,,,,,..,NNH
H a
3 (:)..p.t.-^-,õr,-W.,,,=\
L.,_,.õ......,
0 N
H
Compound 122 Compound 123
0
0
,IL
tr1
.)
6 .)..
0 0
0 0
a
Compound 124 Compound 125
9 0
r.........A.
H '
,-N L.....,1,"*... H0,,,==-=,NN
0 '''..0)'0'(''N` i 0 0
C..../\...-\..
Compound 126 Compound 127
9 0
.,,N HO.,,,N...õ..N
a 0 0
a 0 N
H
Compound 128 Compound 129
H
r.--..õ.õ,.....,.,..N
i,,,,....,....,,0
-..õ.Nw)
o HN
0 a 0
0
Compound 130 Compound 131
- 73 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
0
H (......./"....)(
r.i
r.,..,...,.......õ N
.....f.1:4,=====.õ....,N
a 0
0 0
(sH 0 0
Compound 132 Compound 133
0
q
r....".".....)Lpti ====,,..../....N.......,N H
N=14
H
H
OH OH
Compound 134 Compound 135 .
0 o
(--....----...)-il r..........),11
HO...f. N,..===..,...N HO..õ../,..N..,,,,,N
o 0 0 a 0 N
H
Compound 136 Compound 137
0
O
HO
HO......,,e,.. N,,,,,,N
a .....,,,,,,,./-...õ -
..õ,..N
0 0
(3 0,0
Compound 138 Compound 139
0
0
''-`=='.'s.'A N
:
Ail
6 0 0
lb 0 .
Compound 140 Compound 141
H
r.......õ,..........õ.N r......,,,,,,,õ0
,,,N..õ......,..õ.Th 0 HO,..,.., \ N,===\,,, N
0 6 HN
(3 0
0
Compound 142 Compound 143
- 74-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
H li,,,,T,C017
H
(..,..,,,-....._,..N
N,,,,,,,,...,..Th 0 C8H17
110,,,-,,N.-=-õ,..N.,õ-^,......,Th 0
(3 HN
0 (i 0
coil;
0 C8H17
Compound 144 Compound 145
0 0
H23 r/"L0'Ciii-l23
N,,,..õ,..,."...õ HO,,,---..N.,-,N,,--.õ,õ---,,.
6
6 0---,Nr-i=C
H 81-117 c
Nf, ,Nr--,C H 7
H _ 8 1
C8H17 C81-
117
Compound 146 Compound 147 .
0 0
r,,,,,.....õ......,A0,C1 1 H23
HO N.- N
.,,,,N.
it) cõ,,NrC8H17
H
C81117 a0 N 17
¨C8"
H
C81-117
Compound 148 Compound 149
0
0--/---/---/---/
(--..,,,,,-.......)1,0.-C11H23
"..,- N
HO.,....,."...NN
6 0 N
H A 0
Nor-NyegH 17
H
C8H17
Compound 150 Compound 151
H
(..........õ..,õ,N
-,,,,N...,,,, 0
a 0
A
0 FIN
0
Compound 152 Compound 153
o
HO..õ.....N,====,,,N
HO..,,...-..N.,--õ, N .,....,,,,õ,--..,1
o"
oi ..
0 0
Compound 154 Compound 155
- 75 -
CA 03178455 2022-09-29
WO 2021/204175
PCT/CN2021/085879
182110784FF
[00219] It is understood that any embodiment of the compounds provided herein,
as set forth
above, and any specific substituent and/or variable in the compound provided
herein, as set forth
above, may be independently combined with other embodiments and/or
substituents and/or
variables of the compounds to form embodiments not specifically set forth
above. In addition, in
the event that a list of substituents and/or variables is listed for any
particular group or variable, it
is understood that each individual substituent and/or variable may be deleted
from the particular
embodiment and/or claim and that the remaining list of substituents and/or
variables will be
considered to be within the scope of embodiments provided herein.
[00220] It is understood that in the present description, combinations of
substituents and/or
variables of the depicted formulae are permissible only if such contributions
result in stable
compounds.
5.4 Nanopartick Compositions
[00221] In one aspect, described herein are nanoparticle compositions
comprising a lipid
compound described herein. In particular embodiments, the nanoparticle
composition comprises
a compound according to Formulae (I) to (IV) (and sub-formulas thereof) as
described herein.
1002221 In some embodiments, the largest dimension of a nanoparticle
composition provided
herein is 1 gm or shorter (e.g., m,
_5_900 nm, _5_800 nm, 5_700 nm, 5600 nm, 5_500 nm, _5_400
nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, nm,
50 nm, or shorter),
such as when measured by dynamic light scattering (DLS), transmission electron
microscopy,
scanning electron microscopy, or another method. In one embodiment, the lipid
nanoparticle
provided herein has at least one dimension that is in the range of from about
40 to about 200 nm.
In one embodiment, the at least one dimension is in the range of from about 40
to about 100 nm.
[00223] Nanoparticle compositions that can be used in connection with the
present disclosure
include, for example, lipid nanoparticles (LNPs), nano liproprotein particles,
liposomes, lipid
vesicles, and lipoplexes. In some embodiments, nanoparticle compositions are
vesicles including
one or more lipid bilayers. In some embodiments, a nanoparticle composition
includes two or
more concentric bilayers separated by aqueous compartments. Lipid bilayers may
be
functionalized and/or crosslinked to one another. Lipid bilayers may include
one or more
ligands, proteins, or channels.
-76-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00224] The characteristics of a nanoparticle composition may depend on the
components
thereof. For example, a nanoparticle composition including cholesterol as a
structural lipid may
have different characteristics than a nanoparticle composition that includes a
different structural
lipid. Similarly, the characteristics of a nanoparticle composition may depend
on the absolute or
relative amounts of its components. For instance, a nanoparticle composition
including a higher
molar fraction of a phospholipid may have different characteristics than a
nanoparticle
composition including a lower molar fraction of a phospholipid.
Characteristics may also vary
depending on the method and conditions of preparation of the nanoparticle
composition.
[00225] Nanoparticle compositions may be characterized by a variety of
methods. For
example, microscopy (e.g., transmission electron microscopy or scanning
electron microscopy)
may be used to examine the morphology and size distribution of a nanoparticle
composition.
Dynamic light scattering or potentiometry (e.g., potentiometric titrations)
may be used to
measure zeta potentials. Dynamic light scattering may also be utilized to
determine particle
sizes. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd,
Malvem, and
Worcestershire, UK) may also be used to measure multiple characteristics of a
nanoparticle
composition, such as particle size, polydispersity index, and zeta potential.
[00226] Dh (size): The mean size of a nanoparticle composition may be between
lOs of nm
and 100s of nm. For example, the mean size may be from about 40 nm to about
150 nm, such as
about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90
nm, 95 nm,
100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145
nm, or 150
nm. In some embodiments, the mean size of a nanoparticle composition may be
from about 50
nm to about 100 nm, from about 50 nm to about 90 nm, from about 50 nm to about
80 nm, from
about 50 nm to about 70 nm, from about 50 nm to about 60 nm, from about 60 nm
to about 100
nm, from about 60 nm to about 90 nm, from about 60 nm to about 80 nm, from
about 60 nm to
about 70 nm, from about 70 nm to about 100 nm, from about 70 nm to about 90
nm, from about
70 nm to about 80 nm, from about 80 nm to about 100 nm, from about 80 nm to
about 90 nm, or
from about 90 nm to about 100 nm. In certain embodiments, the mean size of a
nanoparticle
composition may be from about 70 nm to about 100 nm. In some embodiments, the
mean size
may be about 80 nm. In other embodiments, the mean size may be about 100 nm.
-77-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00227] PDI: A nanoparticle composition may be relatively homogenous. A
polydispersity
index may be used to indicate the homogeneity of a nanoparticle composition,
e.g., the particle
size distribution of the nanoparticle compositions. A small (e.g., less than
0.3) polydispersity
index generally indicates a narrow particle size distribution. A nanoparticle
composition may
have a polydispersity index from about 0 to about 0.25, such as 0.01, 0.02,
0.03, 0.04, 0.05, 0.06,
0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19,
0.20, 0.21, 0.22, 0.23,
0.24, or 0.25. In some embodiments, the polydispersity index of a nanoparticle
composition may
be from about 0.10 to about 0.20.
[00228] Encapsulation Efficiency: The efficiency of encapsulation of a
therapeutic and/or
prophylactic agent describes the amount of therapeutic and/or prophylactic
agent that is
encapsulated or otherwise associated with a nanoparticle composition after
preparation, relative
to the initial amount provided. The encapsulation efficiency is desirably high
(e.g., close to 100
%). The encapsulation efficiency may be measured, for example, by comparing
the amount of
therapeutic and/or prophylactic agent in a solution containing the
nanoparticle composition
before and after breaking up the nanoparticle composition with one or more
organic solvents or
detergents. Fluorescence may be used to measure the amount of free therapeutic
and/or
prophylactic agent (e.g., RNA) in a solution. For the nanoparticle
compositions described
herein, the encapsulation efficiency of a therapeutic and/or prophylactic
agent may be at least 50
%, for example 50 %, 55 %, 60 %, 65 %, 70 %, 75 %, 80 %, 85 %, 90 %, 91 %, 92
%, 93 %, 94
%, 95 %, 96 %, 97 %, 98 %, 99 %, or 100 %. In some embodiments, the
encapsulation
efficiency may be at least 80 %. In certain embodiments, the encapsulation
efficiency may be at
least 90 %.
[00229] Apparant pKa: The zeta potential of a nanoparticle composition may be
used to
indicate the electrokinetic potential of the composition. For example, the
zeta potential may
describe the surface charge of a nanoparticle composition. Nanoparticle
compositions with
relatively low charges, positive or negative, are generally desirable, as more
highly charged
species may interact undesirably with cells, tissues, and other elements in
the body. In some
embodiments, the zeta potential of a nanoparticle composition may be from
about - 10 mV to
about +20 mV, from about - 10 mV to about + 15mV, from about - 10 mV to about
+ 10 mV,
from about - 10 mV to about + 5 mV, from about - 10 mV to about 0 mV, from
about - 10 mV to
about - 5 mV, from about - 5 mV to about + 20 mV, from about - 5 mV to about +
15 mV, from
- 78 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
about - 5 mV to about + 10 mV, from about - 5 mV to about + 5 mV, from about -
5 mV to about
0 mV, from about 0 mV to about + 20 mV, from about 0 mV to about + 15 mV, from
about 0
mV to about + 10 mV, from about 0 mV to about +5 mV, from about +5 mV to about
+20 mV,
from about +5 mV to about + 15 mV, or from about + 5 mV to about + 10 mV.
[00230] In another embodiment, the self-replicating RNA may be formulated in a
liposome.
As a non-limiting example, the self-replicating RNA may be formulated in
liposomes as
described in International Publication No. W020120067378, herein incorporated
by reference in
its entirety. In one aspect, the liposomes may comprise lipids which have a
pKa value which
may be advantageous for delivery of mRNA. In another aspect, the liposomes may
have an
essentially neutral Surface charge at physiological pH and may therefore be
effective for
immunization (see e.g., the liposomes described in International Publication
No.
W020120067378, herein incorporated by reference in its entirety).
[00231] In some embodiments, nanoparticle compositions as described comprise a
lipid
component including at least one lipid, such as a compound according to one of
Formulae (I) to
(IV) (and sub-formulas thereof) as described herein. For example, in some
embodiments, a
nanoparticle composition may include a lipid component including one of
compounds provided
herein. Nanoparticle compositions may also include one or more other lipid or
non-lipid
components as described below.
5.4.1 Cationicflonizabk Lipids
[00232] As described herein, in some embodiments, a nanoparticle composition
provided
herein comprises one or more charged or ionizable lipids in addition to a
lipid according
Formulae (I) to (IV) (and sub-formulas thereof). Without being bound by the
theory, it is
contemplated that certain charged or zwitterionic lipid components of a
nanoparticle composition
resembles the lipid component in the cell membrane, thereby can improve
cellular uptake of the
nanoparticle. Exemplary charged or ionizable lipids that can form part of the
present
nanoparticle composition include but are not limited to 3-(didodecylamino)-
NI,N1,4-tridodecyl-
l-piperazineethanamine (KL10), N1-[2-(di dodecylamino)ethyl]-N1,N4,N4-
tridodecyl-1,4-
piperazinediethanamine (KL22), 14,25-ditridecy1-15,18,21,24-tetraaza-
octatriacontane (KL25),
1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoley1-4-
dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-
tetraen-19-y14-
- 79 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoley1-4-(2-
dimethylaminoethy1)41,3]-
dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-(
(8-
[(313)-cholest-5-en-3-yloxy]octyl) oxy)-N,N-dimethy1-3 [(9Z,12Z)-octadeca-9,12-
dien-1-
yloxy]propan-1-amine (Octyl-CLinDMA), (2R)-2-({8-[(313)-cholest-5-en-3-
yloxy]octyl}oxy)-
N,N-dimethy1-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-
CLinDMA
(2R)), (2S)-2-((8-[(313)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethy1-3-[(9Z-
,12Z)-octadeca-
9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2S)), (12Z,15Z)-N,N-dimethy1-
2-
nonylhenicosa-12,15-den-l-amine, N,N-dimethy1-1- {(1S,2R)-2-octylcyclopropyl }
heptadecan-8-
amine. Additional exemplary charged or ionizable lipids that can form part of
the present
nanoparticle composition include the lipids (e.g., lipid 5) described in
Sabnis et al. "A Novel
Amino Lipid Series for mRNA Delivery: Improved Endosomal Escape and Sustained
Pharmacology and Safety in Non-human Primates", Molecular Therapy Vol. 26 No
6, 2018, the
entirety of which is incorporated herein by reference.
[00233] In some embodiments, suitable cationic lipids include N41-(2,3-
dioleyloxy)propy1]-
N,N,N-trimethylammonium chloride (DOTMA); N-[ 1-(2,3-dioleoyloxy)propyl]-N,N,N-
trimethylammonium chloride (DOTAP); 1,2-dioleoyl-sn-glycero-3-
ethylphosphocholine
(DOEPC); 1,2-dilauroyl-sn-glycero-3-ethylphosphocholine (DLEPC); 1,2-
dimyristoyl-sn-
glycero-3-ethylphosphocholine (DMEPC); 1,2-dimyristoleoyl-sn-glycero-3-
ethylphosphocholine
(14:1); N142-(( IS)-1-[(3-aminopropyl)amino]-4-[di(3-amino-
propyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5);
dioctadecylamido-
glycylspermine (DOGS); 3b[N-(N',Nt-dimethylaminoethyl)carbamoyljcholesterol
(DC-Chol);
dioctadecyldimethylammoni um bromide (DDAB); SAINT-2, N-methy1-4-
(dioleyl)methylpyridini um; 1,2-dimyristyloxypropy1-3-
dimethylhydroxyethylammonium
bromide (DMRIE); 1,2-dioleoy1-3-dimethyl-hydroxyethyl ammonium bromide
(DORIE); 1,2-
dioleoyloxypropy1-3-dimethylhydroxyethyl ammonium chloride (DORI); di-
alkylated amino
acid (DILA2) (e.g., C18:1-norArg-C16); dioleyldimethylammonium chloride
(DODAC); 1-
palmitoy1-2-oleoyl-sn-glycero-3-ethylphosphocholine (POEPC); 1,2-
dimyristoleoyl-sn-glycero-
3-ethylphosphocholine (MOEPC); (R)-5-(dimethylamino)pentane-1,2-diy1 dioleate
hydrochloride (DODAPen-C1); (R)-5-guanidinopentane-1,2-diyldioleate
hydrochloride (DOPen-
G); and (R)-N,N,N-trimethy1-4,5-bis(oleoyloxy)pentan-1-aminium chloride
(DOTAPen). Also
suitable are cationic lipids with headgroups that are charged at physiological
pH, such as primary
- 80-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
amines (e.g., DODAG N',N'-dioctadecyl-N-4,8-diaza-10-aminodecanoylglycine
amide) and
guanidinium head groups (e.g., bis-guanidinium-spermidine-cholesterol (BGSC),
bis-
guanidiniumtren-cholesterol (BGTC), PONA, and (R)-5-guanidinopentane-1,2-
diyldioleate
hydrochloride (DOPen-G)). Yet another suitable cationic lipid is (R)-5-
(dimethylamino)pentane-
1,2-diyldioleate hydrochloride (DODAPen-C1). In certain embodiments, the
cationic lipid is a
particular enantiomer or the racemic form, and includes the various salt forms
of a cationic lipid
as above (e.g., chloride or sulfate). For example, in some embodiments, the
cationic lipid is N-
[1-(2,3-dioleoyloxy)propy1]-N,N,N-trimethylammonium chloride (DOTAP-C1) or N-
[1-(2,3-
dioleoyloxy)propy1]-N,N,N-trimethylammonium sulfate (DOTAP-Sulfate). In some
embodiments, the cationic lipid is an ionizable cationic lipid such as, e.g.,
dioctadecyldimethylammonium bromide (DDAB); 1,2-dilinoleyloxy-3-
dimethylaminopropane
(DLinDMA); 2,2-dilinoley1-4-(2dimethylaminoethy1)41,3]-dioxolane (DLin-KC2-
DMA);
heptatriaconta-6,9,28,31-tetraen-19-y1 4-(dimethylamino)butanoate (DLin-MC3-
DMA); 1,2-
dioleoyloxy-3-dimethylaminopropane (DODAP); 1,2-dioleyloxy-3-
dimethylaminopropane
(DODMA); and morpholinocholesterol (Mo-CHOL). In certain embodiments, a lipid
nanoparticle includes a combination or two or more cationic lipids (e.g., two
or more cationic
lipids as above).
[00234] Additionally, in some embodiments, the charged or ionizable lipid that
can form part
of the present nanoparticle composition is a lipid including a cyclic amine
group. Additional
cationic lipids that are suitable for the formulations and methods disclosed
herein include those
described in W02015199952, W02016176330, and W02015011633, the entire contents
of each
of which are hereby incorporated by reference in their entireties.
5.4.2 Polymer Conjugated Lipids
[00235] In some embodiments, the lipid component of a nanoparticle composition
can include
one or more polymer conjugated lipids, such as PEGylated lipids (PEG lipids).
Without being
bound by the theory, it is contemplated that a polymer conjugated lipid
component in a
nanoparticle composition can improve of colloidal stability and/or reduce
protein absorption of
the nanoparticles. Exemplary cationic lipids that can be used in connection
with the present
disclosure include but are not limited to PEG-modified
phosphatidylethanolamines, PEG-
modified phosphatidic acids, PEG-modified ceramides, PEG-modified
dialkylamines, PEG-
- 81 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof.
For example, a
PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-
DSPE, Ceramide-PEG2000, or Chol-PEG2000.
[00236] In one embodiment, the polymer conjugated lipid is a pegylated lipid.
For example,
some embodiments include a pegylated diacylglycerol (PEG-DAG) such as 1-
(monomethoxy-
polyethyleneglycol)-2,3-dimyristoylglycerol (PEG-DMG), a pegylated
phosphatidylethanoloamine (PEG-PE), a PEG succinate diacylglycerol (PEG-S-DAG)
such as 4-
0-(2',3'-di(tetradecanoyloxy)propy1-1-0-(0)-
methoxy(polyethoxy)ethyl)butanedioate (PEG-S-
DMG), a pegylated ceramide (PEG-cer), or a PEG dialkoxypropylcarbamate such as
co-
methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoxy)propyl)carbamate or 2,3-
di(tetradecanoxy)propyl-N-(o-methoxy(polyethoxy)ethyl)carbamate.
1002371 In one embodiment, the polymer conjugated lipid is present in a
concentration
ranging from 1.0 to 2.5 molar percent. In one embodiment, the polymer
conjugated lipid is
present in a concentration of about 1.7 molar percent. In one embodiment, the
polymer
conjugated lipid is present in a concentration of about 1.5 molar percent.
1002381 In one embodiment, the molar ratio of cationic lipid to the polymer
conjugated lipid
ranges from about 35:1 to about 25:1. In one embodiment, the molar ratio of
cationic lipid to
polymer conjugated lipid ranges from about 100:1 to about 20:1.
[00239] In one embodiment, the pegylated lipid has the following Formula:
0
QOL
N_Ri2
w I ,
R1'
or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof,
wherein:
IV2 and R13 are each independently a straight or branched, saturated or
unsaturated alkyl chain
containing from 10 to 30 carbon atoms, wherein the alkyl chain is optionally
interrupted by one
or more ester bonds; and
w has a mean value ranging from 30 to 60.
[00240] In one embodiment, IV2 and R" are each independently straight,
saturated alkyl
chains containing from 12 to 16 carbon atoms. In other embodiments, the
average w ranges from
- 82 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
42 to 55, for example, the average w is 42, 43, 44, 45, 46, 47, 48, 49, 50,
51, 52, 53, 54 or 55. In
some specific embodiments, the average w is about 49.
[00241] In one embodiment, the pegylated lipid has the following Formula:
0
0
w 13
13
wherein the average w is about 49.
5.4.3 Structural Lipids
[002421 In some embodiments, the lipid component of a nanoparticle composition
can include
one or more structural lipids. Without being bound by the theory, it is
contemplated that
structural lipids can stabilize the amphiphilic structure of a nanoparticle,
such as but not limited
to the lipid bilayer structure of a nanoparticle. Exemplary structural lipids
that can be used in
connection with the present disclosure include but are not limited to
cholesterol, fecosterol,
sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine,
tomatine, ursolic acid,
alpha-tocopherol, and mixtures thereof In certain embodiments, the structural
lipid is
cholesterol. In some embodiments, the structural lipid includes cholesterol
and a corticosteroid
(such as prednisolone, dexamethasone, prednisone, and hydrocortisone), or a
combination
thereof.
[00243] In one embodiment, the lipid nanoparticles provided herein comprise a
steroid or
steroid analogue. In one embodiment, the steroid or steroid analogue is
cholesterol. In one
embodiment, the steroid is present in a concentration ranging from 39 to 49
molar percent, 40 to
46 molar percent, from 40 to 44 molar percent, from 40 to 42 molar percent,
from 42 to 44 molar
percent, or from 44 to 46 molar percent. In one embodiment, the steroid is
present in a
concentration of 40, 41, 42, 43, 44, 45, or 46 molar percent.
[00244] In one embodiment, the molar ratio of cationic lipid to the steroid
ranges from 1.0:0.9
to 1.0:1.2, or from 1.0:1.0 to 1.0:1.2. In one embodiment, the molar ratio of
cationic lipid to
cholesterol ranges from about 5:1 to 1:1. In one embodiment, the steroid is
present in a
concentration ranging from 32 to 40 mol percent of the steroid.
- 83 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
5.4.4 Phospholipids
[00245] In some embodiments, the lipid component of a nanoparticle composition
can include
one or more phospholipids, such as one or more (poly)unsaturated lipids.
Without being bound
by the theory, it is contemplated that phospholipids may assemble into one or
more lipid bilayers
structures. Exemplary phospholipids that can form part of the present
nanoparticle composition
include but are not limited to 1,2-distearoyl-sn-glycero-3-phosphocholine
(DSPC), 1,2-dioleoyl-
sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-
phosphocholine
(DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-
glycero-3-
phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-
diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoy1-2-oleoyl-sn-glycero-
3-
phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0
Diether PC),
1-oleoy1-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (0ChemsPC), 1-
hexadecyl-
sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-
phosphocholine,
1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-
glycero-3-
phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE),
1,2-
distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-
phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-
diarachidonoyl-
sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-
phosphoethanolamine,
1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and
sphingomyelin. In
certain embodiments, a nanoparticle composition includes DSPC. In certain
embodiments, a
nanoparticle composition includes DOPE. In some embodiments, a nanoparticle
composition
includes both DSPC and DOPE.
[00246] Additional exemplary neutral lipids include, for example,
dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl-
phosphatidylethanolamine (POPE)
and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-
lcarboxylate
(DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE),
dimyristoylphosphoethanolamine
(DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-0-monomethyl PE, 16-0-
dimethyl
PE, 18-1-trans PE, 1-stearioy1-2-oleoylphosphatidyethanol amine (SOPE), and
1,2-dielaidoyl-sn-
glycero-3-phophoethanolamine (transDOPE). In one embodiment, the neutral lipid
is 1,2-
distearoyl-sn-glycero-3phosphocholine (DSPC). In one embodiment, the neutral
lipid is selected
from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM.
- 84-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00247] In one embodiment, the neutral lipid is phosphatidylcholine (PC),
phosphatidylethanolamine (PE) phosphatidylserine (PS), phosphatidic acid (PA),
or
phosphatidylglycerol (PG).
100248] Additionally phospholipids that can form part of the present
nanoparticle composition
also include those described in W02017/112865, the entire content of which is
hereby
incorporated by reference in its entirety.
5.4.5 Therapeutic Payload
100249] According to the present disclosure, nanoparticle compositions as
described herein
can further comprise one or more therapeutic and/or prophylactic agents. These
therapeutic
and/or prophylactic agents are sometimes referred to as a "therapeutic
payload" or "payload" in
the present disclosure. In some embodiments, the therapeutic payload can be
administered in
vivo or in vitro using the nanoparticles as a delivery vehicle.
[00250] In some embodiments, the nanoparticle composition comprises, as the
therapeutic
payload, a small molecule compound (e.g., a small molecule drug) such as
antineoplastic agents
(e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin,
bleomycin,
cyclophosphamide, methotrexate, and streptozotocin), antitumor agents (e.g.,
actinomycin D,
vincristine, vinblastine, cytosine arabinoside, anthracyclines, alkylating
agents, platinum
compounds, antimetabolites, and nucleoside analogs, such as methotrexate and
purine and
pyrimidine analogs), anti-infective agents, local anesthetics (e.g., dibucaine
and chlorpromazine),
beta-adrenergic blockers (e.g., propranolol, timolol, and labetalol),
antihypertensive agents (e.g.,
clonidine and hydralazine), anti-depressants (e.g., imipramine, amitriptyline,
and doxepin), anti-
convulsants (e.g., phenytoin), antihistamines (e.g., diphenhydramine,
chlorpheniramine, and
promethazine), antibiotic/antibacterial agents (e.g., gentamycin,
ciprofloxacin, and cefoxitin),
antifungal agents (e.g., miconazole, terconazole, econazole, isoconazole,
butaconazole,
clotrimazole, itraconazole, nystatin, naftifine, and amphotericin B),
antiparasitic agents,
hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists,
antiglaucoma
agents, vitamins, narcotics, and imaging agents.
[002511 In some embodiments, the therapeutic payload comprises a cytotoxin, a
radioactive
ion, a chemotherapeutic, a vaccine, a compound that elicits an immune
response, and/or another
therapeutic and/or prophylactic agent. A cytotoxin or cytotoxic agent includes
any agent that
- 85 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
may be detrimental to cells. Examples include, but are not limited to, taxol,
cytochalasin B,
gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide,
vincristine,
vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracinedione,
mitoxantrone,
mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine,
tetracaine,
lidocaine, propranolol, puromycin, maytansinoids, e.g., maytansinol,
rachelmycin (CC-1065),
and analogs or homologs thereof. Radioactive ions include, but are not limited
to iodine (e.g.,
iodine 125 or iodine 131), strontium 89, phosphorous, palladium, cesium,
iridium, phosphate,
cobalt, yttrium 90, samarium 153, and praseodymium.
[00252] In other embodiments, the therapeutic payload of the present
nanoparticle
composition can include, but is not limited to, therapeutic and/or
prophylactic agents such as
antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine,
cytarabine, 5-fluorouracil,
dacarbazine), alkylating agents (e.g., mechlorethamine, thiotepa chlorambucil,
rachelmycin (CC-
1065), melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide,
busulfan,
dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum
(II) (DDP)
cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and
doxorubicin),
antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin,
mithramycin, and
anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine, vinblastine,
taxol and
maytansinoids).
[00253] In some embodiments, the nanoparticle composition comprises, as the
therapeutic
payload, a biological molecule such as peptides and polypeptides. The
biological molecules
forming part of the present nanoparticle composition can be either of a
natural source or
synthetic. For example, in some embodiments, the therapeutic payload of the
present
nanoparticle composition can include, but is not limited to gentamycin,
amikacin, insulin,
erythropoietin (EPO), granulocyte-colony stimulating factor (G-CSF),
granulocyte-macrophage
colony stimulating factor (GM-CSF), Factor VIR, luteinizing hormone-releasing
hormone
(LHRH) analogs, interferons, heparin, Hepatitis B surface antigen, typhoid
vaccine, cholera
vaccine, and peptides and polypeptides.
5.4.5.1 Nucleic Acids
[00254] In some embodiments, the present nanoparticle composition comprises
one or more
nucleic acid molecules (e.g., DNA or RNA molecules) as the therapeutic
payload. Exemplary
- 86-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1821 1 0784FF
forms of nucleic acid molecules that can be included in the present
nanoparticle composition as
therapeutic payload include, but are not limited to, one or more of
deoxyribonucleic acid (DNA),
ribonucleic acid (RNA) including messenger mRNA (mRNA), hybrids thereof, RNAi-
inducing
agents, RNAi agents, siRNAs, shRNAs, miRNAs, antisense RNAs, ribozymes,
catalytic DNA,
RNAs that induce triple helix formation, aptamers, vectors, etc. In certain
embodiments, the
therapeutic payload comprises an RNA. RNA molecules that can be included in
the present
nanoparticle composition as the therapeutic payload include, but are not
limited to, shortmers,
agomirs, antagomirs, antisense, ribozymes, small interfering RNA (siRNA),
asymmetrical
interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA (dsRNA), small
hairpin
RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), and other forms of RNA
molecules known in the art. In particular embodiments, the RNA is an mRNA.
1002551 In other embodiments, the nanoparticle composition comprises a siRNA
molecule as
the therapeutic payload. Particularly, in some embodiments, the siRNA molecule
is capable of
selectively interfering with and downregulate the expression of a gene of
interest. For example,
in some embodiments, the siRNA payload selectively silence a gene associated
with a particular
disease, disorder, or condition upon administration to a subject in need
thereof of a nanoparticle
composition including the siRNA. In some embodiments, the siRNA molecule
comprises a
sequence that is complementary to an mRNA sequence encoding a protein product
of interest. In
some embodiments, the siRNA molecule is an immunomodulatory siRNA.
[00256] In some embodiments, the nanoparticle composition comprises a shRNA
molecule or
a vector encoding the shRNA molecule as the therapeutic payload. Particularly,
in some
embodiments, the therapeutic payload, upon administering to a target cell,
produces shRNA
inside the target cell. Constructs and mechanisms relating to shRNA are well
known in the
relevant arts.
[00257] In some embodiments, the nanoparticle composition comprises an mRNA
molecule
as the therapeutic payload. Particularly, in some embodiments, the mRNA
molecule encodes a
polypeptide of interest, including any naturally or non-naturally occurring or
otherwise modified
polypeptide. A polypeptide encoded by an mRNA may be of any size and may have
any
secondary structure or activity. In some embodiments, the polypeptide encoded
by an mRNA
payload can have a therapeutic effect when expressed in a cell.
- 87 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00258] In some embodiment, a nucleic acid molecule of the present disclosure
comprises an
inRNA molecule. In specific embodiments, the nucleic acid molecule comprises
at least one
coding region encoding a peptide or polypeptide of interest (e.g., an open
reading frame (ORF)).
In some embodiments, the nucleic acid molecule further comprises at least one
untranslated
region (UTR). In particular embodiments, the untranslated region (UTR) is
located upstream (to
the 5'-end) of the coding region, and is referred to herein as the 5'-UTR. In
particular
embodiments, the untranslated region (UTR) is located downstream (to the 3'-
end) of the coding
region, and is referred to herein as the 3'-UTR. In particular embodiments,
the nucleic acid
molecule comprises both a 5'-UTR and a 3'-UTR. In some embodiments, the 5'-UTR
comprises
a 5'-Cap structure. In some embodiments, the nucleic acid molecule comprises a
Kozak
sequence (e.g., in the 5'-UTR). In some embodiments, the nucleic acid molecule
comprises a
poly-A region (e.g., in the 3'-UTR). In some embodiments, the nucleic acid
molecule comprises
a polyadenylation signal (e.g., in the 3'-UTR). In some embodiments, the
nucleic acid molecule
comprises stabilizing region (e.g., in the 3'-UTR). In some embodiments, the
nucleic acid
molecule comprises a secondary structure. In some embodiments, the secondary
structure is a
stem-loop. In some embodiments, the nucleic acid molecule comprises a stem-
loop sequence
(e.g., in the 5'-UTR and/or the 3'-UTR). In some embodiments, the nucleic acid
molecule
comprises one or more intronic regions capable of being excised during
splicing. In a specific
embodiment, the nucleic acid molecule comprises one or more region selected
from a 5'-UTR,
and a coding region. In a specific embodiment, the nucleic acid molecule
comprises one or more
region selected from a coding region and a 3'-UTR. In a specific embodiment,
the nucleic acid
molecule comprises one or more region selected from a 5'-UTR, a coding region,
and a 3'-UTR.
Coding Region
[00259] In some embodiments, the nucleic acid molecule of the present
disclosure comprises
at least one coding region. In some embodiments, the coding region is an open
reading frame
(ORE) that encodes for a single peptide or protein. In some embodiments, the
coding region
comprises at least two ORFs, each encoding a peptide or protein. In those
embodiments where
the coding region comprises more than one ORFs, the encoded peptides and/or
proteins can be
the same as or different from each other. In some embodiments, the multiple
ORFs in a coding
region are separated by non-coding sequences. In specific embodiments, a non-
coding sequence
separating two ORFs comprises an internal ribosome entry sites (IRES).
- 88 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
1002601 Without being bound by the theory, it is contemplated that an internal
ribosome entry
sites (1RES) can act as the sole ribosome binding site, or serve as one of
multiple ribosome
binding sites of an mRNA. An mRNA molecule containing more than one functional
ribosome
binding site can encode several peptides or polypeptides that are translated
independently by the
ribosomes (e.g., multicistronic mRNA). Accordingly, in some embodiments, the
nucleic acid
molecule of the present disclosure (e.g., mRNA) comprises one or more internal
ribosome entry
sites (IRES). Examples of IRES sequences that can be used in connection with
the present
disclosure include, without limitation, those from picomaviruses (e.g., FMDV),
pest viruses
(CFFV), polio viruses (PV), encephalomyocarditis viruses (ECMV), foot-and-
mouth disease
viruses (FMDV), hepatitis C viruses (HCV), classical swine fever viruses
(CSFV), murine
leukemia virus (MLV), simian immune deficiency viruses (SW) or cricket
paralysis viruses
(CrPV).
1002611 In various embodiments, the nucleic acid molecule of the present
disclose encodes for
at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 peptides or proteins.
Peptides and proteins
encoded by a nucleic acid molecule can be the same or different. In some
embodiments, the
nucleic acid molecule of the present disclosure encodes a dipeptide (e.g.,
camosine and
anserine). In some embodiments, the nucleic acid molecule encodes a
tripeptide. In some
embodiments, the nucleic acid molecule encodes a tetrapeptide. In some
embodiments, the
nucleic acid molecule encodes a pentapeptide. In some embodiments, the nucleic
acid molecule
encodes a hexapeptide. In some embodiments, the nucleic acid molecule encodes
a heptapeptide.
In some embodiments, the nucleic acid molecule encodes an octapeptide. In some
embodiments,
the nucleic acid molecule encodes a nonapeptide. In some embodiments, the
nucleic acid
molecule encodes a decapeptide. In some embodiments, the nucleic acid molecule
encodes a
peptide or polypeptide that has at least about 15 amino acids. In some
embodiments, the nucleic
acid molecule encodes a peptide or polypeptide that has at least about 50
amino acids. In some
embodiments, the nucleic acid molecule encodes a peptide or polypeptide that
has at least about
100 amino acids. In some embodiments, the nucleic acid molecule encodes a
peptide or
polypeptide that has at least about 150 amino acids. In some embodiments, the
nucleic acid
molecule encodes a peptide or polypeptide that has at least about 300 amino
acids. In some
embodiments, the nucleic acid molecule encodes a peptide or polypeptide that
has at least about
- 89-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
500 amino acids. In some embodiments, the nucleic acid molecule encodes a
peptide or
polypeptide that has at least about 1000 amino acids.
1.002621 In some embodiments, the nucleic acid molecule of the present
disclosure is at least
about 30 nucleotides (nt) in length. In some embodiments, the nucleic acid
molecule is at least
about 35 nt in length. In some embodiments, the nucleic acid molecule is at
least about 40 nt in
length. In some embodiments, the nucleic acid molecule is at least about 45 nt
in length. In some
embodiments the nucleic acid molecule is at least about 50 nt in length. In
some embodiments,
the nucleic acid molecule is at least about 55 nt in length. In some
embodiments, the nucleic acid
molecule is at least about 60 nt in length. In some embodiments, the nucleic
acid molecule is at
least about 65 nt in length. In some embodiments, the nucleic acid molecule is
at least about 70
nt in length. In some embodiments, the nucleic acid molecule is at least about
75 nt in length. In
some embodiments, the nucleic acid molecule is at least about 80 nt in length.
In some
embodiments the nucleic acid molecule is at least about 85 nt in length. In
some embodiments,
the nucleic acid molecule is at least about 90 nt in length. In some
embodiments, the nucleic acid
molecule is at least about 95 nt in length. In some embodiments, the nucleic
acid molecule is at
least about 100 nt in length. In some embodiments, the nucleic acid molecule
is at least about
120 nt in length. In some embodiments, the nucleic acid molecule is at least
about 140 nt in
length. In some embodiments, the nucleic acid molecule is at least about 160
nt in length. In
some embodiments, the nucleic acid molecule is at least about 180 nt in
length. In some
embodiments, the nucleic acid molecule is at least about 200 nt in length. In
some embodiments,
the nucleic acid molecule is at least about 250 nt in length. In some
embodiments, the nucleic
acid molecule is at least about 300 nt in length. In some embodiments, the
nucleic acid molecule
is at least about 400 nt in length. In some embodiments, the nucleic acid
molecule is at least
about 500 nt in length. In some embodiments, the nucleic acid molecule is at
least about 600 nt
in length. In some embodiments, the nucleic acid molecule is at least about
700 nt in length. In
some embodiments, the nucleic acid molecule is at least about 800 nt in
length. In some
embodiments, the nucleic acid molecule is at least about 900 nt in length. In
some embodiments,
the nucleic acid molecule is at least about 1000 nt in length. In some
embodiments, the nucleic
acid molecule is at least about 1100 nt in length. In some embodiments, the
nucleic acid
molecule is at least about 1200 nt in length. In some embodiments, the nucleic
acid molecule is
at least about 1300 nt in length. In some embodiments, the nucleic acid
molecule is at least about
-90-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
1400 nt in length. In some embodiments, the nucleic acid molecule is at least
about 1500 nt in
length. In some embodiments, the nucleic acid molecule is at least about 1600
nt in length. In
some embodiments, the nucleic acid molecule is at least about 1700 nt in
length. In some
embodiments, the nucleic acid molecule is at least about 1800 nt in length. In
some
embodiments, the nucleic acid molecule is at least about 1900 nt in length. In
some
embodiments, the nucleic acid molecule is at least about 2000 nt in length. In
some
embodiments, the nucleic acid molecule is at least about 2500 nt in length. In
some
embodiments, the nucleic acid molecule is at least about 3000 nt in length. In
some
embodiments, the nucleic acid molecule is at least about 3500 nt in length. In
some
embodiments, the nucleic acid molecule is at least about 4000 nt in length. In
some
embodiments, the nucleic acid molecule is at least about 4500 nt in length. In
some
embodiments, the nucleic acid molecule is at least about 5000 nt in length.
[00263] In specific embodiments, the therapeutic payload comprises a vaccine
composition
(e.g., a genetic vaccine) as described herein. In some embodiments, the
therapeutic payload
comprises a compound capable of eliciting immunity against one or more target
conditions or
disease. In some embodiments, the target condition is related to or caused by
infection by a
pathogen, such as a coronavirus (e.g. 2019-nCoV), influenza, measles, human
papillomavirus
(HPV), rabies, meningitis, whooping cough, tetanus, plague, hepatitis, and
tuberculosis. In some
embodiments, the therapeutic payload comprises a nucleic acid sequence (e.g.,
mRNA) encoding
a pathogenic protein characteristic for the pathogen, or an antigenic fragment
or epitope thereof.
The vaccine, upon administration to a vaccinated subject, allows for
expression of the encoded
pathogenic protein (or the antigenic fragment or epitope thereof), thereby
eliciting immunity in
the subject against the pathogen.
[00264] In some embodiments, the target condition is related to or caused by
neoplastic
growth of cells, such as a cancer. In some embodiments, the therapeutic
payload comprises a
nucleic acid sequence (e.g., mRNA) encoding a tumor associated antigen (TAA)
characteristic
for the cancer, or an antigenic fragment or epitope thereof. The vaccine, upon
administration to a
vaccinated subject, allows for expression of the encoded TAA (or the antigenic
fragment or
epitope thereof), thereby eliciting immunity in the subject against the
neoplastic cells expressing
the TAA.
- 91 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
5'-Cap Structure
[00265] Without being bound by the theory, it is contemplated that, a 5'-cap
structure of a
polynucleotide is involved in nuclear export and increasing polynucleotide
stability and binds the
mRNA Cap Binding Protein (CBP), which is responsible for polynucleotide
stability in the cell
and translation competency through the association of CBP with poly-A binding
protein to form
the mature cyclic mRNA species. The 5'-cap structure further assists the
removal of 5'-proximal
introns removal during mRNA splicing. Accordingly, in some embodiments, the
nucleic acid
molecules of the present disclosure comprise a 5'-cap structure.
[00266] Nucleic acid molecules may be 5'-end capped by the endogenous
transcription
machinery of a cell to generate a 5'-ppp-5'-triphosphate linkage between a
terminal guanosine
cap residue and the 5'-terminal transcribed sense nucleotide of the
polynucleotide. This 5'-
guanylate cap may then be methylated to generate an N7-methyl-guanylate
residue. The ribose
sugars of the terminal and/or anteterminal transcribed nucleotides of the 5'
end of the
polynucleotide may optionally also be 2%0-methylated. 5'-decapping through
hydrolysis and
cleavage of the guanylate cap structure may target a nucleic acid molecule,
such as an mRNA
molecule, for degradation.
[00267] In some embodiments, the nucleic acid molecules of the present
disclosure comprise
one or more alterations to the natural 5'-cap structure generated by the
endogenous process.
Without being bound by the theory, a modification on the 5'-cap may increase
the stability of
polynucleotide, increase the half-life of the polynucleotide, and could
increase the
polynucleotide translational efficiency.
[00268] Exemplary alterations to the natural 5'-Cap structure include
generation of a non-
hydrolyzable cap structure preventing decapping and thus increasing
polynucleotide half-life. In
some embodiments, because cap structure hydrolysis requires cleavage of 5'-ppp-
5'
phosphorodiester linkages, in some embodiments, modified nucleotides may be
used during the
capping reaction. For example, in some embodiments, a Vaccinia Capping Enzyme
from New
England Biolabs (Ipswich, Mass.) may be used with a-thio-guanosine nucleotides
according to
the manufacturer's instructions to create a phosphorothioate linkage in the 5'-
ppp-5' cap.
Additional modified guanosine nucleotides may be used, such as a-methyl-
phosphonate and
seleno-phosphate nucleotides.
-92-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00269] Additional exemplary alterations to the natural 5'-Cap structure also
include
modification at the 2'- and/or 3'-position of a capped guanosine triphosphate
(GTP), a
replacement of the sugar ring oxygen (that produced the carbocyclic ring) with
a methylene
moiety (CI-12), a modification at the triphosphate bridge moiety of the cap
structure, or a
modification at the nucleobase (G) moiety.
[00270] Additional exemplary alterations to the natural 5'-cap structure
include, but are not
limited to, 2'-0-methylation of the ribose sugars of 5'-terminal and/or 5'-
anteterminal
nucleotides of the polynucleotide (as mentioned above) on the 2'-hydroxy group
of the sugar.
Multiple distinct 5'-cap structures can be used to generate the 5'-cap of a
polynucleotide, such as
an mRNA molecule. Additional exemplary 5'-Cap structures that can be used in
connection with
the present disclosure further include those described in International Patent
Publication Nos.
W02008127688, WO 2008016473, and WO 2011015347, the entire contents of each of
which
are incorporated herein by reference.
[00271] In various embodiments, 5'-terminal caps can include cap analogs. Cap
analogs,
which herein are also referred to as synthetic cap analogs, chemical caps,
chemical cap analogs,
or structural or functional cap analogs, differ from natural (i.e.,
endogenous, wild-type, or
physiological) 5'-caps in their chemical structure, while retaining cap
function. Cap analogs may
be chemically (i.e., non-enzymatically) or enzymatically synthesized
and/linked to a
polynucleotide.
[00272] For example, the Anti-Reverse Cap Analog (ARCA) cap contains two
guanosines
linked by a 5'-5'-triphosphate group, wherein one guanosine contains an N7-
methyl group as
well as a 3'-0-methyl group (i.e., N7,3'-0-dimethyl-guanosine-5'-triphosphate-
5'-guanosine,
m7G-3'mppp-G, which may equivalently be designated 3' 0-Me-m7G(5')ppp(5')G).
The 3'-0
atom of the other, unaltered, guanosine becomes linked to the 5'-terminal
nucleotide of the
capped polynucleotide (e.g., an mRNA). The N7- and 3'-0-methlyated guanosine
provides the
terminal moiety of the capped polynucleotide (e.g., mRNA). Another exemplary
cap structure is
mCAP, which is similar to ARCA but has a 2'-0-methyl group on guanosine (i.e.,
N7,2'-0-
dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7Gm-ppp-G).
[00273] In some embodiments, a cap analog can be a dinucleotide cap analog. As
a non-
limiting example, the dinucleotide cap analog may be modified at different
phosphate positions
-93 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
with a boranophosphate group or a phophoroselenoate group such as the
dinucleotide cap
analogs described in U.S. Patent No.: 8,519,110, the entire content of which
is herein
incorporated by reference in its entirety.
[00274] In some embodiments, a cap analog can be a N7-(4-chlorophenoxyethyl)
substituted
dinucleotide cap analog known in the art and/or described herein. Non-limiting
examples of N7-
(4-chlorophenoxyethyl) substituted dinucleotide cap analogs include a N7-(4-
chlorophenoxyethyl)-G(5')ppp(5')G and a N7-(4-chlorophenoxyethyp-m3'-
0G(5)ppp(5')G cap
analog (see, e.g., the various cap analogs and the methods of synthesizing cap
analogs described
in Kore etal. Bioorganic & Medicinal Chemistry 2013 21:4570-4574; the entire
content of
which is herein incorporated by reference). In other embodiments, a cap analog
useful in
connection with the nucleic acid molecules of the present disclosure is a 4-
chloro/bromophenoxyethyl analog.
[00275] In various embodiments, a cap analog can include a guanosine analog.
Useful
guanosine analogs include but are not limited to inosine, Ni-methyl-guanosine,
2'-fluoro-
guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-
guanosine, and 2-
azido-guanosine.
1002761 Without being bound by the theory, it is contemplated that while cap
analogs allow
for the concomitant capping of a polynucleotide in an in vitro transcription
reaction, up to 20%
of transcripts remain uncapped. This, as well as the structural differences of
a cap analog from
the natural 5'-cap structures of polynucleotides produced by the endogenous
transcription
machinery of a cell, may lead to reduced translational competency and reduced
cellular stability.
[00277] Accordingly, in some embodiments, a nucleic acid molecule of the
present disclosure
can also be capped post-transcriptionally, using enzymes, in order to generate
more authentic 5'-
cap structures. As used herein, the phrase "more authentic" refers to a
feature that closely mirrors
or mimics, either structurally or functionally, an endogenous or wild type
feature. That is, a
"more authentic" feature is better representative of an endogenous, wild-type,
natural or
physiological cellular function, and/or structure as compared to synthetic
features or analogs of
the prior art, or which outperforms the corresponding endogenous, wild-type,
natural, or
physiological feature in one or more respects. Non-limiting examples of more
authentic 5'-cap
structures useful in connection with the nucleic acid molecules of the present
disclosure are those
-94-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
which, among other things, have enhanced binding of cap binding proteins,
increased half-life,
reduced susceptibility to 5'-endonucleases, and/or reduced 5'-decapping, as
compared to
synthetic 5'-cap structures known in the art (or to a wild-type, natural or
physiological 5'-cap
structure). For example, in some embodiments, recombinant Vaccinia Virus
Capping Enzyme
and recombinant 2'-0-methyltransferase enzyme can create a canonical 5'-5'-
triphosphate
linkage between the 5'-terminal nucleotide of a polynucleotide and a guanosine
cap nucleotide
wherein the cap guanosine contains an N7-methylation and the 5'-terminal
nucleotide of the
polynucleotide contains a 2'-0-methyl. Such a structure is termed the Capl
structure. This cap
results in a higher translational-competency, cellular stability, and a
reduced activation of
cellular pro-inflammatory cytokines, as compared, e.g., to other 5'cap analog
structures known
in the art. Other exemplary cap structures include 7mG(5')ppp(5')N,pN2p (Cap
0),
7mG(5')ppp(5')NlmpNp (Cap 1), 7mG(5)-ppp(5')NImpN2mp (Cap 2), and
m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (Cap 4).
[00278] Without being bound by the theory, it is contemplated that the nucleic
acid molecules
of the present disclosure can be capped post-transcriptionally, and because
this process is more
efficient, nearly 100% of the nucleic acid molecules may be capped.
Untranslated Regions (UTRs)
[00279] In some embodiments, the nucleic acid molecules of the present
disclosure comprise
one or more untranslated regions (UTRs). In some embodiments, an UTR is
positioned upstream
to a coding region in the nucleic acid molecule, and is termed 5'-UTR. In some
embodiments, an
UTR is positioned downstream to a coding region in the nucleic acid molecule,
and is termed 3'-
UTR. The sequence of an UTR can be homologous or heterologous to the sequence
of the
coding region found in a nucleic acid molecule. Multiple UTRs can be included
in a nucleic acid
molecule and can be of the same or different sequences, and/or genetic origin.
According to the
present disclosure, any portion of UTRs in a nucleic acid molecule (including
none) can be
codon optimized and any may independently contain one or more different
structural or chemical
modification, before and/or after codon optimization.
[00280] In some embodiments, a nucleic acid molecule of the present disclosure
(e.g., mRNA)
comprises UTRs and coding regions that are homologous with respect to each
other. In other
embodiments, a nucleic acid molecule of the present disclosure (e.g., mRNA)
comprises UTRs
-95 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
and coding regions that are heterogeneous with respect to each other. In some
embodiments, to
monitor the activity of a UTR sequence, a nucleic acid molecule comprising the
UTR and a
coding sequence of a detectable probe can be administered in vitro (e.g., cell
or tissue culture) or
in vivo (e.g., to a subject), and an effect of the UTR sequence (e.g.,
modulation on the expression
level, cellular localization of the encoded product, or half-life of the
encoded product) can be
measured using methods known in the art.
[00281] In some embodiments, the UTR of a nucleic acid molecule of the present
disclosure
(e.g., mRNA) comprises at least one translation enhancer element (TEE) that
functions to
increase the amount of polypeptide or protein produced from the nucleic acid
molecule. In some
embodiments, the TEE is located in the 5'-UTR of the nucleic acid molecule. In
other
embodiments, the TEE is located at the 3'-UTR of the nucleic acid molecule. In
yet other
embodiments, at least two TEE are located at the 5'-UTR and 3'-UTR of the
nucleic acid
molecule respectively. In some embodiments, a nucleic acid molecule of the
present disclosure
(e.g., mRNA) can comprise one or more copies of a TEE sequence or comprise
more than one
different TEE sequences. In some embodiments, different TEE sequences that are
present in a
nucleic acid molecule of the present disclosure can be homologues or
heterologous with respect
to one another.
[00282] Various TEE sequences that are known in the art and can be used in
connection with
the present disclosure. For example, in some embodiments, the TEE can be an
internal ribosome
entry site (IRES), HCV-IRES or an IRES element. Chappell et al. Proc. Natl.
Acad. Sci. USA
101:9590-9594, 2004; Zhou et al. Proc. Natl. Acad. ScL 102:6273-6278, 2005.
Additional
internal ribosome entry site (IRES) that can be used in connection with the
present disclosure
include but are not limited to those described in U.S. Patent No. 7,468,275,
U.S. Patent
Publication No. 2007/0048776 and U.S. Patent Publication No. 2011/0124100 and
International
Patent Publication No. W02007/025008 and International Patent Publication No.
W02001/055369, the content of each of which is enclosed herein by reference in
its entirety. In
some embodiments, the TEE can be those described in Supplemental Table 1 and
in
Supplemental Table 2 of Wellensiek et al Genome-wide profiling of human cap-
independent
translation-enhancing elements, Nature Methods, 2013 Aug; 10(8): 747-750; the
content of
which is incorporated by reference in its entirety.
-96-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
1002831 Additional exemplary 'TEEs that can be used in connection with the
present disclosure
include but are not limited to the TEE sequences disclosed in U.S. Patent No.
6,310,197, U.S.
Patent No. 6,849,405, U.S. Patent No. 7,456,273, U.S. Patent No. 7,183,395,
U.S. Patent
Publication No. 2009/0226470, U.S. Patent Publication No. 2013/0177581, U.S.
Patent
Publication No. 2007/0048776, U.S. Patent Publication No. 2011/0124100, U.S.
Patent
Publication No. 2009/0093049, International Patent Publication No.
W02009/075886,
International Patent Publication No. W02012/009644, and International Patent
Publication No.
W01999/024595, International Patent Publication No. W02007/025008,
International Patent
Publication No.W02001/055371, European Patent No. 2610341, European Patent No.
2610340,
the content of each of which is enclosed herein by reference in its entirety.
1002841 In various embodiments, a nucleic acid molecule of the present
disclosure (e.g.,
mRNA) comprises at least one UTR that comprises at least 1, at least 2, at
least 3, at least 4, at
least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least
11, at least 12, at least 13, at
least 14, at least 15, at least 16, at least 17, at least 18 at least 19, at
least 20, at least 21, at least
22, at least 23, at least 24, at least 25, at least 30, at least 35, at least
40, at least 45, at least 50, at
least 55 or more than 60 TEE sequences. In some embodiments, the TEE sequences
in the UTR
of a nucleic acid molecule are copies of the same TEE sequence. In other
embodiments, at least
two TEE sequences in the UTR of a nucleic acid molecule are of different TEE
sequences. In
some embodiments, multiple different TEE sequences are arranged in one or more
repeating
patterns in the UTR region of a nucleic acid molecule. For illustrating
purpose only, a repeating
pattern can be, for example, ABABAB, AABBAABBAABB, ABCABCABC, or the like,
where
in these exemplary patterns, each capitalized letter (A, B, or C) represents a
different TEE
sequence. In some embodiments, at least two TEE sequences are consecutive with
one another
(i.e., no spacer sequence in between) in a UTR of a nucleic acid molecule. In
other
embodiments, at least two TEE sequences are separated by a spacer sequence. In
some
embodiments, a UTR can comprise a TEE sequence-spacer sequence module that is
repeated at
least once, at least twice, at least 3 times, at least 4 times, at least 5
times, at least 6 times, at least
7 times, at least 8 times, at least 9 times, or more than 9 times in the UTR.
In any of the
embodiments described in this paragraph, the UTR can be a 5'-UTR, a 3'-UTR or
both 5'-UTR
and 3'-UTR of a nucleic acid molecule.
-97-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
18211 0784FF
[00285] In some embodiments, the UTR of a nucleic acid molecule of the present
disclosure
(e.g., mRNA) comprises at least one translation suppressing element that
functions to decrease
the amount of polypeptide or protein produced from the nucleic acid molecule.
In some
embodiments, the UTR of the nucleic acid molecule comprises one or more miR
sequences or
fragment thereof (e.g., miR seed sequences) that are recognized by one or more
microRNA. In
some embodiments, the UTR of the nucleic acid molecule comprises one or more
stem-loop
structure that downregulates translational activity of the nucleic acid
molecule. Other
mechanisms for suppressing translational activities associated with a nucleic
acid molecules are
known in the art. In any of the embodiments described in this paragraph, the
UTR can be a 5'-
UTR, a 3'-UTR or both 5'-UTR and 3'-UTR of a nucleic acid molecule.
The Poly ad enylation (Poly-A) Regions
1002861 During natural RNA processing, a long chain of adenosine nucleotides
(poly-A
region) is normally added to messenger RNA (mRNA) molecules to increase the
stability of the
molecule. Immediately after transcription, the 3'-end of the transcript is
cleaved to free a 3%
hydroxy. Then poly-A polymerase adds a chain of adenosine nucleotides to the
RNA. The
process, called polyadenylation, adds a poly-A region that is between 100 and
250 residues long.
Without being bound by the theory, it is contemplated that a poly-A region can
confer various
advantages to the nucleic acid molecule of the present disclosure.
[00287] Accordingly, in some embodiments, a nucleic acid molecule of the
present disclosure
(e.g., an mRNA) comprises a polyadenylation signal. In some embodiments, a
nucleic acid
molecule of the present disclosure (e.g., an mRNA) comprises one or more
polyadenylation
(poly-A) regions. In some embodiments, a poly-A region is composed entirely of
adenine
nucleotides or functional analogs thereof. In some embodiments, the nucleic
acid molecule
comprises at least one poly-A region at its 3'-end. In some embodiments, the
nucleic acid
molecule comprises at least one poly-A region at its 5'-end. In some
embodiments, the nucleic
acid molecule comprises at least one poly-A region at its 5'-end and at least
one poly-A region at
its 3'-end.
[00288] According to the present disclosure, the poly-A region can have varied
lengths in
different embodiments. Particularly, in some embodiments, the poly-A region of
a nucleic acid
molecule of the present disclosure is at least 30 nucleotides in length. In
some embodiments, the
-98-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
poly-A region of a nucleic acid molecule of the present disclosure is at least
35 nucleotides in
length. In some embodiments, the poly-A region of a nucleic acid molecule of
the present
disclosure is at least 40 nucleotides in length. In some embodiments, the poly-
A region of a
nucleic acid molecule of the present disclosure is at least 45 nucleotides in
length. In some
embodiments, the poly-A region of a nucleic acid molecule of the present
disclosure is at least 50
nucleotides in length. In some embodiments, the poly-A region of a nucleic
acid molecule of the
present disclosure is at least 55 nucleotides in length. In some embodiments,
the poly-A region
of a nucleic acid molecule of the present disclosure is at least 60
nucleotides in length. In some
embodiments, the poly-A region of a nucleic acid molecule of the present
disclosure is at least 65
nucleotides in length. In some embodiments, the poly-A region of a nucleic
acid molecule of the
present disclosure is at least 70 nucleotides in length. In some embodiments,
the poly-A region
of a nucleic acid molecule of the present disclosure is at least 75
nucleotides in length. In some
embodiments, the poly-A region of a nucleic acid molecule of the present
disclosure is at least 80
nucleotides in length. In some embodiments, the poly-A region of a nucleic
acid molecule of the
present disclosure is at least 85 nucleotides in length. In some embodiments,
the poly-A region
of a nucleic acid molecule of the present disclosure is at least 90
nucleotides in length. In some
embodiments, the poly-A region of a nucleic acid molecule of the present
disclosure is at least 95
nucleotides in length. In some embodiments, the poly-A region of a nucleic
acid molecule of the
present disclosure is at least 100 nucleotides in length. In some embodiments,
the poly-A region
of a nucleic acid molecule of the present disclosure is at least 110
nucleotides in length. In some
embodiments, the poly-A region of a nucleic acid molecule of the present
disclosure is at least
120 nucleotides in length. In some embodiments, the poly-A region of a nucleic
acid molecule of
the present disclosure is at least 130 nucleotides in length. In some
embodiments, the poly-A
region of a nucleic acid molecule of the present disclosure is at least 140
nucleotides in length. In
some embodiments, the poly-A region of a nucleic acid molecule of the present
disclosure is at
least 150 nucleotides in length. In some embodiments, the poly-A region of a
nucleic acid
molecule of the present disclosure is at least 160 nucleotides in length. In
some embodiments,
the poly-A region of a nucleic acid molecule of the present disclosure is at
least 170 nucleotides
in length. In some embodiments, the poly-A region of a nucleic acid molecule
of the present
disclosure is at least 180 nucleotides in length. In some embodiments, the
poly-A region of a
nucleic acid molecule of the present disclosure is at least 190 nucleotides in
length. In some
-99-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
embodiments, the poly-A region of a nucleic acid molecule of the present
disclosure is at least
200 nucleotides in length. In some embodiments, the poly-A region of a nucleic
acid molecule of
the present disclosure is at least 225 nucleotides in length. In some
embodiments, the poly-A
region of a nucleic acid molecule of the present disclosure is at least 250
nucleotides in length. In
some embodiments, the poly-A region of a nucleic acid molecule of the present
disclosure is at
least 275 nucleotides in length. In some embodiments, the poly-A region of a
nucleic acid
molecule of the present disclosure is at least 300 nucleotides in length. In
some embodiments,
the poly-A region of a nucleic acid molecule of the present disclosure is at
least 350 nucleotides
in length. In some embodiments, the poly-A region of a nucleic acid molecule
of the present
disclosure is at least 400 nucleotides in length. In some embodiments, the
poly-A region of a
nucleic acid molecule of the present disclosure is at least 450 nucleotides in
length. In some
embodiments, the poly-A region of a nucleic acid molecule of the present
disclosure is at least
500 nucleotides in length. In some embodiments, the poly-A region of a nucleic
acid molecule of
the present disclosure is at least 600 nucleotides in length. In some
embodiments, the poly-A
region of a nucleic acid molecule of the present disclosure is at least 700
nucleotides in length. In
some embodiments, the poly-A region of a nucleic acid molecule of the present
disclosure is at
least 800 nucleotides in length. In some embodiments, the poly-A region of a
nucleic acid
molecule of the present disclosure is at least 900 nucleotides in length. In
some embodiments,
the poly-A region of a nucleic acid molecule of the present disclosure is at
least 1000 nucleotides
in length. In some embodiments, the poly-A region of a nucleic acid molecule
of the present
disclosure is at least 1100 nucleotides in length. In some embodiments, the
poly-A region of a
nucleic acid molecule of the present disclosure is at least 1200 nucleotides
in length. In some
embodiments, the poly-A region of a nucleic acid molecule of the present
disclosure is at least
1300 nucleotides in length. In some embodiments, the poly-A region of a
nucleic acid molecule
of the present disclosure is at least 1400 nucleotides in length. In some
embodiments, the poly-A
region of a nucleic acid molecule of the present disclosure is at least 1500
nucleotides in length.
In some embodiments, the poly-A region of a nucleic acid molecule of the
present disclosure is
at least 1600 nucleotides in length. In some embodiments, the poly-A region of
a nucleic acid
molecule of the present disclosure is at least 1700 nucleotides in length. In
some embodiments,
the poly-A region of a nucleic acid molecule of the present disclosure is at
least 1800 nucleotides
in length. In some embodiments, the poly-A region of a nucleic acid molecule
of the present
- 100 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
disclosure is at least 1900 nucleotides in length. In some embodiments, the
poly-A region of a
nucleic acid molecule of the present disclosure is at least 2000 nucleotides
in length. In some
embodiments, the poly-A region of a nucleic acid molecule of the present
disclosure is at least
2250 nucleotides in length. In some embodiments, the poly-A region of a
nucleic acid molecule
of the present disclosure is at least 2500 nucleotides in length. In some
embodiments, the poly-A
region of a nucleic acid molecule of the present disclosure is at least 2750
nucleotides in length.
In some embodiments, the poly-A region of a nucleic acid molecule of the
present disclosure is
at least 3000 nucleotides in length.
[00289] In some embodiments, length of a poly-A region in a nucleic acid
molecule can be
selected based on the overall length of the nucleic acid molecule, or a
portion thereof (such as the
length of the coding region or the length of an open reading frame of the
nucleic acid molecule,
etc.). For example, in some embodiments, the poly-A region accounts for about
5%, 10%, 15%,
20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%
or
more of the total length of nucleic acid molecule containing the poly-A
region.
[00290] Without being bound by the theory, it is contemplated that certain RNA-
binding
proteins can bind to the poly-A region located at the 3'-end of an mRNA
molecule. These poly-
A binding proteins (PABP) can modulate mRNA expression, such as interacting
with translation
initiation machinery in a cell and/or protecting the 3'-poly-A tails from
degradation.
Accordingly, in some embodiments, in some embodiments, the nucleic acid
molecule of the
present disclosure (e.g., mRNA) comprises at least one binding site for poly-A
binding protein
(PABP). In other embodiments, the nucleic acid molecule is conjugated or
complex with a
PABP before loaded into a delivery vehicle (e.g., lipid nanoparticles).
[00291] In some embodiments, the nucleic acid molecule of the present
disclosure (e.g.,
mRNA) comprises a poly-A-G Quartet. The G-quartet is a cyclic hydrogen bonded
array of four
guanosine nucleotides that can be formed by G-rich sequences in both DNA and
RNA. In this
embodiment, the G-quartet is incorporated at the end of the poly-A. region.
The resultant
polynucleotides (e.g., mRNA) may be assayed for stability, protein production
and other
parameters including half-life at various time points. It has been discovered
that the polyA-G
quartet structure results in protein production equivalent to at least 75% of
that seen using a poly-
A region of 120 nucleotides alone.
- 101 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00292] In some embodiments, the nucleic acid molecule of the present
disclosure (e.g.,
mRNA) may include a poly-A region and may be stabilized by the addition of a
3'-stabilizing
region. In some embodiments, the 3'-stabilizing region which may be used to
stabilize a nucleic
acid molecule (e.g., mRNA) including the poly-A or poly-A-G Quartet structures
as described in
International Patent Publication No. W02013/103659, the content of which is
incorporated
herein by reference in its entirety.
[00293] In other embodiments, the 3'-stabilizing region which may be used in
connection
with the nucleic acid molecules of the present disclosure include a chain
termination nucleoside
such as but is not limited to 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine,
3'-deoxycytosine,
3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides, such as 2',3'-
dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-
dideoxyguanosine, 2',3'-
dideoxythymine, a 2'-deoxynucleoside, or an 0-methylnucleoside, 3'-
deoxynucleoside, 2',3'-
dideoxynucleoside 3'-0-methylnucleosides, 3'-0-ethylnucleosides, 3'-
arabinosides, and other
alternative nucleosides known in the art and/or described herein.
Secondary Structure
1002941 Without being bound by the theory, it is contemplated that a stem-loop
structure can
direct RNA folding, protect structural stability of a nucleic acid molecule
(e.g., mRNA), provide
recognition sites for RNA binding proteins, and serve as a substrate for
enzymatic reactions. For
example, the incorporation of a miR sequence and/or a TEE sequence changes the
shape of the
stem loop region which may increase and/or decrease translation (Kedde et al.
A Pumilio-
induced RNA structure switch in p27-3'UTR controls miR-221 and miR-222
accessibility. Nat
Cell Biol., 2010 Oct; 12(10):1014-20, the content of which is herein
incorporated by reference in
its entirety).
[00295] Accordingly, in some embodiments, the nucleic acid molecules as
described herein
(e.g., mRNA) or a portion thereof may assume a stem-loop structure, such as
but is not limited to
a histone stem loop. In some embodiments, the stem-loop structure is formed
from a stem-loop
sequence that is about 25 or about 26 nucleotides in length such as, but not
limited to, those as
described in International Patent Publication No. W02013/103659, the content
of which is
incorporated herein by reference in its entirety. Additional examples of stem-
loop sequences
include those described in International Patent Publication No. W02012/019780
and
- 102 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
International Patent Publication No. W0201502667, the contents of which are
incorporated
herein by reference. In some embodiments, the step-loop sequence comprises a
TEE as described
herein. In some embodiments, the step-loop sequence comprises a miR sequence
as described
herein. In specific embodiments, the stem loop sequence may include a miR-122
seed sequence.
In specific embodiments, the nucleic acid molecule comprises the stem-loop
sequence
CAAAGGCTCTITTCAGAGCCACCA (SEQ ID NO:1). In other embodiments, the nucleic
acid molecule comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA
(SEQ ID NO:2).
[00296] In some embodiments, the nucleic acid molecule of the present
disclosure (e.g.,
mRNA) comprises a stem-loop sequence located upstream (to the 5'-end) of the
coding region in
a nucleic acid molecule. In some embodiments, the stem-loop sequence is
located within the 5'-
UTR of the nucleic acid molecule. In some embodiments, the nucleic acid
molecule of the
present disclosure (e.g., mRNA) comprises a stem-loop sequence located
downstream (to the 3'-
end) of the coding region in a nucleic acid molecule. In some embodiments, the
stem-loop
sequence is located within the 3'-UTR of the nucleic acid molecule. In some
cases, a nucleic acid
molecule can contain more than one stem-loop sequences. In some embodiment,
the nucleic acid
molecule comprises at least one stem-loop sequence in the 5'-UTR, and at least
one stem-loop
sequence in the 3'-UTR.
[00297] In some embodiments, a nucleic acid molecule comprising a stem-loop
structure
further comprises a stabilization region. In some embodiment, the
stabilization region comprises
at least one chain terminating nucleoside that functions to slow down
degradation and thus
increases the half-life of the nucleic acid molecule. Exemplary chain
terminating nucleoside that
can be used in connection with the present disclosure include but are not
limited to 3'-
deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-
deoxyguanosine, 3'-
deoxythym ine, 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-
dideoxyuridine,
2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, a 2'-
deoxynucleoside, or
an 0-methylnucleoside, 3'-deoxynucleoside, 2',3'-dideoxynucleoside 3'-0-
methylnucleosides,
3'-0-ethylnucleosides, 3'-arabinosides, and other alternative nucleosides
known in the art and/or
described herein. In other embodiments, a stem-loop structure may be
stabilized by an alteration
to the 3'-region of the polynucleotide that can prevent and/or inhibit the
addition of oligio(U)
- 103 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
(International Patent Publication No. W02013/103659, incorporated herein by
reference in its
entirety).
[00298] In some embodiments, a nucleic acid molecule of the present disclosure
comprises at
least one stem-loop sequence and a poly-A region or polyadenylation signal.
Non-limiting
examples of polynucleotide sequences comprising at least one stem-loop
sequence and a poly-A
region or a polyadenylation signal include those described in International
Patent Publication No.
W02013/120497, International Patent Publication No. W02013/120629,
International Patent
Publication No. W02013/120500, International Patent Publication No.
W02013/120627,
International Patent Publication No. W02013/120498, International Patent
Publication No.
W02013/120626, International Patent Publication No. W02013/120499 and
International Patent
Publication No. W02013/120628, the content of each of which is incorporated
herein by
reference in its entirety.
[00299] In some embodiments, the nucleic acid molecule comprising a stem-loop
sequence
and a poly-A region or a polyadenylation signal can encode for a pathogen
antigen or fragment
thereof such as the polynucleotide sequences described in International Patent
Publication No.
W02013/120499 and International Patent Publication No. W02013/120628, the
content of each
of which is incorporated herein by reference in its entirety.
[00300] In some embodiments, the nucleic acid molecule comprising a stem-loop
sequence
and a poly-A region or a polyadenylation signal can encode for a therapeutic
protein such as the
polynucleotide sequences described in International Patent Publication No.
W02013/120497 and
International Patent Publication No. W02013/120629, the content of each of
which is
incorporated herein by reference in its entirety.
[00301] In some embodiments, the nucleic acid molecule comprising a stem-loop
sequence
and a poly-A region or a polyadenylation signal can encode for a tumor antigen
or fragment
thereof such as the polynucleotide sequences described in International Patent
Publication No.
W02013/120500 and International Patent Publication No.W02013/120627, the
content of each
of which is incorporated herein by reference in its entirety.
[00302] In some embodiments, the nucleic acid molecule comprising a stem-loop
sequence
and a poly-A region or a polyadenylation signal can code for an allergenic
antigen or an
autoimmune self-antigen such as the polynucleotide sequences described in
International Patent
- 104 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
Publication No. W02013/120498 and International Patent Publication No.
W02013/120626, the
content of each of which is incorporated herein by reference in its entirety.
Functional nucleotide analogs
[00303] In some embodiments, a payload nucleic acid molecule described herein
contains
only canonical nucleotides selected from A (adenosine), G (guanosine), C
(cytosine), U
(uridine), and T (thymidine). Without being bound by the theory, it is
contemplated that certain
functional nucleotide analogs can confer useful properties to a nucleic acid
molecule. Examples
of such as useful properties in the context of the present disclosure include
but are not limited to
increased stability of the nucleic acid molecule, reduced immunogenicity of
the nucleic acid
molecule in inducing innate immune responses, enhanced production of protein
encoded by the
nucleic acid molecule, increased intracellular delivery and/or retention of
the nucleic acid
molecule, and/or reduced cellular toxicity of the nucleic acid molecule, etc.
[00304] Accordingly, in some embodiments, a payload nucleic acid molecule
comprises at
least one functional nucleotide analog as described herein. In some
embodiments, the functional
nucleotide analog contains at least one chemical modification to the
nucleobase, the sugar group
and/or the phosphate group. Accordingly, a payload nucleic acid molecule
comprising at least
one functional nucleotide analog contains at least one chemical modification
to the nucleobases,
the sugar groups, and/or the internucleoside linkage. Exemplary chemical
modifications to the
nucleobases, sugar groups, or internucleoside linkages of a nucleic acid
molecule are provided
herein.
[00305] As described herein, ranging from 0% to 100% of all nucleotides in a
payload nucleic
acid molecule can be functional nucleotide analogs as described herein. For
example, in various
embodiments, from about 1% to about 20%, from about 1% to about 25%, from
about 1% to
about 50%, from about 1% to about 60%, from about 1% to about 70%, from about
1% to about
80%, from about 1% to about 90%, from about 1% to about 95%, from about 10% to
about 20%,
from about 10% to about 25%, from about 10% to about 50%, from about 10% to
about 60%,
from about 10% to about 70%, from about 10% to about 80%, from about 10% to
about 90%,
from about 10% to about 95%, from about 10% to about 100%, from about 20% to
about 25%,
from about 20% to about 50%, from about 20% to about 60%, from about 20% to
about 70%,
from about 20% to about 80%, from about 20% to about 90%, from about 20% to
about 95%,
- 105 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
from about 20% to about 100%, from about 50% to about 60%, from about 50% to
about 70%,
from about 50% to about 80%, from about 50% to about 90%, from about 50% to
about 95%,
from about 50% to about 100%, from about 70% to about 80%, from about 70% to
about 90%,
from about 70% to about 95%, from about 70% to about 100%, from about 80% to
about 90%,
from about 80% to about 95%, from about 80% to about 100%, from about 90% to
about 95%,
from about 90% to about 100%, or from about 95% to about 100% of all
nucleotides in a nucleic
acid molecule are functional nucleotide analogs described herein. In any of
these embodiments, a
functional nucleotide analog can be present at any position(s) of a nucleic
acid molecule,
including the 5'- terminus, 3'- terminus, and/or one or more internal
positions. In some
embodiments, a single nucleic acid molecule can contain different sugar
modifications, different
nucleobase modifications, and/or different types internucleoside linkages
(e.g., backbone
structures).
1003061 As described herein, ranging from 0% to 100% of all nucleotides of a
kind (e.g., all
purine-containing nucleotides as a kind, or all pyrimidine-containing
nucleotides as a kind, or all
A, G, C, T or U as a kind) in a payload nucleic acid molecule can be
functional nucleotide
analogs as described herein. For example, in various embodiments, from about
1% to about
20%, from about 1% to about 25%, from about 1% to about 50%, from about 1% to
about 60%,
from about 1% to about 70%, from about 1% to about 80%, from about 1% to about
90%, from
about 1% to about 95%, from about 10% to about 20%, from about 10% to about
25%, from
about 10% to about 50%, from about 10% to about 60%, from about 10% to about
70%, from
about 10% to about 80%, from about 10% to about 90%, from about 10% to about
95%, from
about 10% to about 100%, from about 20% to about 25%, from about 20% to about
50%, from
about 20% to about 60%, from about 20% to about 70%, from about 20% to about
80%, from
about 20% to about 90%, from about 20% to about 95%, from about 20% to about
100%, from
about 50% to about 60%, from about 50% to about 70%, from about 50% to about
80%, from
about 50% to about 90%, from about 50% to about 95%, from about 50% to about
100%, from
about 70% to about 80%, from about 70% to about 90%, from about 70% to about
95%, from
about 70% to about 100%, from about 80% to about 90%, from about 80% to about
95%, from
about 80% to about 100%, from about 90% to about 95%, from about 90% to about
100%, or
from about 95% to about 100% of a kind of nucleotides in a nucleic acid
molecule are functional
nucleotide analogs described herein. In any of these embodiments, a functional
nucleotide analog
- 106 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1821 1 0784FF
can be present at any position(s) of a nucleic acid molecule, including the 5'-
terminus, 3'-
terminus, and/or one or more internal positions. In some embodiments, a single
nucleic acid
molecule can contain different sugar modifications, different nucleobase
modifications, and/or
different types internucleoside linkages (e.g., backbone structures).
Modification to Nucleobases
100307.1 In some embodiments, a functional nucleotide analog contains a non-
canonical
nucleobase. In some embodiments, canonical nucleobases (e.g., adenine,
guanine, uracil,
thymine, and cytosine) in a nucleotide can be modified or replaced to provide
one or more
functional analogs of the nucleotide. Exemplary modification to nucleobases
include but are not
limited to one or more substitutions or modifications including but not
limited to alkyl, aryl,
halo, oxo, hydroxyl, alkyloxy, and/or thio substitutions; one or more fused or
open rings,
oxidation, and/or reduction.
1003081 In some embodiments, the non-canonical nucleobase is a modified
uracil. Exemplary
nucleobases and nucleosides having an modified uracil include pseudouridine
(w), pyridin-4-one
ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil
(s2U), 4-thio-uracil
(s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho5U), 5-
aminoallyl-uracil,
5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil), 3-methyl-uracil (m3U),
5-methoxy-uracil
(mo5U), uracil 5-oxyacetic acid (cmo5U), uracil 5-oxyacetic acid methyl ester
(mcmo5U), 5-
carboxymethyl-uracil (cm5U), 1-carboxymethyl-pseudouridine, 5-
carboxyhydroxymethyl-uracil
(chm5U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm5U), 5-
methoxycarbonylmethyl-
uracil (mcm5U), 5-methoxycarbonylmethy1-2-thio-uracil (mcm5s2U), 5-aminomethy1-
2-thio-
uracil (nm5s2U), 5-methylaminomethyl-uracil (mnm5U), 5-methylaminomethy1-2-
thio-uracil
(mnm5s2U), 5-methylaminomethy1-2-seleno-uracil (mnm5se2U), 5-carbamoylmethyl-
uracil
(ncm5U), 5-carboxymethylaminomethyl-uracil (cmnm5U), 5-
carboxymethylaminomethy1-2-thio-
uracil (cmnm5s2U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurinomethyl-
uracil (Tin 5U),
1-taurinomethyl-pseudouridine, 5-taurinomethy1-2-thio-uracil(rm55s2U), 1-
taurinomethy1-4-thio-
pseudouridine, 5-methyl-uracil (m5U, i.e., having the nucleobase
deoxythymine), 1-methyl-
pseudouridine (m' y), 1-ethyl-pseudouridine (Et' w). 5-methyl-2-thio-uracil
(m5s2U), 1-methy1-4-
thio-pseudouridine (m1s4w), 4-thio-1-methyl-pseudouridine, 3-methyl-
pseudouridine (m3w), 2-
thio-1 -methyl-pseudouridine, 1-methy1-1-deaza-pseudouridine, 2-thio-1-methy1-
1-deaza-
- 107 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-
methyl-
dihydrouracil (m5D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-
methoxy-uracil, 2-
methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-
pseudouridine, N1-methyl-
pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp3U), 1-methy1-3-(3-amino-
3-
carboxypropyl)pseudouridine (acp3w), 5-(isopentenylaminomethypuracil (m5U), 5-
(isopentenylaminomethyl)-2-thio-uraci1 (m5s2U), 5,2'-0-dimethyl-uridine
(m5Um), 2-thio-2'-0-
methyl-uridine (s2Um), 5-methoxycarbonylmethy1-2'-0-methyl-uridine (mcm5Um), 5-
carbamoylmethy1-2'-0-methyl-uridine (ncm5Um), 5-carboxymethylaminomethy1-2'-0-
methyl-
uridine (cmnm5Um), 3,2'-0-dimethyl-uridine (m3Um), and 5-
(isopentenylaminomethyl)-2'-0-
methyl-uridine (inm5Um), 1-thio-uracil, deoxythymidine, 5-(2-
carbomethoxyviny1)-uracil, 5-
(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethy1-2-thio-uracil, 5-
carboxymethy1-2-thio-
uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil, and 5- [3-(
[00309] In some embodiments, the non-canonical nucleobase is a modified
cytosine.
Exemplary nucleobases and nucleosides having a modified cytosine include 5-aza-
cytosine, 6-
aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C), N4-acetyl-cytosine
(ac4C), 5-formyl-
cytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-
cytosine (e.g., 5-
iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine,
pyrrolo-
cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5-methyl-
cytosine, 4-thio-
pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methy1-1-deaza-
pseudoisocytidine, 1-methyl-l-deaza-pseudoisocytidine, zebularine, 5-aza-
zebularine, 5-methyl-
zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-
methoxy-5-
methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-l-methyl-
pseudoisocytidine, lysidine
(k2C), 5,2'-0-dimethyl-cytidine (m5Cm), N4-acetyl-2'-0-methyl-cytidine
(ac4Cm), N4,2'-0-
dimethyl-cytidine (m4Cm), 5-formy1-2'-0-methyl-cytidine (fSCm), N4,N4,2'-0-
trimethyl-
cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropy1)-
cytosine, and 5-(2-
azidoethyl)-cytosine.
[00310] In some embodiments, the non-canonical nucleobase is a modified
adenine.
Exemplary nucleobases and nucleosides having an alternative adenine include 2-
amino-purine,
2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-
halo-purine (e.g.,
6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-
deaza-8-aza-
- 108 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-
diaminopurine, 7-
deaza-8-aza-2,6-diaminopurine, 1-methyl-adenine (ml A), 2-methyl-adenine
(m2A), N6-methyl-
adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine
(i6A), 2-
methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine
(io6A), 2-
methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyl-
adenine
(g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-
adenine
(m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-
adenine
(m62A), N6-hydroxynorvalylcarbamoyl-adenine (fm6A), 2-methylthio-N6-
hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl-
adenine, 2-
methylthio-adenine, 2-methoxy-adenine, N6,2'-0-dimethyl-adenosine (m6Am),
N6,N6,2'-0-
trimethyl-adenosine (m62Am), 1,2'-0-dimethyl-adenosine (ml Am), 2-amino-N6-
methyl-purine,
1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecy1)-adenine, 2,8-
dimethyl-
adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine.
[00311] In some embodiments, the non-canonical nucleobase is a modified
guanine.
Exemplary nucleobases and nucleosides having a modified guanine include
inosine (I), 1-
methyl-inosine (mil), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine
(imG-14),
isowyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine
(OHyW),
undermodified hydroxywybutosine (OHyW*), 7-deaza-guanine, queuosine (Q),
epoxyqueuosine
(oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-
guanine
(preQ0), 7-aminomethy1-7-deaza-guanine (preQ1), archaeosine (G+), 7-deaza-8-
aza-guanine, 6-
thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-
guanine (m7G),
6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine
(ml G), N2-
methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-dimethyl-guanine
(m2,7G), N2,
N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-
methy1-6-thio-
guanine, N2-methyl-6-thio-guanine, N2,N2-dimethy1-6-thio-guanine, N2-methy1-2'-
0-methyl-
guanosine (m2Gm), N2,N2-dimethy1-2'-0-methyl-guanosine (m22Gm), 1-methy1-2'-0-
methyl-
guanosine (ml Gm), N2,7-dimethy1-2'-0-methyl-guanosine (m2,7Gm), 2'-0-methyl-
inosine
(Im), 1,2'-0-dimethyl-inosine (mum), 1-thio-guanine, and 0-6-methyl-guanine.
[00312] In some embodiments, the non-canonical nucleobase of a functional
nucleotide
analog can be independently a purine, a pyrimidine, a purine or pyrimidine
analog. For example,
in some embodiments, the non-canonical nucleobase can be modified adenine,
cytosine, guanine,
- 109 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
uracil, or hypoxanthine. In other embodiments, the non-canonical nucleobase
can also include,
for example, naturally-occurring and synthetic derivatives of a base,
including pyrazolo[3,4-
d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine,
hypoxanthine,
2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-
propyl and other
alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-
thiocytosine, 5-
propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil
(pseudouracil), 4-
thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy
and other 8-
substituted adenines and guanines, 5-halo particularly 5-bromo, 5-
trifluoromethyl and other 5-
substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-
azaguanine and 8-
a7.nadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-
deazaadenine, 3-
deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5 triazinones, 9-
deazapurines,
imidazo[4,5-d]pyrazines, thiazolo[4,5-d]pyrimidines, pyrazin-2-ones, 1,2,4-
triazine, pyridazine;
or 1,3,5 triazine.
Modification to the Sugar
[00313] In some embodiments, a functional nucleotide analog contains a non-
canonical sugar
group. In various embodiments, the non-canonical sugar group can be a 5-carbon
or 6-carbon
sugar (such as pentose, ribose, arabinose, xylose, glucose, galactose, or a
deoxy derivative
thereof) with one or more substitutions, such as a halo group, a hydroxy
group, a thiol group, an
alkyl group, an alkoxy group, an alkenyloxy group, an alkynyloxy group, an
cycloalkyl group, an
aminoalkoxy group, an alkoxyalkoxy group, an hydroxyalkoxy group, an amino
group, an azido
group, an aryl group, an aminoalkyl group, an aminoalkenyl group, an
aminoalkynyl group, etc.
[00314] Generally, RNA molecules contains the ribose sugar group, which is a 5-
membered
ring having an oxygen. Exemplary, non-limiting alternative nucleotides include
replacement of
the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or
ethylene); addition of a
double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring
contraction of
ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring
expansion of ribose
(e.g., to form a 6- or 7-membered ring having an additional carbon or
heteroatom, such as for
anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino
(that also has a
phosphoramidate backbone)); multicyclic forms (e.g., tricyclo and "unlocked"
forms, such as
glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by
glycol units
- 110 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1821 1 0784FF
attached to phosphodiester bonds), threose nucleic acid (TNA, where ribose is
replace with a-L-
threofuranosyl-(3'42')), and peptide nucleic acid (PNA, where 2-amino-ethyl-
glycine linkages
replace the ribose and phosphodiester backbone).
[00315] In some embodiments, the sugar group contains one or more carbons that
possess the
opposite stereochemical configuration of the corresponding carbon in ribose.
Thus, a nucleic acid
molecule can include nucleotides containing, e.g., arabinose or L-ribose, as
the sugar. In some
embodiments, the nucleic acid molecule includes at least one nucleoside
wherein the sugar is L-
ribose, 2'-0-methyl-ribose, 2'-fluoro-ribose, arabinose, hexitol, an LNA, or a
PNA.
Modifications to the lnternucleoside Linkage
[00316] In some embodiments, the payload nucleic acid molecule of the present
disclosure
can contain one or more modified internucleoside linkage (e.g., phosphate
backbone). Backbone
phosphate groups can be altered by replacing one or more of the oxygen atoms
with a different
substituent.
1003171 In some embodiments, the functional nucleotide analogs can include the
replacement
of an unaltered phosphate moiety with another intemucleoside linkage as
described herein.
Examples of alternative phosphate groups include, but are not limited to,
phosphorothioate,
phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen
phosphonates,
phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and
phosphotriesters.
Phosphorodithioates have both non-linking oxygens replaced by sulfur. The
phosphate linker can
also be altered by the replacement of a linking oxygen with nitrogen (bridged
phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged
methylene-
phosphonates).
[00318] The alternative nucleosides and nucleotides can include the
replacement of one or
more of the non-bridging oxygens with a borane moiety (BH3), sulfur (thio),
methyl, ethyl,
and/or methoxy. As a non-limiting example, two non-bridging oxygens at the
same position
(e.g., the alpha (a), beta (0) or gamma (y) position) can be replaced with a
sulfur (thio) and a
methoxy. The replacement of one or more of the oxygen atoms at the position of
the phosphate
moiety (e.g., a-thio phosphate) is provided to confer stability (such as
against exonuclaases and
endonucleases) to RNA and DNA through the unnatural phosphorothioate backbone
linkages.
- 111 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
Phosphorothioate DNA and RNA have increased nuclease resistance and
subsequently a longer
half-life in a cellular environment.
[00319] Other internucleoside linkages that may be employed according to the
present
disclosure, including internucleoside linkages which do not contain a
phosphorous atom, are
described herein.
1003201 Additional examples of nucleic acid molecules (e.g., mRNA),
compositions,
formulations and/or methods associated therewith that can be used in
connection with the present
disclosure further include those described in W02002/098443, W02003/051401,
W02008/052770, W02009127230, W02006122828, W02008/083949, W02010088927,
W02010/037539, W02004/004743, W02005/016376, W02006/024518, W02007/095976,
W02008/014979, W02008/077592, W02009/030481, W02009/095226, W02011069586,
W02011026641, W02011/144358, W02012019780, W02012013326, W02012089338,
W02012113513, W02012116811, W02012116810, W02013113502, W02013113501,
W02013113736, W02013143698, W02013143699, W02013143700, W02013/120626,
W02013120627, W02013120628, W02013120629, W02013174409, W02014127917,
W02015/024669, W02015/024668, W02015/024667, W02015/024665, W02015/024666,
W02015/024664, W02015101415, W02015101414, W02015024667, W02015062738,
W02015101416, the content of each of which is incorporated herein in its
entirety.
5.5 Formulation
[00321] According to the present disclosure, nanoparticle compositions
described herein can
include at least one lipid component and one or more additional components,
such as a
therapeutic and/or prophylactic agent. A nanoparticle composition may be
designed for one or
more specific applications or targets. The elements of a nanoparticle
composition may be
selected based on a particular application or target, and/or based on the
efficacy, toxicity,
expense, ease of use, availability, or other feature of one or more elements.
Similarly, the
particular formulation of a nanoparticle composition may be selected for a
particular application
or target according to, for example, the efficacy and toxicity of particular
combinations of
elements.
[00322] The lipid component of a nanoparticle composition may include, for
example, a lipid
according to one of formulae (I) to (TV) (and sub-formulas thereof) described
herein, a
- 112 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
phospholipid (such as an unsaturated lipid, e.g., DOPE or DSPC), a PEG lipid,
and a structural
lipid. The elements of the lipid component may be provided in specific
fractions.
[00323] In one embodiment, provided herein is a nanoparticle compositions
comprising a
cationic or ionizable lipid compound provided herein, a therapeutic agent, and
one or more
excipients. In one embodiment, cationic or ionizable lipid compound comprises
a compound
according to one of Formulae (1) to (IV) (and sub-formulas thereof) as
described herein, and
optionally one or more additional ionizable lipid compounds. In one
embodiment, the one or
more excipients are selected from neutral lipids, steroids, and polymer
conjugated lipids. In one
embodiment, the therapeutic agent is encapsulated within or associated with
the lipid
nanoparticle.
[00324] In one embodiment, provided herein is a nanoparticle composition
(lipid
nanoparticle) comprising:
i) between 40 and 50 mol percent of a cationic lipid;
ii) a neutral lipid;
iii) a steroid;
iv) a polymer conjugated lipid; and
v) a therapeutic agent.
[00325] As used herein, "mol percent" refers to a component's molar percentage
relative to
total mols of all lipid components in the LNP (i.e., total mols of cationic
lipid(s), the neutral
lipid, the steroid and the polymer conjugated lipid).
[00326] In one embodiment, the lipid nanoparticle comprises from 41 to 49 mol
percent, from
41 to 48 mol percent, from 42 to 48 mol percent, from 43 to 48 mol percent,
from 44 to 48 mol
percent, from 45 to 48 mol percent, from 46 to 48 mol percent, or from 47.2 to
47.8 mol percent
of the cationic lipid. In one embodiment, the lipid nanoparticle comprises
about 47.0, 47.1, 47.2,
47.3, 47.4,47.5, 47.6, 47.7,47.8, 47.9 or 48.0 mol percent of the cationic
lipid.
[00327] In one embodiment, the neutral lipid is present in a concentration
ranging from 5 to
15 mol percent, 7 to 13 mol percent, or 9 to 11 mol percent. In one
embodiment, the neutral lipid
is present in a concentration of about 9.5, 10 or 10.5 mol percent. In one
embodiment, the molar
ratio of the cationic lipid to the neutral lipid ranges from about 4.1:1.0 to
about 4.9:1.0, from
about 4.5:1.0 to about 4.8:1.0, or from about 4.7:1.0 to 4.8:1Ø
- 113 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00328] In one embodiment, the steroid is present in a concentration ranging
from 39 to 49
molar percent, 40 to 46 molar percent, from 40 to 44 molar percent, from 40 to
42 molar percent,
from 42 to 44 molar percent, or from 44 to 46 molar percent. In one
embodiment, the steroid is
present in a concentration of 40, 41, 42, 43, 44, 45, or 46 molar percent In
one embodiment, the
molar ratio of cationic lipid to the steroid ranges from 1.0:0.9 to 1.0:1.2,
or from 1.0:1.0 to
1.0:1.2. In one embodiment, the steroid is cholesterol.
[00329] In one embodiment, the therapeutic agent to lipid ratio in the LNP
(i.e., NIP, were N
represents the moles of cationic lipid and P represents the moles of phosphate
present as part of
the nucleic acid backbone) range from 2:1 to 30:1, for example 3:1 to 22:1. In
one embodiment,
NA' ranges from 6:1 to 20:1 or 2:1 to 12:1. Exemplary NIP ranges include about
3:1. About 6:1,
about 12:1 and about 22:1.
1003301 In one embodiment, provided herein is a lipid nanoparticle comprising:
i) a cationic lipid having an effective pKa greater than 6.0; ii) from 5 to 15
mol percent of
a neutral lipid;
iii) from 1 to 15 mol percent of an anionic lipid;
iv) from 30 to 45 mol percent of a steroid;
v) a polymer conjugated lipid; and
vi) a therapeutic agent, or a pharmaceutically acceptable salt or prodnig
thereof,
wherein the mol percent is determined based on total mol of lipid present in
the lipid
nanoparticle.
[00331] In one embodiment, the cationic lipid can be any of a number of lipid
species which
carry a net positive charge at a selected pH, such as physiological pH.
Exemplary cationic lipids
are described herein below. In one embodiment, the cationic lipid has a pKa
greater than 6.25.
In one embodiment, the cationic lipid has a pKa greater than 6.5. In one
embodiment, the
cationic lipid has a pKa greater than 6.1, greater than 6.2, greater than 6.3,
greater than 6.35,
greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6,
greater than 6.65, or
greater than 6.7.
[00332] In one embodiment, the lipid nanoparticle comprises from 40 to 45 mol
percent of the
cationic lipid. In one embodiment, the lipid nanoparticle comprises from 45 to
50 mole percent
of the cationic lipid.
- 114 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00333] In one embodiment, the molar ratio of the cationic lipid to the
neutral lipid ranges
from about 2:1 to about 8:1. In one embodiment, the lipid nanoparticle
comprises from 5 to 10
mol percent of the neutral lipid.
100334] Exemplary anionic lipids include, but are not limited to,
phosphatidylglycerol,
dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG) or
1,2-
distearoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DSPG).
[00335] In one embodiment, the lipid nanoparticle comprises from 1 to 10 mole
percent of the
anionic lipid. In one embodiment, the lipid nanoparticle comprises from 1 to 5
mole percent of
the anionic lipid. In one embodiment, the lipid nanoparticle comprises from 1
to 9 mole percent,
from 1 to 8 mole percent, from 1 to 7 mole percent, or from 1 to 6 mole
percent of the anionic
lipid. In one embodiment, the mol ratio of anionic lipid to neutral lipid
ranges from 1:1 to 1:10.
100336] In one embodiment, the steroid cholesterol. In one embodiment, the
molar ratio of
the cationic lipid to cholesterol ranges from about 5:1 to 1:1. In one
embodiment, the lipid
nanoparticle comprises from 32 to 40 mol percent of the steroid.
[00337] In one embodiment, the sum of the mol percent of neutral lipid and mol
percent of
anionic lipid ranges from 5 to 15 mol percent. In one embodiment, wherein the
sum of the mol
percent of neutral lipid and mol percent of anionic lipid ranges from 7 to 12
mol percent.
1003381 In one embodiment, the mol ratio of anionic lipid to neutral lipid
ranges from 1:1 to
1:10. In one embodiment, the sum of the mol percent of neutral lipid and mol
percent steroid
ranges from 35 to 45 mol percent.
[00339] In one embodiment, the lipid nanoparticle comprises:
i) from 45 to 55 mol percent of the cationic lipid;
ii) from 5 to 10 mol percent of the neutral lipid;
iii) from 1 to 5 mol percent of the anionic lipid; and
iv) from 32 to 40 mol percent of the steroid.
[00340] In one embodiment, the lipid nanoparticle comprises from 1.0 to 2.5
mol percent of
the conjugated lipid. In one embodiment, the polymer conjugated lipid is
present in a
concentration of about 1.5 mol percent.
- 115 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00341] In one embodiment, the neutral lipid is present in a concentration
ranging from 5 to
15 mol percent, 7 to 13 mol percent, or 9 to 11 mol percent In one embodiment,
the neutral lipid
is present in a concentration of about 9.5, 10 or 10.5 mol percent. In one
embodiment, the molar
ratio of the cationic lipid to the neutral lipid ranges from about 4.1:1.0 to
about 4.9:1.0, from
about 4.5:1.0 to about 4.8:1.0, or from about 4.7:1.0 to 4.8:1Ø
[00342] In one embodiment, the steroid is cholesterol. In some embodiments,
the steroid is
present in a concentration ranging from 39 to 49 molar percent, 40 to 46 molar
percent, from 40
to 44 molar percent, from 40 to 42 molar percent, from 42 to 44 molar percent,
or from 44 to 46
molar percent In one embodiment, the steroid is present in a concentration of
40, 41, 42, 43, 44,
45, or 46 molar percent. In certain embodiments, the molar ratio of cationic
lipid to the steroid
ranges from 1.0:0.9 to 1.0:1.2, or from 1.0:1.0 to 1.0:1.2.
1003431 In one embodiment, the molar ratio of cationic lipid to steroid ranges
from 5:1 to 1:1.
[00344] In one embodiment, the lipid nanoparticle comprises from 1.0 to 2.5
mol percent of
the conjugated lipid. In one embodiment, the polymer conjugated lipid is
present in a
concentration of about 1.5 mol percent.
1003451 In one embodiment, the molar ratio of cationic lipid to polymer
conjugated lipid
ranges from about 100:1 to about 20:1. In one embodiment, the molar ratio of
cationic lipid to
the polymer conjugated lipid ranges from about 35:1 to about 25:1.
1003461 In one embodiment, the lipid nanoparticle has a mean diameter ranging
from 50 nm
to 100 nm, or from 60 nm to 85 nm.
[003471 In one embodiment, the composition comprises a cationic lipid provided
herein,
DSPC, cholesterol, and PEG-lipid, and mRNA. In one embodiment, the a cationic
lipid provided
herein, DSPC, cholesterol, and PEG-lipid are at a molar ratio of about
50:10:38.5:1.5.
[00348] Nanoparticle compositions can be designed for one or more specific
applications or
targets. For example, a nanoparticle composition can be designed to deliver a
therapeutic and/or
prophylactic agent such as an RNA to a particular cell, tissue, organ, or
system or group thereof
in a mammal's body. Physiochemical properties of nanoparticle compositions can
be altered in
order to increase selectivity for particular bodily targets. For instance,
particle sizes can be
adjusted based on the fenestration sizes of different organs. The therapeutic
and/or prophylactic
- 116 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
agent included in a nanoparticle composition can also be selected based on the
desired delivery
target or targets. For example, a therapeutic and/or prophylactic agent can be
selected for a
particular indication, condition, disease, or disorder and/or for delivery to
a particular cell, tissue,
organ, or system or group thereof (e.g., localized or specific delivery). In
certain embodiments, a
nanoparticle composition can include an inRNA encoding a polypeptide of
interest capable of
being translated within a cell to produce the polypeptide of interest. Such a
composition can be
designed to be specifically delivered to a particular organ. In certain
embodiments, a
composition can be designed to be specifically delivered to a mammalian liver.
1003491 The amount of a therapeutic and/or prophylactic agent in a
nanoparticle composition
can depend on the size, composition, desired target and/or application, or
other properties of the
nanoparticle composition as well as on the properties of the therapeutic
and/or prophylactic
agent. For example, the amount of an RNA useful in a nanoparticle composition
can depend on
the size, sequence, and other characteristics of the RNA. The relative amounts
of a therapeutic
and/or prophylactic agent and other elements (e.g., lipids) in a nanoparticle
composition can also
vary. In some embodiments, the wt/wt ratio of the lipid component to a
therapeutic and/or
prophylactic agent in a nanoparticle composition can be from about 5:1 to
about 60:1, such as
5:1, 6:1, 7:1, 8:1, 9:1, 10:1,11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1,
19:1, 20:1, 25:1, 30:1,
35:1, 40:1, 45:1, 50:1, and 60:1. For example, the wt/wt ratio of the lipid
component to a
therapeutic and/or prophylactic agent can be from about 10:1 to about 40:1. In
certain
embodiments, the wt/wt ratio is about 20:1. The amount of a therapeutic and/or
prophylactic
agent in a nanoparticle composition can, for example, be measured using
absorption
spectroscopy (e.g., ultraviolet-visible spectroscopy).
[00350] In some embodiments, a nanoparticle composition includes one or more
RNAs, and
the one or more RNAs, lipids, and amounts thereof can be selected to provide a
specific NT
ratio. The N:P ratio of the composition refers to the molar ratio of nitrogen
atoms in one or more
lipids to the number of phosphate groups in an RNA. In some embodiments, a
lower N:P ratio is
selected. The one or more RNA, lipids, and amounts thereof can be selected to
provide an N:P
ratio from about 2:1 to about 30:1, such as 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1,
9:1, 10:1, 12:1, 14:1,
16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. ln certain embodiments, the
N:P ratio can be
from about 2:1 to about 8:1. In other embodiments, the N:P ratio is from about
5:1 to about 8:1.
- 117 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
For example, the N:P ratio may be about 5.0:1, about 5.5:1, about 5.67:1,
about 6.0:1, about
6.5:1, or about 7.0:1. For example, the N:P ratio may be about 5.67:1.
[00351] The physical properties of a nanoparticle composition can depend on
the components
thereof. For example, a nanoparticle composition including cholesterol as a
structural lipid can
have different characteristics compared to a nanoparticle composition that
includes a different
structural lipid. Similarly, the characteristics of a nanoparticle composition
can depend on the
absolute or relative amounts of its components. For instance, a nanoparticle
composition
including a higher molar fraction of a phospholipid may have different
characteristics than a
nanoparticle composition including a lower molar fraction of a phospholipid.
Characteristics may
also vary depending on the method and conditions of preparation of the
nanoparticle
composition.
1003521 Nanoparticle compositions may be characterized by a variety of
methods. For
example, microscopy (e.g., transmission electron microscopy or scanning
electron microscopy)
may be used to examine the morphology and size distribution of a nanoparticle
composition.
Dynamic light scattering or potentiometry (e.g., potentiometric titrations)
may be used to
measure zeta potentials. Dynamic light scattering may also be utilized to
determine particle sizes.
Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvem,
Worcestershire,
UK) may also be used to measure multiple characteristics of a nanoparticle
composition, such as
particle size, polydispersity index, and zeta potential.
[00353] In various embodiments, the mean size of a nanoparticle composition
can be between
lOs of nm and 100s of nm. For example, the mean size can be from about 40 nm
to about 150
nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80
nm, 85 nm, 90
nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140
nm, 145
nm, or 150 nm. In some embodiments, the mean size of a nanoparticle
composition can be from
about 50 nm to about 100 nm, from about 50 nm to about 90 nm, from about 50 nm
to about 80
nm, from about 50 nm to about 70 nm, from about 50 nm to about 60 nm, from
about 60 nm to
about 100 nm, from about 60 nm to about 90 nm, from about 60 nm to about 80
nm, from about
60 nm to about 70 nm, from about 70 nm to about 100 nm, from about 70 nm to
about 90 nm,
from about 70 nm to about 80 nm, from about 80 nm to about 100 nm, from about
80 nm to
about 90 nm, or from about 90 nm to about 100 nm. In certain embodiments, the
mean size of a
- 118 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
nanoparticle composition can be from about 70 nm to about 100 nm. In some
embodiments, the
mean size can be about 80 nm. In other embodiments, the mean size can be about
100 nm.
[00354] A nanoparticle composition can be relatively homogenous. A
polydispersity index
can be used to indicate the homogeneity of a nanoparticle composition, e.g.,
the particle size
distribution of the nanoparticle compositions. A small (e.g., less than 0.3)
polydispersity index
generally indicates a narrow particle size distribution. A nanoparticle
composition can have a
polydispersity index from about 0 to about 0.25, such as 0.01, 0.02, 0.03,
0.04, 0.05, 0.06, 0.07,
0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20,
0.21, 0.22, 0.23, 0.24,
or 0.25. In some embodiments, the polydispersity index of a nanoparticle
composition can be
from about 0.10 to about 0.20.
[00355] The zeta potential of a nanoparticle composition can be used to
indicate the
electrokinetic potential of the composition. For example, the zeta potential
can describe the
surface charge of a nanoparticle composition. Nanoparticle compositions with
relatively low
charges, positive or negative, are generally desirable, as more highly charged
species can interact
undesirably with cells, tissues, and other elements in the body. In some
embodiments, the zeta
potential of a nanoparticle composition can be from about -10 mV to about +20
mV, from about
-10 mV to about +15 mV, from about -10 mV to about +10 mV, from about -10 mV
to about +5
mV, from about -10 mV to about 0 mV, from about -10 mV to about -5 mV, from
about -5 mV
to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about
+10 mV, from
about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to
about +20
mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from
about 0 mV to
about +5 mV, from about +5 mV to about +20 mV, from about +5 mV to about +15
mV, or from
about +5 mV to about +10 mV.
[00356] The efficiency of encapsulation of a therapeutic and/or prophylactic
agent describes
the amount of therapeutic and/or prophylactic agent that is encapsulated or
otherwise associated
with a nanoparticle composition after preparation, relative to the initial
amount provided. The
encapsulation efficiency is desirably high (e.g., close to 100%). The
encapsulation efficiency can
be measured, for example, by comparing the amount of therapeutic and/or
prophylactic agent in
a solution containing the nanoparticle composition before and after breaking
up the nanoparticle
composition with one or more organic solvents or detergents. Fluorescence can
be used to
- 119 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
measure the amount of free therapeutic and/or prophylactic agent (e.g., RNA)
in a solution. For
the nanoparticle compositions described herein, the encapsulation efficiency
of a therapeutic
and/or prophylactic agent can be at least 50%, for example 50%, 55%, 60%, 65%,
70%, 75%,
80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some
embodiments, the encapsulation efficiency can be at least 80%. In certain
embodiments, the
encapsulation efficiency can be at least 90%.
[00357] A nanoparticle composition can optionally comprise one or more
coatings. For
example, a nanoparticle composition can be formulated in a capsule, film, or
tablet having a
coating. A capsule, film, or tablet including a composition described herein
can have any useful
size, tensile strength, hardness, or density.
5.6 Pharmaceutical Compositions
1003581 According to the present disclosure, nanoparticle compositions can be
formulated in
whole or in part as pharmaceutical compositions. Pharmaceutical compositions
can include one
or more nanoparticle compositions. For example, a pharmaceutical composition
can include one
or more nanoparticle compositions including one or more different therapeutic
and/or
prophylactic agents. Pharmaceutical compositions can further include one or
more
pharmaceutically acceptable excipients or accessory ingredients such as those
described herein.
General guidelines for the formulation and manufacture of pharmaceutical
compositions and
agents are available, for example, in Remington's The Science and Practice of
Pharmacy, 21st
Edition, A. R Gennaro; Lippincott, Williams & Wilkins, Baltimore, Md., 2006.
Conventional
excipients and accessory ingredients can be used in any pharmaceutical
composition, except
insofar as any conventional excipient or accessory ingredient can be
incompatible with one or
more components of a nanoparticle composition. An excipient or accessory
ingredient can be
incompatible with a component of a nanoparticle composition if its combination
with the
component can result in any undesirable biological effect or otherwise
deleterious effect.
[00359] In some embodiments, one or more excipients or accessory ingredients
can make up
greater than 50% of the total mass or volume of a pharmaceutical composition
including a
nanoparticle composition. For example, the one or more excipients or accessory
ingredients can
make up 50%, 60%, 70%, 80%, 90%, or more of a pharmaceutical convention. In
some
embodiments, a pharmaceutically acceptable excipient is at least 95%, at least
96%, at least 97%,
- 120 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
at least 98%, at least 99%, or 100% pure. In some embodiments, an excipient is
approved for use
in humans and for veterinary use. In some embodiments, an excipient is
approved by United
States Food and Drug Administration. In some embodiments, an excipient is
pharmaceutical
grade. In some embodiments, an excipient meets the standards of the United
States
Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British
Pharmacopoeia, and/or the
International Pharmacopoeia.
1003601 Relative amounts of the one or more nanoparticle compositions, the one
or more
pharmaceutically acceptable excipients, and/or any additional ingredients in a
pharmaceutical
composition in accordance with the present disclosure will vary, depending
upon the identity,
size, and/or condition of the subject treated and further depending upon the
route by which the
composition is to be administered. By way of example, a pharmaceutical
composition can
comprise between 0.1% and 100% (wt/wt) of one or more nanoparticle
compositions.
1003611 In certain embodiments, the nanoparticle compositions and/or
pharmaceutical
compositions of the disclosure are refrigerated or frozen for storage and/or
shipment (e.g., being
stored at a temperature of 4 C or lower, such as a temperature between about -
150 C and about
0 C or between about -80 C and about -20 C (e.g., about -5 C, -10 C, -15 C,
-20 C, -25 C, -
30 C, -40 C, -50 C, -60 C, -70 C, -80 C, -90 C, -130 C or -150 C). For
example, the
pharmaceutical composition comprising a compound of any of Formulae (I) to
(IV) (and sub-
formulas thereof) is a solution that is refrigerated for storage and/or
shipment at, for example,
about -20 C, -30 C, -40 C, -50 C, -60 C, -70 C, or -80 C In certain
embodiments, the
disclosure also relates to a method of increasing stability of the
nanoparticle compositions and/or
pharmaceutical compositions comprising a compound of any of Formulae (I) to
(IV) (and sub-
formulas thereof) by storing the nanoparticle compositions and/or
pharmaceutical compositions
at a temperature of 4 C or lower, such as a temperature between about -150 C
and about 0 C or
between about -80 C and about -20 C, e.g., about -5 C, -10 C, -15 C, -20 C,
-25 C, -30 C, -
40 C, -50 C, -60 C, -70 C, -80 "C, -90 C, -130 C or -150 "C). For example,
the nanoparticle
compositions and/or pharmaceutical compositions disclosed herein are stable
for about at least 1
week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks,
at least 6 weeks, at
least 1 month, at least 2 months, at least 4 months, at least 6 months, at
least 8 months, at least 10
months, at least 12 months, at least 14 months, at least 16 months, at least
18 months, at least 20
months, at least 22 months, or at least 24 months, e.g., at a temperature of 4
C or lower (e.g.,
- 121 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
between about 4 C and -20 "C). In one embodiment, the formulation is
stabilized for at least 4
weeks at about 4 C In certain embodiments, the pharmaceutical composition of
the disclosure
comprises a nanoparticle composition disclosed herein and a pharmaceutically
acceptable carrier
selected from one or more of Tris, an acetate (e.g., sodium acetate), an
citrate (e.g., sodium
citrate), saline, PBS, and sucrose. In certain embodiments, the pharmaceutical
composition of the
disclosure has a pH value between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1,
7.2, 7.3, 7.4, 7.5, 7.6,
7.7, 7.8, 7.9 or 8.0, or between 7.5 and 8 or between 7 and 7.8). For example,
a pharmaceutical
composition of the disclosure comprises a nanoparticle composition disclosed
herein, Iris, saline
and sucrose, and has a pH of about 7.5-8, which is suitable for storage and/or
shipment at, for
example, about -20 C For example, a pharmaceutical composition of the
disclosure comprises a
nanoparticle composition disclosed herein and PBS and has a pH of about 7-7.8,
suitable for
storage and/or shipment at, for example, about 4 C or lower. "Stability,"
"stabilized," and
"stable" in the context of the present disclosure refers to the resistance of
nanoparticle
compositions and/or pharmaceutical compositions disclosed herein to chemical
or physical
changes (e.g., degradation, particle size change, aggregation, change in
encapsulation, etc.) under
given manufacturing, preparation, transportation, storage and/or in-use
conditions, e.g., when
stress is applied such as shear force, freeze/thaw stress, etc.
[00362] Nanoparticle compositions and/or pharmaceutical compositions including
one or
more nanoparticle compositions can be administered to any patient or subject,
including those
patients or subjects that can benefit from a therapeutic effect provided by
the delivery of a
therapeutic and/or prophylactic agent to one or more particular cells,
tissues, organs, or systems
or groups thereof, such as the renal system. Although the descriptions
provided herein of
nanoparticle compositions and pharmaceutical compositions including
nanoparticle compositions
are principally directed to compositions which are suitable for administration
to humans, it will
be understood by the skilled artisan that such compositions are generally
suitable for
administration to any other mammal. Modification of compositions suitable for
administration to
humans in order to render the compositions suitable for administration to
various animals is well
understood, and the ordinarily skilled veterinary pharmacologist can design
and/or perform such
modification with merely ordinary, if any, experimentation. Subjects to which
administration of
the compositions is contemplated include, but are not limited to, humans,
other primates, and
- 122 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
other mammals, including commercially relevant mammals such as cattle, pigs,
horses, sheep,
cats, dogs, mice, and/or rats.
[00363] A pharmaceutical composition including one or more nanoparticle
compositions can
be prepared by any method known or hereafter developed in the art of
pharmacology. In general,
such preparatory methods include bringing the active ingredient into
association with an
excipient and/or one or more other accessory ingredients, and then, if
desirable or necessary,
dividing, shaping, and/or packaging the product into a desired single- or
multi-dose unit.
[00364] A pharmaceutical composition in accordance with the present disclosure
can be
prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a
plurality of single unit
doses. As used herein, a "unit dose" is discrete amount of the pharmaceutical
composition
comprising a predetermined amount of the active ingredient (e.g., nanoparticle
composition).
The amount of the active ingredient is generally equal to the dosage of the
active ingredient
which would be administered to a subject and/or a convenient fraction of such
a dosage such as,
for example, one-half or one-third of such a dosage.
[00365] Pharmaceutical compositions can be prepared in a variety of forms
suitable for a
variety of routes and methods of administration. For example, pharmaceutical
compositions can
be prepared in liquid dosage forms (e.g., emulsions, microemulsions,
nanoemulsions, solutions,
suspensions, syrups, and elixirs), injectable forms, solid dosage forms (e.g.,
capsules, tablets,
pills, powders, and granules), dosage forms for topical and/or transdermal
administration (e.g.,
ointments, pastes, creams, lotions, gels, powders, solutions, sprays,
inhalants, and patches),
suspensions, powders, and other forms.
[00366] Liquid dosage forms for oral and parenteral administration include,
but are not
limited to, pharmaceutically acceptable emulsions, microemulsions,
nanoemulsions, solutions,
suspensions, syrups, and/or elixirs. In addition to active ingredients, liquid
dosage forms can
comprise inert diluents commonly used in the art such as, for example, water
or other solvents,
solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol,
ethyl carbonate,
ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene
glycol,
dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ,
olive, castor, and
sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and
fatty acid esters of
sorbitan, and mixtures thereof. Besides inert diluents, oral compositions can
include additional
- 123 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
therapeutic and/or prophylactic agents, additional agents such as wetting
agents, emulsifying and
suspending agents, sweetening, flavoring, and/or perfuming agents. In certain
embodiments for
parenteral administration, compositions are mixed with solubilizing agents
such as
Cremophor', alcohols, oils, modified oils, glycols, polysorbates,
cyclodextrins, polymers,
and/or combinations thereof.
[00367] Injectable preparations, for example, sterile injectable aqueous or
oleaginous
suspensions can be formulated according to the known art using suitable
dispersing agents,
wetting agents, and/or suspending agents. Sterile injectable preparations can
be sterile injectable
solutions, suspensions, and/or emulsions in nontoxic parenterally acceptable
diluents and/or
solvents, for example, as a solution in 1,3-butanectiol. Among the acceptable
vehicles and
solvents that can be employed are water, Ringer's solution, U.S.P., and
isotonic sodium chloride
solution. Sterile, fixed oils are conventionally employed as a solvent or
suspending medium. For
this purpose any bland fixed oil can be employed including synthetic mono- or
diglycerides.
Fatty acids such as oleic acid can be used in the preparation of injectables.
1003681 Injectable formulations can be sterilized, for example, by filtration
through a
bacterial-retaining filter, and/or by incorporating sterilizing agents in the
form of sterile solid
compositions which can be dissolved or dispersed in sterile water or other
sterile injectable
medium prior to use.
[00369] The disclosure features methods of delivering a therapeutic and/or
prophylactic agent
to a mammalian cell or organ, producing a polypeptide of interest in a
mammalian cell, and
treating a disease or disorder in a mammal in need thereof comprising
administering to a
mammal and/or contacting a mammalian cell with a nanoparticle composition
including a
therapeutic and/or prophylactic agent.
6. EXAMPLES
[00370] The examples in this section are offered by way of illustration, and
not by way of
limitation.
- 124 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
General Methods.
[00371] General preparative HPLC method: HPLC purification is carried out on
an Waters
2767 equipped with a diode array detector (DAD) on an Inertsil Pre-C8 OBD
column, generally
with water containing 0.1% TFA as solvent A and acetonitrile as solvent B.
11003721 General LCMS method: LCMS analysis is conducted on a Shimadzu (LC-
MS2020)
System. Chromatography is performed on a SunFire C18, generally with water
containing 0.1%
formic acid as solvent A and acetonitrile containing 0.1% formic acid as
solvent B.
6.1 Example I: Preparation of Compound I.
0
0
ci
I-10\ J*12 0H
Br K2CO3, CS2CO3.
Nal. ACN.144 h
0 0 0 0
1-1
1-2 1-3
0
[10
1-3
14 11(1"-"e'NH .. -
'6 .6 0 0
1-5 1
Step 1: Preparation of Intermediate 1-2
11003731 To a solution of 1-1 (1.9 g, 4.53 mmol, 2.1 eq) and 2-aminoethanol
(132.0 mg, 2.16
mmol, 1.0 eq) in ACN (15.0 mL) was added K2CO3 (626 mg, 4.53 mmol, 2.1 eq),
Cs2CO3 (210.0
mg, 0.65 mmol, 0.3 eq) and Nal (20.0 mg, 0.11 mmol, 0.05 eq) at RT. The
mixture was stirred
for 144 hours at 80 C. LCMS showed the reaction was completed, the mixture was
evaporated
under reduced pressure and purified with flash column chromatography (FCC)
(petroleum
ether/ethyl acetate (PE/EA)=10/1-4/1) to provide 1-2 (1.1 g, 69% yield) as
colorless oil.
Step 2: Preparation of Intermediate 1-3
[003741 To a solution of 1-2(1.1 g, 1.5 mmol, 1.0 eq) in CHC13 (15.0 mL) was
added SOC12
(535.0 mg, 4.5 mmol, 3.0 eq) at RT. The mixture was stirred for 16 hours. LCMS
showed the
reaction was completed, the mixture was evaporated under reduced pressure to
provide 1-3 (1.0
g, crude) as brown oil.
Step 3: Preparation of Intermediate 1-5
- 125 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00375] A mixture of the ketone 1-4 (0.7 g, 10.0 mmol, 1.0 eq), titanium(IV)
isopropoxide
(3.69 g, 13 mmol, 1.3 eq), and 2-aminoethanol (1.83 g, 30.0 mmol, 3.0 eq) in
methanol (10.0
mL) was stirred under argon at room temperature for 5h. Sodium borohydride
(380.0 mg, 10.0
mmol, 1.0 eq) was then added at 0 C and the resulting mixture was stirred for
an additional 2 h.
The reaction was then quenched by adding water (10.0 mL). Stirring was
continued at room
temperature for 20 min then the reaction mixture was acidified with
hydrochloric acid (1 M, 5
mL). After filtration over a pad of Celite washing with water and EA. The
organic layer was
separated and dried over Na2SO4, the mixture was evaporated under reduced
pressure and
purified with FCC (PE/EA=5/1-0/1) to provide 1-5 (300.0 mg, 26% yield) as
colorless oil.
Step 4: Preparation of Compound 1
[00376] To a solution of 1-3(300 mg, 0.4 mmol, 1.0 eq) and 1-5 (136 mg, 1.2
mmol, 3.0 eq)
in THF (5.0 mL) was added DIEA (258 mg, 2.0 mmol, 5.0 eq) at 0 C. The mixture
was stirred
for 16 hours at 70 C. LCMS showed the reaction was completed, the mixture was
evaporated
under reduced pressure and purified with pre-HPLC to provide Compound 1 (100.0
mg, 30%
yield) as colorless oil.
[00377] NMR (400 MHz, CDC13) 8: 0.86-0.90 (m, 12H), 1.27 (s, 52H), 1.46-
1.67 (m,
1211), 1.95-2.10(m, 5H), 2.29-2.34 (m, 5H), 2.44-2.77(m, 9H), 3.30(s, 1H),
3.66 (s, 2H), 3.96
(d, J=6.0 Hz, 4H). LCMS: Rt: 1.285 min; MS miz (ESI): 835.7[M+11].
6.2 Example 2: Preparation of Compound 2.
2-1 HO..µ'N1-i 1_3
________________ =
0 0
2-2 2
Step 1: Preparation of Intermediate 2-2
[00378] A mixture of the ketone 2-1 (2.0 g, 20.0 mmol, 1.0 eq), titanium(IV)
isopropoxide
(7.4 g, 26 mmol, 1.3 eq), and 2-aminoethanol (3.66 g, 60.0 mmol, 3.0 eq) in
methanol (10.0 mL)
was stirred under argon at room temperature for 5h. Sodium borohydride (760.0
mg, 20.0 mmol,
1.0 eq) was then added at 0 C and the resulting mixture was stirred for an
additional 2 h. The
- 126 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
reaction was then quenched by adding water (10.0 mL). Stirring was continued
at room
temperature for 20 min then the reaction mixture was acidified with
hydrochloric acid (1 M, 5
mL). After filtration over a pad of Celite washing with water and EA. The
organic layer was
separated and dried over Na2SO4, the mixture was evaporated under reduced
pressure and
purified with FCC (PE/EA=5/1-0/1) to provide 2-2 (1.5 g, 52% yield) as yellow
oil.
Step 2: Preparation of Compound 2
1003791 To a solution of 1-3 (378 mg, 0.5 nunol, 1.0 eq) and 2-2 (214 mg, 1.5
mmol, 3.0 eq)
in T1-1F (5.0 mL) was added DIEA (322 mg, 2.5 mmol, 5.0 eq) at 0 C. The
mixture was stirred
for 16 hours at 70 C. LCMS showed the reaction was completed, the mixture was
evaporated
under reduced pressure and purified with pre-HPLC to provide Compound 2(35.0
mg, 8% yield)
as yellow oil.
1003801 NMR (400 MHz, CDC1?) 5: 0.80-0.83 (m, 12H), 0.91-1.20 (m, 4H),1.25
(s, 56H),
1.54-1.59 (m, 8H), 1.70 (s, 3H),1.79-1.86 (m, 6H), 2.22-2.34 (m, 4H), 2.74-
3.06 (m, 6H), 3.06-
3.20 (m, 2H), 3.69 (s, 1H), 3.88-4.05 (m, 4H). LCMS: Rt: 1.989 min; MS m/z
(ESI):
863.7[M+11].
6.3 Example 3: Preparation of Compound 3.
0 0
HO,,,===,Ni-i
HO,,.. 3-1 14
NH2
0,0
3-2 3
Step 1: Preparation of Intermediate 3-2
1003811 A mixture of the ketone 3-1 (1.12 g, 10.0 mmol, 1.0 eq), titanium(IV)
isopropoxide
(3.69 g, 13 mmol, 1.3 eq), and 2-aminoethanol (1.83 g, 30.0 mmol, 3.0 eq) in
methanol (10.0
mL) was stirred under argon at room temperature overnight. Sodium borohydride
(380.0 mg,
10.0 mmol, 1.0 eq) was then added at 0 C and the resulting mixture was stirred
for an additional
2 h. The reaction was then quenched by adding water (10.0 mL). Stirring was
continued at
room temperature for 20 min then the reaction mixture was filtrated over a pad
of Celite washing
with water and EA. The organic layer was separated and dried over Na2SO4, the
mixture was
- 127 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
evaporated under reduced pressure and purified with FCC (PE/EA=5/1-0/1) to
provide 3-2
(550.0 mg, 35% yield) as colorless oil.
Step 2: Preparation of Compound 3
[00382] To a solution of 1-3(300 mg, 0.4 mmol, 1.0 eq) and 3-2(188 mg, 1.2
mmol, 3.0 eq)
in THF (5.0 mL) was added DIEA (258 mg, 2.0 mmol, 5.0 eq) at 0 C. The mixture
was stirred
for 16 hours at 70 C. LCMS showed the reaction was completed, the mixture was
evaporated
under reduced pressure and purified with pre-HPLC to provide Compound 3(53.0
mg, 15%
yield) as colorless oil.
[003831 '11 NMR (400 MHz, CDC13) 5: 0.86-0.90 (m, 15H), 1.26(s, 65H), 1.24-
1.46(m,
4H),1.6-1.67(m, 7H), 2.29-2.47(m, 8H), 2.73-2.77(m, 2H), 3.46-3.50(t, J=8.0
Hz, 1H), 3.96-
3.98 (d, J=8.0 Hz, 4H). LCMS: Rt: 1.834 min; MS miz (ESI): 877.7[M+H].
6.4 Example 4: Preparation of Compound 4.
./NH2
C4411
HO
N H 1-3
Br ___________ ro.
4-1
4-2
4
Step 1: Preparation of Intermediate 4-2
[00384] To a solution of 4-1 (250 mg, 2.0 mmol, 1.0 eq) and cyclopropanamine
(125 mg, 2.2
mmol, 1.1 eq) in ACN (5.0 mL) was added K2CO3 (552 mg, 4.0 mmol, 2.0 eq) at
RT. The
mixture was stirred overnight at 80 C. LCMS showed the reaction was completed,
the mixture
was extracted with EA(40 mix 2), washed by brine and evaporated under reduced
pressure to
provide 4-2(170 mg, crude). The crude product was used for next step without
further
purification.
Step 2: Preparation of Compound 4
[00385] To a solution of 1-3 (300 mg, 0.4 mmol, 1.0 eq) and 4-2 (160 mg, 1.6
mmol, 4.0 eq)
in THF (5.0 mL) was added DIEA (205 mg, 2.0 mmol, 4.0 eq) at 0 C. The mixture
was stirred
for 16 hours at 70 C. LCMS showed the reaction was completed, the mixture was
evaporated
- 128 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
under reduced pressure and purified with pre-HPLC to provide Compound 4(58.0
mg, 17.6%
yield) as colorless oil.
[00386] NMR (400 MHz, CDC13) 5: 0.86-0.90 (t, J=8.0 Hz 12H), 1.26-1.39 (m,
54H),
1.43-1.66(m, 12H), 2.30-2.33 (m, 6H), 2.81-3.01(m, 8H), 3.49(s, 4H), 3.96-3.98
(d, J=8.0 Hz,
4H). LCMS: Rt: 1.39 min; MS m/z (ESI): 821.8[M+H].
6.5 Example 5: Preparation of Compound 5.
6 1-3 ,===
0 0
5-2 5
Step 1: Preparation of Intermediate 5-2
[00387] A mixture of the cyclopentanone 5-1 (840 mg, 10.0 mmol, 1.0 eq),
titanium(W)
isopropoxide (3.69 g, 13 mmol, 1.3 eq), and 2-aminoethanol (1.83 g, 30.0 mmol,
3.0 eq) in
methanol (10.0 mL) was stirred under argon at room temperature overnight.
Sodium
borohydride (380.0 mg, 10.0 mmol, 1.0 eq) was then added at 0 C and the
resulting mixture was
stirred for an additional 2 h. The reaction was then quenched by adding water
(10.0 mL).
Stirring was continued at room temperature for 20 min then the reaction
mixture was filtrated
over a pad of Celite washing with water and EA. The organic layer was
separated and dried over
Na2SO4, the mixture was evaporated under reduced pressure and purified with
FCC (PE/EA=2/1-
0/1) to provide 5-2 (410 mg, 32% yield) as colorless oil.
Step 2: Preparation of Compound 5
[00388] To a solution of 1-3 (300 mg, 0.4 mmol, 1.0 eq) and 5-2(154 mg, 1.2
mmol, 3.0 eq)
in THF (5.0 mL) was added DIEA (258 mg, 2.0 mmol, 5.0 eq) at 0 C. The mixture
was stirred
for 16 hours at 70 C. LCMS showed the reaction was completed, the mixture was
evaporated
under reduced pressure and purified with pre-HPLC to provide Compound 5(10.0
mg, 3% yield)
as colorless oil.
- 129 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
1003891 NMR (400 MHz, CDC13) 5: 0.80-0.83 (m, 12H), 1.20(m, 54H), 1.51-1.61
(m, 4H)
1.68-1.79 (m, 8H), 1.85-1.94(m, 2H), 2.02 (s, 1H), 2.29-2.50(m, 4H) 2.69-
3.15(m, 10H), 3.27-
3.59(m, 4H) 3.89-3.91 (d, J=8.0 Hz, 4H). LCMS: Rt: 2.22 min; MS in/z (ESI):
849.8[M+11].
6.6 Example 6: Preparation of Compound 6.
6-1 a 14 a
NH2
6-2 6
Step 1: Preparation of Intermediate 6-2
1003901 A mixture of the cyclooctanone 6-1 (1.26 g, 10.0 mmol, 1.0 eq),
titanium(IV)
isopropoxide (3.69 g, 13 mmol, 1.3 eq), and 2-aminoethanol (1.83 g, 30.0 mmol,
3.0 eq) in
methanol (10.0 mL) was stirred under argon at room temperature overnight.
Sodium
borohydride (380.0 mg, 10.0 mmol, 1.0 eq) was then added at 0 C and the
resulting mixture was
stirred for an additional 2 h. The reaction was then quenched by adding water
(10.0 mL).
Stirring was continued at room temperature for 20 min then the reaction
mixture was filtrated
over a pad of Celite washing with water and EA. The organic layer was
separated and dried over
Na2SO4, the mixture was evaporated under reduced pressure and purified with
FCC(PE/EA=5/1-
0/1) to provide 2 (900 mg, 52% yield) as colorless oil.
Step 2: Preparation of Compound 6
1003911 To a solution of 1-3(300 mg, 0.4 mmol, 1.0 eq) and 6-2 (208 mg, 1.2
mmol, 3.0 eq)
in THF (5.0 mL) was added DMA (258 mg, 2.0 mmol, 5.0 eq) at 0 C. The mixture
was stirred
for 16 hours at 70 C. LCMS showed the reaction was completed, the mixture was
evaporated
under reduced pressure and purified with pre-HPLC to provide Compound 6(40.0
mg, 11%
yield) as colorless oil.
[00392] NMR (400 MHz, CDC13) 5: 0.86-0.90 (m, 12H), 1.26 (m, 52H), 1.62-
1.73 (m,
16H), 1.94-1.85(m, 2H) 2.12-2.3 (m, 11H), 2.32-2.34 (m, 4H), 2.75-3.30 (m, 8H)
3.96-3.98 (d,
J=8.0 Hz, 4H). LCMS: Rt: 1.81 min; MS m/z (ESI): 891.5[M+11].
- 130 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.7 Example 7: Preparation of Compound 7.
0
110
7-1 HO.NH 1-3
1.1 .'"*""N'NH2 ====
0 0
CUCI
DIEA, THF
7-2 7
Step 1: Preparation of Intermediate 7-2
100393] A mixture of iodobenzene 7-1 (0.81 g, 4.0 mmol, 1.0 eq), 2-
aminoethanol (0.73 g,
12.0 mmol, 3.0 eq) and CuCl (39.6 mg, 0.4 mmol, 0.1 eq), KOH (0.73 g, 12.0
mmol, 3.0 eq) was
stirred under argon at room temperature for 16h. The reaction was then
quenched by adding
water (10.0 mL), exacted with EA. The organic layer was separated and dried
over Na2SO4, the
mixture was evaporated under reduced pressure and purified with FCC (PE/EA=5/1-
1/1) to
provide 7-2 (0.5 g, 90% yield) as yellow oil.
Step 2: Preparation of Compound 7
1003941 To a solution of 1-3(300 mg, 0.4 mmol, 1.0 eq) and 7-2 (163 mg, 1.19
mmol, 3.0 eq)
in THF (10.0 mL) was added DIEA (256 mg, 1.98 mmol, 5.0 eq) at 0 C. The
mixture was
stirred for 16 hours at 70 C. LCMS showed the reaction was completed, the
mixture was
evaporated under reduced pressure and purified with pre-HPLC to provide
Compound 7(60.0
mg, 18% yield) as colorless oil.
1003951 1H NMR (400 MHz, CDC1?) 5: 0.86-0.90 (m, 12H), 1.27-1.37 (m, 55H),
1.69 (s,
12H), 2.31 (s, 4H), 2.43 (s, 2H), 2.70 (s, 1H), 3.61-3.71 (m, 5H), 3.88-3.96
(m, 4H), 6.55-6.83
(m, 3H), 7.14-7.26 (m, 2H). LCMS: Rt: 2.193 min; MS m/z (ESI): 858.2 [M+11].
- 131 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.8 Example 8: Preparation of Compound 8.
1 HO'-µ-}1.-011 HO"--'`-)LN'-'`""Th
-4
NHBoc __________________________________________________ NHBoc
NHBoc
8-1 8-2 8-3
0
0
0
8-5 HONN
NH, ____________________________
0 0
Step 1: Preparation of Intermediate 8-2
[00396] A mixture of the 8-1 (0.5 g, 2.66 mmol, 1.0 eq), and ketone 1-4 (0.37
g, 5.32 mmol,
2.0 eq) in methanol (10.0 mL) was stirred under argon at room temperature for
2h. NaCNBH3
(355.0 mg, 5.32 mmol, 2.0 eq) was then added and the resulting mixture was
stirred for an
additional 16 h. The reaction was then quenched by adding water (10.0 mL).
Stirring was
continued at room temperature for 20 min then the reaction mixture was exacted
with EA,
washed with brine. The organic layer was separated and dried over Na2SO4, the
mixture was
evaporated under reduced pressure to provide 8-2 (0.35 g, 54% yield) as yellow
oil.
Step 2: Preparation of Intermediate 8-3
[00397] A mixture of the 8-2 (0.35 g, 1.45 mmol, 1.0 eq), and 3-
hydroxypropanoic acid (1.2
mL, 4.35 mmol, 3.0 eq) in DMF (10.0 mL) was added HATU (0.72 g, 1.88 mmol, 1.3
eq) and
DMA (0.56 g, 4.35 mmol, 3.0 eq), and was stirred under argon at room
temperature for 2h.
LCMS showed the reaction was completed, EA (100.0 mL) was added. The mixture
was washed
with saturated brine, dried over Na2SO4. The mixture was evaporated under
reduced pressure to
provide 8-3(400 mg, crude) as brown oil.
Step 3: Preparation of Intermediate 8-4
[00398] A mixture of the 8-3(0.4 g, 1.27 mmol, 1.0 eq) in dioxane (5.0 mL) was
added
HC1/dioxane (5.0 mL), and was stirred at room temperature for 2h. LCMS showed
the reaction
- 132-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
was completed. The mixture was evaporated under reduced pressure to provide 8-
4 (170 mg,
crude) as white solid.
Step 4: Preparation of Compound 8
[00399] To a solution of 8-4(120 mg, 0.56 mmol, 1.0 eq) and 8-5 (1.17 g, 2.8
mmol, 5.0 eq)
in ACN (15.0 mL) was added K2CO3 (309 mg, 2.24 mmol, 4.0 eq), Cs2CO3 (55.0 mg,
0.17
mmol, 0.3 eq) and NaI (10.0 mg, 0.06 mmol, 0.1 eq) at RT. The mixture was
stirred for 72 hours
at 80 C. LCMS showed the reaction was completed, the mixture was evaporated
under reduced
pressure and purified with pre-HPLC to provide Compound 8(40.0 mg, 8% yield)
as yellow oil.
[00400] NMR (400 MHz, CDC13) 5: 0.80-0.90 (m, 14H), 0.91-0.98 (m, 2H),1.32
(s, 54H),
1.36-1.50 (m, 4H), 1.62-1.70 (m, 15H), 1.77-1.86 (m, 5H), 2.31-2.34 (m, 4H),
2.89-3.08 (m, 1H),
3.52-3.55 (m, 3H), 3.97 (d, J=6.0 Hz, 4H). LCMS: Rt: 1.149 min; MS m/z (ESI):
891.6 [M+H].
6.9 Example 9: Preparation of Compound 9.
0
o
2-1
HCI in dioxane
.2., ______________________ NHBoc _______________________ NHBoc
NHBoc NaBH3CN,Me0H HATUDIEADMF
8-1 9-1
9-2
0
0 0
8-6
K2CO3.CS2CO3,Nai HO
LN
a NH2 _______________________
MeCN
9-3 9
Step 1: Preparation of Intermediate 9-1
[00401] A mixture of the 8-1(0.5 g, 2.66 mmol, 1.0 eq), and ketone 2-1 (0.5 g,
5.32 mmol,
2.0 eq) in methanol (10.0 mL) was stirred under argon at room temperature for
2h. NaCNBH3
(355.0 mg, 5.32 mmol, 2.0 eq) was then added and the resulting mixture was
stirred for an
additional 16 h. The reaction was then quenched by adding water (10.0 mL).
Stirring was
continued at room temperature for 20 min then the reaction mixture was exacted
with EA,
washed with brine. The organic layer was separated and dried over Na2SO4, the
mixture was
evaporated under reduced pressure to provide 9-1 (0.35 g, 48% yield) as yellow
oil.
- 133 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
Step 2: Preparation of Intermediate 9-2
[00402] A mixture of the 9-1 (0.35 g, 1.31 mmol, 1.0 eq), and 3-
hydroxypropanoic acid (1.0
mL, 3.93 mmol, 3.0 eq) in DMF (10.0 mL) was added HAT'U (0.72g. 1.88 mmol, 1.3
eq) and
DIEA (0.56 g, 4.35 mmol, 3.0 eq), and was stirred under argon at room
temperature for 2h.
LCMS showed the reaction was completed, EA (100.0 mL) was added. The mixture
was washed
with saturated brine, dried over Na2SO4. The mixture was evaporated under
reduced pressure to
provide 9-2(400 mg, crude) as brown oil.
Step 3: Preparation of Intermediate 9-3
[00403] A mixture of the 9-2(0.4 g, 1.2 mmol, 1.0 eq) in dioxane (5.0 mL) was
added
HCl/dioxane (5.0 mL) was stirred at room temperature for 2h. LCMS showed the
reaction was
completed. The mixture was evaporated under reduced pressure to provide 9-3
(170 mg, crude)
as white solid.
Step 4: Preparation of Compound 9
[00404] To a solution of 9-3(120 mg, 0.5 mmol, 1.0 eq) and 8-5 (0.84 g, 2.0
mmol, 4.0 eq) in
ACN (15.0 mL) was added K2CO3 (207 mg, 1.5 mmol, 3.0 eq), C52C0? (50.0 mg,
0.15 mmol,
0.3 eq) and Nal (7.0 mg, 0.05 mmol, 0.1 eq) at RT. The mixture was stirred for
72 hours at
80 C. LCMS showed the reaction was completed, the mixture was evaporated under
reduced
pressure and purified with pre-HPLC to provide Compound 9(24.0 mg, 5% yield)
as colorless
oil.
1004051 1H NMR (400 MHz, CDC1?) 5: 0.86-0.90(m, 12H), 1.27-1.38 (m, 50H), 1.52-
1.57
(m, 8H), 1.79-1.94 (m, 22H), 2.28-2.42 (m, 5H), 2.50-2.60 (m, 2H), 2.90 (s,
3H), 3.29 (s, 1H),
3.57 (s, 1H), 3.83-3.87 (m, 2H), 3.96-3.98 (m, 4H). LCMS: Rt: 1.704 min; MS
m/z (ES!): 919.7
[M+11].
- 134-
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.10 Example 10: Preparation of
Compound 10.
3-1 HO OH HO
NHBoc __________________________________________ ()) NHBoc _______
NHBoc
8-1 10-1 10-2
0
0
HOAN 8-5 HO N
a NH2 ______________________
0 0
10-3 10
Step 1: Preparation of Intermediate 1O-I
[00406] A mixture of the 8-1 (2.0 g, 8.92 mmol, 1.0 eq), and ketone 3-1 (2.0
g, 17.85 mmol,
2.0 eq) in methanol (15.0 mL) was stirred under argon at room temperature for
2h. NaCNBH3
(1.1 2 g, 17.85 mmol, 2.0 eq) was then added and the resulting mixture was
stirred for an
additional 16 h. The reaction was then quenched by adding water (20.0 mL).
Stirring was
continued at room temperature for 20 min then the reaction mixture was exacted
with EA,
washed with brine. The organic layer was separated and dried over Na2SO4, the
mixture was
evaporated under reduced pressure to provide 10-1 (1.52 g, 60% yield) as
yellow oil.
Step 2: Preparation of Intermediate 10-2
[00407] A mixture of the 10-1 (500 mg, 1.76 mmol, 1.0 eq), and 3-
hydroxypropanoic acid
(676 mg, 5.28 mmol, 3.0 eq) in DMF (10.0 mL) was added HATU (869 mg, 2.29
mmol, 1.3 eq)
and DIEA (681 mg, 5.28 mmol, 3.0 eq), and was stirred under argon at room
temperature for 2h.
LCMS showed the reaction was completed, EA (100.0 mL) was added. The mixture
was washed
with saturated brine, dried over Na2SO4. The mixture was evaporated under
reduced pressure to
provide 10-2(590 mg, crude) as brown oil.
Step 3: Preparation of Intermediate 10-3
1004081 A mixture of the 10-2 (590 mg, 1.65 mmol, 1.0 eq) in dioxane (5.0 mL)
was added
HC1/dioxane (5.0 mL) was stirred at room temperature for 2h. LCMS showed the
reaction was
- 135 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
completed. The mixture was evaporated under reduced pressure to provide 10-3
(400 mg, crude)
as white solid.
Step 4: Preparation of Compound /0
[00409] To a solution of 10-3 (150 mg, 0.58 mmol, 1.0 eq) and 8-5 (1.22 g,
2.92 mmol, 5.0
eq) in ACN (15.0 mL) was added K2CO3 (322 mg, 2.32 mmol, 4.0 eq), Cs2CO3 (57.0
mg, 0.17
mmol, 0.3 eq) and Nal (10.0 mg, 0.06 mmol, 0.1 eq) at RT. The mixture was
stirred for 72 hours
at 80 C. LCMS showed the reaction was completed, the mixture was evaporated
under reduced
pressure and purified with pre-HPLC to provide Compound 10(92.0 mg, 17% yield)
as yellow
oil.
[00410] NMR (400 MHz, CDC13) 8: 0.87-0.90 (m, 14H), 1.27 (s, 62H), 1.44-
1.50 (m, 6H),
1.62-1.72 (m, 12H), 1.85-1.92 (m, 2H), 2.29-2.35 (m, 5H), 3.13-3.68 (m, 5H),
3.85-3.87 (m, 2H),
3.96-3.98 (d, J=8.0 Hz, 4H). LCMS: Rt: 1.520 min; MS rn/z (ESI): 933.9 [M+11].
6.11 Example 11: Preparation of Compound 11.
o
FlOBN:72 PMBN PcliC ht4
Br
0 0 0 0
1-1 11-1 11-2
9
Br"k""64 1-5
DIPEA 07'0 K2003 ,o 0
11
11-3
Step 1: Preparation qf Intermediate /1-1
[00411] To a solution of compound 1-1 (10 g, 21.87 mmol, 3.0 eq) in CH3CN (50
mL) was
added K2CO3 (3.02 g, 21.87 mmol, 3.0 eq), Cs2CO3 (2.38 g, 7.29 mmol, 1.0 eq),
Nal (0.2 g, 1.46
mmol, 0.2 eq), and (4-methoxyphenyl)methanamine (1 g, 7.29 mmol, 1.0 eq). The
reaction was
stirred at 80 C for 10 hour. The reaction mixture was poured into water (100
ml) and extracted
with CH2C12 (3*100 mL). The combined organic layer was washed with brine,
dried over
anhydrous Na2SO4 and concentrated in vacuo. The crude product was purified by
flash column
chromatography (Et0Ac : PE =2: 1) to provide 11-1 as yellow oil (5 g, yield:
84%).
- 136 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
Step 2: Preparation of Intermediate 11 -2
[00412] To a solution of 11-1 (5g. 6.14 mmol, 1.0 eq) in Et0Ac (100 mL) was
added Pd/C
(1.0 g). The reaction was stirred at rt for 10 hour under H2. The reaction
mixture was filtrated
concentrated in vacuo to provide 11-2 as yellow oil (4.0 g, yield: 94 %).
Step 3: Preparation of Intermediate 11 -3
[00413] To a solution of 11-2(200 mg, 0.29 mmol, 1.0 eq) in CH2C12 (20 mL) was
added
DIPEA (120 mg, 0.87 mmol, 3.0 eq) and 2-bromoacetyl bromide (120 mg, 0.58
mmol, 2.0 eq).
The reaction was stirred at 0 C for 1 hour. The reaction mixture was poured
into water (50 ml)
and extracted with CH2C12 (3* 50 mL). The combined organic layer was washed
with brine,
dried over anhydrous Na2SO4 and concentrated in vacuo to provide 11-3 as
yellow oil (200 mg,
yield: 85 %).
Step 4: Preparation of Compound 11
[00414] To a solution of 11-3 (200 mg, 0.24 mmol, 1.0 eq) in CH3CN (10 mL) was
added
K2CO3 (170 mg, 1.23 mmol, 3.0 eq) and compound 1-5 (85 mg, 0.74 mmol, 3.0 eq).
The
reaction was stirred at 80 C for 10 hour. The reaction mixture was filtrated
concentrated in
vacuo. The crude product was purified by prep-HPLC to provide Compound 11 as
colorless oil
(50 mg, yield: 24 %).
1004151 NMR (400 MHz, CDC13) 5: 0.87 (t, J= 8 Hz, 12H), 1.22-1.46 (m, 54H),
1.50-1.69
(m, 14H), 1.77-2.04 (m, 4H), 2.28-2.34 (m, 4H), 2.76-2.80 (m, 2H), 3.18-3.44
(m, 4H), 3.51-3.58
(m, 2H), 3.95-3.98(m, 4H). LCMS: Rt: 1.431 min; MS miz (ESI): 849.7 [M+11].
- 137-
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.12 Example 12: Preparation of Compound 12.
o
HN c../ Br Br m
DIPEA 0
0 0 0 0
11-2 12-1
0
r---"---µ-`).(0
1-5
K2CO3 00 0
12
Step 1: Preparation of Intermediate 12-1
[00416] To a solution of 11-2(200 mg, 0.29 mmol, 1.0 eq) in CH2C12 (20 mL) was
added
DIPEA (120 mg, 0.87 mmol, 3.0 eq) and 3-bromopropanoyl chloride (100 mg, 0.58
mmol, 2.0
eq). The reaction was stirred at 0 C for 1 hour. The reaction mixture was
poured into water (50
ml) and extracted with Cli2C12 (3*50 mL). The combined organic layer was
washed with brine,
dried over anhydrous Na2SO4 and concentrated in vacuo to provide 12-1 as
yellow oil (185 mg,
yield: 77 %).
Step 2: Preparation of Compound 12
[00417] To a solution of 12-1 (180 mg, 0.21 mmol, 1.0 eq) in CH3CN (10 mL) was
added
K2CO3 (150 mg, 1.09 mmol, 5.0 eq) and 1-5 (75 mg, 0.65 mmol, 3.0 eq). The
reaction was
stirred at 80 C for 10 hour. The reaction mixture was filtrated concentrated
in vacuo. The crude
product was purified by prep-HPLC to provide Compound 12 as colorless oil (10
mg, yield:5 %).
[00418] 1H NMR (400 MHz, CDC13) 5: 0.87 (t, J = 8 Hz, 12H), 1.02-1.45 (m,
56H), 1.50-1.67
(m, 13H), 1.99-2.08 (m, 2H), 2.23-2.34 (m, 4H), 2.51-3.03 (m, 4H), 3.14-3.31
(m, 5H), 3.51-3.88
(m, 2H), 3.95-3.98(m, 4H). LCMS: Rt: 1.491 min; MS miz (ESI): 863.7 [M+11].
- 138 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.13 Example 13: Preparation of Compound 13.
0
Br
CI
0e/NµO DIPEA 0 u 0
11-2 13-1
a
1-5
K2CO3
13
Step 1: Preparation of Intermediate 13-1
[00419] To a solution of 11-2(200 mg, 0.29 mmol, 1.0 eq) in CH2C12 (20 mL) was
added
DIPEA (120 mg, 0.87 mmol, 3.0 eq) and 4-bromobutanoyl chloride (107 mg, 0.58
mmol, 2.0
eq). The reaction was stirred at 0 C for 1 hour. The reaction mixture was
poured into water (50
ml) and extracted with Cli2C12 (3*50 mL). The combined organic layer was
washed with brine,
dried over anhydrous Na2SO4 and concentrated in vacuo to provide 13-1 as
yellow oil (191 mg,
yield: 78 %).
Step 2: Preparation of Compound 13
[00420] To a solution of 13-1 (190mg, 0.22 mmol, 1.0 eq) in CH3CN (10 mL) was
added
K2CO3 (155 mg, 1.13 mmol, 5.0 eq) and 1-5 (78 mg, 0.67 mmol, 3.0 eq). The
reaction was
stirred at 80 C for 10 hour. The reaction mixture was filtrated concentrated
in vacuo. The crude
product was purified by prep-HPLC to provide Compound 13 as colorless oil (21
mg, yield:10
%).
[00421] NMR (400 MHz, CDC13) 5: 0.87 (t, J= 8 Hz, 12H), 1.39-1.48 (m, 54H),
1.50-1.83
(m, 15H), 2.02-2.04 (m, 2H), 2.24-2.34 (m, 6H), 2.46-2.50 (m, 2H), 2.55-2.57
(m, 2H), 3.18-3.30
(m, 5H), 3.52-3.54 (m, 2H), 3.95-3.98(m, 411). LCMS: Rt: 1.503 mm; MS m/z
(ES!): 877.7
[M+11].
- 139 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.14 Example 14: Preparation of Compound 14.
BrThr 11 8n0H, con 11250.i wirOBn
0 toluene 0
144 14-B
+0 0 0
0
OBn
Nell. 144 Nall. u_s OBn
TFA o
¨ 0 - 0
0 0 THF THF DCM
0 Bn
0 OBn OH
14-1 14-2 14-3 144
0 0
13H3 in 'I HF OBn OH
MsCl. NEt3 H2.126/C mso
HO - Mso
DCM EA
0 OBn 0 OBn 0 OH
14-5 14-6 14-7
0 0
0 0
2 nenqiecan.1-c:, con 1-12804 mso
toitione
0 0
0 1(2003.MeCN
14-5 1 04
Step 1: Preparation of Intermediate 14-B
[00422] A mixture of 14-A (20.0 g, 103 mmol, 1.0 eq), phenylmethanol (10.0 g,
93 mmol, 0.9
eq) and con. H2SO4(1 ml) in toluene(200 ml) was refluxed for 6h with
azeotropic removal of
water. TLC showed the reaction was complete. The mixture was diluted with
ethyl acetate (100
ml) and washed with saturated aq. NaHCO3 and brine, dried over Na2SO4 and
concentrated. The
residue was purified by a chromatography column to provide 14-B (24.2 g, 92%
yield) as
colorless oil.
Step 2: Preparation of Intermediate 14-2
[00423] To a solution of 14-1(12.0 g, 55.4 mmol, 1.0 eq) in anhydrous THF
(100m1) was
added NaH (2.22g. 55.4 mmol, 1.0 eq) at 0 C under inert N2 atmosphere. The
mixture was
stirred for 30 min, and 14-B (15.6g, 55.4mmo1, 1.0 eq) was added. The mixture
was stirred at
room temperature for overnight. TLC showed the reaction was complete. The
mixture was
concentrated and purified by a chromatography column to provide 14-2(16.8 g,
72% yield) as
colorless oil.
Step 3: Preparation of Intermediate 14-3
- 140 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00424] To a solution of 14-2(16.8 g, 40.0 mmol, 1.0 eq) in anhydrous THF
(100m1) was
added NaH (1.60 g, 40.0 mmol, 1.0 eq) at room temperature under inert
atmosphere. The
mixture was stirred for 30 min, and 14-B (7.3 g, 35.6mmo1, 1.0 eq) was added.
The mixture was
stirred at reflux for overnight. TLC showed the reaction was complete. The
mixture was
concentrated and purified by a chromatography column to provide 14-3 (15.0 g,
60% yield) as
colorless oil.
Step 4: Preparation of Intermediate 14-4
[00425] The mixture of 14-3(9.0 g, 14.4 mmol, 1.0 eq) and TFA (8.2 g, 74.0
mmol, 5.0 eq) in
DCM (50 ml) was stirred at reflux for 4h. TLC showed the reaction was
complete. The mixture
was concentrated and the residue was refluxed in dimethylbenzene (100m1) and
concentrated.
The residue was purified by a chromatography column to provide 14-4 (5.8 g,
86% yield) as
colorless oil.
Step 5: Preparation qf Intermediate 14-5
1004261 To a solution of 14-4 (5.8 g, 12.4 mmol, 1.0 eq) in anhydrous THF (30
ml) was added
BR: (in THF, 1M, 20 ml) at -78 C under inert atmosphere. The mixture was
stirred at this
temperature for 4h. TLC showed the reaction was complete. The mixture was
quenched by aq
Na2CO3, extracted with ethyl acetate, washed with water and brine, dried over
Na2SO4 and
concentrated. The residue was purified by a chromatography column to provide
14-5(2.9 g,
51.4% yield) as colorless oil.
Step 6: Preparation of Intermediate 14-6
[00427] To a mixture of 14-5(2.1 g, 5.4 mmol, 1.0 eq) and triethylamine (920
mg, 10.8 mmol,
2.0 eq) in DCM (30 ml) was added methanesulfonyl chloride (880 mg, 6.5 mmol,
1.2 eq)
dropwise at 0 c. The mixture was stirred for 4h. TLC showed the reaction was
complete. The
resulting was washed with water and brine, dried over Na2SO4 and concentrated.
The residue
was purified by a chromatography column to provide 14-6(2.2 g, 89% yield) as
colorless oil.
Step 7: Preparation of Intermediate 14-7
[00428] The mixture of 14-6(2.2 g, 4.1 mmol, 1.0 eq) and Pd/C (200 mg) in
ethyl acetate (30
ml) was stirred at room temperature under a hydrogen balloon for overnight.
TLC showed the
- 141 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
reaction was complete. The resulting was filtered and the filtrate was
concentrated to provide
14-7 (1.5 g, crude). The residue was used for the next step without further
purification.
Step 8: Preparation of Intermediate 14-8
[00429] The mixture of 14-7(1.5 g, 4.1 mmol, 1.0 eq), 2-hexyldecan-1-ol (3.0
g, 12.4 mmol,
3.0 eq) and con. 112SO4 (0.5 ml) in toluene (50 ml) was refluxed for 3h with
azeotropic removal
of water. TLC showed the reaction was complete. The mixture was diluted with
ethyl acetate
(100 ml) and washed with saturated aq. NaHCO3 and brine, dried over Na2SO4 and
concentrated.
The residue was purified by a chromatography column to provide 14-8 (3.2 g,
97% yield) as
colorless oil.
Step 9: Preparation of Compound 14
[00430] The mixture of 14-8(200 mg, 0.25 mmol, 1.0 eq), 2-(methylamino)ethanol
(100 mg,
1.3 mmol, 5.3 eq), K2CO3 (70 mg, 0.50 mmol, 2.0 eq) in acetonitrile (10 ml)
was stirred at 70 C
for overnight. LCMS showed the reaction was complete. The mixture was diluted
with ethyl
acetate (100 ml) and washed with water and brine, dried over Na2SO4 and
concentrated. The
residue was purified by Pre-HPLC to provide Compound 14(69 mg) as colorless
oil.
[00431] 11INMR (400 MHz, CC13D) 8: 0.86-0.90 (m, 12H), 1.26-1.28 (m, 60H),
1.62(s, 8H),
2.20 (s, 5H), 2.28-2.31 (m, 4H), 2.49(s, 2H), 3.55-3.57 (m, 2H), 3.96-3.97 (d,
J=5.6Hz, 4H).
LCMS: Rt: 1.830 min; MS m/z (ESI): 780.7 [M+11].
[00432] The following compounds were prepared in analogous fashion as Compound
14,
using corresponding starting material.
Compound Characterization
0
HO N
C61-113
1H NMR (400 MHz, CDC13) 8: 0.87 (t, J = 8 Hz,
12H), 1.19-1.35 (m, 62H), 1.42-1.55 (m, 9H), 1.58-
2 .24 (m, 6H), 2.46-3.72 (m, 4H), 3.83-3.90(m, 6H).
Compound 16 LCMS: Rt: 2.040 min; MS miz (ESI): 794.7
[M+14].
- 142 -
CA 03178455 2022-09-29
WO 2(121/2(14175
PCT/CN2021/085879
182110784FF
0
C6I-113 NMR
(400 MHz, CDC13) 8: 0.87 (t, J = 8 Hz,
u 12H), 1.27-1.32 (m, 65H), 1.58-1.62 (m,
16H), 1.95-
.
0 0 17 2.32 (m, 6H), 2.65-3.52 (m, 4H), 3.96-
3.97(m, 4H),
C6Fi 13 4.11-4.12(m, 2H). LCMS: Rt: 2.130 min; MS
m/z
Compound 17 (ES!): 876.8 [M+111.
6.15 Example 15: Preparation of Compound 15.
0 -5
0 0 K2CO3 MeCN HO
0 0
14-8 15
100433] To a solution of 14-8 (200 mg, 0.25 mmol, 1.0 eq) in CH3CN (10 mL) was
added
K2CO3 (175 mg, 1.25 mmol, 5.0 eq) and 1-5(90 mg, 0.75 mmol, 3.0 eq). The
reaction was
stirred at 80 C for 10 hour. The reaction mixture was filtrated and
concentrated in vacuo. The
crude product was purified by prep-HPLC to provide Compound 15 as colorless
oil (6 mg, yield:
3%).
[00434] III NMR (400 MHz, CDC13) 8: 0.87 (t, J = 8 Hz, 12H), 1.39-1.48 (m,
55H), 1.50-1.87
(m, 14H), 1.92-2.18 (m, 4H), 2.21-2.325 (m, 4H), 2.40-3.68 (m, 8H), 3.82-3.90
(m, 4H). LCMS:
Rt: 1.883 min; MS m/z (ES!): 820.7 [M+H].
6.16 Example 16: Preparation of Compound A.
0
NH2
DI PEA HON
00
1-3 A
[00435] To a solution of 1-3 (300 mg, 0.4 mmol, 1.0 eq) and 2-aminoethanol 2
(74 mg, 1.2
mmol, 3.0 eq) in THF (5.0 mL) was added DlEA (209 mg, 1.6 mmol, 4.0 eq) at 0
C. The
mixture was stirred for 16 hours at 70 C. LCMS showed the reaction was
completed, the
- 143 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
mixture was evaporated under reduced pressure and purified with pre-HPLC to
provide
Compound A (20.0 mg, 6.4% yield) as colorless oil.
[00436] NMR (400 MHz, CDC13) 8: 0.86-0.90 (t, J=8.0 Hz, 12H), 1.27-1.35 (m,
54H),
1.5-1.53 (m, 4H), 1.6-1.65 (m, 4H), 2.31-2.35 (t, J=8.0 Hz, 4H), 2.51-2.54 (m,
4H), 2.82 (s, 2H),
2.98-3.06 (m, 4H), 3.89-3.91 (m, 2H), 3.95-3.97 (d, J=8.0 Hz, 4H). LCMS: Rt:
2.43 min; MS
m/z (ESI): 781.7[M+H].
6.17 Example 17: Preparation of Compound B.
CI
DIPEA ______________________________ 7.
0 0
1-3
[00437] To a solution of 1-3(300 mg, 0.4 mmol, 1.0 eq) and 2-
(methylamino)ethanol (91 mg,
1.2 mmol, 3.0 eq) in THF (5.0 mL) was added DIEA (209 mg, 1.6 mmol, 4.0 eq) at
0 C. The
mixture was stirred for 16 hours at 70 C. LCMS showed the reaction was
completed, the
mixture was evaporated under reduced pressure and purified with pre-HPLC to
provide
Compound B (104.0 mg, 32.3% yield) as colorless oil.
[00438] IIINMR (400 MHz, CDC13) 8: 0.86-0.90 (t, J=8.0 Hz, 12H),1.26-1.34 (m,
52H),
1.54-1.66 (m, 10H), 2.29-2.35 (m, 7H), 2.60-2.82 (m, 10H), 3.49-3.60 (m, 3H),
3.95-3.97 (d,
J=8.0 Hz, 4H). LCMS: Rt: 1.53 min; MS m/z (ES!): 796.6[M+H].
6.18 Example 18: Preparation of Compound C.
ci r,
L HO
DIEA THF C) 0
1-3
100439.1 To a mixture of compound 1-3 (300 mg, 0.40 mmol, 1.0 eq), DIEA (206
mg, 1.60
mmol, 4.0 eq) in 11-IF (20 mL) was added 2-(butylamino)ethanol (141 mg, 1.20
mmol, 3.0 eq).
The reaction mixture was stirred at 70 C for 16 hours. LCMS showed the
reaction was
- 144 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
complete. After removal of solvent, the residue was purified by pre-HPLC to
give Compound C
(50 mg, 15% yield) as colorless oil.
[00440] 111 NMR (400 MHz, CDC13) 5: 0.86-0.94 (m, 15H), 1.27-1.34 (m, 56H),
1.43-1.68
(m, 12H), 2.29-2.33 (m, 4H), 2.56-2.82 (m, 12H), 3.57-3.58 (m, 1H), 3.97 (d, J
=5.6 Hz, 4H).
LCMS: Rt: 1.650 min; MS m/z (ESI): 837.8[M+11].
6.19 Example 19: Preparation of Compound D.
C(C) HO\
======-="=======")...
DI PEA
0 0
13
[00441] To a solution of 1-3(300 mg, 0.4 mmol, 1.0 eq) and 2-
(hexylamino)ethanol (176 mg,
1.2 mmol, 3.0 eq) in THF (5.0 mL) was added DIEA (209 mg, 1.6 mmol, 4.0 eq) at
0 C. The
mixture was stirred for 16 hours at 70 C. LCMS showed the reaction was
completed, the
mixture was evaporated under reduced pressure and purified with pre-HPLC to
provide
Compound D (48 mg, 14.3% yield) as colorless oil.
[00442] NMR (400 MHz, CDC13) 8: 0.87-0.90 (t, J=6.6 Hz, 15H), 1.26-1.35 (m,
62H),
1.62-1.67 (m, 10H), 2.30-2.34 (m, 4H), 2.70-3.10 (m, 10H) 3.35-3.73 (m, 2H),
3.95-3.97 (d,
J=8.0 Hz, 4H). LCMS: Rt: 1.89 mm; MS miz (ESI): 865.8[M+11].
- 145 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.20 Example 20: Preparation of
Compound 18
9 9 l r-
9 0 C? 18-24NaH 0
0 _____________________________________________
(C0)2C12.DMSO,Et3N 0i3n ,p;,...,,k, Ot-Bu OBn
Pt/C, H2
.. 0 DCM Ti4F t-BUO
). 0....0Bn 0 013n b 0 OBn
14-5 18-2 18-3
0 9
cr...m.,0eHi, _ ,c8H17
Ir................OH
t-BuO EDO DiEA,DMAP t=BuO CeHt3 TFA HO . C614,3
OCM 0 ..."ycoin, DCM 8
0 Hi2
C61-113 Cell 1 3
18-4 18-5 18-8
,C81-1,7
0-1(C8H" CeH ...,,,0"---r
NIH i3 Ms0 C61113
'...ss'
BH3 in THF HO Msel. Et3N HO
CM
TH D
F ..=====yCisHi7 K2CO3,MeCN
CeHi3 C8Hia
18-7 18-8
0
CHL:H317
0 0"-Ny'Co-ii,
C61-113
18
Step 1: Preparation of compound 18-2
[00443] To a mixture of compound 14-5 (800 mg, 1.76 mmol, 1.0 equiv), DMSO
(410 mg,
5.28 mmol, 3.0 equiv) in DCM (30 ml) at -78 C under inert atmosphere was
added a solution of
acyl chloride(450 mg, 3.52 mmol, 2.0 eq) in DCM(10 ml), after stirring at -78
C for 2h, the
reaction was quenched by Et3N (900 mg, 8.8 mmol, 5.0 eq). The reaction mixture
was warmed
to room temperature and diluted with DCM and washed with water and brine,
dried over Na2SO4
and concentrated. The residue was purified by a column chromatography to give
compound 18-
2(760 mg) as colorless oil.
Step 2: Preparation of compound 18-3
[00444] To a solution of compound 18-2a (810 mg, 3.23 mmol, 2.0 eq) in
anhydrous THF
(100m1) was added NaH(130 mg, 3.23 mmol, 2.0 eq) at 0 C under inert
atmosphere. The
mixture was stirred for 30 min, and compound 18-2(730 mg, 1.61mmol, 1.0 eq)
was added. The
mixture was stirred at room temperature for overnight. TLC showed the reaction
was complete.
The mixture was concentrated and purified by a chromatography column to give
compound 18-
3(690 mg) as colorless oil.
- 146 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
Step 3: Preparation of compound 18-4
[00445] The mixture of compound 18-3 (690 mg, 1.25 mmol, 1.0 eq) and Pd/C (70
mg) in
EA(20 ml) was stirred under hydrogen for overnight. TLC showed the reaction
was complete.
The mixture was filtered and the filtrate was concentrated and the residue was
used for the next
step without further purification.
Step 4: Preparation of compound 18-5
[00446] The mixture of compound 18-4(470 mg, 1.25 mmol, 1.0 eq) and EDCI (720
mg, 3.75
mmol, 3.0 eq), octadecyl alcohol (910 mg, 3.75 mmol, 3.0 eq), DMAP(50 mg) and
DIEA (1300
mg, 10.00 mmol, 8.0 eq) in DCM(20 ml) was stirred for overnight. The mixture
was diluted
with DCM and washed with brine and concentrated. And the residue was purified
by a column
chromatography to give compound 18-5 (630 mg).
Step 5: Preparation of compound 18-6
[00447] To a solution of compound 18-5 (630 mg, 0.77 mmol, 1.0eq) in DCM (10
ml) was
added TFA(1 ml). The mixture was stirred at reflux for 4h. TLC showed the
completion of the
reaction. The resulting was concentrated and the residue was used for the next
step without
further purification.
Step 6: Preparation of compound 18-7
[00448] To a mixture of compound 18-6 (580 mg, 0.77 mmol, 1.0 eq) in anhydrous
THE (20
ml) was added BR: (1.0 M in THF, 5.0 ml) at -78 C. The mixture was stirred
for 4h and
quenched by saturated aq. Na2CO3 and extracted with EA, washed with brine and
concentrated.
The residue was purified by a chromatography column to give compound 18-7(320
mg) as
colorless oil.
Step 7: Preparation qf compound 18-8
1004491 To the mixture of compound 18-7(320 mg, 0.43mmo1, 1.0 q) and Et3N (65
mg, 0.65
mmol, 1.5 eq) in DCM (10 ml) was added methane sulfonyl chloride (60 mg, 0.52
mmol, 1.2 eq)
at 0 C. After 4h, TLC showed the completion of the reaction. The mixture was
diluted with
DCM and washed with brine, and concentrated. The residue was purified by a
column
chromatography to give compound 18-8 (280 mg).
- 147 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
Step 8: Preparation of compound 18
[00450] The mixture of compound 18-8 (200 mg, 0.25 mmol, 1.0 eq), 2-
(methylamino)ethanol
(100 mg, 1.3 mmol, 5.3 eq), K2CO3 (70 mg, 0.50 mmol, 2.0 eq) in acetonitrile
(10 ml) was
stirred at 70 C for overnight. LCMS showed the reaction was complete. The
mixture was
diluted with EA (100 ml) and washed with water and brine, dried over Na2SO4
and concentrated.
The residue was purified by Pre-HPLC to give compound 18 (24 mg) as colorless
oil.
[00451] 1H NMR (400 MHz, CC13D) 5: 0.87-0.90 (m, 12H), 1.39 (s, 62H), 1.41-
1.42(m, 4H),
1.60-1.62(m, 6H), 2.25 (s, 3H), 2.28-2.32(m, 4H), 2.35-2.39(m, 2H), 2.51-
2.54(m, 2H),3.57-3.59
(m, 2H), 3.97(d, J=5.6Hz, 4H). LCMS: Rt: 0.090 min; MS miz (ES!): 808.7
[M+11].
6.21 Example 21: Preparation of
Compound 20
NaCH NC' "34 ''AlrY'W- 1.1011.1y3
I. 0
20-1 20-2 204
HO HO 0
0
204 204 204
SOC1, 0 14
6
20-7 20
Step 1: Preparation cl compound 20-2
004521 To a solution of 20-1 (30.0 g, 98.25 mmol) in DMF (800 mL) was added
NaCN (9.63
g, 196.5 mmol). The reaction was stirred at 60 C for 10 hour. The reaction
mixture was poured
into water (500 ml) and extracted with Et0Ac (3*500 mL). The combined organic
layer was
washed with brine, dried over anhydrous Na2SO4 and concentrated in vacua. The
crude product
was purified by flash column chromatography (Et0Ac : PE =1:20) to give the
target product as
yellow oil (18.3 g, yield: 74 %).
Step 2: Preparation of compound 20-3
[00453] To a solution of 20-2 (17.0 g, 67.61 mmol) in Et0H (200 mL) was added
H2504 (40
mL). The reaction was stirred at 90 C for 48 hour. The reaction mixture was
poured into water
(500 ml) and extracted with Et0Ac (3*500 mL). The combined organic layer was
washed with
- 148 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
brine, dried over anhydrous Na2SO4 and concentrated in vacuo to give the
target product as yellow
oil (15 g, yield: 75 %).
Step 3: Preparation of compound 20-4
[00454] To a solution of 20-3 (14 g, 46.90 mmol) in Me0H (240 mL) and H20 (60
mL) was
added LiORH20 (9.84 g, 234.5 mmol). The reaction was stirred at 50 C for 10
hour. The
reaction mixture concentrated in vacuo to give the target product. The crude
product was
dissolved in water. The residue was adjusted to PH =2 with 6M HCl and
extracted with Et0Ac
(3* 500 mL). The combined organic layer was washed with brine, dried over
anhydrous Na2SO4
and concentrated in vacuo to give the target product as yellow oil (15 g,
yield: 75 %).
Step 4: Preparation of compound 20-5
[00455] To a solution of 20-4(4 g, 14.79 mmol) in CH2C12 (100 mL) was added
DIEA (5.73
g, 44.37 mmol), 5-bromopentan-1-ol (2.96 g, 17.75 mmol), EDCI (4.25 g, 22.18
mmol), and
DMAP (550 mg, 4.44 mmol). The reaction was stirred at 50 C for 10 hour. The
reaction
mixture was concentrated in vacuo and purified by flash column chromatography
(Et0Ac: PE
=20:1) to give the target product as yellow oil (4 g, yield: 64 %).
Step 5: Preparation of compound 20-6
[00456] To a solution of 20-5 (2.0 g, 4.91 mmol) in CH3CN (50 mL) was added
K2CO3 (700
mg, 4.91 mmol), Cs2CO3 (160 mg, 0.49 mmol), Nal (80 mg, 0.49 mmol), and 2-
aminoethan-1-ol
(100 mg, 1.64 mmol). The reaction was stirred at 80 C for 10 hour. The
reaction mixture was
concentrated in vacuo. The crude product was purified by flash column
chromatography
(CH2C12: Me0H =10: 1) to give the target product as yellow oil (600 mg, yield:
50%).
Step 6: Preparation of compound 20-7
[00457] To a solution of 20-6 (300 mg, 0.54 mmol) in CH2C12 (10 mL) was added
SOC12 (150
mg, 1.22 mmol). The reaction was stirred at 30 C for 10 hour. The reaction
mixture
concentrated in vacuo to give the target product as yellow oil (308 mg, yield:
100 %).
Step 7: Preparation of compound 20
[00458] To a solution of 20-7 (300 mg, 0.4 mmol) in THF (10 mL) was added DIEA
(160 mg,
1.19 mmol), Nal (60 mg, 0.4 mmol) and 1-5 (100 mg, 0.8 mmol). The reaction was
stirred at 70
- 149 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
C for 10 hour. The reaction mixture was filtrated concentrated in vacuo. The
crude product
was purified by prep-HPLC to give the target product as colorless oil (40 mg,
yield: 12 %).
1.004591 NMR (400 MHz, CDC13): 60.87 (t, J = 8 Hz, 12H), 1.30-1.36 (m,
54H), 1.45-1.52
(m, 4H), 1.56-1.68 (m, 6H), 1.83-1.88 (m, 4H), 1.97-2.01 (m, 211), 2.21-2.23
(m, 411), 2.43-2.56
(m, 9H), 3.14-3.16(m, 1H), 3.51-3.54 (m, 2H), 4.03-4.07(m, 4H). LCMS: Rt:
1.930 min; MS
m/z (ESI): 835.7 [M+11].
1.004601 The following compounds were prepared in analogous fashion as
Compound 20,
using corresponding starting material.
Compound Characterization
NMR (400 MHz, CDCI3) 5: 0.41-0.48 (m,
4H), 0.87 (t, J = 8 Hz, 12H), 1.46 (s, 53H), 1.52-
1.66 (m, 8H), 1.83-1.93 (m, 4H), 2.21-2.23 (m,
4H), 2.36-2.56 (m, 5H), 2.74-2.79 (m, 4H), 3.58
(s, 2H), 4.03-4.07(m, 4H). LCMS: Rt: 1.480
Compound 24 min; MS m/z (ESI): 821.6 [M+11].
NMR (400 MHz, CC13D) 5: 4.06-4.03 (m,
4H), 3.54-3.52 (m, 2H), 3.10-3.06(m, 1H), 2.63-
2.58 (m, 4H), 2.50-2.41 (m, 6H), 2.22 (d, J=6.8
Hz, 4 H), 1.83-1.72 (m, 4 H), 1.67-1.60 (m, 6H),
1.55-1.30 (m, 6 H), 1.26 (s, 55 H), 0.89-0.86 (m,
12 H). LCMS: Rt: 1.480 min; MS m/z (ESI):
Compound 25 849.7[M+14].
NMR (400 MHz, CDCI3) 5: 0.87 (t, J = 8 Hz,
12H), 1.26 (s, 56H), 1.47-2.01 (m, 16H), 2.21-
2.30 (m, 4H), 2.43-2.85 (m, 7H), 2.88-3.14 (m,
ci50.i.rõ.õ 5H), 3.49 (s, 1H), 3.76 (s, 1H), 4.03-4.07 (m,
4H). LCMS: Rt: 1.440 min; MS m/z (ESI):
Compound 26 864.6 [M+H].
'H NMR (400 MHz, CC13D) 5: 4.06-4.03 (m, 4
H), 3.48 (s, 2 H), 2.55 (d, J=14.4 Hz, 5 H), 2.43
o (s, 6 H), 2.22 (d, J=6.8 Hz, 4 H), 1.83
(d,
Hz, 5 H), 1.69-1.60 (m, 7 H), 1.57-1.29 (m, 14
H), 1.26 (s, 49 H), 0.89-0.86 (m, 12 H). LCMS:
Compound 27 Rt: 1.685 min; MS m/z (ESI):
877.7[M+11].
NMR (400 MHz, CDC13) 8: 0.87 (t, J =8 Hz,
9 12H), 1.25-1.48 (m, 68H), 1.54-1.65 (m,
10H),
1.83-2.00 (m, 5H), 2.27-2.33 (m, 2H), 2.42-2.55
<1_), (m, 10H), 3.13-3.17(m, 111), 3.52-3.54(m,
211),
4.04-4.08(m, 4H). LCMS: Rt: 1.861 min; MS
Compound 44 m/z (ESI): 919.8 [M+11].
- 150 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
41 NMR (400 MHz, CDC13) 8: 0.87 (t, J = 8 Hz,
0
r-------^-0 12H), 1.11-1.26 (m, 5611), 1.56-1.66
(m, 10H),
----- 1.80-2.02 (m, 5H), 2.27-2.34 (m, 2H),
2.41-2.55
HO-------N-NN---,....---,,..--,0 (m, 10H), 3.14-3.18 (m, 1H), 3.51-3.54
(m, 2H),
4.04-4.08 (m, 4H). LCMS: Rt: 1.184 min; MS
Compound 45 m/z (ESI): 835.8 [M+11].
6.22 Example 22: Preparation of Compound 21
ci
HONli
0 ibN.,....".01.1 i
ci5NaBHa - 0 OH 1-3
OH :
OH
21-1 21
Step 1: Preparation of compound 21-1
[00461] A mixture of 4-hydroxycyclohexan-l-one (2.28 g, 20 mmol, 1.0 eq), 2-
aminoethanol
(1.2 g, 20 mmol, 1.0 eq) and titanium tetraisopropanolate (7.4 g, 26 mmol, 1.3
eq) in methanol
(40 mL) was stirred at room temperature under argon atmosphere for 16h. Sodium
borohydride
(757 mg, 20 mmol, 1.0 eq) was then added at 0 C and the resulting mixture was
stirred for an
additional 2 h. The reaction was quenched with water (20 mL) and filtered
through a pad of
Celite, washed with Me0H. The filtration was concentrated under reduced
pressure and purified
by column chromatography (silica gel, DCM/Me0H=20/1-10/1) to give the title
compound (1.3
g, 40 % yield) as yellow oil. LCMS: Rt: 0.320 min; MS miz (ESI): 160.3[M+11].
Step 2: Preparation of compound 21
[00462] To a solution of 1-3 (300 mg, 0.40 mmol, 1.0 eq) and 21-1 (191 mg, 1.2
mmol, 3.0
eq) in THF (10 mL) was added DIEA (258 mg, 2.0 mmol, 5.0 eq) and Nal (12 mg,
0.08 mmol,
0.2 eq). The mixture was stirred at 70 C for 16 hours. LCMS showed the
reaction was
completed. The mixture was evaporated under reduced pressure and purified by
prep HPLC to
give the title compound(60 mg, 17%) as colorless oil.
[00463] III NMR (400 MHz, CDC13) 8: 0.88 (t, J=6.8 Hz, 1211), 1.26 (s, 56H),
1.32-1.53 (m,
411), 1.60-1.68 (m, 711), 1.72-1.89 (m, 3H), 1.99-2.04 (m, 1H), 2.31 (t, J=7.4
Hz, 4H), 2.43-2.49
(m, 6H), 2.50-2.65 (m, 4H), 3.49-3.56 (m, 311), 3.97 (d, J=5.6 Hz, 4H). LCMS:
Rt: 1.02 min;
MS mh (ESI): 879.7[M+Hr.
- 151 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
1.004641 The following compounds were prepared in analogous fashion as
Compound 21,
using corresponding starting material.
Compound Characterization
r"--=-)Lo NMR (400 MHz, CDC13) 8: 0.86-0.90 (m,
12H), 1.17-1.41 (m, 53H), 1.62-1.72 (m, 9H),
o o 2.10-2.13 (m, 2H), 2.32-2.36 (m,
4H), 2.60-2.83
(m, 9H), 2.94-3.10 (m, 5H), 3.69 (s, 2H), 3.96-
OH 3.99 (m, 4H). LCMS: Rt: 1.002 min; MS miz
Compound 22 (ESI):851.7[M+H].
o 111 NMR (400 MHz, CDC13) 8: 0.88 (t, J=6.8 Hz,
r^-"--)1=0 12H), 1.26 (s, 56H), 1.57-1.62 (m, 4H), 1.64-1.67
(m, 8H), 1.77-1.80 (m, 4H), 2.15 (s, 2H), 2.28-
o o 2.32 (m, 4H), 2.44 (s, 4H), 2.60-
2.61 (m, 4H),
F F 3.49-3.50 (m, 2H), 3.96-3.97 (m, 4H).
LCMS: Rt:
Compound 23 1.190 min; MS m/z (ESL): 899.7[M+H].
NMR (400 MHz, CC13D) 8: 3.96 (d, J=5.6 Hz,
o 4 H), 3.79-3.77 (m, 2 H), 3.07-3.03 (m, 1 H),
2.60-2.51 (m, 6 H), 2.42-2.38 (m, 4 H), 2.32-2.28
F10/1.1"N (m, 4 H), 2.04-2.00 (m, 2 H), 1.92-1.85
(m, 2 H),
o o 1.67-1.55 (m, 11 H), 1.46-1.38 (m, 5
H), 1.26 (s,
51 H), 0.90-0.86 (m, 12 H). LCMS: Rt: 1.770
Compound 28 min; MS miz (ES!): 849.7[M+H].
NMR (400 MHz, CC13D) 8: 3.966 (d, J=6 Hz,
O 4 H), 3.599 (s, 2 H), 2.571-2.550 (m, 3 H), 2.324
(s, 5 H), 2.324-2.286 (m, 5 H), 2.034 (d, J=3.6 Hz,
3 H), 1.652-1.596 (m, 12 H), 1.460-4.380 (m, 5
o 0 H), 1.264 (s, 55 H), 0.899-0.836 (m,
12 H).
LCMS: Rt: 1.330 min; MS miz (ES!):
Compound 29 863.6[M+111.
o 111 NMR (400 MHz, CC13D) 8: 3.96 (d, J=6 Hz, 4
H), 3.65-3.62 (m, 2 H), 3.101 (s, 1 H), 2.46 (d,
J=36.4 Hz, 9 H), 2.32-2.28 (m, 4 H), 2.02-1.89
o o (m, .6 H), 1.66-1.55 (m, 11 H), 1.53-
1.36(m, 9H),
1.26 (s, 52 H), 0.90-0.86 (m, 12H). LCMS: Rt:
Compound 30 1.630 min; MS trilz (ESI): 891.7[M+11].
11-1 NMR (400 MHz, CC13D) 8: 3.89 (d, J=4.8 Hz,
4 H), 3.58-3.55 (m, 2 H), 3.01 (d, J=18 Hz, 1 H),
2.37 (d, J=33.2 Hz, 10 H), 2.25-2.21 (m, 411),
6 0 0 1.93 (s, 3H), 1.61-1.54 (m, 12 H), 1.49-
1.46 (m, 7
H), 1.20 (s, 59H), 0.83-0.76 (m, 12 H). LCMS:
Compound 31 Rt: 1.710 min; MS m/z (ESI):919.7[M+11].
- 152 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
IIINMR (400 MHz, CC13D) 8: 3.96 (d, J=6 Hz, 4
H), 3.69 (d, J=4.8 Hz, 1 H), 3.16 (s, 1 H), 2.59-
H Or. 2.35 (m, 7 H), 2.32-2.19 (m, 6 H), 1.99-
1.81 (m, 4
H), 1.81-1.38 (m, 13 H), 1.26 (s, 52H), 1.09-1.03
(m, 4 H), 0.88-0.86 (m, 12 H). LCMS: Rt: 1.660
Compound 32 min; MS m/z (ES!): 849.7[M+11].
111 NMR (400 MHz, CDC13) 8: 0.89 (t, J = 6.6 Hz,
o 12H), 1.13-1.26 (m, 4811), 1.59-1.62 (m, 511),
1.75-1.81 (m, 4H), 1.99-2.01 (m, 2H), 2.02-2.05
(m, 2H), 2.3-2.34 (m, 4H), 2.47-2.49 (m, 4H),
2.51-2.59 (m, 6H), 3.17-3.21 (m, 1H), 3.54-3.55
(m, 2H), 3.96-3.97 (m, 4H). LCMS: Rt: 2.210
Compound 35 min; MS m/z (ES!): 779.7 [M+H].
NMR (400 MHz, CDC13) 8: 0.87 (t, J = 8 Hz,
12H), 1.11-1.26 (m, 49H), 1.41-1.67 (m, 12H),
1.83-1.87 (m, 2H), 1.97-2.00 (m, 2H), 2.30-2.53
(m, 14H), 3.13-3.17(m, 1H), 3.50-3.53 (m, 2H),
o 3.96-3.97 (m, 4H). LCMS: Rt: 1.127 min; MS
Compound 36 m/z (ES!): 807.7 [M+11].
111NMR (400 MHz, CDC13) 8: 0.87 (t, J = 8 Hz,
rwir
12H), 1.26-1.48 (m, 61H), 1.56-1.66 (m, 8H),
0 1.82-1.88 (m, 2H), 1.96-2.02 (m, 2H), 2.28-
2.31
(m, 4H), 2.40-2.55 (m, 10H), 3.13-3.17 (m, 1H),
o 3.51-3.53 (m, 2H), 3.96-3.97 (m, 4H). LCMS: Rt:
Compound 37 1.459 min; MS m/z (ES!): 863.7 [M+111.
111NMR (400 MHz, CC13D) 8: 3.96 (d, J= 6 Hz, 4
rio H), 3.54-3.51 (m, 2 H), 3.16 (d, J= 7.6 Hz,
1 H),
2.56-2.45 (m, 10 H), 2.33-2.30 (m, 4H), 2.04-1.98
(m, 2 H), 1.88-1.73 (m, 6 H), 1.66-1.56 (m, 4 H),
<I> 0-0=-0
1.26 (s, 57 H), 0.90-0.87 (m, 12 H). LCMS: Rt:
Compound 41 1.720 min; MS m/z (ES!): 835.7[M+11].
11-1 NMR (400 MHz, CC13D) 6: 3.90 (d, J= 6.0 Hz,
o 4H), 3.47-3.44 (m, 2H), 3.09 (s, 1 H), 2.49-2.36
(m, 10 H), 2.27-2.24 (m, 4 H), 1.94-1.90 (m, 3 H),
1.82-1.69 (m, 7 H), 1.64-1.57 (m, 6 H), 1.55-1.43
(m, 4 H), 1.19 (s, 53 H), 0.83-0.80 (m, 12 H).
(A)
LCMS: Rt: 1.880 min; MS m/z (ESI):
Compound 42 863.7[M+H].
IIINMR (400 MHz, CC13D) 8: 3.96 (d, J= 6 Hz, 4
o H), 3.53 (s, 2H), 3.18-3.14(m, 1 H), 2.54-2.42
(m, 10 H), 2.31-2.28 (m, 4 H), 1.99 (d, J= 7.2 Hz,
2H), 1.66-1.56 (m, 20H), 1.45-1.38 (m, 4H),
1.26 (s, 55 H), 0.90-0.81 (m, 12 H). LCMS: Rt:
Compound 43 2.034 min; MS m/z (ES!): 919.8[M+11].
- 153 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
IIINMR (400 MHz, CC13D) 8: 3.96 (d, Jr= 4.8 Hz,
4 H), 3.53-3.51 (m, 2 H), 3.16 (s, 1 H), 2.54-2.45
HON N- (ITI, 11 H), 2.33-2.29 (m, 4H), 2.00 (d,
J= 6.8 Hz,
3H), 1.87-1.75(m, 10 H), 1.68-1.56 (m, 6 H),
1.26 (s, 57 H), 0.89-0.86 (m, 12 H). LCMS: Rt:
Compound 47 1.090 min; MS m/z (ESI): 891.8[M+111.
NMR (400 MHz, CC13D) 8: 3.97 (d, J= 5.6 Hz,
4 H), 3.72 (s, 2 H), 3.33-2.87 (m, 11 H), 2.34-2.31
(m, 4 H), 2.07 (s, 3 H), 1.67-1.62 (m, 10 H), 1.27
(s, 48H), 0.90-0.87 (m, 12H). LCMS: Rt: 1.590
Compound 48 mm; MS m/z (ESI): 779.7[114+14
111NMR (400 MHz, CC13D) 8: 3.96 (d, J= 5.6 Hz,
4H), 3.54-3.51 (m, 2H), 3.20-3.12 (m, 1 H),
2.54-2.41 (m, 10 H), 2.33-2.29 (m, 4 H), 2.00-
0 0 1.83 (m, 4 H), 1.66-1.60 (m, 8H), 1.47-
1.43 (m, 4
H), 1.27 (s, 53 H), 0.90-0.87 (m, 12 H). LCMS:
Compound 49 Rt: 1.090 min; MS m/z (ESI):
835.8[M+11].
o 11-1 NMR (400 MHz, CC13D) 8: 3.96 (d, J= 5.2 Hz,
4 H), 3.54 (s, 2 H), 3.18 (s, 1 If), 2.52 (d, J= 34.8,
9 H), 2.33-2.29 (m, 4 H), 2.01-1.89 (m, 4 11),
1.68-1.57 (m, 8 H), 1.48 (s, 411), 1.26 (s, 62 H),
0.90-0.86 (m, 12 H). LCMS: Rt: 0.039 min; MS
Compound 50 m/z (ESI): 891.8[M+11].
o IIINMR (400 MHz, CDC13) 8: 0.82-0.94 (m, 12
H), 1.17-1.38 (m, 58H), 1.39-1.51 (m, 5 H), 1.52-
HON 1.75 (m, 25H), 1.78-1.90 (m, 2H), 1.94-
2.08 (m,
3 H), 2.18-2.36 (m,4 H), 2.38-2.60 (m, 5 H), 3.52
(s, 1 H), 3.96 (d, J=6.0Hz, 2H). LCMS: Rt: 0.093
Compound 51 min; MS m/z (ESI): 947.7 [M+H]t
0
L0C101-121
11-1 NMR (400 MHz, CDC13) 8: 0.87 (t, J = 8 Hz,
C10H21 12H), 1.12-1.33 (m, 77H), 1.44-1.68 (m,
12H),
0,0,,yci0H2, (m, 411), 2.29-2.55 (m, 1411), 3.15-3.19
(m 1H), 3.53-3.55 (m, 2H), 3.95-5.97 (m, 41-1).
C10H21 LCMS: Rt: 0.693 min; MS m/z
Compound 52 (ES1):1003.7rm+Ht
11-1 NMR (400 MHz, CDC13) 8: 0.86-0.89 (m, 6H),
1.31-1.50 (m, 21H), 1.62-1.71 (m, 10H), 1.91-
2.13 (m, 12H), 2.28-2.46 (m, 4H), 2.53-2.56 (m,
10H), 3.12-3.21 (m, 1H), 3.53-3.55 (m, 2H), 4.05-
4.08 (m, 4H), 5.32-5.43 (m, 4H). LCMS: Rt:
Compound 62 0.909 min; MS m/z (ESI): 663.4[M+111.
- 154-
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
0
111 NMR (400 MHz, CDC13) 5: 0.86-0.89 (m,
C81117 12H), 1.10-1.13 (m, 5011), 1.43-1.50 (m,
411),
T 1.51-1.69 (m, 29H), 1.71-1.81 (m, 4H), 2.31-
2.37
0 0
(m, 3H), 3.04-3.10 (m, 2H), 3.40-3.45 (m, 2H),
C8H17 3.96-4.05 (m, 4H), 4.07-4.16 (m, 2H). LCMS:
Rt:
Compound 65 1.470min; MS mlz (ES!): 921.8 [M+11].
r"'a 111 NMR (400 MHz, CDC13) 8: 0.87 (t, J = 8
Hz,
12H), 1.27-1.65(m, 57H), 1.80-2.01 (m, 20H),
2.27-2.55 (m, 14H), 3.13-3.16 (m, 1H), 3.21-3.53
(m, 2H), 3.95-3.97 (m, 4H), 5.30-5.40(m, 8H).
Compound 66 LCMS: Rt: 2.44 min; MS m/z
(ESI):995.8[M+11].
0
1 7
C8Hi7 IIINMR (400 MHz, CDC13) 8: 0.86-0.89 (m,
12H), 1.10-1.33 (m, 5211), 1.38-1.40 (m, 4H),
1.41-1.49 (m, 22H), 1.51-1.67 (m, 3H), 1.83-1.90
c8H17 (m, 2H), 2.31-2.34 (m, 3H), 2.80-2.81 (m,
2H),
0 0
3.01-3.17 (m, 4H), 3.41 (s, 1H), 3.91-3.96 (m,
4H), 7.20-7.26 (m, 2H), 7.32-7.26 (m, 2H).
LCMS: Rt: 1.840min; MS m/z (ES!): 967.8
Compound 76
0
---"*."-----"ss"-}L0"----yC8H 1 7
C8H17 11-1 NMR (400 MHz, CDC13) 8: 0.83-0.89 (m,
ce-o'siC8H17 12H), 0.99-1.47(m, 64H), 1.49-1.71 (m, 10H),
C8H17
1.72-1.91 (m, 3H), 2.15-2.24 (m, 211), 2.25-2.33
(m, 5H), 2.35-2.58 (m, 4H), 2.60-2.71 (m, 6H),
F F 3.47-3.59 (m, 2H), 3.91-3.99 (m, 411). LCMS:
Rt:
Compound 78 1.800min; MS m/z (ES!): 955.8 [M+111.
0
IIINMR (400 MHz, CDC13) 8: 0.79-0.83 (m,
12H), 1.15-1.27 (m, 62H), 1.30-1.48 (m, 4H),
CBH17
1.49-1.59 (m, 6H), 2.21-2.31 (m, 4H), 2.33-2.48
,C8H17 (m, 5H), 2.49-2.54 (m, 6H), 2.56-2.61 (m, 2H),
0 o T
co-ii 3.11-3.17 (m, 1H), 3.45-3.50 (m, 2H), 3.85-
F F ' 3.90(m, 4H). LCMS: Rt: 1.620min; MS m/z
Compound 79 (ES!): 927.7 [M+H].
- 155 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
1H NMR. (400 MHz, CDC13) 5: 0.86-0.92 (m,
0 12H), 1.00-1.23 (m, 1H), 1.32-1.40 (m, 58H),
1.41-1.53 (m, 4H), 1.54-1.69 (m, 6H), 1.70-1.98
C8H17 (m, 3H), 1.99-2.24 (m, 2H), 2.25-2.28 (m, 1H),
C81-117 2.31-2.40 (m, 4H), 2.42-2.52 (m, 3H), 2.55-
2.73
1 7 (m, 3H), 2.74-3.00 (m, 1H), 3.01-3.31 (m,
3H),
0 0 3.51-3.69 (m, 2H), 3.70-3.88 (m, 3H), 3.97-
4.14
60 C8F117 (m, 4H). LCMS: Rt: 1.830min; MS m/z (ES!):
Compound 87 907.7 [M+14].
111 NMR. (400 MHz, CDC13) 5: 0.86-0.89 (t, J=6.8
Hz, 12H), 1.26 (s, 52H), 1.42-1.44 (m, 4H), 1.62-
1.77 (m, 6H), 2.02(m, 1H), 2.32-2.36(m, 4H),
2.504(m, 1H), 2.923(m, 1H), 3.08-3.16(m, 3H),
3.38-3.45(m, 4H), 3.62-3.95(m, 8H), 3.95-3.97
(m, 4H). LCMS: Rt: 2.20 min; MS m/z (ES!):
837.7 [M+111-.
Compound 88
NMR (400 MHz, CDC13) 5: 0.88 (t, J=6.8 Hz,
12H), 1.26 (s, 5411), 1.32-1.51 (m, 411), 1.62-1.68
(m, 10H), 2.31 (t, J=7.4 Hz, 4H), 2.43-2.49 (m,
5H), 2.51-2.65 (m, 5H), 3.32-3.36 (m, 211), 3.47-
3.54 (m, 2H), 3.97 (d, J=6.0 Hz, 4H), 4.01-4.04
(m, 2H). LCMS: Rt: 1.220 min; MS m/z (ESI):
Compound 89 865.7[M+H].
NMR. (400 MHz, CDC13) 5: 0.88 (t, J=6.8 Hz,
12H), 1.26 (s, 50H), 1.32-1.51 (m, 4H), 1.62-1.68
o (m, 8H), 1.81-1.87 (m, 2H), 1.97-2.04 (m,
2H),
2.31 (t, J=7.6 Hz, 4H), 2.40-2.49 (m, 5H), 2.57-
N 2.68 (m, 4H), 3.50-3.55 (m, 3H), 3.64-3.68
(m,
0 0 2H), 3.70-3.78 (m, 1H), 3.93-3.99 (m, 4H).
LCMS: Rt: 1.140 min; MS m/z (ES!):
Compound 90 851.71M-1-Hr.
1H NM.R. (400 MHz, CDC13) 5: 0.88 (t, J=6.8 Hz,
9
12H), 1.26 (s, 56H), 1.47 (s, 4H), 1.61-1.67 (m,
8H), 2.07-2.10 (m, 2H), 2.28-2.32 (m, 5H), 2.42
(s, 6H), 2.63-2.70 (m, 8H), 3.50 (s, 2H), 3.96-3.97
(m, 4H). LCMS: Rt: 1.194 min; MS m/z (ES!):
Compound 91 881.6[M+H].
1H NMR (400 MHz, CDC13) 5: 0.87-0.90 (m,
HO 12H), 1.27-1.32 (m, 58H), 1.44-1.45 (m, 4H),
1.60-1.62 (m, 7H), 1.64-1.66 (m, 411), 1.67-2.05
(m, 3H) 2.29-2.33 (m, 5H), 2.42-2.51 (m, 10H),
2.86-2.91 (m, 1H), 3.96-3.97 (m, 4H). LCMS: Rt:
Compound 92 1.48min; MS m/z (ES!): 889.7[M+H].
- 156-
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
111NMR (400 MHz, CDC13) 8: 0.88 (t, J=6.8 Hz,
12H), 1.26 (s, 58H), 1.32-1.51 (m, 4H), 1.59-1.63
(m, 8H), 1.63-1.65 (m, 2H), 1.81-2.04 (m, 6H),
2.28-2.32 (m, 4H), 2.37-2.41 (m, 8H), 3.25 (m,
OH 1H), 3.54 (s, IH), 3.96-3.97 (m, 4H).
LCMS: Rt:
Compound 93 1.230 min; MS m/z (ES!): 889.7[M+H].
NMR (400 MHz, CDC13) 8: 3.89 (d, J=6 Hz, 4
H), 3.42 (d, J=4.4 Hz, 2 H), 2.90 (d, J=9.2 Hz, 2
HO,
H), 2.55 (d, J=4.4 Hz, 4 H), 2.396 (s, 6 H), 2.25-
a
o o 2.18 (m, 6H), 1.97-1.82(m, 2H), 1.64-
1.53(m, 9
H), 1.42 (s, 4 H), 1.19 (s, 56 H), 0.83-0.76 (m, 12
H). LCMS: Rt: 0.865 min; MS iniz (ES!):
Compound 94 878.8[M+14].
1HNMR (400 MHz, CDC13) 8: 0.87-0.90 (m,
12H), 0.94-0.98 (m, 6H), 1.27-1.30 (m, 48H),
1.41-1.47 (m, 6H), 1.65-1.74 (m, 10H), 1.75-1.80
(m, 6H), 1.92-2.08 (m, 5H), 2.30-2.32 (m, 5H),
2.71-3.05 (m, 8H), 3.59-3.69 (m, 2H), 3.96-3.97
OH (m, 4H). LCMS: Rt: 1.36 min; MS m/z
(ES!):
Compound 99 917.7[M+H].
6.23 Example 23: Preparation of Compound 33
uo
HO
NH, /0 \ NH
<k 33-1
1-3
)
Et0H, RI DIEA, Nat, THF, 70 00 0
33-2
33
Step 1: Preparation of compound 33-2
[00465] To a solution of cyclobutanamine (853 mg, 12 mmol, 1.2 eq) in Et0H (10
mL) was
added 33-1 (1 g, 10 mmol). The reaction mixture was stirred at rt for 16
hours. LCMS showed
the reaction was complete. Removal of solvent, FCC to get the compound 33-
2(450 mg,
26.26%) as colorless oil. LCMS: Rt: 0.690 min; MS miz (ES!): 172.2 [M+H].
Step 2: Preparation of compound 33
[00466] To a mixture of compound 33-2(450 mg, 2.626 mmol, 8.0 eq), DIEA (214
mg, 1.652
mmol, 5.0 eq) in THE (10 mL) was added 1-3 (250 mg, 0.3304 mmol, 1 eq). The
reaction
mixture was stirred at 70 C for 16 hours. LCMS showed the reaction was
complete. After
- 157 -
CA 033.78455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
removal of solvent, the residue was purified by pre-HPLC to give the title
compound (90 mg,
30.55% yield) as colorless oil.
1004671 111 NMR (400 MHz, CDC13) 5: 3.96 (d, J=5.6 Hz, 4 H), 3.51-3.50 (m, 1
H), 3.19-3.11
(m, 1 H), 2.42-2.28 (m, 15 H), 2.02-1.76 (m, 6 H), 1.65-1.60 (m, 9 H), 1.45-
1.30 (m, 7 H), 1.26
(s, 52 H), 0.92-0.87 (m, 15 H). LCMS: Rt: 1.760 min; MS m/z (ESI):
891.8[M+11].
[00468] The following compounds were prepared in analogous fashion as Compound
33,
using corresponding starting material.
Compound Characterization
NMR (400 MHz, CDC13) 5: 0.86-0.89 (m,
15H), 1.27 (s, 66H), 1.38-1.49 (m, 6H), 1.52-
1.64 (m, 9H), 1.93-2.02 (m, 2H), 2.14-2.56 (m,
0 0 14H), 3.08-3.22 (m, 1H), 3.51-3.56 (m,
1H),.
3.97 (d, J=5.6 Hz, 1H). LCMS: Rt: 2.100 min;
Compound 34 MS rniz (ESI):947.8[M+H].
6.24 Example 24: Preparation of Compound 39
/'=
MgBr
DMS0,(COCI)4
Et3N THE DIEA,EDCI,DMAP
39-1 39-2 39-3
I-10 SOC.12
K2CO3,Cs2003 Nal 0 0
39-4 39-5
1-5
0 0 Nal.DIEA
0
.2
394 39
Step 1: Preparation o f compound 39-2
[00469] To a solution of (C0C1)2 (7.85 g, 61.87 mmol) in CH2C12 (120 mL) was
added
DMSO (4.83 g, 61.87 mmol) at -78 C. The reaction was stirred at -78 C for 1
hour. A solution
of 39-1 (5 g, 20.62 mmol) in CH2C12 (30 mL) was added. The reaction was
stirred at -78 C for
2 hour. Et3N (10.43 g, 103.17 mmol) was added. The reaction was stirred at rt
for 5 hour. The
reaction mixture was poured into water (100 ml) and extracted with CH2C12
(3*100 mL). The
combined organic layer was washed with brine, dried over anhydrous Na2SO4 and
concentrated
- 158 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
in vacuo. The crude product was purified by flash column chromatography (PE:
Et0Ac = 20: 1)
to give the target product as yellow oil (4.2 g, yield: 84 %).
Step 2: Preparation of compound 39-3
[00470] To a solution of 39-2 (2.1 g, 8.3 mmol) in THF (100 mL) was added
ethylmagnesium
bromide (9 mL, 18 mmol) at -78 C. The reaction was stirred at -30 C for 1
hour. The reaction
mixture was poured into ice-water (100 ml) and extracted with CH2C12 (3*100
mL). The
combined organic layer was washed with brine, dried over anhydrous Na2SO4 and
concentrated
in vacuo. The crude product was purified by flash column chromatography (PE:
Et0Ac = 10: 1)
to give the target product as yellow oil (1.5 g, yield: 63 %).
Step 3: Preparation of compound 39-4
[00471] To a solution of 39-3 (1.5 g, 5.55 mmol) in CH2C12 (50 mL) was added
DIEA (3.58g.
27.73 mmol), 6-bromohexanoic acid (1.62 g, 8.32 mmol), EDCI (2.13 g, 11.09
mmol), and
DMAP (350 mg, 2.77 mmol). The reaction was stirred at 40 C for 10 hour. The
reaction
mixture was concentrated in vacuo and purified by flash column chromatography
(Et0Ac: PE
=20: 1) to give the target product as yellow oil (1.3 g, yield: 52%).
Step 4: Preparation of compound 39-5
[00472] To a solution of 39-4 (1.13 g, 2.46 mmol) in CH3CN (50 mL) was added
K2CO3 (350
mg, 2.46 mmol), Cs2CO3 (80 mg, 0.25 mmol), Nal (40 mg, 0.25 mmol), and 2-
aminoethan-1-ol
(50 mg, 0.82 mmol). The reaction was stirred at 80 C for 10 hour. The reaction
mixture was
concentrated in vacuo. The crude product was purified by flash column
chromatography
(CH2C12: Me0H =10: 1) to give the target product as yellow oil (300 mg, yield:
46 %). LCMS:
Rt: 1.870 min; MS miz (ES!): 794.7 [M+11].
Step 5: Preparation of compound 39-6
1004731 To a solution of 39-5 (300 mg, 0.37 mmol) in CH2C12 (10 mL) was added
SOC12 (135
mg, 1.13 mmol). The reaction was stirred at 30 C for 10 hour. The reaction
mixture concentrated
in vacuo to give the target product as yellow oil (307mg, yield: 100 %). LCMS:
Rt: 0.250 min;
MS m/z (ES!): 812.7 [M+11].
Step 6: Preparation of compound 39
- 159-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00474] To a solution of 39-6(400 mg, 0.51 mmol) in THF (5 mL) was added DIEA
(150 mg,
1.11 mmol), Nal (60 mg, 0.37 mmol) and 1-5 (85 mg, 0.74 mmol). The reaction
was stirred at
70 C for 10 hour. The reaction mixture was filtrated concentrated in vacuo.
The crude product
was purified by prep-HPLC to give the target product as yellow oil (45 mg,
yield: 13 %).
[00475] 111 NMR (400 MHz, CDC13) 5: 0.87 (t, J= 8 Hz, 18H), 1.11-1.26 (m,
52H), 1.43-
1.68 (m, 17H), 1.83-2.02 (m, 411), 2.28-2.55 (m, 14H), 3.14-3.18 (m, 11-1),
3.51-3.53 (m, 2H),
4.83-4.88 (m, 2H). LCMS: Rt: 1.726 min; MS in/z (ESI):891.8 [M+H].
[00476] The following compounds were prepared in analogous fashion as Compound
39,
using corresponding starting material.
Compound Characterization
o 111NMR (400 MHz, CC13D) 5: 4.96-4.92 (m, 2 H),
3.53-3.51 (m, 2 H), 3.18-3.14 (m, 1 H), 2.55-2.41 (m,
HON 10 H), 2.29-2.51 (m, 4 H), 2.00-1.83 (m,
5H),
o o 1.50 (m, 7 H), 1.47-1.30 (m, 6 H),
1.26 (s, 50 H),
1.19-1.06 (m, 7 H), 0.90-0.83 (m, 12 H).
Compound 38 LCMS: Rt: 1.915 min; MS trilz (ESI):
863.7[M+H].
1H NMR (400 MHz, CDC13) 5: 0.87 (t, J = 8 Hz,
,"\A 0
18H), 1.11-1.26 (m, 54H), 1.41-1.67 (m, 19H), 1.80-
2.02 (m, 4H), 2.26-2.30 (m, 4H), 2.40-2.54 (m, 10H),
0 3.13-3.17(m, 1H), 3.50-3.53 (m, 2H), 4.92-
4.97 (m,
2H). LCMS: Rt: 2.101 min; MS m/z (ESI): 919.8
Compound 40 [M+H].
6.25 Example 25: Preparation of Compound 54
NH- oc20 NHBoc N.NH
B
LiAl4H4 1-3
DCM
OH OH OH
53-1 54-2 544 OH 54
Step 1: Preparation of compound 54-2
1004771 To a solution of 53-1 (575mg, 5.0 mmol, 1.0 eq) in DCM (10 ml) was
added Boc20
(1145 mg, 5.25 mmol, 1.05 eq). The mixture was stirred at RT for 3 hours. LCMS
showed the
- 160 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
reaction was completed. The mixture was concentrated under vacuum, the crude
product was
used to next step without further purification (1.1 g, crude) as yellow oil.
Step 2: Preparation of compound 54-3
[004781 To a solution of 54-2 (1.1 g, 5.11 mmol, 1.0 eq) in dry THF (20 ml)
was added
LiA1114 (970 mg, 25.55 mmol, 5.0eq). The mixture was stirred at 75 C
overnight. Quenched by
15% NaOH solution (5 ml), the mixture was filtered. The organic phase was
evaporated under
reduced pressure. The crude product was used to next step without further
purification (550 mg,
crude) as white solid. LCMS: Rt: 0.380 min; MS m/z (ES!): 130.3[M+H].
Step 3: Preparation of conzpound 54
100479] To a solution of 1-3 (300 mg, 0.397 mmol, 1.0 eq) and 54-3 (153 mg,
1.19 mmol,
3.0eq) in THF (10 mL) was added DIEA (205 mg, 1.59mmo1, 4.0 eq). The mixture
was stirred
at 70 C for 16 hours. LCMS showed the reaction was completed. The mixture was
evaporated
under reduced pressure and purified by prep HPLC to give the title compound
(60 mg, 17.9%) as
colorless oil.
[004801 1H NMR (400 MHz, CDC13) 5: 0.87-0.90 (m, 12H), 1.27-1.33 (m, 54H),
1.43-1.47
(m, 5H), 1.59-1.65 (m, 7H), 1.82-2.03 (m, 411), 2.26-2.32 (m, 7H), 2.40-2.44
(m, 5H), 2.46-2.51
(m, 411), 3.59-3.69 (m, 2H), 3.96-3.97 (m, 411). LCMS: Rt: 1.40 min; MS m/z
(ES!):
849.7[M+H].
[00481] The following compounds were prepared in analogous fashion as Compound
54,
using corresponding starting material.
Compound Characterization
111 NMR (400 MHz, CDC13) 5: 0.88-0.90 (m, 12H),
1.27-1.33 (m, 52H), 1.43-1.46 (m, 4H), 1.63-1.67(m,
o o
6H), 1.76-1.77 (m, 211), 2.12-2.29 (m, 5H), 2.30-2.34
(m, 71-1), 2.41-2.51 (m, 4H), 2.53-2.56 (m, 4H), 3.96-
OH 3.98 (m, 4H). LCMS: Rt: 1.58 min; MS m/z
(ESI):
Compound 59 821.6[M+H].
- 161 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
o
III NMR (400 MHz, CC13D) 8: 0.86-0.90 (m, 12 H),
...N,".,...õ..N 6 1.30-1.32 (m, 66H), 1.47-1.60 (m, 4H), 1.62-
1.67(m, . . 7 H), 1.86-2.05 (m, 4H), 2.28-2.32 (m, 6 H), 2.39-
2.55(m,8 H), 3.57-3.58 (m, 1 H), 3.96-3.97 (d,
OH ./..:6.0Hz 4 H). LCMS: Rt: 2.34 min; MS miz
(EST):
Compound 73 905.7[M-411.
6.26 Example 26: Preparation of Compound 55
0
(----)L0
NH2 HN''''''''
0
QN,
Me0H NaBH4 ' 1::ij 1 -3 1::]
1:-,:i _______________________ ......N...N.---"NN,-", W.
W.
OH OH
53-1 55-2 OH 55
Step 1: Preparation of compound 55-2
[00482] To a solution of 53-1 (500 mg, 4.34 mmol, 1.0 eq) in Me0H (10 ml) was
added
acetaldehyde (191 mg, 4.34 mmol, 1.0 eq). The mixture was stirred at RT
overnight. Then
NaBH4 (200 mg 5.21 mmol, 1.2 eq) was added. The mixture was stirred at RT for
2 hours.
LCMS showed the reaction was completed. The mixture was concentrated under
vacuum, the
residual was purified over column chromatography silica gel (DCM:Me0H=1:0 to
10:1) to give
the desired product 55-2 (200mg, 23.6%) as yellow oil. LCMS: Rt: 0.36 min; MS
m/z (ES!):
144.2[M+H].
Step 2: Preparation of compound 55
[00483] To a solution of 1-3 (300 mg, 0.397 mmol, 1.0 eq) and 55-2 (172 mg,
1.19 mmol,
3.0eq) in THF (10 mL) was added DIEA (205 mg, 1.59mmo1, 4.0 eq). The mixture
was stirred
at 70 C for 16 hours. LCMS showed the reaction was completed. The mixture was
evaporated
under reduced pressure and purified by prep HPLC to give the title compound(82
mg, 23.9%) as
colorless oil.
[00484] 11-1 NMR (400 MHz, CDC13) 8: 0.92-0.93 (m, 12H), 0.95-0.97 (m, 3H),
1.25-1.34 (m,
54H), 1.38-1.42 (m, 5H), 1.53-1.60 (m, 7H), 1.72-1.74 (m, 3H), 1,94-1.95 (m,
2H), 2.21-2.25
(m, 4H), 2.32-2.49(m, 11H), 3.49-3.51 (m, 1H), 3.89-3.90 (m, 4H). LCMS: Rt:
1.63 min; MS
in/z (ES!): 863.6[M+H].
- 162 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
1.004851 The following compounds were prepared in analogous fashion as
Compound 55,
using corresponding starting material.
Compound Characterization
r"=--'1L0
IIINMR (400 MHz, CDC13) 5: 0.86-0.90 (m, 1511),
o o 1.26-1.29 (m, 52H), 1.38-1.48 (m, 6H),
1.62-1.65 (m,
1211), 1.7-1.80 (m, 211), 1.98-2.02 (m, 211), 2.41-2.48
OH (1"11, 1411), 3.52-3.60 (m, 111), 3.96-3.97
(m, 4H).
Compound 56 LCMS: Rt: 1.68 min; MS m/z (ES!):
877.7[M+H].
111 NMR (400 MHz, CDC13) 5: 0.88-0.92 (m, 15H),
1.26-1.36 (m, 5611), 1.43-1.48 (m, 611), 1.59-1.74 (m,
0 0
1111), 2.01-2.03 (m, 2H), 2.29-2.34 (m, 411), 2.42-2.48
0H (m, 11H), 3.54-3.56 (m, 1H), 3.96-3.98 (m,
4H).
Compound 58 LCMS: Rt: 1.56 min; MS m/z (ES!):
891.7[M+H].
0
IHNMR (400 MHz, CDC13) 5: 0.88-0.90 (m, 15H),
1.21-1.26 (m, 5111), 1.40-1.46 (m, 611), 1.56-1.79 (m,
10H), 1.99-2.22 (m, 2H), 2.29-2.37 (m, 10H), 2.39-2.68
(m, 6H), 3.96-3.98 (m, 4H). LCMS: Rt: 1.68 min; MS
Compound 60 m/z (ES!): 849.7[M+H].
0
IHNMR (400 MHz, CDC13) 5: 0.86-0.91 (m, 1511),
C5H i 1.26 (s, 6111), 1.44-1.50 (m, 611), 1.60-
1.66 (m, 811),
o o 1.72-1.81 (m, 111), 1.97-2.02 (m, 211),
2.29-2.33 (m,
411), 2.40-2.50 (m, 71), 2.66-2.72 (m, 211), 2.92-3.04
OH (1"11, 111), 3.52-3.61 (m, 111), 3.96-3.97
(m, 4H). LCMS:
Compound 61 Rt: 1.620 min; MS m/z (ES!): 905.7[M+H].
IHNMR (400 MHz, CDC13) 5: 0.86-0.93 (m, 1511),
o o 1.30-1.36 (m, 6211), 1.39-1.49 (m,
611), 1.59-1.77 (m,
1211), 2.02-2.03 (m, 2H), 2.29-2.33(m, 4H), 2.42-2.51
6H (m, 1211), 3.55-3.57 (m, 1H), 3.96-3.97 (m,
4H).
Compound 67 LCMS: Rt: 2.46 min; MS m/z (ES!):
947.8[M+H].
IIINMR (400 MHz, CDC13) 5: 0.87 (t, J = 8 Hz, 1511),
1.15-1.38 (m, 60H), 1.42-1.92 (m, 19H), 2.28-2.83 (m,
o o
15H), 3.85-3.97 (m, 5H). LCMS: Rt: 0.588 min; MS
Compound 68 m/z (ES!): 919.8 [M+H].
- 163 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
IIINMR (400 MHz, CDC13) 8: 0.87 (t, J= 8 Hz, 1511),
ar0H 1.15-1.38 (m, 63H), 1.42-2.11 (m, 18H), 2.08-2.48 (m,
o o
15H), 3.25-3.30 (m, 1H), 3.95-3.97 (m, 4H). LCMS:
Compound 69 Rt: 0.614 min; MS m/z (ES!): 933.7 [M+H].
r'''===)(o
IIINMR. (400 MHz, CC13D) 8: 0.84-0.93 (m, 15 H),
o o 1.26 (s, 64H), 1.33-1.44 (m, 6H), 1.60-
1.74 (m, 7 H),
1.77 (s, 2H), 2.01 (s, 2H), 2.28-2.32 (m, 4 H), 2.36-2.47
OH (m,1 I H), 2.53-3.56 (m, 1 H), 3.96 (d, J=5.6Hz
4 H).
Compound 70 LCMS: Rt: 0.573 min; MS m/z (ES!): 933.8[M+H].
IIINMR (400 MHz, CCI3D) 8: 0.77-0.83 (m, 15 H),
o o 1.20-1.27 (m, 5811), 1.32-1.38 (m, 611),
1.53-1.60 (m, 6
H), 1.71-1.95 (m, 4H), 2.22-2.31 (m, 4H), 2.33-2.41
OH (m,10 H), 3.48-3.49 (m, 1 H), 3.89-3.90 (m, 4
H).
Compound 71 LCMS: Rt: 1.55 min; MS in/z (ES!): 877.7[M+111.
0
r"-",-A=0=-
IIINMR (400 MHz, CCI3D) 8: 0.86-0.90 (m, 15 H),
0 0 1.27-1.32 (m, 4811), 1.43-1.45 (m, 611), 1.60-1.67 (m, 7
H), 1.78-2.02 (m, 4H), 2.29-2.38 (m, 4 H), 2.40-2.49
OH (111,11 H), 3.54-3.56 (m, 1 H), 3.96-3.97 (d,
J=6.0Hz, 4
Compound 72 H). LCMS: Rt: 2.01 min; MS m/z (EST):
821.7[M+H].
0
N 11-1NMR (400 MHz, CCI3D) 8: 0.86-0.91 (m, 1511),
1.26 (s, 68H), 1.30-1.45 (m, 6H), 1.60-1.67 (m, 7H),
1.77 (s, 2H), 2.02 (s, 2H), 2.28-2.32 (m, 4H), 2.41-2.48
OH (Inj 1 H), 3.53 (s, 1 H), 3.96 (d, J=6.0Hz 4H).
LCMS:
Compound 74 Rt: 0.573 min; MS m/z (ES!): 961.8[M+H].
NMR (400 MHz, CC13D) 8: 0.87-0.91 (m, 15 H),
1.26 (s, 69H), 1.38-1.44 (m, 6H), 1.60-1.67 (m, 8 H),
1.77 (s, 2H), 2.01 (s, 2H), 2.28-2.32 (m, 5 H), 2.40-2.46
OH (Inj 0 H), 3.52-3.57 (m, 1 H), 3.96 (d,
J=5.6Hz, 4 H).
Compound 75 LCMS: Rt: 0.600 min; MS in/z (ES!): 975.8[M+H].
- 164 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.27 Example 27: Preparation of Compound 57
NH:.HN
-3
_______________________ . (ji) ======
0 0
Et0H NaHCO3
OH OH
53-1 57-2 OH 57
Step 1: Preparation of compound 57-2
100486.1 To a solution of 53-1 (300 mg, 2.61 mmol, 1.2 eq) in Et0H (10 ml) was
added 2-
iodopropane (369 mg, 2.17 mmol, 1.0 eq), NaHCO3 (547 mg 6.52 mmol, 3.0 eq).
The mixture
was stirred at 80 C overnight LCMS showed the reaction was completed. The
mixture was
filtered, organic layer was concentrated under vacuum, the residual was
purified over column
chromatography silica gel (DCM:Me0H=1:0 to 10:1) to give the desired product
57-2 (300mg,
88%) as white solid.
Step 2: Preparation of compound 57
[00487] To a solution of 1-3 (300 mg, 0.397 mmol, 1.0 eq) and 57-2 (187 mg,
1.19 mmol,
3.0eq) in THF (10 mL) was added DIEA (205 mg, 1.59mmo1, 4.0 eq). The mixture
was stirred
at 70 C for 16 hours. LCMS showed the reaction was completed. The mixture was
evaporated
under reduced pressure and purified by prep HPLC to give the title
compound(35mg, 10.1%) as
yellow oil.
1004881 1H NMR (400 MHz, CDC13) 5: 0.80-0.83 (m, 12H), 0.93-0.94(m, 6H), 1.19-
1.25 (m,
54H), 1.35-1.40 (m, 4H), 1.53-1.59 (m, 8H), 1.70-1.75 (m, 2H), 1.92-1.94 (m,
2H), 2.18-2.51(m,
14H), 2.89-2.91(m, 1H), 3.46-3.53 (m, IH), 3.89-3.90 (m, 4H). LCMS: Rt: 1.34
min; MS m/z
(ES!): 877.7[M+H].
- 165 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.28 Example 28: Preparation of Compound 46
-OH
Br FicNH2 NH
46-2
0 0
HOOCWB,
EDCIDIEA,DIVIAP 0 K
OH
46-1 46-3 2D03,CsCO3,Nal (;)
0,, 0 46-6 46-8 464
0 K2CO3,0,00, NJa
I
46-5
46-7 464
0 0
ut,
ryjLO
1-3
17
soci,
DIEA,Nal
0
0
46-10
46-11
0
0
46
Step 1: Preparation t)f compound 46-3
1004891 To a solution of 46-1 (2.0 g, 10.25 mmol) in CH2Cl2 (50 mL) was added
DIEA (6.63
g, 51.27 mmol), 46-2 (2.19 g, 15.38 mmol), EDCI (3.93 g, 20.51 mmol), and DMAP
(650 mg,
5.13 mmol). The reaction was stirred at rt for 10 hour. The reaction mixture
was concentrated in
vacuo and purified by flash column chromatography (Et0Ac: PE =20: 1) to give
the target
product as yellow oil (2 g, yield: 64 %).
Step 2: Preparation of compound 46-4
1004901 To a solution of 46-3 (1.6 g, 4.91 mmol) in CH3CN (50 mL) was added
K2CO3 (700
mg, 4.91 mmol), C52CO3 (100 mg, 0.49 mmol), Nal (80 mg, 0.49 mmol), and 2-
aminoethan-1-ol
(100 mg, 0.1.64 mmol). The reaction was stirred at 80 C for 10 hour. The
reaction mixture was
concentrated in vacuo. The crude product was purified by flash column
chromatography
(CH2C12: Me0H =10: 1) to give the target product as yellow oil (300 mg, yield:
61 %). LCMS:
Rt: 0.746 min; MS mh (ESI): 300.2 [M+11].
Step 3: Preparation of compound 46-7
- 166 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00491] To a solution of 46-5 (1.0 g, 16.65 mmol) in THF (20 mL) was added 46-
6(100 mL,
100 mmol). The reaction was stirred at rt for 1 hour. The reaction mixture was
poured into ice-
water (100 ml) and extracted with CH2C12 (3*100 mL). The combined organic
layer was washed
with brine, dried over anhydrous Na2SO4 and concentrated in vacuo. The crude
product was
purified by flash column chromatography (PE: Et0Ac = 10: 1) to give the target
product as
yellow oil (1.0 g, yield: 26 %).
Step 4: Preparation of compound 46-9
[00492] To a solution of 46-7 (0.5 g, 2.19 mmol) in PhMe (30 mL) was added
Ts0H.H20 (40
mg, 0.22 mmol) and 46-8(1.1 g, 6.57 mmol). The reaction was stirred at 130 C
for 2 hour. The
reaction mixture was concentrated in vacuo and purified by flash column
chromatography
(Et0Ac: PE =20: 1) to give the target product as yellow oil (0.5 g, yield: 63
%).
Step 5: Preparation of compound 46-10
[00493] To a solution of 46-4 (300 mg, 1.0 mmol) in CH3CN (20 mL) was added
K2CO3 (420
mg, 3.01 mmol), Cs2CO3 (100 mg, 0.3 mmol), Nal (50 mg, 0.3 mmol) and 46-9 (500
mg, 1.3
mmol). The reaction was stirred at 80 C for 10 hour. The reaction mixture was
concentrated in
vacuo. The crude product was purified by flash column chromatography (PE:
Et0Ac =2: 1) to
give the target product as yellow oil (200 mg, yield: 33 %). LCMS: Rt: 0.915
min; MS rn/z
(ES!): 596.4 [M+H].
Step 6: Preparation qf compound 46-11
1004941 To a solution of 46-10(200 mg, 0.33 mmol) in CH2C12 (10 mL) was added
SOC12
(120 mg, 1.01 mmol). The reaction was stirred at 30 C for 10 hour. The
reaction mixture
concentrated in vacuo to give the target product as yellow oil (206 mg, yield:
100 %). LCMS:
Rt: 1.460 min; MS m/z (ES!): 614.4 [M+H].
Step 7: Preparation of compound 46
[00495] To a solution of 46-11(200 mg, 0.32 mmol) in THF (10 mL) was added
DIEA (130
mg, 0.98 mmol), Na! (50 mg, 0.32 mmol) and 1-3 (75 mg, 0.65 mmol). The
reaction was stirred
at 70 C for 10 hour. The reaction mixture was filtrated concentrated in vacuo.
The crude
product was purified by prep-HPLC to give the target product as yellow oil (20
mg, yield: 9 %).
- 167 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
1004961 111 NMR (400 MHz, CDC13) 8: 0.87 (t, J = 8 Hz, 9H), 1.35-1.68 (m,
22H), 1.72-2.33
(m, 24H), 2.41-2.55 (m, 17H), 3.14-3.18 (m, 1H), 3.50-3.53 (m, 211), 4.61-4.63
(m, 2H), 4.85-
4.89 (m, 1H), 5.50-5.65 (m, 2H). LCMS: Rt: 0.940 min; MS miz (ESI):693.5
[M+H].
100497] The following compounds were prepared in analogous fashion as Compound
46,
using corresponding starting material.
Compound Characterization
11-1 NMR (400 MHz, CC13D) 8: 0.86-0.89 (m, 9 H),
9 1.26-1.71 (m, 40 H), 1.80-1.90 (m, 2 H),
1.96-2.13 (m,
r-"=)(0`)`-'------ 14 H), 2.27-2.55 (m, 14 H), 3.14-3.17 (m, 1
H), 3.51-
3.53 (m, 211), 4.05-4.08 (m, 211), 4.87-4.90 (m, 1H),
o 5.28-5.44 (m, 6H). LCMS: Rt: 1.150min; MS
m/z
Compound 63 (ES!): 815.5[M+11].
0
ifl NMR (400 MHz, CDC13) 8: 0.87 (t, J = 8 Hz,
12H), 1.20-1.32 (m, 53H), 1.43-2.02 (m, 16H), 2.28-
.6 0 0 2.55 (m, 14H), 3.13-3.17 (m, 1H), 3.51-3.53
(m, 2H),
3.95-3.97 (m, 4H). LCMS: Rt: 1.650 min; MS m/z
Compound 77 (ES!): 835.7[M+H].
0
NMR (400 MHz, CDC13) 8: 0.45-0.49 (m, 4H),
0.87 (t, J= 8 Hz, 9H), 1.15-1.67 (m, 60H), 1.89-1.93
0 0 (m, 1H), 2.28-2.79 (m, 14H), 3.55-3.58 (m,
2H), 3.95-
4.07 (m, 4H). LCMS: Rt: 1.160 min; MS rn/z (ES!):
Compound 80 779.6[M+11].
'H NMR (400 MHz, CDC13) 8: 0.87 (t, J =8 Hz, 9H),
0 i.15-2.02(m, 66H), 2.28-2.55 (m, 14H), 3.14-
3.18(m,
1H), 3.51-3.53 (m, 2H), 3.95-4.07 (m, 4H). LCMS:
Compound 81 Rt: 1.330 min; MS m/z (ES!): 793.6[M+11].
NMR (400 MHz, CCI3D) 8: 0.86-0.89(m, 9H),
- 1.26-1.30 (m, 50H), 1.45-1.49 (m, 6H), 1.60-
1.77 (m,
12H), 2.28-2.32(m, 4H), 2.40-2.44 (m, 6H), 2.61-2.62
0 0 (m, 4H), 3.04-3.11 (m, 1H), 3.53-3.54 (m,
2H), 3.96-
4.07 (m, 4H). LCMS: Rt: 1.33 min; MS rn/z (ES!):
Compound 82 807.7[M+11].
NMR (400 MHz, CDC13) 8: 0.86-0.90 (m, 911),
i H23
1.26-1.47 (m, 53H), 1.48-1.58 (m, 4H), 1.60-1.70 (m,
10H), 1.71-1.80 (m, 4H), 2.26-2.34 (m, 5H), 2.36-2.51
0 (m, 6H), 2.52-2.69 (m, 4H), 3.41-3.54 (m,
1H), 3.91-
c8H17 4.03 (m, 2H), 4.04-4.07 (m, 2H). LCMS: Rt:
Compound 83 1.240min; MS miz (ES!): 821.7 [M+11].
- 168 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
0
NMR (400 MHz, CDC13) 5: 0.86-0.90 (m, 911),
1.26-1.47 (m, 54H), 1.48-1.58 (m, 9H), 1.60-1.62 (m,
c H, 2H), 1.63-1.75 (m, 1011), 1.76-1.90(m, 1H),
2.26-2.34
I' 8 (m, 4H), 2.36-2.49 (m, 511), 2.50-2.69 (m,
5H), 3.41-
c8H17 3.54 (m, 1H), 3.91-4.01 (m, 2H), 4.03-4.07 (m, 2H).
Compound 84 LCMS: Rt: 1.230min; MS trilz (EST): 835.7
[M+H].
6.29 Example 29: Preparation of Compound 85
H
HYWer F-3.
211. Firh NatiMS, THFdallio I3C+1
Ts011
854 85-2 554
Cs2C09. Nal
Pd.C. WON SOCl2, DCM
ACN
884
1-3
DEA, Nal TFIF
854 85
Step 1: Preparation of compound 85-1
[00498] A mixture of 6-bromohexanoic acid (10.0 g, 51.3 mmol, 1.0 eq) and
PPh3(13.4 g,
51.3 mmol, 1.0 eq) in ACN (150 mL) was stirred under reflux for 16 hours. LCMS
showed the
reaction was complete. The reaction mixture was cooled to room temperature and
filtered. The
cake was dried under vacuo to give the title compound 85-2 (19.3 g, 82 %) as
white solid.
LCMS: Rt: 0.720 min; MS m/z (ESI): 377.1 [M-Br].
Step 2: Preparation of compound 85-2
[00499] To a mixture of NaHMDS (10.0 mL, 20.0 mmol, 2.0 eq) in TI-IF (50.0 mL)
was
added 85-1 (4.5 g, 10.0 mmol, 1.0 eq) at RT under N2. The reaction mixture was
stirred at 45 C
for 1 hours. The 5-nonanone (1.42 g, 10.0 mmol, 1.0 eq) was added. The
reaction mixture was
stirred at 80 C for 16 hours. TLC showed the reaction was complete. The
mixture was adjusted
to P11=2-3 with 1M HCl and extracted with EA. The mixture was washed with
saturated brine,
dried over Na2SO4. Removal of solvent, FCC (PE/EA-100/1-10/1) to get the
compound 85-2
(2.3 g, crude) as yellow oil. NMR (400 MHz, CDC13) 5: 0.86-0.89 (m, 6H),
1.25-1.34 (m,
12H), 1.34-1.42 (m, 2H), 1.93-2.05 (m, 4H), 2.35-2.42 (m, 2H), 5.05-5.09 (m,
111).
- 169 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
Step 3: Preparation of compound 85-3
[00500] To a solution of 85-2 (0.7 g, 3.0 mmol, 1.0 eq) and 5-bromopentan-1-ol
(0.5 g, 3.0
mmol, 1.0 eq) was dissolved in 20 mL of toluene was added followed by
Ts0111120 (60 mg, 0.3
mmol, 0.1 eq). The mixture was stirred for 2.0 hours at 140 C. Evaporation of
the solvent gave
the crude product which was purified by column (silica gel, 0-2% EA in PE)
chromatography
and the pure product fractions were evaporated to provide the product 85-3
(0.8 g, crude) as a
yellow oil. III NMR (400 MHz, CDCI3) 5: 0.86-0.89 (m, 6H), 1.25-1.34 (m, 9H),
1.51-1.53 (m,
311), 1.63-1.69 (m, 311), 1.86-2.37 (m, 6H), 2.39-2.41 (m, 2H), 3.40-3.43 (m,
4H), 4.06-4.09 (m,
2H), 5.07-5.12(m, 1H).
Step 4: Preparation of compound 85-4
[00501] To a solution of 85-3 (0.8 g, 2.0 mmol, 3.0 eq) and ethanolamine (42
mg, 0.68 mmol,
1.0 eq) in ACN (10.0 mL) was added Cs2CO3 (61.0 mg, 0Ø19 mmol, 0.3 eq),
K2CO3 (261.0 mg,
1.89 mmol, 3.0 eq) and NaI (9 mg, 0.063 mmol, 0.1 eq) at RT. The mixture was
stirred for 16
hours at 85 C. LCMS showed the reaction was completed, the mixture was
evaporated under
reduced pressure and purified by FCC (DCM/Me0H=1/0-20/1) to provide 85-4(0.2
g, 42 %
yield) as yellow oil. LCMS: Rt: 0.945 min; MS m/z (ESI): 678.5 [M+H].
Step 5: Preparation of compound 85-5
1005021 To a solution of 85-4 (0.2 g, 0.3 mmol, 1.0 eq) in Me0H (10 mL) was
added Pd/C
(30 mg). The reaction mixture was stirred at RT for 16 hours under H2. LCMS
showed the
reaction was complete. The mixture was filtered through diatomite. Removal of
solvent to get the
compound 85-5 (200 mg, crude) as brown oil. LCMS: Rt: 1.033 min; MS m/z (ESI):
662.6
[M+H].
Step 6: Preparation of compound 85-6
[00503] To a solution of 85-5 (200.0 mg, 0.29 mmol, 1.0 eq) in DCM (5.0 mL)
was added
5002 (105 mg, 0.88 mmol, 3.0 eq) at RT. The mixture was stirred for 16 hours.
LCMS showed
the reaction was completed, the mixture was evaporated under reduced pressure
to provide 85-6
(0.21 g, crude) as brown oil. LCMS: Rt: 0.585min; MS m/z (ESI): 700.4 [M+H].
Step 7: Preparation of compound 85
- 170 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00504] To a solution of 85-6(200.0 mg, 0.28 mmol, 1.0 eq) and 1-3 (98.0 mg,
0.86 mmol,
3.0 eq) in 11-IF (5.0 mL) was added DIEA (180.0 mg, 1.4 mmol, 5.0 eq) at 0 C.
The mixture
was stirred for 16 hours at 70 C. LCMS showed the reaction was completed, the
mixture was
evaporated under reduced pressure and purified with pre-HPLC to provide 85
(70.0 mg, 32 %
yield) as yellow oil.
[00505] 11-1 NMR (400 MHz, CDC13) 5: 0.79-0.90(m, 12H), 1.21-1.35 (m, 43H),
1.58-1.68
(m, 15H), 1.78-2.02 (m, 4H), 2.27-2.31 (m, 4H), 2.47-2.61 (m, 9H), 3.18 (s,
1H), 3.55 (s, 2H),
4.04-4.08 (m, 4H). LCMS: Rt: 1.330 min; MS miz (ESI): 779.6[M+H].
1005061 The following compounds were prepared in analogous fashion as Compound
85,
using corresponding starting material.
Compound Characterization
IIINMR (400 MHz, CDC13) 5: 0.79-0.90 (m,
12H), 1.21-1.35 (m, 62H), 1.52-1.68 (m, 14H),
o 1.84-2.02 (m, 3H), 2.27-2.47 (m, 4H), 2.48-
0 2.56 (m, 8H), 3.18 (s, 111), 3.52 (s,
2H), 4.04-
4.07 (m, 4H). LCMS: Rt: 0.593 min; MS in/z
Compound 86 (ESI): 891.6[M+11].
6.30 Example 30: Preparation of Compound 64
DiPEA
<%. CfN0 Deivl 0 0
1 64
[00507] To a solution of compound 1 (300 mg, 0.36 mmol, 1.0 eq) and DIPEA (140
mg, 1.08
mmol, 3.0 eq) in DCM (10 mL) was added acetic anhydride (74 mg, 0.72 mmol, 2.0
eq). The
mixture was stirred at RT for 16 hours. LCMS showed the reaction was complete.
The reaction
mixture was concentrated and purified by prep HPLC to give the title compound
(40 mg, 13%
yield) as yellow oil.
[00508] 111 NMR (400 MHz, CDC13) 5: 0.86-0.90 (m, 12H), 1.26(s, 52H), 1.43-
1.48 (m, 4H),
1.58-1.67 (m, 8H), 1.89-1.89 (m, 2H), 1.97-2.06 (m, 6H), 2.30 (t, J=7.4 Hz,
4H), 2.35-2.56 (m,
6H), 2.68-2.73 (m, 2H), 2.94-3.07 (m, 1H), 3.12-3.20 (m, 1H), 3.96-3.97 (m,
4H), 4.09 (t, J=6.0
Hz, 2H). LCMS: Rt: 1.630 min; MS in/z (ESI): 878.6[M+H].
- 171 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.31 Example 31: Preparation of Compound 95
1-3
Dl LA Nat
HO
/CNN __________________
HO THF. 70 C
0 0
1005091 To a mixture of pyrrolidin-3-ol (104 mg, 1.189 mmol, 3.0 eq), DIEA
(256 mg, 1.983
mmol, 5.0 eq) in THF (10 mL) was added 1-3 (300 mg, 0.3965 mmol, 1.0 eq), Nal
(10 mg). The
reaction mixture was stirred at 70 C for 16 hours. LCMS showed the reaction
was complete.
After removal of solvent, the residue was purified by pre-HPLC to give the
title compound (120
mg, 37.49% yield) as yellow oil.
1005101 111NMR (400 MHz, CC13D) 5: 4.33 (d, .1.= 1.6 Hz, 1 H), 3.97 (d, J= 5.6
Hz, 4 H), 2.82
(d, J= 4.8 Hz, 1 H), 2.73 (d, J= 9.6 Hz, 1 H), 2.56-2.50 (m, 5 H), 2.44-2.40
(m, 4 H), 2.32-2.25
(m, 5 H), 1.85-1.74 (m, 4 H), 1.67-1.60 (m, 6 H), 1.49-1.41 (m, 4 H), 1.26 (s,
51 H), 0.90-0.87
(m, 12H). LCMS: Rt: 1.640 min; MS m/z (ESI): 806.7[M+H].
[00511] The following compounds were prepared in analogous fashion as Compound
95,
using corresponding starting material.
Compound Characterization
111 NIVIR (400 MHz, CC13D) 5: 3.96 (d, J= 6 Hz, 4 H),
3.70-3.67 (m, 1 H), 2.80-2.77 (m, 2 H), 2.58-2.54 (m,
9
2 H), 2.43-2.40 (m, 6H), 2.32-2.28 (m, 4 H), 2.18-
Ho-CN N
--\
2.13 (m, 2 H), 1.82-1.77 (m, 4 H), 1.67-1.57 (m, 8 H),
0 1.46-1.38 (m, 4 H), 1.26 (s, 51 H), 0.90-
0.87 (m, 12
. "-0
H). LCMS: Rt: 1.500 min; MS m/z (ESI):
Compound 96 821.7[M+Hj.
NMR (400 MHz, CCI3D) 5: 4.42 (d, J= 5.6 Hz, 1
0 H), 3.97 (d, .1.= 6 Hz, 4H), 3.69-3.65 (m, 2
H), 2.96-
2.92 (m, 2 H), 2.57-2.53 (m, 2H), 2.42-2.37 (m, 6 H),
2.32-2.28 (m, 4H), 1.83 (s, 4 H), 1.67-1.59 (m, 6 H),
c?"'o 1.45-1.40 (m, 4H), 1.27 (s, 49 H), 0.90-0.83
(m, 12
H). LCMS: Rt: 1.310 mm; MS m/z (ESI):
Compound 97 793.7[M+11].
- 172 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.32 Example 32: Preparation of Compound 100
NaCN DIBAL
-
DMF DCM
100-1 100-2 100-3
OH
OH pcc 0 LDA, 100-3 0
DCM
W.=
100-4 1004 1004
0 0
0.
0
100-8
EDCLDIEA,DMAP
DCM
0 0
100-7 loo
Step 1: Preparation of compound 100-2
1005121 The mixture of compound 100-1 (3.0 g, 13.0 mmol, 1.0 eq) and NaCN (940
mg, 19.2
mmol, 1.5 eq) in DMF (30 mL) was stirred at 100 C for overnight. TLC showed
the reaction
was complete. The mixture was diluted with water and brine, concentrated, the
residue was
purified by column chromatography to give product SM1(1.8g, 84% yield) as
colorless oil.
NMR (400 MHz, CDC13) 8: 0.85-0.91 (m, 3H), 1.24-1.39 (m, 6H), 1.69-1.76 (m,
2H), 2.01-2.06
(m, 2H), 2.18-2.23(m, 2H), 2.31-2.36 (m, 2H), 5.25-5.31 (m, 1H), 5.45-5.52 (m,
1H).
Step 2: Preparation of compound 100-3
[00513] To a solution of 100-2 (1.8 g, 11.3 mmol, 1.0 eq) in anhydrous DCM (30
ml) was
added DIBAL (1M in hexane, 13.5 ml, 1.2 eq) at -78 C under inert atmosphere.
The mixture
was stirred for 2h. TLC showed the reaction was complete. The mixture was
diluted with 5M
HC1(a.q, 100 ml) and extracted with DCM, dried, concentrated. The residue was
purified by a
column chromatography to give product 100-3 (1.24 g, 66% yield) as colorless
oil. '14 NMR
(400 MHz, CDC13) 8: 0.86-0.90 (m, 3H), 1.22-1.38 (m, 6H), 1.66-1.74 (m, 2H),
1.98-2.11 (m,
4H), 2.43-2.46(m, 2H), 5.29-5.46 (m, 2H), 9.77 (s, 1H).
Step 3: Preparation of compound 100-5
[00514] A solution of compound 100-4 (2.8 g, 9.1 mmol, 1.0 eq) in DCM (30 ml)
was treated
with a 1:1 dispersion of PCC in silica (5.9 g, 27.2 mmol therefore 11.8 g as a
1:1 mix in silica).
After stirring for 90 min, TLC showed the reaction was complete. The mixture
was filtered and
- 173 -
CA 03178455 2022-09-29
WO 2021/204175
PCT/CN2021/085879
182110784FF
concentrated, the residue was purified by a column chromatography to give
product 100-5 (2.2 g,
78.6% yield) as colorless oil. NMR
(400 MHz, CDCI3) 8: 0.85-0.90 (m, 6H), 1.23-1.37 (m,
12H), 1.61-1.67 (m, 4H), 1.97-2.04(m, 8h), 2.38-2.41 (m, 4H), 5.27-5.43 (m,
Step 4: Preparation of compound 100-6
[00515] To a solution of 100-5 (2.2 g, 7.2 mmol, 1.0 eq) in anhydrous THF (20
ml) was added
LDA (2M in THF, 4.3 ml, 1.2 eq) at -78 C under inert atmosphere. After
stirring for 40 min,
100-3 (1.3 g, 7.9 mmol, 1.1 eq) in 11-IF (10 ml) was added dropwise at -78 C.
After stirring for
lh, the reaction was quenched by the addition of NH4C1(a.q, sat) and extracted
with EA, dried
over Na2SO4 and concentrated. The residue was purified by a column
chromatography to give
product 100-6 (1.2 g, 35%) as colorless oil. 111NMR (400 MHz, CDC13) 8: 0.87-
0.90 (m, 9H),
1.23-1.65 (m, 25H), 1.98-2.08 (m, 12H),2.38-2.62 (m, 4H), 3.74-3.76 (m, 1H),
5.28-5.42 (m,
6H).
Step 5: Preparation qf compound 100-7
1005161 The mixture of 100-6(1.2 g, 2.5 mmol, 1.0 eq), 6-bromohexanoic acid
(650 mg, 3.3
mmol, 1.3 eq), EDCI (650 mg, 3.3 mmol, 1.3 eq), DMAP (60 mg, 0.5 mmol, 0.2
eq), DIEA (980
mg, 7.6 mmol, 3.0 eq) in DCM (30 mL) was stirred at RT for 12 hours. TLC
showed the
reaction was complete. The mixture power in water and washed with EA. The
organic was
separated and dried over Na2SO4. Removal of solvent and purified by FCC to get
the compound
100-7 (1.3 g, 86% yield) as colorless oil.
Step 6: Preparation of compound 100
[00517] To a solution of 100-7(1.2 g, 1.92 mmol, 2.0 eq), 100-8 (300 mg, 0.96
mmol, 1 eq),
K2CO3 (400 mg, 2.88 mmol, 3.0 eq), Cs2CO3 (95 mg, 0.29 mmol, 0.3 eq), Na! (43
mg, 0.29
mmol, 0.3 eq) in ACN (10 mL) was stirred at reflux for overnight. TLC showed
the reaction was
complete. The mixture was concentrated and the residue was purified by Pre-
HPLC to give
product (400 mg, 41 % yield) as colorless oil.
[00518] NMR
(400 MHz, CC13D) 8: 0.87-0.90 (m, 12 H), 1.29-1.32 (m, 30 H), 1.42-1.47
(m, 7H), 1.51-1.58(m, 9H), 1.62-1.71 (m, 1H), i.90-1.98(m, 14H), 2.00-2.06(m,
2H), 2.11-2.58
(m, 12H), 2.70-2.77 (m, 1H), 3.49-3.54 (m, 2H), 4.02-4.10 (m, 2H), 5.04-5.13
(m, 1H), 5.30-5.43
(m, 8H). LCMS: Rt: 1.390 min; MS miz (EST): 884.6[M+H].
- 174 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
6.33 Example 33: Preparation of Compound 101
o o o
SOCl2
110
0 CI
0 0
100 101-2
0 0
1-5 El - OH Ho
= N
0
101
Step 1: Preparation of compound 101-2
100519] The mixture of 100 (200 mg, 0.23 mmol, 1.0 eq) and SOC12 (80 mg, 0.9
mmol, 3.0
eq) in DCM (5 ml) was stirred at RT for 4h. LCMS showed the reaction was
complete. The
mixture was concentrated and the residue was used for the next step without
further purification.
Step 2: Preparation of conzpound 101
100520] The mixture of 101-2 (210mg, 0.23 mmol, 1.0 eq), 1-5 (210mg, 1.84
mmol, 8.0 eq),
DlEA (120 mg, 0.92 mmol, 4.0 eq) in THF (10 ml) was stirred at reflux for 12
hours. LCMS
showed the reaction was complete. The mixture was concentrated and the residue
was purified
by pre-HPLC to give product 101 (79 mg, 36% yield) as colorless oil.
1005211 NMR (400 MHz, CC13D) 5: 0.86-0.90 (m, 12 H), 1.28-1.36 (m, 31H),
1.43-1.57
(m, 7 H), 1.59-1.76 (m, 10 H), 1.83-2.09 (m, 2 H), 2.13-2.32 (m, 16 H), 2.73-
2.80 (m, 1H), 3.05-
3.10 (m, 1H),3.51-3.53 (m, 2H), 4.01-4.08 (m, 2H), 5.01-5.14 (m, 1H), 5.22-
5.44 (m, 8H).
LCMS: Rt: 1.560min; MS mh (ESI): 981.7[M+11].
- 175 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.34 Example 34: Preparation of
Compound 102
Br '0 A!, UCH 1120. THF/H20. 8n0.õ,"Ø"Jto11 t02-3A
102-1 NaH 102-2 1024 EOCI, 01E4. 00,14P 102-4
,co,.K Cs2CO3 ?W.
Pd/C, 11C1, 0100H HO0Jo-Th-, MO/ M6 ,....,^,c{Jto ACN
L./W.
1024 1024
110,,,,,t:lli s
ro--10
SOC12, DC111 cr.-0-Th
Od'IC1= e= D1EA Nal. THF
102-7 1024
(4,0 '-0-^-y"....""v"
102
Step 1: Preparation of compound 102-2
[00522] To a mixture of NaH (600 mg, 15.0 mmol, 1.5 eq) in T.HF (20.0 mL) was
added 102-
1 (1.5 g, 10.0 mmol, 1.0 eq) at RT under Nz. The reaction mixture was stirred
at RT for 1 hours.
Methyl 3-bromopropanoate (2.5 g, 15.0 mmol, 1.5 eq) was added. The reaction
mixture was
stirred at RT for 16 hours. TLC showed the reaction was complete. The mixture
power in water
and washed with EA. The organic was separated and dried over Na2SO4. Removal
of solvent,
FCC (PE/EA=10/1-4/1) to get the compound 102-2 (1.0 g, 42%) as yellow oil.
Step 2: Preparation of compound 102-3
[00523] To a solution of 102-2(1.0 g, 4.2 mmol, 1.0 eq) in 11-IF (6.0 mL) and
1120 (3.0 mL)
was added Li01-1.1120 (0.9 g, 21.0 mmol, 5.0 eq) at RT. The mixture was
stirred for 16 hours.
LCMS showed the reaction was completed, the mixture was adjusted to PH=4-5
with 1M HCl
and extracted with EA. The mixture was washed with saturated brine, dried over
Na2SO4. The
mixture was evaporated under reduced pressure to provide 102-3 (0.8 g, 85 %)
as white solid.
LCMS: Rt: 0.934 min; MS m/z (ESI): 223.1 EM-H].
Step 3: Preparation of compound 102-4
[00524] To a solution of 102-3 (0.8 g, 3.6 mmol, 1.0 eq) and 102-3A (1.2 g,
4.6 mmol, 1.3 eq)
was dissolved in 20 mL of dichloromethane was added followed by
diisopropylethylamine (1.4
- 176 -
CA 03178455 2022-09-29
WO 2021/204175
PCT/CN2021/085879
182110784FF
g, 10.7 mmol, 3.0 eq) and DMAP (43.0 mg, 0.36 mmol, 0.1 eq). After stirring
for 5 min at
ambient temperature, EDC1 (1.0 g, 5.4 mmol, 1.5 eq) was added and the reaction
mixture was
stirred at room temperature overnight after which the TLC showed complete
disappearance of
the starting alcohol. The reaction mixture was diluted with CH2C12 (300 mL)
and washed with
saturated NaHCO3 (100 mL), water (100 mL) and brine (100 mL). The combined
organic layers
were dried over Na2SO4 and solvents were removed in vacuo. Evaporation of the
solvent gave
the crude product which was purified by column (silica gel, 0-5% EA in PE)
chromatography
and the pure product fractions were evaporated to provide the product 102-4
(1.2 g, 71%) as a
colorless oil. NMR (400 MHz, CDC13) 5: 0.86-0.89 (m, 6H), 1.26 (s, 28H),
2.60-2.63 (m,
2H), 3.52-3.66 (m, 5H), 3.75-3.78 (m, 2H), 3.98 (d, J=5.6 Hz, 2H), 4.56 (s,
2H), 7.27-7.34 (m,
5H).
Step 4: Preparation of compound 102-5
[00525] To a solution of 102-4(1.2 g, 2.67 mmol, 1.0 eq) in Me0H (10 mL) was
added Pd/C
(300 mg) and HCl (5 drops). The reaction mixture was stirred at RT for 16
hours under H2.
LCMS showed the reaction was complete. The mixture was filtered through
diatomite.
Removal of solvent to get the compound 102-5 (0.8 g, 78%) as brown oil. NMR
(400 MHz,
CDC13) 5: 0.86-0.89 (m, 6H), 1.26 (s, 30H), 2.60 (t, J=6.0 Hz, 2H), 3.57-3.59
(m, 2H), 3.71-3.78
(m, 4H), 4.02 (d, J=6.0 Hz, 2H).
Step 5: Preparation of compound 102-6
[00526] To a solution of 102-5 (0.8 g, 2.07 mmol, 1.0 eq) in DCM (10.0 mL) and
was added
DMA (0.5 g, 4.1 mmol, 2.0 eq) and MsC1 (0.28g. 2.5 mmol, 1.2 eq) at 0 C. The
mixture was
stirred for 1 hours. TLC showed the reaction was completed, the H20 was added
and extracted
with DCM, dried over Na2SO4. The mixture was evaporated under reduced pressure
to provide
102-6 (0.88 g, 88 %) as yellow oil.
Step 6: Preparation of compound 102-7
[00527] To a solution of 102-6 (0.88 g, 1.9 mmol, 3.0 eq) and ethanolamine (38
mg, 0.63
mmol, 1.0 eq) was dissolved in ACN (10.0 mL) was added Cs2CO3 (61.0 mg, 0Ø19
mmol, 0.3
eq), K2CO3 (261.0 mg, 1.89 mmol, 3.0 eq) and Na! (9 mg, 0.063 mmol, 0.1 eq) at
RT. The
mixture was stirred for 16 hours at 85 C. LCMS showed the reaction was
completed, the
- 177 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
mixture was evaporated under reduced pressure and purified by FCC
(DCM/Me0H=1/0-20/1) to
provide 102-7 (0.42 g, 83% yield) as yellow oil. LCMS: Rt: 1.820 min; MS m/z
(ESI): 798.7
[M+H].
Step 7: Preparation of compound 102-8
1005281 To a solution of 102-7(120.0 mg, 0.15 mmol, 1.0 eq) in DCM (5.0 inL)
was added
SOC12 (53.0 mg, 0.45 mmol, 3.0 eq) at RT. The mixture was stirred for 16
hours. LCMS
showed the reaction was completed, the mixture was evaporated under reduced
pressure to
provide 102-8 (0.14 g, crude) as brown oil. LCMS: Rt: 0.696min; MS m/z (ESI):
816.6 [M+H].
Step 8: Preparation of conzpound 102
100529.1 To a solution of 102-8 (140.0 mg, 0.17 mmol, 1.0 eq) and 1-5 (58.0
mg, 0.52mmo1,
3.0 eq) in THF (5.0 inL) was added DIEA (110.0 mg, 0.85 mmol, 5.0 eq) at 0 C.
The mixture
was stirred for 16 hours at 70 C. LCMS showed the reaction was completed, the
mixture was
evaporated under reduced pressure and purified with pre-HPLC to provide 102
(70.0 mg, 46 %
yield) as yellow oil.
1005301 11-1 NMR (400 MHz, CDC13) 5: 0.79-0.83 (m, 12H), 1.25 (s, 58H), 1.47-
1.60 (m, 4H),
1.88-1.95 (m, 4H), 2.49-2.52 (m, 9H), 2.64-2.67 (m, 4H), 3.01 (s, 1H), 3.46-
3.49 (m, 6H), 3.61-
3.64 (m, 411), 3.91 (d, J=6.4 Hz, 411). LCMS: Rt: 1.510 min; MS m/z (ESI):
895.7[M+H].
1005311 The following compounds were prepared in analogous fashion as Compound
102,
using corresponding starting material.
Compound Characterization
ojl,
0 11-1 NMR (400 MHz, CDC13) 5: 0.86-0.90 (m,
1211),
1.25 (s, 61H), 1.62 (s, 411), 2.54-2.70 (m, 511), 2.75-
2.89 (m, 5H), 3.17 (s, 2H), 3.62-3.72 (m, 1311), 4.04
L----... (d, J=6.0 Hz, 411), 4.13 (s, 4H). LCMS: Rt:
1.903
Compound 103 min; MS in/z (ESI): 955.7N+I-11.
r^ejo NMR (400 MHz, CDC13) 5: 0.86-0.90 (m,
12H),
HON 1.25 (s, 6211), 1.54-1.87 (m, 711), 2.39-
2.59 (m, 1011),
2.72 (s, 511), 3.43-3.56 (m, 6H), 3.67-3.71 (m, 4H),
3.98 (d, J=6.0 Hz, 411). LCMS: Rt: 2.050 min; MS
Compound 104 m/z (ESI): 923.7[M+H].
- 178 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
6.35 Example 35: Preparation of Compound 105
HO HO's"...0N511: 0 MsCI, DIEA DCM
0 _____________________________________________________________________ lc=
105-3
204 105-2
soc:2 1.5 0
0
105-4 105-5
0
HN
rco
105
Step 1: Preparation of compound 105-2
[00532] To a solution of 20-4 (5.0 g, 18.49 mmol) in DMF (150 mL) was added
DIEA (7.17
g, 55.46 mmol), 105-1 (2.29 g, 22.18 mmol) and HAW (10.54 g, 27.73 mmol). The
reaction
was stirred at RT for 10 hour. The reaction mixture was poured into water (200
ml) and
extracted with Et0Ac (3*200 mL). The combined organic layer was washed with
brine, dried
over anhydrous Na2SO4 and concentrated in vacuo. The crude product was
purified by flash
column chromatography (Et0Ac) to give the target product as yellow oil (4 g,
yield: 61 %).
Step 2: Preparation qf compound 105-3
[00533] To a solution of 105-2 (4.0 g, 11.25 mmol) in CH2C12 (100 mL) was
added DIEA
(4.36 g, 33.75 mmol) and MsC1 (1.93 g, 16.87 mmol). The reaction was stirred
at rt for 1 hour.
The reaction mixture was poured into water (100 ml) and extracted with CH2C12
(3*100 mL).
The combined organic layer was washed with brine, dried over anhydrous Na2SO4
and
concentrated in vacuo to give the target product as yellow oil (3.1 g, yield:
63%).
Step 3: Preparation of compound 105-4
[00534] To a solution of 105-3 (2.1 g, 4.91 mmol) in CH3CN (50 mL) was added
K2CO3 (700
mg, 4.91 mmol), Cs2CO3 (160 mg, 0.49 mmol), Nal (80 mg, 0.49 mmol), and 2-
aminoethan-l-ol
(100 mg, 1.64 mmol). The reaction was stirred at 80 C for 10 hour. The
reaction mixture was
concentrated in vacuo. The crude product was purified by flash column
chromatography
(CH2C12: Me0H =10: 1) to give the target product as yellow oil (800 mg, yield:
66%).
Step 4: Preparation of compound 105-5
- 179 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00535] To a solution of 105-4(300 mg, 0.4 mmol) in CH2C12 (10 mL) was added
SOC12 (145
mg, 1.22 mmol). The reaction was stirred at 30 C for 10 hour. The reaction
mixture
concentrated in vacuo to give the target product as yellow oil (300 mg, yield:
100 %). LCMS:
Rt: 1.022min; MS m/z (EST): 754.6 [M+H].
Step 5: Preparation of conzpound 105
[00536] To a solution of 105-5 (300 mg, 0.4 mmol) in TI-IF (10 mL) was added
DIEA (155
mg, 1.19 mmol), Na! (60 mg, 0.4 mmol) and 1-5 (100 mg, 0.8 mmol). The reaction
was stirred
at 70 C for 10 hour. The reaction mixture was filtrated concentrated in vacuo.
The crude
product was purified by prep-HPLC to give the target product as colorless oil
(30 mg, yield: 9
[00537] 111 NMR (400 MHz, CDC13) 8: 0.87(t, J = 8 Hz, 1214), 1.25-1.36(m,
51H), 1.44-1.65
(m, 10H), 1.83-2.07 (m, 12H), 2.42-2.55 (m, 10H), 3.15-3.27 (m, 5H), 3.52-3.54
(m, 2H), 5.85-
5.88 (m, 2H). LCMS: Rt: 0.945 min; MS in/z (ES!): 833.7 [M+H].
[00538] The following compounds were prepared in analogous fashion as Compound
105,
using corresponding starting material.
Compound Characterization
1H NMR (400 MHz, CDC13) 8: 0.42-0.47
N (m, 4H), 0.87 (t, J = 8 Hz, 12H), 1.25-1.33
(m, 52H), 1.42-1.54 (m, 8H), 1.85-1.93 (m,
4H), 2.05-2.07 (m, 4H), 2.38-2.54 (m, 6H),
N 2.72-2.79 (m, 4H), 3.21-3.26 (m, 4H), 3.56-
3.58 (m, 2H), 5.78-5.81(m, 2H). LCMS: Rt:
Compound 113 0.930 min; MS rn/z (EST): 819.7
[M+H].
NMR (400 MHz, CDC13) 8: 0.87 (t, J =8
N Hz, 12H), 1.18-1.35 (m, 52H), 1.40-1.55
(m, 1011), 1.59-1.85 (m, 911), 2.05-2.07 (m,
N N
4H), 2.41-2.49 (m, 6H), 2.58-2.63 (m,4H),
H N 3.04-3.08 (m, 1H),3.22-3.27 (m, 4H), 3.52-
0 3.54 (m, 2H), 5.82-5.85(m, 2H).
LCMS: Rt:
Compound 114 0.946 min; MS rrilz (ES!): 847.7
[M+H].
- 180-
CA 03178455 2022-09-29
WO 2(121/2(14175
PCT/CN2021/085879
182110784FF
NMR (400 MHz, CDC13) 8: 0.87 (t, J =8
0 Hz, 12H), 1.18-1.35 (m, 49H), 1.46-
1.86
HN
O (m, 24H), 2.05-2.07 (m, 4H), 2.43-2.62 (m,
11H), 3.22-3.27 (m, 4H), 3.47-3.50 (m, 2H),
5.83-5.84(m, 2H). LCMS: Rt: 0.952 min,
Compound 115 MS m/z (ESI): 861.7 [Win
111 NMR (400 MHz, CDC13) 5: 0.87 (t, J 8
0 Hz, 12H), 1.29-1.38 (m, 42H), 1.42-1.85 NN a HO HN
O (m, 32H), 2.05-2.07 (m, 5H), 2.42-2.59 (m,
11H), 3.22-3.27 (m, 4H), 3.48-3.50 (m, 2H),
5.83-5.84(m, 2H). LCMS: Rt: 0.973 min;
Compound 116 MS miz (ESI): 875.8 [MAI].
NMR (400 MHz, CCI3D) 8: 5.83 (s, 2
H), 3.54 (s, 2 H), 3.50-3.48 (m, 2
3.22 (m, 4 H), 2.58-2.54 (m, 5 H), 2.42 (s, 6
HN
O H), 2.06 (d, J=6.8 Hz, 4 H), 1.86-1.68 (m, 8
H), 1.53-1.45 (m, 10 H), 1.25 (s, 65 H),
0.90-0.86 (m, 12 H). LCMS: Rt: 1.384 min;
Compound 144 MS miz (ESI): 931.8[M+11].
6.36 Example 36 : Preparation of Compound 106
CRHs7
HONH2 106-3 CsH
O
1-1 106-2
SOCl2 H 1-5
0 N 0 N
106.4 106-5
0
0-,=N
H
106
Step I: Preparation of compound 106-2
[00539] To a solution of compound 1-1 (10g. 23.9 mmol) in CH3CN (150 mL) were
added
K2CO3 (9.9 g, 71.7 mmol), Cs2CO3 (2.3 g, 7.17 mmol), Nal (1.1 g, 7.17 mmol),
and 2-
aminoethan-1-ol (2.9 g, 47.8 mmol). The reaction mixture was stirred at 80 C
for 16 hours.
The reaction mixture was concentrated in vacua. The crude product was purified
by flash
- 181 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
column chromatography (CH2C12 : Me0H =20:1-10: 1) to give the target product
as yellow oil
(5.1 g, yield: 53 %). LCMS: Rt: 0.880 min; MS m/z (ES!): 400.3 [M+H].
Step 2: Preparation of compound 106-4
[00540] To a solution of compound 106-2 (5.1 g, 12.8 mmol) in CH3CN (100 mL)
were added
K2CO3 (5.3 g, 38.4 mmol), Cs2CO3 (1.25 g, 3.84 mmol), Na! (576 mg,3.84mm01)
and compound
106-3 (5.4 g, 12.8 mmol). The reaction was stirred at 80 C for 16 hours. TLS
showed the
reaction was complete. The reaction mixture was concentrated in vacuo. The
crude product was
purified by flash column chromatography (CH2C12 : Me0H =20: 1) to give the
target product as
yellow oil (7.1 g, yield: 75 %). LCMS: Rt: 1.060 min; MS m/z (ES!): 737.6
[M+H].
Step 3: Preparation of compound 106-5
[00541] To a solution of compound 106-4(7.1 g, 9.6 mmol) in CH2C12 (50 mL) was
added
50C12 (3.4g, 28.8 mmol). The reaction was stirred at 30 C for 16 hours. The
reaction mixture
concentrated in vacuo. The residue was diluted with EA (50 mL) and washed with
saturated
NaHCO3 solution (pH of the aqueous layre was between 8 and 9), water (50 mL)
and brine (50
mL). The combined organic layers were dried over Na2SO4 and solvents were
removed in
vacuo. The crude product was purified by column chromatography (silica gel,
PE/EA=5/1-3/1)
to provide the title compound 106-5 (2.0 g, 28%) as a yellow oil. LCMS: Rt:
1.470 min; MS m/z
(ES!): 755.6 [M+H].
Step 4: Preparation of compound 106
[005421 To a solution of compound 106-5 (1.7 g, 2.2 mmol) in THF (50 mL) was
added DIEA
(1.4 g, 11.0 mmol), Nal (66 mg, 0.44mm01) and compound 1-5 (760 mg, 0.79
mmol). The
reaction was stirred at 70 C for 16 hours. The reaction mixture was filtrated
concentrated in
vacuo. The crude product was purified by column chromatography (silica gel,
DCM/Me0H=100/1-40/1) to give the target product (1.3 g).
[00543] 11-1 NMR (400 MHz, CDC13) 6: 0.87 (t, J = 8 Hz, 12H), 1.22-1.46 (m,
53H), 1.47-1.52
(m, 6H), 1.53-1.67 (m, 6H), 1.83-1.87 (m, 3H), 1.98-2.01 (m, 2H), 2.15-2.19(m,
2H), 2.29-2.32
(m, 2H), 2.42-2.55 (m, 10H), 3.13-3.19 (m, 2H), 3.51-3.53 (m, 2H), 3.95-
3.97(m, 2H), 5.56-5.57
(m, 1H). LCMS: Rt: 0.999min; MS m/z (ES!): 834.8 [M+H].
- 182 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
1.005441 The following compounds were prepared in analogous fashion as
Compound 106,
using corresponding starting material.
Compound Characterization
1.1.1 NMR (400 MHz, CC13D) 8: 5.47 (s, 1 H), 3.89
(d, J=5.6 fiz, 2 H), 3.51-3.48 (m, 2 H), 3.12-3.09
o (m, 2 H), 2.72-2.64 (m, 4 H), 2.46 (s, 2 H), 2.33-
2.21 (m, 6 H), 2.12-2.08 (m, 2 H), 1.85 (s, 1 H),
1.59-1.53 (m, 6H), 1.37 (d, J=8.4 Hz, 5 H), 1.19
o o (s, 52 H), 0.83-0.79 (m, 12 H), 0.40-
0.35 (m, 4
H). LCMS: Rt: 1.040 min; MS miz (ESI):
Compound 109 820.6[M+H].
11-1 NMR (400 MHz, CDC13) 8: 0.86-0.89 (m,
o 12H), 1.26 (s, 56H), 1.43-1.68 (m, 14H), 1.81-
1.87 (m, 2H), 1.97-2.04 (m, 2H), 2.19-2.26 (m,
HON H 2H), 2.40-2.90 (m, 10H), 3.17 (t, J=6.0
Hz, 2H),
3.64-3.66 (m, 1H), 3.70-3.78 (m, 1H), 3.94-3.98
(m, 2H). LCMS: Rt: 1.070 min; MS m/z (ESI):
Compound 126 848.6[M+H].
NMR (400 MHz, CDC13) 6: 0.79-0.83 (m,
o 12H), 1.26-1.30 (m, 56H), 1.40-1.52(m, 6H),
1.54-1.62(m, 6H), 1.67-1.69(m, 4H), 2.08-2.21
(m,2H), 2.32-2.35 (m, 2H), 2.49-2.51 (m, 7H),
a 2.52-2.54 (m, 4H), 3.09-3.12 (m, 2H),
3.39-3.42
(m, 2H), 3.89-3.90 (m, 2H), 5.55 (s, 1H). LCMS:
Compound 127 Rt: 1.230 min; MS m/z (ESI): 862.7[M+H].
NMR (400 MHz, CDC13) 8: 0.86-0.90 (m,
o 12H), 1.26-1.30(m, 5411), 1.38-1.51 (m, 1011),
r's---kti' 1.65-1.69 (m, 8H), 1.73-1.81 (m,2H), 2.15-2.32
(m, 4H), 2.38-2.58 (m, 11H), 3.19-3.16 (m, 2H),
o o 3.47-3.49 (m, 2H), 3.96-3.97 (m,
2H), 5.62 (s,
1H). LCMS: Rt: 1.250 min; MS rniz (ESI):
Compound 128 876.7[M+H].
111 NMR. (400 MHz, CDC13) 8: 0.87 (t, J = 8 Hz,
15H), 1.27-1.79 (m, 70H), 1.99-2.01 (m, 2H),
o o 2.14-2.24 (m, 2H), 2.35-2.47 (m,
14H), 3.16-3.19
(1Lrj (m, 2H), 3.54-3.55 (m, 1H), 3.96-3.97 (m,
2H),
OH 5.45-5.47 (m, 1H). LCMS: Rt: 1.45 min; MS
m/z
Compound 133 (EST): 876.7 [M+H].
- 183-
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
0
'H NMR (400 MHz, CC13D) 8: 5.60 (s, 1 H), 3.96
(d, J= 5.6 Hz, 2 H), 3.53 (s, 2 H), 3.19-3.06 (m, 3
N
H), 2.62-2.43 (m, 10 H), 2.32-2.29 (m, 2 H), 2.19-
2.15 (m, 2 H), 1.75-1.48 (m, 10 H), 1.40 (s, 7 H),
1.26 (s, 62 H), 0.90-0.86 (m, 12 H). LCMS: Rt:
Compound 136 1.630 min; MS in/z (ES!): 904.8[M+Il].
111NMR (400 MHz, CC13D) 8: 5.59 (s, 1 H), 3.96
o (d, J= 5.6 Hz, 2 H), 3.49-3.46 (m, 2 H), 3.19-3.16
(m, 2 H), 2.62-2.56 (m, 4 H),2.32 (s, 7 H), 2.32-
2.28 (m, 2 H), 2.19-2.15 (m, 2 H), 1.78-1.60 (m,
o o 11 H), 1.48-1.46 (m, 6H), 1.26 (s, 64
H), 0.90-
0.86 (m, 12 H). LCMS: Rt: 1.710 min; MS m/z
Compound 138 (ES!): 918.8[M+11].
111NMR (400 MHz, CC13D) 8: 5.59 (s, 1 H), 3.96
(d, J 5.6 Hz, 2 H), 3.50-3.47 (m, 2 H), 3.19-3.16
(m, 2 H), 2.58-2.52 (m, 5 H), 2.42 (s, 6 H), 2.32-
2.28 (m, 2 H), 2.19-2.15 (m, 2 H), 1.82-1.78 (m, 3
H), 1.67-1.62 (m, 6 H), 1.47-1.45 (m, 8 H), 1.26
(s, 66 H), 0.90-0.86 (m, 12 H). LCMS: Rt: 1.750
Compound 139 min: MS m/z (ESI): 932.8[M+111.
111 N. MR (400 MHz, CDC13) 8: 5.61 (s, 1 H), 3.96
(d, J= 6.0 Hz, 2 H), 3.54-3.51 (m, 2 H), 3.19-3.16
(m, 2 H), 3.09-3.06 (m, 1 H), 2.62-2.59 (m, 4 H),
2.49-2.41 (m, 6 H), 2.32-2.29 (m, 2 H), 2.19-2.15
N
(m, 2 H), 1.78-1.72 (m, 2H), 1.67-1.60 (m, 7 H),
o 1.50-1.46 (m, 7 H), 1.26 (s, 47K), 0.90-0.87 (m,
12 H). LCMS: Rt: 1.030 min; MS m/z (ES!):
Compound 140 792.7[M+H].
11-1 NMR (400 MHz, CDC13) 8: 5.58 (s, 1 H),
o 3.96-3.97 (d, J= 6.0 Hz, 2 H), 3.46-3.49 (m, 2H),
3.19-3.16 (m, 2 H), 2.42-2.58 (m, 12 H), 2.29-
2.34 (m, 2H), 2.15-2.22 (m, 2H), 1.76-1.81 (m, 3
H), 1.59-1.67 (m, 10 H), 1.52-1.58 (m, 12 H),
1.26-1.33(m. 40 H), 0.90-0.87 (m, 12 H). LCMS:
Compound 141 Rt: 1.09 min; MS m/z (ES!): 820.7[M+11]
0
IIINMR (400 MHz, CDC13) 8: 0.86-0.90 (m, 9
H23
H), 1.26 (s, 49 H), 1.47 (s, 5H), 1.56-1.68 (m, 8
H), 1.83-2.00 (m, 4 H), 2.16-2.19 (m, 2 H),
H I 32.32 H) (m,35 21 H), 2.44-2.56 (m, 10 H),
3.16-3.19 (m,
0
, . -3 .5
4 (m, 2H), 4.03-4.07 (m, 2H), 5.60
C8F117 (s, 2H). LCMS: Rt: 1.120 min; MS m/z (ES!):
Compound 146 792.6[M+H].
- 184-
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
0 111NMR (400 MHz, CDC13) 8: 0.78-0.93 (m, 9
r ,...).1.,o,.Ci iH23 H), 1.14-1.39 (m, 50 H), 1.40-1.55
(m, 8 H), 1.56-
1.70 (m, 8 H), 1.71-1.82 (m, 4 H), 2.11-2.20 (m, 2
H), 2.25-2.34 (m, 2 H), 2.35-2.53 (m, 5 H), 2.54-
6 0, N ,,,,,,,..,..Ceili 7 '
H 2.68 (m 4 H), 2.99-3.13 (m, 1 H), 3.14-
3.22 (m, 2
H), 3.46-3.61 (m, 2 H), 3.96-4.12 (m, 2 H).
C8H17 LCMS: Rt: 1.370 min; MS m/z (ES!):
Compound 147 806.7[M+11].
0
IFT NMR (400 MHz, CDC13) 8: 0.86-0.89 (m, 9H),
1.16-1.21 (m, 55H), 1.48-1.57(m, 5H), 1.59-1.68
--,--...s.,,- N -,..._,,,,--..,..,,,-,=.õ, (m, 7H), 1.78 (s, 4H), 2.16-2.20
(m, 2H), 2.28-
a 1.4 2.32 (m 2H) 2.44-2.62 (m 10H) 3.15-3.18
(m
..,.. .^..,,-C8-17 ' ' ' ' '
0 N
H 2H), 3.49 (s, 2H), 4.05 (t, J=6.8 Hz,
2H), 5.62 (s,
C81-117 1H). LCMS: Rt: 1.201 min; MS m/z (EST):
Compound 148 820.71M-fill
0
0_C1 1H23
IIINMR (400 MHz, CDC13) 8: 0.78-0.93 (m, 9
H), 1.14-1.39(m, 48H), 1.37-1.82 (m, 26H),
a 0.õ..N.====.,,,,,C8F117 2.11-2.20 (m, 2H), 2.25-2.34 (m,
2H), 2.36-2.63
H rs (m, 10 H), 3.14-3.22(m, 2H), 3.49(s, 2H),
3.96-
....,8, ,.., .17 4.12 (m, 2H). LCMS: Rt: 1.300 min; MS m/z
Compound 149 (EST): 834.7 [M+II].
0 IIINMR (400 MHz, CDC13) 8: 0.80-0.92 (m, 9
H), 1.16-1.37 (m, 50 H), 1.38-1.51 (m, 5 H), 1.54-
1.77 (m, 13 H), 1.87-1.96 (m, 1 H), 2.12-2.21 (m,
2H), 2.25-2.34 (m, 2H), 2.35-2.45 (m, 3 H),
A '-.1..C8- 1_, 2.48-2.57 (m, 1 H), 2.67-2.82 (m, 3 H), 3.11-
3.24
17 (m, 2 H), 3.51-3.62 (m, 2 H), 4.01-4.11 (m, 2 H).
H
C8H17 LCMS: Rt: 1.050 min; MS m/z (ES!): 778.6
Compound 151 [M+Fl].
6.37 Example 37 : Preparation of Compound 107
'IN./N./J(0H
Hz14 H
K2CO3 Cs2CO3 ACN 1
00,N
HATU, DIEA, DMF
106-3
107-1 H
107-3
HO,,,,,NH .JL
SOC. Dcm r .>.;.3
> 0-----N
.6 0 m
H
107
107-4
Step 1: Preparation of compound 106-3
- 185-
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00545] To a solution of 107-1 (240.0 mg, 1.0 mmol, leq) and 6-bromohexanoic
acid (289.0
mg, 1.5 mmol, 1.5eq) in DMF (5.0 mL) was added HATU (494.0 mg, 1.3 mmol,
1.3eq) and
DMA (387.0 mg, 3.0 mmol, 3.0eq) at RT. The mixture was stirred for 16 hours.
LCMS showed
the reaction was completed, EA (100.0 mL) was added, wash with saturated
brine, dried over
Na2SO4, the mixture was evaporated under reduced pressure. The residue was
purified with a
flash column chromatography (PE/EA=10:1-4:1)to provide 106-3 (300 mg, 72 %
yield) as
colorless oil.
Step 2: Preparation of compound 107-3
[00546] To a solution of 107-2(0.29 g, 0.7 mmol, 2.5 eq) and 2-aminoethan-1-ol
(17.0 mg,
0.27 mmol, 1.0 eq) in ACN (15.0 mL) was added K2CO3 (115.0 mg, 0.83 mmol, 3
eq), Cs2CO3
(27.0 mg, 0.08 mmol, 0.3 eq) and NaI (3.0 mg, 0.028 mmol, 0.1 eq) at RT. The
mixture was
stirred for 24 hours at 80 C. LCMS showed the reaction was completed, the
mixture was
evaporated under reduced pressure and purified with FCC (DCM/Me0H=1/0-10/1) to
provide
107-3 (0.2 g, 90% yield) as colorless oil.
Step 3: Preparation qf compound 107-4
1005471 To a solution of 107-3 (0.2 g, 0.27 mmol, 1.0 eq) in CHC13 (15.0 mL)
was added
SOC12 (94.0 mg, 0.81 mmol, 3.0 eq) at RT. The mixture was stirred for 16
hours. LCMS
showed the reaction was completed, the mixture was evaporated under reduced
pressure to
provide 107-4 (170.0 mg, crude) as brown oil.
Step 4: Preparation of compound 107
[00548] To a solution of 107-4(170 mg, 0.225 mmol, 1.0 eq) and 1-5 (77 mg,
0.675 mmol,
3.0 eq) in THF (5.0 mL) was added DIEA (145 mg, 1.125 mmol, 5.0 eq) at 0 C.
The mixture
was stirred for 16 hours at 70 C. LCMS showed the reaction was completed, the
mixture was
evaporated under reduced pressure and purified with pre-HPLC to provide 107
(90.0 mg, 48%
yield) as brown oil.
[00549] NMR (400 MHz, CDC13) 8: 0.86-0.90 (m, 12H), 1.30-1.34 (s, 52H),
1.46-1.58 (m,
6H), 1.62-1.69 (m, 61-1), 1.83-1.88 (m, 2H), 1.98-2.00 (m, 2H), 2.16-2.20 (m,
4H), 2.42-2.56 (m,
10H), 3.14-3.18(m, 4H), 3.52-3.54(m, 2H), 5.71 (s, 2H). LCMS: Rt: 1.018 min;
MS miz (ESI):
833.7[M+H].
- 186-
CA 03178455 2022-09-29
WO 2021/204175
PCT/CN2021/085879
182110784FF
[00550] The following compounds were prepared in analogous fashion as Compound
107,
using corresponding starting material.
Compound Characterization
III NMR (400 MHz, CDC13) 8: 0.42-0.47 (m, 4H),
0.88-0.92 (m, 1211), 1.26 (m, 48H), 1.43-1.50 (m,
6H), 1.61-1.68 (m, 8H), 1.91-2.02 (m, 2H), 2.15-
4 2.19 (m, 4H), 2.37-2.41 (m, 4H),2.51-2.53
(m,
A o is 2H), 2.71-2.79 (m, 4H), 3.16-3.19 (m,
4H), 3.55-
H 3.58 (m, 2H), 5.57-5.60 (m, 2H). LCMS: Rt:
Compound 110 1.010 min; MS trilz (ES!): 819.7[M+H].
H NMR (400 MHz, CDC13) 8: 0.86-0.90 (m,
j.L. 12H), 1.26 (m, 52H), 1.39-1.47 (m, 8H), 1.54-
H 1.71 (m, 10H), 1.74-2.02 (m, 1H), 2.15-2.19 (m,
HO.-----N.------1`1...,---,...----,, 4H), 2.41-2.44 (m, 6H), 2.58-2.61 (m,
4H), 3.13-
a 0 N N W 3.12 (m,
1H), 3.16-3.19 (m, 4H), 3.51-3.53 (m,
H
2H), 5.58-5.60 (m, 2H). LCMS: Rt: 0.980 min;
Compound 111 MS m/z (EST): 847.7[M+H].
111NMR (400 MHz, CDC13) 8: 0.86-0.90 (m,
o
12H), 1.26 (m, 52H), 1.32-1.47 (m, 12H), 1.63-
(--..,''-..0,11-,N.----a-;-õi---...."-=.
H 1.81 (m, 12H), 2.01 (m, 1H), 2.15-2.22 (m, 4H),
6
HON N----
H
--..----...------... 2.38-2.42 (m, 5H), 2.51-2.58 (m, 4H),
3.16-3.19
(m, 4H), 3.47-3.49 (m, 2H), 5.61 (m, 2H).
LCMS: Rt: 1.000 min; MS m/z (ES!):
Compound 112 875.7[M+H].
Ifi NMR (400 MHz, CDC13) 8: 0.88-0.90 (m, 6
o H), 1.20-1.32 (m, 30H), 1.45-1.50 (m, 811), 1.63-
1 .69 (m, 5H), 1.74-1.78 (m, 4H), 2.14-2.16 (m,
H
HO.,..--.N..,..õ.N 4H), 2.40-2.44 (m, 7H), 2.59-2.62 (m,
4H), 3.23-
a '''''''''IDIN''''W
H 3.25 (m, 4H), 3.46-3.49 (m, 211), 5.84-5.85 (m,
2H). LCMS: Rt: 0.770 min; MS nilz (ES!): 637.6
Compound 123 [M+H].
IFT NMR (400 MHz, CDC13) 8: 0.86-0.90 (m,
r,,..,.. JN 12H), 1.26 (m, 52H), 1.43-1.54 (m, 8H), 1.61-
1.78 (m, 12H), 2.02(m, 1H), 2.15-2.19 (m, 4H),
2.41-2.42 (m, 7H), 2.57-2.60 (m, 4H), 3.16-3.19
H (m, 411), 3.46-3.48 (m, 211), 5.61 (m, 2H).
LCMS: Rt: 0.980 min; MS m/z (ES!):
Compound 129 861.8[M+H].
o
(----...----.}- li III NMR (400 MHz, CDC13) 8: 0.87 (t, J = 8 Hz,
15H), 1.27-1.82(m, 64H), 2.01-2.51 (m, 19H),
-..-----...---.. 2.52-2.53 (m, 0.6H), 3.15-3.19(m, 4H), 3.48-3.51
H
(m, 0.4H), 3.85-3.94 (m, 0.6H), 4.39-4.45 (m,
OH 0.4H), 5.45-5.47 (m, 2H). LCMS: Rt: 1.080 min;
Compound 134 MS nilz (ES!): 847.7 [M+H].
- 187 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
0
IFINMR (400 MHz, CDC13) 5: 0.87 (t,J = 8 Hz,
''...,/"..N."===..-*N==./.\-/"N.
15H), 1.27-1.76(m, 7211), 1.99-2.01 (m, 211),
2.14-2.24 (m, 4H), 2.35-2.47 (m, 10H), 3.16-3.19
(m, 4H), 3.54-3.55 (m, 1H), 5.45-5.47 (m, 2H).
OH LCMS: Rt: 1.033 min; MS rniz (ES!):
875.7
Compound 135 [M+H].
111. NMR (400 MHz, CDC13) 5: 0.88-0.90 (m, 12
o H), 1.13-1.26(m, 62H), 1.44-1.47 (m,
7H), 1.63-
H S 1.69 (m, 7 H), 1.76-1.78 (m, 5H), 2.02-
2.15 (m, 4
H) 2 17-2 20 (m . 7
H) 2 29-2 40 (m' 4H) 3.16-
3.1 .9 H) 4 , 2 6
H), 5. 0-5.6
1(m,
H 214). LCMS: Rt: 1.39 min; MS m/z (ES!):
917.8
Compound 137 [M+11].
6.38 Example 38: Preparation of Compound 108
HO
'
108-3
0 Hess"'NH 0
1-1 108-2
0soci0
H14 1-5
0 0
108-4 1084
6
108
Step 1: Preparation of compound 108-2
[00551] To a solution of 1-1 (1.5 g, 3.58 mmol) in CH3CN (50 mL) was added
K2CO3 (1.48 g,
10.73 mmol), Cs2CO3 (0.4 g, 1.07 mmol), Na! (0.16 g, 1.07 mmol), and 2-
aminoethan-1-01 (0.45
g, 7.15 mmol). The reaction was stirred at 80 C for 10 hour. The reaction
mixture was
concentrated in vacuo. The crude product was purified by flash column
chromatography
(CH2C12: Me0H =10: 1) to give the target product as yellow oil (800 mg, yield:
56%). LCMS:
Rt: 0.898 min; MS m/z (ES!): 400.3 [M+H].
Step 2: Preparation of compound 108-4
- 188 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00552] To a solution of 108-2(800 mg, 2.0 mmol) in CH3CN (20 mL) was added
K2CO3
(830 mg, 6.01 mmol), C52CO3 (200 mg, 0.6 mmol), Nal (90 mg, 0.6 mmol), and 108-
3(1.0 g, 2.4
mmol). The reaction was stirred at 80 C for 10 hour. The reaction mixture was
concentrated in
vacuo. The crude product was purified by flash column chromatography
(CH2C12:Me0H :::1O:
1) to give the target product as yellow oil (1.1 g, yield: 74 %).
Step 3: Preparation of compound 108-5
[00553] To a solution of 108-4(300 mg, 0.4 mmol) in CH2C12 (10 mL) was added
SOC12 (150
mg, 1.22 mmol). The reaction was stirred at 30 C for 10 hour. The reaction
mixture
concentrated in vacuo to give the target product as yellow oil (300 mg, yield:
100 %). LCMS:
Rt: 1.022 min; MS m/z (ESI): 754.6 [M+H].
Step 4: Preparation of conzpound 108
[00554] To a solution of 108-5 (300 mg, 0.4 mmol) in THF (10 mL) was added
DIEA (160
mg, 1.19 mmol), Na! (60 mg, 0.4 mmol) and 1-5 (100 mg, 0.8 mmol). The reaction
was stirred
at 70 C for 10 hour. The reaction mixture was filtrated concentrated in vacuo.
The crude
product was purified by prep-HPLC to give the target product as colorless oil
(50 mg, yield: 15
%).
[00555] 1H NMR (400 MHz, CDC13) 5: 0.87 (t, J =8 Hz, 12H), 1.29-1.35 (m, 53H),
1.51-1.68
(m, 10H), 1.82-1.88 (m, 4H), 1.97-2.07 (m, 4H), 2.21-2.23 (m, 2H), 2.45-2.56
(m, 10H), 3.14-
3.27 (m, 3H), 3.52-3.55 (m, 2H), 4.04-4.07 (m, 2H), 5.91-5.94(m, 1H). LCMS:
Rt: 1.009 min;
MS m/z (ESI): 834.7 [M+H].
[00556] The following compounds were prepared in analogous fashion as Compound
108,
using corresponding starting material.
Compound Characterization
NIAR (400 MHz, CDC13) 5: 0.88 (t, J=6.8
Hz, 12H), 1.26 (s, 50H), 1.32-1.51 (m, 4H),
1.62-1.68 (m, 8H), 1.81-1.87 (m, 2H), 1.97-2.04
(m, 2H), 2.31 (t, J=7.6 Hz, 4H), 2.40-2.49 (m,
o
5H), 2.57-2.68 (m, 4H), 3.50-3.55 (m, 3H), 3.64-
A 3.68 (m, 2H), 3.70-3.78 (m, 1H), 3.93-
3.99 (m,
o 4H). LCMS: Rt: 1.140 min; MS m/z (ESI):
Compound 117 821.6[M+H]+.
- 189-
CA 03178455 2022-09-29
WO 2(121/2(14175
PCT/CN2021/085879
182110784FF
IIINMR (400 MHz, CDC13) 5: 0.88 (t, J=6.6
Hz, 12H), 1.26 (s, 55H), 1.41-1.51 (m, 8H),
1.52-1.68 (m, 4H), 1.71-1.90 (m, 4H), 2.06-2.08
(m, 2H), 2.21-2.23 (m, 2H), 2.36-2.75 (m, 10H),
N 0 3.04-3.10 (m, 1H), 3.16-3.26(m, 2H), 3.53-
3.64
(m, 2H), 4.06 (t, J=6.6 Hz, 2H), 5.91-6.00 (m,
o IH). LCMS: Rt: 1.090 min; MS m/z (ESI):
Compound 130 848.7[M+Hr.
IIINMR (400 MHz, CDC13) 5: 0.86-0.90 (m,
12H), 1.30(m, 5611), 1.48-1.52(m, 6H), 1.61-
H 1.66 (m, 411), 1.75-1.85 (m, 7H), 2.05-
2.07 (d,
N J=7.2Hz, 2H), 2.21-2.23 (d, J=7.2Hz, 2H),
N 0 C.õ,- õ,
2.39-2.48 (m, 7H), 2.58-2.62 (m, 4H), 3.23-3.25
(m, 2H), 3.47-3.49 (m, 2H), 4.04-4.07 (m, 2H),
o 5.88 (m, 111). LCMS: Rt: 1.080 min; MS m/z
Compound 131 (ESI): 862.7[M+H].
11-1 NMR (400 MHz, CDC13) 6: 0.86-0.90 (m,
12H), 1.30 (m, 56H), 1.51-1.62 (m, 12H), 1.73-
H
N 1.74 (m, 4H), 1.78-1.87 (m, 4H), 2.05 (d,
J=7.2Hz, 2H), 2.21 (d, J=7.2Hz, 2H), 2.44-2.48
N N 0
(m, 5H), 2.52-2.58 (m, 5H), 3.22-3.27 (m, 2H),
3.48-3.50 (m, 211), 4.05-4.07 (m, 2H), 5.83-5.86
o (m, 1H). LCMS: Rt: 1.164 min; MS m/z (ESI):
Compound 132 876.8[M+H].
NMR (400 MHz, CC13D) 6: 0.86-0.89 (m,
11 0 12H), 1.26-1.35 (m, 48H), 1.40-1.52 (m,
12H),
1.64-1.89 (m, 8H), 2.05-2.07 (m, 2H), 2.21-2.23
N
(m, 2H), 2.41-2.45 (m, 5H), 2.54-2.59 (m, 5H),
(1)
spy--"="-- 3.24-3.25 (m, 2H), 3.49-3.52 (m, 2H), 4.04-
4.07
o (m, 2H), 5.84-5.87 (m, 1H). LCMS: Rt: 1.10
Compound 142 min; MS m/z (ESI): 820.7[M+H].
IIINMR (400 MHz, CC13D) 5: 5.93 (s, 1 H),
4.07-4.04 (m, 2 H), 3.54 (s, 2 H), 3.27-3.22 (m,
2 H), 3.10-3.05 (m, 1 H), 2.63-2.44 (m, 10 H),
2.22 (d, J.= 6.8 Hz, 2 H), 2.06 (d, J=7.2 Hz, 2 H),
o
N 0
HN
0 1.80 (d, J=39.2 Hz, 6 H), 1.66-1.61 (m, 5
H),
1.53-1.50 (m, 8 H), 1.25 (s, 60 H), 0.89-0.86 (m,
12 H). LCMS: Rt: 1.690 min; MS m/z (ESI):
Compound 143 904.8[M+H].
C8F117 IIINMR (400 MHz, CC13D) 5: 5.81 (s, 1 H),
4.07-4.03 (m, 2 H), 3.50-3.48 (m, 2 H), _8_ 3.25-
_ 0 17 C H
3.24 (m, 2H), 2.59-2.39 (m, 10 H), 2.23-2.21
c8H17 (m, 2 H), 2.07-2.05 (m, 2H), 1.83-1.80 (m,
4H),
0 C8H17 1.68-1.62 (m, 4 H), 1.54-1.46 (m, 12 H),
1.35-
1.30 (m. 64 H), 0.89-0.86 (m, 12 H). LCMS: Rt:
Compound 145 1.56 min; MS m/z (ESI): 932.8[M+H].
- 190-
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
IIINMR (400 MHz, CC13D): 0.86-0.89(m,
12H), 1.26-1.38(m, 50H), 1.43-1.66(m, 9H),
1.75-1.84 (m, 6H), 2.05-2.07 (m, 2H), 2.21-2.23
0
(m, 2H), 2.42-2.44 (m, 7H), 2.57-2.62 (m, 4H),
----------- 3.22-3.27 (m, 2H), 3.56-3.58 (m, 2H),
4.04-4.07
o (m, 2H), 5.86-5.89 (m, 1H). LCMS: Rt: 1.118
Compound 152 min; MS in/z (ESI): 806.7[M+11].
NMR (400 MHz, CC13D) 6: 0.44-0.47 (m,
4H), 0.86-0.89 (m, 12H), 1.26-1.38 (m, 44H),
1.43-1.66 (m, 9H), 1.85-1.94 (m, 3H), 2.05-2.07
(m, 2H), 2.21-2.23 (m, 2H), 2.40-2.42 (m, 4H),
o
H N 2.54-2.55 (m, 2H), 2.72-2.80 (m, 4H),
3.22-3.27
(m, 2H), 3.56-3.58 (m, 2H), 4.04-4.07 (m, 211),
o 5.83-5.85 (m, 1H). LCMS: Rt: 0.99 min; MS
Compound 153 tniz (ESI): 764.6[M+11].
IIINMR (400 MHz, CDC13) 6: 5.87-5.84 (m, 1
H), 4.00-3.97 (m, 2 H), 3.47-3.45 (m, 2 H), 3.20-
3.15 (m, 2 H),3.02-2.98 (m, 1 H), 2.56-2.51 (m,
4 H), 2.42-2.33 (m, 6 H), 2.15 (d, J= 7.2 Hz, 2
HONN10
H), 1.99 (d, J=7.2 Hz, 2 H), 1.78-1.64 (m, 4 H),
(t) HN
O 1.61-1.54 (m, 4 H), 1.48-1.38 (m, 8 H), 1.19 (s,
47 H), 0.82-0.79 (m, 12 H). LCMS: Rt: 1.110
Compound 154 min; MS in/z (ESI): 792.6[M+111.
6.39 Example 39 : Preparation of Compound 121
N
121-2 0 pr** N H2 il,N
NH2 6 N2H4+126
121-5
121-1 11 1214 TrIphosgene
121-3
1 1
OCPA
13r40 NH
H H
1214 121-7
NH
1-5
011=
DMA, Nsl. THF
1214 121
Step 1: Preparation of compound 121-3
- 191 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00557] To a solution of 121-1 (1.0 g, 6.6 mmol, 1.0 eq) and 121-2 (5.6 g,
19.8 mmol, 3.0 eq)
in ACN (20.0 mL) was added K2CO3 (2.7 g, 19.8 mmol, 3.0 eq), at RT. The
mixture was stirred
for 16 hours at 80 C. LCMS showed the reaction was completed, the mixture was
evaporated
under reduced pressure and purified with FCC (PE/EA=10/0-0/1) to provide 121-3
(2.0 g, 55%
yield) as colorless oil. LCMS: Rt: 0.944 min; MS m/z (ES!): 554.2 [M+H].
Step 2: Preparation of compound 121-4
[00558] To a solution of 121-3 (2.0 g, 3.62 mmol, 1.0 eq) in Et0H (20.0 mL)
was added
N2H411120 (2.0 mL) at RT. The mixture was stirred for 3 hours at 80 C. LCMS
showed the
reaction was completed, the mixture was filtered and evaporated under reduced
pressure to
provide 121-4 (1.0 g, crude) as colorless oil. LCMS: Rt: 0.307 min; MS m/z
(ESI): 294.2
[M+H].
Step 3: Preparation of compound 121-6
[00559] To a solution of 121-5 (729.0 mg, 3.0 mmol, 1.0 eq) in DCM (10.0 mL)
at 0 C were
added sequentially DIEA (1.9 g, 15.0 mmol, 5.0 eq) and triphosgene (591.0 mg,
1.5 mmol, 0.5
eq). The mixture was stirred for 1 hours at RT, then 121-4 (288.0 mg, 0.99
mmol, 0.33 eq) was
added. The mixture was stirred for 16 hours at RT. TLC showed the reaction was
completed,
the mixture was poured into 1120, exacted with EA. The mixture was evaporated
under reduced
pressure and purified by FCC (DCM/Me0H=1/0-10/1) to provide 121-6 (0.6 g,
crude) as brown
oil. LCMS: Rt: 1.341 min; MS m/z (ES!): 828.5 [M+H].
Step 4: Preparation of compound 121-7
[00560] To a solution of 121-6(600.0 mg, 0.72 mmol, 1.0 eq) in Me0H (10.0 inL)
were
added Pd/C (30.0 mg) and HC1 (5 drops). The mixture was stirred for 3 hours at
RT under 112.
LCMS showed the reaction was completed, the mixture was filtered and
evaporated under
reduced pressure to provide 121-7 (300 mg, crude) as brown oil. LCMS: Rt:
1.036 min; MS m/z
(ES!): 738.6 [M+H].
Step 5: Preparation of compound 121-8
[00561] To a solution of 121-7(300.0 mg, 0.41 mmol, 1.0 eq) in DCM (5.0 mL)
was added
50C12 (144.0 mg, 1.23 mmol, 3.0 eq) at RT. The mixture was stirred for 16
hours. LCMS
showed the reaction was completed, the mixture was evaporated under reduced
pressure to
- 192 -
CA 03178455 2022-09-29
WO 2(121/2(14175 PCT/CN2021/085879
182110784FF
provide 121-8 (280 mg, crude) as brown oil. LCMS: Rt: 1.329 min; MS miz (ES!):
756.6
[M+11].
Step 6: Preparation of compound 121
[00562] To a solution of 121-8 (110.0 mg, 0.15 mmol, 1.0 eq) and 1-5 (52.0 mg,
0.45 mmol,
3.0 eq) in THF (5.0 mL) were added DMA (97.0 mg, 0.75 mmol, 5.0 eq) and Na!
(2.1 mg, 0.015
mmol, 0.1 eq) at 0 C. The mixture was stirred for 16 hours at 70 C. LCMS
showed the
reaction was completed, the mixture was evaporated under reduced pressure and
purified with
pre-HPLC to provide 121 (50.0 mg, 40% yield) as yellow oil.
1005631 IH NMR (400 MHz, CDC13) 5: 0.79-0.98(m, 1211), 1.62(s, 47H), 1.65 -
1.74(m,
1411), 1.83-2.01 (m, 5H), 2.55-2.62 (m, 9H), 3.06-3.20(m, 9H), 3.55-3.57 (m,
2H), 4.29-4.32 (m,
1H), 5.01-5.28 (m, 3H). LCMS: Rt: 1.030 min; MS m/z (ES!): 835.7[M+H].
[00564] The following compounds were prepared in analogous fashion as Compound
121,
using corresponding starting material.
Compound Characterization
1H NMR (400 MHz, CDC13) 5: 0.79-0.98 (m,
LW.'" 12H), 1.12-1.47 (m, 5511), 1.51-1.79
(m, 1511),
0
2.41-2.64 (m, 11H), 3.06-3.20 (m, 8H), 3.51-
3.53 (m, 2H), 5.06-5.31 (m, 311). LCMS: Rt:
Compound 122 1.079 min; MS mlz (EST): 863.7[M+11].
6.40 Example 40: Preparation of Compound 155
113,.
HO".....-"*.N112
HO
H tnphosgene, Py, OCOA C8,CO3, ACN 0
391 168.2
1864
S0C12,0CM N H
fNEA, Nat INF
0 0
168-4 165
Step 1: Preparation of compound 155-2
[00565] 39-1 (484.0 mg, 1.0 mmol, 1.0 eq) was dissolved in DCM (10.0 mL) at 0
C, then Py
(1.1 g, 16.0 mmol, 8.0 eq) and triphosgene (355.0 mg, 1.2 mmol, 0.6 eq) were
added. The
- 193 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
mixture was stirred for 1 hour at RT, then 4-bromobutan-1-amine (560.0 mg, 2.4
mmol, 1.2 eq)
was added. The mixture was stirred for 16 hours at RT. TLC showed the reaction
was
completed, the mixture was poured into H20,exacted with EA. The mixture was
evaporated
under reduced pressure and purified by FCC (PE/EA=100/1-10/1) to provide 155-2
(0.27 g, 32%
yield) as yellow oil. 41 NMR (400 MHz, CDC13) 5: 0.86-0.90(m, 6H), 1.58 (s,
25H), 1.61-1.70
(m, 2H), 1.86-1.94 (m, 2H), 3.19-3.24 (m, 2H), 3.41-3.56 (m, 211), 3.94-3.96
(m, 211), 5.30 (s,
1H).
Step 2: Preparation of compound 155-3
1005661 To a solution of 155-2(270.0 mg, 0.64 mmol, 3.0 eq) and ethanol amine
(13.0 mg,
0.213 mmol, 1.0 eq) in ACN (15.0 mL) was added K2CO3 (88.0 mg, 0.64 mmol, 3.0
eq), Cs2CO3
(21.0 mg, 0.064 mmol, 0.3 eq) and NaI (3.0 mg, 0.023 mmol, 0.1 eq) at RT. The
mixture was
stirred for 48 hours at 80 C. LCMS showed the reaction was completed, the
mixture was
evaporated under reduced pressure and purified with FCC(DCM/Me0H=1/0-10/1) to
provide
155-3 (0.1 g, 63% yield) as colorless oil. LCMS: Rt: 1.018 min; MS iniz (ESI):
740.6 [M+H].
Step 3: Preparation of compound 155-4
1005671 To a solution of 155-3 (100.0 mg, 0.135 mmol, 1.0 eq) in DCM (5.0 mL)
was added
50C12 (47.0 mg, 0.405 mmol, 3.0 eq) at RT. The mixture was stirred for 16
hours. LCMS
showed the reaction was completed, the mixture was evaporated under reduced
pressure to
provide 155-4 (100 mg, crude) as brown oil. LCMS: Rt: 1.780 min; MS m/z (ESI):
758.6
[M+H].
Step 4: Preparation of compound 155
[00568] To a solution of 155-4(100.0 mg, 0.13 mmol, 1.0 eq) and 1-5 (45.0 mg,
0.397 mmol,
3.0 eq) in THF (5.0 mL) was added DIEA (85 mg, 0.66 mmol, 5.0 eq) at 0 C. The
mixture was
stirred for 16 hours at 70 C. LCMS showed the reaction was completed, the
mixture was
evaporated under reduced pressure and purified with pre-HPLC to provide 155
(30.0 mg, 27%
yield) as yellow oil.
[00569] 'H NMR (400 MHz, CDC13) 5: 0.79-0.83 (m, 12H), 1.23 (s, 48H), 1.51-
1.63 (m,
12H), 1.86-1.96 (m, 5H), 2.47-2.54 (m, 10H), 3.11-3.13 (m, 5H), 3.51 (s, 2H),
3.86-3.88 (m,
4H), 4.95 (s, 2H). LCMS: Rt: 1.232 min; MS trilz (ESI): 837.7[M+H].
- 194 -
CA 03178455 2022-09-29
WO 2021/204175
PCT/CN2021/085879
182110784FF
1.005701 The following compounds were prepared in analogous fashion as
Compound 155,
using corresponding starting material.
Compound Characterization
NAO 'H NMR (400 MHz, CDC13) 5: 0.86-0.90
(m,
12H), 1.26 (s, 53H), 1.51-1.80 (m, 16H), 2.44-
0 2.64 (m, 11H), 3.18 (s, 4H), 3.50 (s,
2H), 3.93-
L.)
3.95 (m, 4H), 4.99 (s, 2H). LCMS: Rt: 1.240
Compound 124 min; MS m/z (ESI): 865.7[M+]].
0
NMR (400 MHz, CDC13) 5: 0.86-0.89 (m,
12H), i.26-1.79(m, 66H), 2.50-2.68(m, 11H),
3.17 (s, 5H), 3.59 (s, 2H), 3.93-3.95 (m, 4H),
5.00 (s, 2H). LCMS: Rt: 1.420 min; MS m/z
Compound 125 (ES!): 851.7[M+11]
6.41 Example 41: Preparation of Compound 118
0 0
OBn
Ph3P=CHCH3
OBn OBn OH
0, 118-2a H,C, Pc1.1C
NIs0 ms0
KMHDS
=ss
0 013n 0 OBn 0 OBn 0
OH
18-2 118-3 1184 118-5
0
0
H2WY-C8H17 H
CO-113 N"....seC8H17 .11
H
118-5a 1.5
_________ Ms0 0 ryCetill
HATU, DIEA, DCM 0 Fry
C81-117 DIEA, Hal, THF
118 CaHia
C,31113
1184
Step 1: Preparation of compound 118-3
1.005711 To a solution of 118-2a (4.4g. 10.9 mmol, 1.2 eq) in anhydrous THF(30
ml) was
added KMHDS (1M in THF, 11 ml) at 0 C, stirred for 2h, compound 18-2(4.1 g,
9.1 mmol, 1.0
eq) was added. The mixture was stirred for 12h, TLC showed the reaction was
complete. The
mixture was diluted with EA and washed with water and brine, concentrated. The
residue was
purified by column chromatography (silica gel, 2%-20% EA in PE) to provide 118-
3 (2.8 g,
68.3%% yield) as yellow oi. NMR
(400 MHz, CDC13) 5: 1.31-1.45 (m, 12H), 1.59-1.66 (m,
4H), 1.88 (s, 1H), 2.32-2.36 (m, 4H), 4.87-4.95 (m, 2H), 5.11 (s, 4H), 5.43-
5.52 (m, 1H), 7.30-
7.38 (m, 10H).
Step 2: Preparation of compound 118-4
- 195 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
[00572] To a solution of 118-3 (2.8 g, 6.2 mmol, 1.0 eq) in anhydrous THF (20
mL) was
added borane (1M in THF, 6.5 ml) at RT. The mixture was stirred at RT for 12
hours. 10%
NaOH solution (2 ml) and 11202 (30%, 4 ml) was added. After stirring for 2h,
TLC showed the
reaction was completed. The mixture was evaporated under reduced pressure. The
residue was
diluted with EA (50 mL) and washed with saturated NaHCO3 solution (pH of the
aqueous layer
was 8) and brine. The combined organic layers were dried over Na2SO4 and
solvents were
removed in vacuo. The residue was dissolved in DCM(20), NEt3 (940 mg, 9.3
mmol, 1.5 eq)
and methansulfonyl chloride (860 mg, 7.5 mmol, 1.2 eq) were added at 0 C.
After stirring for
2h, TLC showed the reaction was complete. The mixture was washed with water
and brine,
concentrated. The residue was purified by column chromatography (silica gel,
10%-40% EA in
PE) to provide 118-4 (1.2g. 36% yield).
Step 3: Preparation of compound 118-5
[00573] The mixture of 118-4(1.2 g, 2.2 mmol, 1.0 eq) and Pd/C(100 mg) in EA
(30 ml) was
stirred under hydrogen atmosphere for 24h at RT. TLC showed the reaction was
complete. The
mixture was filtered and the filtrate was concentrated and to provide 118-5
(0.9 g, crude).
Step 4: Preparation of compound 118-6
[00574] To a solution of 118-5 (0.9 g, 2.45 mmol, 1.0 eq) and 118-5a (1.3 g,
5.4 mmol, 2.2
eq) in anhydrous DCM (30 ml) were added HATU (2.8 g, 7.35 mmol, 3.0 eq) and
DIEA (1.6 g,
12.2 mmol, 5.0 eq) at RT, stirred for 2h. TLC showed the reaction was
complete. The mixture
was diluted with DCM and washed with water and brine, concentrated. The
residue was purified
by column chromatography (silica gel, 2%-100% EA in PE) to provide 118-6 (1.4
g, 70% yield)
as yellow oil.
Step 5: Preparation of compound 118
[00575] To a solution of 118-6(150.0 mg, 0.18 mmol, 1.0 eq) and 1-5 (64.0 mg,
0.55 mmol,
3.0 eq) in THF (5.0 mL) was added DIEA (116.0 mg, 0.9 mmol, 5.0 eq) at 0 C.
The mixture
was stirred for 16 hours at 70 C. LCMS showed the reaction was completed, the
mixture was
evaporated under reduced pressure and purified with pre-HPLC to provide 118
(25.0 mg, 17%
yield) as yellow oil.
- 196 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
1005761 1H NMR (400 MHz, CDC13) 5: 0.81-0.90 (m, 24H), 1.12-1.26 (m, 22H),
1.34-1.45(m,
4211), 1.91-1.98 (m, 4H), 2.10-2.57 (m, 5H), 3.09-3.12 (m, 4H), 3.48-3.49 (m,
2H),5.27-5.44 (m,
2H). LCMS: Rt: 1.320 min; MS m/z (ESI): 832.7[M+11].
100577] The following compounds were prepared in analogous fashion as Compound
118
using corresponding starting material.
Compound
Characterization
11-1 NMR (400 MHz, CDC13) 5: 0.42-0.43 (m, 4H),
0.81-0.90(m, 12H), 1.19-1.24(m, 52H), 1.36-
H
C61-113 1.40 (m, 5H), 1.61-1.75 (m, 14H), 2.08-
2.11 (m,
N 17 4H), 2.51-2.55 (m, 2H), 2.67-2.70 (m,
2H),3.09-
3.12 (m, 4H), 3.51-3.54 (m, 2H), 5.43 (m, 2H).
C6H13 LCMS: Rt: 1.340 min; MS in/z (ER):
Compound 119 818.7[M+11].
0
N 17
H C6H13 NMR (400 MHz, CDC13) 5: 0.81-0.90 (m,
0
H r,
L.61,13 24H), 1.12-1.26(m, 23H), 1.34-1.45 (m,
48H),
2.01-2.17 (m, 4H), 2.45-2.62 (m, 5H), 3.16-3.17
(m, 4H), 3.18 (s, 2H), 5.54-5.55 (m, 2H). LCMS:
Compound 120 Rt: 1.480 min; MS m/z (ES!): 860.8[M+H].
6.42 Example 42 : Preparation of Compound 150
(C0C1)2. DRAW H0 _____________________ Br0
Et3N. DCM
TsCH H20, Na2304
150-2 DCM 1504
HoN
1,
108-3 0^41-y=-..,
MsCI, DIEA, DCM
___________________ HON
K2CO3,Cs2CO3 Nal
ACN
1504
1-101,111
14 _______________________________________ HO
DIEA, Nal, THF NN
150-5 ISO
- 197 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
Step 1: Preparation of compound 150-2
[00578] To a solution of (C0C1)2 (6.7 mL, 77.0 mmol, 2.0 eq) in 30 mL of DCM,
DMSO
(10.9 mL, 154 mmol, 4.0 eq) was added at -78 C. After stirring for 20 min, 6-
bromohexan-1-ol
(6.8 g, 37.6 mmol, 1.0 eq) was added. After stirring for another 1.5 h at -78
C, Et3N (10 mL)
was added and the reaction mixture was stirred at room temperature for 1.0 h.
The reaction
mixture was diluted with CH2Cl2 (100 mL) and washed water (50 mL) and brine
(500 mL). The
combined organic layers were dried over Na2SO4 and solvents were removed in
vacuo.
Evaporation of the solvent gave the crude product which was purified by column
(silica gel, 0-
5% EA in PE) chromatography and the pure product fractions were evaporated to
provide the
product 150-2(7.0 g, crude) as a colorless oil. III NMR (400 MHz, CDC13) 8:
1.45-1.51 (m,
2H), 1.53-1.70 (m, 2H), 1.85-1.91 (m, 2H), 2.44-2.50 (m, 2H), 3.40-3.43 (m,
2H), 9.78 (s, 111).
Step 2: Preparation of compound 150-3
[00579] To a solution of 150-2 (7.0 g, 39.0 mmol, 1.0 eq) and octan-l-ol (15.0
g, 117.0 mmol,
3.0 eq) in DCM (100.0 mL) was added Ts0H H20 (1.3 g, 7.8 mmol, 0.2 eq), Na2SO4
(16.0 g,
117 mmol, 3.0 eq) at RT. The mixture was stirred for 16 hours at RT. TLC
showed the reaction
was completed, the mixture was evaporated under reduced pressure and purified
by FCC (PE) to
provide 150-3 (10.0 g, crude) as yellow oil. ill NMR (400 MHz, CDC13) 8: 0.86-
0.90 (m, 6H),
1.27-1.48 (m, 24H), 1.52-1.64 (m, 6H), 1.85-1.88 (m, 2H), 3.37-3.53 (m, 4H),
3.54-3.59 (m, 2H),
4.44-4.47 (m, 1H).
Step 3: Preparation of compound 150-5
[00580] To a solution of 108-3 (0.2 g, 0.54 mmol, 1.0 eq) and 150-3 (340 mg,
0.81 mmol, 1.5
eq) in ACN (10.0 mL) were added Cs2CO3 (52.0 mg, 0.16 mmol, 0.3 eq), K2CO3
(223.0 mg,
1.62 mmol, 3.0 eq) and Nal (7.0 mg, 0.05 mmol, 0.1 eq) at RT. The mixture was
stirred for 16
hours at 85 'C. LCMS showed the reaction was completed, the mixture was
evaporated under
reduced pressure and purified by FCC (DCM/Me0H=1/0-20/1) to provide 150-4 (0.3
g, 60%
yield) as yellow oil. LCMS: Rt: 1.595min; MS m/z (ES!): 712.7 [M+H].
Step 4: Preparation of compound 150-5
[00581] To a solution of 150-4(0.3 g, 0.42 mmol, 1.0 eq) in DCM (5.0 mL) were
added DIEA
(108.0 mg, 0.84 mmol, 2.0 eq) and MsC1 (60.0 mg, 0.51 mmol, 1.2 eq)at 0 C. The
mixture was
- 198 -
CA 03178455 2022-09-29
WO 2021/204175
PCT/CN2021/085879
182110784FF
stirred for 1 hour. TLC showed the reaction was completed. The reaction
mixture was diluted
with CH2C12 (50 mL) and washed water (10 mL) and brine (10 mL). The combined
organic
layers were dried over Na2SO4 and solvents were removed in vacuo to provide
150-5 (0.35 g,
crude) as brown oil.
Step 5: Preparation of conzpound 150
[00582] To a solution of 150-5 (350 mg, 0.44 mmol, 1.0 eq) and 1-5 (153.0 mg,
1.32 mmol,
3.0 eq) in THF (5.0 mL) were added IAEA (284.0 mg, 2.2 mmol, 5.0 eq) and Na!
(6.0 mg, 0.044
mmol, 0.1 eq) at 0 C. The mixture was stirred for 16 hours at 70 C. LCMS
showed the
reaction was completed, the mixture was evaporated under reduced pressure and
purified with
FCC (DCM/Me0H=1/0-20/1) to provide 150 (18.0 mg, 5% yield) as yellow oil.
[00583] 1H NMR (400 MHz, CDC13) 5: 0.86-0.89 (m, 12H), 1.26-1.54 (m, 52H),
1.57-1.71
(m, 15H), 2.00-2.05 (m, 4H), 2.21-2.24 (m, 2H), 2.58-2.63 (m, 6H), 3.15-3.18
(m, 3H), 3.37-3.43
(m, 2H), 3.54-3.61 (m, 4H), 4.43-4.46 (m, 1H). LCMS: Rt: 1.310 min; MS rn/z
(ES!):
808.7[M+11].
6.43 Example 43: Preparation of Compound 98
Boc 98-2 TFA
HIJ
Ac0i-I,Ts(s-PrO)4,Na8H3CN
0 0o
11-2 98-3
9
Br
rThe=N
DIEA.Nal
0 0
98-4 98
Step 1: Preparation of compound 98-3
[00584] To a solution of 11-1(600 mg, 0.86 mmol) in CH2C12 (50 mL) was added
98-2(520
mg, 2.59 mmol) and Ti(i-PrO)4 (1 mL). The reaction was stirred at RT for 3
hour. The
NaBH3CN (280 mg, 4.32 mmol) was added. The reaction was stirred at RT for 10
hour. The
reaction mixture was poured into water (50 ml) and extracted with CH2C12 (3*50
mL). The
combined organic layer was washed with brine, dried over anhydrous Na2SO4 and
concentrated
- 199 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
in vacuo. The crude product was purified by flash column chromatography (PE:
Et0Ac = 1: 2)
to give the target product as yellow oil (400 mg, yield: 59%). LCMS: Rt: 1.531
min; MS m/z
(ESI): 877.8 [M+H].
Step 2: Preparation of compound 98-4
100585] To a solution of 98-3 (450 mg, 0.51 mmol) in CH2C12 (10 mL) was added
TFA (2
inL). The reaction was stirred at RT for 1 hour. The reaction mixture was
concentrated in vacuo
to give the target product as yellow oil (400 mg, yield: 100 %). LCMS: Rt:
0.965 min; MS m/z
(ESI): 777.7 [M+H].
Step 3: Preparation of conzpound 98
100586] To a solution of 98-4 (400 mg, 0.51 mmol) in CH3CN (20 mL) was added
K2CO3
(220 mg, 1.54 mmol), Nal (80 mg, 0.51 mmol) and 2-bromoethanol (100 mg, 0.77
mmol). The
reaction was stirred at 80 C for 12 hour. The reaction mixture was filtrated
concentrated in
vacuo. The crude product was purified by prep-HPLC to give the target product
as yellow oil
(15 mg, yield: 4%).
1005871 1H NMR (400 MHz, CDC13) 5: 0.87 (t, J = 8 Hz, 12H), 1.26-1.67 (m,
67H), 1.95-2.03
(m, 2H), 2.28-2.51 (m, 11H), 2.89-2.93 (m, 2H), 3.57-3.60 (m, 2H), 3.96-3. (m,
4H). LCMS: Rt:
0.942 min; MS in/z (ESI):821.6 [M+H].
6.44 Example 44: Preparation and characterization of lipid nanoparticles
1005881 Briefly, a cationic lipid provided herein, DSPC, cholesterol, and PEG-
lipid were
solubilized in ethanol at a molar ratio of 50:10:38.5:1.5, and mRNA were
diluted in 10 to 50mM
citrate buffer, pH =4. The LNPs were prepared at a total lipid to mRNA weight
ratio of
approximately 10:1 to 30:1 by mixing the ethanolic lipid solution with the
aqueous mRNA
solution at a volume ratio of 1:3 using a microfluidic apparatus, total flow
rate ranging from 9-
30mL/min. Ethanol were thereby removed and replaced by DPBS using dialysis.
Finally, the
lipid nanoparticles were filtered through a 0.2 pm sterile filter.
[00589] Lipid nanoparticle size were determined by dynamic light scattering
using a Malvern
Zetasizer Nano ZS (Malvern UK) using a 1730 backscatter detection mode. The
encapsulation
efficiency of lipid nanoparticles were determined using a Quant-it Ribogreen
RNA quantification
assay kit (Thermo Fisher Scientific, UK) according to the manufacturer's
instructions.
- 200 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
1821 1 0784FF
[00590] As reported in literature, the apparent pKa of LNP formulations
correlates with the
delivery efficiency of LNPs for nucleic acids in vivo. The range of apparent
pKa is between ¨ 5
to ¨ 7. The apparent pKa of each formulation was determined using an assay
based on
fluorescence of 2-(p-toluidino)-6-napthalene sulfonic acid (INS). LNP
formulations comprising
of cationic lipid / DSPC / cholesterol / DMG-PEG (50/10 /38.5/1.5 mol %) in
PBS were
prepared as described above. TNS was prepared as a 300uM stock solution in
distilled water.
LNP formulations were diluted to 0.1mg/m1 total lipid in 3 mL of buffered
solutions containing
50 mM sodium citrate, 50 mM sodium phosphate, 50 mM sodium borate, and 30mM
sodium
chloride where the pH ranged from 3 to 9. An aliquot of the TNS solution was
added to give a
final concentration of 0.1mg/m1 and following vortex mixing fluorescence
intensity was
measured at room temperature in a Molecular Devices Spectramax iD3
spectrometer using
excitation and mission wavelengths of 325 nm and 435 nm. A sigmoidal best fit
analysis was
applied to the fluorescence data and the pKa value was measured as the pH
giving rise to half¨
maximal fluorescent intensity.
6.45 Example 45: Animal Study
[00591] Lipid nanoparticles comprising compounds 1 - 10 encapsulating human
erythropoietin (hEPO) mRNA were systemically administered to 6-8 week old
female ICR mice
(Xipuer-Bikai, Shanghai) at 0.5mg/kg dose by tail vein injection and mice
blood were sampled at
specific time points (e.g., 6 hours) post administration. In addition to the
aforementioned tested
groups, lipid nanoparticles comprising dilinoleylmethy1-4-
dimethylaminobutyrate (DLin-MC3-
DMA, usually abbreviated to MC3) encapsulating hEPO mRNA were similarly
administered at
the same dose to age and gender comparative groups of mice as a positive
control.
[00592] Mice were euthanized by CO2 overdoses after the last sampling time
point. Serum
were separated from total blood by centrifugation at 5000g for 10 minutes at 4
C, snap-frozen
and stored at -80 C for analysis. ELSA assay were carried out using a
commercial kit (DEPOO,
R&D systems) according to manufacturer's instructions.
[00593] Characteristics of tested lipid nanoparticles, including hEPO
expression levels
(ttg/m1) measured from the tested group are listed the tables below and
plotted in FIG.2.
- 201 -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
Table 2.
-
Lipid size polydispersity Encapsulation Expression at 6 h Apparant
(nm) Efficiency (MAO Pka
1 76.5 0.168 95.7% 16.21 6.40 ,
2 75.3 0.065 96.8% 6.16 . 6.27 .
3 58.7 0.060 96.3% 2.63 6.22
4 57.5 0.068 98.1% 0.48 5.87
54.0 0.029 96.2% 0.25 6.24
6 60.5 0.109 96.6% 0.00 . 5.88 .
7 149.1 0.110 47.0% 0.00 5.39
8 54.7 0.065 96.9% 0.00 5.84
9 77.6 0.106 93.3% 0.86 6.01
69.2 0.113 96.0% 0.79 5.83
A 58.5 0.108 100.0% 0.01 6.96
B 79.0 0.060 100.0% 0.44 7.33
C 65.0 0.061 96.9% 2.95 6.46
D 59.2 0.118 95.5% 1.02 6.28 ,
MC3 79.8 0.042 98.5% 2.35 6.33
Table 3.
Lipid size polydispersity Encapsulation Expression at 6 h Apparant
(nm) Efficiency (1-tgirni) Pia
11 67.23 0.109 90.9% D 5.662
12 75.86 0.015 99.80% D 5.801
13 89.96 0.095 96.8% C 7.206
14 60.13 0.172 . 94.9% C 9.356
51.17 0.313 89.8% D 9.21
16 54.69 0.225 98.87% D 4.403 .
17 57.6 0.209 18.18% D
18 71.85 0.15 . 100.16% C 6.327
76.79 0.103 98.1% A 6.252
21 75.26 0.077 100.6% D 7.652 .
22 71.2 0.081 98.3% D 6.884
23 60.64 0.14 93.9% B
24 64.96 0.077 95.4% C 6.087
74.3 0.032 96.7% A 6.334
26 55.51 0.125 96.7% C
27 58.44 0.133 96.7% C 6.153
28 79.82 0.002 96.5% A 6.529
29 85.17 0.078 97.2% A 6.477
80.46 0.071 95.9% B
31 71.64 0.076 92.4% C 5.822
32 77.76 0.039 94.3% C 5.941
33 62.2 0.091 94.5% D 5.315
34 63.32 0.095 96.1% D 5.29
-I. -
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
35 60.58 0.086 94.8% C 5.945
36 70.36 0.065 98.3% A 5.907
37 84.26 0.034 97.0% A 6.205
38 65.94 0.167 98.7% C 6.172
39 64.4 0.043 98.8% C 6.061
40 66.39 0.081 99.2% C
41 64.04 0.054 97.5% C 5.93 .
42 65.63 0.065 96.4% C 6.196
43 74.8 0.068 . 97.3% B
44 83.85 0.063 97.5% B 6.049
45 71.47 0.032 96.6% A .
46 110.4 0.073 93.8% C 6.307
47 62.38 0.103 . 95.3% C
48 72.52 0.065 91.80% A 6.347
49 65.13 0.075 94.1% A 6.249 .
50 67.68 0.085 94.90% A 6.143
51 59.73 0.073 94.10% A 6.093
52 69.18 0.054 95.70% A
54 102.7 0.051 97.2% D
55 95.51 0.109 96.7% C
56 85.46 0.07 96.4% A 6.466
57 93.52 0.063 96.1% A 6.645
58 74.68 0.067 90.7% A 6.364
59 93.24 0.008 97.7% B 6.682
60 68.6 0.086 92.1% B 6.329
61 65.04 0.087 . 83.4% A
62 244.8 0.156 36.2% D 6.438
63 94.11 0.088 85.9% B 6.406 .
64 84.93 0.181 84.1% D
65 63.83 0.066 . 93.0% A 6.544
66 63.86 0.064 80.0% B 6.036
67 64.75 0.05 79.3% 3 6.341 .
68 56.96 0.052 80.1% C 6.279
69 58.74 0.06 . 78.3% D
70 77.54 0.034 84.3% A 6.381
71 91.13 0.038 93.0% A 6.613
72 113.9 0.109 93.5% A 6.712
73 78.99 0.027 93.1% C
74 54.58 0.076 93.2% B 6.2
75 62.36 0.032 94.1% A
76 54.94 0.096 91.71% C
77 69.81 0.038 90.06% A 6.352
78 44.47 0.091 92.4% C
79 52.19 0.154 89.2% C 5.735
80 76.71 0.06 85.2% 3 6.201
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
81 75.89 0.028 94.6% A 6.476
82 87.68 0.025 94.7% A 6.406
83 67.62 0.087 93.5% B 6.328
84 65.55 0.083 93.2% B 6.064
85 82.91 0.065 93.7% B 6.46
86 76.56 93.8% C 6.32
87 65.71 0.037 91.2% A 6.515 .
88 66.89 0.21 97.2% D 7.41
89 84.53 0.028 . 94.6% A 6.7
90 72 0.067 97.3% B 6.6
91 62.06 0.106 92.1% 3 6.257 .
92 66.94 0.04 95.2% B 6.331
93 93.74 0.041 . 98.3% A 6.491
94 67.01 0.298 100.3% D
95 82.43 0.285 97.2% D .
96 85.98 0.101 96.9% D
97 66.69 0.204 96.8% D
98 86.23 0.105 97.6% D
99 66.06 0.1 100.2% C
100 58.6 0.208 87.7% C 6.187
101 72 0.067 85.5% B 6.071
102 70.49 0.004 94.10% B 6.406
103 67.57 0.054 94.41% C
104 70.93 0.022 89.96% A 6.184
105 92.4 0.042 93.3% A 6.698
106 76.97 0.174 . 95.14% A
107 106.9 0.11 95.64% A
108 80.78 0.064 95.6% A 6.711 .
109 73.52 0.06 97.6% A 6.633
110 91.1 0.063 . 90.0% C 6.696
1 1 1 92.3 0.049 89.0% B 6.668
112 49.51 0.111 95.9% C .
1 1 3 90 0.04 91.2% A 6.728
114 87.92 0.025 . 89.3% A 6.695
115 65.12 0.117 98.2% A 6.732
1 1 6 79.28 0.201 94.5% A 6.795
117 76.79 0.157 95.2% A 6.72
118 62.72 0.057 98.9% A 6.523
119 67.17 0.06 93.2% D
120 59.78 0.1 97.1% 3 6.264
121 71.02 0.134 94.5% B
122 57.81 0.044 89.4% A 7.048
123 264.9 0.285 30.1% A
124 64.66 0.061 96.9% A 6.984
125 72.36 0.116 95.6% A 6.833
CA 03178455 2022-09-29
WO 2021/204175 PCT/CN2021/085879
182110784FF
126 78.17 0.101 100.10% A
127 77.12 0.111 98.70% A
128 79.73 0.107 86.10% A
129 63.13 0.131 91.20% A
130 79.92 0.097 92.50% A
131 79.11 0.064 80.00% A
132 70.33 0.129 88.00% A .
133 109.90 0.083 90.6% A 6.668
134 1 05. 50 0.033 . 87.9% A 6.442
135 104.1 0.035 85.6% C 6.652
136 61.17 0.063 94.29% A .
137 60.84 0.029 95.29% A 6.751
138 63.52 0.013 . 94.50% A 6.688
139 67.31 0.052 92.64% A 6.518
140 1 3 8. 7 0.075 83.4% A 6.981 .
141 71.93 0.036 89.1% A 6.766
142 81.13 0.027 85.3% A 6.678
143 58.61 0.032 93.2% A 6.836
144 64.08 0.035 95.0% A 6.794
145 61.5 0.04 93.1% A 6.634
146 66.27 0.052 94.6% B 7.496
147 69.58 0.082 91..4% A 7.304
148 83.84 0.046 85.6% A 7.146
149 72.85 0.07 86.3% B 6.810
150 66.33 0.06 93.5% A 6.918
151 73.86 0.061 . 94.0% C 6.948
152 92.17 0.026 88.2% A 6.686
153 107.4 0.059 85.5% A 6.621 .
154 104.8 0.068 88.4% A 6.836
155 64.39 0.035 98.4% B 6.797
A: > 2
B: > 1 and < 2
C: > 0.1 and < 1
D: < 0. 1
