Note: Descriptions are shown in the official language in which they were submitted.
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
INIR17 TRANSGENIC MAIZE
REFERENCE TO SEQUENCE LISTING SUBMITTED
ELECTRONICALLY
100011 The sequence listing contained in the file named "10098P1 ST25.txt,"and
which was
created on July 28, 2021 and electronically filed on July 28, 2021, is
incorporated herein by
reference in its entirety.
BACKGROUND
[0002] Transgenes which are placed into different positions in the plant
genome through non-
site specific integration can exhibit different levels of expression (Weising
et al., 1988, Ann.
Rev. Genet. 22:421-477). Such transgene insertion sites can also contain
various undesirable
rearrangements of the foreign DNA elements that include deletions and/or
duplications.
Furthermore, many transgene insertion sites can also comprise selectable or
scoreable marker
genes which in some instances are no longer required once a transgenic plant
event containing
the linked transgenes which confer desirable traits are selected.
[0003] Commercial transgenic plants typically comprise one or more independent
insertions
of transgenes at specific locations in the host plant genome that have been
selected for features
that include expression of the transgene(s) of interest and the transgene-
conferred trait(s),
absence or minimization of rearrangements, and normal Mendelian transmission
of the trait(s)
to progeny. An example of a selected transgenic maize event which confers
tolerance to certain
lepidopteran insect pests is the 5307 transgenic maize event disclosed in U.S.
Patent No.
8,466,346. The 5307 transgenic maize plants express an ecry3.1Ab protein (also
referred to as
an FR8a protein) which can confer resistance to western corn rootworm
(Diabrotica virgifera
virgifera), northern corn rootworm (D. longicomis barberi), southern corn
rootworm (D.
undecimpunctata howardi), and Mexican corn rootworm (D. virgifera zeae)
infestations. 5307
transgenic maize plants also express a phosphomannose isomerase selectable
marker protein.
- 1 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
[0004] Methods for removing selectable marker genes and/or duplicated
transgenes in
transgene insertion sites in plant genomes involving use of site-specific
recombinase systems
(e.g., cre-lox) as well as for insertion of new genes into transgene insertion
sites have been
disclosed (Srivastava and Ow; Methods Mol Biol, 2015,1287:95-103; Dale and Ow,
1991,
Proc. Natl Acad. Sci. USA 88, 10558-10562; Srivastava and Thomson, Plant
Biotechnol
J, 2016;14(2):471-82). Such methods typically require incorporation of the
recombination site
sequences recognized by the recombinase at particular locations within the
transgene.
SUMMARY
[0005] Transgenic maize plant cells, maize plant parts including seeds, and
transgenic plants
comprising a transgenic locus comprising the DNA molecule of SEQ ID NO: 33,
29, 30, 32,
26, 27, 34, 36, or an allelic variant thereof are provided. Use of such cells,
parts, and plants for
maize plant breeding are also provided.
[0006] Methods for obtaining a bulked population of seed comprising selfing
the
aforementioned transgenic maize plants are provided.
[0007] Methods of obtaining hybrid maize seed comprising crossing an
aforementioned
transgenic maize plant to a second maize plant which is genetically distinct
from the first maize
plant and harvesting seed comprising the INIR17 transgenic locus from the
cross are provided.
[0008] DNA molecules comprising SEQ ID NO: 16, 26, 27, 28, 29, 32, 33, 34, 36,
38, 39, or
40 are provided. Processed transgenic maize plant products and biological
samples comprising
the aforementioned DNA molecules are provided. Nucleic acid molecule adapted
for detection
of genomic DNA comprising the aforementioned DNA molecules are provided.
Methods of
detecting a maize plant cell comprising the INIR17 transgenic locus comprising
the DNA
molecule of SEQ ID NO: 33, 29, 30, 32, 26, 27, 34, 36, or an allelic variant
thereof, comprising
the step of detecting DNA molecule comprising SEQ ID NO: 16, 26, 27, 28, 29,
32, 33, 34, 36,
38, 39, or 40, are provided.
[0009] Method of excising an INIR17 transgenic locus from the genome of the
maize plant
cell comprising a transgenic locus comprising the DNA molecule of SEQ ID NO:
33, 29, 30,
or an allelic variant thereof, comprising the steps of: (a) contacting the
edited transgenic plant
genome of the plant cell with: (i) an RNA dependent DNA endonuclease (RdDe);
and (ii) a
guide RNA (gRNA) capable of hybridizing to the guide RNA hybridization site of
the
- 2 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
originator guide RNA recognition site (OgRRS) and the cognate guide
recognitions site
(CgRRS) of the transgenic locus; wherein the RdDe recognizes a OgRRS/gRNA and
a
CgRRS/gRNA hybridization complex; and, (b) selecting a transgenic plant cell,
transgenic
plant part, or transgenic plant wherein the INIR17 transgenic locus flanked by
the OgRRS and
the CgRRS has been excised are provided.
[0010] Methods of modifying a transgenic maize plant cell comprising:
obtaining a 5307 maize
event plant cell, a representative sample of which was deposited at the ATCC
under accession
No. PTA-9561, comprising a nucleotide sequence comprising a C 1V113 promoter,
a eCry3.1Ab
coding region which is operably linked to said promoter, a first nopaline
synthase (NOS)
terminator element which is operably linked to said eCry3.1Ab coding region, a
ZmUbiInt
promoter and an operably linked phosphomannose isomerase coding region, and a
second NOS
terminator element; and modifying said nucleotide sequence to eliminate
functionality of said
phosphomannose isomerase coding region and/or to substantially, essentially,
or completely
remove said phosphomannose isomerase coding region, and optionally to
eliminate
functionality of, or substantially, essentially, or completely remove, said
first NOS terminator,
said ZmUbiInt promoter, and said operably linked phosphomannose isomerase
coding region,
are provided.
[0011] Methods of modifying a transgenic maize plant cell comprising:
obtaining a 5307 maize
event plant cell, a representative sample of which was deposited at the ATCC
under accession
No. PTA-9561, comprising a nucleotide sequence comprising a 5' junction
polynucleotide, a
CMP promoter, a eCry3.1Ab coding region which is operably linked to said
promoter, a first
nopaline synthase (NOS) terminator element which is operably linked to said
eCry3.1Ab
coding region, a ZmUbiInt promoter and an operably linked phosphomannose
isomerase
coding region, and a second NOS terminator element; and modifying said
nucleotide sequence
to: (i) substantially, essentially, or completely remove said first NOS
terminator, said ZmUbiInt
promoter, and said operably linked phosphomannose isomerase coding region; and
(ii) delete
and/or substitute one or more nucleotides of said 5' junction polynucleotide,
optionally wherein
one or more nucleotides or a polynucleotide sequence comprising a CgRRS are
inserted into
said 5' junction polynucleotide, are provided.
[0012] Methods of making transgenic maize plant cell comprising an INIR17
transgenic locus
comprising: (a) contacting the transgenic plant genome of a maize 5307 plant
cell with: (i) a
first set of gene editing molecules comprising a first site-specific nuclease
which introduces at
- 3 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
least one first double stranded DNA break in a 5' junction polynucleotide of a
5307 transgenic
locus; and (ii) a second set of gene editing molecules comprising a second
site-specific nuclease
which introduces a second double stranded DNA break between the eCry3.1Ab
coding
sequence and the first nopaline synthase (NOS) terminator of said 5307
transgenic locus and a
third site specific nuclease which introduces a third double stranded DNA
break between the
phosphomannose isomerase coding region and DNA encoding the second nopaline
synthase
(nos) terminator element of said 5307 transgenic locus; and (b) selecting a
transgenic maize
plant cell, transgenic maize callus, and/or a transgenic maize plant
comprising an INIR17
transgenic locus wherein one or more nucleotides of said 5' junction
polynucleotide have been
deleted and/or substituted, wherein the ClVIP promoter, the eCry3.1Ab coding
region which is
operably linked to the CMP promoter, and the second NOS terminator element of
said 5307
transgenic locus are present, and wherein DNA of said 5307 transgenic locus
comprising the
first NOS terminator, the ZmUbiInt promoter and the phosphomannose isomerase
coding
region is absent, thereby making a transgenic maize plant cell comprising an
INIR17 transgenic
locus, are provided.
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
[0013] Figure 1 shows a schematic diagram of transgene expression cassettes
and selectable
markers in the 5307 transgenic locus in the deposited seed of ATCC accession
No. PTA-9561
with SEQ ID NO for the corresponding segments (not to scale).
[0014] Figure 2 shows a schematic diagram which compares current breeding
strategies for
introgression of transgenic events (i.e., transgenic loci) to alternative
breeding strategies for
introgression of transgenic events where the transgenic events (i.e.,
transgenic loci) can be
removed following introgression to provide different combinations of
transgenic traits. In
Figure 2, "GE" refers to genome editing (e.g., including introduction of
targeted genetic
changes with genome editing molecules and "Event Removal" refers to excision
of a transgenic
locus (i.e., an "Event") or portion thereof with genome editing molecules.
[0015] Figure 3A, B, C. Figure 3A shows a schematic diagram of a non-limiting
example of:
(i) an untransformed plant chromosome containing non-transgenic DNA which
includes the
originator guide RNA recognition site (OgRRS) (top); (ii) the original
transgenic locus with
the OgRRS in the non-transgenic DNA of the 1st junction polynucleotide
(middle); and (iii) the
modified transgenic locus with a cognate guide RNA inserted into the non-
transgenic DNA of
- 4 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
the 2'd junction polynucleotide (bottom). Figure 3B shows a schematic diagram
of a non-
limiting example of a process where a modified transgenic locus with a cognate
guide RNA
inserted into the non-transgenic DNA of the 2'd junction polynucleotide (top)
is subjected to
cleavage at the OgRRS and CgRRS with one guide RNA (gRNA) that hybridizes to
gRNA
hybridization site in both the OgRRS and the CgRRS and an RNA dependent DNA
endonuclease (RdDe) that recognizes and cleaves the gRNA/OgRRS and the
gRNA/CgRRS
complex followed by non-homologous end joining processes to provide a plant
chromosome
where the transgenic locus is excised. Figure 3C shows a schematic diagram of
a non-limiting
example of a process where a modified transgenic locus with a cognate guide
RNA inserted
into the non-transgenic DNA of the 2'd junction polynucleotide (top) is
subjected to cleavage
at the OgRRS and CgRRS with one guide RNA (gRNA) that hybridizes to the gRNA
hybridization site in both the OgRRS and the CgRRS and an RNA dependent DNA
endonuclease (RdDe) that recognizes and cleaves the gRNA/OgRRS and the
gRNA/CgRRS
complex in the presence of a donor DNA template. In Figure 3C, cleavage of the
modified
transgenic locus in the presence of the donor DNA template which has homology
to non-
transgenic DNA but lacks the OgRRS in the 151. and 2nd junction
polynucleotides followed by
homology-directed repair processes to provide a plant chromosome where the
transgenic locus
is excised and non-transgenic DNA present in the untransformed plant
chromosome is at least
partially restored.
[0016] Figure 4 shows a schematic diagram of an unmodified 5307 transgenic
locus (top most),
a strategy for introducing DSB at a 5' junction polynucleotide (2nd from top),
an INIR17
transgenic locus comprising a modified 5' DNA junction polynucleotide sequence
(3'1 from
top), a strategy for introducing additional DSB at sites 5' to the 151. NOS
terminator and 3' to
the pmi CDS (41h from top), a resultant deletion of the 15tNOS terminator,
ZmUbiInt promoter,
and pmi CDS (51h and 611' from top), and a resultant INIR17 locus comprising a
modified 5'
junction sequence and the deletion of the 1" NOS terminator, ZmUbiInt
promoter, and pmi
CDS (bottom most).
[0017] Figure 5 shows a schematic diagram where an Originator guide RNA
Recognition Site
(OgRRS) present in a 5307 transgenic locus (top most and second from top) is
"copied" via
gene editing at the site of a DSB in a 5' junction polynucleotide (e.g., by
homology directed
repair with a donor polynucleotide template at the site of the DSB) to provide
an INIR17 locus
(third from top) with a Cognate guide RNA Recognition Site (CgRRS) which can
be excised
- 5 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
with a single gRNA that recognizes the OgRRS and the CgRRS. An INIR17
transgenic locus
comprising a CgRRS and a deletion of the 1" NOS terminator, ZmUbiInt promoter,
and pmi
CDS is also shown (bottom most).
[0018] Figure 6A and 6B show the sequence of the DNA near the 5' junction
polynucleotide
of the 5307 transgenic locus and the location of Cas12a guide RNA recognition
sites. In the
Fig. 6A and 6B, "SEQ ID NO:5" corresponds to the displayed section of SEQ ID
NO:5 of US
Patent. No. 8,466,346 and the displayed section of SEQ ID NO:7 of the instant
application.
[0019] Figures 7A and 7B show the sequences of the 5307 transgenic locus that
can be used to
delete the 1st NOS terminator, ZmUbiInt promoter, and pmi coding region of the
5307 locus.
Sequences located at the 5' end of the 1st NOS teeminator targeted for
cleavage by the guide
RNA of SEQ ID NO:12 are shown in Fig. 7A and the sequences spanning the 3' end
of the pmi
coding region ans intervening sequence targeted for cleavage by the guide RNA
of SEQ ID
NO:13 are shown in Fig. 7B . In the Fig. 7A and 7B, "SEQ ID NO:7" corresponds
to the
displayed section of SEQ ID NO:7 of US Patent. No. 8,466,346 and the displayed
section of
SEQ ID NO:1 of the instant application.
[0020] Figures 8A, 8B, 8C, and 8D show an annotated sequence of the maize 5307
transgenic
locus (SEQ ID NO: 1). The 5' and 3' flanking plant genomic sequence is
underlined.
[0021] Figures 9A and 9B show an annoted INIR17 transgenic locus sequence (SEQ
ID NO:
33) which contains a CgRRS insertion at the 5'end of the ClVIP promoter and a
deletion of
DNA comprising the first NOS terminator, the ZmUbiInt promoter, and pmi coding
region of
the 5307 transgenic locus. The CgRRS and OgRRS sequences are in italics and
uppercase. The
5' and 3' flanking plant genomic sequence is underlined and in uppercase.
Transgenic insert
sequence other than that corresponding to the CgRRS and OgRRS are in
lowercase.
DETAILED DESCRIPTION
[0022] Unless otherwise stated, nucleic acid sequences in the text of this
specification are
given, when read from left to right, in the 5' to 3' direction. Nucleic acid
sequences may be
provided as DNA or as RNA, as specified; disclosure of one necessarily defines
the other, as
well as necessarily defines the exact complements, as is known to one of
ordinary skill in the
art.
[0023] Where a term is provided in the singular, the inventors also
contemplate embodiments
described by the plural of that term.
- 6 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
[0024] The term "about" as used herein means a value or range of values which
would be
understood as an equivalent of a stated value and can be greater or lesser
than the value or
range of values stated by 10 percent. Each value or range of values preceded
by the term
"about" is also intended to encompass the embodiment of the stated absolute
value or range of
values.
[0025] The phrase "allelic variant" as used herein refers to a polynucleotide
or polypeptide
sequence variant that occurs in a different strain, variety, or isolate of a
given organism.
[0026] The term "and/or" where used herein is to be taken as specific
disclosure of each of the
two specified features or components with or without the other. Thus, the term
and/or" as used
in a phrase such as "A and/or B" herein is intended to include "A and B," "A
or B," "A" (alone),
and "B" (alone). Likewise, the term "and/or" as used in a phrase such as "A,
B, and/or C" is
intended to encompass each of the following embodiments: A, B, and C; A, B, or
C; A or C;
A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C
(alone).
[0027] As used herein, the phrase "approved transgenic locus" is a genetically
modified plant
event which has been authorized, approved, and/or de-regulated for any one of
field testing,
cultivation, human consumption, animal consumption, and/or import by a
governmental body.
Illustrative and non-limiting examples of governmental bodies which provide
such approvals
include the Ministry of Agriculture of Argentina, Food Standards Australia New
Zealand,
National Biosafety Technical Committee (CTNBio) of Brazil, Canadian Food
Inspection
Agency, China Ministry of Agriculture Biosafety Network, European Food Safety
Authority,
US Department of Agriculture, US Department of Environmental Protection, and
US Food and
Drug Administration.
[0028] The term "backcross", as used herein, refers to crossing an F 1 plant
or plants with one
of the original parents. A backcross is used to maintain or establish the
identity of one parent
(species) and to incorporate a particular trait from a second parent
(species). The term
"backcross generation", as used herein, refers to the offspring of a
backcross.
[0029] As used herein, the phrase "biological sample" refers to either intact
or non-intact (e.g.
milled seed or plant tissue, chopped plant tissue, lyophilized tissue) plant
tissue. It may also be
an extract comprising intact or non-intact seed or plant tissue. The
biological sample can
comprise flour, meal, syrup, oil, starch, and cereals manufactured in whole or
in part to contain
crop plant by-products. In certain embodiments, the biological sample is "non-
regenerable"
(i.e., incapable of being regenerated into a plant or plant part). In certain
embodiments, the
- 7 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
biological sample refers to a homogenate, an extract, or any fraction thereof
containing
genomic DNA of the organism from which the biological sample was obtained,
wherein the
biological sample does not comprise living cells.
[0030] As used herein, the terms "correspond," "corresponding," and the like,
when used in
the context of an nucleotide position, mutation, and/or substitution in any
given polynucleotide
(e.g., an allelic variant of SEQ ID NO:1) with respect to the reference
polynucleotide sequence
(e.g., SEQ ID NO:1) all refer to the position of the polynucleotide residue in
the given sequence
that has identity to the residue in the reference nucleotide sequence when the
given
polynucleotide is aligned to the reference polynucleotide sequence using a
pairwise alignment
algorithm (e.g., CLUSTAL 0 1.2.4 with default parameters).
[0031] As used herein, the terms "Cpfl" and "Cas12a" are used interchangeably
to refer to the
same RNA dependent DNA endonuclease (RdDe). Cas12a proteins include the
protein
provided herein as SEQ ID NO:37.
[0032] The term "crossing" as used herein refers to the fertilization of
female plants (or
gametes) by male plants (or gametes). The term "gamete" refers to the haploid
reproductive
cell (egg or pollen) produced in plants by meiosis from a gametophyte and
involved in sexual
reproduction, during which two gametes of opposite sex fuse to form a diploid
zygote. The
term generally includes reference to a pollen (including the sperm cell) and
an ovule (including
the ovum). When referring to crossing in the context of achieving the
introgression of a
genomic region or segment, the skilled person will understand that in order to
achieve the
introgression of only a part of a chromosome of one plant into the chromosome
of another
plant, random portions of the genomes of both parental lines recombine during
the cross due
to the occurrence of crossing-over events in the production of the gametes in
the parent lines.
Therefore, the genomes of both parents must be combined in a single cell by a
cross, where
after the production of gametes from the cell and their fusion in
fertilization will result in an
introgression event.
[0033] As used herein, the phrases "DNA junction polynucleotide" and "junction
polynucleotide" refers to a polynucleotide of about 18 to about 500 base pairs
in length
comprised of both endogenous chromosomal DNA of the plant genome and
heterologous
transgenic DNA which is inserted in the plant genome. A junction
polynucleotide can thus
comprise about 8, 10, 20, 50, 100, 200, 250, 500, or 1000 base pairs of
endogenous
chromosomal DNA of the plant genome and about 8, 10, 20, 50, 100, 200, 250,
500, or 1000
- 8 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
base pairs of heterologous transgenic DNA which span the one end of the
transgene insertion
site in the plant chromosomal DNA. Transgene insertion sites in chromosomes
will typically
contain both a 5' junction polynucleotide and a 3' junction polynucleotide. In
embodiments set
forth herein in SEQ ID NO:1, the 5' junction polynucleotide is located at the
5' end of the
sequence and the 3' junction polynucleotide is located at the 3' end of the
sequence. In a non-
limiting and illustrative example, a 5' junction polynucleotide of a
transgenic locus is telomere
proximal in a chromosome arm and the 3' junction polynucleotide of the
transgenic locus is
centromere proximal in the same chromosome arm. In another non-limiting and
illustrative
example, a 5' junction polynucleotide of a transgenic locus is centromere
proximal in a
chromosome arm and the 3' junction polynucleotide of the transgenic locus is
telomere
proximal in the same chromosome arm. The junction polynucleotide which is
telomere
proximal and the junction polynucleotide which is centromere proximal can be
determined by
comparing non-transgenic genomic sequence of a sequenced non-transgenic plant
genome to
the non-transgenic DNA in the junction polynucleotides.
[0034] The term "donor," as used herein in the context of a plant, refers to
the plant or plant
line from which the trait, transgenic event, or genomic segment originates,
wherein the donor
can have the trait, introgression, or genomic segment in either a heterozygous
or homozygous
state.
[0035] As used herein, the terms "excise" and "delete," when used in the
context of a DNA
molecule, are used interchangeably to refer to the removal of a given DNA
segment or element
(e.g., transgene element or transgenic locus or portion thereof) of the DNA
molecule.
[0036] As used herein, the phrase "elite crop plant" refers to a plant which
has undergone
breeding to provide one or more trait improvements. Elite crop plant lines
include plants which
are an essentially homozygous, e.g. inbred or doubled haploid. Elite crop
plants can include
inbred lines used as is or used as pollen donors or pollen recipients in
hybrid seed production
(e.g. used to produce Fl plants). Elite crop plants can include inbred lines
which are selfed to
produce non-hybrid cultivars or varieties or to produce (e.g., bulk up) pollen
donor or recipient
lines for hybrid seed production. Elite crop plants can include hybrid Fl
progeny of a cross
between two distinct elite inbred or doubled haploid plant lines.
[0037] As used herein, an "event," "a transgenic event," "a transgenic locus"
and related
phrases refer to an insertion of one or more transgenes at a unique site in
the genome of a plant
as well as to DNA fragments, plant cells, plants, and plant parts (e.g.,
seeds) comprising
- 9 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
genomic DNA containing the transgene insertion. Such events typically comprise
both a 5'
and a 3' DNA junction polynucleotide and confer one or more useful traits
including herbicide
tolerance, insect resistance, male sterility, and the like.
[0038] As used herein, the phrases "endogenous sequence," "endogenous gene,"
"endogenous
DNA," "endogenous polynucleotide," and the like refer to the native form of a
polynucleotide,
gene or polypeptide in its natural location in the organism or in the genome
of an organism.
[0039] The terms "exogenous" and "heterologous" as are used synonymously
herein to refer
to any polynucleotide (e.g. DNA molecule) that has been inserted into a new
location in the
genome of a plant. Non-limiting examples of an exogenous or heterologous DNA
molecule
include a synthetic DNA molecule, a non-naturally occurring DNA molecule, a
DNA molecule
found in another species, a DNA molecule found in a different location in the
same species,
and/or a DNA molecule found in the same strain or isolate of a species, where
the DNA
molecule has been inserted into a new location in the genome of a plant.
[0040] As used herein, the term "Fl" refers to any offspring of a cross
between two genetically
unlike individuals.
[0041] As used herein, the terms "1' NOS terminator" or "first NOS terminator"
and "2nd NOS
terminator" or "second NOS terminator" refer respectively to the NOS
terminator which is
operably linked to the 3' end of the eCry3.1Ab coding region of the 5307
transgenic locus and
the NOS terminator which is operably linked to the 3' end of the pmi coding
region of the 5307
transgenic locus. In Figure 1, the "1" NOS terminator" or "first NOS
terminator" is located
between the 3' end of the eCry3.1Ab coding region and the ZmUbiInt promoter.
The "2nd NOS
terminator" or "second NOS terminator" is located between the 3' end of the
pmi coding region
and the 3' junction in Figure 1.
[0042] The term "gene," as used herein, refers to a hereditary unit consisting
of a sequence of
DNA that occupies a specific location on a chromosome and that contains the
genetic
instruction for a particular characteristics or trait in an organism. The term
"gene" thus includes
a nucleic acid (for example, DNA or RNA) sequence that comprises coding
sequences
necessary for the production of an RNA, or a polypeptide or its precursor. A
functional
polypeptide can be encoded by a full-length coding sequence or by any portion
of the coding
sequence as long as the desired activity or functional properties (e.g.,
enzymatic activity,
pesticidal activity, ligand binding, and/or signal transduction) of the RNA or
polypeptide are
retained.
- 10 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
[0043] The term "identifying," as used herein with respect to a plant, refers
to a process of
establishing the identity or distinguishing character of a plant, including
exhibiting a certain
trait, containing one or more transgenes, and/or containing one or more
molecular markers.
[0044] As used herein, the term "INIR17" is used herein to refer either
individually or
collectively to items that include any or all of the 5307 transgenic maize
loci which have been
modified as disclosed herein, transgenic maize plants and parts thereof
including seed that
comprise the modified 5307 transgenic loci, and DNA obtained therefrom.
[0045] The term "isolated" as used herein means having been removed from its
natural
environment.
[0046] As used herein, the terms "include," "includes," and "including" are to
be construed as
at least having the features to which they refer while not excluding any
additional unspecified
features.
[0047] As used herein, the phrase "introduced transgene" is a transgene not
present in the
original transgenic locus in the genome of an initial transgenic event or in
the genome of a
progeny line obtained from the initial transgenic event. Examples of
introduced transgenes
include exogenous transgenes which are inserted in a resident original
transgenic locus.
[0048] As used herein, the terms "introgression", "introgressed" and
"introgressing" refer to
both a natural and artificial process, and the resulting plants, whereby
traits, genes or DNA
sequences of one species, variety or cultivar are moved into the genome of
another species,
variety or cultivar, by crossing those species. The process may optionally be
completed by
backcrossing to the recurrent parent. Examples of introgression include entry
or introduction
of a gene, a transgene, a regulatory element, a marker, a trait, a trait
locus, or a chromosomal
segment from the genome of one plant into the genome of another plant.
[0049] The phrase "marker-assisted selection", as used herein, refers to the
diagnostic process
of identifying, optionally followed by selecting a plant from a group of
plants using the
presence of a molecular marker as the diagnostic characteristic or selection
criterion. The
process usually involves detecting the presence of a certain nucleic acid
sequence or
polymorphism in the genome of a plant.
[0050] As used herein, the term "5307" is used to refer to items that include
a transgenic maize
locus, transgenic maize plants and parts thereof including seed set forth in
US Patent No.
8,466,346, which is incorporated herein by reference in its entirety.
Representative 5307
transgenic maize seed have been deposited at the American Type Culture
Collection (ATCC,
-11-
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
Manassas, VA, USA) as accession No. PTA-9561. 5307 transgenic loci include
loci having
the sequence of SEQ ID NO:1, the sequence of the 5307 locus in the deposited
seed of
accession No. PTA-9561 and any progeny thereof, as well as allelic variants
and other variants
of SEQ ID NO: 1. Other variants of a 5307 locus can include variants in 5307
other than those
disclosed herein obtained by gene editing techniques (e.g., by use of RdDe,
CBE, or ABE and
gRNAs, TALENs, and/or ZFN).
[0051] The phrase "molecular marker", as used herein, refers to an indicator
that is used in
methods for visualizing differences in characteristics of nucleic acid
sequences. Examples of
such indicators are restriction fragment length polymorphism (RFLP) markers,
amplified
fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms
(SNPs),
microsatellite markers (e.g. SSRs), sequence-characterized amplified region
(SCAR) markers,
Next Generation Sequencing (NGS) of a molecular marker, cleaved amplified
polymorphic
sequence (CAPS) markers or isozyme markers or combinations of the markers
described herein
which defines a specific genetic and chromosomal location.
[0052] As used herein the terms "native" or "natural" define a condition found
in nature. A
"native DNA sequence" is a DNA sequence present in nature that was produced by
natural
means or traditional breeding techniques but not generated by genetic
engineering (e.g., using
molecular biology/transformation techniques).
[0053] The term "offspring", as used herein, refers to any progeny generation
resulting from
crossing, selfing, or other propagation technique.
[0054] The phrase "operably linked" refers to a juxtaposition wherein the
components so
described are in a relationship permitting them to function in their intended
manner. For
instance, a promoter is operably linked to a coding sequence if the promoter
affects its
transcription or expression. When the phrase "operably linked" is used in the
context of a PAM
site and a guide RNA hybridization site, it refers to a PAM site which permits
cleavage of at
least one strand of DNA in a polynucleotide with an RNA dependent DNA
endonuclease or
RNA dependent DNA nickase which recognize the PAM site when a guide RNA
complementary to guide RNA hybridization site sequences adjacent to the PAM
site is present.
A OgRRS and its CgRRS, sPAM sites, or sigRNAR sites are operably linked to
junction
polynucleotides when they can be recognized by a gRNA and an RdDe to provide
for excision
of the transgenic locus or portion thereof flanked by the junction
polynucleotides. When the
phrase "operably linked" is used in the context of a signature PAM site and a
DNA junction
- 12 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
polynucleotide, it refers to a PAM site which permits cleavage of at least one
strand of DNA
in the junction polynucleotide with an RNA dependent DNA endonuclease, RNA
dependent
DNA binding protein, or RNA dependent DNA nickase which recognizes the PAM
site when
a guide RNA complementary to sequences adj acent to the PAM site is present.
When the phrase
"operably linked" is used in the context of a sigRNAR site and a DNA junction
polynucleotide,
it refers to a sigRNAR site which permits cleavage of at least one strand of
DNA in the junction
polynucleotide with an RNA dependent DNA endonuclease, RNA dependent DNA
binding
protein, or RNA dependent DNA nickase which recognizes the sigRNAR site when a
guide
RNA complementary to the heterologous sequences adjacent in the sigRNAR site
is present.
[0055] As used herein, the term "plant" includes a whole plant and any
descendant, cell, tissue,
or part of a plant. The term "plant parts" include any part(s) of a plant,
including, for example
and without limitation: seed (including mature seed and immature seed); a
plant cutting; a plant
cell; a plant cell culture; or a plant organ (e.g., pollen, embryos, flowers,
fruits, shoots, leaves,
roots, stems, and explants). A plant tissue or plant organ may be a seed,
protoplast, callus, or
any other group of plant cells that is organized into a structural or
functional unit. A plant cell
or tissue culture may be capable of regenerating a plant having the
physiological and
morphological characteristics of the plant from which the cell or tissue was
obtained, and of
regenerating a plant having substantially the same genotype as the plant.
Regenerable cells in
a plant cell or tissue culture may be embryos, protoplasts, meristematic
cells, callus, pollen,
leaves, anthers, roots, root tips, silk, flowers, kernels, ears, cobs, husks,
or stalks. In contrast,
some plant cells are not capable of being regenerated to produce plants and
are referred to
herein as "non-regenerable" plant cells.
[0056] The term "purified," as used herein defines an isolation of a molecule
or compound in
a form that is substantially free of contaminants normally associated with the
molecule or
compound in a native or natural environment and means having been increased in
purity as a
result of being separated from other components of the original composition.
The term
"purified nucleic acid" is used herein to describe a nucleic acid sequence
which has been
separated from other compounds including, but not limited to polypeptides,
lipids and
carbohydrates.
[0057] The term "recipient", as used herein, refers to the plant or plant line
receiving the trait,
transgenic event or genomic segment from a donor, and which recipient may or
may not have
- 13 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
the have trait, transgenic event or genomic segment itself either in a
heterozygous or
homozygous state.
[0058] As used herein the term "recurrent parent" or "recurrent plant"
describes an elite line
that is the recipient plant line in a cross and which will be used as the
parent line for successive
backcrosses to produce the final desired line.
[0059] As used herein the term "recurrent parent percentage" relates to the
percentage that a
backcross progeny plant is identical to the recurrent parent plant used in the
backcross. The
percent identity to the recurrent parent can be determined experimentally by
measuring genetic
markers such as SNPs and/or RFLPs or can be calculated theoretically based on
a mathematical
formula.
[0060] The terms "selfed," "selfing," and "self," as used herein, refer to any
process used to
obtain progeny from the same plant or plant line as well as to plants
resulting from the process.
As used herein, the terms thus include any fertilization process wherein both
the ovule and
pollen are from the same plant or plant line and plants resulting therefrom.
Typically, the terms
refer to self-pollination processes and progeny plants resulting from self-
pollination.
[0061] The term "selecting", as used herein, refers to a process of picking
out a certain
individual plant from a group of individuals, usually based on a certain
identity, trait,
characteristic, and/or molecular marker of that individual.
[0062] As used herein, the phrase "originator guide RNA recognition site" or
the acronym
"OgRRS" refers to an endogenous DNA polynucleotide comprising a protospacer
adjacent
motif (PAM) site operably linked to a guide RNA hybridization site. In certain
embodiments,
an OgRRS can be located in an untransformed plant chromosome or in non-
transgenic DNA
of a DNA junction polynucleotide of both an original transgenic locus and a
modified
transgenic locus. In certain embodiments, an OgRRS can be located in
transgenic DNA of a
DNA junction polynucleotide of both an original transgenic locus and a
modified transgenic
locus. In certain embodiments, an OgRRS can be located in both transgenic DNA
and non-
transgenic DNA of a DNA junction polynucleotide of both an original transgenic
locus and a
modified transgenic locus (i.e., can span transgenic and non-transgenic DNA in
a DNA
junction polynucleotide).
[0063] As used herein the phrase "cognate guide RNA recognition site" or the
acronym
"CgRRS" refer to a DNA polynucleotide comprising a PAM site operably linked to
a guide
RNA hybridization site, where the CgRRS is absent from transgenic plant
genomes comprising
- 14 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
a first original transgenic locus that is unmodified and where the CgRRS and
its corresponding
OgRRS can hybridize to a single gRNA. A CgRRS can be located in transgenic DNA
of a
DNA junction polynucleotide of a modified transgenic locus, in transgenic DNA
of a DNA
junction polynucleotide of a modified transgenic locus, or in both transgenic
and non-
transgenic DNA of a modified transgenic locus (i.e., can span transgenic and
non-transgenic
DNA in a DNA junction polynucleotide).
[0064] As used herein, the phrase "a transgenic locus excision site" refers to
the DNA which
remains in the genome of a plant or in a DNA molecule (e.g., an isolated or
purified DNA
molecule) wherein a segment comprising, consisting essentially of, or
consisting of a
transgenic locus or portion thereof has been deleted. In a non-limiting and
illustrative example,
a transgenic locus excision site can thus comprise a contiguous segment of DNA
comprising
at least 10 base pairs of DNA that is telomere proximal to the deleted
transgenic locus or to the
deleted segment of the transgenic locus and at least 10 base pairs of DNA that
is centromere
proximal to the deleted transgenic locus or to the deleted segment of the
transgenic locus.
[0065] As used herein, the phrase "signature protospacer adjacent motif
(sPAM)" or acronym
"sPAM" refer to a PAM which has been introduced into a transgenic plant genome
by genome
editing, wherein the sPAM is absent from a transgenic plant genome comprising
the original
transgenic locus. A sPAM can be introduced by an insertion, deletion, and or
substitution of
one or more nucleotides in genomic DNA.
[0066] As used herein the phrase "signature guide RNA Recognition site" or
acronym
"sigRNAR site" refer to a DNA polynucleotide comprising a heterologous crRNA
(CRISPR
RNA) binding sequence located immediately 5' or 3' to a PAM site, wherein the
sigRNAR site
has been introduced into a transgenic plant genome by genome editing and
wherein at least the
heterologous crRNA binding sequence is absent from a transgenic plant genome
comprising
the original transgenic locus. In certain embodiments, the heterologous crRNA
binding
sequence is operably linked to a pre-existing PAM site in the transgenic plant
genome. In other
embodiments, the heterologous crRNA binding sequence is operably linked to a
sPAM site in
the transgenic plant genome.
[0067] As used herein, the phrase "transgene element" refers to a segment of
DNA comprising,
consisting essentially of, or consisting of a promoter, a 5' UTR, an intron, a
coding region, a
3'UTR, or a polyadenylation signal. Polyadenylation signals include transgene
elements
referred to as "terminators" (e.g., NOS, pinII, rbcs, Hsp17, TubA).
- 15 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
[0068] To the extent to which any of the preceding definitions is inconsistent
with definitions
provided in any patent or non-patent reference incorporated herein by
reference, any patent or
non-patent reference cited herein, or in any patent or non-patent reference
found elsewhere, it
is understood that the preceding definition will be used herein.
[0069] Various sequences set forth in the sequence listing are described in
the following table.
[0070] Table 1. Description of sequences.
SEQ ID NO Description
5307 transgenic locus sequence comprising 5' flanking plant genomic DNA, 5'
junction, eCry3.1Ab expression cassette, pmi expression cassette, 3' junction,
and
1 3' flanking plant genomic DNA
2 3' flanking plant genomic DNA.
3 3' junction (small)
4 3' junction (large)
5' junction (small)
6 5' junction (large)
7 5' flanking plant genomic DNA
8 DNA encoding guide targeting 5' junction
9 DNA encoding guide targeting 5' junction
DNA encoding guide targeting 5' junction (gRNA-3)
11 DNA encoding guide targeting 5' junction (gRNA-4)
DNA encoding first guide targeting 1st NOS term, ZmUbiInt promoter, and pmi
12 removal
DNA encoding second guide targeting 1st NOS term, ZmUbiInt promoter, and pmi
13 removal
14 Forward primer to PCR amplify or sequence 5'-junction
Reverse primer to PCR amplify or sequence 5'-junction
Template for HDR-mediated insertion of a CgRRS comprising SEQ ID NO: 20 at
16 5' end of 5307 transgenic insert
17 Sequence of an OgRRS located in 3' junction of 5307 locus
18 Forward primer to PCR amplify the HDR insert at the 5'-junction
19 Reverse primer to PCR amplify the HDR insert at the 5'-junction
Guide RNA recognition site in OgRRS of SEQ ID NO: 20
21 HDR product produced by PCR with SEQ ID NO: 18 and 19 primers.
22 HDR product produced by PCR with SEQ ID NO: 18 and 19primers
This is 5307-PMI-ampseq-5' in the text. Used to confirm elimination of
23 NOS::ZmUBI::PMI. Currently SEQ ID NO: 35.
This is 5307-PMI-ampseq-3' in the text. Used to confirm elimination of
24 NOS::ZmUBI::PMI.
The complete, modified insert sequence after SEQ ID NO: 8 (cut/repair-Option 1
from Example 1)
INIR17 transgenic locus subsequence comprising the 5' flanking genomic DNA
26 and 5' junction polynucleotide using 1st option (SEQ ID NO: 8) for
single cut
The complete, modified insert sequence after SEQ ID NO: 9 cut/repair-Option 2
27 from Example 1
- 16 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
INIR17 transgenic locus subsequence obtained using 2d option (SEQ ID NO: 9)
28 for single cut
INIR17 transgenic locus comprising a 5'-CgRRS addition in 5307 transgenic
locus
29 using the SEQ ID NO: 8 gRNA recognition site
INIR17 transgenic locus comprising a 5'-CgRRS addition in 5307 transgenic
locus
30 using the SEQ ID NO: 8 gRNA recognition site
31 guide RNA target sequence for effecting deletions in a 5307 5'
junction sequence
INIR17 transgenic locus comprising a NOS::ZmUbi::PMI deletion obtained with
32 SEQ ID NOS: 12 & 13
INIR17 transgenic locus comprising a 5'-CgRRS addition and a
33 NOS::ZmUbi::PMI deletion obtained with SEQ ID NOS: 12 & 13.
INIR17 transgenic locus subsequence comprising a 5' junction polynucleotide
edit
34 and a NOS::ZmUbi::PMI deletion
35 Remainder of insert, see event 5307
INIR17 transgenic locus sequence comprising a 5' junction polynucleotide edit
and
36 a NOS::ZmUbi::PMI deletion
(Cas12a Nuclease ) (>splU2UMQ6ICS12A_ACISB CRISPR-associated
endonuclease Cas12a OS=Acidaminococcus sp. (strain BV3L6) OX=1111120
37 GN=cas12a PE=1 SV=1)
38 Unique 5' junction polynucleotode
39 Unique 5' junction polynucleotode
40 Unique NOS/ZmUbi/PMI deletion junction
41 5' jxn detection primer 1
42 5' jxn detection primer 2
[0071] Genome editing molecules can permit introduction of targeted
genetic change
conferring desirable traits in a variety of crop plants (Zhang et al. Genome
Biol. 2018; 19: 210;
Schindele et al. FEBS Lett. 2018;592(12):1954). Desirable traits introduced
into crop plants
such as maize include herbicide tolerance, improved food and/or feed
characteristics, male-
sterility, and drought stress tolerance. Nonetheless, full realization of the
potential of genome
editing methods for crop improvement will entail efficient incorporation of
the targeted genetic
changes in germplasm of different elite crop plants adapted for distinct
growing conditions.
Such elite crop plants will also desirably comprise useful transgenic loci
which confer various
traits including herbicide tolerance, pest resistance (e.g.; insect, nematode,
fungal disease, and
bacterial disease resistance), conditional male sterility systems for hybrid
seed production,
abiotic stress tolerance (e.g., drought tolerance), improved food and/or feed
quality, and
improved industrial use (e.g., biofuel).
[0072] INIR17 transgenic loci comprising modifications of a 5307
transgenic loci in a
maize plant genome by directed insertion, deletion, and/or substitution of DNA
within or
adjacent to such 5307 transgenic loci as well as methods of making and using
such INIR17
- 17 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
transgenic loci are provided herein. In certain embodiments, the INIR17
transgenic loci
comprise the CMP promoter, the eCry3.1Ab coding region which is operably
linked to said
promoter, and the 2nd nopaline synthase terminator element of a 5307
transgenic locus which
is operably linked to the eCry3.1Ab coding region, wherein DNA of said 5307
transgenic locus
comprising the 1" NOS terminator element, the ZmUbiInt promoter and the
operably linked
phosphomannose isomerase (pmi) coding region is absent. Such INIR17 transgenic
loci can
thus comprise an eCry3.1Ab expression cassette and a single NOS terminator
element (i.e., the
2nd NOS terminator) while lacking non-essential DNA elements (e.g.., the 1"
NOS terminator,
the ZmUbiInt promoter, and the pmi selectable marker gene which is operably
linked thereto)
such as in the non-limiting examples illustrated in Figures 4 and 5. In
certain embodiments, the
INIR17 transgenic loci can comprise a cognate guide RNA recognition site
(CgRRS) or can
comprise both a CgRRS and lack non-essential DNA elements (e.g., the 1" NOS
terminator,
the ZmUbiInt promoter, and the pmi selectable marker gene which is operably
linked thereto)
such as in the non-limiting example illustrated in Figure 5.
[0073] In certain embodiments, INIR17 transgenic loci provided herein can
thus
comprise deletions of selectable marker genes and/or repetitive sequences. In
its unmodified
form (in certain embodiments, the "unmodified form" is the "original form,"
"original
transgenic locus," etc.) a 5307 transgenic locus comprises a phosphomannose
isomerase (pmi)-
encoding selectable marker gene which confers the ability to grow on mannose
as a carbon
source. In embodiments provided herein, the selectable marker gene which is
deleted
comprises, consists essentially of, or consists of a DNA molecule encoding:
(i) the
phosphomannose isomerase (pmi) of a 5307 transgenic locus and the ZmUbi
promoter that is
operably linked thereto; or (ii) the 1" NOS terminator, the ZmUbi promoter,
and the
phosphomannose isomerase (pmi) selectable marker gene of a 5307 transgenic
locus. In certain
embodiments, DNA elements comprising the 1" NOS terminator, the ZmUbi
promoter, and
the phosphomannose isomerase (pmi) selectable marker gene of a 5307 transgenic
locus of
SEQ ID NO:1 can be absent from an INIR17 locus. In certain embodiments, the
INIR17 locus
comprising a deletion of DNA encoding the 1" NOS terminator, the ZmUbi
promoter, and the
phosphomannose isomerase (pmi) selectable marker gene of a 5307 transgenic
locus is set forth
in SEQ ID NO:32, 33, or 36. In certain embodiments, the DNA comprising the 1"
NOS
terminator, the ZmUbi promoter, and the phosphomannose isomerase (pmi)
selectable marker
gene to be deleted is flanked by operably linked protospacer adjacent motif
(PAM) sites in a
- 18 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
5307 transgenic locus which are recognized by an RNA dependent DNA
endonuclease (RdDe);
for example, a class 2 type II or class 2 type V RdDe. In certain embodiments,
the deleted
selectable marker gene is replaced in an INIR17 transgenic locus by an
introduced DNA
sequence as discussed in further detail elsewhere herein. For example, in
certain embodiments,
the introduced DNA sequence comprises a trait expression cassette such as a
trait expression
cassette of another transgenic locus. In addition to the deletion of a
selectable marker gene, in
certain embodiments at least one copy of a repetitive sequence (i.e. the 1"
NOS terminator) has
also been deleted with genome editing molecules from a 5307 transgenic locus.
In certain
embodiments, the repetitive sequence comprises, consists essentially of, or
consists of the two
NOS terminators which are each operably linked to either the eCry3.1Ab gene
and to the pmi
selectable marker gene within the 5307 transgenic locus (e.g., as depicted in
Figure 1, 4, and
5). In certain embodiments, at least one of the repetitive sequences which
comprises, consists
essentially of, or consists of the 1" NOS terminator of a 5307 transgenic
locus is absent or
essentially deleted from the INIR17 transgenic locus (e.g., wherein no more
than about 1 or 2
to about 8 to 10 nucleotides of the 1" NOS terminator are deleted). In certain
embodiments,
any of the aforementioned INIR17 transgenic loci can optionally further
comprise: (i) an
OgRRS and a CgRRS which are operably linked to a 1" and a 2nd junction
sequence of the
INIR17 transgenic locus; (ii) one or more signature protospacer adjacent motif
(sPAM) sites
which are operably linked to a 1" and a 2nd junction sequence of the INIR17
transgenic locus;
or (iii) signature guide RNA Recognition site (sigRNAR) sites which are
operably linked to a
1" and a 2' junction sequence of the INIR17 transgenic locus. Also provided
herein are plants
comprising any of the aforementioned INIR17 transgenic loci.
[0074] In certain embodiments, an INIR17 transgenic locus can further
comprise
modifications of a 5' or 3' junction polynucleotide of a 5307 transgenic locus
(e.g., as set forth
in SEQ ID NO:1 and in Figure 1). Such modifications of junction
polynucleotides include
deletions of DNA segments comprising non-essential transgenic DNA in a
junction
polynucleotide. In certain embodiments, such deletions of non-essential DNA of
a 5' junction
polynucleotide of an INIR17 transgenic locus include those set forth in SEQ ID
NO:25, 26, 27,
28, 34, and 36. In certain embodiments, such deletions of non-essential DNA of
a 5' junction
polynucleotide of an INIR17 transgenic locus include those wherein nucleotides
corresponding
to nucleotides 1,350 to 1,356 of SEQ ID NO:1 are deleted and/or replaced in
whole or in part
by a distinct polynucleotide sequence.
- 19 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
[0075] Also provided herein are methods whereby targeted genetic changes
are
efficiently combined with desired subsets of transgenic loci in elite progeny
plant lines (e.g.,
elite inbreds used for hybrid seed production or for inbred varietal
production). Examples of
such methods include those illustrated in Figure 2. In certain embodiments,
INIR17 transgenic
loci provided here are characterized by polynucleotide sequences that can
facilitate as
necessary the removal of the INIR17 transgenic loci from the genome. Useful
applications of
such INIR17 transgenic loci and related methods of making include targeted
excision of a
INIR17 transgenic locus or portion thereof in certain breeding lines to
facilitate recovery of
germplasm with subsets of transgenic traits tailored for specific geographic
locations and/or
grower preferences. Other useful applications of such INIR17 transgenic loci
and related
methods of making include removal of transgenic traits from certain breeding
lines when it is
desirable to replace the trait in the breeding line without disrupting other
transgenic loci and/or
non-transgenic loci. In certain embodiments, maize genomes containing INIR17
transgenic loci
or portions thereof which can be selectively excised with one or more gRNA
molecules and
RdDe (RNA dependent DNA endonucleases) which form gRNA/target DNA complexes.
Such
selectively excisable INIR17 transgenic loci can comprise an originator guide
RNA recognition
site (OgRRS) which is identified in non-transgenic DNA, transgenic DNA, or a
combination
thereof in of a first junction polynucleotide of the transgenic locus and
cognate guide RNA
recognition site (CgRRS) which is introduced (e.g., by genome editing methods)
into a second
junction polynucleotide of the transgenic locus and which can hybridize to the
same gRNA as
the OgRRS, thereby permitting excision of the modified transgenic locus or
portions thereof
with a single guide RNA (e.g., as shown in Figures 3A and B). In certain
embodiments, an
originator guide RNA recognition site (OgRRS) comprises endogenous DNA found
in
untransformed plants and in endogenous non-transgenic DNA of junction
polynucleotides of
transgenic plants containing a modified or unmodified transgenic locus. In
certain
embodiments, an originator guide RNA recognition site (OgRRS) comprises
exogenous
transgenic DNA of junction polynucleotides of transgenic plants containing a
modified or
unmodified transgenic locus. The OgRRS located in non-transgenic DNA,
transgenic DNA, or
a combination thereof in of a first DNA junction polynucleotide is used to
design a related
cognate guide RNA recognition site (CgRRS) which is introduced (e.g., by
genome editing
methods) into the second junction polynucleotide of the transgenic locus. A
CgRRS is thus
present in junction polynucleotides of modified transgenic loci provided
herein and is absent
- 20 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
from endogenous DNA found in untransformed plants and absent from junction
sequences of
transgenic plants containing an unmodified transgenic locus. A CgRRS is also
absent from a
combination of non-transgenic and transgenic DNA found in junction sequences
of transgenic
plants containing an unmodified transgenic locus. In certain embodiments such
as those
illustrated in the non-limiting example of Figure 3, the OgRRS is located in
non-transgenic
DNA of a 5' junction polynucleotide and the CgRRS is introduced into non-
transgenic DNA
of a 3' junction polynucleotide. In other embodiments, the OgRRS can be
located in non-
transgenic DNA of a 3' junction polynucleotide and the CgRRS is introduced
into non-
transgenic DNA, transgenic DNA, or a combination thereof in a 5' junction
polynucleotide.
Examples of OgRRS polynucleotide sequences in or near a 3' junction
polynucleotide in a
5307 transgenic locus include SEQ ID NO:20. OgRRS polynucleotide sequences
located in a
first junction polynucleotide can be introduced into the second junction
polynucleotide using
donor DNA templates as illustrated in Figure 3A and as elsewhere described
herein. A donor
DNA template for introducing the SEQ ID NO:17 OgRRS into the 5' junction
polynucleotide
of a 5307 locus includes the donor DNA template of SEQ ID NO:16. Integration
of the SEQ
ID NO:16 donor DNA template into the 5' junction polynucleotide of a 5307
locus can provide
an INIR17 locus comprising the CgRRS sequence set forth in SEQ ID NO:17.
Integration of
the SEQ ID NO:16 donor DNA template into the 5' junction polynucleotide of a
5307 locus
can provide an INIR17 locus set forth in SEQ ID NO:29 or 30, wherein the
entire
phosphomannose isomerase (pmi)-encoding selectable marker gene is retained. An
INIR17
transgenic locus of comprising a CgRRS sequence in its 5' junction
polynucleotide and a
deletion of the 1st NOS terminator, the ZmUbiInt promoter, and the
phosphomannose
isomerase coding region is illustrated in Figure 9A and 9B. Integration of the
SEQ ID NO:16
donor DNA template into the 5' junction polynucleotide of an INIR17 transgenic
locus
comprising a deletion of the 1st NOS terminator, the ZmUbiInt promoter, and
the
phosphomannose isomerase coding region can provide an INIR17 locus set forth
in SEQ ID
NO:33, wherein the 1st NOS terminator, the ZmUbiInt promoter, and the
phosphomannose
isomerase coding region are absent.
[0076] Such selectively excisable INIR17 transgenic loci can also
comprise signature
protospacer adjacent motif (sPAM) sites and/or signature guide RNA recognition
(sigRNAR)
sites, wherein the sPAM and/or sigRNAR sites are operably linked to both DNA
junction
polynucleotides of the INIR17 transgenic locus. Such sigRNAR sites can be
recognized by
-21 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
RdDe and suitable guide RNAs containing crRNA complementary to heterologous
DNA
sequences adjacent to a PAM or sPAM site to provide for cleavage within or
near the two
junction polynucleotides. Such heterologous sequences which introduced at the
sigRNAR site
are at least 17 or 18 nucleotides in length and are complementary to the crRNA
of a guide
RNA. In certain embodiments, the heterologous polynucleotide of the sigRNAR is
about 17 or
18 to about 24 nucleotides in length. Non-limiting features of the
heterologous DNA sequences
in the sigRNAR include: (i) absence of significant homology or sequence
identity (e.g., less
than 50% sequence identity across the entire length of the heterologous
sequence) to any other
endogenous or transgenic sequences present in the transgenic plant genome or
in other
transgenic genomes of the maize plant being edited (ii) absence of significant
homology or
sequence identity (e.g., less than 50% sequence identity across the entire
length of the
heterologous sequence) of a heterologous sequence of a first sigRNAR site to a
heterologous
sequence of a second or third sigRNAR site; and/or (ii) optimization of the
heterologoussequence for recognition by the RdDe and guide RNA when used in
conjunction
with a particular PAM sequence. In certain embodiments, the sigRNAR sites
which are created
are recognized by the same class of RdDe (e.g., Class 2 type II or Class 2
type V) or by the
sameRdDe (e.g., both sPAMs or PAMs of the sigRNAR recognized by the same RdDe
(e.g.,
Cas9 or Cas 12 RdDe). In certain embodiments, the same sigRNAR sites can be
introduced in
both 5' and 3' junction polynucleotides to permit excision of the INIR17
transgenic locus by a
single guide RNA and a single RdDe. In certain embodiments, different sets of
distinct
sigRNAR sites can be introduced in the 5' and 3' junction polynucleotides of
different
transgenic loci to permit selective excision of any single transgenic locus by
a single guide
RNA and a single RdDe directed to the distinct sigRNAR sites that flank the
transgenic locus.
A sigRNAR site can be created in the plant genome by inserting the
heterologous sequence
adjacent to a pre-existing PAM sequence using genome editing molecules. A
sigRNAR site
can be created in the plant genome by inserting the heterologous sequence
adjacent to a
preexisting PAM sequence using genome editing molecules. A sigRNAR site also
can be
created in the plant genome by inserting both the heterologous sequence and an
associated
PAM or sPAM site in a junction polynucleotide. Such insertions can be made in
non-transgenic
plant genomic DNA of the junction polynucleotide, in the inserted transgenic
DNA of the
junction polynucleotide, or can span the junction comprising both non-
transgenic plant
genomic DNA and inserted transgenic DNA of the junction polynucleotide. Such
nucleotide
- 22 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
insertions can be effected in the plant genome by using gene editing molecules
(e.g., RdDe and
guide RNAs, RNA dependent nickases and guide RNAs, Zinc Finger nucleases or
nickases, or
TALE nucleases or nickases) which introduce blunt double stranded breaks or
staggered double
stranded breaks in the DNA junction polynucleotides. In the case of DNA
insertions, the
genome editing molecules can also in certain embodiments further comprise a
donor DNA
template or other DNA template which comprises the heterologous nucleotides
for insertion.
Guide RNAs can be directed to the junction polynucleotides by using a pre-
existing PAM site
located within or adjacent to a junction polynucleotide of the transgenic
locus.
[0077] Also provided herein are allelic variants of any of the INIR17
transgenic loci or
DNA molecules provided herein. In certain embodiments, such allelic variants
of INIR17
transgenic loci include sequences having at least 85%, 90%, 95%, 98%, or 99%
sequence
identity across the entire length or at least 20, 40, 100, 500, 1,000, 2,000,
4,000, 8,000, or 8,865
nucleotides of SEQ ID NO: 26, 27, 29, 30, 32, 33, 34, or 36. In certain
embodiments, such
allelic variants of INIR17 DNA molecules include sequences having at least
85%, 90%, 95%,
98%, or 99% sequence identity across the entire length of SEQ ID NO: 16, 26,
27, 28, 29, 32,
33, 34, 36, 38, 39, or 40.
[0078] Also provided are unique transgenic locus excision sites created
by excision of
INIR17 transgenic loci or selectively excisable INIR17 transgenic loci, DNA
molecules
comprising the INIR17 transgenic loci or unique fragments thereof (i.e.,
fragments of an
INIR17 locus which are not found in a 5307 transgenic locus), INIR17 plants
comprising the
same, biological samples containing the DNA, nucleic acid markers adapted for
detecting the
DNA molecules, and related methods of identifying maize plants comprising
unique INIR17
transgenic locus excision sites and unique fragments of a INIR17 transgenic
locus. DNA
molecules comprising unique fragments of an INIR17 transgenic locus are
diagnostic for the
presence of an INIR17 transgenic locus or fragments thereof in a maize plant,
maize cell, maize
seed, products obtained therefrom (e.g., seed meal or stover), and biological
samples. DNA
molecules comprising unique fragments of an INIR17 transgenic locus include
DNA molecules
comprising modified 5' junction polynucleotides. Unique 5' junction
polynucleotides of an
INIR17 transgenic locus include DNA molecules comprising SEQ ID NO:38 and 39.
DNA
molecules comprising unique fragments of an INIR17 transgenic locus also
include DNA
molecules comprising modified junction polynucleotides containing CgRRS
sequences
comprising insertions of OgRRS sequences (e.g., a CgRRS element comprising SEQ
ID
- 23 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
NO:17) that include SEQ ID NO:16. DNA molecules comprising unique fragments of
an
INIR17 transgenic locus also include DNA molecules comprising deletion
junctions
corresponding to residues spanning the deletion of the phosphomannose
isomerase coding
region and operably linked ZmUbiInt promoter in the INIR17 transgenic locus.
Such deletion
junctions thus comprise one or more nucleotides located between the 3' end of
the eCry3.1Ab
coding region and the 5' end of the 1st NOS terminator which are directly
joined to (i.e., are
contiguous with) nucleotides located between or at the 3' terminus of the pmi
coding region
and the 5' end of the 2nd NOS terminator in a 5307 locus as illustrated in
Figure 4. Examples
of unique INIR17 DNA fragment comprising a such deletion include of SEQ ID
NO:40. In
certain embodiments, any of the aforementioned unique fragments of an INIR17
transgenic
locus comprise DNA molecules of at least about 18, 20, or 24 nucleotides to
about 30, 50, 100,
or 200 nucleotides in length. Also provided herein are nucleic acid
hybridization probes and
primers (e.g., for SNP analysis) adapted for detection of INIR17 transgenic
loci which can
comprise all or part of any of the aforementioned DNA molecules and optionally
a detectable
label. Methods and reagents (e.g., nucleic acid markers including nucleic acid
probes and/or
primers) for detecting plants, edited plant genomes, and biological samples
containing DNA
molecules comprising the transgenic loci excision sites and/or non-essential
DNA deletions are
also provided herein. Detection of the DNA molecules can be achieved by any
combination of
nucleic acid amplification (e.g., PCR amplification), hybridization,
sequencing, and/or mass-
spectrometry based techniques. Methods set forth for detecting junction
nucleic acids in
unmodified transgenic loci set forth in US 20190136331 and US 9,738,904, both
incorporated
herein by reference in their entireties, can be adapted for use in detection
of the nucleic acids
provided herein. In certain embodiments, such detection is achieved by
amplification and/or
hybridization-based detection methods using a method (e.g., selective
amplification primers)
and/or probe (e.g., capable of selective hybridization or generation of a
specific primer
extension product) which specifically recognizes the target DNA molecule
(e.g., transgenic
locus excision site) but does not recognize DNA from an unmodified transgenic
locus. In
certain embodiments, the hybridization probes can comprise detectable labels
(e.g.,
fluorescent, radioactive, epitope, and chemiluminescent labels). In certain
embodiments, a
single nucleotide polymorphism detection assay can be adapted for detection of
the target DNA
molecule (e.g., transgenic locus excision site). Detection of any of the
aforementioned unique
- 24 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
DNA fragments comprising SEQ ID NO:16, 38, 39, or 40, and/or in a biological
sample
indicates that the sample contains material from a INIR17 plant or seed.
[0079] Methods provided herein can be used to excise any transgenic locus
where the
first and second junction sequences comprising the endogenous non-transgenic
genomic DNA
and the heterologous transgenic DNA which are joined at the site of transgene
insertion in the
plant genome are known or have been determined. In certain embodiments
provided herein,
transgenic loci can be removed from crop plant lines to obtain crop plant
lines with tailored
combinations of transgenic loci and optionally targeted genetic changes. Such
first and second
junction sequences are readily identified in new transgenic events by inverse
PCR techniques
using primers which are complementary the inserted transgenic sequences. In
certain
embodiments, the first and second junction sequences of transgenic loci are
published. An
example of a transgenic locus which can be improved and used in the methods
provided herein
is the maize 5307 transgenic locus. The maize 5307 transgenic locus and its
transgenic junction
sequences are also depicted in Figure 1. Maize plants comprising the 5307
transgenic locus and
seed thereof have been cultivated, been placed in commerce, and have been
described in a
variety of publications by various governmental bodies. Databases which have
compiled
descriptions of the 5307 transgenic locus include the International Service
for the Acquisition
of Agri-biotech Applications (ISAAA) database (available on the world wide web
internet site
"isaaa.org/gmapprovaldatabase/event"), the GenBit LLC database (available on
the world wide
web internet site "genbitgroup.com/en/gmo/gmodatabase"), and the Biosafety
Clearing-House
(BCH) database (available on the http internet site
:lbch.cbd.int/database/organisms").
[0080] Sequences of the junction polynucleotides as well as the
transgenic insert(s) of
an original 5307 transgenic locus which can be improved by the methods
provided herein are
set forth or otherwise provided in SEQ ID NO:1, US 8,466,346, the sequence of
the 5307 locus
in the deposited seed of ATCC accession No. PTA-9561, and elsewhere in this
disclosure. In
certain embodiments provided herein, the 5307 transgenic locus set forth in
SEQ ID NO:1 or
present in the deposited seed of ATCC accession No. PTA-9561is referred to as
an original
5307 transgenic locus. The 5307 transgenic locus set forth in SEQ ID NO:1
encodes the
eCry3.1Ab protein. Allelic or other variants of the sequence set forth in SEQ
ID NO:1, the
patent references set forth therein and incorporated herein by reference in
their entireties, and
elsewhere in this disclosure which may be present in certain variant 5307
transgenic plant loci
(e.g., progeny of deposited seed of accession No. PTA-9561 which contain
allelic variants of
- 25 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
SEQ ID NO:1 or progeny originating from transgenic plant cells comprising the
original 5307
transgenic set forth in US 8,466,346 which contain allelic variants of SEQ ID
NO:1) can also
be improved by identifying sequences in the variants that correspond to the
sequences of SEQ
ID NO:1 by performing a pairwise alignment (e.g., using CLUSTAL 0 1.2.4 with
default
parameters) and making corresponding changes in the allelic or other variant
sequences. Such
allelic or other variant sequences include sequences having at least 85%, 90%,
95%, 98%, or
99% sequence identity across the entire length or at least 20, 40, 100, 500,
1,000, 2,000, 4,000,
8,000, or 8,865 nucleotides of SEQ ID NO:l. Also provided are plants, plant
parts including
seeds, genomic DNA, and/or DNA obtained from INIR17 plants which comprise one
or more
modifications (e.g., via insertion of a CgRRS in a junction polynucleotide
sequence) which
provide for selective excision of the INIR17 transgenic locus or a portion
thereof (e.g., the
eCry3.1Ab coding region and operably linked promoter). Such INIR17 transgenic
loci can be
treated with gene editing molecules (e.g., RdDe and gRNA(s)) to obtain plants
wherein a
segment comprising, consisting essentially of, or consisting of the INIR17
transgenic locus or
a portion thereof (e.g., the eCry3.1Ab coding region and operably linked
promoter) is deleted.
In certain embodiments, the 5307 transgenic loci set forth in SEQ ID NO:1 and
allelic variants
thereof are further modified by deletion of a segment of DNA comprising,
consisting
essentially of, or consisting of a selectable marker gene or portions thereof
(e.g, the 1" NOS
terminator, pmi coding region and operably linked ZmUbi promoter) and/or non-
essential
DNA (e.g., T-DNA border sequences or anything other than the CMP ::Cry3.1Ab :
:NOS
expression cassette) to obtain INIR17 transgenic loci. In certain embodiments,
the INIR17
transgenic locus comprises a deletion of the 1" NOS terminator, phosphomannose
isomerase
(PMI) coding region, and ZmUbi promoter which are in a 5307 transgenic locus.
Also provided
herein are methods of detecting plants, genomic DNA, and/or DNA obtained from
plants
comprising a INIR17 transgenic locus which contains one or more of a CgRRS,
deletions of
selectable marker genes, deletions of non-essential DNA, and/or a transgenic
locus excision
site. A first junction polynucleotide of a 5307 transgenic locus can comprise
either one of the
junction polynucleotides found at the 5' end or the 3' end of any one of the
sequences set forth
in SEQ ID NO:1, allelic variants thereof, or other variants thereof. An OgRRS
can be found
within non-transgenic DNA, transgenic DNA, or a combination thereof in either
one of the
junction polynucleotides of any one of SEQ ID NO:1, allelic variants thereof,
or other variants
thereof A second junction polynucleotide of a transgenic locus can comprise
either one of the
- 26 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
junction polynucleotides found at the 5' or 3' end of any one of the sequences
set forth in SEQ
ID NO:1, allelic variants thereof, or other variants thereof. A CgRRS can be
introduced within
transgenic, non-transgenic DNA, or a combination thereof of either one of the
junction
polynucleotides of any one of SEQ ID NO:1, allelic variants thereof, or other
variants thereof
to obtain an INIR17 transgenic locus. In certain embodiments, the OgRRS is
found in non-
transgenic DNA or transgenic DNA of the 5' junction polynucleotide of a
transgenic locus of
any one of SEQ ID NO:1, allelic variants thereof, or other variants thereof
and the
corresponding CgRRS is introduced into the transgenic DNA, non-transgenic DNA,
or a
combination thereof in the 3' junction polynucleotide of the 5307 transgenic
locus of SEQ ID
NO:1, allelic variants thereof, or other variants thereof to obtain an INIR17
transgenic locus.
In other embodiments, the OgRRS is found in non-transgenic DNA or transgenic
DNA of the
3' junction polynucleotide of the 5307 transgenic locus of any one of SEQ ID
NO:1, allelic
variants thereof, or other variants thereof and the corresponding CgRRS is
introduced into the
transgenic DNA, non-transgenic DNA, or a combination thereof in the 5'
junction
polynucleotide of the transgenic locus of SEQ ID NO:1, allelic variants
thereof, or other
variants thereof to obtain an INIR17 transgenic locus.
[0081] In certain embodiments, the CgRRS is comprised in whole or in part
of an
exogenous DNA molecule that is introduced into a DNA junction polynucleotide
by genome
editing. In certain embodiments, the guide RNA hybridization site of the CgRRS
is operably
linked to a pre-existing PAM site in the transgenic DNA or non-transgenic DNA
of the
transgenic plant genome. In other embodiments, the guide RNA hybridization
site of the
CgRRS is operably linked to a new PAM site that is introduced in the DNA
junction
polynucleotide by genome editing. A CgRRS can be located in non-transgenic
plant genomic
DNA of a DNA junction polynucleotide of an INIR17 transgenic locus, in
transgenic DNA of
a DNA junction polynucleotide of an INIR17 transgenic locus or can span the
junction of the
transgenic and non-transgenic DNA of a DNA junction polynucleotide of an
INIR17 transgenic
locus. An OgRRS can likewise be located in non-transgenic plant genomic DNA of
a DNA
junction polynucleotide of an INIR17 transgenic locus, in transgenic DNA of a
DNA junction
polynucleotide of an INIR17 transgenic locus or can span the junction of the
transgenic and
non-transgenic DNA of a DNA junction polynucleotide of an INIR17 transgenic
locus.
[0082] Methods provided herein can be used in a variety of breeding
schemes to obtain
elite crop plants comprising subsets of desired modified transgenic loci
comprising an OgRRS
- 27 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
and a CgRRS operably linked to junction polynucleotide sequences and
transgenic loci
excision sites where undesired transgenic loci or portions thereof have been
removed (e.g., by
use of the OgRRS and a CgRRS). Such methods are useful at least insofar as
they allow for
production of distinct useful donor plant lines each having unique sets of
modified transgenic
loci and, in some instances, targeted genetic changes that are tailored for
distinct geographies
and/or product offerings. In an illustrative and non-limiting example, a
different product lines
comprising transgenic loci conferring only two of three types of herbicide
tolerance (e.g..,
glyphosate, glufosinate, and dicamba) can be obtained from a single donor line
comprising
three distinct transgenic loci conferring resistance to all three herbicides.
In certain aspects,
plants comprising the subsets of undesired transgenic loci and transgenic loci
excision sites can
further comprise targeted genetic changes. Such elite crop plants can be
inbred plant lines or
can be hybrid plant lines. In certain embodiments, at least two transgenic
loci (e.g., transgenic
loci including an INIRI 7 and another modified transgenic locus wherein an
OgRRS and a
CgRRS site is operably linked to a first and a second junction sequence and
optionally a
selectable marker gene and/or non-essential DNA are deleted) are introgressed
into a desired
donor line comprising elite crop plant germplasm and then subjected to genome
editing
molecules to recover plants comprising one of the two introgressed transgenic
loci as well as a
transgenic loci excision site introduced by excision of the other transgenic
locus or portion
thereof by the genome editing molecules. In certain embodiments, the genome
editing
molecules can be used to remove a transgenic locus and introduce targeted
genetic changes in
the crop plant genome. Introgression can be achieved by backcrossing plants
comprising the
transgenic loci to a recurrent parent comprising the desired elite germplasm
and selecting
progeny with the transgenic loci and recurrent parent germplasm. Such
backcrosses can be
repeated and/or supplemented by molecular assisted breeding techniques using
SNP or other
nucleic acid markers to select for recurrent parent germplasm until a desired
recurrent parent
percentage is obtained (e.g., at least about 95%, 96%, 97%, 98%, or 99%
recurrent parent
percentage). A non-limiting, illustrative depiction of a scheme for obtaining
plants with both
subsets of transgenic loci and the targeted genetic changes is shown in the
Figure 2 (bottom
"Alternative" panel), where two or more of the transgenic loci ("Event" in
Figure 2) are
provided in Line A and then moved into elite crop plant germplasm by
introgression. In the
non-limiting Figure 2 illustration, introgression can be achieved by crossing
a "Line A"
comprising two or more of the modified transgenic loci to the elite germplasm
and then
- 28 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
backcrossing progeny of the cross comprising the transgenic loci to the elite
germplasm as the
recurrent parent) to obtain a "Universal Donor" (e.g. Line A+ in Figure 2)
comprising two or
more of the modified transgenic loci. This elite germplasm containing the
modified transgenic
loci (e.g. "Universal Donor" of Figure 2) can then be subjected to genome
editing molecules
which can excise at least one of the transgenic loci ("Event Removal" in
Figure 2) and introduce
other targeted genetic changes ("GE" in Figure 2) in the genomes of the elite
crop plants
containing one of the transgenic loci and a transgenic locus excision site
corresponding to the
removal site of one of the transgenic loci. Such selective excision of
transgenic loci or portion
thereof can be effected by contacting the genome of the plant comprising two
transgenic loci
with gene editing molecules (e.g., RdDe and gRNAs, TALENS, and/or ZFN) which
recognize
one transgenic loci but not another transgenic loci. Genome editing molecules
that provide for
selective excision of a first modified transgenic locus comprising an OgRRS
and a CgRRS
include a gRNA that hybridizes to the OgRRS and CgRRS of the first modified
transgenic
locus and an RdDe that recognizes the gRNA/OgRRS and gRNA/CgRRS complexes.
Distinct
plant lines with different subsets of transgenic loci and desired targeted
genetic changes are
thus recovered (e.g., "Line B-1," "Line B-2," and "Line B-3" in Figure 2). In
certain
embodiments, it is also desirable to bulk up populations of inbred elite crop
plants or their seed
comprising the subset of transgenic loci and a transgenic locus excision site
by selfing. In
certain embodiments, inbred progeny of the selfed maize plants comprising the
INIR17
transgenic loci can be used as a pollen donor or recipient for hybrid seed
production. Such
hybrid seed and the progeny grown therefrom can comprise a subset of desired
transgenic loci
and a transgenic loci excision site.
[0083] Hybrid plant lines comprising elite crop plant germplasm, at least
one transgenic
locus and at least one transgenic locus excision site, and in certain aspects,
additional targeted
genetic changes are also provided herein. Methods for production of such
hybrid seed can
comprise crossing elite crop plant lines where at least one of the pollen
donor or recipient
comprises at least the transgenic locus and a transgenic locus excision site
and/or additional
targeted genetic changes. In certain embodiments, the pollen donor and
recipient will comprise
germplasm of distinct heterotic groups and provide hybrid seed and plants
exhibiting heterosis.
In certain embodiments, the pollen donor and recipient can each comprise a
distinct transgenic
locus which confers either a distinct trait (e.g., herbicide tolerance or
insect resistance), a
different type of trait (e.g., tolerance to distinct herbicides or to distinct
insects such as
- 29 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
lepidopteran insects or coleopteran insects other than Diabrotica spp.), or a
different mode-of-
action for the same trait (e.g., resistance to coleopteran insects by two
distinct modes-of-action
or resistance to lepidopteran insects by two distinct modes-of-action). In
certain embodiments,
the pollen recipient will be rendered male sterile or conditionally male
sterile. Methods for
inducing male sterility or conditional male sterility include emasculation
(e.g., detasseling),
cytoplasmic male sterility, chemical hybridizing agents or systems, a
transgenes or transgene
systems, and/or mutation(s) in one or more endogenous plant genes.
Descriptions of various
male sterility systems that can be adapted for use with the elite crop plants
provided herein are
described in Wan et al. Molecular Plant; 12, 3, (2019):321-342 as well as in
US 8,618,358; US
20130031674; and US 2003188347.
[0084] In certain embodiments, it will be desirable to use genome editing
molecules to
make modified transgenic loci by introducing a CgRRS into the transgenic loci,
to excise
modified transgenic loci comprising an OgRRS and a CgRRS, and/or to make
targeted genetic
changes in elite crop plant or other germplasm. Techniques for effecting
genome editing in
crop plants (e.g., maize,) include use of morphogenic factors such as Wuschel
(WUS), Ovule
Development Protein (ODP), and/or Babyboom (BBM) which can improve the
efficiency of
recovering plants with desired genome edits. In some aspects, the morphogenic
factor
comprises WUS1, WUS2, WUS3, WOX2A, WOX4, WOX5, WOX9, BBM2, BMN2, BMN3,
and/or ODP2. In certain embodiments, compositions and methods for using WUS,
BBM,
and/or ODP, as well as other techniques which can be adapted for effecting
genome edits in
elite crop plant and other germplasm, are set forth in US 20030082813, US
20080134353, US
20090328252, US 20100100981, US 20110165679, US 20140157453, US 20140173775,
and
US 20170240911, which are each incorporated by reference in their entireties.
In certain
embodiments, the genome edits can be effected in regenerable plant parts
(e.g.; plant embryos)
of elite crop plants by transient provision of gene editing molecules or
polynucleotides
encoding the same and do not necessarily require incorporating a selectable
marker gene into
the plant genome (e.g., US 20160208271 and US 20180273960, both incorporated
herein by
reference in their entireties; Svitashev et al. Nat Commun. 2016; 7:13274).
[0085] In certain embodiments, edited transgenic plant genomes,
transgenic plant cells,
parts, or plants containing those genomes, and DNA molecules obtained
therefrom, can
comprise a desired subset of transgenic loci and/or comprise at least one
transgenic locus
excision site. In certain embodiments, a segment comprising an INIR17
transgenic locus
- 30 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
comprising an OgRRS in non-transgenic DNA of a 1st junction polynucleotide
sequence and a
CgRRS in a 2' junction polynucleotide sequence is deleted with a gRNA and RdDe
that
recognize the OgRRS and the CgRRS to produce an INIR17 transgenic locus
excision site. In
certain embodiments, a segment comprising an INIR17 transgenic locus
comprising a sPAM
and/or a sigRNAR site in a lstjunction polynucleotide sequence and a sPAM
and/or a sigRNAR
in a 2nd junction polynucleotide sequence is deleted with at least one gRNA
and RdDe that
recognize the sPAM and/or a sigRNAR to produce an INIR17 transgenic locus
excision site.
In certain embodiments, the transgenic locus excision site can comprise a
contiguous segment
of DNA comprising at least 10 base pairs of DNA that is telomere proximal to
the deleted
segment of the transgenic locus and at least 10 base pairs of DNA that is
centromere proximal
to the deleted segment of the transgenic locus wherein the transgenic DNA
(i.e., the
heterologous DNA) that has been inserted into the crop plant genome has been
deleted. In
certain embodiments where a segment comprising a transgenic locus has been
deleted, the
transgenic locus excision site can comprise a contiguous segment of DNA
comprising at least
base pairs DNA that is telomere proximal to the deleted segment of the
transgenic locus and
at least 10 base pairs of DNA that is centromere proximal DNA to the deleted
segment of the
transgenic locus wherein the heterologous transgenic DNA and at least 1, 2, 5,
10, 20, 50, or
more base pairs of endogenous DNA located in a 5' junction sequence and/or in
a 3' junction
sequence of the original transgenic locus that has been deleted. In such
embodiments where
DNA comprising the transgenic locus is deleted, a transgenic locus excision
site can comprise
at least 10 base pairs of DNA that is telomere proximal to the deleted segment
of the transgenic
locus and at least 10 base pairs of DNA that is centromere proximal to the
deleted segment of
the transgenic locus wherein all of the transgenic DNA is absent and either
all or less than all
of the endogenous DNA flanking the transgenic DNA sequences are present. In
certain
embodiments where a segment consisting essentially of an original transgenic
locus has been
deleted, the transgenic locus excision site can be a contiguous segment of at
least 10 base pairs
of DNA that is telomere proximal to the deleted segment of the transgenic
locus and at least 10
base pairs of DNA that is centromere proximal to the deleted segment of the
transgenic locus
wherein less than all of the heterologous transgenic DNA that has been
inserted into the crop
plant genome is excised. In certain aforementioned embodiments where a segment
consisting
essentially of an original transgenic locus has been deleted, the transgenic
locus excision site
can thus contain at least 1 base pair of DNA or 1 to about 2 or 5, 8, 10, 20,
or 50 base pairs of
-31-
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
DNA comprising the telomere proximal and/or centromere proximal heterologous
transgenic
DNA that has been inserted into the crop plant genome. In certain embodiments
where a
segment consisting of an original transgenic locus has been deleted, the
transgenic locus
excision site can contain a contiguous segment of DNA comprising at least 10
base pairs of
DNA that is telomere proximal to the deleted segment of the transgenic locus
and at least 10
base pairs of DNA that is centromere proximal to the deleted segment of the
transgenic locus
wherein the heterologous transgenic DNA that has been inserted into the crop
plant genome is
deleted. In certain embodiments where DNA consisting of the transgenic locus
is deleted, a
transgenic locus excision site can comprise at least 10 base pairs of DNA that
is telomere
proximal to the deleted segment of the transgenic locus and at least 10 base
pairs of DNA that
is centromere proximal to the deleted segment of the transgenic locus wherein
all of the
heterologous transgenic DNA that has been inserted into the crop plant genome
is deleted and
all of the endogenous DNA flanking the heterologous sequences of the
transgenic locus is
present. In any of the aforementioned embodiments or in other embodiments, the
continuous
segment of DNA comprising the transgenic locus excision site can further
comprise an
insertion of 1 to about 2, 5, 10, 20, or more nucleotides between the DNA that
is telomere
proximal to the deleted segment of the transgenic locus and the DNA that is
centromere
proximal to the deleted segment of the transgenic locus. Such insertions can
result either from
endogenous DNA repair and/or recombination activities at the double stranded
breaks
introduced at the excision site and/or from deliberate insertion of an
oligonucleotide. Plants,
edited plant genomes, biological samples, and DNA molecules (e.g., including
isolated or
purified DNA molecules) comprising the INIR17 transgenic loci excision sites
are provided
herein.
[0086] In other embodiments, a segment comprising a INIR17 transgenic
locus (e.g., a
transgenic locus comprising an OgRRS in non-transgenic DNA of a 1st junction
sequence and
a CgRRS in a 2nd junction sequence) can be deleted with a gRNA and RdDe that
recognize the
OgRRS and the CgRRS and replaced with DNA comprising the endogenous non-
transgenic
plant genomic DNA present in the genome prior to transgene insertion. A non-
limiting example
of such replacements can be visualized in Figure 3C, where the donor DNA
template can
comprise the endogenous non-transgenic plant genomic DNA present in the genome
prior to
transgene insertion along with sufficient homology to non-transgenic DNA on
each side of the
excision site to permit homology-directed repair. In certain embodiments, the
endogenous non-
- 32 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
transgenic plant genomic DNA present in the genome prior to transgene
insertion can be at
least partially restored. In certain embodiments, the endogenous non-
transgenic plant genomic
DNA present in the genome prior to transgene insertion can be essentially
restored such that
no more than about 5, 10, or 20 to about 50, 80, or 100nucleotides are changed
relative to the
endogenous DNA at the essentially restored excision site.
[0087] In certain embodiments, edited transgenic plant genomes and
transgenic plant
cells, plant parts, or plants containing those edited genomes, comprising a
modification of an
original transgenic locus, where the modification comprises an OgRRS and a
CgRRS which
are operably linked to a 1" and a 2nd junction sequence, respectively or
irrespectively, and
optionally further comprise a deletion of a segment of the original transgenic
locus. In certain
embodiments, the modification comprises two or more separate deletions and/or
there is a
modification in two or more original transgenic plant loci. In certain
embodiments, the deleted
segment comprises, consists essentially of, or consists of a segment of non-
essential DNA in
the transgenic locus. Illustrative examples of non-essential DNA include but
are not limited to
synthetic cloning site sequences, duplications of transgene sequences;
fragments of transgene
sequences, and Agrobacterium right and/or left border sequences. In certain
embodiments, the
non-essential DNA is a duplication and/or fragment of a promoter sequence
and/or is not the
promoter sequence operably linked in the cassette to drive expression of a
transgene. In certain
embodiments, excision of the non-essential DNA improves a characteristic,
functionality,
and/or expression of a transgene of the transgenic locus or otherwise confers
a recognized
improvement in a transgenic plant comprising the edited transgenic plant
genome. In certain
embodiments, the non-essential DNA does not comprise DNA encoding a selectable
marker
gene. In certain embodiments of an edited transgenic plant genome, the
modification comprises
a deletion of the non-essential DNA and a deletion of a selectable marker
gene. The
modification producing the edited transgenic plant genome could occur by
excising both the
non-essential DNA and the selectable marker gene at the same time, e.g., in
the same
modification step, or the modification could occur stepwise. For example, an
edited transgenic
plant genome in which a selectable marker gene has previously been removed
from the
transgenic locus can comprise an original transgenic locus from which a non-
essential DNA is
further excised and vice versa. In certain embodiments, the modification
comprising deletion
of the non-essential DNA and deletion of the selectable marker gene comprises
excising a
single segment of the original transgenic locus that comprises both the non-
essential DNA and
- 33 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
the selectable marker gene. Such modification would result in one excision
site in the edited
transgenic genome corresponding to the deletion of both the non-essential DNA
and the
selectable marker gene. In certain embodiments, the modification comprising
deletion of the
non-essential DNA and deletion of the selectable marker gene comprises
excising two or more
segments of the original transgenic locus to achieve deletion of both the non-
essential DNA
and the selectable marker gene. Such modification would result in at least two
excision sites in
the edited transgenic genome corresponding to the deletion of both the non-
essential DNA and
the selectable marker gene. In certain embodiments of an edited transgenic
plant genome, prior
to excision, the segment to be deleted is flanked by operably linked
protospacer adjacent motif
(PAM) sites in the original or unmodified transgenic locus and/or the segment
to be deleted
encompasses an operably linked PAM site in the original or unmodified
transgenic locus. In
certain embodiments, following excision of the segment, the resulting edited
transgenic plant
genome comprises PAM sites flanking the deletion site in the modified
transgenic locus. In
certain embodiments of an edited transgenic plant genome, the modification
comprises a
modification of a 5307 transgenic locus.
[0088] In certain embodiments, improvements in a transgenic plant locus
are obtained
by introducing a new cognate guide RNA recognition site (CgRRS) which is
operably linked
to a DNA junction polynucleotide of the transgenic locus in the transgenic
plant genome. Such
CgRRS sites can be recognized by RdDe and a single suitable guide RNA directed
to the
CgRRS and the originator gRNA Recognition Site (OgRRS) to provide for cleavage
within the
junction polynucleotides which flank an INIR17 transgenic locus. In certain
embodiments, the
CgRRS/gRNA and OgRRS/gRNA hybridization complexes are recognized by the same
class
of RdDe (e.g., Class 2 type II or Class 2 type V) or by the same RdDe (e.g.,
both the
CgRRS/gRNA and OgRRS/gRNA hybridization complexes recognized by the same Cas9
or
Cas 12 RdDe). Such CgRRS and OgRRS can be recognized by RdDe and suitable
guide RNAs
containing crRNA sufficiently complementary to the guide RNA hybridization
site DNA
sequences adjacent to the PAM site of the CgRRS and the OgRRS to provide for
cleavage
within or near the two junction polynucleotides. Suitable guide RNAs can be in
the form of a
single gRNA comprising a crRNA or in the form of a crRNA/tracrRNA complex. In
the case
of the OgRRS site, the PAM and guide RNA hybridization site are endogenous DNA
polynucleotide molecules found in the plant genome. In certain embodiments
where the
CgRRS is introduced into the plant genome by genome editing, gRNA
hybridization site
- 34 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
polynucleotides introduced at the CgRRS are at least 17 or 18 nucleotides in
length and are
complementary to the crRNA of a guide RNA. In certain embodiments, the gRNA
hybridization site sequence of the OgRRS and/or the CgRRS is about 17 or 18 to
about 24
nucleotides in length. The gRNA hybridization site sequence of the OgRRS and
the gRNA
hybridization site of the CgRRS can be of different lengths or comprise
different sequences so
long as there is sufficient complementarity to permit hybridization by a
single gRNA and
recognition by a RdDe that recognizes and cleaves DNA at the gRNA/OgRRS and
gRNA/CgRRS complex. In certain embodiments, the guide RNA hybridization site
of the
CgRRS comprise about a 17 or 18 to about 24 nucleotide sequence which is
identical to the
guide RNA hybridization site of the OgRRS. In other embodiments, the guide RNA
hybridization site of the CgRRS comprise about a 17 or 18 to about 24
nucleotide sequence
which has one, two, three, four, or five nucleotide insertions, deletions or
substitutions when
compared to the guide RNA hybridization site of the OgRRS. Certain CgRRS
comprising a
gRNA hybridization site containing has one, two, three, four, or five
nucleotide insertions,
deletions or substitutions when compared to the guide RNA hybridization site
of the OgRRS
can undergo hybridization with a gRNA which is complementary to the OgRRS gRNA
hybridization site and be cleaved by certain RdDe. Examples of mismatches
between gRNAs
and guide RNA hybridization sites which allow for RdDe recognition and
cleavage include
mismatches resulting from both nucleotide insertions and deletions in the DNA
which is
hybridized to the gRNA (e.g., Lin et al., doi: 10.1093/nar/sku402). In certain
embodiments, an
operably linked PAM site is co-introduced with the gRNA hybridization site
polynucleotide at
the CgRRS. In certain embodiments, the gRNA hybridization site polynucleotides
are
introduced at a position adjacent to a resident endogenous PAM sequence in the
junction
polynucleotide sequence to form a CgRRS where the gRNA hybridization site
polynucleotides
are operably linked to the endogenous PAM site. In certain embodiments, non-
limiting features
of the OgRRS, CgRRS, and/or the gRNA hybridization site polynucleotides
thereof include:
(i) absence of significant homology or sequence identity (e.g., less than 50%
sequence identity
across the entire length of the OgRRS, CgRRS, and/or the gRNA hybridization
site sequence)
to any other endogenous or transgenic sequences present in the transgenic
plant genome or in
other transgenic genomes of the maize plant being transformed and edited; (ii)
absence of
significant homology or sequence identity (e.g., less than 50% sequence
identity across the
entire length of the sequence) of a sequence of a first OgRRS and a first
CgRRS to a second
- 35 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
OgRRS and a second CgRRS which are operably linked to junction polynucleotides
of a
distinct transgenic locus; (iii) the presence of some sequence identity (e.g.,
about 25%, 40%,
or 50% to about 60%, 70%, or 80%) between the OgRRS sequence and endogenous
sequences
present at the site where the CgRRS sequence is introduced; and/or (iv)
optimization of the
gRNA hybridization site polynucleotides for recognition by the RdDe and guide
RNA when
used in conjunction with a particular PAM sequence. In certain embodiments,
the first and
second OgRRS as well as the first and second CgRRS are recognized by the same
class of
RdDe (e.g., Class 2 type II or Class 2 type V) or by the same RdDe (e.g., Cas9
or Cas 12 RdDe).
In certain embodiments, the first OgRRS site in a first junction
polynucleotide and the CgRRS
introduced in the second junction polynucleotide to permit excision of a first
transgenic locus
by a first single guide RNA and a single RdDe. Such nucleotide insertions or
genome edits
used to introduce CgRRS in a transgenic plant genome can be effected in the
plant genome by
using gene editing molecules (e.g., RdDe and guide RNAs, RNA dependent
nickases and guide
RNAs, Zinc Finger nucleases or nickases, or TALE nucleases or nickases) which
introduce
blunt double stranded breaks or staggered double stranded breaks in the DNA
junction
polynucleotides. In the case of DNA insertions, the genome editing molecules
can also in
certain embodiments further comprise a donor DNA template or other DNA
template which
comprises the heterologous nucleotides for insertion to form the CgRRS. Guide
RNAs can be
directed to the junction polynucleotides by using a pre-existing PAM site
located within or
adjacent to a junction polynucleotide of the transgenic locus. Non-limiting
examples of such
pre-existing PAM sites present in junction polynucleotides, which can be used
either in
conjunction with an inserted heterologous sequence to form a CgRRS or which
can be used to
create a double stranded break to insert or create a CgRRS, include PAM sites
recognized by a
Cas12a enzyme. Non-limiting examples where a CgRRS are created in a DNA
sequence are
illustrated in Example 2.
[0089] Transgenic loci comprising OgRRS and CgRRS in a first and a second
junction
polynucleotides can be excised from the genomes of transgenic plants by
contacting the
transgenic loci with RdDe or RNA directed nickases, and a suitable guide RNA
directed to the
OgRRS and CgRRS. A non-limiting example where a modified transgenic locus is
excised
from a plant genome by use of a gRNA and an RdDe that recognizes an OgRRS/gRNA
and a
CgRRS/gRNA complex and introduces dsDNA breaks in both junction
polynucleotides and
repaired by NHEJ is depicted in Figure 3B. In the depicted example set forth
in Figure 3B, the
- 36 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
OgRRS site and the CgRRS site are absent from the plant chromosome comprising
the
transgene excision site that results from the process. In other embodiments
provided herein
where a modified transgenic locus is excised from a plant genome by use of a
gRNA and an
RdDe that recognizes an OgRRS/gRNA and a CgRRS/gRNA complex and repaired by
NHEJ
or microhomology-mediated end joining (MMEJ), the OgRRS and/or other non-
transgenic
sequences that were originally present prior to transgene insertion are at
least partially or
essentially restored.
[0090] In certain embodiments, edited transgenic plant genomes provided
herein can
lack one or more selectable and/or scoreable markers found in an original
event (transgenic
locus). Original 5307 transgenic loci (events), including those set forth in
SEQ ID NO:1), US
8,466,346, the sequence of the 5307 locus in the deposited seed of accession
No. PTA-9561
and progeny thereof, contain a selectable phosphomannose isomerase (pmi)
transgene marker
conferring an ability to grow on mannose. Transgenes encoding a phosphomannose
isomerase
(pmi) can confer the ability to grow on mannose. In certain embodiments
provided herein, the
DNA element comprising, consisting essentially of, or consisting of the ZmUbi
promoter
which is operably linked to a pmi coding region of a 5307 transgenic locus is
absent from an
INIR17 transgenic locus, or scoreable marker transgenes can be excised from an
original
transgenic locus by contacting the transgenic locus with one or more gene
editing molecules
which introduce double stranded breaks in the transgenic locus at the 5' and
3' end of the
expression cassette comprising the selectable marker transgene (e.g., an RdDe
and guide RNAs
directed to PAM sites located at the 5' and 3' end of the expression cassette
comprising the
selectable marker transgenes) and selecting for plant cells, plant parts, or
plants wherein the
selectable or scoreable marker has been excised. In certain embodiments, the
selectable or
scoreable marker transgene can be inactivated. Inactivation can be achieved by
modifications
including insertion, deletion, and/or substitution of one or more nucleotides
in a promoter
element, 5' or 3' untranslated region (UTRs), intron, coding region, and/or 3'
terminator and/or
polyadenylation site of the selectable marker transgene. Such modifications
can inactivate the
selectable or scoreable marker transgene by eliminating or reducing promoter
activity,
introducing a missense mutation, and/or introducing a pre-mature stop codon.
In certain
embodiments, the selectable and/or scoreable marker transgene can be replaced
by an
introduced transgene. In certain embodiments, an original transgenic locus
that was contacted
with gene editing molecules which introduce double stranded breaks in the
transgenic locus at
- 37 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
the 5' and 3' end of the expression cassette comprising the selectable marker
and/or scoreable
transgene can also be contacted with a suitable donor DNA template comprising
an expression
cassette flanked by DNA homologous to remaining DNA in the transgenic locus
located 5' and
3' to the selectable marker excision site. In certain embodiments, a coding
region of the
selectable and/or scoreable marker transgene can be replaced with another
coding region such
that the replacement coding region is operably linked to the promoter and 3'
terminator or
polyadenylation site of the selectable and/or scoreable marker transgene.
[0091] In certain embodiments, edited transgenic plant genomes provided
herein can
comprise additional new introduced transgenes (e.g., expression cassettes)
inserted into the
transgenic locus of a given event. Introduced transgenes inserted at the
transgenic locus of an
event subsequent to the event's original isolation can be obtained by inducing
a double stranded
break at a site within an original transgenic locus (e.g., with genome editing
molecules
including an RdDe and suitable guide RNA(s); a suitable engineered zinc-finger
nuclease; a
TALEN protein and the like) and providing an exogenous transgene in a donor
DNA template
which can be integrated at the site of the double stranded break (e.g. by
homology-directed
repair (HDR) or by non-homologous end-joining (NHEJ)). In certain embodiments,
an OgRRS
and a CgRRS located in a 1st junction polynucleotide and a 2nd junction
polynucleotide,
respectively, can be used to delete the transgenic locus and replace it with
one or more new
expression cassettes. In certain embodiments, such deletions and replacements
are effected by
introducing dsDNA breaks in both junction polynucleotides and providing the
new expression
cassettes on a donor DNA template (e.g., in Figure 3C, the donor DNA template
can comprise
an expression cassette flanked by DNA homologous to non-transgenic DNA located
telomere
proximal and centromere proximal to the excision site). Suitable expression
cassettes for
insertion include DNA molecules comprising promoters which are operably linked
to DNA
encoding proteins and/or RNA molecules which confer useful traits which are in
turn operably
linked to polyadenylation sites or terminator elements. In certain
embodiments, such
expression cassettes can also comprise 5' UTRs, 3' UTRs, and/or introns.
Useful traits include
biotic stress tolerance (e.g., insect resistance, nematode resistance, or
disease resistance),
abiotic stress tolerance (e.g., heat, cold, drought, and/or salt tolerance),
herbicide tolerance, and
quality traits (e.g., improved fatty acid compositions, protein content,
starch content, and the
like). Suitable expression cassettes for insertion include expression
cassettes which confer
insect resistance, herbicide tolerance, biofuel use, or male sterility traits
contained in any of the
- 38 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
transgenic events set forth in US Patent Application Public. Nos. 20090038026,
20130031674,
20150361446, 20170088904, 20150267221, 201662346688, and 20200190533 as well
as in
US Patent Nos. 6342660, 7323556, 8575434, 6040497, 8759618, 7157281, 6852915,
7705216,
10316330, 8618358, 8450561, 8212113, 9428765, 7897748, 8273959,
8093453,8901378,
9994863, 7928296, and 8466346, each of which are incorporated herein by
reference in their
entireties.
[0092] In certain embodiments, INIR17 plants provided herein, including
plants with
one or more transgenic loci, modified transgenic loci, and/or comprising
transgenic loci
excision sites can further comprise one or more targeted genetic changes
introduced by one or
more of gene editing molecules or systems. Also provided are methods where the
targeted
genetic changes are introduced and one or more transgenic loci are removed
from plants either
in series or in parallel (e.g., as set forth in the non-limiting illustration
in Figure 2, bottom
"Alternative" panel, where "GE" can represent targeted genetic changes induced
by gene
editing molecules and "Event Removal" represents excision of one or more
transgenic loci with
gene editing molecules). Such targeted genetic changes include those
conferring traits such as
improved yield, improved food and/or feed characteristics (e.g., improved oil,
starch, protein,
or amino acid quality or quantity), improved nitrogen use efficiency, improved
biofuel use
characteristics (e.g., improved ethanol production), male
sterility/conditional male sterility
systems (e.g., by targeting endogenous M526, M545 and MSCA1 genes), herbicide
tolerance
(e.g., by targeting endogenous ALS, EPSPS, HPPD, or other herbicide target
genes), delayed
flowering, non-flowering, increased biotic stress resistance (e.g., resistance
to insect,
nematode, bacterial, or fungal damage), increased abiotic stress resistance
(e.g., resistance to
drought, cold, heat, metal, or salt ), enhanced lodging resistance, enhanced
growth rate,
enhanced biomass, enhanced tillering, enhanced branching, delayed flowering
time, delayed
senescence, increased flower number, improved architecture for high density
planting,
improved photosynthesis, increased root mass, increased cell number, improved
seedling vigor,
improved seedling size, increased rate of cell division, improved metabolic
efficiency, and
increased meristem size in comparison to a control plant lacking the targeted
genetic change.
Types of targeted genetic changes that can be introduced include insertions,
deletions, and
substitutions of one or more nucleotides in the crop plant genome. Sites in
endogenous plant
genes for the targeted genetic changes include promoter, coding, and non-
coding regions (e.g.,
5' UTRs, introns, splice donor and acceptor sites and 3' UTRs). In certain
embodiments, the
- 39 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
targeted genetic change comprises an insertion of a regulatory or other DNA
sequence in an
endogenous plant gene. Non-limiting examples of regulatory sequences which can
be inserted
into endogenous plant genes with gene editing molecules to effect targeted
genetic changes
which confer useful phenotypes include those set forth in US Patent
Application Publication
20190352655, which is incorporated herein by reference in its entirety, such
as: (a) auxin
response element (AuxRE) sequence; (b) at least one D1-4 sequence (Ulmasov et
al. (1997)
Plant Cell, 9:1963-1971), (c) at least one DR5 sequence (Ulmasov et al. (1997)
Plant Cell,
9:1963-1971); (d) at least one m5-DR5 sequence (Ulmasov et al. (1997) Plant
Cell, 9:1963-
1971); (e) at least one P3 sequence; (f) a small RNA recognition site sequence
bound by a
corresponding small RNA (e.g., an siRNA, a microRNA (miRNA), a trans-acting
siRNA as
described in U.S. Patent No. 8,030,473, or a phased sRNA as described in U.S.
Patent No.
8,404,928; both of these cited patents are incorporated by reference herein);
(g) a microRNA
(miRNA) recognition site sequence; (h) the sequence recognizable by a specific
binding agent
includes a microRNA (miRNA) recognition sequence for an engineered miRNA
wherein the
specific binding agent is the corresponding engineered mature miRNA; (i) a
transposon
recognition sequence; (j) a sequence recognized by an ethylene-responsive
element binding-
factor-associated amphiphilic repression (EAR) motif; (k) a splice site
sequence (e.g., a donor
site, a branching site, or an acceptor site; see, for example, the splice
sites and splicing signals
set forth in the internet site
lemur[dot]amu[dot]edu[dot]pl/share/ERISdb/home.html); (1) a
recombinase recognition site sequence that is recognized by a site-specific
recombinase; (m) a
sequence encoding an RNA or amino acid aptamer or an RNA riboswitch, the
specific binding
agent is the corresponding ligand, and the change in expression is
upregulation or
downregulation; (n) a hormone responsive element recognized by a nuclear
receptor or a
hormone-binding domain thereof; (o) a transcription factor binding sequence;
and (p) a
polycomb response element (see Xiao et al. (2017) Nature Genetics, 49:1546-
1552, doi:
10.1038/ng.3937). Non limiting examples of target maize genes that can be
subjected to
targeted gene edits to confer useful traits include: (a) ZmIPK1 (herbicide
tolerant and phytate
reduced maize; Shukla et al., Nature. 2009; 459:437-41); (b) ZmGL2 (reduced
epicuticular
wax in leaves; Char et al. Plant Biotechnol J. 2015; 13:1002); (c) ZmMTL
(induction of haploid
plants; Kelliher et al. Nature. 2017; 542:105); (d) Wxl (high amylopectin
content; US
20190032070; incorporated herein by reference in its entirety); (e) TMS5
(thermosensitive
male sterile; Li et al. J Genet Genomics. 2017; 44:465-8); (f) ALS (herbicide
tolerance;
- 40 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
Svitashev etal.; Plant Physiol. 2015; 169:931-45); and (g) ARGOS8 (drought
stress tolerance;
Shi etal., Plant Biotechnol J. 2017;15:207-16). Non-limiting examples of
target genes in crop
plants including maize which can be subjected to targeted genetic changes
which confer useful
phenotypes include those set forth in US Patent Application Nos.
20190352655,20200199609,
20200157554, and 20200231982, which are each incorporated herein in their
entireties; and
Zhang etal. (Genome Biol. 2018; 19: 210).
[0093] Gene editing molecules of use in methods provided herein include
molecules
capable of introducing a double-strand break ("DSB") or single-strand break
("SSB") in
double-stranded DNA, such as in genomic DNA or in a target gene located within
the genomic
DNA as well as accompanying guide RNA or donor DNA template polynucleotides.
Examples
of such gene editing molecules include: (a) a nuclease comprising an RNA-
guided nuclease,
an RNA-guided DNA endonuclease or RNA directed DNA endonuclease (RdDe), a
class 1
CRISPR type nuclease system, a type II Cas nuclease, a Cas9, a nCas9 nickase,
a type V Cas
nuclease, a Cas12a nuclease, a nCas12a nickase, a Cas12d (CasY), a Cas12e
(CasX), a Cas12b
(C2c1), a Cas12c (C2c3), a Cas12i, a Cas12j, a Cas14, an engineered nuclease,
a codon-
optimized nuclease, a zinc-finger nuclease (ZFN) or nickase, a transcription
activator-like
effector nuclease (TAL-effector nuclease or TALEN) or nickase (TALE-nickase),
an
Argonaute, and a meganuclease or engineered meganuclease; (b) a polynucleotide
encoding
one or more nucleases capable of effectuating site-specific alteration
(including introduction
of a DSB or SSB) of a target nucleotide sequence; (c) a guide RNA (gRNA) for
an RNA-
guided nuclease, or a DNA encoding a gRNA for an RNA-guided nuclease; (d)
donor DNA
template polynucleotides; and (e) other DNA templates (dsDNA, ssDNA, or
combinations
thereof) suitable for insertion at a break in genomic DNA (e.g., by non-
homologous end joining
(NHEJ) or microhomology-mediated end joining (MMEJ).
[0094] CRISPR-type genome editing can be adapted for use in the plant
cells and
methods provided herein in several ways. CRISPR elements, e.g., gene editing
molecules
comprising CRISPR endonucleases and CRISPR guide RNAs including single guide
RNAs or
guide RNAs in combination with tracrRNAs or scoutRNA, or polynucleotides
encoding the
same, are useful in effectuating genome editing without remnants of the CRISPR
elements or
selective genetic markers occurring in progeny. In certain embodiments, the
CRISPR elements
are provided directly to the eukaryotic cell (e.g., plant cells), systems,
methods, and
compositions as isolated molecules, as isolated or semi-purified products of a
cell free synthetic
-41 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
process (e.g., in vitro translation), or as isolated or semi-purified products
of in a cell-based
synthetic process (e.g., such as in a bacterial or other cell lysate). In
certain embodiments,
genome-inserted CRISPR elements are useful in plant lines adapted for use in
the methods
provide herein. In certain embodiments, plants or plant cells used in the
systems, methods, and
compositions provided herein can comprise a transgene that expresses a CRISPR
endonuclease
(e.g., a Cas9, a Cpfl -type or other CRISPR endonuclease). In certain
embodiments, one or
more CRISPR endonucleases with unique PAM recognition sites can be used. Guide
RNAs
(sgRNAs or crRNAs and a tracrRNA) to form an RNA-guided endonuclease/guide RNA
complex which can specifically bind sequences in the gDNA target site that are
adjacent to a
protospacer adjacent motif (PAM) sequence. The type of RNA-guided endonuclease
typically
informs the location of suitable PAM sites and design of crRNAs or sgRNAs. G-
rich PAM
sites, e.g., 5'-NGG are typically targeted for design of crRNAs or sgRNAs used
with Cas9
proteins. Examples of PAM sequences include 5'-NGG (Streptococcus pyogenes),
5'-
NNAGAA (Streptococcus thermophilus CRISPR1), 5'-NGGNG (Streptococcus
thermophilus
CRISPR3), 5'-NNGRRT or 5'-NNGRR (Staphylococcus aureus Cas9, SaCas9), and 5'-
NNNGATT (Neisseria meningitidis). T-rich PAM sites (e.g., 5'-TTN or 5'-TTTV,
where "V"
is A, C, or G) are typically targeted for design of crRNAs or sgRNAs used with
Cas12a
proteins. In some instances, Cas12a can also recognize a 5'-CTA PAM motif.
Other examples
of potential Cas12a PAM sequences include TTN, CTN, TCN, CCN, TTTN, TCTN,
TTCN,
CTTN, ATTN, TCCN, TTGN, GTTN, CCCN, CCTN, TTAN, TCGN, CTCN, ACTN, GCTN,
TCAN, GCCN, and CCGN (wherein N is defined as any nucleotide). Cpfl (i.e.,
Cas12a)
endonuclease and corresponding guide RNAs and PAM sites are disclosed in US
Patent
Application Publication 2016/0208243 Al, which is incorporated herein by
reference for its
disclosure of DNA encoding Cpfl endonucleases and guide RNAs and PAM sites.
Introduction of one or more of a wide variety of CRISPR guide RNAs that
interact with
CRISPR endonucleases integrated into a plant genome or otherwise provided to a
plant is
useful for genetic editing for providing desired phenotypes or traits, for
trait screening, or for
gene editing mediated trait introgression (e.g., for introducing a trait into
a new genotype
without backcrossing to a recurrent parent or with limited backcrossing to a
recurrent parent).
Multiple endonucleases can be provided in expression cassettes with the
appropriate promoters
to allow multiple genome site editing.
- 42 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
[0095]
CRISPR technology for editing the genes of eukaryotes is disclosed in US
Patent Application Publications 2016/0138008A1 and US2015/0344912A1, and in US
Patents
8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406,
8,889,418,
8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616.
Cpfl endonuclease and
corresponding guide RNAs and PAM sites are disclosed in US Patent Application
Publication
2016/0208243 Al. Other CRISPR nucleases useful for editing genomes include
Cas12b and
Cas12c (see Shmakov et al. (2015) Mol. Cell, 60:385 ¨397; Harrington et al.
(2020) Molecular
Cell doi:10.1016/j.molce1.2020.06.022) and CasX and CasY (see Burstein et al.
(2016) Nature,
doi:10.1038/nature21059; Harrington et al. (2020)
Molecular .. Cell
doi:10.1016/j.molce1.2020.06.022), or Cas12j (Pausch et al, (2020) Science
10.1126/science.abb1400). Plant RNA promoters for expressing CRISPR guide RNA
and
plant codon-optimized CRISPR Cas9 endonuclease are disclosed in International
Patent
Application PCT/U52015/018104 (published as WO 2015/131101 and claiming
priority to US
Provisional Patent Application 61/945,700). Methods of using CRISPR technology
for
genome editing in plants are disclosed in US Patent Application Publications
US
2015/0082478A1 and US 2015/0059010A1 and in International Patent Application
PCT/U52015/038767 Al (published as WO 2016/007347 and claiming priority to US
Provisional Patent Application 62/023,246). All of the patent publications
referenced in this
paragraph are incorporated herein by reference in their entirety. In certain
embodiments, an
RNA-guided endonuclease that leaves a blunt end following cleavage of the
target site is used.
Blunt-end cutting RNA-guided endonucleases include Cas9, Cas12c, and Cas 12h
(Yan et al.,
2019). In certain embodiments, an RNA-guided endonuclease that leaves a
staggered single
stranded DNA overhanging end following cleavage of the target site following
cleavage of the
target site is used. Staggered-end cutting RNA-guided endonucleases include
Cas12a, Cas12b,
and Cas12e.
[0096] The
methods can also use sequence-specific endonucleases or sequence-specific
endonucleases and guide RNAs that cleave a single DNA strand in a dsDNA target
site. Such
cleavage of a single DNA strand in a dsDNA target site is also referred to
herein and elsewhere
as "nicking" and can be effected by various "nickases" or systems that provide
for nicking.
Nickases that can be used include nCas9 (Cas9 comprising a DlOA amino acid
substitution),
nCas12a (e.g., Cas12a comprising an R1226A amino acid substitution; Yamano et
al., 2016),
Cas12i (Yan et al. 2019), a zinc finger nickase e.g., as disclosed in Kim et
al., 2012), a TALE
- 43 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
nickase (e.g., as disclosed in Wu et al., 2014), or a combination thereof. In
certain
embodiments, systems that provide for nicking can comprise a Cas nuclease
(e.g., Cas9 and/or
Cas12a) and guide RNA molecules that have at least one base mismatch to DNA
sequences in
the target editing site (Fu et al., 2019). In certain embodiments, genome
modifications can be
introduced into the target editing site by creating single stranded breaks
(i.e., "nicks") in
genomic locations separated by no more than about 10, 20, 30, 40, 50, 60, 80,
100, 150, or 200
base pairs of DNA. In certain illustrative and non-limiting embodiments, two
nickases (i.e., a
CAS nuclease which introduces a single stranded DNA break including nCas9,
nCas12a,
Cas12i, zinc finger nickases, TALE nickases, combinations thereof, and the
like) or nickase
systems can directed to make cuts to nearby sites separated by no more than
about 10, 20, 30,
40, 50, 60, 80 or 100 base pairs of DNA. In instances where an RNA guided
nickase and an
RNA guide are used, the RNA guides are adjacent to PAM sequences that are
sufficiently close
(i.e., separated by no more than about 10, 20, 30, 40, 50, 60, 80, 100, 150,
or 200 base pairs of
DNA). For the purposes of gene editing, CRISPR arrays can be designed to
contain one or
multiple guide RNA sequences corresponding to a desired target DNA sequence;
see, for
example, Cong et at. (2013) Science, 339:819-823; Ran et at. (2013) Nature
Protocols, 8:2281
¨ 2308. At least 16 or 17 nucleotides of gRNA sequence are required by Cas9
for DNA
cleavage to occur; for Cpfl at least 16 nucleotides of gRNA sequence are
needed to achieve
detectable DNA cleavage and at least 18 nucleotides of gRNA sequence were
reported
necessary for efficient DNA cleavage in vitro; see Zetsche et at. (2015) Cell,
163:759 ¨ 771.
In practice, guide RNA sequences are generally designed to have a length of 17
¨ 24
nucleotides (frequently 19, 20, or 21 nucleotides) and exact complementarity
(i.e., perfect base-
pairing) to the targeted gene or nucleic acid sequence; guide RNAs having less
than 100%
complementarity to the target sequence can be used (e.g., a gRNA with a length
of 20
nucleotides and 1 ¨ 4 mismatches to the target sequence) but can increase the
potential for off-
target effects. The design of effective guide RNAs for use in plant genome
editing is disclosed
in US Patent Application Publication 2015/0082478 Al, the entire specification
of which is
incorporated herein by reference. More recently, efficient gene editing has
been achieved using
a chimeric "single guide RNA" ("sgRNA"), an engineered (synthetic) single RNA
molecule
that mimics a naturally occurring crRNA-tracrRNA complex and contains both a
tracrRNA
(for binding the nuclease) and at least one crRNA (to guide the nuclease to
the sequence
targeted for editing); see, for example, Cong et at. (2013) Science, 339:819 ¨
823; Xing et at.
- 44 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
(2014) BMC Plant Biol., 14:327 ¨340. Chemically modified sgRNAs have been
demonstrated
to be effective in genome editing; see, for example, Hendel et at. (2015)
Nature Biotechnol.,
985 ¨ 991. The design of effective gRNAs for use in plant genome editing is
disclosed in US
Patent Application Publication 2015/0082478 Al, the entire specification of
which is
incorporated herein by reference.
[0097] Genomic DNA may also be modified via base editing. Both adenine
base editors
(ABE) which convert A/T base pairs to G/C base pairs in genomic DNA as well as
cytosine
base pair editors (CBE) which effect C to T substitutions can be used in
certain embodiments
of the methods provided herein. In certain embodiments, useful ABE and CBE can
comprise
genome site specific DNA binding elements (e.g., RNA-dependent DNA binding
proteins
including catalytically inactive Cas9 and Cas12 proteins or Cas9 and Cas12
nickases) operably
linked to adenine or cytidine deaminases and used with guide RNAs which
position the protein
near the nucleotide targeted for substitution. Suitable ABE and CBE disclosed
in the literature
(Kim, Nat Plants, 2018 Mar;4(3):148-151) can be adapted for use in the methods
set forth
herein. In certain embodiments, a CBE can comprise a fusion between a
catalytically inactive
Cas9 (dCas9) RNA dependent DNA binding protein fused to a cytidine deaminase
which
converts cytosine (C) to uridine (U) and selected guide RNAs, thereby
effecting a C to T
substitution; see Komor et at. (2016) Nature, 533:420 ¨ 424. In other
embodiments, C to T
substitutions are effected with Cas9 nickase [Cas9n(D10A)] fused to an
improved cytidine
deaminase and optionally a bacteriophage Mu dsDNA (double-stranded DNA) end-
binding
protein Gam; see Komor et at., Sci Adv. 2017 Aug; 3(8):eaa04774. In other
embodiments,
adenine base editors (ABEs) comprising an adenine deaminase fused to
catalytically inactive
Cas9 (dCas9) or a Cas9 DlOA nickase can be used to convert A/T base pairs to
G/C base pairs
in genomic DNA (Gaudelli et al., (2017)Nature 551(7681):464-471.
[0098] In certain embodiments, zinc finger nucleases or zinc finger
nickases can also
be used in the methods provided herein. Zinc-finger nucleases are site-
specific endonucleases
comprising two protein domains: a DNA-binding domain, comprising a plurality
of individual
zinc finger repeats that each recognize between 9 and 18 base pairs, and a DNA-
cleavage
domain that comprises a nuclease domain (typically Fokl). The cleavage domain
dimerizes in
order to cleave DNA; therefore, a pair of ZFNs are required to target non-
palindromic target
polynucleotides. In certain embodiments, zinc finger nuclease and zinc finger
nickase design
methods which have been described (Urnov et at. (2010) Nature Rev.
Genet.,11:636 ¨ 646;
- 45 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
Mohanta et al. (2017) Genes vol. 8,12: 399; Ramirez et al. Nucleic Acids Res.
(2012); 40(12):
5560-5568; Liu et al. (2013) Nature Communications, 4: 2565) can be adapted
for use in the
methods set forth herein. The zinc finger binding domains of the zinc finger
nuclease or nickase
provide specificity and can be engineered to specifically recognize any
desired target DNA
sequence. The zinc finger DNA binding domains are derived from the DNA-binding
domain
of a large class of eukaryotic transcription factors called zinc finger
proteins (ZFPs). The DNA-
binding domain of ZFPs typically contains a tandem array of at least three
zinc "fingers" each
recognizing a specific triplet of DNA. A number of strategies can be used to
design the binding
specificity of the zinc finger binding domain. One approach, termed "modular
assembly",
relies on the functional autonomy of individual zinc fingers with DNA. In this
approach, a
given sequence is targeted by identifying zinc fingers for each component
triplet in the
sequence and linking them into a multifinger peptide. Several alternative
strategies for
designing zinc finger DNA binding domains have also been developed. These
methods are
designed to accommodate the ability of zinc fingers to contact neighboring
fingers as well as
nucleotide bases outside their target triplet. Typically, the engineered zinc
finger DNA binding
domain has a novel binding specificity, compared to a naturally-occurring zinc
finger protein.
Engineering methods include, for example, rational design and various types of
selection.
Rational design includes, for example, the use of databases of triplet (or
quadruplet) nucleotide
sequences and individual zinc finger amino acid sequences, in which each
triplet or quadruplet
nucleotide sequence is associated with one or more amino acid sequences of
zinc fingers which
bind the particular triplet or quadruplet sequence. See, e.g., US Patents
6,453,242 and
6,534,261, both incorporated herein by reference in their entirety. Exemplary
selection methods
(e.g., phage display and yeast two-hybrid systems) can be adapted for use in
the methods
described herein. In addition, enhancement of binding specificity for zinc
finger binding
domains has been described in US Patent 6,794,136, incorporated herein by
reference in its
entirety. In addition, individual zinc finger domains may be linked together
using any suitable
linker sequences. Examples of linker sequences are publicly known, e.g., see
US Patents
6,479,626; 6,903,185; and 7,153,949, incorporated herein by reference in their
entirety. The
nucleic acid cleavage domain is non-specific and is typically a restriction
endonuclease, such
as Fokl. This endonuclease must dimerize to cleave DNA. Thus, cleavage by Fokl
as part of
a ZFN requires two adjacent and independent binding events, which must occur
in both the
correct orientation and with appropriate spacing to permit dimer formation.
The requirement
- 46 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
for two DNA binding events enables more specific targeting of long and
potentially unique
recognition sites. Fokl variants with enhanced activities have been described
and can be
adapted for use in the methods described herein; see, e.g., Guo et at. (2010)
1 Mol. Biol.,
400:96 - 107.
[0099] Transcription activator like effectors (TALEs) are proteins
secreted by certain
Xanthomonas species to modulate gene expression in host plants and to
facilitate the
colonization by and survival of the bacterium. TALEs act as transcription
factors and modulate
expression of resistance genes in the plants. Recent studies of TALEs have
revealed the code
linking the repetitive region of TALEs with their target DNA-binding sites.
TALEs comprise
a highly conserved and repetitive region consisting of tandem repeats of
mostly 33 or 34 amino
acid segments. The repeat monomers differ from each other mainly at amino acid
positions 12
and 13. A strong correlation between unique pairs of amino acids at positions
12 and 13 and
the corresponding nucleotide in the TALE-binding site has been found. The
simple relationship
between amino acid sequence and DNA recognition of the TALE binding domain
allows for
the design of DNA binding domains of any desired specificity. TALEs can be
linked to a non-
specific DNA cleavage domain to prepare genome editing proteins, referred to
as TAL-effector
nucleases or TALENs. As in the case of ZFNs, a restriction endonuclease, such
as Fokl, can be
conveniently used. Methods for use of TALENs in plants have been described and
can be
adapted for use in the methods described herein, see Mahfouz et al. (2011)
Proc. Natl. Acad.
Sci. USA, 108:2623 ¨2628; Mahfouz (2011) GM Crops, 2:99 ¨ 103; and Mohanta et
al. (2017)
Genes vol. 8,12: 399). TALE nickases have also been described and can be
adapted for use in
methods described herein (Wu et al.; Biochem Biophys Res Commun.
(2014);446(1):261-6;
Luo et al; Scientific Reports 6, Article number: 20657 (2016)).
[00100] Embodiments of the donor DNA template molecule having a sequence
that is
integrated at the site of at least one double-strand break (DSB) in a genome
include double-
stranded DNA, a single-stranded DNA, a single-stranded DNA/RNA hybrid, and a
double-
stranded DNA/RNA hybrid. In embodiments, a donor DNA template molecule that is
a double-
stranded (e.g., a dsDNA or dsDNA/RNA hybrid) molecule is provided directly to
the plant
protoplast or plant cell in the form of a double-stranded DNA or a double-
stranded DNA/RNA
hybrid, or as two single-stranded DNA (ssDNA) molecules that are capable of
hybridizing to
form dsDNA, or as a single-stranded DNA molecule and a single-stranded RNA
(ssRNA)
molecule that are capable of hybridizing to form a double-stranded DNA/RNA
hybrid; that is
- 47 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
to say, the double-stranded polynucleotide molecule is not provided
indirectly, for example, by
expression in the cell of a dsDNA encoded by a plasmid or other vector. In
various non-limiting
embodiments of the method, the donor DNA template molecule that is integrated
(or that has
a sequence that is integrated) at the site of at least one double-strand break
(DSB) in a genome
is double-stranded and blunt-ended; in other embodiments the donor DNA
template molecule
is double-stranded and has an overhang or "sticky end" consisting of unpaired
nucleotides (e.g.,
1, 2, 3, 4, 5, or 6 unpaired nucleotides) at one terminus or both termini. In
an embodiment, the
DSB in the genome has no unpaired nucleotides at the cleavage site, and the
donor DNA
template molecule that is integrated (or that has a sequence that is
integrated) at the site of the
DSB is a blunt-ended double-stranded DNA or blunt-ended double-stranded
DNA/RNA hybrid
molecule, or alternatively is a single-stranded DNA or a single-stranded
DNA/RNA hybrid
molecule. In another embodiment, the DSB in the genome has one or more
unpaired
nucleotides at one or both sides of the cleavage site, and the donor DNA
template molecule
that is integrated (or that has a sequence that is integrated) at the site of
the DSB is a double-
stranded DNA or double-stranded DNA/RNA hybrid molecule with an overhang or
"sticky
end" consisting of unpaired nucleotides at one or both termini, or
alternatively is a single-
stranded DNA or a single-stranded DNA/RNA hybrid molecule; in embodiments, the
donor
DNA template molecule DSB is a double-stranded DNA or double-stranded DNA/RNA
hybrid molecule that includes an overhang at one or at both termini, wherein
the overhang
consists of the same number of unpaired nucleotides as the number of unpaired
nucleotides
created at the site of a DSB by a nuclease that cuts in an off-set fashion
(e.g., where a Cas12
nuclease effects an off-set DSB with 5-nucleotide overhangs in the genomic
sequence, the
donor DNA template molecule that is to be integrated (or that has a sequence
that is to be
integrated) at the site of the DSB is double-stranded and has 5 unpaired
nucleotides at one or
both termini). In certain embodiments, one or both termini of the donor DNA
template
molecule contain no regions of sequence homology (identity or complementarity)
to genomic
regions flanking the DSB; that is to say, one or both termini of the donor DNA
template
molecule contain no regions of sequence that is sufficiently complementary to
permit
hybridization to genomic regions immediately adjacent to the location of the
DSB. In
embodiments, the donor DNA template molecule contains no homology to the locus
of the
DSB, that is to say, the donor DNA template molecule contains no nucleotide
sequence that is
sufficiently complementary to permit hybridization to genomic regions
immediately adjacent
- 48 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
to the location of the DSB. In embodiments, the donor DNA template molecule is
at least
partially double-stranded and includes 2-20 base-pairs, e. g., 2, 3, 4, 5, 6,
7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, or 20 base-pairs; in embodiments, the donor DNA
template molecule
is double-stranded and blunt-ended and consists of 2-20 base-pairs, e.g., 2,
3, 4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base-pairs; in other
embodiments, the donor DNA
template molecule is double-stranded and includes 2-20 base-pairs, e.g., 2, 3,
4, 5, 6, 7, 8, 9,
10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 base-pairs and in addition has
at least one overhang
or "sticky end" consisting of at least one additional, unpaired nucleotide at
one or at both
termini. In an embodiment, the donor DNA template molecule that is integrated
(or that has a
sequence that is integrated) at the site of at least one double-strand break
(DSB) in a genome
is a blunt-ended double-stranded DNA or a blunt-ended double-stranded DNA/RNA
hybrid
molecule of about 18 to about 300 base-pairs, or about 20 to about 200 base-
pairs, or about 30
to about 100 base-pairs, and having at least one phosphorothioate bond between
adjacent
nucleotides at a 5' end, 3' end, or both 5' and 3' ends. In embodiments, the
donor DNA template
molecule includes single strands of at least 11, at least 18, at least 20, at
least 30, at least 40, at
least 60, at least 80, at least 100, at least 120, at least 140, at least 160,
at least 180, at least 200,
at least 240, at about 280, or at least 320 nucleotides. In embodiments, the
donor DNA template
molecule has a length of at least 2, at least 3, at least 4, at least 5, at
least 6, at least 7, at least
8, at least 9, at least 10, or at least 11 base-pairs if double-stranded (or
nucleotides if single-
stranded), or between about 2 to about 320 base-pairs if double-stranded (or
nucleotides if
single-stranded), or between about 2 to about 500 base-pairs if double-
stranded (or nucleotides
if single-stranded), or between about 5 to about 500 base-pairs if double-
stranded (or
nucleotides if single-stranded), or between about 5 to about 300 base-pairs if
double-stranded
(or nucleotides if single-stranded), or between about 11 to about 300 base-
pairs if double-
stranded (or nucleotides if single-stranded), or about 18 to about 300 base-
pairs if double-
stranded (or nucleotides if single-stranded), or between about 30 to about 100
base-pairs if
double-stranded (or nucleotides if single-stranded). In embodiments, the donor
DNA template
molecule includes chemically modified nucleotides (see, e.g., the various
modifications of
internucleotide linkages, bases, and sugars described in Verma and Eckstein
(1998) Annu. Rev.
Biochem., 67:99-134); in embodiments, the naturally occurring phosphodiester
backbone of
the donor DNA template molecule is partially or completely modified with
phosphorothioate,
phosphorodithioate, or methylphosphonate internucleotide linkage
modifications, or the donor
- 49 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
DNA template molecule includes modified nucleoside bases or modified sugars,
or the donor
DNA template molecule is labelled with a fluorescent moiety (e.g., fluorescein
or rhodamine
or a fluorescent nucleoside analogue) or other detectable label (e.g., biotin
or an isotope). In
another embodiment, the donor DNA template molecule contains secondary
structure that
provides stability or acts as an aptamer. Other related embodiments include
double-stranded
DNA/RNA hybrid molecules, single-stranded DNA/RNA hybrid donor molecules, and
single-
stranded donor DNA template molecules (including single-stranded, chemically
modified
donor DNA template molecules), which in analogous procedures are integrated
(or have a
sequence that is integrated) at the site of a double-strand break. Donor DNA
templates provided
herein include those comprising CgRRS sequences flanked by DNA with homology
to a donor
DNA template (e.g., SEQ ID NO:16). In certain embodiments, integration of the
donor DNA
templates can be facilitated by use of a bacteriophage lambda exonuclease, a
bacteriophage
lambda beta S SAP protein, and an E. coli SSB essentially as set forth in US
Patent Application
Publication 20200407754, which is incorporated herein by reference in its
entirety.
[00101] Donor DNA template molecules used in the methods provided herein
include
DNA molecules comprising, from 5' to 3', a first homology arm, a replacement
DNA, and a
second homology arm, wherein the homology arms containing sequences that are
partially or
completely homologous to genomic DNA (gDNA) sequences flanking a target site-
specific
endonuclease cleavage site in the gDNA. In certain embodiments, the
replacement DNA can
comprise an insertion, deletion, or substitution of 1 or more DNA base pairs
relative to the
target gDNA. In an embodiment, the donor DNA template molecule is double-
stranded and
perfectly base-paired through all or most of its length, with the possible
exception of any
unpaired nucleotides at either terminus or both termini. In another
embodiment, the donor DNA
template molecule is double-stranded and includes one or more non-terminal
mismatches or
non-terminal unpaired nucleotides within the otherwise double-stranded duplex.
In an
embodiment, the donor DNA template molecule that is integrated at the site of
at least one
double-strand break (DSB) includes between 2-20 nucleotides in one (if single-
stranded) or in
both strands (if double-stranded), e. g., 2, 3,4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18,
19, or 20 nucleotides on one or on both strands, each of which can be base-
paired to a nucleotide
on the opposite strand (in the case of a perfectly base-paired double-stranded
polynucleotide
molecule). Such donor DNA templates can be integrated in genomic DNA
containing blunt
and/or staggered double stranded DNA breaks by homology-directed repair (HDR).
In certain
- 50 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
embodiments, a donor DNA template homology arm can be about 20, 50, 100, 200,
400, or
600 to about 800, or 1000 base pairs in length. In certain embodiments, a
donor DNA template
molecule can be delivered to a plant cell) in a circular (e.g., a plasmid or a
viral vector including
a geminivirus vector) or a linear DNA molecule. In certain embodiments, a
circular or linear
DNA molecule that is used can comprise a modified donor DNA template molecule
comprising, from 5' to 3', a first copy of the target sequence-specific
endonuclease cleavage
site sequence, the first homology arm, the replacement DNA, the second
homology arm, and a
second copy of the target sequence-specific endonuclease cleavage site
sequence. Without
seeking to be limited by theory, such modified donor DNA template molecules
can be cleaved
by the same sequence-specific endonuclease that is used to cleave the target
site gDNA of the
eukaryotic cell to release a donor DNA template molecule that can participate
in HDR-
mediated genome modification of the target editing site in the plant cell
genome. In certain
embodiments, the donor DNA template can comprise a linear DNA molecule
comprising, from
5' to 3', a cleaved target sequence-specific endonuclease cleavage site
sequence, the first
homology arm, the replacement DNA, the second homology arm, and a cleaved
target
sequence-specific endonuclease cleavage site sequence. In certain embodiments,
the cleaved
target sequence-specific endonuclease sequence can comprise a blunt DNA end or
a blunt DNA
end that can optionally comprise a 5' phosphate group. In certain embodiments,
the cleaved
target sequence-specific endonuclease sequence comprises a DNA end having a
single-
stranded 5' or 3' DNA overhang. Such cleaved target sequence-specific
endonuclease cleavage
site sequences can be produced by either cleaving an intact target sequence-
specific
endonuclease cleavage site sequence or by synthesizing a copy of the cleaved
target sequence-
specific endonuclease cleavage site sequence. Donor DNA templates can be
synthesized either
chemically or enzymatically (e.g., in a polymerase chain reaction (PCR)).
Donor DNA
templates provided herein include those comprising CgRRS sequences flanked by
DNA with
homology to a donor DNA template (e.g., SEQ ID NO:).
[00102] Various treatments are useful in delivery of gene editing
molecules and/or other
molecules to a 5307 or INIR17 plant cell. In certain embodiments, one or more
treatments is
employed to deliver the gene editing or other molecules (e.g., comprising a
polynucleotide,
polypeptide or combination thereof) into a eukaryotic or plant cell, e.g.,
through barriers such
as a cell wall, a plasma membrane, a nuclear envelope, and/or other lipid
bilayer. In certain
embodiments, a polynucleotide-, polypeptide-, or RNP-containing composition
comprising the
-51 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
molecules are delivered directly, for example by direct contact of the
composition with a plant
cell. Aforementioned compositions can be provided in the form of a liquid, a
solution, a
suspension, an emulsion, a reverse emulsion, a colloid, a dispersion, a gel,
liposomes, micelles,
an injectable material, an aerosol, a solid, a powder, a particulate, a
nanoparticle, or a
combination thereof can be applied directly to a plant, plant part, plant
cell, or plant explant
(e.g., through abrasion or puncture or otherwise disruption of the cell wall
or cell membrane,
by spraying or dipping or soaking or otherwise directly contacting, by
microinjection). For
example, a plant cell or plant protoplast is soaked in a liquid genome editing
molecule-
containing composition, whereby the agent is delivered to the plant cell. In
certain
embodiments, the agent-containing composition is delivered using negative or
positive
pressure, for example, using vacuum infiltration or application of
hydrodynamic or fluid
pressure. In certain embodiments, the agent-containing composition is
introduced into a plant
cell or plant protoplast, e.g., by microinjection or by disruption or
deformation of the cell wall
or cell membrane, for example by physical treatments such as by application of
negative or
positive pressure, shear forces, or treatment with a chemical or physical
delivery agent such as
surfactants, liposomes, or nanoparticles; see, e.g., delivery of materials to
cells employing
microfluidic flow through a cell-deforming constriction as described in US
Published Patent
Application 2014/0287509, incorporated by reference in its entirety herein.
Other techniques
useful for delivering the agent-containing composition to a eukaryotic cell,
plant cell or plant
protoplast include: ultrasound or sonication; vibration, friction, shear
stress, vortexing,
cavitation; centrifugation or application of mechanical force; mechanical cell
wall or cell
membrane deformation or breakage; enzymatic cell wall or cell membrane
breakage or
permeabilization; abrasion or mechanical scarification (e.g., abrasion with
carborundum or
other particulate abrasive or scarification with a file or sandpaper) or
chemical scarification
(e.g., treatment with an acid or caustic agent); and electroporation. In
certain embodiments,
the agent-containing composition is provided by bacterially mediated (e.g.,
Agrobacterium sp.,
Rhizobium sp., Sinorhizobium sp., Mesorhizobium sp., Bradyrhizobium sp.,
Azobacter sp.,
Phyllobacterium sp.) transfection of the plant cell or plant protoplast with a
polynucleotide
encoding the genome editing molecules (e.g., RNA dependent DNA endonuclease,
RNA
dependent DNA binding protein, RNA dependent nickase, ABE, or CBE, and/or
guide RNA);
see, e.g., Broothaerts et at. (2005) Nature, 433:629 ¨ 633). Any of these
techniques or a
combination thereof are alternatively employed on the plant explant, plant
part or tissue or
- 52 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
intact plant (or seed) from which a plant cell is optionally subsequently
obtained or isolated; in
certain embodiments, the agent-containing composition is delivered in a
separate step after the
plant cell has been isolated.
[00103] In some embodiments, one or more polynucleotides or vectors
driving
expression of one or more genome editing molecules or trait-conferring genes
(e.g.; herbicide
tolerance, insect resistance, and/or male sterility) are introduced into a
5307 or INIR17 plant
cell. In certain embodiments, a polynucleotide vector comprises a regulatory
element such as
a promoter operably linked to one or more polynucleotides encoding genome
editing molecules
and/or trait-conferring genes. In such embodiments, expression of these
polynucleotides can
be controlled by selection of the appropriate promoter, particularly promoters
functional in a
eukaryotic cell (e.g., plant cell); useful promoters include constitutive,
conditional, inducible,
and temporally or spatially specific promoters (e.g., a tissue specific
promoter, a
developmentally regulated promoter, or a cell cycle regulated promoter).
Developmentally
regulated promoters that can be used in plant cells include Phospholipid
Transfer Protein
(PLTP), fructose-1,6-bisphosphatase protein, NAD(P)-binding Rossmann-Fold
protein,
adipocyte plasma membrane-associated protein-like protein, Rieske [2Fe-2S]
iron-sulfur
domain protein, chlororespiratory reduction 6 protein, D-glycerate 3-kinase,
chloroplastic-like
protein, chlorophyll a-b binding protein 7, chloroplastic-like protein,
ultraviolet-B-repressible
protein, Soul heme-binding family protein, Photosystem I reaction center
subunit psi-N protein,
and short-chain dehydrogenase/reductase protein that are disclosed in US
Patent Application
Publication No. 20170121722, which is incorporated herein by reference in its
entirety and
specifically with respect to such disclosure. In certain embodiments, the
promoter is operably
linked to nucleotide sequences encoding multiple guide RNAs, wherein the
sequences
encoding guide RNAs are separated by a cleavage site such as a nucleotide
sequence encoding
a microRNA recognition/cleavage site or a self-cleaving ribozyme (see, e.g.,
Ferre-D'Amare
and Scott (2014) Cold Spring Harbor Perspectives Biol., 2:a003574). In certain
embodiments,
the promoter is an RNA polymerase III promoter operably linked to a nucleotide
sequence
encoding one or more guide RNAs. In certain embodiments, the RNA polymerase
III promoter
is a plant U6 spliceosomal RNA promoter, which can be native to the genome of
the plant cell
or from a different species, e.g., a U6 promoter from maize, tomato, or
soybean such as those
disclosed U.S. Patent Application Publication 2017/0166912, or a homologue
thereof; in an
example, such a promoter is operably linked to DNA sequence encoding a first
RNA molecule
- 53 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
including a Cas12a gRNA followed by an operably linked and suitable 3' element
such as a
U6 poly-T terminator. In another embodiment, the RNA polymerase III promoter
is a plant
U3, 7SL (signal recognition particle RNA), U2, or U5 promoter, or chimerics
thereof, e.g., as
described in U.S. Patent Application Publication 20170166912. In certain
embodiments, the
promoter operably linked to one or more polynucleotides is a constitutive
promoter that drives
gene expression in eukaryotic cells (e.g., plant cells). In certain
embodiments, the promoter
drives gene expression in the nucleus or in an organelle such as a chloroplast
or mitochondrion.
Examples of constitutive promoters for use in plants include a CaMV 35S
promoter as
disclosed in US Patents 5,858,742 and 5,322,938, a rice actin promoter as
disclosed in US
Patent 5,641,876, a maize chloroplast aldolase promoter as disclosed in US
Patent 7,151,204,
and the nopaline synthase (NOS) and octopine synthase (OCS) promoters from
Agrobacterium
tumefaciens. In certain embodiments, the promoter operably linked to one or
more
polynucleotides encoding elements of a genome-editing system is a promoter
from figwort
mosaic virus (FMV), a RUBISCO promoter, or a pyruvate phosphate dikinase
(PPDK)
promoter, which is active in photosynthetic tissues. Other contemplated
promoters include
cell-specific or tissue-specific or developmentally regulated promoters, for
example, a
promoter that limits the expression of the nucleic acid targeting system to
germline or
reproductive cells (e.g., promoters of genes encoding DNA ligases,
recombinases, replicases,
or other genes specifically expressed in germline or reproductive cells). In
certain
embodiments, the genome alteration is limited only to those cells from which
DNA is inherited
in subsequent generations, which is advantageous where it is desirable that
expression of the
genome-editing system be limited in order to avoid genotoxicity or other
unwanted effects. All
of the patent publications referenced in this paragraph are incorporated
herein by reference in
their entirety.
[00104] Expression vectors or polynucleotides provided herein may contain
a DNA
segment near the 3' end of an expression cassette that acts as a signal to
terminate transcription
and directs polyadenylation of the resultant mRNA and may also support
promoter activity.
Such a 3' element is commonly referred to as a "3'-untranslated region" or "3'-
UTR" or a
"polyadenylation signal." In some cases, plant gene-based 3' elements (or
terminators) consist
of both the 3' -UTR and downstream non-transcribed sequence (Nuccio et al.,
2015). Useful 3'
elements include: Agrobacterium tumefaciens nos 3', tml 3', tmr 3', tms 3',
ocs 3', and tr7 3'
elements disclosed in US Patent No. 6,090,627, incorporated herein by
reference, and 3'
- 54 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
elements from plant genes such as the heat shock protein 17, ubiquitin, and
fructose-1,6-
biphosphatase genes from wheat (Triticum aestivum), and the glutelin, lactate
dehydrogenase,
and beta-tubulin genes from rice (Oryza sativa), disclosed in US Patent
Application Publication
2002/0192813 Al. All of the patent publications referenced in this paragraph
are incorporated
herein by reference in their entireties.
[00105] In certain embodiments, the 5307 or INIR17 plant cells used herein
can
comprise haploid, diploid, or polyploid plant cells or plant protoplasts, for
example, those
obtained from a haploid, diploid, or polyploid plant, plant part or tissue, or
callus. In certain
embodiments, plant cells in culture (or the regenerated plant, progeny seed,
and progeny plant)
are haploid or can be induced to become haploid; techniques for making and
using haploid
plants and plant cells are known in the art, see, e.g., methods for generating
haploids in
Arabidopsis thaliana by crossing of a wild-type strain to a haploid-inducing
strain that
expresses altered forms of the centromere-specific histone CENH3, as described
by
Maruthachalam and Chan in "How to make haploid Arabidopsis thaliana" ,
protocol available
at www [dot] op enwetware [dot] org/im ages/d/d3/Hapl oi d Arab i dop si
s_protocol [dot]p df; (Ravi
et al. (2014) Nature Communications, 5:5334, doi: 10.1038/nc0mm56334).
Haploids can also
be obtained in a wide variety of monocot plants (e.g., maize, wheat, rice,
sorghum, barley) by
crossing a plant comprising a mutated CENH3 gene with a wildtype diploid plant
to generate
haploid progeny as disclosed in US Patent No. 9,215,849, which is incorporated
herein by
reference in its entirety. Haploid-inducing maize lines that can be used to
obtain haploid maize
plants and/or cells include Stock 6, MHI (Moldovian Haploid Inducer),
indeterminate
gametophyte (ig) mutation, KEMS, RWK, ZEM, ZMS, KMS, and well as transgenic
haploid
inducer lines disclosed in US Patent No. 9,677,082, which is incorporated
herein by reference
in its entirety. Examples of haploid cells include but are not limited to
plant cells obtained
from haploid plants and plant cells obtained from reproductive tissues, e.g.,
from flowers,
developing flowers or flower buds, ovaries, ovules, megaspores, anthers,
pollen,
megagametophyte, and microspores. In certain embodiments where the plant cell
or plant
protoplast is haploid, the genetic complement can be doubled by chromosome
doubling (e.g.,
by spontaneous chromosomal doubling by meiotic non-reduction, or by using a
chromosome
doubling agent such as colchicine, oryzalin, trifluralin, pronamide, nitrous
oxide gas, anti-
microtubule herbicides, anti-microtubule agents, and mitotic inhibitors) in
the plant cell or
plant protoplast to produce a doubled haploid plant cell or plant protoplast
wherein the
- 55 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
complement of genes or alleles is homozygous; yet other embodiments include
regeneration of
a doubled haploid plant from the doubled haploid plant cell or plant
protoplast. Another
embodiment is related to a hybrid plant having at least one parent plant that
is a doubled haploid
plant provided by this approach. Production of doubled haploid plants provides
homozygosity
in one generation, instead of requiring several generations of self-crossing
to obtain
homozygous plants. The use of doubled haploids is advantageous in any
situation where there
is a desire to establish genetic purity (i.e., homozygosity) in the least
possible time. Doubled
haploid production can be particularly advantageous in slow-growing plants or
for producing
hybrid plants that are offspring of at least one doubled-haploid plant.
[00106] In certain embodiments, the 5307 or INIR17 plant cells used in the
methods
provided herein can include non-dividing cells. Such non-dividing cells can
include plant cell
protoplasts, plant cells subjected to one or more of a genetic and/or
pharmaceutically-induced
cell-cycle blockage, and the like.
[00107] In certain embodiments, the 5307 or INIR17 plant cells in used in
the methods
provided herein can include dividing cells. Dividing cells can include those
cells found in
various plant tissues including leaves, meristems, and embryos. These tissues
include but are
not limited to dividing cells from young maize leaf, meristems and scutellar
tissue from about
8 or 10 to about 12 or 14 days after pollination (DAP) embryos. The isolation
of maize embryos
has been described in several publications (Brettschneider, Becker, and Lorz
1997; Leduc et
al. 1996; Frame et al. 2011; K. Wang and Frame 2009). In certain embodiments,
basal leaf
tissues (e.g., leaf tissues located about 0 to 3 cm from the ligule of a maize
plant; Kirienko,
Luo, and Sylvester 2012) are targeted for HDR-mediated gene editing. Methods
for obtaining
regenerable plant structures and regenerating plants from the NHEJ-, MMEJ-, or
HDR-
mediated gene editing of plant cells provided herein can be adapted from
methods disclosed in
US Patent Application Publication No. 20170121722, which is incorporated
herein by
reference in its entirety and specifically with respect to such disclosure. In
certain
embodiments, single plant cells subjected to the HDR-mediated gene editing
will give rise to
single regenerable plant structures. In certain embodiments, the single
regenerable plant cell
structure can form from a single cell on, or within, an explant that has been
subjected to the
NHEJ-, MMEJ-, or HDR-mediated gene editing.
[00108] In some embodiments, methods provided herein can include the
additional step
of growing or regenerating an INIR17 plant from a INIR17 plant cell that had
been subjected
- 56 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
to the gene editing or from a regenerable plant structure obtained from that
INIR17 plant cell.
In certain embodiments, the plant can further comprise an inserted transgene,
a target gene edit,
or genome edit as provided by the methods and compositions disclosed herein.
In certain
embodiments, callus is produced from the plant cell, and plantlets and plants
produced from
such callus. In other embodiments, whole seedlings or plants are grown
directly from the plant
cell without a callus stage. Thus, additional related aspects are directed to
whole seedlings and
plants grown or regenerated from the plant cell or plant protoplast having a
target gene edit or
genome edit, as well as the seeds of such plants. In certain embodiments
wherein the plant cell
or plant protoplast is subjected to genetic modification (for example, genome
editing by means
of, e.g., an RdDe), the grown or regenerated plant exhibits a phenotype
associated with the
genetic modification. In certain embodiments, the grown or regenerated plant
includes in its
genome two or more genetic or epigenetic modifications that in combination
provide at least
one phenotype of interest. In certain embodiments, a heterogeneous population
of plant cells
having a target gene edit or genome edit, at least some of which include at
least one genetic or
epigenetic modification, is provided by the method; related aspects include a
plant having a
phenotype of interest associated with the genetic or epigenetic modification,
provided by either
regeneration of a plant having the phenotype of interest from a plant cell or
plant protoplast
selected from the heterogeneous population of plant cells having a target gene
or genome edit,
or by selection of a plant having the phenotype of interest from a
heterogeneous population of
plants grown or regenerated from the population of plant cells having a
targeted genetic edit or
genome edit. Examples of phenotypes of interest include herbicide resistance,
improved
tolerance of abiotic stress (e.g., tolerance of temperature extremes, drought,
or salt) or biotic
stress (e.g., resistance to nematode, bacterial, or fungal pathogens),
improved utilization of
nutrients or water, modified lipid, carbohydrate, or protein composition,
improved flavor or
appearance, improved storage characteristics (e.g., resistance to bruising,
browning, or
softening), increased yield, altered morphology (e.g., floral architecture or
color, plant height,
branching, root structure). In an embodiment, a heterogeneous population of
plant cells having
a target gene edit or genome edit (or seedlings or plants grown or regenerated
therefrom) is
exposed to conditions permitting expression of the phenotype of interest;
e.g., selection for
herbicide resistance can include exposing the population of plant cells having
a target gene edit
or genome edit (or seedlings or plants grown or regenerated therefrom) to an
amount of
herbicide or other substance that inhibits growth or is toxic, allowing
identification and
- 57 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
selection of those resistant plant cells (or seedlings or plants) that survive
treatment. Methods
for obtaining regenerable plant structures and regenerating plants from plant
cells or
regenerable plant structures can be adapted from published procedures (Roest
and Gilissen,
Acta Bot. Neerl., 1989, 38(1), 1-23; Bhaskaran and Smith, Crop Sci. 30(6):1328-
1337; Ikeuchi
et al., Development, 2016, 143: 1442-1451). Methods for obtaining regenerable
plant
structures and regenerating plants from plant cells or regenerable plant
structures can also be
adapted from US Patent Application Publication No. 20170121722, which is
incorporated
herein by reference in its entirety and specifically with respect to such
disclosure. Also
provided are heterogeneous or homogeneous populations of such plants or parts
thereof (e.g.,
seeds), succeeding generations or seeds of such plants grown or regenerated
from the plant
cells or plant protoplasts, having a target gene edit or genome edit.
Additional related aspects
include a hybrid plant provided by crossing a first plant grown or regenerated
from a plant cell
or plant protoplast having a target gene edit or genome edit and having at
least one genetic or
epigenetic modification, with a second plant, wherein the hybrid plant
contains the genetic or
epigenetic modification; also contemplated is seed produced by the hybrid
plant. Also
envisioned as related aspects are progeny seed and progeny plants, including
hybrid seed and
hybrid plants, having the regenerated plant as a parent or ancestor. The plant
cells and
derivative plants and seeds disclosed herein can be used for various purposes
useful to the
consumer or grower. In other embodiments, processed products are made from the
INIR17
plant or its seeds, including: (a) maize seed meal (defatted or non-defatted);
(b) extracted
proteins, oils, sugars, and starches; (c) fermentation products; (d) animal
feed or human food
products (e.g., feed and food comprising maize seed meal (defatted or non-
defatted) and other
ingredients (e.g., other cereal grains, other seed meal, other protein meal,
other oil, other starch,
other sugar, a binder, a preservative, a humectant, a vitamin, and/or mineral;
(e) a
pharmaceutical; (f) raw or processed biomass (e.g., cellulosic and/or
lignocellulosic material);
and (g) various industrial products.
EMBODIMENTS
[00109] Various embodiments of the plants, genomes, methods, biological
samples, and
other compositions described herein are set forth in the following sets of
numbered
embodiments.
- 58 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
[00110] la. A transgenic maize plant cell comprising an INIR17 transgenic
locus that
comprises a C 1V113 promoter, an eCry3.1Ab coding region which is operably
linked to said
promoter, and a nopaline synthase terminator element, wherein said cell does
not contain a
ZmUbiInt promoter, an operably linked phosphomannose isomerase coding region
and a
second NOS terminator elements, wherein the CMP promoter, the eCry3.1Ab coding
region
which is operably linked to said promoter, and the NOS terminator element
which is operably
linked to said eCry3.1Ab coding region are located in the maize plant cell
genomic location of
the 5307 transgenic locus.
[00111] lb. A transgenic maize plant cell comprising an INIR17 transgenic
locus that
comprises (i) a CMP promoter, an eCry3.1Ab coding region which is operably
linked to said
promoter, and a nopaline synthase terminator element; and (ii) an insertion
and/or substitution
of a DNA element comprising a cognate guide RNA recognition site (CgRRS) in a
DNA
junction polynucleotide of said INIR17 transgenic locus, wherein the CMP
promoter, the
eCry3.1Ab coding region which is operably linked to said promoter, and the NOS
terminator
element which is operably linked to said eCry3.1Ab coding region are located
in the maize
plant cell genomic location of the 5307 transgenic locus.
[00112] lc. A transgenic maize plant cell comprising an INIR17 transgenic
locus that
comprises (i) a CMP promoter, an eCry3.1Ab coding region which is operably
linked to said
promoter, and a nopaline synthase terminator element; and (ii) a deletion of
non-essential DNA
in a DNA junction polynucleotide of said INIR17 transgenic locus, wherein the
CMP promoter,
the eCry3.1Ab coding region which is operably linked to said promoter, and the
NOS
terminator element which is operably linked to said eCry3.1Ab coding region
are located in
the maize plant cell genomic location of the 5307 transgenic locus.
[00113] ld. A transgenic maize plant cell comprising an INIR17 transgenic
locus that
comprises (i) a C 1V113 promoter, an eCry3.1Ab coding region which is operably
linked to said
promoter, and a nopaline synthase terminator element; (ii) an insertion and/or
substitution of a
DNA element comprising a cognate guide RNA recognition site (CgRRS) in a DNA
junction
polynucleotide of said INIR17 transgenic locus and/or (iii) a deletion of non-
essential DNA in
a DNA junction polynucleotide of said INIR17 transgenic locus; wherein the C
1V113 promoter,
the eCry3.1Ab coding region which is operably linked to said promoter, and the
NOS
terminator element which is operably linked to said eCry3.1Ab coding region
are located in
the maize plant cell genomic location of the 5307 transgenic locus
- 59 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
[00114] 2. The transgenic maize plant cell of embodiment la, lb, lc, or
id, wherein said
INIR17 transgenic locus comprises DNA corresponding to at least nucleotide
number 1 to 3865
of SEQ ID NO:1 or an allelic variant thereof and nucleotide number 7415 to
8865 of SEQ ID
NO:1 or an allelic variant thereof, wherein nucleotides corresponding to at
least 4164 to 7355
of SEQ ID NO:1 or an allelic variant thereof are absent, optionally wherein
said transgenic
locus comprises SEQ ID NO: 40 or an allelic variant thereof.
[00115] 3. The transgenic maize plant cell of embodiment la, wherein said
INIR17
transgenic locus comprises the DNA molecule set forth in SEQ ID NO: 32, 33, or
an allelic
variant thereof; or transgenic maize plant cell of embodiment lb, wherein said
INIR17
transgenic locus comprises the DNA molecule set forth in SEQ ID NO: 29, 30,
33, or an allelic
variant thereof.
[00116] 4. The transgenic maize plant cell of embodiment lc or id, wherein
said INIR17
transgenic locus comprises a 5' DNA junction polynucleotide set forth as SEQ
ID NO: 38, 39,
or an allelic variant thereof or optionally comprises SEQ ID NO: 26, 27, 34,
36, or an allelic
variant thereof.
[00117] 5. The transgenic maize plant cell of embodiment la, lc, or id
wherein said
INIR17 transgenic locus further comprises an insertion and/or substitution of
a DNA element
comprising a cognate guide RNA recognition site (CgRRS) in a DNA junction
polynucleotide
of said INIR17 transgenic locus.
[00118] 6. The transgenic maize plant cell of embodiment lb, id, or 5,
wherein said
cognate guide RNA recognition site (CgRRS) comprises SEQ ID NO: 17, wherein
the insertion
and/or substitution is in a 5' junction polynucleotide of said INIR17
transgenic locus.
[00119] 7. The transgenic maize plant cell of embodiment 6, wherein said
INIR17
transgenic locus comprising the CgRRS comprises the DNA molecule set forth in
SEQ ID NO:
16, 29, 30, 33, or an allelic variant thereof.
[00120] 8. The transgenic maize plant cell of embodiment la, lb, lc, or
id, wherein said
5307 transgenic locus comprises the DNA molecule set forth in SEQ ID NO:1 or
is present in
seed deposited at the ATCC under accession No. PTA-9561, is present in progeny
thereof, is
present in allelic variants thereof, or is present in other variants thereof.
[00121] 9. A transgenic maize plant part comprising the maize plant cell
of any one of
embodiments la, lb, lc, id, 2, 3, 4, 5, 6, 7, or 8, wherein said maize plant
part is optionally a
seed.
- 60 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
[00122] 10. A transgenic maize plant comprising the maize plant cell of
any one of
embodiments la, lb, lc, id, 2, 3, 4, 5, 6, 7, or 8.
[00123] 11. A method for obtaining a bulked population of inbred seed
comprising
selfing the transgenic maize plant of embodiment 10 and harvesting seed
comprising the
INIR17 transgenic locus from the selfed maize plant.
[00124] 12. A method of obtaining hybrid maize seed comprising crossing
the transgenic
maize plant of embodiment 10 to a second maize plant which is genetically
distinct from the
first maize plant and harvesting seed comprising the INIR17 transgenic locus
from the cross.
[00125] 13. A DNA molecule comprising SEQ ID NO: 16, 26, 27, 28, 29, 32,
33, 34,
36, 38, 39, or 40.
[00126] 14. A processed transgenic maize plant product comprising the DNA
molecule
of embodiment 13.
[00127] 15. A biological sample containing the DNA molecule of embodiment
13.
[00128] 16. A nucleic acid molecule adapted for detection of genomic DNA
comprising
the DNA molecule of embodiment 13, wherein said nucleic acid molecule
optionally comprises
a detectable label.
[00129] 17. A method of detecting a plant cell comprising the INIR17
transgenic locus
of any one of embodiments la, lb, lc, or id to 8, comprising the step of
detecting DNA
molecule comprising SEQ ID NO: 16, 26, 27, 28, 29, 32, 33, 34, 36, 38, 39, or
40.
[00130] 18. A method of excising the INIR17 transgenic locus from the
genome of the
maize plant cell of any one of embodiments lb, ld, 5, 6, 7, or 8, comprising
the steps of:
(a) contacting the edited transgenic plant genome of the plant cell of
embodiment lb,
id, 5, 6, 7, or 8 with: (i) an RNA dependent DNA endonuclease (RdDe); and (ii)
a guide RNA
(gRNA) capable of hybridizing to the guide RNA hybridization site of the OgRRS
and the
CgRRS; wherein the RdDe recognizes a OgRRS/gRNA and a CgRRS/gRNA hybridization
complex; and,
(b) selecting a transgenic plant cell, transgenic plant part, or transgenic
plant wherein
the INIR17 transgenic locus flanked by the OgRRS and the CgRRS has been
excised.
[00131] 19. The method of embodiment 18, wherein the OgRRS is located in a
3'
flanking DNA junction polynucleotide and comprises SEQ ID NO: 20 and wherein
the CgRRS
comprises an insertion or substitution of SEQ ID NO:17 in a 5' junction
polynucleotide of said
INIR17 transgenic locus.
- 61 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
[00132] 20. The method of embodiment 19, wherein the insertion and/or
substitution is
in a 5' junction polynucleotide of the INIR17 transgenic locus corresponding
to at least one of:
(i) nucleotides 1350 to 1356 of SEQ ID NO:1; or (ii) nucleotides 1336 to 1342
of SEQ ID NO:
1.
[00133] 21. The method of embodiment 19, wherein the CgRRS comprises the
DNA
molecule set forth in SEQ ID NO:16.
[00134] 20a. A method of modifying a transgenic maize plant cell
comprising: obtaining
a 5307 maize event plant cell, a representative sample of which was deposited
at the ATCC
under accession No. PTA-9561, comprising a nucleotide sequence comprising a
CMP
promoter, a eCry3.1Ab coding region which is operably linked to said promoter,
a first nopaline
synthase (NOS) terminator element which is operably linked to said eCry3.1Ab
coding region,
a ZmUbiInt promoter and an operably linked phosphomannose isomerase coding
region, and a
second NOS terminator element; and modifying said nucleotide sequence to
eliminate
functionality of said phosphomannose isomerase coding region and/or to
substantially,
essentially, or completely remove said phosphomannose isomerase coding region,
and
optionally to eliminate functionality of, or substantially, essentially, or
completely remove, said
first NOS terminator, said ZmUbiInt promoter, and said operably linked
phosphomannose
isomerase coding region.
[00135] 20b. A method of modifying a transgenic maize plant cell
comprising: obtaining
a 5307 maize event plant cell, a representative sample of which was deposited
at the ATCC
under accession No. PTA-9561, comprising a nucleotide sequence comprising a 5'
junction
polynucleotide, a CMP promoter, a eCry3.1Ab coding region which is operably
linked to said
promoter, a first nopaline synthase (NOS) terminator element which is operably
linked to said
eCry3.1Ab coding region, a ZmUbiInt promoter and an operably linked
phosphomannose
isomerase coding region, and a second NOS terminator element; and modifying
said nucleotide
sequence to: (i) substantially, essentially, or completely remove said first
NOS terminator, said
ZmUbiInt promoter, and said operably linked phosphomannose isomerase coding
region; and
(ii) delete and/or substitute one or more nucleotides of said 5' junction
polynucleotide,
optionally wherein one or more nucleotides or a polynucleotide sequence
comprising a CgRRS
are inserted into said 5' junction polynucleotide.
[00136] 20c. A method of making transgenic maize plant cell comprising an
INIR17
transgenic locus comprising:
- 62 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
(a) contacting the transgenic plant genome of a maize 5307 plant cell with:
(i) a first set of gene
editing molecules comprising a first site-specific nuclease which introduces
at least one first
double stranded DNA break in a 5' junction polynucleotide of a 5307 transgenic
locus; and (ii)
a second set of gene editing molecules comprising a second site-specific
nuclease which
introduces a second double stranded DNA break between the eCry3.1Ab coding
sequence and
the first nopaline synthase (NOS) terminator of said 5307 transgenic locus and
a third site
specific nuclease which introduces a third double stranded DNA break between
the
phosphomannose isomerase coding region and DNA encoding the second nopaline
synthase
(nos) terminator element of said 5307 transgenic locus; and
(b) selecting a transgenic maize plant cell, transgenic maize callus, and/or a
transgenic
maize plant comprising an INIR17 transgenic locus wherein one or more
nucleotides of said
5' junction polynucleotide have been deleted and/or substituted, wherein the
ClVIP promoter,
the eCry3.1Ab coding region which is operably linked to the CMP promoter, and
the second
NOS terminator element of said 5307 transgenic locus are present, and wherein
DNA of said
5307 transgenic locus comprising the first NOS terminator, the ZmUbiInt
promoter and the
phosphomannose isomerase coding region is absent, thereby making a transgenic
maize plant
cell comprising an INIR17 transgenic locus.
[00137] 21. The method of embodiment 20c, comprising:
(a) contacting the transgenic plant genome of a maize 5307 plant cell with:
(i) a first set of gene
editing molecules comprising a first site-specific nuclease which introduces
at least one first
double stranded DNA break between nucleotide residues corresponding to
nucleotides 1350 to
1356 of SEQ ID NO:1; and/or nucleotides 1336 to 1342 of SEQ ID NO: 1; and (ii)
a second
set of gene editing molecules comprising a second site-specific nuclease which
introduces a
second double stranded DNA break between nucleotide residues corresponding to
nucleotide
number 3866 to 3895 of SEQ ID NO:1 and a third site specific nuclease which
introduces a
third double stranded DNA break between nucleotide residues corresponding to
nucleotide
number 7356 to 7415 of SEQ ID NO:1; and
(b) selecting a transgenic maize plant cell, transgenic maize plant callus,
and/or a
transgenic maize plant wherein one or more nucleotides corresponding to
nucleotide number
1336 to 1356 of SEQ ID NO:1 have been deleted and/or substituted, wherein
nucleotides
corresponding to at least nucleotide number 4164 to 7355 of SEQ ID NO:1 have
been deleted
- 63 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
and/or replaced, and wherein nucleotides corresponding to at least nucleotide
number 1360 to
3865 and 7415 to 8865 of SEQ ID NO:1 are retained.
[00138] 22. The method of embodiment 20c or 21, further comprising
contacting the
transgenic plant genome of the maize 5307 plant cell with a donor DNA template
comprising
a cognate guide RNA recognition site (CgRRS), wherein said CgRRS optionally
comprises a
polynucleotide set forth in SEQ ID NO:17; and selecting a transgenic plant
cell wherein said
CgRRS has integrated into and/or replaced one or more nucleotides
corresponding to at least
one of nucleotides of SEQ ID NO:l.
[00139] 23. The method of any one of embodiments 20c or 21, wherein the
gene editing
molecules comprise: (i) a zinc finger nuclease; (ii) a TALEN; and/or (iii) an
RNA dependent
DNA endonuclease (RdDe) and a guide RNA.
[00140] 24. The method of embodiment 23, wherein the RNA dependent DNA
endonuclease (RdDe) comprises a Cas12a RdDe and wherein the guide RNA of said
first set
of gene editing molecules comprises SEQ ID NO:8, 9, 10, and/or 11, the guide
RNA of said
second set of gene-editing molecules comprises SEQ ID NO:12, and the guide RNA
of said
third set of gene-editing molecules comprises SEQ ID NO:13.
[00141] 25. The method of any one of embodiments 20a, b, or c to 24,
further comprising
the step of regenerating transgenic maize plant callus and/or a transgenic
maize plant
comprising the modification or the INIR17 transgenic locus from said
transgenic maize plant
cell selected in step (c).
[00142] 26. The method of any one of embodiments 20a, b, or c to 25,
further comprising
the step of harvesting a transgenic maize plant seed comprising the
modification or the INIR17
transgenic locus from the transgenic maize plant comprising the modification
or the INIR17
transgenic locus.
[00143] 27. A transgenic maize plant cell comprising a modification or an
INIR17
transgenic locus made by the method of any one of embodiments 20a, b, or c to
25.
[00144] 28. Transgenic maize plant callus comprising a modification or an
INIR17
transgenic locus made by the method of any one of embodiments 20a, b, or c to
25.
[00145] 29. A transgenic maize plant comprising a modification or an
INIR17 transgenic
locus made by the method of any one of embodiments 20a, b, or c to 25.
[00146] 30. A transgenic maize plant seed comprising a modification or an
INIR17
transgenic locus made by the method of embodiment 26.
- 64 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
Examples
[00147] Example 1. Application of a Cas12a and guide RNAs to change or
excise the
5'-T-DNA junction sequence in the 5307 event.
[00148] Maize Event 5307 5'- junction sequence shown in Figure 6A an 6B
has 4
Cas12a recognition sequences close by, gRNA-1 (SEQ ID NO:8;
tttcccgccttcagtttaaactatcag),
gRNA-2 (SEQ ID NO:9; tttaaactatcagttcgtgagttgaat), gRNA-3 (SEQ ID NO:10;
tttagaggcacaccggacagcgtatcg), and gRNA-4 (SEQ ID NO:11;
tttaaactgaaggcgggaaacgacaat)
that can be used to modify some of the 5' junction sequence or eliminate most
of it. There are
a few possible iterations of this approach. Two depend on gRNA-1 and gRNA-2
alone to
disrupt Maize Event 5307 5'-junction sequence. Two others combine gRNA-3 with
either
gRNA-1 or gRNA-4 to eliminate most of Maize Event 5307 junction sequence. In
certain
instances, gRNA-1 (SEQ ID NO:8) is used to modify the 5' DNA junction
polynucleotide and
obtain a modified 5' junction polynucleotide comprising SEQ ID NO:34. In
certain instances,
gRNA-2 (SEQ ID NO:9) is used to modify the 5' DNA junction polynucleotide and
obtain a
modified 5' junction polynucleotide comprising SEQ ID NO:28.
[00149] The Cas12a nuclease and the single or combined gRNAs are
introduced into
Maize Event 5307. This can be accomplished in different ways. The first is to
encode
expression of the Cas12a nuclease and gRNA(s) on a T-DNA and insert it into
Maize Event
5307 via Agrobacterium-mediated transformation. Alternatively, the T-DNA can
be
transformed into any convenient maize line, and then crossed with Maize Event
5307 to
combine the Cas12a ribonucleoprotein expressing T-DNA with Maize Event 5307.
The Cas12a
nuclease and gRNAs can also be assembled in vitro then delivered to Maize
Event 5307
explants as ribonucleoprotein complexes using a biolistic approach (Svitashev
et al., 2016; doi:
10.1038/ncomms13274). Also, a plasmid encoding a Cas12a nuclease and the
gRNA(s) can be
delivered to Maize Event 5307 explants using a biolistic approach. This will
produce plant cells
that have a high likelihood of incurring mutations that disrupt Maize Event
5307 5'-junction
sequence. To use the Agrobacterium approach a binary vector that contains a
strong
constitutive expression cassette like the ZmUbi 1 promoter::ZmUbi 1 terminator
driving
Cas12a, a PolII or PolIII gene cassette driving the Cas12a gRNA(s) and a CaMV
355:PAT:NOS or other suitable plant selectable marker is constructed. An
expression cassette
driving a fluorescent protein like mScarlet may also be useful to the plant
transformation
process. Constructs are transformed into Agrobacterium strain LBA4404.
- 65 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
[00150] Maize transformations are performed based on published methods
(Ishida et. al,
Nature Protocols 2007; 2, 1614-1621). Briefly, immature embryos from inbred
line GIBE0104,
approximately 1.8-2.2 mm in size, are isolated from surface sterilized ears 10-
14 days after
pollination. Embryos are placed in an Agrobacterium suspension made with
infection medium
at a concentration of OD 600=1Ø Acetosyringone (200 [tM) is added to the
infection medium
at the time of use. Embryos and Agrobacterium are placed on a rocker shaker at
slow speed for
15 minutes. Embryos are then poured onto the surface of a plate of co-culture
medium. Excess
liquid media is removed by tilting the plate and drawing off all liquid with a
pipette. Embryos
are flipped as necessary to maintain a scutelum up orientation. Co-culture
plates are placed in
a box with a lid and cultured in the dark at 22 C for 3 days. Embryos are
then transferred to
resting medium, maintaining the scutellum up orientation. Embryos remain on
resting medium
for 7 days at 27-28 C. Embryos that produce callus are transferred to
Selection 1 medium with
7.5 mg/L phosphinothricin (PPT) and cultured for an additional 7 days.
Callused embryos are
placed on Selection 2 medium with 10 mg/L PPT and cultured for 14 days at 27-
28 C.
Growing calli resistant to the selection agent are transferred to Pre-
Regeneration media with
mg/L PPT to initiate shoot development. Calli remain on Pre-Regeneration media
for 7
days. Calli beginning to initiate shoots are transferred to Regeneration
medium with 7.5 mg/L
PPT in Phytatrays and cultured in light at 27-28 C. Shoots that reach the top
of the Phytatray
with intact roots are transferred to Shoot Elongation medium prior to
transplant into soil and
gradual acclimatization to greenhouse conditions.
[00151] When a sufficient amount of viable tissue is obtained, it can be
screened for
mutations at Maize Event 5307 5'-junction sequence, using a PCR-based
approach. One way
to screen is to design DNA oligonucleotide primers that flank and amplify
Maize Event 5307
junction plus surrounding sequence. For example, the primers (5'-
tgctgcgcatgggcgcaccggacag-
3'; SEQ ID NO:41) and (5'-caattcctgcagcgttgcggttctg-3'; SEQ ID NO:42) will
produce a ¨293
bp product that can be analyzed for edits at the target site. The size of this
product will vary
based on the nature of the edit. Amplicons can be sequenced directly using an
amplicon
sequencing approach or ligated to a convenient plasmid vector for Sanger
sequencing. Those
plants in which Maize Event 5307 5'-junction sequence is disrupted are
selected and grown to
maturity. The DNA encoding the Cas12a reagents can be segregated away from the
modified
junction sequence in a subsequent generation.
- 66 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
[00152] Example 2. Insertion of a CgRRS element in the 5' -junction of the
5307 event.
[00153] This example describes the construction of plant expression
vectors for
Agrobacterium mediated maize transformation. Two plant gene expression vectors
are
prepared. Plant expression cassettes for expressing a Bacteriophage lambda
exonuclease, a
bacteriophage lambda beta SSAP protein, and an E. coli SSB are constructed
essentially as set
forth in US Patent Application Publication 20200407754, which is incorporated
herein by
reference in its entirety. A DNA sequence encoding a tobacco c2 nuclear
localization signal
(NLS) is fused in-frame to the DNA sequences encoding the exonuclease, the
bacteriophage
lambda beta SSAP protein, and the E. coli SSB to provide a DNA sequence
encoding the c2
NLS-Exo, c2 NLS lambda beta SSAP, and c2 NLS-SSB fusion proteins that are set
forth in
SEQ ID NO:135, SEQ ID NO:134, and SEQ ID NO:133 of US Patent Application
Publication
20200407754, respectively, and incorporated herein by reference in their
entireties. DNA
sequences encoding the c2 NLS-Exo, c2 NLS lambda beta SSAP, and c2NLS-SSB
fusion
proteins are operably linked to a OsUBIL ZmUBIL OsACT promoter and a OsUbil,
ZmUBIL
OsACT polyadenylation site respectively, to provide the exonuclease, S SAP,
and SSB plant
expression cassettes.
[00154] A donor DNA template sequence (SEQ ID NO:16) that targets the 5' -
T-DNA
junction of Maize Event 5307 for insertion of a 27 base pair heterologous
sequence, that is
identical to a Cas12a recognition site at the 3' -junction of the Maize Event
5307 T-DNA insert,
by HDR is constructed. The donor DNA template sequence includes a replacement
template
with desired insertion region (27 base pair long sequence of SEQ ID NO: 17;
TTTACACCACAATATAccctatccct) flanked on both sides by homology arms about 550
bp
in length. The homology arms match (i.e., are homologous to) gDNA (genomic
DNA) regions
flanking the target gDNA insertion site. The replacement template region
comprising the donor
DNA template is flanked at each end by DNA sequences identical to Maize Event
5307 5'
polynucleotide sequence recognized by an RNA-guided nuclease and one or more
gRNA(s)
(e.g. gRNAs comprising SEQ ID NO:8 or 9). In certain cases, a deletion is made
in the targeted
Maize Event 5307 5' polynucleotide sequence (e.g., using gRNAs comprising SEQ
ID NO:10
(gRNA-3) and SEQ ID NO: 8 in combination or by using gRNAs comprising SEQ ID
NO:10
(gRNA-3) and SEQ ID NO: 11 (gRNA-4) in combination).
[00155] A plant expression cassette that provides for expression of the
RNA-guided
sequence-specific Cas12a endonuclease is constructed. A plant expression
cassette that
- 67 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
provides for expression of a guide RNA complementary to sequences adjacent to
the insertion
site (e.g. gRNAs comprising SEQ ID NO:8 or 9) is constructed. An Agrobacterium
superbinary
plasmid transformation vector containing a cassette that provides for the
expression of the
phosphinothricin N-acetyltransferasesynthase (PAT) protein is constructed.
Once the cassettes,
donor sequence and Agrobacterium superbinary plasmid transformation vector are
constructed, they were combined to generate two maize transformation plasmids.
[00156] A maize transformation plasmid is constructed with the PAT
cassette, the RNA-
guided sequence-specific endonuclease cassette, the guide RNA cassette, and
Maize Event
5307 5'- junction polynucleotide donor DNA template sequence into
the Agrobacterium superbinary plasmid transformation vector (the control
vector).
[00157] A maize transformation plasmid is constructed with the PAT
cassette, the RNA-
guided sequence-specific endonuclease cassette, the guide RNA cassette, the
SSB cassette, the
lambda beta SSAP cassette, the Exo cassette, and the Maize Event 5307 5'-
junction
polynucleotide donor DNA template into the Agrobacterium superbinary plasmid
transformation vector (the lambda red vector).
[00158] All constructs are delivered from superbinary vectors
in Agrobacterium strain LBA4404.
[00159] Maize transformations are performed based on published methods
(Ishida
et. al, Nature Protocols 2007; 2, 1614-1621). Briefly, immature embryos from
inbred line
GIBE0104, approximately 1.8-2.2 mm in size, are isolated from surface
sterilized ears 10-
14 days after pollination. Embryos are placed in an Agrobacterium suspension
made with
infection medium at a concentration of OD 600=1Ø Acetosyringone (200 pM) is
added to
the infection medium at the time of use. Embryos and Agrobacterium are placed
on a
rocker shaker at slow speed for 15 minutes. Embryos are then poured onto the
surface of
a plate of co-culture medium. Excess liquid media is removed by tilting the
plate and
drawing off all liquid with a pipette. Embryos are flipped as necessary to
maintain a
scutelum up orientation. Co-culture plates are placed in a box with a lid and
cultured in
the dark at 22 C for 3 days. Embryos are then transferred to resting medium,
maintaining
the scutellum up orientation. Embryos remain on resting medium for 7 days at
27-28 C.
Embryos that produced callus are transferred to Selection 1 medium with 7.5
mg/L
phosphinothricin (PPT) and cultured for an additional 7 days. Callused embryos
are placed
on Selection 2 medium with 10 mg/L PPT and cultured for 14 days at 27-28 C.
Growing
- 68 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
calli resistant to the selection agent are transferred to Pre-Regeneration
media with 10
mg/L PPT to initiate shoot development. Calli remained on Pre-Regeneration
media for 7
days. Calli beginning to initiate shoots are transferred to Regeneration
medium with 7.5
mg/L PPT in Phytatrays and cultured in light at 27-28 C. Shoots that reached
the top of
the Phytatray with intact roots are isolated into Shoot Elongation medium
prior to
transplant into soil and gradual acclimatization to greenhouse conditions.
[00160] When a sufficient amount of viable tissue is obtained, it can be
screened
for insertion at the Maize Event 5307 junction sequence, using a PCR-based
approach.
The PCR primer on the 5'-end can be 5'-aagcaaggtttagaagactcctcca-3' (SEQ ID
NO:18)
and the PCR primer on the 3'-end is 5'-gggaagcccaccacgcccagcaggt-3' (SEQ ID
NO:19).
These primers that flank donor DNA homology arms are used to amplify the Maize
Event
5307 5'-junction sequence. The correct donor sequence insertion will produce a
1398 bp
product. Amplicons can be sequenced directly using an amplicon sequencing
approach or
ligated to a convenient plasmid vector for Sanger sequencing. Those plants in
which the
Maize Event 5307 5' junction polynucleotide sequence now contains the intended
CgRRS
(e.g., Cas12a recognition sequence in SEQ ID NO:17) are selected and grown to
maturity.
The T-DNA encoding the Cas12a reagents can be segregated away from the
modified
junction sequence in a subsequent generation. The resultant INIR12 transgenic
locus
comprising the CgRRS and OgRRS (e.g. which each comprise SEQ ID NO:20 and an
operably linked PAM site) can be excised using Cas12a and a suitable gRNA
which
hybridizes to DNA comprising SEQ ID NO:20 at both the OgRRS and the CgRRS. An
example of an INIR12 locus comprising the intended CgRRS in SEQ ID NO:17 is
provided as SEQ ID NO:29. Another example of an INIR12 locus comprising the
intended
CgRRS in SEQ ID NO:17 is provided as SEQ ID NO:30.
[00161] Example 3. Deletion of the 5307 PMI gene cassette.
[00162] The ZmUbi 1 ::PMI coding sequence in Maize Event 5307 transgenic
maize
performs no useful function with respect to field productivity. It can be
removed using a
Cas12a-mediated genomic DNA deletion approach. The procedure calls for
creating an
Agrobacterium transformation vector encoding the Cas12a nuclease, the Maize
Event 5307
PMI 5' guide RNA encoded by 5'-tttccccgatcgttcaaacatttggca-3' (SEQ ID NO:12),
the Maize
- 69 -
CA 03188277 2022-12-23
WO 2022/026566 PCT/US2021/043483
Event 5307 PMI 3' guide RNA encoded by 5'-tttacaacaagctgtaagagettactg-3'; (SEQ
ID
NO:13), and a plant selectable marker gene.
[00163] A binary vector that contains a strong constitutive expression
cassette like the
ZmUbil promoter: :ZmUbil terminator driving Cas12a, a PolII or PolIII gene
cassette driving
the Cas12a gRNAs and a CaMV 355:PAT:NOS or other suitable plant selectable
marker is
constructed. An expression cassette driving a fluorescent protein like
mScarlet may also be
useful to the plant transformation process and included in the binary vector.
[00164] The aforementioned binary vector is transformed into maize using
the procedure
essentially as outlined in Example 1. The regenerated plants can be screened
with the primer
set below to identify individuals that have lost the first NOS::ZmUbi 1 ::PMI
fragment. The
primers span 4097 bases in the intact insert. If both cuts occur and the ends
are ligated together,
this will produce a ¨652 bp amplicon. This is verified by DNA sequence
analysis. The primer
set includes 5307-PMI-ampseq-5' (5'-gagttcgtgcccgccgaggtgacct-3'; SEQ ID NO
:23) and
5307-PMI-ampseq-3' (5' -tgtccggtgcaccctttgccagtgg-3'; SEQ ID NO :24).
[00165] Example 4. Introduction of a CgRRS into an INIR17 maize plant
comprising a
deletion of the 5307 ZmUbil::PMI fragment
[00166] Maize plants comprising Maize plants comprising the deletion of
the Maize
Event 5307 NOS : :ZmUbil: :PMI fragment are subjected to the procedures for
integration of
the SEQ ID NO:16 donor DNA template set forth in Example 2 to provide for a
resultant
INIR12 transgenic locus comprising the CgRRS and OgRRS (e.g. which each
comprise SEQ
ID NO :20 and an operably linked PAM site) where the NOS: :ZmUbil: :PMI
fragment is absent.
This resultant INIR12 transgenic locus can be excised using Cas12a and a
suitable gRNA
which hybridizes to DNA comprising SEQ ID NO:27 at both the OgRRS and the
CgRRS. An
example of a INIR12 transgenic locus comprising the deletion of the Maize
Event 5307
NOS::ZmUbi 1 ::PMI fragment, the CgRRS sequence, and the OgRRS sequence (e.g.
which
each comprise SEQ ID NO:20 and an operably linked PAM site) is set forth in
SEQ ID NO:33.
[00167] The breadth and scope of the present disclosure should not be
limited by any of
the above-described embodiments.
- 70 -
